The occurrence of fungi, yeasts and bacteria in the air of a Spanish winery during vintage.
Garijo, Patrocinio; Santamaría, Pilar; López, Rosa; Sanz, Susana; Olarte, Carmen; Gutiérrez, Ana Rosa
2008-07-15
This research studies the presence of microorganisms of enological interest (yeasts, bacteria and molds) and their evolution in the air of a wine cellar. The samples were taken throughout the winemaking campaign (September-December) in a winery of the D.O.Ca. Rioja, Spain. They were collected using an airIDEAL atmosphere sampler from Biomerieux. For the isolation, specific selective media were used for each group of microorganisms. The results obtained indicate that the presence in the winery air of the various different microorganisms studied is directly related to the winemaking processes that are taking place in the winery. Thus, the number of molds present decreases once grapes have ceased to be brought into the winery. The maximum number of yeasts in the air is found when all the vats in the cellar are fermenting, while the lactic bacteria are not detected until the first malolactic fermentation begins. The species of yeasts and molds identified are also related to the winemaking processes. The coincidence of strains of Saccharomyces cerevisiae among those present in the vats during alcoholic fermentation and those isolated from the air, confirms the role of the latter as a transmitter of microorganisms.
Electron beam radiation of dried fruits and nuts to reduce yeast and mold bioburden.
Ic, Erhan; Kottapalli, Bala; Maxim, Joseph; Pillai, Suresh D
2007-04-01
Dried fruits and nuts make up a significant portion of the commodities traded globally, and the presence of yeasts and molds on dried fruits and nuts can be a public health risk because of the potential for exposure to toxigenic fungi. Since current postharvest treatment technologies are rather limited for dried fruits and nuts, electron beam (E-beam) radiation experiments were performed to determine the doses required to reduce the yeast and mold bioburden of raisins, walnuts, and dates. The indigenous yeast and mold bioburden on a select number of commodities sold at retail ranged from 10(2) to 10(3) CFU/g. E-beam inactivation kinetics based on the linear model suggest that the decimal reduction dose required to eliminate 90% of the microbial population (D10-value) of these indigenous fungal populations ranges from 1.09 to 1.59 kGy. Some samples, however, exhibited inactivation kinetics that were better modeled by a quadratic model. The results indicate that different commodities can contain molds and yeasts of varying resistance to ionizing radiation. It is thus essential for the dried fruit and nut industry to determine empirically the minimum E-beam dose that is capable of reducing or eliminating the bioburden of yeasts and molds in their specific commodities.
McKernan, Kevin; Spangler, Jessica; Helbert, Yvonne; Lynch, Ryan C; Devitt-Lee, Adrian; Zhang, Lei; Orphe, Wendell; Warner, Jason; Foss, Theodore; Hudalla, Christopher J; Silva, Matthew; Smith, Douglas R
2016-01-01
Background : The presence of bacteria and fungi in medicinal or recreational Cannabis poses a potential threat to consumers if those microbes include pathogenic or toxigenic species. This study evaluated two widely used culture-based platforms for total yeast and mold (TYM) testing marketed by 3M Corporation and Biomérieux, in comparison with a quantitative PCR (qPCR) approach marketed by Medicinal Genomics Corporation. Methods : A set of 15 medicinal Cannabis samples were analyzed using 3M and Biomérieux culture-based platforms and by qPCR to quantify microbial DNA. All samples were then subjected to next-generation sequencing and metagenomics analysis to enumerate the bacteria and fungi present before and after growth on culture-based media. Results : Several pathogenic or toxigenic bacterial and fungal species were identified in proportions of >5% of classified reads on the samples, including Acinetobacter baumannii, Escherichia coli, Pseudomonas aeruginosa, Ralstonia pickettii, Salmonella enterica, Stenotrophomonas maltophilia, Aspergillus ostianus, Aspergillus sydowii, Penicillium citrinum and Penicillium steckii. Samples subjected to culture showed substantial shifts in the number and diversity of species present, including the failure of Aspergillus species to grow well on either platform. Substantial growth of Clostridium botulinum and other bacteria were frequently observed on one or both of the culture-based TYM platforms. The presence of plant growth promoting (beneficial) fungal species further influenced the differential growth of species in the microbiome of each sample. Conclusions : These findings have important implications for the Cannabis and food safety testing industries.
McKernan, Kevin; Spangler, Jessica; Helbert, Yvonne; Lynch, Ryan C.; Devitt-Lee, Adrian; Zhang, Lei; Orphe, Wendell; Warner, Jason; Foss, Theodore; Hudalla, Christopher J.; Silva, Matthew; Smith, Douglas R.
2016-01-01
Background: The presence of bacteria and fungi in medicinal or recreational Cannabis poses a potential threat to consumers if those microbes include pathogenic or toxigenic species. This study evaluated two widely used culture-based platforms for total yeast and mold (TYM) testing marketed by 3M Corporation and Biomérieux, in comparison with a quantitative PCR (qPCR) approach marketed by Medicinal Genomics Corporation. Methods: A set of 15 medicinal Cannabis samples were analyzed using 3M and Biomérieux culture-based platforms and by qPCR to quantify microbial DNA. All samples were then subjected to next-generation sequencing and metagenomics analysis to enumerate the bacteria and fungi present before and after growth on culture-based media. Results: Several pathogenic or toxigenic bacterial and fungal species were identified in proportions of >5% of classified reads on the samples, including Acinetobacter baumannii, Escherichia coli, Pseudomonas aeruginosa, Ralstonia pickettii, Salmonella enterica, Stenotrophomonas maltophilia, Aspergillus ostianus, Aspergillus sydowii, Penicillium citrinum and Penicillium steckii. Samples subjected to culture showed substantial shifts in the number and diversity of species present, including the failure of Aspergillus species to grow well on either platform. Substantial growth of Clostridium botulinum and other bacteria were frequently observed on one or both of the culture-based TYM platforms. The presence of plant growth promoting (beneficial) fungal species further influenced the differential growth of species in the microbiome of each sample. Conclusions: These findings have important implications for the Cannabis and food safety testing industries. PMID:27853518
Ananias, Karla Rubia; de Melo, Adriane Alexandre Machado; de Moura, Celso José
2013-01-01
The development of mold of environmental origin in honey affects its quality and leads to its deterioration, so yeasts and molds counts have been used as an important indicator of hygiene levels during its processing, transportation and storage. The aim of this study was to evaluate the levels of yeasts and molds contamination and their correlation with moisture and acidity levels in Apis mellifera L. honey from central Brazil. In 20% of the samples, the yeasts and molds counts exceeded the limit established by legislation for the marketing of honey in the MERCOSUR, while 42.8% and 5.7% presented above-standard acidity and moisture levels, respectively. Although samples showed yeasts and molds counts over 1.0 × 102 UFC.g−1, there was no correlation between moisture content and the number of microorganisms, since, in part of the samples with above-standard counts, the moisture level was below 20%. In some samples the acidity level was higher than that established by legislation, but only one sample presented a yeasts and molds count above the limit established by MERCOSUR, which would suggest the influence of the floral source on this parameter. In general, of the 35 samples analyzed, the quality was considered inadequate in 45.7% of cases. PMID:24516434
Ananias, Karla Rubia; de Melo, Adriane Alexandre Machado; de Moura, Celso José
2013-01-01
The development of mold of environmental origin in honey affects its quality and leads to its deterioration, so yeasts and molds counts have been used as an important indicator of hygiene levels during its processing, transportation and storage. The aim of this study was to evaluate the levels of yeasts and molds contamination and their correlation with moisture and acidity levels in Apis mellifera L. honey from central Brazil. In 20% of the samples, the yeasts and molds counts exceeded the limit established by legislation for the marketing of honey in the MERCOSUR, while 42.8% and 5.7% presented above-standard acidity and moisture levels, respectively. Although samples showed yeasts and molds counts over 1.0 × 10(2) UFC.g(-1), there was no correlation between moisture content and the number of microorganisms, since, in part of the samples with above-standard counts, the moisture level was below 20%. In some samples the acidity level was higher than that established by legislation, but only one sample presented a yeasts and molds count above the limit established by MERCOSUR, which would suggest the influence of the floral source on this parameter. In general, of the 35 samples analyzed, the quality was considered inadequate in 45.7% of cases.
Beuchat, L R; Mann, David A; Gurtler, Joshua B
2007-11-01
A study was done to compare Nissui Compact Dry Yeast and Mold plates (CDYM), 3M Petrifilm Yeast and Mold count plates (PYM), dichloran-rose bengal chloramphenicol (DRBC) agar, and dichloran 18% glycerol (DG18) agar for enumerating yeasts and molds naturally occurring in 97 foods (grains, legumes, raw fruits and vegetables, nuts, dairy products, meats, and miscellaneous processed foods and dry mixes). Correlation coefficients for plates incubated for 5 days were DG18 versus DRBC (0.93), PYM versus DRBC (0.81), CDYM versus DG18 (0.81), PYM versus DG18 (0.80), CDYM versus DRBC (0.79), and CDYM versus PYM (0.75). The number of yeasts and molds recovered from a group of foods (n = 32) analyzed on a weight basis (CFU per gram) was not significantly different (alpha = 0.05) when samples were plated on DRBC, DG18, PYM, or CDYM. However, the order of recovery from foods (n = 65) in a group analyzed on a unit or piece basis, or a composite of both groups (n = 97), was DRBC > DG18 = CDYM > PYM. Compared with PYM, CDYM recovered equivalent, significantly higher (alpha = 0.05) or significantly lower (alpha = 0.05) numbers of yeasts and molds in 51.5, 27.8, and 20.6%, respectively, of the 97 foods tested; respective values were 68.8, 15.6, and 15.6% in the small group (n = 32) and 43.1, 33.8, and 23.1% in the large group (n = 65) of foods. The two groups contained different types of foods, the latter consisting largely (73.8%) of raw fruits (n = 16) and vegetables (n = 32). Differences in efficacy of the four methods in recovering yeasts and molds from foods in the two groups are attributed in part to differences in genera and predominant mycoflora. While DG18 agar, CDYM, and PYM appear to be acceptable for enumerating yeasts and molds in the foods analyzed in this study, overall, DRBC agar recovered higher numbers from the 97 test foods, thereby supporting its recommended use as a general purpose medium for mycological analysis.
Knight, M T; Newman, M C; Benzinger, M J; Neufang, K L; Agin, J R; McAllister, J S; Ramos, M
1997-01-01
A collaborative study was performed involving 18 laboratories and 6 food types to compare 3M Petrifilm yeast and mold count plates with the method described in the U.S. Food and Drug Administration's Bacteriological Analytical Manual. Four species of mold and 2 species of yeast were used to inoculate the following foods: hot dogs, corn meal, ketchup, orange juice, yogurt, and cake mix. Each collaborator received 15 samples of each food type: 5 low-level inoculations, 5 high-level inoculations, and 5 uninoculated samples. There was no significant difference between the means of the 2 methods for any product or inoculation level. The Petrifilm yeast and mold count plate method for enumeration of yeasts and molds in foods has been adopted first action by AOAC INTERNATIONAL.
Comparison of culture media, simplate, and petrifilm for enumeration of yeasts and molds in food.
Taniwaki, M H; Silva, N; Banhe, A A; Iamanaka, B T
2001-10-01
The efficacy of three culture media, dichloran rose bengal chloramphenicol (DRBC), dichloran 18% glycerol agar (DG18), and potato dextrose agar (PDA) supplemented with two antibiotics, were compared with the Simplate and Petrifilm techniques for mold and yeast enumeration. The following foods were analyzed: corn meal, wheat flour, cassava flour, bread crumbs, whole meal, sliced bread, ground peanuts, mozzarella cheese, grated parmesan cheese, cheese rolls, orange juice, pineapple pulp, pineapple cake, and mushroom in conserve. Correlation coefficients of DRBC versus PDA and DG18 for recovering total mold and yeast counts from the composite of 14 foods indicated that the three media were generally equivalent. Correlation coefficients for Petrifilm versus culture media were acceptable, although not as good as between culture media. Correlation coefficients of Simplate versus DRBC, DG18, PDA, and Petrifilm for recovering total yeasts and molds from a composite of 11 foods demonstrated that there was no equivalence between the counts obtained by Simplate and other culture media and Petrifilm, with significant differences observed for the most foods analyzed.
Survey of molds, yeast and Alicyclobacillus spp. from a concentrated apple juice productive process.
de Cássia Martins Salomão, Beatriz; Muller, Chalana; do Amparo, Hudson Couto; de Aragão, Gláucia Maria Falcão
2014-01-01
Bacteria and molds may spoil and/or contaminate apple juice either by direct microbial action or indirectly by the uptake of metabolites as off-flavours and toxins. Some of these microorganisms and/or metabolites may remain in the food even after extensive procedures. This study aim to identify the presence of molds (including heat resistant species) and Alicyclobacillus spp., during concentrated apple juice processing. Molds were isolated at different steps and then identified by their macroscopic and microscopic characteristics after cultivation on standard media at 5, 25 and 37 °C, during 7 days. Among the 19 isolated found, 63% were identified as Penicillium with 50% belonging to the P. expansum specie. With regards to heat resistant molds, the species Neosartorya fischeri, Byssochlamys fulva and also the genus Eupenicillium sp., Talaromyces sp. and Eurotium sp. were isolated. The thermoacidophilic spore-forming bacteria were identified as A. acidoterrestris by a further investigation based on 16S rRNA sequence similarity. The large contamination found indicates the need for methods to eliminate or prevent the presence of these microorganisms in the processing plants in order to avoid both spoilage of apple juice and toxin production.
Interactions between yeasts and bacteria in the smear surface-ripened cheeses.
Corsetti, A; Rossi, J; Gobbetti, M
2001-09-19
In the initial phase of ripening, the microflora of bacterial smear surface-ripened cheeses such as Limburger, Taleggio, Brick, Münster and Saint-Paulin and that of surface mould-ripened cheeses such as Camembert and Brie may be similar, but at the end of the ripening, bacteria such as Brevibacterium spp., Arthrobacter spp., Micrococcus spp., Corynebacterium spp. and moulds such as Penicillium camemberti are, respectively, the dominant microorganisms. Yeasts such as Candida spp., Cryptococcus spp., Debaryomyces spp., Geotrichum candidum, Pichia spp., Rhodotorula spp., Saccharomyces spp. and Yarrowia lipolytica are often and variably isolated from the smear surface-ripened cheeses. Although not dominant within the microorganisms of the smear surface-ripened cheeses, yeasts establish significant interactions with moulds and especially bacteria, including surface bacteria and lactic acid bacteria. Some aspects of the interactions between yeasts and bacteria in such type of cheeses are considered in this paper.
Identification of yeast and bacteria involved in the mezcal fermentation of Agave salmiana.
Escalante-Minakata, P; Blaschek, H P; Barba de la Rosa, A P; Santos, L; De León-Rodríguez, A
2008-06-01
To identify the yeast and bacteria present in the mezcal fermentation from Agave salmiana. The restriction and sequence analysis of the amplified region, between 18S and 28S rDNA and 16S rDNA genes, were used for the identification of yeast and bacteria, respectively. Eleven different micro-organisms were identified in the mezcal fermentation. Three of them were the following yeast: Clavispora lusitaniae, Pichia fermentans and Kluyveromyces marxianus. The bacteria found were Zymomonas mobilis subsp. mobilis and Zymomonas mobilis subsp. pomaceae, Weissella cibaria, Weissella paramesenteroides, Lactobacillus pontis, Lactobacillus kefiri, Lactobacillus plantarum and Lactobacillus farraginis. The phylogenetic analysis of 16S rDNA and ITS sequences showed that microbial diversity present in mezcal is dominated by bacteria, mainly lactic acid bacteria species and Zymomonas mobilis. Pichia fermentans and K. marxianus could be micro-organisms with high potential for the production of some volatile compounds in mezcal. We identified the community of bacteria and yeast present in mezcal fermentation from Agave salmiana.
Genome dynamics and evolution in yeasts: A long-term yeast-bacteria competition experiment
Katz, Michael; Knecht, Wolfgang; Compagno, Concetta; Piškur, Jure
2018-01-01
There is an enormous genetic diversity evident in modern yeasts, but our understanding of the ecological basis of such diversifications in nature remains at best fragmented so far. Here we report a long-term experiment mimicking a primordial competitive environment, in which yeast and bacteria co-exist and compete against each other. Eighteen yeasts covering a wide phylogenetic background spanning approximately 250 million years of evolutionary history were used to establish independent evolution lines for at most 130 passages. Our collection of hundreds of modified strains generated through such a rare two-species cross-kingdom competition experiment re-created the appearance of large-scale genomic rearrangements and altered phenotypes important in the diversification history of yeasts. At the same time, the methodology employed in this evolutionary study would also be a non-gene-technological method of reprogramming yeast genomes and then selecting yeast strains with desired traits. Cross-kingdom competition may therefore be a method of significant value to generate industrially useful yeast strains with new metabolic traits. PMID:29624585
The cellular slime mold: eukaryotic model microorganism.
Urushihara, Hideko
2009-04-01
Cellular slime molds are eukaryotic microorganisms in the soil. They feed on bacteria as solitary amoebae but conditionally construct multicellular forms in which cell differentiation takes place. Therefore, they are attractive for the study of fundamental biological phenomena such as phagocytosis, cell division, chemotactic movements, intercellular communication, cell differentiation, and morphogenesis. The most widely used species, Dictyostelium discoideum, is highly amenable to experimental manipulation and can be used with most recent molecular biological techniques. Its genome and cDNA analyses have been completed and well-annotated data are publicly available. A larger number of orthologues of human disease-related genes were found in D. discoideum than in yeast. Moreover, some pathogenic bacteria infect Dictyostelium amoebae. Thus, this microorganism can also offer a good experimental system for biomedical research. The resources of cellular slime molds, standard strains, mutants, and genes are maintained and distributed upon request by the core center of the National BioResource Project (NBRP-nenkin) to support Dictyostelium community users as well as new users interested in new platforms for research and/or phylogenic consideration.
Nectar bacteria, but not yeast, weaken a plant-pollinator mutualism.
Vannette, Rachel L; Gauthier, Marie-Pierre L; Fukami, Tadashi
2013-02-07
Mutualistic interactions are often subject to exploitation by species that are not directly involved in the mutualism. Understanding which organisms act as such 'third-party' species and how they do so is a major challenge in the current study of mutualistic interactions. Here, we show that even species that appear ecologically similar can have contrasting effects as third-party species. We experimentally compared the effects of nectar-inhabiting bacteria and yeasts on the strength of a mutualism between a hummingbird-pollinated shrub, Mimulus aurantiacus, and its pollinators. We found that the common bacterium Gluconobacter sp., but not the common yeast Metschnikowia reukaufii, reduced pollination success, seed set and nectar consumption by pollinators, thereby weakening the plant-pollinator mutualism. We also found that the bacteria reduced nectar pH and total sugar concentration more greatly than the yeasts did and that the bacteria decreased glucose concentration and increased fructose concentration whereas the yeasts affected neither. These distinct changes to nectar chemistry may underlie the microbes' contrasting effects on the mutualism. Our results suggest that it is necessary to understand the determinants of microbial species composition in nectar and their differential modification of floral rewards to explain the mutual benefits that plants and pollinators gain from each other.
Nectar bacteria, but not yeast, weaken a plant–pollinator mutualism
Vannette, Rachel L.; Gauthier, Marie-Pierre L.; Fukami, Tadashi
2013-01-01
Mutualistic interactions are often subject to exploitation by species that are not directly involved in the mutualism. Understanding which organisms act as such ‘third-party’ species and how they do so is a major challenge in the current study of mutualistic interactions. Here, we show that even species that appear ecologically similar can have contrasting effects as third-party species. We experimentally compared the effects of nectar-inhabiting bacteria and yeasts on the strength of a mutualism between a hummingbird-pollinated shrub, Mimulus aurantiacus, and its pollinators. We found that the common bacterium Gluconobacter sp., but not the common yeast Metschnikowia reukaufii, reduced pollination success, seed set and nectar consumption by pollinators, thereby weakening the plant–pollinator mutualism. We also found that the bacteria reduced nectar pH and total sugar concentration more greatly than the yeasts did and that the bacteria decreased glucose concentration and increased fructose concentration whereas the yeasts affected neither. These distinct changes to nectar chemistry may underlie the microbes' contrasting effects on the mutualism. Our results suggest that it is necessary to understand the determinants of microbial species composition in nectar and their differential modification of floral rewards to explain the mutual benefits that plants and pollinators gain from each other. PMID:23222453
Stochastic simulations of a synthetic bacteria-yeast ecosystem
2012-01-01
Background The field of synthetic biology has greatly evolved and numerous functions can now be implemented by artificially engineered cells carrying the appropriate genetic information. However, in order for the cells to robustly perform complex or multiple tasks, co-operation between them may be necessary. Therefore, various synthetic biological systems whose functionality requires cell-cell communication are being designed. These systems, microbial consortia, are composed of engineered cells and exhibit a wide range of behaviors. These include yeast cells whose growth is dependent on one another, or bacteria that kill or rescue each other, synchronize, behave as predator-prey ecosystems or invade cancer cells. Results In this paper, we study a synthetic ecosystem comprising of bacteria and yeast that communicate with and benefit from each other using small diffusible molecules. We explore the behavior of this heterogeneous microbial consortium, composed of Saccharomyces cerevisiae and Escherichia coli cells, using stochastic modeling. The stochastic model captures the relevant intra-cellular and inter-cellular interactions taking place in and between the eukaryotic and prokaryotic cells. Integration of well-characterized molecular regulatory elements into these two microbes allows for communication through quorum sensing. A gene controlling growth in yeast is induced by bacteria via chemical signals and vice versa. Interesting dynamics that are common in natural ecosystems, such as obligatory and facultative mutualism, extinction, commensalism and predator-prey like dynamics are observed. We investigate and report on the conditions under which the two species can successfully communicate and rescue each other. Conclusions This study explores the various behaviors exhibited by the cohabitation of engineered yeast and bacterial cells. The way that the model is built allows for studying the dynamics of any system consisting of two species communicating with one
Wilson, Deborah A; Young, Stephen; Timm, Karen; Novak-Weekley, Susan; Marlowe, Elizabeth M; Madisen, Neil; Lillie, Jennifer L; Ledeboer, Nathan A; Smith, Rebecca; Hyke, Josh; Griego-Fullbright, Christen; Jim, Patricia; Granato, Paul A; Faron, Matthew L; Cumpio, Joven; Buchan, Blake W; Procop, Gary W
2017-06-01
A report on the multicenter evaluation of the Bruker MALDI Biotyper CA System (MBT-CA; Bruker Daltonics, Billerica, MA) for the identification of clinically important bacteria and yeasts. In total, 4,399 isolates of medically important bacteria and yeasts were assessed in the MBT-CA. These included 2,262 aerobic gram-positive (AGP) bacteria, 792 aerobic gram-negative (AGN) bacteria 530 anaerobic (AnA) bacteria, and 815 yeasts (YSTs). Three processing methods were assesed. Overall, 98.4% (4,329/4,399) of all bacterial and yeast isolates were correctly identified to the genus and species/species complex level, and 95.7% of isolates were identified with a high degree of confidence. The percentage correctly identified and the percentage identified correctly with a high level of confidence, respectively, were as follows: AGP bacteria (98.6%/96.5%), AGN bacteria (98.5%/96.8%), AnA bacteria (98.5%/97.4%), and YSTs (97.8%/87.6%). The extended direct transfer method was only minimally superior to the direct transfer method for bacteria (89.9% vs 86.8%, respectively) but significantly superior for yeast isolates (74.0% vs 48.9%, respectively). The Bruker MALDI Biotyper CA System accurately identifies most clinically important bacteria and yeasts and has optional processing methods to improve isolate characterization. © American Society for Clinical Pathology, 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
[Treatment of oil-manufacturing wastewater by yeast-SBR system].
Lü, Wen-zhou; Liu, Ying; Huang, Yi-zhen
2008-04-01
Eight yeast strains were applied to a sequencing batch reactor (SBR) to treat high-strength oil-containing wastewater. The removal performance, yeast cultivation method and key factors affecting the stability of system were discussed. The results show yeast sludge with MLSS of 19 g/L and SVI of 35 mL/g can be obtained in 6 d in an open system without any molds and bacteria inhibitor addition; In 30 d continuous wastewater treatment, COD and oil removal rate achieve 86.8%-96.9% and above 99.5% respectively under the influent conditions of the COD of 9000-23000 mg/L and oil of 4500-16000 mg/L; Short period of pH impact brings reversible effects on the system and the sludge retention time can affect the SVI of the yeast; Absence of nitrogen induces morphology conversion of some yeast cells from single cell to filamentous one and impairs the settling capability of the yeast.
Antimicrobial activity of yeasts against some pathogenic bacteria
Younis, Gamal; Awad, Amal; Dawod, Rehab E.; Yousef, Nehal E.
2017-01-01
Aim: This study was designed to isolate and identify yeast species from milk and meat products, and to test their antimicrobial activity against some bacterial species. Materials and Methods: A total of 160 milk and meat products samples were collected from random sellers and super markets in New Damietta city, Damietta, Egypt. Samples were subjected to yeast isolation procedures and tested for its antimicrobial activity against Staphylococcus aureus, Pseudomonas aeruginosa, and Escherichia coli. In addition, all yeast species isolates were subjected to polymerase chain reaction (PCR) for detection of khs (kievitone hydratase) and pelA (pectate degrading enzyme)genes. Results: The recovery rate of yeasts from sausage was 20% (2/10) followed by kareish cheese, processed cheese, and butter 10% (1/10) each as well as raw milk 9% (9/100), and fruit yoghurt 30% (6/20). Different yeast species were recovered, namely, Candida kefyr (5 isolates), Saccharomyces cerevisiae (4 isolates), Candida intermedia (3 isolates), Candida tropicalis (2 isolates), Candida lusitaniae (2 isolates), and Candida krusei (1 isolate). khs gene was detected in all S. cerevisiae isolates, however, pelA gene was not detected in all identified yeast species. Antimicrobial activity of recovered yeasts against the selected bacterial species showed high activity with C. intermedia against S. aureus and E. coli, C. kefyr against E. coli, and C. lusitaniae against S. aureus. Moderate activities were obtained with C. tropicalis, C. lusitaniae, and S. cerevisiae against E. coli; meanwhile, all the tested yeasts revealed a very low antimicrobial activity against P. aeruginosa. Conclusion: The obtained results confirmed that some kinds of yeasts have the ability to produce antimicrobial compounds that could inhibit some pathogenic and spoilage bacteria and these antimicrobial activity of yeasts enables them to be one of the novel agents in controlling spoilage of food. PMID:28919693
Chlorine dioxide against bacteria and yeasts from the alcoholic fermentation
Meneghin, Silvana Perissatto; Reis, Fabricia Cristina; de Almeida, Paulo Garcia; Ceccato-Antonini, Sandra Regina
2008-01-01
The ethanol production in Brazil is carried out by fed-batch or continuous process with cell recycle, in such way that bacterial contaminants are also recycled and may be troublesome due to the substrate competition. Addition of sulphuric acid when inoculum cells are washed can control the bacterial growth or alternatively biocides are used. This work aimed to verify the effect of chlorine dioxide, a well-known biocide for bacterial decontamination of water and equipments, against contaminant bacteria (Bacillus subtilis, Lactobacillus plantarum, Lactobacillus fermentum and Leuconostoc mesenteroides) from alcoholic fermentation, through the method of minimum inhibitory concentration (MIC), as well as its effect on the industrial yeast inoculum. Lower MIC was found for B. subtilis (10 ppm) and Leuconostoc mesenteroides (50 ppm) than for Lactobacillus fermentum (75 ppm) and Lactobacillus plantarum (125 ppm). Additionally, these concentrations of chlorine dioxide had similar effects on bacteria as 3 ppm of Kamoran® (recommended dosage for fermentation tanks), exception for B. subtilis, which could not be controlled at this Kamoran® dosage. The growth of industrial yeasts was affected when the concentration of chlorine dioxide was higher than 50 ppm, but the effect was slightly dependent on the type of yeast strain. Smooth yeast colonies (dispersed cells) seemed to be more sensitive than wrinkled yeast colonies (clustered cells/pseudohyphal growth), both isolated from an alcohol-producing unit during the 2006/2007 sugar cane harvest. The main advantage in the usage of chlorine dioxide that it can replace antibiotics, avoiding the selection of resistant populations of microorganisms. PMID:24031227
Weckesser, S; Engel, K; Simon-Haarhaus, B; Wittmer, A; Pelz, K; Schempp, C M
2007-08-01
There is cumulative resistance against antibiotics of many bacteria. Therefore, the development of new antiseptics and antimicrobial agents for the treatment of skin infections is of increasing interest. We have screened six plant extracts and isolated compounds for antimicrobial effects on bacteria and yeasts with dermatological relevance. The following plant extracts have been tested: Gentiana lutea, Harpagophytum procumbens, Boswellia serrata (dry extracts), Usnea barbata, Rosmarinus officinalis and Salvia officinalis (supercritical carbon dioxide [CO2] extracts). Additionally, the following characteristic plant substances were tested: usnic acid, carnosol, carnosic acid, ursolic acid, oleanolic acid, harpagoside, boswellic acid and gentiopicroside. The extracts and compounds were tested against 29 aerobic and anaerobic bacteria and yeasts in the agar dilution test. U. barbata-extract and usnic acid were the most active compounds, especially in anaerobic bacteria. Usnea CO2-extract effectively inhibited the growth of several Gram-positive bacteria like Staphylococcus aureus (including methicillin-resistant strains - MRSA), Propionibacterium acnes and Corynebacterium species. Growth of the dimorphic yeast Malassezia furfur was also inhibited by Usnea-extract. Besides the Usnea-extract, Rosmarinus-, Salvia-, Boswellia- and Harpagophytum-extracts proved to be effective against a panel of bacteria. It is concluded that due to their antimicrobial effects some of the plant extracts may be used for the topical treatment of skin disorders like acne vulgaris and seborrhoic eczema.
NUTRITION OF CELLULAR SLIME MOLDS I.
Hohl, Hans-Rudolf; Raper, Kenneth B.
1963-01-01
Hohl, Hans-Rudolf (University of Wisconsin, Madison) and Kenneth B. Raper. Nutrition of cullular slime molds. I. Growth on living and dead bacteria. J. Bacteriol. 85:191–198. 1963.—Methods for growing selected species of cellular slime molds in liquid culture on living and dead bacteria are described. Species investigated included Polysphondylium pallidum, P. violaceum, Dictyostelium discoideum, and D. purpureum. Maximal growth of myxamoebae occurred in suspensions of 1010 living bacteria (Escherichia coli B/r)/ml in Sörensen's phosphate buffer (pH 6.0), reaching a density of 107 to 2 × 107 cells/ml in 48 hr. The generation time for the different slime molds ranged from 2.4 hr for P. violaceum to 2.9 hr for D. discoideum (strain V-12). Good growth of P. pallidum occurred between pH 3.6 and 7.8. The slime molds grew less well on dead (autoclaved) than on living bacteria and, except for P. pallidum, the amount and rate of growth decreased markedly as the time of autoclaving was increased from 2.5 to 80 min. Bacteria killed with propylene oxide supported growth equal to those autoclaved for a few minutes. The myxamoebae were very sensitive to the osmotic pressure of the culture medium, especially in the presence of living bacteria, and addition of as little as 0.01 m NaCl caused a measurable decrease in slime mold growth. The culture techniques employed afford useful methods for investigating the nutritional requirements of the cellular slime molds, and the experiments described provide the bases for subsequent studies relating to the axenic cultivation of these singular microorganisms. Images PMID:13961228
Ben Hassan, Ines; Ennouri, Monia; Lafforgue, Christine; Schmitz, Philippe; Ayadi, Abdelmoneim
2013-01-01
Microfiltration of model cell suspensions combining macroscopic and microscopic approaches was studied in order to better understand microbial membrane fouling mechanisms. The respective impact of Saccharomyces cerevisiae yeast and Escherichia coli bacteria on crossflow microfiltration performances was investigated using a multichannel ceramic 0.2 µm membrane. Pure yeast suspensions (5 µm ovoid cells) and mixtures of yeast and bacteria (1 to 2.5 µm rod shape cells) were considered in order to analyse the effect of interaction between these two microorganisms on fouling reversibility. The resistances varied significantly with the concentration and characteristics of the microorganisms. Membrane fouling with pure yeast suspension was mainly reversible. For yeast and bacteria mixed suspensions (6 g L−1 yeast concentration) the increase in bacteria from 0.15 to 0.30 g L−1 increased the percentage of normalized reversible resistance. At 10 g L−1 yeast concentration, the addition of bacteria tends to increase the percentage of normalized irreversible resistance. For the objective of performing local analysis of fouling, an original filtration chamber allowing direct in situ observation of the cake by confocal laser scanning microscopy (CLSM) was designed, developed and validated. This device will be used in future studies to characterize cake structure at the microscopic scale. PMID:24958619
Sy, Kaye V; McWatters, Kay H; Beuchat, Larry R
2005-06-01
Gaseous chlorine dioxide (ClO2) was tested for its effectiveness in killing Salmonella, yeasts, and molds on blueberries, strawberries, and red raspberries. An inoculum (100 microl, 6.0 to 6.8 log CFU/g of fruit) that contained five serotypes of Salmonella enterica was deposited on the skin, calyx tissue, or stem scar tissue of blueberries, skin or stem scar tissue of strawberries, and skin of red raspberries, dried for 2 h at 22 degrees C, then held for 20 h at 4 degrees C and 2 h at 22 degrees C before treatment. Sachets that contained reactant chemicals were formulated to release gaseous ClO2 at concentrations of 4.1, 6.2, and 8.0 mg/ liter of air within treatment times of 30, 60, and 120 min, respectively, at 23 +/- 1 degrees C. Lethality of ClO2 to Salmonella, yeasts, and molds was measured when fruits were in an atmosphere that contained 75 to 90% relative humidity. Treatment with 8.0 mg/liter of ClO2 significantly (alpha = 0.05) reduced the population of Salmonella on blueberries by 2.4 to 3.7 log CFU/g. Lethality was higher to cells in inoculum placed on the skin compared with the stem scar tissue. Populations of Salmonella on strawberries treated with 8.0 mg/liter of ClO2 were reduced by 3.8 to 4.4 log CFU/g; a significant reduction of 1.5 log CFU/g of raspberries was achieved. Treatment with 4.1 to 8.0 mg/liter of ClO2 caused reductions in populations of yeast and molds on blueberries, strawberries, and raspberries of 1.4 to 2.5, 1.4 to 4.2, and 2.6 to 3.0 log CFU/g, respectively. Treatment with 4.1 mg/liter of ClO2 did not markedly affect the sensory quality of fruits stored for up to 10 days at 8 degrees C. Results indicate that gaseous ClO2 has promise as a sanitizer for small fruits.
Bacteria and yeast microbiota in milk kefir grains from different Italian regions.
Garofalo, Cristiana; Osimani, Andrea; Milanović, Vesna; Aquilanti, Lucia; De Filippis, Francesca; Stellato, Giuseppina; Di Mauro, Simone; Turchetti, Benedetta; Buzzini, Pietro; Ercolini, Danilo; Clementi, Francesca
2015-08-01
Kefir grains are a unique symbiotic association of different microrganisms, mainly lactic acid bacteria, yeasts and occasionally acetic acid bacteria, cohabiting in a natural polysaccharide and a protein matrix. The microbial composition of kefir grains can be considered as extremely variable since it is strongly influenced by the geographical origin of the grains and by the sub-culturing method used. The aim of this study was to elucidate the bacteria and yeast species occurring in milk kefir grains collected in some Italian regions by combining the results of scanning electron microscopy analysis, viable counts on selective culture media, PCR-DGGE and pyrosequencing. The main bacterial species found was Lactobacillus kefiranofaciens while Dekkera anomala was the predominant yeast. The presence of sub-dominant species ascribed to Streptococcus thermophilus, Lactococcus lactis and Acetobacter genera was also highlighted. In addition, Lc. lactis, Enterococcus sp., Bacillus sp., Acetobacter fabarum, Acetobacter lovaniensis and Acetobacter orientalis were identified as part of the cultivable community. This work further confirms both the importance of combining culture-independent and culture-dependent approaches to study microbial diversity in food and how the combination of multiple 16S rRNA gene targets strengthens taxonomic identification using sequence-based identification approaches. Copyright © 2015 Elsevier Ltd. All rights reserved.
Evaluation of DuPont Qualicon Bax System PCR assay for yeast and mold.
Wallace, F Morgan; Burns, Frank; Fleck, Lois; Andaloro, Bridget; Farnum, Andrew; Tice, George; Ruebl, Joanne
2010-01-01
Evaluations were conducted to test the performance of the BAX System PCR assay which was certified as Performance Tested Method 010902 for screening yeast and mold in yogurt, corn starch, and milk-based powdered infant formula. Method comparison studies performed on samples with low-level inoculates showed that the BAX System demonstrates a sensitivity equivalent to the U.S. Food and Drug Administration's Bacteriological Analytical Manual culture method, but with a significantly shorter time to obtain results. Tests to evaluate inclusivity and exclusivity returned no false-negative and no false-positive results on a diverse panel of isolates, and tests for lot-to-lot variability and tablet stability demonstrated consistent performance. Ruggedness studies determined that none of the factors examined affected the performance of the assay.
Miranda-Castilleja, Dalia E; Martínez-Peniche, Ramón Á; Nadal Roquet-Jalmar, Montserrat; Aldrete-Tapia, J Alejandro; Arvizu-Medrano, Sofía M
2018-06-15
Despite the importance of strain compatibility, most of the enological strain selection studies are carried out separately on yeasts and lactic acid bacteria (LAB). In this study, the enological traits and interactions between native yeasts and LAB were studied. The H 2 S and acetic acid production, growth rates at 8 °C, killer phenotypes, flocculation, and tolerance to must and wine inhibitors were determined for 25 Saccharomyces yeasts. The ability to grow under two wine-like conditions was also determined in 37 LAB (Oenococcus oeni and Lactobacillus plantarum). The yeast-LAB compatibility of selected strains was tested in a sequential scheme. Finally, microvinification trials were performed using two strains from each group to determine the efficiencies and quality parameters. The phenotypic characterization by the K-means and hierarchical clusters indicated a correlation between flocculation and optical density increase in simulated must and wine medium (r = -0.415) and grouped the prominent yeasts SR19, SR26, and N05 as moderately flocculent, killer, acid producing, and highly tolerant strains. Among the LAB, L. plantarum FU39 grew 230% more than the rest. With regard to interactions, LAB growth stimulation (14-fold on average) due to the previous action of yeasts, particularly of SR19, was observed. The final quality of all wines was similar, but yeast SR19 performed a faster and more efficient fermentation than did N05, Also L. plantarum FU39 fermented faster than did O. oeni VC32. The use of quantitative data, and multivariate analyses allowed an integrative approach to the selection of a compatible and efficient pair of enological yeast-LAB strains. An alternative scheme is proposed for the joint selection of yeast and lactic acid bacteria strains, which allows us to foresee the interactions that may occur between them during winemaking. The kinetic parameters, turbidimetrically measured and analyzed by multivariate methods, simplify the detection of
Addis, E; Fleet, G H; Cox, J M; Kolak, D; Leung, T
2001-09-19
The growth of yeasts and bacteria were monitored during the maturation of Camembert and blue-veined cheese produced in Australia. Yeasts were prominent throughout maturation, growing to 10(5)-10(9)/g, depending on the manufacturer. Debaryomyces hansenii predominated, but there were lesser, inconsistent contributions from Yarrowia lipolytica. Of the non-lactic acid bacteria, Acinetobacter species were significant during the maturation of Camembert but not blue-veined cheeses, and grew to 10(6)-10(8) cfu/g. Staphylococcus and Micrococcus species were consistently isolated from the cheeses with Staphylococcus xylosus growing to 10(5)-10(9) cfu/g, depending on the product. Lactic acid bacteria (10(7)-10(9) cfu/g) were present throughout maturation but were not identified. Interactions between the various yeasts and bacterial isolates were examined. Several strains of D. hansenii exhibited killer activity but not against Y. lipolytica. None of the yeasts were antagonistic towards the bacteria but some strains of D. hansenii enhanced the growth of Y. lipolytica and S. xylosus. The yeast and bacterial isolates exhibited various degrees of extracellular proteolytic and lipolytic activities.
Muñoz, Viviana; Beccaria, Bruno; Abreo, Eduardo
2014-01-01
Interactions between yeasts and lactic acid bacteria are strain specific, and their outcome is expected to change in simultaneous alcoholic - malolactic fermentations from the pattern observed in successive fermentations. One Oenococcus oeni strain Lalvin VP41™ was inoculated with two Saccharomyces cerevisiae strains either simultaneously, three days after the yeast inoculation, or when alcoholic fermentation was close to finish. Early bacterial inoculations with each yeast strain allowed for the growth of the bacterial populations, and the length of malolactic fermentation was reduced to six days. Alcoholic fermentation by Lalvin ICV D80® yeast strain left the highest residual sugar, suggesting a negative effect of the bacterial growth and malolactic activity on its performance. In sequential inoculations the bacterial populations did not show actual growth with either yeast strain. In this strategy, both yeast strains finished the alcoholic fermentations, and malolactic fermentations took longer to finish. Lalvin ICV D80® allowed for higher viability and activity of the bacterial strain than Fermicru UY4® under the three inoculation strategies. This was beneficial for the sequential completion of both fermentations, but negatively affected the completion of alcoholic fermentation by Lalvin ICV D80® in the early bacteria additions. Conversely, Fermicru UY4®, which was rather inhibitory towards the bacteria, favored the timely completion of both fermentations simultaneously. As bacteria in early inoculations with low or no SO2 addition can be expected to multiply and interact with fermenting yeasts, not only are the yeast-bacterium strains combination and time point of the inoculation to be considered, but also the amount of bacteria inoculated. PMID:24948914
Gammacurta, Marine; Marchand, Stéphanie; Moine, Virginie; de Revel, Gilles
2017-09-01
The typical fruity aroma of red Bordeaux wines depends on the grape variety but also on microbiological processes, such as alcoholic and malolactic fermentations. These transformations involve respectively the yeast Saccharomyces cerevisiae and the lactic acid bacterium Oenococcus oeni. Both species play a central role in red winemaking but their quantitative and qualitative contribution to the revelation of the organoleptic qualities of wine has not yet been fully described. The aim of this study was to elucidate the influence of sequential inoculation of different yeast and bacteria strains on the aromatic profile of red Bordeaux wine. All microorganisms completed fermentations and no significant difference was observed between tanks regarding the main oenological parameters until 3 months' aging. Regardless of the yeast strain, B28 bacteria required the shortest period to completely degrade the malic acid, compared to the other strain. Quantification of 73 major components highlighted a specific volatile profile corresponding to each microorganism combination. However, the yeast strain appeared to have a predominant effect on aromatic compound levels, as well as on fruity aroma perception. Yeasts had a greater impact on wine quality and have more influence on the aromatic style of red wine than bacteria. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Buchovec, Irina; Lukseviciute, Viktorija; Marsalka, Arunas; Reklaitis, Ignas; Luksiene, Zivile
2016-04-01
This study is focused on the novel approaches to enhance the inactivation of the Gram (-) food pathogen Salmonella enterica and harmful molds in vitro and on the surface of strawberries using the chlorophyllin-chitosan complex. Salmonella enterica (∼1 × 10(7) CFU mL(-1)) was incubated with chlorophyllin 1.5 × 10(-5) M (Chl, food additive), chitosan 0.1% (CHS, food supplement) or the chlorophyllin-chitosan complex (1.5 × 10(-5) M Chl-0.1% CHS) and illuminated with visible light (λ = 405 nm, light dose 38 J cm(-2)) in vitro. Chlorophyllin (Chl)-based photosensitization inactivated Salmonella just by 1.8 log. Chitosan (CHS) alone incubated for 2 h with Salmonella reduced viability 2.15 log, whereas photoactivated Chl-CHS diminished bacterial viability by 7 log. SEM images indicate that the Chl-CHS complex under these experimental conditions covered the entire bacterial surface. Significant cell membrane disintegration was the main lethal injury induced in Gram (-) bacteria by this treatment. Analysis of strawberry decontamination from surface-inoculated Salmonella indicated that photoactivated Chl-CHS (1.5 × 10(-5) M Chl-0.1% CHS, 30 min incubation, light dose 38 J cm(-2)) coatings diminished the pathogen population on the surface of strawberries by 2.2 log. Decontamination of strawberries from naturally distributed yeasts/molds revealed that chitosan alone reduced the population of yeasts/molds just by 0.4 log, Chl-based photosensitization just by 0.9 log, whereas photoactivated Chl-CHS coatings reduced yeasts/molds on the surface of strawberries by 1.4 log. Electron paramagnetic resonance spectroscopy confirmed that no additional photosensitization-induced free radicals have been found in the strawberry matrix. Visual quality (color, texture) of the treated strawberries was not affected either. In conclusion, photoactive Chl-CHS exhibited strong antimicrobial action against more resistant to photosensitization Gram (-) Salmonella enterica in comparison with
USDA-ARS?s Scientific Manuscript database
Live yeast probiotics and yeast cell wall components (paraprobiotics) may serve as an alternative to the use of antibiotics in prevention and treatment of infections caused by pathogenic bacteria. Probiotics and paraprobiotics can bind directly to pathogens, which limits binding of the pathogens to ...
Degradation of spent craft brewer's yeast by caprine rumen hyper ammonia-producing bacteria.
Harlow, B E; Bryant, R W; Cohen, S D; O'Connell, S P; Flythe, M D
2016-10-01
Spent yeast from craft beers often includes more hops (Humulus lupulus L.) secondary metabolites than traditional recipes. These compounds include α- and β- acids, which are antimicrobial to the rumen hyper ammonia-producing bacteria (HAB) that are major contributors to amino acid degradation. The objective was to determine if the hops acids in spent craft brewer's yeast (CY; ~ 3·5 mg g(-1) hops acids) would protect it from degradation by caprine rumen bacteria and HAB when compared to a baker's yeast (BY; no hops acids). Cell suspensions were prepared by harvesting rumen fluid from fistulated goats, straining and differential centrifugation. The cells were re-suspended in media with BY or CY. After 24 h (39°C), HAB were enumerated and ammonia was measured. Fewer HAB and less ammonia was produced from CY than from BY. Pure culture experiments were conducted with Peptostreptococcus anaerobiusBG1 (caprine HAB). Ammonia production by BG1 from BY was greater than from CY. Ammonia production was greater when exogenous amino acids were included, but similar inhibition was observed in CY treatments. These results indicate that rumen micro-organisms deaminated the amino acids in CY to a lesser degree than BY. Spent brewer's yeast has long been included in ruminant diets as a protein supplement. However, modern craft beers often include more hops (Humulus lupulus L.) than traditional recipes. These compounds include α- and β- acids, which are antimicrobial to the rumen hyper ammonia-producing bacteria (HAB) that are major contributors to amino acid degradation. This study demonstrated that hops acids in spent craft brewer's yeast protected protein from destruction by HABin vitro. These results suggest that the spent yeast from craft breweries, a source of beneficial hops secondary metabolites, could have value as rumen-protected protein. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.
Lacerda, Inayara C A; Miranda, Rose L; Borelli, Beatriz M; Nunes, Alvaro C; Nardi, Regina M D; Lachance, Marc-André; Rosa, Carlos A
2005-11-25
Sour cassava starch is a traditional fermented food used in the preparation of fried foods and baked goods such as traditional cheese breads in Brazil. Thirty samples of sour cassava starch were collected from two factories in the state of Minas Gerais. The samples were examined for the presence of lactic acid bacteria, yeasts, mesophilic microorganisms, Bacillus cereus and faecal coliforms. Lactic acid bacteria and yeasts isolates were identified by biochemical tests, and the identities were confirmed by molecular methods. Lactobacillus plantarum and Lactobacillus fermentum were the prevalent lactic acid bacteria in product from both factories, at numbers between 6.0 and 9.0 log cfu g(-)(1). Lactobacillus perolans and Lactobacillus brevis were minor fractions of the population. Galactomyces geothricum and Issatchenkia sp. were the prevalent yeasts at numbers of 5.0 log cfu g(-)(1). A species similar to Candida ethanolica was frequently isolated from one factory. Mesophilic bacteria and amylolytic microorganisms were recovered in high numbers at all stages of the fermentation. B. cereus was found at low numbers in product at both factories. The spontaneous fermentations associated with the production of sour cassava starch involve a few species of lactic acid bacteria at high numbers and a variety of yeasts at relatively low numbers.
Antifungal Activity of Lactobacillus sp. Bacteria in the Presence of Xylitol and Galactosyl-Xylitol
Lipińska, Lidia; Klewicki, Robert; Klewicka, Elżbieta; Kołodziejczyk, Krzysztof; Sójka, Michał; Nowak, Adriana
2016-01-01
Lactic acid fermentation is a natural method of antimicrobial food protection. Antagonistic activity of Lactobacillus sp. bacteria, taking part in this process, is directed mainly against the same or other microorganisms. In this work we determine the impact of the presence of xylitol and galactosyl-xylitol on the antagonistic activity of 60 Lactobacillus sp. strains against indicator molds (Alternaria alternata, Alternaria brassicicola, Aspergillus niger, Fusarium latenicum, Geotrichum candidum, and Mucor hiemalis) and yeasts (Candida vini). We used double-layer method to select antifungal strains of Lactobacillus bacteria and poisoned medium method to confirm their fungistatic properties. Additionally, we examined the inhibition of Alternaria brassicicola by Lactobacillus paracasei ŁOCK 0921 cultivated with xylitol or galactosyl-xylitol directly on wild cherries. The presence of xylitol and its galactosyl derivative led to increase of spectrum of antifungal activity in most of the studied plant-associated lactobacilli strains. However, no single strain exhibited activity against all the indicator microorganisms. The antifungal activity of Lactobacillus bacteria against molds varied considerably and depended on both the indicator strain and the composition of the medium. The presence of xylitol and galactosyl-xylitol in the growth medium is correlated with the antifungal activity of the studied Lactobacillus sp. bacteria against selected indicator molds. PMID:27294124
Antifungal Activity of Lactobacillus sp. Bacteria in the Presence of Xylitol and Galactosyl-Xylitol.
Lipińska, Lidia; Klewicki, Robert; Klewicka, Elżbieta; Kołodziejczyk, Krzysztof; Sójka, Michał; Nowak, Adriana
2016-01-01
Lactic acid fermentation is a natural method of antimicrobial food protection. Antagonistic activity of Lactobacillus sp. bacteria, taking part in this process, is directed mainly against the same or other microorganisms. In this work we determine the impact of the presence of xylitol and galactosyl-xylitol on the antagonistic activity of 60 Lactobacillus sp. strains against indicator molds (Alternaria alternata, Alternaria brassicicola, Aspergillus niger, Fusarium latenicum, Geotrichum candidum, and Mucor hiemalis) and yeasts (Candida vini). We used double-layer method to select antifungal strains of Lactobacillus bacteria and poisoned medium method to confirm their fungistatic properties. Additionally, we examined the inhibition of Alternaria brassicicola by Lactobacillus paracasei ŁOCK 0921 cultivated with xylitol or galactosyl-xylitol directly on wild cherries. The presence of xylitol and its galactosyl derivative led to increase of spectrum of antifungal activity in most of the studied plant-associated lactobacilli strains. However, no single strain exhibited activity against all the indicator microorganisms. The antifungal activity of Lactobacillus bacteria against molds varied considerably and depended on both the indicator strain and the composition of the medium. The presence of xylitol and galactosyl-xylitol in the growth medium is correlated with the antifungal activity of the studied Lactobacillus sp. bacteria against selected indicator molds.
Hu, Hao; Xu, Yang; Lu, Huang-ping; Xiao, Rui; Zheng, Xiao-dong; Yu, Ting
2015-01-01
A total of 20 strains of yeast isolated from Tibetan fermented products were screened for antagonism against blue mold of pear caused by Penicillium expansum. Six isolates that inhibited incidence of postharvest decay by 35% or more were selected for further screening. Among them, the most effective was Rhodotorula mucilaginosa. The results showed that washed cell suspensions of R. mucilaginosa yielded better antagonistic efficacy than unwashed cell-culture mixtures, cell-free culture filtrates, and autoclaved cell cultures. Biocontrol activity improved with increasing concentrations of incubated cells. The best concentration was 1×108 cells/ml, at which the incidence of decay was only 16.7% after 6 d of incubation. The germination of conidia of P. expansum in vitro was significantly inhibited by both washed cell-suspensions and unwashed cell-culture mixtures. Rapid colonization by yeast at different concentrations showed a relationship between yeast-cell concentration and biocontrol activity. Although the titratable acidity of pear fruits increased after treatment, R. mucilaginosa did not affect the total soluble solids or ascorbic acid content. This is the first study to report that the yeast R. mucilaginosa from Tibet Autonomous Region of China may have potential as an antagonist to control the postharvest decay of pear fruits. PMID:25845361
Hu, Hao; Xu, Yang; Lu, Huang-ping; Xiao, Rui; Zheng, Xiao-dong; Yu, Ting
2015-04-01
A total of 20 strains of yeast isolated from Tibetan fermented products were screened for antagonism against blue mold of pear caused by Penicillium expansum. Six isolates that inhibited incidence of postharvest decay by 35% or more were selected for further screening. Among them, the most effective was Rhodotorula mucilaginosa. The results showed that washed cell suspensions of R. mucilaginosa yielded better antagonistic efficacy than unwashed cell-culture mixtures, cell-free culture filtrates, and autoclaved cell cultures. Biocontrol activity improved with increasing concentrations of incubated cells. The best concentration was 1×10(8) cells/ml, at which the incidence of decay was only 16.7% after 6 d of incubation. The germination of conidia of P. expansum in vitro was significantly inhibited by both washed cell-suspensions and unwashed cell-culture mixtures. Rapid colonization by yeast at different concentrations showed a relationship between yeast-cell concentration and biocontrol activity. Although the titratable acidity of pear fruits increased after treatment, R. mucilaginosa did not affect the total soluble solids or ascorbic acid content. This is the first study to report that the yeast R. mucilaginosa from Tibet Autonomous Region of China may have potential as an antagonist to control the postharvest decay of pear fruits.
Möritz, M; Peters, H; Nipko, B; Rüden, H
2001-07-01
The capability of air filters (filterclass: F6, F7) to retain airborne outdoor microorganisms was examined in field experiments in two heating, ventilating and air conditioning (HVAC) systems. At the beginning of the 15-month investigation period, the first filter stages of both HVAC systems were equipped with new unused air filters. The number of airborne bacteria and molds before and behind the filters were determined simultaneously in 14 days-intervals using 6-stage Andersen cascade impactors. Under relatively dry (< 80% R. H.) and warm (> 12 degrees C) outdoor air conditions air filters led to a marked reduction of airborne microorganism concentrations (bacteria by approximately 70% and molds by > 80%). However, during long periods of high relative humidity (> 80% R. H.) a proliferation of bacteria on air filters with subsequent release into the filtered air occurred. These microorganisms were mainly smaller than 1.1 microns therefore being part of the respirable fraction. The results showed furthermore that one possibility to avoid microbial proliferation is to limit the relative humidity in the area of the air filters to 80% R. H. (mean of 3 days), e.g. by using preheaters in front of air filters in HVAC-systems.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Blanchette, R.A.; Shaw, C.G.; Cohen, A.L.
The scanning electron microscope was used to 1) examine the associations among microorganisms during wood decay and 2) observe the effect of these organisms on degradation of cell wall components. Bacteria (Enterobacter) and yeasts (Cryptococcus Pichia, and Saccharomyces) were found to have a mutualistic association with a white-rot fungus during decay of coniferous wood. Coriolus (Polyporus versicolar) degraded cell wall components in a typical ''erosion trough'' manner (i.e., by lysing zones around fungal hyphae). Bacteria and yeasts were seen only in these lysed zones. Typical gross decay patterns caused by the white-rot fungus were unaltered by bacteria and yeasts. Themore » SEM study suggests that the decay process is enhanced when these organisms are associated. In contrast, the same bacteria and yeasts were inhibitory when combined with a brown-rot fungus.« less
Carvalho, B F; Ávila, C L S; Bernardes, T F; Pereira, M N; Santos, C; Schwan, R F
2017-03-01
The aim of this study was to evaluate the chemical and microbiological characteristics and to identify the lactic acid bacteria (LAB) and yeasts involved in rehydrated corn kernel silage. Four replicates for each fermentation time: 5, 15, 30, 60, 90, 150, 210 and 280 days were prepared. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and PCR-based identification were utilized to identify LAB and yeasts. Eighteen bacteria and four yeast species were identified. The bacteria population reached maximum growth after 15 days and moulds were detected up to this time. The highest dry matter (DM) loss was 7·6% after 280 days. The low concentration of water-soluble carbohydrates (20 g kg -1 of DM) was not limiting for fermentation, although the reduction in pH and acid production occurred slowly. Storage of the rehydrated corn kernel silage increased digestibility up to day 280. This silage was dominated by LAB but showed a slow decrease in pH values. This technique of corn storage on farms increased the DM digestibility. This study was the first to evaluate the rehydrated corn kernel silage fermentation dynamics and our findings are relevant to optimization of this silage fermentation. © 2016 The Society for Applied Microbiology.
Genotoxicity of diphenyl diselenide in bacteria and yeast.
Rosa, Renato Moreira; Sulzbacher, Krisley; Picada, Jaqueline Nascimento; Roesler, Rafael; Saffi, Jenifer; Brendel, Martin; Henriques, João Antonio Pêgas
2004-10-10
Diphenyl diselenide (DPDS) is an electrophilic reagent used in the synthesis of a variety of pharmacologically active organic selenium compounds. This may increase the risk of human exposure to the chemical at the workplace. We have determined its mutagenic potential in the Salmonella/microsome assay and used the yeast Saccharomyces cerevisiae to assay for putative genotoxicity, recombinogenicity and to determine whether DNA damage produced by DPDS is repairable. Only in exponentially growing cultures was DPDS able to induce frameshift mutations in S. typhimurium and haploid yeast and to increase crossing over and gene conversion frequencies in diploid strains of S. cerevisiae. Thus, DPDS presents a behavior similar to that of an intercalating agent. Mutants defective in excision-resynthesis repair (rad3, rad1), in error-prone repair (rad6) and in recombinational repair (rad52) showed higher than WT-sensitivity to DPDS. It appears that this compound is capable of inducing single and/or double strand breaks in DNA. An epistatic interaction was shown between rad3-e5 and rad52-1 mutant alleles, indicating that excision-resynthesis and strand-break repair may possess common steps in the repair of DNA damage induced by DPDS. DPDS was able to enhance the mutagenesis induced by oxidative mutagens in bacteria. N-acetylcysteine, a glutathione biosynthesis precursor, prevented mutagenesis induced by DPDS in yeast. We have shown that DPDS is a weak mutagen which probably generates DNA strand breaks through both its intercalating action and pro-oxidant effect.
Effects of yeasts and bacteria on the levels of folates in rye sourdoughs.
Kariluoto, Susanna; Aittamaa, Marja; Korhola, Matti; Salovaara, Hannu; Vahteristo, Liisa; Piironen, Vieno
2006-02-01
Fermentation of rye dough is often accompanied with an increase in folate content. In this study, three sourdough yeasts, Candida milleri CBS 8195, Saccharomyces cerevisiae TS 146, and Torulaspora delbrueckii TS 207; a control, baker's yeast S. cerevisiae ALKO 743; and four Lactobacillus spp., L. acidophilus TSB 262, L. brevis TSB 307, L. plantarum TSB 304, and L. sanfranciscensis TSB 299 originally isolated from rye sourdough were examined for their abilities to produce or consume folates. The microorganisms were grown in yeast extract-peptone-d-glucose medium as well as in small-scale fermentations that modelled the sourdough fermentation step used in rye baking. Total folate contents were determined using Lactobacillus rhamnosus (ATCC 7469) as the growth indicator organism. The microorganisms studied did not excrete folates into the media in significant amounts. Yeasts increased the folate contents of sterilised rye flour-water mixtures from 6.5 microg/100 g to between 15 and 23 microg/100 g after 19-h fermentation, whereas lactic acid bacteria decreased it to between 2.9 and 4.2 microg/100 g. Strains of Lactobacillus bulgaricus, L. casei, L. curvatus, L. fermentum, L. helveticus, Pediococcus spp., and Streptococcus thermophilus that were also tested gave folate contents after fermentation that varied between 2 and 10.4 microg/100 g. Although the four Lactobacillus spp. from sourdough consumed folates their effect on folate contents in co-cultivations was minimal. It was concluded that the increase of folate content during fermentation was mainly due to folate synthesis by yeasts. Fermentation of non-sterilised flour-water mixtures as such resulted in three-fold increases in the folate contents. Two folate producing bacteria were isolated from the non-sterilised flour and identified as Enterobacter cowanii and Pantoea agglomerans.
Maphanga, Tsidiso G; Britz, Erika; Zulu, Thokozile G; Mpembe, Ruth S; Naicker, Serisha D; Schwartz, Ilan S; Govender, Nelesh P
2017-06-01
Disseminated emmonsiosis is an important AIDS-related mycosis in South Africa that is caused by Emergomyces africanus , a newly described and renamed dimorphic fungal pathogen. In vitro antifungal susceptibility data can guide management. Identification of invasive clinical isolates was confirmed phenotypically and by sequencing of the internal transcribed spacer region. Yeast and mold phase MICs of fluconazole, voriconazole, itraconazole, posaconazole, caspofungin, anidulafungin, micafungin, and flucytosine were determined with custom-made frozen broth microdilution (BMD) panels in accordance with Clinical and Laboratory Standards Institute recommendations. MICs of amphotericin B, itraconazole, posaconazole, and voriconazole were determined by Etest. Fifty unique E. africanus isolates were tested. The yeast and mold phase geometric mean (GM) BMD and Etest MICs of itraconazole were 0.01 mg/liter. The voriconazole and posaconazole GM BMD MICs were 0.01 mg/liter for both phases, while the GM Etest MICs were 0.001 and 0.002 mg/liter, respectively. The fluconazole GM BMD MICs were 0.18 mg/liter for both phases. The GM Etest MICs of amphotericin B, for the yeast and mold phases were 0.03 and 0.01 mg/liter. The echinocandins and flucytosine had very limited in vitro activity. Treatment and outcome data were available for 37 patients; in a multivariable model including MIC data, only isolation from blood (odds ratio [OR], 8.6; 95% confidence interval [CI], 1.3 to 54.4; P = 0.02) or bone marrow (OR, 12.1; 95% CI, 1.2 to 120.2; P = 0.03) (versus skin biopsy) was associated with death. In vitro susceptibility data support the management of disseminated emmonsiosis with amphotericin B, followed by itraconazole, voriconazole, or posaconazole. Fluconazole was a relatively less potent agent. Copyright © 2017 American Society for Microbiology.
Britz, Erika; Zulu, Thokozile G.; Mpembe, Ruth S.; Naicker, Serisha D.; Schwartz, Ilan S.
2017-01-01
ABSTRACT Disseminated emmonsiosis is an important AIDS-related mycosis in South Africa that is caused by Emergomyces africanus, a newly described and renamed dimorphic fungal pathogen. In vitro antifungal susceptibility data can guide management. Identification of invasive clinical isolates was confirmed phenotypically and by sequencing of the internal transcribed spacer region. Yeast and mold phase MICs of fluconazole, voriconazole, itraconazole, posaconazole, caspofungin, anidulafungin, micafungin, and flucytosine were determined with custom-made frozen broth microdilution (BMD) panels in accordance with Clinical and Laboratory Standards Institute recommendations. MICs of amphotericin B, itraconazole, posaconazole, and voriconazole were determined by Etest. Fifty unique E. africanus isolates were tested. The yeast and mold phase geometric mean (GM) BMD and Etest MICs of itraconazole were 0.01 mg/liter. The voriconazole and posaconazole GM BMD MICs were 0.01 mg/liter for both phases, while the GM Etest MICs were 0.001 and 0.002 mg/liter, respectively. The fluconazole GM BMD MICs were 0.18 mg/liter for both phases. The GM Etest MICs of amphotericin B, for the yeast and mold phases were 0.03 and 0.01 mg/liter. The echinocandins and flucytosine had very limited in vitro activity. Treatment and outcome data were available for 37 patients; in a multivariable model including MIC data, only isolation from blood (odds ratio [OR], 8.6; 95% confidence interval [CI], 1.3 to 54.4; P = 0.02) or bone marrow (OR, 12.1; 95% CI, 1.2 to 120.2; P = 0.03) (versus skin biopsy) was associated with death. In vitro susceptibility data support the management of disseminated emmonsiosis with amphotericin B, followed by itraconazole, voriconazole, or posaconazole. Fluconazole was a relatively less potent agent. PMID:28356416
Interaction between lactic acid bacteria and yeasts in sour-dough using a rheofermentometer.
Gobbetti, M; Corsetti, A; Rossi, J
1995-11-01
Rheofermentometer assays were used to characterize the leavening of sour-doughs produced using species of lactic acid bacteria (LAB) and yeasts, alone or in combination. Saccharomyces cerevisiae 141 produced the most CO2 and ethanol whereas S. exiguus M14 and Lactobacillus brevis subsp. lindneri CB1 contributed poorly to leavening and gave sour-doughs without porosity. In comparison with that seen in sour-dough produced with yeast alone, yeast fermentation with heterofermentative LAB present was faster whereas that with homofermentative LAB (L. plantarum DC400, L. farciminis CF3) present was slower and produced more CO2. Combining L. brevis subsp. lindneri CB1 with S. cerevisiae 141 decreased bacterial cell numbers and souring activity. However, addition of fructose to the sour-dough overcame these problems as well as activating S. cerevisiae 141.
Use of an acidophilic yeast strain to enable the growth of leaching bacteria on solid media.
Ngom, Baba; Liang, Yili; Liu, Yi; Yin, Huaqun; Liu, Xueduan
2015-03-01
In this study, a Candida digboiensis strain was isolated from a heap leaching plant in Zambia and used in double-layer agar plate to efficiently isolate and purify leaching bacteria. Unlike Acidiphilium sp., the yeast strain was tetrathionate tolerant and could metabolize a great range of organic compounds including organic acids. These properties allowed the yeast strain to enable and fasten the growth of iron and sulfur oxidizers on double-layer agar plate. The isolates were identified as Acidithiobacillus ferrooxidans FOX1, Leptospirillun ferriphilum BN, and Acidithiobacillus thiooxidans ZMB. These three leaching bacteria were inhibited by organic acids such as acetic and propionic acids; however, their activities were enhanced by Candida digboiensis NB under dissolved organic matter stress.
Hu, Hao; Wisniewski, Michael E; Abdelfattah, Ahmed; Zheng, Xiaodong
2017-07-01
Cold-adapted biocontrol yeast was selected from four yeast isolates from Tibet against gray mold of cherry tomato in cold storage. The strain numbered LB2 showed the best biocontrol activity and identified as Cryptococcus laurentii. Competition for nutrient, space, and induced fruit resistance was also its antagonistic mechanism. Compared with C. laurentii from sea-level place, the reason why LB2 had a better biocontrol activity was studied. More trehalose and proline in cell of LB2 made it exhibit a better cellular activity at low temperature, such as higher population dynamics in the wounds of cherry tomato and more biocontrol-related enzyme secretion, chitinase and β-glucanase. The better oxidative stress tolerance was another characteristic of LB2. Maybe because of the ideal culture condition, there was no obvious difference between these two yeasts in the growth in vitro test at low temperature. Although the same phenomenon existed in the low pH stress test, LB2 still had higher cell concentration under this stress. Comparative transcriptomics method was also applied to analyze the cell activity of LB2 and C. laurentii at different temperatures. The results showed that more active response in the intracellular structure and intracellular metabolic process to cold temperature made LB2 had a better activity. The present study indicated a possibility to select cold-adapted biocontrol yeast from Tibet and also showed its primary action mechanism.
