Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association.

PubMed

Pulk, Arto; Maiväli, Ulo; Remme, Jaanus

2006-05-01

The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts.

Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association

PubMed Central

Pulk, Arto; Maiväli, Ülo; Remme, Jaanus

2006-01-01

The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts. PMID:16556933

Clinical identification of bacteria in human chronic wound infections: culturing vs. 16S ribosomal DNA sequencing

PubMed Central

2012-01-01

Background Chronic wounds affect millions of people and cost billions of dollars in the United States each year. These wounds harbor polymicrobial biofilm communities, which can be difficult to elucidate using culturing methods. Clinical molecular microbiological methods are increasingly being employed to investigate the microbiota of chronic infections, including wounds, as part of standard patient care. However, molecular testing is more sensitive than culturing, which results in markedly different results being reported to clinicians. This study compares the results of aerobic culturing and molecular testing (culture-free 16S ribosomal DNA sequencing), and it examines the relative abundance score that is generated by the molecular test and the usefulness of the relative abundance score in predicting the likelihood that the same organism would be detected by culture. Methods Parallel samples from 51 chronic wounds were studied using aerobic culturing and 16S DNA sequencing for the identification of bacteria. Results One hundred forty-five (145) unique genera were identified using molecular methods, and 68 of these genera were aerotolerant. Fourteen (14) unique genera were identified using aerobic culture methods. One-third (31/92) of the cultures were determined to be < 1% of the relative abundance of the wound microbiota using molecular testing. At the genus level, molecular testing identified 85% (78/92) of the bacteria that were identified by culture. Conversely, culturing detected 15.7% (78/497) of the aerotolerant bacteria and detected 54.9% of the collective aerotolerant relative abundance of the samples. Aerotolerant bacterial genera (and individual species including Staphylococcus aureus, Pseudomonas aeruginosa, and Enterococcus faecalis) with higher relative abundance scores were more likely to be detected by culture as demonstrated with regression modeling. Conclusion Discordance between molecular and culture testing is often observed. However

[Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence

NASA Technical Reports Server (NTRS)

Ortega, Maya

2010-01-01

My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

Bacteriological incidence in pneumonia patients with pulmonary emphysema: a bacterial floral analysis using the 16S ribosomal RNA gene in bronchoalveolar lavage fluid.

PubMed

Naito, Keisuke; Yamasaki, Kei; Yatera, Kazuhiro; Akata, Kentaro; Noguchi, Shingo; Kawanami, Toshinori; Fukuda, Kazumasa; Kido, Takashi; Ishimoto, Hiroshi; Mukae, Hiroshi

2017-01-01

Pulmonary emphysema is an important radiological finding in chronic obstructive pulmonary disease patients, but bacteriological differences in pneumonia patients according to the severity of emphysematous changes have not been reported. Therefore, we evaluated the bacteriological incidence in the bronchoalveolar lavage fluid (BALF) of pneumonia patients using cultivation and a culture-independent molecular method. Japanese patients with community-acquired pneumonia (83) and healthcare-associated pneumonia (94) between April 2010 and February 2014 were evaluated. The BALF obtained from pneumonia lesions was evaluated by both cultivation and a molecular method. In the molecular method, ~600 base pairs of bacterial 16S ribosomal RNA genes in the BALF were amplified by polymerase chain reaction, and clone libraries were constructed. The nucleotide sequences of 96 randomly selected colonies were determined, and a homology search was performed to identify the bacterial species. A qualitative radiological evaluation of pulmonary emphysema based on chest computed tomography (CT) images was performed using the Goddard classification. The severity of pulmonary emphysema based on the Goddard classification was none in 47.4% (84/177), mild in 36.2% (64/177), moderate in 10.2% (18/177), and severe in 6.2% (11/177). Using the culture-independent molecular method, Moraxella catarrhalis was significantly more frequently detected in moderate or severe emphysema patients than in patients with no or mild emphysematous changes. The detection rates of Haemophilus influenzae and Pseudomonas aeruginosa were unrelated to the severity of pulmonary emphysematous changes, and Streptococcus species - except for the S. anginosus group and S. pneumoniae - were detected more frequently using the molecular method we used for the BALF of patients with pneumonia than using culture methods. Our findings suggest that M. catarrhalis is more frequently detected in pneumonia patients with moderate or

Bacteriological incidence in pneumonia patients with pulmonary emphysema: a bacterial floral analysis using the 16S ribosomal RNA gene in bronchoalveolar lavage fluid

PubMed Central

Naito, Keisuke; Yamasaki, Kei; Yatera, Kazuhiro; Akata, Kentaro; Noguchi, Shingo; Kawanami, Toshinori; Fukuda, Kazumasa; Kido, Takashi; Ishimoto, Hiroshi; Mukae, Hiroshi

2017-01-01

Pulmonary emphysema is an important radiological finding in chronic obstructive pulmonary disease patients, but bacteriological differences in pneumonia patients according to the severity of emphysematous changes have not been reported. Therefore, we evaluated the bacteriological incidence in the bronchoalveolar lavage fluid (BALF) of pneumonia patients using cultivation and a culture-independent molecular method. Japanese patients with community-acquired pneumonia (83) and healthcare-associated pneumonia (94) between April 2010 and February 2014 were evaluated. The BALF obtained from pneumonia lesions was evaluated by both cultivation and a molecular method. In the molecular method, ~600 base pairs of bacterial 16S ribosomal RNA genes in the BALF were amplified by polymerase chain reaction, and clone libraries were constructed. The nucleotide sequences of 96 randomly selected colonies were determined, and a homology search was performed to identify the bacterial species. A qualitative radiological evaluation of pulmonary emphysema based on chest computed tomography (CT) images was performed using the Goddard classification. The severity of pulmonary emphysema based on the Goddard classification was none in 47.4% (84/177), mild in 36.2% (64/177), moderate in 10.2% (18/177), and severe in 6.2% (11/177). Using the culture-independent molecular method, Moraxella catarrhalis was significantly more frequently detected in moderate or severe emphysema patients than in patients with no or mild emphysematous changes. The detection rates of Haemophilus influenzae and Pseudomonas aeruginosa were unrelated to the severity of pulmonary emphysematous changes, and Streptococcus species – except for the S. anginosus group and S. pneumoniae – were detected more frequently using the molecular method we used for the BALF of patients with pneumonia than using culture methods. Our findings suggest that M. catarrhalis is more frequently detected in pneumonia patients with moderate

The plastid ribosomal proteins. Identification of all the proteins in the 30 S subunit of an organelle ribosome (chloroplast).

PubMed

Yamaguchi, K; von Knoblauch, K; Subramanian, A R

2000-09-15

Identification of all the protein components of a plastid (chloroplast) ribosomal 30 S subunit has been achieved, using two-dimensional gel electropholesis, high performance liquid chromatography purification, N-terminal sequencing, polymerase chain reaction-based screening of cDNA library, nucleotide sequencing, and mass spectrometry (electrospray ionization, matrix-assisted laser desorption/ionization time-of-flight, and reversed-phase HPLC coupled with electrospray ionization mass spectrometry). 25 proteins were identified, of which 21 are orthologues of all Escherichia coli 30 S ribosomal proteins (S1-S21), and 4 are plastid-specific ribosomal proteins (PSRPs) that have no homologues in the mitochondrial, archaebacterial, or cytosolic ribosomal protein sequences in data bases. 12 of the 25 plastid 30 S ribosomal proteins (PRPs) are encoded in the plastid genome, whereas the remaining 13 are encoded by the nuclear genome. Post-translational transit peptide cleavage sites for the maturation of the 13 cytosolically synthesized PRPs, and post-translational N-terminal processing in the maturation of the 12 plastid synthesized PRPs are described. Post-translational modifications in several PRPs were observed: alpha-N-acetylation of S9, N-terminal processings leading to five mature forms of S6 and two mature forms of S10, C-terminal and/or internal modifications in S1, S14, S18, and S19, leading to two distinct forms differing in mass and/or charge (the corresponding modifications are not observed in E. coli). The four PSRPs in spinach plastid 30 S ribosomal subunit (PSRP-1, 26.8 kDa, pI 6.2; PSRP-2, 21.7 kDa, pI 5.0; PSRP-3, 13.8 kDa, pI 4.9; PSRP-4, 5.2 kDa, pI 11.8) comprise 16% (67.6 kDa) of the total protein mass of the 30 S subunit (429.3 kDa). PSRP-1 and PSRP-3 show sequence similarities with hypothetical photosynthetic bacterial proteins, indicating their possible origins in photosynthetic bacteria. We propose the hypothesis that PSRPs form a "plastid

Structures of the orthosomycin antibiotics avilamycin and evernimicin in complex with the bacterial 70S ribosome

PubMed Central

Arenz, Stefan; Graf, Michael; Nguyen, Fabian; Huter, Paul; Polikanov, Yury S.; Blanchard, Scott C.; Wilson, Daniel N.

2016-01-01

The ribosome is one of the major targets for therapeutic antibiotics; however, the rise in multidrug resistance is a growing threat to the utility of our current arsenal. The orthosomycin antibiotics evernimicin (EVN) and avilamycin (AVI) target the ribosome and do not display cross-resistance with any other classes of antibiotics, suggesting that they bind to a unique site on the ribosome and may therefore represent an avenue for development of new antimicrobial agents. Here we present cryo-EM structures of EVN and AVI in complex with the Escherichia coli ribosome at 3.6- to 3.9-Å resolution. The structures reveal that EVN and AVI bind to a single site on the large subunit that is distinct from other known antibiotic binding sites on the ribosome. Both antibiotics adopt an extended conformation spanning the minor grooves of helices 89 and 91 of the 23S rRNA and interacting with arginine residues of ribosomal protein L16. This binding site overlaps with the elbow region of A-site bound tRNA. Consistent with this finding, single-molecule FRET (smFRET) experiments show that both antibiotics interfere with late steps in the accommodation process, wherein aminoacyl-tRNA enters the peptidyltransferase center of the large ribosomal subunit. These data provide a structural and mechanistic rationale for how these antibiotics inhibit the elongation phase of protein synthesis. PMID:27330110

Identification of causative pathogens in mouse eyes with bacterial keratitis by sequence analysis of 16S rDNA libraries

PubMed Central

Song, Hong-Yan; Qiu, Bao-Feng; Liu, Chun; Zhu, Shun-Xing; Wang, Sheng-Cun; Miao, Jin; Jing, Jing; Shao, Yi-Xiang

2014-01-01

The clone library method using PCR amplification of the 16S ribosomal RNA (rRNA) gene was used to identify pathogens from corneal scrapings of C57BL/6-corneal opacity (B6-Co) mice with bacterial keratitis. All 10 samples from the eyes with bacterial keratitis showed positive PCR results. All 10 samples from the normal cornea showed negative PCR results. In all 10 PCR-positive samples, the predominant and second most predominant species accounted for 20.9 to 40.6% and 14.7 to 26.1%, respectively, of each clone library. The predominant species were Staphylococcus lentus, Pseudomonas aeruginosa, and Staphylococcus epidermidis. The microbiota analysis detected a diverse group of microbiota in the eyes of B6-Co mice with bacterial keratitis and showed that the causative pathogens could be determined based on percentages of bacterial species in the clone libraries. The bacterial species detected in this study were mostly in accordance with results of studies on clinical bacterial keratitis in human eyes. Based on the results of our previous studies and this study, the B6-Co mouse should be considered a favorable model for studying bacterial keratitis. PMID:25312507

Complete kinetic mechanism for recycling of the bacterial ribosome

PubMed Central

Borg, Anneli; Pavlov, Michael

2016-01-01

How EF-G and RRF act together to split a post-termination ribosomal complex into its subunits has remained obscure. Here, using stopped-flow experiments with Rayleigh light scattering detection and quench-flow experiments with radio-detection of GTP hydrolysis, we have clarified the kinetic mechanism of ribosome recycling and obtained precise estimates of its kinetic parameters. Ribosome splitting requires that EF-G binds to an already RRF-containing ribosome. EF-G binding to RRF-free ribosomes induces futile rounds of GTP hydrolysis and inhibits ribosome splitting, implying that while RRF is purely an activator of recycling, EF-G acts as both activator and competitive inhibitor of RRF in recycling of the post-termination ribosome. The ribosome splitting rate and the number of GTPs consumed per splitting event depend strongly on the free concentrations of EF-G and RRF. The maximal recycling rate, here estimated as 25 sec−1, is approached at very high concentrations of EF-G and RRF with RRF in high excess over EF-G. The present in vitro results, suggesting an in vivo ribosome recycling rate of ∼5 sec−1, are discussed in the perspective of rapidly growing bacterial cells. PMID:26527791

RISSC: a novel database for ribosomal 16S–23S RNA genes spacer regions

PubMed Central

García-Martínez, Jesús; Bescós, Ignacio; Rodríguez-Sala, Jesús Javier; Rodríguez-Valera, Francisco

2001-01-01

A novel database, under the acronym RISSC (Ribosomal Intergenic Spacer Sequence Collection), has been created. It compiles more than 1600 entries of edited DNA sequence data from the 16S–23S ribosomal spacers present in most prokaryotes and organelles (e.g. mitochondria and chloroplasts) and is accessible through the Internet (http://ulises.umh.es/RISSC), where systematic searches for specific words can be conducted, as well as BLAST-type sequence searches. Additionally, a characteristic feature of this region, the presence/absence and nature of tRNA genes within the spacer, is included in all the entries, even when not previously indicated in the original database. All these combined features could provide a useful documen­tation tool for studies on evolution, identification, typing and strain characterization, among others. PMID:11125084

Bacterial Community Composition of South China Sea Sediments through Pyrosequencing-Based Analysis of 16S rRNA Genes

PubMed Central

Zhu, Daochen; Tanabe, Shoko-Hosoi; Yang, Chong; Zhang, Weimin; Sun, Jianzhong

2013-01-01

Background Subseafloor sediments accumulate large amounts of organic and inorganic materials that contain a highly diverse microbial ecosystem. The aim of this study was to survey the bacterial community of subseafloor sediments from the South China Sea. Methodology/Principal Findings Pyrosequencing of over 265,000 amplicons of the V3 hypervariable region of the 16S ribosomal RNA gene was performed on 16 sediment samples collected from multiple locations in the northern region of the South China Sea from depths ranging from 35 to 4000 m. A total of 9,726 operational taxonomic units (OTUs; between 695 and 2819 unique OTUs per sample) at 97% sequence similarity level were generated. In total, 40 bacterial phyla including 22 formally described phyla and 18 candidate phyla, with Proteobacteria, Firmicutes, Planctomycetes, Actinobacteria and Chloroflexi being most diverse, were identified. The most abundant phylotype, accounting for 42.6% of all sequences, belonged to Gammaproteobacteria, which possessed absolute predominance in the samples analyzed. Among the 18 candidate phyla, 12 were found for the first time in the South China Sea. Conclusions This study provided a novel insight into the composition of bacterial communities of the South China Sea subseafloor. Furthermore, abundances and community similarity analysis showed that the compositions of the bacterial communities are very similar at phylum level at different depths from 35-4000 m. PMID:24205246

Bacterial community composition of South China Sea sediments through pyrosequencing-based analysis of 16S rRNA genes.

PubMed

Zhu, Daochen; Tanabe, Shoko-Hosoi; Yang, Chong; Zhang, Weimin; Sun, Jianzhong

2013-01-01

Subseafloor sediments accumulate large amounts of organic and inorganic materials that contain a highly diverse microbial ecosystem. The aim of this study was to survey the bacterial community of subseafloor sediments from the South China Sea. Pyrosequencing of over 265,000 amplicons of the V3 hypervariable region of the 16S ribosomal RNA gene was performed on 16 sediment samples collected from multiple locations in the northern region of the South China Sea from depths ranging from 35 to 4000 m. A total of 9,726 operational taxonomic units (OTUs; between 695 and 2819 unique OTUs per sample) at 97% sequence similarity level were generated. In total, 40 bacterial phyla including 22 formally described phyla and 18 candidate phyla, with Proteobacteria, Firmicutes, Planctomycetes, Actinobacteria and Chloroflexi being most diverse, were identified. The most abundant phylotype, accounting for 42.6% of all sequences, belonged to Gammaproteobacteria, which possessed absolute predominance in the samples analyzed. Among the 18 candidate phyla, 12 were found for the first time in the South China Sea. This study provided a novel insight into the composition of bacterial communities of the South China Sea subseafloor. Furthermore, abundances and community similarity analysis showed that the compositions of the bacterial communities are very similar at phylum level at different depths from 35-4000 m.

Quantitation of ten 30S ribosomal assembly intermediates using fluorescence triple correlation spectroscopy

PubMed Central

Ridgeway, William K.; Millar, David P.; Williamson, James R.

2012-01-01

The self-assembly of bacterial 30S ribosomes involves a large number of RNA folding and RNA-protein binding steps. The sequence of steps determines the overall assembly mechanism and the structure of the mechanism has ramifications for the robustness of biogenesis and resilience against kinetic traps. Thermodynamic interdependencies of protein binding inferred from omission-reconstitution experiments are thought to preclude certain assembly pathways and thus enforce ordered assembly, but this concept is at odds with kinetic data suggesting a more parallel assembly landscape. A major challenge is deconvolution of the statistical distribution of intermediates that are populated during assembly at high concentrations approaching in vivo assembly conditions. To specifically resolve the intermediates formed by binding of three ribosomal proteins to the full length 16S rRNA, we introduce Fluorescence Triple-Correlation Spectroscopy (F3CS). F3CS identifies specific ternary complexes by detecting coincident fluctuations in three-color fluorescence data. Triple correlation integrals quantify concentrations and diffusion kinetics of triply labeled species, and F3CS data can be fit alongside auto-correlation and cross-correlation data to quantify the populations of 10 specific ribosome assembly intermediates. The distribution of intermediates generated by binding three ribosomal proteins to the entire native 16S rRNA included significant populations of species that were not previously thought to be thermodynamically accessible, questioning the current interpretation of the classic omission-reconstitution experiments. F3CS is a general approach for analyzing assembly and function of macromolecular complexes, especially those too large for traditional biophysical methods. PMID:22869699

Chromosomal 16S Ribosomal RNA Methyltransferase RmtE1 in Escherichia coli Sequence Type 448

PubMed Central

Li, Bin; Pacey, Marissa P.

2017-01-01

We identified rmtE1, an uncommon 16S ribosomal methyltransferase gene, in an aminoglycoside- and cephalosporin-resistant Escherichia coli sequence type 448 clinical strain co-harboring blaCMY-2. Long-read sequencing revealed insertion of a 101,257-bp fragment carrying both resistance genes to the chromosome. Our findings underscore E. coli sequence type 448 as a potential high-risk multidrug-resistant clone. PMID:28418308

Impact of training sets on classification of high-throughput bacterial 16s rRNA gene surveys

PubMed Central

Werner, Jeffrey J; Koren, Omry; Hugenholtz, Philip; DeSantis, Todd Z; Walters, William A; Caporaso, J Gregory; Angenent, Largus T; Knight, Rob; Ley, Ruth E

2012-01-01

Taxonomic classification of the thousands–millions of 16S rRNA gene sequences generated in microbiome studies is often achieved using a naïve Bayesian classifier (for example, the Ribosomal Database Project II (RDP) classifier), due to favorable trade-offs among automation, speed and accuracy. The resulting classification depends on the reference sequences and taxonomic hierarchy used to train the model; although the influence of primer sets and classification algorithms have been explored in detail, the influence of training set has not been characterized. We compared classification results obtained using three different publicly available databases as training sets, applied to five different bacterial 16S rRNA gene pyrosequencing data sets generated (from human body, mouse gut, python gut, soil and anaerobic digester samples). We observed numerous advantages to using the largest, most diverse training set available, that we constructed from the Greengenes (GG) bacterial/archaeal 16S rRNA gene sequence database and the latest GG taxonomy. Phylogenetic clusters of previously unclassified experimental sequences were identified with notable improvements (for example, 50% reduction in reads unclassified at the phylum level in mouse gut, soil and anaerobic digester samples), especially for phylotypes belonging to specific phyla (Tenericutes, Chloroflexi, Synergistetes and Candidate phyla TM6, TM7). Trimming the reference sequences to the primer region resulted in systematic improvements in classification depth, and greatest gains at higher confidence thresholds. Phylotypes unclassified at the genus level represented a greater proportion of the total community variation than classified operational taxonomic units in mouse gut and anaerobic digester samples, underscoring the need for greater diversity in existing reference databases. PMID:21716311

Estimates of Soil Bacterial Ribosome Content and Diversity Are Significantly Affected by the Nucleic Acid Extraction Method Employed

PubMed Central

Wüst, Pia K.; Nacke, Heiko; Kaiser, Kristin; Marhan, Sven; Sikorski, Johannes; Kandeler, Ellen; Daniel, Rolf

2016-01-01

Modern sequencing technologies allow high-resolution analyses of total and potentially active soil microbial communities based on their DNA and RNA, respectively. In the present study, quantitative PCR and 454 pyrosequencing were used to evaluate the effects of different extraction methods on the abundance and diversity of 16S rRNA genes and transcripts recovered from three different types of soils (leptosol, stagnosol, and gleysol). The quality and yield of nucleic acids varied considerably with respect to both the applied extraction method and the analyzed type of soil. The bacterial ribosome content (calculated as the ratio of 16S rRNA transcripts to 16S rRNA genes) can serve as an indicator of the potential activity of bacterial cells and differed by 2 orders of magnitude between nucleic acid extracts obtained by the various extraction methods. Depending on the extraction method, the relative abundances of dominant soil taxa, in particular Actinobacteria and Proteobacteria, varied by a factor of up to 10. Through this systematic approach, the present study allows guidelines to be deduced for the selection of the appropriate extraction protocol according to the specific soil properties, the nucleic acid of interest, and the target organisms. PMID:26896137

Ribosomal RNA and ribosomal proteins in corynebacteria.

PubMed

Martín, Juan F; Barreiro, Carlos; González-Lavado, Eva; Barriuso, Mónica

2003-09-04

Ribosomal RNAs (rRNAs) (16S, 23S, 5S) encoded by the rrn operons and ribosomal proteins play a very important role in the formation of ribosomes and in the control of translation. Five copies of the rrn operon were reported by hybridization studies in Brevibacterium (Corynebacterium) lactofermentum but the genome sequence of Corynebacterium glutamicum provided evidence for six rrn copies. All six copies of the C. glutamicum 16S rRNA have a size of 1523 bp and each of the six copies of the 5S contain 120 bp whereas size differences are found between the six copies of the 23S rRNA. The anti-Shine-Dalgarno sequence at the 3'-end of the 16S rRNA was 5'-CCUCCUUUC-3'. Each rrn operon is transcribed as a large precursor rRNA (pre-rRNA) that is processed by RNaseIII and other RNases at specific cleavage boxes that have been identified in the C. glutamicum pre-rRNA. A secondary structure of the C. glutamicum 16S rRNA is proposed. The 16S rRNA sequence has been used as a molecular evolution clock allowing the deduction of a phylogenetic tree of all Corynebacterium species. In C. glutamicum, there are 11 ribosomal protein gene clusters encoding 42 ribosomal proteins. The organization of some of the ribosomal protein gene cluster is identical to that of Escherichia coli whereas in other clusters the organization of the genes is rather different. Some specific ribosomal protein genes are located in a different cluster in C. glutamicum when compared with E. coli, indicating that the control of expression of these genes is different in E. coli and C. glutamicum.

Short communication: Evaluation of the microbiota of kefir samples using metagenetic analysis targeting the 16S and 26S ribosomal DNA fragments.

PubMed

Korsak, N; Taminiau, B; Leclercq, M; Nezer, C; Crevecoeur, S; Ferauche, C; Detry, E; Delcenserie, V; Daube, G

2015-06-01

Milk kefir is produced by fermenting milk in the presence of kefir grains. This beverage has several benefits for human health. The aim of this experiment was to analyze 5 kefir grains (and their products) using a targeted metagenetic approach. Of the 5 kefir grains analyzed, 1 was purchased in a supermarket, 2 were provided by the Ministry of Agriculture (Namur, Belgium), and 2 were provided by individuals. The metagenetic approach targeted the V1-V3 fragment of the 16S ribosomal (r)DNA for the grains and the resulting beverages at 2 levels of grain incorporation (5 and 10%) to identify the bacterial species population. In contrast, the 26S rDNA pyrosequencing was performed only on kefir grains with the aim of assessing the yeast populations. In parallel, pH measurements were performed on the kefir obtained from the kefir grains using 2 incorporation rates. Regarding the bacterial population, 16S pyrosequencing revealed the presence of 20 main bacterial species, with a dominance of the following: Lactobacillus kefiranofaciens, Lactococcus lactis ssp. cremoris, Gluconobacter frateurii, Lactobacillus kefiri, Acetobacter orientalis, and Acetobacter lovaniensis. An important difference was noticed between the kefir samples: kefir grain purchased from a supermarket (sample E) harbored a much higher proportion of several operational taxonomic units of Lactococcus lactis and Leuconostoc mesenteroides. This sample of grain was macroscopically different from the others in terms of size, apparent cohesion of the grains, structure, and texture, probably associated with a lower level of Lactobacillus kefiranofaciens. The kefir (at an incorporation rate of 5%) produced from this sample of grain was characterized by a lower pH value (4.5) than the others. The other 4 samples of kefir (5%) had pH values above 5. Comparing the kefir grain and the kefir, an increase in the population of Gluconobacter in grain sample B was observed. This was also the case for Acetobacter orientalis

Escherichia coli Ribosomal Protein S1 Unfolds Structured mRNAs Onto the Ribosome for Active Translation Initiation

PubMed Central

Duval, Mélodie; Korepanov, Alexey; Fuchsbauer, Olivier; Fechter, Pierre; Haller, Andrea; Fabbretti, Attilio; Choulier, Laurence; Micura, Ronald; Klaholz, Bruno P.; Romby, Pascale; Springer, Mathias; Marzi, Stefano

2013-01-01

Regulation of translation initiation is well appropriate to adapt cell growth in response to stress and environmental changes. Many bacterial mRNAs adopt structures in their 5′ untranslated regions that modulate the accessibility of the 30S ribosomal subunit. Structured mRNAs interact with the 30S in a two-step process where the docking of a folded mRNA precedes an accommodation step. Here, we used a combination of experimental approaches in vitro (kinetic of mRNA unfolding and binding experiments to analyze mRNA–protein or mRNA–ribosome complexes, toeprinting assays to follow the formation of ribosomal initiation complexes) and in vivo (genetic) to monitor the action of ribosomal protein S1 on the initiation of structured and regulated mRNAs. We demonstrate that r-protein S1 endows the 30S with an RNA chaperone activity that is essential for the docking and the unfolding of structured mRNAs, and for the correct positioning of the initiation codon inside the decoding channel. The first three OB-fold domains of S1 retain all its activities (mRNA and 30S binding, RNA melting activity) on the 30S subunit. S1 is not required for all mRNAs and acts differently on mRNAs according to the signals present at their 5′ ends. This work shows that S1 confers to the ribosome dynamic properties to initiate translation of a large set of mRNAs with diverse structural features. PMID:24339747

16S Ribosomal DNA Characterization of Nitrogen-Fixing Bacteria Isolated from Banana (Musa spp.) and Pineapple (Ananas comosus (L.) Merril)

PubMed Central

Magalhães Cruz, Leonardo; Maltempi de Souza, Emanuel; Weber, Olmar Baler; Baldani, José Ivo; Döbereiner, Johanna; de Oliveira Pedrosa, Fábio

2001-01-01

Nitrogen-fixing bacteria isolated from banana (Musa spp.) and pineapple (Ananas comosus (L.) Merril) were characterized by amplified 16S ribosomal DNA restriction analysis and 16S rRNA sequence analysis. Herbaspirillum seropedicae, Herbaspirillum rubrisubalbicans, Burkholderia brasilensis, and Burkholderia tropicalis were identified. Eight other types were placed in close proximity to these genera and other alpha and beta Proteobacteria. PMID:11319127

16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

PubMed

Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

1990-01-01

16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing.

PubMed

Naveed, Muhammad; Mubeen, Samavia; Khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad

2014-01-01

In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

PubMed Central

Naveed, Muhammad; Mubeen, Samavia; khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad

2014-01-01

In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization. PMID:25477935

Mapping of ribosomal 23S ribosomal RNA modifications in Clostridium sporogenes.

PubMed

Kirpekar, Finn; Hansen, Lykke H; Mundus, Julie; Tryggedsson, Stine; Teixeira Dos Santos, Patrícia; Ntokou, Eleni; Vester, Birte

2018-06-27

All organisms contain RNA modifications in their ribosomal RNA (rRNA), but the importance, positions and exact function of these are still not fully elucidated. Various functions such as stabilising structures, controlling ribosome assembly and facilitating interactions have been suggested and in some cases substantiated. Bacterial rRNA contains much fewer modifications than eukaryotic rRNA. The rRNA modification patterns in bacteria differ from each other, but too few organisms have been mapped to draw general conclusions. This study maps 23S ribosomal RNA modifications in Clostridium sporogenes that can be characterised as a non-toxin producing Clostridium botulinum. Clostridia are able to sporulate and thereby survive harsh conditions, and are in general considered to be resilient to antibiotics. Selected regions of the 23S rRNA were investigated by mass spectrometry and by primer extension analysis to pinpoint modified sites and the nature of the modifications. Apparently, C. sporogenes 23S rRNA contains few modifications compared to other investigated bacteria. No modifications were identified in domain II and III of 23S rRNA. Three modifications were identified in domain IV, all of which have also been found in other organisms. Two unusual modifications were identified in domain V, methylated dihydrouridine at position U2449 and dihydrouridine at position U2500 (Escherichia coli numbering), in addition to four previously known modified positions. The enzymes responsible for the modifications were searched for in the C. sporogenes genome using BLAST with characterised enzymes as query. The search identified genes potentially coding for RNA modifying enzymes responsible for most of the found modifications.

Predicting the dynamics of bacterial growth inhibition by ribosome-targeting antibiotics

NASA Astrophysics Data System (ADS)

Greulich, Philip; Doležal, Jakub; Scott, Matthew; Evans, Martin R.; Allen, Rosalind J.

2017-12-01

Understanding how antibiotics inhibit bacteria can help to reduce antibiotic use and hence avoid antimicrobial resistance—yet few theoretical models exist for bacterial growth inhibition by a clinically relevant antibiotic treatment regimen. In particular, in the clinic, antibiotic treatment is time-dependent. Here, we use a theoretical model, previously applied to steady-state bacterial growth, to predict the dynamical response of a bacterial cell to a time-dependent dose of ribosome-targeting antibiotic. Our results depend strongly on whether the antibiotic shows reversible transport and/or low-affinity ribosome binding (‘low-affinity antibiotic’) or, in contrast, irreversible transport and/or high affinity ribosome binding (‘high-affinity antibiotic’). For low-affinity antibiotics, our model predicts that growth inhibition depends on the duration of the antibiotic pulse, and can show a transient period of very fast growth following removal of the antibiotic. For high-affinity antibiotics, growth inhibition depends on peak dosage rather than dose duration, and the model predicts a pronounced post-antibiotic effect, due to hysteresis, in which growth can be suppressed for long times after the antibiotic dose has ended. These predictions are experimentally testable and may be of clinical significance.

Predicting the dynamics of bacterial growth inhibition by ribosome-targeting antibiotics

PubMed Central

Greulich, Philip; Doležal, Jakub; Scott, Matthew; Evans, Martin R; Allen, Rosalind J

2017-01-01

Understanding how antibiotics inhibit bacteria can help to reduce antibiotic use and hence avoid antimicrobial resistance—yet few theoretical models exist for bacterial growth inhibition by a clinically relevant antibiotic treatment regimen. In particular, in the clinic, antibiotic treatment is time-dependent. Here, we use a theoretical model, previously applied to steady-state bacterial growth, to predict the dynamical response of a bacterial cell to a time-dependent dose of ribosome-targeting antibiotic. Our results depend strongly on whether the antibiotic shows reversible transport and/or low-affinity ribosome binding (‘low-affinity antibiotic’) or, in contrast, irreversible transport and/or high affinity ribosome binding (‘high-affinity antibiotic’). For low-affinity antibiotics, our model predicts that growth inhibition depends on the duration of the antibiotic pulse, and can show a transient period of very fast growth following removal of the antibiotic. For high-affinity antibiotics, growth inhibition depends on peak dosage rather than dose duration, and the model predicts a pronounced post-antibiotic effect, due to hysteresis, in which growth can be suppressed for long times after the antibiotic dose has ended. These predictions are experimentally testable and may be of clinical significance. PMID:28714461

Amicoumacin A inhibits translation by stabilizing mRNA interaction with the ribosome

PubMed Central

Polikanov, Yury S.; Osterman, Ilya A.; Szal, Teresa; Tashlitsky, Vadim N.; Serebryakova, Marina V.; Kusochek, Pavel; Bulkley, David; Malanicheva, Irina A.; Efimenko, Tatyana A.; Efremenkova, Olga V.; Konevega, Andrey L.; Shaw, Karen J.; Bogdanov, Alexey A.; Rodnina, Marina V.; Dontsova, Olga A.; Mankin, Alexander S.; Steitz, Thomas A.; Sergiev, Petr V.

2014-01-01

SUMMARY We demonstrate that the antibiotic amicoumacin A (AMI) whose cellular target was unknown, is a potent inhibitor of protein synthesis. Resistance mutations in helix 24 of the 16S rRNA mapped the AMI binding site to the small ribosomal subunit. The crystal structure of bacterial ribosome in complex with AMI solved at 2.4 Å resolution revealed that the antibiotic makes contacts with universally conserved nucleotides of 16S rRNA in the E site and the mRNA backbone. Simultaneous interactions of AMI with 16S rRNA and mRNA and the in vivo experimental evidence suggest that it may inhibit the progression of the ribosome along mRNA. Consistent with this proposal, binding of AMI interferes with translocation in vitro. The inhibitory action of AMI can be partly compensated by mutations in the translation elongation factor G. PMID:25306919

Nucleotides in 16S rRNA that are required in unmodified form for features recognized by ribosomal protein S8.

PubMed Central

Thurlow, D L; Ehresmann, C; Ehresmann, B

1983-01-01

Nucleotides in 16S rRNA which are required in unmodified form for specific recognition of ribosomal protein S8 from Escherichia coli were identified using a damage-selection experimental approach. Prior to complex formation with S8, 16S rRNA was treated under fully denaturing conditions with either diethyl pyrocarbonate or 25% hydrazine. Following separation of bound from unbound fragments of RNA, those associated with S8 were analyzed for their content of modified bases by treatment with aniline. Nucleotides found to be consistently unmodified in such fragments were located near the base of a stable helix (encompassing bases 581-656) or near the apex of the helix on the 3' proximal side. A minor S8 ribonucleoprotein particle was found to contain fragments which extended in the 3' direction to position 671. Images PMID:6356037

Diagnostics of Neisseriaceae and Moraxellaceae by Ribosomal DNA Sequencing: Ribosomal Differentiation of Medical Microorganisms

PubMed Central

Harmsen, Dag; Singer, Christian; Rothgänger, Jörg; Tønjum, Tone; Sybren de Hoog, Gerrit; Shah, Haroun; Albert, Jürgen; Frosch, Matthias

2001-01-01

Fast and reliable identification of microbial isolates is a fundamental goal of clinical microbiology. However, in the case of some fastidious gram-negative bacterial species, classical phenotype identification based on either metabolic, enzymatic, or serological methods is difficult, time-consuming, and/or inadequate. 16S or 23S ribosomal DNA (rDNA) bacterial sequencing will most often result in accurate speciation of isolates. Therefore, the objective of this study was to find a hypervariable rDNA stretch, flanked by strongly conserved regions, which is suitable for molecular species identification of members of the Neisseriaceae and Moraxellaceae. The inter- and intrageneric relationships were investigated using comparative sequence analysis of PCR-amplified partial 16S and 23S rDNAs from a total of 94 strains. When compared to the type species of the genera Acinetobacter, Moraxella, and Neisseria, an average of 30 polymorphic positions was observed within the partial 16S rDNA investigated (corresponding to Escherichia coli positions 54 to 510) for each species and an average of 11 polymorphic positions was observed within the 202 nucleotides of the 23S rDNA gene (positions 1400 to 1600). Neisseria macacae and Neisseria mucosa subsp. mucosa (ATCC 19696) had identical 16S and 23S rDNA sequences. Species clusters were heterogeneous in both genes in the case of Acinetobacter lwoffii, Moraxella lacunata, and N. mucosa. Neisseria meningitidis isolates failed to cluster only in the 23S rDNA subset. Our data showed that the 16S rDNA region is more suitable than the partial 23S rDNA for the molecular diagnosis of Neisseriaceae and Moraxellaceae and that a reference database should include more than one strain of each species. All sequence chromatograms and taxonomic and disease-related information are available as part of our ribosomal differentiation of medical microorganisms (RIDOM) web-based service (http://www.ridom.hygiene.uni-wuerzburg.de/). Users can submit a

Ribosomal protein L14 contributes to the early assembly of 60S ribosomal subunits in Saccharomyces cerevisiae.

PubMed

Espinar-Marchena, Francisco; Rodríguez-Galán, Olga; Fernández-Fernández, José; Linnemann, Jan; de la Cruz, Jesús

2018-05-18

The contribution of most ribosomal proteins to ribosome synthesis has been quite well analysed in Saccharomyces cerevisiae. However, few yeast ribosomal proteins still await characterization. Herein, we show that L14, an essential 60S ribosomal protein, assembles in the nucleolus at an early stage into pre-60S particles. Depletion of L14 results in a deficit in 60S subunits and defective processing of 27SA2 and 27SA3 to 27SB pre-rRNAs. As a result, 27S pre-rRNAs are subjected to turnover and export of pre-60S particles is blocked. These phenotypes likely appear as the direct consequence of the reduced pre-60S particle association not only of L14 upon its depletion but also of a set of neighboring ribosomal proteins located at the solvent interface of 60S subunits and the adjacent region surrounding the polypeptide exit tunnel. These pre-60S intermediates also lack some essential trans-acting factors required for 27SB pre-rRNA processing but accumulate practically all factors required for processing of 27SA3 pre-rRNA. We have also analysed the functional interaction between the eukaryote-specific carboxy-terminal extensions of the neighboring L14 and L16 proteins. Our results indicate that removal of the most distal parts of these extensions cause slight translation alterations in mature 60S subunits.

Pseudoknot and translational control in the expression of the S15 ribosomal protein.

PubMed

Bénard, L; Philippe, C; Ehresmann, B; Ehresmann, C; Portier, C

1996-01-01

Translational autocontrol of the expression of the ribosomal protein S15 proceeds through the transitory formation of a pseudoknot. A synopsis of the known data is used to propose a molecular model of the mechanism involved and for the role of the pseudoknot. This latter structure is able to recruit 30S ribosomal subunits to initiate translation, but also to bind S15 and to stop translation by trapping the ribosome on its loading site. Information on the S15 protein recognition of the messenger RNA site was deduced from mutational analyses and chemical probing. A comparison of this messenger site with the S15 ribosomal binding site was conducted by analysing hydroxyl radical footprintings of these two sites. The existence of two subsites in 16S RNA suggests that the ribosomal protein S15 might present either two different binding sites or at least one common subsite. Clues for the presence of a common site between the messenger and 16S RNA are given which cannot rule out that recognition specificity is linked to a few other determinants. Whether these determinants are different or not remains an open question.

5S rRNA and ribosome.

PubMed

Gongadze, G M

2011-12-01

5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

Ribosomal targets for antibiotic drug discovery

DOEpatents

Blanchard, Scott C.; Feldman, Michael Brian; Wang, Leyi; Doudna Cate, James H.; Pulk, Arto; Altman, Roger B.; Wasserman, Michael R

2016-09-13

The present invention relates to methods to identify molecules that binds in the neomycin binding pocket of a bacterial ribosome using structures of an intact bacterial ribosome that reveal how the ribosome binds tRNA in two functionally distinct states, determined by x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor (RRF) and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit (P/E) site. Additionally, the invention relates to various assays, including single-molecule assay for ribosome recycling, and methods to identify compounds that interfere with ribosomal function by detecting newly identified intermediate FRET states using known and novel FRET pairs on the ribosome. The invention also provides vectors and compositions with an N-terminally tagged S13 protein.

Miscoding-induced stalling of substrate translocation on the bacterial ribosome.

PubMed

Alejo, Jose L; Blanchard, Scott C

2017-10-10

Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.

Miscoding-induced stalling of substrate translocation on the bacterial ribosome

PubMed Central

Alejo, Jose L.; Blanchard, Scott C.

2017-01-01

Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G–catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors. PMID:28973849

Specific recognition of rpsO mRNA and 16S rRNA by Escherichia coli ribosomal protein S15 relies on both mimicry and site differentiation.

PubMed

Mathy, Nathalie; Pellegrini, Olivier; Serganov, Alexander; Patel, Dinshaw J; Ehresmann, Chantal; Portier, Claude

2004-05-01

The ribosomal protein S15 binds to 16S rRNA, during ribosome assembly, and to its own mRNA (rpsO mRNA), affecting autocontrol of its expression. In both cases, the RNA binding site is bipartite with a common subsite consisting of a G*U/G-C motif. The second subsite is located in a three-way junction in 16S rRNA and in the distal part of a stem forming a pseudoknot in Escherichia coli rpsO mRNA. To determine the extent of mimicry between these two RNA targets, we determined which amino acids interact with rpsO mRNA. A plasmid carrying rpsO (the S15 gene) was mutagenized and introduced into a strain lacking S15 and harbouring an rpsO-lacZ translational fusion. Analysis of deregulated mutants shows that each subsite of rpsO mRNA is recognized by a set of amino acids known to interact with 16S rRNA. In addition to the G*U/G-C motif, which is recognized by the same amino acids in both targets, the other subsite interacts with amino acids also involved in contacts with helix H22 of 16S rRNA, in the region adjacent to the three-way junction. However, specific S15-rpsO mRNA interactions can also be found, probably with A(-46) in loop L1 of the pseudoknot, demonstrating that mimicry between the two targets is limited.

Ribosomal protein L14 contributes to the early assembly of 60S ribosomal subunits in Saccharomyces cerevisiae

PubMed Central

Espinar-Marchena, Francisco; Rodríguez-Galán, Olga; Fernández-Fernández, José; Linnemann, Jan; de la Cruz, Jesús

2018-01-01

Abstract The contribution of most ribosomal proteins to ribosome synthesis has been quite well analysed in Saccharomyces cerevisiae. However, few yeast ribosomal proteins still await characterization. Herein, we show that L14, an essential 60S ribosomal protein, assembles in the nucleolus at an early stage into pre-60S particles. Depletion of L14 results in a deficit in 60S subunits and defective processing of 27SA2 and 27SA3 to 27SB pre-rRNAs. As a result, 27S pre-rRNAs are subjected to turnover and export of pre-60S particles is blocked. These phenotypes likely appear as the direct consequence of the reduced pre-60S particle association not only of L14 upon its depletion but also of a set of neighboring ribosomal proteins located at the solvent interface of 60S subunits and the adjacent region surrounding the polypeptide exit tunnel. These pre-60S intermediates also lack some essential trans-acting factors required for 27SB pre-rRNA processing but accumulate practically all factors required for processing of 27SA3 pre-rRNA. We have also analysed the functional interaction between the eukaryote-specific carboxy-terminal extensions of the neighboring L14 and L16 proteins. Our results indicate that removal of the most distal parts of these extensions cause slight translation alterations in mature 60S subunits. PMID:29788267

Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

NASA Technical Reports Server (NTRS)

Villanueva, E.; Delihas, N.; Luehrsen, K. R.; Fox, G. E.; Gibson, J.

1985-01-01

The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.

Characterization of the Gut Microbiome Using 16S or Shotgun Metagenomics

PubMed Central

Jovel, Juan; Patterson, Jordan; Wang, Weiwei; Hotte, Naomi; O'Keefe, Sandra; Mitchel, Troy; Perry, Troy; Kao, Dina; Mason, Andrew L.; Madsen, Karen L.; Wong, Gane K.-S.

2016-01-01

The advent of next generation sequencing (NGS) has enabled investigations of the gut microbiome with unprecedented resolution and throughput. This has stimulated the development of sophisticated bioinformatics tools to analyze the massive amounts of data generated. Researchers therefore need a clear understanding of the key concepts required for the design, execution and interpretation of NGS experiments on microbiomes. We conducted a literature review and used our own data to determine which approaches work best. The two main approaches for analyzing the microbiome, 16S ribosomal RNA (rRNA) gene amplicons and shotgun metagenomics, are illustrated with analyses of libraries designed to highlight their strengths and weaknesses. Several methods for taxonomic classification of bacterial sequences are discussed. We present simulations to assess the number of sequences that are required to perform reliable appraisals of bacterial community structure. To the extent that fluctuations in the diversity of gut bacterial populations correlate with health and disease, we emphasize various techniques for the analysis of bacterial communities within samples (α-diversity) and between samples (β-diversity). Finally, we demonstrate techniques to infer the metabolic capabilities of a bacteria community from these 16S and shotgun data. PMID:27148170

Thermodynamics of the pseudo-knot in helix 18 of 16S ribosomal RNA.

PubMed

Wojciechowska, Monika; Dudek, Marta; Trylska, Joanna

2018-04-01

A fragment of E. coli 16S rRNA formed by nucleotides 500 to 545 is termed helix 18. Nucleotides 505-507 and 524-526 form a pseudo-knot and its distortion affects ribosome function. Helix 18 isolated from the ribosome context is thus an interesting fragment to investigate the structural properties and folding of RNA with pseudo-knots. With all-atom molecular dynamics simulations, spectroscopic and gel electrophoresis experiments, we investigated thermodynamics of helix 18, with a focus on its pseudo-knot. In solution studies at ambient conditions we observed dimerization of helix 18. We proposed that the loop, containing nucleotides forming the pseudo-knot, interacts with another monomer of helix 18. The native dimer is difficult to break but introducing mutations in the pseudo-knot indeed assured a monomeric form of helix 18. Molecular dynamics simulations at 310 K confirmed the stability of the pseudo-knot but at elevated temperatures this pseudo-knot was the first part of helix 18 to lose the hydrogen bond pattern. To further determine helix 18 stability, we analyzed the interactions of helix 18 with short oligomers complementary to a nucleotide stretch containing the pseudo-knot. The formation of higher-order structures by helix 18 impacts hybridization efficiency of peptide nucleic acid and 2'-O methyl RNA oligomers. © 2018 Wiley Periodicals, Inc.

