Sample records for bacterial cpg oligodeoxynucleotides

  1. Chitosan-coated boron nitride nanospheres enhance delivery of CpG oligodeoxynucleotides and induction of cytokines

    PubMed Central

    Zhang, Huijie; Chen, Song; Zhi, Chunyi; Yamazaki, Tomohiko; Hanagata, Nobutaka

    2013-01-01

    Background Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides activate Toll-like receptor 9, leading to induction of proinflammatory cytokines, which play an important role in induction and maintenance of innate and adaptive immune responses. Previously, we have used boron nitride nanospheres (BNNS) as a carrier for delivery of unmodified CpG oligodeoxynucleotides to activate Toll-like receptor 9. However, because CpG oligodeoxynucleotides and BNNS are both negatively charged, electrostatic repulsion between them is likely to reduce the loading of CpG oligodeoxynucleotides onto BNNS. Therefore, the efficiency of uptake of CpG oligodeoxynucleotides is also limited and does not result in induction of a robust cytokine response. To ameliorate these problems, we developed a CpG oligodeoxynucleotide delivery system using chitosan-coated BNNS as a carrier. Methods To facilitate attachment of CpG oligodeoxynucleotides onto the BNNS and improve their loading capacity, we prepared positively charged BNNS by coating them with chitosan preparations of three different molecular weights and used them as carriers for delivery of CpG oligodeoxynucleotides. Results The zeta potentials of the BNNS-CS complexes were positive, and chitosan coating improved their dispersity and stability in aqueous solution compared with BNNS. The positive charge of the BNNS-CS complexes greatly improved the loading capacity and cellular uptake efficiency of CpG oligodeoxynucleotides. The loading capacity of the CpG oligodeoxynucleotides depended on the molecular weight of chitosan, which affected the positive charge density on the surface of the BNNS. CpG oligodeoxynucleotides loaded onto BNNS-CS complexes significantly enhanced production of interleukin-6 and tumor necrosis factor-α by peripheral blood mononuclear cells compared with CpG oligodeoxynucleotides directly loaded onto BNNS, or when Lipofectamine™ 2000 was used as the carrier. The molecular weight of the chitosan used to coat the

  2. Immunotherapeutic potential of CpG oligodeoxynucleotides in veterinary species.

    PubMed

    Manuja, Anju; Manuja, Balvinder K; Kaushik, Jyoti; Singha, Harisankar; Singh, Raj Kumar

    2013-10-01

    Innate immunity plays a critical role in host defense against infectious diseases by discriminating between self and infectious non-self. The recognition of infectious non-self involves germ-line encoded pattern recognition receptors (PRRs) that recognize pathogen-associated molecular patterns (PAMPs). The PAMPs are the components of pathogenic microbes which include not only the cell wall constituents but also the unmethylated 2'-deoxy-ribo-cytosine-phosphate-guanosine (CpG) motifs. These CpG motifs present within bacterial and viral DNA are recognized by toll-like receptor 9 (TLR9), and signaling by this receptor triggers a proinflammatory cytokine response which, in turn, influences both innate and adaptive immune responses. The activation of TLR9 with synthetic CpG oligodeoxynucleotides (ODNs) induces powerful Th1-like immune responses. It has been shown to provide protection against infectious diseases, allergy and cancer in laboratory animal models and some domestic animal species. With better understanding of the basic biology and immune mechanisms, it would be possible to exploit the potential of CpG motifs for animal welfare. The research developments in the area of CpG and TLR9 and the potential applications in animal health have been reviewed in this article.

  3. Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA

    DTIC Science & Technology

    2005-09-01

    tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such

  4. Intraperitoneal prophylaxis with CpG oligodeoxynucleotides protects neutropenic mice against intracerebral Escherichia coli K1 infection.

    PubMed

    Ribes, Sandra; Meister, Tanja; Ott, Martina; Redlich, Sandra; Janova, Hana; Hanisch, Uwe-Karsten; Nessler, Stefan; Nau, Roland

    2014-01-23

    Prophylaxis with unmethylated cytosine phosphate guanidine (CpG) oligodeoxynucleotides (ODN) protects against several systemic experimental infections. Escherichia coli is a major cause of Gram-negative neonatal bacterial meningitis and also causes meningitis and meningoencephalitis in older and immunocompromised patients. Wild-type (wt) and Toll-like receptor 9 (TLR9)-deficient mice were rendered neutropenic by intraperitoneal administration of the anti-Ly-6G monoclonal antibody. Immunocompetent and neutropenic mice received intraperitoneal CpG ODN or vehicle 72 h prior to induction of E. coli K1 meningoencephalitis. Pre-treatment with CpG ODN significantly increased survival of neutropenic wt mice from 33% to 75% (P = 0.0003) but did not protect neutropenic TLR9-/- mice. The protective effect of CpG ODN was associated with an enhanced production of interleukin (IL)-12/IL-23p40 with sustained increased levels in serum and spleen at least for 17 days after conditioning compared to buffer-treated animals. CpG-treated neutropenic wt mice showed reduced bacterial concentrations and increased recruitment of Ly6ChighCCR2+ monocytes in brain and spleen 42 h after infection. The levels of macrophage inflammatory protein 1α (MIP-1α) and interferon gamma (IFN-γ) in spleen were higher 42 h after infection in CpG-treated compared to buffer-treated neutropenic animals. In immunocompetent mice, prophylaxis with CpG ODN did not significantly increase survival compared to the buffer group (60% vs. 45%, P = 0.2). These findings suggest that systemic administration of CpG ODN may help to prevent bacterial CNS infections in immunocompromised individuals.

  5. The effect of TLR9 agonist CpG oligodeoxynucleotides on the intestinal immune response of cobia (Rachycentron canadum).

    PubMed

    Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

    2014-01-01

    Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1 β . Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1 β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia.

  6. The Effect of TLR9 Agonist CpG Oligodeoxynucleotides on the Intestinal Immune Response of Cobia (Rachycentron canadum)

    PubMed Central

    Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

    2014-01-01

    Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1β. Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia. PMID:24991578

  7. Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

    PubMed Central

    Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

    2001-01-01

    Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

  8. CpG oligodeoxynucleotide nanomedicines for the prophylaxis or treatment of cancers, infectious diseases, and allergies.

    PubMed

    Hanagata, Nobutaka

    2017-01-01

    Unmethylated cytosine-guanine dinucleotide-containing oligodeoxynucleotides (CpG ODNs), which are synthetic agonists of Toll-like receptor 9 (TLR9), activate humoral and cellular immunity and are being developed as vaccine adjuvants to prevent or treat cancers, infectious diseases, and allergies. Free CpG ODNs have been used in many clinical trials implemented to verify their effects. However, recent research has reported that self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes demonstrate higher adjuvant effects than free CpG ODNs, owing to their improved uptake efficiency into cells expressing TLR9. Moreover, protein/peptide-CpG ODN conjugates and nanomaterial-CpG ODN complexes are able to deliver CpG ODNs and antigens (or allergens) to the same types of cells, which enables a higher degree of prophylaxis or therapeutic effect. In this review, the author describes recent trends in the research and development of CpG ODN nanomedicines containing self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes, focusing mainly on the results of preclinical and clinical studies.

  9. Immunostimulatory Oligodeoxynucleotides Containing the CpG Motif are Effective as Immune Adjuvants in Tumor Antigen Immunization

    NASA Astrophysics Data System (ADS)

    Weiner, George J.; Liu, Hsin-Ming; Wooldridge, James E.; Dahle, Christopher E.; Krieg, Arthur M.

    1997-09-01

    Recent advances in our understanding of the immune response are allowing for the logical design of new approaches to cancer immunization. One area of interest is the development of new immune adjuvants. Immunostimulatory oligodeoxynucleotides containing the CpG motif (CpG ODN) can induce production of a wide variety of cytokines and activate B cells, monocytes, dendritic cells, and NK cells. Using the 38C13 B cell lymphoma model, we assessed whether CpG ODN can function as immune adjuvants in tumor antigen immunization. The idiotype served as the tumor antigen. Select CpG ODN were as effective as complete Freund's adjuvant at inducing an antigen-specific antibody response but were associated with less toxicity. These CpG ODN induced a higher titer of antigen-specific IgG2a than did complete Freund's adjuvant, suggesting an enhanced TH1 response. Mice immunized with CpG ODN as an adjuvant were protected from tumor challenge to a degree similar to that seen in mice immunized with complete Freund's adjuvant. We conclude that CpG ODN are effective as immune adjuvants and are attractive as part of a tumor immunization strategy.

  10. CpG oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by a goose parvovirus vaccine in ducks.

    PubMed

    Lee, Jai-Wei; Lin, Yu-Ming; Yen, Ting-Ying; Yang, Wen-Jen; Chu, Chun-Yen

    2010-11-23

    Recombinant parvovirus VP2 (rVP2) was formulated with different types of adjuvant, including aluminum adjuvant and CpG oligodeoxynucleotides (ODNs), and the immunological responses after vaccination in ducks were examined. In comparison with the control group, production of rVP2-specific antibodies, expression of cytokines in peripheral blood mononuclear cells (PBMC) stimulated by rVP2, and percentage of CD4(+)/CD8(+) cells in PBMC were significantly increased in ducks immunized with rVP2 formulated with CpG ODNs containing 3 copies of GACGTT motif. CpG ODNs with GACGTT motifs might be used to improve the efficacy of vaccines for ducks. Copyright © 2010 Elsevier Ltd. All rights reserved.

  11. CpG Oligodeoxynucleotide and Montanide ISA 51 Adjuvant Combination Enhanced the Protective Efficacy of a Subunit Malaria Vaccine

    PubMed Central

    Kumar, Sanjai; Jones, Trevor R.; Oakley, Miranda S.; Zheng, Hong; Kuppusamy, Shanmuga P.; Taye, Alem; Krieg, Arthur M.; Stowers, Anthony W.; Kaslow, David C.; Hoffman, Stephen L.