Hagler, A N; Rosa, C A; Morais, P B; Mendonça-Hagler, L C; Franco, G M; Araujo, F V; Soares, C A
1993-10-01
Yeasts and coliform bacteria were isolated from water that accumulated in the central cups and adjacent leaf axilae of two bromeliads, Neoregelia cruenta of a coastal sand dune and Quesnelia quesneliana of a mangrove ecosystem near the city of Rio de Janeiro, Brazil. The mean total coliform counts were above 10,000 per 100 mL for waters of both plants, but the mean fecal coliform counts were only 74 per 100 mL for Q. quesneliana and mostly undetected in water from N. cruenta. Of 90 fecal coliform isolates, 51 were typical of Escherichia coli in colony morphology and indol, methyl red, Volges-Proskauer, and citrate (IMViC) tests. Seven representatives of the typical E. coli cultures were identified as this species, but the identifications of nine other coliform bacteria were mostly dubious. The yeast community of N. cruenta was typical of plant surfaces with basidiomycetous yeasts anamorphs, and the black yeast Aureobasidium pullulans was prevalent. Quesnelia quesneliana had a substantial proportion of ascomycetous yeasts and their anamorphs, including a probable new biotype of Saccharomyces unisporus. Our results suggested that the microbial communities in bromeliad waters are typically autochtonous and not contaminants.
Kwon, Sang-Jo; Chang, Yoonjee; Han, Jaejoon
2017-08-01
This study investigated the effectiveness of a polyvinyl alcohol (PVA) film containing the natural antimicrobial oregano essential oil (OEO) as an active packaging application for decreasing the microbial growth. The film exerted an antimicrobial effect via the atmosphere surrounding the food rather than direct contact, thereby preserving the quality of cherry tomatoes. A packaging film containing microencapsulated OEO was developed. The loading content increased gradually (104.29-234.29 μg OEO/mg film) with the amount of OEO incorporated (1%, 2%, and 3%), where the PVA films containing 2% OEO had the highest loading efficiency (91.64%), followed by 1% OEO (90.96%) and 3% OEO (88.38%). The antimicrobial activities of the films were evaluated by applying it to fresh cherry tomatoes at 4 °C and 22 °C for 7 days. The large 2% OEO film as well as both the small and large 3% OEO films had strong antimicrobial effects against Salmonella enterica, molds and yeasts, and mesophilic aerobic bacteria. The changes in the hardness, weight, and color of the cherry tomatoes during storage did not differ significantly. The films could be utilized as a packaging material for fresh produce with antimicrobial effects because of the controlled atmosphere surrounding the food rather than by direct contact. Copyright © 2017 Elsevier Ltd. All rights reserved.
Wu, Jia Jia; Ma, Ying Kun; Zhang, Fen Fen; Chen, Fu Sheng
2012-05-01
Shanxi aged vinegar is a famous traditional Chinese vinegar made from several kinds of cereal by spontaneous solid-state fermentation techniques. In order to get a comprehensive understanding of culturable microorganism's diversity present in its fermentation, the indigenous microorganisms including 47 yeast isolates, 28 lactic acid bacteria isolates and 58 acetic acid bacteria isolates were recovered in different fermenting time and characterized based on a combination of phenotypic and genotypic approaches including inter-delta/PCR, PCR-RFLP, ERIC/PCR analysis, as well as 16S rRNA and 26S rRNA partial gene sequencing. In the alcoholic fermentation, the dominant yeast species Saccharomyces (S.) cerevisiae (96%) exhibited low phenotypic and genotypic diversity among the isolates, while Lactobacillus (Lb.) fermentum together with Lb. plantarum, Lb. buchneri, Lb. casei, Pediococcus (P.) acidilactici, P. pentosaceus and Weissella confusa were predominated in the bacterial population at the same stage. Acetobacter (A.) pasteurianus showing great variety both in genotypic and phenotypic tests was the dominant species (76%) in the acetic acid fermentation stage, while the other acetic acid bacteria species including A. senegalensis, A. indonesiensis, A. malorum and A. orientalis, as well as Gluconobacter (G.) oxydans were detected at initial point of alcoholic and acetic acid fermentation stage respectively. Copyright © 2011 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Jehlicka, J.; Osterrothova, K.; Nedbalova, L.; Gunde-Cimerman, N.; Oren, A.
2014-06-01
Handheld Raman instrumentation with 532 nm lasers can be used to distinguish carotenoids of autotrophic microalgae, purple sulfur bacteria, halophilic Archaea and pigmented yeasts. Pigments are proposed as biomarkers for astrobiology of Mars.
Wang, Huxuan; Hu, Zhongqiu; Long, Fangyu; Niu, Chen; Yuan, Yahong; Yue, Tianli
2015-08-01
Yeasts and yeast-like fungal isolates were recovered from apple orchards and apple juice processing plants located in the Shaanxi province of China. The strains were evaluated for osmotolerance by growing them in 50% (w/v) glucose. Of the strains tested, 66 were positive for osmotolerance and were subsequently identified by 26S or 5.8S-ITS ribosomal RNA (rRNA) gene sequencing. Physiological tests and RAPD-PCR analysis were performed to reveal the polymorphism of isolates belonging to the same species. Further, the spoilage potential of the 66 isolates was determining by evaluating their growth in 50% to 70% (w/v) glucose and measuring gas generation in 50% (w/v) glucose. Thirteen osmotolerant isolates representing 9 species were obtained from 10 apple orchards and 53 target isolates representing 19 species were recovered from 2 apple juice processing plants. In total, members of 14 genera and 23 species of osmotolerant isolates including yeast-like molds were recovered from all sources. The commonly recovered osmotolerant isolates belonged to Kluyveromyces marxianus, Hanseniaspora uvarum, Saccharomyces cerevisiae, Zygosaccharomyces rouxii, Candida tropicalis, and Pichia kudriavzevii. The polymorphism of isolates belonging to the same species was limited to 1 to 3 biotypes. The majority of species were capable of growing within a range of glucose concentration, similar to sugar concentrations found in apple juice products with a lag phase from 96 to 192 h. Overall, Z. rouxii was particularly the most tolerant to high glucose concentration with the shortest lag phase of 48 h in 70% (w/v) glucose and the fastest gas generation rate in 50% (w/v) glucose. © 2015 Institute of Food Technologists®
Antimicrobial Treatments of Indoor Mold and Bacteria
Biological contaminants especially mold in buildings are known to act as sources of indoor air pollution, discomfort, asthma and pulmonary disease to building occupants. Sick buildings are evidence of extremely problematic indoor air quality (IAQ), often resulting from unacceptab...
Matrix factorization-based data fusion for gene function prediction in baker's yeast and slime mold.
Zitnik, Marinka; Zupan, Blaž
2014-01-01
The development of effective methods for the characterization of gene functions that are able to combine diverse data sources in a sound and easily-extendible way is an important goal in computational biology. We have previously developed a general matrix factorization-based data fusion approach for gene function prediction. In this manuscript, we show that this data fusion approach can be applied to gene function prediction and that it can fuse various heterogeneous data sources, such as gene expression profiles, known protein annotations, interaction and literature data. The fusion is achieved by simultaneous matrix tri-factorization that shares matrix factors between sources. We demonstrate the effectiveness of the approach by evaluating its performance on predicting ontological annotations in slime mold D. discoideum and on recognizing proteins of baker's yeast S. cerevisiae that participate in the ribosome or are located in the cell membrane. Our approach achieves predictive performance comparable to that of the state-of-the-art kernel-based data fusion, but requires fewer data preprocessing steps.
House microbiotas as sources of lactic acid bacteria and yeasts in traditional Italian sourdoughs.
Minervini, Fabio; Lattanzi, Anna; De Angelis, Maria; Celano, Giuseppe; Gobbetti, Marco
2015-12-01
This study aimed at understanding the extent of contamination by lactic acid bacteria (LAB) and yeasts from the house microbiotas during sourdough back-slopping. Besides sourdoughs, wall, air, storage box, dough mixer and flour of four bakeries were analyzed. Based on plate counts, LAB and yeasts dominated the house microbiota. Based on high throughput sequencing of the 16S rRNA genes, flour harbored the highest number of Firmicutes, but only few of them adapted to storage box, dough mixer and sourdough. Lactobacillus sanfranciscensis showed the highest abundance in dough mixer and sourdoughs. Lactobacillus plantarum persisted only in storage box, dough mixer and sourdough of two bakeries. Weissella cibaria also showed higher adaptability in sourdough than in bakery equipment, suggesting that flour is the main origin of this species. Based on 18S rRNA data, Saccharomyces cerevisiae was the dominant yeast in house and sourdough microbiotas, excepted one bakery dominated by Kazachstania exigua. The results of this study suggest that the dominant species of sourdough LAB and yeasts dominated also the house microbiota. Copyright © 2015 Elsevier Ltd. All rights reserved.
Interaction between lactic acid bacteria and yeasts in airag, an alcoholic fermented milk.
Sudun; Wulijideligen; Arakawa, Kensuke; Miyamoto, Mari; Miyamoto, Taku
2013-01-01
The interaction between nine lactic acid bacteria (LAB) and five yeast strains isolated from airag of Inner Mongolia Autonomic Region, China was investigated. Three representative LAB and two yeasts showed symbioses were selected and incubated in 10% (w/v) reconstituted skim milk as single and mixed cultures to measure viable count, titratable acidity, ethanol and sugar content every 24 h for 1 week. LAB and yeasts showed high viable counts in the mixed cultures compared to the single cultures. Titratable acidity of the mixed cultures was obviously enhanced compared with that of the single cultures, except for the combinations of Lactobacillus reuteri 940B3 with Saccharomyces cerevisiae 4C and Lactobacillus helveticus 130B4 with Candida kefyr 2Y305. C. kefyr 2Y305 produced large amounts of ethanol (maximum 1.35 g/L), whereas non-lactose-fermenting S. cerevisiae 4C produced large amounts of ethanol only in the mixed cultures. Total glucose and galactose content increased while lactose content decreased in the single cultures of Leuconostoc mesenteroides 6B2081 and Lb. helveticus 130B4. However, both glucose and galactose were completely consumed and lactose was markedly reduced in the mixed cultures with yeasts. The result suggests that yeasts utilize glucose and galactose produced by LAB lactase to promote cell growth. © 2012 The Authors. Animal Science Journal © 2012 Japanese Society of Animal Science.
M Weerasekera, Manjula; H Sissons, Chris; Wong, Lisa; A Anderson, Sally; R Holmes, Ann; D Cannon, Richard
2017-10-01
The aim was to investigate the relationship between groups of bacteria identified by cluster analysis of the DGGE fingerprints and the amounts and diversity of yeast present. Bacterial and yeast populations in saliva samples from 24 adults were analysed using denaturing gradient gel electrophoresis (DGGE) of the bacteria present and by yeast culture. Eubacterial DGGE banding patterns showed considerable variation between individuals. Seventy one different amplicon bands were detected, the band number per saliva sample ranged from 21 to 39 (mean±SD=29.3±4.9). Cluster and principal component analysis of the bacterial DGGE patterns yielded three major clusters containing 20 of the samples. Seventeen of the 24 (71%) saliva samples were yeast positive with concentrations up to 10 3 cfu/mL. Candida albicans was the predominant species in saliva samples although six other yeast species, including Candida dubliniensis, Candida tropicalis, Candida krusei, Candida guilliermondii, Candida rugosa and Saccharomyces cerevisiae, were identified. The presence, concentration, and species of yeast in samples showed no clear relationship to the bacterial clusters. Despite indications of in vitro bacteria-yeast interactions, there was a lack of association between the presence, identity and diversity of yeasts and the bacterial DGGE fingerprint clusters in saliva. This suggests significant ecological individual-specificity of these associations in highly complex in vivo oral biofilm systems under normal oral conditions. Copyright © 2017 Elsevier Ltd. All rights reserved.
Visintin, Simonetta; Alessandria, Valentina; Valente, Antonio; Dolci, Paola; Cocolin, Luca
2016-01-04
Yeast, lactic acid bacteria (LAB) and acetic acid bacteria (AAB) populations, isolated from cocoa bean heap and box fermentations in West Africa, have been investigated. The fermentation dynamicswere determined by viable counts, and 106 yeasts, 105 LAB and 82 AAB isolateswere identified by means of rep-PCR grouping and sequencing of the rRNA genes. During the box fermentations, the most abundant species were Saccharomyces cerevisiae, Candida ethanolica, Lactobacillus fermentum, Lactobacillus plantarum, Acetobacter pasteurianus and Acetobacter syzygii, while S. cerevisiae, Schizosaccharomyces pombe, Hanseniaspora guilliermondii, Pichia manshurica, C. ethanolica, Hanseniaspora uvarum, Lb. fermentum, Lb. plantarum, A. pasteurianus and Acetobacter lovaniensis were identified in the heap fermentations. Furthermore, the most abundant species were molecularly characterized by analyzing the rep-PCR profiles. Strains grouped according to the type of fermentations and their progression during the transformation process were also highlighted. The yeast, LAB and AAB isolates were physiologically characterized to determine their ability to grow at different temperatures, as well as at different pH, and ethanol concentrations, tolerance to osmotic stress, and lactic acid and acetic acid inhibition. Temperatures of 45 °C, a pH of 2.5 to 3.5, 12% (v/v) ethanol and high concentrations of lactic and acetic acid have a significant influence on the growth of yeasts, LAB and AAB. Finally, the yeastswere screened for enzymatic activity, and the S. cerevisiae, H. guilliermondii, H. uvarumand C. ethanolica species were shown to possess several enzymes that may impact the quality of the final product.
Gaetti-Jardim Júnior, Elerson; Nakano, Viviane; Wahasugui, Thais C.; Cabral, Fátima C.; Gamba, Rosa; Avila-Campos, Mario Julio
2008-01-01
The purpose of this study was to determine the prevalence of enteric bacteria and yeasts in biofilm of 80 HIV-positive patients with plaque-associated gingivitis or necrotizing periodontitis. Patients were subjected to extra, intra oral and radiographic examinations. The oral hygiene, bleeding on probing, gingival conditions, and attachment loss were evaluated. Clinical specimens were collected from gingival crevices or periodontal pockets, transferred to VMGA III, diluted and transferred to Sabouraud Dextrose agar with 100 μg/ml of chloramphenicol, peptone water, EVA broth, EMB agar, SS agar, Bile esculin agar and Brilliant green agar. Isolation of yeasts was carried out at room temperature, for 3-7 days; and for the isolation of enteric microorganisms plates were incubated at 37°C, for 24-48 h. The yeasts identification was performed according to the carbon and nitrogen assimilation, fermentation of carbohydrates and germ tube formation. Bacteria were identified according to their colonial and cellular morphologies and biochemical tests. Yeasts were identified as Candida albicans and its occurrence was more common in patients with CD4+ below 200/mm3 and was affected by the extension of periodontal involvement (P = 0.0345). Enteric bacteria recovered from clinical specimens were identified as Enterobacter sakazakii, Enterobacter cloacae, Serratia liquefaciens, Klebsiella oxytoca and Enterococcus sp. Enterobacteriaceae and enterococci were detected in 32.5% of clinical samples from patients with necrotizing periodontitis. In conclusion, non-oral pathogenic bacteria and C. albicans were more prevalent in periodontal sites of HIV-positive patients with necrotizing periodontitis and chronic gingivitis. PMID:24031212
Li, Yang; He, Dongwei; Niu, Dongjie; Zhao, Youcai
2015-05-01
In this study, yeast and acetic acid bacteria strains were adopted to enhance the ethanol-type fermentation resulting to a volatile fatty acids yield of 30.22 g/L, and improve acetic acid production to 25.88 g/L, with food wastes as substrate. In contrast, only 12.81 g/L acetic acid can be obtained in the absence of strains. The parameters such as pH, oxidation reduction potential and volatile fatty acids were tested and the microbial diversity of different strains and activity of hydrolytic ferment were investigated to reveal the mechanism. The optimum pH and oxidation reduction potential for the acetic acid production were determined to be at 3.0-3.5 and -500 mV, respectively. Yeast can convert organic matters into ethanol, which is used by acetic acid bacteria to convert the organic wastes into acetic acid. The acetic acid thus obtained from food wastes micro-aerobic fermentation liquid could be extracted by distillation to get high-pure acetic acid.
Species-specific cell mobility of bacteria-feeding myxamoebae in plasmodial slime molds.
Hoppe, Thomas; Kutschera, Ulrich
2015-01-01
On decaying wood or litter in forests, plasmodial slime molds (myxomycetes) represent a large fraction of eukaryotic protists that feed on bacteria. In his seminal book Experimental Physiology of Plants (1865), Julius Sachs referred to the multinucleate plasmodium of myxomycetes, which were considered at that time as primitive plants (or fungi). Today it is well established that myxomycetes are members of the Amoebozoa (Protista). In this study we compare the mobility of myxamoebae of 3 European species, Lycogala epidendrum (order Liceales), Tubulifera arachnoidea, and Trichia decipiens (order Trichiales). Using agar plates, on which 3 separate bacterial species were cultivated as prey organisms (Methylobacterium mesophilicum, Escherichia coli, Agrobacterium tumefaciens), we document large differences in cell motility between the myxomycetes investigated. In addition, we show that the 3 species of myxamoebae can be distinguished based on their average cell size. These data shed light on the mode of co-occurrence via differential substrate utilization in these members of the Amoebozoa.
Species-specific cell mobility of bacteria-feeding myxamoebae in plasmodial slime molds
Hoppe, Thomas; Kutschera, Ulrich
2015-01-01
On decaying wood or litter in forests, plasmodial slime molds (myxomycetes) represent a large fraction of eukaryotic protists that feed on bacteria. In his seminal book Experimental Physiology of Plants (1865), Julius Sachs referred to the multinucleate plasmodium of myxomycetes, which were considered at that time as primitive plants (or fungi). Today it is well established that myxomycetes are members of the Amoebozoa (Protista). In this study we compare the mobility of myxamoebae of 3 European species, Lycogala epidendrum (order Liceales), Tubulifera arachnoidea, and Trichia decipiens (order Trichiales). Using agar plates, on which 3 separate bacterial species were cultivated as prey organisms (Methylobacterium mesophilicum, Escherichia coli, Agrobacterium tumefaciens), we document large differences in cell motility between the myxomycetes investigated. In addition, we show that the 3 species of myxamoebae can be distinguished based on their average cell size. These data shed light on the mode of co-occurrence via differential substrate utilization in these members of the Amoebozoa. PMID:26357877
Culex pipiens Development Is Greatly Influenced by Native Bacteria and Exogenous Yeast
Díaz-Nieto, Leonardo M.; D´Alessio, Cecilia
2016-01-01
Culex pipiens is the most cosmopolitan mosquito of the Pipiens Assemblage. By studying the nature of interactions between this species and microorganisms common to its breeding environment we can unravel important pitfalls encountered during development. We tested the survival rate of larval stages, pupae and adults of a Cx. pipiens colony exposed to a variety of microorganisms in laboratory conditions and assessed the transmission to offspring (F1) by those organisms that secured development up to adulthood. Three complementary experiments were designed to: 1) explore the nutritional value of yeasts and other microorganisms during Cx. pipiens development; 2) elucidate the transstadial transmission of yeast to the host offspring; and 3) to examine the relevance of all these microorganisms in female choice for oviposition-substratum. The yeast Saccharomyces cerevisiae proved to be the most nutritional diet, but despite showing the highest survival rates, vertical transmission to F1 was never confirmed. In addition, during the oviposition trials, none of the gravid females was attracted to the yeast substratum. Notably, the two native bacterial strains, Klebsiella sp. and Aeromonas sp., were the preferred oviposition media, the same two bacteria that managed to feed neonates until molting into 2nd instar larvae. Our results not only suggest that Klebsiella sp. or Aeromonas sp. serve as attractants for oviposition habitat selection, but also nurture the most fragile instar, L1, to assure molting into a more resilient stage, L2, while yeast proves to be the most supportive diet for completing development. These experiments unearthed survival traits that might be considered in the future development of strategies of Cx. pipiens control. These studies can be extended to other members of the Pipiens Assemblage. PMID:27055276
Bille, E; Dauphin, B; Leto, J; Bougnoux, M-E; Beretti, J-L; Lotz, A; Suarez, S; Meyer, J; Join-Lambert, O; Descamps, P; Grall, N; Mory, F; Dubreuil, L; Berche, P; Nassif, X; Ferroni, A
2012-11-01
All organisms usually isolated in our laboratory are now routinely identified by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) using the Andromas software. The aim of this study was to describe the use of this strategy in a routine clinical microbiology laboratory. The microorganisms identified included bacteria, mycobacteria, yeasts and Aspergillus spp. isolated on solid media or extracted directly from blood cultures. MALDI-TOF MS was performed on 2665 bacteria isolated on solid media, corresponding to all bacteria isolated during this period except Escherichia coli grown on chromogenic media. All acquisitions were performed without extraction. After a single acquisition, 93.1% of bacteria grown on solid media were correctly identified. When the first acquisition was not contributory, a second acquisition was performed either the same day or the next day. After two acquisitions, the rate of bacteria identified increased to 99.2%. The failures reported on 21 strains were due to an unknown profile attributed to new species (9) or an insufficient quality of the spectrum (12). MALDI-TOF MS has been applied to 162 positive blood cultures. The identification rate was 91.4%. All mycobacteria isolated during this period (22) were correctly identified by MALDI-TOF MS without any extraction. For 96.3% and 92.2% of yeasts and Aspergillus spp., respectively, the identification was obtained with a single acquisition. After a second acquisition, the overall identification rate was 98.8% for yeasts (160/162) and 98.4% (63/64) for Aspergillus spp. In conclusion, the MALDI-TOF MS strategy used in this work allows a rapid and efficient identification of all microorganisms isolated routinely. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.
Smith, Robert J; Klieger, Sarah B; Sulieman, Salwa E; Berger, Emily; Treat, James R; Fisher, Brian T
2018-01-01
Cutaneous lesions are often the first marker of invasive mold infection, which can cause substantial morbidity in immunocompromised children. The purpose of this study was to describe the evaluation and outcomes of immunocompromised children who presented with findings requiring skin biopsy because of concern about invasive infection. In children who were biopsied, we sought to determine the factors predictive of invasive mold infection. A retrospective review was conducted at the Children's Hospital of Philadelphia. Patients included in the study were immunocompromised individuals younger than 26 years old who underwent skin biopsy by the inpatient dermatology consultation team between January 1, 2003, and March 15, 2015, because of development of new cutaneous lesions that were suspected of being invasive infection. One hundred five encounters met the inclusion criteria. Fifty (47.6%) biopsied individuals had an infectious pathogen identified on histopathology or culture. Mold was the most common (36%) pathogen, followed by bacteria (32%) and yeast (26%). The presence of a single lesion (P = .001) and prior occlusion at the site of the lesion (P < .001) were associated with mold on biopsy. The combination of a single lesion, history of occlusion, and tissue necrosis on examination was highly predictive for invasive mold infection (86.3% [95% confidence interval 55.1-97.0%]). Of the 18 individuals with confirmed invasive mold infection, 13 (72%) underwent surgical resection, of whom 12 (92%) survived the 30-day follow-up period. Skin biopsy enabled the detection of a pathogen that informed directed therapeutic interventions in nearly half of participants. Institutions caring for immunocompromised children should ensure adequate staffing of clinical personnel approved to perform skin biopsies. © 2017 Wiley Periodicals, Inc.
Phenotypic responses to microbial volatiles render a mold fungus more susceptible to insect damage.
Caballero Ortiz, Silvia; Trienens, Monika; Pfohl, Katharina; Karlovsky, Petr; Holighaus, Gerrit; Rohlfs, Marko
2018-04-01
In decomposer systems, fungi show diverse phenotypic responses to volatile organic compounds of microbial origin (volatiles). The mechanisms underlying such responses and their consequences for the performance and ecological success of fungi in a multitrophic community context have rarely been tested explicitly. We used a laboratory-based approach in which we investigated a tripartite yeast-mold-insect model decomposer system to understand the possible influence of yeast-borne volatiles on the ability of a chemically defended mold fungus to resist insect damage. The volatile-exposed mold phenotype (1) did not exhibit protein kinase A-dependent morphological differentiation, (2) was more susceptible to insect foraging activity, and (3) had reduced insecticidal properties. Additionally, the volatile-exposed phenotype was strongly impaired in secondary metabolite formation and unable to activate "chemical defense" genes upon insect damage. These results suggest that volatiles can be ecologically important factors that affect the chemical-based combative abilities of fungi against insect antagonists and, consequently, the structure and dynamics of decomposer communities.
Influence of various scavengers of •OH radicals on the radiation sensitivity of yeast and bacteria.
Múčka, Viliam; Bláha, Pavel; Čuba, Václav; Červenák, Jaroslav
2013-12-01
To quantitatively investigate the influence of various •OH (hydroxyl radical) scavengers on the radiation sensitivity of yeast and bacteria, particularly to define the relationship between the protective effect of a scavenger and its •OH scavenging efficiency. In order to study the protective effect of •OH scavengers we used various concentrations of four scavengers (methanol, potassium formate, ethanol and ascorbic acid) in isotonic salt solutions. These solutions containing live yeast (Saccharomyces cerevisiae) or bacteria (Escherichia coli) were irradiated with (60)Co isotope γ -radiation using two different doses and dose rates. The number of surviving cells was determined prior to and after irradiation both in suspension with and without scavengers. The surviving fractions after irradiation with and without the scavenger were evaluated. The main results of the paper were: The surviving fraction increased approximately linearly within the measured interval with increasing concentration of the scavenger. The same dependences were found for the protecting effect depending on the scavenging efficiency. The slopes of these dependences (k) were found to be characteristic for each scavenger. The k value determined the degree in which the scavenging of •OH radicals participated in the protection of living cells. The protective effects of scavengers at the same scavenging efficiency were different and unique for each scavenger. No simple relation was found between the efficiency of scavenger k and the rate constant kOH of the reactions between scavengers and •OH radicals. Our results suggest that the studied scavengers effectively protected yeast and bacteria against ionizing radiation. Although the scavenging of •OH radicals seems to be important for protection of living cells, it is clearly not the only process on which the protection is based.
MATRIX FACTORIZATION-BASED DATA FUSION FOR GENE FUNCTION PREDICTION IN BAKER’S YEAST AND SLIME MOLD
ŽITNIK, MARINKA; ZUPAN, BLAŽ
2014-01-01
The development of effective methods for the characterization of gene functions that are able to combine diverse data sources in a sound and easily-extendible way is an important goal in computational biology. We have previously developed a general matrix factorization-based data fusion approach for gene function prediction. In this manuscript, we show that this data fusion approach can be applied to gene function prediction and that it can fuse various heterogeneous data sources, such as gene expression profiles, known protein annotations, interaction and literature data. The fusion is achieved by simultaneous matrix tri-factorization that shares matrix factors between sources. We demonstrate the effectiveness of the approach by evaluating its performance on predicting ontological annotations in slime mold D. discoideum and on recognizing proteins of baker’s yeast S. cerevisiae that participate in the ribosome or are located in the cell membrane. Our approach achieves predictive performance comparable to that of the state-of-the-art kernel-based data fusion, but requires fewer data preprocessing steps. PMID:24297565
Kapetanakou, A E; Kollias, J N; Drosinos, E H; Skandamis, P N
2012-01-16
Five composites of yeast and six of bacterial isolates from fermented products were studied, in order to assess their ability to inhibit Aspergillus carbonarius growth and reduce OTA concentration in culture media and beverages. The antagonistic effect of the above composites against A. carbonarius growth was studied in synthetic grape medium of pH 3.5 and a(w) 0.98, 0.95, 0.92 after incubation at 25°C. Different combinations of initial inocula of bacteria or yeast composites and fungi were used (10(2)cfu/mL vs 10(5)spores/mL; 10(5)cfu/mL vs 10(2)spores/mL; and 10(5)cfu/mL vs 10(5)spores/mL). Regarding the OTA reduction experiment, 10(3) and 10(7)cfu/mL of the bacteria and yeast composites were inoculated in liquid media of different pH (3.0, 4.0, 5.0, and 6.1 or 6.5) and initial OTA concentration (50 and 100μg/L) and incubated at 30°C. Moreover, grape juice, red wine, and beer were supplemented with 100μg/L of OTA and inoculated with composites of 16 yeasts (16YM) and 29 bacterial (29BM) strains (10(7)cfu/mL) to estimate the kinetics of OTA reduction at 25°C for 5days. Fungal inhibition and OTA reduction were calculated in comparison to control samples. None of the bacterial composites inhibited A. carbonarius growth. The high inoculum of yeast composites (10(5) cfu/mL) showed more efficient fungal inhibition compared to cell density of 10(2) cfu/mL. All yeast composites showed higher OTA reduction (up to 65%) compared to bacteria (2-25%), at all studied assays. The maximum OTA reduction was obtained at pH 3.0 by almost all yeast composites. For all studied beverages the decrease in OTA concentration was higher by yeasts (16YM) compared to bacteria (29BM). The highest OTA reduction was observed in grape juice (ca 32%) followed by wine (ca 22%), and beer (ca 12%). The present findings may assist in the control of A. carbonarius growth and OTA production in fermented foodstuffs by the use of proper strains of technological importance. Copyright © 2011 Elsevier
Gaetti-Jardim, Elerson; Ciesielski, Francisco Isaak Nicolas; de Sousa, Fátima Regina Nunes; Nwaokorie, Francisca; Schweitzer, Christiane Marie; Avila-Campos, Mario Júlio
2011-01-01
The aim of this study was to evaluate the occurrence of yeasts, pseudomonads and enteric bacteria in the oral cavity of patients undergoing radiotherapy (RT) for treatment of head and neck cancer. Fifty patients receiving RT were examined before, during and 30 days after RT. Saliva, mucosa, and biofilm samples were collected and microorganisms were detected by culture and polymerase chain reaction (PCR). The most prevalent yeasts in patients submitted to RT were Candida albicans, C. tropicalis, C. krusei, C. glabrata and C. parapsilosis. Citrobacter, Enterobacter, Enterococcus, Klebsiella, Proteus, and Pseudomonas were the most frequently cultivated bacteria. Before RT, targeted bacteria were cultivated from 22.2% of edentulous patients and 16.6% of dentate patients; 30 days after RT, these microorganisms were recovered from 77.8% edentulous and 46.8% dentate patients. By PCR, these microorganisms were detected from all edentulous patients, 78.1% of dentate patients. The presence of Gram-negative enteric roads and fungi was particularly frequent in patients presenting mucositis level III or IV. Modifications in the oral environment due to RT treatment seem to facilitate the colonization of oral cavity by members of family Enterobacteriaceae, genera Enterococcus and Candida. PMID:24031721
Lactic acid bacteria and yeasts associated with gowé production from sorghum in Bénin.
Vieira-Dalodé, G; Jespersen, L; Hounhouigan, J; Moller, P L; Nago, C M; Jakobsen, M
2007-08-01
To identify the dominant micro-organisms involved in the production of gowé, a fermented beverage, and to select the most appropriate species for starter culture development. Samples of sorghum gowé produced twice at three different production sites were taken at different fermentation times. DNA amplification by internal transcribed spacer-polymerase chain reaction of 288 lactic acid bacteria (LAB) isolates and 16S rRNA gene sequencing of selected strains revealed that the dominant LAB responsible for gowé fermentation were Lactobacillus fermentum, Weissella confusa, Lactobacillus mucosae, Pediococcus acidilactici, Pediococcus pentosaceus and Weissella kimchii. DNA from 200 strains of yeasts was amplified and the D1/D2 domain of the 26S rRNA gene was sequenced for selected isolates, revealing that the yeasts species were Kluyveromyces marxianus, Pichia anomala, Candida krusei and Candida tropicalis. Gowé processing is characterized by a mixed fermentation dominated by Lact. fermentum, W. confusa and Ped. acidilactici for the LAB and by K. marxianus, P. anomala and C. krusei for the yeasts. The diversity of the LAB and yeasts identified offers new opportunities for technology upgrading and products development in gowé production. The identified species can be used as possible starter for a controlled fermentation of gowé.
Taxonomic re-evaluation of black koji molds.
Hong, Seung-Beom; Yamada, Osamu; Samson, Robert A
2014-01-01
Black koji molds including its albino mutant, the white koji mold, have been widely used for making the distilled spirit shochu in Northeast Asia because they produce citric acid which prevents undesirable contamination from bacteria. Since Inui reported Aspergillus luchuensis from black koji in Okinawa in 1901, many fungal names associated with black koji molds were reported. However, some species are similar and differentiation between species is difficult. Fungal taxonomists tried to arrange a taxonomic system for black koji molds, but the results were not clear. Recently, multi-locus sequence typing has been successfully used to taxonomy of black Aspergillus. According to β-tubulin and calmodulin gene sequences, black koji molds can be subdivided in three species, A. luchuensis, Aspergillus niger, and Aspergillus tubingensis. Aspergillus awamori, Aspergillus kawachii, Aspergillus inuii, Aspergillus nakazawai, and Aspergillus coreanus are synonyms of A. luchuensis, Aspergillus batatae, Aspergillus aureus (or Aspergillus foetidus), Aspergillus miyakoensis, and Aspergillus usamii (including A. usamii mut. shirousamii) are synonyms of A. niger and Aspergillus saitoi and A. saitoi var. kagoshimaensis are synonyms of A. tubingensis. A. luchuensis mut. kawachii was suggested particular names for A. kawachii because of their industrial importance. The history and modern taxonomy of black koji molds is further discussed.
A PLAUSIBLE ROLE FOR POLLEN-RESIDING MOLDS IN AGRICULTURAL PURPOSES.
Belhadj, H; Harzallah, D; Dahamna, S; Ghadbane, M
2015-01-01
Pollen microbial content of 15 samples was investigated. Pollen was collected by honeybees. Total aerobic mesophilic count ranged from 3.00 to 5.48 Log CFU/g. Total mold and yeast count ranged from 2.3 to 6.99 Log CFU/g. Selected strains of isolated molds from pollen samples were characterized by conventional methods. Potent phytopathogenic and food spoilage species such as Penicillium sp., Alternaria alternata, Alternaria sp., Cladosporium werneckii, Mucor hiemalis, Rhizomucor pusillus, Aspergillus flavus, Aspergillus niger, Drechslera tritici-repentis, Verticillium albo-atrum, and Aspergillus alliaceus were recovered. Other fungal species with valuable biotechnological and plant diseases control purposes were isolated. They were characterized as Geotrichum candidum, Monilia sitophilia, and Sepedonium chrysospermum. Animal pathogenic molds were also isolated. Bee pollen may be considered as a source for a highly diverse fungal flora with different applications.
Rodríguez, Valle; Medina, Luis; Jordano, Rafael
2003-04-01
The possible effect of different modified atmospheres on the shelf life of prebaked pizza dough, with and without added calcium propionate, was investigated. Three packaging atmospheres were tested: 20% CO2: 80% N2, 50% CO2: 50% N2, 100% CO2, and air (control). Samples were examined daily for visible mold growth and analysed after 2, 8, 17 and 31 days throughout storage (15-20 degrees C and 54-65% relative humidity, RH) for changes in gaseous composition, pH and microbial populations (mesophilic aerobic and anaerobic bacteria, lactic acid bacteria (LAB), and yeasts and molds). Microbiological results showed that molds had a greater sensitivity to CO2 than bacteria and yeasts. Products containing calcium propionate did not show mold growth throughout storage (31 days) when packaged in air or in CO2-enriched atmospheres (20, 50 and 100%). However, in pizza dough without preservative (calcium propionate), mold growth was evident after 7 days, except under 100% CO2 atmosphere (13 days) regardless of the packaging atmosphere. From these results we conclude that the addition of calcium propionate had more and decisive influence on the shelf life extension of prebaked pizza dough.
Jussier, Delphine; Dubé Morneau, Amélie; Mira de Orduña, Ramón
2006-01-01
Inoculating grape musts with wine yeast and lactic acid bacteria (LAB) concurrently in order to induce simultaneous alcoholic fermentation (AF) and malolactic fermentation (MLF) can be an efficient alternative to overcome potential inhibition of LAB in wines because of high ethanol concentrations and reduced nutrient content. In this study, the simultaneous inoculation of yeast and LAB into must was compared with a traditional vinification protocol, where MLF was induced after completion of AF. For this, two suitable commercial yeast-bacterium combinations were tested in cool-climate Chardonnay must. The time courses of glucose and fructose, acetaldehyde, several organic acids, and nitrogenous compounds were measured along with the final values of other key wine parameters. Sensory evaluation was done after 12 months of storage. The current study could not confirm a negative impact of simultaneous AF/MLF on fermentation success and kinetics or on final wine parameters. While acetic acid concentrations were slightly increased in wines after simultaneous AF/MLF, the differences were of neither practical nor legal significance. No statistically significant differences were found with regard to the final values of pH or total acidity and the concentrations of ethanol, acetaldehyde, glycerol, citric and lactic acids, and the nitrogen compounds arginine, ammonia, urea, citrulline, and ornithine. Sensory evaluation by a semiexpert panel confirmed the similarity of the wines. However, simultaneous inoculation led to considerable reductions in overall fermentation durations. Furthermore, differences of physiological and microbiological relevance were found. Specifically, we report the vinification of “super-dry” wines devoid of glucose and fructose after simultaneous inoculation of yeast and bacteria. PMID:16391046
Santovito, Elisa; Greco, Donato; Logrieco, Antonio F; Avantaggiato, Giuseppina
2018-06-06
The population increase in the last century was the first cause of the industrialization of animal productions, together with the necessity to satisfy the high food demand and the lack of space and land for the husbandry practices. As a consequence, the farmers moved from extensive to intensive agricultural systems and introduced new practices, such as the administration of antimicrobial drugs. Antibiotics were then used as growth promoters and for disease prevention. The uncontrolled and continuous use of antibiotics contributed to the spread of antibiotic resistance in animals, and this had adverse impacts on human health. This emergence led the European Union, in 2003, to ban the marketing and use of antibiotics as growth promoters, and for prophylaxis purposes from January 2006. This ban caused problems in farms, due to the decrease in animal performances (weight gain, feed conversion ratio, reproduction, etc.), and the rise in the incidence of certain diseases, such as those induced by Clostridium perfringens, Salmonella, Escherichia coli, and Listeria monocytogenes. The economic losses due to the ban increased the interest in researching alternative strategies for the prophylaxis of infectious diseases and for health and growth promotion, such as feed additives. Yeast-based materials, such as cell wall extract, represent promising alternatives to antibiotics, on the base of their prebiotic activity and their claimed capacity to bind enteropathogenic bacteria. Several authors reported examples of the effectiveness of yeast cell wall products in adsorbing bacteria, but there is a lack of knowledge on the mechanisms involved in this interaction. The purpose of this review is to provide an overview of the current approaches used for the control of pathogenic bacteria in feed, with a particular focus on the use of yeast-derived materials proposed to control zoonoses at farm level, and on their effect on animal health.
James, T C; Gallagher, L; Titze, J; Bourke, P; Kavanagh, J; Arendt, E; Bond, U
2014-02-01
To examine the use of a natural antimicrobial peptide, human β-defensin-3 (HBD3), as a means of preventing spoilage from bacterial contamination in brewery fermentations and in bottled beer. A chemically synthesised HBD3 peptide was tested for bactericidal activity against common Gram-positive and Gram-negative beer-spoiling bacteria, including species of Lactobacillus, Pediococcus and Pectinatus. The peptide was effective at the μmol l(-1) range in vitro, reducing bacterial counts by 95%. A gene construct encoding a secretable form of HBD3 was integrated into the genome of the lager yeast Saccharomyces pastorianus strain CMBS-33. The integrated gene was expressed under fermentation conditions and was secreted from the cell into the medium, but a significant amount remains associated with yeast cell surface. We demonstrate that under pilot-scale fermentation conditions, secreted HBD3 possesses bactericidal activity against beer-spoiling bacteria. Furthermore, when added to bottled beer, a synthetic form of HBD3 reduces the growth of beer-spoiling bacteria. Defensins provide prophylactic protection against beer-spoiling bacteria under brewing conditions and also in bottled beer. The results have direct application to the brewing industry where beer spoilage due to bacterial contamination continues to be a major problem in breweries around the world. © 2013 The Society for Applied Microbiology.
Pacheco-Cano, R D; Salcedo-Hernández, R; López-Meza, J E; Bideshi, D K; Barboza-Corona, J E
2018-01-01
The objective of this study was to show whether the edible part of broccoli has antibacterial and antifungal activity against micro-organism of importance in human health and vegetable spoilage, and to test if this effect was partially due to antimicrobial peptides (AMPs). Crude extracts were obtained from florets and stems of broccoli cultivar Avenger and the inhibitory effect was demonstrated against pathogenic bacteria (Bacillus cereus, Staphylococcus xylosus, Staphylococcus aureus, Shigella flexneri, Shigella sonnei, Proteus vulgaris), phytopathogenic fungi (Colletotrichum gloeosporioides, Asperigillus niger) and yeasts (Candida albicans and Rhodotorula sp.). It was shown that samples treated with proteolytic enzymes had a reduction of approximately 60% in antibacterial activity against Staph. xylosus, suggesting that proteinaceous compounds might play a role in the inhibitory effect. Antimicrobial components in crude extracts were thermoresistant and the highest activity was observed under acidic conditions. It was shown that antifungal activity of broccoli's crude extracts might not be attributed to chitinases. Organic broccoli cultivar Avenger has antimicrobial activity against pathogenic bacteria, yeast and phytophatogenic fungi. Data suggest that this effect is partially due to AMPs. Broccoli's crude extracts have activity not only against pathogenic bacteria but also against phytophatogenic fungi of importance in agriculture. We suggest for first time that the inhibitory effect is probably due to AMPs. © 2017 The Society for Applied Microbiology.
Yeasts Diversity in Fermented Foods and Beverages
NASA Astrophysics Data System (ADS)
Tamang, Jyoti Prakash; Fleet, Graham H.
People across the world have learnt to culture and use the essential microorganisms for production of fermented foods and alcoholic beverages. A fermented food is produced either spontaneously or by adding mixed/pure starter culture(s). Yeasts are among the essential functional microorganisms encountered in many fermented foods, and are commercially used in production of baker's yeast, breads, wine, beer, cheese, etc. In Asia, moulds are predominant followed by amylolytic and alcohol-producing yeasts in the fermentation processes, whereas in Africa, Europe, Australia and America, fermented products are prepared exclusively using bacteria or bacteria-yeasts mixed cultures. This chapter would focus on the varieties of fermented foods and alcoholic beverages produced by yeasts, their microbiology and role in food fermentation, widely used commercial starters (pilot production, molecular aspects), production technology of some common commercial fermented foods and alcoholic beverages, toxicity and food safety using yeasts cultures and socio-economy
Atmospheric transport of mold spores in clouds of desert dust
Shinn, E.A.; Griffin, Dale W.; Seba, D.B.
2003-01-01
Fungal spores can be transported globally in clouds of desert dust. Many species of fungi (commonly known as molds) and bacteria--including some that are human pathogens--have characteristics suited to long-range atmospheric transport. Dust from the African desert can affect air quality in Africa, Europe, the Middle East, and the Americas. Asian desert dust can affect air quality in Asia, the Arctic, North America, and Europe. Atmospheric exposure to mold-carrying desert dust may affect human health directly through allergic induction of respiratory stress. In addition, mold spores within these dust clouds may seed downwind ecosystems in both outdoor and indoor environments.
Petersson, S; Schnürer, J
1995-01-01
Pichia anomala inhibits the growth of Penicillium roqueforti and Aspergillus candidus on agar. In this investigation, antagonistic activity on agar against 17 mold species was determined. The abilities of Pichia anomala, Pichia guilliermondii, and Saccharomyces cerevisiae to inhibit the growth of the mold Penicillium roqueforti in nonsterile high-moisture wheat were compared by adding 10(3) Penicillium roqueforti spores and different amounts of yeast cells per gram of wheat. Inoculated grain was packed in glass tubes, incubated at 25 degrees C with a restricted air supply, and the numbers of yeast and mold CFU were determined on selective media after 7 and 14 days. Pichia anomala reduced growth on agar plates for all of the mold species tested in a dose-dependent manner. Aspergillus fumigatus and Eurotium amstelodami were the most sensitive, while Penicillium italicum and Penicillium digitatum were the most resistant. Pichia anomala had the strongest antagonistic activity in wheat, with 10(5) and 10(6) CFU/g completely inhibiting the growth of Penicillium roqueforti. Inhibition was least pronounced at the optimum temperature (21 degrees C) and water activity (0.95) for the growth of Penicillium roqueforti. Pichia guilliermondii slightly reduced the growth of Penicillium roqueforti in wheat inoculated with 10(5) and 10(6) yeast CFU/g. S. cerevisiae inhibited mold growth only weakly at the highest inoculum level. Pichia anomala grew from 10(3) to 10(7) CFU/g of wheat in 1 week. To reach the same level, Pichia guilliermondii had to be inoculated at 10(4) CFU while S. cerevisiae required an inoculum of 10(5) CFU to reach 10(7) CFU/g of wheat. PMID:7793907
Ho, Van Thi Thuy; Fleet, Graham H; Zhao, Jian
2018-08-20
Cocoa beans (Theobroma cacao L.) are the raw material for chocolate production. Fermentation of the bean pulp by microorganisms is essential for developing the precursors of chocolate flavour. Currently, the cocoa fermentation is still conducted by an uncontrolled traditional process via a consortium of indigenous species of yeasts, lactic acid bacteria and acetic acid bacteria. Although the essential contribution of yeasts to the production of good quality beans and, typical chocolate character is generally agreed, the roles of lactic acid bacteria and acetic acid bacteria are less certain. The objective of this study was to investigate the contribution of LAB and AAB in cocoa bean fermentation by conducting small scale laboratory fermentations under aseptic conditions, inoculated with different groups of microorganisms previously isolated from spontaneous cocoa fermentations. The inoculation protocols were: (1) four yeasts Hanseniaspora guilliermondii, Pichia kudriavzevii, Kluyveromyces marxianus and Saccharomyces cerevisiae; (2) four yeasts plus the lactic acid bacteria Lactobacillus plantarum and Lactobacillus fermentum; (3) four yeasts plus the acetic acid bacteria Acetobacter pasteurianus and Gluconobacter frateuri and (4) four yeasts plus two lactic acid bacteria and two acetic acid bacteria. Only the inoculated species were detected in the microbiota of their respective fermentations. Beans from the inoculated fermentations showed no significant differences in colour, shell weights and concentrations of residual sugars, alcohols and esters (p>0.05), but they were slightly different in contents of lactic acid and acetic acid (p<0.05). All beans were fully brown and free of mould. Residual sugar levels were less than 2.6 mg/g while the shell contents and ethanol were in the range of 11-13.4% and 4.8-7 mg/g, respectively. Beans fermented in the presence of LAB contained higher levels of lactic acid (0.6-1.2 mg/g) whereas higher concentrations of acetic acid
van Veen, S Q; Claas, E C J; Kuijper, Ed J
2010-03-01
Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is suitable for high-throughput and rapid diagnostics at low costs and can be considered an alternative for conventional biochemical and molecular identification systems in a conventional microbiological laboratory. First, we evaluated MALDI-TOF MS using 327 clinical isolates previously cultured from patient materials and identified by conventional techniques (Vitek-II, API, and biochemical tests). Discrepancies were analyzed by molecular analysis of the 16S genes. Of 327 isolates, 95.1% were identified correctly to genus level, and 85.6% were identified to species level by MALDI-TOF MS. Second, we performed a prospective validation study, including 980 clinical isolates of bacteria and yeasts. Overall performance of MALDI-TOF MS was significantly better than conventional biochemical systems for correct species identification (92.2% and 83.1%, respectively) and produced fewer incorrect genus identifications (0.1% and 1.6%, respectively). Correct species identification by MALDI-TOF MS was observed in 97.7% of Enterobacteriaceae, 92% of nonfermentative Gram-negative bacteria, 94.3% of staphylococci, 84.8% of streptococci, 84% of a miscellaneous group (mainly Haemophilus, Actinobacillus, Cardiobacterium, Eikenella, and Kingella [HACEK]), and 85.2% of yeasts. MALDI-TOF MS had significantly better performance than conventional methods for species identification of staphylococci and genus identification of bacteria belonging to HACEK group. Misidentifications by MALDI-TOF MS were clearly associated with an absence of sufficient spectra from suitable reference strains in the MALDI-TOF MS database. We conclude that MALDI-TOF MS can be implemented easily for routine identification of bacteria (except for pneumococci and viridans streptococci) and yeasts in a medical microbiological laboratory.
Liu, Yu; Tortora, George; Ryan, Maria E.; Lee, Hsi-Ming; Golub, Lorne M.
2002-01-01
The broth macrodilution method (BMM) for antifungal susceptibility testing, approved by the National Committee for Clinical Laboratory Standards (NCCLS), was found to have deficiencies in testing of the antifungal activity of a new type of antifungal agent, a nonantibacterial chemically modified tetracycline (CMT-3). The high content of phosphate in the medium was found to greatly increase the MICs of CMT-3. To avoid the interference of phosphate in the test, a new method using potato dextrose agar (PDA) as a culture medium was developed. Eight strains of fungi, including five American Type Culture Collection strains and three clinical isolates, were used to determine the MICs of amphotericin B and itraconazole with both the BMM and the PDA methods. The MICs of the two antifungal agents determined with the PDA method showed 99% agreement with those determined with the BMM method within 1 log2 dilution. Similarly, the overall reproducibility of the MICs with the PDA method was above 97%. Three other antifungal agents, fluconazole, ketoconazole, and CMT-3, were also tested in parallel against yeasts and molds with both the BMM and the PDA methods. The MICs of fluconazole and ketoconazole determined with the PDA method showed 100% agreement within 1 log2 dilution of those obtained with the BMM method. However, the MICs of CMT-3 determined with the BMM method were as high as 128 times those determined with the PDA method. The effect of phosphate on the antifungal activity of CMT-3 was evaluated by adding Na2HPO4 to PDA in the new method. It was found that the MIC of CMT-3 against a Penicillium sp. increased from 0.5 μg/ml (control) to 2.0 μg/ml when the added phosphate was used at a concentration of 0.8 mg/ml, indicating a strong interference of Na2HPO4 with the antifungal activity of CMT-3. Except for fluconazole, all the other antifungal agents demonstrated clear end points among the yeasts and molds tested. Nevertheless, with its high reproducibility, good
Mousavi, Fereshteh; Beheshti-Maal, Keivan; Massah, Ahmadreza
2015-08-01
Biosurfactants are a family of diverse amphipathic molecules that are produced by several microorganisms such as bacteria, molds, and yeasts. These surface active agents have several applications in agriculture, oil processing, food, and pharmaceutical industries. In this research using YMG and YUG culture media, a native yeast strain, HG5, was isolated from honey bee. The oil spread test as a screening method was used to evaluate biosurfactant production by the yeast HG5 isolate. The 5.8s-rDNA analysis confirmed that the isolated yeast was related to Lachancea thermotolerans. We named this strain Lachancea thermotolerans strain BBMCZ7FA20 and its 5.8s-rDNA sequence was deposited in GenBank, NCBI under accession number of KM042082.1. The best precursor of biosurfactant production was canola oil and the sophorolipid amount was measured for 24.2 g/l. The thin layer chromatography and Fourier Transform Infrared Spectroscopy analysis showed that the extracted biosurfactant from Lachancea thermotolerans was sophorolipid. In conclusion, this is the first report of sophorolipid production by a native yeast Lachancea thermotolerans BBMCZ7FA20 we isolated from the honey bee gut collected from an apiary farm in Saman, Chaharmahal Bakhtiari province, Iran. We suggested that some cost-effective supplements such as canola oil, sunflower oil, and corn oils could be applied for increasing the sophorolipid production by this native yeast strain. According to several applications of biosurfactants in today world, the production of sophorolipid by Lachancea thermotolerans could be considered as a potential in the current industrial microbiology and modern microbial biotechnology.
Curbing indoor mold growth with mold inhibitors
Carol A. Clausen; Vina W. Yang
2004-01-01
Environmentally acceptable mold inhibitors are needed to curb the growth of mold fungi in woodframe housing when moisture management measures fail. Excess indoor moisture can lead to rapid mold establishment which, in turn, can have deleterious affects on indoor air quality. Compounds with known mold inhibitory properties and low mammalian toxicity, such as food...
Resin film infusion mold tooling and molding method
NASA Technical Reports Server (NTRS)
Burgess, Roger (Inventor); Grossheim, Brian (Inventor); Mouradian, Karbis (Inventor); Thrash, Patrick J. (Inventor)
1999-01-01
A mold apparatus and method for resin film infusion molding including an outer mold tool having a facing sheet adapted to support a resin film and preform assembly. The facing sheet includes attachment features extending therefrom. An inner mold tool is positioned on the facing sheet to enclose the resin film and preform assembly for resin film infusion molding. The inner mold tool includes a plurality of mandrels positioned for engagement with the resin film and preform assembly. Each mandrel includes a slot formed therein. A plurality of locating bars cooperate with the slots and with the attachment features for locating the mandrels longitudinally on the outer mold tool.
Ložienė, Kristina; Švedienė, Jurgita; Paškevičius, Algimantas; Raudonienė, Vita; Sytar, Oksana; Kosyan, Anatoliy
2018-04-22
Although the nature-identical chemical compounds are cheaper, they not always repeat biological activity of plant origin natural chemical compounds, often react allergies and resistance of microorganisms. The aim of this study was to investigate effects of Juniperus communis origin α-pinene with different enantiomeric composition on bacteria, yeasts and fungi. Results showed that different enantiomeric composition of α-pinene have different activities on microorganisms: essential oil with (1S)-(-) ≈ (1R)-(+) enantiomeric composition of α-pinene influenced on some microorganisms stronger than essential oil with (1S)-(-) < (1R)-(+) enantiomeric composition of α-pinene; the pure natural α-pinene with enantiomeric composition S < R more strongly inhibited growth of investigated bacteria and Candida yeasts, α-pinene with enantiomeric composition S ≈ R - growth of Trichophyton and Aspergillus. (1S)-(-) and (1R)-(+) enantiomeric forms of α-pinene can have also different synergistic effects with other compounds of essential oil. The results of study showed that the same amount of α-pinene with different enantiomeric composition can have diverse antimicrobial potential due different specific interactions with other chemical compounds of essential oil. Therefore, it is very important to determine and present the enantiomeric composition of those plant origin compounds, which are characterized by enantiomerisation, during the course of research of biological activities of natural plant products (essential oils and other) and their isolated compounds. Copyright © 2018 Elsevier B.V. All rights reserved.
... Home ▸ Conditions & Treatments ▸ Allergies ▸ Mold Allergy Share | Mold Allergy Overview Symptoms & Diagnosis Treatment & Management Mold Allergy Overview Molds are tiny fungi whose spores float ...
van Veen, S. Q.; Claas, E. C. J.; Kuijper, Ed J.
2010-01-01
Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is suitable for high-throughput and rapid diagnostics at low costs and can be considered an alternative for conventional biochemical and molecular identification systems in a conventional microbiological laboratory. First, we evaluated MALDI-TOF MS using 327 clinical isolates previously cultured from patient materials and identified by conventional techniques (Vitek-II, API, and biochemical tests). Discrepancies were analyzed by molecular analysis of the 16S genes. Of 327 isolates, 95.1% were identified correctly to genus level, and 85.6% were identified to species level by MALDI-TOF MS. Second, we performed a prospective validation study, including 980 clinical isolates of bacteria and yeasts. Overall performance of MALDI-TOF MS was significantly better than conventional biochemical systems for correct species identification (92.2% and 83.1%, respectively) and produced fewer incorrect genus identifications (0.1% and 1.6%, respectively). Correct species identification by MALDI-TOF MS was observed in 97.7% of Enterobacteriaceae, 92% of nonfermentative Gram-negative bacteria, 94.3% of staphylococci, 84.8% of streptococci, 84% of a miscellaneous group (mainly Haemophilus, Actinobacillus, Cardiobacterium, Eikenella, and Kingella [HACEK]), and 85.2% of yeasts. MALDI-TOF MS had significantly better performance than conventional methods for species identification of staphylococci and genus identification of bacteria belonging to HACEK group. Misidentifications by MALDI-TOF MS were clearly associated with an absence of sufficient spectra from suitable reference strains in the MALDI-TOF MS database. We conclude that MALDI-TOF MS can be implemented easily for routine identification of bacteria (except for pneumococci and viridans streptococci) and yeasts in a medical microbiological laboratory. PMID:20053859
Molds are fungi that can be found both outdoors and indoors. They grow best in warm, damp and humid conditions. If ... spots in your house, you will probably get mold. Molds can cause health problems. Inhaling or touching ...
Pardali, Eleni; Paramithiotis, Spiros; Papadelli, Marina; Mataragas, Marios; Drosinos, Eleftherios H
2017-06-01
The aim of the present study was to assess the microecosystem development and the dynamics of the lactic acid bacteria population during spontaneous fermentation of radish (Raphanus sativus L.) roots in brine at 20 and 30 °C. In both temperatures, lactic acid bacteria prevailed the fermentation; as a result, the pH value was reduced to ca. 3.6 and total titrable acidity increased to ca. 0.4% lactic acid. Enterococci population increased and formed a secondary microbiota while pseudomonads, Enterobacteriaceae and yeasts/molds populations were below enumeration limit already before the middle of fermentation. Pediococcus pentosaceus dominated during the first days, followed by Lactobacillus plantarum that prevailed the fermentation until the end. Lactobacillus brevis was also detected during the final days of fermentation. A succession at sub-species level was revealed by the combination of RAPD-PCR and rep-PCR analyses. Glucose and fructose were the main carbohydrates detected in brine and were metabolized into lactic acid, acetic acid and ethanol.
Marty, Amber J; Gauthier, Gregory M
2013-01-01
Blastomyces dermatitidis, the etiologic agent of blastomycosis, belongs to a group of thermally dimorphic fungi that change between mold (22°C) and yeast (37°C) in response to temperature. The contribution of structural proteins such as septins to this phase transition in these fungi remains poorly understood. Septins are GTPases that serve as a scaffold for proteins involved with cytokinesis, cell polarity, and cell morphology. In this study, we use a GFP sentinel RNA interference system to investigate the impact of CDC3, CDC10, CDC12, and ASPE on the morphology and phase transition of B. dermatitidis. Targeting CDC3, CDC10, and CDC12 by RNA interference resulted in yeast with aberrant morphology at 37°C with defects in cytokinesis. Downshifting the temperature to 22°C promoted the conversion to the mold phase, but did not abrogate the morphologic defects. CDC3, CDC10, and CDC12 knockdown strains grew as mold with curved, thickened hyphae. Knocking down ASPE transcript did not alter morphology of yeast at 37°C or mold at 22°C. Following an increase in temperature from 22°C to 37°C, all septin knockdown strains were able to revert to yeast. In conclusion, CDC3, CDC10, and CDC12 septin- encoding genes are required for proper morphology of yeast and hyphae, but are dispensable for the phase transition.
Native Killer Yeasts as Biocontrol Agents of Postharvest Fungal Diseases in Lemons.
Perez, María Florencia; Contreras, Luciana; Garnica, Nydia Mercedes; Fernández-Zenoff, María Verónica; Farías, María Eugenia; Sepulveda, Milena; Ramallo, Jacqueline; Dib, Julián Rafael
2016-01-01
Economic losses caused by postharvest diseases represent one of the main problems of the citrus industry worldwide. The major diseases affecting citrus are the "green mold" and "blue mold", caused by Penicillium digitatum and P. italicum, respectively. To control them, synthetic fungicides are the most commonly used method. However, often the emergence of resistant strains occurs and their use is becoming more restricted because of toxic effects and environmental pollution they generate, combined with trade barriers to international markets. The aim of this work was to isolate indigenous killer yeasts with antagonistic activity against fungal postharvest diseases in lemons, and to determine their control efficiency in in vitro and in vivo assays. Among 437 yeast isolates, 8.5% show to have a killer phenotype. According to molecular identification, based on the 26S rDNA D1/D2 domain sequences analysis, strains were identified belonging to the genera Saccharomyces, Wickerhamomyces, Kazachstania, Pichia, Candida and Clavispora. Killers were challenged with pathogenic molds and strains that caused the maximum in vitro inhibition of P. digitatum were selected for in vivo assays. Two strains of Pichia and one strain of Wickerhamomyces depicted a significant protection (p <0.05) from decay by P. digitatum in assays using wounded lemons. Thus, the native killer yeasts studied in this work showed to be an effective alternative for the biocontrol of postharvest fungal infections of lemons and could be promising agents for the development of commercial products for the biological control industry.
Di Cagno, Raffaella; Cardinali, Gainluigi; Minervini, Giovanna; Antonielli, Livio; Rizzello, Carlo Giuseppe; Ricciuti, Patrizia; Gobbetti, Marco
2010-05-01
Pichia guilliermondii was the only identified yeast in pineapple fruits. Lactobacillus plantarum and Lactobacillus rossiae were the main identified species of lactic acid bacteria. Typing of lactic acid bacteria differentiated isolates depending on the layers. L. plantarum 1OR12 and L. rossiae 2MR10 were selected within the lactic acid bacteria isolates based on the kinetics of growth and acidification. Five technological options, including minimal processing, were considered for pineapple: heating at 72 degrees C for 15 s (HP); spontaneous fermentation without (FP) or followed by heating (FHP), and fermentation by selected autochthonous L. plantarum 1OR12 and L. rossiae 2MR10 without (SP) or preceded by heating (HSP). After 30 days of storage at 4 degrees C, HSP and SP had a number of lactic acid bacteria 1000 to 1,000,000 times higher than the other processed pineapples. The number of yeasts was the lowest in HSP and SP. The Community Level Catabolic Profiles of processed pineapples indirectly confirmed the capacity of autochthonous starters to dominate during fermentation. HSP and SP also showed the highest antioxidant activity and firmness, the better preservation of the natural colours and were preferred for odour and overall acceptability. Copyright (c) 2009 Elsevier Ltd. All rights reserved.
Du, Hai; Song, Zhewei; Xu, Yan
2018-01-10
This study aimed to identify specific microorganisms related to the formation of precursors of EC (ethyl carbamate) in the solid-state fermentation of Chinese Moutai-flavor liquor. The EC content was significantly correlated with the urea content during the fermentation process (R 2 = 0.772, P < 0.01). Differences in urea production and degradation were found at both species and functional gene levels by metatranscriptomic sequencing and culture-dependent analysis. Lactobacillus spp. could competitively degrade arginine through the arginine deiminase pathway with yeasts, and most Lactobacillus species were capable of degrading urea. Some dominant nonconventional yeasts, such as Pichia, Schizosaccharomyces, and Zygosaccharomyces species, were shown to produce low amounts of urea relative to Saccharomyces cerevisiae. Moreover, unusual urea degradation pathways (urea carboxylase, allophanate hydrolase, and ATP-independent urease) were identified. Our results indicate that EC precursor levels in the solid-state fermentation can be controlled using lactic acid bacteria and nonconventional yeasts.
Tiunov, Alexei V; Semenina, Eugenia E; Aleksandrova, Alina V; Tsurikov, Sergey M; Anichkin, Alexander E; Novozhilov, Yuri K
2015-08-30
Data on the bulk stable isotope composition of soil bacteria and bacterivorous soil animals are required to estimate the nutrient and energy fluxes via bacterial channels within detrital food webs. We measured the isotopic composition of slime molds (Myxogastria, Amoebozoa), a group of soil protozoans forming macroscopic spore-bearing fruiting bodies. An analysis of largely bacterivorous slime molds can provide information on the bulk stable isotope composition of soil bacteria. Fruiting bodies of slime molds were collected in a monsoon tropical forest of Cat Tien National Park, Vietnam, and analyzed by continuous-flow isotope ratio mass spectrometry. Prior to stable isotope analysis, carbonates were removed from a subset of samples by acidification. To estimate the trophic position of slime molds, their δ(13) C and δ(15) N values were compared with those of plant debris, soil, microbial destructors (litter-decomposing, humus-decomposing, and ectomycorrhizal fungi) and members of higher trophic levels (oribatid mites, termites, predatory macroinvertebrates). Eight species of slime molds represented by at least three independent samples were 3-6‰ enriched in (13) C and (15) N relative to plant litter. A small but significant difference in the δ(13) C and δ(15) N values suggests that different species of myxomycetes can differ in feeding behavior. The slime molds were enriched in (15) N compared with litter-decomposing fungi, and depleted in (15) N compared with mycorrhizal or humus-decomposing fungi. Slime mold sporocarps and plasmodia largely overlapped with oribatid mites in the isotopic bi-plot, but were depleted in (15) N compared with predatory invertebrates and humiphagous termites. A comparison with reference groups of soil organisms suggests strong trophic links of slime molds to saprotrophic microorganisms which decompose plant litter, but not to humus-decomposing microorganisms or to mycorrhizal fungi. Under the assumption that slime molds are
NASA Astrophysics Data System (ADS)
Fallah, Aziz A.; Siavash Saei-Dehkordi, S.; Rahnama, Mohammad
2010-10-01
Ready-to-cook Iranian barbecued chicken consists of cubed chicken breast, lemon juice, salt, red pepper, onion, saffron and vegetable oil with an overall pH value of about 5.5. This product is sometimes consumed under-cooked, hence it may pose health hazards to consumers when contaminated with food-borne pathogens. In this study, the effect of gamma irradiation (0, 1.5, 3 and 4.5 kGy) on the microbial quality of ready-to-cook (RTC) barbecued chicken samples stored at 4 °C for 15 days was investigated. Moreover, the effectiveness of irradiation for inactivating Listeria monocytogenes, Escherichia coli O157:H7 and Salmonella typhimurium inoculated into the samples was also studied. Irradiation of the samples resulted in dose dependent reduction in counts of aerobic mesophilic bacteria, yeasts and molds, Enterobacteriaceae and lactic acid bacteria. Among the microbial flora, yeasts and molds and Enterobacteriaceae were more sensitive to irradiation and got completely eliminated at dose of 3 kGy. D10 values of L. monocytogenes, E. coli O157:H7 and S. typhimurium inoculated into the samples were 0.680, 0.397 and 0.601 kGy, respectively. An irradiation dose of 3 kGy reduced the counts of E. coli O157:H7 to an undetectable level in RTC barbecued chicken but was ineffective on elimination of L. monocytogenes and S. typhimurium. However, none of the food-borne pathogens were detected in the samples irradiated at 4.5 kGy. This study showed that irradiation had no undesirable effects on the initial sensory attributes of barbecued chicken. At the end of the storage period, irradiated samples were more acceptable compared to non-irradiated ones.
Karabıçak, Nilgün; Karatuna, Onur; Akyar, Işın
2016-06-01
Serious mycological work requires a reliable source of cultures that are maintained under safe long-term storage. In this study, 1186 clinical fungal isolates consisting of molds (20 species in 11 genera) and yeasts (21 species in seven genera) maintained in water, under mineral oil at room temperature and cryopreserved at -80 °C for periods ranging from 1 to 12 years, were evaluated for their viabilities and stabilities. The strains were subcultured onto either Sabouraud dextrose agar or potato dextrose agar to determine the viabilities and purities. The stabilities of the dermatophytes were investigated using urease test medium, the Trichophyton agar test and morphological examination. The stabilities of yeasts were evaluated by microscopic morphology and by determining the antifungal susceptibilities of random samples of yeasts (n = 120). Additionally, 365 strains (dermatophytes, n = 115; yeasts, n = 250) were further characterized by "matrix-assisted laser desorption/ionization time-of-flight mass spectrometry." After 12 years of preservation, the survival rates with the three different preservation techniques, i.e., in water, under mineral oil and by freezing, were assessed as 94.7, 82.0 and 97.4 %, respectively. Viability was generally unrelated to the duration of storage. More stable and consistent growth was achieved after storage in water and freezing compared with mineral oil preservation. Our results demonstrate that the procedure for maintaining fungal cultures in water is a simple and inexpensive method, next to cryopreservation, and that both can be reliably used for the long-term preservation of most fungal isolates.