Protein-RNA crosslinking in Escherichia coli 30S ribosomal subunits. Identification of a 16S rRNA fragment crosslinked to protein S12 by the use of the chemical crosslinking reagent 1-ethyl-3-dimethyl-aminopropylcarbodiimide.

PubMed Central

Chiaruttini, C; Expert-Bezançon, A; Hayes, D; Ehresmann, B

1982-01-01

1-ethyl-3-dimethyl aminopropylcarbodiimide (EDC) was used to cross-link 30S ribosomal proteins to 16S rRNA within the E. coli 3OS ribosomal subunit. Covalently linked complexes containing 30S proteins and 16S rRNA, isolated by sedimentation of dissociated crosslinked 30S subunits through SDS containing sucrose gradients, were digested with RNase T1, and the resulting oligonucleotide-protein complexes were fractionated on SDS containing polyacrylamide gels. Eluted complexes containing 30S proteins S9 and S12 linked to oligonucleotides were obtained in pure form. Oligonucleotide 5'terminal labelling was successful in the case of S12 containing but not of the S9 containing complex and led to identification of the S12 bound oligonucleotide as CAACUCG which is located at positions 1316-1322 in the 16S rRNA sequence. Protein S12 is crosslinked to the terminal G of this heptanucleotide. Images PMID:6760129

The essential nature of YqfG, a YbeY homologue required for 3' maturation of Bacillus subtilis 16S ribosomal RNA is suppressed by deletion of RNase R.

PubMed

Baumgardt, Kathrin; Gilet, Laetitia; Figaro, Sabine; Condon, Ciarán

2018-06-05

Ribosomal RNAs are processed from primary transcripts containing 16S, 23S and 5S rRNAs in most bacteria. Maturation generally occurs in a two-step process, consisting of a first crude separation of the major species by RNase III during transcription, followed by precise trimming of 5' and 3' extensions on each species upon accurate completion of subunit assembly. The various endo- and exoribonucleases involved in the final processing reactions are strikingly different in Escherichia coli and Bacillus subtilis, the two best studied representatives of Gram-negative and Gram-positive bacteria, respectively. Here, we show that the one exception to this rule is the protein involved in the maturation of the 3' end of 16S rRNA. Cells depleted for the essential B. subtilis YqfG protein, a homologue of E. coli YbeY, specifically accumulate 16S rRNA precursors bearing 3' extensions. Remarkably, the essential nature of YqfG can be suppressed by deleting the ribosomal RNA degrading enzyme RNase R, i.e. a ΔyqfG Δrnr mutant is viable. Our data suggest that 70S ribosomes containing 30S subunits with 3' extensions of 16S rRNA are functional to a degree, but become substrates for degradation by RNase R and are eliminated.

Detection of Verrucomicrobia in a Pasture Soil by PCR-Mediated Amplification of 16S rRNA Genes

PubMed Central

O’Farrell, Katrina A.; Janssen, Peter H.

1999-01-01

Oligonucleotide primers were designed and used to amplify, by PCR, partial 16S rRNA genes of members of the bacterial division Verrucomicrobia in DNA extracted from a pasture soil. By applying most-probable-number theory to the assay, verrucomicrobia appeared to contribute some 0.2% of the soil DNA. Amplified ribosomal DNA restriction analysis of 53 cloned PCR-amplified partial 16S rRNA gene fragments and comparative sequence analysis of 21 nonchimeric partial 16S rRNA genes showed that these primers amplified only 16S rRNA genes of members of the Verrucomicrobia in DNA extracted from the soil. PMID:10473454

Molecular Characterization and Analysis of 16S Ribosomal DNA in Some Isolates of Demodex folicullorum

PubMed Central

DANESHPARVAR, Afrooz; MOWLAVI, Gholamreza; MIRJALALI, Hamed; HAJJARAN, Homa; MOBEDI, Iraj; NADDAF, Saeed Reza; SHIDFAR, Mohammadreza; SADAT MAKKI, Mahsa

2017-01-01

Background: Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct and transmits through close contact with an infested host. Methods: This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, already obtained from four different patients and identified morphologically though clearing with 10% Potassium hydroxide (KOH) and microscopical examination. Amplified fragments from the isolates were compared with GeneBank database and phylogenetic analysis was carried out using MEGA6 software. Results: A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs) in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Conclusion: Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites. PMID:28761482

Molecular Characterization and Analysis of 16S Ribosomal DNA in Some Isolates of Demodex folicullorum.

PubMed

Daneshparvar, Afrooz; Mowlavi, Gholamreza; Mirjalali, Hamed; Hajjaran, Homa; Mobedi, Iraj; Naddaf, Saeed Reza; Shidfar, Mohammadreza; Sadat Makki, Mahsa

2017-01-01

Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct and transmits through close contact with an infested host. This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, already obtained from four different patients and identified morphologically though clearing with 10% Potassium hydroxide (KOH) and microscopical examination. Amplified fragments from the isolates were compared with GeneBank database and phylogenetic analysis was carried out using MEGA6 software. A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs) in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.

Specific recognition of rpsO mRNA and 16S rRNA by Escherichia coli ribosomal protein S15 relies on both mimicry and site differentiation

PubMed Central

Mathy, Nathalie; Pellegrini, Olivier; Serganov, Alexander; Patel, Dinshaw J.; Ehresmann, Chantal; Portier, Claude

2015-01-01

Summary The ribosomal protein S15 binds to 16S rRNA, during ribosome assembly, and to its own mRNA (rpsO mRNA), affecting autocontrol of its expression. In both cases, the RNA binding site is bipartite with a common subsite consisting of a G•U/G-C motif. The second subsite is located in a three-way junction in 16S rRNA and in the distal part of a stem forming a pseudoknot in Escherichia coli rpsO mRNA. To determine the extent of mimicry between these two RNA targets, we determined which amino acids interact with rpsO mRNA. A plasmid carrying rpsO (the S15 gene) was mutagenized and introduced into a strain lacking S15 and harbouring an rpsO–lacZ translational fusion. Analysis of deregulated mutants shows that each subsite of rpsO mRNA is recognized by a set of amino acids known to interact with 16S rRNA. In addition to the G•U/G-C motif, which is recognized by the same amino acids in both targets, the other subsite interacts with amino acids also involved in contacts with helix H22 of 16S rRNA, in the region adjacent to the three-way junction. However, specific S15–rpsO mRNA interactions can also be found, probably with A(−46) in loop L1 of the pseudoknot, demonstrating that mimicry between the two targets is limited. PMID:15101974

Molecular Diversity of Lactobacillus spp. and Other Lactic Acid Bacteria in the Human Intestine as Determined by Specific Amplification of 16S Ribosomal DNA

PubMed Central

Heilig, Hans G.H.J.; Zoetendal, Erwin G.; Vaughan, Elaine E.; Marteau, Philippe; Akkermans, Antoon D.L.; de Vos, Willem M.

2002-01-01

A Lactobacillus group-specific PCR primer, S-G-Lab-0677-a-A-17, was developed to selectively amplify 16S ribosomal DNA (rDNA) from lactobacilli and related lactic acid bacteria, including members of the genera Leuconostoc, Pediococcus, and Weissella. Amplicons generated by PCR from a variety of gastrointestinal (GI) tract samples, including those originating from feces and cecum, resulted predominantly in Lactobacillus-like sequences, of which ca. 28% were most similar to the 16S rDNA of Lactobacillus ruminis. Moreover, four sequences of Leuconostoc species were retrieved that, so far, have only been detected in environments other than the GI tract, such as fermented food products. The validity of the primer was further demonstrated by using Lactobacillus-specific PCR and denaturing gradient gel electrophoresis (DGGE) of the 16S rDNA amplicons of fecal and cecal origin from different age groups. The stability of the GI-tract bacterial community in different age groups over various time periods was studied. The Lactobacillus community in three adults over a 2-year period showed variation in composition and stability depending on the individual, while successional change of the Lactobacillus community was observed during the first 5 months of an infant’s life. Furthermore, the specific PCR and DGGE approach was tested to study the retention in fecal samples of a Lactobacillus strain administered during a clinical trial. In conclusion, the combination of specific PCR and DGGE analysis of 16S rDNA amplicons allows the diversity of important groups of bacteria that are present in low numbers in specific ecosystems to be characterized, such as the lactobacilli in the human GI tract. PMID:11772617

High-Resolution Melting Curve Analysis of the 16S Ribosomal Gene to Detect and Identify Pathogenic and Saprophytic Leptospira species in Colombian Isolates

PubMed Central

Peláez Sánchez, Ronald G.; Quintero, Juan Álvaro López; Pereira, Martha María; Agudelo-Flórez, Piedad

2017-01-01

It is important to identify the circulating Leptospira agent to enhance the performance of serodiagnostic tests by incorporating specific antigens of native species, develop vaccines that take into account the species/serovars circulating in different regions, and optimize prevention and control strategies. The objectives of this study were to develop a polymerase chain reaction (PCR)–high-resolution melting (HRM) assay for differentiating between species of the genus Leptospira and to verify its usefulness in identifying unknown samples to species level. A set of primers from the initial region of the 16S ribosomal gene was designed to detect and differentiate the 22 species of Leptospira. Eleven reference strains were used as controls to establish the reference species and differential melting curves. Twenty-five Colombian Leptospira isolates were studied to evaluate the usefulness of the PCR–HRM assay in identifying unknown samples to species level. This identification was confirmed by sequencing and phylogenetic analysis of the 16S ribosomal gene. Eleven Leptospira species were successfully identified, except for Leptospira meyeri/Leptospira yanagawae because the sequences were 100% identical. The 25 isolates from humans, animals, and environmental water sources were identified as Leptospira santarosai (twelve), Leptospira interrogans (nine), and L. meyeri/L. yanagawae (four). The species verification was 100% concordant between PCR–HRM and phylogenetic analysis of the 16S ribosomal gene. The PCR–HRM assay designed in this study is a useful tool for identifying Leptospira species from isolates. PMID:28500802

Assessing genetic structure and diversity of airborne bacterial communities by DNA fingerprinting and 16S rDNA clone library

NASA Astrophysics Data System (ADS)

Maron, Pierre-Alain; Lejon, David P. H.; Carvalho, Esmeralda; Bizet, Karine; Lemanceau, Philippe; Ranjard, Lionel; Mougel, Christophe

The density, genetic structure and diversity of airborne bacterial communities were assessed in the outdoor atmosphere. Two air samples were collected on the same location (north of France) at two dates (March 2003 (sample1) and May 2003 (sample 2)). Molecular culture -independent methods were used to characterise airborne bacterial communities regardless of the cell culturability. The automated-ribosomal intergenic spacer analysis (A-RISA) was performed to characterise the community structure in each sample. For both sampling dates, complex A-RISA patterns were observed suggesting a highly diverse community structure, comparable to those found in soil, water or sediment environments. Furthermore, differences in the genetic structure of airborne bacterial communities were observed between samples 1 and 2 suggesting an important variability in time. A clone library of 16S rDNA directly amplified from air DNA of sample 1 was constructed and sequenced to analyse the community composition and diversity. The Proteobacteria group had the greatest representation (60%), with bacteria belonging to the different subdivisions α- (19%), β-(21%), γ-(12%) and δ-(8%). Firmicute and Actinobacteria were also well represented with 14% and 12%, respectively. Most of the identified bacteria are known to be commonly associated with soil or plant environments suggesting that the atmosphere is mainly colonised transiently by microorganisms from local sources, depending on air fluxes.

Benthic bacterial diversity in submerged sinkhole ecosystems.

PubMed

Nold, Stephen C; Pangborn, Joseph B; Zajack, Heidi A; Kendall, Scott T; Rediske, Richard R; Biddanda, Bopaiah A

2010-01-01

Physicochemical characterization, automated ribosomal intergenic spacer analysis (ARISA) community profiling, and 16S rRNA gene sequencing approaches were used to study bacterial communities inhabiting submerged Lake Huron sinkholes inundated with hypoxic, sulfate-rich groundwater. Photosynthetic cyanobacterial mats on the sediment surface were dominated by Phormidium autumnale, while deeper, organically rich sediments contained diverse and active bacterial communities.

Unique localization of the plastid-specific ribosomal proteins in the chloroplast ribosome small subunit provides mechanistic insights into the chloroplastic translation

PubMed Central

Ahmed, Tofayel; Shi, Jian

2017-01-01

Abstract Chloroplastic translation is mediated by a bacterial-type 70S chloroplast ribosome. During the evolution, chloroplast ribosomes have acquired five plastid-specific ribosomal proteins or PSRPs (cS22, cS23, bTHXc, cL37 and cL38) which have been suggested to play important regulatory roles in translation. However, their exact locations on the chloroplast ribosome remain elusive due to lack of a high-resolution structure, hindering our progress to understand their possible roles. Here we present a cryo-EM structure of the 70S chloroplast ribosome from spinach resolved to 3.4 Å and focus our discussion mainly on the architecture of the 30S small subunit (SSU) which is resolved to 3.7 Å. cS22 localizes at the SSU foot where it seems to compensate for the deletions in 16S rRNA. The mRNA exit site is highly remodeled due to the presence of cS23 suggesting an alternative mode of translation initiation. bTHXc is positioned at the SSU head and appears to stabilize the intersubunit bridge B1b during thermal fluctuations. The translation factor plastid pY binds to the SSU on the intersubunit side and interacts with the conserved nucleotide bases involved in decoding. Most of the intersubunit bridges are conserved compared to the bacteria, except for a new bridge involving uL2c and bS6c. PMID:28582576

Genetic variability of Echinococcus granulosus based on the mitochondrial 16S ribosomal RNA gene.

PubMed

Wang, Ning; Wang, Jiahai; Hu, Dandan; Zhong, Xiuqin; Jiang, Zhongrong; Yang, Aiguo; Deng, Shijin; Guo, Li; Tsering, Dawa; Wang, Shuxian; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou

2015-06-01

Echinococcus granulosus is the etiological agent of cystic echinococcosis, a major zoonotic disease of both humans and animals. In this study, we assessed genetic variability and genetic structure of E. granulosus in the Tibet plateau, using the complete mitochondrial 16 S ribosomal RNA gene for the first time. We collected and sequenced 62 isolates of E. granulosus from 3 populations in the Tibet plateau. A BLAST analysis indicated that 61 isolates belonged to E. granulosus sensu stricto (genotypes G1-G3), while one isolate belonged to E. canadensis (genotype G6). We detected 16 haplotypes with a haplotype network revealing a star-like expansion, with the most common haplotype occupying the center of the network. Haplotype diversity and nucleotide diversity were low, while negative values were observed for Tajima's D and Fu's Fs. AMOVA results and Fst values revealed that the three geographic populations were not genetically differentiated. Our results suggest that a population bottleneck or population expansion has occurred in the past, and that this explains the low genetic variability of E. granulosus in the Tibet Plateau.

In silico analysis of 16S ribosomal RNA gene sequencing‐based methods for identification of medically important anaerobic bacteria

PubMed Central

Woo, Patrick C Y; Chung, Liliane M W; Teng, Jade L L; Tse, Herman; Pang, Sherby S Y; Lau, Veronica Y T; Wong, Vanessa W K; Kam, Kwok‐ling; Lau, Susanna K P; Yuen, Kwok‐Yung

2007-01-01

This study is the first study that provides useful guidelines to clinical microbiologists and technicians on the usefulness of full 16S rRNA sequencing, 5′‐end 527‐bp 16S rRNA sequencing and the existing MicroSeq full and 500 16S rDNA bacterial identification system (MicroSeq, Perkin‐Elmer Applied Biosystems Division, Foster City, California, USA) databases for the identification of all existing medically important anaerobic bacteria. Full and 527‐bp 16S rRNA sequencing are able to identify 52–63% of 130 Gram‐positive anaerobic rods, 72–73% of 86 Gram‐negative anaerobic rods and 78% of 23 anaerobic cocci. The existing MicroSeq databases are able to identify only 19–25% of 130 Gram‐positive anaerobic rods, 38% of 86 Gram‐negative anaerobic rods and 39% of 23 anaerobic cocci. These represent only 45–46% of those that should be confidently identified by full and 527‐bp 16S rRNA sequencing. To improve the usefulness of MicroSeq, bacterial species that should be confidently identified by full and/or 527‐bp 16S rRNA sequencing but not included in the existing MicroSeq databases should be included. PMID:17046845

Cryo-EM structure of the spinach chloroplast ribosome reveals the location of plastid-specific ribosomal proteins and extensions

PubMed Central

Graf, Michael; Arenz, Stefan; Huter, Paul; Dönhöfer, Alexandra; Nováček, Jiří

2017-01-01

Abstract Ribosomes are the protein synthesizing machines of the cell. Recent advances in cryo-EM have led to the determination of structures from a variety of species, including bacterial 70S and eukaryotic 80S ribosomes as well as mitoribosomes from eukaryotic mitochondria, however, to date high resolution structures of plastid 70S ribosomes have been lacking. Here we present a cryo-EM structure of the spinach chloroplast 70S ribosome, with an average resolution of 5.4 Å for the small 30S subunit and 3.6 Å for the large 50S ribosomal subunit. The structure reveals the location of the plastid-specific ribosomal proteins (RPs) PSRP1, PSRP4, PSRP5 and PSRP6 as well as the numerous plastid-specific extensions of the RPs. We discover many features by which the plastid-specific extensions stabilize the ribosome via establishing additional interactions with surrounding ribosomal RNA and RPs. Moreover, we identify a large conglomerate of plastid-specific protein mass adjacent to the tunnel exit site that could facilitate interaction of the chloroplast ribosome with the thylakoid membrane and the protein-targeting machinery. Comparing the Escherichia coli 70S ribosome with that of the spinach chloroplast ribosome provides detailed insight into the co-evolution of RP and rRNA. PMID:27986857

Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.

PubMed

Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel

2007-12-07

The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.

Elevated levels of Era GTPase improve growth, 16S rRNA processing, and 70S ribosome assembly of Escherichia coli lacking highly conserved multifunctional YbeY endoribonuclease.

PubMed

Ghosal, Anubrata; Babu, Vignesh M P; Walker, Graham C

2018-06-18

YbeY is a highly conserved, multifunctional endoribonuclease that plays a significant role in ribosome biogenesis and has several additional roles. Here, we show in Escherichia coli that overexpressing the conserved GTPase, Era, partially suppresses the growth defect of a ΔybeY strain while improving 16S rRNA processing and 70S ribosome assembly. This suppression requires both Era's ability to hydrolyze GTP and the function of three exoribonucleases, RNase II, RNase R and RNase PH, suggesting a model for Era's action. Overexpressing Vibrio cholerae Era similarly partially suppresses the defects of an E. coli ΔybeY strain indicating this property of Era is conserved in bacteria other than E. coli Importance This work provides additional insights into the critical, but still incompletely understood, mechanism of the processing of the E. coli 16S rRNA 3'-terminus. The highly conserved GTPase, Era, is known to bind to the precursor of the 16S rRNA near its 3-end. Both the endoribonuclease YbeY, which binds to Era, and four exoribonucleases have been implicated in this 3'-end processing. Results reported here offer additional insights into the role of Era in 16S rRNA 3'-maturation and into the relationship between the action of the endoribonuclease YbeY and the four exoribonucleases. This study also hints at why YbeY is only essential in some bacteria and suggests that the YbeY could be a target for a new class of antibiotic in these bacteria. Copyright © 2018 American Society for Microbiology.

Benthic Bacterial Diversity in Submerged Sinkhole Ecosystems▿ †

PubMed Central

Nold, Stephen C.; Pangborn, Joseph B.; Zajack, Heidi A.; Kendall, Scott T.; Rediske, Richard R.; Biddanda, Bopaiah A.

2010-01-01

Physicochemical characterization, automated ribosomal intergenic spacer analysis (ARISA) community profiling, and 16S rRNA gene sequencing approaches were used to study bacterial communities inhabiting submerged Lake Huron sinkholes inundated with hypoxic, sulfate-rich groundwater. Photosynthetic cyanobacterial mats on the sediment surface were dominated by Phormidium autumnale, while deeper, organically rich sediments contained diverse and active bacterial communities. PMID:19880643

16S rRNA Next Generation Sequencing Analysis Shows Bacteria in Alzheimer’s Post-Mortem Brain

PubMed Central

Emery, David C.; Shoemark, Deborah K.; Batstone, Tom E.; Waterfall, Christy M.; Coghill, Jane A.; Cerajewska, Tanya L.; Davies, Maria; West, Nicola X.; Allen, Shelley J.

2017-01-01

The neurological deterioration associated with Alzheimer’s disease (AD), involving accumulation of amyloid-beta peptides and neurofibrillary tangles, is associated with evident neuroinflammation. This is now seen to be a significant contributor to pathology. Recently the tenet of the privileged status of the brain, regarding microbial compromise, has been questioned, particularly in terms of neurodegenerative diseases. It is now being considered that microbiological incursion into the central nervous system could be either an initiator or significant contributor to these. This is a novel study using 16S ribosomal gene-specific Next generation sequencing (NGS) of extracted brain tissue. A comparison was made of the bacterial species content of both frozen and formaldehyde fixed sections of a small cohort of Alzheimer-affected cases with those of cognitively unimpaired (normal). Our findings suggest an increase in bacterial populations in Alzheimer brain tissue compared with normal. PMID:28676754

Linezolid-induced lactic acidosis: the thin line between bacterial and mitochondrial ribosomes.

PubMed

Santini, Alessandro; Ronchi, Dario; Garbellini, Manuela; Piga, Daniela; Protti, Alessandro

2017-07-01

Linezolid inhibits bacterial growth by targeting bacterial ribosomes and by interfering with bacterial protein synthesis. Lactic acidosis is a rare, but potentially lethal, side effect of linezolid. Areas covered: The pathogenesis of linezolid-induced lactic acidosis is reviewed with special emphasis on aspects relevant to the recognition, prevention and treatment of the syndrome. Expert opinion: Linezolid-induced lactic acidosis reflects the untoward interaction between the drug and mitochondrial ribosomes. The inhibition of mitochondrial protein synthesis diminishes the respiratory chain enzyme content and thus limits aerobic energy production. As a result, anaerobic glycolysis and lactate generation accelerate independently from tissue hypoxia. In the absence of any confirmatory test, linezolid-induced lactic acidosis should be suspected only after exclusion of other, more common, causes of lactic acidosis such as hypoxemia, anemia or low cardiac output. Normal-to-high whole-body oxygen delivery, high venous oxygen saturation and lack of response to interventions that effectively increase tissue oxygen provision all suggest a primary defect in oxygen use at the mitochondrial level. During prolonged therapy with linezolid, blood drug and lactate levels should be regularly monitored. The current standard-of-care treatment of linezolid-induced lactic acidosis consists of drug withdrawal to reverse mitochondrial intoxication and intercurrent life support.

Identification of 16S Ribosomal DNA-Defined Bacterial Populations at a Shallow Submarine Hydrothermal Vent near Milos Island (Greece)

PubMed Central

Sievert, Stefan M.; Kuever, Jan; Muyzer, Gerard

2000-01-01

In a recent publication (S. M. Sievert, T. Brinkhoff, G. Muyzer, W. Ziebis, and J. Kuever, Appl. Environ. Microbiol. 65:3834–3842, 1999) we described spatiotemporal changes in the bacterial community structure at a shallow-water hydrothermal vent in the Aegean Sea near the isle of Milos (Greece). Here we describe identification and phylogenetic analysis of the predominant bacterial populations at the vent site and their distribution at the vent site as determined by sequencing of DNA molecules (bands) excised from denaturing gradient gels. A total of 36 bands could be sequenced, and there were representatives of eight major lineages of the domain Bacteria. Cytophaga-Flavobacterium and Acidobacterium were the most frequently retrieved bacterial groups. Less than 33% of the sequences exhibited 90% or more identity with cultivated organisms. The predominance of putative heterotrophic populations in the sequences retrieved is explained by the input of allochthonous organic matter at the vent site. PMID:10877814

Biolog(TM) ID as compared to 16S ribosomal RNA ID for environmental isolates from the deep subsurface

DOE Office of Scientific and Technical Information (OSTI.GOV)

McKinsey, P.C.

2000-05-05

The U.S. Dept of Energy (DOE) Subsurface Microbial Culture Collection (SMCC) contains nearly 10,000 strains of microorganisms isolated from terrestrial subsurface environments. Many of the aerobic, gram-negative, chemoheterotrophs isolated from the DOE Savannah River Site (SRS) have previously been identified by phylogenetic analysis of 16S ribosomal RNA (rRNA) gene nucleotide sequences. These SMCC isolates are currently being examined using Biolog GN Microplates and the Biolog Microstation System in order to gain knowledge of their metabolic capabilities and to compare Biolog IDs with 16S IDs. To accommodate the particular needs of these subsurface isolates, which are often incapable of growing undermore » high-nutrient conditions, Biolog's recommendations for inoculating isolates into Biolog GN Microplates have been altered. The isolates are grown on low nutrient media, sodium thioglycolate (3mM) is added to the culture media to inhibit capsule formation, and a low density of bacteria is inoculated into the microplate. Using these altered inoculation criteria, 60 percent of these SMCC isolates have a Biolog genus ID that matches the 16S rRNA ID. These results indicate that the Biolog System can be a good means of identifying unusual environmental isolates, even when recommended inoculation procedures are altered to accommodate particular isolate needs.« less

Correlation of 16S Ribosomal DNA Signature Sequences with Temperature-Dependent Growth Rates of Mesophilic and Psychrotolerant Strains of the Bacillus cereus Group

PubMed Central

Prüß, Birgit M.; Francis, Kevin P.; von Stetten, Felix; Scherer, Siegfried

1999-01-01

Sequences of the 16S ribosomal DNA (rDNA) from psychrotolerant and mesophilic strains of the Bacillus cereus group revealed signatures which were specific for these two thermal groups of bacteria. Further analysis of the genomic DNA from a wide range of food and soil isolates showed that B. cereus group strains have between 6 and 10 copies of 16S rDNA. Moreover, a number of these environmental strains have both rDNA operons with psychrotolerant signatures and rDNA operons with mesophilic signatures. The ability of these isolates to grow at low temperatures correlates with the prevalence of rDNA operons with psychrotolerant signatures, indicating specific nucleotides within the 16S rRNA to play a role in psychrotolerance. PMID:10198030

Distribution and diversity of ribosome binding sites in prokaryotic genomes.

PubMed

Omotajo, Damilola; Tate, Travis; Cho, Hyuk; Choudhary, Madhusudan

2015-08-14

Prokaryotic translation initiation involves the proper docking, anchoring, and accommodation of mRNA to the 30S ribosomal subunit. Three initiation factors (IF1, IF2, and IF3) and some ribosomal proteins mediate the assembly and activation of the translation initiation complex. Although the interaction between Shine-Dalgarno (SD) sequence and its complementary sequence in the 16S rRNA is important in initiation, some genes lacking an SD ribosome binding site (RBS) are still well expressed. The objective of this study is to examine the pattern of distribution and diversity of RBS in fully sequenced bacterial genomes. The following three hypotheses were tested: SD motifs are prevalent in bacterial genomes; all previously identified SD motifs are uniformly distributed across prokaryotes; and genes with specific cluster of orthologous gene (COG) functions differ in their use of SD motifs. Data for 2,458 bacterial genomes, previously generated by Prodigal (PROkaryotic DYnamic programming Gene-finding ALgorithm) and currently available at the National Center for Biotechnology Information (NCBI), were analyzed. Of the total genes examined, ~77.0% use an SD RBS, while ~23.0% have no RBS. Majority of the genes with the most common SD motifs are distributed in a manner that is representative of their abundance for each COG functional category, while motifs 13 (5'-GGA-3'/5'-GAG-3'/5'-AGG-3') and 27 (5'-AGGAGG-3') appear to be predominantly used by genes for information storage and processing, and translation and ribosome biogenesis, respectively. These findings suggest that an SD sequence is not obligatory for translation initiation; instead, other signals, such as the RBS spacer, may have an overarching influence on translation of mRNAs. Subsequent analyses of the 5' secondary structure of these mRNAs may provide further insight into the translation initiation mechanism.

A comparison between elastic network interpolation and MD simulation of 16S ribosomal RNA.

PubMed

Kim, Moon K; Li, Wen; Shapiro, Bruce A; Chirikjian, Gregory S

2003-12-01

In this paper a coarse-grained method called elastic network interpolation (ENI) is used to generate feasible transition pathways between two given conformations of the core central domain of 16S Ribosomal RNA (16S rRNA). The two given conformations are the extremes generated by a molecular dynamics (MD) simulation, which differ from each other by 10A in root-mean-square deviation (RMSD). It takes only several hours to build an ENI pathway on a 1.5GHz Pentium with 512 MB memory, while the MD takes several weeks on high-performance multi-processor servers such as the SGI ORIGIN 2000/2100. It is shown that multiple ENI pathways capture the essential anharmonic motions of millions of timesteps in a particular MD simulation. A coarse-grained normal mode analysis (NMA) is performed on each intermediate ENI conformation, and the lowest 1% of the normal modes (representing about 40 degrees of freedom (DOF)) are used to parameterize fluctuations. This combined ENI/NMA method captures all intermediate conformations in the MD run with 1.5A RMSD on average. In addition, if we restrict attention to the time interval of the MD run between the two extreme conformations, the RMSD between the closest ENI/NMA pathway and the MD results is about 1A. These results may serve as a paradigm for reduced-DOF dynamic simulations of large biological macromolecules as well as a method for the reduced-parameter interpretation of massive amounts of MD data.

Identification of the bacterial community of maple sap by using amplified ribosomal DNA (rDNA) restriction analysis and rDNA sequencing.

PubMed

Lagacé, L; Pitre, M; Jacques, M; Roy, D

2004-04-01

The bacterial community of maple sap was characterized by analysis of samples obtained at the taphole of maple trees for the 2001 and 2002 seasons. Among the 190 bacterial isolates, 32 groups were formed according to the similarity of the banding patterns obtained by amplified ribosomal DNA restriction analysis (ARDRA). A subset of representative isolates for each ARDRA group was identified by 16S rRNA gene fragment sequencing. Results showed a wide variety of organisms, with 22 different genera encountered. Pseudomonas and Ralstonia, of the gamma- and beta-Proteobacteria, respectively, were the most frequently encountered genera. Gram-positive bacteria were also observed, and Staphylococcus, Plantibacter, and Bacillus were the most highly represented genera. The sampling period corresponding to 50% of the cumulative sap flow percentage presented the greatest bacterial diversity according to its Shannon diversity index value (1.1). gamma-Proteobacteria were found to be dominant almost from the beginning of the season to the end. These results are providing interesting insights on maple sap microflora that will be useful for further investigation related to microbial contamination and quality of maple products and also for guiding new strategies on taphole contamination control.

Identification of the Bacterial Community of Maple Sap by Using Amplified Ribosomal DNA (rDNA) Restriction Analysis and rDNA Sequencing

PubMed Central

Lagacé, L.; Pitre, M.; Jacques, M.; Roy, D.

2004-01-01

The bacterial community of maple sap was characterized by analysis of samples obtained at the taphole of maple trees for the 2001 and 2002 seasons. Among the 190 bacterial isolates, 32 groups were formed according to the similarity of the banding patterns obtained by amplified ribosomal DNA restriction analysis (ARDRA). A subset of representative isolates for each ARDRA group was identified by 16S rRNA gene fragment sequencing. Results showed a wide variety of organisms, with 22 different genera encountered. Pseudomonas and Ralstonia, of the γ- and β-Proteobacteria, respectively, were the most frequently encountered genera. Gram-positive bacteria were also observed, and Staphylococcus, Plantibacter, and Bacillus were the most highly represented genera. The sampling period corresponding to 50% of the cumulative sap flow percentage presented the greatest bacterial diversity according to its Shannon diversity index value (1.1). γ-Proteobacteria were found to be dominant almost from the beginning of the season to the end. These results are providing interesting insights on maple sap microflora that will be useful for further investigation related to microbial contamination and quality of maple products and also for guiding new strategies on taphole contamination control. PMID:15066796

Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.

PubMed

Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal

2014-05-01

Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.

The path from nucleolar 90S to cytoplasmic 40S pre-ribosomes.

PubMed

Schäfer, Thorsten; Strauss, Daniela; Petfalski, Elisabeth; Tollervey, David; Hurt, Ed

2003-03-17

Recent reports have increased our knowledge of the consecutive steps during 60S ribosome biogenesis substantially, but 40S subunit formation is less well understood. Here, we investigate the maturation of nucleolar 90S pre-ribosomes into cytoplasmic 40S pre-ribosomes. During the transition from 90S to 40S particles, the majority of non-ribosomal proteins (approximately 30 species) dissociate, and significantly fewer factors associate with 40S pre-ribosomes. Notably, some of these components are part of both early 90S and intermediate 40S pre-particles in the nucleolus (e.g. Enp1p, Dim1p and Rrp12p), whereas others (e.g. Rio2p and Nob1p) are found mainly on late cytoplasmic pre-40S subunits. Finally, temperature-sensitive mutants mapping either in earlier (enp1-1) or later (rio2-1) components exhibit defects in the formation and nuclear export of pre-40S subunits. Our data provide an initial biochemical map of the pre-40S ribosomal subunit on its path from the nucleolus to the cytoplasm. This pathway involves fewer changes in composition than seen during 60S biogenesis.

Evolution of ribosomal proteins in Enterobacteriaceae.

PubMed Central

Hori, H; Osawa, S

1978-01-01

The evolution of ribosomal proteins of about 70 bacterial strains belonging to the family Enterobacteriaceae has been studied by use of previously reported data (S. Osawa, T. Itoh, and E. Otaka, J. Bacteriol. 107:168-178, 1971) and those obtained in this paper. The proximity of the bacteria was quantified by co-chromatographing the differentially labeled ribosomal proteins from two strains on a column of carboxymethyl cellulose in various combinations. The were then classified into 12 groups (=species?) according to their ribosomal protein compositions and were placed in a phylogenic tree. PMID:346556

RNA regulators responding to ribosomal protein S15 are frequent in sequence space

PubMed Central

Slinger, Betty L.; Meyer, Michelle M.

2016-01-01

There are several natural examples of distinct RNA structures that interact with the same ligand to regulate the expression of homologous genes in different organisms. One essential question regarding this phenomenon is whether such RNA regulators are the result of convergent or divergent evolution. Are the RNAs derived from some common ancestor and diverged to the point where we cannot identify the similarity, or have multiple solutions to the same biological problem arisen independently? A key variable in assessing these alternatives is how frequently such regulators arise within sequence space. Ribosomal protein S15 is autogenously regulated via an RNA regulator in many bacterial species; four apparently distinct regulators have been functionally validated in different bacterial phyla. Here, we explore how frequently such regulators arise within a partially randomized sequence population. We find many RNAs that interact specifically with ribosomal protein S15 from Geobacillus kaustophilus with biologically relevant dissociation constants. Furthermore, of the six sequences we characterize, four show regulatory activity in an Escherichia coli reporter assay. Subsequent footprinting and mutagenesis analysis indicates that protein binding proximal to regulatory features such as the Shine–Dalgarno sequence is sufficient to enable regulation, suggesting that regulation in response to S15 is relatively easily acquired. PMID:27580716

Identification of Clinical Isolates of Actinomyces Species by Amplified 16S Ribosomal DNA Restriction Analysis

PubMed Central

Hall, Val; Talbot, P. R.; Stubbs, S. L.; Duerden, B. I.

2001-01-01

Amplified 16S ribosomal DNA (rDNA) restriction analysis (ARDRA), using enzymes HaeIII and HpaII, was applied to 176 fresh and 299 stored clinical isolates of putative Actinomyces spp. referred to the Anaerobe Reference Unit of the Public Health Laboratory Service for confirmation of identity. Results were compared with ARDRA results obtained previously for reference strains and with conventional phenotypic reactions. Identities of some strains were confirmed by analysis of partial 16S rDNA sequences. Of the 475 isolates, 331 (70%) were clearly assigned to recognized Actinomyces species, including 94 isolates assigned to six recently described species. A further 52 isolates in 12 ARDRA profiles were designated as apparently resembling recognized species, and 44 isolates, in 18 novel profiles, were confirmed as members of genera other than Actinomyces. The identities of 48 isolates in nine profiles remain uncertain, and they may represent novel species of Actinomyces. For the majority of species, phenotypic results, published reactions for the species, and ARDRA profiles concurred. However, of 113 stored isolates originally identified as A. meyeri or resembling A. meyeri by phenotypic tests, only 21 were confirmed as A. meyeri by ARDRA; 63 were reassigned as A. turicensis, 7 as other recognized species, and 22 as unidentified actinomycetes. Analyses of incidence and clinical associations of Actinomyces spp. add to the currently sparse knowledge of some recently described species. PMID:11574572

Identification of Bacterial Species in Kuwaiti Waters Through DNA Sequencing

NASA Astrophysics Data System (ADS)

Chen, K.

2017-01-01

With an objective of identifying the bacterial diversity associated with ecosystem of various Kuwaiti Seas, bacteria were cultured and isolated from 3 water samples. Due to the difficulties for cultured and isolated fecal coliforms on the selective agar plates, bacterial isolates from marine agar plates were selected for molecular identification. 16S rRNA genes were successfully amplified from the genome of the selected isolates using Universal Eubacterial 16S rRNA primers. The resulted amplification products were subjected to automated DNA sequencing. Partial 16S rDNA sequences obtained were compared directly with sequences in the NCBI database using BLAST as well as with the sequences available with Ribosomal Database Project (RDP).

Plastid ribosomal protein S5 is involved in photosynthesis, plant development, and cold stress tolerance in Arabidopsis

PubMed Central

Zhang, Junxiang; Yuan, Hui; Yang, Yong; Fish, Tara; Lyi, Sangbom M.; Thannhauser, Theodore W; Zhang, Lugang; Li, Li

2016-01-01

Plastid ribosomal proteins are essential components of protein synthesis machinery and have diverse roles in plant growth and development. Mutations in plastid ribosomal proteins lead to a range of developmental phenotypes in plants. However, how they regulate these processes is not fully understood, and the functions of some individual plastid ribosomal proteins remain unknown. To identify genes responsible for chloroplast development, we isolated and characterized a mutant that exhibited pale yellow inner leaves with a reduced growth rate in Arabidopsis. The mutant (rps5) contained a missense mutation of plastid ribosomal protein S5 (RPS5), which caused a dramatically reduced abundance of chloroplast 16S rRNA and seriously impaired 16S rRNA processing to affect ribosome function and plastid translation. Comparative proteomic analysis revealed that the rps5 mutation suppressed the expression of a large number of core components involved in photosystems I and II as well as many plastid ribosomal proteins. Unexpectedly, a number of proteins associated with cold stress responses were greatly decreased in rps5, and overexpression of the plastid RPS5 improved plant cold stress tolerance. Our results indicate that RPS5 is an important constituent of the plastid 30S subunit and affects proteins involved in photosynthesis and cold stress responses to mediate plant growth and development. PMID:27006483

Identifying the bacterial community on the surface of Intralox belting in a meat boning room by culture-dependent and culture-independent 16S rDNA sequence analysis.

PubMed

Brightwell, Gale; Boerema, Jackie; Mills, John; Mowat, Eilidh; Pulford, David

2006-05-25

We examined the bacterial community present on an Intralox conveyor belt system in an operating lamb boning room by sequencing the 16S ribosomal DNA (rDNA) of bacteria extracted in the presence or absence of cultivation. RFLP patterns for 16S rDNA clone library and cultures were generated using HaeIII and MspI restriction endonucleases. 16S rDNA amplicons produced 8 distinct RFLP pattern groups. RFLP groups I-IV were represented in the clone library and RFLP groups I and V-VIII were represented amongst the cultured isolates. Partial DNA sequences from each RFLP group revealed that all group I, II and VIII representatives were Pseudomonas spp., group III were Sphingomonas spp., group IV clones were most similar to an uncultured alpha proteobacterium, group V was similar to a Serratia spp., group VI with an Alcaligenes spp., and group VII with Microbacterium spp. Sphingomonads were numerically dominant in the culture-independent clone library and along with the group IV alpha proteobacterium were not represented amongst the cultured isolates. Serratia, Alcaligenes and Microbacterium spp. were only represented with cultured isolates. Pseudomonads were detected by both culture-dependent (84% of isolates) and culture-independent (12.5% of clones) methods and their presence at high frequency does pose the risk of product spoilage if transferred onto meat stored under aerobic conditions. The detection of sphingomonads in large numbers by the culture-independent method demands further analysis because sphingomonads may represent a new source of meat spoilage that has not been previously recognised in the meat processing environment. The 16S rDNA collections generated by both methods were important at representing the diversity of the bacterial population associated with an Intralox conveyor belt system.

Problem-Based Test: Functional Analysis of Mutant 16S rRNAs

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2010-01-01

Terms to be familiar with before you start to solve the test: ribosome, ribosomal subunits, antibiotics, point mutation, 16S, 5S, and 23S rRNA, Shine-Dalgarno sequence, mRNA, tRNA, palindrome, hairpin, restriction endonuclease, fMet-tRNA, peptidyl transferase, initiation, elongation, termination of translation, expression plasmid, transformation,…

Characterization of bacterial community associated to biofilms of corroded oil pipelines from the southeast of Mexico.

PubMed

Neria-González, Isabel; Wang, En Tao; Ramírez, Florina; Romero, Juan M; Hernández-Rodríguez, César

2006-06-01

Microbial communities associated to biofilms promote corrosion of oil pipelines. The community structure of bacteria in the biofilm formed in oil pipelines is the basic knowledge to understand the complexity and mechanisms of metal corrosion. To assess bacterial diversity, biofilm samples were obtained from X52 steel coupons corroded after 40 days of exposure to normal operation and flow conditions. The biofilm samples were directly used to extract metagenomic DNA, which was used as template to amplify 16S ribosomal gene by PCR. The PCR products of 16S ribosomal gene were also employed as template for sulfate-reducing bacteria (SRB) specific nested-PCR and both PCR products were utilized for the construction of gene libraries. The V3 region of the 16S rRNA gene was also amplified to analyse the bacterial diversity by analysis of denaturing gradient gel electrophoresis (DGGE). Ribosomal library and DGGE profiles exhibited limited bacterial diversity, basically including Citrobacter spp., Enterobacter spp. and Halanaerobium spp. while Desulfovibrio alaskensis and a novel clade within the genus Desulfonatronovibrio were detected from the nested PCR library. The biofilm samples were also taken for the isolation of SRB. Desulfovibrio alaskensis and Desulfovibrio capillatus, as well as some strains related to Citrobacter were isolated. SRB consists in a very small proportion of the community and Desulfovibrio spp. were the relatively abundant groups among the SRB. This is the first study directly exploring bacterial diversity in corrosive biofilms associated to steel pipelines subjected to normal operation conditions.

Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site.

PubMed

Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D

2015-01-13

Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

Directed hydroxyl radical probing of the rRNA neighborhood of ribosomal protein S13 using tethered Fe(II).

PubMed Central

Heilek, G M; Noller, H F

1996-01-01

Directed hydroxyl radical probing was used to probe the rRNA neighborhood around protein S13 in the 30S ribosomal subunit. The unique cysteine at position 84 of S13 served as a tethering site for attachment of Fe(II)-1-(p-bromoacetamidobenzyl)-EDTA. Derivatized S13 (Fe-C84-S13) was then assembled into 30S ribosomal subunits by in vitro reconstitution with 16S rRNA and a mixture of the remaining 30S subunit proteins. Hydroxyl radicals generated from the tethered Fe(II) resulted in cleavage of the RNA backbone in two localized regions of the 3' major domain of 16S rRNA. One region spans nt 1308-1333 and is close to a site previously crosslinked to S13. A second set of cleavages is found in the 950/1230 helix. Both regions have been implicated in binding of S13 by previous chemical footprinting studies using base-specific chemical probes and solution-based hydroxyl radical probing. These results place both regions of 16S rRNA in proximity to position C84 of S13 in the three-dimensional structure of the 30S ribosomal subunit. PMID:8718688

A model for the study of ligand binding to the ribosomal RNA helix h44

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dibrov, Sergey M.; Parsons, Jerod; Hermann, Thomas

2010-09-02

Oligonucleotide models of ribosomal RNA domains are powerful tools to study the binding and molecular recognition of antibiotics that interfere with bacterial translation. Techniques such as selective chemical modification, fluorescence labeling and mutations are cumbersome for the whole ribosome but readily applicable to model RNAs, which are readily crystallized and often give rise to higher resolution crystal structures suitable for detailed analysis of ligand-RNA interactions. Here, we have investigated the HX RNA construct which contains two adjacent ligand binding regions of helix h44 in 16S ribosomal RNA. High-resolution crystal structure analysis confirmed that the HX RNA is a faithful structuralmore » model of the ribosomal target. Solution studies showed that HX RNA carrying a fluorescent 2-aminopurine modification provides a model system that can be used to monitor ligand binding to both the ribosomal decoding site and, through an indirect effect, the hygromycin B interaction region.« less

Ribosomal Protein Rps26 Influences 80S Ribosome Assembly in Saccharomyces cerevisiae

PubMed Central

Belyy, Alexander; Levanova, Nadezhda; Tabakova, Irina; Rospert, Sabine

2016-01-01

ABSTRACT The eukaryotic ribosome consists of a small (40S) and a large (60S) subunit. Rps26 is one of the essential ribosomal proteins of the 40S subunit and is encoded by two almost identical genes, RPS26a and RPS26b. Previous studies demonstrated that Rps26 interacts with the 5′ untranslated region of mRNA via the eukaryote-specific 62-YXXPKXYXK-70 (Y62–K70) motif. Those observations suggested that this peptide within Rps26 might play an important and specific role during translation initiation. By using alanine-scanning mutagenesis and engineered strains of the yeast Saccharomyces cerevisiae, we found that single amino acid substitutions within the Y62–K70 motif of Rps26 did not affect the in vivo function of the protein. In contrast, complete deletion of the Y62–K70 segment was lethal. The simultaneous replacement of five conserved residues within the Y62–K70 segment by alanines resulted in growth defects under stress conditions and produced distinct changes in polysome profiles that were indicative of the accumulation of free 60S subunits. Human Rps26 (Rps26-Hs), which displays significant homology with yeast Rps26, supported the growth of an S. cerevisiae Δrps26a Δrps26b strain. However, the Δrps26a Δrps26b double deletion strain expressing Rps26-Hs displayed substantial growth defects and an altered ratio of 40S/60S ribosomal subunits. The combined data strongly suggest that the eukaryote-specific motif within Rps26 does not play a specific role in translation initiation. Rather, the data indicate that Rps26 as a whole is necessary for proper assembly of the 40S subunit and the 80S ribosome in yeast. IMPORTANCE Rps26 is an essential protein of the eukaryotic small ribosomal subunit. Previous experiments demonstrated an interaction between the eukaryote-specific Y62–K70 segment of Rps26 and the 5′ untranslated region of mRNA. The data suggested a specific role of the Y62–K70 motif during translation initiation. Here, we report that single

Ribosomal Protein Rps26 Influences 80S Ribosome Assembly in Saccharomyces cerevisiae.