    2004-01-01

    Unmethylated CpG dinucleotide motifs present in bacterial genomes or synthetic oligodeoxynucleotides (ODNs) serve as strong immunostimulatory agents in mice, monkeys and humans. We determined the adjuvant effect of murine CpG ODN 1826 on the immunogenicity and protective efficacy of the Saccharomyces cerevisiae-expressed 19-kDa C-terminal region of merozoite surface protein 1 (yMSP119) of the murine malaria parasite Plasmodium yoelii. We found that in C57BL/6 mice, following sporozoite challenge, the degree of protective immunity against malaria induced by yMSP119 in a formulation of Montanide ISA 51 (ISA) plus CpG ODN 1826 was similar or superior to that conferred by yMSP119 emulsified in complete Freund's adjuvant (CFA/incomplete Freund's adjuvant). In total, among mice immunized with yMSP119, 22 of 32 (68.7%) with ISA plus CpG 1826, 0 of 4 (0%) with CFA/incomplete Freund’s adjuvant, 0 of 4 (0%) with CpG 1826 mixed with ISA (no yMSP119), and 0 of 11 (0%) with CpG 1826 alone were completely protected against development of erythrocytic stage infection after sporozoite challenge. The adjuvant effect of CpG ODN 1826 was manifested as both significantly improved complete protection from malaria (defined as the absence of detectable erythrocytic form parasites) (P = 0.007, chi square) and reduced parasite burden in infected mice. In vivo depletions of interleukin-12 and gamma interferon cytokines and CD4+ and CD8+ T cells in vaccinated mice had no significant effect on immunity. On the other hand, immunoglobulin G (IgG) isotype levels appeared to correlate with protection. Inclusion of CpG ODN 1826 in the yMSP119 plus ISA vaccine contributed towards the induction of higher levels of IgG2a and IgG2b (Th1 type) antibodies, suggesting that CpG ODN 1826 caused a shift towards a Th1 type of immune response that could be responsible for the higher degree of protective immunity. Our results indicate that this potent adjuvant formulation should be further evaluated for use

  12. Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides

    PubMed Central

    Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

    2015-01-01

    CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS–PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS–PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS–PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS–PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS–PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS–PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α. PMID:26346655

  13. Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides.

    PubMed

    Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

    2015-01-01

    CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS-PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS-PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS-PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS-PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS-PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS-PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α.

  14. DNA containing CpG motifs induces angiogenesis

    NASA Astrophysics Data System (ADS)

    Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.

    2002-06-01

    New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.

  15. Differential production of immunoglobulin classes and subclasses by mucosal-type human B-lymphocytes exposed in vitro to CpG oligodeoxynucleotides.

    PubMed

    Cognasse, Fabrice; Acquart, Sophie; Beniguel, Lydie; Sabido, Odile; Chavarin, Patricia; Genin, Christian; Garraud, Olivier

    2005-01-01

    As B-lymphocytes play an important role in innate and adaptive immunity, we aimed to examine the effects of CpG oligodeoxynucleotides (ODNs) on purified tonsil-originating CD19+ B-cells, representing mucosal B-cells. We screened various K-type ODNs, reactive with human B-cells, and tested for the production of immunoglobulins in vitro. Using one CpG-ODN, DSP30, we observed that it could upregulate not only Toll-like receptor 9 (TLR9) mRNA expression in activated B-cells, but also the early expression of CD69 followed by the sequential expression of CD80, CD86 and the nuclear factor (NF)-kappaB pathway. Furthermore, mRNA expression of certain B-cell-derived cytokines was influenced by exposure to DSP30, with a strong upregulation of interleukin 6 (IL-6) and downregulation of IL1-beta. Stimulation of B-cells, co-stimulated with IL-2, IL-10 and soluble CD40 ligand (sCD40L) with different CpG-ODNs, had differing effects on the terminal differentiation in vitro of B-cells into immunoglobulin-secreting cells. TLR9 is involved in innate immunity and the recognition of bound CpG DNA from invading bacterial pathogens. As tonsillar B-cells are mucosal-type B-lymphocytes, this study suggests that CpG-ODNs show promise as mucosal adjuvants in modulating the local production of immunoglobulins of certain classes and subclasses, a crucial issue in vaccine perspectives.

  16. CpG oligodeoxynucleotides augment the murine immune response to the Yersinia pestis F1-V vaccine in bubonic and pneumonic models of plague.

    PubMed

    Amemiya, Kei; Meyers, Jennifer L; Rogers, Taralyn E; Fast, Randy L; Bassett, Anthony D; Worsham, Patricia L; Powell, Bradford S; Norris, Sarah L; Krieg, Arthur M; Adamovicz, Jeffrey J

    2009-04-06

    The current U.S. Department of Defense candidate plague vaccine is a fusion between two Yersinia pestis proteins: the F1 capsular protein, and the low calcium response (Lcr) V-protein. We hypothesized that an immunomodulator, such as CpG oligodeoxynucleotide (ODN)s, could augment the immune response to the plague F1-V vaccine in a mouse model for plague. CpG ODNs significantly augmented the antibody response and efficacy of a single dose of the plague vaccine in murine bubonic and pneumonic models of plague. In the latter study, we also found an overall significant augmentation the immune response to the individual subunits of the plague vaccine by CpG ODN 2006. In a long-term, prime-boost study, CpG ODN induced a significant early augmentation of the IgG response to the vaccine. The presence of CpG ODN induced a significant increase in the IgG2a subclass response to the vaccine up to 5 months after the boost. Our studies showed that CpG ODNs significantly augmented the IgG antibody response to the plague vaccine, which increased the probability of survival in murine models of plague (P<0.0001).

  17. Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination.

    PubMed

    Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye; Kang, Sang-Moo

    2017-10-01

    Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination.

  18. Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination

    PubMed Central

    Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye

    2017-01-01

    Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination. PMID:29093654

  19. TLR9-ERK-mTOR signaling is critical for autophagic cell death induced by CpG oligodeoxynucleotide 107 combined with irradiation in glioma cells

    PubMed Central

    Li, Xiaoli; Cen, Yanyan; Cai, Yongqing; Liu, Tao; Liu, Huan; Cao, Guanqun; Liu, Dan; Li, Bin; Peng, Wei; Zou, Jintao; Pang, Xueli; Zheng, Jiang; Zhou, Hong

    2016-01-01

    Synthetic oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) function as potential radiosensitizers for glioma treatment, although the underlying mechanism is unclear. It was observed that CpG ODN107, when combined with irradiation, did not induce apoptosis. Herein, the effect of CpG ODN107 + irradiation on autophagy and the related signaling pathways was investigated. In vitro, CpG ODN107 + irradiation induced autophagosome formation, increased the ratio of LC3 II/LC3 I, beclin 1 and decreased p62 expression in U87 cells. Meanwhile, CpG ODN107 also increased LC3 II/LC3 I expression in U251 and CHG-5 cells. In vivo, CpG ODN107 combined with local radiotherapy induced autophagosome formation in orthotopic transplantation tumor. Investigation of the molecular mechanisms demonstrated that CpG ODN107 + irradiation increased the levels of TLR9 and p-ERK, and decreased the level of p-mTOR in glioma cells. Further, TLR9-specific siRNA could affect the expressions of p-ERK and autophagy-related proteins in glioma cells. Taken together, CpG ODN107 combined with irradiation could induce autophagic cell death, and this effect was closely related to the TLR9-ERK-mTOR signaling pathway in glioma cells, providing new insights into the investigation mechanism of CpG ODN. PMID:27251306

  20. Enhanced immune response to gastric cancer specific antigen Peptide by coencapsulation with CpG oligodeoxynucleotides in nanoemulsion.

    PubMed

    Shi, Rui; Hong, Liu; Wu, Daocheng; Ning, Xiaoxuan; Chen, Yu; Lin, Tao; Fan, Daiming; Wu, Kaichun

    2005-02-01

    CpG oligodeoxynucleotides (CpG ODN) have been shown to have potent adjuvant activity for a wide range of antigens. Of particular interest is their improved activity when closely associated with the antigen. The purpose of this study is to construct a nanovaccine coencapsulated with a gastric cancer specific antigen MG7 mimotope peptide and adjuvant CpG ODN 1645 using new nanotechnology as nanoemulsion and evaluate its immunocompetence. Nanoemulsion vaccine was prepared using magnetic ultrasound methods. BALB/c mice were immunized and the in vivo effectiveness was evaluated using tumor challenge assay. It was shown that the tumor masses formed in the mice immunized with coencapsulated nanovaccine (0.0825 g) markedly smaller (P < 0.01) than those formed in the mice immunized with nanovaccine encapsulated with antigen peptide alone (0.4465 g). A tumor inhibiting rate as high as 82.5% of the coencapsulated nanovaccine was obtained, while nanovaccine encapsulated with peptide only could not achieve the same effect (28.5%) (P < 0.01). Enzyme-linked immunospot assay (ELISPOT) showed that immunization using MG7 mimotope peptide coencapsulated with CpG ODN within the same nanoemulsion enhanced the frequency of splenocytes secreting IFN-gamma significantly (P < 0.01) when compared with immunization using MG7 peptide encapsulated in nanoemulsion alone (197spots/1 x 10(6) vs. 73 spots/1 x 10(6)). Cellular ELISA indicated that serum titer of antibody against MG7-Ag was significantly higher (P < 0.01) in mice immunized with coencapsulation form nanovaccine (0.7884) than that in the group immunized with nanovaccine encapsulated with MG7 peptide alone (0.3616). Using intracellular flow cytometric analysis, it was found that the IFN-gamma response was contributed by CD4+ T-cells. Our experiments suggest that a vaccinal approach using nano-delivery system carrying in tumoral epitope and CpG ODN as adjuvant may have important implications for cancer therapy.