Borling Welin, Jenny; Lyberg, Karin; Passoth, Volkmar; Olstorpe, Matilda
2015-01-01
This study combined moist airtight storage of moist grain with pig feed fermentation. Starter cultures with the potential to facilitate both technologies were added to airtight stored moist crimped cereal grain, and the impact on storage microflora and the quality of feed fermentations generated from the grain was investigated. Four treatments were compared: three based on moist barley, either un-inoculated (M), inoculated with Wickerhamomyces anomalus (W), or inoculated with W. anomalus and LAB starter culture, containing Pediococcus acidilactici DSM 16243, Pediococcus pentosaceus DSM 12834 and Lactobacillus plantarum DSM 12837 (WLAB); and one treatment based on dried barley (D). After 6 weeks of storage, four feed fermentations FM, FW, FWLAB, and FD, were initiated from M, W, WLAB, and D, respectively, by mixing the grain with water to a dry matter content of 30%. Each treatment was fermented in batch initially for 7 days and then kept in a continuous mode by adding new feed daily with 50% back-slop. During the 6 week storage period, the average water activity decreased in M, W and WLAB from 0.96 to 0.85, and cereal pH decreased from approximately 6.0 at harvest to 4.5. Feed fermentation conferred a further pH decrease to 3.8–4.1. In M, W and WLAB, molds and Enterobacteriaceae were mostly below detection limit, whereas both organism groups were detected in D. In fermented feed, Enterobacteriaceae were below detection limit in almost all conditions. Molds were detected in FD, for most of the fermentation time in FM and at some sampling points in FW and FWLAB. Starter organisms, especially W. anomalus and L. plantarum comprised a considerable proportion of the yeast and LAB populations, respectively, in both stored grain and fermented feed. However, autochthonous Pichia kudriavzevii and Kazachstania exigua partially dominated the yeast populations in stored grain and fermented feed, respectively. PMID:25954295
Taggiasca extra virgin olive oil colonization by yeasts during the extraction process.
Ciafardini, G; Cioccia, G; Zullo, B A
2017-04-01
The opalescent appearance of the newly produced olive oil is due to the presence of solid particles and microdrops of vegetation water in which the microorganisms from the olives' carposphere are trapped. Present research has demonstrated that the microbiota of the fresh extracted olive oil, produced in the mills, is mainly composed of yeasts and to a lesser extent of molds. The close link between the composition of the microbiota of the olives' carposphere undergoing to processing, and that of the microbiota of the newly produced olive oil, concerns only the yeasts and molds, given that the bacterial component is by and large destroyed mainly in the kneaded paste during the malaxation process. Six physiologically homogenous yeast groups were highlighted in the wash water, kneaded paste and newly produced olive oil from the Taggiasca variety which had been collected in mills located in the Liguria region. The more predominant yeasts of each group belonged to a single species called respectively: Kluyveromyces marxianus, Candida oleophila, Candida diddensiae, Candida norvegica, Wickerhamomyces anomalus and Debaryomyces hansenii. Apart from K. marxianus, which was found only in the wash water, all the other species were found in the wash water and in the kneaded paste as well as in the newly produced olive oil, while in the six-month stored olive oil, was found only one physiologically homogeneous group of yeast represented by the W. anomalus specie. These findings in according to our previous studies carried out on other types of mono varietal olive oils, confirms that the habitat of the Taggiascas' extra virgin olive oil, had a strong selective pressure on the yeast biota, allowing only to a few member of yeast species, contaminating the fresh product, to survive and reproduce in it during storage. Copyright © 2016 Elsevier Ltd. All rights reserved.
Mold Flux Crystallization and Mold Thermal Behavior
NASA Astrophysics Data System (ADS)
Peterson, Elizabeth Irene
Mold flux plays a small but critical role in the continuous casting of steel. The carbon-coated powder is added at the top of the water-cooled copper mold, over time it melts and infiltrates the gap between the copper mold and the solidifying steel strand. Mold powders serve five primary functions: (1) chemical insulation, (2) thermal insulation, (3) lubrication between the steel strand and mold, (4) absorption of inclusions, and (5) promotion of even heat flux. All five functions are critical to slab casting, but surface defect prevention is primarily controlled through even heat flux. Glassy fluxes have high heat transfer and result in a thicker steel shell. Steels with large volumetric shrinkage on cooling must have a crystalline flux to reduce the radiative heat transfer and avoid the formation of cracks in the shell. Crystallinity plays a critical role in steel shell formation, therefore it is important to study the thermal conditions that promote each phase and its morphology. Laboratory tests were performed to generate continuous cooling transformation (CCT) and time-temperature-transformation (TTT) diagrams. Continuous cooling transformation tests were performed in an instrumented eight cell step chill mold. Results showed that cuspidine was the only phase formed in conventional fluxes and all observed structures were dendritic. An isothermal tin bath quench method was also developed to isothermally age glassy samples. Isothermal tests yielded different microstructures and different phases than those observed by continuous cooling. Comparison of aged tests with industrial flux films indicates similar faceted structures along the mold wall, suggesting that mold flux first solidifies as a glass along the mold wall, but the elevated temperature devitrifies the glassy structure forming crystals that cannot form by continuous cooling.
Yeast ecology of Kombucha fermentation.
Teoh, Ai Leng; Heard, Gillian; Cox, Julian
2004-09-01
Kombucha is a traditional fermentation of sweetened tea, involving a symbiosis of yeast species and acetic acid bacteria. Despite reports of different yeast species being associated with the fermentation, little is known of the quantitative ecology of yeasts in Kombucha. Using oxytetracycline-supplemented malt extract agar, yeasts were isolated from four commercially available Kombucha products and identified using conventional biochemical and physiological tests. During the fermentation of each of the four products, yeasts were enumerated from both the cellulosic pellicle and liquor of the Kombucha. The number and diversity of species varied between products, but included Brettanomyces bruxellensis, Candida stellata, Schizosaccharomyces pombe, Torulaspora delbrueckii and Zygosaccharomyces bailii. While these yeast species are known to occur in Kombucha, the enumeration of each species present throughout fermentation of each of the four Kombucha cultures demonstrated for the first time the dynamic nature of the yeast ecology. Kombucha fermentation is, in general, initiated by osmotolerant species, succeeded and ultimately dominated by acid-tolerant species.
Native Killer Yeasts as Biocontrol Agents of Postharvest Fungal Diseases in Lemons
Garnica, Nydia Mercedes; Fernández-Zenoff, María Verónica; Farías, María Eugenia; Sepulveda, Milena; Ramallo, Jacqueline; Dib, Julián Rafael
2016-01-01
Economic losses caused by postharvest diseases represent one of the main problems of the citrus industry worldwide. The major diseases affecting citrus are the "green mold" and "blue mold", caused by Penicillium digitatum and P. italicum, respectively. To control them, synthetic fungicides are the most commonly used method. However, often the emergence of resistant strains occurs and their use is becoming more restricted because of toxic effects and environmental pollution they generate, combined with trade barriers to international markets. The aim of this work was to isolate indigenous killer yeasts with antagonistic activity against fungal postharvest diseases in lemons, and to determine their control efficiency in in vitro and in vivo assays. Among 437 yeast isolates, 8.5% show to have a killer phenotype. According to molecular identification, based on the 26S rDNA D1/D2 domain sequences analysis, strains were identified belonging to the genera Saccharomyces, Wickerhamomyces, Kazachstania, Pichia, Candida and Clavispora. Killers were challenged with pathogenic molds and strains that caused the maximum in vitro inhibition of P. digitatum were selected for in vivo assays. Two strains of Pichia and one strain of Wickerhamomyces depicted a significant protection (p <0.05) from decay by P. digitatum in assays using wounded lemons. Thus, the native killer yeasts studied in this work showed to be an effective alternative for the biocontrol of postharvest fungal infections of lemons and could be promising agents for the development of commercial products for the biological control industry. PMID:27792761
53. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL ...
53. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL MOLDS IN THE MORAVIAN POTTERY AND TILE WORKS COLLECTION, AND ARE USED TO PRESS TILES. THE FACTORY KEEPS TEN PRODUCTION MOLDS FOR EACH IMAGE. THE ORIGINAL MOLDS ARE NOT USED IN PRODUCTION. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA
Prevalence of IgE reactivities in mold-allergic subjects to commercially available fungal enzymes.
Horner, W Elliott; Armstrong, Maricelis; El-Dahr, Jane; McCants, Marjorie; Reese, Gerald; Kobernick, Aaron K; Lehrer, Samuel B
2008-01-01
Fungi are important aeroallergens. However, fungal allergen sources of consistent quality for clinical testing are not readily available. Because some allergens have been identified as enzymes, we assessed the prevalence of IgE reactivity to commercially available fungal enzymes. The purpose of this study was to determine IgE antibody reactivity by radioallergosorbent assay (RAST) to commercially available fungal enzymes in mold-allergic individuals. Sera from 20 subjects with symptoms of respiratory allergies and skin test reactivity to 2 or more fungal allergens (4 conidial [imperfecti] fungi and/or 8 basidiomycetes) were selected. Controls were six atopic individuals with neither history of fungal allergy nor skin test reactivity to fungi. Seventeen commercial fungal enzymes were used as antigens to evaluate the subjects' IgE antibody reactivity by RAST. Sera from most fungus-allergic individuals showed substantial IgE antibody reactivity to enzymes; control sera showed little or no reactivity. The mean reactivity to all commercial enzymes of all subjects tested was RAST > or = 3% with only one exception. The most reactive fungal enzymes were invertase (bakers' yeast, Saccharomyces cerevisiae), cellulase (Trichoderma viride), and glucosidase (brewers yeast, S. cerevisiae) with mean binding of 14.6, 9.5, and 8.8%, respectively. Using RAST results with a combination of four enzymes from S. cerevisiae (brewers yeast glucosidase, bakers' yeast maltase, invertase, and invertase V), a sensitivity of 100% was shown for detecting mold-allergic patients. The studies suggest that fungal enzymes may be useful source materials for the identification of fungal allergens and may also provide readily available source materials to produce improved diagnostic and therapeutic reagents.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bernacki, Bruce E.
2012-10-05
This brief report contains a critique of two key components of FiveFocal's cost model for glass compression molding of chalcogenide lenses for infrared applications. Molding preforms and mold technology have the greatest influence on the ultimate cost of the product and help determine the volumes needed to select glass molding over conventional single-point diamond turning or grinding and polishing. This brief report highlights key areas of both technologies with recommendations for further study.
92. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL ...
92. PRODUCTION MOLDS. THESE MOLDS ARE COPIES OF THE ORIGINAL MOLDS IN THE MORAVIAN POTTERY AND TILE WORKS COLLECTION, AND ARE USED TO PRESS TILES. THE FACTORY KEEPS TEN PRODUCTION MOLDS FOR EACH IMAGE. THE ORIGINAL MOLDS ARE NOT USED IN PRODUCTION. SAME VIEW AS PA-107-53. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA
The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.
Hori, H; Osawa, S; Iwabuchi, M
1980-01-01
The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421
[Distiller Yeasts Producing Antibacterial Peptides].
Klyachko, E V; Morozkina, E V; Zaitchik, B Ts; Benevolensky, S V
2015-01-01
A new method of controlling lactic acid bacteria contamination was developed with the use of recombinant Saccharomyces cerevisiae strains producing antibacterial peptides. Genes encoding the antibacterial peptides pediocin and plantaricin with codons preferable for S. cerevisiae were synthesized, and a system was constructed for their secretory expression. Recombinant S. cerevisiae strains producing antibacterial peptides effectively inhibit the growth of Lactobacillus sakei, Pediacoccus pentasaceus, Pediacoccus acidilactici, etc. The application of distiller yeasts producing antibacterial peptides enhances the ethanol yield in cases of bacterial contamination. Recombinant yeasts producing the antibacterial peptides pediocin and plantaricin can successfully substitute the available industrial yeast strains upon ethanol production.
Mohammed, R; Vyas, D; Yang, W Z; Beauchemin, K A
2017-06-01
To characterize the changes in the relative population size (RPS) of select ruminal bacteria and rumen fermentation variables in beef heifers supplemented with a strain of Saccharomyces cerevisiae as viable active dried (ADY) or killed dried (KDY) yeast following an induced episode of ruminal acidosis. Six ruminally cannulated beef heifers fed a diet consisting of 50% forage and 50% grain (dry matter basis) were used in a replicated 3 × 3 Latin square design with three 28-day periods. Treatments were: (i) control (CTRL; no yeast); (ii) ADY (4 g day -1 providing 10 10 CFU per g; AB Vista, UK); and (iii) KDY (4 g day -1 autoclaved ADY). The acidosis challenge was induced on day 22 and rumen samples were collected on day 15 (baseline; BASE), day 22 (challenge day; CHAL), and on day 29 (168th hour post acid challenge or recovery, REC) of each period. Over the study, duration of pH <5·8 (indicative of subacute ruminal acidosis) was less for ADY and KDY than CTRL, with ADY less than KDY. No treatment effects were observed on relative abundance of ruminal bacteria, but the day effect was significant. The RPS of lactate producers and utilizers was greater while RPS of fibrolytic bacteria was lower during CHAL than BASE and REC. Yeast supplementation, irrespective of its viability, showed beneficial effects on ruminal pH variables in animals more susceptible to acidosis. Rumen microbial population was altered with the induction of severe acidosis. Most of the changes reverted back to baseline values during the recovery phase. Yeast supplementation reduced subacute rumen acidosis in the most susceptible cattle, but failed to attenuate severe acidosis induced by a grain challenge. The study provided valuable insight into the mechanism by which acidosis affects cattle performance. Individual animal variation in ruminal fermentation partly explained the variability in response to yeast supplementation in the study. © 2017 Her Majesty the Queen in Right of Canada
MOLD-SPECIFIC QUANTITATIVE PCR: THE EMERGING STANDARD IN MOLD ANALYSIS
Molds can cause health problems like infections and allergies, destroy crops, and contaminate our food or pharmaceuticals. We can't avoid molds. Molds are essential players in the biological processes on earth, but we can now identify and quantify the molds that will be most pr...
Molds have the potential to cause health problems. Molds produce allergens (substances that can cause allergic reactions) and irritants. Inhaling or touching mold or mold spores may cause allergic reactions in sensitive individuals.
Vogelmann, Stephanie A; Seitter, Michael; Singer, Ulrike; Brandt, Markus J; Hertel, Christian
2009-04-15
The adaptability of lactic acid bacteria (LAB) and yeasts to sourdoughs prepared from cereals, pseudocereals and cassava was investigated using PCR-DGGE and bacteriological culture combined with rRNA gene sequence analysis. Sourdoughs were prepared either from flours of the cereals wheat, rye, oat, barley, rice, maize, and millet, or from the pseudocereals amaranth, quinoa, and buckwheat, or from cassava, using a starter consisting of various species of LAB and yeasts. Doughs were propagated until a stable microbiota was established. The dominant LAB and yeast species were Lactobacillus fermentum, Lactobacillus helveticus, Lactobacillus paralimentarius, Lactobacillus plantarum, Lactobacillus pontis, Lactobacillus spicheri, Issatchenkia orientalis and Saccharomyces cerevisiae. The proportion of the species within the microbiota varied. L. paralimentarius dominated in the pseudocereal sourdoughs, L. fermentum, L. plantarum and L. spicheri in the cassava sourdough, and L. fermentum, L. helveticus and L. pontis in the cereal sourdoughs. S. cerevisiae constituted the dominating yeast, except for quinoa sourdough, where I. orientalis also reached similar counts, and buckwheat and oat sourdoughs, where no yeasts could be detected. To assess the usefulness of competitive LAB and yeasts as starters, the fermentations were repeated using flours from rice, maize, millet and the pseudocereals, and by starting the dough fermentation with selected dominant strains. At the end of fermentation, most of starter strains belonged to the dominating microbiota. For the rice, millet and quinoa sourdoughs the species composition was similar to that of the prior fermentation, whereas in the other sourdoughs, the composition differed.
Severe Sequelae to Mold-Related Illness as Demonstrated in Two Finnish Cohorts
Tuuminen, Tamara; Rinne, Kyösti Sakari
2017-01-01
The presence of toxic indoor molds with accompanying bacterial growth is clearly detrimental to human health. The pathophysiological and toxicological effects of toxins and structural components of molds and bacteria have been clarified in experiments conducted in tissue culture and animals, and there is convincing epidemiologic evidence; nonetheless their implications for human health are either ignored or denied, at least in Finland. In this communication, we describe two cohorts suffering severe sequelae to mold-related illness. One cohort is a nine-member family with pets that moved into a new house, which soon proved to be infested with pathogenic molds. The other cohort consists of 30 teachers and 50 students from a mold-infested school building. The first cohort experienced a plethora of mucosal irritation, neurological, skin, allergic, and other symptoms, with all family members ultimately developing a multiple chemical syndrome. In the second cohort, we detected a greatly elevated prevalence of autoimmune conditions and malignancies. We claim that mold-related illness exists in multiple facets; if not simply a transient mucosal irritation or even an increased risk of asthma onset or its exacerbation. We propose a scheme to explain the natural course of the mold-related illness. We recommend that future studies should combine data from, e.g., cancer, autoimmune, and endocrine disorder registers and neurological and mental health or neuropsychological registers with mold-exposed individuals being monitored for prolonged follow-up times. PMID:28421079
Severe Sequelae to Mold-Related Illness as Demonstrated in Two Finnish Cohorts.
Tuuminen, Tamara; Rinne, Kyösti Sakari
2017-01-01
The presence of toxic indoor molds with accompanying bacterial growth is clearly detrimental to human health. The pathophysiological and toxicological effects of toxins and structural components of molds and bacteria have been clarified in experiments conducted in tissue culture and animals, and there is convincing epidemiologic evidence; nonetheless their implications for human health are either ignored or denied, at least in Finland. In this communication, we describe two cohorts suffering severe sequelae to mold-related illness. One cohort is a nine-member family with pets that moved into a new house, which soon proved to be infested with pathogenic molds. The other cohort consists of 30 teachers and 50 students from a mold-infested school building. The first cohort experienced a plethora of mucosal irritation, neurological, skin, allergic, and other symptoms, with all family members ultimately developing a multiple chemical syndrome. In the second cohort, we detected a greatly elevated prevalence of autoimmune conditions and malignancies. We claim that mold-related illness exists in multiple facets; if not simply a transient mucosal irritation or even an increased risk of asthma onset or its exacerbation. We propose a scheme to explain the natural course of the mold-related illness. We recommend that future studies should combine data from, e.g., cancer, autoimmune, and endocrine disorder registers and neurological and mental health or neuropsychological registers with mold-exposed individuals being monitored for prolonged follow-up times.
Yeasts are essential for cocoa bean fermentation.
Ho, Van Thi Thuy; Zhao, Jian; Fleet, Graham
2014-03-17
Cocoa beans (Theobroma cacao) are the major raw material for chocolate production and fermentation of the beans is essential for the development of chocolate flavor precursors. In this study, a novel approach was used to determine the role of yeasts in cocoa fermentation and their contribution to chocolate quality. Cocoa bean fermentations were conducted with the addition of 200ppm Natamycin to inhibit the growth of yeasts, and the resultant microbial ecology and metabolism, bean chemistry and chocolate quality were compared with those of normal (control) fermentations. The yeasts Hanseniaspora guilliermondii, Pichia kudriavzevii and Kluyveromyces marxianus, the lactic acid bacteria Lactobacillus plantarum and Lactobacillus fermentum and the acetic acid bacteria Acetobacter pasteurianus and Gluconobacter frateurii were the major species found in the control fermentation. In fermentations with the presence of Natamycin, the same bacterial species grew but yeast growth was inhibited. Physical and chemical analyses showed that beans fermented without yeasts had increased shell content, lower production of ethanol, higher alcohols and esters throughout fermentation and lesser presence of pyrazines in the roasted product. Quality tests revealed that beans fermented without yeasts were purplish-violet in color and not fully brown, and chocolate prepared from these beans tasted more acid and lacked characteristic chocolate flavor. Beans fermented with yeast growth were fully brown in color and gave chocolate with typical characters which were clearly preferred by sensory panels. Our findings demonstrate that yeast growth and activity were essential for cocoa bean fermentation and the development of chocolate characteristics. Crown Copyright © 2014. Published by Elsevier B.V. All rights reserved.
Bacteria, mould and yeast spore inactivation studies by scanning electron microscope observations.
Rozali, Siti N M; Milani, Elham A; Deed, Rebecca C; Silva, Filipa V M
2017-12-18
Spores are the most resistant form of microbial cells, thus difficult to inactivate. The pathogenic or food spoilage effects of certain spore-forming microorganisms have been the primary basis of sterilization and pasteurization processes. Thermal sterilization is the most common method to inactivate spores present on medical equipment and foods. High pressure processing (HPP) is an emerging and commercial non-thermal food pasteurization technique. Although previous studies demonstrated the effectiveness of thermal and non-thermal spore inactivation, the in-depth mechanisms of spore inactivation are as yet unclear. Live and dead forms of two food spoilage bacteria, a mould and a yeast were examined using scanning electron microscopy before and after the inactivation treatment. Alicyclobacillus acidoterrestris and Geobacillus stearothermophilus bacteria are indicators of acidic foods pasteurization and sterilization processes, respectively. Neosartorya fischeri is a phyto-pathogenic mould attacking fruits. Saccharomyces cerevisiae is a yeast with various applications for winemaking, brewing, baking and the production of biofuel from crops (e.g. sugar cane). Spores of the four microbial species were thermally inactivated. Spores of S. cerevisiae were observed in the ascus and free form after thermal and HPP treatments. Different forms of damage and cell destruction were observed for each microbial spore. Thermal treatment inactivated bacterial spores of A. acidoterrestris and G. stearothermophilus by attacking the inner core of the spore. The heat first altered the membrane permeability allowing the release of intracellular components. Subsequently, hydration of spores, physicochemical modifications of proteins, flattening and formation of indentations occurred, with subsequent spore death. Regarding N. fischeri, thermal inactivation caused cell destruction and leakage of intracellular components. Both thermal and HPP treatments of S. cerevisiae free spores attacked
Effect of the yeast and bacteria biomass on the microbiota in the rumen.
Vamanu, E; Vamanu, A; Popa, O; Vassu, Tatiana; Ghindea, Raluca; Pelinescu, Diana; Nita, Sultana; Babeanu, Narcisa
2008-09-15
This study aims at obtaining a probiotic product based on viable biomass from 6 yeast strains and 2 strains of lactic bacteria used for nutrition of animals. The strains are subjected to some resistance tests, at temperature, pH, pepsin, pancreatin and biliary salts so as to make obvious their viability. Tests were done by comparison to the witness strain and respectively a protective solution based on mucin and casein. Based on the resulted viabilities 2 products are formulated. Their effect is tested by inoculating fresh rumen content and supervising the microbic balance for a period of 12 days. After the final tests, it resulted that the product Fpl (20% Saccharomyces cerevisiae 1-29, 10% Kluyveromyces marxianus R-CS, 20% Issatchenkia orientalis R-BC, 30% Lactobacillus paracasei CMGB16, 20% Enterococcus faecium GM8) was chosen because anaerobic strains were preponderant as a consequence of the tests performed with rumen.
Taveira, Gabriel B; Mathias, Luciana S; da Motta, Olney V; Machado, Olga L T; Rodrigues, Rosana; Carvalho, André O; Teixeira-Ferreira, André; Perales, Jonas; Vasconcelos, Ilka M; Gomes, Valdirene M
2014-01-01
Plants defend themselves against pathogens with production of antimicrobial peptides (AMPs). Herein we describe the discovery of a new antifungal and antibacterial peptide from fruits of Capsicum annuum that showed similarity to an already well characterized family of plant AMPs, thionins. Other fraction composed of two peptides, in which the major peptide also showed similarity to thionins. Among the obtained fractions, fraction 1, which is composed of a single peptide of 7 kDa, was sequenced by Edman method and its comparative sequence analysis in database (nr) showed similarity to thionin-like peptides. Tests against microorganisms, fraction 1 presented inhibitory activity to the cells of yeast Saccharomyces cerevisiae, Candida albicans, and Candida tropicalis and caused growth reduction to the bacteria species Escherichia coli and Pseudomonas aeruginosa. Fraction 3 caused inhibitory activity only for C. albicans and C. tropicalis. This fraction was composed of two peptides of ∼7 and 10 kDa, and the main protein band correspondent to the 7 kDa peptide, also showed similarity to thionins. This plasma membrane permeabilization assay demonstrates that the peptides present in the fractions 1 and 3 induced changes in the membranes of all yeast strains, leading to their permeabilization. Fraction 1 was capable of inhibiting acidification of the medium of glucose-induced S. cerevisiae cells 78% after an incubation time of 30 min, and opposite result was obtained for C. albicans. Experiments demonstrate that the fraction 1 and 3 were toxic and induced changes in the membranes of all yeast strains, leading to their permeabilization. Copyright © 2013 Wiley Periodicals, Inc.
Yeast alter micro-oxygenation of wine: oxygen consumption and aldehyde production.
Han, Guomin; Webb, Michael R; Richter, Chandra; Parsons, Jessica; Waterhouse, Andrew L
2017-08-01
Micro-oxygenation (MOx) is a common winemaking treatment used to improve red wine color development and diminish vegetal aroma, amongst other effects. It is commonly applied to wine immediately after yeast fermentation (phase 1) or later, during aging (phase 2). Although most winemakers avoid MOx during malolactic (ML) fermentation, it is often not possible to avoid because ML bacteria are often present during phase 1 MOx treatment. We investigated the effect of common yeast and bacteria on the outcome of micro-oxygenation. Compared to sterile filtered wine, Saccharomyces cerevisiae inoculation significantly increased oxygen consumption, keeping dissolved oxygen in wine below 30 µg L -1 during micro-oxygenation, whereas Oenococcus oeni inoculation was not associated with a significant impact on the concentration of dissolved oxygen. The unfiltered baseline wine also had both present, although with much higher populations of bacteria and consumed oxygen. The yeast-treated wine yielded much higher levels of acetaldehyde, rising from 4.3 to 29 mg L -1 during micro-oxygenation, whereas no significant difference was found between the bacteria-treated wine and the filtered control. The unfiltered wine exhibited rapid oxygen consumption but no additional acetaldehyde, as well as reduced pyruvate. Analysis of the acetaldehyde-glycerol acetal levels showed a good correlation with acetaldehyde concentrations. The production of acetaldehyde is a key outcome of MOx and it is dramatically increased in the presence of yeast, although it is possibly counteracted by the metabolism of O. oeni bacteria. Additional controlled experiments are necessary to clarify the interaction of yeast and bacteria during MOx treatments. Analysis of the glycerol acetals may be useful as a proxy for acetaldehyde levels. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Rapid control of mold temperature during injection molding process
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liparoti, Sara; Titomanlio, Giuseppe; Hunag, Tsang Min
2015-05-22
The control of mold surface temperature is an important factor that determines surface morphology and its dimension in thickness direction. It can also affect the frozen molecular orientation and the mold surface replicability in injection molded products. In this work, thin thermally active films were used to quickly control the mold surface temperature. In particular, an active high electrical conductivity carbon black loaded polyimide composites sandwiched between two insulating thin polymeric layers was used to condition the mold surface. By controlling the heating time, it was possible to control precisely the temporal variation of the mold temperature surface during themore » entire cycle. The surface heating rate was about 40°C/s and upon contact with the polymer the surface temperature decreased back to 40°C within about 5 s; the overall cycle time increased only slightly. The effect on cross section sample morphology of samples of iPP were analyzed and discussed on the basis of the recorded temperature evolution.« less
Yadav, Devbrat; Kumar, Arvind; Kumar, Pramod; Mishra, Diwaker
2015-01-01
Black grape peel possesses a substantial amount of polyphenolic antimicrobial compounds that can be used for controlling the growth of pathogenic microorganisms. The purpose of this study was to assess antibacterial and antifungal activity of black grape peel extracts against antibiotic-resistant pathogenic bacteria and toxin producing molds, respectively. Peel of grape was subjected to polyphenolic extraction using different solvents viz., water, ethanol, acetone, and methanol. Antibiotic-resistant strains of Staphylococcus aureus, Enterococcus faecalis, Enterobacter aerogenes, Salmonella typhimurium, and Escherichia coli were screened for the antibacterial activity of different grape extracts. Antibacterial activity was analyzed using agar well diffusion method. Penicillium chrysogenum, Penicillium expansum, Aspergillus niger and Aspergillus versicolor were screened for the antifungal activity. Antifungal activity was determined by counting nongerminated spores in the presence of peel extracts. As compared to other solvent extracts, methanol extracts possessed high antibacterial and antifungal activity. S. typhimurium and E. coli showed complete resistance against antibacterial action at screened concentrations of grape peel extracts. Maximum zone of inhibition was found in case of S. aureus, i.e., 22 mm followed by E. faecalis and E. aerogenes, i.e., 18 and 21 mm, respectively, at 1080 mg tannic acid equivalent (TAE)/ml. The maximum and minimum percent of growth inhibition was shown by P. expansum and A. niger as 73% and 15% at 1080 TAE/ml concentration of grape peel extract, respectively. Except S. typhimurium and E. coli, growth of all bacterial and mold species were found to be significantly (P < 0.05) inhibited by all the solvent extracts.
Challenges in mold manufacturing for high precision molded diffractive optical elements
NASA Astrophysics Data System (ADS)
Pongs, Guido; Bresseler, Bernd; Schweizer, Klaus; Bergs, Thomas
2016-09-01
Isothermal precision glass molding of imaging optics is the key technology for mass production of precise optical elements. Especially for numerous consumer applications (e.g. digital cameras, smart phones, …), high precision glass molding is applied for the manufacturing of aspherical lenses. The usage of diffractive optical elements (DOEs) can help to further reduce the number of lenses in the optical systems which will lead to a reduced weight of hand-held optical devices. But today the application of molded glass DOEs is limited due to the technological challenges in structuring the mold surfaces. Depending on the application submicrometer structures are required on the mold surface. Furthermore these structures have to be replicated very precisely to the glass lens surface. Especially the micro structuring of hard and brittle mold materials such as Tungsten Carbide is very difficult and not established. Thus a multitude of innovative approaches using diffractive optical elements cannot be realized. Aixtooling has investigated in different mold materials and different suitable machining technologies for the micro- and sub-micrometer structuring of mold surfaces. The focus of the work lays on ultra-precision grinding to generate the diffractive pattern on the mold surfaces. This paper presents the latest achievements in diffractive structuring of Tungsten Carbide mold surfaces by ultra-precision grinding.
Reactive airway - mold; Bronchial asthma - mold; Triggers - mold; Allergic rhinitis - pollen ... Things that make allergies or asthma worse are called triggers. Mold is a common trigger. When your asthma or allergies become worse due to mold, you are ...
[Quorum sensing in bacteria and yeast].
March Rosselló, Gabriel Alberto; Eiros Bouza, José María
2013-10-19
Bacterial sets are complex dynamic systems, which interact with each other and through the interaction, bacteria coexist, collaborate, compete and share information in a coordinated manner. A way of bacterial communication is quorum sensing. Through this mechanism the bacteria can recognize its concentration in a given environment and they can decide the time at which the expression of a particular set of genes should be started for developing a specific and simultaneous response. The result of these interconnections raises properties that cannot be explained from a single isolated bacterial cell. Copyright © 2012 Elsevier España, S.L. All rights reserved.
Sieburth, J M; Jensen, A
1967-07-01
Meal from the brown seaweed Ascophyllum nodosum (L.) Le Jol. is mainly used as an animal feed supplement. Since moist weed often develops a marked mold growth and since little was known about the microflora of seaweed meal, a cultural procedure was developed to enumerate the populations of bacteria, yeasts, and molds of seaweed meals manufactured by different drying processes. The microflora could be supported by a variety of media varying in levels of nutrition and in the source and concentration of salts. Fresh weed contained less than 10(3) bacteria and less than 10(2) yeasts and molds per g (dry weight). The type and extent of microbial populations in seaweed meal appeared to be dependent upon the method of seaweed drying. Rotary drum-drying at temperatures decreasing from 800 to 80 C maintained or reduced the microbial populations to 10(3) organisms per g (dry weight). Although meals with high nutritional quality can be obtained with warm air- or rock-dried weed, these conditions can also permit bacterial and mold development. Extended rock-drying in variable weather conditions and prolonged storage of moist weed, both of which decrease the nutritional quality, also lead to high bacterial numbers and to a marked development of the halophilic brown mold Sporendonema minutum which attained populations of 10(8) viable spores per g of dried weed. A poultry diet containing 5% badly molded weed had no apparent toxic or growth-depressing effect when fed to chicks.
Improved compression molding process
NASA Technical Reports Server (NTRS)
Heier, W. C.
1967-01-01
Modified compression molding process produces plastic molding compounds that are strong, homogeneous, free of residual stresses, and have improved ablative characteristics. The conventional method is modified by applying a vacuum to the mold during the molding cycle, using a volatile sink, and exercising precise control of the mold closure limits.
Study on In-mold Punching during PPS/GF Injection Molding
NASA Astrophysics Data System (ADS)
Inuzuka, Takayuki; Fujita, Akihiro; Nakai, Asami; Hamada, Hiroyuki
The influence of the punching condition on strength and the amount of shear droop was investigated to optimize the processing condition for punching in the mold during glass fiber reinforced polyphenylenesulfide (PPS/GF) injection molding. For in-mold punching part during cooling process, the tensile strength was constant because the pressure loss by the punch did not occur. The amount of the shear droop decreased in line with the increase in delay time because the rigidity of injection molded part in the mold increased when the resin was cooled. Moreover, when the resin temperature lowered more than the glass transition temperature, the amount of the shear droop was constant because the rigidity became constant. It is necessary to begin punching when the resin temperature lowers more than the glass transition temperature after holding pressure process is completed, to secure high strength and to assume 0.05 mm or less, at which level the shear droop cannot be visually recognized. The shortest delay time for PPS/GF is 8 sec. The delay time to minimize the amount of the shear droop can be guessed by analyzing the temperature change of the resin in the mold by injection molding CAE.
Photodynamic inactivation of mold fungi spores by newly developed charged corroles.
Preuß, Annegret; Saltsman, Irena; Mahammed, Atif; Pfitzner, Michael; Goldberg, Israel; Gross, Zeev; Röder, Beate
2014-04-05
The photodynamic effect, originally used in photodynamic therapy (PDT) for the treatment of different diseases, e.g. of cancer, has recently been introduced for the inactivation of bacteria. Mold fungi, which provoke health problems like allergies and diseases of the respiratory tract, are even more resistant and their biology is also very different. This study presents the development of four new photosensitizers, which, in combination with low doses of white light, inhibit the germination of mold fungi spores. Two of them even cause lethal damage to the conidia (spores) which are responsible for the spreading of mold fungi. The photoactivity of the newly synthesized corroles was obtained by their application on three different mold fungi: Aspergillus niger, Cladosporium cladosporoides, and Penicillium purpurgenum. To distinguish between inactivation of germination and permanent damage, the fungi were first incubated under illumination for examination of photosensitizer-induced growth inhibition and then left in darkness to test the survival of the conidia. None of the compounds displayed dark toxicity, but all of them attenuated or prevented germination when exposed to light, and the positively charged complexes induced a complete damage of the conidia. Copyright © 2014 Elsevier B.V. All rights reserved.
Hydrogen silsesquioxane mold coatings for improved replication of nanopatterns by injection molding
NASA Astrophysics Data System (ADS)
Hobæk, Thor Christian; Matschuk, Maria; Kafka, Jan; Pranov, Henrik J.; Larsen, Niels B.
2015-03-01
We demonstrate the replication of nanosized pillars in polymer (cyclic olefin copolymer) by injection molding using nanostructured thermally cured hydrogen silsesquioxane (HSQ) ceramic coatings on stainless steel mold inserts with mold nanostructures produced by a simple embossing process. At isothermal mold conditions, the average pillar height increases by up to 100% and a more uniform height distribution is observed compared to a traditional metal mold insert. Thermal heat transfer simulations predict that the HSQ film retards the cooling of the polymer melt during the initial stages of replication, thus allowing more time to fill the nanoscale cavities compared to standard metal molds. A monolayer of a fluorinated silane (heptadecafluorotrichlorosilane) deposited on the mold surface reduces the mold/polymer interfacial energy to support demolding of the polymer replica. The mechanical stability of thermally cured HSQ makes it a promising material for nanopattern replication on an industrial scale without the need for slow and energy intensive variotherm processes.
ERIC Educational Resources Information Center
Phaff, Herman J.
1981-01-01
Describes industrially important yeasts, molds, bacteria, and actinomycetes. Discussed in detail are microbial products, such as primary metabolites, secondary metabolites, enzymes, and capsular polysaccharides. Traces the historical background of human cell culture, mentioning recombinant DNA research and hybridization of normal mammalian cells…
1986-11-15
assignment to treatment groups all rats were subjected to physical examination and specimens were examined for pathogenic bacteria, molds , yeasts, M...HISTOPATHOLOGY: >NO OBSFVABLE ABNORMALITIES. NOT APPLICABLE 180 THE EF"FECTS OF SUBCHRONIC EPOSURES TO RED PHOSPHORUS / BUTYL RUBBER (RP/BR) COMBUSTION
Palla, Michela; Cristani, Caterina; Giovannetti, Manuela; Agnolucci, Monica
2017-06-05
Sourdough fermentation has been increasingly used worldwide, in accordance with the demand of consumers for tasty, natural and healthy food. The high diversity of lactic acid bacteria (LAB) and yeast species, detected in sourdoughs all over the world, may affect nutritional, organoleptic and technological traits of leavened baked goods. A wide regional variety of traditional sourdough breads, over 200 types, has been recorded in Italy, including special types selected as worthy of either Protected Geographical Indication (PGI) or Protected Designation of Origin (PDO), whose sourdough microbiota has been functionally and molecularly characterized. As, due to the very recent designation, the microbiota of Tuscan bread sourdough has not been investigated so far, the aim of the present work was to isolate and characterize the species composition of LAB and yeasts of PDO Tuscan bread sourdough by culture-independent and dependent methods. A total of 130 yeasts from WLN medium and 193 LAB from both mMRS and SDB media were isolated and maintained to constitute the germplasm bank of PDO Tuscan bread. Ninety six LAB from mMRS medium and 68 yeasts from WLN medium were randomly selected and molecularly identified by ARDRA (Amplified Ribosomal DNA Restriction Analysis) and PCR-RFLP analysis of the ITS region, respectively, and sequencing. The yeast identity was confirmed by 26S D1/D2 sequencing. All bacterial isolates showed 99% identity with Lactobacillus sanfranciscensis, 65 yeast isolates were identified as Candida milleri, and 3 as Saccharomyces cerevisiae. Molecular characterization of PDO Tuscan bread sourdough by PCR-DGGE confirmed such data. The distinctive tripartite species association, detected as the microbiota characterizing the sourdough used to produce PDO Tuscan bread, encompassed a large number of L. sanfranciscensis and C. milleri strains, along with a few of S. cerevisiae. The relative composition and specific physiological characteristics of such microbiota
[Groups and sources of yeasts in house dust].
Glushakova, A M; Zheltikova, T M; Chernov, I Iu
2004-01-01
House dust contains bacteria, mycelial fungi, microarthropods, and yeasts. The house dust samples collected in 25 apartments in Moscow and the Moscow region were found to contain yeasts belonging to the genera Candida, Cryptococcus, Debaryomyces, Rhodotorula, Sporobolomyces, and Trichosporon. The most frequently encountered microorganisms were typical epiphytic yeasts, such as Cryptococcus diffluens and Rhodotorula mucilaginosa, which are capable of long-term preservation in an inactive state. The direct source of epiphytic yeasts occurring in the house dust might be the indoor plants, which were contaminated with these yeasts, albeit to a lesser degree than outdoor plants. Along with the typical epiphytic yeasts, the house dust contained the opportunistic yeast pathogens Candida catenulata, C. guillermondii, C. haemulonii, C. rugosa, and C. tropicalis, which are known as the causal agents of candidiasis. We failed to reveal any correlation between the abundance of particular yeast species in the house dust, residential characteristics, and the atopic dermatitis of the inhabitants.
In most cases, if visible mold growth is present, sampling is unnecessary. Since no EPA or other federal limits have been set for mold or mold spores, sampling cannot be used to check a building's compliance with federal mold standards.
Yarrowia lipolytica: a model yeast for citric acid production.
Cavallo, Ema; Charreau, Hernán; Cerrutti, Patricia; Foresti, María Laura
2017-12-01
Every year more than 2 million tons of citric acid (CA) are produced around the world for industrial uses. Although initially extracted from citrus, the low profitability of the process and the increasing demand soon stimulated the search for more efficient methods to produce CA. Currently, most world CA demand (99%) is satisfied by fermentations with microorganisms, especially filamentous fungi and yeasts. CA production with yeasts has certain advantages over molds (e.g. higher productivity and easier cultivation), which in the last two decades have triggered a clear increase in publications and patents devoted to the use of yeasts in this field. Yarrowia lipolytica has become a model yeast that proved to be successful in different production systems. Considering the current interest evidenced in the literature, the most significant information on CA production using Y. lipolytica is summarized. The relevance on CA yields of key factors such as strains, media formulation, environmental conditions and production regimes is thoroughly discussed, with particular focus on increasing CA productivity. Besides, the possibility of tuning the mentioned variables to reduce concomitant isocitric acid production-the biggest disadvantage of using yeasts-is analyzed. Available methods for CA purification/quantification are also discussed. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Manufacturing plastic injection optical molds
NASA Astrophysics Data System (ADS)
Bourque, David
2008-08-01
ABCO Tool & Die, Inc. is a mold manufacturer specializing in the manufacturing of plastic injection molds for molded optical parts. The purpose of this presentation is to explain the concepts and procedures required to build a mold that produces precision optical parts. Optical molds can produce a variety of molded parts ranging from safety eyewear to sophisticated military lens parts, which must meet precise optical specifications. The manufacturing of these molds begins with the design engineering of precision optical components. The mold design and the related optical inserts are determined based upon the specific optical criteria and optical surface geometry. The mold manufacturing techniques will be based upon the optical surface geometry requirements and specific details. Manufacturing processes used will be specific to prescribed geometrical surface requirements of the molded part. The combined efforts result in a robust optical mold which can produce molded parts that meet the most precise optical specifications.
Microbiological Safety of Kitchen Sponges Used in Food Establishments
Bacha, Ketema
2016-01-01
Kitchen sponges are among the possible sources of contaminants in food establishments. The main purpose of the current study was, therefore, to assess the microbiological safety of sponges as it has been used in selected food establishments of Jimma town. Accordingly, the microbiological safety of a total of 201 kitchen sponges randomly collected from food establishments was evaluated against the total counts of aerobic mesophilic bacteria (AMB), Enterobacteriaceae, coliforms, and yeast and molds. The mean counts of aerobic mesophilic bacteria ranged from 7.43 to 12.44 log CFU/mm3. The isolated genera were dominated by Pseudomonas (16.9%), Bacillus (11.1%), Micrococcus (10.6%), Streptococcus (7.8%), and Lactobacillus (6%) excluding the unidentified Gram positive rods (4.9%) and Gram negative rods (9.9%). The high microbial counts (aerobic mesophilic bacteria, coliforms, Enterobacteriaceae, and yeast and molds) reveal the existence of poor kitchen sponge sanitization practice. Awareness creation training on basic hygienic practices to food handlers and periodic change of kitchen sponges are recommended. PMID:27840819
Sensory quality of Camembert-type cheese: Relationship between starter cultures and ripening molds.
Galli, Bruno Domingues; Martin, José Guilherme Prado; da Silva, Paula Porrelli Moreira; Porto, Ernani; Spoto, Marta Helena Fillet
2016-10-03
Starter cultures and ripening molds used in the manufacture of moldy cheese aimed at obtaining characteristic flavors and textures considerably differ among dairy industries. Thus, the study of variables inherent to the process and their influence on sensory patterns in cheese can improve the standardization and control of the production process. The aim of this work was to study the influence of three different variables on the sensory quality of Camembert-type cheese: type of lactic bacteria, type of ripener molds and inoculation method. Batches of Camembert-type cheese were produced using O or DL-type mesophilic starter culture, ripened with Penicillium camemberti or Penicillium candidum and mold inoculation was made directly into the milk or by spraying. All batches were sensorially evaluated using Quantitative Descriptive Analysis (QDA) with panelists trained for various attributes. Among the combinations analyzed, those resulting in more typical Camembert-type cheese were those using O-type mesophilic starter culture and P. candidum maturation mold directly applied into the milk or sprayed and those using DL-type mesophilic starter and P. camemberti ripener mold applied by surface spraying. These results demonstrate, therefore, that the combination of different ripener molds, inoculation methods and starter cultures directly influences the sensory quality of Camembert-type cheese, modifying significantly its texture, appearance, aroma and taste. Copyright © 2016 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Koizumi, Koji; Charles, Ted; de Keyser, Hendrik
Phenolic Molding Compounds continue to exhibit well balanced properties such as heat resistance, chemical resistance, dimensional stability, and creep resistance. They are widely applied in electrical, appliance, small engine, commutator, and automotive applications. As the focus of the automotive industry is weight reduction for greater fuel efficiency, phenolic molding compounds become appealing alternatives to metals. Current market volumes and trends, formulation components and its impact on properties, and a review of common manufacturing methods are presented. Molding processes as well as unique advanced techniques such as high temperature molding, live sprue, and injection/compression technique provide additional benefits in improving the performance characterisitics of phenolic molding compounds. Of special interest are descriptions of some of the latest innovations in automotive components, such as the phenolic intake manifold and valve block for dual clutch transmissions. The chapter also characterizes the most recent developments in new materials, including long glass phenolic molding compounds and carbon fiber reinforced phenolic molding compounds exhibiting a 10-20-fold increase in Charpy impact strength when compared to short fiber filled materials. The role of fatigue testing and fatigue fracture behavior presents some insight into long-term reliability and durability of glass-filled phenolic molding compounds. A section on new technology outlines the important factors to consider in modeling phenolic parts by finite element analysis and flow simulation.
NASA Astrophysics Data System (ADS)
Bhalla, Tek Chand; Sharma, Monica; Sharma, Nitya Nand
Nitriles and amides are widely distributed in the biotic and abiotic components of our ecosystem. Nitrile form an important group of organic compounds which find their applications in the synthesis of a large number of compounds used as/in pharmaceutical, cosmetics, plastics, dyes, etc>. Nitriles are mainly hydro-lyzed to corresponding amide/acid in organic chemistry. Industrial and agricultural activities have also lead to release of nitriles and amides into the environment and some of them pose threat to human health. Biocatalysis and biotransformations are increasingly replacing chemical routes of synthesis in organic chemistry as a part of ‘green chemistry’. Nitrile metabolizing organisms or enzymes thus has assumed greater significance in all these years to convert nitriles to amides/ acids. The nitrile metabolizing enzymes are widely present in bacteria, fungi and yeasts. Yeasts metabolize nitriles through nitrilase and/or nitrile hydratase and amidase enzymes. Only few yeasts have been reported to possess aldoxime dehydratase. More than sixty nitrile metabolizing yeast strains have been hither to isolated from cyanide treatment bioreactor, fermented foods and soil. Most of the yeasts contain nitrile hydratase-amidase system for metabolizing nitriles. Transformations of nitriles to amides/acids have been carried out with free and immobilized yeast cells. The nitrilases of Torulopsis candida>and Exophiala oligosperma>R1 are enantioselec-tive and regiospecific respectively. Geotrichum>sp. JR1 grows in the presence of 2M acetonitrile and may have potential for application in bioremediation of nitrile contaminated soil/water. The nitrilase of E. oligosperma>R1 being active at low pH (3-6) has shown promise for the hydroxy acids. Immobilized yeast cells hydrolyze some additional nitriles in comparison to free cells. It is expected that more focus in future will be on purification, characterization, cloning, expression and immobilization of nitrile metabolizing
Transferability of glass lens molding
NASA Astrophysics Data System (ADS)
Katsuki, Masahide
2006-02-01
Sphere lenses have been used for long time. But it is well known that sphere lenses theoretically have spherical aberration, coma and so on. And, aspheric lenses attract attention recently. Plastic lenses are molded easily with injection machines, and are relatively low cost. They are suitable for mass production. On the other hand, glass lenses have several excellent features such as high refractive index, heat resistance and so on. Many aspheric glass lenses came to be used for the latest digital camera and mobile phone camera module. It is very difficult to produce aspheric glass lenses by conventional process of curve generating and polishing. For the solution of this problem, Glass Molding Machine was developed and is spreading through the market. High precision mold is necessary to mold glass lenses with Glass Molding Machine. The mold core is ground or turned by high precision NC aspheric generator. To obtain higher transferability of the mold core, the function of the molding machine and the conditions of molding are very important. But because of high molding temperature, there are factors of thermal expansion and contraction of the mold and glass material. And it is hard to avoid the factors. In this session, I introduce following items. [1] Technology of glass molding and the machine is introduced. [2] The transferability of glass molding is analyzed with some data of glass lenses molded. [3] Compensation of molding shape error is discussed with examples.
ERIC Educational Resources Information Center
Huckabee, Christopher
2003-01-01
Asserts that one of the surest ways to prevent indoor air quality and mold issues is to use preventive construction materials, discussing typical resistance to dealing with mold problems (usually budget-related) and describing mold-resistant construction, which uses concrete masonry, brick, and stone and is intended to withstand inevitable…
Antimicrobial Properties of Natural Phenols and Related Compounds
Jurd, L.; King, A. D.; Mihara, K.; Stanley, W. L.
1971-01-01
Obtusastyrene (4-cinnamylphenol) displays effective antimicrobial activity in vitro against a variety of gram-positive bacteria, yeasts, and molds. The activity of obtusastyrene is not appreciably affected by pH, and its minimal inhibitory concentrations, 12 to 25 μg/ml for bacteria and 12 to 100 μg/ml for fungi, compare favorably with those of a number of synthetic, phenolic antimicrobial agents. PMID:5553287
Ouoba, L I I; Kando, C; Parkouda, C; Sawadogo-Lingani, H; Diawara, B; Sutherland, J P
2012-12-01
To investigate physicochemical characteristics and especially genotypic diversity of the main culturable micro-organisms involved in fermentation of sap from Borassus akeassii, a newly identified palm tree from West Africa. Physicochemical characterization was performed using conventional methods. Identification of micro-organisms included phenotyping and sequencing of: 26S rRNA gene for yeasts, 16S rRNA and gyrB genes for lactic acid bacteria (LAB) and acetic acid bacteria (AAB). Interspecies and intraspecies genotypic diversities of the micro-organisms were screened respectively by amplification of the ITS1-5.8S rDNA-ITS2/16S-23S rDNA ITS regions and repetitive sequence-based PCR (rep-PCR). The physicochemical characteristics of samples were: pH: 3.48-4.12, titratable acidity: 1.67-3.50 mg KOH g(-1), acetic acid: 0.16-0.37%, alcohol content: 0.30-2.73%, sugars (degrees Brix): 2.70-8.50. Yeast included mainly Saccharomyces cerevisiae and species of the genera Arthroascus, Issatchenkia, Candida, Trichosporon, Hanseniaspora, Kodamaea, Schizosaccharomyces, Trigonopsis and Galactomyces. Lactobacillus plantarum was the predominant LAB species. Three other species of Lactobacillus were also identified as well as isolates of Leuconostoc mesenteroides, Fructobacillus durionis and Streptococcus mitis. Acetic acid bacteria included nine species of the genus Acetobacter with Acetobacter indonesiensis as predominant species. In addition, isolates of Gluconobacter oxydans and Gluconacetobacter saccharivorans were also identified. Intraspecies diversity was observed for some species of micro-organisms including four genotypes for Acet. indonesiensis, three for Candida tropicalis and Lactobacillus fermentum and two each for S. cerevisiae, Trichosporon asahii, Candida pararugosa and Acetobacter tropicalis. fermentation of palm sap from B. akeassii involved multi-yeast-LAB-AAB cultures at genus, species and intraspecies level. First study describing microbiological and
Accelerating Yeast Prion Biology using Droplet Microfluidics
NASA Astrophysics Data System (ADS)
Ung, Lloyd; Rotem, Assaf; Jarosz, Daniel; Datta, Manoshi; Lindquist, Susan; Weitz, David
2012-02-01
Prions are infectious proteins in a misfolded form, that can induce normal proteins to take the misfolded state. Yeast prions are relevant, as a model of human prion diseases, and interesting from an evolutionary standpoint. Prions may also be a form of epigenetic inheritance, which allow yeast to adapt to stressful conditions at rates exceeding those of random mutations and propagate that adaptation to their offspring. Encapsulation of yeast in droplet microfluidic devices enables high-throughput measurements with single cell resolution, which would not be feasible using bulk methods. Millions of populations of yeast can be screened to obtain reliable measurements of prion induction and loss rates. The population dynamics of clonal yeast, when a fraction of the cells are prion expressing, can be elucidated. Furthermore, the mechanism by which certain strains of bacteria induce yeast to express prions in the wild can be deduced. Integrating the disparate fields of prion biology and droplet microfluidics reveals a more complete picture of how prions may be more than just diseases and play a functional role in yeast.
Chaucheyras-Durand, F; Ameilbonne, A; Bichat, A; Mosoni, P; Ossa, F; Forano, E
2016-03-01
To monitor the effect of a live yeast additive on feedstuff colonization by targeted fibrolytic micro-organisms and fibre degradation in the cow rumen. Abundance of adhering fibrolytic bacteria and fungi on feedstuffs incubated in sacco in the cow rumen was quantified by qPCR and neutral detergent fibre (NDF) degradation was measured. Saccharomyces cerevisiae I-1077 (SC) increased the abundance of fibre-associated Fibrobacter succinogenes on wheat bran (WB) and that of Ruminococcus flavefaciens on alfalfa hay (AH) and wheat silage (WS). The greatest effect was observed on the abundance of Butyrivibrio fibrisolvens on AH and soya hulls (SH) (P < 0·001). Fungal biomass increased on AH, SH, WS and WB in the presence of SC. NDF degradation of AH and SH was improved (P < 0·05) with SC supplementation. Live yeasts enhanced microbial colonization of fibrous materials, the degree of enhancement depended on their nature and composition. As an effect on rumen pH was not likely to be solely involved, the underlying mechanisms could involve nutrient supply or oxygen scavenging by the live yeast cells. Distribution of this microbial additive could be an interesting tool to increase fibre digestion in the rumen and thereby improve cow feed efficiency. © 2015 The Society for Applied Microbiology.
The Occurrence of Beer Spoilage Lactic Acid Bacteria in Craft Beer Production.
Garofalo, Cristiana; Osimani, Andrea; Milanović, Vesna; Taccari, Manuela; Aquilanti, Lucia; Clementi, Francesca
2015-12-01
Beer is one of the world's most ancient and widely consumed fermented alcoholic beverages produced with water, malted cereal grains (generally barley and wheat), hops, and yeast. Beer is considered an unfavorable substrate of growth for many microorganisms, however, there are a limited number of bacteria and yeasts, which are capable of growth and may spoil beer especially if it is not pasteurized or sterile-filtered as craft beer. The aim of this research study was to track beer spoilage lactic acid bacteria (LAB) inside a brewery and during the craft beer production process. To that end, indoor air and work surface samples, collected in the brewery under study, together with commercial active dry yeasts, exhausted yeasts, yeast pellet (obtained after mature beer centrifugation), and spoiled beers were analyzed through culture-dependent methods and PCR-DGGE in order to identify the contaminant LAB species and the source of contamination. Lactobacillus brevis was detected in a spoiled beer and in a commercial active dry yeast. Other LAB species and bacteria ascribed to Staphylococcus sp., Enterobaceriaceae, and Acetobacter sp. were found in the brewery. In conclusion, the PCR-DGGE technique coupled with the culture-dependent method was found to be a useful tool for identifying the beer spoilage bacteria and the source of contamination. The analyses carried out on raw materials, by-products, final products, and the brewery were useful for implementing a sanitization plan to be adopted in the production plant. © 2015 Institute of Food Technologists®
Sieburth, John McN.; Jensen, Arne
1967-01-01
Meal from the brown seaweed Ascophyllum nodosum (L.) Le Jol. is mainly used as an animal feed supplement. Since moist weed often develops a marked mold growth and since little was known about the microflora of seaweed meal, a cultural procedure was developed to enumerate the populations of bacteria, yeasts, and molds of seaweed meals manufactured by different drying processes. The microflora could be supported by a variety of media varying in levels of nutrition and in the source and concentration of salts. Fresh weed contained less than 103 bacteria and less than 102 yeasts and molds per g (dry weight). The type and extent of microbial populations in seaweed meal appeared to be dependent upon the method of seaweed drying. Rotary drum-drying at temperatures decreasing from 800 to 80 C maintained or reduced the microbial populations to 103 organisms per g (dry weight). Although meals with high nutritional quality can be obtained with warm air- or rock-dried weed, these conditions can also permit bacterial and mold development. Extended rock-drying in variable weather conditions and prolonged storage of moist weed, both of which decrease the nutritional quality, also lead to high bacterial numbers and to a marked development of the halophilic brown mold Sporendonema minutum which attained populations of 108 viable spores per g of dried weed. A poultry diet containing 5% badly molded weed had no apparent toxic or growth-depressing effect when fed to chicks. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:6069160
Chemorheology of in-mold coating for compression molded SMC applications
NASA Astrophysics Data System (ADS)
Ko, Seunghyun; Straus, Elliott J.; Castro, Jose M.
2015-05-01
In-mold coating (IMC) is applied to compression molded sheet molding compound (SMC) exterior automotive or truck body panels as an environmentally friendly alternative to make the surface conductive for subsequent electrostatic painting operations. The coating is a thermosetting liquid that when injected onto the surface of the part cures and bonds to provide a smooth conductive surface. In order to optimize the IMC process, it is essential to predict the time available for flow, that is the time before the thermosetting reaction starts (inhibition time) as well as the time when the coating has enough structural integrity so that the mold can be opened without damaging the part surface (cure time). To predict both the inhibition time and the cure time, it is critical to study the chemorheology of IMC. In this paper, we study the chemorheology for a typical commercial IMC system, and show its relevance to both the flow and cure time for the IMC stage during SMC compression molding.
NASA Astrophysics Data System (ADS)
Mertus, Lou; Symmons, Alan
2012-10-01
In recent years, the trend within the molded optics community has been an overall advancement in the capability to diamond grind molds using a variety of grinding techniques. Improvements in grinding equipment, materials and tooling have enabled higher quality ceramic and carbide molds and thereby lenses. Diamond turned molds from ductile metals are still used prevalently throughout the molding industry. Each technology presents a unique set of advantages and disadvantages whether used for precision injection molding of plastic optics or precision glass molding. This paper reviews the manufacturing techniques for each approach and applicable molding process. The advantages and disadvantages of each are compared and analyzed. The subtle differences that exist in optics molded from each technique and the impact they have on the performance in various applications is reviewed. Differences stemming from tooling material properties, material-specific minor defects, as well as cutting and grinding process-induced artifacts are described in detail as well as their influence on the roughness, waviness, and form errors present on the molded surface. A comparison with results between similar surfaces for both diamond grinding and diamond turning is presented.
Morales, Alfredo M [Livermore, CA
2006-10-24
The present invention describes a method for rapidly fabricating a robust 3-dimensional silicon-mold for use in preparing complex metal micro-components. The process begins by depositing a conductive metal layer onto one surface of a silicon wafer. A thin photoresist and a standard lithographic mask are then used to transfer a trace image pattern onto the opposite surface of the wafer by exposing and developing the resist. The exposed portion of the silicon substrate is anisotropically etched through the wafer thickness down to conductive metal layer to provide an etched pattern consisting of a series of rectilinear channels and recesses in the silicon which serve as the silicon micro-mold. Microcomponents are prepared with this mold by first filling the mold channels and recesses with a metal deposit, typically by electroplating, and then removing the silicon micro-mold by chemical etching.
[Banana peel: a possible source of infection in the treatment of nipple fissures].
Novak, Franz Reis; de Almeida, João Aprígio Guerra; de Souza e Silva, Rosana
2003-01-01
To study the microbiology of banana peel being sold in the city of Rio de Janeiro, in an attempt to determine the possibility that the peel may represent a source of infection for women who use it to treat nipple fissures. The following microorganisms were studied in 20 banana peel samples: mesophiles, total coliforms, fecal coliforms, Pseudomonas aeruginosa, lipolytic and proteolytic microorganisms, molds and yeasts, lactic bacteria, and coagulase-positive staphylococcus. The microbiological analyses revealed the occurrence of several typical groups of microorganisms, with the following distribution of positive results being detected in banana peel samples: mesophiles, 100%; total coliforms, 20%; coagulase-positive staphylococcus, 25%; molds and yeasts, 30%; proteolytic microorganisms, 70%; lipolytic microorganisms, 30%, and lactic bacteria, 95%. Fecal coliforms and Pseudomonas aeruginosa were not isolated. The results show the presence of potentially pathogenic microorganisms in levels which could compromise the microbiological quality of the banana peel. Its use for the treatment of nipple fissures can initiate an infectious process.
Potential benefits of the application of yeast starters in table olive processing.
Arroyo-López, Francisco N; Romero-Gil, Verónica; Bautista-Gallego, Joaquín; Rodríguez-Gómez, Francisco; Jiménez-Díaz, Rufino; García-García, Pedro; Querol, Amparo; Garrido-Fernández, Antonio
2012-01-01
Yeasts play an important role in the food and beverage industry, especially in products such as bread, wine, and beer, among many others. However, their use as a starter in table olive processing has not yet been studied in detail. The candidate yeast strains should be able to dominate fermentation, together with lactic acid bacteria, but should also provide a number of beneficial advantages. Technologically, yeasts should resist low pH and high salt concentrations, produce desirable aromas, improve lactic acid bacteria growth, and inhibit spoilage microorganisms. Nowadays, they are being considered as probiotic agents because many species are able to resist the passage through the gastrointestinal tract and show favorable effects on the host. In this way, yeasts may improve the health of consumers by means of the degradation of non-assimilated compounds (such as phytate complexes), a decrease in cholesterol levels, the production of vitamins and antioxidants, the inhibition of pathogens, an adhesion to intestinal cell line Caco-2, and the maintenance of epithelial barrier integrity. Many yeast species, usually found in table olive processing (Wickerhamomyces anomalus, Saccharomyces cerevisiae, Pichia membranifaciens, and Kluyveromyces lactis, among others), have exhibited some of these properties. Thus, the selection of the most appropriate strains to be used as starters in this fermented vegetable, alone or in combination with lactic acid bacteria, is a promising research line to develop in the near future.
Potential benefits of the application of yeast starters in table olive processing
Arroyo-López, Francisco N.; Romero-Gil, Verónica; Bautista-Gallego, Joaquín; Rodríguez-Gómez, Francisco; Jiménez-Díaz, Rufino; García-García, Pedro; Querol, Amparo; Garrido-Fernández, Antonio
2012-01-01
Yeasts play an important role in the food and beverage industry, especially in products such as bread, wine, and beer, among many others. However, their use as a starter in table olive processing has not yet been studied in detail. The candidate yeast strains should be able to dominate fermentation, together with lactic acid bacteria, but should also provide a number of beneficial advantages. Technologically, yeasts should resist low pH and high salt concentrations, produce desirable aromas, improve lactic acid bacteria growth, and inhibit spoilage microorganisms. Nowadays, they are being considered as probiotic agents because many species are able to resist the passage through the gastrointestinal tract and show favorable effects on the host. In this way, yeasts may improve the health of consumers by means of the degradation of non-assimilated compounds (such as phytate complexes), a decrease in cholesterol levels, the production of vitamins and antioxidants, the inhibition of pathogens, an adhesion to intestinal cell line Caco-2, and the maintenance of epithelial barrier integrity. Many yeast species, usually found in table olive processing (Wickerhamomyces anomalus, Saccharomyces cerevisiae, Pichia membranifaciens, and Kluyveromyces lactis, among others), have exhibited some of these properties. Thus, the selection of the most appropriate strains to be used as starters in this fermented vegetable, alone or in combination with lactic acid bacteria, is a promising research line to develop in the near future.
ERIC Educational Resources Information Center
Woody, Daniel
2002-01-01
Offers a primer on toxic mold and its removal, warning against ignorant or unethical mold remediation companies and offering five considerations (checking references, considering the big picture, sampling more than the air, considering release, and considering the source) when hiring such services. (EV)
Mold pollution is the growth of molds in a building resulting in a negative impact on the use of that structure. The negative impacts generally fall into two categories: destruction of the structure itself and adverse health impacts on the building's occupants. It is estimated...
The effect of lactic acid bacteria on cocoa bean fermentation.
Ho, Van Thi Thuy; Zhao, Jian; Fleet, Graham
2015-07-16
Cocoa beans (Theobroma cacao L.) are the raw material for chocolate production. Fermentation of cocoa pulp by microorganisms is crucial for developing chocolate flavor precursors. Yeasts conduct an alcoholic fermentation within the bean pulp that is essential for the production of good quality beans, giving typical chocolate characters. However, the roles of bacteria such as lactic acid bacteria and acetic acid bacteria in contributing to the quality of cocoa bean and chocolate are not fully understood. Using controlled laboratory fermentations, this study investigated the contribution of lactic acid bacteria to cocoa bean fermentation. Cocoa beans were fermented under conditions where the growth of lactic acid bacteria was restricted by the use of nisin and lysozyme. The resultant microbial ecology, chemistry and chocolate quality of beans from these fermentations were compared with those of indigenous (control) fermentations. The yeasts Hanseniaspora guilliermondii, Pichia kudriavzevii, Kluyveromyces marxianus and Saccharomyces cerevisiae, the lactic acid bacteria Lactobacillus plantarum, Lactobacillus pentosus and Lactobacillus fermentum and the acetic acid bacteria Acetobacter pasteurianus and Gluconobacter frateurii were the major species found in control fermentations. In fermentations with the presence of nisin and lysozyme, the same species of yeasts and acetic acid bacteria grew but the growth of lactic acid bacteria was prevented or restricted. These beans underwent characteristic alcoholic fermentation where the utilization of sugars and the production of ethanol, organic acids and volatile compounds in the bean pulp and nibs were similar for beans fermented in the presence of lactic acid bacteria. Lactic acid was produced during both fermentations but more so when lactic acid bacteria grew. Beans fermented in the presence or absence of lactic acid bacteria were fully fermented, had similar shell weights and gave acceptable chocolates with no differences
... visit this page: About CDC.gov . Mold Cleanup & Remediation Homeowner’s and Renter’s Guide to Mold Cleanup After ... Home or Building with Mold Damage Prevention and Remediation Strategies for the Control and Removal of Fungal ...
Design of Revolute Joints for In-Mold Assembly Using Insert Molding.
Ananthanarayanan, Arvind; Ehrlich, Leicester; Desai, Jaydev P; Gupta, Satyandra K
2011-12-01
Creating highly articulated miniature structures requires assembling a large number of small parts. This is a very challenging task and increases cost of mechanical assemblies. Insert molding presents the possibility of creating a highly articulated structure in a single molding step. This can be accomplished by placing multiple metallic bearings in the mold and injecting plastic on top of them. In theory, this idea can generate a multi degree of freedom structures in just one processing step without requiring any post molding assembly operations. However, the polymer material has a tendency to shrink on top of the metal bearings and hence jam the joints. Hence, until now insert molding has not been used to create articulated structures. This paper presents a theoretical model for estimating the extent of joint jamming that occurs due to the shrinkage of the polymer on top of the metal bearings. The level of joint jamming is seen as the effective torque needed to overcome the friction in the revolute joints formed by insert molding. We then use this model to select the optimum design parameters which can be used to fabricate functional, highly articulating assemblies while meeting manufacturing constraints. Our analysis shows that the strength of weld-lines formed during the in-mold assembly process play a significant role in determining the minimum joint dimensions necessary for fabricating functional revolute joints. We have used the models and methods described in this paper to successfully fabricate the structure for a minimally invasive medical robot prototype with potential applications in neurosurgery. To the best of our knowledge, this is the first demonstration of building an articulated structure with multiple degrees of freedom using insert molding.