PubMed

Belyy, Alexander; Levanova, Nadezhda; Tabakova, Irina; Rospert, Sabine; Belyi, Yury

2016-01-01

The eukaryotic ribosome consists of a small (40S) and a large (60S) subunit. Rps26 is one of the essential ribosomal proteins of the 40S subunit and is encoded by two almost identical genes, RPS26a and RPS26b. Previous studies demonstrated that Rps26 interacts with the 5' untranslated region of mRNA via the eukaryote-specific 62-YXXPKXYXK-70 (Y62-K70) motif. Those observations suggested that this peptide within Rps26 might play an important and specific role during translation initiation. By using alanine-scanning mutagenesis and engineered strains of the yeast Saccharomyces cerevisiae, we found that single amino acid substitutions within the Y62-K70 motif of Rps26 did not affect the in vivo function of the protein. In contrast, complete deletion of the Y62-K70 segment was lethal. The simultaneous replacement of five conserved residues within the Y62-K70 segment by alanines resulted in growth defects under stress conditions and produced distinct changes in polysome profiles that were indicative of the accumulation of free 60S subunits. Human Rps26 (Rps26-Hs), which displays significant homology with yeast Rps26, supported the growth of an S. cerevisiae Δrps26a Δrps26b strain. However, the Δrps26a Δrps26b double deletion strain expressing Rps26-Hs displayed substantial growth defects and an altered ratio of 40S/60S ribosomal subunits. The combined data strongly suggest that the eukaryote-specific motif within Rps26 does not play a specific role in translation initiation. Rather, the data indicate that Rps26 as a whole is necessary for proper assembly of the 40S subunit and the 80S ribosome in yeast. IMPORTANCE Rps26 is an essential protein of the eukaryotic small ribosomal subunit. Previous experiments demonstrated an interaction between the eukaryote-specific Y62-K70 segment of Rps26 and the 5' untranslated region of mRNA. The data suggested a specific role of the Y62-K70 motif during translation initiation. Here, we report that single-site substitutions

Expansion of the aminoglycoside-resistance 16S rRNA (m(1)A1408) methyltransferase family: expression and functional characterization of four hypothetical enzymes of diverse bacterial origin.

PubMed

Witek, Marta A; Conn, Graeme L

2014-09-01

The global dissemination, potential activity in diverse species and broad resistance spectrum conferred by the aminoglycoside-resistance ribosomal RNA methyltransferases make them a significant potential new threat to the efficacy of aminoglycoside antibiotics in the treatment of serious bacterial infections. The N1 methylation of adenosine 1408 (m(1)A1408) confers resistance to structurally diverse aminoglycosides, including kanamycin, neomycin and apramycin. The limited analyses to date of the enzymes responsible have identified common features but also potential differences in their molecular details of action. Therefore, with the goal of expanding the known 16S rRNA (m(1)A1408) methyltransferase family as a platform for developing a more complete mechanistic understanding, we report here the cloning, expression and functional analyses of four hypothetical aminoglycoside-resistance rRNA methyltransferases from recent genome sequences of diverse bacterial species. Each of the genes produced a soluble, folded protein with a secondary structure, as determined from circular dichroism (CD) spectra, consistent with enzymes for which high-resolution structures are available. For each enzyme, antibiotic minimum inhibitory concentration (MIC) assays revealed a resistance spectrum characteristic of the known 16S rRNA (m(1)A1408) methyltransferases and the modified nucleotide was confirmed by reverse transcription as A1408. In common with other family members, higher binding affinity for the methylation reaction by-product S-adenosylhomocysteine (SAH) than the cosubstrate S-adenosyl-L-methionine (SAM) was observed for three methyltransferases, while one unexpectedly showed no measurable affinity for SAH. Collectively, these results confirm that each hypothetical enzyme is a functional 16S rRNA (m(1)A1408) methyltransferase but also point to further potential mechanistic variation within this enzyme family. Copyright © 2014 Elsevier B.V. All rights reserved.

PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

PubMed Central

Machida, Ryuji J.; Knowlton, Nancy

2012-01-01

Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

16S rRNA beacons for bacterial monitoring during human space missions.

PubMed

Larios-Sanz, Maia; Kourentzi, Katerina D; Warmflash, David; Jones, Jeffrey; Pierson, Duane L; Willson, Richard C; Fox, George E

2007-04-01

Microorganisms are unavoidable in space environments and their presence has, at times, been a source of problems. Concerns about disease during human space missions are particularly important considering the significant changes the immune system incurs during spaceflight and the history of microbial contamination aboard the Mir space station. Additionally, these contaminants may have adverse effects on instrumentation and life-support systems. A sensitive, highly specific system to detect, characterize, and monitor these microbial populations is essential. Herein we describe a monitoring approach that uses 16S rRNA targeted molecular beacons to successfully detect several specific bacterial groupings. This methodology will greatly simplify in-flight monitoring by minimizing sample handling and processing. We also address and provide solutions to target accessibility problems encountered in hybridizations that target 16S rRNA.

The primary structures of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui.

PubMed

Hatakeyama, T; Hatakeyama, T; Kimura, M

1988-11-21

The complete amino acid sequences of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui were determined. The sequences were established by manual sequencing of peptides produced with several proteases as well as by cleavage with dilute HCl. Proteins L16, L23 and L33 consist of 119, 154 and 69 amino acid residues, and their molecular masses are 13,538, 16,812 and 7620 Da, respectively. The comparison of their sequences with those of ribosomal proteins from other organisms revealed that L23 and L33 are related to eubacterial ribosomal proteins from Escherichia coli and Bacillus stearothermophilus, while protein L16 was found to be homologous to a eukaryotic ribosomal protein from yeast. These results provide information about the special phylogenetic position of archaebacteria.

Conformational dynamics of bacterial trigger factor in apo and ribosome-bound states.

PubMed

Can, Mehmet Tarik; Kurkcuoglu, Zeynep; Ezeroglu, Gokce; Uyar, Arzu; Kurkcuoglu, Ozge; Doruker, Pemra

2017-01-01

The chaperone trigger factor (TF) binds to the ribosome exit tunnel and helps cotranslational folding of nascent chains (NC) in bacterial cells and chloroplasts. In this study, we aim to investigate the functional dynamics of fully-atomistic apo TF and its complex with 50S. As TF accomodates a high percentage of charged residues on its surface, the effect of ionic strength on TF dynamics is assessed here by performing five independent molecular dynamics (MD) simulations (total of 1.3 micro-second duration) at 29 mM and 150 mM ionic strengths. At both concentrations, TF exhibits high inter- and intra-domain flexibility related to its binding (BD), core (CD), and head (HD) domains. Even though large oscillations in gyration radius exist during each run, we do not detect the so-called 'fully collapsed' state with both HD and BD collapsed upon the core. In fact, the extended conformers with relatively open HD and BD are highly populated at the physiological concentration of 150 mM. More importantly, extended TF snapshots stand out in terms of favorable docking onto the 50S subunit. Elastic network modeling (ENM) indicates significant changes in TF's functional dynamics and domain decomposition depending on its conformation and positioning on the 50S. The most dominant slow motions are the lateral sweeping and vertical opening/closing of HD relative to 50S. Finally, our ENM-based efficient technique -ClustENM- is used to sample atomistic conformers starting with an extended TF-50S complex. Specifically, BD and CD motions are restricted near the tunnel exit, while HD is highly mobile. The atomistic conformers generated without an NC are in agreement with the cryo-EM maps available for TF-ribosome-NC complex.

Gram Stains: A Resource for Retrospective Analysis of Bacterial Pathogens in Clinical Studies

PubMed Central

Srinivasan, Usha; Ponnaluri, Sreelatha; Villareal, Lisa; Gillespie, Brenda; Wen, Ai; Miles, Arianna; Bucholz, Brigette; Marrs, Carl F.; Iyer, Ram K.; Misra, Dawn; Foxman, Betsy

2012-01-01

We demonstrate the feasibility of using qPCR on DNA extracted from vaginal Gram stain slides to estimate the presence and relative abundance of specific bacterial pathogens. We first tested Gram stained slides spiked with a mix of 108 cfu/ml of Escherichia coli and 105 cfu/ml of Lactobacillus acidophilus. Primers were designed for amplification of total and species-specific bacterial DNA based on 16S ribosomal gene regions. Sample DNA was pre-amplified with nearly full length 16S rDNA ribosomal gene fragment, followed by quantitative PCR with genera and species-specific 16S rDNA primers. Pre-amplification PCR increased the bacterial amounts; relative proportions of Escherichia coli and Lactobacillus recovered from spiked slides remained unchanged. We applied this method to forty two archived Gram stained slides available from a clinical trial of cerclage in pregnant women at high risk of preterm birth. We found a high correlation between Nugent scores based on bacterial morphology of Lactobacillus, Gardenerella and Mobiluncus and amounts of quantitative PCR estimated genus specific DNA (rrn copies) from Gram stained slides. Testing of a convenience sample of eight paired vaginal swabs and Gram stains freshly collected from healthy women found similar qPCR generated estimates of Lactobacillus proportions from Gram stained slides and vaginal swabs. Archived Gram stained slides collected from large scale epidemiologic and clinical studies represent a valuable, untapped resource for research on the composition of bacterial communities that colonize human mucosal surfaces. PMID:23071487

Gram stains: a resource for retrospective analysis of bacterial pathogens in clinical studies.

PubMed

Srinivasan, Usha; Ponnaluri, Sreelatha; Villareal, Lisa; Gillespie, Brenda; Wen, Ai; Miles, Arianna; Bucholz, Brigette; Marrs, Carl F; Iyer, Ram K; Misra, Dawn; Foxman, Betsy

2012-01-01

We demonstrate the feasibility of using qPCR on DNA extracted from vaginal Gram stain slides to estimate the presence and relative abundance of specific bacterial pathogens. We first tested Gram stained slides spiked with a mix of 10(8) cfu/ml of Escherichia coli and 10(5) cfu/ml of Lactobacillus acidophilus. Primers were designed for amplification of total and species-specific bacterial DNA based on 16S ribosomal gene regions. Sample DNA was pre-amplified with nearly full length 16S rDNA ribosomal gene fragment, followed by quantitative PCR with genera and species-specific 16S rDNA primers. Pre-amplification PCR increased the bacterial amounts; relative proportions of Escherichia coli and Lactobacillus recovered from spiked slides remained unchanged. We applied this method to forty two archived Gram stained slides available from a clinical trial of cerclage in pregnant women at high risk of preterm birth. We found a high correlation between Nugent scores based on bacterial morphology of Lactobacillus, Gardenerella and Mobiluncus and amounts of quantitative PCR estimated genus specific DNA (rrn copies) from Gram stained slides. Testing of a convenience sample of eight paired vaginal swabs and Gram stains freshly collected from healthy women found similar qPCR generated estimates of Lactobacillus proportions from Gram stained slides and vaginal swabs. Archived Gram stained slides collected from large scale epidemiologic and clinical studies represent a valuable, untapped resource for research on the composition of bacterial communities that colonize human mucosal surfaces.

Ribosome reinitiation at leader peptides increases translation of bacterial proteins.

PubMed

Korolev, Semen A; Zverkov, Oleg A; Seliverstov, Alexandr V; Lyubetsky, Vassily A

2016-04-16

Short leader genes usually do not encode stable proteins, although their importance in expression control of bacterial genomes is widely accepted. Such genes are often involved in the control of attenuation regulation. However, the abundance of leader genes suggests that their role in bacteria is not limited to regulation. Specifically, we hypothesize that leader genes increase the expression of protein-coding (structural) genes via ribosome reinitiation at the leader peptide in the case of a short distance between the stop codon of the leader gene and the start codon of the structural gene. For instance, in Actinobacteria, the frequency of leader genes at a distance of 10-11 bp is about 70 % higher than the mean frequency within the 1 to 65 bp range; and it gradually decreases as the range grows longer. A pronounced peak of this frequency-distance relationship is also observed in Proteobacteria, Bacteroidetes, Spirochaetales, Acidobacteria, the Deinococcus-Thermus group, and Planctomycetes. In contrast, this peak falls to the distance of 15-16 bp and is not very pronounced in Firmicutes; and no such peak is observed in cyanobacteria and tenericutes. Generally, this peak is typical for many bacteria. Some leader genes located close to a structural gene probably play a regulatory role as well.

Phylogenetic study of Geitlerinema and Microcystis (Cyanobacteria) using PC-IGS and 16S-23S ITS as markers: investigation of horizontal gene transfer.

PubMed

Piccin-Santos, Viviane; Brandão, Marcelo Mendes; Bittencourt-Oliveira, Maria Do Carmo

2014-08-01

Selection of genes that have not been horizontally transferred for prokaryote phylogenetic inferences is regarded as a challenging task. The markers internal transcribed spacer of ribosomal genes (16S-23S ITS) and phycocyanin intergenic spacer (PC-IGS), based on the operons of ribosomal and phycocyanin genes respectively, are among the most used markers in cyanobacteria. The region of the ribosomal genes has been considered stable, whereas the phycocyanin operon may have undergone horizontal transfer. To investigate the occurrence of horizontal transfer of PC-IGS, phylogenetic trees of Geitlerinema and Microcystis strains were generated using PC-IGS and 16S-23S ITS and compared. Phylogenetic trees based on the two markers were mostly congruent for Geitlerinema and Microcystis, indicating a common evolutionary history among ribosomal and phycocyanin genes with no evidence for horizontal transfer of PC-IGS. Thus, PC-IGS is a suitable marker, along with 16S-23S ITS for phylogenetic studies of cyanobacteria. © 2014 Phycological Society of America.

[C-terminal fragment of ribosomal protein S15 is located at the decoding site of the human ribosome].

PubMed

Khaĭrulina, Iu S; Molotkov, M V; Bulygin, K N; Graĭfer, D M; Ven'iaminova, A G; Karpova, G G

2008-01-01

Protein S15 is a characteristic component of the mammalian 80S ribosome that neighbors mRNA codon at the decoding site and the downstream triplets. In this study we determined S15 protein fragments located close to mRNA positions +4 to +12 with respect to the first nucleotide of the P site codon on the human ribosome. For cross-linking to ribosomal protein S15, a set of mRNA was used that contained triplet UUU/UUC at the 5'-termini and a perfluorophenyl azide-modified uridine in position 3' of this triplet. The locations of mRNA analogues on the ribosome were governed by tRNAPhe cognate to the UUU/UUC triplet targeted to the P site. Cross-linked S15 protein was isolated from the irradiated with mild UV light complexes of 80S ribosomes with tRNAPhe and mRNA analogues with subsequent cleavage with CNBr that splits polypeptide chain after methionines. Analysis of modified oligopeptides resulted from the cleavage revealed that in all cases cross-linking site was located in C-terminal fragment 111-145 of protein S15 indicating that this fragment is involved in formation of decoding site of the eukaryotic ribosome.

Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family.

PubMed

Kimura, M; Kimura, J; Hatakeyama, T

1988-11-21

The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

Modular Assembly of the Bacterial Large Ribosomal Subunit

PubMed Central

Davis, Joseph H.; Tan, Yong Zi; Carragher, Bridget; Potter, Clinton S.; Lyumkis, Dmitry; Williamson, James R.

2016-01-01

SUMMARY The ribosome is a complex macromolecular machine and serves as an ideal system for understanding biological macromolecular assembly. Direct observation of ribosome assembly in vivo is difficult, as few intermediates have been isolated and thoroughly characterized. Herein, we deploy a genetic system to starve cells of an essential ribosomal protein, which results in the accumulation of assembly intermediates that are competent for maturation. Quantitative mass spectrometry and single-particle cryo-electron microscopy reveal 13 distinct intermediates, which were each resolved to ~4–5Å resolution and could be placed in an assembly pathway. We find that ribosome biogenesis is a parallel process, that blocks of structured rRNA and proteins assemble cooperatively, and that the entire process is dynamic and can be ‘re-routed’ through different pathways as needed. This work reveals the complex landscape of ribosome assembly in vivo and provides the requisite tools to characterize additional assembly pathways for ribosomes and other macromolecular machines. PMID:27912064

Using DGGE and 16S rRNA gene sequence analysis to evaluate changes in oral bacterial composition.

PubMed

Chen, Zhou; Trivedi, Harsh M; Chhun, Nok; Barnes, Virginia M; Saxena, Deepak; Xu, Tao; Li, Yihong

2011-01-01

To investigate whether a standard dental prophylaxis followed by tooth brushing with an antibacterial dentifrice will affect the oral bacterial community, as determined by denaturing gradient gel electrophoresis (DGGE) combined with 16S rRNA gene sequence analysis. Twenty-four healthy adults were instructed to brush their teeth using commercial dentifrice for 1 week during a washout period. An initial set of pooled supragingival plaque samples was collected from each participant at baseline (0 h) before prophylaxis treatment. The subjects were given a clinical examination and dental prophylaxis and asked to brush for 1 min with a dentifrice containing 0.3% triclosan, 2.0% PVM/MA copolymer and 0.243% sodium fluoride (Colgate Total). On the following day, a second set of pooled supragingival plaque samples (24 h) was collected. Total bacterial genomic DNA was isolated from the samples. Differences in the microbial composition before and after the prophylactic procedure and tooth brushing were assessed by comparing the DGGE profiles and 16S rRNA gene segments sequence analysis. Two distinct clusters of DGGE profiles were found, suggesting that a shift in the microbial composition had occurred 24 h after the prophylaxis and brushing. A detailed sequencing analysis of 16S rRNA gene segments further identified 6 phyla and 29 genera, including known and unknown bacterial species. Importantly, an increase in bacterial diversity was observed after 24 h, including members of the Streptococcaceae family, Prevotella, Corynebacterium, TM7 and other commensal bacteria. The results suggest that the use of a standard prophylaxis followed by the use of the dentifrice containing 0.3% triclosan, 2.0% PVM/MA copolymer and 0.243% sodium fluoride may promote a healthier composition within the oral bacterial community.

Modular Assembly of the Bacterial Large Ribosomal Subunit.

PubMed

Davis, Joseph H; Tan, Yong Zi; Carragher, Bridget; Potter, Clinton S; Lyumkis, Dmitry; Williamson, James R

2016-12-01

The ribosome is a complex macromolecular machine and serves as an ideal system for understanding biological macromolecular assembly. Direct observation of ribosome assembly in vivo is difficult, as few intermediates have been isolated and thoroughly characterized. Herein, we deploy a genetic system to starve cells of an essential ribosomal protein, which results in the accumulation of assembly intermediates that are competent for maturation. Quantitative mass spectrometry and single-particle cryo-electron microscopy reveal 13 distinct intermediates, which were each resolved to ∼4-5 Å resolution and could be placed in an assembly pathway. We find that ribosome biogenesis is a parallel process, that blocks of structured rRNA and proteins assemble cooperatively, and that the entire process is dynamic and can be "re-routed" through different pathways as needed. This work reveals the complex landscape of ribosome assembly in vivo and provides the requisite tools to characterize additional assembly pathways for ribosomes and other macromolecular machines. Copyright © 2016 Elsevier Inc. All rights reserved.

Phylogenetic Diversity of Lactic Acid Bacteria Associated with Paddy Rice Silage as Determined by 16S Ribosomal DNA Analysis

PubMed Central

Ennahar, Saïd; Cai, Yimin; Fujita, Yasuhito

2003-01-01

A total of 161 low-G+C-content gram-positive bacteria isolated from whole-crop paddy rice silage were classified and subjected to phenotypic and genetic analyses. Based on morphological and biochemical characters, these presumptive lactic acid bacterium (LAB) isolates were divided into 10 groups that included members of the genera Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, and Weissella. Analysis of the 16S ribosomal DNA (rDNA) was used to confirm the presence of the predominant groups indicated by phenotypic analysis and to determine the phylogenetic affiliation of representative strains. The virtually complete 16S rRNA gene was PCR amplified and sequenced. The sequences from the various LAB isolates showed high degrees of similarity to those of the GenBank reference strains (between 98.7 and 99.8%). Phylogenetic trees based on the 16S rDNA sequence displayed high consistency, with nodes supported by high bootstrap values. With the exception of one species, the genetic data was in agreement with the phenotypic identification. The prevalent LAB, predominantly homofermentative (66%), consisted of Lactobacillus plantarum (24%), Lactococcus lactis (22%), Leuconostoc pseudomesenteroides (20%), Pediococcus acidilactici (11%), Lactobacillus brevis (11%), Enterococcus faecalis (7%), Weissella kimchii (3%), and Pediococcus pentosaceus (2%). The present study, the first to fully document rice-associated LAB, showed a very diverse community of LAB with a relatively high number of species involved in the fermentation process of paddy rice silage. The comprehensive 16S rDNA-based approach to describing LAB community structure was valuable in revealing the large diversity of bacteria inhabiting paddy rice silage and enabling the future design of appropriate inoculants aimed at improving its fermentation quality. PMID:12514026

Phylogenetic diversity of lactic acid bacteria associated with paddy rice silage as determined by 16S ribosomal DNA analysis.

PubMed

Ennahar, Saïd; Cai, Yimin; Fujita, Yasuhito

2003-01-01

A total of 161 low-G+C-content gram-positive bacteria isolated from whole-crop paddy rice silage were classified and subjected to phenotypic and genetic analyses. Based on morphological and biochemical characters, these presumptive lactic acid bacterium (LAB) isolates were divided into 10 groups that included members of the genera Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, and WEISSELLA: Analysis of the 16S ribosomal DNA (rDNA) was used to confirm the presence of the predominant groups indicated by phenotypic analysis and to determine the phylogenetic affiliation of representative strains. The virtually complete 16S rRNA gene was PCR amplified and sequenced. The sequences from the various LAB isolates showed high degrees of similarity to those of the GenBank reference strains (between 98.7 and 99.8%). Phylogenetic trees based on the 16S rDNA sequence displayed high consistency, with nodes supported by high bootstrap values. With the exception of one species, the genetic data was in agreement with the phenotypic identification. The prevalent LAB, predominantly homofermentative (66%), consisted of Lactobacillus plantarum (24%), Lactococcus lactis (22%), Leuconostoc pseudomesenteroides (20%), Pediococcus acidilactici (11%), Lactobacillus brevis (11%), Enterococcus faecalis (7%), Weissella kimchii (3%), and Pediococcus pentosaceus (2%). The present study, the first to fully document rice-associated LAB, showed a very diverse community of LAB with a relatively high number of species involved in the fermentation process of paddy rice silage. The comprehensive 16S rDNA-based approach to describing LAB community structure was valuable in revealing the large diversity of bacteria inhabiting paddy rice silage and enabling the future design of appropriate inoculants aimed at improving its fermentation quality.

Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

NASA Technical Reports Server (NTRS)

Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

1976-01-01

Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

Characterization of 16S rRNA Processing with Pre-30S Subunit Assembly Intermediates from E. coli.

PubMed

Smith, Brian A; Gupta, Neha; Denny, Kevin; Culver, Gloria M

2018-06-08

Ribosomal RNA (rRNA) is a major component of ribosomes and is fundamental to the process of translation. In bacteria, 16S rRNA is a component of the small ribosomal subunit and plays a critical role in mRNA decoding. rRNA maturation entails the removal of intervening spacer sequences contained within the pre-rRNA transcript by nucleolytic enzymes. Enzymatic activities involved in maturation of the 5'-end of 16S rRNA have been identified, but those involved in 3'-end maturation of 16S rRNA are more enigmatic. Here, we investigate molecular details of 16S rRNA maturation using purified in vivo-formed small subunit (SSU) assembly intermediates (pre-SSUs) from wild-type Escherichia coli that contain precursor 16S rRNA (17S rRNA). Upon incubation of pre-SSUs with E. coli S100 cell extracts or purified enzymes implicated in 16S rRNA processing, the 17S rRNA is processed into additional intermediates and mature 16S rRNA. These results illustrate that exonucleases RNase R, RNase II, PNPase, and RNase PH can process the 3'-end of pre-SSUs in vitro. However, the endonuclease YbeY did not exhibit nucleolytic activity with pre-SSUs under these conditions. Furthermore, these data demonstrate that multiple pathways facilitate 16S rRNA maturation with pre-SSUs in vitro, with the dominant pathways entailing complete processing of the 5'-end of 17S rRNA prior to 3'-end maturation or partial processing of the 5'-end with concomitant processing of the 3'-end. These results reveal the multifaceted nature of SSU biogenesis and suggest that E. coli may be able to escape inactivation of any one enzyme by using an existing complementary pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.

Measurement of the Dissociation-Equilibrium Constants for Low Affinity Antibiotic Binding Interaction with Bacterial Ribosomes by the T2 (CPMG) and Line-Broadening Methods

NASA Astrophysics Data System (ADS)

Verdier, L.; Gharbi-Benarous, J.; Bertho, G.; Mauvais, P.; Girault, J.-P.

1999-10-01

In this study the dissociation constants of the low antibiotic-ribosomes interaction were determined by the T2 (CPMG), the Carr-Purcell-Meiboom-Gill spin-echo decay rate and the line-broadening methods. Three MLSB antibiotics were studied, a macrolide roxithromycin, a ketolide HMR 3647 and a lincosamide clindamycin for their weak interaction with three bacterial ribosomes, E. coli, Staphylococcus aureus sensitive and resistant to erythromycin. Nous avons mesuré la constante de dissociation, Kd correspondant à l'interaction faible antibiotique-ribosome bactérien pour des antibiotiques de différentes classes, un macrolide (roxithromycine), un kétolide (HMR 3647) et une lincosamide (clindamycine) avec des ribosomes de différentes souches bactériennes (E. coli, Staphylococcus aureus sensible ou résistant à l'erythromycin) par deux méthodes : l'une basée sur la variation des largeurs de raies et l'autre sur les temps de relaxation transversaux T2 en utilisant une séquence CPMG.

Initial insights into bacterial succession during human decomposition.

PubMed

Hyde, Embriette R; Haarmann, Daniel P; Petrosino, Joseph F; Lynne, Aaron M; Bucheli, Sibyl R

2015-05-01

Decomposition is a dynamic ecological process dependent upon many factors such as environment, climate, and bacterial, insect, and vertebrate activity in addition to intrinsic properties inherent to individual cadavers. Although largely attributed to microbial metabolism, very little is known about the bacterial basis of human decomposition. To assess the change in bacterial community structure through time, bacterial samples were collected from several sites across two cadavers placed outdoors to decompose and analyzed through 454 pyrosequencing and analysis of variable regions 3-5 of the bacterial 16S ribosomal RNA (16S rRNA) gene. Each cadaver was characterized by a change in bacterial community structure for all sites sampled as time, and decomposition, progressed. Bacteria community structure is variable at placement and before purge for all body sites. At bloat and purge and until tissues began to dehydrate or were removed, bacteria associated with flies, such as Ignatzschineria and Wohlfahrtimonas, were common. After dehydration and skeletonization, bacteria associated with soil, such as Acinetobacter, were common at most body sites sampled. However, more cadavers sampled through multiple seasons are necessary to assess major trends in bacterial succession.

An accurate bacterial DNA quantification assay for HTS library preparation of human biological samples.

PubMed

Seashols-Williams, Sarah; Green, Raquel; Wohlfahrt, Denise; Brand, Angela; Tan-Torres, Antonio Limjuco; Nogales, Francy; Brooks, J Paul; Singh, Baneshwar

2018-05-17

Sequencing and classification of microbial taxa within forensically relevant biological fluids has the potential for applications in the forensic science and biomedical fields. The quantity of bacterial DNA from human samples is currently estimated based on quantity of total DNA isolated. This method can miscalculate bacterial DNA quantity due to the mixed nature of the sample, and consequently library preparation is often unreliable. We developed an assay that can accurately and specifically quantify bacterial DNA within a mixed sample for reliable 16S ribosomal DNA (16S rDNA) library preparation and high throughput sequencing (HTS). A qPCR method was optimized using universal 16S rDNA primers, and a commercially available bacterial community DNA standard was used to develop a precise standard curve. Following qPCR optimization, 16S rDNA libraries from saliva, vaginal and menstrual secretions, urine, and fecal matter were amplified and evaluated at various DNA concentrations; successful HTS data were generated with as low as 20 pg of bacterial DNA. Changes in bacterial DNA quantity did not impact observed relative abundances of major bacterial taxa, but relative abundance changes of minor taxa were observed. Accurate quantification of microbial DNA resulted in consistent, successful library preparations for HTS analysis. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Use of 16S rRNA Gene for Identification of a Broad Range of Clinically Relevant Bacterial Pathogens

PubMed Central

Srinivasan, Ramya; Karaoz, Ulas; Volegova, Marina; MacKichan, Joanna; Kato-Maeda, Midori; Miller, Steve; Nadarajan, Rohan; Brodie, Eoin L.; Lynch, Susan V.

2015-01-01

According to World Health Organization statistics of 2011, infectious diseases remain in the top five causes of mortality worldwide. However, despite sophisticated research tools for microbial detection, rapid and accurate molecular diagnostics for identification of infection in humans have not been extensively adopted. Time-consuming culture-based methods remain to the forefront of clinical microbial detection. The 16S rRNA gene, a molecular marker for identification of bacterial species, is ubiquitous to members of this domain and, thanks to ever-expanding databases of sequence information, a useful tool for bacterial identification. In this study, we assembled an extensive repository of clinical isolates (n = 617), representing 30 medically important pathogenic species and originally identified using traditional culture-based or non-16S molecular methods. This strain repository was used to systematically evaluate the ability of 16S rRNA for species level identification. To enable the most accurate species level classification based on the paucity of sequence data accumulated in public databases, we built a Naïve Bayes classifier representing a diverse set of high-quality sequences from medically important bacterial organisms. We show that for species identification, a model-based approach is superior to an alignment based method. Overall, between 16S gene based and clinical identities, our study shows a genus-level concordance rate of 96% and a species-level concordance rate of 87.5%. We point to multiple cases of probable clinical misidentification with traditional culture based identification across a wide range of gram-negative rods and gram-positive cocci as well as common gram-negative cocci. PMID:25658760

mRNA bound to the 30S subunit is a HigB toxin substrate

PubMed Central

Schureck, Marc A.; Maehigashi, Tatsuya; Miles, Stacey J.; Marquez, Jhomar; Dunham, Christine M.

2016-01-01

Activation of bacterial toxins during stress results in cleavage of mRNAs in the context of the ribosome. These toxins are thought to function as global translational inhibitors yet recent studies suggest each may have distinct mRNA specificities that result in selective translation for bacterial survival. Here we demonstrate that mRNA in the context of a bacterial 30S subunit is sufficient for ribosome-dependent toxin HigB endonucleolytic activity, suggesting that HigB interferes with the initiation step of translation. We determined the X-ray crystal structure of HigB bound to the 30S, revealing that two solvent-exposed clusters of HigB basic residues directly interact with 30S 16S rRNA helices 18, 30, and 31. We further show that these HigB residues are essential for ribosome recognition and function. Comparison with other ribosome-dependent toxins RelE and YoeB reveals that each interacts with similar features of the 30S aminoacyl (A) site yet does so through presentation of diverse structural motifs. PMID:27307497

New bacterial species associated with chronic periodontitis.

PubMed

Kumar, P S; Griffen, A L; Barton, J A; Paster, B J; Moeschberger, M L; Leys, E J

2003-05-01

Recent investigations of the human subgingival oral flora based on ribosomal 16S cloning and sequencing have shown many of the bacterial species present to be novel species or phylotypes. The purpose of the present investigation was to identify potential periodontal pathogens among these newly identified species and phylotypes. Species-specific ribosomal 16S primers for PCR amplification were developed for detection of new species. Associations with chronic periodontitis were observed for several new species or phylotypes, including uncultivated clones D084 and BH017 from the Deferribacteres phylum, AU126 from the Bacteroidetes phylum, Megasphaera clone BB166, clone X112 from the OP11 phylum, and clone I025 from the TM7 phylum, and the named species Eubacterium saphenum, Porphyromonas endodontalis, Prevotella denticola, and Cryptobacterium curtum. Species or phylotypes more prevalent in periodontal health included two uncultivated phylotypes, clone W090 from the Deferribacteres phylum and clone BU063 from the Bacteroidetes, and named species Atopobium rimae and Atopobium parvulum.

Phylogenetic analysis of a biofilm bacterial population in a water pipeline in the Gulf of Mexico.

PubMed

López, Miguel A; Zavala-Díaz de la Serna, F Javier; Jan-Roblero, Janet; Romero, Juan M; Hernández-Rodríguez, César

2006-10-01

The aim of this study was to assess the bacterial diversity associated with a corrosive biofilm in a steel pipeline from the Gulf of Mexico used to inject marine water into the oil reservoir. Several aerobic and heterotrophic bacteria were isolated and identified by 16S rRNA gene sequence analysis. Metagenomic DNA was also extracted to perform a denaturing gradient gel electrophoresis analysis of ribosomal genes and to construct a 16S rRNA gene metagenomic library. Denaturing gradient gel electrophoresis profiles and ribosomal libraries exhibited a limited bacterial diversity. Most of the species detected in the ribosomal library or isolated from the pipeline were assigned to Proteobacteria (Halomonas spp., Idiomarina spp., Marinobacter aquaeolei, Thalassospira sp., Silicibacter sp. and Chromohalobacter sp.) and Bacilli (Bacillus spp. and Exiguobacterium spp.). This is the first report that associates some of these bacteria with a corrosive biofilm. It is relevant that no sulfate-reducing bacteria were isolated or detected by a PCR-based method. The diversity and relative abundance of bacteria from water pipeline biofilms may contribute to an understanding of the complexity and mechanisms of metal corrosion during marine water injection in oil secondary recovery.

Vertical Distribution of Bacterial Communities in the Indian Ocean as Revealed by Analyses of 16S rRNA and nasA Genes.

PubMed

Jiang, Xuexia; Jiao, Nianzhi

2016-09-01

Bacteria play an important role in the marine biogeochemical cycles. However, research on the bacterial community structure of the Indian Ocean is scarce, particularly within the vertical dimension. In this study, we investigated the bacterial diversity of the pelagic, mesopelagic and bathypelagic zones of the southwestern Indian Ocean (50.46°E, 37.71°S). The clone libraries constructed by 16S rRNA gene sequence revealed that most phylotypes retrieved from the Indian Ocean were highly divergent from those retrieved from other oceans. Vertical differences were observed based on the analysis of natural bacterial community populations derived from the 16S rRNA gene sequences. Based on the analysis of the nasA gene sequences from GenBank database, a pair of general primers was developed and used to amplify the bacterial nitrate-assimilating populations. Environmental factors play an important role in mediating the bacterial communities in the Indian Ocean revealed by canonical correlation analysis.

Role of conserved nucleotides in building the 16S rRNA binding site of E. coli ribosomal protein S8.

PubMed Central

Allmang, C; Mougel, M; Westhof, E; Ehresmann, B; Ehresmann, C

1994-01-01

Ribosomal protein S8 specifically recognizes a helical and irregular region of 16S rRNA that is highly evolutionary constrained. Despite its restricted size, the precise conformation of this region remains a question of debate. Here, we used chemical probing to analyze the structural consequences of mutations in this RNA region. These data, combined with computer modelling and previously published data on protein binding were used to investigate the conformation of the RNA binding site. The experimental data confirm the model in which adenines A595, A640 and A642 bulge out in the deep groove. In addition to the already proposed non canonical U598-U641 interaction, the structure is stabilized by stacking interactions (between A595 and A640) and an array of hydrogen bonds involving bases and the sugar phosphate backbone. Mutations that alter the ability to form these interdependent interactions result in a local destabilization or reorganization. The specificity of recognition by protein S8 is provided by the irregular and distorted backbone and the two bulged adenines 640 and 642 in the deep groove. The third adenine (A595) is not a direct recognition site but must adopt a bulged position. The U598-U641 pair should not be directly in contact with the protein. Images PMID:7937081

Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens

DOE PAGES

Srinivasan, Ramya; Karaoz, Ulas; Volegova, Marina; ...

2015-02-06

According to World Health Organization statistics of 2011, infectious diseases remain in the top five causes of mortality worldwide. However, despite sophisticated research tools for microbial detection, rapid and accurate molecular diagnostics for identification of infection in humans have not been extensively adopted. Time-consuming culture-based methods remain to the forefront of clinical microbial detection. The 16S rRNA gene, a molecular marker for identification of bacterial species, is ubiquitous to members of this domain and, thanks to ever-expanding databases of sequence information, a useful tool for bacterial identification. In this study, we assembled an extensive repository of clinical isolates (n =more » 617), representing 30 medically important pathogenic species and originally identified using traditional culture-based or non-16S molecular methods. This strain repository was used to systematically evaluate the ability of 16S rRNA for species level identification. To enable the most accurate species level classification based on the paucity of sequence data accumulated in public databases, we built a Naïve Bayes classifier representing a diverse set of high-quality sequences from medically important bacterial organisms. We show that for species identification, a model-based approach is superior to an alignment based method. Overall, between 16S gene based and clinical identities, our study shows a genus-level concordance rate of 96% and a species-level concordance rate of 87.5%. We point to multiple cases of probable clinical misidentification with traditional culture based identification across a wide range of gram-negative rods and gram-positive cocci as well as common gram-negative cocci.« less

Potential key bases of ribosomal RNA to kingdom-specific spectra of antibiotic susceptibility and the possible archaeal origin of eukaryotes.

PubMed

Xie, Qiang; Wang, Yanhui; Lin, Jinzhong; Qin, Yan; Wang, Ying; Bu, Wenjun

2012-01-01

In support of the hypothesis of the endosymbiotic origin of eukaryotes, much evidence has been found to support the idea that some organelles of eukaryotic cells originated from bacterial ancestors. Less attention has been paid to the identity of the host cell, although some biochemical and molecular genetic properties shared by archaea and eukaryotes have been documented. Through comparing 507 taxa of 16S-18S rDNA and 347 taxa of 23S-28S rDNA, we found that archaea and eukaryotes share twenty-six nucleotides signatures in ribosomal DNA. These signatures exist in all living eukaryotic organisms, whether protist, green plant, fungus, or animal. This evidence explicitly supports the archaeal origin of eukaryotes. In the ribosomal RNA, besides A2058 in Escherichia coli vs. G2400 in Saccharomyces cerevisiae, there still exist other twenties of sites, in which the bases are kingdom-specific. Some of these sites concentrate in the peptidyl transferase centre (PTC) of the 23S-28S rRNA. The results suggest potential key sites to explain the kingdom-specific spectra of drug resistance of ribosomes.

Structural insights into species-specific features of the ribosome from the pathogen Staphylococcus aureus

PubMed Central

Eyal, Zohar; Matzov, Donna; Krupkin, Miri; Wekselman, Itai; Paukner, Susanne; Zimmerman, Ella; Rozenberg, Haim; Bashan, Anat; Yonath, Ada

2015-01-01

The emergence of bacterial multidrug resistance to antibiotics threatens to cause regression to the preantibiotic era. Here we present the crystal structure of the large ribosomal subunit from Staphylococcus aureus, a versatile Gram-positive aggressive pathogen, and its complexes with the known antibiotics linezolid and telithromycin, as well as with a new, highly potent pleuromutilin derivative, BC-3205. These crystal structures shed light on specific structural motifs of the S. aureus ribosome and the binding modes of the aforementioned antibiotics. Moreover, by analyzing the ribosome structure and comparing it with those of nonpathogenic bacterial models, we identified some unique internal and peripheral structural motifs that may be potential candidates for improving known antibiotics and for use in the design of selective antibiotic drugs against S. aureus. PMID:26464510

Characterization of bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, as determined by 16S rDNA analysis.

PubMed

Escalante, Adelfo; Rodríguez, María Elena; Martínez, Alfredo; López-Munguía, Agustín; Bolívar, Francisco; Gosset, Guillermo

2004-06-15

The bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, was studied in 16S rDNA clone libraries from three pulque samples. Sequenced clones identified as Lactobacillus acidophilus, Lactobacillus strain ASF360, L. kefir, L. acetotolerans, L. hilgardii, L. plantarum, Leuconostoc pseudomesenteroides, Microbacterium arborescens, Flavobacterium johnsoniae, Acetobacter pomorium, Gluconobacter oxydans, and Hafnia alvei, were detected for the first time in pulque. Identity of 16S rDNA sequenced clones showed that bacterial diversity present among pulque samples is dominated by Lactobacillus species (80.97%). Seventy-eight clones exhibited less than 95% of relatedness to NCBI database sequences, which may indicate the presence of new species in pulque samples.

Ribosomes in the sea: a window on taxon-specific lysis

NASA Astrophysics Data System (ADS)

Suttle, C.; Zhong, X.; Wirth, J.

2016-02-01

Microbes are estimated to comprise more than 90% of the biomass in the world's oceans, are major drivers of biogeochemical cycles, and have turnover rates ranging from hours to days. Despite the central role that microbes play in marine ecosystems, there is no robust method to evaluate taxon-specific mortality rates. Here, we report a method that employs extracellular free-ribosomes as a proxy to evaluate taxon-specific microbial lysis. The method was validated with laboratory cultures of the marine heterotrophic bacterium Vibrio natriegens strain PWH3a and the photoautotroph Synechococcus strain DC2, with and without grazers or viruses, to identify the origin and fate of the extracellular free-ribosomes. Our results showed both viral lysis and programmed-cell-death (PCD) contribute to free-ribosome production. Ribosomes were not released when cells were grazed, but grazers could consume free-ribosomes. We show that extracellular free-ribosomes can be used to evaluate microbial mortality caused by viral lysis and PCD. This approach was applied to environmental samples by examining the taxonomic composition and relative abundance of free 16S-ribosomes in seawater samples collected from the Strait of Georgia and Saanich Inlet, British Columbia, Canada. Based on the presence of free ribosomes, lysis was detected in 2198 out of 4013 prokaryotic taxa, representing 22 bacterial and three archaeal phyla. Of these, lysis of 140 taxa could be detected in all nine samples. Based on the ratio of free ribosomes to cellular ribosomes, some taxa associated with specific ecological niches appeared to be subject to high rates of lysis, including the genera Achromobacter, Chryseobacterium, Clostridium, Delftia, Ferruginibacter, Lactobacillus, Marinomonas, Massilia, Microbacterium, Ochrobactrum, Paenibacillus, Phyllobacterium, Pseudomonas, Rhodobacter, and Stenotrophomonas. Our results showed high-lysis coupled with low-abundance, suggesting that taxa in lower abundance are subject

Comprehensive Analysis of Bacterial Flora in Postoperative Maxillary Cyst Fluid by 16S rRNA Gene and Culture Methods

PubMed Central

Sano, Naoto; Yamashita, Yoshio; Fukuda, Kazumasa; Taniguchi, Hatsumi; Goto, Masaaki; Miyamoto, Hiroshi

2012-01-01

Intracystic fluid was aseptically collected from 11 patients with postoperative maxillary cyst (POMC), and DNA was extracted from the POMC fluid. Bacterial species were identified by sequencing after cloning of approximately 580 bp of the 16S rRNA gene. Identification of pathogenic bacteria was also performed by culture methods. The phylogenetic identity was determined by sequencing 517–596 bp in each of the 1139 16S rRNA gene clones. A total of 1114 clones were classified while the remaining 25 clones were unclassified. A total of 103 bacterial species belonging to 42 genera were identified in POMC fluid samples by 16S rRNA gene analysis. Species of Prevotella (91%), Neisseria (73%), Fusobacterium (73%), Porphyromonas (73%), and Propionibacterium (73%) were found to be highly prevalent in all patients. Streptococcus mitis (64%), Fusobacterium nucleatum (55%), Propionibacterium acnes (55%), Staphylococcus capitis (55%), and Streptococcus salivarius (55%) were detected in more than 6 of the 11 patients. The results obtained by the culture method were different from those obtained by 16S rRNA gene analysis, but both approaches may be necessary for the identification of pathogens, especially of bacteria that are difficult to detect by culture methods, and the development of rational treatments for patients with POMC. PMID:22685668

Factors Affecting Nuclear Export of the 60S Ribosomal Subunit In Vivo

PubMed Central

Stage-Zimmermann, Tracy; Schmidt, Ute; Silver, Pamela A.

2000-01-01

In Saccharomyces cerevisiae, the 60S ribosomal subunit assembles in the nucleolus and then is exported to the cytoplasm, where it joins the 40S subunit for translation. Export of the 60S subunit from the nucleus is known to be an energy-dependent and factor-mediated process, but very little is known about the specifics of its transport. To begin to address this problem, an assay was developed to follow the localization of the 60S ribosomal subunit in S. cerevisiae. Ribosomal protein L11b (Rpl11b), one of the ∼45 ribosomal proteins of the 60S subunit, was tagged at its carboxyl terminus with the green fluorescent protein (GFP) to enable visualization of the 60S subunit in living cells. A panel of mutant yeast strains was screened for their accumulation of Rpl11b–GFP in the nucleus as an indicator of their involvement in ribosome synthesis and/or transport. This panel included conditional alleles of several rRNA-processing factors, nucleoporins, general transport factors, and karyopherins. As predicted, conditional alleles of rRNA-processing factors that affect 60S ribosomal subunit assembly accumulated Rpl11b–GFP in the nucleus. In addition, several of the nucleoporin mutants as well as a few of the karyopherin and transport factor mutants also mislocalized Rpl11b–GFP. In particular, deletion of the previously uncharacterized karyopherin KAP120 caused accumulation of Rpl11b–GFP in the nucleus, whereas ribosomal protein import was not impaired. Together, these data further define the requirements for ribosomal subunit export and suggest a biological function for KAP120. PMID:11071906

5SRNAdb: an information resource for 5S ribosomal RNAs.

PubMed

Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

2016-01-04

Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

The host antimicrobial peptide Bac71-35 binds to bacterial ribosomal proteins and inhibits protein synthesis.