  1. Formulation of vaccines containing CpG oligonucleotides and alum

    PubMed Central

    Aebig, Joan A.; Mullen, Gregory E. D.; Dobrescu, Gelu; Rausch, Kelly; Lambert, Lynn; Ajose-Popoola, Olubunmi; Long, Carole A.; Saul, Allan; Miles, Aaron P.

    2007-01-01

    CpG oligodeoxynucleotides are potent immunostimulants. For parenterally delivered alum based vaccines, the immunostimulatory effect of CpG depends on the association of the CpG and antigen to the alum. We describe effects of buffer components on the binding of CPG 7909 to aluminum hydroxide (Alhydrogel), assays for measuring binding of CPG 7909 to alum and CPG 7909 induced dissociation of antigen from the alum. Free CPG 7909 is a potent inducer of IP-10 in mice. However the lack of IP-10 production from formulations containing bound CPG 7909 suggested that CPG 7909 does not rapidly dissociate from the alum after injection. It also suggests that IP-10 assays are not a good basis for potency assays for alum based vaccines containing CPG 7909. PMID:17512533

  2. Response of immune response genes to adjuvants poly [di(sodium carboxylatoethylphenoxy)phosphazene] (PCEP), CpG oligodeoxynucleotide and emulsigen at intradermal injection site in pigs.

    PubMed

    Magiri, R B; Lai, K; Chaffey, A M; Wilson, H L; Berry, W E; Szafron, M L; Mutwiri, G K

    2016-07-01

    Understanding the mechanisms by which adjuvants mediate their effects provide critical information on how innate immunity influences the development of adaptive immunity. Despite being a critical vaccine component, the mechanisms by which adjuvants mediate their effects are not fully understood and this is especially true when they are used in large animals. This lack of understanding limits our ability to design effective vaccines. In the present study, we administered polyphosphazene (PCEP), CpG oligodeoxynucleotides (CpG), emulsigen or saline via an intradermal injection into pigs and assessed the impact on the expression of reported 'adjuvant response genes' over time. CpG induced a strong upregulation of the chemokine CXL10 several 'Interferon Response Genes', as well as TNFα, and IL-10, and a down-regulation of IL-17 genes. Emulsigen upregulated expression of chemokines CCL2 and CCL5, proinflammatory cytokines IL-6 and TNFα, as well as TLR9, and several IFN response genes. PCEP induced the expression of chemokine CCL2 and proinflammatory cytokine IL-6. These results suggest that emulsigen and CpG may promote recruitment of innate immune cells and Th1 type cytokine production but that PCEP may promote a Th-2 type immune response through the induction of IL-6, an inducer of B cell activity and differentiation. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. CpG oligodeoxynucleotides are a potent adjuvant for an inactivated polio vaccine produced from Sabin strains of poliovirus.

    PubMed

    Yang, Chunting; Shi, Huiying; Zhou, Jun; Liang, Yanwen; Xu, Honglin

    2009-11-05

    Poliovirus transmission is controlled globally through world-wide use of a live attenuated oral polio vaccine (OPV). However, the imminence of global poliovirus eradication calls for a switch to the inactivated polio vaccine (IPV). Given the limited manufacturing capacity and high cost of IPV, this switch is unlikely in most developing and undeveloped countries. Adjuvantation is an effective strategy for antigen sparing. In this study, we evaluated the adjuvanticity of CpG oligodeoxynucleotides (CpG-ODN) for an experimental IPV produced from Sabin strains of poliovirus. Our results showed that CpG-ODN, alone or in combination with alum, can significantly enhance both the humoral and cellular immune responses to IPV in mice, and, consequently, the antigen dose could be reduced substantially. Therefore, our study suggests that the global use of IPV could be facilitated by using CpG-ODN or other feasible adjuvants.

  4. CpG oligodeoxynucleotide induces apoptosis and cell cycle arrest in A20 lymphoma cells via TLR9-mediated pathways.

    PubMed

    Qi, Xu-Feng; Zheng, Li; Kim, Cheol-Su; Lee, Kyu-Jae; Kim, Dong-Heui; Cai, Dong-Qing; Qin, Jun-Wen; Yu, Yan-Hong; Wu, Zheng; Kim, Soo-Ki

    2013-07-01

    Recent studies have suggested that the anti-cancer activity of CpG-oligodeoxynucleotides (CpG-ODNs) is owing to their immunomodulatory effects in tumor-bearing host. The purpose of this study is to investigate the directly cytotoxic activity of KSK-CpG, a novel CpG-ODN with an alternative CpG motif, against A20 and EL4 lymphoma cells in comparison with previously used murine CpG motif (1826-CpG). To evaluate the potential cytotoxic effects of KSK-CpG on lymphoma cells, cell viability assay, confocal microscopy, flow cytometry, DNA fragmentation, Western blotting, and reverse transcription-polymerase chain reaction (RT-PCR) analysis were used. We found that KSK-CpG induced direct cytotoxicity in A20 lymphoma cells, but not in EL4 lymphoma cells, at least in part via TLR9-mediated pathways. Apoptotic cell death was demonstrated to play an important role in CpG-ODNs-induced cytotoxicity. In addition, both mitochondrial membrane potential decrease and G1-phase arrest were involved in KSK-CpG-induced apoptosis in A20 cells. The activities of apoptotic molecules such as caspase-3, PARP, and Bax were increased, but the activation of p27 Kip1 and ERK were decreased in KSK-CpG-treated A20 cells. Furthermore, autocrine IFN-γ partially contributed to apoptotic cell death in KSK-CpG-treated A20 cells. Collectively, our findings suggest that KSK-CpG induces apoptotic cell death in A20 lymphoma cells at least in part by inducing G1-phase arrest and autocrine IFN-γ via increasing TLR9 expression, without the need for immune system of tumor-bearing host. This new understanding supports the development of TLR9-targeted therapy with CpG-ODN as a direct therapeutic agent for treating B lymphoma. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei

    PubMed Central

    Waag, David M.; McCluskie, Michael J.; Zhang, Ningli; Krieg, Arthur M.

    2006-01-01

    Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-γ)-inducible protein 10, interleukin-12 (IL-12), IFN-γ, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders. PMID:16495571

  6. A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.

    PubMed

    Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M

    2006-03-01

    Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.

  7. CpG Oligodeoxynucleotides Facilitate Delivery of Whole Inactivated H9N2 Influenza Virus via Transepithelial Dendrites of Dendritic Cells in Nasal Mucosa

    PubMed Central

    Qin, Tao; Yin, Yinyan; Yu, Qinghua; Huang, Lulu; Wang, Xiaoqing; Lin, Jian

    2015-01-01

    ABSTRACT The spread of the low-pathogenicity avian H9N2 influenza virus has seriously increased the risk of a new influenza pandemic. Although whole inactivated virus (WIV) vaccine via intranasal pathway is the effective method of blocking virus transmission, the mucosal barrier seems to be a major factor hampering its development. CpG oligodeoxynucleotides, a known adjuvant, can target downstream dendritic cells (DCs) and effectively enhance the mucosal and systemic immune responses. However, the ability of CpGs to assist H9N2 WIV in transepithelial transport remains unknown. Here, in vitro and in vivo, we showed that CpGs provided assistance for H9N2 WIV in recruiting DCs to the nasal epithelial cells (ECs) and forming transepithelial dendrites (TEDs) to capture luminal viruses. CD103+ DCs participated in this process. Chemokine CCL20 from nasal ECs played a key role in driving DC recruitment and TED formation. Virus-loaded DCs quickly migrated into the draining cervical lymph nodes (CLNs) for antigen presentation. In addition, the competence of CpGs was independent of direct epithelial transport via the transcellular or paracellular pathway. Taken together, our data demonstrated that CpGs enhanced the transport of H9N2 WIV via TEDs of nasal DCs, which might be a novel mechanism for optimal adaptive immune responses. IMPORTANCE This paper demonstrates by both an in vivo and an in vitro coculture model that CpG oligodeoxynucleotides, known as an adjuvant generally targeting downstream immune responses, also are crucial for the transport of H9N2 WIV across nasal epithelial cells (ECs) via the uptake of transepithelial dendrites (TEDs). Our results prove for the first time to our knowledge that the immune-potentiating mechanism of CpGs is based on strengthening the transepithelial uptake of H9N2 WIV in nasal mucosa. These findings provide a fresh perspective for further improvement of intranasal influenza vaccines, which are urgently needed in the face of the

  8. In vitro effects of CpG oligodeoxynucleotides delivered by gelatin nanoparticles on canine peripheral blood mononuclear cells of atopic and healthy dogs - a pilot study.

    PubMed

    Prélaud, Ana Rostaher; Fuchs, Sebastian; Weber, Karin; Winter, Gerhard; Coester, Conrad; Mueller, Ralf S

    2013-10-01

    Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides offer a novel promising immunotherapeutic approach for atopic dermatitis (AD) both in humans and animals. Gelatin nanoparticles (GNP) enhance and prolong CpG-associated immunomodulatory effects and minimize adverse effects both in vitro and in vivo. Information about the effects of this combination in dogs is lacking. The aim of this study was to evaluate immunological effects of CpG coupled to GNP on canine peripheral blood mononuclear cells (PBMCs) in vitro. Eight dogs with AD, diagnosed by standard criteria and with a concurrent immediate hypersensitivity to house dust mites were included. Control samples were taken from eight healthy, age-matched control dogs without history or evidence of cutaneous or systemic illness. Peripheral blood mononuclear cells of healthy and allergic dogs were incubated with CpG-GNP and the uptake of CpG-GNP was demonstrated using confocal laser scanning microscopy. Cell culture supernatant concentrations of interferon gamma (IFN-γ), interleukin (IL)-4, IL-6 and IL-10 were measured by Canine Cytokine Milliplex. No significant changes in IFN-γ and IL-4 were found when comparing PBMCs incubated with CpG and CpG-GNP with the negative controls in atopic and healthy dogs. Interleukin-6 was not detected in any of the groups. However, a statistically significant increase in IL-10 concentration was found after 24 h stimulation with CpG-GNP compared with CpG alone both in atopic and healthy dogs. As IL-10 is considered an immunosuppressive cytokine playing a key role in peripheral tolerance; the reported CpG-GNP formulation could be a new approach in allergy treatment. © 2013 ESVD and ACVD.