NASA Technical Reports Server (NTRS)
Bryant, Robert G. (Inventor); Namkung, Min (Inventor); Wincheski, Russell A. (Inventor); Fulton, James P. (Inventor); Fox, Robert L. (Inventor)
2000-01-01
A molded magnetic article and fabrication method are provided. Particles of ferromagnetic material embedded in a polymer binder are molded under heat and pressure into a geometric shape. Each particle is an oblate spheroid having a radius-to-thickness aspect ratio approximately in the range of 15-30. Each oblate spheroid has flattened poles that are substantially in perpendicular alignment to a direction of the molding pressure throughout the geometric shape.
Get a quick glimpse of some of the most important ways to protect your home from mold by this interactive tour of the Mold House. Room-by-room, you'll learn about common mold issues and how to address them.
Rea, Shane L.; Graham, Brett H.; Nakamaru-Ogiso, Eiko; Kar, Adwitiya; Falk, Marni J.
2013-01-01
The extensive conservation of mitochondrial structure, composition, and function across evolution offers a unique opportunity to expand our understanding of human mitochondrial biology and disease. By investigating the biology of much simpler model organisms, it is often possible to answer questions that are unreachable at the clinical level. Here, we review the relative utility of four different model organisms, namely the bacteria Escherichia coli, the yeast Saccharomyces cerevisiae, the nematode Caenorhabditis elegans and the fruit fly Drosophila melanogaster, in studying the role of mitochondrial proteins relevant to human disease. E. coli are single cell, prokaryotic bacteria that have proven to be a useful model system in which to investigate mitochondrial respiratory chain protein structure and function. S. cerevisiae is a single-celled eukaryote that can grow equally well by mitochondrial-dependent respiration or by ethanol fermentation, a property that has proven to be a veritable boon for investigating mitochondrial functionality. C. elegans is a multi-cellular, microscopic worm that is organized into five major tissues and has proven to be a robust model animal for in vitro and in vivo studies of primary respiratory chain dysfunction and its potential therapies in humans. Studied for over a century, D. melanogaster is a classic metazoan model system offering an abundance of genetic tools and reagents that facilitates investigations of mitochondrial biology using both forward and reverse genetics. The respective strengths and limitations of each species relative to mitochondrial studies are explored. In addition, an overview is provided of major discoveries made in mitochondrial biology in each of these four model systems. PMID:20818735
7 CFR 52.1008 - Absence of defects.
Code of Federal Regulations, 2012 CFR
2012-01-01
... MARKETING ACT OF 1946 PROCESSED FRUITS AND VEGETABLES, PROCESSED PRODUCTS THEREOF, AND CERTAIN OTHER PROCESSED FOOD PRODUCTS 1 United States Standards for Grades of Dates Factors of Quality § 52.1008 Absence... sugars into alcohol and acetic acid by yeasts and bacteria. (21) Affected by mold is the presence of...
7 CFR 52.1008 - Absence of defects.
Code of Federal Regulations, 2011 CFR
2011-01-01
... MARKETING ACT OF 1946 PROCESSED FRUITS AND VEGETABLES, PROCESSED PRODUCTS THEREOF, AND CERTAIN OTHER PROCESSED FOOD PRODUCTS 1 United States Standards for Grades of Dates Factors of Quality § 52.1008 Absence... sugars into alcohol and acetic acid by yeasts and bacteria. (21) Affected by mold is the presence of...
Microbiological quality and safety of cooking butter in Beni-Suef governorate-Egypt.
Meshref, A M S
2010-06-01
Cooking butter is one of the most popular types of fat consumed in Egyptian houses. It is produced in villages by rural women that are usually using their traditional knowledge during manufacturing. To study the rate of contamination and hygienic quality of cooking butter A total of 60 random samples of cooking butter, were collected from different farmers' houses in different villages, Beni-Suef Governorate, Egypt. Cooking butter samples were examined for psychrotrophic bacteria, total coliforms, faecal coliforms and molds and yeasts counts. Additionally examination for the presence of pathogenic bacteria like E.coli, S.aureus and Ps.aeruginosa were also performed. The microbiological examination revealed that 100, 100, 36.7, 31.7, 31.7 and 23.3% of the examined samples were contaminated by psychrotrophic bacteria, molds and yeasts, coliforms, faecal coliforms, E.coli and S.aureus, respectively. None of the examined cooking butter samples contained Ps.aeruginosa. The means values of sodium chloride and titratable acidity were 0.57 ± 0.05 % and 0.20 ± 0.013%, respectively. The present study showed that cooking butter is produced under unhygienic condition and without good manufacturing practice. The Public health significance and suggestive control measures are discussed.
Grinding technoloy of aspheric molds for glass-molding; Technical Digest
NASA Astrophysics Data System (ADS)
Kojima, Yoichi
2005-05-01
We introduce the method of precisely grinding of axis-symmetric aspherical glass-molding dies by using a diamond wheel. Those show how to select vertical-grinding or slant-grinding, how to grind molds with high accuracy and actual grinding results.
Irkin, Reyhan; Korukluoglu, Mihriban
2009-04-01
Food safety is a fundamental concern of both consumers and the food industry. The increasing incidence of foodborne diseases increases the demand of using antimicrobials in foods. Spices and plants are rich in essential oils and show inhibition activity against microorganisms, which are composed of many compounds. In this research, effects of garlic, bay, black pepper, origanum, orange, thyme, tea tree, mint, clove, and cumin essential oils on Listeria monocytogenes AUFE 39237, Escherichia coli ATCC 25922, Salmonella enteritidis ATCC 13076, Proteus mirabilis AUFE 43566, Bacillus cereus AUFE 81154, Saccharomyces uvarum UUFE 16732, Kloeckera apiculata UUFE 10628, Candida albicans ATCC 10231, Candida oleophila UUPP 94365, and Metschnikowia fructicola UUPP 23067 and effects of thyme oil at a concentration of 0.5% on L. monocytogenes and C. albicans in apple-carrot juice during +4 degrees C storage (first to fifth day) were investigated. Strong antibacterial and antifungal activities of some essential oils were found. Thyme, origanum, clove, and orange essential oils were the most inhibitory against bacteria and yeasts. Cumin, tea tree, and mint oils inhibited the yeasts actively. It is concluded that some essential oils could be used as potential biopreservatives capable of controlling foodborne pathogens and food spoilage yeasts.
Roose, L.D.
1996-12-10
Molds for use in making end moldings for high-voltage cables are described wherein the dielectric insulator of a cable is heated and molded to conform to a desired shape. As a consequence, high quality substantially bubble-free cable connectors suitable for mating to premanufactured fittings are made. 5 figs.
A new methodology to obtain wine yeast strains overproducing mannoproteins.
Quirós, Manuel; Gonzalez-Ramos, Daniel; Tabera, Laura; Gonzalez, Ramon
2010-04-30
Yeast mannoproteins are highly glycosylated proteins that are covalently bound to the beta-1,3-glucan present in the yeast cell wall. Among their outstanding enological properties, yeast mannoproteins contribute to several aspects of wine quality by protecting against protein haze, reducing astringency, retaining aroma compounds and stimulating growth of lactic-acid bacteria. The development of a non-recombinant method to obtain enological yeast strains overproducing mannoproteins would therefore be very useful. Our previous experience on the genetic determinants of the release of these molecules by Saccharomyces cerevisiae has allowed us to propose a new methodology to isolate and characterize wine yeast that overproduce mannoproteins. The described methodology is based on the resistance of the killer 9 toxin produced by Williopsis saturnus, a feature linked to an altered biogenesis of the yeast cell wall. Copyright 2010 Elsevier B.V. All rights reserved.
Bleach Neutralizes Mold Allergens
ERIC Educational Resources Information Center
Science Teacher, 2005
2005-01-01
Researchers at National Jewish Medical and Research Center have demonstrated that dilute bleach not only kills common household mold, but may also neutralize the mold allergens that cause most mold-related health complaints. The study, published in the Journal of Allergy and Clinical Immunology, is the first to test the effect on allergic…
Effecting aging time of epoxy molding compound to molding process for integrated circuit packaging
NASA Astrophysics Data System (ADS)
Tachapitunsuk, Jirayu; Ugsornrat, Kessararat; Srisuwitthanon, Warayoot; Thonglor, Panakamon
2017-09-01
This research studied about effecting aging time of epoxy molding compound (EMC) that effect to reliability performance of integrated circuit (IC) package in molding process. Molding process is so important of IC packaging process for protecting IC chip (or die) from temperature and humidity environment using encapsulated EMC. For general molding process, EMC are stored in the frozen at 5°C and left at room temperature at 25 °C for aging time on self before molding of die onto lead frame is 24 hours. The aging time effect to reliability performance of IC package due to different temperature and humidity inside the package. In experiment, aging time of EMC were varied from 0 to 24 hours for molding process of SOIC-8L packages. For analysis, these packages were tested by x-ray and scanning acoustic microscope to analyze properties of EMC with an aging time and also analyzed delamination, internal void, and wire sweep inside the packages with different aging time. The results revealed that different aging time of EMC effect to properties and reliability performance of molding process.
Microbiological and fermentative properties of baker's yeast starter used in breadmaking.
Reale, A; Di Renzo, T; Succi, M; Tremonte, P; Coppola, R; Sorrentino, E
2013-08-01
This study assessed the levels of microbial contaminants in liquid, compressed and dry commercial baker's yeasts used as starters in breadmaking. Eumycetes, Enterobacteriaceae, total and fecal coliforms, Bacillus spp., and lactic acid bacteria (LAB), in particular enterococci, were quantified. Results obtained in this study highlighted that baker's yeast could represent a potential vehicle of spoilage and undesirable microorganisms into the baking environment, even if these do not influence the leavening activity in the dough, as ascertained by rheofermentometer analysis. Different microbial groups, such as spore-forming bacteria and moulds, were found in baker's yeast starters. Moreover, different species of LAB, which are considered the main contaminants in large-scale yeast fermentations, were isolated and identified by Denaturing Gradient Gel Electrophoresis (DGGE) and 16S rDNA sequencing. The most recurrent species were Lactobacillus plantarum, Enterococcus faecalis, and Enterococcus durans, isolated from both compressed and dry starters, whereas strains belonging to Leuconostoc and Pediococcus genera were found only in dry ones. Nested-Polymerase Chain Reaction (Nested-PCR) and Randomly Amplified Polymorphic DNA-PCR (RAPD-PCR) were also used to highlight the biodiversity of the different commercial yeast strains, and to ascertain the culture purity. © 2013 Institute of Food Technologists®
Staged mold for encapsulating hazardous wastes
Unger, Samuel L.; Telles, Rodney W.; Lubowitz, Hyman R.
1990-01-01
A staged mold for stabilizing hazardous wastes for final disposal by molding an agglomerate of the hazardous wastes and encapsulating the agglomerate. Three stages are employed in the process. In the first stage, a first mold body is positioned on a first mold base, a mixture of the hazardous wastes and a thermosetting plastic is loaded into the mold, the mixture is mechanically compressed, heat is applied to cure the mixture to form a rigid agglomerate, and the first mold body is removed leaving the agglomerate sitting on the first mold base. In the second stage, a clamshell second mold body is positioned around the agglomerate and the first mold base, a powdered thermoplastic resin is poured on top of the agglomerate and in the gap between the sides of the agglomerate and the second mold body, the thermoplastic is compressed, heat is applied to melt the thermoplastic, and the plastic is cooled jacketing the agglomerate on the top and sides. In the third stage, the mold with the jacketed agglomerate is inverted, the first mold base is removed exposing the former bottom of the agglomerate, powdered thermoplastic is poured over the former bottom, the first mold base is replaced to compress the thermoplastic, heat is applied to melt the new thermoplastic and the top part of the jacket on the sides, the plastic is cooled jacketing the bottom and fusing with the jacketing on the sides to complete the seamless encapsulation of the agglomerate.
Staged mold for encapsulating hazardous wastes
Unger, Samuel L.; Telles, Rodney W.; Lubowitz, Hyman R.
1988-01-01
A staged mold for stabilizing hazardous wastes for final disposal by molding an agglomerate of the hazardous wastes and encapsulating the agglomerate. Three stages are employed in the process. In the first stage, a first mold body is positioned on a first mold base, a mixture of the hazardous wastes and a thermosetting plastic is loaded into the mold, the mixture is mechanically compressed, heat is applied to cure the mixture to form a rigid agglomerate, and the first mold body is removed leaving the agglomerate sitting on the first mold base. In the second stage, a clamshell second mold body is positioned around the agglomerate and the first mold base, a powdered thermoplastic resin is poured on top of the agglomerate and in the gap between the sides of the agglomerate and the second mold body, the thermoplastic is compressed, heat is applied to melt the thermoplastic, and the plastic is cooled jacketing the agglomerate on the top and sides. In the third stage, the mold with the jacketed agglomerate is inverted, the first mold base is removed exposing the former bottom of the agglomerate, powdered thermoplastic is poured over the former bottom, the first mold base is replaced to compress the thermoplastic, heat is applied to melt the new thermoplastic and the top part of the jacket on the sides, the plastic is cooled jacketing the bottom and fusing with the jacketing on the sides to complete the seamless encapsulation of the agglomerate.
Nectar yeasts: a natural microcosm for ecology.
Chappell, Callie R; Fukami, Tadashi
2018-06-01
The species of yeasts that colonize floral nectar can modify the mutualistic relationships between plants and pollinators by changing the chemical properties of nectar. Recent evidence supporting this possibility has led to increased interest among ecologists in studying these fungi as well as the bacteria that interact with them in nectar. Although not fully explored, nectar yeasts also constitute a promising natural microcosm that can be used to facilitate development of general ecological theory. We discuss the methodological and conceptual advantages of using nectar yeasts from this perspective, including simplicity of communities, tractability of dispersal, replicability of community assembly, and the ease with which the mechanisms of species interactions can be studied in complementary experiments conducted in the field and the laboratory. To illustrate the power of nectar yeasts as a study system, we discuss several topics in community ecology, including environmental filtering, priority effects, and metacommunity dynamics. An exciting new direction is to integrate metagenomics and comparative genomics into nectar yeast research to address these fundamental ecological topics. Copyright © 2018 John Wiley & Sons, Ltd.
There is growing awareness that indoor molds/fungi may be connected to such conditions as asthma, allergies, hemorrhaging, chronic rhinosinusitis, memory loss, and a symptom complex called sick-building-syndrome. In addition, molds cause frequently fatal nosocomical infections. ...
Saito, T; Ochiai, H
1999-10-01
cDNA fragments putatively encoding amino acid sequences characteristic of the fatty acid desaturase were obtained using expressed sequence tag (EST) information of the Dictyostelium cDNA project. Using this sequence, we have determined the cDNA sequence and genomic sequence of a desaturase. The cloned cDNA is 1489 nucleotides long and the deduced amino acid sequence comprised 464 amino acid residues containing an N-terminal cytochrome b5 domain. The whole sequence was 38.6% identical to the initially identified Delta5-desaturase of Mortierella alpina. We have confirmed its function as Delta5-desaturase by over expression mutation in D. discoideum and also the gain of function mutation in the yeast Saccharomyces cerevisiae. Analysis of the lipids from transformed D. discoideum and yeast demonstrated the accumulation of Delta5-desaturated products. This is the first report concering fatty acid desaturase in cellular slime molds.
Thermophilic molds: Biology and applications.
Singh, Bijender; Poças-Fonseca, Marcio J; Johri, B N; Satyanarayana, Tulasi
2016-11-01
Thermophilic molds thrive in a variety of natural habitats including soils, composts, wood chip piles, nesting materials of birds and other animals, municipal refuse and others, and ubiquitous in their distribution. These molds grow in simple media containing carbon and nitrogen sources and mineral salts. Polyamines are synthesized in these molds and the composition of lipids varies considerably, predominantly containing palmitic, oleic and linoleic acids with low levels of lauric, palmiotoleic and stearic acids. Thermophilic molds are capable of efficiently degrading organic materials by secreting thermostable enzymes, which are useful in the bioremediation of industrial wastes and effluents that are rich in oil, heavy metals, anti-nutritional factors such as phytic acid and polysaccharides. Thermophilic molds synthesize several antimicrobial substances and biotechnologically useful miscellaneous enzymes. The analysis of genomes of thermophilic molds reveals high G:C contents, shorter introns and intergenic regions with lesser repetitive sequences, and further confirms their ability to degrade agro-residues efficiently. Genetic engineering has aided in ameliorating the characteristics of the enzymes of thermophilic molds. This review is aimed at focusing on the biology of thermophilic molds with emphasis on recent developments in the analysis of genomes, genetic engineering and potential applications.
Antimicrobial activity of some Pacific Northwest woods against anaerobic bacteria and yeast.
Johnston, W H; Karchesy, J J; Constantine, G H; Craig, A M
2001-11-01
Extracts of woods commonly used for animal bedding were tested for antimicrobial activity. Essential oils from Alaska cedar (Chamaecyparis nootkatensis), western juniper (Juniperus occidentalis) and old growth Douglas fir (Pseudotsuga menziesii) as well as methanol extracts of wood from these trees plus western red cedar (Thuja plicata) and ponderosa pine (Pinus ponderosa) were tested for antimicrobial activity against anaerobic bacteria and yeast. The test microbes included Fusobacterium necrophorum, Clostridium perfringens, Actinomyces bovis and Candida albicans which are common to foot diseases and other infections in animals. The essential oils and methanol extracts were tested using a standardized broth assay. Only extracts of Alaska cedar and western juniper showed significant antimicrobial activity against each of the microbes tested. The essential oil of Douglas fir did show antimicrobial activity against A. bovis at the concentrations tested. The methanol extracts of the heartwood of Douglas fir and the sapwood of ponderosa pine showed no antimicrobial activity. The major chemical components of western juniper (cedrol and alpha- and beta-cedrene) and Alaska cedar (nootkatin) were also tested. In western juniper, alpha- and beta-cedrene were found to be active components. Nootkatin showed activity only against C. albicans. The inhibitory activity in Alaska cedar oil was high enough to justify further efforts to define the other chemical components responsible for the antimicrobial activity. Copyright 2001 John Wiley & Sons, Ltd.
MOLD SPECIFIC QUANTITATIVE PCR: THE EMERGING STANDARD IN MOLD ANALYSIS
Today I will talk about the use of quantitative or Real time PCR for the standardized identification and quantification of molds. There are probably at least 100,000 species of molds or fungi. But there are actually about 100 typically found indoors. Some pose a threat to human...
Garofalo, C; Silvestri, G; Aquilanti, L; Clementi, F
2008-07-01
To study lactic acid bacteria (LAB) and yeast dynamics during the production processes of sweet-leavened goods manufactured with type I sourdoughs. Fourteen sourdough and dough samples were taken from a baking company in central Italy during the production lines of three varieties of Panettone. The samples underwent pH measurements and plating analysis on three solid media. The microbial DNA was extracted from both the (sour)doughs and the viable LAB and yeast cells collected in bulk, and subjected to PCR-denaturing gradient gel electrophoresis (DGGE) analysis. The molecular fingerprinting of the cultivable plus noncultivable microbial populations provide evidence of the dominance of Lactobacillus sanfranciscensis, Lactobacillus brevis and Candida humilis in the three fermentation processes. The DGGE profiles of the cultivable communities reveal a bacterial shift in the final stages of two of the production processes, suggesting an effect of technological parameters on the selection of the dough microflora. Our findings confirm the importance of using a combined analytical approach to explore microbial communities that develop during the leavening process of sweet-leavened goods. In-depth studies of sourdough biodiversity and population dynamics occurring during sourdough fermentation are fundamental for the control of the leavening process and the manufacture of standardized, high-quality products.
Mold Allergy: Proper Humidifier Care
... Training Home Conditions Allergy Allergy Overview Allergy Allergens Mold Allergy Proper Humidifier Care Proper Humidifier Care Make ... neglected humidifier can be a major source of mold and mold spores. Learn how to keep a ...
Fungi in Ontario maple syrup & some factors that determine the presence of mold damage.
Frasz, Samantha L; Miller, J David
2015-08-17
Maple syrup is a high value artisanal product produced mainly in Canada and a number of States primarily in the northeast USA. Mold growth (Wallemia sebi) on commercial product was first reported in syrup in 1908. Since then, few data have been published. We conducted a systematic examination for fungi in maple syrup from 68 producers from all of the syrup-producing areas of Ontario, Canada. The mean pH of the samples was pH 6.82, sugar content averaged 68.0±0.89 °Brix and aw averaged 0.841±0.011. Some 23 species of fungi were isolated based on morphology and molecular techniques. The most common fungus in the maple syrup samples was Eurotium herbariorum, followed by Penicillium chrysogenum, Aspergillus penicillioides, Aspergillus restrictus, Aspergillus versicolor and two species of Wallemia. Cladosporium cladosporioides was also common but only recovered when fungi known from high sugar substrates were also present in the mold damaged sample. The rarely reported yeast Citeromyces matrinsis was found in samples from three producers. There appear to be three potential causes for mold damage observed. High aw was associated with about one third of the mold damage. Independently, cold packing (bottling at ~25 °C) was a risk factor. However, syrup of good quality and quite low aw values was contaminated. We hypothesize that sanitation in the bottling line and other aspects of the bottling process may be partial explanations. Clarifying this requires further study. Copyright © 2015 Elsevier B.V. All rights reserved.
Allergy and "toxic mold syndrome".
Edmondson, David A; Nordness, Mark E; Zacharisen, Michael C; Kurup, Viswanath P; Fink, Jordan N
2005-02-01
"Toxic mold syndrome" is a controversial diagnosis associated with exposure to mold-contaminated environments. Molds are known to induce asthma and allergic rhinitis through IgE-mediated mechanisms, to cause hypersensitivity pneumonitis through other immune mechanisms, and to cause life-threatening primary and secondary infections in immunocompromised patients. Mold metabolites may be irritants and may be involved in "sick building syndrome." Patients with environmental mold exposure have presented with atypical constitutional and systemic symptoms, associating those symptoms with the contaminated environment. To characterize the clinical features and possible etiology of symptoms in patients with chief complaints related to mold exposure. Review of patients presenting to an allergy and asthma center with the chief complaint of toxic mold exposure. Symptoms were recorded, and physical examinations, skin prick/puncture tests, and intracutaneous tests were performed. A total of 65 individuals aged 1 1/2 to 52 years were studied. Symptoms included rhinitis (62%), cough (52%), headache (34%), respiratory symptoms (34%), central nervous system symptoms (25%), and fatigue (23%). Physical examination revealed pale nasal mucosa, pharyngeal "cobblestoning," and rhinorrhea. Fifty-three percent (33/62) of the patients had skin reactions to molds. Mold-exposed patients can present with a variety of IgE- and non-IgE-mediated symptoms. Mycotoxins, irritation by spores, or metabolites may be culprits in non-IgE presentations; environmental assays have not been perfected. Symptoms attributable to the toxic effects of molds and not attributable to IgE or other immune mechanisms need further evaluation as to pathogenesis. Allergic, rather than toxic, responses seemed to be the major cause of symptoms in the studied group.
Molding process for imidazopyrrolone polymers
NASA Technical Reports Server (NTRS)
Johnson, C. L. (Inventor)
1973-01-01
A process is described for producing shaped articles of imidazopyrrolone polymers comprising molding imidazopyrrolone polymer molding power under pressure and at a temperature greater than 475 C. Moderate pressures may be employed. Preferably, prior to molding, a preform is prepared by isostatic compression. The preform may be molded at a relatively low initial pressure and temperature; as the temperature is increased to a value greater than 475 C., the pressure is also increased.
Creating mold-free buildings: a key to avoiding health effects of indoor molds.
Small, Bruce M
2003-08-01
In view of the high costs of building diagnostics and repair subsequent to water damage--as well as the large medical diagnostic and healthcare costs associated with mold growth in buildings--commitment to a philosophy of proactive preventive maintenance for home, apartment, school, and commercial buildings could result in considerable cost savings and avoidance of major health problems among building occupants. The author identifies common causes of mold growth in buildings and summarizes key building design and construction principles essential for preventing mold contamination indoors. Physicians and healthcare workers must be made aware of conditions within buildings that can give rise to mold growth, and of resulting health problems. Timely advice provided to patients already sensitized by exposure to molds could save these individuals, and their families, from further exposures as a result of inadequate building maintenance or an inappropriate choice of replacement housing.
Sawada, Kazutaka; Sato, Tomoya; Hamajima, Hiroshi; Jayakody, Lahiru Niroshan; Hirata, Miyo; Yamashiro, Mikako; Tajima, Marie; Mitsutake, Susumu; Nagao, Koji; Tsuge, Keisuke; Abe, Fumiyoshi; Hanada, Kentaro
2015-01-01
In nature, different microorganisms create communities through their physiochemical and metabolic interactions. Many fermenting microbes, such as yeasts, lactic acid bacteria, and acetic acid bacteria, secrete acidic substances and grow faster at acidic pH values. However, on the surface of cereals, the pH is neutral to alkaline. Therefore, in order to grow on cereals, microbes must adapt to the alkaline environment at the initial stage of colonization; such adaptations are also crucial for industrial fermentation. Here, we show that the yeast Saccharomyces cerevisiae, which is incapable of synthesizing glucosylceramide (GlcCer), adapted to alkaline conditions after exposure to GlcCer from koji cereal cultured with Aspergillus kawachii. We also show that various species of GlcCer derived from different plants and fungi similarly conferred alkali tolerance to yeast. Although exogenous ceramide also enhanced the alkali tolerance of yeast, no discernible degradation of GlcCer to ceramide was observed in the yeast culture, suggesting that exogenous GlcCer itself exerted the activity. Exogenous GlcCer also increased ethanol tolerance and modified the flavor profile of the yeast cells by altering the membrane properties. These results indicate that GlcCer from A. kawachii modifies the physiology of the yeast S. cerevisiae and demonstrate a new mechanism for cooperation between microbes in food fermentation. PMID:25795678
Traditional environmental mold analysis is based-on microscopic observations and counting of mold structures collected from the air on a sticky surface or culturing of molds on growth media for identification and quantification. A DNA-based method of mold analysis called mol...
A polyphasic study on the taxonomic position of industrial sour dough yeasts.
Mäntynen, V H; Korhola, M; Gudmundsson, H; Turakainen, H; Alfredsson, G A; Salovaara, H; Lindström, K
1999-02-01
The sour dough bread making process is extensively used to produce wholesome palatable rye bread. The process is traditionally done using a back-slopping procedure. Traditional sour doughs in Finland comprise of lactic acid bacteria and yeasts. The yeasts present in these doughs have been enriched in the doughs due to their metabolic activities, e.g. acid tolerance. We characterized the yeasts in five major sour bread bakeries in Finland. We found that most of the commercial sour doughs contained yeasts which were similar to Candida milleri on the basis of 18S rDNA and EF-3 PCR-RFLP patterns and metabolic activities. Some of the bakery yeasts exhibited extensive karyotype polymorphism. The minimum growth temperature was 8 degrees C for C. milleri and also for most of sour dough yeasts.
Computer-aided injection molding system
NASA Astrophysics Data System (ADS)
Wang, K. K.; Shen, S. F.; Cohen, C.; Hieber, C. A.; Isayev, A. I.
1982-10-01
Achievements are reported in cavity-filling simulation, modeling viscoelastic effects, measuring and predicting frozen-in birefringence in molded parts, measuring residual stresses and associated mechanical properties of molded parts, and developing an interactive mold-assembly design program and an automatic NC maching data generation and verification program. The Cornell Injection Molding Program (CIMP) consortium is discussed as are computer user manuals that have been published by the consortium. Major tasks which should be addressed in future efforts are listed, including: (1) predict and experimentally determine the post-fillin behavior of thermoplastics; (2) simulate and experimentally investigate the injection molding of thermosets and filled materials; and (3) further investigate residual stresses, orientation and mechanical properties.
Effects of mold geometry on fiber orientation of powder injection molded metal matrix composites
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahmad, Faiz, E-mail: faizahmad@petronas.com.my; Aslam, Muhammad, E-mail: klaira73@gmail.com; Altaf, Khurram, E-mail: khurram.altaf@petronas.com.my
2015-07-22
Fiber orientations in metal matrix composites have significant effect on improving tensile properties. Control of fiber orientations in metal injection molded metal composites is a difficult task. In this study, two mold cavities of dimensions 6x6x90 mm and 10x20x180 mm were used for comparison of fiber orientation in injection molded metal composites test parts. In both mold cavities, convergent and divergent flows were developed by modifying the sprue dimensions. Scanning electron microscope (SEM) was used to examine the fiber orientations within the test samples. The results showed highly aligned fiber in injection molded test bars developed from the convergent melt flow. Randommore » orientation of fibers was noted in the composites test bars produced from divergent melt flow.« less
Robison, Nathan E; Tantbirojn, Daranee; Versluis, Antheunis; Cagna, David R
2016-08-01
Denture tooth fracture or debonding remains a common problem in removable prosthodontics. The purpose of this in vitro study was to explore factors determining failure strengths for combinations of different denture tooth designs (shape, materials) and injection or compression molded denture base resins. Three central incisor denture tooth designs were tested: nanohybrid composite (NHC; Ivoclar Phonares II), interpenetrating network (IPN; Dentsply Portrait), and microfiller reinforced polyacrylic (MRP; VITA Physiodens). Denture teeth of each type were processed on an injection molded resin (IvoBase HI; Ivoclar Vivadent AG) or a compression molded resin (Lucitone 199; Dentsply Intl) (n=11 or 12). The denture teeth were loaded at 45 degrees on the incisal edge. The failure load was recorded and analyzed with 2-way ANOVA (α=.05), and the fracture mode was categorized from observed fracture surfaces as cohesive, adhesive, or mixed failure. The following failure loads (mean ±SD) were recorded: NHC/injection molded 280 ±52 N; IPN/injection molded 331 ±41 N; MRP/injection molded 247 ±23 N; NHC/compression molded 204 ±31 N; IPN/compression molded 184 ±17 N; MRP/compression molded 201 ±16 N. Injection molded resin yielded significantly higher failure strength for all denture teeth (P<.001), among which IPN had the highest strength. Failure was predominantly cohesive in the teeth, with the exception of mixed mode for the IPN/compression group. When good bonding was achieved, the strength of the structure (denture tooth/base resin combination) was determined by the strength of the denture teeth, which may be affected by the processing technique. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.
Pyrotechnic filled molding powder
Hartzel, Lawrence W.; Kettling, George E.
1978-01-01
The disclosure relates to thermosetting molding compounds and more particularly to a pyrotechnic filled thermosetting compound comprising a blend of unfilled diallyl phthalate molding powder and a pyrotechnic mixture.
Living bacteria in silica gels
NASA Astrophysics Data System (ADS)
Nassif, Nadine; Bouvet, Odile; Noelle Rager, Marie; Roux, Cécile; Coradin, Thibaud; Livage, Jacques
2002-09-01
The encapsulation of enzymes within silica gels has been extensively studied during the past decade for the design of biosensors and bioreactors. Yeast spores and bacteria have also been recently immobilized within silica gels where they retain their enzymatic activity, but the problem of the long-term viability of whole cells in an inorganic matrix has never been fully addressed. It is a real challenge for the development of sol-gel processes. Generic tests have been performed to check the viability of Escherichia coli bacteria in silica gels. Surprisingly, more bacteria remain culturable in the gel than in an aqueous suspension. The metabolic activity of the bacteria towards glycolysis decreases slowly, but half of the bacteria are still viable after one month. When confined within a mineral environment, bacteria do not form colonies. The exchange of chemical signals between isolated bacteria rather than aggregates can then be studied, a point that could be very important for 'quorum sensing'.
Mixed-species biofilm formation by lactic acid bacteria and rice wine yeasts.
Kawarai, Taketo; Furukawa, Soichi; Ogihara, Hirokazu; Yamasaki, Makari
2007-07-01
We found that species combinations such as Lactobacillus casei subsp. rhamnosus IFO3831 and Saccharomyces cerevisiae Kyokai-10 can form a mixed-species biofilm in coculture. Moreover, the Kyokai-10 yeast strain can form a biofilm in monoculture in the presence of conditioned medium (CM) from L. casei IFO3831. The active substance(s) in bacterial CM is heat sensitive and has a molecular mass of between 3 and 5 kDa. In biofilms from cocultures or CM monocultures, yeast cells had a distinct morphology, with many hill-like protrusions on the cell surface.
Liu, Jia; Li, Guangkun; Sui, Yuan
2017-01-01
Viable biomass production is a key determinant of suitability of antagonistic yeasts as potential biocontrol agents. This study investigated the effects of three metal ions (magnesium, ferrous, and zinc) on biomass production and viability of the antagonistic yeast, Candida diversa . Using response surface methodology to optimize medium components, a maximum biomass was obtained, when the collective Mg 2+ , Fe 2+ , and Zn 2+ concentrations were adjusted in a minimal mineral (MM) medium. Compared with the unmodified MM, and three ion-deficient MM media, yeast cells cultured in the three ion-modified MM medium exhibited a lower level of cellular oxidative damage, and a higher level of antioxidant enzyme activity. A biocontrol assay indicated that C. diversa grown in the ion-modified MM exhibited the greatest level of control of gray mold on apple fruit. These results provide new information on culture medium optimization to grow yeast antagonists in order to improve biomass production and biocontrol efficacy.
Liu, Jia; Li, Guangkun; Sui, Yuan
2017-01-01
Viable biomass production is a key determinant of suitability of antagonistic yeasts as potential biocontrol agents. This study investigated the effects of three metal ions (magnesium, ferrous, and zinc) on biomass production and viability of the antagonistic yeast, Candida diversa. Using response surface methodology to optimize medium components, a maximum biomass was obtained, when the collective Mg2+, Fe2+, and Zn2+ concentrations were adjusted in a minimal mineral (MM) medium. Compared with the unmodified MM, and three ion-deficient MM media, yeast cells cultured in the three ion-modified MM medium exhibited a lower level of cellular oxidative damage, and a higher level of antioxidant enzyme activity. A biocontrol assay indicated that C. diversa grown in the ion-modified MM exhibited the greatest level of control of gray mold on apple fruit. These results provide new information on culture medium optimization to grow yeast antagonists in order to improve biomass production and biocontrol efficacy. PMID:29089939
ILLUSTRATED HANDBOOK OF SOME COMMON MOLDS.
ERIC Educational Resources Information Center
CHANDLER, MARION N.
THIS DOCUMENT IS A PICTURE GUIDE FOR THE IDENTIFICATION OF TEN COMMON MOLDS. IT IS DESIGNED FOR USE WITH THE ELEMENTARY SCIENCE STUDY UNIT "MICROGARDENING" AND IS SUGGESTED FOR UPPER ELEMENTARY GRADES. INCLUDED FOR EACH MOLD ARE COLOR PHOTOGRAPHS AND PHOTOMICROGRAPHS OF THE INTACT MOLD MASS AND OF THE MOLD'S SPORE PRODUCING STRUCTURES.…
21 CFR 133.184 - Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 21 Food and Drugs 2 2012-04-01 2012-04-01 false Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk. 133.184 Section 133.184 Food and Drugs FOOD AND DRUG ADMINISTRATION..., sheep's milk blue-mold, and blue-mold cheese from sheep's milk. (a) Description. (1) Roquefort cheese...
21 CFR 133.184 - Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 2 2014-04-01 2014-04-01 false Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk. 133.184 Section 133.184 Food and Drugs FOOD AND DRUG ADMINISTRATION..., sheep's milk blue-mold, and blue-mold cheese from sheep's milk. (a) Description. (1) Roquefort cheese...
21 CFR 133.184 - Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 2 2013-04-01 2013-04-01 false Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk. 133.184 Section 133.184 Food and Drugs FOOD AND DRUG ADMINISTRATION..., sheep's milk blue-mold, and blue-mold cheese from sheep's milk. (a) Description. (1) Roquefort cheese...
Enteridinines A and B from slime mold Enteridium lycoperdon.
Rezanka, Tomás; Dvoráková, Radmila; Hanus, Lumír O; Dembitsky, Valery M
2004-02-01
Two novel deoxysugar esters, named enteridinines A and B, were isolated from the slime mold Enteridium lycoperdon. Their structures, including the absolute configurations of the hydroxyl and methyl groups, were determined by means of extensive spectroscopic data such as UV, IR, MS, 1D and 2D NMR spectra. Enteridinines A and B have unique structures containing 1,7-dioxaspiro[5.5]undecanes with an O-beta-D-mycarosyl-(1-->4)-beta-D-olivosyl and an O-beta-L-olivomycosyl-(1-->4)-beta-D-amicetosyl-(1-->4)-beta-L-digitoxosyl unit, respectively, and showed growth inhibitory activities against Gram positive bacteria.
Mathematical modeling of the process of filling a mold during injection molding of ceramic products
NASA Astrophysics Data System (ADS)
Kulkov, S. N.; Korobenkov, M. V.; Bragin, N. A.
2015-10-01
Using the software package Fluent it have been predicted of the filling of a mold in injection molding of ceramic products is of great importance, because the strength of the final product is directly related to the presence of voids in the molding, making possible early prediction of inaccuracies in the mold prior to manufacturing. The calculations were performed in the formulation of mathematical modeling of hydrodynamic turbulent process of filling a predetermined volume of a viscous liquid. The model used to determine the filling forms evaluated the influence of density and viscosity of the feedstock, and the injection pressure on the mold filling process to predict the formation of voids in the area caused by the shape defect geometry.
Mold growth may be a problem after flooding. Excess moisture in the home is cause for concern about indoor air quality primarily because it provides breeding conditions for pests, molds and other microorganisms.
Park, Yoen Ju; Chen, Jinru
2009-12-01
This study was undertaken to evaluate the microbial quality of the soft drinks served by fast food restaurants and gas station convenience stores in Griffin, GA, and surrounding areas. The soft drinks were collected from the dispensing machines in 8 fast food restaurants or gas station convenience stores in 2005 (n = 25) and in 10 fast food restaurants or gas station convenience stores in 2006 (n = 43) and 2007 (n = 43). One hundred milliliters of each soft drink was filtered through a hydrophobic grid membrane filter. The remaining portion of the soft drink was kept at room temperature for 4 h before sampling in order to mimic the possible holding time between purchase and consumption. The membrane filters were sampled for total aerobic bacteria, Enterobacteriaceae, lactic acid bacteria, and yeasts and molds. The microbial counts in the 2006 samples were numerically higher than the counts in the 2007 samples except for the average lactic acid bacteria counts, and were either significantly or numerically higher than the counts in the 2005 samples. Soft drinks sampled after the 4-h holding period had relatively higher counts than those sampled initially, with a few exceptions. Some soft drinks had over 4 log CFU/100 ml of total aerobic bacteria, Enterobacteriaceae, lactic acid bacteria, and yeast and mold cells. The study revealed the microbial quality of soft drinks served by dispensing machines in Griffin, GA, and surrounding areas, emphasizing the importance of effective sanitizing practice in retail settings.
Phillips, Christie A; Harrison, Mark A
2005-06-01
Considerable speculation has occurred concerning the potential for higher numbers of foodborne pathogens on organically grown produce compared with produce not grown organically. The microflora composition of spring mix or mesclun, a mixture of multiple salad ingredients, grown either by organic or conventional means was determined. Unwashed or washed spring mix was obtained from a commercial California fresh-cut produce processor who does not use manure in their cultivation practices. Fifty-four samples of each type of product were supplied over a 4-month period. Analysis included enumeration of total mesophiles, psychrotrophs, coliforms, generic Escherichia coli, lactic acid bacteria, yeasts, and molds. In addition, spring mix was analyzed for the presence of Salmonella and Listeria monocytogenes. The mean populations of mesophilic and psychrotrophic bacteria, yeasts, molds, lactic acid bacteria, and coliforms on conventionally grown spring mix were not statistically different (P > 0.05) from respective mean populations on organically grown spring mix. The mean population of each microbial group was significantly higher on unwashed spring mix compared with the washed product. Of the 14 samples found to contain E. coli, eight were from nonwashed conventional spring mix, one was from washed conventional spring mix, and four were from nonwashed organic spring mix. Salmonella and L. monocytogenes were not detected in any of the samples analyzed.
Pokala, Hanumantha R.; Leonard, David; Cox, Jennifer; Metcalf, Pat; McClay, John; Siegel, Jane; Winick, Naomi
2014-01-01
Background Healthcare associated mold infections (HAEMI) increase morbidity and mortality in children with leukemia. Excavation adjacent to Children’s Medical Center Dallas (CMCD) April 2006–February 2007 provided an opportunity to determine if excavation adjacent to a hospital building is associated with increased risk of developing HAEMI in children receiving intensive chemotherapy for acute leukemia. Methods Children who began receiving intensive chemotherapy for acute leukemia at CMCD from 2004–2008 were identified (N=275). Exposures to the CMCD campus during intensive chemotherapy and duration of neutropenia per exposure were recorded. Proven, probable or possible invasive fungal disease (IFD) was classified using EORTC/MSG guidelines. Institutional guidelines categorized mold infections as definite or possible HAEMI. A bivariate time-to-event model compared the association of excavation with HAEMI and yeast infections, controlling for neutropenia. Results There were 7454 CMCD exposures, 1007(13.5%) during excavation. Of 50 cases of IFD, 31 were HAEMI. By time-to-event analysis exposure to the CMCD campus during the excavation period was significantly associated with HAEMI (HR=2.8, P=0.01) but not yeast infections (HR=0.75, P=0.75). Neutropenia was significantly associated with both HAEMI and yeast infections (P<0.001). Voriconazole prophylaxis did not prevent HAEMI in 42% of the 14 patients with AML who had been receiving this agent. Conclusion This study is the first to demonstrate an association between exposure to hospital construction that includes excavation and HAEMI in pediatric oncology patients. Since neutropenic patients need protection from aerosolized fungal spores during visits to expanding medical centers, preventive strategies with adherence monitoring need additional study. PMID:23970381
Environmental Sustainability and Mold Hygiene in Buildings
Ng, Tsz Wai; Lai, Ka Man
2018-01-01
Environmental sustainability is one of the key issues in building management. In Hong Kong, one of the initiatives is to reduce the operation hours of air-conditioning in buildings to cut down energy consumption. In this study, we reported a mold contamination case in a newly refurbished laboratory, in which the air-conditioner was switched from 24- to 18-h mode after refurbishment. In order to prevent mold recurrence, the air-conditioner was switched back to 24-h mode in the laboratory. During the mold investigation, visible mold patches in the laboratory were searched and then cultured, counted and identified. Building and environmental conditions were recorded, and used to deduce different causes of mold contamination. Eight contaminated sites including a wall, a bench, some metal and plastic surfaces and seven types of molds including two Cladosporium spp., two Aspergillus spp., one Rhizopus sp., one Trichoderma sp., and one Tritirachium sp. were identified. Cladosporium spp. were the most abundant and frequently found molds in the laboratory. The contaminated areas could have one to five different species on them. Based on the mold and environmental conditions, several scenarios causing the mold contamination were deduced, and different mold control measures were discussed to compare them with the current solution of using 24-h air-conditioning to control mold growth. This study highlights the importance of mold hygiene in sustainable building management. PMID:29617339
Environmental Sustainability and Mold Hygiene in Buildings.
Wu, Haoxiang; Ng, Tsz Wai; Wong, Jonathan Wc; Lai, Ka Man
2018-04-04
Environmental sustainability is one of the key issues in building management. In Hong Kong, one of the initiatives is to reduce the operation hours of air-conditioning in buildings to cut down energy consumption. In this study, we reported a mold contamination case in a newly refurbished laboratory, in which the air-conditioner was switched from 24- to 18-h mode after refurbishment. In order to prevent mold recurrence, the air-conditioner was switched back to 24-h mode in the laboratory. During the mold investigation, visible mold patches in the laboratory were searched and then cultured, counted and identified. Building and environmental conditions were recorded, and used to deduce different causes of mold contamination. Eight contaminated sites including a wall, a bench, some metal and plastic surfaces and seven types of molds including two Cladosporium spp., two Aspergillus spp., one Rhizopus sp., one Trichoderma sp., and one Tritirachium sp. were identified. Cladosporium spp. were the most abundant and frequently found molds in the laboratory. The contaminated areas could have one to five different species on them. Based on the mold and environmental conditions, several scenarios causing the mold contamination were deduced, and different mold control measures were discussed to compare them with the current solution of using 24-h air-conditioning to control mold growth. This study highlights the importance of mold hygiene in sustainable building management.
Sawada, Kazutaka; Sato, Tomoya; Hamajima, Hiroshi; Jayakody, Lahiru Niroshan; Hirata, Miyo; Yamashiro, Mikako; Tajima, Marie; Mitsutake, Susumu; Nagao, Koji; Tsuge, Keisuke; Abe, Fumiyoshi; Hanada, Kentaro; Kitagaki, Hiroshi
2015-06-01
In nature, different microorganisms create communities through their physiochemical and metabolic interactions. Many fermenting microbes, such as yeasts, lactic acid bacteria, and acetic acid bacteria, secrete acidic substances and grow faster at acidic pH values. However, on the surface of cereals, the pH is neutral to alkaline. Therefore, in order to grow on cereals, microbes must adapt to the alkaline environment at the initial stage of colonization; such adaptations are also crucial for industrial fermentation. Here, we show that the yeast Saccharomyces cerevisiae, which is incapable of synthesizing glucosylceramide (GlcCer), adapted to alkaline conditions after exposure to GlcCer from koji cereal cultured with Aspergillus kawachii. We also show that various species of GlcCer derived from different plants and fungi similarly conferred alkali tolerance to yeast. Although exogenous ceramide also enhanced the alkali tolerance of yeast, no discernible degradation of GlcCer to ceramide was observed in the yeast culture, suggesting that exogenous GlcCer itself exerted the activity. Exogenous GlcCer also increased ethanol tolerance and modified the flavor profile of the yeast cells by altering the membrane properties. These results indicate that GlcCer from A. kawachii modifies the physiology of the yeast S. cerevisiae and demonstrate a new mechanism for cooperation between microbes in food fermentation. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Predicting shrinkage and warpage in injection molding: Towards automatized mold design
NASA Astrophysics Data System (ADS)
Zwicke, Florian; Behr, Marek; Elgeti, Stefanie
2017-10-01
It is an inevitable part of any plastics molding process that the material undergoes some shrinkage during solidification. Mainly due to unavoidable inhomogeneities in the cooling process, the overall shrinkage cannot be assumed as homogeneous in all volumetric directions. The direct consequence is warpage. The accurate prediction of such shrinkage and warpage effects has been the subject of a considerable amount of research, but it is important to note that this behavior depends greatly on the type of material that is used as well as the process details. Without limiting ourselves to any specific properties of certain materials or process designs, we aim to develop a method for the automatized design of a mold cavity that will produce correctly shaped moldings after solidification. Essentially, this can be stated as a shape optimization problem, where the cavity shape is optimized to fulfill some objective function that measures defects in the molding shape. In order to be able to develop and evaluate such a method, we first require simulation methods for the diffierent steps involved in the injection molding process that can represent the phenomena responsible for shrinkage and warpage ina sufficiently accurate manner. As a starting point, we consider the solidification of purely amorphous materials. In this case, the material slowly transitions from fluid-like to solid-like behavior as it cools down. This behavior is modeled using adjusted viscoelastic material models. Once the material has passed a certain temperature threshold during cooling, any viscous effects are neglected and the behavior is assumed to be fully elastic. Non-linear elastic laws are used to predict shrinkage and warpage that occur after this point. We will present the current state of these simulation methods and show some first approaches towards optimizing the mold cavity shape based on these methods.
Yong, Hae In; Lee, Haelim; Park, Sanghoo; Park, Jooyoung; Choe, Wonho; Jung, Samooel; Jo, Cheorun
2017-01-01
The aims of the present study were to examine the use of a flexible thin-layer plasma system in inactivating bacteria and mold on beef jerky in a commercial package and to evaluate the physicochemical changes of the jerky. After plasma treatment for 10min, Escherichia coli O157:H7, Listeria monocytogenes, Salmonella Typhimurium, and Aspergillus flavus populations on the beef jerky were reduced by approximately 2 to 3Log CFU/g. No significant changes in metmyoglobin content, shear force, and myofibrillar fragmentation index were found in the plasma-treated beef jerky. On the other hand, the peroxide content and L ⁎ value were decreased whereas the a ⁎ and ΔE value were increased in the plasma-treated sample. Sensory evaluation indicated negative effects of plasma treatment on flavor, off-odor, and overall acceptability of the beef jerky. In conclusion, the flexible thin-layer plasma system could be employed as a means for decontamination of beef jerky, with slight changes to the physicochemical quality of the product. Copyright © 2016 Elsevier Ltd. All rights reserved.
Lehman, R Michael; Rosentrater, Kurt A
2007-09-01
Distillers grains are coproduced with ethanol and carbon dioxide during the production of fuel ethanol from the dry milling and fermentation of corn grain, yet there is little basic microbiological information on these materials. We undertook a replicated field study of the microbiology of distillers wet grains (DWG) over a 9 day period following their production at an industrial fuel ethanol plant. Freshly produced DWG had a pH of about 4.4, a moisture content of about 53.5% (wet mass basis), and 4 x 10(5) total yeast cells/g dry mass, of which about 0.1% were viable. Total bacterial cells were initially below detection limits (ca. 10(6) cells/g dry mass) and then were estimated to be approximately 5 x 10(7) cells/g dry mass during the first 4 days following production. Culturable aerobic heterotrophic organisms (fungi plus bacteria) ranged between 10(4) and 10(5) CFU/g dry mass during the initial 4 day period, and lactic acid bacteria increased from 36 to 10(3) CFU/g dry mass over this same period. At 9 days, total viable bacteria and yeasts and (or) molds topped 10(8) CFU/g dry mass and lactic acid bacteria approached 10(6) CFU/g dry mass. Community phospholipid fatty acid analysis indicated a stable microbial community over the first 4 days of storage. Thirteen morphologically distinct isolates were recovered, of which 10 were yeasts and molds from 6 different genera, 2 were strains of the lactic-acid-producing Pediococcus pentosaceus and only one was an aerobic heterotrophic bacteria, Micrococcus luteus. The microbiology of DWG is fundamental to the assessment of spoilage, deleterious effects (e.g., toxins), or beneficial effects (e.g., probiotics) in its use as feed or in alternative applications.
Method for molding ceramic powders
Janney, Mark A.
1990-01-01
A method for molding ceramic powders comprises forming a slurry mixture including ceramic powder, a dispersant for the metal-containing powder, and a monomer solution. The monomer solution includes at least one multifunctional monomer, a free-radical initiator, and an organic solvent. The slurry mixture is transferred to a mold, and the mold containing the slurry mixture is heated to polymerize and crosslink the monomer and form a firm polymer-solvent gel matrix. The solid product may be removed from the mold and heated to first remove the solvent and subsequently remove the polymer, whereafter the product may be sintered.
Method for molding ceramic powders
Janney, M.A.
1990-01-16
A method for molding ceramic powders comprises forming a slurry mixture including ceramic powder, a dispersant for the metal-containing powder, and a monomer solution. The monomer solution includes at least one multifunctional monomer, a free-radical initiator, and an organic solvent. The slurry mixture is transferred to a mold, and the mold containing the slurry mixture is heated to polymerize and crosslink the monomer and form a firm polymer-solvent gel matrix. The solid product may be removed from the mold and heated to first remove the solvent and subsequently remove the polymer, where after the product may be sintered.
Precision injection molding of freeform optics
NASA Astrophysics Data System (ADS)
Fang, Fengzhou; Zhang, Nan; Zhang, Xiaodong
2016-08-01
Precision injection molding is the most efficient mass production technology for manufacturing plastic optics. Applications of plastic optics in field of imaging, illumination, and concentration demonstrate a variety of complex surface forms, developing from conventional plano and spherical surfaces to aspheric and freeform surfaces. It requires high optical quality with high form accuracy and lower residual stresses, which challenges both optical tool inserts machining and precision injection molding process. The present paper reviews recent progress in mold tool machining and precision injection molding, with more emphasis on precision injection molding. The challenges and future development trend are also discussed.
Fine Structure of Tibetan Kefir Grains and Their Yeast Distribution, Diversity, and Shift
Lu, Man; Wang, Xingxing; Sun, Guowei; Qin, Bing; Xiao, Jinzhou; Yan, Shuling; Pan, Yingjie; Wang, Yongjie
2014-01-01
Tibetan kefir grains (TKGs), a kind of natural starter for fermented milk in Tibet, China, host various microorganisms of lactic acid bacteria, yeasts, and occasionally acetic acid bacteria in a polysaccharide/protein matrix. In the present study, the fine structure of TKGs was studied to shed light on this unusual symbiosis with stereomicroscopy and thin sections. The results reveal that TKGs consist of numerous small grain units, which are characterized by a hollow globular structure with a diameter between 2.0 and 9.0 mm and a wall thickness of approximately 200 µm. A polyhedron-like net structure, formed mainly by the bacteria, was observed in the wall of the grain units, which has not been reported previously to our knowledge. Towards the inside of the grain unit, the polyhedron-like net structures became gradually larger in diameter and fewer in number. Such fine structures may play a crucial role in the stability of the grains. Subsequently, the distribution, diversity, and shift of yeasts in TKGs were investigated based on thin section, scanning electron microscopy, cloning and sequencing of D1/D2 of the 26S rRNA gene, real-time quantitative PCR, and in situ hybridization with specific fluorescence-labeled oligonucleotide probes. These show that (i) yeasts appear to localize on the outer surface of the grains and grow normally together to form colonies embedded in the bacterial community; (ii) the diversity of yeasts is relatively low on genus level with three dominant species – Saccharomyces cerevisiae, Kluyveromyces marxianus, and Yarrowia lipolytica; (iii) S. cerevisiae is the stable predominant yeast species, while the composition of Kluyveromyces and Yarrowia are subject to change over time. Our results indicate that TKGs are relatively stable in structure, and culture conditions to some extent shape the microbial community and interaction in kefir grains. These findings pave the way for further study of the specific symbiotic associations between S
Yu, X; Martin, S E; Schmidt, S J
2008-03-01
Mold growth is a common problem during the equilibration of food materials at high relative humidity values using the standard saturated salt slurry method. Exposing samples to toluene vapor and mixing samples with mold inhibitor chemicals are suggested methods for preventing mold growth while obtaining isotherms. However, no published research was found that examined the effect of mold growth on isotherm performance or the efficacy of various mold inhibitor methods, including their possible effect on the physicochemical properties of food materials. Therefore, the objectives of this study were to (1) explore the effect of mold growth on isotherm performance in a range of food materials, (2) investigate the effectiveness of 4 mold inhibitor methods, irradiation, 2 chemical inhibitors (potassium sorbate and sodium acetate), and toluene vapor, on mold growth on dent corn starch inoculated with A. niger, and (3) examine the effect of mold inhibitor methods on the physicochemical properties of dent corn starch, including isotherm performance, pasting properties, gelatinization temperature, and enthalpy. Mold growth was found to affect starch isotherm performance by contributing to weight changes during sample equilibration. Among the 4 mold inhibitor methods tested, irradiation and toluene vapor were found to be the most effective for inhibiting growth of A. niger on dent cornstarch. However, both methods exhibited a significant impact on the starches' physiochemical properties, suggesting the need to probe the efficacy of other mold inhibitor methods and explore the use of new rapid isotherm instruments, which hamper mold growth by significantly decreasing measurement time.
REFRACTORY COATING FOR GRAPHITE MOLDS
Stoddard, S.D.
1958-06-24
Refractory coating for graphite molds used in the casting of uranium is described. The coating is an alumino-silicate refractory composition which may be used as a mold surface in solid form or as a coating applied to the graphite mold. The composition consists of a mixture of ball clay, kaolin, alumina cement, alumina, water, sodium silicate, and sodium carbonate.
Benadé, Eliska; Stone, Wendy; Mouton, Marnel; Postma, Ferdinand; Wilsenach, Jac; Botha, Alfred
2016-04-01
We used both aerobic and anaerobic liquid co-cultures, prepared with Luria Bertani broth, to study the effect of bacteria on the survival of Candida albicans in the external environment, away from an animal host. The bacteria were represented by Aeromonas hydrophila, Bacillus cereus, Bacillus subtilis, Clostridium, Enterobacter, Klebsiella pneumoniae, Kluyvera ascorbata and Serratia marcescens. Under aerobic conditions, the yeast's growth was inhibited in the presence of bacterial growth; however, under anaerobic conditions, yeast and bacterial growth in co-cultures was similar to that observed for pure cultures. Subsequent assays revealed that the majority of bacterial strains aerobically produced extracellular hydrolytic enzymes capable of yeast cell wall hydrolysis, including chitinases and mannan-degrading enzymes. In contrast, except for the A. hydrophila strain, these enzymes were not detected in anaerobic bacterial cultures, nor was the antimicrobial compound prodigiosin found in anaerobic cultures of S. marcescens. When we suspended C. albicans cells in crude extracellular enzyme preparations from K. pneumoniae and S. marcescens, we detected no negative effect on yeast viability. However, we found that these preparations enhance the toxicity of prodigiosin towards the yeast, especially in combination with mannan-degrading enzymes. Analyses of the chitin and mannan content of yeast cell walls revealed that less chitin was produced under anaerobic than aerobic conditions; however, the levels of mannan, known for its low permeability, remained the same. The latter phenomenon, as well as reduced production of the bacterial enzymes and prodigiosin, may contribute to anaerobic growth and survival of C. albicans in the presence of bacteria.
[Yeast microbiota in artisanal cheeses from Corrientes, Argentina].
Cardozo, Marina C; Fusco, Ángel J V; Carrasco, Marta S
The artisanal cheese from Corrientes (from the Spanish acronym QAC-Queso Artesanal de Corrientes/Artisanal Cheese from Corrientes) is a soft cheese elaborated with raw cow milk and an artisanal coagulant agent. Lactic bacteria contitute the main flora of this cheese although yeasts are also present in high quantities as secondary microbiota and might play a relevant role in cheese ripening. The aim of this work was to evaluate yeast occurrence during QAC elaboration and ripening, and the effect of seasonal variation. Yeasts were isolated and purified from raw materials and cheese at different ripening stagesl elaborated during the different seasons. Yeast sample counts were in the order of 10 3 - 10 7 UFC/ml o UFC/g. Ninety yeast strains were classified: 9 from milk, 28 from the coagulant agent, 10 from curd and 43 from cheese. Candida predominated in milk samples while other yeast genera had low incidence. Candida also predominated in the coagulant agent samples, followed by genera Myxozyma and Debaryomyces. The isolates obtained from cheese belonged to the same genera predominating in the coagulant agent, and showed the same order of prevalence. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
Briones-Roblero, Carlos I; Rodríguez-Díaz, Roberto; Santiago-Cruz, José A; Zúñiga, Gerardo; Rivera-Orduña, Flor N
2017-01-01
Bark beetles (Curculionidae: Scolytinae) feed on the xylem and phloem of their host, which are composed of structural carbohydrates and organic compounds that are not easily degraded by the insects. Some of these compounds might be hydrolyzed by digestive enzymes produced by microbes present in the gut of these insects. In this study, we evaluated the enzymatic capacity of bacteria (Acinetobacter lwoffii, Arthrobacter sp., Pseudomonas putida, Pseudomonas azotoformans, and Rahnella sp.) and yeasts (Candida piceae, Candida oregonensis, Cyberlindnera americana, Zygoascus sp., and Rhodotorula mucilaginosa) isolated from the Dendroctonus rhizophagus gut to hydrolyze cellulose, xylan, pectin, starch, lipids, and esters. All isolates, with the exception of C. piceae, showed lipolytic activity. Furthermore, P. putida, P. azotoformans, C. americana, C. piceae, and R. mucilaginosa presented amylolytic activity. Esterase activity was shown by A. lwoffii, P. azotoformans, and Rahnella sp. Cellulolytic and xylanolytic activities were present only in Arthrobacter sp. and P. azotoformans. The pectinolytic activity was not recorded in any isolate. This is the first study to provide evidence on the capacity of microbes associated with the D. rhizophagus gut to hydrolyze specific substrates, which might cover part of the nutritional requirements for the development, fitness, and survival of these insects.
Investigation of Heat Transfer at the Mold/Metal Interface in Permanent Mold Casting of Light Alloys
DOE Office of Scientific and Technical Information (OSTI.GOV)
Robert D. Pehlke; John T. Berry
2005-12-16
Accurate modeling of the metal casting process prior to creating a mold design demands reliable knowledge of the interfacial heat transfer coefficient at the mold metal interface as a function of both time and location. The phenomena concerned with the gap forming between the mold and the solidifying metal are complex but need to be understood before any modeling is attempted. The presence of mold coatings further complicates the situation. A commercial casting was chosen and studied in a gravity permanent mold casting process. The metal/mold interfacial heat transfer coefficient (IHTC) was the focus of the research. A simple, directmore » method has been used to evaluate the IHTC. Both the simulation and experiments have shown that a reasonably good estimate of the heat transfer coefficient could be made in the case studied. It has been found that there is a good agreement between experiments and simulations in the temperature profiles during the solidification process, given that the primary mechanism of heat transfer across the gap in permanent mold casting of light alloys is by conduction across the gap. The procedure utilized to determine the interfacial heat transfer coefficient can be applied to other casting processes. A recently completed project involving The University of Michigan and Mississippi State University, together with several industrial partners, which was supported by the USDOE through the Cast Metals Coalition, examined a number of cases of thermal contact. In an investigation which gave special consideration to the techniques of measurement, several mold coatings were employed and results presented as a function of time. Realistic conditions of coating thickness and type together with an appropriate combination of mold preheat and metal pouring temperature were strictly maintained throughout the investigation. Temperature sensors, in particular thermocouples, play an important part in validating the predictions of solidification models
NASA Astrophysics Data System (ADS)
Park, Keun; Lee, Sang-Ik
2010-03-01
High-frequency induction is an efficient, non-contact means of heating the surface of an injection mold through electromagnetic induction. Because the procedure allows for the rapid heating and cooling of mold surfaces, it has been recently applied to the injection molding of thin-walled parts or micro/nano-structures. The present study proposes a localized heating method involving the selective use of mold materials to enhance the heating efficiency of high-frequency induction heating. For localized induction heating, a composite injection mold of ferromagnetic material and paramagnetic material is used. The feasibility of the proposed heating method is investigated through numerical analyses in terms of its heating efficiency for localized mold surfaces and in terms of the structural safety of the composite mold. The moldability of high aspect ratio micro-features is then experimentally compared under a variety of induction heating conditions.
Particle Image Velocimetry During Injection Molding
NASA Astrophysics Data System (ADS)
Bress, Thomas; Dowling, David
2012-11-01
Injection molding involves the unsteady non-isothermal flow of a non-Newtonian polymer melt. An optical-access mold has been used to perform particle image velocimetry (PIV) on molten polystyrene during injection molding. Velocimetry data of the mold-filling flow will be presented. Statistical assessments of the velocimetry data and scaled residuals of the continuity equation suggest that PIV can be conducted in molten plastics with an uncertainty of +/-2 percent. Simulations are often used to model polymer flow during injection molding to design molds and select processing parameters but it is difficult to determine the accuracy of these simulations due to a lack of in-mold velocimetry and melt-front progression data. Moldflow was used to simulate the filling of the optical-access mold, and these simulated results are compared to the appropriately-averaged time-varying velocity field measurements. Simulated results for melt-front progression are also compared with the experimentally observed flow fronts. The ratio of the experimentally measured average velocity magnitudes to the simulation magnitudes was found on average to be 0.99 with a standard deviation of 0.25, and the difference in velocity orientations was found to be 0.9 degree with a standard deviation of 3.2 degrees. formerly at the University of Michigan.
Dynamic Feed Control For Injection Molding
Kazmer, David O.
1996-09-17
The invention provides methods and apparatus in which mold material flows through a gate into a mold cavity that defines the shape of a desired part. An adjustable valve is provided that is operable to change dynamically the effective size of the gate to control the flow of mold material through the gate. The valve is adjustable while the mold material is flowing through the gate into the mold cavity. A sensor is provided for sensing a process condition while the part is being molded. During molding, the valve is adjusted based at least in part on information from the sensor. In the preferred embodiment, the adjustable valve is controlled by a digital computer, which includes circuitry for acquiring data from the sensor, processing circuitry for computing a desired position of the valve based on the data from the sensor and a control data file containing target process conditions, and control circuitry for generating signals to control a valve driver to adjust the position of the valve. More complex embodiments include a plurality of gates, sensors, and controllable valves. Each valve is individually controllable so that process conditions corresponding to each gate can be adjusted independently. This allows for great flexibility in the control of injection molding to produce complex, high-quality parts.
Quintero-Galvis, Julian F; Paleo-López, Rocío; Solano-Iguaran, Jaiber J; Poupin, María Josefina; Ledger, Thomas; Gaitan-Espitia, Juan Diego; Antoł, Andrzej; Travisano, Michael; Nespolo, Roberto F
2018-05-01
There have been over 25 independent unicellular to multicellular evolutionary transitions, which have been transformational in the complexity of life. All of these transitions likely occurred in communities numerically dominated by unicellular organisms, mostly bacteria. Hence, it is reasonable to expect that bacteria were involved in generating the ecological conditions that promoted the stability and proliferation of the first multicellular forms as protective units. In this study, we addressed this problem by analyzing the occurrence of multicellularity in an experimental phylogeny of yeasts ( Sacharomyces cerevisiae ) a model organism that is unicellular but can generate multicellular clusters under some conditions. We exposed a single ancestral population to periodic divergences, coevolving with a cocktail of environmental bacteria that were inoculated to the environment of the ancestor, and compared to a control (no bacteria). We quantified culturable microorganisms to the level of genera, finding up to 20 taxa (all bacteria) that competed with the yeasts during diversification. After 600 generations of coevolution, the yeasts produced two types of multicellular clusters: clonal and aggregative. Whereas clonal clusters were present in both treatments, aggregative clusters were only present under the bacteria treatment and showed significant phylogenetic signal. However, clonal clusters showed different properties if bacteria were present as follows: They were more abundant and significantly smaller than in the control. These results indicate that bacteria are important modulators of the occurrence of multicellularity, providing support to the idea that they generated the ecological conditions-promoting multicellularity.
Cellular and molecular effects of yeast probiotics on cancer.
Saber, Amir; Alipour, Beitollah; Faghfoori, Zeinab; Yari Khosroushahi, Ahmad
2017-02-01
The cancer is one of the main causes of human deaths worldwide. The exact mechanisms of initiation and progression of malignancies are not clear yet, but there is a common agreement about the role of colonic microbiota in the etiology of different cancers. Probiotics have been examined for their anti-cancer effects, and different mechanisms have been suggested about their antitumor functions. Nonpathogenic yeasts, as members of probiotics family, can be effective on gut microbiota dysbiosis. Generally safe yeasts have shown so many beneficial effects on human health. Probiotic yeasts influence physiology, metabolism, and immune homeostasis in the colon and contribute to cancer treatment due to possessing anti-inflammatory, anti-proliferative and anti-cancer properties. This study reviews some of the health-beneficial effects of probiotic yeasts and their biological substances like folic acid and β-glucan on cancer and focuses on the possible cellular and molecular mechanisms of probiotic yeasts such as influencing pathogenic bacteria, inactivation of carcinogenic compounds, especially those derived from food, improvement of intestinal barrier function, modulation of immune responses, antitoxic function, apoptosis, and anti-proliferative effects.