PubMed

Mardirossian, Mario; Grzela, Renata; Giglione, Carmela; Meinnel, Thierry; Gennaro, Renato; Mergaert, Peter; Scocchi, Marco

2014-12-18

Antimicrobial peptides (AMPs) are molecules from innate immunity with high potential as novel anti-infective agents. Most of them inactivate bacteria through pore formation or membrane barrier disruption, but others cross the membrane without damages and act inside the cells, affecting vital processes. However, little is known about their intracellular bacterial targets. Here we report that Bac71-35, a proline-rich AMP belonging to the cathelicidin family, can reach high concentrations (up to 340 μM) inside the E. coli cytoplasm. The peptide specifically and completely inhibits in vitro translation in the micromolar concentration range. Experiments of incorporation of radioactive precursors in macromolecules with E. coli cells confirmed that Bac71-35 affects specifically protein synthesis. Ribosome coprecipitation and crosslinking assays showed that the peptide interacts with ribosomes, binding to a limited subset of ribosomal proteins. Overall, these results indicate that the killing mechanism of Bac71-35 is based on a specific block of protein synthesis. Copyright © 2014 Elsevier Ltd. All rights reserved.

Defining the bacteroides ribosomal binding site.

PubMed

Wegmann, Udo; Horn, Nikki; Carding, Simon R

2013-03-01

The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.

Visualizing the 16-membered ring macrolides tildipirosin and tilmicosin bound to their ribosomal site.

PubMed

Poehlsgaard, Jacob; Andersen, Niels M; Warrass, Ralf; Douthwaite, Stephen

2012-08-17

The veterinary antibiotic tildipirosin (20,23-dipiperidinyl-mycaminosyl-tylonolide, Zuprevo) was developed recently to treat bovine and swine respiratory tract infections caused by bacterial pathogens such as Pasteurella multocida. Tildipirosin is a derivative of the naturally occurring compound tylosin. Here, we define drug-target interactions by combining chemical footprinting with structure modeling and show that tildipirosin, tylosin, and an earlier tylosin derivative, tilmicosin (20-dimethylpiperidinyl-mycaminosyl-tylonolide, Micotil), bind to the same macrolide site within the large subunit of P. multocida and Escherichia coli ribosomes. The drugs nevertheless differ in how they occupy this site. Interactions of the two piperidine components, which are unique to tildipirosin, distinguish this drug from tylosin and tilmicosin. The 23-piperidine of tildipirosin contacts ribosomal residues on the tunnel wall while its 20-piperidine is oriented into the tunnel lumen and is positioned to interfere with the growing nascent peptide.

Phylogenetic Analysis of Pasteuria penetrans by 16S rRNA Gene Cloning and Sequencing.

PubMed

Anderson, J M; Preston, J F; Dickson, D W; Hewlett, T E; Williams, N H; Maruniak, J E

1999-09-01

Pasteuria penetrans is an endospore-forming bacterial parasite of Meloidogyne spp. This organism is among the most promising agents for the biological control of root-knot nematodes. In order to establish the phylogenetic position of this species relative to other endospore-forming bacteria, the 16S ribosomal genes from two isolates of P. penetrans, P-20, which preferentially infects M. arenaria race 1, and P-100, which preferentially infects M. incognita and M. javanica, were PCR-amplified from a purified endospore extraction. Universal primers for the 16S rRNA gene were used to amplify DNA which was cloned, and a nucleotide sequence was obtained for 92% of the gene (1,390 base pairs) encoding the 16S rDNA from each isolate. Comparison of both isolates showed identical sequences that were compared to 16S rDNA sequences of 30 other endospore-forming bacteria obtained from GenBank. Parsimony analyses indicated that P. penetrans is a species within a clade that includes Alicyclobacillus acidocaldarius, A. cycloheptanicus, Sulfobacillus sp., Bacillus tusciae, B. schlegelii, and P. ramosa. Its closest neighbor is P. ramosa, a parasite of Daphnia spp. (water fleas). This study provided a genomic basis for the relationship of species assigned to the genus Pasteuria, and for comparison of species that are parasites of different phytopathogenic nematodes.

Translational control of ribosomal protein S15.

PubMed

Portier, C; Philippe, C; Dondon, L; Grunberg-Manago, M; Ebel, J P; Ehresmann, B; Ehresmann, C

1990-08-27

The expression of ribosomal protein S15 is shown to be translationally and negatively autocontrolled using a fusion within a reporter gene. Isolation and characterization of several deregulated mutants indicate that the regulatory site (the translational operator site) overlaps the ribosome loading site of the S15 messenger. In this region, three domains, each exhibiting a stem-loop structure, were determined using chemical and enzymatic probes. The most downstream hairpin carries the Shine-Dalgarno sequence and the initiation codon. Genetic and structural data derived from mutants constructed by site-directed mutagenesis show that the operator is a dynamic structure, two domains of which can form a pseudoknot. Binding of S15 to these two domains suggests that the pseudoknot could be stabilized by S15. A model is presented in which two alternative structures would explain the molecular basis of the S15 autocontrol.

sORFs.org: a repository of small ORFs identified by ribosome profiling.

PubMed

Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

2016-01-04

With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Characterization of bovine ruminal epithelial bacterial communities using 16S rRNA sequencing, PCR-DGGE, and qRT-PCR analysis.

PubMed

Li, Meiju; Zhou, Mi; Adamowicz, Elizabeth; Basarab, John A; Guan, Le Luo

2012-02-24

Currently, knowledge regarding the ecology and function of bacteria attached to the epithelial tissue of the rumen wall is limited. In this study, the diversity of the bacterial community attached to the rumen epithelial tissue was compared to the rumen content bacterial community using 16S rRNA gene sequencing, PCR-DGGE, and qRT-PCR analysis. Sequence analysis of 2785 randomly selected clones from six 16S rDNA (∼1.4kb) libraries showed that the community structures of three rumen content libraries clustered together and were separated from the rumen tissue libraries. The diversity index of each library revealed that ruminal content bacterial communities (4.12/4.42/4.88) were higher than ruminal tissue communities (2.90/2.73/3.23), based on 97% similarity. The phylum Firmicutes was predominant in the ruminal tissue communities, while the phylum Bacteroidetes was predominant in the ruminal content communities. The phyla Fibrobacteres, Planctomycetes, and Verrucomicrobia were only detected in the ruminal content communities. PCR-DGGE analysis of the bacterial profiles of the rumen content and ruminal epithelial tissue samples from 22 steers further confirmed that there is a distinct bacterial community that inhibits the rumen epithelium. The distinctive epimural bacterial communities suggest that Firmicutes, together with other epithelial-specific species, may have additional functions other than food digestion. Copyright © 2011 Elsevier B.V. All rights reserved.

Evaluation of partial 16S ribosomal DNA sequencing for identification of nocardia species by using the MicroSeq 500 system with an expanded database.

PubMed

Cloud, Joann L; Conville, Patricia S; Croft, Ann; Harmsen, Dag; Witebsky, Frank G; Carroll, Karen C

2004-02-01

Identification of clinically significant nocardiae to the species level is important in patient diagnosis and treatment. A study was performed to evaluate Nocardia species identification obtained by partial 16S ribosomal DNA (rDNA) sequencing by the MicroSeq 500 system with an expanded database. The expanded portion of the database was developed from partial 5' 16S rDNA sequences derived from 28 reference strains (from the American Type Culture Collection and the Japanese Collection of Microorganisms). The expanded MicroSeq 500 system was compared to (i). conventional identification obtained from a combination of growth characteristics with biochemical and drug susceptibility tests; (ii). molecular techniques involving restriction enzyme analysis (REA) of portions of the 16S rRNA and 65-kDa heat shock protein genes; and (iii). when necessary, sequencing of a 999-bp fragment of the 16S rRNA gene. An unknown isolate was identified as a particular species if the sequence obtained by partial 16S rDNA sequencing by the expanded MicroSeq 500 system was 99.0% similar to that of the reference strain. Ninety-four nocardiae representing 10 separate species were isolated from patient specimens and examined by using the three different methods. Sequencing of partial 16S rDNA by the expanded MicroSeq 500 system resulted in only 72% agreement with conventional methods for species identification and 90% agreement with the alternative molecular methods. Molecular methods for identification of Nocardia species provide more accurate and rapid results than the conventional methods using biochemical and susceptibility testing. With an expanded database, the MicroSeq 500 system for partial 16S rDNA was able to correctly identify the human pathogens N. brasiliensis, N. cyriacigeorgica, N. farcinica, N. nova, N. otitidiscaviarum, and N. veterana.

sORFs.org: a repository of small ORFs identified by ribosome profiling

PubMed Central

Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

2016-01-01

With the advent of ribosome profiling, a next generation sequencing technique providing a “snap-shot’’ of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these ‘sORFs’, indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. PMID:26527729

Salmonella Enterica Serovar Typhimurium BipA Exhibits Two Distinct Ribosome Binding Modes

DOE Office of Scientific and Technical Information (OSTI.GOV)

deLivron, M.; Robinson, V

BipA is a highly conserved prokaryotic GTPase that functions to influence numerous cellular processes in bacteria. In Escherichia coli and Salmonella enterica serovar Typhimurium, BipA has been implicated in controlling bacterial motility, modulating attachment and effacement processes, and upregulating the expression of virulence genes and is also responsible for avoidance of host defense mechanisms. In addition, BipA is thought to be involved in bacterial stress responses, such as those associated with virulence, temperature, and symbiosis. Thus, BipA is necessary for securing bacterial survival and successful invasion of the host. Steady-state kinetic analysis and pelleting assays were used to assess themore » GTPase and ribosome-binding properties of S. enterica BipA. Under normal bacterial growth, BipA associates with the ribosome in the GTP-bound state. However, using sucrose density gradients, we demonstrate that the association of BipA and the ribosome is altered under stress conditions in bacteria similar to those experienced during virulence. The data show that this differential binding is brought about by the presence of ppGpp, an alarmone that signals the onset of stress-related events in bacteria.« less

Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

PubMed

Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

2002-12-01

The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

PubMed Central

Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

2002-01-01

The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit. PMID:12515387

Then and now: use of 16S rDNA gene sequencing for bacterial identification and discovery of novel bacteria in clinical microbiology laboratories.

PubMed

Woo, P C Y; Lau, S K P; Teng, J L L; Tse, H; Yuen, K-Y

2008-10-01

In the last decade, as a result of the widespread use of PCR and DNA sequencing, 16S rDNA sequencing has played a pivotal role in the accurate identification of bacterial isolates and the discovery of novel bacteria in clinical microbiology laboratories. For bacterial identification, 16S rDNA sequencing is particularly important in the case of bacteria with unusual phenotypic profiles, rare bacteria, slow-growing bacteria, uncultivable bacteria and culture-negative infections. Not only has it provided insights into aetiologies of infectious disease, but it also helps clinicians in choosing antibiotics and in determining the duration of treatment and infection control procedures. With the use of 16S rDNA sequencing, 215 novel bacterial species, 29 of which belong to novel genera, have been discovered from human specimens in the past 7 years of the 21st century (2001-2007). One hundred of the 215 novel species, 15 belonging to novel genera, have been found in four or more subjects. The largest number of novel species discovered were of the genera Mycobacterium (n = 12) and Nocardia (n = 6). The oral cavity/dental-related specimens (n = 19) and the gastrointestinal tract (n = 26) were the most important sites for discovery and/or reservoirs of novel species. Among the 100 novel species, Streptococcus sinensis, Laribacter hongkongensis, Clostridium hathewayi and Borrelia spielmanii have been most thoroughly characterized, with the reservoirs and routes of transmission documented, and S. sinensis, L. hongkongensis and C. hathewayi have been found globally. One of the greatest hurdles in putting 16S rDNA sequencing into routine use in clinical microbiology laboratories is automation of the technology. The only step that can be automated at the moment is input of the 16S rDNA sequence of the bacterial isolate for identification into one of the software packages that will generate the result of the identity of the isolate on the basis of its sequence database. However

The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen

2010-04-26

Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, themore » streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.« less

Sampling and pyrosequencing methods for characterizing bacterial communities in the human gut using 16S sequence tags

PubMed Central

2010-01-01

Intense interest centers on the role of the human gut microbiome in health and disease, but optimal methods for analysis are still under development. Here we present a study of methods for surveying bacterial communities in human feces using 454/Roche pyrosequencing of 16S rRNA gene tags. We analyzed fecal samples from 10 individuals and compared methods for storage, DNA purification and sequence acquisition. To assess reproducibility, we compared samples one cm apart on a single stool specimen for each individual. To analyze storage methods, we compared 1) immediate freezing at -80°C, 2) storage on ice for 24 or 3) 48 hours. For DNA purification methods, we tested three commercial kits and bead beating in hot phenol. Variations due to the different methodologies were compared to variation among individuals using two approaches--one based on presence-absence information for bacterial taxa (unweighted UniFrac) and the other taking into account their relative abundance (weighted UniFrac). In the unweighted analysis relatively little variation was associated with the different analytical procedures, and variation between individuals predominated. In the weighted analysis considerable variation was associated with the purification methods. Particularly notable was improved recovery of Firmicutes sequences using the hot phenol method. We also carried out surveys of the effects of different 454 sequencing methods (FLX versus Titanium) and amplification of different 16S rRNA variable gene segments. Based on our findings we present recommendations for protocols to collect, process and sequence bacterial 16S rDNA from fecal samples--some major points are 1) if feasible, bead-beating in hot phenol or use of the PSP kit improves recovery; 2) storage methods can be adjusted based on experimental convenience; 3) unweighted (presence-absence) comparisons are less affected by lysis method. PMID:20673359

Sampling and pyrosequencing methods for characterizing bacterial communities in the human gut using 16S sequence tags.

PubMed

Wu, Gary D; Lewis, James D; Hoffmann, Christian; Chen, Ying-Yu; Knight, Rob; Bittinger, Kyle; Hwang, Jennifer; Chen, Jun; Berkowsky, Ronald; Nessel, Lisa; Li, Hongzhe; Bushman, Frederic D

2010-07-30

Intense interest centers on the role of the human gut microbiome in health and disease, but optimal methods for analysis are still under development. Here we present a study of methods for surveying bacterial communities in human feces using 454/Roche pyrosequencing of 16S rRNA gene tags. We analyzed fecal samples from 10 individuals and compared methods for storage, DNA purification and sequence acquisition. To assess reproducibility, we compared samples one cm apart on a single stool specimen for each individual. To analyze storage methods, we compared 1) immediate freezing at -80 degrees C, 2) storage on ice for 24 or 3) 48 hours. For DNA purification methods, we tested three commercial kits and bead beating in hot phenol. Variations due to the different methodologies were compared to variation among individuals using two approaches--one based on presence-absence information for bacterial taxa (unweighted UniFrac) and the other taking into account their relative abundance (weighted UniFrac). In the unweighted analysis relatively little variation was associated with the different analytical procedures, and variation between individuals predominated. In the weighted analysis considerable variation was associated with the purification methods. Particularly notable was improved recovery of Firmicutes sequences using the hot phenol method. We also carried out surveys of the effects of different 454 sequencing methods (FLX versus Titanium) and amplification of different 16S rRNA variable gene segments. Based on our findings we present recommendations for protocols to collect, process and sequence bacterial 16S rDNA from fecal samples--some major points are 1) if feasible, bead-beating in hot phenol or use of the PSP kit improves recovery; 2) storage methods can be adjusted based on experimental convenience; 3) unweighted (presence-absence) comparisons are less affected by lysis method.

Inhibition of Protein Synthesis on the Ribosome by Tildipirosin Compared with Other Veterinary Macrolides

PubMed Central

Andersen, Niels Møller; Poehlsgaard, Jacob; Warrass, Ralf

2012-01-01

Tildipirosin is a 16-membered-ring macrolide developed to treat bacterial pathogens, including Mannheimia haemolytica and Pasteurella multocida, that cause respiratory tract infections in cattle and swine. Here we evaluated the efficacy of tildipirosin at inhibiting protein synthesis on the ribosome (50% inhibitory concentration [IC50], 0.23 ± 0.01 μM) and compared it with the established veterinary macrolides tylosin, tilmicosin, and tulathromycin. Mutation and methylation at key rRNA nucleotides revealed differences in the interactions of these macrolides within their common ribosomal binding site. PMID:22926570

Bacterial DNA detected on pathologically changed heart valves using 16S rRNA gene amplification.

PubMed

Chalupova, Miroslava; Skalova, Anna; Hajek, Tomas; Geigerova, Lenka; Kralova, Dana; Liska, Pavel; Hecova, Hana; Molacek, Jiri; Hrabak, Jaroslav

2018-05-22

Nowadays, dental diseases are one of the most common illnesses in the world. Some of them can lead to translocation of oral bacteria to the bloodstream causing intermittent bacteraemia. Therefore, a potential association between oral infection and cardiovascular diseases has been discussed in recent years as a result of adhesion of oral microbes to the heart valves. The aim of this study was to detect oral bacteria on pathologically changed heart valves not caused by infective endocarditis. In the study, patients with pathologically changed heart valves were involved. Samples of heart valves removed during heart valve replacement surgery were cut into two parts. One aliquot was cultivated aerobically and anaerobically. Bacterial DNA was extracted using Ultra-Deep Microbiome Prep (Molzym GmbH, Bremen, Germany) followed by a 16S rRNA gene PCR amplification using Mastermix 16S Complete kit (Molzym GmbH, Bremen, Germany). Positive PCR products were sequenced and the sequences were analyzed using BLAST database ( http://www.ncbi.nlm.nih/BLAST ). During the study period, 41 samples were processed. Bacterial DNA of the following bacteria was detected in 21 samples: Cutibacterium acnes (formerly Propionibacterium acnes) (n = 11; 52.38% of patients with positive bacterial DNA detection), Staphylococcus sp. (n = 9; 42.86%), Streptococcus sp. (n = 1; 4.76%), Streptococcus sanguinis (n = 4; 19.05%), Streptococcus oralis (n = 1; 4.76%), Carnobacterium sp. (n = 1; 4.76%), Bacillus sp. (n = 2; 9.52%), and Bergeyella sp. (n = 1; 4.76%). In nine samples, multiple bacteria were found. Our results showed significant appearance of bacteria on pathologically changed heart valves in patients with no symptoms of infective endocarditis.

The eukaryote-specific N-terminal extension of ribosomal protein S31 contributes to the assembly and function of 40S ribosomal subunits

PubMed Central

Fernández-Pevida, Antonio; Martín-Villanueva, Sara; Murat, Guillaume; Lacombe, Thierry; Kressler, Dieter; de la Cruz, Jesús

2016-01-01

The archaea-/eukaryote-specific 40S-ribosomal-subunit protein S31 is expressed as an ubiquitin fusion protein in eukaryotes and consists of a conserved body and a eukaryote-specific N-terminal extension. In yeast, S31 is a practically essential protein, which is required for cytoplasmic 20S pre-rRNA maturation. Here, we have studied the role of the N-terminal extension of the yeast S31 protein. We show that deletion of this extension partially impairs cell growth and 40S subunit biogenesis and confers hypersensitivity to aminoglycoside antibiotics. Moreover, the extension harbours a nuclear localization signal that promotes active nuclear import of S31, which associates with pre-ribosomal particles in the nucleus. In the absence of the extension, truncated S31 inefficiently assembles into pre-40S particles and two subpopulations of mature small subunits, one lacking and another one containing truncated S31, can be identified. Plasmid-driven overexpression of truncated S31 partially suppresses the growth and ribosome biogenesis defects but, conversely, slightly enhances the hypersensitivity to aminoglycosides. Altogether, these results indicate that the N-terminal extension facilitates the assembly of S31 into pre-40S particles and contributes to the optimal translational activity of mature 40S subunits but has only a minor role in cytoplasmic cleavage of 20S pre-rRNA at site D. PMID:27422873

[Investigation of bacterial diversity in the biological desulfurization reactor for treating high salinity wastewater by the 16S rDNA cloning method].

PubMed

Liu, Wei-Guo; Liang, Cun-Zhen; Yang, Jin-Sheng; Wang, Gui-Ping; Liu, Miao-Miao

2013-02-01

The bacterial diversity in the biological desulfurization reactor operated continuously for 1 year was studied by the 16S rDNA cloning and sequencing method. Forty clones were randomly selected and their partial 16S rDNA genes (ca. 1,400 bp) were sequenced and blasted. The results indicated that there were dominant bacterias in the biological desulfurization reactor, where 33 clones belonged to 3 different published phyla, while 1 clone belonged to unknown phylum. The dominant bacterial community in the system was Proteobacteria, which accounted for 85.3%. The bacterial community succession was as follows: the gamma-Proteobacteria(55.9%), beta-Proteobacteria(17.6%), Actinobacteridae (8.8%), delta-Proteobacteria (5.9%) , alpha-Proteobacteria(5.9%), and Sphingobacteria (2.9%). Halothiobacillus sp. ST15 and Thiobacillus sp. UAM-I were the major desulfurization strains.

Ribonucleic Acid and Ribosomes of Bacillus stearothermophilus1

PubMed Central

Saunders, Grady F.; Campbell, L. Leon

1966-01-01

Saunders, Grady F. (University of Illinois, Urbana), and L. Leon Campbell. Ribonucleic acid and ribosomes of Bacillus stearothermophilus. J. Bacteriol. 91:332–339. 1966.—The ability of some thermophilic bacteria to grow at temperatures as high as 76 C emphasizes the remarkable thermal stability of their crucial macromolecules. An investigation of the ribonucleic acid (RNA) and ribosomes of Bacillus stearothermophilus was conducted. Washed log-phase cells were disrupted either by sonic treatment or by alumina grinding in 10−2m MgCl2–10−2m tris-(hydroxymethyl)aminomethane buffer, pH 7.4 (TM buffer). Ultracentrifugal analysis revealed peaks at 72.5S, 101S, and 135S, with the 101S peak being the most prominent. By lowering the Mg++ concentration to 10−3m, the ribosome preparation was dissociated to give 40S, 31S, and 54S peaks. These in turn were reassociated in the presence of 10−2m Mg++ to give the larger 73S and 135S particles. When heated in TM buffer, Escherichia coli ribosomes began a gradual dissociation at 58 C, and at 70 C underwent a large hyperchromic shift with a Tm at 72.8 C. In contrast, B. stearothermophilus ribosomes did not show a hyperchromic shift below 70 C; they had a Tm of 77.9 C. The thermal denaturation curves of the 4S, 16S, and 23S RNA from both organisms were virtually identical. The gross amino acid composition of B. stearothermophilus ribosomes showed no marked differences from that reported for E. coli ribosomes. These data suggest that the unusual thermal stability of B. stearothermophilus ribosomes may reflect either an unusual packing arrangement of the protein to the RNA or differences in the primary structure of the ribosomal proteins. Images PMID:5903099

Purification, characterization and crystallization of the human 80S ribosome

PubMed Central

Khatter, Heena; Myasnikov, Alexander G.; Mastio, Leslie; Billas, Isabelle M. L.; Birck, Catherine; Stella, Stefano; Klaholz, Bruno P.

2014-01-01

Ribosomes are key macromolecular protein synthesis machineries in the cell. Human ribosomes have so far not been studied to atomic resolution because of their particularly complex structure as compared with other eukaryotic or prokaryotic ribosomes, and they are difficult to prepare to high homogeneity, which is a key requisite for high-resolution structural work. We established a purification protocol for human 80S ribosomes isolated from HeLa cells that allows obtaining large quantities of homogenous samples as characterized by biophysical methods using analytical ultracentrifugation and multiangle laser light scattering. Samples prepared under different conditions were characterized by direct single particle imaging using cryo electron microscopy, which helped optimizing the preparation protocol. From a small data set, a 3D reconstruction at subnanometric resolution was obtained showing all prominent structural features of the human ribosome, and revealing a salt concentration dependence of the presence of the exit site tRNA, which we show is critical for obtaining crystals. With these well-characterized samples first human 80S ribosome crystals were obtained from several crystallization conditions in capillaries and sitting drops, which diffract to 26 Å resolution at cryo temperatures and for which the crystallographic parameters were determined, paving the way for future high-resolution work. PMID:24452798

Detection of a mixed infection in a culture-negative brain abscess by broad-spectrum bacterial 16S rRNA gene PCR.

PubMed

Keller, Peter M; Rampini, Silvana K; Bloemberg, Guido V

2010-06-01

We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis.

From learning taxonomies to phylogenetic learning: integration of 16S rRNA gene data into FAME-based bacterial classification.

PubMed

Slabbinck, Bram; Waegeman, Willem; Dawyndt, Peter; De Vos, Paul; De Baets, Bernard

2010-01-30

Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for the discrimination of bacterial

From learning taxonomies to phylogenetic learning: Integration of 16S rRNA gene data into FAME-based bacterial classification

PubMed Central

2010-01-01

Background Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. Results In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. Conclusions FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for

Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

PubMed

Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

2018-04-24

Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

Comparative study between prokaryotes and eukaryotes by chemical iodination of ribosomal proteins.

PubMed

Bernabeu, C; Vázquez, D; Conde, F P

1979-04-25

Escherichia coli and Saccharomyces cerevisiae ribosomal proteins were chemically iodinated with 125I by chloramine T under conditions in which the proteins were denatured. The labelled proteins were subsequently separated by two-dimensional gel electrophoresis with an excess of untreated ribosomal proteins from the same species. The iodination did not change the electrophoretic mobility of the proteins as shown by the pattern of spots in the stained gel slabs and their autoradiography. The 125I radioactivity incorporated in the proteins was estimated by cutting out the gel spots from the two-dimensional electrophoresis gel slabs. The highest content of 125I was found in the ribosomal proteins L2, L11, L13, L20/S12, S4 and S9 from E. coli, and L2/L3, L4/L6/S7, L5, L19/L20, L22/S17, L29/S27, L35/L37 and S14/S15 from S. cerevisiae. Comparisons between the electrophoretic patterns of E. coli and S. cerevisiae ribosomal proteins were carried out by coelectrophoresis of labelled and unlabelled proteins from both species. E. coli ribosomal proteins L5, L11, L20, S2, S3 and S15/S16 were found to overlap with L15, L11/L16, L36/L37, S3, S10 and S33 from S. cerevisiae, respectively. Similar coelectrophoresis of E. coli 125I-labelled proteins with unlabelled rat liver and wheat germ ribosomal proteins showed the former to overlap with proteins L1, L11, L14, L16, L19, L20 and the latter with L2, L5, L6, L15, L17 from E. coli.

Sequential protein association with nascent 60S ribosomal particles.

PubMed

Saveanu, Cosmin; Namane, Abdelkader; Gleizes, Pierre-Emmanuel; Lebreton, Alice; Rousselle, Jean-Claude; Noaillac-Depeyre, Jacqueline; Gas, Nicole; Jacquier, Alain; Fromont-Racine, Micheline

2003-07-01

Ribosome biogenesis in eukaryotes depends on the coordinated action of ribosomal and nonribosomal proteins that guide the assembly of preribosomal particles. These intermediate particles follow a maturation pathway in which important changes in their protein composition occur. The mechanisms involved in the coordinated assembly of the ribosomal particles are poorly understood. We show here that the association of preribosomal factors with pre-60S complexes depends on the presence of earlier factors, a phenomenon essential for ribosome biogenesis. The analysis of the composition of purified preribosomal complexes blocked in maturation at specific steps allowed us to propose a model of sequential protein association with, and dissociation from, early pre-60S complexes for several preribosomal factors such as Mak11, Ssf1, Rlp24, Nog1, and Nog2. The presence of either Ssf1 or Nog2 in complexes that contain the 27SB pre-rRNA defines novel, distinct pre-60S particles that contain the same pre-rRNA intermediates and that differ only by the presence or absence of specific proteins. Physical and functional interactions between Rlp24 and Nog1 revealed that the assembly steps are, at least in part, mediated by direct protein-protein interactions.

Bacterial 16S rRNA gene analysis revealed that bacteria related to Arcobacter spp. constitute an abundant and common component of the oyster microbiota (Tiostrea chilensis).

PubMed

Romero, J; García-Varela, M; Laclette, J P; Espejo, R T

2002-11-01

To explore the bacterial microbiota in Chilean oyster (Tiostrea chilensis), a molecular approach that permits detection of different bacteria, independently of their capacity to grow in culture media, was used. Bacterial diversity was assessed by analysis of both the 16S rDNA and the 16S-23S intergenic region, obtained by PCR amplifications of DNA extracted from depurated oysters. RFLP of the PCR amplified 16S rDNA showed a prevailing pattern in most of the individuals analyzed, indicating that a few bacterial species were relatively abundant and common in oysters. Cloning and sequencing of the 16S rDNA with the prevailing RFLP pattern indicated that this rRNA was most closely related to Arcobacter spp. However, analysis by the size of the amplified 16S-23S rRNA intergenic regions revealed not Arcobacter spp. but Staphylococcus spp. related bacteria as a major and common component in oyster. These different results may be caused by the absence of target for one of the primers employed for amplification of the intergenic region. Neither of the two bacteria species found in large abundance was recovered after culturing under aerobic, anaerobic, or microaerophilic conditions. This result, however, is expected because the number of bacteria recovered after cultivation was less than 0.01% of the total. All together, these observations suggest that Arcobacter-related strains are probably abundant and common in the Chilean oyster bacterial microbiota.

The eukaryote-specific N-terminal extension of ribosomal protein S31 contributes to the assembly and function of 40S ribosomal subunits.

PubMed

Fernández-Pevida, Antonio; Martín-Villanueva, Sara; Murat, Guillaume; Lacombe, Thierry; Kressler, Dieter; de la Cruz, Jesús

2016-09-19

The archaea-/eukaryote-specific 40S-ribosomal-subunit protein S31 is expressed as an ubiquitin fusion protein in eukaryotes and consists of a conserved body and a eukaryote-specific N-terminal extension. In yeast, S31 is a practically essential protein, which is required for cytoplasmic 20S pre-rRNA maturation. Here, we have studied the role of the N-terminal extension of the yeast S31 protein. We show that deletion of this extension partially impairs cell growth and 40S subunit biogenesis and confers hypersensitivity to aminoglycoside antibiotics. Moreover, the extension harbours a nuclear localization signal that promotes active nuclear import of S31, which associates with pre-ribosomal particles in the nucleus. In the absence of the extension, truncated S31 inefficiently assembles into pre-40S particles and two subpopulations of mature small subunits, one lacking and another one containing truncated S31, can be identified. Plasmid-driven overexpression of truncated S31 partially suppresses the growth and ribosome biogenesis defects but, conversely, slightly enhances the hypersensitivity to aminoglycosides. Altogether, these results indicate that the N-terminal extension facilitates the assembly of S31 into pre-40S particles and contributes to the optimal translational activity of mature 40S subunits but has only a minor role in cytoplasmic cleavage of 20S pre-rRNA at site D. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Satratoxin G interaction with 40S and 60S ribosomal subunits precedes apoptosis in the macrophage

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bae, Hee Kyong; Shinozuka, Junko; Islam, Zahidul

2009-06-01

Satratoxin G (SG) and other macrocyclic trichothecene mycotoxins are potent inhibitors of eukaryotic translation that are potentially immunosuppressive. The purpose of this research was to test the hypothesis that SG-induced apoptosis in the macrophage correlates with binding of this toxin to the ribosome. Exposure of RAW 264.7 murine macrophages to SG at concentrations of 10 to 80 ng/ml induced DNA fragmentation within 4 h that was indicative of apoptosis. To relate these findings to ribosome binding of SG, RAW cells were exposed to different toxin concentrations for various time intervals, ribosomal fractions isolated by sucrose density gradient ultracentrifugation and resultantmore » fractions analyzed for SG by competitive ELISA. SG was found to specifically interact with 40S and 60S ribosomal subunits as early as 5 min and that, at high concentrations or extended incubation times, the toxin induced polysome disaggregation. While co-incubation with the simple Type B trichothecene DON had no effect on SG uptake into cell cytoplasm, it inhibited SG binding to the ribosome, suggesting that the two toxins bound to identical sites and that SG binding was reversible. Although both SG and DON induced mobilization of p38 and JNK 1/2 to the ribosome, phosphorylation of ribosomal bound MAPKs occurred only after DON treatment. SG association with the 40S and 60S subunits was also observed in the PC-12 neuronal cell model which is similarly susceptible to apoptosis. To summarize, SG rapidly binds small and large ribosomal subunits in a concentration- and time-dependent manner that was consistent with induction of apoptosis.« less

Interaction of tetracycline with RNA: photoincorporation into ribosomal RNA of Escherichia coli.

PubMed Central

Oehler, R; Polacek, N; Steiner, G; Barta, A

1997-01-01

Photolysis of [3H]tetracycline in the presence of Escherichia coli ribosomes results in an approximately 1:1 ratio of labelling ribosomal proteins and RNAs. In this work we characterize crosslinks to both 16S and 23S RNAs. Previously, the main target of photoincorporation of [3H]tetracycline into ribosomal proteins was shown to be S7, which is also part of the one strong binding site of tetracycline on the 30S subunit. The crosslinks on 23S RNA map exclusively to the central loop of domain V (G2505, G2576 and G2608) which is part of the peptidyl transferase region. However, experiments performed with chimeric ribosomal subunits demonstrate that peptidyltransferase activity is not affected by tetracycline crosslinked solely to the 50S subunits. Three different positions are labelled on the 16S RNA, G693, G1300 and G1338. The positions of these crosslinked nucleotides correlate well with footprints on the 16S RNA produced either by tRNA or the protein S7. This suggests that the nucleotides are labelled by tetracycline bound to the strong binding site on the 30S subunit. In addition, our results demonstrate that the well known inhibition of tRNA binding to the A-site is solely due to tetracycline crosslinked to 30S subunits and furthermore suggest that interactions of the antibiotic with 16S RNA might be involved in its mode of action. PMID:9092632

Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

PubMed Central

Dron, M; Rahire, M; Rochaix, J D

1982-01-01

The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784

Deletion of L4 domains reveals insights into the importance of ribosomal protein extensions in eukaryotic ribosome assembly.

PubMed

Gamalinda, Michael; Woolford, John L

2014-11-01

Numerous ribosomal proteins have a striking bipartite architecture: a globular body positioned on the ribosomal exterior and an internal loop buried deep into the rRNA core. In eukaryotes, a significant number of conserved r-proteins have evolved extra amino- or carboxy-terminal tail sequences, which thread across the solvent-exposed surface. The biological importance of these extended domains remains to be established. In this study, we have investigated the universally conserved internal loop and the eukaryote-specific extensions of yeast L4. We show that in contrast to findings with bacterial L4, deleting the internal loop of yeast L4 causes severely impaired growth and reduced levels of large ribosomal subunits. We further report that while depleting the entire L4 protein blocks early assembly steps in yeast, deletion of only its extended internal loop affects later steps in assembly, revealing a second role for L4 during ribosome biogenesis. Surprisingly, deletion of the entire eukaryote-specific carboxy-terminal tail of L4 has no effect on viability, production of 60S subunits, or translation. These unexpected observations provide impetus to further investigate the functions of ribosomal protein extensions, especially eukaryote-specific examples, in ribosome assembly and function. © 2014 Gamalinda and Woolford; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Protein-protein interactions within late pre-40S ribosomes.

PubMed

Campbell, Melody G; Karbstein, Katrin

2011-01-20

Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp

Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly,more » cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.« less

Identification of the bacterial etiology of culture-negative endocarditis by amplification and sequencing of a small ribosomal RNA gene.

PubMed

Khulordava, Irakli; Miller, Geraldine; Haas, David; Li, Haijing; McKinsey, Joel; Vanderende, Daniel; Tang, Yi-Wei

2003-05-01

We report two cases of culture-negative bacterial endocarditis in which the organisms were identified by amplification and sequencing of the bacterial 16S rRNA gene. These results support an important role for polymerase chain reaction followed by direct sequencing to determine the etiology of culture-negative bacterial endocarditis and to guide appropriate antimicrobial therapy.

The 5S RNP Couples p53 Homeostasis to Ribosome Biogenesis and Nucleolar Stress

PubMed Central

Sloan, Katherine E.; Bohnsack, Markus T.; Watkins, Nicholas J.

2013-01-01

Summary Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14ARF, a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. PMID:24120868

Protein-Protein Interactions within Late Pre-40S Ribosomes

PubMed Central

Campbell, Melody G.; Karbstein, Katrin

2011-01-01

Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps. PMID:21283762

Seasonal Change in Bacterial Flora and Biomass in Mountain Snow from the Tateyama Mountains, Japan, Analyzed by 16S rRNA Gene Sequencing and Real-Time PCR

PubMed Central

Segawa, Takahiro; Miyamoto, Koji; Ushida, Kazunari; Agata, Kiyokazu; Okada, Norihiro; Kohshima, Shiro

2005-01-01

The bacterial flora and biomass in mountain snow from the Tateyama Mountains, Toyama Prefecture, Japan, one of the heaviest snowfall regions in the world, were analyzed by amplified ribosomal DNA restriction analysis followed by 16S rRNA gene sequencing and DNA quantification by real-time PCR. Samples of surface snow collected in various months during the melting season contained a psychrophilic bacterium, Cryobacterium psychrophilum, and two psychrotrophic bacteria, Variovorax paradoxus and Janthinobacterium lividum. Bacterial colonies that developed in an in situ meltwater medium at 4°C were revealed to be V. paradoxus. The biomasses of C. psychrophilum, J. lividum, and V. paradoxus, as estimated by real-time PCR, showed large increases during the melting season from March to October (2.0 × 105-fold, 1.5 × 105-fold, and 1.0 × 104-fold increases, respectively), suggesting their rapid growth in the surface snow. The biomasses of C. psychrophilum and J. lividum increased significantly from March to April, reached a maximum in August, and dropped at the end of the melting season. In contrast, the biomass of V. paradoxus did not increase as rapidly during the early melting season but continued to increase from June until October. The differences in development observed among these bacterial species suggest that their growth was promoted by different nutrients and/or environmental conditions in the snow. Since these three types of bacteria have also been reported to be present in a glacier in Antarctica and a Greenland ice core, they seem to be specialized members of the snow biota that are distributed in snow and ice environments in various parts of the world. PMID:15640179

Seasonal change in bacterial flora and biomass in mountain snow from the Tateyama Mountains, Japan, analyzed by 16S rRNA gene sequencing and real-time PCR.

PubMed

Segawa, Takahiro; Miyamoto, Koji; Ushida, Kazunari; Agata, Kiyokazu; Okada, Norihiro; Kohshima, Shiro

2005-01-01

The bacterial flora and biomass in mountain snow from the Tateyama Mountains, Toyama Prefecture, Japan, one of the heaviest snowfall regions in the world, were analyzed by amplified ribosomal DNA restriction analysis followed by 16S rRNA gene sequencing and DNA quantification by real-time PCR. Samples of surface snow collected in various months during the melting season contained a psychrophilic bacterium, Cryobacterium psychrophilum, and two psychrotrophic bacteria, Variovorax paradoxus and Janthinobacterium lividum. Bacterial colonies that developed in an in situ meltwater medium at 4 degrees C were revealed to be V. paradoxus. The biomasses of C. psychrophilum, J. lividum, and V. paradoxus, as estimated by real-time PCR, showed large increases during the melting season from March to October (2.0 x 10(5)-fold, 1.5 x 10(5)-fold, and 1.0 x 10(4)-fold increases, respectively), suggesting their rapid growth in the surface snow. The biomasses of C. psychrophilum and J. lividum increased significantly from March to April, reached a maximum in August, and dropped at the end of the melting season. In contrast, the biomass of V. paradoxus did not increase as rapidly during the early melting season but continued to increase from June until October. The differences in development observed among these bacterial species suggest that their growth was promoted by different nutrients and/or environmental conditions in the snow. Since these three types of bacteria have also been reported to be present in a glacier in Antarctica and a Greenland ice core, they seem to be specialized members of the snow biota that are distributed in snow and ice environments in various parts of the world.

Phylogenetic characterization of a biogas plant microbial community integrating clone library 16S-rDNA sequences and metagenome sequence data obtained by 454-pyrosequencing.

PubMed

Kröber, Magdalena; Bekel, Thomas; Diaz, Naryttza N; Goesmann, Alexander; Jaenicke, Sebastian; Krause, Lutz; Miller, Dimitri; Runte, Kai J; Viehöver, Prisca; Pühler, Alfred; Schlüter, Andreas

2009-06-01

The phylogenetic structure of the microbial community residing in a fermentation sample from a production-scale biogas plant fed with maize silage, green rye and liquid manure was analysed by an integrated approach using clone library sequences and metagenome sequence data obtained by 454-pyrosequencing. Sequencing of 109 clones from a bacterial and an archaeal 16S-rDNA amplicon library revealed that the obtained nucleotide sequences are similar but not identical to 16S-rDNA database sequences derived from different anaerobic environments including digestors and bioreactors. Most of the bacterial 16S-rDNA sequences could be assigned to the phylum Firmicutes with the most abundant class Clostridia and to the class Bacteroidetes, whereas most archaeal 16S-rDNA sequences cluster close to the methanogen Methanoculleus bourgensis. Further sequences of the archaeal library most probably represent so far non-characterised species within the genus Methanoculleus. A similar result derived from phylogenetic analysis of mcrA clone sequences. The mcrA gene product encodes the alpha-subunit of methyl-coenzyme-M reductase involved in the final step of methanogenesis. BLASTn analysis applying stringent settings resulted in assignment of 16S-rDNA metagenome sequence reads to 62 16S-rDNA amplicon sequences thus enabling frequency of abundance estimations for 16S-rDNA clone library sequences. Ribosomal Database Project (RDP) Classifier processing of metagenome 16S-rDNA reads revealed abundance of the phyla Firmicutes, Bacteroidetes and Euryarchaeota and the orders Clostridiales, Bacteroidales and Methanomicrobiales. Moreover, a large fraction of 16S-rDNA metagenome reads could not be assigned to lower taxonomic ranks, demonstrating that numerous microorganisms in the analysed fermentation sample of the biogas plant are still unclassified or unknown.

Design and Evaluation of PCR Primers for Analysis of Bacterial Populations in Wine by Denaturing Gradient Gel Electrophoresis

PubMed Central

Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.

2003-01-01

Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643

The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

PubMed

Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

2013-10-17

Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

A framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates.

PubMed

Helbling, Damian E; Johnson, David R; Lee, Tae Kwon; Scheidegger, Andreas; Fenner, Kathrin

2015-03-01

The rates at which wastewater treatment plant (WWTP) microbial communities biotransform specific substrates can differ by orders of magnitude among WWTP communities. Differences in taxonomic compositions among WWTP communities may predict differences in the rates of some types of biotransformations. In this work, we present a novel framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates. We selected ten WWTPs with substantial variation in their environmental and operational metrics and measured the in situ ammonia biotransformation rate constants in nine of them. We isolated total RNA from samples from each WWTP and analyzed 16S rRNA sequence reads. We then developed multivariate models between the measured abundances of specific bacterial 16S rRNA sequence reads and the ammonia biotransformation rate constants. We constructed model scenarios that systematically explored the effects of model regularization, model linearity and non-linearity, and aggregation of 16S rRNA sequences into operational taxonomic units (OTUs) as a function of sequence dissimilarity threshold (SDT). A large percentage (greater than 80%) of model scenarios resulted in well-performing and significant models at intermediate SDTs of 0.13-0.14 and 0.26. The 16S rRNA sequences consistently selected into the well-performing and significant models at those SDTs were classified as Nitrosomonas and Nitrospira groups. We then extend the framework by applying it to the biotransformation rate constants of ten micropollutants measured in batch reactors seeded with the ten WWTP communities. We identified phylogenetic groups that were robustly selected into all well-performing and significant models constructed with biotransformation rates of isoproturon, propachlor, ranitidine, and venlafaxine. These phylogenetic groups can be used as predictive biomarkers of WWTP microbial community activity towards these specific

Diversity of Bacterial Communities in Container Habitats of Mosquitoes

PubMed Central

Ponnusamy, Loganathan; Xu, Ning; Stav, Gil; Wesson, Dawn M.; Schal, Coby

2010-01-01

We investigated the bacterial diversity of microbial communities in water-filled, human-made and natural container habitats of the mosquitoes Aedes aegypti and Aedes albopictus in suburban landscapes of New Orleans, Louisiana in 2003. We collected water samples from three classes of containers, including tires (n=12), cemetery urns (n=23), and miscellaneous containers that included two tree holes (n=19). Total genomic DNA was extracted from water samples, and 16S ribosomal DNA fragments (operational taxonomic units, OTUs) were amplified by PCR and separated by denaturing gradient gel electrophoresis (DGGE). The bacterial communities in containers represented diverse DGGE-DNA banding patterns that were not related to the class of container or to the local spatial distribution of containers. Mean richness and evenness of OTUs were highest in water samples from tires. Bacterial phylotypes were identified by comparative sequence analysis of 90 16S rDNA DGGE band amplicons. The majority of sequences were placed in five major taxa: Alpha-, Beta- and Gammaproteobacteria, Actinobacteria, Bacteroidetes, Cyanobacteria, Firmicutes, and an unclassified group; Proteobacteria and Bacteroidetes were the predominant heterotrophic bacteria in containers. The bacterial communities in human-made containers consisted mainly of undescribed species, and a phylogenetic analysis based on 16S rRNA sequences suggested that species composition was independent of both container type and the spatial distribution of containers. Comparative PCR-based, cultivation-independent rRNA surveys of microbial communities associated with mosquito habitats can provide significant insight into community organization and dynamics of bacterial species. PMID:18373113

Acquisition of 16S rRNA methylase gene in Pseudomonas aeruginosa.