  9. The potential of immunostimulatory CpG DNA for inducing immunity against genital herpes: opportunities and challenges.

    PubMed

    Harandi, Ali M

    2004-07-01

    Herpes simplex virus type 2 (HSV-2) invades human genital tract mucosa and following local replications can be rapidly transmitted via peripheral nerve axons to the sacral ganglia where it can establish latency. Reactivation of the latent viral reservoir results in recurrent ulcers in the genital region. Innate immunity, the first line of defence during both primary and recurrent genital herpes infections, is crucial during the period of acute infection to limit early virus replication and to facilitate the development of an appropriate specific acquired immunity. Recent developments in immunology reveal that the mammalian innate immune systems use Toll-like receptor (TLR) to specifically sense evolutionary conserved molecules such as bacterial DNA in pathogens. Recently, local-vaginal delivery of CpG containing oligodeoxynucleotide (ODN), a synthetic mimic of bacterial DNA, holds substantial promise as a strong inducer of innate immunity against genital herpes infections in the animal models of the disease. These preclinical observations provide a scientific ground work for introduction of this novel intervention strategy to clinic. This review aims to highlight recent developments and future challenges in use of immunostimulatory CpG ODN for inducing immunity against genital herpes infection and disease.

  10. Identification of a boron nitride nanosphere-binding peptide for the intracellular delivery of CpG oligodeoxynucleotides

    NASA Astrophysics Data System (ADS)

    Zhang, Huijie; Yamazaki, Tomohiko; Zhi, Chunyi; Hanagata, Nobutaka

    2012-09-01

    CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications.CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7

  11. Liposomal SLA co-incorporated with PO CpG ODNs or PS CpG ODNs induce the same protection against the murine model of leishmaniasis.

    PubMed

    Shargh, Vahid Heravi; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jaafari, Iman; Jalali, Seyed Amir; Abbasi, Azam; Badiee, Ali

    2012-06-06

    First generation Leishmania vaccines consisting of whole killed parasites with or without adjuvants have reached phase 3 trial and failed to show enough efficacy mainly due to the lack of an appropriate adjuvant. In this study, the nuclease-resistant phosphorothioate CpG oligodeoxynucleotides (PS CpG) or nuclease-sensitive phosphodiester CpG ODNs (PO CpG) were used as adjuvants to enhance immunogenicity and rate of protection against leishmaniasis. Due to the susceptibility of PO CpG to nuclease degradation, an efficient liposomal delivery system was developed to protect them from degradation. 1, 2-dioleoyl-3-trimethylammonium-propane (DOTAP) as a cationic lipid was used because of its unique adjuvanticity and electrostatic interaction with negatively charged CpG ODNs. To evaluate the role of liposomal formulation in protection rate and enhanced immune response, BALB/c mice were immunized subcutaneously with liposomal soluble Leishmania antigens (SLA) co-incorporated with PO CpG (Lip-SLA-PO CpG), Lip-SLA-PS CpG, SLA+PO CpG, SLA+PS CpG, SLA or buffer. As criteria for protection, footpad swelling at the site of challenge, parasite loads, the levels of IFN-γ and IL-4, and the IgG subtypes were evaluated. The groups of mice receiving Lip-SLA-PO CpG or Lip-SLA-PS CpG showed a high protection rate compared with the control groups. In addition, there was no significant difference in immune response generation between mice immunized with PS CpG and the group receiving PO CpG when incorporated into the liposomes. The results suggested that liposomal form of PO CpG might be used instead of PS CpG in future vaccine formulations as an efficient adjuvant. Copyright © 2012 Elsevier Ltd. All rights reserved.

  12. Carbon nanotubes enhance CpG uptake and potentiate antiglioma immunity.

    PubMed

    Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J; Badie, Behnam

    2011-02-15

    Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Because TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNT) as a CpG delivery vehicle in brain tumor models. Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and antiglioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated proinflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (>3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term antitumor immunity. These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. ©2010 AACR.

  13. Efficacy of QCDCR formulated CpG ODN 2007 in Nile tilapia against Streptococcus iniae and identification of upregulated genes

    USDA-ARS?s Scientific Manuscript database

    The potential of using a QCDCR (quilA:cholesterol:dimethyl dioctadecyl ammonium bromide:carbopol:R1005 glycolipid) formulated CpG oligodeoxynucleotide (ODN), ODN 2007, to confer protection in Nile tilapia against Streptococcus iniae infection was evaluated in this study. At two days post treatment, ...

  14. Carbon Nanotubes Enhance CpG Uptake and Potentiate Anti-Glioma Immunity

    PubMed Central

    Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J.; Badie, Behnam

    2010-01-01

    Purpose Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Since TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNTs) as a CpG delivery vehicle in brain tumor models. Experimental Design Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and anti-glioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. Results CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated pro-inflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (> 3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term anti-tumor immunity. Conclusions These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. PMID:21088258

  15. Immunoregulation of GVHD by triggering the innate immune system with CpG.

    PubMed

    Morecki, Shoshana; Slavin, Shimon

    2009-08-01

    Stimulation of Toll-like receptors by oligodeoxynucleotide sequences containing a CpG motif provides signals capable of triggering the innate and adaptive immune systems, thereby leading either to stimulation or suppression of immunoreactivities. Similar immunoregulatory capabilities are necessary for achieving the fine balance between engraftment and graft-versus-host disease required in the setup of allogeneic cell therapy. Ligation of CpG to its Toll-like receptors can be accomplished by treatment of the host or pretransplant treatment of the donor in vivo. These different strategies are presented in this review, which summarizes the attempts to maximize beneficial alloreactivity against malignant or other undesirable host cells, while controlling graft-versus-host disease.

  16. Gene expression profiling of chicken cecal tonsils and ileum following oral exposure to soluble and PLGA-encapsulated CpG ODN, and lysate of Campylobacter jejuni.

    PubMed

    Taha-Abdelaziz, Khaled; Alkie, Tamiru Negash; Hodgins, Douglas C; Yitbarek, Alexander; Shojadoost, Bahram; Sharif, Shayan

    2017-12-01

    Campylobacter jejuni (C. jejuni) is a leading bacterial cause of food-borne illness in humans. Contaminated chicken meat is an important source of infection for humans. Chickens are not clinically affected by colonization, and immune responses following natural infection have limited effects on bacterial load in the gut. Induction of intestinal immune responses may possibly lead to a breakdown of the commensal relationship of chickens with Campylobacter. We have recently shown that soluble and poly D, L-lactic-co-glycolic acid (PLGA)-encapsulated CpG oligodeoxynucleotide (ODN) as well as C. jejuni lysate, are effective in reducing the intestinal burden of C. jejuni in chickens; however, the mechanisms behind this protection have yet to be determined. The present study was undertaken to investigate the mechanisms of host responses conferred by these treatments. Chickens were treated orally with soluble CpG ODN, or PLGA-encapsulated CpG ODN, or C. jejuni lysate, and expression of cytokines and antimicrobial peptides was evaluated in cecal tonsils and ileum using quantitative RT-PCR. Oral administration of soluble CpG ODN upregulated the expression of interferon (IFN)-γ, interleukin (IL)-1β, CXCLi2, transforming growth factor (TGF)-β4/1, IL-10 and IL-13, while treatment with PLGA-encapsulated CpG ODN upregulated the expression of IL-1β, CXCLi2, TGF-β4/1, IL-13, avian β-defensin (AvBD) 1, AvBD2 and cathelicidin 3 (CATHL-3). C. jejuni lysate upregulated the expression of IFN-γ, IL-1β, TGF-β4/1, IL-13, AvBD1, and CATHL-3. In conclusion, induction of cytokine and antimicrobial peptides expression in intestinal microenvironments may provide a means of reducing C. jejuni colonization in broiler chickens, a key step in reducing the incidence of campylobacteriosis in humans. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Cancer immunotherapeutic effects of novel CpG ODN in murine tumor model.

    PubMed

    Cho, Hyeon Cheol; Kim, Bo Hwan; Kim, Kyunghoon; Park, Ju Youn; Chang, Jae-Ho; Kim, Soo-Ki

    2008-10-01

    While CpG oligodeoxynucleotides (ODN) are excellent candidates for cancer immunotherapeutics, the numbers of usable CpG ODNs are limited in current clinical settings. To resolve this, we investigated whether novel CpG ODN (KSK-CpG) would be an effective immunotherapeutic in a murine tumor model by affecting in vivo and in vitro parameters, such as survival span, the number of tumor nodules, natural killer (NK) cell and cytotoxic T lymphocyte (CTL) activity and interleukin (IL)-6 or IL-12 cytokine release in splenocytes. We found that KSK-CpG was effective in the murine cancer model by way of prolonging survival span, reducing the number of tumor nodules, augmenting NK cell and CTL cytotoxicity, as well as evoking IL-6 and IL-12 cytokine release in splenocytes. Collectively, these data demonstrate that KSK-CpG is active against the highly malignant B16BL6 and EL4 tumor mouse model via innate immune augmentation.