Manipulating Genetic Material in Bacteria
NASA Technical Reports Server (NTRS)
1998-01-01
Lisa Crawford, a graduate research assistant from the University of Toledo, works with Laurel Karr of Marshall Space Flight Center (MSFC) in the molecular biology laboratory. They are donducting genetic manipulation of bacteria and yeast for the production of large amount of desired protein. Photo credit: NASA/Marshall Space Flight Center (MSFC)
Chung, Philip; Heller, J Alex; Etemadi, Mozziyar; Ottoson, Paige E; Liu, Jonathan A; Rand, Larry; Roy, Shuvo
2014-06-27
Biologically inert elastomers such as silicone are favorable materials for medical device fabrication, but forming and curing these elastomers using traditional liquid injection molding processes can be an expensive process due to tooling and equipment costs. As a result, it has traditionally been impractical to use liquid injection molding for low-cost, rapid prototyping applications. We have devised a method for rapid and low-cost production of liquid elastomer injection molded devices that utilizes fused deposition modeling 3D printers for mold design and a modified desiccator as an injection system. Low costs and rapid turnaround time in this technique lower the barrier to iteratively designing and prototyping complex elastomer devices. Furthermore, CAD models developed in this process can be later adapted for metal mold tooling design, enabling an easy transition to a traditional injection molding process. We have used this technique to manufacture intravaginal probes involving complex geometries, as well as overmolding over metal parts, using tools commonly available within an academic research laboratory. However, this technique can be easily adapted to create liquid injection molded devices for many other applications.
Beginnings of microbiology and biochemistry: the contribution of yeast research.
Barnett, James A
2003-03-01
With improvements in microscopes early in the nineteenth century, yeasts were seen to be living organisms, although some famous scientists ridiculed the idea and their influence held back the development of microbiology. In the 1850s and 1860s, yeasts were established as microbes and responsible for alcoholic fermentation, and this led to the study of the rôle of bacteria in lactic and other fermentations, as well as bacterial pathogenicity. At this time, there were difficulties in distinguishing between the activities of microbes and of extracellular enzymes. Between 1884 and 1894, Emil Fischer's study of sugar utilization by yeasts generated an understanding of enzymic specificity and the nature of enzyme-substrate complexes.
NASA Astrophysics Data System (ADS)
Slobodzinsky, A.
Features, materials, and techniques of vacuum, pressure, and autoclave FRP bag molding processes are described. The bags are used in sealed environments, inflated to flexibly force a curing FRP laminate to conform to a stiff mold form which defines the shape of the finished product. Densification is achieved as the bag presses out the voids and excess resin from the laminate, and consolidation occurs as the plies and adherends are bonded by the bag pressure. Curing techniques nominally involved room temperature or high temperature, and investigations of alternative techniques, such as induction, dielectric, microwave, xenon flash, UV, electron beam, and gamma radiation heating are proceeding. Polysulfone is the most common thermoplastic. Details are given of mold preparations, peel plies or release films and fabrics, bagging techniques, and reusable venting blankets and silicone rubber bags.
Cigarette Smoke, Bacteria, Mold, Microbial Toxins, and Chronic Lung Inflammation
Pauly, John L.; Paszkiewicz, Geraldine
2011-01-01
Chronic inflammation associated with cigarette smoke fosters malignant transformation and tumor cell proliferation and promotes certain nonneoplastic pulmonary diseases. The question arises as to whether chronic inflammation and/or colonization of the airway can be attributed, at least in part, to tobacco-associated microbes (bacteria, fungi, and spores) and/or microbial toxins (endotoxins and mycotoxins) in tobacco. To address this question, a literature search of documents in various databases was performed. The databases included PubMed, Legacy Tobacco Documents Library, and US Patents. This investigation documents that tobacco companies have identified and quantified bacteria, fungi, and microbial toxins at harvest, throughout fermentation, and during storage. Also characterized was the microbial flora of diverse smoking and smokeless tobacco articles. Evidence-based health concerns expressed in investigations of microbes and microbial toxins in cigarettes, cigarette smoke, and smokeless tobacco products are reasonable; they warrant review by regulatory authorities and, if necessary, additional investigation to address scientific gaps. PMID:21772847
Cell biology of the Koji mold Aspergillus oryzae.
Kitamoto, Katsuhiko
2015-01-01
Koji mold, Aspergillus oryzae, has been used for the production of sake, miso, and soy sauce for more than one thousand years in Japan. Due to the importance, A. oryzae has been designated as the national micro-organism of Japan (Koku-kin). A. oryzae has been intensively studied in the past century, with most investigations focusing on breeding techniques and developing methods for Koji making for sake brewing. However, the understanding of fundamental biology of A. oryzae remains relatively limited compared with the yeast Saccharomyces cerevisiae. Therefore, we have focused on studying the cell biology including live cell imaging of organelles, protein vesicular trafficking, autophagy, and Woronin body functions using the available genomic information. In this review, I describe essential findings of cell biology of A. oryzae obtained in our study for a quarter of century. Understanding of the basic biology will be critical for not its biotechnological application, but also for an understanding of the fundamental biology of other filamentous fungi.
Graf, Neil J; Bowser, Michael T
2013-10-07
Two different fabrication methods were employed to fabricate micropumps with different cross-sectional channel geometries. The first was to fabricate rectangular cross-sectional microchannel geometries using the well known fabrication method of replica molding (REM). The second, and far less utilized fabrication technique, was to create microchannel molds using an in-house fabricated handheld micro injection molding apparatus. The injection mold apparatus was designed for use with elastomeric room temperature vulcanization (RTV) polymers, as opposed to most other injection molding machines, which are designed for use with thermoplastic polymers. The injection mold's bottom plate was used as a microchannel molding template. The molding template was created by threading a small-diameter wire (150 μm or less) through the injection mold's bottom plate, with subsequent adhesion and smoothing of a thin piece of aluminum foil over the wire-raised injection mold template. When molded against, the template produced a rounded/Gaussian-shaped PDMS microchannel. The design of the injection mold will be presented, along with a direct comparison for micropump performance metrics such as flow rate, valving characteristics, and maximum backpressures attainable for each of the respective micropump channel geometries.
Shen, Congcong; Yao, Caroline A; Magee, William; Chai, Gang; Zhang, Yan
2015-06-01
The authors present a novel nasoalveolar molding protocol by prefabricating sets of nasoalveolar molding appliances using three-dimensional technology. Prospectively, 17 infants with unilateral complete cleft lip and palate underwent the authors' protocol before primary cheiloplasty. An initial nasoalveolar molding appliance was created based on the patient's first and only in-person maxillary cast, produced from a traditional intraoral dental impression. Thereafter, each patient's molding course was simulated using computer software that aimed to narrow the alveolar gap by 1 mm each week by rotating the greater alveolar segment. A maxillary cast of each predicted molding stage was created using three-dimensional printing. Subsequent appliances were constructed in advance, based on the series of computer-generated casts. Each patient had a total three clinic visits spaced 1 month apart. Anthropometric measurements and bony segment volumes were recorded before and after treatment. Alveolar cleft widths narrowed significantly (p < 0.01), soft-tissue volume of each segment expanded (p < 0.01), and the arc of the alveolus became more contiguous across the cleft (p < 0.01). One patient required a new appliance at the second visit because of bleeding and discomfort. Eleven patients had mucosal irritation and two experienced minor mucosal ulceration. Three-dimensional technology can precisely represent anatomic structures in pediatric clefts. Results from the authors' algorithm are equivalent to those of traditional nasoalveolar molding therapies; however, the number of required clinic visits and appliance adjustments decreased. As three-dimensional technology costs decrease, multidisciplinary teams may design customized nasoalveolar molding treatment with improved efficiency and less burden to medical staff, patients, and families. Therapeutic, IV.
Li, Yang; Chen, Zhangxing; Xu, Hongyi; ...
2017-01-02
Compression molded SMC composed of chopped carbon fiber and resin polymer which balances the mechanical performance and manufacturing cost presents a promising solution for vehicle lightweight strategy. However, the performance of the SMC molded parts highly depends on the compression molding process and local microstructure, which greatly increases the cost for the part level performance testing and elongates the design cycle. ICME (Integrated Computational Material Engineering) approaches are thus necessary tools to reduce the number of experiments required during part design and speed up the deployment of the SMC materials. As the fundamental stage of the ICME workflow, commercial softwaremore » packages for SMC compression molding exist yet remain not fully validated especially for chopped fiber systems. In this study, SMC plaques are prepared through compression molding process. The corresponding simulation models are built in Autodesk Moldflow with the same part geometry and processing conditions as in the molding tests. The output variables of the compression molding simulations, including press force history and fiber orientation of the part, are compared with experimental data. Influence of the processing conditions to the fiber orientation of the SMC plaque is also discussed. It is found that generally Autodesk Moldflow can achieve a good simulation of the compression molding process for chopped carbon fiber SMC, yet quantitative discrepancies still remain between predicted variables and experimental results.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Yang; Chen, Zhangxing; Xu, Hongyi
Compression molded SMC composed of chopped carbon fiber and resin polymer which balances the mechanical performance and manufacturing cost presents a promising solution for vehicle lightweight strategy. However, the performance of the SMC molded parts highly depends on the compression molding process and local microstructure, which greatly increases the cost for the part level performance testing and elongates the design cycle. ICME (Integrated Computational Material Engineering) approaches are thus necessary tools to reduce the number of experiments required during part design and speed up the deployment of the SMC materials. As the fundamental stage of the ICME workflow, commercial softwaremore » packages for SMC compression molding exist yet remain not fully validated especially for chopped fiber systems. In this study, SMC plaques are prepared through compression molding process. The corresponding simulation models are built in Autodesk Moldflow with the same part geometry and processing conditions as in the molding tests. The output variables of the compression molding simulations, including press force history and fiber orientation of the part, are compared with experimental data. Influence of the processing conditions to the fiber orientation of the SMC plaque is also discussed. It is found that generally Autodesk Moldflow can achieve a good simulation of the compression molding process for chopped carbon fiber SMC, yet quantitative discrepancies still remain between predicted variables and experimental results.« less
Chung, Philip; Heller, J. Alex; Etemadi, Mozziyar; Ottoson, Paige E.; Liu, Jonathan A.; Rand, Larry; Roy, Shuvo
2014-01-01
Biologically inert elastomers such as silicone are favorable materials for medical device fabrication, but forming and curing these elastomers using traditional liquid injection molding processes can be an expensive process due to tooling and equipment costs. As a result, it has traditionally been impractical to use liquid injection molding for low-cost, rapid prototyping applications. We have devised a method for rapid and low-cost production of liquid elastomer injection molded devices that utilizes fused deposition modeling 3D printers for mold design and a modified desiccator as an injection system. Low costs and rapid turnaround time in this technique lower the barrier to iteratively designing and prototyping complex elastomer devices. Furthermore, CAD models developed in this process can be later adapted for metal mold tooling design, enabling an easy transition to a traditional injection molding process. We have used this technique to manufacture intravaginal probes involving complex geometries, as well as overmolding over metal parts, using tools commonly available within an academic research laboratory. However, this technique can be easily adapted to create liquid injection molded devices for many other applications. PMID:24998993
HIGH TEMPERATURE REFRACTORY COATING FOR GRAPHITE MOLDS
Stoddard, S.D.
1958-10-21
An improved foundry mold coating for use with graphite molds used in the casting of uranium is presented. The refractory mold coating serves to keep the molten uranium from contact with graphite of the mold and thus prevents carbon pickup by the molten metal. The refractory coating is made by dry mixing certain specific amounts of aluminum oxide, bentonite, Tennessee ball clay, and a soluble silicate salt. Water is then added to the mixture and the suspension thus formed is applied by spraying onto the mold.
Hierro, Núria; Esteve-Zarzoso, Braulio; González, Ángel; Mas, Albert; Guillamón, Jose M.
2006-01-01
Real-time PCR, or quantitative PCR (QPCR), has been developed to rapidly detect and quantify the total number of yeasts in wine without culturing. Universal yeast primers were designed from the variable D1/D2 domains of the 26S rRNA gene. These primers showed good specificity with all the wine yeasts tested, and they did not amplify the most representative wine species of acetic acid bacteria and lactic acid bacteria. Numerous standard curves were constructed with different strains and species grown in yeast extract-peptone-dextrose medium or incubated in wine. The small standard errors with these replicas proved that the assay is reproducible and highly robust. This technique was validated with artificially contaminated and natural wine samples. We also performed a reverse transcription-QPCR (RT-QPCR) assay from rRNA for total viable yeast quantification. This technique had a low detection limit and was more accurate than QPCR because the dead cells were not quantified. As far as we know, this is the first time that RT-QPCR has been performed to quantify viable yeasts from rRNA. RT-QPCR is a rapid and accurate technique for enumerating yeasts during industrial wine fermentation and controlling the risk of wine spoilage. PMID:17088381
DOE Office of Scientific and Technical Information (OSTI.GOV)
Williams, Stuart S; Samulski, Edward; Lopez, Renee
2010-01-01
ABSTRACT. Described herein is the development and investigation of PFPE-based elastomers for high resolution replica molding applications. The modulus of the elastomeric materials was increased through synthetic and additive approaches while maintaining relatively low surface energies (<25 mN/m). Using practically relevant large area master templates, we show that the resolution of the molds is strongly dependant upon the elastomeric mold modulus. A composite mold approach was used to form flexible molds out of stiff, high modulus materials that allow for replication of sub-20 nm post structures. Sub-100 nm line grating master templates, formed using e-beam lithography, were used to determinemore » the experimental stability of the molding materials. It was observed that as the feature spacing decreased, high modulus composite molds were able to effectively replicate the nano-grating structures without cracking or tear-out defects that typically occur with high modulus elastomers.« less
Snow Mold Investigations in Eastern Washington
T. H. Filer; A. G. Law
1961-01-01
"Snow mold of turf" in the Pacific Northwest must include both Fusarium Patch caused by Calonectria graminicola (Berk and Br.) (conidial stage Fusarium nivale (Fr. ) CES.), and Gray snow mold caused by Typhula itoana Imai, which occur together to give a disease complex. Snow mold of turf is the most...
Molds are ubiquitous in the environment and exposures to molds contribute to various human diseases. Damp/moldy environments have been associated with asthma exacerbation, but mold's role in allergic asthma induction is less clear. The molds selected for these studies are commonl...
Rotationally Molded Liquid Crystalline Polymers
NASA Technical Reports Server (NTRS)
Rogers, Martin; Stevenson, Paige; Scribben, Eric; Baird, Donald; Hulcher, Bruce
2002-01-01
Rotational molding is a unique process for producing hollow plastic parts. Rotational molding offers advantages of low cost tooling and can produce very large parts with complicated shapes. Products made by rotational molding include water tanks with capacities up to 20,000 gallons, truck bed liners, playground equipment, air ducts, Nylon fuel tanks, pipes, toys, stretchers, kayaks, pallets, and many others. Thermotropic liquid crystalline polymers are an important class of engineering resins employed in a wide variety of applications. Thermotropic liquid crystalline polymers resins are composed of semi-rigid, nearly linear polymeric chains resulting in an ordered mesomorphic phase between the crystalline solid and the isotropic liquid. Ordering of the rigid rod-like polymers in the melt phase yields microfibrous, self-reinforcing polymer structures with outstanding mechanical and thermal properties. Rotational molding of liquid crystalline polymer resins results in high strength and high temperature hollow structures useful in a variety of applications. Various fillers and reinforcements can potentially be added to improve properties of the hollow structures. This paper focuses on the process and properties of rotationally molded liquid crystalline polymers.
Transfer molding of PMR-15 polyimide resin
NASA Technical Reports Server (NTRS)
Reardon, J. P.; Moyer, D. W.; Nowak, B. E.
1985-01-01
Transfer molding is an economically viable method of producing small shapes of PMR-15 polyimide. It is shown that with regard to flexural, compressive, and tribological properties transfer-molded PMR-15 polyimide is essentially equivalent to PMR-15 polyimide produced by the more common method of compression molding. Minor variations in anisotropy are predictable effects of molding design and secondary finishing operations.
Extracellular electron transfer in yeast-based biofuel cells: A review.
Hubenova, Yolina; Mitov, Mario
2015-12-01
This paper reviews the state-of-the art of the yeast-based biofuel cell research and development. The established extracellular electron transfer (EET) mechanisms in the presence and absence of exogenous mediators are summarized and discussed. The approaches applied for improvement of mediator-less yeast-based biofuel cells performance are also presented. The overview of the literature shows that biofuel cells utilizing yeasts as biocatalysts generate power density in the range of 20 to 2440 mW/m(2), which values are comparable with the power achieved when bacteria are used instead. The electrons' origin and the contribution of the glycolysis, fermentation, aerobic respiration, and phosphorylation to the EET are commented. The reported enhanced current generation in aerobic conditions presumes reconsideration of some basic MFC principles. The challenges towards the practical application of the yeast-based biofuel cells are outlined. Copyright © 2015 Elsevier B.V. All rights reserved.
Non-Conventional Yeast Strains Increase the Aroma Complexity of Bread
Rezaei, Mohammad Naser; Steensels, Jan; Courtin, Christophe M.; Verstrepen, Kevin J.
2016-01-01
Saccharomyces cerevisiae is routinely used yeast in food fermentations because it combines several key traits, including fermentation efficiency and production of desirable flavors. However, the dominance of S. cerevisiae in industrial fermentations limits the diversity in the aroma profiles of the end products. Hence, there is a growing interest in non-conventional yeast strains that can help generate the diversity and complexity desired in today’s diversified and consumer-driven markets. Here, we selected a set of non-conventional yeast strains to examine their potential for bread fermentation. Here, we tested ten non-conventional yeasts for bread fermentation, including two Saccharomyces species that are not currently used in bread making and 8 non-Saccharomyces strains. The results show that Torulaspora delbrueckii and Saccharomyces bayanus combine satisfactory dough fermentation with an interesting flavor profile. Sensory analysis and HS-SPME-GC-MS analysis confirmed that these strains produce aroma profiles that are very different from that produced by a commercial bakery strain. Moreover, bread produced with these yeasts was preferred by a majority of a trained sensory panel. These results demonstrate the potential of T. delbrueckii and S. bayanus as alternative yeasts for bread dough leavening, and provide a general experimental framework for the evaluation of more yeasts and bacteria. PMID:27776154
Non-Conventional Yeast Strains Increase the Aroma Complexity of Bread.
Aslankoohi, Elham; Herrera-Malaver, Beatriz; Rezaei, Mohammad Naser; Steensels, Jan; Courtin, Christophe M; Verstrepen, Kevin J
2016-01-01
Saccharomyces cerevisiae is routinely used yeast in food fermentations because it combines several key traits, including fermentation efficiency and production of desirable flavors. However, the dominance of S. cerevisiae in industrial fermentations limits the diversity in the aroma profiles of the end products. Hence, there is a growing interest in non-conventional yeast strains that can help generate the diversity and complexity desired in today's diversified and consumer-driven markets. Here, we selected a set of non-conventional yeast strains to examine their potential for bread fermentation. Here, we tested ten non-conventional yeasts for bread fermentation, including two Saccharomyces species that are not currently used in bread making and 8 non-Saccharomyces strains. The results show that Torulaspora delbrueckii and Saccharomyces bayanus combine satisfactory dough fermentation with an interesting flavor profile. Sensory analysis and HS-SPME-GC-MS analysis confirmed that these strains produce aroma profiles that are very different from that produced by a commercial bakery strain. Moreover, bread produced with these yeasts was preferred by a majority of a trained sensory panel. These results demonstrate the potential of T. delbrueckii and S. bayanus as alternative yeasts for bread dough leavening, and provide a general experimental framework for the evaluation of more yeasts and bacteria.
Digital Twin concept for smart injection molding
NASA Astrophysics Data System (ADS)
Liau, Y.; Lee, H.; Ryu, K.
2018-03-01
Injection molding industry has evolved over decades and became the most common method to manufacture plastic parts. Monitoring and improvement in the injection molding industry are usually performed separately in each stage, i.e. mold design, mold making and injection molding process. However, in order to make a breakthrough and survive in the industrial revolution, all the stages in injection molding need to be linked and communicated with each other. Any changes in one stage will cause a certain effect in other stage because there is a correlation between each other. Hence, the simulation should not only based on the input of historical data, but it also needs to include the current condition of equipment and prediction of future events in other stages to make the responsive decision. This can be achieved by implementing the concept of Digital Twin that models the entire process as a virtual model and enables bidirectional control with the physical process. This paper presented types of data and technology required to build the Digital Twin for the injection molding industry. The concept includes Digital Twin of each stage and integration of these Digital Twin model as a thoroughgoing model of the injection molding industry.
Li, Chaolan; Zhang, Hongyin; Yang, Qiya; Komla, Mahunu Gustav; Zhang, Xiaoyun; Zhu, Shuyun
2014-07-30
The effect of ascorbic acid (VC) on improving oxidative stress tolerance of Pichia caribbica and biocontrol efficacy against blue mold caused by Penicillium expansum on apples was investigated. P. caribbica showed susceptibility to the oxidative stress in vitro test, and 250 μg/mL VC treatment improved its oxidative stress tolerance. The higher viability exhibited by VC-treated yeast was associated with a lower intracellular ROS level. The activities of antioxidant enzymes of P. caribbica were improved by VC treatment, including catalase (CAT), superoxide dismutase (SOD), and glutathione peroxidase (GPX). Additionally, VC-treated yeast exhibited greater biocontrol activity against P. expansum and faster growth when stored at 25 and 4 °C, respectively, compared to the performance of the non-VC-treated yeast. In response to the VC treatment under oxidative stress, several differentially expressed proteins were identified in P. caribbica, and most of the poteins were confirmed to be related to basic metabolism. Therefore, the application of ascorbic acid is a useful approach to improve oxidative stress tolerance of P. caribbica and its biocontrol efficacy on apples.
Permanent Mold Casting of JIS-AC4C Aluminum Alloy Using a Low-Temperature Mold
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yamagata, Hiroshi; Nikawa, Makoto
2011-01-17
Permanent mold casting using mold temperatures below 200 deg. C was conducted to obtain a high-strength, thin-walled casting. Al-7.36 mass% Si -0.18 Cu- 0.27Mg-0.34Fe alloy JIS-AC4C was cast using a bottom pouring cast plan. The product had a rectangular tube shape (70 mm W x 68 mm D x 180 mm H) with wall thicknesses of 1, 3 and 5 mm. The effect of heat insulation at the melt path was compared when using a sand runner insert and when using a steel runner insert as well as a powder mold release agent. Fine microstructures were observed in the casting.more » The smaller the thickness, the higher the hardness with smaller secondary dendrite arm spacing (SDAS). However, the hardness and the SDAS were unaffected by the mold temperature. It was proposed that the avoidance of the formation of primary {alpha} dendrite at the melt path generates a higher strength casting with adequate mold filling.« less
Mold inhibition on unseasoned southern pine
Carol A. Clausen; Vina W. Yang
2003-01-01
Concerns about indoor air quality due to mold growth have increased dramatically in the United States. In the absence of moisture management, fungicides need to be developed for indoor use to control mold establishment. An ideal fungicide for prevention of indoor mold growth on wood-based materials needs to specifically prevent spore germination and provide long-term...
Medical diagnostics for indoor mold exposure.
Hurraß, Julia; Heinzow, Birger; Aurbach, Ute; Bergmann, Karl-Christian; Bufe, Albrecht; Buzina, Walter; Cornely, Oliver A; Engelhart, Steffen; Fischer, Guido; Gabrio, Thomas; Heinz, Werner; Herr, Caroline E W; Kleine-Tebbe, Jörg; Klimek, Ludger; Köberle, Martin; Lichtnecker, Herbert; Lob-Corzilius, Thomas; Merget, Rolf; Mülleneisen, Norbert; Nowak, Dennis; Rabe, Uta; Raulf, Monika; Seidl, Hans Peter; Steiß, Jens-Oliver; Szewszyk, Regine; Thomas, Peter; Valtanen, Kerttu; Wiesmüller, Gerhard A
2017-04-01
In April 2016, the German Society of Hygiene, Environmental Medicine and Preventative Medicine (Gesellschaft für Hygiene, Umweltmedizin und Präventivmedizin (GHUP)) together with other scientific medical societies, German and Austrian medical societies, physician unions and experts has provided an AWMF (Association of the Scientific Medical Societies) guideline 'Medical diagnostics for indoor mold exposure'. This guideline shall help physicians to advise and treat patients exposed indoors to mold. Indoor mold growth is a potential health risk, even without a quantitative and/or causal association between the occurrence of individual mold species and health effects. Apart from the allergic bronchopulmonary aspergillosis (ABPA) and the mycoses caused by mold, there is only sufficient evidence for the following associations between moisture/mold damages and different health effects: Allergic respiratory diseases, asthma (manifestation, progression, exacerbation), allergic rhinitis, exogenous allergic alveolitis and respiratory tract infections/bronchitis. In comparison to other environmental allergens, the sensitizing potential of molds is estimated to be low. Recent studies show a prevalence of sensitization of 3-10% in the total population of Europe. The evidence for associations to mucous membrane irritation and atopic eczema (manifestation, progression, exacerbation) is classified as limited or suspected. Inadequate or insufficient evidence for an association is given for COPD, acute idiopathic pulmonary hemorrhage in children, rheumatism/arthritis, sarcoidosis, and cancer. The risk of infections from indoor molds is low for healthy individuals. Only molds that are capable to form toxins can cause intoxications. The environmental and growth conditions and especially the substrate determine whether toxin formation occurs, but indoor air concentrations are always very low. In the case of indoor moisture/mold damages, everyone can be affected by odor effects and
A Mold by Any Other Name: One Librarian's Battle Against a Mold Bloom.
ERIC Educational Resources Information Center
Smith, Laura Katz
1997-01-01
Describes how library staff at Virginia Polytechnic Institute and State University cleaned up materials after a mold bloom in the rare book room. Includes advice for controlling mold: set up a hygrothermograph, clean dust from books, set up fans, do a "skin" test at regular intervals, keep windows closed, have dehumidifiers available.…
Serra, S; De Simeis, D
2018-03-01
The preparation of the high-value flavour γ-dodecalactone is based on the biotransformation of natural 10-HSA, which is in turn obtained by microbial hydration of oleic acid. We want to establish a reliable baker's yeast-mediated procedure for 10-HSA preparation. The previously reported yeast-mediated hydration procedures are unreliable because bacteria-free baker's yeast is not able to hydrate oleic acid. The actual responsible for performing this reaction are the bacterial contaminants present in baker's yeast. Moreover, we demonstrated that the enantioselectivity in the production of (R)-10-HSA is affected mainly by the temperature used in the biotransformation. We demonstrated that Saccharomyces cerevisiae is not able to hydrate oleic acid, whereas different bacterial strains present in baker's yeast transform oleic acid into (R)-10-HSA. We reported a general procedure for the preparation of (R)-10-HSA starting from oleic acid and using commercially available baker's yeast. This study holds both scientific and industrial interest. It unambiguously establishes that the eukaryote micro-organisms present in baker's yeast are not able to hydrate oleic acid. The isolation of oleic acid hydrating bacterial strains from commercial baker's yeast points to their prospective use for the industrial synthesis of 10-HSA. © 2017 The Society for Applied Microbiology.
Aureobasidium pullulansas a biocontrol agent of blue mold in "Rocha" pear.
Ferreira-Pinto, M M; Moura-Guedes, M C; Barreiro, M G; Pais, I; Santos, M R; Silva, M J
2006-01-01
The blue mold of "Rocha" pear caused by Penicillium expansum is an important postharvest disease which is adequately controlled by application of synthetic fungicides. In recent years, strategies like biological control have been considered a desirable alternative to chemicals. Several studies have demonstrated the potential of the yeast-like fungus Aureobasidium pullulans for control of postharvest decay of pear. A Portuguese isolate of Aureobasidium pullulans was characterized and evaluated for its activity in reducing postharvest blue mold decay of "Rocha" pear caused by Penicillium expansum. Study of optimal conditions for antagonist growth was carried out in six different culture media. The effect of four maturity stages of fruits in the development of A. pullulans was also studied. Biocontrol studies were performed with two concentrations of the antagonist (3 x 10(8) and 4 x 10(9) CFU/ml). A. pullulans growth was significantly different (P < or = 0.001) according to the various media and time of incubation. Best results were obtained in Corn Meal Agar (CMA) and Potato Dextrose Agar (PDA) media which contains the higher concentration of glucose (20 mg/l). Medium resulted from fruits of the first harvest date presented lower colony diameter. Inoculation of A. pullulans at 3 x 10(8) and 4 x 10(9) CFU/ml reduced the incidence of the disease by 23 and 63%, and reduced the lesion diameter by 36 and 46%, respectively.
NASA Astrophysics Data System (ADS)
Kuhn, Sascha; Burr, August; Kübler, Michael; Deckert, Matthias; Bleesen, Christoph
2011-02-01
In this paper the replication qualities of periodically and randomly arranged micro-features molded in the injection molding process and their effects on surface properties are studied. The features are molded in PC, PMMA and PP at different mold wall temperatures in order to point out the necessity and profitability of a variotherm mold wall temperature control system. A one-dimensional heat conduction model is proposed to predict the cycle times of the variotherm injection molding processes. With regard to these processes, the molding results are compared to the molded surface feature heights using an atomic force microscope. In addition, the effects of the molded surface features on macroscopic surfaces are characterized in terms of light reflection using a spectrometer and in terms of water wettability by measuring the static contact angle. Furthermore, due to the sensitivity of the surface features on the molded parts, their durability is compared in a scratch test with a diamond tip. This leads to successful implementation in applications in which the optical appearance, in terms of gloss and reflection, and the water repellence, in terms of drag flow and adhesion, are of importance.
Graf, Neil J.
2013-01-01
Two different fabrication methods were employed to fabricate micropumps with different cross-sectional channel geometries. The first was to fabricate rectangular cross-sectional microchannel geometries using the well known fabrication method of replica molding (REM).1 The second, and far less utilized fabrication technique, was to create microchannel molds using an in-house fabricated handheld micro injection molding apparatus. The injection mold apparatus was designed for use with elastomeric room temperature vulcanization (RTV) polymers, as opposed to most other injection molding machines, which are designed for use with thermoplastic polymers. The injection mold’s bottom plate was used as a microchannel molding template. The molding template was created by threading a small-diameter wire (150 μm or less) through the injection mold’s bottom plate, with subsequent adhesion and smoothing of a thin piece of aluminum foil over the wire-raised injection mold template. When molded against, the template produced a rounded/Gaussian-shaped PDMS microchannel. The design of the injection mold will be presented, along with a direct comparison for micropump performance metrics such as flow rate, valving characteristics, and maximum backpressures attainable for each of the respective micropump channel geometries. PMID:23917263
Bolla, P A; Abraham, A G; Pérez, P F; de Los Angeles Serradell, M
2016-02-01
The aim of this work was to evaluate the ability of a kefir-isolated microbial mixture containing three bacterial and two yeast strains (MM) to protect intestinal epithelial cells against Shigella flexneri invasion, as well as to analyse the effect on pro-inflammatory response elicited by this pathogen. A significant decrease in S. flexneri strain 72 invasion was observed on both HT-29 and Caco-2 cells pre-incubated with MM. Pre-incubation with the individual strains Saccharomyces cerevisiae CIDCA 8112 or Lactococcus lactis subsp. lactis CIDCA 8221 also reduced the internalisation of S. flexneri into HT-29 cells although in a lesser extent than MM. Interestingly, Lactobacillus plantarum CIDCA 83114 exerted a protective effect on the invasion of Caco-2 and HT-29 cells by S. flexneri. Regarding the pro-inflammatory response on HT-29 cells, S. flexneri infection induced a significant activation of the expression of interleukin 8 (IL-8), chemokine (C-C motif) ligand 20 (CCL20) and tumour necrosis factor alpha (TNF-α) encoding genes (P<0.05), whereas incubation of cells with MM did not induce the expression of any of the mediators assessed. Interestingly, pre-incubation of HT-29 monolayer with MM produced an inhibition of S. flexneri-induced IL-8, CCL20 and TNF-α mRNA expression. In order to gain insight on the effect of MM (or the individual strains) on this pro-inflammatory response, a series of experiments using a HT-29-NF-κB-hrGFP reporter system were performed. Pre-incubation of HT-29-NF-κB-hrGFP cells with MM significantly dampened Shigella-induced activation. Our results showed that the contribution of yeast strain Kluyveromyces marxianus CIDCA 8154 seems to be crucial in the observed effect. In conclusion, results presented in this study demonstrate that pre-treatment with a microbial mixture containing bacteria and yeasts isolated from kefir, resulted in inhibition of S. flexneri internalisation into human intestinal epithelial cells, along with the
Evacuated displacement compression molding
NASA Technical Reports Server (NTRS)
Heier, W. C. (Inventor)
1973-01-01
A process for molding long, thin-wall tubular bodies from thermosetting plastic molding compounds is described. The tubular bodies produced may have body lengths several times the diameters. The application of the process for manufacturing rocket engine cases and nozzles is discussed. The advantages of the system over other methods of circular tube manufacture are analyzed.
Mold and Indoor Air Quality in Schools
... Centers Mold Contact Us Share Mold and Indoor Air Quality in Schools Mold and Moisture in Schools Webinar ... premier resource on this issue is the Indoor Air Quality Tools for Schools kit. Our schools-related resources ...
The antimicrobial effects of chopped garlic in ground beef and raw meatball (ciğ köfte).
Aydin, Ali; Bostan, Kamil; Erkan, Mehmet Emin; Bingöl, Bariş
2007-03-01
This study was carried out to investigate the antimicrobial effects of chopped garlic in ground beef and raw meatball (çig köfte), which is a traditional food product eaten raw. Fresh minced ground beef and raw meatball batter prepared with traditional methods were separated into groups. Chopped and crushed garlic was added to each batch in order to reach various concentrations from 0% to 10%. The ground beef samples were stored at refrigerator and ambient temperatures. The raw meatball samples were only stored at room temperature. All samples were analyzed in order to determine the microbial counts at the 2(nd), 6(th), 12(th), and 24(th) hours of storage. Garlic addition decreased the microbial growth in some ground beef samples kept either at room temperature or in the refrigerator. However, microbial growth increased in some ground beef samples kept in similar conditions. The difference was found in samples kept in the refrigerator for 24 hours in terms of total aerobic mesophilic bacteria and coliform bacteria when garlic used at 10%. The effects of garlic on the microbial growth of both coliforms and Staphylococcus/Micrococcus in the samples kept at room temperature were increased. The yeast and mold counts in ground beef samples kept in any condition were not affected by garlic addition. However, the addition of garlic to the raw meatball mix decreased the microbial count, in terms of total aerobic mesophilic bacteria and yeast and mold counts, when the garlic was added at 5% or 10% (P < .05). The addition of 10% garlic to raw meatball caused a permanent decrease in yeast and mold count, unlike in ground beef. The results of this study indicate that the chopped garlic has a slowing-down effect on microbiological growth in ground meat depending on the garlic concentration, but this effect was not at an expected level even at the highest concentration, because potential antimicrobial agents in chopped garlic were probably insufficiently extracted.
Limyati, D A; Juniar, B L
1998-12-01
An examination on the microbiological quality of seven kinds of Jamu Gendong (JG) and their raw materials has been conducted according to the requirements of microbial contamination in traditional medicine, issued by the Department of Health of Indonesia in 1986. Samples of JG and their raw materials were taken from producers in three districts of Surabaya. The samples were subject to the following examinations: total plate count (TPC), MPN coliform, the enumeration of molds and yeasts, the presence or absence of Staphylococcus aureus, Salmonella and Vibrio. Each time the JG samples were taken from different producers together with their raw materials. The results of this investigation showed that most of the JG samples were heavily contaminated with bacteria, yeasts and molds. For bacteria, taken from the TPC results, their numbers were ranging from 7.7 x 10(2) microorganisms/ml to too many to count (TMTC). For yeasts and molds the numbers showed variations from 0 microorganisms/ml to TMTC. Contamination with Coliform in 1 ml of JG were ranged from 0 to > 2.4 x 10(6) microorganisms. In most of the samples pathogenic Staphylococci, Salmonella sp. and Vibrio sp. were not detected, so that a conclusion can be drawn that most of the contamination in JG are saprophytic, only a few pathogenic. The results also show that it is possible to have JG which fulfill the government's requirements. Similar results were obtained with the plant material constituents of JG such as rhizomes, leaves, herbs and fruits of Piper nigrum and Piper retrofractum, with the exception of Piper betle leaves and P. retrofractum fruits, both showing low contamination of Coliform bacteria. However, the fruits of Citrus aurantifolia and Morinda citrifolia were less contaminated, just like seeds of Oryza sativa, Parkia roxburghii, bulbs of Allium sativum and the pulp of Tamarindus indica. With these plant constituents of JG, it might be of interest to screen their antibacterial and antifungal
NASA Astrophysics Data System (ADS)
Bogdan, Janusz; Zarzyńska, Joanna; Pławińska-Czarnak, Joanna
2015-08-01
Nanotechnology contributes towards a more effective eradication of pathogens that have emerged in hospitals, veterinary clinics, and food processing plants and that are resistant to traditional drugs or disinfectants. Since new methods of pathogens eradication must be invented and implemented, nanotechnology seems to have become the response to that acute need. A remarkable achievement in this field of science was the creation of self-disinfecting surfaces that base on advanced oxidation processes (AOPs). Thus, the phenomenon of photocatalysis was practically applied. Among the AOPs that have been most studied in respect of their ability to eradicate viruses, prions, bacteria, yeasts, and molds, there are the processes of TiO2/UV and ZnO/UV. Titanium dioxide (TiO2) and zinc oxide (ZnO) act as photocatalysts, after they have been powdered to nanoparticles. Ultraviolet (UV) radiation is an agent that determines their excitation. Methods using photocatalytic properties of nanosized TiO2 and ZnO prove to be highly efficient in inactivation of infectious agents. Therefore, they are being applied on a growing scale. AOP-based disinfection is regarded as a very promising tool that might help overcome problems in food hygiene and public health protection. The susceptibility of infectious agents to photocatalylic processes can be generally arranged in the following order: viruses > prions > Gram-negative bacteria > Gram-positive bacteria > yeasts > molds.
Mold and Human Health: a Reality Check.
Borchers, Andrea T; Chang, Christopher; Eric Gershwin, M
2017-06-01
There are possibly millions of mold species on earth. The vast majority of these mold spores live in harmony with humans, rarely causing disease. The rare species that does cause disease does so by triggering allergies or asthma, or may be involved in hypersensitivity diseases such as allergic bronchopulmonary aspergillosis or allergic fungal sinusitis. Other hypersensitivity diseases include those related to occupational or domiciliary exposures to certain mold species, as in the case of Pigeon Breeder's disease, Farmer's lung, or humidifier fever. The final proven category of fungal diseases is through infection, as in the case of onchomycosis or coccidiomycosis. These diseases can be treated using anti-fungal agents. Molds and fungi can also be particularly important in infections that occur in immunocompromised patients. Systemic candidiasis does not occur unless the individual is immunodeficient. Previous reports of "toxic mold syndrome" or "toxic black mold" have been shown to be no more than media hype and mass hysteria, partly stemming from the misinterpreted concept of the "sick building syndrome." There is no scientific evidence that exposure to visible black mold in apartments and buildings can lead to the vague and subjective symptoms of memory loss, inability to focus, fatigue, and headaches that were reported by people who erroneously believed that they were suffering from "mycotoxicosis." Similarly, a causal relationship between cases of infant pulmonary hemorrhage and exposure to "black mold" has never been proven. Finally, there is no evidence of a link between autoimmune disease and mold exposure.
Interface conditions of two-shot molded parts
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kisslinger, Thomas, E-mail: thomas.kisslinger@pccl.at; Bruckmoser, Katharina, E-mail: katharina.bruckmoser@unileoben.ac.at; Resch, Katharina, E-mail: katharina.resch@unileoben.ac.at
2014-05-15
The focus of this work is on interfaces of two-shot molded parts. It is well known that e.g. material combination, process parameters and contact area structures show significant effects on the bond strength of multi-component injection molded parts. To get information about the bond strength at various process parameter settings and material combinations a test mold with core back technology was used to produce two-component injection molded tensile test specimens. At the core back process the different materials are injected consecutively, so each component runs through the whole injection molding cycle (two-shot process). Due to this consecutive injection molding processes,more » a cold interface is generated. This is defined as overmolding of a second melt to a solidified polymer preform. Strong interest lies in the way the interface conditions change during the adhesion formation between the individual components. Hence the interface conditions were investigated by computed tomography and Raman spectroscopy. By analyzing these conditions the understanding of the adhesion development during the multi-component injection molding was improved.« less
Kitagaki, Hiroshi; Kitamoto, Katsuhiko
2013-01-01
Sake is an alcoholic beverage of Japan, with a tradition lasting more than 1,300 years; it is produced from rice and water by fermenting with the koji mold Aspergillus oryzae and sake yeast Saccharomyces cerevisiae. Breeding research on sake yeasts was originally developed in Japan by incorporating microbiological and genetic research methodologies adopted in other scientific areas. Since the advent of a genetic paradigm, isolation of yeast mutants has been a dominant approach for the breeding of favorable sake yeasts. These sake yeasts include (a) those that do not form foams (produced by isolating a mutant that does not stick to foams, thus decreasing the cost of sake production); (b) those that do not produce urea, which leads to the formation of ethyl carbamate, a possible carcinogen (isolated by positive selection in a canavanine-, arginine-, and ornithine-containing medium); (c) those that produce an increased amount of ethyl caproate, an apple-like flavor (produced by isolating a mutant resistant to cerulenin, an inhibitor of fatty-acid synthesis); and (d) those that produce a decreased amount of pyruvate (produced by isolating a mutant resistant to an inhibitor of mitochondrial transport, thus decreasing the amount of diacetyl). Given that sake yeasts perform sexual reproduction, sporulation and mating are potent approaches for their breeding. Recently, the genome sequences of sake yeasts have been determined and made publicly accessible. By utilizing this information, the quantitative trait loci (QTLs) for the brewing characteristics of sake yeasts have been identified, which paves a way to DNA marker-assisted selection of the mated strains. Genetic engineering technologies for experimental yeast strains have recently been established by academic groups, and these technologies have also been applied to the breeding of sake yeasts. Sake yeasts whose genomes have been modified with these technologies correspond to genetically modified organisms (GMOs
Rotationally Molded Liquid Crystalline Polymers
NASA Technical Reports Server (NTRS)
Rogers, Martin; Scribben, Eric; Baird, Donald; Hulcher, Bruce
2002-01-01
Rotational molding is a unique process for producing hollow plastic parts. Rotational molding offers low cost tooling and can produce very large parts with complicated shapes. Products made by rotational molding include water tanks with capacities up to 20,000 gallons, truck bed liners, playground equipment, air ducts, Nylon fuel tanks, pipes, toys, stretchers, kayaks, pallets, and many others. Thermotropic liquid crystalline polymers are an important class of engineering resins employed in a wide variety of applications. Thermotropic liquid crystalline polymers resins are composed of semirigid, nearly linear polymeric chains resulting in an ordered mesomorphic phase between the crystalline solid and the isotropic liquid. Ordering of the rigid rod-like polymers in the melt phase yields microfibrous, self-reinforcing polymer structures with outstanding mechanical and thermal properties. Rotational molding of liquid crystalline polymer resins results in high strength and high temperature hollow structures useful in a variety of applications. Various fillers and reinforcements can potentially be added to improve properties of the hollow structures. This paper focuses on the process and properties of rotationally molded liquid crystalline polymers. This paper will also highlight the interactions between academia and small businesses in developing new products and processes.
Rao, Carol Y; Riggs, Margaret A; Chew, Ginger L; Muilenberg, Michael L; Thorne, Peter S; Van Sickle, David; Dunn, Kevin H; Brown, Clive
2007-03-01
In August and September 2005, Hurricanes Katrina and Rita caused breeches in the New Orleans, LA, levee system, resulting in catastrophic flooding. The city remained flooded for several weeks, leading to extraordinary mold growth in homes. To characterize the potential risks of mold exposures, we measured airborne molds and markers of molds and bacteria in New Orleans area homes. In October 2005, we collected air samples from 5 mildly water-damaged houses, 15 moderately to heavily water-damaged houses, and 11 outdoor locations. The air filters were analyzed for culturable fungi, spores, (1-->3,1-->6)-beta-D-glucans, and endotoxins. Culturable fungi were significantly higher in the moderately/heavily water-damaged houses (geometric mean=67,000 CFU/m3) than in the mildly water-damaged houses (geometric mean=3,700 CFU/m3) (P=0.02). The predominant molds found were Aspergillus niger, Penicillium spp., Trichoderma, and Paecilomyces. The indoor and outdoor geometric means for endotoxins were 22.3 endotoxin units (EU)/m3 and 10.5 EU/m3, respectively, and for (1-->3,1-->6)-beta-D-glucans were 1.7 microg/m3 and 0.9 microg/m3, respectively. In the moderately/heavily water-damaged houses, the geometric means were 31.3 EU/m3 for endotoxins and 1.8 microg/m3 for (1-->3,1-->6)-beta-D-glucans. Molds, endotoxins, and fungal glucans were detected in the environment after Hurricanes Katrina and Rita in New Orleans at concentrations that have been associated with health effects. The species and concentrations were different from those previously reported for non-water-damaged buildings in the southeastern United States.
Pressurized Shell Molds For Metal-Matrix Composites
NASA Technical Reports Server (NTRS)
Kashalikar, Uday K.; Lusignea, Richard N.; Cornie, James
1993-01-01
Balanced-pressure molds used to make parts in complex shapes from fiber-reinforced metal-matrix composite materials. In single step, molding process makes parts in nearly final shapes; only minor finishing needed. Because molding pressure same on inside and outside, mold does not have to be especially strong and can be made of cheap, nonstructural material like glass or graphite. Fibers do not have to be cut to conform to molds. Method produces parts with high content of continuous fibers. Parts stiff but light in weight, and coefficients of thermal expansion adjusted. Parts resistant to mechanical and thermal fatigue superior to similar parts made by prior fabrication methods.
Injection molding ceramics to high green densities
NASA Technical Reports Server (NTRS)
Mangels, J. A.; Williams, R. M.
1983-01-01
The injection molding behavior of a concentrated suspension of Si powder in wax was studied. It was found that the injection molding behavior was a function of the processing techniques used to generate the powder. Dry ball-milled powders had the best molding behavior, while air classified and impact-milled powders demonstrated poorer injection moldability. The relative viscosity of these molding batches was studied as a function of powder properties: distribution shape, surface area, packing density, and particle morphology. The experimental behavior, in all cases, followed existing theories. The relative viscosity of an injection molding composition composed of dry ball-milled powders could be expressed using Farris' relation.
The presence of Enterococcus, coliforms and E. coli in a commercial yeast manufacturing process.
O'Brien, S S; Lindsay, D; von Holy, A
2004-07-01
This study evaluated a typical commercial yeast manufacturing process for bacterial contamination. Product line samples of a commercial yeast manufacturing process and the corresponding seed yeast manufacturing process were obtained upstream from the final compressed and dry yeast products. All samples were analysed before (non-PI) and after preliminary incubation (PI) at 37 degrees C for 24 h. The PI procedure was incorporated for amplification of bacterial counts below the lower detection limit. Enterococcus, coliform and Escherichia coli counts were quantified by standard pour-plate techniques using selective media. Presence at all stages and progressive increases in counts of Enterococcus, coliforms and E. coli during processing in the commercial manufacturing operation suggested that the primary source of contamination of both compressed and dry yeast with these bacteria was the seed yeast manufacturing process and that contamination was amplified throughout the commercial yeast manufacturing process. This was confirmed by surveys of the seed yeast manufacturing process which indicated that contamination of the seed yeast with Enterococcus, coliforms and E. coli occurred during scale up of seed yeast biomass destined as inoculum for the commercial fermentation.
Polypropionate lactones of deoxysugars glycosides from slime mold Lycogala epidendrum.
Rezanka, Tomás; Dvoráková, Radmila
2003-08-01
Two novel polypropionate lactone glycosides (1 and 2, i.e. lycogalinosides A and B) were isolated from the slime mold Lycogala epidendrum. Their structures, including the absolute configurations of the hydroxyl and methyls groups, were determined by means of extensive spectroscopic data such as mass, IR, UV, and 1D and 2D NMR spectra and chemical degradation followed by spectroscopic and chromatographic analysis. Compounds 1 and 2 are unique in structure containing a 2-deoxy-alpha-L-fucopyranosyl-(1-4)-6-deoxy-beta-D-gulopyranosyl unit and a beta-D-olivopyranosyl-(1-4)-beta-D-fucopyranosyl unit, respectively, and showed growth inhibitory activities against Gram-positive bacteria.
Toxic mold: phantom risk vs science.
Chapman, Jean A; Terr, Abba I; Jacobs, Robert L; Charlesworth, Ernest N; Bardana, Emil J
2003-09-01
To review the available literature on the subject of fungi (molds) and their potential impact on health and to segregate information that has scientific validity from information that is yet unproved and controversial. This review represents a synthesis of the available literature in this area with the authors' collective experience with many patients presenting with complaints of mold-related illness. Pertinent scientific investigation on toxic mold issues and previously published reviews on this and related subjects that met the educational objectives were critically reviewed. Indoor mold growth is variable, and its discovery in a building does not necessarily mean occupants have been exposed. Human response to fungal antigens may induce IgE or IgG antibodies that connote prior exposure but not necessarily a symptomatic state. Mold-related disease has been discussed in the framework of noncontroversial and controversial disorders. When mold-related symptoms occur, they are likely the result of transient irritation, allergy, or infection. Building-related illness due to mycotoxicosis has never been proved in the medical literature. Prompt remediation of water-damaged material and infrastructure repair should be the primary response to fungal contamination in buildings.
Castable plastic mold with electroplatable base
Domeier, Linda A.; Morales, Alfredo M.; Gonzales, Marcela G.; Keifer, Patrick M.
2004-01-20
A sacrificial plastic mold having an electroplatable backing is provided as are methods of making such a mold via the infusion of a castable liquid formulation through a porous metal substrate (sheet, screen, mesh or foam) and into the features of a micro-scale master mold. Upon casting and demolding, the porous metal substrate is embedded within the cast formulation and projects a plastic structure with features determined by the mold tool. The plastic structure provides a sacrificial plastic mold mechanically bonded to the porous metal substrate, which provides a conducting support suitable for electroplating either contiguous or non-contiguous metal replicates. After electroplating and lapping, the sacrificial plastic can be dissolved, leaving the desired metal structure bonded to the porous metal substrate. Optionally, the electroplated structures may be debonded from the porous substrate by selective dissolution of the porous substrate or a coating thereon.
Pankowski, Jarosław A.; Puckett, Stephanie M.
2016-01-01
We have assembled a collection of 13 psychrophilic ligA alleles that can serve as genetic elements for engineering mesophiles to a temperature-sensitive (TS) phenotype. When these ligA alleles were substituted into Francisella novicida, they conferred a TS phenotype with restrictive temperatures between 33 and 39°C. When the F. novicida ligA hybrid strains were plated above their restrictive temperatures, eight of them generated temperature-resistant variants. For two alleles, the mutations that led to temperature resistance clustered near the 5′ end of the gene, and the mutations increased the predicted strength of the ribosome binding site at least 3-fold. Four F. novicida ligA hybrid strains generated no temperature-resistant variants at a detectable level. These results suggest that multiple mutations are needed to create temperature-resistant variants of these ligA gene products. One ligA allele was isolated from a Colwellia species that has a maximal growth temperature of 12°C, and this allele supported growth of F. novicida only as a hybrid between the psychrophilic and the F. novicida ligA genes. However, the full psychrophilic gene alone supported the growth of Salmonella enterica, imparting a restrictive temperature of 27°C. We also tested two ligA alleles from two Pseudoalteromonas strains for their ability to support the viability of a Saccharomyces cerevisiae strain that lacked its essential gene, CDC9, encoding an ATP-dependent DNA ligase. In both cases, the psychrophilic bacterial alleles supported yeast viability and their expression generated TS phenotypes. This collection of ligA alleles should be useful in engineering bacteria, and possibly eukaryotic microbes, to predictable TS phenotypes. PMID:26773080
INDOOR MOLDS AND ALLERGIC POTENTIAL
Rationale: Damp/moldy environments have been associated with asthma exacerbation, but mold¿s role in allergic asthma induction is less clear. Recently, 5 molds were statistically associated with water-damaged asthmatic homes in the Cleveland area. The asthma exacerbation...
Lactic acid bacteria in the quality improvement and depreciation of wine.
Lonvaud-Funel, A
1999-01-01
The winemaking process includes two main steps: lactic acid bacteria are responsible for the malolactic fermentation which follows the alcoholic fermentation by yeasts. Both types of microorganisms are present on grapes and on cellar equipment. Yeasts are better adapted to growth in grape must than lactic acid bacteria, so the alcoholic fermentation starts quickly. In must, up to ten lactic acid bacteria species can be identified. They belong to the Lactobacillus, Pediococcus, Leuconostoc and Oenococcus genera. Throughout alcoholic fermentation, a natural selection occurs and finally the dominant species is O. oeni, due to interactions between yeasts and bacteria and between bacteria themselves. After bacterial growth, when the population is over 10(6) CFU/ml, malolactic transformation is the obvious change in wine composition. However, many other substrates can be metabolized. Some like remaining sugars and citric acid are always assimilated by lactic acid bacteria, thus providing them with energy and carbon. Other substrates such as some amino acids may be used following pathways restricted to strains carrying the adequate enzymes. Some strains can also produce exopolysaccharides. All these transformations greatly influence the sensory and hygienic quality of wine. Malic acid transformation is encouraged because it induces deacidification. Diacetyl produced from citric acid is also helpful to some extent. Sensory analyses show that many other reactions change the aromas and make malolactic fermentation beneficial, but they are as yet unknown. On the contrary, an excess of acetic acid, the synthesis of glucane, biogenic amines and precursors of ethylcarbamate are undesirable. Fortunately, lactic acid bacteria normally multiply in dry wines; moreover some of these activities are not widespread. Moreover, the most striking trait of wine lactic acid bacteria is their capacity to adapt to a hostile environment. The mechanisms for this are not yet completely elucidated
Dual phylogenetic staining protocol for simultaneous analysis of yeast and bacteria in artworks
NASA Astrophysics Data System (ADS)
González-Pérez, Marina; Brinco, Catarina; Vieira, Ricardo; Rosado, Tânia; Mauran, Guilhem; Pereira, António; Candeias, António; Caldeira, Ana Teresa
2017-02-01
The detection and analysis of metabolically active microorganisms are useful to determine those directly involved in the biodeterioration of cultural heritage (CH). Fluorescence in situ hybridization with oligonucleotide probes targeted at rRNA (RNA-FISH) has demonstrated to be a powerful tool for signaling them. However, more efforts are required for the technique to become a vital tool for the analysis of CH's microbiological communities. Simultaneous analysis of microorganisms belonging to different kingdoms, by RNA-FISH in-suspension approach, could represent an important progress: it could open the door for the future use of the technique to analyze the microbial communities by flow cytometry, which has shown to be a potent tool in environmental microbiology. Thus, in this work, various already implemented in-suspension RNA-FISH protocols for ex situ analysis of yeast and bacteria were investigated and adapted for allowing the simultaneous detection of these types of microorganisms. A deep investigation of the factors that can affect the results was carried out, focusing particular attention on the selection of the fluorochromes used for labelling the probe set. The resultant protocol, involving the use of EUK516-6-FAM/EUB338-Cy3 probes combination, was validated using artificial consortia and gave positive preliminary results when applied in samples from a real case study: the Paleolithic archaeological site of Escoural Cave (Alentejo, Portugal). This approach represents the first dual-staining RNA-FISH in-suspension protocol developed and applied for the simultaneous investigation of CH biodeteriogenic agents belonging to different kingdoms.
Study of parameters in precision optical glass molding
NASA Astrophysics Data System (ADS)
Ni, Ying; Wang, Qin-hua; Yu, Jing-chi
2010-10-01
Precision glass compression molding is an attractive approach to manufacture small precision optics in large volume over traditional manufacturing techniques because of its advantages such as lower cost, faster time to market and being environment friendly. In order to study the relationship between the surface figures of molded lenses and molding process parameters such as temperature, pressure, heating rate, cooling rate and so on, we present some glass compression molding experiments using same low Tg (transition temperature) glass material to produce two different kinds of aspheric lenses by different molding process parameters. Based on results from the experiments, we know the major factors influencing surface figure of molded lenses and the changing range of these parameters. From the knowledge we could easily catch proper molding parameters which are suitable for aspheric lenses with diameter from 10mm to 30mm.
Kuwaki, Shinsuke; Nakajima, Nobuyoshi; Tanaka, Hidehiko; Ishihara, Kohji
2012-01-01
A plant-based paste fermented by lactic acid bacteria and yeast (fermented paste) was made from various plant materials. The paste was made of fermented food by applying traditional food-preservation techniques, that is, fermentation and sugaring. The fermented paste contained major nutrients (carbohydrates, proteins, and lipids), 18 kinds of amino acids, and vitamins (vitamin A, B1, B2, B6, B12, E, K, niacin, biotin, pantothenic acid, and folic acid). It contained five kinds of organic acids, and a large amount of dietary fiber and plant phytochemicals. Sucrose from brown sugar, used as a material, was completely resolved into glucose and fructose. Some physiological functions of the fermented paste were examined in vitro. It was demonstrated that the paste possessed antioxidant, antihypertensive, antibacterial, anti-inflammatory, anti-allergy and anti-tyrosinase activities in vitro. It was thought that the fermented paste would be a helpful functional food with various nutrients to help prevent lifestyle diseases. PMID:25114554
Rotational molding of pultruded profiles reinforced polyethylene
NASA Astrophysics Data System (ADS)
Greco, Antonio; Maffezzoli, Alfonso; Romano, Giorgio
2014-05-01
The aim of this paper is the production of fiber reinforced LLDPE components by rotational molding. To this purpose, a process upgrade was developed, for the incorporation of pultruded tapes in the rotational molding cycle. Pultruded tapes, made of 50% by weight of glass fibers dispersed in a high density polyethylene(HDPE) matrix, were glued on the internal surface of a cubic mold, and rotational molding process was run using the same processing conditions used for conventional LLDPE processing. During processing, melting of LLDPE powders and of HDPE allowed to incorporate the tapes inside rotational molded LLDPE. The glass fiber reinforced prototypes were characterized in terms of mechanical properties. Plate bending tests were performed on the square faces extracted from the rotational molded product. The rotational molding products were also subjected to internal hydrostatic pressure tests up to 10 bar. In any case, no failure of the cubic samples was observed. In both cases, it was found that addition of a single pultruded strips, which corresponds to addition of about 0.6% by weight of glass fibers, involved an increase of the stiffness of the faces by about 25%.
Method for encapsulating hazardous wastes using a staged mold
Unger, Samuel L.; Telles, Rodney W.; Lubowitz, Hyman R.
1989-01-01
A staged mold and method for stabilizing hazardous wastes for final disposal by molding an agglomerate of the hazardous wastes and encapsulating the agglomerate. Three stages are employed in the process. In the first stage, a first mold body is positioned on a first mold base, a mixture of the hazardous wastes and a thermosetting plastic is loaded into the mold, the mixture is mechanically compressed, heat is applied to cure the mixture to form a rigid agglomerate, and the first mold body is removed leaving the agglomerate sitting on the first mold base. In the second stage, a clamshell second mold body is positioned around the agglomerate and the first mold base, a powdered thermoplastic resin is poured on top of the agglomerate and in the gap between the sides of the agglomerate and the second mold body, the thermoplastic is compressed, heat is applied to melt the thermoplastic, and the plastic is cooled jacketing the agglomerate on the top and sides. In the third stage, the mold with the jacketed agglomerate is inverted, the first mold base is removed exposing the former bottom of the agglomerate, powdered thermoplastic is poured over the former bottom, the first mold base is replaced to compress the thermoplastic, heat is applied to melt the new thermoplastic and the top part of the jacket on the sides, the plastic is cooled jacketing the bottom and fusing with the jacketing on the sides to complete the seamless encapsulation of the agglomerate.
Yeast diversity of sourdoughs and associated metabolic properties and functionalities.
De Vuyst, Luc; Harth, Henning; Van Kerrebroeck, Simon; Leroy, Frédéric
2016-12-19
Together with acidifying lactic acid bacteria, yeasts play a key role in the production process of sourdough, where they are either naturally present or added as a starter culture. Worldwide, a diversity of yeast species is encountered, with Saccharomyces cerevisiae, Candida humilis, Kazachstania exigua, Pichia kudriavzevii, Wickerhamomyces anomalus, and Torulaspora delbrueckii among the most common ones. Sourdough-adapted yeasts are able to withstand the stress conditions encountered during their growth, including nutrient starvation as well as the effects of acidic, oxidative, thermal, and osmotic stresses. From a technological point of view, their metabolism primarily contributes to the leavening and flavour of sourdough products. Besides ethanol and carbon dioxide, yeasts can produce metabolites that specifically affect flavour, such as organic acids, diacetyl, higher alcohols from branched-chain amino acids, and esters derived thereof. Additionally, several yeast strains possess functional properties that can potentially lead to nutritional and safety advantages. These properties encompass the production of vitamins, an improvement of the bioavailability of phenolic compounds, the dephosphorylation of phytic acid, the presence of probiotic potential, and the inhibition of fungi and their mycotoxin production. Strains of diverse species are new candidate functional starter cultures, offering opportunities beyond the conventional use of baker's yeast. Copyright © 2016 Elsevier B.V. All rights reserved.
Page, Natalie; González-Buesa, Jaime; Ryser, Elliot T; Harte, Janice; Almenar, Eva
2016-02-02
Onions are one of the most widely utilized vegetables worldwide, with demand for fresh-cut onions steadily increasing. Due to heightened safety concerns and consumer demand, the implications of sanitizing and packaging on fresh-cut onion safety and quality need to be better understood. The objective of this study was to investigate the effect of produce sanitizers, in-package atmospheres, and their interactions on the growth of Salmonella Typhimurium, mesophilic aerobic bacteria, yeast and mold, and the physico-chemical quality of diced onions to determine the best sanitizer and in-package atmosphere combination for both safety and quality. Diced onions were inoculated or not with S. Typhimurium, sanitized in sodium hypochlorite, peroxyacetic acid, or liquid chlorine dioxide, and then packaged in either polylactic acid bags containing superatmospheric O2, elevated CO2/reduced O2, or air, or in polyethylene terephthalate snap-fit containers. Throughout 14 days of storage at 7 °C, packaged diced onions were assessed for their safety (S. Typhimurium), and quality (mesophilic aerobic bacteria, yeasts and molds, physico-chemical analyses, and descriptive and consumer acceptance sensory panels). While sanitizer affected (P<0.05) fewer parameters (S. Typhimurium, mesophiles, yeasts and molds, headspace CO2, weight loss, and pH), in-package atmosphere had a significant (P<0.05) effect on all parameters evaluated. Two-way interactions between sanitizer and atmosphere that affected S. Typhimurium and pH were identified whereas 3-way interactions (sanitizer, atmosphere and time) were only observed for headspace CO2. Sodium hypochlorite and elevated CO2/reduced O2 was the best sanitizer and in-package atmosphere combination for enhancing the safety and quality of packaged diced onions. In addition, this combination led to diced onions acceptable for purchase after 2 weeks of storage by trained and consumer panels. Copyright © 2015 Elsevier B.V. All rights reserved.
Direct micropatterning of polymer materials by ice mold
NASA Astrophysics Data System (ADS)
Yu, Xinhong; Xing, Rubo; Luan, Shifang; Wang, Zhe; Han, Yanchun
2006-10-01
Micropatterning of functional polymer materials by micromolding in capillaries (MIMIC) with ice mold is reported in this paper. Ice mold was selected due to its thaw or sublimation. Thus, the mold can be easily removed. Furthermore, the polymer solution did not react with, swell, or adhere to the ice mold, so the method is suitable for many kinds of materials (such as P3HT, PMMA Alq 3/PVK, PEDOT: PSS, PS, P2VP, etc.). Freestanding polymer microstructures, binary polymer pattern, and microchannels have been fabricated by the use of ice mold freely.
Heavy metals alter the electrokinetic properties of bacteria, yeasts, and clay minerals.
Collins, Y E; Stotzky, G
1992-01-01
The electrokinetic patterns of four bacterial species (Bacillus subtilis, Bacillus megaterium, Pseudomonas aeruginosa, and Agrobacterium radiobacter), two yeasts (Saccharomyces cerevisiae and Candida albicans), and two clay minerals (montmorillonite and kaolinite) in the presence of the chloride salts of the heavy metals, Cd, Cr, Cu, Hg, Ni, Pb, and Zn, and of Na and Mg were determined by microelectrophoresis. The cells and kaolinite were net negatively charged at pH values above their isoelectric points (pI) in the presence of Na, Mg, Hg, and Pb at an ionic strength (mu) of 3 x 10(-4); montmorillonite has no pI and was net negatively charged at all pH values in the presence of these metals. However, the charge of some bacteria, S. cerevisiae, and kaolinite changed to a net positive charge (charge reversal) in the presence of Cd, Cr, Cu, Ni, and Zn at pH values above 5.0 (the pH at which charge reversal occurred differed with the metal) and then, at higher pH values, again became negative. The charge of the bacteria and S. cerevisiae also reversed in solutions of Cu and Ni with a mu of greater than 3 x 10(-4), whereas there was no reversal in solutions with a mu of less than 3 x 10(-4). The clays became net positively charged when the mu of Cu was greater than 3 x 10(-4) and that of Ni was greater than 1.5 x 10(-4). The charge of the cells and clays also reversed in solutions containing both Mg and Ni or both Cu and Ni (except montmorillonite) but not in solutions containing both Mg and Cu (except kaolinite) (mu = 3 x 10(-4)). The pIs of the cells in the presence of the heavy metals were at either higher or lower pH values than in the presence of Na and Mg. Exposure of the cells to the various metals at pH values from 2 to 9 for the short times (ca. 10 min) required to measure the electrophoretic mobility did not affect their viability. The specific adsorption on the cells and clays of the hydrolyzed species of some of the heavy metals that formed at higher p
Influence of mold surface temperature on polymer part warpage in rapid heat cycle molding
NASA Astrophysics Data System (ADS)
Berger, G. R.; Pacher, G. A.; Pichler, A.; Friesenbichler, W.; Gruber, D. P.
2014-05-01
Dynamic mold surface temperature control was examined for its influence on the warpage. A test mold, featuring two different rapid heat cycle molding (RHCM) technologies was used to manufacture complex plate-shaped parts having different ribs, varying thin-wall regions, and both, circular and rectangular cut-outs. The mold's nozzle side is equipped with the areal heating and cooling technology BFMOLD®, where the heating/cooling channels are replaced by a ball-filled slot near the cavity surface flooded through with hot and cold water sequentially. Two local electrical ceramic heating elements are installed into the mold's ejection side. Based on a 23 full-factorial design of experiments (DoE) plan, varying nozzle temperature (Tnozzle), rapid heat cycle molding temperature (TRHCM) and holding pressure (pn), specimens of POM were manufactured systematically. Five specimens were examined per DoE run. The resulting warpage was measured at 6 surface line scans per part using the non-contact confocal topography system FRT MicroProf®. Two warpage parameters were calculated, the curvature of a 2nd order approximation a, and the vertical deflection at the profile center d. Both, the influence strength and the acting direction of the process parameters and their interactions on a and d were calculated by statistical analysis. Linear mathematical process models were determined for a and d to predict the warpage as a function of the process parameter settings. Finally, an optimum process setting was predicted, based on the process models and Microsoft Excel GRG solver. Clear and significant influences of TRHCM, pn, Tnozzle, and the interaction of TRHCM and pn were determined. While TRHCM was dominant close to the gate, pn became more effective as the flow length increased.