PubMed

Yokoyama, Keiko; Doi, Yohei; Yamane, Kunikazu; Kurokawa, Hiroshi; Shibata, Naohiro; Shibayama, Keigo; Yagi, Tetsuya; Kato, Haru; Arakawa, Yoshichika

2003-12-06

Bacteria develop resistance to aminoglycosides by producing aminoglycoside-modifying enzymes such as acetyltransferase, phosphorylase, and adenyltransferase. These enzymes, however, cannot confer consistent resistance to various aminoglycosides because of their substrate specificity. Notwithstanding, a Pseudomonas aeruginosa strain AR-2 showing high-level resistance (minimum inhibitory concentration >1024 mg/L) to various aminoglycosides was isolated clinically. We aimed to clone and characterise the genetic determinant of this resistance. We used conventional methods for DNA manipulation, susceptibility testing, and gene analyses to clone and characterise the genetic determinant of the resistance seen. PCR detection of the gene was also done on a stock of P aeruginosa strains that were isolated clinically since 1997. An aminoglycoside-resistance gene, designated rmtA, was identified in P aeruginosa AR-2. The Escherichia coli transformant and transconjugant harbouring the rmtA gene showed very high-level resistance to various aminoglycosides, including amikacin, tobramycin, isepamicin, arbekacin, kanamycin, and gentamicin. The 756-bp nucleotide rmtA gene encoded a protein, RmtA. This protein showed considerable similarity to the 16S rRNA methylases of aminoglycoside-producing actinomycetes, which protect bacterial 16S rRNA from intrinsic aminoglycosides by methylation. Incorporation of radiolabelled methyl groups into the 30S ribosome was detected in the presence of RmtA. Of 1113 clinically isolated P aeruginosa strains, nine carried the rmtA gene, as shown by PCR analyses. Our findings strongly suggest intergeneric lateral gene transfer of 16S rRNA methylase gene from some aminoglycoside-producing microorganisms to P aeruginosa. Further dissemination of the rmtA gene in nosocomial bacteria could be a matter of concern in the future.

Automated Identification of Medically Important Bacteria by 16S rRNA Gene Sequencing Using a Novel Comprehensive Database, 16SpathDB▿

PubMed Central

Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

2011-01-01

Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154

Differentiation of the Ribosomal Protein Compositions in the Genus Escherichia and Its Related Bacteria

PubMed Central

Osawa, Syozo; Itoh, Takuzi; Otaka, Eiko

1971-01-01

Compositions of the ribosomal proteins of 60 bacterial strains belonging to the genus Escherichia and its related genera were examined by use of a column of carboxymethyl cellulose. The ribosomes were classified into seven groups and were further differentiated into several types (subgroups) according to their protein compositions. It was shown that ribosomal protein composition is a useful characteristic for studies of bacterial taxonomy. PMID:5563866

Cross-linking of initiation factor IF3 to Escherichia coli 30S ribosomal subunit by trans-diamminedichloroplatinum(II): characterization of two cross-linking sites in 16S rRNA; a possible way of functioning for IF3.

PubMed Central

Ehresmann, C; Moine, H; Mougel, M; Dondon, J; Grunberg-Manago, M; Ebel, J P; Ehresmann, B

1986-01-01

The initiation factor IF3 is platinated with trans-diamminedichloroplatinum(II) and cross-linked to Escherichia coli 30S ribosomal subunit. Two cross-linking sites are unambiguously identified on the 16S rRNA: a major one, in the region 819-859 in the central domain, and a minor one, in the region 1506-1529 in the 3'-terminal domain. Specific features of these sequences together with their particular location within the 30S subunit lead us to postulate a role for IF3, that conciliates topographical and functional observations made so far. Images PMID:2425339

Detection of a Mixed Infection in a Culture-Negative Brain Abscess by Broad-Spectrum Bacterial 16S rRNA Gene PCR ▿ †

PubMed Central

Keller, Peter M.; Rampini, Silvana K.; Bloemberg, Guido V.

2010-01-01

We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis. PMID:20392909

Hypermethylation of 28S ribosomal RNA in β-thalassemia trait carriers.

PubMed

Sornjai, Wannapa; Lithanatudom, Pathrapol; Erales, Jenny; Joly, Philippe; Francina, Alain; Hacot, Sabine; Fucharoen, Suthat; Svasti, Saovaros; Diaz, Jean Jacques; Mertani, Hichem C; Smith, Duncan R

2017-01-01

Ribosome biogenesis is the process of synthesis of the cellular ribosomes which mediate protein translation. Integral with the ribosomes are four cytoplasmic ribosomal RNAs (rRNAs) which show extensive post-transcriptional modifications including 2'-O-methylation and pseudouridylation. Several hereditary hematologic diseases including Diamond-Blackfan anemia have been shown to be associated with defects in ribosome biogenesis. Thalassemia is the most important hematologic inherited genetic disease worldwide, and this study examined the post-transcriptional ribose methylation status of three specific active sites of the 28S rRNA molecule at positions 1858, 4197 and 4506 of β-thalassemia trait carriers and normal controls. Samples from whole blood and cultured erythroid cells were examined. Results showed that site 4506 was hypermethylated in β-thalassemia trait carriers in both cohorts. Expression of fibrillarin, the ribosomal RNA methyltransferase as well as snoRNAs were additionally quantified by RT-qPCR and evidence of dysregulation was seen. Hemoglobin E trait carriers also showed evidence of dysregulation. These results provide the first evidence that ribosome biogenesis is dysregulated in β-thalassemia trait carriers. Copyright © 2016 Elsevier B.V. All rights reserved.

Translational Control of Hemoglobin Synthesis by an Initiation Factor Required for Recycling of Ribosomes and for their Binding to Messenger RNA

PubMed Central

Kaempfer, Raymond; Kaufman, Jennifer

1972-01-01

The continued recycling of ribosomes during protein synthesis in rabbit reticulocyte lysates at 37° requires an initiation factor whose activity is rapidly lost in the absence of added heme. Partially purified factor (i) fully maintains the polysomes; (ii) inhibits the association of 40S and 60S ribosomal subunits into single ribosomes; (iii) promotes the quantitative entry of added 60S subunits into polysomes; (iv) allows the accumulation of ribosomal subunits, instead of single ribosomes, when initiation is blocked with aurin tricarboxylate; and (v) is absolutely required for the binding of globin messenger RNA to ribosomes. These properties suggest that this mammalian initiation factor functions analogously to bacterial IF-3. In addition, the translational control of globin synthesis by heme is exerted, directly or indirectly, through this factor. PMID:4508325

16S partial gene mitochondrial DNA and internal transcribed spacers ribosomal DNA as differential markers of Trichuris discolor populations.

PubMed

Callejón, R; Halajian, A; de Rojas, M; Marrugal, A; Guevara, D; Cutillas, C

2012-05-25

Comparative morphological, biometrical and molecular studies of Trichuris discolor isolated from Bos taurus from Spain and Iran was carried out. Furthermore, Trichuris ovis isolated from B. taurus and Capra hircus from Spain has been, molecularly, analyzed. Morphological studies revealed clear differences between T. ovis and T. discolor isolated from B. taurus but differences were not observed between populations of T. discolor isolated from different geographical regions. Nevertheless, the molecular studies based on the amplification and sequencing of the internal transcribed spacers 1 and 2 ribosomal DNA and 16S partial gene mitochondrial DNA showed clear differences between both populations of T. discolor from Spain and Iran suggesting two cryptic species. Phylogenetic studies corroborated these data. Thus, phylogenetic trees based on ITS1, ITS2 and 16S partial gene sequences showed that individuals of T. discolor from B. taurus from Iran clustered together and separated, with high bootstrap values, of T. discolor isolated from B. taurus from Spain, while populations of T. ovis from B. taurus and C. hircus from Spain clustered together but separated with high bootstrap values of both populations of T. discolor. Furthermore, a comparative phylogenetic study has been carried out with the ITS1and ITS2 sequences of Trichuris species from different hosts. Three clades were observed: the first clustered all the species of Trichuris parasitizing herbivores (T. discolor, T. ovis, Trichuris leporis and Trichuris skrjabini), the second clustered all the species of Trichuris parasitizing omnivores (Trichuris trichiura and Trichuris suis) and finally, the third clustered species of Trichuris parasitizing carnivores (Trichuris muris, Trichuris arvicolae and Trichuris vulpis). Copyright © 2011 Elsevier B.V. All rights reserved.

[Congenital skull base defect causing recurrent bacterial meningitis].

PubMed

Berliner, Elihay; Bar Meir, Maskit; Megged, Orli

2012-08-01

Bacterial meningitis is a life threatening disease. Most patients will experience only one episode throughout life. Children who experience bacterial meningitis more than once, require further immunologic or anatomic evaluation. We report a 9 year old child with five episodes of bacterial meningitis due to a congenital defect of the skull base. A two and a half year old boy first presented to our medical center with pneumococcal meningitis. He was treated with antibiotics and fully recovered. Two months later he presented again with a similar clinical picture. Streptococcus pneumoniae grew in cerebrospinal fluid (CSF) culture. CT scan and later MRI of the brain revealed a defect in the anterior middle fossa floor, with protrusion of brain tissue into the sphenoidal sinus. Corrective surgery was recommended but the parents refused. Three months later, a third episode of pneumococcal meningitis occurred. The child again recovered with antibiotics and this time corrective surgery was performed. Five years later, the boy presented once again with clinical signs and symptoms consistent with bacterial meningitis. CSF culture was positive, but the final identification of the bacteria was conducted by broad spectrum 16S ribosomal RNA PCR (16S rRNA PCR) which revealed a sequence of Neisseria lactamica. CT and MRI showed recurrence of the skull base defect with encephalocele in the sphenoid sinus. The parents again refused neurosurgical intervention. A year later the patient presented with bacterial meningitis. CSF culture obtained after initiation of antibiotics was negative, but actinobacillus was identified in the CSF by 16S rRNA PCR. The patient is scheduled for neurosurgical intervention. In patients with recurrent bacterial meningitis caused by organisms colonizing the oropharynx or nasopharynx, an anatomical defect should be carefully sought and surgically repaired.

The ribosome as a missing link in the evolution of life.

PubMed

Root-Bernstein, Meredith; Root-Bernstein, Robert

2015-02-21

Many steps in the evolution of cellular life are still mysterious. We suggest that the ribosome may represent one important missing link between compositional (or metabolism-first), RNA-world (or genes-first) and cellular (last universal common ancestor) approaches to the evolution of cells. We present evidence that the entire set of transfer RNAs for all twenty amino acids are encoded in both the 16S and 23S rRNAs of Escherichia coli K12; that nucleotide sequences that could encode key fragments of ribosomal proteins, polymerases, ligases, synthetases, and phosphatases are to be found in each of the six possible reading frames of the 16S and 23S rRNAs; and that every sequence of bases in rRNA has information encoding more than one of these functions in addition to acting as a structural component of the ribosome. Ribosomal RNA, in short, is not just a structural scaffold for proteins, but the vestigial remnant of a primordial genome that may have encoded a self-organizing, self-replicating, auto-catalytic intermediary between macromolecules and cellular life. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

The RNA-binding protein Hfq is important for ribosome biogenesis and affects translation fidelity.

PubMed

Andrade, José M; Dos Santos, Ricardo F; Chelysheva, Irina; Ignatova, Zoya; Arraiano, Cecília M

2018-06-01

Ribosome biogenesis is a complex process involving multiple factors. Here, we show that the widely conserved RNA chaperone Hfq, which can regulate sRNA-mRNA basepairing, plays a critical role in rRNA processing and ribosome assembly in Escherichia coli Hfq binds the 17S rRNA precursor and facilitates its correct processing and folding to mature 16S rRNA Hfq assists ribosome assembly and associates with pre-30S particles but not with mature 30S subunits. Inactivation of Hfq strikingly decreases the pool of mature 70S ribosomes. The reduction in ribosome levels depends on residues located in the distal face of Hfq but not on residues found in the proximal and rim surfaces which govern interactions with the sRNAs. Our results indicate that Hfq-mediated regulation of ribosomes is independent of its function as sRNA-regulator. Furthermore, we observed that inactivation of Hfq compromises translation efficiency and fidelity, both features of aberrantly assembled ribosomes. Our work expands the functions of the Sm-like protein Hfq beyond its function in small RNA-mediated regulation and unveils a novel role of Hfq as crucial in ribosome biogenesis and translation. © 2018 The Authors.

The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.

PubMed

MacConnell, W P; Kaplan, N O

1982-05-25

The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes.

16S rRNA analysis provides evidence of biofilms on all components of three infected periprosthetic knees including permanent braided suture.

PubMed

Swearingen, Matthew C; DiBartola, Alex C; Dusane, Devendra; Granger, Jeffrey; Stoodley, Paul

2016-10-01

Bacterial biofilms are the main etiological agent of periprosthetic joint infections (PJI); however, it is unclear if biofilms colonize one or multiple components. Because biofilms can colonize a variety of surfaces, we hypothesized that biofilms would be present on all components. 16S ribosomal RNA (rRNA) gene sequencing analysis was used to identify bacteria recovered from individual components and non-absorbable suture material recovered from three PJI total knee revision cases. Bray-Curtis non-metric multidimensional scaling analysis revealed no significant differences in similarity when factoring component, material type, or suture versus non-suture material, but did reveal significant differences in organism profile between patients (P < 0.001) and negative controls (P < 0.001). Confocal microscopy and a novel agar encasement culturing method also confirmed biofilm growth on a subset of components. While 16S sequencing suggested that the microbiology was more complex than revealed by culture contaminating, bacterial DNA generates a risk of false positives. This report highlights that biofilm bacteria may colonize all infected prosthetic components including braided suture material, and provides further evidence that clinical culture can fail to sufficiently identify the full pathogen profile in PJI cases. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Bacterial community profiling of milk samples as a means to understand culture-negative bovine clinical mastitis.

PubMed

Kuehn, Joanna S; Gorden, Patrick J; Munro, Daniel; Rong, Ruichen; Dong, Qunfeng; Plummer, Paul J; Wang, Chong; Phillips, Gregory J

2013-01-01

Inflammation and infection of bovine mammary glands, commonly known as mastitis, imposes significant losses each year in the dairy industry worldwide. While several different bacterial species have been identified as causative agents of mastitis, many clinical mastitis cases remain culture negative, even after enrichment for bacterial growth. To understand the basis for this increasingly common phenomenon, the composition of bacterial communities from milk samples was analyzed using culture independent pyrosequencing of amplicons of 16S ribosomal RNA genes (16S rDNA). Comparisons were made of the microbial community composition of culture negative milk samples from mastitic quarters with that of non-mastitic quarters from the same animals. Genomic DNA from culture-negative clinical and healthy quarter sample pairs was isolated, and amplicon libraries were prepared using indexed primers specific to the V1-V2 region of bacterial 16S rRNA genes and sequenced using the Roche 454 GS FLX with titanium chemistry. Evaluation of the taxonomic composition of these samples revealed significant differences in the microbiota in milk from mastitic and healthy quarters. Statistical analysis identified seven bacterial genera that may be mainly responsible for the observed microbial community differences between mastitic and healthy quarters. Collectively, these results provide evidence that cases of culture negative mastitis can be associated with bacterial species that may be present below culture detection thresholds used here. The application of culture-independent bacterial community profiling represents a powerful approach to understand long-standing questions in animal health and disease.

Comparison of Primer Sets for Use in Automated Ribosomal Intergenic Spacer Analysis of Aquatic Bacterial Communities: an Ecological Perspective▿

PubMed Central

Jones, Stuart E.; Shade, Ashley L.; McMahon, Katherine D.; Kent, Angela D.

2007-01-01

Two primer sets for automated ribosomal intergenic spacer analysis (ARISA) were used to assess the bacterial community composition (BCC) in Lake Mendota, Wisconsin, over 3 years. Correspondence analysis revealed differences in community profiles generated by different primer sets, but overall ecological patterns were conserved in each case. ARISA is a powerful tool for evaluating BCC change through space and time, regardless of the specific primer set used. PMID:17122397

Bacterial communities associated with four ctenophore genera from the German Bight (North Sea).

PubMed

Hao, Wenjin; Gerdts, Gunnar; Peplies, Jörg; Wichels, Antje

2015-01-01

Intense research has been conducted on jellyfish and ctenophores in recent years. They are increasingly recognized as key elements in the marine ecosystem that serve as critical indicators and drivers of ecosystem performance and change. However, the bacterial community associated with ctenophores is still poorly investigated. Based on automated ribosomal intergenic spacer analysis (ARISA) and 16S ribosomal RNA gene amplicon pyrosequencing, we investigated bacterial communities associated with the frequently occurring ctenophore species Mnemiopsis leidyi, Beroe sp., Bolinopsis infundibulum and Pleurobrachia pileus at Helgoland Roads in the German Bight (North Sea). We observed significant differences between the associated bacterial communities of the different ctenophore species based on ARISA patterns. With respect to bacterial taxa, all ctenophore species were dominated by Proteobacteria as revealed by pyrosequencing. Mnemiopsis leidyi and P. pileus mainly harboured Gammaproteobacteria, with Marinomonas as the dominant phylotype of M. leidyi. By contrast, Pseudoalteromonas and Psychrobacter were the most abundant Gammaproteobacteria in P. pileus. Beroe sp. was mainly dominated by Alphaproteobacteria, particularly by the genus Thalassospira. For B. infundibulum, the bacterial community was composed of Alphaproteobacteria and Gammaproteobacteria in equal parts, which consisted of the genera Thalassospira and Marinomonas. In addition, the bacterial communities associated with M. leidyi display a clear variation over time that needs further investigation. Our results indicate that the bacterial communities associated with ctenophores are highly species- specific. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Stimulation of skeletal muscle myofibrillar protein synthesis, p70 S6 kinase phosphorylation, and ribosomal protein S6 phosphorylation by inhibition of myostatin in mature mice.

PubMed

Welle, Stephen; Burgess, Kerri; Mehta, Sangeeta

2009-03-01

Knocking out myostatin activity during development increases the rate of muscle protein synthesis. The present study was done to determine whether postdevelopmental loss of myostatin activity stimulates myofibrillar protein synthesis and the phosphorylation of some of the proteins involved in regulation of protein synthesis rate. Myostatin activity was inhibited for 4 days, in 4- to 5-mo-old male mice, with injections of an anti-myostatin antibody (JA16). The mean myofibrillar synthesis rate increased 19% (P < 0.01) relative to the mean rate in saline-treated mice, as determined by incorporation of deuterium-labeled phenylalanine. JA16 increased phosphorylation of p70 S6 kinase (S6K) and ribosomal protein S6 (rpS6) 1.9-fold (P < 0.05). It did not affect phosphorylation of eukaryotic initiation factor 4E-binding protein-1 or Akt. Microarrays and real-time PCR analyses indicated that JA16 administration did not selectively enrich levels of mRNAs encoding myofibrillar proteins, ribosomal proteins, or translation initiation and elongation factors. Rapamycin treatment did not affect the rate of myofibrillar protein synthesis whether or not the mice received JA16 injections, although it eliminated the phosphorylation of S6K and rpS6. We conclude that the normal level of myostatin activity in mature muscle is sufficient to inhibit myofibrillar synthesis rate and phosphorylation of S6K and rpS6. Reversal of the inhibition of myofibrillar synthesis with an anti-myostatin antibody is not dependent on mTOR activation.

Structures of proline-rich peptides bound to the ribosome reveal a common mechanism of protein synthesis inhibition

DOE PAGES

Gagnon, Matthieu G.; Roy, Raktim N.; Lomakin, Ivan B.; ...

2016-01-24

Here, with bacterial resistance becoming a serious threat to global public health, antimicrobial peptides (AMPs) have become a promising area of focus in antibiotic research. AMPs are derived from a diverse range of species, from prokaryotes to humans, with a mechanism of action that often involves disruption of the bacterial cell membrane. Proline-rich antimicrobial peptides (PrAMPs) are instead actively transported inside the bacterial cell where they bind and inactivate specific targets. Recently, it was reported that some PrAMPs, such as Bac7 1–35, oncocins and apidaecins, bind and inactivate the bacterial ribosome. Here we report the crystal structures of Bac7 1–35,more » Pyrrhocoricin, Metalnikowin and two oncocin derivatives, bound to the Thermus thermophilus 70S ribosome. Each of the PrAMPs blocks the peptide exit tunnel of the ribosome by simultaneously occupying three well characterized antibioticbinding sites and interferes with the initiation step of translation, thereby revealing a common mechanism of action used by these PrAMPs to inactivate protein synthesis. Our study expands the repertoire of PrAMPs and provides a framework for designing new-generation therapeutics.« less

Structures of proline-rich peptides bound to the ribosome reveal a common mechanism of protein synthesis inhibition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gagnon, Matthieu G.; Roy, Raktim N.; Lomakin, Ivan B.

Here, with bacterial resistance becoming a serious threat to global public health, antimicrobial peptides (AMPs) have become a promising area of focus in antibiotic research. AMPs are derived from a diverse range of species, from prokaryotes to humans, with a mechanism of action that often involves disruption of the bacterial cell membrane. Proline-rich antimicrobial peptides (PrAMPs) are instead actively transported inside the bacterial cell where they bind and inactivate specific targets. Recently, it was reported that some PrAMPs, such as Bac7 1–35, oncocins and apidaecins, bind and inactivate the bacterial ribosome. Here we report the crystal structures of Bac7 1–35,more » Pyrrhocoricin, Metalnikowin and two oncocin derivatives, bound to the Thermus thermophilus 70S ribosome. Each of the PrAMPs blocks the peptide exit tunnel of the ribosome by simultaneously occupying three well characterized antibioticbinding sites and interferes with the initiation step of translation, thereby revealing a common mechanism of action used by these PrAMPs to inactivate protein synthesis. Our study expands the repertoire of PrAMPs and provides a framework for designing new-generation therapeutics.« less

Prevalence of Corynebacterial 16S rRNA Sequences in Patients with Bacterial and “Nonbacterial” Prostatitis

PubMed Central

Tanner, Michael A.; Shoskes, Daniel; Shahed, Asha; Pace, Norman R.

1999-01-01

The etiology of chronic prostatitis syndromes in men is controversial, particularly when positive cultures for established uropathogens are lacking. Although identification of bacteria in prostatic fluid has relied on cultivation and microscopy, most microorganisms in the environment, including some human pathogens, are resistant to cultivation. We report here on an rRNA-based molecular phylogenetic approach to the identification of bacteria in prostate fluid from prostatitis patients. Positive bacterial signals were seen for 65% of patients with chronic prostatitis overall. Seven of 11 patients with bacterial signals but none of 6 patients without bacterial signals were cured with antibiotic-based therapy. Results indicate the occurrence in the prostate fluid of a wide spectrum of bacterial species representing several genera. Most rRNA genes were closely related to those of species belonging to the genera Corynebacterium, Staphylococcus, Peptostreptococcus, Streptococcus, and Escherichia. Unexpectedly, a wide diversity of Corynebacterium species was found in high proportion compared to the proportions of other bacterial species found. A subset of these 16S rRNA sequences represent those of undescribed species on the basis of their positions in phylogenetic trees. These uncharacterized organisms were not detected in control samples, suggesting that the organisms have a role in the disease or are the consequence of the disease. These studies show that microorganisms associated with prostatitis generally occur as complex microbial communities that differ between patients. The results also indicate that microbial communities distinct from those associated with prostatitis may occur at low levels in normal prostatic fluid. PMID:10325338

Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli.

PubMed

Triman, K; Becker, E; Dammel, C; Katz, J; Mori, H; Douthwaite, S; Yapijakis, C; Yoast, S; Noller, H F

1989-10-20

Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance alleles, originally identified by Morgan and co-workers, enable us to follow expression of cloned rRNA genes in vivo. Recessive mutations causing the loss of expression of the cloned 16 S rRNA gene were identified by the loss of the ability of cells to survive on media containing spectinomycin. The mutations were localized by in vitro restriction fragment replacement followed by in vivo marker rescue and were identified by DNA sequence analysis. We report here seven single-base alterations in 16 S rRNA (A146, U153, A350, A359, A538, A1292 and U1293), five of which produce temperature-sensitive spectinomycin resistance and two that produce unconditional loss of resistance. In each case, loss of ribosomal function can be accounted for by disruption of base-pairing in the secondary structure of 16 S rRNA. For the temperature-sensitive mutants, there is a lag period of about two generations between a shift to the restrictive temperature and cessation of growth, implying that the structural defects cause impairment of ribosome assembly.

New Fluorescent Macrolide Derivatives for Studying Interactions of Antibiotics and Their Analogs with the Ribosomal Exit Tunnel.

PubMed

Tereshchenkov, A G; Shishkina, A V; Karpenko, V V; Chertkov, V A; Konevega, A L; Kasatsky, P S; Bogdanov, A A; Sumbatyan, N V

2016-10-01

Novel fluorescent derivatives of macrolide antibiotics related to tylosin bearing rhodamine, fluorescein, Alexa Fluor 488, BODIPY FL, and nitrobenzoxadiazole (NBD) residues were synthesized. The formation of complexes of these compounds with 70S E. coli ribosomes was studied by measuring the fluorescence polarization depending on the ribosome amount at constant concentration of the fluorescent substance. With the synthesized fluorescent tylosin derivatives, the dissociation constants for ribosome complexes with several known antibiotics and macrolide analogs previously obtained were determined. It was found that the fluorescent tylosin derivatives containing BODIPY FL and NBD groups could be used to screen the binding of novel antibiotics to bacterial ribosomes in the macrolide-binding site.

The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

PubMed

Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

2016-08-15

Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES

EPA Science Inventory

This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...

Single 23S rRNA mutations at the ribosomal peptidyl transferase centre confer resistance to valnemulin and other antibiotics in Mycobacterium smegmatis by perturbation of the drug binding pocket.

PubMed

Long, Katherine S; Poehlsgaard, Jacob; Hansen, Lykke H; Hobbie, Sven N; Böttger, Erik C; Vester, Birte

2009-03-01

Tiamulin and valnemulin target the peptidyl transferase centre (PTC) on the bacterial ribosome. They are used in veterinary medicine to treat infections caused by a variety of bacterial pathogens, including the intestinal spirochetes Brachyspira spp. Mutations in ribosomal protein L3 and 23S rRNA have previously been associated with tiamulin resistance in Brachyspira spp. isolates, but as multiple mutations were isolated together, the roles of the individual mutations are unclear. In this work, individual 23S rRNA mutations associated with pleuromutilin resistance at positions 2055, 2447, 2504 and 2572 (Escherichia coli numbering) are introduced into a Mycobacterium smegmatis strain with a single rRNA operon. The single mutations each confer a significant and similar degree of valnemulin resistance and those at 2447 and 2504 also confer cross-resistance to other antibiotics that bind to the PTC in M. smegmatis. Antibiotic footprinting experiments on mutant ribosomes show that the introduced mutations cause structural perturbations at the PTC and reduced binding of pleuromutilin antibiotics. This work underscores the fact that mutations at nucleotides distant from the pleuromutilin binding site can confer the same level of valnemulin resistance as those at nucleotides abutting the bound drug, and suggests that the former function indirectly by altering local structure and flexibility at the drug binding pocket.

Intestinal alkaline phosphatase deficiency leads to dysbiosis and bacterial translocation in the newborn intestine.

PubMed

Fawley, Jason; Koehler, Shannon; Cabrera, Susan; Lam, Vy; Fredrich, Katherine; Hessner, Martin; Salzman, Nita; Gourlay, David

2017-10-01

Intestinal alkaline phosphatase (IAP) has been shown to help maintain intestinal homeostasis. Decreased expression of IAP has been linked with pediatric intestinal diseases associated with bacterial overgrowth and subsequent inflammation. We hypothesize that the absence of IAP leads to dysbiosis, with increased inflammation and permeability of the newborn intestine. Sprague-Dawley heterozygote IAP cross-matches were bred. Pups were dam fed ad lib and euthanized at weaning. The microbiotas of terminal ileum (TI) and colon was determined by quantitative real-time polymerase chain reaction (qRT-PCR) of subphylum-specific bacterial 16S ribosomal RNA. RT-PCR was performed on TI for inflammatory cytokines. Intestinal permeability was quantified by fluorescein isothiocyanate-dextran permeability and bacterial translocation by qRT-PCR for bacterial 16S ribosomal RNA in mesenteric lymph nodes. Statistical analysis was done by chi-square analysis. All three genotypes had similar concentrations of bacteria in the TI and colon. However, IAP knockout (IAP-KO) had significantly decreased diversity of bacterial species in their colonic stool compared with heterozygous and wild-type (WT). IAP-KO pups had a nonstatistically significant 3.9-fold increased inducible nitric oxide synthase messenger RNA expression compared with WT (IAP-KO, 3.92 ± 1.36; WT, 1.0 ± 0.27; P = 0.03). IAP-KO also had significantly increased bacterial translocation to mesenteric lymph nodes occurred in IAP-KO (IAP-KO, 7625 RFU/g ± 3469; WT, 4957 RFU/g ± 1552; P = 0.04). Furthermore, IAP-KO had increased permeability (IAP-KO, 0.297 mg/mL ± 0.2; WT, 0.189 mg/mL ± 0.15 P = 0.07), but was not statistically significant. Deficiency of IAP in the newborn intestine is associated with dysbiosis and increased inflammation, permeability, and bacterial translocation. Copyright © 2017 Elsevier Inc. All rights reserved.

Has1 regulates consecutive maturation and processing steps for assembly of 60S ribosomal subunits

PubMed Central

Dembowski, Jill A.; Kuo, Benjamin; Woolford, John L.

2013-01-01

Ribosome biogenesis requires ∼200 assembly factors in Saccharomyces cerevisiae. The pre-ribosomal RNA (rRNA) processing defects associated with depletion of most of these factors have been characterized. However, how assembly factors drive the construction of ribonucleoprotein neighborhoods and how structural rearrangements are coupled to pre-rRNA processing are not understood. Here, we reveal ATP-independent and ATP-dependent roles of the Has1 DEAD-box RNA helicase in consecutive pre-rRNA processing and maturation steps for construction of 60S ribosomal subunits. Has1 associates with pre-60S ribosomes in an ATP-independent manner. Has1 binding triggers exonucleolytic trimming of 27SA3 pre-rRNA to generate the 5′ end of 5.8S rRNA and drives incorporation of ribosomal protein L17 with domain I of 5.8S/25S rRNA. ATP-dependent activity of Has1 promotes stable association of additional domain I ribosomal proteins that surround the polypeptide exit tunnel, which are required for downstream processing of 27SB pre-rRNA. Furthermore, in the absence of Has1, aberrant 27S pre-rRNAs are targeted for irreversible turnover. Thus, our data support a model in which Has1 helps to establish domain I architecture to prevent pre-rRNA turnover and couples domain I folding with consecutive pre-rRNA processing steps. PMID:23788678

Ribosomal proteins S12 and S13 function as control elements for translocation of the mRNA:tRNA complex.

PubMed

Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel

2003-08-01

Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.

On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.

PubMed

Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T

2009-10-09

The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its

Ribosomal proteins L7 and L8 function in concert with six A3 assembly factors to propagate assembly of domains I and II of 25S rRNA in yeast 60S ribosomal subunits

PubMed Central

Jakovljevic, Jelena; Ohmayer, Uli; Gamalinda, Michael; Talkish, Jason; Alexander, Lisa; Linnemann, Jan; Milkereit, Philipp; Woolford, John L.

2012-01-01

Ribosome biogenesis is a complex multistep process that involves alternating steps of folding and processing of pre-rRNAs in concert with assembly of ribosomal proteins. Recently, there has been increased interest in the roles of ribosomal proteins in eukaryotic ribosome biogenesis in vivo, focusing primarily on their function in pre-rRNA processing. However, much less is known about participation of ribosomal proteins in the formation and rearrangement of preribosomal particles as they mature to functional subunits. We have studied ribosomal proteins L7 and L8, which are required for the same early steps in pre-rRNA processing during assembly of 60S subunits but are located in different domains within ribosomes. Depletion of either leads to defects in processing of 27SA3 to 27SB pre-rRNA and turnover of pre-rRNAs destined for large ribosomal subunits. A specific subset of proteins is diminished from these residual assembly intermediates: six assembly factors required for processing of 27SA3 pre-rRNA and four ribosomal proteins bound to domain I of 25S and 5.8S rRNAs surrounding the polypeptide exit tunnel. In addition, specific sets of ribosomal proteins are affected in each mutant: In the absence of L7, proteins bound to domain II, L6, L14, L20, and L33 are greatly diminished, while proteins L13, L15, and L36 that bind to domain I are affected in the absence of L8. Thus, L7 and L8 might establish RNP structures within assembling ribosomes necessary for the stable association and function of the A3 assembly factors and for proper assembly of the neighborhoods containing domains I and II. PMID:22893726

Leuconostoc pseudomesenteroides WCFur3 partial 16S rRNA gene

USDA-ARS?s Scientific Manuscript database

This study used a partial 535 base pair 16S rRNA gene sequence to identify a bacterial isolate. Fatty acid profiles are consistent with the 16S rRNA gene sequence identification of this bacterium. The isolate was obtained from a compost bin in Fort Collins, Colorado, USA. The 16S rRNA gene sequen...

Ribosomal vaccines. I. Immunogenicity of ribosomal fractions isolated from Salmonella typhimurium and Yersinia pestis.

PubMed

Johnson, W

1972-06-01

The immunogenicity of ribosomes and ribosomal subfractions isolated from Yersina pestis and Salmonella typhimurium has been studied. Ribosomes and ribosomal protein isolated from S. typhimurium protected mice against lethal challenge. Ribosomal ribonucleic acid isolated by phenol extraction failed to induce any significant level of protection in mice. None of the ribosomes or ribosomal subfractions isolated from Y. pestis were effective in inducing immunity to lethal challenge. These results suggest that the immunogen of the ribosomal vaccine is protein.

Introducing W.A.T.E.R.S.: a workflow for the alignment, taxonomy, and ecology of ribosomal sequences.

PubMed

Hartman, Amber L; Riddle, Sean; McPhillips, Timothy; Ludäscher, Bertram; Eisen, Jonathan A

2010-06-12

For more than two decades microbiologists have used a highly conserved microbial gene as a phylogenetic marker for bacteria and archaea. The small-subunit ribosomal RNA gene, also known as 16 S rRNA, is encoded by ribosomal DNA, 16 S rDNA, and has provided a powerful comparative tool to microbial ecologists. Over time, the microbial ecology field has matured from small-scale studies in a select number of environments to massive collections of sequence data that are paired with dozens of corresponding collection variables. As the complexity of data and tool sets have grown, the need for flexible automation and maintenance of the core processes of 16 S rDNA sequence analysis has increased correspondingly. We present WATERS, an integrated approach for 16 S rDNA analysis that bundles a suite of publicly available 16 S rDNA analysis software tools into a single software package. The "toolkit" includes sequence alignment, chimera removal, OTU determination, taxonomy assignment, phylogentic tree construction as well as a host of ecological analysis and visualization tools. WATERS employs a flexible, collection-oriented 'workflow' approach using the open-source Kepler system as a platform. By packaging available software tools into a single automated workflow, WATERS simplifies 16 S rDNA analyses, especially for those without specialized bioinformatics, programming expertise. In addition, WATERS, like some of the newer comprehensive rRNA analysis tools, allows researchers to minimize the time dedicated to carrying out tedious informatics steps and to focus their attention instead on the biological interpretation of the results. One advantage of WATERS over other comprehensive tools is that the use of the Kepler workflow system facilitates result interpretation and reproducibility via a data provenance sub-system. Furthermore, new "actors" can be added to the workflow as desired and we see WATERS as an initial seed for a sizeable and growing repository of interoperable

Ribosomal Vaccines I. Immunogenicity of Ribosomal Fractions Isolated from Salmonella typhimurium and Yersinia pestis

PubMed Central

Johnson, William

1972-01-01

The immunogenicity of ribosomes and ribosomal subfractions isolated from Yersina pestis and Salmonella typhimurium has been studied. Ribosomes and ribosomal protein isolated from S. typhimurium protected mice against lethal challenge. Ribosomal ribonucleic acid isolated by phenol extraction failed to induce any significant level of protection in mice. None of the ribosomes or ribosomal subfractions isolated from Y. pestis were effective in inducing immunity to lethal challenge. These results suggest that the immunogen of the ribosomal vaccine is protein. Images PMID:4564407

Low bacterial community diversity in two introduced aphid pests revealed with 16S rRNA amplicon sequencing

PubMed Central

Ortiz-Martínez, Sebastían; Silva, Andrea X.; Lavandero, Blas

2018-01-01

Bacterial endosymbionts that produce important phenotypic effects on their hosts are common among plant sap-sucking insects. Aphids have become a model system of insect-symbiont interactions. However, endosymbiont research has focused on a few aphid species, making it necessary to make greater efforts to other aphid species through different regions, in order to have a better understanding of the role of endosymbionts in aphids as a group. Aphid endosymbionts have frequently been studied by PCR-based techniques, using species-specific primers, nevertheless this approach may omit other non-target bacteria cohabiting a particular host species. Advances in high-throughput sequencing technologies are complementing our knowledge of microbial communities by allowing us the study of whole microbiome of different organisms. We used a 16S rRNA amplicon sequencing approach to study the microbiome of aphids in order to describe the bacterial community diversity in introduced populations of the cereal aphids, Sitobion avenae and Rhopalosiphum padi in Chile (South America). An absence of secondary endosymbionts and two common secondary endosymbionts of aphids were found in the aphids R. padi and S. avenae, respectively. Of those endosymbionts, Regiella insecticola was the dominant secondary endosymbiont among the aphid samples. In addition, the presence of a previously unidentified bacterial species closely related to a phytopathogenic Pseudomonad species was detected. We discuss these results in relation to the bacterial endosymbiont diversity found in other regions of the native and introduced range of S. avenae and R. padi. A similar endosymbiont diversity has been reported for both aphid species in their native range. However, variation in the secondary endosymbiont infection could be observed among the introduced and native populations of the aphid S. avenae, indicating that aphid-endosymbiont associations can vary across the geographic range of an aphid species. In

Comparative analysis of bacteria associated with different mosses by 16S rRNA and 16S rDNA sequencing.

PubMed

Tian, Yang; Li, Yan Hong

2017-01-01

To understand the differences of the bacteria associated with different mosses, a phylogenetic study of bacterial communities in three mosses was carried out based on 16S rDNA and 16S rRNA sequencing. The mosses used were Hygroamblystegium noterophilum, Entodon compressus and Grimmia montana, representing hygrophyte, shady plant and xerophyte, respectively. In total, the operational taxonomic units (OTUs), richness and diversity were different regardless of the moss species and the library level. All the examined 1183 clones were assigned to 248 OTUs, 56 genera were assigned in rDNA libraries and 23 genera were determined at the rRNA level. Proteobacteria and Bacteroidetes were considered as the most dominant phyla in all the libraries, whereas abundant Actinobacteria and Acidobacteria were detected in the rDNA library of Entodon compressus and approximately 24.7% clones were assigned to Candidate division TM7 in Grimmia montana at rRNA level. The heatmap showed the bacterial profiles derived from rRNA and rDNA were partly overlapping. However, the principle component analysis of all the profiles derived from rDNA showed sharper differences between the different mosses than that of rRNA-based profiles. This suggests that the metabolically active bacterial compositions in different mosses were more phylogenetically similar and the differences of the bacteria associated with different mosses were mainly detected at the rDNA level. Obtained results clearly demonstrate that combination of 16S rDNA and 16S rRNA sequencing is preferred approach to have a good understanding on the constitution of the microbial communities in mosses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Bacterial Community Profiling of Milk Samples as a Means to Understand Culture-Negative Bovine Clinical Mastitis

PubMed Central

Kuehn, Joanna S.; Gorden, Patrick J.; Munro, Daniel; Rong, Ruichen; Dong, Qunfeng; Plummer, Paul J.; Wang, Chong; Phillips, Gregory J.

2013-01-01

Inflammation and infection of bovine mammary glands, commonly known as mastitis, imposes significant losses each year in the dairy industry worldwide. While several different bacterial species have been identified as causative agents of mastitis, many clinical mastitis cases remain culture negative, even after enrichment for bacterial growth. To understand the basis for this increasingly common phenomenon, the composition of bacterial communities from milk samples was analyzed using culture independent pyrosequencing of amplicons of 16S ribosomal RNA genes (16S rDNA). Comparisons were made of the microbial community composition of culture negative milk samples from mastitic quarters with that of non-mastitic quarters from the same animals. Genomic DNA from culture-negative clinical and healthy quarter sample pairs was isolated, and amplicon libraries were prepared using indexed primers specific to the V1–V2 region of bacterial 16S rRNA genes and sequenced using the Roche 454 GS FLX with titanium chemistry. Evaluation of the taxonomic composition of these samples revealed significant differences in the microbiota in milk from mastitic and healthy quarters. Statistical analysis identified seven bacterial genera that may be mainly responsible for the observed microbial community differences between mastitic and healthy quarters. Collectively, these results provide evidence that cases of culture negative mastitis can be associated with bacterial species that may be present below culture detection thresholds used here. The application of culture-independent bacterial community profiling represents a powerful approach to understand long-standing questions in animal health and disease. PMID:23634219

Goniometer-based femtosecond X-ray diffraction of mutant 30S ribosomal subunit crystals

DOE PAGES

Dao, E. Han; Sierra, Raymond G.; Laksmono, Hartawan; ...

2015-04-30

In this work, we collected radiation-damage-free data from a set of cryo-cooled crystals for a novel 30S ribosomal subunit mutant using goniometer-based femtosecond crystallography. Crystal quality assessment for these samples was conducted at the X-ray Pump Probe end-station of the Linac Coherent Light Source (LCLS) using recently introduced goniometer-based instrumentation. These 30S subunit crystals were genetically engineered to omit a 26-residue protein, Thx, which is present in the wild-type Thermus thermophilus 30S ribosomal subunit. We are primarily interested in elucidating the contribution of this ribosomal protein to the overall 30S subunit structure. To assess the viability of this study, femtosecondmore » X-ray diffraction patterns from these crystals were recorded at the LCLS during a protein crystal screening beam time. During our data collection, we successfully observed diffraction from these difficult-to-grow 30S ribosomal subunit crystals. Most of our crystals were found to diffract to low resolution, while one crystal diffracted to 3.2 Å resolution. These data suggest the feasibility of pursuing high-resolution data collection as well as the need to improve sample preparation and handling in order to collect a complete radiation-damage-free data set using an X-ray Free Electron Laser.« less

A Numbers Game: Ribosome Densities, Bacterial Growth, and Antibiotic-Mediated Stasis and Death

PubMed Central

McCall, Ingrid C.; Perrot, Véronique; Weiss, Howard; Ovesepian, Armen; Baquero, Fernando

2017-01-01

ABSTRACT We postulate that the inhibition of growth and low rates of mortality of bacteria exposed to ribosome-binding antibiotics deemed bacteriostatic can be attributed almost uniquely to these drugs reducing the number of ribosomes contributing to protein synthesis, i.e., the number of effective ribosomes. We tested this hypothesis with Escherichia coli K-12 MG1655 and constructs that had been deleted for 1 to 6 of the 7 rRNA (rrn) operons. In the absence of antibiotics, constructs with fewer rrn operons have lower maximum growth rates and longer lag phases than those with more ribosomal operons. In the presence of the ribosome-binding “bacteriostatic” antibiotics tetracycline, chloramphenicol, and azithromycin, E. coli strains with 1 and 2 rrn operons are killed at a substantially higher rate than those with more rrn operons. This increase in the susceptibility of E. coli with fewer rrn operons to killing by ribosome-targeting bacteriostatic antibiotics is not reflected in their greater sensitivity to killing by the bactericidal antibiotic ciprofloxacin, which does not target ribosomes, but also to killing by gentamicin, which does. Finally, when such strains are exposed to these ribosome-targeting bacteriostatic antibiotics, the time before these bacteria start to grow again when the drugs are removed, referred to as the post-antibiotic effect (PAE), is markedly greater for constructs with fewer rrn operons than for those with more rrn operons. We interpret the results of these other experiments reported here as support for the hypothesis that the reduction in the effective number of ribosomes due to binding to these structures provides a sufficient explanation for the action of bacteriostatic antibiotics that target these structures. PMID:28174311

21 CFR 1210.16 - Method of bacterial count.

Code of Federal Regulations, 2010 CFR

2010-04-01

... Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... FEDERAL IMPORT MILK ACT Inspection and Testing § 1210.16 Method of bacterial count. The bacterial count of milk and cream refers to the number of viable bacteria as determined by the standard plate method of...

21 CFR 1210.16 - Method of bacterial count.

Code of Federal Regulations, 2011 CFR

2011-04-01

... Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... FEDERAL IMPORT MILK ACT Inspection and Testing § 1210.16 Method of bacterial count. The bacterial count of milk and cream refers to the number of viable bacteria as determined by the standard plate method of...

Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes.

PubMed

Peng, Mu; Zi, Xiaoxue; Wang, Qiuyu

2015-09-24

Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA) indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future.

Bacterial diversity at different stages of the composting process

PubMed Central

2010-01-01

Background Composting is an aerobic microbiological process that is facilitated by bacteria and fungi. Composting is also a method to produce fertilizer or soil conditioner. Tightened EU legislation now requires treatment of the continuously growing quantities of organic municipal waste before final disposal. However, some full-scale composting plants experience difficulties with the efficiency of biowaste degradation and with the emission of noxious odours. In this study we examine the bacterial species richness and community structure of an optimally working pilot-scale compost plant, as well as a full-scale composting plant experiencing typical problems. Bacterial species composition was determined by isolating total DNA followed by amplifying and sequencing the gene encoding the 16S ribosomal RNA. Results Over 1500 almost full-length 16S rRNA gene sequences were analysed and of these, over 500 were present only as singletons. Most of the sequences observed in either one or both of the composting processes studied here were similar to the bacterial species reported earlier in composts, including bacteria from the phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Deinococcus-Thermus. In addition, a number of previously undetected bacterial phylotypes were observed. Statistical calculations estimated a total bacterial diversity of over 2000 different phylotypes in the studied composts. Conclusions Interestingly, locally enriched or evolved bacterial variants of familiar compost species were observed in both composts. A detailed comparison of the bacterial diversity revealed a large difference in composts at the species and strain level from the different composting plants. However, at the genus level, the difference was much smaller and illustrated a delay of the composting process in the full-scale, sub-optimally performing plants. PMID:20350306

Isolation, screening and molecular identification of novel bacterial strain removing methylene blue from water solutions

NASA Astrophysics Data System (ADS)

Kilany, Mona

2017-11-01

The potentially deleterious effects of methylene blue (MB) on human health drove the interest in its removal promptly. Bioremediation is an effective and eco friendly for removing MB. Soil bacteria were isolated and examined for their potential to remove MB. The most potent bacterial candidate was characterized and identified using 16S rRNA sequence technique. The evolutionary history of the isolate was conducted by maximum likelihood method. Some physiochemical parameters were optimized for maximum decolorization. Decolorization mechanism and microbial toxicity study of MB (100 mg/l) and by-products were investigated. Participation of heat killed bacteria in color adsorption have been investigated too. The bacterial isolate was identified as Stenotrophomonas maltophilia strain Kilany_MB 16S ribosomal RNA gene with 99% sequence similarity. The sequence was submitted to NCBI (Accession number = KU533726). Phylogeny depicted the phylogenetic relationships between 16S ribosomal RNA gene, partial sequence (1442 bp), of the isolated strain and other strains related to Stenotrophomonas maltophilia in the GenBank database. The optimal conditions were investigated to be pH 5 at 30 °C, after 24 h using 5 mg/l MB showing optimum decolorization percentage (61.3%). Microbial toxicity study demonstrated relative reduction in the toxicity of MB decolorized products on test bacteria. Mechanism of color removal was proved by both biosorption and biodegradation, where heat-killed and live cells showed 43 and 52% of decolorization, respectively, as a maximum value after 24-h incubation. It was demonstrated that the mechanism of color removal is by adsorption. Therefore, good performance of S maltophilia in MB color removal reinforces the exploitation of these bacteria in environmental clean-up and restoration of the ecosystem.