  18. Enhancement of infectious disease vaccines through TLR9-dependent recognition of CpG DNA.

    PubMed

    McCluskie, M J; Krieg, A M

    2006-01-01

    The adaptive immune system-with its remarkable ability to generate antigen-specific antibodies and T lymphocytes against pathogens never before "seen" by an organism-is one of the marvels of evolution. However, to generate these responses, the adaptive immune system requires activation by the innate immune system. Toll-like receptors (TLRs) are perhaps the best-understood family of innate immune receptors for detecting infections and stimulating adaptive immune responses. TLR9 appears to have evolved to recognize infections by a subtle structural difference between eukaryotic and prokaryotic/viral DNA; only the former frequently methylates CpG dinucleotides. Used as vaccine adjuvants, synthetic oligodeoxynucleotide (ODN) ligands for TLR9--CpG ODN--greatly enhance the speed and strength of the immune responses to vaccination.

  19. Immunostimulatory Properties of Lipid Modified CpG Oligonucleotides.

    PubMed

    Yu, Chunsong; An, Myunggi; Li, Meng; Liu, Haipeng

    2017-08-07

    Innate immune responses recognizing pathogen associated molecular patterns play important roles in adaptive immunity. As such, ligands which mimic the conserved products of microbial and activate innate immunity are widely used as adjuvants for vaccines. Synthetic single strand oligodeoxynucleotides (ODNs) containing unmethylated cytosine-guanine (CpG) motifs which bind Toll-like receptor 9 (TLR9) are powerful molecular adjuvants, potentiating both humoral and cellular responses. However, CpG ODN's in vitro potency has not been translated to in vivo settings primarily due to issues associated with delivery and toxicity. A major challenge in clinical application of CpG ODN is the efficient delivery to lymph nodes, the anatomic sites where all the immune responses are initiated. Targeting CpG to the key antigen presenting cells (APC) is essential for its application as a vaccine adjuvant, as it not only enhances CpG's efficacy, but also greatly reduces the systemic toxicity. We recently discovered an "albumin-hitchhiking" approach by which CpG ODNs were conjugated to a lipophilic lipid tail and follow subcutaneous injection, accumulated in lymph nodes by binding and transporting with endogenous albumin. This molecular approach targets CpG to antigen presenting cells in the draining lymph nodes via an endogenous albumin-mediated mechanism and simultaneously improves both the efficacy and safety of CpG as a vaccine adjuvant. Since CpG ODNs can be divided into structurally distinct classes, and each class of CpG ODN activates different types of immune cells and triggers different types of immunostimulatory activities, it is important to thoroughly evaluate the efficacy of this "albumin-hitchhiking" strategy in each class of CpG. Here we compare the immunostimulatory activities of three classes of lipid conjugated CpG ODNs in vitro and in vivo. Three representative sequences of lipid modified CpG ODNs were synthesized and their stimulatory effects as a vaccine adjuvant

  20. 78 FR 46594 - Prospective Grant of Start-up Exclusive License: Topical Antibiotic With Immune Stimulating...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-01

    ... Speed Wound Healing; and Use of CpG Oligodeoxynucleotides To Induce Epithelial Cell Growth AGENCY... CpG Oligodeoxynucleotides to Induce Epithelial Cell Growth'' to Tollgene having a place of business... 37 CFR part 404. These technologies relate to relate to use of CpG oligodeoxynucleotides (ODNs) to...

  1. Nanoparticle conjugation enhances the immunomodulatory effects of intranasally delivered CpG in house dust mite-allergic mice

    DOE PAGES

    Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre; ...

    2015-09-21

    An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

  2. Cytosine-phosphate-guanine oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by keyhole limpet hemocyanin antigen in dairy cattle.

    PubMed

    Chu, Chun-Yen; Lee, Shang-Chun; Liu, Shyh-Shyan; Lin, Yu-Ming; Shen, Perng-Chi; Yu, Chi; Lee, Kuo-Hua; Zhao, Xin; Lee, Jai-Wei

    2011-10-01

    Adjuvants are important components of vaccine formulations. Effective adjuvants line innate and adaptive immunity by signaling through pathogen recognition receptors. Synthetic cytosine-phosphate-guanine (CpG) oligodeoxynucleotides (ODNs) have been shown to have potentials as adjuvants for vaccines. However, the immunostimulatory effect of CpG is species-specific and depends on the sequence of CpG motifs. A CpG ODN (2135), containing 3 identical copies of GTCGTT motif, was previously reported to have the strongest effects on bovine peripheral blood mononuclear cells (PBMC). Based on the sequence of 2135, we replaced the GTCGTT motif with 11 other sequences containing CG and investigated their effects on bovine lymphocyte proliferation. Results showed that the CpG ODNs containing 3 copies of GACGTT motif had the highest lymphocyte stimulation index (7.91±1.18), which was significantly (P<0.05) higher than that of 2135 (4.25±0.56). The CpG ODNs containing 3 copies of GACGTT motif also significantly increased the mRNA expression of interferon (IFN)-α, interleukin (IL)-12, and IL-21 in bovine PBMC. When dairy cows were immunized with the keyhole limpet hemocyanin (KLH) antigen formulated with CpG ODNs containing 3 copies of GACGTT, production of KLH-specific antibodies in serum and in milk whey was significantly (P<0.05) enhanced. IFN-γ in whole blood stimulated by KLH was also significantly (P<0.05) increased in cows immunized with KLH plus CpG ODNs. Our results indicate that CpG ODNs containing 3 copies of the GACGTT motifs is a potential adjuvant for bovine vaccines.

  3. A crucial role for plasmacytoid dendritic cells in antiviral protection by CpG ODN–based vaginal microbicide

    PubMed Central

    Shen, Hong; Iwasaki, Akiko

    2006-01-01

    Topical microbicides represent a promising new approach to preventing HIV and other sexually transmitted infections. TLR agonists are ideal candidates for microbicides, as they trigger a multitude of antiviral genes effective against a broad range of viruses. Although vaginal application of CpG oligodeoxynucleotides (ODNs) and poly I:C has been shown to protect mice from genital herpes infection, the mechanism by which these agents provide protection remains unclear. Here, we show that plasmacytoid DCs (pDCs) are required for CpG ODN–mediated protection against lethal vaginal challenge with herpes simplex virus type 2 (HSV-2). Moreover, we demonstrate that cells of both the hematopoietic and stromal compartments must respond to CpG ODN via TLR9 and to type I IFNs through IFN-αβ receptor (IFN-αβR) for protection. Thus, crosstalk between pDCs and vaginal stromal cells provides for optimal microbicide efficacy. Our results imply that temporally and spatially controlled targeting of CpG ODN to pDCs and epithelial cells can potentially maximize their effectiveness as microbicides while minimizing the associated inflammatory responses. PMID:16878177

  4. CpG DNA in the prevention and treatment of infections.

    PubMed

    Dalpke, Alexander; Zimmermann, Stefan; Heeg, Klaus

    2002-01-01

    Microbial infection is sensed by Toll-like receptors (TLRs) on innate immune cells. Among the ten so far defined TLRs, TLR9 and its ligand are peculiar. TLR9 recognises bacterial DNA characterised by the abundance of unmethylated CpG dinucleotides, which distinguish bacterial DNA (CpG DNA) from mammalian DNA. Moreover, TLR9 shows a restricted cellular and subcellular pattern of expression. In contrast to other TLR agonists, CpG DNA is superior in activation of dendritic dells and induction of costimulatory cytokines such as interleukin (IL)-12 and IL-18. This qualifies CpG DNA as a Th1-promoting adjuvant. During infection, recognition of CpG DNA of intracellular pathogens skews and fine-tunes the ongoing immune response and induces long-lasting Th1 milieus. Thus, CpG DNA might play an important role in driving the immune system to a Th1 profile, preventing undesired Th2 milieus that might favour induction of allergic responses. Since CpG DNA can be synthesised with high purity and sequence fidelity, synthetic CpG DNA will become an important agent for Th1 instruction and be an effective adjuvant during vaccination.

  5. Effects of probiotics, probiotic DNA and the CpG oligodeoxynucleotides on ovalbumin-sensitized Brown-Norway rats via TLR9/NF-κB pathway.

    PubMed

    Zhong, Yan; Huang, Juan; Tang, Wenjing; Chen, Bing; Cai, Wei

    2012-10-01

    The aim of the study was to investigate the effect of living probiotics, probiotic DNA and the synthetic oligodeoxynucleotides containing CpG motifs (CpG-ODN) on both immune response and intestinal barrier function in ovalbumin-sensitized rat and the underlying mechanisms. Brown-Norway rats were orally sensitized with ovalbumin, and living probiotics, probiotic DNA extraction, synthetic CpG-ODN or non-CpG ODN control was administered. In the living probiotics, probiotic DNA and CpG-ODN groups, the allergic response was significantly inhibited, the Th1/Th2 cytokine balance was shifted away from Th2 side, the percentage of CD4(+) CD25(+high) Treg cells was increased, and the intestinal barrier function was improved. The levels of toll-like receptor (TLR) 9 mRNA and nuclear factor (NF)-κB activity, as well as the IκB-α phosphorylation (p-IκB-α) was significantly increased in these three intervention groups compared with the OVA-positive group, whereas no such effects were found in the non-CpG ODN control group. These data show that the probiotic genomic DNA and the synthetic CpG-ODN was comparable with living probiotics in preventing food allergic response by immune modulation and intestinal barrier function enhancement, and the activation of TLR9/NF-κB signal pathway might be involved in this process. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  6. Maternal treatment with a high dose of CpG ODN during gestation alters fetal craniofacial and distal limb development in C57BL/6 mice.