Biotechnology, Industry Study, Spring 2009
2009-01-01
roots to zymotechnology ( fermentation ), practiced by the Sumerians and Babylonians as early as 6,000 B.C.3 This core technology expanded to other...applications, including using yeast to make bread, bacteria to derive yogurt , and molds to make cheeses.4 Early biotechnology endeavors included...alcohol or ethanol. This first generation process uses the fermentation of sugars or starches to produce ethanol but is dependent upon corn, a
Yeast: An Overlooked Component of Bactrocera tryoni (Diptera: Tephritidae) Larval Gut Microbiota.
Deutscher, Ania T; Reynolds, Olivia L; Chapman, Toni A
2017-02-01
Yeasts, often in hydrolyzed form, are key ingredients in the larval and adult diets of tephritid fruit fly colonies. However, very little is known about the presence or role of yeasts in the diets of tephritid fruit flies in nature. Previous studies have identified bacteria but not detected yeasts in the gut of Queensland fruit fly, Bactrocera tryoni (Froggatt), one of Australia's most economically damaging insect pests of horticultural crops and of significant biosecurity concern domestically and internationally. Here we demonstrate that cultivable yeasts are commonly found in the gut of B. tryoni larvae from fruit hosts. Analysis of the ITS1, 5.8S rRNA gene, and ITS2 sequences of randomly selected isolates identified yeasts and yeast-like fungi of the genera Aureobasidium, Candida, Cryptococcus, Hanseniaspora, Pichia, and Starmerella. The prevalence of these yeasts in fruits suggests that larvae consume the yeasts as part of their diet. This work highlights that yeasts should be considered in future tephritid larval gut microbiota studies. Understanding tephritid-microbial symbiont interactions will lead to improvements in artificial diets and the quality of mass-reared tephritids for the sterile insect technique. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Paraphyly and (yeast) classification.
Lachance, Marc-André
2016-12-01
Yeast systematics has wholeheartedly embraced the phylogenetic approach. Central to this has been the unspoken convention that taxa at all ranks be strictly monophyletic. This can result in a proliferation of small genera and instances of nomenclatural instability, counter to the expected benefit of phylogenetic systematics. But the literature abounds with examples, at all taxonomic levels, where paraphyly is a reality that can no longer be ignored. The very concepts of Bacteria or Archaea, under the constraint of monophyly, are in peril. It is therefore desirable to effect a shift in practices that will recognize the existence of paraphyletic taxa.
Devi, Apramita; Archana, Kodira Muthanna; Bhavya, Panikuttria Kuttappa; Anu-Appaiah, Konerira Aiyappaa
2018-02-01
Co-inoculation has been adapted by many wine-producing countries because it enhances the success of malolactic fermentation and reduces the fermentation cost, as well as time. However, wine phenolics have been sparsely highlighted during co-inoculation, even though polyphenols are an important parameter affecting wine colour, astringency and aroma. In the present study, we investigated the impact of co-inoculation on non-anthocyanin polyphenol profile for two different grape varieties. Co-inoculation of native yeast strain (AAV2) along with Oenococcus oeni was adapted for Cabernet Sauvignon and Shiraz wine. It was observed that the co-inoculation had minimal yet significant impact on the phenolic composition of wines for both the grape varieties. Color loss, as well as fruity aroma development, was observed in co-inoculated wines. The wines were on a par with the commercial wine, as well as wines without malolactic fermentation, in terms of phenolic compounds and overall organoleptic acceptance. Principal component analysis and hierarchical cluster analysis further suggested that the varietal influence on phenolic composition was dominating compared to inoculation strategies. Among the varieties, the inoculation strategies have significantly influenced the Cabernet wines compared to Shiraz wines. The results of the present study demonstrate that the phenolic compounds are not drastically affected by metabolic activities of malolactic bacteria during co-inoculation and, hence, are equally suitable for wine fermentation. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Anderson, J.W.; Miley, F.; Pritchard, W.C.
1962-02-27
A coated mold for casting plutonium comprises a mold base portion of a material which remains solid and stable at temperatures as high as the pouring temperature of the metal to be cast and having a thin coating of the order of 0.005 inch thick on the interior thereof. The coating is composed of finely divided calcium fluoride having a particle size of about 149 microns. (AEC)
Shorter, Caroline; Crane, Julian; Pierse, Nevil; Barnes, Phillipa; Kang, Janice; Wickens, Kristin; Douwes, Jeroen; Stanley, Thorsten; Täubel, Martin; Hyvärinen, Anne; Howden-Chapman, Philippa
2018-01-01
Evidence is accumulating that indoor dampness and mold are associated with the development of asthma. The underlying mechanisms remain unknown. New Zealand has high rates of both asthma and indoor mold and is ideally placed to investigate this. We conducted an incident case-control study involving 150 children with new-onset wheeze, aged between 1 and 7 years, each matched to two control children with no history of wheezing. Each participant's home was assessed for moisture damage, condensation, and mold growth by researchers, an independent building assessor and parents. Repeated measures of temperature and humidity were made, and electrostatic dust cloths were used to collect airborne microbes. Cloths were analyzed using qPCR. Children were skin prick tested for aeroallergens to establish atopy. Strong positive associations were found between observations of visible mold and new-onset wheezing in children (adjusted odds ratios ranged between 1.30 and 3.56; P ≤ .05). Visible mold and mold odor were consistently associated with new-onset wheezing in a dose-dependent manner. Measurements of qPCR microbial levels, temperature, and humidity were not associated with new-onset wheezing. The association between mold and new-onset wheeze was not modified by atopic status, suggesting a non-allergic association. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Schoeman, H; Vivier, M A; Du Toit, M; Dicks, L M; Pretorius, I S
1999-06-15
The excessive use of sulphur dioxide and other chemical preservatives in wine, beer and other fermented food and beverage products to prevent the growth of unwanted microbes holds various disadvantages for the quality of the end-products and is confronted by mounting consumer resistance. The objective of this study was to investigate the feasibility of controlling spoilage bacteria during yeast-based fermentations by engineering bactericidal strains of Saccharomyces cerevisiae. To test this novel concept, we have successfully expressed a bacteriocin gene in yeast. The pediocin operon of Pediococcus acidilactici PAC1.0 consists of four clustered genes, namely pedA (encoding a 62 amino acid precursor of the PA-1 pediocin), pedB (encoding an immunity factor), pedC (encoding a PA-1 transport protein) and pedD (encoding a protein involved in the transport and processing of PA-1). The pedA gene was inserted into a yeast expression/secretion cassette and introduced as a multicopy episomal plasmid into a laboratory strain (Y294) of S. cerevisiae. Northern blot analysis confirmed that the pedA structural gene in this construct (ADH1P-MFa1S-pedA-ADH1T, designated PED1), was efficiently expressed under the control of the yeast alcohol dehydrogenase I gene promoter (ADH1P) and terminator (ADH1T). Secretion of the PED1-encoded pediocin PA-1 was directed by the yeast mating pheromone alpha-factor's secretion signal (MFa1S). The presence of biologically active antimicrobial peptides produced by the yeast transformants was indicated by agar diffusion assays against sensitive indicator bacteria (e.g. Listeria monocytogenes B73). Protein analysis indicated the secreted heterologous peptide to be approximately 4.6 kDa, which conforms to the expected size. The heterologous peptide was present at relatively low levels in the yeast supernatant but pediocin activity was readily detected when intact yeast colonies were used in sensitive strain overlays. This study could lead to the
Porous media heat transfer for injection molding
Beer, Neil Reginald
2016-05-31
The cooling of injection molded plastic is targeted. Coolant flows into a porous medium disposed within an injection molding component via a porous medium inlet. The porous medium is thermally coupled to a mold cavity configured to receive injected liquid plastic. The porous medium beneficially allows for an increased rate of heat transfer from the injected liquid plastic to the coolant and provides additional structural support over a hollow cooling well. When the temperature of the injected liquid plastic falls below a solidifying temperature threshold, the molded component is ejected and collected.
Code of Federal Regulations, 2010 CFR
2010-07-01
... Existing Open Molding Sources, New Open Molding Sources Emitting Less Than 100 TPY of HAP, and New and... CATEGORIES National Emissions Standards for Hazardous Air Pollutants: Reinforced Plastic Composites... Existing Open Molding Sources, New Open Molding Sources Emitting Less Than 100 TPY of HAP, and New and...
Microcellular nanocomposite injection molding process
Mingjun Yuan; Lih-Sheng Turng; Rick Spindler; Daniel Caulfield; Chris Hunt
2003-01-01
This study aims to explore the processing benefits and property improvements of combining nanocomposites with microcellular injection molding. The molded parts produced based on the Design of Experiments (DOE) matrices were subjected to tensile testing, impact testing, and Scanning Electron Microscope (SEM), Transmission Electron Microscope (TEM), Dynamic Mechanical...
Rao, Carol Y.; Riggs, Margaret A.; Chew, Ginger L.; Muilenberg, Michael L.; Thorne, Peter S.; Van Sickle, David; Dunn, Kevin H.; Brown, Clive
2007-01-01
In August and September 2005, Hurricanes Katrina and Rita caused breeches in the New Orleans, LA, levee system, resulting in catastrophic flooding. The city remained flooded for several weeks, leading to extraordinary mold growth in homes. To characterize the potential risks of mold exposures, we measured airborne molds and markers of molds and bacteria in New Orleans area homes. In October 2005, we collected air samples from 5 mildly water-damaged houses, 15 moderately to heavily water-damaged houses, and 11 outdoor locations. The air filters were analyzed for culturable fungi, spores, (1→3,1→6)-β-d-glucans, and endotoxins. Culturable fungi were significantly higher in the moderately/heavily water-damaged houses (geometric mean = 67,000 CFU/m3) than in the mildly water-damaged houses (geometric mean = 3,700 CFU/m3) (P = 0.02). The predominant molds found were Aspergillus niger, Penicillium spp., Trichoderma, and Paecilomyces. The indoor and outdoor geometric means for endotoxins were 22.3 endotoxin units (EU)/m3 and 10.5 EU/m3, respectively, and for (1→3,1→6)-β-d-glucans were 1.7 μg/m3 and 0.9 μg/m3, respectively. In the moderately/heavily water-damaged houses, the geometric means were 31.3 EU/m3 for endotoxins and 1.8 μg/m3 for (1→3,1→6)-β-d-glucans. Molds, endotoxins, and fungal glucans were detected in the environment after Hurricanes Katrina and Rita in New Orleans at concentrations that have been associated with health effects. The species and concentrations were different from those previously reported for non-water-damaged buildings in the southeastern United States. PMID:17209066
The BAR Domain Proteins: Molding Membranes in Fission, Fusion, and Phagy
Ren, Gang; Vajjhala, Parimala; Lee, Janet S.; Winsor, Barbara; Munn, Alan L.
2006-01-01
The Bin1/amphiphysin/Rvs167 (BAR) domain proteins are a ubiquitous protein family. Genes encoding members of this family have not yet been found in the genomes of prokaryotes, but within eukaryotes, BAR domain proteins are found universally from unicellular eukaryotes such as yeast through to plants, insects, and vertebrates. BAR domain proteins share an N-terminal BAR domain with a high propensity to adopt α-helical structure and engage in coiled-coil interactions with other proteins. BAR domain proteins are implicated in processes as fundamental and diverse as fission of synaptic vesicles, cell polarity, endocytosis, regulation of the actin cytoskeleton, transcriptional repression, cell-cell fusion, signal transduction, apoptosis, secretory vesicle fusion, excitation-contraction coupling, learning and memory, tissue differentiation, ion flux across membranes, and tumor suppression. What has been lacking is a molecular understanding of the role of the BAR domain protein in each process. The three-dimensional structure of the BAR domain has now been determined and valuable insight has been gained in understanding the interactions of BAR domains with membranes. The cellular roles of BAR domain proteins, characterized over the past decade in cells as distinct as yeasts, neurons, and myocytes, can now be understood in terms of a fundamental molecular function of all BAR domain proteins: to sense membrane curvature, to bind GTPases, and to mold a diversity of cellular membranes. PMID:16524918
Matched metal die compression molded structural random fiber sheet molding compound flywheel
Kulkarni, Satish V.; Christensen, Richard M.; Toland, Richard H.
1985-01-01
A flywheel (10) is described that is useful for energy storage in a hybrid vehicle automotive power system or in some stationary applications. The flywheel (10) has a body of essentially planar isotropic high strength structural random fiber sheet molding compound (SMC-R). The flywheel (10) may be economically produced by a matched metal die compression molding process. The flywheel (10) makes energy intensive efficient use of a fiber/resin composite while having a shape designed by theory assuming planar isotropy.
Perchlorate Reduction by Yeast for Mars Exploration
NASA Technical Reports Server (NTRS)
Sharma, Alaisha
2015-01-01
Martian soil contains high levels (0.6 percentage by mass) of calcium perchlorate (Ca(ClO4)2), which readily dissociates into calcium and the perchlorate ion (ClO4-) in water. Even in trace amounts, perchlorates are toxic to humans and have been implicated in thyroid dysfunction. Devising methods to lessen perchlorate contamination is crucial to minimizing the health risks associated with human exploration and colonization of Mars. We designed a perchlorate reduction pathway, which sequentially reduces perchlorate to chloride (Cl-) and oxygen (O2), for implementation in the yeast Saccharomyces cerevisiae. Using genes obtained from perchlorate reducing bacteria Azospira oryzae and Dechloromonas aromatica, we plan to assemble this pathway directly within S. cerevisiae through recombinational cloning. A perchlorate reduction pathway would enable S. cerevisiae to lower perchlorate levels and produce oxygen, which may be harvested or used directly by S. cerevisiae for aerobic growth and compound synthesis. Moreover, using perchlorate as an external electron acceptor could improve the efficiency of redox-imbalanced production pathways in yeast. Although several perchlorate reducing bacteria have been identified and utilized in water treatment systems on Earth, the widespread use of S. cerevisiae as a synthetic biology platform justifies the development of a perchlorate reducing strain for implementation on Mars.
The yeasts phosphorelay systems: a comparative view.
Salas-Delgado, Griselda; Ongay-Larios, Laura; Kawasaki-Watanabe, Laura; López-Villaseñor, Imelda; Coria, Roberto
2017-06-01
Cells contain signal transduction pathways that mediate communication between the extracellular environment and the cell interior. These pathways control transcriptional programs and posttranscriptional processes that modify cell metabolism in order to maintain homeostasis. One type of these signal transduction systems are the so-called Two Component Systems (TCS), which conduct the transfer of phosphate groups between specific and conserved histidine and aspartate residues present in at least two proteins; the first protein is a sensor kinase which autophosphorylates a histidine residue in response to a stimulus, this phosphate is then transferred to an aspartic residue located in a response regulator protein. There are classical and hybrid TCS, whose difference consists in the number of proteins and functional domains involved in the phosphorelay. The TCS are widespread in bacteria where the sensor and its response regulator are mostly specific for a given stimulus. In eukaryotic organisms such as fungi, slime molds, and plants, TCS are present as hybrid multistep phosphorelays, with a variety of arrangements (Stock et al. in Annu Rev Biochem 69:183-215, 2000; Wuichet et al. in Curr Opin Microbiol 292:1039-1050, 2010). In these multistep phosphorelay systems, several phosphotransfer events take place between different histidine and aspartate residues localized in specific domains present in more than two proteins (Thomason and Kay, in J Cell Sci 113:3141-3150, 2000; Robinson et al. in Nat Struct Biol 7:626-633, 2000). This review presents a brief and succinct description of the Two-component systems of model yeasts, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Candida albicans, Cryptococcus neoformans and Kluyveromyces lactis. We have focused on the comparison of domain organization and functions of each component present in these phosphorelay systems.
HOW to Recognize and Control Sooty Molds
Kenneth J. Jr. Kessler
1992-01-01
Sooty molds are dark fungi that grow on honeydew excreted by sucking insects or on exudates from leaves of certain plants. Typically, sooty mold growths are composed of fungal complexes made up of ascomycetes and fungi imperfecti. Some of the common genera of fungi found in sooty mold complexes are Cladosporium, Aureobasidium, Antennariella, Limacinula, Scorias, and...
Grinding aspheric and freeform micro-optical molds
NASA Astrophysics Data System (ADS)
Tohme, Yazid E.
2007-02-01
Fueled by the need for better performing optics, glass optics are now replacing plastic optics in many industrial and consumer electronic devices. One of these devices is the mobile phone camera. The optical sub-assembly in a mobile phone includes several micro lenses that are spherical and/or aspherical in shape and require form tolerances in the submicron range. These micro glass lenses are mass produced by a replication process known as glass press molding. The process entails the compression of a glass gob between two precise optical quality molds at an elevated temperature, usually near the transition temperature of the glass material. The elevated forces and temperatures required in the glass molding process limits the materials of the molds to very tough materials such as tungsten carbide or silicon carbide. These materials can withstand large pressing forces at high temperatures without any significant deformation. These materials offer great mechanical properties for glass press molding but they are also a challenge to machine to submicron accuracy. The work in this paper discusses a deterministic micro grinding manufacturing process referred to as wheel normal grinding, which is utilized to produce these optical quality molds. Wheel normal grinding is more accurate and more deterministic than most other grinding techniques and can produce molds to the form and finish tolerances required for optical molding. This method relies on the ability to recognize and compensate for grinding wheel wear and machine repeatable errors. Results will be presented to illustrate the accuracy of this micro grinding technique.
Zhang, Miao; Wang, Xiaojie; Cui, Meiyan; Wang, Yanping; Jiao, Zhen
2018-01-01
Five different species of selected broad-spectrum antibiotic lactic acid bacteria isolated from extremely high–cold areas were used as starters to ferment indigenous forage oats and wheatgrass under rigid alpine climatic conditions. The five isolates were Lactobacillus plantarum QZ227, Enterococcus mundtii QZ251, Pediococcus cellicola QZ311, Leuconostoc mesenteroides QZ1137 and Lactococcus lactis QZ613, and commercial Lactobacillus plantarum FG1 was used as the positive control and sterile water as the negative control. The minimum and maximum temperatures were −22°C and 23°C during the fermentation process, respectively. The pH of wheatgrass silage fermented by the QZ227 and FG1 inocula reached the expected values (≤4.15) although the pathogens detected in the silage should be further investigated. All of the inocula additives used in this study were effective in improving the fermentation quality of oat silage as indicated by the higher content of lactic acid, lower pH values (≤4.17) and significant inhibition of pathogens. QZ227 exhibited a fermentation ability that was comparable with the commercial inoculum FG1 for the whole process, and the deterioration rate was significantly lower than for FG1 after storage for 7 months. The pathogens Escherichia coli, mold and yeast were counted and isolated from the deteriorated silage. E. coli were the main NH3-N producer while F. fungi and yeast produced very little. PMID:29408855
Rodrigues, Andre; Cable, Rachel N; Mueller, Ulrich G; Bacci, Maurício; Pagnocca, Fernando C
2009-10-01
We investigate the diversity of yeasts isolated in gardens of the leafcutter ant Atta texana. Repeated sampling of gardens from four nests over a 1-year time period showed that gardens contain a diverse assemblage of yeasts. The yeast community in gardens consisted mostly of yeasts associated with plants or soil, but community composition changed between sampling periods. In order to understand the potential disease-suppressing roles of the garden yeasts, we screened isolates for antagonistic effects against known microfungal garden contaminants. In vitro assays revealed that yeasts inhibited the mycelial growth of two strains of Escovopsis (a specialized attine garden parasite), Syncephalastrum racemosum (a fungus often growing in gardens of leafcutter lab nests), and the insect pathogen Beauveria bassiana. These garden yeasts add to the growing list of disease-suppressing microbes in attine nests that may contribute synergistically, together with actinomycetes and Burkholderia bacteria, to protect the gardens and the ants against diseases. Additionally, we suggest that garden immunity against problem fungi may therefore derive not only from the presence of disease-suppressing Pseudonocardia actinomycetes, but from an enrichment of multiple disease-suppressing microorganisms in the garden matrix.
Use of acrylic sheet molds for elastomeric products
NASA Technical Reports Server (NTRS)
Heisman, R. M.; Koerner, A. E.; Messineo, S. M.
1970-01-01
Molds constructed of acrylic sheet are more easily machined than metal, are transparent to ensure complete filling during injection, and have smooth surfaces free of contamination. Technique eliminates flashing on molded parts and mold release agents.
Borreani, G; Tabacco, E
2008-11-01
The outgrowth of Clostridium spore-forming bacteria causes late blowing in cheeses. Recently, the role of air diffusion during storage and feed-out and the role of aerobic deterioration has been shown to indirectly favor butyric acid bacteria (BAB) growth and to determine the presence of high concentrations of BAB spores in farm tank milk. A new oxygen barrier (OB) film was tested and compared with conventional polyethylene (ST). The objective was to verify whether the OB film could prevent BAB spore formation in whole-crop corn silage during storage on 2 commercial farms with different potential silage spoilage risks. Two bunkers (farms 1 and 2) were divided into 2 parts along the length so that half the feed-out face would be covered with ST film and the other half with OB film. Plastic net bags with freshly chopped corn were buried in the upper layer and in the central part (CORE) of the bunkers. The silos were opened in summer and fed out at different removal rates (19 vs. 33 cm/d). Herbage at ensiling, silage at unloading, and silage after air exposure (6 and 15 d) were analyzed for pH, nitrate, BAB spores, yeasts, and molds. The BAB spores in herbages at ensiling were 2.84 log(10) most probable number (MPN)/g, with no differences between treatments or farms. Nitrate was below the detection limit on farm 1 and exceeded 2,300 mg/kg of fresh matter on farm 2. At unloading, the BAB spores in the ST silage on farm 1 were greater than 5 log(10) MPN/g, whereas in the CORE and the OB silages, they were approximately 2 log(10) MPN/g. The ST silage had the greatest pH (5.89), the greatest mold count (5.07 log(10) cfu/g), and the greatest difference between silage temperature and ambient temperature (dT(section-ambient)). On farm 2, the ST silage had the greatest concentration of BAB spores (2.19 log(10) MPN/g), the greatest pH (4.05), and the least nitrate concentration compared with the CORE and the OB silages. Pooled data on BAB spores collected from aerobically
Introduction/Study Goal Molds are ubiquitous in the environment and exposures to molds contribute to various human diseases including allergic lung diseases. The Institute of Medicine reports and WHO gUidelines concluded that the role of molds in asthma induction is not clear bu...
Hu, Hao; Yan, Fujie; Wilson, Charles; Shen, Qing; Zheng, Xiaodong
2015-12-01
Cold-adapted yeasts were isolated from soil samples collected in Tibet and evaluated as potential biocontrol agents against blue mold (Penicillium expansum) of pear fruit in cold storage. YC1, an isolate identified as Rhodotorula mucilaginosa, was found to exhibit the greatest biocontrol activity among the different isolates that were screened. A washed cell suspension of YC1 exhibited the best biocontrol activity among three different preparations that were used in the current study. A concentration of 10(8) cells/ml reduced the incidence of decay to 35 %, compared to the control where decay incidence was 100 %. A higher intracellular level of trehalose and a higher proportion of polyunsaturated acids present in YC1, was associated with increased the tolerance of this strain to low temperatures, relative to the other strains that were evaluated. The increased tolerance to low temperature allowed the YC1 strain of yeast to more effectively compete for nutrients and space in wounded pear fruit that had been inoculated with spores of P. expansum and placed in cold storage. The present study demonstrated the ability to select cold-adapted yeasts from cold climates and use them as biocontrol agents of postharvest diseases of fruit placed in cold storage.
Mirabal Alonso, Loreli; Kleiner, Diethelm; Ortega, Eduardo
2008-04-01
The present paper reports the presence of bacteria and yeasts tightly associated with spores of an isolate of Glomus mosseae. Healthy spores were surface disinfected by combining chloramine-T 5%, Tween-40, and cephalexin 2.5 g L(-1) (CTCf). Macerates of these spores were incubated on agar media, microorganisms were isolated, and two yeasts were characterized (EndoGm1, EndoGm11). Both yeasts were able to solubilize low-soluble P sources (Ca and Fe phosphates) and accumulate polyphosphates (polyPs). Sequence analysis of 18S ribosomal deoxyribonucleic acid showed that the yeasts belong to the genera Rhodotorula or Rhodosporidium (EndoGm1) and Cryptococcus (EndoGm11). Results from inoculation experiments showed an effect of the spore-associated yeasts on the root growth of rice, suggesting potential tripartite interactions with mycorrhizal fungi and plants.
The Mold that Almost Ate the Principal
ERIC Educational Resources Information Center
Barry, Wayne; Bishop, Chuck; Byars, Jennifer
2006-01-01
New-building mold was a bane for many home construction companies and new homeowners during the 1990s. It was not unusual to read or watch the news and see the tragedy played out in one's local community. Untold, however, is the story of the toll new-building mold can take on school systems and their principals, especially as these mold problems…
Slimeware: engineering devices with slime mold.
Adamatzky, Andrew
2013-01-01
The plasmodium of the acellular slime mold Physarum polycephalum is a gigantic single cell visible to the unaided eye. The cell shows a rich spectrum of behavioral patterns in response to environmental conditions. In a series of simple experiments we demonstrate how to make computing, sensing, and actuating devices from the slime mold. We show how to program living slime mold machines by configurations of repelling and attracting gradients and demonstrate the workability of the living machines on tasks of computational geometry, logic, and arithmetic.
Commercial and Residential Water Damage: The Mold Connection.
ERIC Educational Resources Information Center
Williams, Del
2002-01-01
Describes the problem of toxic mold in residential and commercial property resulting from excess moisture. Includes common sources of unwanted moisture, design and construction flaws, determining the presence of mold, and advice for identifying and hiring reputable mold remediators. (PKP)
... the AAAAI Foundation Donate Utility navigation Español Journals Pollen Counts Annual Meeting Member Login / My Membership Search ... email alert to keep tabs on mold and pollen counts in your area. • Keep away from uncut ...
Microbiological Spoilage of Dairy Products
NASA Astrophysics Data System (ADS)
Ledenbach, Loralyn H.; Marshall, Robert T.
The wide array of available dairy foods challenges the microbiologist, engineer, and technologist to find the best ways to prevent the entry of microorganisms, destroy those that do get in along with their enzymes, and prevent the growth and activities of those that escape processing treatments. Troublesome spoilage microorganisms include aerobic psychrotrophic Gram-negative bacteria, yeasts, molds, heterofermentative lactobacilli, and spore-forming bacteria. Psychrotrophic bacteria can produce large amounts of extracellular hydrolytic enzymes, and the extent of recontamination of pasteurized fluid milk products with these bacteria is a major determinant of their shelf life. Fungal spoilage of dairy foods is manifested by the presence of a wide variety of metabolic by-products, causing off-odors and flavors, in addition to visible changes in color or texture.
Yeast synthetic biology toolbox and applications for biofuel production.
Tsai, Ching-Sung; Kwak, Suryang; Turner, Timothy L; Jin, Yong-Su
2015-02-01
Yeasts are efficient biofuel producers with numerous advantages outcompeting bacterial counterparts. While most synthetic biology tools have been developed and customized for bacteria especially for Escherichia coli, yeast synthetic biological tools have been exploited for improving yeast to produce fuels and chemicals from renewable biomass. Here we review the current status of synthetic biological tools and their applications for biofuel production, focusing on the model strain Saccharomyces cerevisiae We describe assembly techniques that have been developed for constructing genes, pathways, and genomes in yeast. Moreover, we discuss synthetic parts for allowing precise control of gene expression at both transcriptional and translational levels. Applications of these synthetic biological approaches have led to identification of effective gene targets that are responsible for desirable traits, such as cellulosic sugar utilization, advanced biofuel production, and enhanced tolerance against toxic products for biofuel production from renewable biomass. Although an array of synthetic biology tools and devices are available, we observed some gaps existing in tool development to achieve industrial utilization. Looking forward, future tool development should focus on industrial cultivation conditions utilizing industrial strains. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permission@oup.com.
Volume-change indicator for molding plastic
NASA Technical Reports Server (NTRS)
Heler, W. C.
1979-01-01
Monitor consisting of two concentric disks measures change in volume of charge during compression/displacement molding. Device enables operator to decide whether process pressure and temperature are set properly or whether sufficient material has been placed in mold.
Microbial Quality and Shelf Life of Blueberry Purée Developed Using Cavitation Technology.
Fan, Lihua; Martynenko, Alex; Doucette, Craig; Hughes, Timothy; Fillmore, Sherry
2018-03-01
Blueberry purée was developed using hydrodynamic cavitation technology. The product was made from entire blueberries without adding any food additives. In this study, microbial reduction following each processing stage (at the industry setting) and after product pasteurization at 86, 88, 90, 92, 94, and 96 °C was investigated. Microbial quality including total plate counts, yeast and molds, and heat-resistant molds counts was determined. Shelf life of pasteurized products stored for up to 24 weeks at room temperature were assessed for microbial quality, soluble solids (°Brix), titratable acidity (citric acid %), pH, viscosity (cP) and flow rate (cm/30 s). Our results indicated that heat-resistant molds, initially present in frozen blueberries with counts at 2.03 log CFU/200g, were totally inactivated at 94 to 96 °C with 1 to 2 min holding time. Shelf life study showed that no product spoilage was caused by bacteria, yeasts and heat-resistant molds along with non-significant changes of textural characteristics. This study provided useful information for the food industry to develop variety of fruit purée products with no wastes of fruit materials. This study provides useful information for the food industry to develop safe liquid food products using cavitation technology without wasting any raw materials. © 2018 Institute of Food Technologists®.
Silicon micro-mold and method for fabrication
Morales, Alfredo M.
2005-01-11
The present invention describes a method for rapidly fabricating a robust 3-dimensional silicon micro-mold for use in preparing complex metal micro-components. The process begins by depositing a conductive metal layer onto one surface of a silicon wafer. A thin photoresist and a standard lithographic mask are then used to transfer a trace image pattern onto the opposite surface of the wafer by exposing and developing the resist. The exposed portion of the silicon substrate is anisotropically etched through the wafer thickness down to conductive metal layer to provide an etched pattern consisting of a series of rectilinear channels and recesses in the silicon which serve as the silicon micro-mold. Microcomponents are prepared with this mold by first filling the mold channels and recesses with a metal deposit, typically by electroplating, and then removing the silicon micro-mold by chemical etching.
Seghir, A; Boucherit-Otmani, Z; Sari-Belkharroubi, L; Boucherit, K
2017-03-01
The Candida yeasts are the fourth leading cause of death from systemic infections, the risk may increase when the infection also involves bacteria. Yeasts and bacteria can adhere to medical implants, such as peripheral vascular catheters, and form a multicellular structures called "mixed biofilms" more resistant to antimicrobials agents. However, the formation of mixed biofilms on implants leads to long-term persistent infections because they can act as reservoirs of pathogens that have poorly understood interactions. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Medeiros, Adriana O.; Missagia, Beatriz S.; Brandão, Luciana R.; Callisto, Marcos; Barbosa, Francisco A. R.; Rosa, Carlos A.
2012-01-01
Yeast communities were assessed in 14 rivers and four lakes from the Doce River basin in Brazil, during the rainy and dry seasons of the years 2000 and 2001. Water samples were collected at the subsurface in all sites. The following physical and chemical parameters were measured: temperature, dissolved oxygen, pH, electrical conductivity, total phosphorus, ortho-phosphate, ammonium, nitrate, nitrite and total nitrogen and the counts of faecal coliforms and heterotrophic bacteria were carried out to characterize the aquatic environmental sampled. The yeast counts were higher in aquatic environments with the highest counts of coliform and heterotrophic bacteria. These environments receive a high influx of domestic and industrial waste. A total of 317 isolates identified in forty eight yeast species were recorded in the sites sampled and the specie Aureobasidium pullulans were found in eleven out of eighteen sites sampled and some opportunistic pathogens such as the yeast species Candida krusei were isolated only in the polluted rivers with a positive correlation with the biotic and abiotic parameters that indicate sewage contamination. PMID:24031990
Li, Boqiang; Peng, Huaimin; Tian, Shiping
2016-01-01
Rhodotorula glutinis as an antagonism show good biocontrol performance against various post-harvest diseases in fruits. In the present study, strong attachment capability of R. glutinis to spores and hyphae of Botrytis cinerea was observed. Further analysis showed that certain protein components on the yeast cell surface played critical role during the interaction between R. glutinis and B. cinerea. The components mainly distributed at the poles of yeast cells and might contain glycosylation modification, as tunicamycin treated yeast cells lost attachment capability to B. cinerea. To investigate contributions of attachment capability of R. glutinis to its biocontrol efficacy, yeast cells were mutagenized with 3% methane-sulfonic acid ethyl ester (EMS), and a mutant CE4 with stable non-attaching phenotype was obtained. No significant difference was found on colony, cell morphology, reproductive ability, and capsule formation between the mutant and wild-type. However, there was a distinct difference in India ink positive staining patterns between the two strains. Moreover, wild-type strain of R. glutinis showed better performance on inhibiting spore germination and mycelial growth of B. cinerea than CE4 strain when yeast cells and B. cinerea were co-cultured in vitro. In biocontrol assay, both wild-type and CE4 strains showed significant biocontrol efficacy against gray mold caused by B. cinerea in apple fruit, whereas, control effect of CE4 strain was lower than that of wild-type. Our findings provided new evidences that attachment capability of R. glutinis to B. cinerea contributed to its biocontrol efficacy.
Li, Boqiang; Peng, Huaimin; Tian, Shiping
2016-01-01
Rhodotorula glutinis as an antagonism show good biocontrol performance against various post-harvest diseases in fruits. In the present study, strong attachment capability of R. glutinis to spores and hyphae of Botrytis cinerea was observed. Further analysis showed that certain protein components on the yeast cell surface played critical role during the interaction between R. glutinis and B. cinerea. The components mainly distributed at the poles of yeast cells and might contain glycosylation modification, as tunicamycin treated yeast cells lost attachment capability to B. cinerea. To investigate contributions of attachment capability of R. glutinis to its biocontrol efficacy, yeast cells were mutagenized with 3% methane-sulfonic acid ethyl ester (EMS), and a mutant CE4 with stable non-attaching phenotype was obtained. No significant difference was found on colony, cell morphology, reproductive ability, and capsule formation between the mutant and wild-type. However, there was a distinct difference in India ink positive staining patterns between the two strains. Moreover, wild-type strain of R. glutinis showed better performance on inhibiting spore germination and mycelial growth of B. cinerea than CE4 strain when yeast cells and B. cinerea were co-cultured in vitro. In biocontrol assay, both wild-type and CE4 strains showed significant biocontrol efficacy against gray mold caused by B. cinerea in apple fruit, whereas, control effect of CE4 strain was lower than that of wild-type. Our findings provided new evidences that attachment capability of R. glutinis to B. cinerea contributed to its biocontrol efficacy. PMID:27199931
Replication of the nano-scale mold fabricated with focused ion beam
NASA Astrophysics Data System (ADS)
Gao, J. X.; Chan-Park, M. B.; Xie, D. Z.; Ngoi, Bryan K. A.
2004-12-01
Silicon mold fabricated with Focused Ion Beam lithography (FIB) was used to make silicone elastomer molds. The silicon mold is composed of lattice of holes which the diameter and depth are about 200 nm and 60 nm, respectively. The silicone elastomer material was then used to replicate slavery mold. Our study show the replication process with the elastomer mold had been performed successfully and the diameter of humps on the elastomer mold is near to that of holes on the master mold. But the height of humps in the elastomer mold is only 42 nm and it is different from the depth of holes in the master mold.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, K.; Meng, W. J.; Mei, F.
2011-02-01
A single crystal Al specimen was molded at room temperature with long, rectangular, strip diamond punches. Quantitative molding response curves were obtained at a series of punch widths, ranging from 5 {micro}m to 550 nm. A significant size effect was observed, manifesting itself in terms of significantly increasing characteristic molding pressure as the punch width decreases to 1.5 {micro}m and below. A detailed comparison of the present strip punch molding results was made with Berkovich pyramidal indentation on the same single crystal Al specimen. The comparison reveals distinctly different dependence of the characteristic pressure on corresponding characteristic length. The presentmore » results show the feasibility of micro-/nano-scale compression molding as a micro-/nano-fabrication technique, and offer an experimental test case for size-dependent plasticity theories.« less
Microbiological quality of Argentinian paprika.
Melo González, María G; Romero, Stella M; Arjona, Mila; Larumbe, Ada G; Vaamonde, Graciela
The aim of this study was to evaluate the microbiological quality of paprika produced in Catamarca, Argentina. Microbiological analyses were carried out for the enumeration of total aerobic mesophilic bacteria, coliforms, yeasts and molds, and the detection of Salmonella in samples obtained from different local producers during three consecutive years. The mycobiota was identified paying special attention to the mycotoxigenic molds. Standard plate counts of aerobic mesophilic bacteria ranged from 2.7×10 5 to 3.7×10 7 CFU/g. Coliform counts ranged from <10 to 8.1×10 4 CFU/g. Salmonella was not detected in any of the samples tested. Fungal counts (including yeasts and molds) ranged between 2×10 2 and 1.9×10 5 CFU/g. These results showed a high level of microbial contamination, exceeding in several samples the maximum limits set in international food regulations. The study of the mycobiota demonstrated that Aspergillus was the predominant genus and Aspergillus niger (potential producer of ochratoxin A) the most frequently isolated species, followed by Aspergillus flavus (potential producer of aflatoxins). Other species of potential toxigenic fungi such as Aspergillus ochraceus, Aspergillus westerdijkiae, Penicillium chrysogenum, Penicillium crustosum, Penicillium commune, Penicillium expansum and Alternaria tenuissima species group were encountered as part of the mycobiota of the paprika samples indicating a risk of mycotoxin contamination. A. westerdijkiae was isolated for the first time in Argentina. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
Sacrificial plastic mold with electroplatable base
Domeier, Linda A.; Hruby, Jill M.; Morales, Alfredo M.
2002-01-01
A sacrificial plastic mold having an electroplatable backing is provided. One embodiment consists of the infusion of a softened or molten thermoplastic through a porous metal substrate (sheet, screen, mesh or foam) and into the features of a micro-scale molding tool contacting the porous metal substrate. Upon demolding, the porous metal substrate will be embedded within the thermoplastic and will project a plastic structure with features determined by the mold tool. This plastic structure, in turn, provides a sacrificial plastic mold mechanically bonded to the porous metal substrate which provides a conducting support suitable for electroplating either contiguous or non-contiguous metal replicates. After electroplating and lapping, the sacrificial plastic can be dissolved to leave the desired metal structure bonded to the porous metal substrate. Optionally, the electroplated structures may be debonded from the porous substrate by selective dissolution of the porous substrate or a coating thereon.
Sacrificial Plastic Mold With Electroplatable Base
Domeier, Linda A.; Hruby, Jill M.; Morales, Alfredo M.
2005-08-16
A sacrificial plastic mold having an electroplatable backing is provided. One embodiment consists of the infusion of a softened or molten thermoplastic through a porous metal substrate (sheet, screen, mesh or foam) and into the features of a micro-scale molding tool contacting the porous metal substrate. Upon demolding, the porous metal substrate will be embedded within the thermoplastic and will project a plastic structure with features determined by the mold tool. This plastic structure, in turn, provides a sacrificial plastic mold mechanically bonded to the porous metal substrate which provides a conducting support suitable for electroplating either contiguous or non-contiguous metal replicates. After electroplating and lapping, the sacrificial plastic can be dissolved to leave the desired metal structure bonded to the porous metal substrate. Optionally, the electroplated structures may be debonded from the porous substrate by selective dissolution of the porous substrate or a coating thereon.
Study of injection molded microcellular polyamide-6 nanocomposites
Mingjun Yuan; Lih-Sheng Turng; Shaoqin Gong; Daniel Caulfield; Chris Hunt; Rick Spindler
2004-01-01
This study aims to explore the processing benefits and property improvements of combining nanocomposites with microcellular injection molding. The microcellular nanocomposite processing was performed on an injection-molding machine equipped with a commercially available supercritical fluid (SCF) system. The molded samples produced based on the Design of Experiments (...
Zhang, Lin; Zhou, Wenchen; Yi, Allen Y
2017-04-01
In compression molding of polymer optical components with micro/nanoscale surface features, rapid heating of the mold surface is critical for the implementation of this technology for large-scale applications. In this Letter, a novel method of a localized rapid heating process is reported. This process is based on induction heating of a thin conductive coating deposited on a silicon mold. Since the graphene coating is very thin (∼45 nm), a high heating rate of 10∼20°C/s can be achieved by employing a 1200 W 30 kHz electrical power unit. Under this condition, the graphene-coated surface and the polymer substrate can be heated above the polymer's glass transition temperature within 30 s and subsequently cooled down to room temperature within several tens of seconds after molding, resulting in an overall thermal cycle of about 3 min or shorter. The feasibility of this process was validated by fabrication of optical gratings, micropillar matrices, and microlens arrays on polymethylmethacrylate (PMMA) substrates with very high precision. The uniformity and surface geometries of the replicated optical elements are evaluated using an optical profilometer, a diffraction test setup, and a Shack-Hartmann wavefront sensor built with a molded PMMA microlens array. Compared with the conventional bulk heating molding process, this novel rapid localized induction heating process could improve replication efficiency with better geometrical fidelity.
Factors influencing microinjection molding replication quality
NASA Astrophysics Data System (ADS)
Vera, Julie; Brulez, Anne-Catherine; Contraires, Elise; Larochette, Mathieu; Trannoy-Orban, Nathalie; Pignon, Maxime; Mauclair, Cyril; Valette, Stéphane; Benayoun, Stéphane
2018-01-01
In recent years, there has been increased interest in producing and providing high-precision plastic parts that can be manufactured by microinjection molding: gears, pumps, optical grating elements, and so on. For all of these applications, the replication quality is essential. This study has two goals: (1) fabrication of high-precision parts using the conventional injection molding machine; (2) identification of robust parameters that ensure production quality. Thus, different technological solutions have been used: cavity vacuuming and the use of a mold coated with DLC or CrN deposits. AFM and SEM analyses were carried out to characterize the replication profile. The replication quality was studied in terms of the process parameters, coated and uncoated molds and crystallinity of the polymer. Specific studies were processed to quantify the replicability of injection molded parts (ABS, PC and PP). Analysis of the Taguchi experimental designs permits prioritization of the impact of each parameter on the replication quality. A discussion taking into account these new parameters and the thermal and spreading properties on the coatings is proposed. It appeared that, in general, increasing the mold temperature improves the molten polymer fill in submicron features except for the steel insert (for which the presence of a vacuum is the most important factor). Moreover, the DLC coating was the best coating to increase the quality of the replication. This result could be explained by the lower thermal diffusivity of this coating. We noted that the viscosity of the polymers is not a primordial factor of the replication quality.
Wild Grape-Associated Yeasts as Promising Biocontrol Agents against Vitis vinifera Fungal Pathogens.
Cordero-Bueso, Gustavo; Mangieri, Nicola; Maghradze, David; Foschino, Roberto; Valdetara, Federica; Cantoral, Jesús M; Vigentini, Ileana
2017-01-01
The increasing level of hazardous residues in the environment and food chains has led the European Union to restrict the use of chemical fungicides. Thus, exploiting new natural antagonistic microorganisms against fungal diseases could serve the agricultural production to reduce pre- and post-harvest losses, to boost safer practices for workers and to protect the consumers' health. The main aim of this work was to evaluate the antagonistic potential of epiphytic yeasts against Botrytis cinerea, Aspergillus carbonarius , and Penicillium expansum pathogen species. In particular, yeast isolation was carried out from grape berries of Vitis vinifera ssp sylvestris populations, of the Eurasian area, and V. vinifera ssp vinifera cultivars from three different farming systems (organic, biodynamic, and conventional). Strains able to inhibit or slow the growth of pathogens were selected by in vitro and in vivo experiments. The most effective antagonist yeast strains were subsequently assayed for their capability to colonize the grape berries. Finally, possible modes of action, such as nutrients and space competition, iron depletion, cell wall degrading enzymes, diffusible and volatile antimicrobial compounds, and biofilm formation, were investigated as well. Two hundred and thirty-one yeast strains belonging to 26 different species were isolated; 20 of them, ascribed to eight species, showed antagonistic action against all molds. Yeasts isolated from V. vinifera ssp sylvestris were more effective (up to 50%) against B. cinerea rather than those isolated from V. vinifera ssp vinifera. Six strains, all isolated from wild vines, belonging to four species ( Meyerozyma guilliermondii, Hanseniaspora uvarum, Hanseniaspora clermontiae , and Pichia kluyveri ) revealed one or more phenotypical characteristics associated to the analyzed modes of antagonistic action.
Wild Grape-Associated Yeasts as Promising Biocontrol Agents against Vitis vinifera Fungal Pathogens
Cordero-Bueso, Gustavo; Mangieri, Nicola; Maghradze, David; Foschino, Roberto; Valdetara, Federica; Cantoral, Jesús M.; Vigentini, Ileana
2017-01-01
The increasing level of hazardous residues in the environment and food chains has led the European Union to restrict the use of chemical fungicides. Thus, exploiting new natural antagonistic microorganisms against fungal diseases could serve the agricultural production to reduce pre- and post-harvest losses, to boost safer practices for workers and to protect the consumers' health. The main aim of this work was to evaluate the antagonistic potential of epiphytic yeasts against Botrytis cinerea, Aspergillus carbonarius, and Penicillium expansum pathogen species. In particular, yeast isolation was carried out from grape berries of Vitis vinifera ssp sylvestris populations, of the Eurasian area, and V. vinifera ssp vinifera cultivars from three different farming systems (organic, biodynamic, and conventional). Strains able to inhibit or slow the growth of pathogens were selected by in vitro and in vivo experiments. The most effective antagonist yeast strains were subsequently assayed for their capability to colonize the grape berries. Finally, possible modes of action, such as nutrients and space competition, iron depletion, cell wall degrading enzymes, diffusible and volatile antimicrobial compounds, and biofilm formation, were investigated as well. Two hundred and thirty-one yeast strains belonging to 26 different species were isolated; 20 of them, ascribed to eight species, showed antagonistic action against all molds. Yeasts isolated from V. vinifera ssp sylvestris were more effective (up to 50%) against B. cinerea rather than those isolated from V. vinifera ssp vinifera. Six strains, all isolated from wild vines, belonging to four species (Meyerozyma guilliermondii, Hanseniaspora uvarum, Hanseniaspora clermontiae, and Pichia kluyveri) revealed one or more phenotypical characteristics associated to the analyzed modes of antagonistic action. PMID:29163377
EXPOSURE OF CHILDREN TO INDOOR MOLDS
Children now spend more than 90% of their time indoors. Thus, any exposure to indoor pollutants may be critical to their health. Molds are one of the most important pollutants children are exposed to indoors. Molds produce hundreds of allergens and toxins. These products ha...
Zamani, M; Sharifi Tehrani, A; Ali Abadi, A Alizadeh
2007-01-01
The aim of this research was to determine if the attacks of green mold on orange could be reduced by edible salts alone or in combination with biocontrol agent. For this purpose toxicity to Pantoea digitatum and practical use of sodium carbonate (SC), sodium bicarbonate (SBC) and potassium carbonate, and potassium bicarbonate alone or in combination with antagonistic bacteria (Pseudomonas fluorescens isolate PN, Bacillus subtilis isolate VHN, Pantoea agglomerans isolate CA) to control green mold were determined. All were fungistatic. SC and SBC were equal and superior to the other salts for control of green mold on oranges inoculated 6h before treatment and were chosen for subsequent trails under cold storage conditions. The biocontrol agents were found completely tolerant to 3% sodium bicarbonate and sodium carbonate at room temperature; although their culturability was reduced by > 1000-fold after 60 min in 1% other salt solutions. Satisfactory results were also obtained with the combined treatment for control of green mold. A significant increase in biocontrol activity of all isolate was observed when combined with sodium carbonate and sodium bicarbonate. The treatments comprising CA combined with SB was as effective as fungicide treatment. Thus, use of sodium bicarbonate treatment at 3% followed by the antagonist P. agglomerans CA could be an alternative to chemical fungicides for control of green mold on oranges.
Lemos Junior, Wilson José Fernandes; Bovo, Barbara; Nadai, Chiara; Crosato, Giulia; Carlot, Milena; Favaron, Francesco; Giacomini, Alessio; Corich, Viviana
2016-01-01
Gray mold is one of the most important diseases of grapevine in temperate climates. This plant pathogen affects plant growth and reduces wine quality. The use of yeasts as biocontrol agents to apply in the vineyard have been investigated in recent years as an alternative to agrochemicals. In this work, fermenting musts obtained from overripe grape berries, therefore more susceptible to infection by fungal pathogens such as Botrytis cinerea, were considered for the selection of yeasts carrying antifungal activity. Thirty-six isolates were identified as Starmerella bacillaris, a species recently proven to be of enological interest. Among them 14 different strains were studied and antifungal activity against B. cinerea was demonstrated, for the first time, to be present in S. bacillaris species. The production of volatile organic compounds (VOCs), tested in vitro, was found to be the main responsible of S. bacillaris antifungal effects. All the strains were able to reduce B. cinerea decay on wounded grape berries artificially inoculated with gray mold. The colonization level of wound was very high reaching, after 5 days, a concentration of 106 cells per ml of grape juice obtained after berry crushing. At this cell concentration S. bacillaris strains were used to ferment synthetic and natural musts. The sequential yeast inoculation, performed by adding S. cerevisiae 48 h after S. bacillaris, was needed to complete sugar consumption and determined a significant increase in glicerol content and a reduction of ethanol and acetic acid concentrations. The high wound colonization ability, found in this work, together with the propensity to colonize grape berry and the interesting enological traits possessed by the selected S. bacillaris strains allow the use of this yeast as biocontrol agent on vine and grape berries with possible positive effects on must fermentation, although the presence of S. cerevisiae is needed to complete the fermentation process. This work introduces
A hybrid optimization approach in non-isothermal glass molding
NASA Astrophysics Data System (ADS)
Vu, Anh-Tuan; Kreilkamp, Holger; Krishnamoorthi, Bharathwaj Janaki; Dambon, Olaf; Klocke, Fritz
2016-10-01
Intensively growing demands on complex yet low-cost precision glass optics from the today's photonic market motivate the development of an efficient and economically viable manufacturing technology for complex shaped optics. Against the state-of-the-art replication-based methods, Non-isothermal Glass Molding turns out to be a promising innovative technology for cost-efficient manufacturing because of increased mold lifetime, less energy consumption and high throughput from a fast process chain. However, the selection of parameters for the molding process usually requires a huge effort to satisfy precious requirements of the molded optics and to avoid negative effects on the expensive tool molds. Therefore, to reduce experimental work at the beginning, a coupling CFD/FEM numerical modeling was developed to study the molding process. This research focuses on the development of a hybrid optimization approach in Non-isothermal glass molding. To this end, an optimal configuration with two optimization stages for multiple quality characteristics of the glass optics is addressed. The hybrid Back-Propagation Neural Network (BPNN)-Genetic Algorithm (GA) is first carried out to realize the optimal process parameters and the stability of the process. The second stage continues with the optimization of glass preform using those optimal parameters to guarantee the accuracy of the molded optics. Experiments are performed to evaluate the effectiveness and feasibility of the model for the process development in Non-isothermal glass molding.
Predicting and preventing mold spoilage of food products.
Dagnas, Stéphane; Membré, Jeanne-Marie
2013-03-01
This article is a review of how to quantify mold spoilage and consequently shelf life of a food product. Mold spoilage results from having a product contaminated with fungal spores that germinate and form a visible mycelium before the end of the shelf life. The spoilage can be then expressed as the combination of the probability of having a product contaminated and the probability of mold growth (germination and proliferation) up to a visible mycelium before the end of the shelf life. For products packed before being distributed to the retailers, the probability of having a product contaminated is a function of factors strictly linked to the factory design, process, and environment. The in-factory fungal contamination of a product might be controlled by good manufacturing hygiene practices and reduced by particular processing practices such as an adequate air-renewal system. To determine the probability of mold growth, both germination and mycelium proliferation can be mathematically described by primary models. When mold contamination on the product is scarce, the spores are spread on the product and more than a few spores are unlikely to be found at the same spot. In such a case, models applicable for a single spore should be used. Secondary models can be used to describe the effect of intrinsic and extrinsic factors on either the germination or proliferation of molds. Several polynomial models and gamma-type models quantifying the effect of water activity and temperature on mold growth are available. To a lesser extent, the effect of pH, ethanol, heat treatment, addition of preservatives, and modified atmospheres on mold growth also have been quantified. However, mold species variability has not yet been properly addressed, and only a few secondary models have been validated for food products. Once the probability of having mold spoilage is calculated for various shelf lives and product formulations, the model can be implemented as part of a risk management
NASA Astrophysics Data System (ADS)
Roch, A.; Kehret, L.; Huber, T.; Henning, F.; Elsner, P.
2015-05-01
Investigations on PA6-GF50 integral foams have been carried out using different material systems: longfiber- and shortfiber-reinforced PA6 as well as unreinforced PA6 as a reference material. Both chemical and physical blowing agents were applied. Breathing mold technology (decompression of the mold) was selected for the foaming process. The integral foam design, which can be conceived as a sandwich structure, helps to save material in the neutral axis area and maintains a distance between load-bearing, unfoamed skin layers. For all test series an initial mold gap of 2.5 mm was chosen and the same amount of material was injected. In order to realize different density reductions, the mold opening stroke was varied. The experiments showed that, at a constant mass per unit area, integral polyamide 6 foams have a significantly higher bending stiffness than compact components, due to their higher area moment of inertia after foaming. At a constant surface weight the bending stiffness in these experiments could be increased by up to 600 %. Both shortfiber- and longfiber-reinforced polyamide 6 showed an increase in energy absorption during foaming.
Antimicrobial and Probiotic Properties of Yeasts: From Fundamental to Novel Applications
Hatoum, Rima; Labrie, Steve; Fliss, Ismail
2012-01-01
The yeasts constitute a large and heterogeneous group of microorganisms that are currently attracting increased attention from scientists and industry. Numerous and diverse biological activities make them promising candidates for a wide range of applications not limited to the food sector. In addition to their major contribution to flavor development in fermented foods, their antagonistic activities toward undesirable bacteria, and fungi are now widely known. These activities are associated with their competitiveness for nutrients, acidification of their growth medium, their tolerance of high concentrations of ethanol, and release of antimicrobial compounds such as antifungal killer toxins or “mycocins” and antibacterial compounds. While the design of foods containing probiotics (microorganisms that confer health benefits) has focused primarily on Lactobacillus and Bifidobacterium, the yeast Saccharomyces cerevisiae var. boulardii has long been known effective for treating gastroenteritis. In this review, the antimicrobial activities of yeasts are examined. Mechanisms underlying this antagonistic activity as well as recent applications of these biologically active yeasts in both the medical and veterinary sectors are described. PMID:23267352
Brightness field distributions of microlens arrays using micro molding.
Cheng, Hsin-Chung; Huang, Chiung-Fang; Lin, Yi; Shen, Yung-Kang
2010-12-20
This study describes the brightness field distributions of microlens arrays fabricated by micro injection molding (μIM) and micro injection-compression molding (μICM). The process for fabricating microlens arrays used room-temperature imprint lithography, photoresist reflow, electroforming, μIM, μICM, and optical properties measurement. Analytical results indicate that the brightness field distribution of the molded microlens arrays generated by μICM is better than those made using μIM. Our results further demonstrate that mold temperature is the most important processing parameter for brightness field distribution of molded microlens arrays made by μIM or μICM.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fang, Jun; Burghardt, Wesley R.; Bubeck, Robert A.
The development of molecular orientation in thermotropic liquid crystalline polymers (TLCPs) during injection molding has been investigated using two-dimensional wide-angle X-ray scattering coordinated with numerical computations employing the Larson-Doi polydomain model. Orientation distributions were measured in 'short shot' moldings to characterize structural evolution prior to completion of mold filling, in both thin and thick rectangular plaques. Distinct orientation patterns are observed near the filling front. In particular, strong extension at the melt front results in nearly transverse molecular alignment. Far away from the flow front shear competes with extension to produce complex spatial distributions of orientation. The relative influence ofmore » shear is stronger in the thin plaque, producing orientation along the filling direction. Exploiting an analogy between the Larson-Doi model and a fiber orientation model, we test the ability of process simulation tools to predict TLCP orientation distributions during molding. Substantial discrepancies between model predictions and experimental measurements are found near the flow front in partially filled short shots, attributed to the limits of the Hele-Shaw approximation used in the computations. Much of the flow front effect is however 'washed out' by subsequent shear flow as mold filling progresses, leading to improved agreement between experiment and corresponding numerical predictions.« less
Proactive approaches for mold-free interior environments.
Warsco, Katherine; Lindsey, Patricia F
2003-08-01
Interior design education and practice can contribute to the prevention of mold growth in indoor environments. The authors provide an overview of current thinking within the interior design educational and professional communities regarding proactive approaches to achieving mold-free building interiors, including identification of current best practices for the prevention of mold problems in buildings. They also discuss the development of certification programs. A review of recent literature points to the need for interior designers to be educated to specify the use of ecologically sound materials that support the health of building occupants. The authors present trade-offs between best practices for designing mold-free indoor environments (including considerations of cost, maintenance, and operation) and occupant comfort, health, and well-being.
Huffer, Sarah; Clark, Melinda E.; Ning, Jonathan C.; Blanch, Harvey W.; Clark, Douglas S.
2011-01-01
Increased membrane fluidity, which causes cofactor leakage and loss of membrane potential, has long been documented as a cause for decreased cell growth during exposure to ethanol, butanol, and other alcohols. Reinforcement of the membrane with more complex lipid components is thus thought to be beneficial for the generation of more tolerant organisms. In this study, organisms with more complex membranes, namely, archaea, did not maintain high growth rates upon exposure to alcohols, indicating that more complex lipids do not necessarily fortify the membrane against the fluidizing effects of alcohols. In the presence of alcohols, shifts in lipid composition to more saturated and unbranched lipids were observed in most of the organisms tested, including archaea, yeasts, and bacteria. However, these shifts did not always result in a decrease in membrane fluidity or in greater tolerance of the organism to alcohol exposure. In general, organisms tolerating the highest concentrations of alcohols maintained membrane fluidity after alcohol exposure, whereas organisms that increased membrane rigidity were less tolerant. Altered lipid composition was a common response to alcohol exposure, with the most tolerant organisms maintaining a modestly fluid membrane. Our results demonstrate that increased membrane fluidity is not the sole cause of growth inhibition and that alcohols may also denature proteins within the membrane and cytosol, adversely affecting metabolism and decreasing cell growth. PMID:21784917
Mathematical modeling of the in-mold coating process for injection-molded thermoplastic parts
NASA Astrophysics Data System (ADS)
Chen, Xu
In-Mold Coating (IMC) has been successfully used for many years for exterior body panels made from compression molded Sheet Molding Compound (SMC). The coating material is a single component reactive fluid, designed to improve the surface quality of SMC moldings in terms of functional and cosmetic properties. When injected onto a cured SMC part, IMC cures and bonds to provide a pain-like surface. Because of its distinct advantages, IMC is being considered for application to injection molded thermoplastic parts. For a successful in mold coating operation, there are two key issues related to the flow of the coating. First, the injection nozzle should be located such that the thermoplastic substrate is totally covered and the potential for air trapping is minimized. The selected location should be cosmetically acceptable since it most likely will leave a mark on the coated surface. The nozzle location also needs to be accessible for easy of maintenance. Secondly, the hydraulic force generated by the coating injection pressure should not exceed the available clamping tonnage. If the clamping force is exceeded, coating leakage will occur. In this study, mathematical models for IMC flow on the compressible thermoplastic substrate have been developed. Finite Difference Method (FDM) is first used to solve the 1 dimensional (1D) IMC flow problem. In order to investigate the application of Control Volume based Finite Element Method (CV/FEM) to more complicated two dimensional IMC flow, that method is first evaluated by solving the 1D IMC flow problem. An analytical solution, which can be obtained when a linear relationship between the coating thickness and coating injection pressure is assumed, is used to verify the numerical results. The mathematical models for the 2 dimensional (2D) IMC flow are based on the generalized Hele-Shaw approximation. It has been found experimentally that the power law viscosity model adequately predicts the rheological behavior of the coating
Adamatzky, Andrew I
2014-01-01
A cellular slime mould Physarum polycephalum is a monstrously large single cell visible by an unaided eye. The slime mold explores space in parallel, is guided by gradients of chemoattractants, and propagates toward sources of nutrients along nearly shortest paths. The slime mold is a living prototype of amorphous biological computers and robotic devices capable of solving a range of tasks of graph optimization and computational geometry. When presented with a distribution of nutrients, the slime mold spans the sources of nutrients with a network of protoplasmic tubes. This protoplasmic network matches a network of major transport routes of a country when configuration of major urban areas is represented by nutrients. A transport route connecting two cities should ideally be a shortest path, and this is usually the case in computer simulations and laboratory experiments with flat substrates. What searching strategies does the slime mold adopt when exploring 3-D terrains? How are optimal and transport routes approximated by protoplasmic tubes? Do the routes built by the slime mold on 3-D terrain match real-world transport routes? To answer these questions, we conducted pioneer laboratory experiments with Nylon terrains of USA and Germany. We used the slime mold to approximate route 20, the longest road in USA, and autobahn 7, the longest national motorway in Europe. We found that slime mold builds longer transport routes on 3-D terrains, compared to flat substrates yet sufficiently approximates man-made transport routes studied. We demonstrate that nutrients placed in destination sites affect performance of slime mold, and show how the mold navigates around elevations. In cellular automaton models of the slime mold, we have shown variability of the protoplasmic routes might depends on physiological states of the slime mold. Results presented will contribute toward development of novel algorithms for sensorial fusion, information processing, and decision making, and
[Yeast colonization of urinary catheters and the significance of biofilm formation].
Růžička, Filip; Holá, Veronika; Mahelová, Martina; Procházková, Alena
2012-08-01
Urinary catheters are colonized by a wide range of microorganisms, including numerous yeasts. The catheters are usually colonized by more microbial species forming a community - multispecies biofilm. Catheter colonization usually does not affect the patient's clinical status in any significant way. On the other hand, the biofilm can become a source of endogenous infection and its presence can affect functionality of the catheter and formation of urinary stones. Material a A total of 721 urinary catheters were studied. Microorganisms were released from catheters by sonication and subsequently cultured. Their identification was performed with the use of common phenotypic tests, as well as using MALDI TOF. Yeasts whose identification was ambiguous were recognized by sequencing. Biofilm formation was assessed by growth in a microtiter plate. Yeast colonization was proved in 244 urinary catheters. However, a total of 274 yeast strains were isolated. Most of them occurred together with other yeast species and/or bacteria on the catheters, producing multispecies biofilm there. The most frequent species was Candida albicans (a total of 144 isolated strains), followed by Candida glabrata (41), Candida tropicalis (41) and Candida parapsilosis sensu stricto (14). Other isolated species were as follows: Candida kefyr (10), Candida krusei (9), Candida fabianii (6), Candida lusitaniae (5), Candida dubliniensis (3) and Saccharomyces cerevisiae (one case). Most of the yeasts rather readily formed a firmly adhering biofilm layer on artificial surfaces.
Molded polymer solar water heater
Bourne, Richard C.; Lee, Brian E.
2004-11-09
A solar water heater has a rotationally-molded water box and a glazing subassembly disposed over the water box that enhances solar gain and provides an insulating air space between the outside environment and the water box. When used with a pressurized water system, an internal heat exchanger is integrally molded within the water box. Mounting and connection hardware is included to provide a rapid and secure method of installation.
Kulkarni, S.V.; Christensen, R.M.; Toland, R.H.
1980-09-24
A flywheel is described that is useful for energy storage in a hybrid vehicle automotive power system or in some stationary applications. The flywheel has a body of essentially planar isotropic high strength structural random fiber sheet molding compound (SMC-R). The flywheel may be economically produced by a matched metal die compression molding process. The flywheel makes energy intensive efficient use of a fiber/resin composite while having a shape designed by theory assuming planar isotropy.
Indoor molds and lung function in healthy adults.
Hernberg, Samu; Sripaiboonkij, Penpatra; Quansah, Reginald; Jaakkola, Jouni J K; Jaakkola, Maritta S
2014-05-01
Indoor mold exposure is common worldwide and constitutes an important health problem. There are very few studies assessing the relation between mold exposure and lung function levels among non-asthmatic adults. Our objective was to assess the relations between dampness and mold exposures at home and at work and lung function. In particular, we elaborated the importance of different exposure indicators. In a population-based study, 269 non-asthmatic adults from South Finland answered a questionnaire on indoor dampness and mold exposures at home or at work and other factors potentially influencing lung function, and performed spirometry. Multiple linear regression model was applied to study the relations between exposures and spirometric lung function levels. In linear regression adjusting for confounding, FEV1 level was reduced on average 200 ml related to mold odor at home (effect estimate -0.20, 95% CI -0.60 to 0.21) and FVC level was reduced on average 460 ml (-0.46, -0.95 to 0.03) respectively. Exposure to mold odor at home or at work or both was related to reduced FEV1 (-0.15, -0.42 to 0.12) and FVC (-0.22, -0.55 to 0.11) levels. Women had on average 510 ml reduced FEV1 levels (-0.51, -1.0 to 0.03) and 820 ml reduced FVC levels (-0.82, -1.4 to -0.20) related to mold odor exposure at home. Mold odor exposure was related to lower lung function levels among non-asthmatic adults, especially among women. Copyright © 2014 Elsevier Ltd. All rights reserved.
Preparation and properties of an internal mold release for rigid urethane foam
NASA Astrophysics Data System (ADS)
Paker, B. G.
1980-08-01
Most mold release agents used in the molding of rigid polyurethane foam are applied to the internal surfaces of the mold. These materials form a thin layer between the surface of the mold and the foam, allowing for easy release of the molded parts. This type of mold release must be applied prior to each molding operation; and, after repeated use, cleaning of the mold is required. Small amounts of this mold release are transferred to the molded part, resulting in a part with poor surface bondability characteristics. An internal release agent, which can be mixed in a urethane foam resin was investigated. The internal mold release provided good releasability and resulted in urethane foam that has excellent surface bondability. No compatibility problems are expected from the use of this type of release agent.
Applying simulation to optimize plastic molded optical parts
NASA Astrophysics Data System (ADS)
Jaworski, Matthew; Bakharev, Alexander; Costa, Franco; Friedl, Chris
2012-10-01
Optical injection molded parts are used in many different industries including electronics, consumer, medical and automotive due to their cost and performance advantages compared to alternative materials such as glass. The injection molding process, however, induces elastic (residual stress) and viscoelastic (flow orientation stress) deformation into the molded article which alters the material's refractive index to be anisotropic in different directions. Being able to predict and correct optical performance issues associated with birefringence early in the design phase is a huge competitive advantage. This paper reviews how to apply simulation analysis of the entire molding process to optimize manufacturability and part performance.
Mold exposure and health effects following hurricanes Katrina and Rita.
Barbeau, Deborah N; Grimsley, L Faye; White, LuAnn E; El-Dahr, Jane M; Lichtveld, Maureen
2010-01-01
The extensive flooding in the aftermath of Hurricanes Katrina and Rita created conditions ideal for indoor mold growth, raising concerns about the possible adverse health effects associated with indoor mold exposure. Studies evaluating the levels of indoor and outdoor molds in the months following the hurricanes found high levels of mold growth. Homes with greater flood damage, especially those with >3 feet of indoor flooding, demonstrated higher levels of mold growth compared with homes with little or no flooding. Water intrusion due to roof damage was also associated with mold growth. However, no increase in the occurrence of adverse health outcomes has been observed in published reports to date. This article considers reasons why studies of mold exposure after the hurricane do not show a greater health impact.
Testing single point incremental forming molds for thermoforming operations
NASA Astrophysics Data System (ADS)
Afonso, Daniel; de Sousa, Ricardo Alves; Torcato, Ricardo
2016-10-01
Low pressure polymer processing processes as thermoforming or rotational molding use much simpler molds then high pressure processes like injection. However, despite the low forces involved with the process, molds manufacturing for this operations is still a very material, energy and time consuming operation. The goal of the research is to develop and validate a method for manufacturing plastically formed sheets metal molds by single point incremental forming (SPIF) operation for thermoforming operation. Stewart platform based SPIF machines allow the forming of thick metal sheets, granting the required structural stiffness for the mold surface, and keeping the short lead time manufacture and low thermal inertia.