5S ribosomal RNA database Y2K

PubMed Central

Szymanski, Maciej; Barciszewska, Miroslawa Z.; Barciszewski, Jan; Erdmann, Volker A.

2000-01-01

This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan. pl/5SData/index.html . This edition of the database contains 1985 primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms. PMID:10592212

5S ribosomal RNA database Y2K.

PubMed

Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

2000-01-01

This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

PubMed Central

Donati, Giulio; Peddigari, Suresh; Mercer, Carol A.; Thomas, George

2013-01-01

SUMMARY Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. PMID:23831031

5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint.

PubMed

Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George

2013-07-11

Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Translational autocontrol of the Escherichia coli ribosomal protein S15.

PubMed

Portier, C; Dondon, L; Grunberg-Manago, M

1990-01-20

When rpsO, the gene encoding the ribosomal protein S15 in Escherichia coli, is carried by a multicopy plasmid, the mRNA synthesis rate of S15 increases with the gene dosage but the rate of synthesis of S15 does not rise. A translational fusion between S15 and beta-galactosidase was introduced on the chromosome in a delta lac strain and the expression of beta-galactosidase studied under different conditions. The presence of S15 in trans represses the beta-galactosidase level five- to sixfold, while the synthesis rate of the S15-beta-galactosidase mRNA decreases by only 30 to 50%. These data indicate that S15 is subject to autogenous translational control. Derepressed mutants were isolated and sequenced. All the point mutations map in the second codon of S15, suggesting a location for the operator site that is very near to the translation initiation codon. However, the creation of deletion mutations shows that the operator extends into the 5' non-coding part of the message, thus overlapping the ribosome loading site.

Bacterial diversity in typical Italian salami at different ripening stages as revealed by high-throughput sequencing of 16S rRNA amplicons.

PubMed

Połka, Justyna; Rebecchi, Annalisa; Pisacane, Vincenza; Morelli, Lorenzo; Puglisi, Edoardo

2015-04-01

The bacterial diversity involved in food fermentations is one of the most important factors shaping the final characteristics of traditional foods. Knowledge about this diversity can be greatly improved by the application of high-throughput sequencing technologies (HTS) coupled to the PCR amplification of the 16S rRNA subunit. Here we investigated the bacterial diversity in batches of Salame Piacentino PDO (Protected Designation of Origin), a dry fermented sausage that is typical of a regional area of Northern Italy. Salami samples from 6 different local factories were analysed at 0, 21, 49 and 63 days of ripening; raw meat at time 0 and casing samples at 21 days of ripening where also analysed, and the effect of starter addition was included in the experimental set-up. Culture-based microbiological analyses and PCR-DGGE were carried out in order to be compared with HTS results. A total of 722,196 high quality sequences were obtained after trimming, paired-reads assembly and quality screening of raw reads obtained by Illumina MiSeq sequencing of the two bacterial 16S hypervariable regions V3 and V4; manual curation of 16S database allowed a correct taxonomical classification at the species for 99.5% of these reads. Results confirmed the presence of main bacterial species involved in the fermentation of salami as assessed by PCR-DGGE, but with a greater extent of resolution and quantitative assessments that are not possible by the mere analyses of gel banding patterns. Thirty-two different Staphylococcus and 33 Lactobacillus species where identified in the salami from different producers, while the whole data set obtained accounted for 13 main families and 98 rare ones, 23 of which were present in at least 10% of the investigated samples, with casings being the major sources of the observed diversity. Multivariate analyses also showed that batches from 6 local producers tend to cluster altogether after 21 days of ripening, thus indicating that HTS has the potential

Functional genetic selection of Helix 66 in Escherichia coli 23S rRNA identified the eukaryotic-binding sequence for ribosomal protein L2

PubMed Central

Kitahara, Kei; Kajiura, Akimasa; Sato, Neuza Satomi; Suzuki, Tsutomu

2007-01-01

Ribosomal protein L2 is a highly conserved primary 23S rRNA-binding protein. L2 specifically recognizes the internal bulge sequence in Helix 66 (H66) of 23S rRNA and is localized to the intersubunit space through formation of bridge B7b with 16S rRNA. The L2-binding site in H66 is highly conserved in prokaryotic ribosomes, whereas the corresponding site in eukaryotic ribosomes has evolved into distinct classes of sequences. We performed a systematic genetic selection of randomized rRNA sequences in Escherichia coli, and isolated 20 functional variants of the L2-binding site. The isolated variants consisted of eukaryotic sequences, in addition to prokaryotic sequences. These results suggest that L2/L8e does not recognize a specific base sequence of H66, but rather a characteristic architecture of H66. The growth phenotype of the isolated variants correlated well with their ability of subunit association. Upon continuous cultivation of a deleterious variant, we isolated two spontaneous mutations within domain IV of 23S rRNA that compensated for its weak subunit association, and alleviated its growth defect, implying that functional interactions between intersubunit bridges compensate ribosomal function. PMID:17553838

Endophytic bacterial diversity in grapevine (Vitis vinifera L.) leaves described by 16S rRNA gene sequence analysis and length heterogeneity-PCR.

PubMed

Bulgari, Daniela; Casati, Paola; Brusetti, Lorenzo; Quaglino, Fabio; Brasca, Milena; Daffonchio, Daniele; Bianco, Piero Attilio

2009-08-01

Diversity of bacterial endophytes associated with grapevine leaf tissues was analyzed by cultivation and cultivation-independent methods. In order to identify bacterial endophytes directly from metagenome, a protocol for bacteria enrichment and DNA extraction was optimized. Sequence analysis of 16S rRNA gene libraries underscored five diverse Operational Taxonomic Units (OTUs), showing best sequence matches with gamma-Proteobacteria, family Enterobacteriaceae, with a dominance of the genus Pantoea. Bacteria isolation through cultivation revealed the presence of six OTUs, showing best sequence matches with Actinobacteria, genus Curtobacterium, and with Firmicutes genera Bacillus and Enterococcus. Length Heterogeneity-PCR (LH-PCR) electrophoretic peaks from single bacterial clones were used to setup a database representing the bacterial endophytes identified in association with grapevine tissues. Analysis of healthy and phytoplasma-infected grapevine plants showed that LH-PCR could be a useful complementary tool for examining the diversity of bacterial endophytes especially for diversity survey on a large number of samples.

Phylogenetic relationships between some members of the genera Neisseria, Acinetobacter, Moraxella, and Kingella based on partial 16S ribosomal DNA sequence analysis.

PubMed

Enright, M C; Carter, P E; MacLean, I A; McKenzie, H

1994-07-01

We obtained 16S ribosomal DNA (rDNA) sequence data for strains belonging to 11 species of Proteobacteria, including the type strains of Kingella kingae, Neisseria lactamica, Neisseria meningitidis, Moraxella lacunata subsp. lacunata, [Neisseria] ovis, Moraxella catarrhalis, Moraxella osloensis, [Moraxella] phenylpyruvica, and Acinetobacter lwoffii, as well as strains of Neisseria subflava and Acinetobacter calcoaceticus. The data in a distance matrix constructed by comparing the sequences supported the proposal that the genera Acinetobacter and Moraxella and [N.] ovis should be excluded from the family Neisseriaceae. Our results are consistent with hybridization data which suggest that these excluded taxa should be part of a new family, the Moraxellaceae. The strains that we studied can be divided into the following five groups: (i) M. lacunata subsp. lacunata, [N.] ovis, and M. catarrhalis; (ii) M. osloensis; (iii) [M.] phenylpyruvica; (iv) A. calcoaceticus and A. lwoffii; and (v) N. meningitidis, N. subflava, N. lactamica, and K. kingae. We agree with the previous proposal that [N.] ovis should be renamed Moraxella ovis, as this organism is closely related to Moraxella species and not to Neisseria species. The generically misnamed taxon [M.] phenylpyruvica belongs to the proposed family Moraxellaceae, but it is sufficiently different to warrant exclusion from the genus Moraxella. Further work needs to be done to investigate genetically similar species, such as Psychrobacter immobilis, before the true generic position of this organism can be determined. Automated 16S rDNA sequencing with the PCR allows workers to accurately determine phylogenetic relationships between groups of organisms.(ABSTRACT TRUNCATED AT 250 WORDS)

Regulation of the protein-conducting channel by a bound ribosome

PubMed Central

Gumbart, James; Trabuco, Leonardo G.; Schreiner, Eduard; Villa, Elizabeth; Schulten, Klaus

2009-01-01

Summary During protein synthesis, it is often necessary for the ribosome to form a complex with a membrane-bound channel, the SecY/Sec61 complex, in order to translocate nascent proteins across a cellular membrane. Structural data on the ribosome-channel complex are currently limited to low-resolution cryo-electron microscopy maps, including one showing a bacterial ribosome bound to a monomeric SecY complex. Using that map along with available atomic-level models of the ribosome and SecY, we have determined, through molecular dynamics flexible fitting (MDFF), an atomic-resolution model of the ribosome-channel complex. We characterized computationally the sites of ribosome-SecY interaction within the complex and determined the effect of ribosome binding on the SecY channel. We also constructed a model of a ribosome in complex with a SecY dimer by adding a second copy of SecY to the MDFF-derived model. The study involved 2.7-million-atom simulations over altogether nearly 50 ns. PMID:19913480

Microbial profiles of a drinking water resource based on different 16S rRNA V regions during a heavy cyanobacterial bloom in Lake Taihu, China.

PubMed

Zhang, Junyi; Zhu, Congming; Guan, Rui; Xiong, Zhipeng; Zhang, Wen; Shi, Junzhe; Sheng, Yi; Zhu, Bingchuan; Tu, Jing; Ge, Qinyu; Chen, Ting; Lu, Zuhong

2017-05-01

Understanding of the bacterial community structure in drinking water resources helps to enhance the security of municipal water supplies. In this study, bacterial communities were surveyed in water and sediment during a heavy cyanobacterial bloom in a drinking water resource of Lake Taihu, China. A total of 325,317 high-quality sequences were obtained from different 16S ribosomal RNA (rRNA) regions (V3, V4, and V6) using the Miseq sequencing platform. A notable difference was shown between the water and sediment samples, as predominated by Cyanobacteria, Proteobacteria, and Actinobacteria in the water and Proteobacteria, Chloroflexi, and Verrucomicrobia in the sediment, respectively. The LD12 family dominated the water surface and was tightly associated with related indicators of cyanobacterial propagation, indicating involvement in the massive proliferation of cyanobacterial blooms. Alternatively, the genus Nitrospira dominated the sediment samples, which indicates that nitrite oxidation was very active in the sediment. Although pathogenic bacteria were not detected in a large amount, some genera such as Mycobacterium, Acinetobacter, and Legionella were still identified but in very low abundance. In addition, the effects of different V regions on bacterial diversity survey were evaluated. Overall, V4 and V3 were proven to be more promising V regions for bacterial diversity survey in water and sediment samples during heavy water blooms in Lake Taihu, respectively. As longer, cheaper, and faster DNA sequencing technologies become more accessible, we expect that bacterial community structures based on 16S rRNA amplicons as an indicator could be used alongside with physical and chemical indicators, to conduct comprehensive assessments for drinking water resource management.

[Protein S3 in the human 80S ribosome adjoins mRNA from 3'-side of the A-site codon].

PubMed

Molotkov, M V; Graĭfer, D M; Popugaeva, E A; Bulygin, K N; Meshchaninova, M I; Ven'iaminova, A G; Karpova, G G

2007-01-01

The protein environment of mRNA 3' of the A-site codon (the decoding site) in the human 80S ribosome was studied using a set of oligoribonucleotide derivatives bearing a UUU triplet at the 5'-end and a perfluoroarylazide group at one of the nucleotide residues at the 3'-end of this triplet. Analogues of mRNA were phased into the ribosome using binding at the tRNAPhe P-site, which recognizes the UUU codon. Mild UV irradiation of ribosome complexes with tRNAPhe and mRNA analogues resulted in the predominant crosslinking of the analogues with the 40S subunit components, mainly with proteins and, to a lesser extent, with rRNA. Among the 40S subunit ribosomal proteins, the S3 protein was the main target for modification in all cases. In addition, minor crosslinking with the S2 protein was observed. The crosslinking with the S3 and S2 proteins occurred both in triple complexes and in the absence of tRNA. Within triple complexes, crosslinking with S15 protein was also found, its efficiency considerably falling when the modified nucleotide was moved from positions +5 to +12 relative to the first codon nucleotide in the P-site. In some cases, crosslinking with the S30 protein was observed, it was most efficient for the derivative containing a photoreactive group at the +7 adenosine residue. The results indicate that the S3 protein in the human ribosome plays a key role in the formation of the mRNA binding site 3' of the codon in the decoding site.

Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

PubMed

Al-Hadid, Qais; White, Jonelle; Clarke, Steven

2016-02-12

A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

S-adenosylmethionine directly inhibits binding of 30S ribosomal subunits to the SMK box translational riboswitch RNA

PubMed Central

Fuchs, Ryan T.; Grundy, Frank J.; Henkin, Tina M.

2007-01-01

The SMK box is a conserved riboswitch motif found in the 5′ untranslated region of metK genes [encoding S-adenosylmethionine (SAM) synthetase] in lactic acid bacteria, including Enterococcus, Streptococcus, and Lactococcus sp. Previous studies showed that this RNA element binds SAM in vitro, and SAM binding causes a structural rearrangement that sequesters the Shine–Dalgarno (SD) sequence by pairing with an anti-SD (ASD) element. A model was proposed in which SAM binding inhibits metK translation by preventing binding of the ribosome to the SD region of the mRNA. In the current work, the addition of SAM was shown to inhibit binding of 30S ribosomal subunits to SMK box RNA; in contrast, the addition of S-adenosylhomocysteine (SAH) had no effect. A mutant RNA, which has a disrupted SD-ASD pairing, was defective in SAM binding and showed no reduction of ribosome binding in the presence of SAM, whereas a compensatory mutation that restored SD-ASD pairing restored the response to SAM. Primer extension inhibition assays provided further evidence for SD-ASD pairing in the presence of SAM. These results strongly support the model that SMK box translational repression operates through occlusion of the ribosome binding site and that SAM binding requires the SD-ASD pairing. PMID:17360376

Ribosomal proteins: functions beyond the ribosome.

PubMed

Zhou, Xiang; Liao, Wen-Juan; Liao, Jun-Ming; Liao, Peng; Lu, Hua

2015-04-01

Although ribosomal proteins are known for playing an essential role in ribosome assembly and protein translation, their ribosome-independent functions have also been greatly appreciated. Over the past decade, more than a dozen of ribosomal proteins have been found to activate the tumor suppressor p53 pathway in response to ribosomal stress. In addition, these ribosomal proteins are involved in various physiological and pathological processes. This review is composed to overview the current understanding of how ribosomal stress provokes the accumulation of ribosome-free ribosomal proteins, as well as the ribosome-independent functions of ribosomal proteins in tumorigenesis, immune signaling, and development. We also propose the potential of applying these pieces of knowledge to the development of ribosomal stress-based cancer therapeutics. © The Author (2015). Published by Oxford University Press on behalf of Journal of Molecular Cell Biology, IBCB, SIBS, CAS. All rights reserved.

Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

PubMed

Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

2017-11-01

Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

Oligonucleotide probes to the 16S ribosomal RNA: implications of sequence homology and secondary structure with particular reference to the oral species Prevotella intermedia and Prevotella nigrescens.

PubMed

Shah, H N; Gharbia, S E; Scully, C; Finegold, S M

1995-03-01

Eight oligonucleotides based upon regions of the small subunit 16S ribosomal RNA gene sequences were analysed against a background of their position within the molecule and their two-dimensional structure to rationalise their use in recognising Prevotella intermedia and Prevotella nigrescens. The 41 clinical isolates from both oral and respiratory sites and two reference strains were subjected to DNA-DNA hybridisation and multilocus enzyme electrophoresis to confirm their identity. Alignment of oligonucleotide probes designated I Bi-2 to I Bi-6 (for P. intermedia) and 2Bi-2 (for P. nigrescens) with the 16S rRNA suggested that these probes lacked specificity or were constructed from hypervariable regions. A 52-mer oligonucleotide (designated Bi) reliably detected both species. Because of the high degree of concordance between the 16S rRNAs of both species, it was necessary to vary the stringency of hybridisation conditions for detection of both species. Thus probe I Bi-I recognised P. intermedia while I Bi-I detected both P. intermedia and P. nigrescens at low stringency. However, under conditions of high stringency only P. nigrescens was recognised by probe 2Bi-I. These probes were highly specific and did not hybridise with DNA from the closely related P. corporis, nor other periodontal pathogens such as Fusobacterium nucleatum, Actinobacillus actinomycetemcomitans, Treponema denticola and several pigmented species such as Prevotella melaninogenica, P. denticola, P. loescheii, Porphyromonas asaccharolytica, Py. endodontalis, Py. gingivalis, Py. levii, and Py. macacae.

Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

NASA Technical Reports Server (NTRS)

Delihas, N.; Fox, G. E.

1987-01-01

In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

Identification of candidate periodontal pathogens and beneficial species by quantitative 16S clonal analysis.

PubMed

Kumar, Purnima S; Griffen, Ann L; Moeschberger, Melvin L; Leys, Eugene J

2005-08-01

Most studies of the bacterial etiology of periodontitis have used either culture-based or targeted DNA approaches, and so it is likely that pathogens remain undiscovered. The purpose of this study was to use culture-independent, quantitative analysis of biofilms associated with chronic periodontitis and periodontal health to identify pathogens and beneficial species. Samples from subjects with periodontitis and controls were analyzed using ribosomal 16S cloning and sequencing. Several genera, many of them uncultivated, were associated with periodontitis, the most numerous of which were gram positive, including Peptostreptococcus and Filifactor. The genera Megasphaera and Desulfobulbus were elevated in periodontitis, and the levels of several species or phylotypes of Campylobacter, Selenomonas, Deferribacteres, Dialister, Catonella, Tannerella, Streptococcus, Atopobium, Eubacterium, and Treponema were elevated in disease. Streptococcus and Veillonella spp. were found in high numbers in all samples and accounted for a significantly greater fraction of the microbial community in healthy subjects than in those with periodontitis. The microbial profile of periodontal health also included the less-abundant genera Campylobacter, Abiotrophia, Gemella, Capnocytophaga, and Neisseria. These newly identified candidates outnumbered Porphyromonas gingivalis and other species previously implicated as periodontopathogens, and it is not clear if newly identified and more numerous species may play a more important role in pathogenesis. Finally, more differences were found in the bacterial profile between subjects with periodontitis and healthy subjects than between deep and shallow sites within the same subject. This suggests that chronic periodontitis is the result of a global perturbation of the oral bacterial ecology rather than a disease-site specific microbial shift.

Specific 16S ribosomal RNA targeted oligonucleotide probe against Clavibacter michiganensis subsp. sepedonicus.

PubMed

Mirza, M S; Rademaker, J L; Janse, J D; Akkermans, A D

1993-11-01

In this article we report on the polymerase chain reaction amplification of a partial 16S rRNA gene from the plant pathogenic bacterium Clavibacter michiganensis subsp. sepedonicus. A partial sequence (about 400 base pairs) of the gene was determined that covered two variable regions important for oligonucleotide probe development. A specific 24mer oligonucleotide probe targeted against the V6 region of 16S rRNA was designed. Specificity of the probe was determined using dot blot hybridization. Under stringent conditions (60 degrees C), the probe hybridized with all 16 Cl. michiganensis subsp. sepedonicus strains tested. Hybridization did not occur with 32 plant pathogenic and saprophytic bacteria used as controls under the same conditions. Under less stringent conditions (55 degrees C) the related Clavibacter michiganensis subsp. insidiosus, Clavibacter michiganensis subsp. nebraskensis, and Clavibacter michiganensis subsp. tesselarius also showed hybridization. At even lower stringency (40 degrees C), all Cl. michiganensis subspecies tested including Clavibacter michiganensis subsp. michiganensis showed hybridization signal, suggesting that under these conditions the probe may be used as a species-specific probe for Cl. michiganensis.

Bacterial community composition in the gut content of Lampetra japonica revealed by 16S rRNA gene pyrosequencing.

PubMed

Zuo, Yu; Xie, Wenfang; Pang, Yue; Li, Tiesong; Li, Qingwei; Li, Yingying

2017-01-01

The composition of the bacterial communities in the hindgut contents of Lampetrs japonica was surveyed by Illumina MiSeq of the 16S rRNA gene. An average of 32385 optimized reads was obtained from three samples. The rarefaction curve based on the operational taxonomic units tended to approach the asymptote. The rank abundance curve representing the species richness and evenness was calculated. The composition of microbe in six classification levels was also analyzed. Top 20 members in genera level were displayed as the classification tree. The abundance of microorganisms in different individuals was displayed as the pie charts at the branch nodes in the classification tree. The differences of top 50 genera in abundance between individuals of lamprey are displayed as a heatmap. The pairwise comparison of bacterial taxa abundance revealed that there are no significant differences of gut microbiota between three individuals of lamprey at a given rarefied depth. Also, the gut microbiota derived from L. japonica displays little similarity with other aquatic organism of Vertebrata after UPGMA analysis. The metabolic function of the bacterial communities was predicted through KEGG analysis. This study represents the first analysis of the bacterial community composition in the gut content of L. japonica. The investigation of the gut microbiota associated with L. japonica will broaden our understanding of this unique organism.

Ribosome-inactivating proteins

PubMed Central

Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M

2013-01-01

Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms. PMID:24071927

Molecular Phylogenetic Exploration of Bacterial Diversity in a Bakreshwar (India) Hot Spring and Culture of Shewanella-Related Thermophiles

PubMed Central

Ghosh, Dhritiman; Bal, Bijay; Kashyap, V. K.; Pal, Subrata

2003-01-01

The bacterial diversity of a hot spring in Bakreshwar, India, was investigated by a culture-independent approach. 16S ribosomal DNA clones derived from the sediment samples were found to be associated with gamma-Proteobacteria, cyanobacteria, and green nonsulfur and low-GC gram-positive bacteria. The first of the above phylotypes cobranches with Shewanella, a well-known iron reducer. This phylogenetic correlation has been exploited to develop culture conditions for thermophilic iron-reducing microorganisms. PMID:12839826

Bacterial biota in reflux esophagitis and Barrett’s esophagus

PubMed Central

Pei, Zhiheng; Yang, Liying; Peek, Richard M; Levine, Jr Steven M; Pride, David T; Blaser, Martin J

2005-01-01

AIM: To identify the bacterial flora in conditions such as Barrett’s esophagus and reflux esophagitis to determine if they are similar to normal esophageal flora. METHODS: Using broad-range 16S rDNA PCR, esophageal biopsies were examined from 24 patients [9 with normal esophageal mucosa, 12 with gastroesophageal reflux disease (GERD), and 3 with Barrett’s esophagus]. Two separate broad-range PCR reactions were performed for each patient, and the resulting products were cloned. In one patient with Barrett’s esophagus, 99 PCR clones were analyzed. RESULTS: Two separate clones were recovered from each patient (total = 48), representing 24 different species, with 14 species homologous to known bacteria, 5 homologous to unidentified bacteria, and 5 were not homologous (<97% identity) to any known bacterial 16S rDNA sequences. Seventeen species were found in the reflux esophagitis patients, 5 in the Barrett’s esophagus patients, and 10 in normal esophagus patients. Further analysis concentrating on a single biopsy from an individual with Barrett’s esophagus revealed the presence of 21 distinct bacterial species. Members of four phyla were represented, including Bacteroidetes, Firmicutes, Proteobacteria, and Actinobacteria. Microscopic examination of each biopsy demonstrated bacteria in intimate association with the distal esophageal epithelium, suggesting that the presence of these bacteria is not transitory. CONCLUSION: These findings provide evidence for a complex, residential bacterial population in esophageal reflux-related disorders. While much of this biota is present in the normal esophagus, more detailed comparisons may help identify potential disease associations. PMID:16437628

5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

NASA Technical Reports Server (NTRS)

Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

1989-01-01

The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

PubMed

Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

2015-10-06

The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

Revival and Identification of Bacterial Spores in 25- to 40-Million-Year-Old Dominican Amber

NASA Astrophysics Data System (ADS)

Cano, Raul J.; Borucki, Monica K.

1995-05-01

A bacterial spore was revived, cultured, and identified from the abdominal contents of extinct bees preserved for 25 to 40 million years in buried Dominican amber. Rigorous surface decontamination of the amber and aseptic procedures were used during the recovery of the bacterium. Several lines of evidence indicated that the isolated bacterium was of ancient origin and not an extant contaminant. The characteristic enzymatic, biochemical, and 16S ribosomal DNA profiles indicated that the ancient bacterium is most closely related to extant Bacillus sphaericus.

Investigation of postpartum dairy cows' uterine microbial diversity using metagenomic pyrosequencing of the 16S rRNA gene.

PubMed

Machado, V S; Oikonomou, G; Bicalho, M L S; Knauer, W A; Gilbert, R; Bicalho, R C

2012-10-12

The objective of this study was the use of metagenomic pyrosequencing of the 16S rRNA gene for the investigation of postpartum dairy cows' uterine bacterial diversity. The effect of subcutaneous supplementation of a trace mineral supplement containing Zn, Mn, Se, and Cu (Multimin North America, Inc., Fort Collins, CO) at 230 days of gestation and 260 days of gestation on dairy cows' uterine microbiota was also evaluated. Uterine lavage samples were collected at 35 DIM and were visually scored for the presence of purulent or mucopurulent secretion. The same samples were also used for the acquisition of bacterial DNA. The 16S rRNA genes were individually amplified from each sample. Pyrosequencing of the samples was carried at the Cornell University Life Sciences Core Laboratories Center using Roche 454 GS-FLX System Titanium Chemistry. The Ribosomal Database Project online tools were used for the analysis of the obtained sequences library. Bacteroides spp., Ureaplasma spp., Fusobacterium spp., Peptostreptococcus spp., Sneathia spp., Prevotella spp. and Arcanobacterium spp. prevalence was significantly (P<0.05) higher in samples derived from cows that had a higher uterine lavage sample score. Bacteroides spp., Ureaplasma spp., Fusobacterium spp., and Arcanobacterium spp. prevalence was significantly (P<0.05) higher in samples derived from cows that were not pregnant by 200 DIM. Anaerococcus spp., Peptostreptococcus spp., Parabacteroides spp., and Propionibacterium spp. prevalence was significantly (P<0.05) lower in samples derived from cows that were trace mineral supplemented. Copyright © 2012 Elsevier B.V. All rights reserved.

Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

PubMed Central

Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

1978-01-01

A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

Massively Convergent Evolution for Ribosomal Protein Gene Content in Plastid and Mitochondrial Genomes

PubMed Central

Maier, Uwe-G; Zauner, Stefan; Woehle, Christian; Bolte, Kathrin; Hempel, Franziska; Allen, John F.; Martin, William F.

2013-01-01

Plastid and mitochondrial genomes have undergone parallel evolution to encode the same functional set of genes. These encode conserved protein components of the electron transport chain in their respective bioenergetic membranes and genes for the ribosomes that express them. This highly convergent aspect of organelle genome evolution is partly explained by the redox regulation hypothesis, which predicts a separate plastid or mitochondrial location for genes encoding bioenergetic membrane proteins of either photosynthesis or respiration. Here we show that convergence in organelle genome evolution is far stronger than previously recognized, because the same set of genes for ribosomal proteins is independently retained by both plastid and mitochondrial genomes. A hitherto unrecognized selective pressure retains genes for the same ribosomal proteins in both organelles. On the Escherichia coli ribosome assembly map, the retained proteins are implicated in 30S and 50S ribosomal subunit assembly and initial rRNA binding. We suggest that ribosomal assembly imposes functional constraints that govern the retention of ribosomal protein coding genes in organelles. These constraints are subordinate to redox regulation for electron transport chain components, which anchor the ribosome to the organelle genome in the first place. As organelle genomes undergo reduction, the rRNAs also become smaller. Below size thresholds of approximately 1,300 nucleotides (16S rRNA) and 2,100 nucleotides (26S rRNA), all ribosomal protein coding genes are lost from organelles, while electron transport chain components remain organelle encoded as long as the organelles use redox chemistry to generate a proton motive force. PMID:24259312

Type 1 ribosome-inactivating proteins depurinate plant 25S rRNA without species specificity.

PubMed Central

Prestle, J; Schönfelder, M; Adam, G; Mundry, K W

1992-01-01

Four different type 1 ribosome-inactivating proteins (RIPs) with RNA N-glycosidase activity were tested for their ability to attack the large rRNA of plant ribosomes derived from tobacco plants, as well as from the plant species from which the particular RIP had been isolated. Incubation of tobacco ribosomes with RIPs isolated from either Phytolacca americana L. (pokeweed), Dianthus barbatus L. (carnation), Spinacia oleracea L. (spinach) or Chenopodium amaranthicolor Coste and Reyn. (chenopodium) rendered the 25S rRNA sensitive to aniline-catalyzed hydrolysis, generating a single rRNA-fragment of about 350 nucleotides. The same fragment was generated when rRNAs from pokeweed, carnation, spinach or chenopodium ribosomes were aniline-treated without any deliberate treatment of the ribosomes with the respective RIP. This indicated that ribosomes from all RIP-producing plants were already inactivated by their own RIPs during preparation. These results demonstrate that plant ribosomes are generally susceptible to RIP attack, including modification by their own RIPs. Direct sequencing of the newly generated fragments revealed that a single N-glycosidic bond at an adenosine residue within the highly conserved sequence 5'-AGUACGAGAGGA-3' was cleaved by all of the RIPs investigated, a situation also found in animal, yeast and Escherichia coli ribosomes. Images PMID:1620614

Metabolism of ribosomal proteins microinjected into the oocytes of Xenopus laevis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsurugi, K.; Motizuki, M.; Mitsui, K.

1988-01-01

When the total proteins from Xenopus laevis 60 S ribosomal subunits (TP60) were /sup 3/H-labeled in vitro and injected back into X. laevis oocytes, most /sup 3/H-TP60 are integrated into the cytoplasmic 60 S subunits via the nucleus during 16 h of incubation. In the oocytes whose rRNA synthesis is inhibited, /sup 3/H-TP60 are rapidly degraded with a half-life of 2-3 h. This degradation ceased as soon as rRNA synthesis was resumed, suggesting that ribosomal proteins unassociated with nascent rRNA are unstable in the oocytes. The degradation of /sup 3/H-TP60 in the absence of RNA synthesis was inhibited by iodoacetamide,more » a cysteine protease inhibitor, resulting in the accumulation of /sup 3/H-TP60 in the nucleus reaching about a threefold concentration in the cytoplasm. Considering the results with enucleated oocytes, we suggest that the X. laevis nucleus has a limited capacity to accumulate ribosomal proteins in an active manner but that those ribosomal proteins accumulated in excess over rRNA synthesis are degraded by a cysteine protease in the nucleus. By contrast, ribosomal proteins from Escherichia coli only equilibrate between the nucleus and the cytoplasm and are degraded by serine protease(s) in the cytoplasm without being integrated in the form of ribosomes in the nucleus.« less

Mineral Type and Solution Chemistry Affect the Structure and Composition of Actively Growing Bacterial Communities as Revealed by Bromodeoxyuridine Immunocapture and 16S rRNA Pyrosequencing.

PubMed

Kelly, L C; Colin, Y; Turpault, M-P; Uroz, S

2016-08-01

Understanding how minerals affect bacterial communities and their in situ activities in relation to environmental conditions are central issues in soil microbial ecology, as minerals represent essential reservoirs of inorganic nutrients for the biosphere. To determine the impact of mineral type and solution chemistry on soil bacterial communities, we compared the diversity, composition, and functional abilities of a soil bacterial community incubated in presence/absence of different mineral types (apatite, biotite, obsidian). Microcosms were prepared containing different liquid culture media devoid of particular essential nutrients, the nutrients provided only in the introduced minerals and therefore only available to the microbial community through mineral dissolution by biotic and/or abiotic processes. By combining functional screening of bacterial isolates and community analysis by bromodeoxyuridine DNA immunocapture and 16S rRNA gene pyrosequencing, we demonstrated that bacterial communities were mainly impacted by the solution chemistry at the taxonomic level and by the mineral type at the functional level. Metabolically active bacterial communities varied with solution chemistry and mineral type. Burkholderia were significantly enriched in the obsidian treatment compared to the biotite treatment and were the most effective isolates at solubilizing phosphorous or mobilizing iron, in all the treatments. A detailed analysis revealed that the 16S rRNA gene sequences of the OTUs or isolated strains assigned as Burkholderia in our study showed high homology with effective mineral-weathering bacteria previously recovered from the same experimental site.

A Possible Role of the Full-Length Nascent Protein in Post-Translational Ribosome Recycling.

PubMed

Das, Debasis; Samanta, Dibyendu; Bhattacharya, Arpita; Basu, Arunima; Das, Anindita; Ghosh, Jaydip; Chakrabarti, Abhijit; Das Gupta, Chanchal

2017-01-01

Each cycle of translation initiation in bacterial cell requires free 50S and 30S ribosomal subunits originating from the post-translational dissociation of 70S ribosome from the previous cycle. Literature shows stable dissociation of 70S from model post-termination complexes by the concerted action of Ribosome Recycling Factor (RRF) and Elongation Factor G (EF-G) that interact with the rRNA bridge B2a/B2b joining 50S to 30S. In such experimental models, the role of full-length nascent protein was never considered seriously. We observed relatively slow release of full-length nascent protein from 50Sof post translation ribosome, and in that process, its toe prints on the rRNA in vivo and in in vitro translation with E.coli S30 extract. We reported earlier that a number of chemically unfolded proteins like bovine carbonic anhydrase (BCA), lactate dehydrogenase (LDH), malate dehydrogenase (MDH), lysozyme, ovalbumin etc., when added to free 70Sin lieu of the full length nascent proteins, also interact with identical RNA regions of the 23S rRNA. Interestingly the rRNA nucleotides that slow down release of the C-terminus of full-length unfolded protein were found in close proximity to the B2a/B2b bridge. It indicated a potentially important chemical reaction conserved throughout the evolution. Here we set out to probe that conserved role of unfolded protein conformation in splitting the free or post-termination 70S. How both the RRF-EFG dependent and the plausible nascent protein-EFG dependent ribosome recycling pathways might be relevant in bacteria is discussed here.

A Possible Role of the Full-Length Nascent Protein in Post-Translational Ribosome Recycling

PubMed Central

Das, Debasis; Samanta, Dibyendu; Bhattacharya, Arpita; Basu, Arunima; Das, Anindita; Ghosh, Jaydip; Chakrabarti, Abhijit; Das Gupta, Chanchal

2017-01-01

Each cycle of translation initiation in bacterial cell requires free 50S and 30S ribosomal subunits originating from the post-translational dissociation of 70S ribosome from the previous cycle. Literature shows stable dissociation of 70S from model post-termination complexes by the concerted action of Ribosome Recycling Factor (RRF) and Elongation Factor G (EF-G) that interact with the rRNA bridge B2a/B2b joining 50S to 30S. In such experimental models, the role of full-length nascent protein was never considered seriously. We observed relatively slow release of full-length nascent protein from 50Sof post translation ribosome, and in that process, its toe prints on the rRNA in vivo and in in vitro translation with E.coli S30 extract. We reported earlier that a number of chemically unfolded proteins like bovine carbonic anhydrase (BCA), lactate dehydrogenase (LDH), malate dehydrogenase (MDH), lysozyme, ovalbumin etc., when added to free 70Sin lieu of the full length nascent proteins, also interact with identical RNA regions of the 23S rRNA. Interestingly the rRNA nucleotides that slow down release of the C-terminus of full-length unfolded protein were found in close proximity to the B2a/B2b bridge. It indicated a potentially important chemical reaction conserved throughout the evolution. Here we set out to probe that conserved role of unfolded protein conformation in splitting the free or post-termination 70S. How both the RRF-EFG dependent and the plausible nascent protein–EFG dependent ribosome recycling pathways might be relevant in bacteria is discussed here. PMID:28099529

Bacterial taxa associated with the hematophagous mite Dermanyssus gallinae detected by 16S rRNA PCR amplification and TTGE fingerprinting.

PubMed

Valiente Moro, Claire; Thioulouse, Jean; Chauve, Claude; Normand, Philippe; Zenner, Lionel

2009-01-01

Dermanyssus gallinae (Arthropoda, Mesostigmata) is suspected to be involved in the transmission of a wide variety of pathogens, but nothing is known about its associated non-pathogenic bacterial community. To address this question, we examined the composition of bacterial communities in D. gallinae collected from standard poultry farms in Brittany, France. Genetic fingerprints of bacterial communities were generated by temporal temperature gradient gel electrophoresis (TTGE) separation of individual polymerase chain reaction (PCR)-amplified 16S rRNA gene fragments, followed by DNA sequence analysis. Most of the sequences belonged to the Proteobacteria and Firmicute phyla, with a majority of sequences corresponding to the Enterobacteriales order and the Staphylococcus genus. By using statistical analysis, we showed differences in biodiversity between poultry farms. We also determined the major phylotypes that compose the characteristic microbiota associated with D. gallinae. Saprophytes, opportunistic pathogens and pathogenic agents such as Pasteurella multocida, Erysipelothrix rhusiopathiae and sequences close to the genus Aerococcus were identified. Endosymbionts such as Schineria sp., Spiroplasma sp. Anistosticta, "Candidatus Cardinium hertigii" and Rickettsiella sp. were also present in the subdominant bacterial community. Identification of potential targets within the symbiont community may be considered in the future as a means of ectoparasite control.

Rifaximin Reduces Markers of Inflammation and Bacterial 16S rRNA in Zambian Adults with Hepatosplenic Schistosomiasis: A Randomized Control Trial.

PubMed

Sinkala, Edford; Zyambo, Kanekwa; Besa, Ellen; Kaonga, Patrick; Nsokolo, Bright; Kayamba, Violet; Vinikoor, Michael; Zulu, Rabison; Bwalya, Martin; Foster, Graham R; Kelly, Paul

2018-04-01

Cirrhosis is the dominant cause of portal hypertension globally but may be overshadowed by hepatosplenic schistosomiasis (HSS) in the tropics. In Zambia, schistosomiasis seroprevalence can reach 88% in endemic areas. Bacterial translocation (BT) drives portal hypertension in cirrhosis contributing to mortality but remains unexplored in HSS. Rifaximin, a non-absorbable antibiotic may reduce BT. We aimed to explore the influence of rifaximin on BT, inflammation, and fibrosis in HSS. In this phase II open-label trial (ISRCTN67590499), 186 patients with HSS in Zambia were evaluated and 85 were randomized to standard care with or without rifaximin for 42 days. Changes in markers of inflammation, BT, and fibrosis were the primary outcomes. BT was measured using plasma 16S rRNA, lipopolysaccharide-binding protein, and lipopolysaccharide, whereas hyaluronan was used to measure fibrosis. Tumor necrosis factor receptor 1 (TNFR1) and soluble cluster of differentiation 14 (sCD14) assessed inflammation. 16S rRNA reduced from baseline (median 146 copies/µL, interquartile range [IQR] 9, 537) to day 42 in the rifaximin group (median 63 copies/µL, IQR 12, 196), P < 0.01. The rise in sCD14 was lower ( P < 0.01) in the rifaximin group (median rise 122 ng/mL, IQR-184, 783) than in the non-rifaximin group (median rise 832 ng/mL, IQR 530, 967). TNFR1 decreased ( P < 0.01) in the rifaximin group (median -39 ng/mL IQR-306, 563) but increased in the non-rifaximin group (median 166 ng/mL, IQR 3, 337). Other markers remained unaffected. Rifaximin led to a reduction of inflammatory markers and bacterial 16S rRNA which may implicate BT in the inflammation in HSS.

Rifaximin Reduces Markers of Inflammation and Bacterial 16S rRNA in Zambian Adults with Hepatosplenic Schistosomiasis: A Randomized Control Trial

PubMed Central

Sinkala, Edford; Zyambo, Kanekwa; Besa, Ellen; Kaonga, Patrick; Nsokolo, Bright; Kayamba, Violet; Vinikoor, Michael; Zulu, Rabison; Bwalya, Martin; Foster, Graham R.; Kelly, Paul

2018-01-01

Abstract. Cirrhosis is the dominant cause of portal hypertension globally but may be overshadowed by hepatosplenic schistosomiasis (HSS) in the tropics. In Zambia, schistosomiasis seroprevalence can reach 88% in endemic areas. Bacterial translocation (BT) drives portal hypertension in cirrhosis contributing to mortality but remains unexplored in HSS. Rifaximin, a non-absorbable antibiotic may reduce BT. We aimed to explore the influence of rifaximin on BT, inflammation, and fibrosis in HSS. In this phase II open-label trial (ISRCTN67590499), 186 patients with HSS in Zambia were evaluated and 85 were randomized to standard care with or without rifaximin for 42 days. Changes in markers of inflammation, BT, and fibrosis were the primary outcomes. BT was measured using plasma 16S rRNA, lipopolysaccharide-binding protein, and lipopolysaccharide, whereas hyaluronan was used to measure fibrosis. Tumor necrosis factor receptor 1 (TNFR1) and soluble cluster of differentiation 14 (sCD14) assessed inflammation. 16S rRNA reduced from baseline (median 146 copies/µL, interquartile range [IQR] 9, 537) to day 42 in the rifaximin group (median 63 copies/µL, IQR 12, 196), P < 0.01. The rise in sCD14 was lower (P < 0.01) in the rifaximin group (median rise 122 ng/mL, IQR-184, 783) than in the non-rifaximin group (median rise 832 ng/mL, IQR 530, 967). TNFR1 decreased (P < 0.01) in the rifaximin group (median -39 ng/mL IQR-306, 563) but increased in the non-rifaximin group (median 166 ng/mL, IQR 3, 337). Other markers remained unaffected. Rifaximin led to a reduction of inflammatory markers and bacterial 16S rRNA which may implicate BT in the inflammation in HSS. PMID:29436337

Pesticide Side Effects in an Agricultural Soil Ecosystem as Measured by amoA Expression Quantification and Bacterial Diversity Changes

PubMed Central

Feld, Louise; Hjelmsø, Mathis Hjort; Nielsen, Morten Schostag; Jacobsen, Anne Dorthe; Rønn, Regin; Ekelund, Flemming; Krogh, Paul Henning; Strobel, Bjarne Westergaard; Jacobsen, Carsten Suhr

2015-01-01

Background and Methods Assessing the effects of pesticide hazards on microbiological processes in the soil is currently based on analyses that provide limited insight into the ongoing processes. This study proposes a more comprehensive approach. The side effects of pesticides may appear as changes in the expression of specific microbial genes or as changes in diversity. To assess the impact of pesticides on gene expression, we focused on the amoA gene, which is involved in ammonia oxidation. We prepared soil microcosms and exposed them to dazomet, mancozeb or no pesticide. We hypothesized that the amount of amoA transcript decreases upon pesticide application, and to test this hypothesis, we used reverse-transcription qPCR. We also hypothesized that bacterial diversity is affected by pesticides. This hypothesis was investigated via 454 sequencing and diversity analysis of the 16S ribosomal RNA and RNA genes, representing the active and total soil bacterial communities, respectively. Results and Conclusion Treatment with dazomet reduced both the bacterial and archaeal amoA transcript numbers by more than two log units and produced long-term effects for more than 28 days. Mancozeb also inhibited the numbers of amoA transcripts, but only transiently. The bacterial and archaeal amoA transcripts were both sensitive bioindicators of pesticide side effects. Additionally, the numbers of bacterial amoA transcripts correlated with nitrate production in N-amended microcosms. Dazomet reduced the total bacterial numbers by one log unit, but the population size was restored after twelve days. The diversity of the active soil bacteria also seemed to be re-established after twelve days. However, the total bacterial diversity as reflected in the 16S ribosomal RNA gene sequences was largely dominated by Firmicutes and Proteobacteria at day twelve, likely reflecting a halt in the growth of early opportunists and the re-establishment of a more diverse population. We observed no

Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

PubMed

Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

2011-11-01

Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

Structural insights into cell cycle control by essential GTPase Era.

PubMed

Ji, Xinhua

Era (Escherichia coli Ras-like protein), essential for bacterial cell viability, is composed of an N-terminal GTPase domain and a C-terminal KH domain. In bacteria, it is required for the processing of 16S ribosomal RNA (rRNA) and maturation of 30S (small) ribosomal subunit. Era recognizes 10 nucleotides ( 1530 GAUCACCUCC 1539 ) near the 3' end of 16S rRNA and interacts with helix 45 (h45, nucleotides 1506-1529). GTP binding enables Era to bind RNA, RNA binding stimulates Era's GTP-hydrolyzing activity, and GTP hydrolysis releases Era from matured 30S ribosomal subunit. As such, Era controls cell growth rate via regulating the maturation of the 30S ribosomal subunit. Ribosomes manufacture proteins in all living organisms. The GAUCA sequence and h45 are highly conserved in all three kingdoms of life. Homologues of Era are present in eukaryotic cells. Hence, the mechanism of bacterial Era action also sheds light on the cell cycle control of eukaryotes.