    PubMed

    Prater, M Renee; Johnson, Victor J; Germolec, Dori R; Luster, Michael I; Holladay, Steven D

    2006-01-16

    Synthetic oligodeoxynucleotides (ODN) containing CpG motifs, characteristic of bacterial DNA, are currently being evaluated as vaccine adjuvants for inducing protective immunity. Recently, there is increasing pressure to vaccinate pregnant women against maternally transmitted diseases including AIDS and tetanus, as well as against potential bio-weapons such as anthrax. CpG vaccines are effective because they trigger transient increases in T(H)1 cytokine production. Recent literature suggests, however, that a shift toward a T(H)1 cytokine profile during pregnancy may increase the risk of fetal morphologic defects. On this basis, we hypothesized that exposure to CpG motifs during pregnancy could result in T(H)1 inflammation leading to adverse effects on fetal development. To address this hypothesis, pregnant C57BL/6 mice were injected with CpG ODN (0-300 microg/dam) and maternal and fetal outcomes were determined. Injection of dams with the highest dose of CpG ODN resulted in markedly increased fetal resorptions and craniofacial/limb defects, while lower doses had little, if any effects. Histological examination of placentas revealed cellular necrosis with mixed inflammation and calcification in the spongiotrophoblast layer and dysregulation of labyrinthine vascular development. Concomitant elevations in maternal serum cytokine levels were observed including interleukin (IL)-2, IL-10 and IL-12. Treatment with 300 microg of non-CpG ODN did not cause any adverse effects. The 300 microg dose of CpG ODN used in the present study is 30-fold higher than the highest dose that has been administered to humans during clinical trials. These results suggest that the induction of T(H)1 cytokines during pregnancy by CpG motifs may potentially increase the risk of fetal loss and morphologic defects in mice, at least at high doses, and support the need for further investigation of teratogenesis that may result from exposure to vaccine adjuvants designed to produce T(H)1 cytokine

  7. Oral and intraperitoneal administration of phosphorothioate oligodeoxynucleotides leads to control of Cryptosporidium parvum infection in neonatal mice.

    PubMed

    Barrier, Mathieu; Lacroix-Lamandé, Sonia; Mancassola, Roselyne; Auray, Gaël; Bernardet, Nelly; Chaussé, Anne-Marie; Uematsu, Satoshi; Akira, Shizuo; Laurent, Fabrice

    2006-05-15

    Neonates are particularly vulnerable to infections, in part because of the incomplete development of their immune system. Recent advances in immunostimulatory treatments based on conserved microbial components led us to assess the potential of oligodeoxynucleotides (ODNs) for decreasing the sensitivity of neonates to Cryptosporidium parvum infection. Neonate mice were treated orally or intraperitoneally (ip) with CpG ODNs or non-CpG ODNs 24 h before C. parvum infection, and parasite load and cytokine up-regulation were evaluated. CpG ODN 1668 and non-CpG ODN 1668 administered orally, as well as CpG ODN 1668 administered ip, induced an 80%-95% decrease in intestinal parasite load 6 days after infection. Intraperitoneal and oral pretreatment with CpG ODN 1668 led to a strong initial up-regulation of cytokines and CD69 messenger RNA in the intestine and a decrease in parasite load by a Toll-like receptor 9 (TLR9)-dependent mechanism. By contrast, oral administration of non-CpG ODN 1668 decreased parasite load by a TLR9-independent mechanism. The control of neonatal C. parvum infection by ip or oral administration of ODNs is feasible by 2 different mechanisms: (1) the well-known interaction involving CpG/TLR9, leading to the production of cytokines and lymphocyte activation, and (2) a new unknown mechanism that is independent of TLR9 and effective orally.

  8. Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages

    PubMed Central

    Shi, Yongyu; Felder, Mildred A.R.; Sondel, Paul M.; Rakhmilevich, Alexander L.

    2015-01-01

    Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. PMID:25829245

  9. Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages.

    PubMed

    Shi, Yongyu; Felder, Mildred A R; Sondel, Paul M; Rakhmilevich, Alexander L

    2015-08-01

    Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Neonate intestinal immune response to CpG oligodeoxynucleotide stimulation.

    PubMed

    Lacroix-Lamandé, Sonia; Rochereau, Nicolas; Mancassola, Roselyne; Barrier, Mathieu; Clauzon, Amandine; Laurent, Fabrice

    2009-12-14

    The development of mucosal vaccines is crucial to efficiently control infectious agents for which mucosae are the primary site of entry. Major drawbacks of these protective strategies are the lack of effective mucosal adjuvant. Synthetic oligodeoxynucleotides that contain several unmethylated cytosine-guanine dinucleotide (CpG-ODN) motifs are now recognized as promising adjuvants displaying mucosal adjuvant activity through direct activation of TLR9-expressing cells. However, little is known about the efficacy of these molecules in stimulating the intestinal immune system in neonates. First, newborn mice received CpG-ODN orally, and the intestinal cytokine and chemokine response was measured. We observed that oral administration of CpG-ODN induces CXC and CC chemokine responses and a cellular infiltration in the intestine of neonates as detected by immunohistochemistry. We next compared the efficiency of the oral route to intraperitoneal administration in stimulating the intestinal immune responses of both adults and neonates. Neonates were more responsive to TLR9-stimulation than adults whatever the CpG-ODN administration route. Their intestinal epithelial cells (IECs) indirectly responded to TLR9 stimulation and contributed to the CXC chemokine response, whereas other TLR9-bearing cells of the lamina-propria produced CC chemokines and Th1-type cytokines. Moreover, we showed that the intestine of adult exhibited a significantly higher level of IL10 at homeostasis than neonates, which might be responsible for the unresponsiveness to TLR9-stimulation, as confirmed by our findings in IL10-deficient mice. This is the first report that deciphers the role played by CpG-ODN in the intestine of neonates. This work clearly demonstrates that an intraperitoneal administration of CpG-ODN is more efficient in neonates than in adults to stimulate an intestinal chemokine response due to their lower IL-10 intestinal level. In addition we report the efficiency of the oral route at

  11. Preliminary evaluation of cytosine-phosphate-guanine oligodeoxynucleotides bound to gelatine nanoparticles as immunotherapy for canine atopic dermatitis.

    PubMed

    Wagner, I; Geh, K J; Hubert, M; Winter, G; Weber, K; Classen, J; Klinger, C; Mueller, R S

    2017-07-29

    Cytosine-phosphate-guanine oligodeoxynucleotides (CpG ODN) are a promising new immunotherapeutic treatment option for canine atopic dermatitis (AD). The aim of this uncontrolled pilot study was to evaluate clinical and immunological effects of gelatine nanoparticle (GNP)-bound CpG ODN (CpG GNP) on atopic dogs. Eighteen dogs with AD were treated for 8 weeks (group 1, n=8) or 18 weeks (group 2, n=10). Before inclusion and after 2 weeks, 4 weeks, 6 weeks (group 1+2), 8 weeks, 12 weeks and 16 weeks (group 2) 75 µg CpG ODN/dog (bound to 1.5 mg GNP) were injected subcutaneously. Pruritus was evaluated daily by the owner. Lesions were evaluated and serum concentrations and mRNA expressions of interferon-γ, tumour necrosis factor-α, transforming growth factor-β, interleukin (IL) 10 and IL-4 (only mRNA expression) were determined at inclusion and after 8 weeks (group 1+2) and 18 weeks (group 2). Lesions and pruritus improved significantly from baseline to week 8. Mean improvements from baseline to week 18 were 23 per cent and 44 per cent for lesions and pruritus, respectively, an improvement of ≥50 per cent was seen in six out of nine and three out of six dogs, respectively. IL-4 mRNA expression decreased significantly. The results of this study show a clinical improvement of canine AD with CpG GNP comparable to allergen immunotherapy. Controlled studies are needed to confirm these findings. British Veterinary Association.

  12. Characterization of Immune Responses to an Inactivated Avian Influenza Virus Vaccine Adjuvanted with Nanoparticles Containing CpG ODN.

    PubMed

    Singh, Shirene M; Alkie, Tamiru N; Abdelaziz, Khaled Taha; Hodgins, Douglas C; Novy, Anastasia; Nagy, Éva; Sharif, Shayan

    2016-06-01

    Avian influenza virus (AIV), a mucosal pathogen, gains entry into host chickens through respiratory and gastrointestinal routes. Most commercial AIV vaccines for poultry consist of inactivated, whole virus with adjuvant, delivered by parenteral administration. Recent advances in vaccine development have led to the application of nanoparticle emulsion delivery systems, such as poly (d,l-lactic-co-glycolic acid) (PLGA) nanoparticles to enhance antigen-specific immune responses. In chickens, the Toll-like receptor 21 ligand, CpG oligodeoxynucleotides (ODNs), have been demonstrated to be immunostimulatory. The objective of this study was to compare the adjuvant potential of CpG ODN 2007 encapsulated in PLGA nanoparticles with nonencapsulated CpG ODN 2007 when combined with a formalin-inactivated H9N2 virus, through intramuscular and aerosol delivery routes. Chickens were vaccinated at days 7 and 21 posthatch for the intramuscular route and at days 7, 21, and 35 for the aerosol route. Antibody-mediated responses were evaluated weekly in sera and lacrimal secretions in specific pathogen-free chickens. The results indicate that nonencapsulated CpG ODN 2007 in inactivated AIV vaccines administered by the intramuscular route generated higher antibody responses compared to the encapsulated CpG ODN 2007 formulation by the same route. Additionally, encapsulated CpG ODN 2007 in AIV vaccines administered by the aerosol route elicited higher mucosal responses compared to nonencapsulated CpG ODN 2007. Future studies may be aimed at evaluating protective immune responses induced with PLGA encapsulation of AIV and adjuvants.

  13. Cancer Vaccine Composed of Oligonucleotides Conjugated to Apoptotic Tumor Cells | NCI Technology Transfer Center | TTC

    Cancer.gov

    Synthetic oligodeoxynucleotides (ODN) containing unmethylated Cytosine-Guanine (CpG) motifs mimic the immunostimulatory activity of bacterial DNA. CpG ODN directly stimulate B cells and plasmacytoid dendritic cells (pDC), promote the production of T Helper 1 cells (Th1) and pro-inflammatory cytokines, and  trigger the maturation/activation of professional antigen presenting cells. The National Cancer Institute, Laboratory of Experimental Immunology, seeks interested parties to co- develop methods for inducing an immune response to tumors.