Micro-optical fabrication by ultraprecision diamond machining and precision molding
NASA Astrophysics Data System (ADS)
Li, Hui; Li, Likai; Naples, Neil J.; Roblee, Jeffrey W.; Yi, Allen Y.
2017-06-01
Ultraprecision diamond machining and high volume molding for affordable high precision high performance optical elements are becoming a viable process in optical industry for low cost high quality microoptical component manufacturing. In this process, first high precision microoptical molds are fabricated using ultraprecision single point diamond machining followed by high volume production methods such as compression or injection molding. In the last two decades, there have been steady improvements in ultraprecision machine design and performance, particularly with the introduction of both slow tool and fast tool servo. Today optical molds, including freeform surfaces and microlens arrays, are routinely diamond machined to final finish without post machining polishing. For consumers, compression molding or injection molding provide efficient and high quality optics at extremely low cost. In this paper, first ultraprecision machine design and machining processes such as slow tool and fast too servo are described then both compression molding and injection molding of polymer optics are discussed. To implement precision optical manufacturing by molding, numerical modeling can be included in the future as a critical part of the manufacturing process to ensure high product quality.
Nasoalveolar molding in cleft care: is it efficacious?
Abbott, Megan M; Meara, John G
2012-09-01
In the era of evidence-based medicine, new treatment protocols and interventions should be routinely evaluated for their efficacy by reviewing the available evidence. In the cleft literature, nasoalveolar molding has garnered attention over the last decade as a new option for improving nasal form and symmetry before primary surgical repair. Systematic review of the evidence is, however, currently lacking. This review evaluates whether nasoalveolar molding can improve nasal symmetry and form toward the norm, as well as whether nasoalveolar molding demonstrates advantages over other protocols in achieving this goal. A literature search of five databases plus relevant reference lists retrieved 98 articles regarding nasoalveolar molding, 21 of which reported objective outcome measures of nasal symmetry and form, and six of which were able to be given evidence level ratings, all in the unilateral cleft population. Statistical analysis was not possible given the range of techniques and outcomes. Studies of bilateral cleft were not given evidence level ratings, given the inability to separate the effects of nasoalveolar molding from other primary nasal interventions in studies that would have otherwise been rated. In unilateral cleft lip-cleft palate, there was some evidence that nasoalveolar molding may improve nasal outcomes, though comparison with other techniques was limited. Despite a relative paucity of high-level evidence, nasoalveolar molding appears to be a promising technique that deserves further study.
Long-chain alkane production by the yeast Saccharomyces cerevisiae.
Buijs, Nicolaas A; Zhou, Yongjin J; Siewers, Verena; Nielsen, Jens
2015-06-01
In the past decade industrial-scale production of renewable transportation biofuels has been developed as an alternative to fossil fuels, with ethanol as the most prominent biofuel and yeast as the production organism of choice. However, ethanol is a less efficient substitute fuel for heavy-duty and maritime transportation as well as aviation due to its low energy density. Therefore, new types of biofuels, such as alkanes, are being developed that can be used as drop-in fuels and can substitute gasoline, diesel, and kerosene. Here, we describe for the first time the heterologous biosynthesis of long-chain alkanes by the yeast Saccharomyces cerevisiae. We show that elimination of the hexadecenal dehydrogenase Hfd1 and expression of a redox system are essential for alkane biosynthesis in yeast. Deletion of HFD1 together with expression of an alkane biosynthesis pathway resulted in the production of the alkanes tridecane, pentadecane, and heptadecane. Our study provides a proof of principle for producing long-chain alkanes in the industrial workhorse S. cerevisiae, which was so far limited to bacteria. We anticipate that these findings will be a key factor for further yeast engineering to enable industrial production of alkane based drop-in biofuels, which can allow the biofuel industry to diversify beyond bioethanol. © 2014 Wiley Periodicals, Inc.
Serpaggi, Virginie; Remize, Fabienne; Recorbet, Ghislaine; Gaudot-Dumas, Eliane; Sequeira-Le Grand, Anabelle; Alexandre, Hervé
2012-06-01
Although the viable but not culturable (VBNC) state has been studied in detail in bacteria, it has been suggested that maintenance of viability with loss of culturability also exists in eukaryotic cells, such as in the wine spoilage yeast Brettanomyces. To provide conclusive evidence for the existence of a VBNC state in this yeast, we investigated its capacity to become viable and nonculturable after sulfite stress, and its ability to recover culturability after stressor removal. Sulfite addition induced loss of culturability but maintenance of viability. Increasing the medium pH to decrease the concentration of toxic SO(2) allowed yeast cells to become culturable again, thus demonstrating the occurrence of a VBNC state in Brettanomyces upon SO(2) exposure. Relative to culturable Brettanomyces, VBNC yeast cells were found to display a 22% decrease in size on the basis of laser granulometry. Assays for 4-ethylguaiacol and 4-ethylphenol, volatile phenols produced by Brettanomyces, indicated that spoilage compound production could persist in VBNC cells. These morphological and physiological changes in VBNC Brettanomyces were coupled to extensive protein pattern modifications, as inferred by comparative two-dimensional electrophoresis and mass spectrometric analyses. Upon identification of 53 proteins out of the 168 spots whose abundance was significantly modified in treated cells relative to control, we propose that the SO(2)-induced VBNC state in Brettanomyces is characterized by a reduced glycolytic flux coupled to changes in redox homeostatis/protein turnover-related processes. This study points out the existence of common mechanisms between yeast and bacteria upon entry to the VBNC state. Copyright © 2012 Elsevier Ltd. All rights reserved.
Flow behavior in liquid molding
NASA Technical Reports Server (NTRS)
Hunston, D.; Phelan, F.; Parnas, R.
1992-01-01
The liquid molding (LM) process for manufacturing polymer composites with structural properties has the potential to significantly lower fabrication costs and increase production rates. LM includes both resin transfer molding and structural reaction injection molding. To achieve this potential, however, the underlying science base must be improved to facilitate effective process optimization and implementation of on-line process control. The National Institute of Standards and Technology (NIST) has a major program in LM that includes materials characterization, process simulation models, on-line process monitoring and control, and the fabrication of test specimens. The results of this program are applied to real parts through cooperative projects with industry. The key feature in the effort is a comprehensive and integrated approach to the processing science aspects of LM. This paper briefly outlines the NIST program and uses several examples to illustrate the work.
Solving ethanol production problems with genetically modified yeast strains
Abreu-Cavalheiro, A.; Monteiro, G.
2013-01-01
The current world demand for bioethanol is increasing as a consequence of low fossil fuel availability and a growing number of ethanol/gasoline flex-fuel cars. In addition, countries in several parts of the world have agreed to reduce carbon dioxide emissions, and the use of ethanol as a fuel (which produces fewer pollutants than petroleum products) has been considered to be a good alternative to petroleum products. The ethanol that is produced in Brazil from the first-generation process is optimized and can be accomplished at low cost. However, because of the large volume of ethanol that is produced and traded each year, any small improvement in the process could represent a savings of billions dollars. Several Brazilian research programs are investing in sugarcane improvement, but little attention has been given to the improvement of yeast strains that participate in the first-generation process at present. The Brazilian ethanol production process uses sugarcane as a carbon source for the yeast Saccharomyces cerevisiae. Yeast is then grown at a high cellular density and high temperatures in large-capacity open tanks with cells recycle. All of these culture conditions compel the yeast to cope with several types of stress. Among the main stressors are high temperatures and high ethanol concentrations inside the fermentation tanks during alcohol production. Moreover, the competition between the desired yeast strains, which are inoculated at the beginning of the process, with contaminants such as wild type yeasts and bacteria, requires acid treatment to successfully recycle the cells. This review is focused on describing the problems and stressors within the Brazilian ethanol production system. It also highlights some genetic modifications that can help to circumvent these difficulties in yeast. PMID:24516432
Solving ethanol production problems with genetically modified yeast strains.
Abreu-Cavalheiro, A; Monteiro, G
2013-01-01
The current world demand for bioethanol is increasing as a consequence of low fossil fuel availability and a growing number of ethanol/gasoline flex-fuel cars. In addition, countries in several parts of the world have agreed to reduce carbon dioxide emissions, and the use of ethanol as a fuel (which produces fewer pollutants than petroleum products) has been considered to be a good alternative to petroleum products. The ethanol that is produced in Brazil from the first-generation process is optimized and can be accomplished at low cost. However, because of the large volume of ethanol that is produced and traded each year, any small improvement in the process could represent a savings of billions dollars. Several Brazilian research programs are investing in sugarcane improvement, but little attention has been given to the improvement of yeast strains that participate in the first-generation process at present. The Brazilian ethanol production process uses sugarcane as a carbon source for the yeast Saccharomyces cerevisiae. Yeast is then grown at a high cellular density and high temperatures in large-capacity open tanks with cells recycle. All of these culture conditions compel the yeast to cope with several types of stress. Among the main stressors are high temperatures and high ethanol concentrations inside the fermentation tanks during alcohol production. Moreover, the competition between the desired yeast strains, which are inoculated at the beginning of the process, with contaminants such as wild type yeasts and bacteria, requires acid treatment to successfully recycle the cells. This review is focused on describing the problems and stressors within the Brazilian ethanol production system. It also highlights some genetic modifications that can help to circumvent these difficulties in yeast.
The occurrence of molds in patients with chronic sinusitis.
Twarużek, Magdalena; Soszczyńska, Ewelina; Winiarski, Piotr; Zwierz, Aleksander; Grajewski, Jan
2014-05-01
Chronic rhinosinusitis (CRS) is a common inflammatory condition of nasal and paranasal sinus mucosa. Although pathogenic bacteria were postulated as main etiological factor responsible for most cases of CRS, the involvement of molds was recently proved in some cases. The aim of the study was to conduct mycological analysis of material obtained from patients operated on due to chronic sinusitis. The study included 107 patients, 45 women and 62 men. During the surgery, a fragment of mucosa from the region of the ethmoid bulla was obtained as microbiological characteristics of this material closely resemble those of sinus mucosa. In addition, maxillary sinus lavage was obtained. The control group comprised patients without chronic sinusitis. The dithiothreitol solution method was used for the lavage examination. The tissue material (mucosal fragment from the region of the ethmoid bulla) was incubated in 2% liquid Sabouraud medium for 24 h. The material was inoculated onto culture media. The presence of molds was detected in 67% of examined samples. Overall, 41 species belonging to 12 genera were isolated. The most frequently detected genera included Penicillium spp. (46%) and Aspergillus spp. (16%). In addition, Cladosporium spp. (11%), Fusarium spp. (7%), Acremonium spp. (4%), Eurotium spp. (4%), Alternaria spp. (2%), Chaetomium spp. (1%), Geotrichum spp. (1%), Verticillium spp. (1%), Rhizopus spp. (1%), and some unidentified colonies (5%) were isolated. Penicillium crustosum, Penicillium citrinum, Aspergillus niger, Cladosporium cladosporioides, and Fusarium verticillioides were the most prevalent species.
Thapa, Rupak; Bhagat, Chintan; Shrestha, Pragya; Awal, Suvash; Dudhagara, Pravin
2017-05-16
Silver nanoparticles (AgNPs) are believed to be emerging tool against various infectious diseases including multi-drug resistant (MDR) bacteria. In the present study, in vitro synthesis of AgNPs was optimized using 1:50 ratio of macerozyme (25 μg/μl) and 1 mM AgNO 3 incubated at 80 °C for 8 h. AgNPs were characterized by UV-Visible spectroscopy, dynamic light scattering (DLS), scanning electron microscopy, energy-dispersive X-ray spectroscopy, transmission electron microscopy (TEM) and X-ray diffraction (XRD). Characterization studies suggest the synthesis of elliptical, stable and crystalline AgNPs with an average size of 38.26 ± 0.4 nm calculated using TEM. The XRD pattern revealed the face-centered-cubic (fcc) form of metallic silver. Good shape integrity and dispersion of AgNPs after 1 year of incubation confirmed their stability. AgNPs were exibited the antimicrobial property against ten pathogenic bacteria, three molds and one yeast. The AgNPs also revealed remarkable antimicrobial activity against three MDR strains i.e. Extended spectrum beta-lactamase positive Escherichia coli, Staphylococcus aureus (MRSA) and Teicoplanin resistant Streptococcus Pneumoniae. The AgNPs coated surgical threads (suture) were revealed the remarkble antibacterial activity against three MDR strains. This is the first report to synthesize antimicrobial elliptical AgNPs using enzymes. The results suggest the possibilities to develop the nanoparticles coated antimicrobial medical fabric to combat against MDR infection.
Wei, Wei; Wang, Xu; Xie, Zhongwen; Wang, Wen; Xu, Junfeng; Liu, Yuanjing; Gao, Haiyan; Zhou, Yu
2017-01-01
Strawberries, cherry tomatoes, and red bayberries, which are the most popular types of fresh produce in China, are vulnerable to microbial contamination. In this study, different sanitizing methods [treatment with 2% organic acids, 0.02% sodium hypochlorite (SH), 0.1% sodium chlorite (SC), and 0.1% acidified sodium chlorite (ASC)] were applied to fresh strawberry, cherry tomato, and red bayberry, and their abilities to reduce aerobic bacteria, Escherichia coli O157:H7, mold, yeast, and Salmonella Typhimurium were evaluated. The commercially used SH method reduced the background microbiota on strawberry, cherry tomato, and red bayberry by 0.20–2.07 log cfu/g. The ASC method reduced background microbiota (except for mold) on strawberry and cherry tomato by more than 3.0 log cfu/g. ASC was the only sanitizer that significantly reduced mold on red bayberry, and lactic acid was the only organic acid sanitizer that effectively reduced yeast on red bayberry. The ASC method had the best sterilizing effect on the three fresh fruits and also required the shortest sanitizing time and low chlorite content. The application of ASC method significantly reduced the microbiota on retail grocery samples, and the effect was similar to that achieved by sanitizing methods comparison. PMID:29259594
Wei, Wei; Wang, Xu; Xie, Zhongwen; Wang, Wen; Xu, Junfeng; Liu, Yuanjing; Gao, Haiyan; Zhou, Yu
2017-01-01
Strawberries, cherry tomatoes, and red bayberries, which are the most popular types of fresh produce in China, are vulnerable to microbial contamination. In this study, different sanitizing methods [treatment with 2% organic acids, 0.02% sodium hypochlorite (SH), 0.1% sodium chlorite (SC), and 0.1% acidified sodium chlorite (ASC)] were applied to fresh strawberry, cherry tomato, and red bayberry, and their abilities to reduce aerobic bacteria, Escherichia coli O157:H7, mold, yeast, and Salmonella Typhimurium were evaluated. The commercially used SH method reduced the background microbiota on strawberry, cherry tomato, and red bayberry by 0.20-2.07 log cfu/g. The ASC method reduced background microbiota (except for mold) on strawberry and cherry tomato by more than 3.0 log cfu/g. ASC was the only sanitizer that significantly reduced mold on red bayberry, and lactic acid was the only organic acid sanitizer that effectively reduced yeast on red bayberry. The ASC method had the best sterilizing effect on the three fresh fruits and also required the shortest sanitizing time and low chlorite content. The application of ASC method significantly reduced the microbiota on retail grocery samples, and the effect was similar to that achieved by sanitizing methods comparison.
Epoxy-resin patterns speed shell-molding of aluminum parts
NASA Technical Reports Server (NTRS)
1965-01-01
Half patterns cast from commercial epoxy resin containing aluminum powder are used for shell-molding of aluminum parts. The half patterns are cast in plastic molds of the original wooden pattern. Ten serviceable sand resin molds are made from each epoxy pattern.
NASA Astrophysics Data System (ADS)
Peanpunga, Udom; Ugsornrat, Kessararat; Thorlor, Panakamol; Sumithpibul, Chalermsak
2017-09-01
This research studied about an epoxy molding compound (EMC) floor life to reliability performance of integrated circuit (IC) package. Molding is the process for protecting the die of IC package form mechanical and chemical reaction from external environment by shaping EMC. From normal manufacturing process, the EMC is stored in the frozen at 5oC and left at around room temperature for aging time or floor life before molding process. The EMC floor life effect to its properties and reliability performance of IC package. Therefore, this work interested in varied the floor life of EMC before molding process to analyze properties of EMC such as spiral flow length, gelation time, and viscosity. In experiment, the floor life of EMC was varied to check the effect of its property to reliability performance. The EMC floor life were varied from 0 hours to 60 hours with a step of 12 hours and observed wire sweep, incomplete EMC, and delamination inside the packages for 3x3, 5x5 and 8x8 mm2 of QFN packages. The evaluation showed about clearly effect of EMC floor life to IC packaging reliability. EMC floor life is not any concern for EMC property, moldabilty, and reliability from 0 hours to 48 hours for molding process of 3x3,5x5 and 8x8 mm2 QFN packaging manufacturing
A programmable nanoreplica molding for the fabrication of nanophotonic devices.
Liu, Longju; Zhang, Jingxiang; Badshah, Mohsin Ali; Dong, Liang; Li, Jingjing; Kim, Seok-min; Lu, Meng
2016-03-01
The ability to fabricate periodic structures with sub-wavelength features has a great potential for impact on integrated optics, optical sensors, and photovoltaic devices. Here, we report a programmable nanoreplica molding process to fabricate a variety of sub-micrometer periodic patterns using a single mold. The process utilizes a stretchable mold to produce the desired periodic structure in a photopolymer on glass or plastic substrates. During the replica molding process, a uniaxial force is applied to the mold and results in changes of the periodic structure, which resides on the surface of the mold. Direction and magnitude of the force determine the array geometry, including the lattice constant and arrangement. By stretching the mold, 2D arrays with square, rectangular, and triangular lattice structures can be fabricated. As one example, we present a plasmonic crystal device with surface plasmon resonances determined by the force applied during molding. In addition, photonic crystal slabs with different array patterns are fabricated and characterized. This unique process offers the capability of generating various periodic nanostructures rapidly and inexpensively.
A programmable nanoreplica molding for the fabrication of nanophotonic devices
Liu, Longju; Zhang, Jingxiang; Badshah, Mohsin Ali; Dong, Liang; Li, Jingjing; Kim, Seok-min; Lu, Meng
2016-01-01
The ability to fabricate periodic structures with sub-wavelength features has a great potential for impact on integrated optics, optical sensors, and photovoltaic devices. Here, we report a programmable nanoreplica molding process to fabricate a variety of sub-micrometer periodic patterns using a single mold. The process utilizes a stretchable mold to produce the desired periodic structure in a photopolymer on glass or plastic substrates. During the replica molding process, a uniaxial force is applied to the mold and results in changes of the periodic structure, which resides on the surface of the mold. Direction and magnitude of the force determine the array geometry, including the lattice constant and arrangement. By stretching the mold, 2D arrays with square, rectangular, and triangular lattice structures can be fabricated. As one example, we present a plasmonic crystal device with surface plasmon resonances determined by the force applied during molding. In addition, photonic crystal slabs with different array patterns are fabricated and characterized. This unique process offers the capability of generating various periodic nanostructures rapidly and inexpensively. PMID:26925828
21 CFR 133.184 - Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk. 133.184 Section 133.184 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE...
21 CFR 133.184 - Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 2 2011-04-01 2011-04-01 false Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk. 133.184 Section 133.184 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE...
Additive Manufacturing of Wind Turbine Molds
DOE Office of Scientific and Technical Information (OSTI.GOV)
Post, Brian; Richardson, Bradley; Lloyd, Peter
The objective of this project was to explore the utility of Big Area Additive Manufacturing (BAAM) for low cost manufacturing of wind turbine molds. Engineers at Oak Ridge National Laboratory (ORNL) and TPI Composites (TPI) collaborated to design and manufacture a printed mold that can be used for resin infusion of wind turbine components. Specific focus was on required material properties (operating temperatures and pressures, coefficient of thermal expansion (CTE), thermal conductivity), surface finish (accuracy and coatings) and system integration (integrated vacuum ports, and heating element). The project began with a simple proof of principle components, targeting surface coatings andmore » material properties for printing a small section (approximately 4’ x 4’ x 2’) of a mold. Next, the second phase scaled up and integrated with the objective of capturing all of the necessary components (integrated heating to accelerate cure time, and vacuum, sealing) for resin infusion on a mold of significant size (8’ x 20’ x 6’).« less
Neuropsychological exploration of alleged mold neurotoxicity.
Reinhard, Matthew J; Satz, Paul; Scaglione, Cris A; D'Elia, Louis F; Rassovsky, Yuri; Arita, Anthony A; Hinkin, Charles H; Thrasher, Delaney; Ordog, Gary
2007-05-01
Cognitive and emotional correlates of toxic mold exposure and potential dose-response effects for both outcomes were investigated. Self-reported length of exposure, time since last exposure, and serum immunoglobulin (IgG) levels were assessed. Despite CNS complaints often seen with mold exposed individuals, overall results did not uncover concomitant cognitive deficits suggested in previous studies or a significant reduction in intellectual functioning. Fewer subjects were excluded as result of failing effort/motivation assessment than expected. Correlations of IgG and cognitive function are discussed. A dose-effect for self-reported length of exposure and cognitive outcome was not seen. The sample's overall Minnesota Multiphasic Personality Inventory II (MMPI-2) profile indicated elevations on scales 1, 2, 3, 7 and 8. MMPI-2 clinical scales 1 and 3 were significantly correlated with length of exposure. The MMPI-2 may be sensitive to increasing physical and emotional sequelae as length of exposure increases. A potential subgroup of cognitively impaired outliers within mold exposure litigants is explored. Limitations of self-reported and objective measurements for mold exposure and exploratory statistical methodology are discussed.
Evacuated, displacement compression mold. [of tubular bodies from thermosetting plastics
NASA Technical Reports Server (NTRS)
Heier, W. C. (Inventor)
1974-01-01
A process of molding long thin-wall tubular bodies from thermosetting plastic molding compounds is described wherein the tubular body lengths may be several times the diameters. The process is accomplished by loading a predetermined quantity of molding compound into a female mold cavity closed at one end by a force mandrel. After closing the other end of the female mold with a balance mandrel, the loaded cavity is evacuated by applying a vacuum of from one-to-five mm pressure for a period of fifteen-to-thirty minutes. The mold temperature is raised to the minimum temperature at which the resin constituent of the compound will soften or plasticize and a pressure of 2500 psi is applied.
Karabulut, Gulsah; Cagri-Mehmetoglu, Arzu
2018-03-01
The molding of food products causing health risks is a main problem in the food industry. In this study, as an alternative solution for preventing mold growth, an antifungal edible film was developed by incorporating Williopsis saturnus var. saturnus (0; 3; 7; and 9 logs CFU/cm 2 ) into whey protein concentrate (WPC) based films. Antifungal properties of the films against Penicilium expansum and Aspergillus niger were analyzed using the disc diffusion method. Physical (barrier, solubility, color), mechanical (tensile strength and percent elongation) properties of the films as well as the survival of W. saturnus in the film were assessed during 28 days of storage at 23 °C. According to the results, the viability of W. saturnus (7 and 9 logs CFU/cm 2 ) in WPC films stored for 28 days under vacuum or non-vacuum decreased to 36% and 60%, respectively. In addition, films containing W. saturnus decreased the viability of P. expansum and A. niger by 29% and 19%, respectively. Adding yeast did not change the tensile strength (P > 0.05), but significantly decreased % elongation and increased water vapor and oxygen permeability and water solubility (P < 0.05). In conclusion, this study showed that the developed films may be useful for inhibiting mold growth on foods. © 2018 Institute of Food Technologists®.
ERIC Educational Resources Information Center
Huckabee, Christopher
2003-01-01
Using the example of a Texas elementary school, describes how to eliminate mold and mildew from school facilities, including discovering the problem, responding quickly, reconstructing the area, and crisis planning and prevention. (EV)
Sophorolipid biosurfactant against bacteria relevant to tooth caries and skin hygiene
USDA-ARS?s Scientific Manuscript database
Sophorolipid (SL) is glycolipid biosurfactant produced by yeast. Its general antimicrobial activity was previously reported. In this paper, we present the antimicrobial activity of SL specifically against oral and skin bacteria. Using a microplate to continuously monitor cell growth, we found com...
Genomic characterization of recurrent mold infections in thoracic transplant recipients.
Messina, Julia A; Wolfe, Cameron R; Hemmersbach-Miller, Marion; Milano, Carmelo; Todd, Jamie L; Reynolds, John; Alexander, Barbara D; Schell, Wiley A; Cuomo, Christina A; Perfect, John R
2018-05-31
Invasive mold disease in thoracic organ transplant recipients is a well-recognized complication, but the long-term persistence of molds within the human body and evasion of host defenses has not been well-described. We present 2 cases of invasive mold disease (Verruconis gallopava and Aspergillus fumigatus) in thoracic transplant recipients who had the same mold cultured years prior to the invasive disease presentation. The paired isolates from the index and recurrent infections in both patients were compared using whole-genome sequencing to determine if the same strain of mold caused both the index and recurrent infections. In Case 1, the isolates were found to be of the same strain indicating that the initial colonizing isolate identified pre-transplant eventually caused invasive mold disease post-transplant while in Case 2, the 2 isolates were not of the same strain. These results demonstrate the distinct possibility of molds both persisting within the human body for years prior to invasive mold disease or the long-term risk of recurrent, persistent infection with more than one strain. Further studies of long-term molecular epidemiology of IMD and risk factors for mold persistence in transplant recipients are encouraged. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
[Biological monitoring in the molding of plastics and rubbers].
Fustinoni, S; Campo, L; Cirla, A M; Cirla, P E; Cutugno, V; Lionetti, C; Martinotti, I; Mossini, E; Foà, V
2007-01-01
This survey was carried out in the molding of plastics and rubbers, in the "Professional Cancer Prevention Project" sponsored by the Lombardy region with the objective of developing and implementing protocols for evaluating exposure to carcinogens through the biological monitoring. The realities of molding the thermoplastic polymer ABS, rubber, and thermosetting plastics containing formaldehyde were examined. The carcinogenic substances identified in these processes were: 1,3-butadiene, acrylonitrile and styrene in molding ABS, polycyclic aromatic hydrocarbons (PAH) in molding rubber, and formaldehyde in molding the thermosetting plastics. Only for some of these substances biological indicators are available. The limited exposure to airborne chemicals in molding ABS and the intrinsic characteristics of biological indicators available for 1-3 butadiene have determined the non applicability of biological monitoring to this situation. The absence of a biological indicator of exposure to formaldehyde has made this situation not investigable. Exposure in the rubber molding was studied in 19 subjects applying the determination not metabolized PAH in urine. The levels of these indicators were similar to those measured in other groups of subjects without occupational exposure to PAH, confirming a low airborne contamination in this workplace.
Static Mixer for Heat Transfer Enhancement for Mold Cooling Application
NASA Astrophysics Data System (ADS)
Becerra, Rodolfo; Barbosa, Raul; Lee, Kye-Hwan; Park, Younggil
Injection molding is the process by which a material is melted in a barrel and then it is injected through a nozzle in the mold cavity. When it cools down, the material solidifies into the shape of the cavity. Typical injection mold has cooling channels to maintain constant mold temperature during injection molding process. Even and constant temperature throughout the mold are very critical for a part quality and productivity. Conformal cooling improves the quality and productivity of injection molding process through the implementation of cooling channels that ``conform'' to the shape of the molded part. Recent years, the use of conformal cooling increases with advance of 3D printing technology such as Selective Laser Melting (SLM). Although it maximizes cooling, material and dimension limitations make SLM methods highly expensive. An alternative is the addition of static mixers in the molds with integrated cooling channels. A static mixer is a motionless mixing device that enhances heat transfer by producing improved flow mixing in the pipeline. In this study, the performance of the cooling channels will be evaluated with and without static mixers, by measuring temperature, pressure drop, and flow rate. The following question is addressed: Can a static mixer effectively enhance heat transfer for mold cooling application processes? This will provide insight on the development of design methods and guidelines that can be used to increase cooling efficiency at a lower cost.
Treating "cauliflower ear" with silicone mold.
Gross, C G
1978-01-01
Acute hematoma of the ear (cauliflower ear) can be satisfactorily treated with aspiration and the use of the silicone mold to prevent reaccumulation of the blood or serum in the ear. Advantages of the silicone mold over other dressings appears to be ease of application, patient acceptance, and prevention of reoccurrence of reaccumulation of the hematoma.
... condensation because there is a hole in the insulation and it is cold outdoors. Photo courtesy of ... Inside of wall from above, moldy gypsum board, insulation Photo courtesy of Terry Brennan Looking for mold ...
Simulation of cracking cores when molding piston components
NASA Astrophysics Data System (ADS)
Petrenko, Alena; Soukup, Josef
2014-08-01
The article deals with pistons casting made from aluminum alloy. Pistons are casting at steel mold with steel core. The casting is provided by gravity casting machine. The each machine is equipped by two metal molds, which are preheated above temperature 160 °C before use. The steel core is also preheated by flame. The metal molds and cores are heated up within the casting process. The temperature of the metal mold raise up to 200 °C and temperature of core is higher. The surface of the core is treated by nitration. The mold and core are cooled down by water during casting process. The core is overheated and its top part is finally cracked despite its intensive water-cooling. The life time cycle of the core is decreased to approximately 5 to 15 thousands casting, which is only 15 % of life time cycle of core for production of other pistons. The article presents the temperature analysis of the core.
Functional inclusion bodies produced in the yeast Pichia pastoris.
Rueda, Fabián; Gasser, Brigitte; Sánchez-Chardi, Alejandro; Roldán, Mònica; Villegas, Sandra; Puxbaum, Verena; Ferrer-Miralles, Neus; Unzueta, Ugutz; Vázquez, Esther; Garcia-Fruitós, Elena; Mattanovich, Diethard; Villaverde, Antonio
2016-10-01
Bacterial inclusion bodies (IBs) are non-toxic protein aggregates commonly produced in recombinant bacteria. They are formed by a mixture of highly stable amyloid-like fibrils and releasable protein species with a significant extent of secondary structure, and are often functional. As nano structured materials, they are gaining biomedical interest because of the combination of submicron size, mechanical stability and biological activity, together with their ability to interact with mammalian cell membranes for subsequent cell penetration in absence of toxicity. Since essentially any protein species can be obtained as IBs, these entities, as well as related protein clusters (e.g., aggresomes), are being explored in biocatalysis and in biomedicine as mechanically stable sources of functional protein. One of the major bottlenecks for uses of IBs in biological interfaces is their potential contamination with endotoxins from producing bacteria. To overcome this hurdle, we have explored here the controlled production of functional IBs in the yeast Pichia pastoris (Komagataella spp.), an endotoxin-free host system for recombinant protein production, and determined the main physicochemical and biological traits of these materials. Quantitative and qualitative approaches clearly indicate the formation of IBs inside yeast, similar in morphology, size and biological activity to those produced in E. coli, that once purified, interact with mammalian cell membranes and penetrate cultured mammalian cells in absence of toxicity. Structurally and functionally similar from those produced in E. coli, the controlled production of IBs in P. pastoris demonstrates that yeasts can be used as convenient platforms for the biological fabrication of self-organizing protein materials in absence of potential endotoxin contamination and with additional advantages regarding, among others, post-translational modifications often required for protein functionality.
Direct molding of pavement tiles made of ground tire rubber
NASA Astrophysics Data System (ADS)
Quadrini, Fabrizio; Gagliardi, Donatella; Tedde, Giovanni Matteo; Santo, Loredana; Musacchi, Ettore
2016-10-01
Large rubber products can be molded by using only ground tire rubber (GTR) without any additive or binder due to a new technology called "direct molding". Rubber granules and powders from tire recycling are compression molded at elevated temperatures and pressures. The feasibility of this process was clearly shown in laboratory but the step to the industrial scale was missing. Thanks to an European Project (SMART "Sustainable Molding of Articles from Recycled Tires") this step has been made and some results are reported in this study. The press used for compression molding is described. Some tests were made to measure the energy consumption so as to evaluate costs for production in comparison with conventional technologies for GTR molding (by using binders). Results show that 1 m2 tiles can be easily molded with several thicknesses in a reasonable low time. Energy consumption is higher than conventional technologies but it is lower than the cost for binders.
Fundamentals of rapid injection molding for microfluidic cell-based assays.
Lee, Ulri N; Su, Xiaojing; Guckenberger, David J; Dostie, Ashley M; Zhang, Tianzi; Berthier, Erwin; Theberge, Ashleigh B
2018-01-30
Microscale cell-based assays have demonstrated unique capabilities in reproducing important cellular behaviors for diagnostics and basic biological research. As these assays move beyond the prototyping stage and into biological and clinical research environments, there is a need to produce microscale culture platforms more rapidly, cost-effectively, and reproducibly. 'Rapid' injection molding is poised to meet this need as it enables some of the benefits of traditional high volume injection molding at a fraction of the cost. However, rapid injection molding has limitations due to the material and methods used for mold fabrication. Here, we characterize advantages and limitations of rapid injection molding for microfluidic device fabrication through measurement of key features for cell culture applications including channel geometry, feature consistency, floor thickness, and surface polishing. We demonstrate phase contrast and fluorescence imaging of cells grown in rapid injection molded devices and provide design recommendations to successfully utilize rapid injection molding methods for microscale cell-based assay development in academic laboratory settings.
Gallup, J; Kozak, P; Cummins, L; Gillman, S
1987-01-01
We are constantly being exposed to molds in our environment. Indoor mold problems occur after prolonged or chronic water damage to a variety of organic materials such as unfinished wood, jutebacked carpeting, wallpaper, books, cardboard, leather, cork, paper, wallboard, and wicker baskets. Mechanisms for spore dispersal (such as air currents or foot traffic on carpets) must also be present. The presence of these organic materials and dispersal mechanisms leads to significant increases in indoor spore levels.
Paulino, Gustavo Vasconcelos Bastos; Félix, Ciro Ramon; Broetto, Leonardo; Landell, Melissa Fontes
2017-10-15
Some of the main threats to coral reefs come from human actions on marine environment, such as tourism, overfishing and pollution from urban development. While several studies have demonstrated an association between bacteria and corals, demonstrating how these communities react to different anthropogenic stressors, yeast communities associated with corals have received far less attention from researchers. The aim of this work was therefore to describe cultivable yeasts associated with three coral species and to evaluate the influence of sewage discharge on yeasts community. We obtained 130 isolates, mostly belonging to phylum Ascomycota and many of them had previously been isolated from human samples or are considered pathogens. The mycobiota was more similar among corals collected from the same reef, indicating that the composition of reef yeast community is more influenced by environmental conditions than host species. We suggest further studies to elucidate which factors are most influential on the composition of the coral-associated yeast community. Copyright © 2017 Elsevier Ltd. All rights reserved.
Spoilage of sous vide cooked salmon (Salmo salar) stored under refrigeration.
Díaz, P; Garrido, M D; Bañón, S
2011-02-01
The spoilage of Sous Vide 'SV' cooked salmon stored under refrigeration was studied. Samples were packaged under vacuum in polyamide-polypropylene pouches, cooked at an oven temperature/time of 80 (°)C/45 min, quickly chilled at 3 (°)C and stored at 2 (°)C for 0, 5 or 10 weeks for catering use. Microbial (aerobic and anaerobic psychrotrophs, lactic acid bacteria, molds and yeasts and Enterobacteriaceae), physical-chemical (pH, water activity, TBARS, acidity, L*a*b* color, texture profile analysis and shear force) and sensory (appearance, odor, flavor, texture and overall quality) parameters were determined. SV processing prevented the growth of aerobic and anaerobic psychrotrophs, lactic acid bacteria, molds and yeasts and Enterobacteriaceae. There were no relevant changes in pH, water activity, TBARS, CIELab color associated with cooked salmon spoilage. Instrumental texture data were contradictory. Slight decrease in lactic acid levels was found. In contrast, the SV cooked salmon suffered considerable sensory deterioration during its refrigerated storage, consisting of severe losses of cooked salmon odor and flavor, slight rancidity, discoloration associated with white precipitation, and moderates softness, and loss of chewiness and juiciness. No acidification, putrefaction or relevant rancidity was detected. The sensory spoilage preceded microbiological and physical-chemical spoilage, suggesting that microbiological quality alone may overestimate the shelf life of SV cooked salmon.
Functional food red yeast rice (RYR) for metabolic syndrome amelioration: a review on pros and cons.
Patel, Seema
2016-05-01
Red yeast rice (RYR), the fermentation product of mold Monascus purpureus has been an integral part of Oriental food and traditional Chinese medicine, long before the discovery of their medicinal roles. With the identification of bioactive components as polyketide pigments (statins), and unsaturated fatty acids, RYR has gained a nutraceutical status. Hypercholesterolemic effect of this fermented compound has been validated and monacolin K has been recognized as the pivotal component in cholesterol alleviation. Functional similarity with commercial drug lovastatin sans the side effects has catapulted its popularity in other parts of the world as well. Apart from the hypotensive role, ameliorative benefits of RYR as anti-inflammatory, antidiabetic, anticancer and osteogenic agent have emerged, fueling intense research on it. Mechanistic studies have revealed their interaction with functional agents like coenzyme Q10, astaxanthin, vitamin D, folic acid, policosanol, and berberine. On the other hand, concurrence of mycotoxin citrinin and variable content of statin has marred its integration in mainstream medication. In this disputable scenario, evaluation of the scopes and lacunae to overcome seems to contribute to an eminent area of healthcare. Red yeast rice (RYR), the rice-based fermentation product of mold Monascus purpureus is a functional food. Its bioactive component monacolin K acts like synthetic drug lovastatin, without the severe side effects of the latter. RYR has been validated to lower cholesterol, control high blood pressure; confer anti-flammation, hypoglycaemic, anticancer and osteogenic properties. However, dose inconsistency and co-occurrence of toxin citrinin hampers its dietary supplementation prospect. Further research might facilitate development of RYR as a nutraceutical.
Glycerol Enhances the Antifungal Activity of Dairy Propionibacteria
Lind, Helena; Broberg, Anders; Jacobsson, Karin; Jonsson, Hans; Schnürer, Johan
2010-01-01
Dairy propionibacteria are widely used in starter cultures for Swiss type cheese. These bacteria can ferment glucose, lactic acid, and glycerol into propionic acid, acetic acid, and carbon dioxide. This research examined the antifungal effect of dairy propionibacteria when glycerol was used as carbon source for bacterial growth. Five type strains of propionibacteria were tested against the yeast Rhodotorula mucilaginosa and the molds Penicillium commune and Penicillium roqueforti. The conversion of 13C glycerol by Propionibacterium jensenii was followed with nuclear magnetic resonance. In a dual culture assay, the degree of inhibition of the molds was strongly enhanced by an increase in glycerol concentrations, while the yeast was less affected. In broth cultures, decreased pH in glycerol medium was probably responsible for the complete inhibition of the indicator fungi. NMR spectra of the glycerol conversion confirmed that propionic acid was the dominant metabolite. Based on the results obtained, the increased antifungal effect seen by glycerol addition to cultures of propionibacteria is due to the production of propionic acid and pH reduction of the medium. PMID:21331381
56. ORIGINAL MOLDS. THE MORAVIAN POTTERY AND TILE WORKS HAS ...
56. ORIGINAL MOLDS. THE MORAVIAN POTTERY AND TILE WORKS HAS APPROXIMATELY 6,000 PLASTER MOLDS OF VARIOUS TYPES, INCLUDING THE DEEP CAVITY MOLDS IN THE CENTER OF THE PHOTOGRAPH. THESE MOLDS PRODUCED ALLEGORICAL FIGURES TO BE INSTALLED AROUND THE CORNICES OF PUBLIC SCHOOLS. - Moravian Pottery & Tile Works, Southwest side of State Route 313 (Swamp Road), Northwest of East Court Street, Doylestown, Bucks County, PA
Cho, S. J.; Cox-Ganser, J. M.; Park, J.-H.
2015-01-01
We examined associations between observational dampness scores and measurements of microbial agents and moisture in three public schools. A dampness score was created for each room from 4-point-scale scores (0–3) of water damage, water stains, visible mold, moldy odor, and wetness for each of 8 room components (ceiling, walls, windows, floor, ventilation, furniture, floor trench, and pipes), when present. We created mixed microbial exposure indices (MMEIs) for each of 121 rooms by summing decile ranks of 8 analytes (total culturable fungi; total, Gram-negative, and Gram-positive culturable bacteria; ergosterol; (1→3)-β-D-glucan; muramic acid; and endotoxin) in floor dust. We found significant (P ≤ 0.01) linear associations between the dampness score and culturable bacteria (total, Gram-positive, and Gram-negative) and the MMEIs. Rooms with dampness scores greater than 0.25 (median) had significantly (P < 0.05) higher levels of most microbial agents, MMEIs, and relative moisture content than those with lower scores (≤0.25). Rooms with reported recent water leaks had significantly (P < 0.05) higher dampness scores than those with historical or no reported water leaks. This study suggests that observational assessment of dampness and mold using a standardized form may be valuable for identifying and documenting water damage and associated microbial contamination. PMID:25650175
Recombinant protein subunit vaccine synthesis in microbes: a role for yeast?
Bill, Roslyn M
2015-03-01
Recombinant protein subunit vaccines are formulated using protein antigens that have been synthesized in heterologous host cells. Several host cells are available for this purpose, ranging from Escherichia coli to mammalian cell lines. This article highlights the benefits of using yeast as the recombinant host. The yeast species, Saccharomyces cerevisiae and Pichia pastoris, have been used to optimize the functional yields of potential antigens for the development of subunit vaccines against a wide range of diseases caused by bacteria and viruses. Saccharomyces cerevisiae has also been used in the manufacture of 11 approved vaccines against hepatitis B virus and one against human papillomavirus; in both cases, the recombinant protein forms highly immunogenic virus-like particles. Advances in our understanding of how a yeast cell responds to the metabolic load of producing recombinant proteins will allow us to identify host strains that have improved yield properties and enable the synthesis of more challenging antigens that cannot be produced in other systems. Yeasts therefore have the potential to become important host organisms for the production of recombinant antigens that can be used in the manufacture of subunit vaccines or in new vaccine development. © 2014 Royal Pharmaceutical Society.
21ST CENTURY MOLD ANALYSIS IN FOOD
Traditionally, the indoor air community has relied on mold analysis performed by either microscopic observations or the culturing of molds on various media to assess indoor air quality. These techniques were developed in the 19th century and are very laborious and time consumin...
Environmental Mold and Mycotoxin Exposures Elicit Specific Cytokine and Chemokine Responses
Rosenblum Lichtenstein, Jamie H.; Hsu, Yi-Hsiang; Gavin, Igor M.; Donaghey, Thomas C.; Molina, Ramon M.; Thompson, Khristy J.; Chi, Chih-Lin; Gillis, Bruce S.; Brain, Joseph D.
2015-01-01
Background Molds can cause respiratory symptoms and asthma. We sought to use isolated peripheral blood mononuclear cells (PBMCs) to understand changes in cytokine and chemokine levels in response to mold and mycotoxin exposures and to link these levels with respiratory symptoms in humans. We did this by utilizing an ex vivo assay approach to differentiate mold-exposed patients and unexposed controls. While circulating plasma chemokine and cytokine levels from these two groups might be similar, we hypothesized that by challenging their isolated white blood cells with mold or mold extracts, we would see a differential chemokine and cytokine release. Methods and Findings Peripheral blood mononuclear cells (PBMCs) were isolated from blood from 33 patients with a history of mold exposures and from 17 controls. Cultured PBMCs were incubated with the most prominent Stachybotrys chartarum mycotoxin, satratoxin G, or with aqueous mold extract, ionomycin, or media, each with or without PMA. Additional PBMCs were exposed to spores of Aspergillus niger, Cladosporium herbarum and Penicillium chrysogenum. After 18 hours, cytokines and chemokines released into the culture medium were measured by multiplex assay. Clinical histories, physical examinations and pulmonary function tests were also conducted. After ex vivo PBMC exposures to molds or mycotoxins, the chemokine and cytokine profiles from patients with a history of mold exposure were significantly different from those of unexposed controls. In contrast, biomarker profiles from cells exposed to media alone showed no difference between the patients and controls. Conclusions These findings demonstrate that chronic mold exposures induced changes in inflammatory and immune system responses to specific mold and mycotoxin challenges. These responses can differentiate mold-exposed patients from unexposed controls. This strategy may be a powerful approach to document immune system responsiveness to molds and other inflammation
Mold contamination of automobile air conditioner systems.
Kumar, P; Lopez, M; Fan, W; Cambre, K; Elston, R C
1990-02-01
Eight cars belonging to patients who were found to have exacerbation of allergic rhinitis and bronchial asthma after turning on the air conditioner in their cars were examined. Mold concentrations inside the passenger compartment with the a/c turned off and at different climate control settings were lower than concentrations in the outside air. After turning on the air conditioner to "Max", cultures obtained at various intervals revealed that mold concentrations decreased significantly with time. Furthermore, placement of a filter at the portal of entry of outside air significantly reduced the mold concentration in the passenger compartment.
Rapid manufacturing of metallic Molds for parts in Automobile
NASA Astrophysics Data System (ADS)
Zhang, Renji; Xu, Da; Liu, Yuan; Yan, Xudong; Yan, Yongnian
1998-03-01
The recent research of RPM (Rapid Prototyping Manufacturing) in our lab has been focused on the rapid creation of alloyed cast iron (ACI) molds. There are a lot of machinery parts in an automobile, so a lot of mettallic molds are needed in automobile industry. A new mold manufacturing technology has been proposed. A new large scale RP machine has been set up in our lab now. Then rapid prototypes could be manufactured by means of laminated object manufacturing (LOM) technology. The molds for parts in automobile have been produced by ceramic shell precision casting. An example is a drawing mold for cover parts in automobile. Sufficient precision and surface roughness have been obtained. Itis proved that this is a vew kind of technology. Work supported by the Mational Science Foundation of China.
Development of In-Mold Assembly Methods for Producing Mesoscale Revolute Joints
2009-01-01
tolerances available for manufacturing the molds are relatively low. Any inaccuracy in mold First stage part (ABS) Second stage part ( LDPE ) Pins...case, the viscosity of LDPE is also a function of temperature. For each of these cases, they have considered the filling of a thin mold cavity. From...predicting the weld-line strengths of crystalline polymers such as LDPE . 63 3 Issues in In-Mold Assembly at the Mesoscale 3.1 Motivation In-mold
NASA Astrophysics Data System (ADS)
Lyu, Peisheng; Wang, Wanlin; Long, Xukai; Zhang, Kaixuan; Gao, Erzhuo; Qin, Rongshan
2018-02-01
The chamfered mold with a typical corner shape (angle between the chamfered face and hot face is 45 deg) was applied to the mold simulator study in this paper, and the results were compared with the previous results from a well-developed right-angle mold simulator system. The results suggested that the designed chamfered structure would increase the thermal resistance and weaken the two-dimensional heat transfer around the mold corner, causing the homogeneity of the mold surface temperatures and heat fluxes. In addition, the chamfered structure can decrease the fluctuation of the steel level and the liquid slag flow around the meniscus at mold corner. The cooling intensities at different longitudinal sections of shell are close to each other due to the similar time-average solidification factors, which are 2.392 mm/s1/2 (section A-A: chamfered center), 2.372 mm/s1/2 (section B-B: 135 deg corner), and 2.380 mm/s1/2 (section D-D: face), respectively. For the same oscillation mark (OM), the heights of OM roots at different positions (profile L1 (face), profile L2 (135 deg corner), and profile L3 (chamfered center)) are very close to each other. The average value of height difference (HD) between two OMs roots for L1 and L2 is 0.22 mm, and for L2 and L3 is 0.38 mm. Finally, with the help of metallographic examination, the shapes of different hooks were also discussed.
Three-dimensional numerical simulation for plastic injection-compression molding
NASA Astrophysics Data System (ADS)
Zhang, Yun; Yu, Wenjie; Liang, Junjie; Lang, Jianlin; Li, Dequn
2018-03-01
Compared with conventional injection molding, injection-compression molding can mold optical parts with higher precision and lower flow residual stress. However, the melt flow process in a closed cavity becomes more complex because of the moving cavity boundary during compression and the nonlinear problems caused by non-Newtonian polymer melt. In this study, a 3D simulation method was developed for injection-compression molding. In this method, arbitrary Lagrangian- Eulerian was introduced to model the moving-boundary flow problem in the compression stage. The non-Newtonian characteristics and compressibility of the polymer melt were considered. The melt flow and pressure distribution in the cavity were investigated by using the proposed simulation method and compared with those of injection molding. Results reveal that the fountain flow effect becomes significant when the cavity thickness increases during compression. The back flow also plays an important role in the flow pattern and redistribution of cavity pressure. The discrepancy in pressures at different points along the flow path is complicated rather than monotonically decreased in injection molding.
Is there, and should there be, apoptosis in bacteria?
Häcker, Georg
2013-01-01
Apoptosis is a well-studied form of cell death in metazoans, where it has a clear role during the life of the (multicellular) animal. Some situations of cell death in unicellular eukaryotes (protozoa and yeast) have also been referred to as apoptosis. In recent years apoptosis has further been identified in bacteria several times. As a bacterial response to external stimuli, apoptosis could be important not only for the bacteria but also to the host. Here I will discuss why I believe that the term apoptosis should be avoided for these situations in bacteria, no matter how interesting the molecular background or how biologically important the underlying mechanism may be. Copyright © 2013 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
47 CFR 76.805 - Access to molding.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 47 Telecommunication 4 2010-10-01 2010-10-01 false Access to molding. 76.805 Section 76.805 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES MULTICHANNEL VIDEO AND CABLE TELEVISION SERVICE Cable Inside Wiring § 76.805 Access to molding. (a) An MVPD shall be permitted...
Precision lens molding of asphero diffractive surfaces in chalcogenide materials
NASA Astrophysics Data System (ADS)
Nelson, J.; Scordato, M.; Schwertz, K.; Bagwell, J.
2015-10-01
Finished lens molding, and the similar process of precision lens molding, have long been practiced for high volume, accurate replication of optical surfaces on oxide glass. The physics surrounding these processes are well understood, and the processes are capable of producing high quality optics with great fidelity. However, several limitations exist due to properties inherent with oxide glasses. Tooling materials that can withstand the severe environmental conditions of oxide glass molding cannot easily be machined to produce complex geometries such as diffractive surfaces, lens arrays, and off axis features. Current machining technologies coupled with a limited selection of tool materials greatly limits the type of structures that can be molded into the finished optic. Tooling for chalcogenide glasses are not bound by these restrictions since the molding temperatures required are much lower than for oxide glasses. Innovations in tooling materials and manufacturing techniques have enabled the production of complex geometries to optical quality specifications and have demonstrated the viability of creating tools for molding diffractive surfaces, off axis features, datums, and arrays. Applications for optics having these features are found in automotive, defense, security, medical, and industrial domains. This paper will discuss results achieved in the study of various molding techniques for the formation of positive diffractive features on a concave spherical surface molded from As2Se3 chalcogenide glass. Examples and results of molding with tools having CTE match with the glass and non CTE match will be reviewed. The formation of stress within the glass during molding will be discussed, and methods of stress management will also be demonstrated and discussed. Results of process development methods and production of good diffractive surfaces will be shown.
Ultrasound - Aided ejection in micro injection molding
NASA Astrophysics Data System (ADS)
Masato, D.; Sorgato, M.; Lucchetta, G.
2018-05-01
In this work, an ultrasound-aided ejection system was designed and tested for different polymers (PS, COC and POM) and mold topographies. The proposed solution aims at reducing the ejection friction by decreasing the adhesion component of the frictional force, which is controlled by the contact area developed during the filling stage of the injection molding process. The experimental results indicate a positive effect of ultrasound vibration on the friction force values, with a maximum reduction of 16. Moreover, it is demonstrated that the ultrasound effect is strictly related to both polymer selection and mold roughness. The combined effect on the ejection force of mold surface roughness, melt viscosity during filling and polymer elastic modulus at ejection was modeled to the experimental data, in order to demonstrate that the effect of ultrasound vibration on the ejection friction reduction is due to the heating of the contact interface and the consequent reduction of the polymer elastic modulus.
Method and composition for molding low-density desiccant syntactic-foam articles
Not Available
1981-12-07
These and other objects of the invention are achieved by a process for molding to size a desiccant syntactic foam article having a density of 0.2 to 0.9 g/cc and a moisture capacity of 1 to 12% by weight, comprising the steps of: charging a mold with a powdery mixture of an activated desiccant, microspheres and a thermosetting resin, the amount of the desiccant being sufficient to provide the required moisture capacity, and the amounts of the microspheres and resin being such that the microspheres/desiccant volume fraction exceeds the packing factor by an amount sufficient to substantially avoid shrinkage without causing excessively high molding pressures; covering the mold and heating the covered mold to a temperature and for an amount of time sufficient to melt the resin; and tightly closing the mold and heating the closed mold to a temperature and for an amount of time sufficient to cure the resin, and removing the resultant desiccant syntactic foam article from the mold. In a composition of matter aspect, the present invention provides desiccant syntactic foam articles, and a composition of matter for use in molding the same.
Injection molded polymer optics in the 21st Century
NASA Astrophysics Data System (ADS)
Beich, William S.
2005-08-01
Precision polymer optics, manufactured by injection molding techniques, has been a key enabling technology for several decades now. The technology, which can be thought of as a subset of the wider field of precision optics manufacturing, was pioneered in the United States by companies such as Eastman Kodak, US Precision Lens, and Polaroid. In addition to suppliers in the U.S. there are several companies worldwide that design and manufacture precision polymer optics, for example Philips High Tech Plastics in Europe and Fujinon in Japan. Designers who are considering using polymer optics need a fundamental understanding of exactly how the optics are created. This paper will survey the technology and processes that are employed in the successful implementation of a polymer optic solution from a manufacturer's perspective. Special emphasis will be paid to the unique relationship between the molds and the optics that they produce. We will discuss the key elements of production: molding resins, molds and molding equipment, and metrology. Finally we will offer a case study to illustrate just how the optics designer carries a design concept through to production. The underlying theme throughout the discussion of polymer optics is the need for the design team to work closely with an experienced polymer optics manufacturer with a solid track record of success in molded optics. As will be seen shortly, the complex interaction between thermoplastics, molds, and molding machines dictates the need for working closely with a supplier who has the critical knowledge needed to manage all aspects of the program.
Flexible Nonstick Replica Mold for Transfer Printing of Ag Ink.
Lee, Bong Kuk; Yu, Han Young; Kim, Yarkyeon; Yoon, Yong Sun; Jang, Won Ik; Do, Lee-Mi; Park, Ji-Ho; Park, Jaehoon
2016-03-01
We report the fabrication of flexible replica molds for transfer printing of Ag ink on a rigid glass substrate. As mold precursors, acrylic mixtures were prepared from silsesquioxane-based materials, silicone acrylate, poly(propylene glycol) diacrylate, 3,3,4,4,5,5,6,6,7,7,8,8, 9,9,10,10,10-heptadecafluorodecyl methacrylate, and photoinitiator. By using these materials, the replica molds were fabricated from a silicon master onto a flexible substrate by means of UV-assisted molding process at room temperature. The wettability of Ag ink decreased with increase in the water contact angle of replica molds. On the other hand, the transfer rate of Ag ink onto adhesive-modified substrates increased with increase in the water contact angle of replica molds. Transferred patterns were found to be thermally stable on the photocurable adhesive layer, whereas Ag-ink patterns transferred on non-photocurable adhesives were distorted by thermal treatment. We believe that these characteristics of replica molds and adhesives offer a new strategy for the development of the transfer printing of solution-based ink materials.
A would-be nervous system made from a slime mold.
Adamatzky, Andrew
2015-01-01
The slime mold Physarum polycephalum is a huge single cell that has proved to be a fruitful material for designing novel computing architectures. The slime mold is capable of sensing tactile, chemical, and optical stimuli and converting them to characteristic patterns of its electrical potential oscillations. The electrical responses to stimuli may propagate along protoplasmic tubes for distances exceeding tens of centimeters, as impulses in neural pathways do. A slime mold makes decisions about its propagation direction based on information fusion from thousands of spatially extended protoplasmic loci, similarly to a neuron collecting information from its dendritic tree. The analogy is distant yet inspiring. We speculate on whether alternative-would-be-nervous systems can be developed and practically implemented from the slime mold. We uncover analogies between the slime mold and neurons, and demonstrate that the slime mold can play the roles of primitive mechanoreceptors, photoreceptors, and chemoreceptors; we also show how the Physarum neural pathways develop. The results constituted the first step towards experimental laboratory studies of nervous system implementation in slime molds.
Zhao, Xue; Yu, Zhimin; Wang, Ting; Guo, Xuan; Luan, Jing; Sun, Yumei; Li, Xianzhen
2016-04-01
To identify a biological preservative that can protect beer from microbial contamination, which often results in the production of turbidity and off-flavor. The antimicrobial activity of a chitooligosaccharide against beer-spoilage bacteria and its effect on the fermentation performance of brewer's yeast was studied. Chitooligosaccharide with an average 2 kDa molecular weight was the best at inhibiting all tested beer-spoilage bacteria. The application of chitooligosaccharide in the brewing process did not influence the fermentation of brewer's yeast. The change in beer performance induced by the contamination of Lactobacillus brevis could be effectively controlled by application of chitooligosaccharide in the beer brewing process. The experimental data suggested that chitooligosaccharide should be an excellent preservative to inhibit beer-spoilage bacteria in the brewing process and in the end product.
TRUFLO GONDOLA, USED WITH THE HUNTER 10 MOLDING MACHINE, OPERATES ...
TRUFLO GONDOLA, USED WITH THE HUNTER 10 MOLDING MACHINE, OPERATES THE SAME AS THE TWO LARGER TRUFLOS USED IN CONJUNCTION WITH THE TWO HUNTER 20S. EACH GONDOLA IS CONNECTED TO THE NEXT AND RIDES ON A SINGLE TRACK RAIL FROM MOLDING MACHINES THROUGH POURING AREAS CARRYING A MOLD AROUND TWICE BEFORE THE MOLD IS PUSHED OFF ONTO A VIBRATING SHAKEOUT CONVEYOR. - Southern Ductile Casting Company, Casting, 2217 Carolina Avenue, Bessemer, Jefferson County, AL
Inactivation of bacterial quorum sensing signals N-acyl homoserine lactones is widespread in yeasts.
Leguina, Ana Carolina Del V; Nieto, Carolina; Pajot, Hipólito M; Bertini, Elisa V; Mac Cormack, Walter; Castellanos de Figueroa, Lucía I; Nieto-Peñalver, Carlos G
2018-01-01
The inactivation of quorum sensing signals, a phenomenon known as quorum quenching, has been described in diverse microorganisms, though it remains almost unexplored in yeasts. Beyond the well-known properties of these microorganisms for the industry or as eukaryotic models, the role of yeasts in soil or in the inner tissues of a plant is largely unknown. In this report, the wider survey of quorum quenching activities in yeasts isolated from Antarctic soil and the inner tissues of sugarcane, a tropical crop, is presented. Results show that, independently of their niche, quorum quenching activities are broadly present in unicellular fungi. Although yeasts showing a broad range of quorum quenching activity are present in the two niches, at the same time specific AHL inactivation profiles can also be found. Furthermore, yeasts from both sampling sites show quorum quenching activities compatible with lactonase-like and acylase-like inactivations of AHLs. Interestingly, the characterization of Rhodotorula mucilaginosa 7Apo1 showed that the presence of a particular AHL does not interfere with the quenching of a second molecule. Evidence suggests that yeasts could play a role in the modulation of the quorum sensing activity of bacteria. The relationship among phylogeny, sampling sites and yeast quorum quenching activities of the isolates is analyzed. Copyright © 2017 British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Production application of injection-molded diffractive elements
NASA Astrophysics Data System (ADS)
Clark, Peter P.; Chao, Yvonne Y.; Hines, Kevin P.
1995-12-01
We demonstrate that transmission kinoforms for visible light applications can be injection molded in acrylic in production volumes. A camera is described that employs molded Fresnel lenses to change the convergence of a projection ranging system. Kinoform surfaces are used in the projection system to achromatize the Fresnel lenses.
Classification of buildings mold threat using electronic nose
NASA Astrophysics Data System (ADS)
Łagód, Grzegorz; Suchorab, Zbigniew; Guz, Łukasz; Sobczuk, Henryk
2017-07-01
Mold is considered to be one of the most important features of Sick Building Syndrome and is an important problem in current building industry. In many cases it is caused by the rising moisture of building envelopes surface and exaggerated humidity of indoor air. Concerning historical buildings it is mostly caused by outdated raising techniques among that is absence of horizontal isolation against moisture and hygroscopic materials applied for construction. Recent buildings also suffer problem of mold risk which is caused in many cases by hermetization leading to improper performance of gravitational ventilation systems that make suitable conditions for mold development. Basing on our research there is proposed a method of buildings mold threat classification using electronic nose, based on a gas sensors array which consists of MOS sensors (metal oxide semiconductor). Used device is frequently applied for air quality assessment in environmental engineering branches. Presented results show the interpretation of e-nose readouts of indoor air sampled in rooms threatened with mold development in comparison with clean reference rooms and synthetic air. Obtained multivariate data were processed, visualized and classified using a PCA (Principal Component Analysis) and ANN (Artificial Neural Network) methods. Described investigation confirmed that electronic nose - gas sensors array supported with data processing enables to classify air samples taken from different rooms affected with mold.
Biofilm inhibition of spoilage bacteria by Argentinean fruit juices with antihypertensive activity.
Vallejo, Claudia V; Aredes-Fernández, Pedro A; Farías, Marta E; Rodríguez-Vaquero, María J
2013-01-01
Argentinean juices have been studied for their antihypertensive activity, the inhibition of bacteria biofilm formation and the effect on the viability of wine yeast. The influence of phenolic compounds on these activities was evaluated. These studies are the first step for the development of a new type of wine that includes grape must supplement with fruit juices with antihypertensive effect. All juices posses a high antihypertensive activity, higher than 50%. Strawberry juices and eureka lemon showed the highest activity, whereas clarified juices posses the lowest activity. All studied juices produce a high inhibition of bacteria biofilm formation, and the strawberry, orange and mandarin varieties not affect the growth or viability of yeast. Our results permit to conclude that it could be possible the use of these juices in a new type of wine or as a source of new antihypertensive agents for pharmaceutical industry.
Selection of antifungal protein-producing molds from dry-cured meat products.
Acosta, Raquel; Rodríguez-Martín, Andrea; Martín, Alberto; Núñez, Félix; Asensio, Miguel A
2009-09-30
To control unwanted molds in dry-cured meats it is necessary to allow the fungal development essential for the desired characteristics of the final product. Molds producing antifungal proteins could be useful to prevent hazards due to the growth of mycotoxigenic molds. The objective has been to select Penicillium spp. that produce antifungal proteins against toxigenic molds. To obtain strains adapted to these products, molds were isolated from dry-cured ham. A first screening with 281 isolates by the radial inhibition assay revealed that 166 were active against some of the toxigenic P. echinulatum, P. commune, and Aspergillusniger used as reference molds. The activity of different extracts from cultured medium was evaluated by a microspectroscopic assay. Molds producing active chloroform extracts were eliminated from further consideration. A total of 16 Penicillium isolates were screened for antifungal activity from both cell-free media and the aqueous residues obtained after chloroform extraction. The cell-free media of 10 isolates that produced a strong inhibition of the three reference molds were fractionated by FPLC on a cationic column. For protein purification, the fractions of the three molds that showed high inhibitory activity were further chromatographed on a gel filtration column, and the subfractions containing the highest absorbance peaks were assayed against the most sensitive reference molds. One subfraction each from strains AS51D and RP42C from Penicilliumchrysogenum confirmed the inhibitory activity against the reference molds. SDS-PAGE revealed a single band from each subfraction, with estimated molecular masses of 37kDa for AS51D and 9kDa for RP42C. Although further characterisation is required, both these proteins and the producing strains can be of interest to control unwanted molds on foods.
Differential allergy induction by molds found in water-damaged homes**
Molds are ubiquitous in the environment and exposures to molds contribute to various human diseases including allergic lung diseases. The Institute of Medicine reports (NAS, 2004) and World Health Organization guidelines (WHO, 2009) concluded that the role of molds in asthma indu...
Integrally cored ceramic investment casting mold fabricated by ceramic stereolithography
NASA Astrophysics Data System (ADS)
Bae, Chang-Jun
Superalloy airfoils are produced by investment casting (IC), which uses ceramic cores and wax patterns with ceramic shell molds. Hollow cored superalloy airfoils in a gas turbine engine are an example of complex IC parts. The complex internal hollow cavities of the airfoil are designed to conduct cooling air through one or more passageways. These complex internal passageways have been fabricated by a lost wax process requiring several processing steps; core preparation, injection molding for wax pattern, and dipping process for ceramic shell molds. Several steps generate problems such as high cost and decreased accuracy of the ceramic mold. For example, costly tooling and production delay are required to produce mold dies for complex cores and wax patterns used in injection molding, resulting in a big obstacle for prototypes and smaller production runs. Rather than using separate cores, patterns, and shell molds, it would be advantageous to directly produce a mold that has the casting cavity and the ceramic core by one process. Ceramic stereolithography (CerSLA) can be used to directly fabricate the integrally cored ceramic casting mold (ICCM). CerSLA builds ceramic green objects from CAD files from many thin liquid layers of powder in monomer, which are solidified by polymerization with a UV laser, thereby "writing" the design for each slice. This dissertation addresses the integrally cored casting ceramic mold (ICCM), the ceramic core with a ceramic mold shell in a single patternless construction, fabricated by ceramic stereolithography (CerSLA). CerSLA is considered as an alternative method to replace lost wax processes, for small production runs or designs too complex for conventional cores and patterns. The main topic is the development of methods to successfully fabricate an ICCM by CerSLA from refractory silica, as well as related issues. The related issues are the segregation of coarse fused silica powders in a layer, the degree of segregation parameter to
NASA Astrophysics Data System (ADS)
Shimomura-Shimizu, Mifumi; Karube, Isao
Since the first microbial cell sensor was studied by Karube et al. in 1977, many types of yeast based sensors have been developed as analytical tools. Yeasts are known as facultative anaerobes. Facultative anaerobes can survive in both aerobic and anaerobic conditions. The yeast based sensor consisted of a DO electrode and an immobilized omnivorous yeast. In yeast based sensor development, many kinds of yeast have been employed by applying their characteristics to adapt to the analyte. For example, Trichosporon cutaneum was used to estimate organic pollution in industrial wastewater. Yeast based sensors are suitable for online control of biochemical processes and for environmental monitoring. In this review, principles and applications of yeast based sensors are summarized.
Mold Remediation in Schools and Commercial Buildings.
ERIC Educational Resources Information Center
Environmental Protection Agency, Washington, DC. Office of Radiation and Indoor Air.
This document describes how to investigate and evaluate moisture and mold problems in educational facilities, and presents the key steps for implementing a remediation plan. A checklist is provided for conducting mold remediation efforts along with a resource list of helpful organizations and governmental agencies. Appendices contain a glossary,…
Feasibility of using Big Area Additive Manufacturing to Directly Manufacture Boat Molds
DOE Office of Scientific and Technical Information (OSTI.GOV)
Post, Brian K.; Chesser, Phillip C.; Lind, Randall F.