Mpp10 represents a platform for the interaction of multiple factors within the 90S pre-ribosome

PubMed Central

Kharde, Satyavati; Ahmed, Yasar Luqman; Stier, Gunter; Kunze, Ruth; Sinning, Irmgard

2017-01-01

In eukaryotes, ribosome assembly is a highly complex process that involves more than 200 assembly factors that ensure the folding, modification and processing of the different rRNA species as well as the timely association of ribosomal proteins. One of these factors, Mpp10 associates with Imp3 and Imp4 to form a complex that is essential for the normal production of the 18S rRNA. Here we report the crystal structure of a complex between Imp4 and a short helical element of Mpp10 to a resolution of 1.88 Å. Furthermore, we extend the interaction network of Mpp10 and characterize two novel interactions. Mpp10 is able to bind the ribosome biogenesis factor Utp3/Sas10 through two conserved motifs in its N-terminal region. In addition, Mpp10 interacts with the ribosomal protein S5/uS7 using a short stretch within an acidic loop region. Thus, our findings reveal that Mpp10 provides a platform for the simultaneous interaction with multiple proteins in the 90S pre-ribosome. PMID:28813493

The Expansion Segments of 28S Ribosomal RNA Extensively Match Human Messenger RNAs

PubMed Central

Parker, Michael S.; Balasubramaniam, Ambikaipakan; Sallee, Floyd R.; Parker, Steven L.

2018-01-01

Eukaryote ribosomal RNAs (rRNAs) have expanded in the course of phylogeny by addition of nucleotides in specific insertion areas, the expansion segments. These number about 40 in the larger (25–28S) rRNA (up to 2,400 nucleotides), and about 12 in the smaller (18S) rRNA (<700 nucleotides). Expansion of the larger rRNA shows a clear phylogenetic increase, with a dramatic rise in mammals and especially in hominids. Substantial portions of expansion segments in this RNA are not bound to ribosomal proteins, and may engage extraneous interactants, including messenger RNAs (mRNAs). Studies on the ribosome-mRNA interaction have focused on proteins of the smaller ribosomal subunit, with some examination of 18S rRNA. However, the expansion segments of human 28S rRNA show much higher density and numbers of mRNA matches than those of 18S rRNA, and also a higher density and match numbers than its own core parts. We have studied that with frequent and potentially stable matches containing 7–15 nucleotides. The expansion segments of 28S rRNA average more than 50 matches per mRNA even assuming only 5% of their sequence as available for such interaction. Large expansion segments 7, 15, and 27 of 28S rRNA also have copious long (≥10-nucleotide) matches to most human mRNAs, with frequencies much higher than in other 28S rRNA parts. Expansion segments 7 and 27 and especially segment 15 of 28S rRNA show large size increase in mammals compared to other metazoans, which could reflect a gain of function related to interaction with non-ribosomal partners. The 28S rRNA expansion segment 15 shows very high increments in size, guanosine, and cytidine nucleotide content and mRNA matching in mammals, and especially in hominids. With these segments (but not with other 28S rRNA or any 18S rRNA expansion segments) the density and number of matches are much higher in 5′-terminal than in 3′-terminal untranslated mRNA regions, which may relate to mRNA mobilization via 5′ termini. Matches

The primary structure of rat liver ribosomal protein L37. Homology with yeast and bacterial ribosomal proteins.

PubMed

Lin, A; McNally, J; Wool, I G

1983-09-10

The covalent structure of the rat liver 60 S ribosomal subunit protein L37 was determined. Twenty-four tryptic peptides were purified and the sequence of each was established; they accounted for all 111 residues of L37. The sequence of the first 30 residues of L37, obtained previously by automated Edman degradation of the intact protein, provided the alignment of the first 9 tryptic peptides. Three peptides (CN1, CN2, and CN3) were produced by cleavage of protein L37 with cyanogen bromide. The sequence of CN1 (65 residues) was established from the sequence of secondary peptides resulting from cleavage with trypsin and chymotrypsin. The sequence of CN1 in turn served to order tryptic peptides 1 through 14. The sequence of CN2 (15 residues) was determined entirely by a micromanual procedure and allowed the alignment of tryptic peptides 14 through 18. The sequence of the NH2-terminal 28 amino acids of CN3 (31 residues) was determined; in addition the complete sequences of the secondary tryptic and chymotryptic peptides were done. The sequence of CN3 provided the order of tryptic peptides 18 through 24. Thus the sequence of the three cyanogen bromide peptides also accounted for the 111 residues of protein L37. The carboxyl-terminal amino acids were identified after carboxypeptidase A treatment. There is a disulfide bridge between half-cystinyl residues at positions 40 and 69. Rat liver ribosomal protein L37 is homologous with yeast YP55 and with Escherichia coli L34. Moreover, there is a segment of 17 residues in rat L37 that occurs, albeit with modifications, in yeast YP55 and in E. coli S4, L20, and L34.

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

PubMed Central

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Heat treatment induced bacterial changes in irrigation water and their implications for plant disease management.

PubMed

Hao, W; Hong, C X

2014-05-01

A new heat treatment for recycled irrigation water using 48 °C for 24 h to inactivate Phytophthora and bacterial plant pathogens is estimated to reduce fuel cost and environmental footprint by more than 50 % compared to current protocol (95 °C for 30 s). The objective of this study was to determine the impact of this new heat treatment temperature regime on bacterial community structure in water and its practical implications. Bacterial communities in irrigation water were analyzed before and after heat treatment using both culture-dependent and -independent strategies based on the 16S ribosomal DNA. A significant shift was observed in the bacterial community after heat treatment. Most importantly, bacteria with biological control potential--Bacillus and Paenibacillus, and Pseudomonas species became more abundant at both 48 and 42 °C. These findings imply that the new heat treatment procedure not only controls existing plant pathogens but also may make the heat-treated irrigation water a more antagonistic environment against plant pathogens, promoting sustainable disease management.

Differential phosphorylation of ribosomal proteins in Arabidopsis thaliana plants during day and night.

PubMed

Turkina, Maria V; Klang Årstrand, Hanna; Vener, Alexander V

2011-01-01

Protein synthesis in plants is characterized by increase in the translation rates for numerous proteins and central metabolic enzymes during the day phase of the photoperiod. The detailed molecular mechanisms of this diurnal regulation are unknown, while eukaryotic protein translation is mainly controlled at the level of ribosomal initiation complexes, which also involves multiple events of protein phosphorylation. We characterized the extent of protein phosphorylation in cytosolic ribosomes isolated from leaves of the model plant Arabidopsis thaliana harvested during day or night. Proteomic analyses of preparations corresponding to both phases of the photoperiod detected phosphorylation at eight serine residues in the C-termini of six ribosomal proteins: S2-3, S6-1, S6-2, P0-2, P1 and L29-1. This included previously unknown phosphorylation of the 40S ribosomal protein S6 at Ser-231. Relative quantification of the phosphorylated peptides using stable isotope labeling and mass spectrometry revealed a 2.2 times increase in the day/night phosphorylation ratio at this site. Phosphorylation of the S6-1 and S6-2 variants of the same protein at Ser-240 increased by the factors of 4.2 and 1.8, respectively. The 1.6 increase in phosphorylation during the day was also found at Ser-58 of the 60S ribosomal protein L29-1. It is suggested that differential phosphorylation of the ribosomal proteins S6-1, S6-2 and L29-1 may contribute to modulation of the diurnal protein synthesis in plants.

Genomic Location of the Major Ribosomal Protein Gene Locus Determines Vibrio cholerae Global Growth and Infectivity

PubMed Central

Soler-Bistué, Alfonso; Mondotte, Juan A.; Bland, Michael Jason; Val, Marie-Eve; Saleh, María-Carla; Mazel, Didier

2015-01-01

The effects on cell physiology of gene order within the bacterial chromosome are poorly understood. In silico approaches have shown that genes involved in transcription and translation processes, in particular ribosomal protein (RP) genes, localize near the replication origin (oriC) in fast-growing bacteria suggesting that such a positional bias is an evolutionarily conserved growth-optimization strategy. Such genomic localization could either provide a higher dosage of these genes during fast growth or facilitate the assembly of ribosomes and transcription foci by keeping physically close the many components of these macromolecular machines. To explore this, we used novel recombineering tools to create a set of Vibrio cholerae strains in which S10-spec-α (S10), a locus bearing half of the ribosomal protein genes, was systematically relocated to alternative genomic positions. We show that the relative distance of S10 to the origin of replication tightly correlated with a reduction of S10 dosage, mRNA abundance and growth rate within these otherwise isogenic strains. Furthermore, this was accompanied by a significant reduction in the host-invasion capacity in Drosophila melanogaster. Both phenotypes were rescued in strains bearing two S10 copies highly distal to oriC, demonstrating that replication-dependent gene dosage reduction is the main mechanism behind these alterations. Hence, S10 positioning connects genome structure to cell physiology in Vibrio cholerae. Our results show experimentally for the first time that genomic positioning of genes involved in the flux of genetic information conditions global growth control and hence bacterial physiology and potentially its evolution. PMID:25875621

Methyltransferase That Modifies Guanine 966 of the 16 S rRNA: FUNCTIONAL IDENTIFICATION AND TERTIARY STRUCTURE*

PubMed Central

Lesnyak, Dmitry V.; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V.; Bogdanov, Alexey A.; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A.

2010-01-01

N2-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m2G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m2G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m2G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05 Å. The structure closely resembles RsmC rRNA methyltransferase, specific for m2G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m2G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed. PMID:17189261

Methyltransferase that modifies guanine 966 of the 16 S rRNA: functional identification and tertiary structure.

PubMed

Lesnyak, Dmitry V; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V; Bogdanov, Alexey A; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A

2007-02-23

N(2)-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m(2)G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m(2)G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m(2)G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05A(.) The structure closely resembles RsmC rRNA methyltransferase, specific for m(2)G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m(2)G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed.

A novel lignin degradation bacterial consortium for efficient pulping.

PubMed

Wang, Yanxia; Liu, Quan; Yan, Lei; Gao, Yamei; Wang, Yanjie; Wang, Weidong

2013-07-01

A lignin degradation bacterial consortium named LDC was screened from the sludge of a reeds pond by a restricted subculture. It could break down 60.9% lignin in reeds at 30°C under conditions of static culture within 15 days. In order to analyze the diversity of LDC, plate isolation, 16S rDNA clone library and ARDRA (Amplified Ribosomal DNA Restriction Analysis) were performed. Six bacterial strains were isolated from LDC and eighteen DNA phylotypes were identified from 230 bacterial analyzed clones. They were classified into Clostridiales(9.1%), Geovibrio thiophilus (5.1%), Desulfomicrobium (10.9%), Pseudomonas sp. (25.2%), Azoarcus sp. (5.1%), Thauera (5.1%), Paenibacillus sp. (5.1%), Cohnella sp. (2.2%), Acinetobacter sp. (3.1%), Microbacterium (7.8%), and uncultured bacterium (21.3%). In addition, physical characteristics of paper hand-sheets between biological pretreatment and chemical pretreatment were compared. The results showed that LDC had the capability of lignin degradation and was efficient for pulping, which would provide a new choice for biopulping. Copyright © 2013 Elsevier Ltd. All rights reserved.

Protein folding on the ribosome studied using NMR spectroscopy

PubMed Central

Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John

2013-01-01

NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462

rrndb: the Ribosomal RNA Operon Copy Number Database

PubMed Central

Klappenbach, Joel A.; Saxman, Paul R.; Cole, James R.; Schmidt, Thomas M.

2001-01-01

The Ribosomal RNA Operon Copy Number Database (rrndb) is an Internet-accessible database containing annotated information on rRNA operon copy number among prokaryotes. Gene redundancy is uncommon in prokaryotic genomes, yet the rRNA genes can vary from one to as many as 15 copies. Despite the widespread use of 16S rRNA gene sequences for identification of prokaryotes, information on the number and sequence of individual rRNA genes in a genome is not readily accessible. In an attempt to understand the evolutionary implications of rRNA operon redundancy, we have created a phylogenetically arranged report on rRNA gene copy number for a diverse collection of prokaryotic microorganisms. Each entry (organism) in the rrndb contains detailed information linked directly to external websites including the Ribosomal Database Project, GenBank, PubMed and several culture collections. Data contained in the rrndb will be valuable to researchers investigating microbial ecology and evolution using 16S rRNA gene sequences. The rrndb web site is directly accessible on the WWW at http://rrndb.cme.msu.edu. PMID:11125085

A Plant 5S Ribosomal RNA Mimic Regulates Alternative Splicing of Transcription Factor IIIA Pre-mRNAs

PubMed Central

Hammond, Ming C.; Wachter, Andreas; Breaker, Ronald R.

2009-01-01

Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with striking resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs (pre-mRNAs) from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. Since the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing. PMID:19377483

A plant 5S ribosomal RNA mimic regulates alternative splicing of transcription factor IIIA pre-mRNAs.

PubMed

Hammond, Ming C; Wachter, Andreas; Breaker, Ronald R

2009-05-01

Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with clear resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. As the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing.

Real-time polymerase chain reaction in transfusion medicine: applications for detection of bacterial contamination in blood products.

PubMed

Dreier, Jens; Störmer, Melanie; Kleesiek, Knut

2007-07-01

Bacterial contamination of blood components, particularly of platelet concentrates (PCs), represents the greatest infectious risk in blood transfusion. Although the incidence of platelet bacterial contamination is approximately 1 per 2,000 U, the urgent need for a method for the routine screening of PCs to improve safety for patients had not been considered for a long time. Besides the culturing systems, which will remain the criterion standard, rapid methods for sterility screening will play a more important role in transfusion medicine in the future. In particular, nucleic acid amplification techniques (NATs) are powerful potential tools for bacterial screening assays. The combination of excellent sensitivity and specificity, reduced contamination risk, ease of performance, and speed has made real-time polymerase chain reaction (PCR) technology an appealing alternative to conventional culture-based testing methods. When using real-time PCR for the detection of bacterial contamination, several points have to be considered. The main focus is the choice of the target gene; the assay format; the nucleic acid extraction method, depending on the sample type; and the evaluation of an ideal sampling strategy. However, several factors such as the availability of bacterial-derived nucleic acid amplification reagents, the impracticability, and the cost have limited the use of NATs until now. Attempts to reduce the presence of contaminating nucleic acids from reagents in real-time PCR have been described, but none of these approaches have proven to be very effective or to lower the sensitivity of the assay. Recently, a number of broad-range NAT assays targeting the 16S ribosomal DNA or 23S ribosomal RNA for the detection of bacteria based on real-time technology have been reported. This review will give a short survey of current approaches to and the limitations of the application of real-time PCR for bacterial detection in blood components, with emphasis on the bacterial

Post-translational modification of ribosomally synthesized peptides by a radical SAM epimerase in Bacillus subtilis

NASA Astrophysics Data System (ADS)

Benjdia, Alhosna; Guillot, Alain; Ruffié, Pauline; Leprince, Jérôme; Berteau, Olivier

2017-07-01

Ribosomally synthesized peptides are built out of L-amino acids, whereas D-amino acids are generally the hallmark of non-ribosomal synthetic processes. Here we show that the model bacterium Bacillus subtilis is able to produce a novel type of ribosomally synthesized and post-translationally modified peptide that contains D-amino acids, and which we propose to call epipeptides. We demonstrate that a two [4Fe-4S]-cluster radical S-adenosyl-L-methionine (SAM) enzyme converts L-amino acids into their D-counterparts by catalysing Cα-hydrogen-atom abstraction and using a critical cysteine residue as the hydrogen-atom donor. Unexpectedly, these D-amino acid residues proved to be essential for the activity of a peptide that induces the expression of LiaRS, a major component of the bacterial cell envelope stress-response system. Present in B. subtilis and in several members of the human microbiome, these epipeptides and radical SAM epimerases broaden the landscape of peptidyl structures accessible to living organisms.

Investigating bacterial populations in styrene-degrading biofilters by 16S rDNA tag pyrosequencing.

PubMed

Portune, Kevin J; Pérez, M Carmen; Álvarez-Hornos, F Javier; Gabaldón, Carmen

2015-01-01

Microbial biofilms are essential components in the elimination of pollutants within biofilters, yet still little is known regarding the complex relationships between microbial community structure and biodegradation function within these engineered ecosystems. To further explore this relationship, 16S rDNA tag pyrosequencing was applied to samples taken at four time points from a styrene-degrading biofilter undergoing variable operating conditions. Changes in microbial structure were observed between different stages of biofilter operation, and the level of styrene concentration was revealed to be a critical factor affecting these changes. Bacterial genera Azoarcus and Pseudomonas were among the dominant classified genera in the biofilter. Canonical correspondence analysis (CCA) and correlation analysis revealed that the genera Brevundimonas, Hydrogenophaga, and Achromobacter may play important roles in styrene degradation under increasing styrene concentrations. No significant correlations (P > 0.05) could be detected between biofilter operational/functional parameters and biodiversity measurements, although biological heterogeneity within biofilms and/or technical variability within pyrosequencing may have considerably affected these results. Percentages of selected bacterial taxonomic groups detected by fluorescence in situ hybridization (FISH) were compared to results from pyrosequencing in order to assess the effectiveness and limitations of each method for identifying each microbial taxon. Comparison of results revealed discrepancies between the two methods in the detected percentages of numerous taxonomic groups. Biases and technical limitations of both FISH and pyrosequencing, such as the binding of FISH probes to non-target microbial groups and lack of classification of sequences for defined taxonomic groups from pyrosequencing, may partially explain some differences between the two methods.

Phylogenetic diversity in the genus Bacillus as seen by 16S rRNA sequencing studies

NASA Technical Reports Server (NTRS)

Rossler, D.; Ludwig, W.; Schleifer, K. H.; Lin, C.; McGill, T. J.; Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.

1991-01-01

Comparative sequence analysis of 16S ribosomal (r)RNAs or DNAs of Bacillus alvei, B. laterosporus, B. macerans, B. macquariensis, B. polymyxa and B. stearothermophilus revealed the phylogenetic diversity of the genus Bacillus. Based on the presently available data set of 16S rRNA sequences from bacilli and relatives at least four major "Bacillus clusters" can be defined: a "Bacillus subtilis cluster" including B. stearothermophilus, a "B. brevis cluster" including B. laterosporus, a "B. alvei cluster" including B. macerans, B. maquariensis and B. polymyxa and a "B. cycloheptanicus branch".

Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

PubMed Central

Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

2011-01-01

5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

Crystal Structure of Ribosome-Inactivating Protein Ricin A Chain in Complex with the C-Terminal Peptide of the Ribosomal Stalk Protein P2.

PubMed

Shi, Wei-Wei; Tang, Yun-Sang; Sze, See-Yuen; Zhu, Zhen-Ning; Wong, Kam-Bo; Shaw, Pang-Chui

2016-10-13

Ricin is a type 2 ribosome-inactivating protein (RIP), containing a catalytic A chain and a lectin-like B chain. It inhibits protein synthesis by depurinating the N-glycosidic bond at α-sarcin/ricin loop (SRL) of the 28S rRNA, which thereby prevents the binding of elongation factors to the GTPase activation center of the ribosome. Here, we present the 1.6 Å crystal structure of Ricin A chain (RTA) complexed to the C-terminal peptide of the ribosomal stalk protein P2, which plays a crucial role in specific recognition of elongation factors and recruitment of eukaryote-specific RIPs to the ribosomes. Our structure reveals that the C-terminal GFGLFD motif of P2 peptide is inserted into a hydrophobic pocket of RTA, while the interaction assays demonstrate the structurally untraced SDDDM motif of P2 peptide contributes to the interaction with RTA. This interaction mode of RTA and P protein is in contrast to that with trichosanthin (TCS), Shiga-toxin (Stx) and the active form of maize RIP (MOD), implying the flexibility of the P2 peptide-RIP interaction, for the latter to gain access to ribosome.

G-protein control of the ribosome-associated stress response protein SpoT.

PubMed

Jiang, Mengxi; Sullivan, Susan M; Wout, Patrice K; Maddock, Janine R

2007-09-01

The bacterial response to stress is controlled by two proteins, RelA and SpoT. RelA generates the alarmone (p)ppGpp under amino acid starvation, whereas SpoT is responsible for (p)ppGpp hydrolysis and for synthesis of (p)ppGpp under a variety of cellular stress conditions. It is widely accepted that RelA is associated with translating ribosomes. The cellular location of SpoT, however, has been controversial. SpoT physically interacts with the ribosome-associated GTPase CgtA, and we show here that, under an optimized salt condition, SpoT is also associated with a pre-50S particle. Analysis of spoT and cgtA mutants and strains overexpressing CgtA suggests that the ribosome associations of SpoT and CgtA are mutually independent. The steady-state level of (p)ppGpp is increased in a cgtA mutant, but the accumulation of (p)ppGpp during amino acid starvation is not affected, providing strong evidence that CgtA regulates the (p)ppGpp level during exponential growth but not during the stringent response. We show that CgtA is not associated with pre-50S particles during amino acid starvation, indicating that under these conditions in which (p)ppGpp accumulates, CgtA is not bound either to the pre-50S particle or to SpoT. We propose that, in addition to its role as a 50S assembly factor, CgtA promotes SpoT (p)ppGpp degradation activity on the ribosome and that the loss of CgtA from the ribosome is necessary for maximal (p)ppGpp accumulation under stress conditions. Intriguingly, we found that in the absence of spoT and relA, cgtA is still an essential gene in Escherichia coli.

Polybacterial community analysis in human conjunctiva through 16S rRNA gene libraries.

PubMed

Deepthi, KrishnanNair Geetha; Jayasudha, Rajagopalaboopathi; Girish, Rameshan Nair; Manikandan, Palanisamy; Ram, Rammohan; Narendran, Venkatapathy; Prabagaran, Solai Ramatchandirane

2018-05-14

The conjunctival sac of healthy human harbours a variety of microorganisms. When the eye is compromised, an occasional inadvertent spread happens to the adjacent tissue, resulting in bacterial ocular infections. Microbiological investigation of the conjunctival swab is one of the broadly used modality to study the aetiological agent of conjunctiva. However, most of the time such methods yield unsatisfactory results. Hence, the present study intends to identify the bacterial community in human conjunctiva of pre-operative subjects through 16S rRNA gene libraries. Out of 45 samples collected from preoperative patients undergoing cataract surgery, 36 libraries were constructed with bacterial nested-PCR-positive samples. The representative clones with unique restriction pattern were generated through Amplified Ribosomal DNA Restriction Analysis (ARDRA) which were sequenced for phylogenetic affiliation. A total of 211 representative clones were obtained which were distributed in phyla Actinobacteria, Firmicutes, α-Proteobacteria, β-Proteobacteria, γ-Proteobacteria, Bacteroidetes, and Deinococcus-Thermus. Findings revealed the presence of polybacterial community, especially in some cases even though no bacterium or a single bacterium alone was identified through cultivable method. Remarkably, we identified 17 species which have never been reported in any ocular infections. The sequencing data reported 6 unidentified bacteria suggesting the possibility of novel organisms in the sample. Since, polybacterial community has been identified consisting of both gram positive and gram negative bacteria, a broad spectrum antibiotic therapy is advisable to the patients who are undergoing cataract surgery. Consolidated effort would significantly improve a clear understanding of the nature of microbial community in the human conjunctiva which will promote administration of appropriate antibiotic regimen and also help in the development of oligonucleotide probes to screen the

Comparison of 16S ribosomal RNA genes in Clavibacter michiganensis subspecies with other coryneform bacteria.

PubMed

Li, X; De Boer, S H

1995-10-01

Nearly complete sequences (97-99%) of the 16S rRNA genes were determined for type strains of Clavibacter michiganensis subsp. michiganensis, Clavibacter michiganensis subsp. insidiosus, Clavibacter michiganensis subsp. sepedonicus, and Clavibacter michiganensis subsp. nebraskensis. The four subspecies had less than 1% dissimilarity in their 16S rRNA genes. Comparative studies indicated that the C. michiganensis subsp. shared relatively high homology with the 16S rRNA gene of Clavibacter xyli. Further comparison with representatives of other Gram-positive coryneform and related bacteria with high G+C% values showed that this group of bacteria was subdivided into three clusters. One cluster consisted of the Clavibacter michiganensis subsp., Clavibacter xyli, Arthrobacter globiformis, Arthrobacter simplex, and Frankia sp.; another cluster consisted of members of the corynebacteria-mycobacteria-nocardia (CMN) group of Mycobacteriaceae including Tsukamurella paurometabolum; and Propionibacterium freudenreichii alone formed a unique cluster, which was remote from other coryneform bacteria analyzed. The three clusters may reflect a systematic rank higher than the genus level among these bacteria.

Phylogenetic Network Analysis Revealed the Occurrence of Horizontal Gene Transfer of 16S rRNA in the Genus Enterobacter

PubMed Central

Sato, Mitsuharu; Miyazaki, Kentaro

2017-01-01

Horizontal gene transfer (HGT) is a ubiquitous genetic event in bacterial evolution, but it seldom occurs for genes involved in highly complex supramolecules (or biosystems), which consist of many gene products. The ribosome is one such supramolecule, but several bacteria harbor dissimilar and/or chimeric 16S rRNAs in their genomes, suggesting the occurrence of HGT of this gene. However, we know little about whether the genes actually experience HGT and, if so, the frequency of such a transfer. This is primarily because the methods currently employed for phylogenetic analysis (e.g., neighbor-joining, maximum likelihood, and maximum parsimony) of 16S rRNA genes assume point mutation-driven tree-shape evolution as an evolutionary model, which is intrinsically inappropriate to decipher the evolutionary history for genes driven by recombination. To address this issue, we applied a phylogenetic network analysis, which has been used previously for detection of genetic recombination in homologous alleles, to the 16S rRNA gene. We focused on the genus Enterobacter, whose phylogenetic relationships inferred by multi-locus sequence alignment analysis and 16S rRNA sequences are incompatible. All 10 complete genomic sequences were retrieved from the NCBI database, in which 71 16S rRNA genes were included. Neighbor-joining analysis demonstrated that the genes residing in the same genomes clustered, indicating the occurrence of intragenomic recombination. However, as suggested by the low bootstrap values, evolutionary relationships between the clusters were uncertain. We then applied phylogenetic network analysis to representative sequences from each cluster. We found three ancestral 16S rRNA groups; the others were likely created through recursive recombination between the ancestors and chimeric descendants. Despite the large sequence changes caused by the recombination events, the RNA secondary structures were conserved. Successive intergenomic and intragenomic recombination

Ericoid Roots and Mycospheres Govern Plant-Specific Bacterial Communities in Boreal Forest Humus.

PubMed

Timonen, Sari; Sinkko, Hanna; Sun, Hui; Sietiö, Outi-Maaria; Rinta-Kanto, Johanna M; Kiheri, Heikki; Heinonsalo, Jussi

2017-05-01

In this study, the bacterial populations of roots and mycospheres of the boreal pine forest ericoid plants, heather (Calluna vulgaris), bilberry (Vaccinium myrtillus), and lingonberry (Vaccinium vitis-idaea), were studied by qPCR and next-generation sequencing (NGS). All bacterial communities of mycosphere soils differed from soils uncolonized by mycorrhizal mycelia. Colonization by mycorrhizal hyphae increased the total number of bacterial 16S ribosomal DNA (rDNA) gene copies in the humus but decreased the number of different bacterial operational taxonomic units (OTUs). Nevertheless, ericoid roots and mycospheres supported numerous OTUs not present in uncolonized humus. Bacterial communities in bilberry mycospheres were surprisingly similar to those in pine mycospheres but not to bacterial communities in heather and lingonberry mycospheres. In contrast, bacterial communities of ericoid roots were more similar to each other than to those of pine roots. In all sample types, the relative abundances of bacterial sequences belonging to Alphaproteobacteria and Acidobacteria were higher than the sequences belonging to other classes. Soil samples contained more Actinobacteria, Deltaproteobacteria, Opitutae, and Planctomycetia, whereas Armatimonadia, Betaproteobacteria, Gammaproteobacteria, and Sphingobacteriia were more common to roots. All mycosphere soils and roots harbored bacteria unique to that particular habitat. Our study suggests that the habitation by ericoid plants increases the overall bacterial diversity of boreal forest soils.

Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

NASA Technical Reports Server (NTRS)

Fox, G. E.

1985-01-01

Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

Metagenomic analyses of the dominant bacterial community in the Fildes Peninsula, King George Island (South Shetland Islands)

NASA Astrophysics Data System (ADS)

Foong, Choon Pin; Wong Vui Ling, Clemente Michael; González, Marcelo

2010-08-01

There is little information on the bacterial diversity of the Fildes Peninsula, King George Island. Hence, this study was conducted to determine the bacterial population of sediments and soils from the lakes, river, glacier and an abandoned oil tank area in the Fildes Peninsula, using a metagenomic approach. DNA was extracted from the sediment and soil samples, and analyzed using the 16S rDNA polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE). A total of 299 DNA fragments resolved using the DGGE were sequenced. The results of the analysis provided an overview of the predominant groups of bacteria and the diversity of the bacterial communities. The most abundant phyla of bacteria in Fildes Peninsula were Bacteroidetes, Proteobacteria, Acidobacteria, Gemmatimonadetes, Nitrospira, Firmicutes, Actinobacteria, Chloroflexi, Cyanobacteria, Spirochaetes, Deinococcus-Thermus, WS3 and BRC1. All of the sediment samples from the lakes had different representatives of dominant bacterial species. Interestingly, 15% of the operational taxonomic units (OTUs) did not group into any of the existing phyla in the Ribosomal Database Project (RDP). One of the OTUs had a similarity of <0.90 when compared to the GenBank sequences and probably was a novel bacterium specific to that location. The majority of the bacterial 16S rDNA sequences were found to be closely related to those found elsewhere.

[Family of ribosomal proteins S1 contains unique conservative domain].

PubMed

Deriusheva, E I; Machulin, A V; Selivanova, O M; Serdiuk, I N

2010-01-01

Different representatives of bacteria have different number of amino acid residues in the ribosomal proteins S1. This number varies from 111 (Spiroplasma kunkelii) to 863 a.a. (Treponema pallidum). Traditionally and for lack of this protein three-dimensional structure, its architecture is represented as repeating S1 domains. Number of these domains depends on the protein's length. Domain's quantity and its boundaries data are contained in the specialized databases, such as SMART, Pfam and PROSITE. However, for the same object these data may be very different. For search of domain's quantity and its boundaries, new approach, based on the analysis of dicted secondary structure (PsiPred), was used. This approach allowed us to reveal structural domains in amino acid sequences of S1 proteins and at that number varied from one to six. Alignment of S1 proteins, containing different domain's number, with the S1 RNAbinding domain of Escherichia coli PNPase elicited a fact that in family of ribosomal proteins SI one domain has maximal homology with S1 domain from PNPase. This conservative domain migrates along polypeptide chain and locates in proteins, containing different domain's number, according to specified pattern. In this domain as well in the S1 domain from PNPase, residues Phe-19, Phe-22, His-34, Asp-64 and Arg-68 are clustered on the surface and formed RNA binding site.

Mitochondrial ribosome assembly in health and disease

PubMed Central

De Silva, Dasmanthie; Tu, Ya-Ting; Amunts, Alexey; Fontanesi, Flavia; Barrientos, Antoni

2015-01-01

The ribosome is a structurally and functionally conserved macromolecular machine universally responsible for catalyzing protein synthesis. Within eukaryotic cells, mitochondria contain their own ribosomes (mitoribosomes), which synthesize a handful of proteins, all essential for the biogenesis of the oxidative phosphorylation system. High-resolution cryo-EM structures of the yeast, porcine and human mitoribosomal subunits and of the entire human mitoribosome have uncovered a wealth of new information to illustrate their evolutionary divergence from their bacterial ancestors and their adaptation to synthesis of highly hydrophobic membrane proteins. With such structural data becoming available, one of the most important remaining questions is that of the mitoribosome assembly pathway and factors involved. The regulation of mitoribosome biogenesis is paramount to mitochondrial respiration, and thus to cell viability, growth and differentiation. Moreover, mutations affecting the rRNA and protein components produce severe human mitochondrial disorders. Despite its biological and biomedical significance, knowledge on mitoribosome biogenesis and its deviations from the much-studied bacterial ribosome assembly processes is scarce, especially the order of rRNA processing and assembly events and the regulatory factors required to achieve fully functional particles. This article focuses on summarizing the current available information on mitoribosome assembly pathway, factors that form the mitoribosome assembly machinery, and the effect of defective mitoribosome assembly on human health. PMID:26030272

Molecular Characterization of Epiphytic Bacterial Communities on Charophycean Green Algae

PubMed Central

Fisher, Madeline M.; Wilcox, Lee W.; Graham, Linda E.

1998-01-01

Epiphytic bacterial communities within the sheath material of three filamentous green algae, Desmidium grevillii, Hyalotheca dissiliens, and Spondylosium pulchrum (class Charophyceae, order Zygnematales), collected from a Sphagnum bog were characterized by PCR amplification, cloning, and sequencing of 16S ribosomal DNA. A total of 20 partial sequences and nine different sequence types were obtained, and one sequence type was recovered from the bacterial communities on all three algae. By phylogenetic analysis, the cloned sequences were placed into several major lineages of the Bacteria domain: the Flexibacter/Cytophaga/Bacteroides phylum and the α, β, and γ subdivisions of the phylum Proteobacteria. Analysis at the subphylum level revealed that the majority of our sequences were not closely affiliated with those of known, cultured taxa, although the estimated evolutionary distances between our sequences and their nearest neighbors were always less than 0.1 (i.e., greater than 90% similar). This result suggests that the majority of sequences obtained in this study represent as yet phenotypically undescribed bacterial species and that the range of bacterial-algal interactions that occur in nature has not yet been fully described. PMID:9797295

An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum

NASA Technical Reports Server (NTRS)

Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.

1993-01-01

The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.

Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

NASA Astrophysics Data System (ADS)

Poirot, Olivier; Timsit, Youri

2016-05-01

From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

Seasonal succession leads to habitat-dependent differentiation in ribosomal RNA:DNA ratios among freshwater lake bacteria

DOE PAGES

Denef, Vincent J.; Fujimoto, Masanori; Berry, Michelle A.; ...

2016-04-29

Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP). Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA genemore » sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate) water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. Furthermore, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors.« less

Seasonal succession leads to habitat-dependent differentiation in ribosomal RNA:DNA ratios among freshwater lake bacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Denef, Vincent J.; Fujimoto, Masanori; Berry, Michelle A.

Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP). Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA genemore » sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate) water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. Furthermore, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors.« less

Mode of inheritance and evidence for cistron heterogeneity of chloroplast 16S ribosomal RNA genes in Nicotiana.

PubMed

Vacek, A T; Bourque, D P

1980-09-01

Oligonucleotide maps (fingerprints) of T1 RNase digests of 125I-labeled 16 S chloroplast rRNA of Nicotiana tabacum and N. gossei revealed the presence of T1 oligonucleotide fragment 100 in the 16 S rRNA of N. gossei while N. tabacum 16 S rRNA had a unique T1 oligonucleotide (fragment 101) as well as some fragment 100. From the positions in the fingerprints and from fingerprints of secondary enzymatic digestion of the fragments, we conclude that fragments 100 and 101 are similar in sequence and size, but fragment 100 probably contains an extra uracil residue. This difference is shown to be maternally inherited, thus confirming the location of 16 S chloroplast rRNA genes on chloroplast DNA and ruling out the possibility of genetically active chloroplast rRNA genes in the nucleus. The presence of both fragments 100 and 101 in N. tabacum may indicate sequence heterogeneity between the two cistrons for 16 S chloroplast rRNA. These results demonstrate the feasibility of determining the inheritance of organelle genes by genetic analysis of their primary transcripts.

Bacterial Diversity in Human Subgingival Plaque

PubMed Central

Paster, Bruce J.; Boches, Susan K.; Galvin, Jamie L.; Ericson, Rebecca E.; Lau, Carol N.; Levanos, Valerie A.; Sahasrabudhe, Ashish; Dewhirst, Floyd E.

2001-01-01

The purpose of this study was to determine the bacterial diversity in the human subgingival plaque by using culture-independent molecular methods as part of an ongoing effort to obtain full 16S rRNA sequences for all cultivable and not-yet-cultivated species of human oral bacteria. Subgingival plaque was analyzed from healthy subjects and subjects with refractory periodontitis, adult periodontitis, human immunodeficiency virus periodontitis, and acute necrotizing ulcerative gingivitis. 16S ribosomal DNA (rDNA) bacterial genes from DNA isolated from subgingival plaque samples were PCR amplified with all-bacterial or selective primers and cloned into Escherichia coli. The sequences of cloned 16S rDNA inserts were used to determine species identity or closest relatives by comparison with sequences of known species. A total of 2,522 clones were analyzed. Nearly complete sequences of approximately 1,500 bases were obtained for putative new species. About 60% of the clones fell into 132 known species, 70 of which were identified from multiple subjects. About 40% of the clones were novel phylotypes. Of the 215 novel phylotypes, 75 were identified from multiple subjects. Known putative periodontal pathogens such as Porphyromonas gingivalis, Bacteroides forsythus, and Treponema denticola were identified from multiple subjects, but typically as a minor component of the plaque as seen in cultivable studies. Several phylotypes fell into two recently described phyla previously associated with extreme natural environments, for which there are no cultivable species. A number of species or phylotypes were found only in subjects with disease, and a few were found only in healthy subjects. The organisms identified only from diseased sites deserve further study as potential pathogens. Based on the sequence data in this study, the predominant subgingival microbial community consisted of 347 species or phylotypes that fall into 9 bacterial phyla. Based on the 347 species seen in our

A pilot study to assess the bacterial contaminants in hookah pipes in a community setting.

PubMed

Martinasek, M; Rivera, Z; Ferrer, A; Freundt, E

2018-05-01

Hookah smoking among young adults remains a public health threat. Increasing research has uncovered the deleterious effects of hookah smoking, including both acute and chronic health conditions. Due to the current lack of regulation, hookah bars/lounges lack protocols for equipment sanitation. To examine evidence of bacterial contamination in hookah pipes due to a lack of sanitation regulations. For this field/laboratory study, 10 hookah bars/lounges were studied. Isolated bacteria were characterized and identified by species using 16S ribosomal RNA gene sequencing. At the 10 hookah bars sampled, the mouthpiece had the highest bacterial prevalence and diversity. Some of the bacterial isolates were found to be antibiotic-resistant. Ten of the isolated bacteria were Gram-positive and two were identified as Gram-negative. Levels of bacterial contamination vary widely from one hookah bar to the next, and reflect a lack of industry standards for cleaning these devices. Bacterial contamination of hookah pipes may represent a fomite for transmission of infectious diseases. Our results warrant future surveillance of hookahs to monitor for potential human pathogens.

Primer selection impacts specific population abundances but not community dynamics in a monthly time-series 16S rRNA gene amplicon analysis of coastal marine bacterioplankton.

PubMed

Wear, Emma K; Wilbanks, Elizabeth G; Nelson, Craig E; Carlson, Craig A

2018-03-09

Primers targeting the 16S small subunit ribosomal RNA marker gene, used to characterize bacterial and archaeal communities, have recently been re-evaluated for marine planktonic habitats. To investigate whether primer selection affects the ecological interpretation of bacterioplankton populations and community dynamics, amplicon sequencing with four primer sets targeting several hypervariable regions of the 16S rRNA gene was conducted on both mock communities constructed from cloned 16S rRNA genes and a time-series of DNA samples from the temperate coastal Santa Barbara Channel. Ecological interpretations of community structure (delineation of depth and seasonality, correlations with environmental factors) were similar across primer sets, while population dynamics varied. We observed substantial differences in relative abundances of taxa known to be poorly resolved by some primer sets, such as Thaumarchaeota and SAR11, and unexpected taxa including Roseobacter clades. Though the magnitude of relative abundances of common OTUs differed between primer sets, the relative abundances of the OTUs were nonetheless strongly correlated. We do not endorse one primer set but rather enumerate strengths and weaknesses to facilitate selection appropriate to a system or experimental goal. While 16S rRNA gene primer bias suggests caution in assessing quantitative population dynamics, community dynamics appear robust across studies using different primers. © 2018 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

Bacterial Diversity in Bentonites, Engineered Barrier for Deep Geological Disposal of Radioactive Wastes.

PubMed

Lopez-Fernandez, Margarita; Cherkouk, Andrea; Vilchez-Vargas, Ramiro; Jauregui, Ruy; Pieper, Dietmar; Boon, Nico; Sanchez-Castro, Ivan; Merroun, Mohamed L

2015-11-01

The long-term disposal of radioactive wastes in a deep geological repository is the accepted international solution for the treatment and management of these special residues. The microbial community of the selected host rocks and engineered barriers for the deep geological repository may affect the performance and the safety of the radioactive waste disposal. In this work, the bacterial population of bentonite formations of Almeria (Spain), selected as a reference material for bentonite-engineered barriers in the disposal of radioactive wastes, was studied. 16S ribosomal RNA (rRNA) gene-based approaches were used to study the bacterial community of the bentonite samples by traditional clone libraries and Illumina sequencing. Using both techniques, the bacterial diversity analysis revealed similar results, with phylotypes belonging to 14 different bacterial phyla: Acidobacteria, Actinobacteria, Armatimonadetes, Bacteroidetes, Chloroflexi, Cyanobacteria, Deinococcus-Thermus, Firmicutes, Gemmatimonadetes, Planctomycetes, Proteobacteria, Nitrospirae, Verrucomicrobia and an unknown phylum. The dominant groups of the community were represented by Proteobacteria and Bacteroidetes. A high diversity was found in three of the studied samples. However, two samples were less diverse and dominated by Betaproteobacteria.

DIVERSITY OF BAT-ASSOCIATED LEPTOSPIRA IN THE PERUVIAN AMAZON INFERRED BY BAYESIAN PHYLOGENETIC ANALYSIS OF 16S RIBOSOMAL DNA SEQUENCES

PubMed Central

MATTHIAS, MICHAEL A.; DÍAZ, M. MÓNICA; CAMPOS, KALINA J.; CALDERON, MARITZA; WILLIG, MICHAEL R.; PACHECO, VICTOR; GOTUZZO, EDUARDO; GILMAN, ROBERT H.; VINETZ, JOSEPH M.

2008-01-01

The role of bats as potential sources of transmission to humans or as maintenance hosts of leptospires is poorly understood. We quantified the prevalence of leptospiral colonization in bats in the Peruvian Amazon in the vicinity of Iquitos, an area of high biologic diversity. Of 589 analyzed bats, culture (3 of 589) and molecular evidence (20 of 589) of leptospiral colonization was found in the kidneys, yielding an overall colonization rate of 3.4%. Infection rates differed with habitat and location, and among different bat species. Bayesian analysis was used to infer phylogenic relationships of leptospiral 16S ribosomal DNA sequences. Tree topologies were consistent with groupings based on DNA-DNA hybridization studies. A diverse group of leptospires was found in peri-Iquitos bat populations including Leptospira interrogans (5 clones), L. kirschneri (1), L. borgpetersenii (4), L. fainei (1), and two previously undescribed leptospiral species (8). Although L. kirschenri and L. interrogans have been previously isolated from bats, this report is the first to describe L. borgpetersenii and L. fainei infection of bats. A wild animal reservoir of L. fainei has not been previously described. The detection in bats of the L. interrogans serovar Icterohemorrhagiae, a leptospire typically maintained by peridomestic rats, suggests a rodent-bat infection cycle. Bats in Iquitos maintain a genetically diverse group of leptospires. These results provide a solid basis for pursuing molecular epidemiologic studies of bat-associated Leptospira, a potentially new epidemiologic reservoir of transmission of leptospirosis to humans. PMID:16282313

The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

PubMed

Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

2017-01-17

Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

Ribosomes: Ribozymes that Survived Evolution Pressures but Is Paralyzed by Tiny Antibiotics

NASA Astrophysics Data System (ADS)

Yonath, Ada

An impressive number of crystal structures of ribosomes, the universal cellular machines that translate the genetic code into proteins, emerged during the last decade. The determination of ribosome high resolution structure, which was widely considered formidable, led to novel insights into the ribosomal function, namely, fidelity, catalytic mechanism, and polymerize activities. They also led to suggestions concerning its origin and shed light on the action, selectivity and synergism of ribosomal antibiotics; illuminated mechanisms acquiring bacterial resistance and provided structural information for drug improvement and design. These studies required the pioneering and implementation of advanced technologies, which directly influenced the remarkable increase of the number of structures deposited in the Protein Data Bank.

The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition

PubMed Central

Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

2017-01-01

Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA. PMID:28032591

How conserved are the bacterial communities associated with aphids? A detailed assessment of the Brevicoryne brassicae (Hemiptera: Aphididae) using 16S rDNA.

PubMed

Clark, E L; Daniell, T J; Wishart, J; Hubbard, S F; Karley, A J

2012-12-01

Aphids harbor a community of bacteria that include obligate and facultative endosymbionts belonging to the Enterobacteriaceae along with opportunistic, commensal, or pathogenic bacteria. This study represents the first detailed analysis of the identity and diversity of the bacterial community associated with the cabbage aphid, Brevicoryne brassicae (L.). 16S rDNA sequence analysis revealed that the community of bacteria associated with B. brassicae was diverse, with at least four different bacterial community types detected among aphid lines, collected from widely dispersed sites in Northern Britain. The bacterial sequence types isolated from B. brassicae showed little similarity to any bacterial endosymbionts characterized in insects; instead, they were closely related to free-living extracellular bacterial species that have been isolated from the aphid gut or that are known to be present in the environment, suggesting that they are opportunistic bacteria transmitted between the aphid gut and the environment. To quantify variation in bacterial community between aphid lines, which was driven largely by differences in the proportions of two dominant bacterial orders, the Pseudomonales and the Enterobacteriales, we developed a novel real-time (Taqman) qPCR assay. By improving our knowledge of aphid microbial ecology, and providing novel molecular tools to examine the presence and function of the microbial community, this study forms the basis of further research to explore the influence of the extracellular bacterial community on aphid fitness, pest status, and susceptibility to control by natural enemies.

16S rRNA gene pyrosequencing reveals bacterial dysbiosis in the duodenum of dogs with idiopathic inflammatory bowel disease.