  14. Topical CpG Adjuvantation of a Protein-Based Vaccine Induces Protective Immunity to Listeria monocytogenes

    PubMed Central

    Cheng, Wing Ki; Wee, Kathleen; Kollmann, Tobias R.

    2014-01-01

    Robust CD8+ T cell responses are essential for immune protection against intracellular pathogens. Using parenteral administration of ovalbumin (OVA) protein as a model antigen, the effect of the Toll-like receptor 9 (TLR9) agonist, CpG oligodeoxynucleotide (ODN) 1826, as an adjuvant delivered either topically, subcutaneously, or intramuscularly on antigen-specific CD8+ T cell responses in a mouse model was evaluated. Topical CpG adjuvant increased the frequency of OVA-specific CD8+ T cells in the peripheral blood and in the spleen. The more effective strategy to administer topical CpG adjuvant to enhance CD8+ T cell responses was single-dose administration at the time of antigen injection with a prime-boost regimen. Topical CpG adjuvant conferred both rapid and long-lasting protection against systemic challenge with recombinant Listeria monocytogenes expressing the cytotoxic T lymphocyte (CTL) epitope of OVA257–264 (strain Lm-OVA) in a TLR9-dependent manner. Topical CpG adjuvant induced a higher proportion of CD8+ effector memory T cells than parenteral administration of the adjuvant. Although traditional vaccination strategies involve coformulation of antigen and adjuvant, split administration using topical adjuvant is effective and has advantages of safety and flexibility. Split administration of topical CpG ODN 1826 with parenteral protein antigen is superior to other administration strategies in enhancing both acute and memory protective CD8+ T cell immune responses to subcutaneous protein vaccines. This vaccination strategy induces rapid and persistent protective immune responses against the intracellular organism L. monocytogenes. PMID:24391136

  15. DNA activates human immune cells through a CpG sequence-dependent manner

    PubMed Central

    Bauer, M; Heeg, K; Wagner, H; Lipford, G B

    1999-01-01

    While bacterial DNA and cytosine–guanosine-dinucleotide-containing oligonucleotides (CpG ODN) are well described activators of murine immune cells, their effect on human cells is inconclusive. We investigated their properties on human peripheral blood mononuclear cells (PBMC) and subsets thereof, such as purified monocytes, T and B cells. Here we demonstrate that bacterial DNA and CpG ODN induce proliferation of B cells, while other subpopulations, such as monocytes and T cells, did not proliferate. PBMC mixed cell cultures, as well as purified monocytes, produced interleukin-6 (IL-6), IL-12 and tumour necrosis factor-α upon stimulation with bacterial DNA; however, only IL-6 and IL-12 secretion became induced upon CpG ODN stimulation. We conclude that monocytes, but not B or T cells, represent the prime source of cytokines. Monocytes up-regulated expression of antigen-presenting, major histocompatibility complex class I and class II molecules in response to CpG DNA. In addition, both monocytes and B cells up-regulate costimulatory CD86 and CD40 molecules. The activation by CpG ODN depended on sequence motifs containing the core dinucleotide CG since destruction of the motif strongly reduced immunostimulatory potential. PMID:10457226

  16. A bacterial reporter system for the evaluation of antisense oligodeoxynucleotides directed against human papillomavirus type 16 (HPV-16).

    PubMed

    Guapillo, Mario R; Márquez, Miguel A; Benítez-Hess, María L; Alvarez-Salas, Luis M

    2006-07-01

    Antisense oligodeoxynucleotides (AS-ODNs) are a promising alternative for the cure of many diseases because of their in vivo specificity and stability. However, AS-ODNs have a strong dependence on the target mRNA structure making necessary extensive in vivo testing. There is, therefore, a need to develop assays to rapidly evaluate in vivo ODN performance. We report a simple and inexpensive bacterial reporter system for the rapid in vivo evaluation of AS-ODNs directed against human papillomavirus type 16 (HPV-16) based on the destruction of a chimeric CFP mRNA using the reported HPV-16 nt 410-445 target. In vitro RNaseH assays confirmed target RNA accessibility after AS-ODN treatment. Expression of CFP in Escherichia coli BL21(DE3) with pGST-TSd2-CFP plasmid containing HPV-16 nt 410-445 target linked to CFP was blocked by transformed antisense PS-ODNs but not by two different scrambled ODN controls. A correlation was observed between bacterial CFP downregulation with the HPV-16 E6/E7 mRNA downregulation and the inhibition of anchorage-independent growth of HPV-16 containing cells suggesting that inhibition of HPV-16 E6/E7 expression by AS-ODNs directed against 410-445 target in cervical tumor cells can be tested in bacterial models.

  17. 75 FR 60761 - Government-Owned Inventions; Availability for Licensing

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-01

    ... cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to a subject. Methods for treating a tumor... therapeutically effective amount of apoptotic tumor cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to... the prevention of cancer and other indications Use of CpG oligonucleotides for prophylaxis and/or...

  18. A dinucleotide motif in oligonucleotides shows potent immunomodulatory activity and overrides species-specific recognition observed with CpG motif.

    PubMed

    Kandimalla, Ekambar R; Bhagat, Lakshmi; Zhu, Fu-Gang; Yu, Dong; Cong, Yan-Ping; Wang, Daqing; Tang, Jimmy X; Tang, Jin-Yan; Knetter, Cathrine F; Lien, Egil; Agrawal, Sudhir

    2003-11-25

    Bacterial and synthetic DNAs containing CpG dinucleotides in specific sequence contexts activate the vertebrate immune system through Toll-like receptor 9 (TLR9). In the present study, we used a synthetic nucleoside with a bicyclic heterobase [1-(2'-deoxy-beta-d-ribofuranosyl)-2-oxo-7-deaza-8-methyl-purine; R] to replace the C in CpG, resulting in an RpG dinucleotide. The RpG dinucleotide was incorporated in mouse- and human-specific motifs in oligodeoxynucleotides (oligos) and 3'-3-linked oligos, referred to as immunomers. Oligos containing the RpG motif induced cytokine secretion in mouse spleen-cell cultures. Immunomers containing RpG dinucleotides showed activity in transfected-HEK293 cells stably expressing mouse TLR9, suggesting direct involvement of TLR9 in the recognition of RpG motif. In J774 macrophages, RpG motifs activated NF-kappa B and mitogen-activated protein kinase pathways. Immunomers containing the RpG dinucleotide induced high levels of IL-12 and IFN-gamma, but lower IL-6 in time- and concentration-dependent fashion in mouse spleen-cell cultures costimulated with IL-2. Importantly, immunomers containing GTRGTT and GARGTT motifs were recognized to a similar extent by both mouse and human immune systems. Additionally, both mouse- and human-specific RpG immunomers potently stimulated proliferation of peripheral blood mononuclear cells obtained from diverse vertebrate species, including monkey, pig, horse, sheep, goat, rat, and chicken. An immunomer containing GTRGTT motif prevented conalbumin-induced and ragweed allergen-induced allergic inflammation in mice. We show that a synthetic bicyclic nucleotide is recognized in the C position of a CpG dinucleotide by immune cells from diverse vertebrate species without bias for flanking sequences, suggesting a divergent nucleotide motif recognition pattern of TLR9.

  19. Immunization of Aged Pigs with Attenuated Pseudorabies Virus Vaccine Combined with CpG Oligodeoxynucleotide Restores Defective Th1 Immune Responses

    PubMed Central

    Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua

    2013-01-01

    Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433

  20. CpG DNA: A pathogenic factor in systemic lupus erythematosus?

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krieg, A.M.

    1995-11-01

    Systemic lupus erythematosus (SLE) is a multifactorial disease of unknown etiology. Characteristic features of SLE include (1) polyclonal B cell activation, (2) overexpression of the immune stimulatory cytokine interleukin-6 (IL-6), (3) defective tolerance to self antigens, and (4) production of anti-DNA antibodies (Ab). Bacterial infection has been suspected as a triggering factor for lupus. Bacterial DNA differs from vertebrate DNA in the frequency and methylation of CpG dinucleotides. These CpG motifs in bacterial DNA induce a variety of immune effects, including (1) polyclonal activation of murine and human B cells, (2) IL-6 secretion, and (3) resistance to apoptosis, thereby potentiallymore » allowing the survival of autoreactive cells. These results suggest that microbial DNA could therefore be a pathogenic factor in SLE. SLE patients have elevated levels of circulating plasma DNA which is reportedly enriched in hypomethylated CpGs. Genomic DNA is also hypomethylated in SLE. The purpose of this review is to summarize the immune effects of CpG motifs and to present the evidence for their possible involvement in the pathogenesis of SLE. 77 refs.« less

  1. Antibody classes & subclasses induced by mucosal immunization of mice with Streptococcus pyogenes M6 protein & oligodeoxynucleotides containing CpG motifs.