The goal of this project was to explore the feasibility of using Big Area Additive Manufacturing (BAAM) to directly manufacture a boat mold without the need for coatings. All prior tooling projects with BAAM required the use to thick coatings to overcome the surface finish limitations of the BAAM process. While the BAAM process significantly lowers the cost of building the mold, the high cost element rapidly became the coatings (cost of the material, labor on coating, and finishing). As an example, the time and cost to manufacture the molds for the Wind Turbine project with TPI Composites Inc. andmore » the molds for the submarine project with Carderock Naval Warfare Systems was a fraction of the time and cost of the coatings. For this project, a catamaran boat hull mold was designed, manufactured, and assembled with an additional 0.15” thickness of material on all mold surfaces. After printing, the mold was immediately machined and assembled. Alliance MG, LLC (AMG), the industry partner of this project, experimented with mold release agents on the carbon-fiber reinforced acrylonitrile butadiene styrene (CF ABS) to verify that the material can be directly used as a mold (rather than needing a coating). In addition, for large molds (such as the wind turbine mold with TPI Composites Inc.), the mold only provided the target surface. A steel subframe had to be manufactured to provide structural integrity. If successful, this will significantly reduce the time and cost necessary for manufacturing large resin infusion molds using the BAAM process.« less
The US EPA has patented a mold ID technology (#6,387,652) licensed by 15 companies in the US and EU. This technology is based upon DNA sequences. In conjunction with HUD, this technology will be used in a National Survey of Homes.
Prompt remediation of water intrusion corrects the resultant mold contamination in a home.
Rockwell, William
2005-01-01
More patients are turning to their allergists with symptoms compatible with allergic rhinitis, allergic sinusitis, and/or bronchial asthma after exposure to mold-contaminated indoor environments. These patients often seek guidance from their allergists in the remediation of the contaminated home or office. The aim of this study was to determine baseline mold spore counts for noncontaminated homes and report a successful mold remediation in one mold-contaminated home. Indoor air quality was tested using volumetric spore counts in 50 homes where homeowners reported no mold-related health problems and in one mold-contaminated home that was remediated. The health of the occupant of the mold-contaminated home also was assessed. Indoor volumetric mold spore counts ranged from 300 to 1200 spores/m3 in the baseline homes. For the successful remediation, the mold counts started at 300 spores/m3, increased to 2800 spores/m3 at the height of the mold contamination, and then fell to 800 spores/m3 after remediation. The occupant's allergic symptoms ceased on complete remediation of the home. Indoor volumetric mold counts taken with the Allergenco MK-3 can reveal a potential indoor mold contamination, with counts above 1000 spores/m3 suggesting indoor mold contamination. Once the presence of indoor mold growth is found, a prompt and thorough remediation can bring mold levels back to near-baseline level and minimize negative health effects for occupants.
Hope, Janette
2013-01-01
Physicians are increasingly being asked to diagnose and treat people made ill by exposure to water-damaged environments, mold, and mycotoxins. In addition to avoidance of further exposure to these environments and to items contaminated by these environments, a number of approaches have been used to help persons affected by exposure to restore their health. Illness results from a combination of factors present in water-damaged indoor environments including, mold spores and hyphal fragments, mycotoxins, bacteria, bacterial endotoxins, and cell wall components as well as other factors. Mechanisms of illness include inflammation, oxidative stress, toxicity, infection, allergy, and irritant effects of exposure. This paper reviews the scientific literature as it relates to commonly used treatments such as glutathione, antioxidants, antifungals, and sequestering agents such as cholestyramine, charcoal, clay and chlorella, antioxidants, probiotics, and induced sweating.
Mangold, A.J. Jr.; MaHaffey, J.W.; Reese, S.L.
1958-04-29
An improved ingot-mold assembly is described, consisting of a body having a cavity and a recess extending through to the bottom of the body from the cavity, and the bottom of the cavity having an internal shoulder extending downward and a plug having an external shoulder. The plug extends above the shoulders and below the bottom of the body.
Yeast strains as potential aroma enhancers in dry fermented sausages.
Flores, Mónica; Corral, Sara; Cano-García, Liliana; Salvador, Ana; Belloch, Carmela
2015-11-06
Actual healthy trends produce changes in the sensory characteristics of dry fermented sausages therefore, new strategies are needed to enhance their aroma. In particular, a reduction in the aroma characteristics was observed in reduced fat and salt dry sausages. In terms of aroma enhancing, generally coagulase-negative cocci were selected as the most important group from the endogenous microbiota in the production of flavour compounds. Among the volatile compounds analysed in dry sausages, ester compounds contribute to fruity aroma notes associated with high acceptance of traditional dry sausages. However, the origin of ester compounds in traditional dry sausages can be due to other microorganisms as lactic acid bacteria, yeast and moulds. Yeast contribution in dry fermented sausages was investigated with opposite results attributed to low yeast survival or low activity during processing. Generally, they affect sausage colour and flavour by their oxygen-scavenging and lipolytic activities in addition to, their ability to catabolize fermentation products such as lactate increasing the pH and contributing to less tangy and more aromatic sausages. Recently, the isolation and characterization of yeast from traditional dry fermented sausages made possible the selection of those with ability to produce aroma active compounds. Molecular methods were used for genetic typing of the isolated yeasts whereas their ability to produce aroma compounds was tested in different systems such as in culture media, in model systems and finally on dry fermented sausages. The results revealed that the appropriate selection of yeast strains with aroma potential may be used to improve the sensory characteristics of reformulated fermented sausages. Copyright © 2015 Elsevier B.V. All rights reserved.
Bolla, Patricia A; Serradell, María de los Angeles; de Urraza, Patricio J; De Antoni, Graciela L
2011-02-01
The effect of freeze-drying on viability and probiotic properties of a microbial mixture containing selected bacterial and yeast strains isolated from kefir grains (Lactobacillus kefir, Lactobacillus plantarum, Lactococcus lactis, Saccharomyces cerevisiae and Kluyveromyces marxianus) was studied. The microorganisms were selected according to their potentially probiotic properties in vitro already reported. Two types of formulations were performed, a microbial mixture (MM) suspended in milk and a milk product fermented with MM (FMM). To test the effect of storage on viability of microorganisms, MM and FMM were freeze-dried and maintained at 4°C for six months. After 180 days of storage at 4°C, freeze-dried MM showed better survival rates for each strain than freeze-dried FMM. The addition of sugars (trehalose or sucrose) did not improve the survival rates of any of the microorganisms after freeze-drying. Freeze-drying did not affect the capacity of MM to inhibit growth of Shigella sonnei in vitro, since the co-incubation of this pathogen with freeze-dried MM produced a decrease of 2 log in Shigella viability. The safety of freeze-dried MM was tested in mice and non-translocation of microorganisms to liver or spleen was observed in BALB/c mice feed ad libitum during 7 or 20 days. To our knowledge, this is the first report about the effect of freeze-drying on viability, in vitro probiotic properties and microbial translocation of a mixture containing different strains of both bacteria and yeasts isolated from kefir.
THE DURABILITY OF LARGE-SCALE ADDITIVE MANUFACTURING COMPOSITE MOLDS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Post, Brian K; Love, Lonnie J; Duty, Chad
2016-01-01
Oak Ridge National Laboratory s Big Area Additive Manufacturing (BAAM) technology permits the rapid production of thermoplastic composite molds using a carbon fiber filled Acrylonitrile-Butadiene-Styrene (ABS) thermoplastic. Demonstration tools (i.e. 0.965 m X 0.559 m X 0.152 m) for composite part fabrication have been printed, coated, and finished with a traditional tooling gel. We present validation results demonstrating the stability of thermoplastic printed molds for room temperature Vacuum Assisted Resin Transfer Molding (VARTM) processes. Arkema s Elium thermoplastic resin was investigated with a variety of reinforcement materials. Experimental results include dimensional characterization of the tool surface using laser scanning techniquemore » following demolding of 10 parts. Thermoplastic composite molds offer rapid production compared to traditionally built thermoset molds in that near-net deposition allows direct digital production of the net geometry at production rate of 45 kg/hr.« less
Degradation of spent craft brewer’s yeast by caprine rumen hyper ammonia-producing bacteria
USDA-ARS?s Scientific Manuscript database
Spent brewer’s yeast has long been included in ruminant diets as a protein supplement. However, modern craft beers often include more hops (Humulus lupulus L.) compounds than traditional recipes. These compounds include alpha and beta-acids, which are antimicrobial to the rumen hyper ammonia-produci...
Additive Manufacturing of Molds for Fabrication of Insulated Concrete Block
DOE Office of Scientific and Technical Information (OSTI.GOV)
Love, Lonnie J.; Lloyd, Peter D.
ORNL worked with concrete block manufacturer, NRG Insulated Block, to demonstrate additive manufacturing of a multi-component block mold for its line of insulated blocks. Solid models of the mold parts were constructed from existing two-dimensional drawings and the parts were fabricated on a Stratasys Fortus 900 using ULTEM 9085. Block mold parts were delivered to NRG and installed on one of their fabrication lines. While form and fit were acceptable, the molds failed to function during NRG’s testing.
Introducing the slime mold graph repository
NASA Astrophysics Data System (ADS)
Dirnberger, M.; Mehlhorn, K.; Mehlhorn, T.
2017-07-01
We introduce the slime mold graph repository or SMGR, a novel data collection promoting the visibility, accessibility and reuse of experimental data revolving around network-forming slime molds. By making data readily available to researchers across multiple disciplines, the SMGR promotes novel research as well as the reproduction of original results. While SMGR data may take various forms, we stress the importance of graph representations of slime mold networks due to their ease of handling and their large potential for reuse. Data added to the SMGR stands to gain impact beyond initial publications or even beyond its domain of origin. We initiate the SMGR with the comprehensive Kist Europe data set focusing on the slime mold Physarum polycephalum, which we obtained in the course of our original research. It contains sequences of images documenting growth and network formation of the organism under constant conditions. Suitable image sequences depicting the typical P. polycephalum network structures are used to compute sequences of graphs faithfully capturing them. Given such sequences, node identities are computed, tracking the development of nodes over time. Based on this information we demonstrate two out of many possible ways to begin exploring the data. The entire data set is well-documented, self-contained and ready for inspection at http://smgr.mpi-inf.mpg.de.
75 FR 55340 - Recovery Fact Sheet 9580.100, Mold Remediation
Federal Register 2010, 2011, 2012, 2013, 2014
2010-09-10
...] Recovery Fact Sheet 9580.100, Mold Remediation AGENCY: Federal Emergency Management Agency, DHS. ACTION... accepting comments on Recovery Fact Sheet RP9580.100, Mold Remediation. DATES: Comments must be received by... 20472-3100. II. Background The Recovery Fact Sheet RP9580.100, Mold Remediation, identifies the expenses...
NASA Astrophysics Data System (ADS)
Yoon, Dae-Woo; Cho, Jung-Wook; Kim, Seon-Hyo
2017-08-01
The present study proposes a countermeasure for regulating total heat flux through the mold flux layer by designed mold flux with additive metallic iron particles. The heat flux through the B2O3-CaO-SiO2-Na2O-CaF2-Fe system was investigated using the infrared emitter technique to evaluate total flux density across the mold flux film. Both scanning electron microscope (SEM) and X-ray diffraction analysis were employed in order to identify the morphological and compositional changes of the crystalline phase, according to increasing iron contents in the mold flux. It was confirmed that the crystalline layer of studied mold fluxes does not have a meaningful effect on the total heat flux density due to the similar structure and fraction of the crystalline phase. The extinction coefficient was measured for glassy mold fluxes using an ultraviolet/visible and a Fourier transformation-infrared ray spectrometer in the range of 0.5 to 5 μm. For analyzing the scattering behavior of iron particles on the extinction coefficient, the number density and diameter of particles were observed by an automated SEM (auto-SEM). With these data, Mie scattering theory is adopted to define the scattering behavior of dispersed iron droplets in glassy matrix. It was found that the theoretical scattering coefficient demonstrated about 1623 to 3295 m-1, which is in accordance with the experimental results. In doing so, this study successfully achieves the strong scattering behavior that would contribute greatly to the optimization of overall heat flux through the mold flux film during the casting process.
Chemotaxis in the Plasmodial Slime Mold, Physarum polycephalum.
ERIC Educational Resources Information Center
Bozzone, Donna M.; Martin, Denise A.
1998-01-01
Describes a biology unit designed so that students pose their own questions and perform experiments to answer these questions. Plasmodial slime mold is employed as the focus of the study with background information about the mold provided. (DDR)
Crack-resistant siloxane molding compounds. [Patent application
McFarland, J.W.; Swearngin, C.B.
1980-11-03
The crack resistance of phenyl silicone molding resins containing siliceous fillers is improved by incorporating therein about 0.5 to 5.5% by weight of ..beta..-eucryptite, a lithium aluminum silicate having a negative thermal expansion coefficient. These molding resins are particularly suitable for encapsulating electronic devices such as diodes, coils, resistors, and the like.
Method and mold for casting thin metal objects
Pehrson, Brandon P; Moore, Alan F
2014-04-29
Provided herein are various embodiments of systems for casting thin metal plates and sheets. Typical embodiments include layers of mold cavities that are oriented vertically for casting the metal plates. In some embodiments, the mold cavities include a beveled edge such that the plates that are cast have a beveled edge. In some embodiments, the mold cavities are filled with a molten metal through an open horizontal edge of the cavity. In some embodiments, the mold cavities are filled through one or more vertical feed orifices. Further disclosed are methods for forming a thin cast metal plate or sheet where the thickness of the cast part is in a range from 0.005 inches to 0.2 inches, and the surface area of the cast part is in a range from 16 square inches to 144 square inches.
Progress in Titanium Metal Powder Injection Molding.
German, Randall M
2013-08-20
Metal powder injection molding is a shaping technology that has achieved solid scientific underpinnings. It is from this science base that recent progress has occurred in titanium powder injection molding. Much of the progress awaited development of the required particles with specific characteristics of particle size, particle shape, and purity. The production of titanium components by injection molding is stabilized by a good understanding of how each process variable impacts density and impurity level. As summarized here, recent research has isolated the four critical success factors in titanium metal powder injection molding (Ti-MIM) that must be simultaneously satisfied-density, purity, alloying, and microstructure. The critical role of density and impurities, and the inability to remove impurities with sintering, compels attention to starting Ti-MIM with high quality alloy powders. This article addresses the four critical success factors to rationalize Ti-MIM processing conditions to the requirements for demanding applications in aerospace and medical fields. Based on extensive research, a baseline process is identified and reported here with attention to linking mechanical properties to the four critical success factors.
Progress in Titanium Metal Powder Injection Molding
German, Randall M.
2013-01-01
Metal powder injection molding is a shaping technology that has achieved solid scientific underpinnings. It is from this science base that recent progress has occurred in titanium powder injection molding. Much of the progress awaited development of the required particles with specific characteristics of particle size, particle shape, and purity. The production of titanium components by injection molding is stabilized by a good understanding of how each process variable impacts density and impurity level. As summarized here, recent research has isolated the four critical success factors in titanium metal powder injection molding (Ti-MIM) that must be simultaneously satisfied—density, purity, alloying, and microstructure. The critical role of density and impurities, and the inability to remove impurities with sintering, compels attention to starting Ti-MIM with high quality alloy powders. This article addresses the four critical success factors to rationalize Ti-MIM processing conditions to the requirements for demanding applications in aerospace and medical fields. Based on extensive research, a baseline process is identified and reported here with attention to linking mechanical properties to the four critical success factors. PMID:28811458
Epidemics of mold poisoning past and present.
Meggs, William J
2009-01-01
Molds are ubiquitous throughout the biosphere of planet earth and cause infectious, allergic, and toxic diseases. Toxic diseases arise from exposure to mycotoxins produced by molds. Throughout history, there have been a number of toxic epidemics associated with exposure to mycotoxins. Acute epidemics of ergotism are caused by consumption of grain infested by fungi of the genus Claviceps, which produce the bioactive amine ergotamine that mimics the neurotransmitters norepinephrine, serotonin, and dopamine. Acute aflatoxin outbreaks have occurred from ingestion of corn stored in damp conditions that potentiate growth of the molds of the species Aspergillus. Contemporary construction methods that use cellulose substrates such as fiber board and indoor moisture have caused an outbreak of contaminated buildings with Stachybotrys chartarum, with the extent of health effects still a subject of debate and ongoing research. This article reviews several of the more prominent epidemics and discusses the nature of the toxins. Two diseases that were leading causes of childhood mortality in England in the 1970s and vanished with changing dietary habits, putrid malignant fever, and slow nervous fever were most likely toxic mold epidemics.
Index change of chalcogenide materials from precision glass molding processes
NASA Astrophysics Data System (ADS)
Deegan, J.; Walsh, K.; Lindberg, G.; Benson, R.; Gibson, D.; Bayya, S.; Sanghera, J.; Stover, E.
2015-05-01
With the increase in demand for infrared optics for thermal applications and the use of glass molding of chalcogenide materials to support these higher volume optical designs, an investigation of changes to the optical properties of these materials is required. Typical precision glass molding requires specific thermal conditions for proper lens molding of any type of optical glass. With these conditions a change (reduction) of optical index occurs after molding of all oxide glass types and it is presumed that a similar behavior will happen with chalcogenide based materials. We will discuss the effects of a typical molding thermal cycle for use with commercially and newly developed chalcogenide materials and show results of index variation from nominally established material data.
Onychomycosis due to opportunistic molds*
Martínez-Herrera, Erick Obed; Arroyo-Camarena, Stefanie; Tejada-García, Diana Luz; Porras-López, Carlos Francisco; Arenas, Roberto
2015-01-01
BACKGROUND: Onychomycosis are caused by dermatophytes and Candida, but rarely by non- dermatophyte molds. These opportunistic agents are filamentous fungi found as soil and plant pathogens. OBJECTIVES: To determine the frequency of opportunistic molds in onychomycosis. METHODS: A retrospective analysis of 4,220 cases with onychomycosis, diagnosed in a 39-month period at the Institute of Dermatology and Skin surgery "Prof. Dr. Fernando A. Cordero C." in Guatemala City, and confirmed with a positive KOH test and culture. RESULTS: 32 cases (0.76%) of onychomycosis caused by opportunistic molds were confirmed. The most affected age group ranged from 41 to 65 years (15 patients, 46.9%) and females were more commonly affected (21 cases, 65.6%) than males. Lateral and distal subungual onychomycosis (OSD-L) was detected in 20 cases (62.5%). The microscopic examination with KOH showed filaments in 19 cases (59.4%), dermatophytoma in 9 cases (28.1%), spores in 2 cases (6.25%), and filaments and spores in 2 cases (6.25%). Etiologic agents: Aspergillus sp., 11 cases (34.4%); Scopulariopsis brevicaulis, 8 cases (25.0%); Cladosporium sp., 3 cases (9.4%); Acremonium sp., 2 cases (6.25%); Paecilomyces sp., 2 cases (6.25%); Tritirachium oryzae, 2 cases (6.25%); Fusarium sp., Phialophora sp., Rhizopus sp. and Alternaria alternate, 1 case (3.1%) each. CONCLUSIONS: We found onychomycosis by opportunistic molds in 0.76% of the cases and DLSO was present in 62.5%. The most frequent isolated etiological agents were: Aspergillus sp. and Scopulariopsis brevicaulis. PMID:26131862
Low Cost Injection Mold Creation via Hybrid Additive and Conventional Manufacturing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dehoff, Ryan R.; Watkins, Thomas R.; List, III, Frederick Alyious
2015-12-01
The purpose of the proposed project between Cummins and ORNL is to significantly reduce the cost of the tooling (machining and materials) required to create injection molds to make plastic components. Presently, the high cost of this tooling forces the design decision to make cast aluminum parts because Cummins typical production volumes are too low to allow injection molded plastic parts to be cost effective with the amortized cost of the injection molding tooling. In addition to reducing the weight of components, polymer injection molding allows the opportunity for the alternative cooling methods, via nitrogen gas. Nitrogen gas cooling offersmore » an environmentally and economically attractive cooling option, if the mold can be manufactured economically. In this project, a current injection molding design was optimized for cooling using nitrogen gas. The various components of the injection mold tooling were fabricated using the Renishaw powder bed laser additive manufacturing technology. Subsequent machining was performed on the as deposited components to form a working assembly. The injection mold is scheduled to be tested in a projection setting at a commercial vendor selected by Cummins.« less
Diagnosis of mold allergy by RAST and skin prick testing.
Nordvall, S L; Agrell, B; Malling, H J; Dreborg, S
1990-11-01
Sera from 33 patients with mold allergy proven by bronchial provocation were analyzed for specific IgE against six mold species comparing an improved Phadebas RAST with four other techniques. The new method was more sensitive and gave significantly higher IgE antibody concentrations for all tested molds except Cladosporium herbarum.
Investigation of micro-injection molding based on longitudinal ultrasonic vibration core.
Qiu, Zhongjun; Yang, Xue; Zheng, Hui; Gao, Shan; Fang, Fengzhou
2015-10-01
An ultrasound-assisted micro-injection molding method is proposed to improve the rheological behavior of the polymer melt radically, and a micro-injection molding system based on a longitudinal ultrasonic vibration core is developed and employed in the micro-injection molding process of Fresnel lenses. The verification experiments show that the filling mold area of the polymer melt is increased by 6.08% to 19.12%, and the symmetric deviation of the Fresnel lens is improved 15.62% on average. This method improved the filling performance and replication quality of the polymer melt in the injection molding process effectively.
Design and Checking Analysis of Injection Mold for a Plastic Cup
NASA Astrophysics Data System (ADS)
Li, Xuebing
2018-03-01
A special injection mold was designed for the structural characteristics of a plastic cup part. The mold was simulated by Moldflow software and verified by calculating the stripping force, the pulling force and the clamping force of the mold so that to determine the appropriate injection parameters. It has been proved that the injection mold is effective and practical in the actual producing and can meet the quality requirements during the course of using it, which solved some problems for injection molding of this kind of parts and can provide some reference for the production of other products in the same industry.
Residual stresses in injection molded shape memory polymer parts
NASA Astrophysics Data System (ADS)
Katmer, Sukran; Esen, Huseyin; Karatas, Cetin
2016-03-01
Shape memory polymers (SMPs) are materials which have shape memory effect (SME). SME is a property which has the ability to change shape when induced by a stimulator such as temperature, moisture, pH, electric current, magnetic field, light, etc. A process, known as programming, is applied to SMP parts in order to alter them from their permanent shape to their temporary shape. In this study we investigated effects of injection molding and programming processes on residual stresses in molded thermoplastic polyurethane shape memory polymer, experimentally. The residual stresses were measured by layer removal method. The study shows that injection molding and programming process conditions have significantly influence on residual stresses in molded shape memory polyurethane parts.
Extracellular Polysaccharides Produced by Yeasts and Yeast-Like Fungi
NASA Astrophysics Data System (ADS)
van Bogaert, Inge N. A.; de Maeseneire, Sofie L.; Vandamme, Erick J.
Several yeasts and yeast-like fungi are known to produce extracellular polysaccharides. Most of these contain D-mannose, either alone or in combination with other sugars or phosphate. A large chemical and structural variability is found between yeast species and even among different strains. The types of polymers that are synthesized can be chemically characterized as mannans, glucans, phosphoman-nans, galactomannans, glucomannans and glucuronoxylomannans. Despite these differences, almost all of the yeast exopolysaccharides display some sort of biological activity. Some of them have already applications in chemistry, pharmacy, cosmetics or as probiotic. Furthermore, some yeast exopolysaccharides, such as pullulan, exhibit specific physico-chemical and rheological properties, making them useful in a wide range of technical applications. A survey is given here of the production, the characteristics and the application potential of currently well studied yeast extracellular polysaccharides.
Characterization and stability of lactobacilli and yeast microbiota in kefir grains.
Vardjan, T; Mohar Lorbeg, P; Rogelj, I; Čanžek Majhenič, A
2013-05-01
Characterization and stability of lactobacilli and yeasts from kefir grains using culture-dependent and culture-independent methods were investigated in this study. Culture-dependent analysis, followed by sequencing of 16S ribosomal DNA for bacteria and 26S rRNA gene for yeasts, revealed 3 different species of lactobacilli and yeasts, respectively. The most frequently isolated bacterial species were Lactobacillus kefiranofaciens ssp. kefirgranum, Lb. parakefiri, and Lb. kefiri, whereas yeasts belonged to Kluyveromyces marxianus, Kazachstania exigua, and Rhodosporidium kratochvilovae. This study is the first to report on the presence of R. kratochvilovae in kefir grains. On the other hand, PCR-denaturing gradient gel electrophoresis in the culture-independent method showed that the dominant microorganisms were Lb. kefiranofaciens ssp. kefirgranum, Kl. marxianus and Ka. exigua, but did not reveal bands corresponding to Lb. parakefiri, Lb. kefiri, or R. kratochvilovae. Our results support the necessity of combining more techniques for detailed and reliable study of microbial communities in kefir grains. Another interesting finding confirmed that the detected dominant microbiota of kefir grains is very stable and did not change over experimental time. This finding is important to ensure consistent product quality. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Srinivasulu Reddy, K.; Venkata Reddy, Vajrala; Mandava, Ravi Kumar
2017-08-01
Chemically bonded no-bake molds and cores have good mechanical properties and produce dimensionally accurate castings compared to green sand molds. Poor collapsibility property of CO2 hardened sodium silicate bonded sand mold and phenolic urethane no-bake (PUN) binder system, made the reclamation of the sands more important. In the present work fine silica sand is mixed with phenolic urethane no-bake binder and the sand sets in a very short time within few minutes. In this paper it is focused on optimizing the process parameters of PUN binder based sand castings for better collapsibility and surface finish of gray cast iron using Taguchi design. The findings were successfully verified through experiments.
Murray, Melissa P.; Zinchuk, Riva; Larone, Davise H.
2005-01-01
The chromogenic medium BBL CHROMagar Candida (CAC) was evaluated as a sole primary medium for the isolation of yeasts from clinical specimens in which yeasts are the primary concern. Additionally, the reliability of the rapid-assimilation-of-trehalose (RAT) test in yielding correct results with isolates taken from CAC was assessed. A total of 270 throat, urine, and genital (TUG) specimens were streaked onto CAC, Sabouraud dextrose agar (SDA), inhibitory mold agar (IMA), and Mycosel (MYC). A total of 69 blood culture broths that were smear positive for yeast were streaked onto CAC and SDA. A 1-h RAT test (NCCLS M35-A) was performed simultaneously on isolates from CAC and SDA. A total of 112 TUG specimens yielded yeast colonies (CAC, 111 colonies; IMA, 105; SDA, 103; MYC, 91). The 69 blood culture yeasts grew on both CAC and SDA. Mixed cultures of yeasts were detected on 11 CAC plates but were unrecognized on other media. Colonies suspected of being C. glabrata on 32 CAC plates were all RAT test positive and confirmed to be C. glabrata; of 59 colonies with various characteristics of color and morphology on CAC, none were RAT positive, and all were conventionally identified as yeasts other than C. glabrata (sensitivity and specificity, 100%). The same isolates from SDA tested for RAT produced six false negatives and no false positives (sensitivity, 81%; specificity, 100%). The results show that CAC can be used as the sole primary medium for recovery of yeasts from clinical specimens. Additionally, isolates grown on CAC yield excellent results with the RAT test utilized in this study. PMID:15750085
Murray, Melissa P; Zinchuk, Riva; Larone, Davise H
2005-03-01
The chromogenic medium BBL CHROMagar Candida (CAC) was evaluated as a sole primary medium for the isolation of yeasts from clinical specimens in which yeasts are the primary concern. Additionally, the reliability of the rapid-assimilation-of-trehalose (RAT) test in yielding correct results with isolates taken from CAC was assessed. A total of 270 throat, urine, and genital (TUG) specimens were streaked onto CAC, Sabouraud dextrose agar (SDA), inhibitory mold agar (IMA), and Mycosel (MYC). A total of 69 blood culture broths that were smear positive for yeast were streaked onto CAC and SDA. A 1-h RAT test (NCCLS M35-A) was performed simultaneously on isolates from CAC and SDA. A total of 112 TUG specimens yielded yeast colonies (CAC, 111 colonies; IMA, 105; SDA, 103; MYC, 91). The 69 blood culture yeasts grew on both CAC and SDA. Mixed cultures of yeasts were detected on 11 CAC plates but were unrecognized on other media. Colonies suspected of being C. glabrata on 32 CAC plates were all RAT test positive and confirmed to be C. glabrata; of 59 colonies with various characteristics of color and morphology on CAC, none were RAT positive, and all were conventionally identified as yeasts other than C. glabrata (sensitivity and specificity, 100%). The same isolates from SDA tested for RAT produced six false negatives and no false positives (sensitivity, 81%; specificity, 100%). The results show that CAC can be used as the sole primary medium for recovery of yeasts from clinical specimens. Additionally, isolates grown on CAC yield excellent results with the RAT test utilized in this study.
Yeast infection (vaginal) Overview A vaginal yeast infection is a fungal infection that causes irritation, discharge and intense itchiness ... symptoms Causes The fungus candida causes a vaginal yeast infection. Your vagina naturally contains a balanced mix of yeast, including ...
Molding apparatus. [for thermosetting plastic compositions
NASA Technical Reports Server (NTRS)
Heier, W. C. (Inventor)
1974-01-01
Apparatus for compression molding of thermosetting plastics compositions including interfitting hollow male and female components is reported. The components are adapted to be compressed to form a rocket nozzle in a cavity. A thermal jacket is provided exteriorly adjacent to the female component for circulating a thermal transfer fluid to effect curing of a thermosetting plastics material being molded. Each of the male and female components is provided with suitable inlets and outlets for circulating a thermal transfer fluid.
Isolation and Purification of Antibiotic Material from Physarum gyrosum
Schroeder, H. R.; Mallette, M. F.
1973-01-01
The myxomycete Physarum gyrosum was cultured in its plasmodial stage on agar plates containing 0.025 M phosphate buffer at pH 6.5, 2% bakers' yeast, and 0.2% glucose and was supplemented with live Escherichia coli. Extracts of these plasmodia contained several antibiotic substances. Antibiotic materials were partially purified by dialysis of the agar medium-mold mixture, evaporation of the dialyzate, and butanol extraction of the residue. Further purification in two paper and two thin-layer chromatographic systems gave one product which was pure in six thin-layer chromatographic systems. Antibiotic activity against some gram-positive and gram-negative bacteria and yeasts was demonstrated with partially purified extracts and a paper-chromatographically separated fraction. One pure antibiotic was effective against Bacillus cereus. PMID:4799591
Immobilization of Cells and Enzymes for Fermented Dairy or Meat Products
NASA Astrophysics Data System (ADS)
Champagne, Claude P.; Lee, Byong H.; Saucier, Linda
Historically, we can find fermented products in almost all cultural backgrounds around the world. Notably, there are many different milk or meat-based foods and this chapter will focus on them (Kosikowski 1982; Wood 1998). Cheese, yoghurt, sour cream, kefir, or cultured butter are probably the most common fermented dairy products, but many regional varieties exist (Farnworth 2004). Fermented meats are typically found as dry sausages (Lüke 1998). Yeasts are mostly involved in the manufacture of bread and alcoholic beverages, which are basically cereal- or fruit-based products. In fermented meat and milk, the main microorganisms used are the lactic acid bacteria (LAB). Yeast and molds are rather involved in ripening. Therefore, the LAB will constitute the main focus of this chapter.
Ultrasonically-assisted Polymer Molding: An Evaluation
NASA Astrophysics Data System (ADS)
Moles, Matthew; Roy, Anish; Silberschmidt, Vadim
Energy reduction in extrusion and injection molding processes can be achieved by the introduction of ultrasonic energy. Polymer flow can be enhanced on application of ultrasonic vibration, which can reduce the thermal and pressure input requirements to produce the same molding; higher productivity may also be achieved. In this paper, a design of an ultrasound-assisted injection mold machine is explored. An extrusion-die design was augmented with a commercial 1.5 kW ultrasonic transducer and sonotrode designed to resonate close to 20 kHz with up to 100 μm vibration amplitude. The design was evaluated with modal and thermal analysis using finite-element analysis software. The use of numerical techniques, including computational fluid dynamics, fluid-structure interaction and coupled Lagrangian-Eulerian method, to predict the effect of ultrasound on polymer flow was considered. A sonotrode design utilizing ceramic to enhance thermal isolation was also explored.
Neonatal Ear Molding: Timing and Technique.
Anstadt, Erin Elizabeth; Johns, Dana Nicole; Kwok, Alvin Chi-Ming; Siddiqi, Faizi; Gociman, Barbu
2016-03-01
The incidence of auricular deformities is believed to be ∼11.5 per 10,000 births, excluding children with microtia. Although not life-threatening, auricular deformities can cause undue distress for patients and their families. Although surgical procedures have traditionally been used to reconstruct congenital auricular deformities, ear molding has been gaining acceptance as an efficacious, noninvasive alternative for the treatment of newborns with ear deformations. We present the successful correction of bilateral Stahl's ear deformity in a newborn through a straightforward, nonsurgical method implemented on the first day of life. The aim of this report is to make pediatric practitioners aware of an effective and simple molding technique appropriate for correction of congenital auricular anomalies. In addition, it stresses the importance of very early initiation of ear cartilage molding for achieving the desired outcome. Copyright © 2016 by the American Academy of Pediatrics.
METHOD FOR EVALUATING MOLD GROWTH ON CEILING TILE
A method to extract mold spores from porous ceiling tiles was developed using a masticator blender. Ceiling tiles were inoculated and analyzed using four species of mold. Statistical analysis comparing results obtained by masticator extraction and the swab method was performed. T...
Cho, S J; Cox-Ganser, J M; Park, J-H
2016-04-01
We examined associations between observational dampness scores and measurements of microbial agents and moisture in three public schools. A dampness score was created for each room from 4-point-scale scores (0-3) of water damage, water stains, visible mold, moldy odor, and wetness for each of 8 room components (ceiling, walls, windows, floor, ventilation, furniture, floor trench, and pipes), when present. We created mixed microbial exposure indices (MMEIs) for each of 121 rooms by summing decile ranks of 8 analytes (total culturable fungi; total, Gram-negative, and Gram-positive culturable bacteria; ergosterol; (1→3)-β-D-glucan; muramic acid; and endotoxin) in floor dust. We found significant (P ≤ 0.01) linear associations between the dampness score and culturable bacteria (total, Gram-positive, and Gram-negative) and the MMEIs. Rooms with dampness scores greater than 0.25 (median) had significantly (P < 0.05) higher levels of most microbial agents, MMEIs, and relative moisture content than those with lower scores (≤0.25). Rooms with reported recent water leaks had significantly (P < 0.05) higher dampness scores than those with historical or no reported water leaks. This study suggests that observational assessment of dampness and mold using a standardized form may be valuable for identifying and documenting water damage and associated microbial contamination. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.
Laser-Etched Designs for Molding Hydrogel-Based Engineered Tissues
Munarin, Fabiola; Kaiser, Nicholas J.; Kim, Tae Yun; Choi, Bum-Rak
2017-01-01
Rapid prototyping and fabrication of elastomeric molds for sterile culture of engineered tissues allow for the development of tissue geometries that can be tailored to different in vitro applications and customized as implantable scaffolds for regenerative medicine. Commercially available molds offer minimal capabilities for adaptation to unique conditions or applications versus those for which they are specifically designed. Here we describe a replica molding method for the design and fabrication of poly(dimethylsiloxane) (PDMS) molds from laser-etched acrylic negative masters with ∼0.2 mm resolution. Examples of the variety of mold shapes, sizes, and patterns obtained from laser-etched designs are provided. We use the patterned PDMS molds for producing and culturing engineered cardiac tissues with cardiomyocytes derived from human-induced pluripotent stem cells. We demonstrate that tight control over tissue morphology and anisotropy results in modulation of cell alignment and tissue-level conduction properties, including the appearance and elimination of reentrant arrhythmias, or circular electrical activation patterns. Techniques for handling engineered cardiac tissues during implantation in vivo in a rat model of myocardial infarction have been developed and are presented herein to facilitate development and adoption of surgical techniques for use with hydrogel-based engineered tissues. In summary, the method presented herein for engineered tissue mold generation is straightforward and low cost, enabling rapid design iteration and adaptation to a variety of applications in tissue engineering. Furthermore, the burden of equipment and expertise is low, allowing the technique to be accessible to all. PMID:28457187
Vishniac, H S
1995-11-01
Microcosms containing an air-dried autoclaved loamy sand (Eufala A) with low salt and organic content were inoculated with a representative (obligately aerobic, encapsulated) soil yeast, Cryptococcus albidus var. albidus (T) ATCC 10666, singly (for growth rate and survival determinations) and together with the bacterial biota native to Eufala A. The yeast competed successfully with the more rapidly growing bacteria in the presence of added water from 1% (5.7% of field capacity) to 14% (80% of field capacity) but grew for shorter times than when grown alone; times correlated with the lag phase of the bacterial biota. When well-watered (10 and 14%) competition cultures were allowed to dry and used as inoculum for subcultures, the yeast made significant growth only at 1% added water but survived at the higher moisture concentrations. The competitive ability of Cr. albidus confirms the previously reported advantages of the cryptococcal capsule in hydration and desiccation and, together with lengthy survival, suggests that the importance of such yeasts in the biogeochemistry of arid soils has been seriously underestimated.
Manufacture of mold of polymeric composite water pipe reinforced charcoal
NASA Astrophysics Data System (ADS)
Zulfikar; Misdawati; Idris, M.; Nasution, F. K.; Harahap, U. N.; Simanjuntak, R. K.; Jufrizal; Pranoto, S.
2018-03-01
In general, household wastewater pipelines currently use thermoplastic pipes of Polyvinyl Chloride (PVC). This material is known to be not high heat resistant, contains hazardous chemicals (toxins), relatively inhospitable, and relatively more expensive. Therefore, researchers make innovations utilizing natural materials in the form of wood charcoal as the basic material of making the water pipe. Making this pipe requires a simple mold design that can be worked in the scale of household and intermediate industries. This research aims to produce water pipe mold with simple design, easy to do, and making time relatively short. Some considerations for molding materials are weight of mold, ease of raw material, strong, sturdy, and able to cast. Pipe molds are grouped into 4 (four) main parts, including: outer diameter pipe molding, pipe inside diameter, pipe holder, and pipe alignment control. Some materials have been tested as raw materials for outer diameter of pipes, such as wood, iron / steel, cement, and thermoset. The best results are obtained on thermoset material, where the process of disassembling is easier and the resulting mold weight is relatively lighter. For the inside diameter of the pipe is used stainless steel, because in addition to be resistant to chemical processes that occur, in this part of the mold must hold the press load due to shrinkage of raw materials of the pipe during the process of hardening (polymerization). Therefore, it needs high pressure resistant material and does not blend with the raw material of the pipe. The base of the mold is made of stainless steel material because it must be resistant to corrosion due to chemical processes. As for the adjustment of the pipe is made of ST 37 carbon steel, because its function is only as a regulator of the alignment of the pipe structure.
Quantification and Qualification of Bacteria Trapped in Chewed Gum
Wessel, Stefan W.; van der Mei, Henny C.; Morando, David; Slomp, Anje M.; van de Belt-Gritter, Betsy; Maitra, Amarnath; Busscher, Henk J.
2015-01-01
Chewing of gum contributes to the maintenance of oral health. Many oral diseases, including caries and periodontal disease, are caused by bacteria. However, it is unknown whether chewing of gum can remove bacteria from the oral cavity. Here, we hypothesize that chewing of gum can trap bacteria and remove them from the oral cavity. To test this hypothesis, we developed two methods to quantify numbers of bacteria trapped in chewed gum. In the first method, known numbers of bacteria were finger-chewed into gum and chewed gums were molded to standard dimensions, sonicated and plated to determine numbers of colony-forming-units incorporated, yielding calibration curves of colony-forming-units retrieved versus finger-chewed in. In a second method, calibration curves were created by finger-chewing known numbers of bacteria into gum and subsequently dissolving the gum in a mixture of chloroform and tris-ethylenediaminetetraacetic-acid (TE)-buffer. The TE-buffer was analyzed using quantitative Polymerase-Chain-Reaction (qPCR), yielding calibration curves of total numbers of bacteria versus finger-chewed in. Next, five volunteers were requested to chew gum up to 10 min after which numbers of colony-forming-units and total numbers of bacteria trapped in chewed gum were determined using the above methods. The qPCR method, involving both dead and live bacteria yielded higher numbers of retrieved bacteria than plating, involving only viable bacteria. Numbers of trapped bacteria were maximal during initial chewing after which a slow decrease over time up to 10 min was observed. Around 108 bacteria were detected per gum piece depending on the method and gum considered. The number of species trapped in chewed gum increased with chewing time. Trapped bacteria were clearly visualized in chewed gum using scanning-electron-microscopy. Summarizing, using novel methods to quantify and qualify oral bacteria trapped in chewed gum, the hypothesis is confirmed that chewing of gum can trap
Zarei, Omid; Dastmalchi, Siavoush; Hamzeh-Mivehroud, Maryam
2016-01-01
Yeasts, especially Saccharomyces cerevisiae, are one of the oldest organisms with broad spectrum of applications, owing to their unique genetics and physiology. Yeast extract, i.e. the product of yeast cells, is extensively used as nutritional resource in bacterial culture media. The aim of this study was to develop a simple, rapid and cost benefit process to produce the yeast extract. In this procedure mechanical methods such as high temperature and pressure were utilized to produce the yeast extract. The growth of the bacteria feed with the produced yeast extract was monitored in order to assess the quality of the product. The results showed that the quality of the produced yeast extract was very promising concluded from the growth pattern of bacterial cells in media prepared from this product and was comparable with that of the three commercial yeast extracts in terms of bacterial growth properties. One of the main advantages of the current method was that no chemicals and enzymes were used, leading to the reduced production cost. The method is very simple and cost effective, and can be performed in a reasonable time making it suitable for being adopted by research laboratories. Furthermore, it can be scaled up to produce large quantities for industrial applications. PMID:28243289
Frazer, LilyAnn Novak; O'Keefe, Raymond T
2007-09-01
The availability of Saccharomyces cerevisiae yeast strains with multiple auxotrophic markers allows the stable introduction and selection of more than one yeast shuttle vector containing marker genes that complement the auxotrophic markers. In certain experimental situations there is a need to recover more than one shuttle vector from yeast. To facilitate the recovery and identification of multiple plasmids from S. cerevisiae, we have constructed a series of plasmids based on the pRS series of yeast shuttle vectors. Bacterial antibiotic resistance genes to chloramphenicol, kanamycin and zeocin have been combined with the yeast centromere sequence (CEN6), the autonomously replicating sequence (ARSH4) and one of the four yeast selectable marker genes (HIS3, TRP1, LEU2 or URA3) from the pRS series of vectors. The 12 plasmids produced differ in antibiotic resistance and yeast marker gene within the backbone of the multipurpose plasmid pBluescript II. The newly constructed vectors show similar mitotic stability to the original pRS vectors. In combination with the ampicillin-resistant pRS series of yeast shuttle vectors, these plasmids now allow the recovery and identification in bacteria of up to four different vectors from S. cerevisiae. Copyright (c) 2007 John Wiley & Sons, Ltd.
MOLD GROWTH ON GYPSUM WALLBOARD--A RESEARCH SUMMARY
Reducing occupant exposure to mold growing on damp gypsum wallboard is a research objective of the U.S. Environmental Protection Agency. Often mold contaminated building materials are not properly removed but instead surface cleaners are used and then paint is applied in an attem...
High rate fabrication of compression molded components
DOE Office of Scientific and Technical Information (OSTI.GOV)
Matsen, Marc R.; Negley, Mark A.; Dykstra, William C.
2016-04-19
A method for fabricating a thermoplastic composite component comprises inductively heating a thermoplastic pre-form with a first induction coil by inducing current to flow in susceptor wires disposed throughout the pre-form, inductively heating smart susceptors in a molding tool to a leveling temperature with a second induction coil by applying a high-strength magnetic field having a magnetic flux that passes through surfaces of the smart susceptors, shaping the magnetic flux that passes through surfaces of the smart susceptors to flow substantially parallel to a molding surface of the smart susceptors, placing the heated pre-form between the heated smart susceptors; andmore » applying molding pressure to the pre-form to form the composite component.« less
Fabrication of sinterable silicon nitride by injection molding
NASA Technical Reports Server (NTRS)
Quackenbush, C. L.; French, K.; Neil, J. T.
1982-01-01
Transformation of structural ceramics from the laboratory to production requires development of near net shape fabrication techniques which minimize finish grinding. One potential technique for producing large quantities of complex-shaped parts at a low cost, and microstructure of sintered silicon nitride fabricated by injection molding is discussed and compared to data generated from isostatically dry-pressed material. Binder selection methodology, compounding of ceramic and binder components, injection molding techniques, and problems in binder removal are discussed. Strength, oxidation resistance, and microstructure of sintered silicon nitride fabricated by injection molding is discussed and compared to data generated from isostatically dry-pressed material.
Distinct Domestication Trajectories in Top-Fermenting Beer Yeasts and Wine Yeasts.
Gonçalves, Margarida; Pontes, Ana; Almeida, Pedro; Barbosa, Raquel; Serra, Marta; Libkind, Diego; Hutzler, Mathias; Gonçalves, Paula; Sampaio, José Paulo
2016-10-24
Beer is one of the oldest alcoholic beverages and is produced by the fermentation of sugars derived from starches present in cereal grains. Contrary to lager beers, made by bottom-fermenting strains of Saccharomyces pastorianus, a hybrid yeast, ale beers are closer to the ancient beer type and are fermented by S. cerevisiae, a top-fermenting yeast. Here, we use population genomics to investigate (1) the closest relatives of top-fermenting beer yeasts; (2) whether top-fermenting yeasts represent an independent domestication event separate from those already described; (3) whether single or multiple beer yeast domestication events can be inferred; and (4) whether top-fermenting yeasts represent non-recombinant or recombinant lineages. Our results revealed that top-fermenting beer yeasts are polyphyletic, with a main clade composed of at least three subgroups, dominantly represented by the German, British, and wheat beer strains. Other beer strains were phylogenetically close to sake, wine, or bread yeasts. We detected genetic signatures of beer yeast domestication by investigating genes previously linked to brewing and using genome-wide scans. We propose that the emergence of the main clade of beer yeasts is related with a domestication event distinct from the previously known cases of wine and sake yeast domestication. The nucleotide diversity of the main beer clade more than doubled that of wine yeasts, which might be a consequence of fundamental differences in the modes of beer and wine yeast domestication. The higher diversity of beer strains could be due to the more intense and different selection regimes associated to brewing. Copyright © 2016 Elsevier Ltd. All rights reserved.
Material flow data for numerical simulation of powder injection molding
NASA Astrophysics Data System (ADS)
Duretek, I.; Holzer, C.
2017-01-01
The powder injection molding (PIM) process is a cost efficient and important net-shape manufacturing process that is not completely understood. For the application of simulation programs for the powder injection molding process, apart from suitable physical models, exact material data and in particular knowledge of the flow behavior are essential in order to get precise numerical results. The flow processes of highly filled polymers are complex. Occurring effects are very hard to separate, like shear flow with yield stress, wall slip, elastic effects, etc. Furthermore, the occurrence of phase separation due to the multi-phase composition of compounds is quite probable. In this work, the flow behavior of a 316L stainless steel feedstock for powder injection molding was investigated. Additionally, the influence of pre-shearing on the flow behavior of PIM-feedstocks under practical conditions was examined and evaluated by a special PIM injection molding machine rheometer. In order to have a better understanding of key factors of PIM during the injection step, 3D non-isothermal numerical simulations were conducted with a commercial injection molding simulation software using experimental feedstock properties. The simulation results were compared with the experimental results. The mold filling studies amply illustrate the effect of mold temperature on the filling behavior during the mold filling stage. Moreover, the rheological measurements showed that at low shear rates no zero shear viscosity was observed, but instead the viscosity further increased strongly. This flow behavior could be described with the Cross-WLF approach with Herschel-Bulkley extension very well.
Soft lithography of ceramic microparts using wettability-tunable poly(dimethylsiloxane) (PDMS) molds
NASA Astrophysics Data System (ADS)
Su, Bo; Zhang, Aijun; Meng, Junhu; Zhang, Zhaozhu
2016-07-01
Green alumina microparts were fabricated from a high solid content aqueous suspension by microtransfer molding using air plasma-treated poly(dimethylsiloxane) (PDMS) molds. The wettability of the air plasma-treated PDMS molds spontaneously changed between the hydrophilic and hydrophobic states during the process. Initial hydrophilicity of the air plasma-treated PDMS molds significantly improved the flowability of the concentrated suspension. Subsequent hydrophobic recovery of the air plasma-treated PDMS molds enabled a perfect demolding of the green microparts. Consequently, defect-free microchannel parts of 60 μm and a micromixer with an area of several square centimeters were successfully fabricated. In soft lithography, tuning the wetting behavior of PDMS molds has a great effect on the quality of ceramic microparts. Using wettability-tunable PDMS molds has great potential in producing complex-shaped and large-area ceramic microparts and micropatterns.
Manufacturing Science of Improved Molded Optics
2013-12-05
Forrer, “Interaction of N-FK5 and L- BAL35 optical glass with various carbide and other precision glass mold tooling”, SPIE Optifab 2013 Conference...Richardson, S. Mourad, M. Huber, A. Kunz, M. Forrer. Interaction of N-FK5 and L-BAL35 optical glass with various carbide and other precision glass mold...stoichiometric compounds. As an example, if silicon and oxygen are present in a material, then it was assumed that they are present in the form of
2013-01-01
Physicians are increasingly being asked to diagnose and treat people made ill by exposure to water-damaged environments, mold, and mycotoxins. In addition to avoidance of further exposure to these environments and to items contaminated by these environments, a number of approaches have been used to help persons affected by exposure to restore their health. Illness results from a combination of factors present in water-damaged indoor environments including, mold spores and hyphal fragments, mycotoxins, bacteria, bacterial endotoxins, and cell wall components as well as other factors. Mechanisms of illness include inflammation, oxidative stress, toxicity, infection, allergy, and irritant effects of exposure. This paper reviews the scientific literature as it relates to commonly used treatments such as glutathione, antioxidants, antifungals, and sequestering agents such as Cholestyramine, charcoal, clay and chlorella, antioxidants, probiotics, and induced sweating. PMID:23710148
Antibodies to molds and satratoxin in individuals exposed in water-damaged buildings.
Vojdani, Aristo; Thrasher, Jack D; Madison, Roberta A; Gray, Michael R; Heuser, Gunnar; Campbell, Andrew W
2003-07-01
Immunoglobulin (Ig)A, IgM, and IgG antibodies against Penicillium notatum, Aspergillus niger, Stachybotrys chartarum, and satratoxin H were determined in the blood of 500 healthy blood donor controls, 500 random patients, and 500 patients with known exposure to molds. The patients were referred to the immunological testing laboratory for health reasons other than mold exposure, or for measurement of mold antibody levels. Levels of IgA, IgM, and IgG antibodies against molds were significantly greater in the patients (p < 0.001 for all measurements) than in the controls. However, in mold-exposed patients, levels of these antibodies against satratoxin differed significantly for IgG only (p < 0.001), but not for IgM or IgA. These differences in the levels of mold antibodies among the 3 groups were confirmed by calculation of z score and by Scheffé's significant difference tests. A general linear model was applied in the majority of cases, and 3 different subsets were formed, meaning that the healthy control groups were different from the random patients and from the mold-exposed patients. These findings indicated that mold exposure was more common in patients who were referred for immunological evaluation than it was in healthy blood donors. The detection of antibodies to molds and satratoxin H likely resulted from antigenic stimulation of the immune system and the reaction of serum with specially prepared mold antigens. These antigens, which had high protein content, were developed in this laboratory and used in the enzyme-linked immunosorbent assay (ELISA) procedure. The authors concluded that the antibodies studied are specific to mold antigens and mycotoxins, and therefore could be useful in epidemiological and other studies of humans exposed to molds and mycotoxins.
Injection Molding Parameters Calculations by Using Visual Basic (VB) Programming
NASA Astrophysics Data System (ADS)
Tony, B. Jain A. R.; Karthikeyen, S.; Alex, B. Jeslin A. R.; Hasan, Z. Jahid Ali
2018-03-01
Now a day’s manufacturing industry plays a vital role in production sectors. To fabricate a component lot of design calculation has to be done. There is a chance of human errors occurs during design calculations. The aim of this project is to create a special module using visual basic (VB) programming to calculate injection molding parameters to avoid human errors. To create an injection mold for a spur gear component the following parameters have to be calculated such as Cooling Capacity, Cooling Channel Diameter, and Cooling Channel Length, Runner Length and Runner Diameter, Gate Diameter and Gate Pressure. To calculate the above injection molding parameters a separate module has been created using Visual Basic (VB) Programming to reduce the human errors. The outcome of the module dimensions is the injection molding components such as mold cavity and core design, ejector plate design.
ASTHMATIC HUMAN SERUM IGE-REACTIVITY WITH MOLD EXTRACTS
Although molds have demonstrated the ability to induce allergic asthma-like responses in mouse models, their role in human disease is unclear. This study was undertaken to provide insight into the prevalence of human IgE-reactivity and identify the target mold protein(s). The st...
Failure Analysis in Platelet Molded Composite Systems
NASA Astrophysics Data System (ADS)
Kravchenko, Sergii G.
Long-fiber discontinuous composite systems in the form of chopped prepreg tapes provide an advanced, structural grade, molding compound allowing for fabrication of complex three-dimensional components. Understanding of process-structure-property relationship is essential for application of prerpeg platelet molded components, especially because of their possible irregular disordered heterogeneous morphology. Herein, a structure-property relationship was analyzed in the composite systems of many platelets. Regular and irregular morphologies were considered. Platelet-based systems with more ordered morphology possess superior mechanical performance. While regular morphologies allow for a careful inspection of failure mechanisms derived from the morphological characteristics, irregular morphologies are representative of the composite architectures resulting from uncontrolled deposition and molding with chopped prerpegs. Progressive failure analysis (PFA) was used to study the damaged deformation up to ultimate failure in a platelet-based composite system. Computational damage mechanics approaches were utilized to conduct the PFA. The developed computational models granted understanding of how the composite structure details, meaning the platelet geometry and system morphology (geometrical arrangement and orientation distribution of platelets), define the effective mechanical properties of a platelet-molded composite system, its stiffness, strength and variability in properties.
... U.S. Environmental Protection Agency (EPA) guide titled Mold Remediation in Schools and Commercial Buildings . Also available is ... Resources NIOSH Interim Recommendations for the Cleaning and Remediation of Flood-Contaminated HVAC Systems: A Guide for ...
... National Center for Environmental Health (NCEH) Cleanup and Remediation Recommend on Facebook Tweet Share Compartir On This ... CDC and EPA on mold cleanup, removal and remediation. Cleanup information for you and your family Homeowner’s ...
Precision glass molding of high-resolution diffractive optical elements
NASA Astrophysics Data System (ADS)
Prater, Karin; Dukwen, Julia; Scharf, Toralf; Herzig, Hans P.; Plöger, Sven; Hermerschmidt, Andreas
2016-04-01
The demand of high resolution diffractive optical elements (DOE) is growing. Smaller critical dimensions allow higher deflection angles and can fulfill more demanding requirements, which can only be met by using electron-beam lithography. Replication techniques are more economical, since the high cost of the master can be distributed among a larger number of replicas. The lack of a suitable mold material for precision glass molding has so far prevented an industrial use. Glassy Carbon (GC) offers a high mechanical strength and high thermal strength. No anti-adhesion coatings are required in molding processes. This is clearly an advantage for high resolution, high aspect ratio microstructures, where a coating with a thickness between 10 nm and 200 nm would cause a noticeable rounding of the features. Electron-beam lithography was used to fabricate GC molds with highest precision and feature sizes from 250 nm to 2 μm. The master stamps were used for precision glass molding of a low Tg glass L-BAL42 from OHARA. The profile of the replicated glass is compared to the mold with the help of SEM images. This allows discussion of the max. aspect-ratio and min. feature size. To characterize optical performances, beamsplitting elements are fabricated and their characteristics were investigated, which are in excellent agreement to theory.
Skaar, I; Stenwig, H
1996-01-01
A general medium named malt-yeast extract-sucrose agar (MYSA) containing oxgall was designed. The medium was intended for the enumeration and isolation of molds and yeasts in routine examinations of animal feed stuffs. In this study MYSA was tested as a general medium for mycological examination of silage. The medium was compared with dichloran-rose bengal medium (DRBC) in an examination of more than 500 specimens of big bale grass silage. Selected characteristics of known fungal species commonly isolated from feeds were examined after growth on MYSA and DRBC and on malt extract agar, used as a noninhibitory control medium. MYSA suppressed bacterial growth, without affecting the growth of fungi common in feeds. The fungi growing on MYSA were easily recognized, and the medium seemed to slow radial growth of fungal colonies, which permitted, easy counting. The number of species found was higher on MYSA than on DRBC. When we compared MYSA with DRBC for mycological examination of grass silage samples, MYSA was found to be the medium of choice. PMID:8837416
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aikin, Jr., Robert M.
This work describes the experiments and modeling that have been performed to improve and try to optimize the simultaneous casting of three plates of U-10wt%Mo in a single coil vacuum induction melting (VIM) furnace. The plates of interest are 280 mm wide by 203 mm tall by 5 mm thick (11" x 8" x 0.2"). The initial mold design and processing parameters were supplied by Y-12. The mold and casting cavity were instrumented with a number of thermocouples, and the casting performed to determine the thermal history of the mold and casting. The resulting cast plates were radiographed and numerousmore » defects identified. Metallography was performed to help identify the nature of the radiographically observed defects. This information was then used to validate a mold filling and solidification model of that casting. Based on the initial casting, good casting design practice, and process simulation of several design alternatives, a revised design was developed with the goal of minimizing casting defects such as porosity. The redesigned mold had a larger hot-top and had its long axis along the horizontal direction. These changes were to try to develop a strong thermal gradient conducive to good feeding and minimization of micro- and macroporosity in the cast plates. An instrumented casting was then performed with the revised mold design and a linear distributor. This design yielded cast plates with significantly less radiographically identified defects. Unfortunately, there was significant variation in plate weight and metal content in their hot-tops. Fluid flow simulations were then performed on this mold/distributor design. This helped identify the issue with this linear distributor design. Additional simulations were then performed on candidate distributor redesigns and a preferred distributor annular design was identified. This improved annular design was used to produce a third instrumented casting with favorable results. These refined designs and their radiographic
An Impedance-Based Mold Sensor with on-Chip Optical Reference
Papireddy Vinayaka, Poornachandra; van den Driesche, Sander; Blank, Roland; Tahir, Muhammad Waseem; Frodl, Mathias; Lang, Walter; Vellekoop, Michael J.
2016-01-01
A new miniaturized sensor system with an internal optical reference for the detection of mold growth is presented. The sensor chip comprises a reaction chamber provided with a culture medium that promotes the growth of mold species from mold spores. The mold detection is performed by measuring impedance changes with integrated electrodes fabricated inside the reaction chamber. The impedance change in the culture medium is caused by shifts in the pH (i.e., from 5.5 to 8) as the mold grows. In order to determine the absolute pH value without the need for calibration, a methyl red indicator dye has been added to the culture medium. It changes the color of the medium as the pH passes specific values. This colorimetric principle now acts as a reference measurement. It also allows the sensitivity of the impedance sensor to be established in terms of impedance change per pH unit. Major mold species that are involved in the contamination of food, paper and indoor environments, like Fusarium oxysporum, Fusarium incarnatum, Eurotium amstelodami, Aspergillus penicillioides and Aspergillus restrictus, have been successfully analyzed on-chip. PMID:27690039
Comparison of Yeasts as Hosts for Recombinant Protein Production.
Vieira Gomes, Antonio Milton; Souza Carmo, Talita; Silva Carvalho, Lucas; Mendonça Bahia, Frederico; Parachin, Nádia Skorupa
2018-04-29
Recombinant protein production emerged in the early 1980s with the development of genetic engineering tools, which represented a compelling alternative to protein extraction from natural sources. Over the years, a high level of heterologous protein was made possible in a variety of hosts ranging from the bacteria Escherichia coli to mammalian cells. Recombinant protein importance is represented by its market size, which reached $1654 million in 2016 and is expected to reach $2850.5 million by 2022. Among the available hosts, yeasts have been used for producing a great variety of proteins applied to chemicals, fuels, food, and pharmaceuticals, being one of the most used hosts for recombinant production nowadays. Historically, Saccharomyces cerevisiae was the dominant yeast host for heterologous protein production. Lately, other yeasts such as Komagataella sp., Kluyveromyces lactis , and Yarrowia lipolytica have emerged as advantageous hosts. In this review, a comparative analysis is done listing the advantages and disadvantages of using each host regarding the availability of genetic tools, strategies for cultivation in bioreactors, and the main techniques utilized for protein purification. Finally, examples of each host will be discussed regarding the total amount of protein recovered and its bioactivity due to correct folding and glycosylation patterns.
Addressing environmental health Implications of mold exposure after major flooding.
Metts, Tricia A
2008-03-01
Extensive water damage resulting from major flooding is often associated with mold growth if materials are not quickly and thoroughly dried. Exposure to fungal contamination can lead to several infectious and noninfectious health effects impacting the respiratory system, skin, and eyes. Adverse health effects can be categorized as infections, allergic or hypersensitivity reactions, or toxic-irritant reactions. Workers and building occupants can minimize their exposure to mold by avoiding areas with excessive mold growth, using personal protective equipment, and implementing environmental controls. Occupational health professionals should encourage workers to seek health care if they experience any symptoms that may be linked to mold exposure.
Cross Section of Legislative Approaches to Reducing Indoor Dampness and Mold
Boese, Gerald W.
2017-01-01
Exposure to indoor dampness and mold is associated with numerous adverse respiratory conditions, including asthma. While no quantitative health-based threshold currently exists for mold, the conditions that support excessive dampness and mold are known and preventable; experts agree that controlling these conditions could lead to substantial savings in health care costs and improvement in public health. This article reviews a sample of state and local policies to limit potentially harmful exposures. Adoption of laws to strengthen building codes, specify dampness and mold in habitability laws, regulate mold contractors, and other legislative approaches are discussed, as are key factors supporting successful implementation. Communicating these lessons learned could accelerate the process for other jurisdictions considering similar approaches. Information about effectiveness of legislation as prevention is lacking; thus, evaluation could yield important information to inform the development of model state or local laws that significantly address mold as a public health concern. PMID:27977504
Alvarez-Pérez, Sergio; Herrera, Carlos M; de Vega, Clara
2012-06-01
Floral nectar of some animal-pollinated plants usually harbours highly adapted yeast communities which can profoundly alter nectar characteristics and, therefore, potentially have significant impacts on plant reproduction through their effects on insect foraging behaviour. Bacteria have also been occasionally observed in floral nectar, but their prevalence, phylogenetic diversity and ecological role within plant-pollinator-yeast systems remains unclear. Here we present the first reported survey of bacteria in floral nectar from a natural plant community. Culturable bacteria occurring in a total of 71 nectar samples collected from 27 South African plant species were isolated and identified by 16S rRNA gene sequencing. Rarefaction-based analyses were used to assess operational taxonomic units (OTUs) richness at the plant community level using nectar drops as sampling units. Our results showed that bacteria are common inhabitants of floral nectar of South African plants (53.5% of samples yielded growth), and their communities are characterized by low species richness (18 OTUs at a 16S rRNA gene sequence dissimilarity cut-off of 3%) and moderate phylogenetic diversity, with most isolates belonging to the Gammaproteobacteria. Furthermore, isolates showed osmotolerance, catalase activity and the ability to grow under microaerobiosis, three traits that might help bacteria to overcome important factors limiting their survival and/or growth in nectar. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Modeling and flow analysis of pure nylon polymer for injection molding process
NASA Astrophysics Data System (ADS)
Nuruzzaman, D. M.; Kusaseh, N.; Basri, S.; Oumer, A. N.; Hamedon, Z.
2016-02-01
In the production of complex plastic parts, injection molding is one of the most popular industrial processes. This paper addresses the modeling and analysis of the flow process of the nylon (polyamide) polymer for injection molding process. To determine the best molding conditions, a series of simulations are carried out using Autodesk Moldflow Insight software and the processing parameters are adjusted. This mold filling commercial software simulates the cavity filling pattern along with temperature and pressure distributions in the mold cavity. In the modeling, during the plastics flow inside the mold cavity, different flow parameters such as fill time, pressure, temperature, shear rate and warp at different locations in the cavity are analyzed. Overall, this Moldflow is able to perform a relatively sophisticated analysis of the flow process of pure nylon. Thus the prediction of the filling of a mold cavity is very important and it becomes useful before a nylon plastic part to be manufactured.
Numerical prediction of flow induced fibers orientation in injection molded polymer composites
NASA Astrophysics Data System (ADS)
Oumer, A. N.; Hamidi, N. M.; Mat Sahat, I.
2015-12-01
Since the filling stage of injection molding process has important effect on the determination of the orientation state of the fibers, accurate analysis of the flow field for the mold filling stage becomes a necessity. The aim of the paper is to characterize the flow induced orientation state of short fibers in injection molding cavities. A dog-bone shaped model is considered for the simulation and experiment. The numerical model for determination of the fibers orientation during mold-filling stage of injection molding process was solved using Computational Fluid Dynamics (CFD) software called MoldFlow. Both the simulation and experimental results showed that two different regions (or three layers of orientation structures) across the thickness of the specimen could be found: a shell region which is near to the mold cavity wall, and a core region at the middle of the cross section. The simulation results support the experimental observations that for thin plates the probability of fiber alignment to the flow direction near the mold cavity walls is high but low at the core region. It is apparent that the results of this study could assist in decisions regarding short fiber reinforced polymer composites.
Zhu, Ruiyu; Yu, Ting; Guo, Shuanghuan; Hu, Hao; Zheng, Xiaodong; Karlovsky, Petr
2015-01-01
The effect of a strain of marine yeast Rhodosporidium paludigenum on postharvest blue mold and patulin accumulation in apples and pears stored at 23°C was evaluated. The occurrence and severity of apple and pear decay caused by Penicillium expansum were significantly inhibited by R. paludigenum. However, the application of the yeast at a high concentration (10(8) cells per ml) enhanced patulin accumulation after 7 days of storage; the amount of patulin increased 24.2 times and 12.6 times compared to the controls in infected apples and pears, respectively. However, R. paludigenum reduced the patulin concentration in the growth medium by both biological degradation and physical adsorption. Optimal in vitro patulin reduction was observed at 30°C and at pH 6.0. R. paludigenum incubated at 28°C was tolerant to patulin at concentrations up to 100 mg/liter. In conclusion, R. paludigenum was able to control postharvest decay in apples and pears and to remove patulin in vitro effectively. However, because the yeast induced patulin accumulation in fruit, the assessment of mycotoxin content after biological treatments in postharvest decay control is important. R. paludigenum may also be a promising source of gene(s) and enzyme(s) for patulin degradation and may be a tool to decrease patulin contamination in commercial fruit-derived products.
Code of Federal Regulations, 2011 CFR
2011-07-01
... cure 25 lb/ton.4 NA—this is considered to be a closed molding operation. 25 lb/ton.4 Use the... vented during spinning and cure 20 lb/ton.4 NA—this is considered to be a closed molding operation. 20 lb...
A novel aromatic oil compound inhibits microbial overgrowth on feet: a case study.
Misner, Bill D
2007-07-13
surfaces of feet completely inhibited both aerobic bacteria and yeast-fungi-mold proliferation for 8-hours in spite of being in an enclosed environment compatible to microbial proliferation. Whether topical application of this compound prevents microbial infections in larger populations is not known. This calls for more research collected from subjects exposed to elements that may increase the risk of microbial-induced foot diseases.
A novel aromatic oil compound inhibits microbial overgrowth on feet: a case study
Misner, Bill D
2007-01-01
novel compound to the external surfaces of feet completely inhibited both aerobic bacteria and yeast-fungi-mold proliferation for 8-hours in spite of being in an enclosed environment compatible to microbial proliferation. Whether topical application of this compound prevents microbial infections in larger populations is not known. This calls for more research collected from subjects exposed to elements that may increase the risk of microbial-induced foot diseases. PMID:17908343