PubMed

Suchodolski, Jan S; Dowd, Scot E; Wilke, Vicky; Steiner, Jörg M; Jergens, Albert E

2012-01-01

Canine idiopathic inflammatory bowel disease (IBD) is believed to be caused by a complex interaction of genetic, immunologic, and microbial factors. While mucosa-associated bacteria have been implicated in the pathogenesis of canine IBD, detailed studies investigating the enteric microbiota using deep sequencing techniques are lacking. The objective of this study was to evaluate mucosa-adherent microbiota in the duodenum of dogs with spontaneous idiopathic IBD using 16 S rRNA gene pyrosequencing. Biopsy samples of small intestinal mucosa were collected endoscopically from healthy dogs (n = 6) and dogs with moderate IBD (n = 7) or severe IBD (n = 7) as assessed by a clinical disease activity index. Total RNA was extracted from biopsy specimens and 454-pyrosequencing of the 16 S rRNA gene was performed on aliquots of cDNA from each dog. Intestinal inflammation was associated with significant differences in the composition of the intestinal microbiota when compared to healthy dogs. PCoA plots based on the unweighted UniFrac distance metric indicated clustering of samples between healthy dogs and dogs with IBD (ANOSIM, p<0.001). Proportions of Fusobacteria (p = 0.010), Bacteroidaceae (p = 0.015), Prevotellaceae (p = 0.022), and Clostridiales (p = 0.019) were significantly more abundant in healthy dogs. In contrast, specific bacterial genera within Proteobacteria, including Diaphorobacter (p = 0.044) and Acinetobacter (p = 0.040), were either more abundant or more frequently identified in IBD dogs. In conclusion, dogs with spontaneous IBD exhibit alterations in microbial groups, which bear resemblance to dysbiosis reported in humans with chronic intestinal inflammation. These bacterial groups may serve as useful targets for monitoring intestinal inflammation.

Reductive alkylation of ribosomes as a probe to the topography of ribosomal proteins*

PubMed Central

Moore, Graham; Crichton, Robert R.

1974-01-01

Escherichia coli ribosomes were treated with a number of different aldehydes of various sizes in the presence of NaBH4. After incorporation of either 3H or 14C, the ribosomal proteins were separated by two-dimensional polyacrylamide-gel electrophoresis and the extent of alkylation of the lysine residues in each protein was measured. The same pattern of alkylation was observed with the four reagents used, namely formaldehyde, acetone, benzaldehyde and 3,4,5-trimethoxybenzaldehyde. Every protein in 30S and 50S subunits was modified, although there was considerable variation in the degree of alkylation of individual proteins. A topographical classification of ribosomal proteins is presented, based on the degree of exposure of lysine residues. The data indicate that every protein of the ribosome has at least one lysine residue exposed at or near the surface of the ribonucleo-protein complex. PMID:4462744

A Comparison of Structural and Evolutionary Attributes of Escherichia coli and Thermus thermophilus Small Ribosomal Subunits: Signatures of Thermal Adaptation

PubMed Central

Mallik, Saurav; Kundu, Sudip

2013-01-01

Here we compare the structural and evolutionary attributes of Thermus thermophilus and Escherichia coli small ribosomal subunits (SSU). Our results indicate that with few exceptions, thermophilic 16S ribosomal RNA (16S rRNA) is densely packed compared to that of mesophilic at most of the analogous spatial regions. In addition, we have located species-specific cavity clusters (SSCCs) in both species. E. coli SSCCs are numerous and larger compared to T. thermophilus SSCCs, which again indicates densely packed thermophilic 16S rRNA. Thermophilic ribosomal proteins (r-proteins) have longer disordered regions than their mesophilic homologs and they experience larger disorder-to-order transitions during SSU-assembly. This is reflected in the predicted higher conformational changes of thermophilic r-proteins compared to their mesophilic homologs during SSU-assembly. This high conformational change of thermophilic r-proteins may help them to associate with the 16S ribosomal RNA with high complementary interfaces, larger interface areas, and denser molecular contacts, compared to those of mesophilic. Thus, thermophilic protein-rRNA interfaces are tightly associated with 16S rRNA than their mesophilic homologs. Densely packed 16S rRNA interior and tight protein-rRNA binding of T. thermophilus (compared to those of E. coli) are likely the signatures of its thermal adaptation. We have found a linear correlation between the free energy of protein-RNA interface formation, interface size, and square of conformational changes, which is followed in both prokaryotic and eukaryotic SSU. Disorder is associated with high protein-RNA interface polarity. We have found an evolutionary tendency to maintain high polarity (thereby disorder) at protein-rRNA interfaces, than that at rest of the protein structures. However, some proteins exhibit exceptions to this general trend. PMID:23940533

Comprehensive description of blood microbiome from healthy donors assessed by 16S targeted metagenomic sequencing.

PubMed

Païssé, Sandrine; Valle, Carine; Servant, Florence; Courtney, Michael; Burcelin, Rémy; Amar, Jacques; Lelouvier, Benjamin

2016-05-01

Recent studies have revealed that the blood of healthy humans is not as sterile as previously supposed. The objective of this study was to provide a comprehensive description of the microbiome present in different fractions of the blood of healthy individuals. The study was conducted in 30 healthy blood donors to the French national blood collection center (Établissement Français du Sang). We have set up a 16S rDNA quantitative polymerase chain reaction assay as well as a 16S targeted metagenomics sequencing pipeline specifically designed to analyze the blood microbiome, which we have used on whole blood as well as on different blood fractions (buffy coat [BC], red blood cells [RBCs], and plasma). Most of the blood bacterial DNA is located in the BC (93.74%), and RBCs contain more bacterial DNA (6.23%) than the plasma (0.03%). The distribution of 16S DNA is different for each fraction and spreads over a relatively broad range among donors. At the phylum level, blood fractions contain bacterial DNA mostly from the Proteobacteria phylum (more than 80%) but also from Actinobacteria, Firmicutes, and Bacteroidetes. At deeper taxonomic levels, there are striking differences between the bacterial profiles of the different blood fractions. We demonstrate that a diversified microbiome exists in healthy blood. This microbiome has most likely an important physiologic role and could be implicated in certain transfusion-transmitted bacterial infections. In this regard, the amount of 16S bacterial DNA or the microbiome profile could be monitored to improve the safety of the blood supply. © 2016 AABB.

High-resolution structure of the Escherichia coli ribosome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Noeske, Jonas; Wasserman, Michael R.; Terry, Daniel S.

Protein synthesis by the ribosome is highly dependent on the ionic conditions in the cellular environment, but the roles of ribosome solvation remain poorly understood. Moreover, the function of modifications to ribosomal RNA and ribosomal proteins are unclear. Here we present the structure of the Escherichia coli 70S ribosome to 2.4 Å resolution. The structure reveals details of the ribosomal subunit interface that are conserved in all domains of life, and suggest how solvation contributes to ribosome integrity and function. The structure also suggests how the conformation of ribosomal protein uS12 likely impacts its contribution to messenger RNA decoding. Inmore » conclusion, this structure helps to explain the phylogenetic conservation of key elements of the ribosome, including posttranscriptional and posttranslational modifications and should serve as a basis for future antibiotic development.« less

High-resolution structure of the Escherichia coli ribosome

DOE PAGES

Noeske, Jonas; Wasserman, Michael R.; Terry, Daniel S.; ...

2015-03-16

Protein synthesis by the ribosome is highly dependent on the ionic conditions in the cellular environment, but the roles of ribosome solvation remain poorly understood. Moreover, the function of modifications to ribosomal RNA and ribosomal proteins are unclear. Here we present the structure of the Escherichia coli 70S ribosome to 2.4 Å resolution. The structure reveals details of the ribosomal subunit interface that are conserved in all domains of life, and suggest how solvation contributes to ribosome integrity and function. The structure also suggests how the conformation of ribosomal protein uS12 likely impacts its contribution to messenger RNA decoding. Inmore » conclusion, this structure helps to explain the phylogenetic conservation of key elements of the ribosome, including posttranscriptional and posttranslational modifications and should serve as a basis for future antibiotic development.« less

Multiple effects of S13 in modulating the strength of intersubunit interactions in the ribosome during translation.

PubMed

Cukras, Anthony R; Green, Rachel

2005-05-27

The ribosomal protein S13 is found in the head region of the small subunit, where it interacts with the central protuberance of the large ribosomal subunit and with the P site-bound tRNA through its extended C terminus. The bridging interactions between the large and small subunits are dynamic, and are thought to be critical in orchestrating the molecular motions of the translation cycle. S13 provides a direct link between the tRNA-binding site and the movements in the head of the small subunit seen during translocation, thereby providing a possible pathway of signal transduction. We have created and characterized an rpsM(S13)-deficient strain of Escherichia coli and have found significant defects in subunit association, initiation and translocation through in vitro assays of S13-deficient ribosomes. Targeted mutagenesis of specific bridge and tRNA contact elements in S13 provides evidence that these two interaction domains play critical roles in maintaining the fidelity of translation. This ribosomal protein thus appears to play a non-essential, yet important role by modulating subunit interactions in multiple steps of the translation cycle.

The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

NASA Astrophysics Data System (ADS)

Alejo, Jose Luis

In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

The Arabidopsis TOR Kinase Specifically Regulates the Expression of Nuclear Genes Coding for Plastidic Ribosomal Proteins and the Phosphorylation of the Cytosolic Ribosomal Protein S6

PubMed Central

Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A.; Hanson, Johannes; Meyer, Christian

2016-01-01

Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5′ untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5′ terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase. PMID:27877176

Nonenzymatic microorganism identification based on ribosomal RNA

NASA Astrophysics Data System (ADS)

Ives, Jeffrey T.; Pierini, Alicia M.; Stokes, Jeffrey A.; Wahlund, Thomas M.; Read, Betsy; Bechtel, James H.; Bronk, Burt V.

1999-11-01

Effective defense against biological warfare (BW) agents requires rapid, fieldable and accurate systems. For micro- organisms like bacteria and viruses, ribosomal RNA (rRNA) provides a valuable target with multiple advantages of species specificity and intrinsic target amplification. Vegetative and spore forms of bacteria contain approximately 104 copies of rRNA. Direct detection of rRNA copies can eliminate some of the interference and preparation difficulties involved in enzymatic amplification methods. In order to apply the advantages of rRNA to BW defense, we are developing a fieldable system based on 16S rRNA, physical disruption of the micro-organism, solid phase hybridization, and fluorescence detection. Our goals include species-specific identification, complete operation from raw sample to identification in 15 minutes or less, and compact, fieldable instrumentation. Initial work on this project has investigated the lysis and hybridization steps, the species-specificity of oligonucleotides probes, and the development of a novel electromagnetic method to physically disrupt the micro- organisms. Target bacteria have been Escherichia coli (E. coli) and Bacillus subtilis (B. subtilis). Continuing work includes further development of methods to rapidly disrupt the micro-organisms and release the rRNA, improved integration and processing, and extension to bacterial and mammalian viruses like MS2 and vesicular stomatitis virus.

Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

PubMed Central

Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

1990-01-01

The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

Viral-bacterial associations in acute apical abscesses.

PubMed

Ferreira, Dennis C; Rôças, Isabela N; Paiva, Simone S M; Carmo, Flávia L; Cavalcante, Fernanda S; Rosado, Alexandre S; Santos, Kátia R N; Siqueira, José F

2011-08-01

Viral-bacterial and bacterial synergism have been suggested to contribute to the pathogenesis of several human diseases. This study sought to investigate the possible associations between 9 candidate endodontic bacterial pathogens and 9 human viruses in samples from acute apical abscesses. DNA extracts from purulent exudate aspirates of 33 cases of acute apical abscess were surveyed for the presence of 9 selected bacterial species using a 16S ribosomal RNA gene-based nested polymerase chain reaction (PCR) approach. Single or nested PCR assays were used for detection of the human papillomavirus (HPV) and herpesviruses types 1 to 8. Two-thirds of the abscess samples were positive for at least one of the target viruses. Specifically, the most frequently detected viruses were HHV-8 (54.5%); HPV (9%); and varicella zoster virus (VZV), Epstein-Barr virus (EBV), and HHV-6 (6%). Bacterial DNA was present in all cases and the most prevalent bacterial species were Treponema denticola (70%), Tannerella forsythia (67%), Porphyromonas endodontalis (67%), Dialister invisus (61%), and Dialister pneumosintes (57.5%). HHV-8 was positively associated with 7 of the target bacterial species and HPV with 4, but all these associations were weak. Several bacterial pairs showed a moderate positive association. Viral coinfection was found in 6 abscess cases, but no significant viral association could be determined. Findings demonstrated that bacterial and viral DNA occurred concomitantly in two-thirds of the samples from endodontic abscesses. Although this may suggest a role for viruses in the etiology of apical abscesses, the possibility also exists that the presence of viruses in abscess samples is merely a consequence of the bacterially induced disease process. Further studies are necessary to clarify the role of these viral-bacterial interactions, if any, in the pathogenesis of acute apical abscesses. Copyright © 2011 Mosby, Inc. All rights reserved.

Combination of culture-independent and culture-dependent molecular methods for the determination of bacterial community of iru, a fermented Parkia biglobosa seeds.

PubMed

Adewumi, Gbenga A; Oguntoyinbo, Folarin A; Keisam, Santosh; Romi, Wahengbam; Jeyaram, Kumaraswamy

2012-01-01

In this study, bacterial composition of iru produced by natural, uncontrolled fermentation of Parkia biglobosa seeds was assessed using culture-independent method in combination with culture-based genotypic typing techniques. PCR-denaturing gradient gel electrophoresis (DGGE) revealed similarity in DNA fragments with the two DNA extraction methods used and confirmed bacterial diversity in the 16 iru samples from different production regions. DNA sequencing of the highly variable V3 region of the 16S rRNA genes obtained from PCR-DGGE identified species related to Bacillus subtilis as consistent bacterial species in the fermented samples, while other major bands were identified as close relatives of Staphylococcus vitulinus, Morganella morganii, B. thuringiensis, S. saprophyticus, Tetragenococcus halophilus, Ureibacillus thermosphaericus, Brevibacillus parabrevis, Salinicoccus jeotgali, Brevibacterium sp. and uncultured bacteria clones. Bacillus species were cultured as potential starter cultures and clonal relationship of different isolates determined using amplified ribosomal DNA restriction analysis (ARDRA) combined with 16S-23S rRNA gene internal transcribed spacer (ITS) PCR amplification, restriction analysis (ITS-PCR-RFLP), and randomly amplified polymorphic DNA (RAPD-PCR). This further discriminated B. subtilis and its variants from food-borne pathogens such as B. cereus and suggested the need for development of controlled fermentation processes and good manufacturing practices (GMP) for iru production to achieve product consistency, safety quality, and improved shelf life.

Correlation of maple sap composition with bacterial and fungal communities determined by multiplex automated ribosomal intergenic spacer analysis (MARISA).

PubMed

Filteau, Marie; Lagacé, Luc; LaPointe, Gisèle; Roy, Denis

2011-08-01

During collection, maple sap is contaminated by bacteria and fungi that subsequently colonize the tubing system. The bacterial microbiota has been more characterized than the fungal microbiota, but the impact of both components on maple sap quality remains unclear. This study focused on identifying bacterial and fungal members of maple sap and correlating microbiota composition with maple sap properties. A multiplex automated ribosomal intergenic spacer analysis (MARISA) method was developed to presumptively identify bacterial and fungal members of maple sap samples collected from 19 production sites during the tapping period. Results indicate that the fungal community of maple sap is mainly composed of yeast related to Mrakia sp., Mrakiella sp., Guehomyces pullulans, Cryptococcus victoriae and Williopsis saturnus. Mrakia, Mrakiella and Guehomyces peaks were identified in samples of all production sites and can be considered dominant and stable members of the fungal microbiota of maple sap. A multivariate analysis based on MARISA profiles and maple sap chemical composition data showed correlations between Candida sake, Janthinobacterium lividum, Williopsis sp., Leuconostoc mesenteroides, Mrakia sp., Rhodococcus sp., Pseudomonas tolaasii, G. pullulans and maple sap composition at different flow periods. This study provides new insights on the relationship between microbial community and maple sap quality. Copyright © 2011 Elsevier Ltd. All rights reserved.

Association Between Breast Milk Bacterial Communities and Establishment and Development of the Infant Gut Microbiome.

PubMed

Pannaraj, Pia S; Li, Fan; Cerini, Chiara; Bender, Jeffrey M; Yang, Shangxin; Rollie, Adrienne; Adisetiyo, Helty; Zabih, Sara; Lincez, Pamela J; Bittinger, Kyle; Bailey, Aubrey; Bushman, Frederic D; Sleasman, John W; Aldrovandi, Grace M

2017-07-01

Establishment of the infant microbiome has lifelong implications on health and immunity. Gut microbiota of breastfed compared with nonbreastfed individuals differ during infancy as well as into adulthood. Breast milk contains a diverse population of bacteria, but little is known about the vertical transfer of bacteria from mother to infant by breastfeeding. To determine the association between the maternal breast milk and areolar skin and infant gut bacterial communities. In a prospective, longitudinal study, bacterial composition was identified with sequencing of the 16S ribosomal RNA gene in breast milk, areolar skin, and infant stool samples of 107 healthy mother-infant pairs. The study was conducted in Los Angeles, California, and St Petersburg, Florida, between January 1, 2010, and February 28, 2015. Amount and duration of daily breastfeeding and timing of solid food introduction. Bacterial composition in maternal breast milk, areolar skin, and infant stool by sequencing of the 16S ribosomal RNA gene. In the 107 healthy mother and infant pairs (median age at the time of specimen collection, 40 days; range, 1-331 days), 52 (43.0%) of the infants were male. Bacterial communities were distinct in milk, areolar skin, and stool, differing in both composition and diversity. The infant gut microbial communities were more closely related to an infant's mother's milk and skin compared with a random mother (mean difference in Bray-Curtis distances, 0.012 and 0.014, respectively; P < .001 for both). Source tracking analysis was used to estimate the contribution of the breast milk and areolar skin microbiomes to the infant gut microbiome. During the first 30 days of life, infants who breastfed to obtain 75% or more of their daily milk intake received a mean (SD) of 27.7% (15.2%) of the bacteria from breast milk and 10.3% (6.0%) from areolar skin. Bacterial diversity (Faith phylogenetic diversity, P = .003) and composition changes were associated with the

Enzymatic specificity of three ribosome-inactivating proteins against fungal ribosomes, and correlation with antifungal activity.

PubMed

Park, Sang-Wook; Stevens, Noah M; Vivanco, Jorge M

2002-12-01

Ribosome-inactivating proteins (RIPs) are enzymes that cleave a specific adenine base from the highly conserved sarcin/ricin (S/R) loop of the large ribosomal RNA, thus arresting protein synthesis at the translocation step. In the present study, we employed three RIPs to dissect the antifungal activity of RIPs as plant defense proteins. We measured the catalytic activity of RAT (the catalytic A-chain of ricin from Ricinus communis L.), saporin-S6 (from Saponaria officinalis L.), and ME (RIP from Mirabilis expansa R&P) against intact ribosomal substrates isolated from various pathogenic fungi. We further determined the enzymatic specificity of these three RIPs against fungal ribosomes, from Rhizoctonia solani Kuhn, Alternaria solani Sorauer, Trichoderma reesei Simmons and Candida albicans Berkhout, and correlated the data with antifungal activity. RAT showed the strongest toxicity against all tested fungal ribosomes, except for the ribosomes isolated from C. albicans, which were most susceptible to saporin. RAT and saporin showed higher enzymatic activity than ME against ribosomes from all of the fungal species assayed, but did not show detectable antifungal activity. In contrast, ME showed substantial inhibitory activity against fungal growth. Using N-hydroxysuccinimide-fluorescein labeling of RIPs and fluorescence microscopy, we determined that ME was targeted to the surface of fungal cells and transferred into the cells. Thus, ME caused ribosome depurination and subsequent fungal mortality. In contrast, saporin did not interact with fungal cells, correlating with its lack of antifungal activity.

Principles of 60S ribosomal subunit assembly emerging from recent studies in yeast

PubMed Central

Konikkat, Salini; Woolford, John L.

2017-01-01

Ribosome biogenesis requires the intertwined processes of folding, modification, and processing of ribosomal RNA, together with binding of ribosomal proteins. In eukaryotic cells, ribosome assembly begins in the nucleolus, continues in the nucleoplasm, and is not completed until after nascent particles are exported to the cytoplasm. The efficiency and fidelity of ribosome biogenesis are facilitated by >200 assembly factors and ~76 different small nucleolar RNAs. The pathway is driven forward by numerous remodeling events to rearrange the ribonucleoprotein architecture of pre-ribosomes. Here, we describe principles of ribosome assembly that have emerged from recent studies of biogenesis of the large ribosomal subunit in the yeast Saccharomyces cerevisiae. We describe tools that have empowered investigations of ribosome biogenesis, and then summarize recent discoveries about each of the consecutive steps of subunit assembly. PMID:28062837

Bacterial diversity in water injection systems of Brazilian offshore oil platforms.

PubMed

Korenblum, Elisa; Valoni, Erika; Penna, Mônica; Seldin, Lucy

2010-01-01

Biogenic souring and microbial-influenced corrosion is a common scenario in water-flooded petroleum reservoirs. Water injection systems are continuously treated to control bacterial contamination, but some bacteria that cause souring and corrosion can persist even after different treatments have been applied. Our aim was to increase our knowledge of the bacterial communities that persist in the water injection systems of three offshore oil platforms in Brazil. To achieve this goal, we used a culture-independent molecular approach (16S ribosomal RNA gene clone libraries) to analyze seawater samples that had been subjected to different treatments. Phylogenetic analyses revealed that the bacterial communities from the different platforms were taxonomically different. A predominance of bacterial clones affiliated with Gammaproteobacteria, mostly belonging to the genus Marinobacter (60.7%), were observed in the platform A samples. Clones from platform B were mainly related to the genera Colwellia (37.9%) and Achromobacter (24.6%), whereas clones obtained from platform C were all related to unclassified bacteria. Canonical correspondence analyses showed that different treatments such as chlorination, deoxygenation, and biocide addition did not significantly influence the bacterial diversity in the platforms studied. Our results demonstrated that the injection water used in secondary oil recovery procedures contained potentially hazardous bacteria, which may ultimately cause souring and corrosion.

Bacterial Population Changes in a Membrane Bioreactor for Graywater Treatment Monitored by Denaturing Gradient Gel Electrophoretic Analysis of 16S rRNA Gene Fragments

PubMed Central

Stamper, David M.; Walch, Marianne; Jacobs, Rachel N.

2003-01-01

The bacterial population of a graywater treatment system was monitored over the course of 100 days, along with several wastewater biochemical parameters. The graywater treatment system employed an 1,800-liter membrane bioreactor (MBR) to process the waste, with essentially 100% recycling of the biomass. Graywater feed consisting of 10% galley water and 90% laundry water, selected to approximate the graywater composition on board U.S. Navy ships, was collected offsite. Five-day biological oxygen demand (BOD5), oils and greases (O/G), nitrogen, and phosphorus were monitored in the feed and were found to vary greatly day to day. Changes in the bacterial population were monitored by PCR amplification of region 332 to 518 (Escherichia coli numbering) of the 16S rRNA gene and denaturing gradient gel electrophoresis (DGGE) analysis of the resultant PCR products. DGGE analysis indicated a diverse and unstable bacterial population throughout the 100-day period, with spikes in feed strength causing significant changes in community structure. Long-term similarity between the communities was 0 to 25%, depending on the method of analysis. In spite of the unstable bacterial population, the MBR system was able to meet effluent quality parameters approximately 90% of the time. PMID:12571004

Bacterial population changes in a membrane bioreactor for graywater treatment monitored by denaturing gradient gel electrophoretic analysis of 16S rRNA gene fragments.

PubMed

Stamper, David M; Walch, Marianne; Jacobs, Rachel N

2003-02-01

The bacterial population of a graywater treatment system was monitored over the course of 100 days, along with several wastewater biochemical parameters. The graywater treatment system employed an 1,800-liter membrane bioreactor (MBR) to process the waste, with essentially 100% recycling of the biomass. Graywater feed consisting of 10% galley water and 90% laundry water, selected to approximate the graywater composition on board U.S. Navy ships, was collected offsite. Five-day biological oxygen demand (BOD(5)), oils and greases (O/G), nitrogen, and phosphorus were monitored in the feed and were found to vary greatly day to day. Changes in the bacterial population were monitored by PCR amplification of region 332 to 518 (Escherichia coli numbering) of the 16S rRNA gene and denaturing gradient gel electrophoresis (DGGE) analysis of the resultant PCR products. DGGE analysis indicated a diverse and unstable bacterial population throughout the 100-day period, with spikes in feed strength causing significant changes in community structure. Long-term similarity between the communities was 0 to 25%, depending on the method of analysis. In spite of the unstable bacterial population, the MBR system was able to meet effluent quality parameters approximately 90% of the time.

Translation Initiation Factor eIF4B Interacts with a Picornavirus Internal Ribosome Entry Site in both 48S and 80S Initiation Complexes Independently of Initiator AUG Location

PubMed Central

Ochs, Kerstin; Rust, René C.; Niepmann, Michael

1999-01-01

Most eukaryotic initiation factors (eIFs) are required for internal translation initiation at the internal ribosome entry site (IRES) of picornaviruses. eIF4B is incorporated into ribosomal 48S initiation complexes with the IRES RNA of foot-and-mouth disease virus (FMDV). In contrast to the weak interaction of eIF4B with capped cellular mRNAs and its release upon entry of the ribosomal 60S subunit, eIF4B remains tightly associated with the FMDV IRES during formation of complete 80S ribosomes. Binding of eIF4B to the IRES is energy dependent, and binding of the small ribosomal subunit to the IRES requires the previous energy-dependent association of initiation factors with the IRES. The interaction of eIF4B with the IRES in 48S and 80S complexes is independent of the location of the initiator AUG and thus independent of the mechanism by which the small ribosomal subunit is placed at the actual start codon, either by direct internal ribosomal entry or by scanning. eIF4B does not greatly rearrange its binding to the IRES upon entry of the ribosomal subunits, and the interaction of eIF4B with the IRES is independent of the polypyrimidine tract-binding protein, which enhances FMDV translation. PMID:10438840

Development of Amplified 16S Ribosomal DNA Restriction Analysis for Identification of Actinomyces Species and Comparison with Pyrolysis-Mass Spectrometry and Conventional Biochemical Tests

PubMed Central

Hall, Val; O’Neill, G. L.; Magee, J. T.; Duerden, B. I.

1999-01-01

Identification of Actinomyces spp. by conventional phenotypic methods is notoriously difficult and unreliable. Recently, the application of chemotaxonomic and molecular methods has clarified the taxonomy of the group and has led to the recognition of several new species. A practical and discriminatory identification method is now needed for routine identification of clinical isolates. Amplified 16S ribosomal DNA restriction analysis (ARDRA) was applied to reference strains (n = 27) and clinical isolates (n = 36) of Actinomyces spp. and other gram-positive rods. Clinical strains were identified initially to the species level by conventional biochemical tests. However, given the low degree of confidence in conventional methods, the findings obtained by ARDRA were also compared with those obtained by pyrolysis-mass spectrometry. The ARDRA profiles generated by the combination of HaeIII and HpaII endonuclease digestion differentiated all reference strains to the species or subspecies level. The profiles correlated well with the findings obtained by pyrolysis-mass spectrometry and by conventional tests and enabled the identification of 31 of 36 clinical isolates to the species level. ARDRA was shown to be a simple, rapid, cost-effective, and highly discriminatory method for routine identification of Actinomyces spp. of clinical origin. PMID:10364594

A bacterial reporter system for the evaluation of antisense oligodeoxynucleotides directed against human papillomavirus type 16 (HPV-16).

PubMed

Guapillo, Mario R; Márquez, Miguel A; Benítez-Hess, María L; Alvarez-Salas, Luis M

2006-07-01

Antisense oligodeoxynucleotides (AS-ODNs) are a promising alternative for the cure of many diseases because of their in vivo specificity and stability. However, AS-ODNs have a strong dependence on the target mRNA structure making necessary extensive in vivo testing. There is, therefore, a need to develop assays to rapidly evaluate in vivo ODN performance. We report a simple and inexpensive bacterial reporter system for the rapid in vivo evaluation of AS-ODNs directed against human papillomavirus type 16 (HPV-16) based on the destruction of a chimeric CFP mRNA using the reported HPV-16 nt 410-445 target. In vitro RNaseH assays confirmed target RNA accessibility after AS-ODN treatment. Expression of CFP in Escherichia coli BL21(DE3) with pGST-TSd2-CFP plasmid containing HPV-16 nt 410-445 target linked to CFP was blocked by transformed antisense PS-ODNs but not by two different scrambled ODN controls. A correlation was observed between bacterial CFP downregulation with the HPV-16 E6/E7 mRNA downregulation and the inhibition of anchorage-independent growth of HPV-16 containing cells suggesting that inhibition of HPV-16 E6/E7 expression by AS-ODNs directed against 410-445 target in cervical tumor cells can be tested in bacterial models.

The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science.

PubMed

Ames, Nancy J; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R

As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and healthcare practitioners to analyze these microbial communities and their role in health and disease. 16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. The objectives of this review are to (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung, and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists-individuals uniquely positioned to utilize these techniques in future studies in clinical settings.

The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science

PubMed Central

Ames, Nancy J.; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R.

2017-01-01

Background As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and health care practitioners to analyze these microbial communities and their role in health and disease.16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. Objectives The objectives of this review are to: (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Discussion Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists—individuals uniquely positioned to utilize these techniques in future studies in clinical settings. PMID:28252578

[Ribosomal RNA Evolution

NASA Technical Reports Server (NTRS)

1997-01-01

It is generally believed that an RNA World existed at an early stage in the history of life. During this early period, RNA molecules are seen to be potentially involved in both catalysis and the storage of genetic information. Translation presents several interrelated themes of inquiry for exobiology. First, it is essential, for understanding the very origin of life, how peptides and eventually proteins might have come to be made on the early Earth in a template directed manner. Second, it is necessary to understand how a machinery of similar complexity to that found in the ribosomes of modern organisms came to exist by the time of the last common ancestor (as detected by 16S rRNA sequence studies). Third, the ribosomal RNAs themselves likely had a very early origin and studies of their history may be very informative about the nature of the RNA World. Moreover, studies of these RNAs will contribute to a better understanding of the potential roles of RNA in early evolution.During the past year we have ave conducted a comparative study of four completely sequenced bacterial genoames. We have focused initially on conservation of gene order. The second component of the project continues to build on the model system for studying the validity of variant 5S rRNA sequences in the vicinity of the modern Vibrio proteolyticus 5S rRNA that we established earlier. This system has made it possible to conduct a detailed and extensive analysis of a local portion of the sequence space. These core methods have been used to construct numerous mutants during the last several years. Although it has been a secondary focus, this work has continued over the last year such that we now have in excess of 125 V. proteolyticus derived constructs which have been made and characterized. We have also continued high resolution NMR work on RNA oligomers originally initiated by G. Kenneth Smith who was funded by a NASA Graduate Student Researcher's Fellowship Award until May of 1996. Mr. Smith

Exposure to West Nile Virus Increases Bacterial Diversity and Immune Gene Expression in Culex pipiens.

PubMed

Zink, Steven D; Van Slyke, Greta A; Palumbo, Michael J; Kramer, Laura D; Ciota, Alexander T

2015-10-27

Complex interactions between microbial residents of mosquitoes and arboviruses are likely to influence many aspects of vectorial capacity and could potentially have profound effects on patterns of arbovirus transmission. Such interactions have not been well studied for West Nile virus (WNV; Flaviviridae, Flavivirus) and Culex spp. mosquitoes. We utilized next-generation sequencing of 16S ribosomal RNA bacterial genes derived from Culex pipiens Linnaeus following WNV exposure and/or infection and compared bacterial populations and broad immune responses to unexposed mosquitoes. Our results demonstrate that WNV infection increases the diversity of bacterial populations and is associated with up-regulation of classical invertebrate immune pathways including RNA interference (RNAi), Toll, and Jak-STAT (Janus kinase-Signal Transducer and Activator of Transcription). In addition, WNV exposure alone, without the establishment of infection, results in similar alterations to microbial and immune signatures, although to a lesser extent. Multiple bacterial genera were found in greater abundance inWNV-exposed and/or infected mosquitoes, yet the most consistent and notable was the genus Serratia.

The impact of recent improvements in cryo-electron microscopy technology on the understanding of bacterial ribosome assembly

PubMed Central

Razi, Aida; Britton, Robert A.

2017-01-01

Abstract Cryo-electron microscopy (cryo-EM) had played a central role in the study of ribosome structure and the process of translation in bacteria since the development of this technique in the mid 1980s. Until recently cryo-EM structures were limited to ∼10 Å in the best cases. However, the recent advent of direct electron detectors has greatly improved the resolution of cryo-EM structures to the point where atomic resolution is now achievable. This improved resolution will allow cryo-EM to make groundbreaking contributions in essential aspects of ribosome biology, including the assembly process. In this review, we summarize important insights that cryo-EM, in combination with chemical and genetic approaches, has already brought to our current understanding of the ribosomal assembly process in bacteria using previous detector technology. More importantly, we discuss how the higher resolution structures now attainable with direct electron detectors can be leveraged to propose precise testable models regarding this process. These structures will provide an effective platform to develop new antibiotics that target this fundamental cellular process. PMID:28180306

Characterization of bacterial community associated with phytoplankton bloom in a eutrophic lake in South Norway using 16S rRNA gene amplicon sequence analysis.

PubMed

Parulekar, Niranjan Nitin; Kolekar, Pandurang; Jenkins, Andrew; Kleiven, Synne; Utkilen, Hans; Johansen, Anette; Sawant, Sangeeta; Kulkarni-Kale, Urmila; Kale, Mohan; Sæbø, Mona

2017-01-01

Interactions between different phytoplankton taxa and heterotrophic bacterial communities within aquatic environments can differentially support growth of various heterotrophic bacterial species. In this study, phytoplankton diversity was studied using traditional microscopic techniques and the bacterial communities associated with phytoplankton bloom were studied using High Throughput Sequencing (HTS) analysis of 16S rRNA gene amplicons from the V1-V3 and V3-V4 hypervariable regions. Samples were collected from Lake Akersvannet, a eutrophic lake in South Norway, during the growth season from June to August 2013. Microscopic examination revealed that the phytoplankton community was mostly represented by Cyanobacteria and the dinoflagellate Ceratium hirundinella. The HTS results revealed that Proteobacteria (Alpha, Beta, and Gamma), Bacteriodetes, Cyanobacteria, Actinobacteria and Verrucomicrobia dominated the bacterial community, with varying relative abundances throughout the sampling season. Species level identification of Cyanobacteria showed a mixed population of Aphanizomenon flos-aquae, Microcystis aeruginosa and Woronichinia naegeliana. A significant proportion of the microbial community was composed of unclassified taxa which might represent locally adapted freshwater bacterial groups. Comparison of cyanobacterial species composition from HTS and microscopy revealed quantitative discrepancies, indicating a need for cross validation of results. To our knowledge, this is the first study that uses HTS methods for studying the bacterial community associated with phytoplankton blooms in a Norwegian lake. The study demonstrates the value of considering results from multiple methods when studying bacterial communities.

Bacterial Microbiota of Rice Roots: 16S-Based Taxonomic Profiling of Endophytic and Rhizospheric Diversity, Endophytes Isolation and Simplified Endophytic Community.

PubMed

Moronta-Barrios, Felix; Gionechetti, Fabrizia; Pallavicini, Alberto; Marys, Edgloris; Venturi, Vittorio

2018-02-11

Rice is currently the most important food crop in the world and we are only just beginning to study the bacterial associated microbiome. It is of importance to perform screenings of the core rice microbiota and also to develop new plant-microbe models and simplified communities for increasing our understanding about the formation and function of its microbiome. In order to begin to address this aspect, we have performed a 16S rDNA taxonomic bacterial profiling of the rhizosphere and endorhizosphere of two high-yield rice cultivars-Pionero 2010 FL and DANAC SD20A-extensively grown in Venezuela in 2014. Fifteen putative bacterial endophytes were then isolated from surface-sterilized roots and further studied in vitro and in planta . We have then performed inoculation of rice seedlings with a simplified community composed by 10 of the isolates and we have tracked them in the course of 30 days in greenhouse cultivation. The results obtained suggest that a set was able to significantly colonize together the rice endorhizospheres, indicating possible cooperation and the ability to form a stable multispecies community. This approach can be useful in the development of microbial solutions for a more sustainable rice production.

Characterization of Fe(II) oxidizing bacterial activities and communities at two acidic Appalachian coalmine drainage-impacted sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Senko, John M.; Wanjugi, Pauline; Lucas, Melanie

2008-06-12

We characterized the microbiologically mediated oxidative precipitation of Fe(II) from coalminederived acidic mine drainage (AMD) along flow-paths at two sites in northern Pennsylvania. At the Gum Boot site, dissolved Fe(II) was efficiently removed from AMD whereas minimal Fe(II) removal occurred at the Fridays-2 site. Neither site received human intervention to treat the AMD. Culturable Fe(II) oxidizing bacteria were most abundant at sampling locations along the AMD flow path corresponding to greatest Fe(II) removal and where overlying water contained abundant dissolved O2. Rates of Fe(II) oxidation determined in laboratory-based sediment incubations were also greatest at these sampling locations. Ribosomal RNA intergenicmore » spacer analysis and sequencing of partial 16S rRNA genes recovered from sediment bacterial communities revealed similarities among populations at points receiving regular inputs of Fe(II)-rich AMD and provided evidence for the presence of bacterial lineages capable of Fe(II) oxidation. A notable difference between bacterial communities at the two sites was the abundance of Chloroflexi-affiliated 16S rRNA gene sequences in clone libraries derived from the Gum Boot sediments. Our results suggest that inexpensive and reliable AMD treatment strategies can be implemented by mimicking the conditions present at the Gum Boot field site.« less

16S rRNA Gene Pyrosequencing Reveals Bacterial Dysbiosis in the Duodenum of Dogs with Idiopathic Inflammatory Bowel Disease

PubMed Central

Suchodolski, Jan S.; Dowd, Scot E.; Wilke, Vicky; Steiner, Jörg M.; Jergens, Albert E.

2012-01-01

Background Canine idiopathic inflammatory bowel disease (IBD) is believed to be caused by a complex interaction of genetic, immunologic, and microbial factors. While mucosa-associated bacteria have been implicated in the pathogenesis of canine IBD, detailed studies investigating the enteric microbiota using deep sequencing techniques are lacking. The objective of this study was to evaluate mucosa-adherent microbiota in the duodenum of dogs with spontaneous idiopathic IBD using 16 S rRNA gene pyrosequencing. Methodology/Principal Findings Biopsy samples of small intestinal mucosa were collected endoscopically from healthy dogs (n = 6) and dogs with moderate IBD (n = 7) or severe IBD (n = 7) as assessed by a clinical disease activity index. Total RNA was extracted from biopsy specimens and 454-pyrosequencing of the 16 S rRNA gene was performed on aliquots of cDNA from each dog. Intestinal inflammation was associated with significant differences in the composition of the intestinal microbiota when compared to healthy dogs. PCoA plots based on the unweighted UniFrac distance metric indicated clustering of samples between healthy dogs and dogs with IBD (ANOSIM, p<0.001). Proportions of Fusobacteria (p = 0.010), Bacteroidaceae (p = 0.015), Prevotellaceae (p = 0.022), and Clostridiales (p = 0.019) were significantly more abundant in healthy dogs. In contrast, specific bacterial genera within Proteobacteria, including Diaphorobacter (p = 0.044) and Acinetobacter (p = 0.040), were either more abundant or more frequently identified in IBD dogs. Conclusions/Significance In conclusion, dogs with spontaneous IBD exhibit alterations in microbial groups, which bear resemblance to dysbiosis reported in humans with chronic intestinal inflammation. These bacterial groups may serve as useful targets for monitoring intestinal inflammation. PMID:22720094

Sequence heterogeneities of genes encoding 16S rRNAs in Paenibacillus polymyxa detected by temperature gradient gel electrophoresis.

PubMed Central

Nübel, U; Engelen, B; Felske, A; Snaidr, J; Wieshuber, A; Amann, R I; Ludwig, W; Backhaus, H

1996-01-01

Sequence heterogeneities in 16S rRNA genes from individual strains of Paenibacillus polymyxa were detected by sequence-dependent separation of PCR products by temperature gradient gel electrophoresis (TGGE). A fragment of the 16S rRNA genes, comprising variable regions V6 to V8, was used as a target sequence for amplifications. PCR products from P. polymyxa (type strain) emerged as a well-defined pattern of bands in the gradient gel. Six plasmids with different inserts, individually demonstrating the migration characteristics of single bands of the pattern, were obtained by cloning the PCR products. Their sequences were analyzed as a representative sample of the total heterogeneity. An amount of 10 variant nucleotide positions in the fragment of 347 bp was observed, with all substitutions conserving the relevant secondary structures of the V6 and V8 regions in the RNA molecules. Hybridizations with specifically designed probes demonstrated different chromosomal locations of the respective rRNA genes. Amplifications of reverse-transcribed rRNA from ribosome preparations, as well as whole-cell hybridizations, revealed a predominant representation of particular sequences in ribosomes of exponentially growing laboratory cultures. Different strains of P. polymyxa showed not only remarkably differing patterns of PCR products in TGGE analysis but also discriminative whole-cell labeling with the designed oligonucleotide probes, indicating the different representation of individual sequences in active ribosomes. Our results demonstrate the usefulness of TGGE for the structural analysis of heterogeneous rRNA genes together with their expression, stress problems of the generation of meaningful data for 16S rRNA sequences and probe designs, and might have consequences for evolutionary concepts. PMID:8824607

Marine mesocosm bacterial colonisation of volcanic ash

NASA Astrophysics Data System (ADS)

Witt, Verena; Cimarelli, Corrado; Ayris, Paul; Kueppers, Ulrich; Erpenbeck, Dirk; Dingwell, Donald; Woerheide, Gert

2015-04-01

Volcanic eruptions regularly eject large quantities of ash particles into the atmosphere, which can be deposited via fallout into oceanic environments. Such fallout has the potential to alter pH, light and nutrient availability at local scales. Shallow-water coral reef ecosystems - "rainforests of the sea" - are highly sensitive to disturbances, such as ocean acidification, sedimentation and eutrophication. Therefore, wind-delivered volcanic ash may lead to burial and mortality of such reefs. Coral reef ecosystem resilience may depend on pioneer bacterial colonisation of the ash layer, supporting subsequent establishment of the micro- and ultimately the macro-community. However, which bacteria are involved in pioneer colonisation remain unknown. We hypothesize that physico-chemical properties (i.e., morphology, mineralogy) of the ash may dictate bacterial colonisation. The effect of substrate properties on bacterial colonisation was tested by exposing five substrates: i) quartz sand ii) crystalline ash (Sakurajima, Japan) iii) volcanic glass iv) carbonate reef sand and v) calcite sand of similar grain size, in controlled marine coral reef aquaria under low light conditions for six months. Bacterial communities were screened every month by Automated Ribosomal Intergenic Spacer Analysis of the 16S-23S rRNA Internal Transcribed Spacer region. Multivariate statistics revealed discrete groupings of bacterial communities on substrates of volcanic origin (ash and glass) and reef origin (three sands). Analysis of Similarity supported significantly different communities associated with all substrates (p=0.0001), only quartz did not differ from both carbonate and calcite sands. The ash substrate exhibited the most diverse bacterial community with the most substrate-specific bacterial operational taxonomic units. Our findings suggest that bacterial diversity and community composition during colonisation of volcanic ash in a coral reef-like environment is controlled by the

Marine Mesocosm Bacterial Colonisation of Volcanic Ash

NASA Astrophysics Data System (ADS)

Witt, V.; Cimarelli, C.; Ayris, P. M.; Kueppers, U.; Erpenbeck, D.; Dingwell, D. B.; Woerheide, G.

2014-12-01

Explosive volcanic eruptions regularly eject large quantities of ash particles into the atmosphere, which can be deposited via fallout into oceanic environments. Such fallout has the potential to alter pH, light and nutrient availability at local or regional scales. Shallow-water coral reef ecosystems - "rainforests of the sea" - are highly sensitive to disturbances, such as ocean acidification, sedimentation and eutrophication. Therefore, ash deposition may lead to burial and mortality of such reefs. Coral reef ecosystem resilience may depend on pioneer bacterial colonisation of the ash layer, supporting subsequent establishment of the micro- and ultimately the macro-community. However, it is currently unknown which bacteria are involved in pioneer colonisation. We hypothesize that physico-chemical properties (i.e., morphology, chemistry, mineralogy) of the ash may dictate bacterial colonisation. We have tested the effect of substrate properties on bacterial diversity and abundance colonising five substrates: i) quartz sand ii) crystalline ash from the Sakurajima volcano (Japan) iii) volcanic glass iv) carbonate reef sand and v) calcite sand of similar grain size - by incubation in a controlled marine mesocosm (coral reef aquarium) under low light conditions for three months. Bacterial communities were screened every month by Automated Ribosomal Intergenic Spacer Analysis of the 16S-23S rRNA Internal Transcribed Spacer region. Multivariate statistics revealed discrete groupings of bacterial communities on substrates of volcanic origin (ash and glass) and reef origin (three sands). Analysis Of Similarity supports significantly different communities associated with all substrates (p=0.0001), only quartz did not differ from both carbonate and calcite sands. The ash substrate exhibited the most diverse bacterial community and carried the most substrate-specific bacterial operational taxonomic units. Our findings suggest that bacterial diversity and community

Vegetation cover of forest, shrub and pasture strongly influences soil bacterial community structure as revealed by 16S rRNA gene T-RFLP analysis.

PubMed

Chim Chan, On; Casper, Peter; Sha, Li Qing; Feng, Zhi Li; Fu, Yun; Yang, Xiao Dong; Ulrich, Andreas; Zou, Xiao Ming

2008-06-01

Bacterial community structure is influenced by vegetation, climate and soil chemical properties. To evaluate these influences, terminal restriction fragment length polymorphism (T-RFLP) and cloning of the 16S rRNA gene were used to analyze the soil bacterial communities in different ecosystems in southwestern China. We compared (1) broad-leaved forest, shrub and pastures in a high-plateau region, (2) three broad-leaved forests representing a climate gradient from high-plateau temperate to subtropical and tropical regions and (3) the humus and mineral soil layers of forests, shrub lands and pastures with open and restricted grazing activities, having varied soil carbon and nutrient contents. Principal component analysis of the T-RFLP patterns revealed that soil bacterial communities of the three vegetation types were distinct. The broad-leaved forests in different climates clustered together, and relatively minor differences were observed between the soil layers or the grazing regimes. Acidobacteria dominated the broad-leaved forests (comprising 62% of the total clone sequences), but exhibited lower relative abundances in the soils of shrub (31%) and pasture (23%). Betaproteobacteria was another dominant taxa of shrub land (31%), whereas Alpha- (19%) and Gammaproteobacteria (13%) and Bacteriodetes (16%) were major components of pasture. Vegetation exerted more pronounced influences than climate and soil chemical properties.