    PubMed

    Teloni, R; von Hunolstein, C; Mariotti, S; Donati, S; Orefici, G; Nisini, R

    2004-05-01

    Type-specific antibodies against M protein are critical for human protection as they enhance phagocytosis and are protective. An ideal vaccine for the protection against Streptococcus pyogenes would warrant mucosal immunity, but mucosally administered M-protein has been shown to be poorly immunogenic in animals. We used a recombinant M type 6 protein to immunize mice in the presence of synthetic oligodeoxynucleotides containing CpG motifs (immunostimulatory sequences: ISS) or cholera toxin (CT) to explore its possible usage in a mucosal vaccine. Mice were immunized by intranasal (in) or intradermal (id) administration with four doses at weekly intervals of M6-protein (10 microg/mouse) with or without adjuvant (ISS, 10 microg/mouse or CT, 0,5 microg/mouse). M6 specific antibodies were measured by enzyme linked immunosorbent assay using class and subclass specific monoclonal antibodies. The use of ISS induced an impressive anti M-protein serum IgG response but when id administered was not detectable in the absence of adjuvant. When used in, M-protein in the presence of both ISS and CT induced anti M-protein IgA in the bronchoalveolar lavage, as well as specific IgG in the serum. IgG were able to react with serotype M6 strains of S. pyogenes. The level of antibodies obtained by immunizing mice in with M-protein and CT was higher in comparison to M-protein and ISS. The analysis of anti-M protein specific IgG subclasses showed high levels of IgG1, IgG2a and IgG2b, and low levels of IgG3 when ISS were used as adjuvant. Thus, in the presence of ISS, the ratio IgG2a/IgG1 and (IgG2a+IgG3)/IgG1 >1 indicated a type 1-like response obtained both in mucosally or systemically vaccinated mice. Our study offers a reproducible model of anti-M protein vaccination that could be applied to test new antigenic formulations to induce an anti-group A Streptococcus (GAS) vaccination suitable for protection against the different diseases caused by this bacterium.

  2. Randomized phase 2/3 trial of CpG oligodeoxynucleotide PF-3512676 alone or with dacarbazine for patients with unresectable stage III and IV melanoma.

    PubMed

    Weber, Jeffrey S; Zarour, Hassan; Redman, Bruce; Trefzer, Uwe; O'Day, Steven; van den Eertwegh, Alfons J M; Marshall, Ernest; Wagner, Stefan

    2009-09-01

    The primary objective of this phase 2 study was to assess the objective response rate (complete response [CR] + partial responses [PR]), by Response Evaluation Criteria in Solid Tumors, of PF-3512676, a CpG oligodeoxynucleotide, alone in 2 doses or in combination with dacarbazine (DTIC) in patients with unresectable stage IIIB/C or stage IV malignant melanoma, with the aim of selecting an arm to take forward to a phase 3 portion of the study. A total of 184 patients were randomized to 1 of 4 treatments: PF-3512676 10 mg (low dose), at 40 mg (high dose), 40 mg plus DTIC (850 mg/m(2)), or DTIC (850 mg/m(2)) alone. Patients received PF-3512676 subcutaneously weekly in a 3-week cycle and received DTIC intravenously on the first week of the cycle. The objective response rate (PR or CR, confirmed or unconfirmed) in the 40 mg + DTIC arm was 16% (7 patients) compared with 8% (3 patients) with DTIC alone. One (2%) patient in the 10-mg and 0 patients in the 40-mg arms achieved an objective response. Best response of CR or PR or stable disease (SD), with no minimum duration defined for SD, was achieved by 15 (33%) patients in the 40 mg + DTIC arm, 15 (38%) patients in the DTIC-only arm, 8 (17%) patients in the 10-mg arm, and 9 (20%) patients in the 40-mg arm. The most frequently reported adverse events were classified as local injection site reactions or systemic flu-like symptoms, specifically fatigue, rigors, and pyrexia. PF-3512676 at the doses used was generally well tolerated. The modest objective response rates observed in all arms did not warrant continuation to the phase 3 portion of the study.

  3. CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols.

    PubMed

    Rozak, David A; Gelhaus, Herbert C; Smith, Mark; Zadeh, Mojgan; Huzella, Louis; Waag, David; Adamovicz, Jeffrey J

    2010-02-05

    Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species.

  4. CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols

    PubMed Central

    2010-01-01

    Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species. PMID:20181102

  5. Marked enhancement of the immune response to BioThrax® (Anthrax Vaccine Adsorbed) by the TLR9 agonist CPG 7909 in healthy volunteers.

    PubMed

    Rynkiewicz, Dianna; Rathkopf, Melinda; Sim, Iain; Waytes, A Thomas; Hopkins, Robert J; Giri, Lallan; DeMuria, Deborah; Ransom, Janet; Quinn, James; Nabors, Gary S; Nielsen, Carl J

    2011-08-26

    Immunization with BioThrax(®) (Anthrax Vaccine Adsorbed) is a safe and effective means of preventing anthrax. Animal studies have demonstrated that the addition of CpG DNA adjuvants to BioThrax can markedly increase the immunogenicity of the vaccine, increasing both serum anti-protective antigen (PA) antibody and anthrax toxin-neutralizing antibody (TNA) concentrations. The immune response to CpG-adjuvanted BioThrax in animals was not only stronger, but was also more rapid and led to higher levels of protection in spore challenge models. The B-class CpG DNA adjuvant CPG 7909, a 24-base synthetic, single-strand oligodeoxynucleotide, was evaluated for its safety profile and adjuvant properties in a Phase 1 clinical trial. A double-blind study was performed in which 69 healthy subjects, age 18-45 years, were randomized to receive three doses of either: (1) BioThrax alone, (2) 1 mg of CPG 7909 alone or (3) BioThrax plus 1 mg of CPG 7909, all given intramuscularly on study days 0, 14 and 28. Subjects were monitored for IgG to PA by ELISA and for TNA titers through study day 56 and for safety through month 6. CPG 7909 increased the antibody response by 6-8-fold at peak, and accelerated the response by 3 weeks compared to the response seen in subjects vaccinated with BioThrax alone. No serious adverse events related to study agents were reported, and the combination was considered to be reasonably well tolerated. The marked acceleration and enhancement of the immune response seen by combining BioThrax and CPG 7909 offers the potential to shorten the course of immunization and reduce the time to protection, and may be particularly useful in the setting of post-exposure prophylaxis. Copyright © 2011 Elsevier Ltd. All rights reserved.

  6. Effects of CPG ODN on biological behavior of PANC-1 and expression of TLR9 in pancreatic cancer.

    PubMed

    Wu, Han-Qing; Wang, Bo; Zhu, Shi-Kai; Tian, Yuan; Zhang, Jing-Hui; Wu, He-Shui

    2011-02-28

    To determine the expression of toll-like receptor 9 (TLR9) in pancreatic tumor and the effects of cytosine phosphate-guanosine oligodeoxynucleotides 2216 (CPG ODN2216) on biological behavior of pancreatic carcinoma cell line PANC-1 and explore their clinical significance. The immunohistochemistry and Western blot were used to determine the expression of TLR9 protein in pancreatic cancer tissues, and immunofluorescence staining was performed to detect the TLR9 protein expression in pancreatic carcinoma cell line PANC-1. To assess the effects of CPG ODN2216 on the invasive property of Panc-1 cells, in vitro cell adhesion, wound-healing scrape, and invasion and cell colony formation were evaluated. TLR9 was highly expressed in pancreatic cancer tissues and PANC-1 cells. The percentage of positive cells expressing TLR9 protein in human pancreatic tissues, paracancerous tissues and normal tissues were 73.3%, 33.3% and 20.0%, respectively, and the protein expression level of TLR9 was gradually descending (P < 0.05). In vitro tests in wound-healing scrape, cell adhesion, colony formation and matrigel invasion showed that the adhesion and motility of PANC-1 cells in CPG ODN 2216 treatment group were significantly lower than in the control group (P < 0.05). The cell growth assay showed that the proliferative ability of PANC-1 cells in treatment group was significantly decreased and CPG ODN2216 had an inhibitive effect in the growth of Panc-1 cells in a dose and time-dependent manner (P < 0.05). The gene of TLR9 is correlated with the invasive and metastatic potential of human pancreatic carcinoma, and CPG ODN2216 induces the inhibition of migration and invasion of Panc-1 cells.

  7. Alternate-strand triple-helix formation by the 3'-3'-linked oligodeoxynucleotides with the intercalators at the junction point.

    PubMed

    Ueno, Y; Mikawa, M; Hoshika, S; Takeba, M; Kitade, Y; Matsuda, A

    2001-01-01

    3'-3'-Linked oligodeoxynucleotides (ODNs) with the anthraquinonyl group at the junction point were synthesized on a DNA synthesizer using a controlled pore glass (CPG), which has pentaerythritol carrying the intercalator at one of the four hydroxymethyl groups. Stability of the triplexes with the target duplexes was studied by thermal denaturation. The 3'-3'-linked ODNs with the anthraquinonyl group enhanced the thermal stability of the triplexes when compared with those without the intercalator and the unmodified nonamer. The inhibitory activity of the 3'-3'-linked ODNs against the cleavage of the target DNA by the restriction enzyme Hind III was tested. It was found that the 3'-3'-linked ODN with the anthraquinonyl group at the junction point inhibited the cleavage by the enzyme more effectively than the nonamer and the 3'-3'-linked ODN without the intercalator.

  8. Immune response in domestic ducks following intradermal delivery of inactivated vaccine against H5N1 highly pathogenic avian influenza virus adjuvanted with oligodeoxynucleotides containing CpG motifs.

    PubMed

    Yuk, Seong-Su; Lee, Dong-Hun; Park, Jae-Keun; To, Eredene-Ochir; Kwon, Jung-Hoon; Noh, Jin-Yong; Gomis, Susantha; Song, Chang-Seon

    2015-08-01

    Ducks are a natural reservoir for H5N1 highly pathogenic avian influenza (HPAI) viruses, which produces a range of clinical outcomes from asymptomatic infections to severe disease with mortality. Vaccination against HPAI is one of the few methods available for controlling avian influenza virus (AIV) infection in domestic ducks; therefore, it is necessary to improve vaccine efficacy against HPAI in domestic ducks. However, few studies have focused on enhancing the immune response by testing alternative administration routes and adjuvants. While attempting to maximize the efficacy of a vaccine, it is important to select an appropriate vaccine delivery route and adjuvant to elicit an enhanced immune response. Although several studies have indicated that the vaccination of ducks against HPAI viruses has offered protection against lethal virus challenge, the immunogenicity of the vaccine still requires improvement. In this study, we characterized the immune response following a novel vaccination strategy against H5N1 HPAI virus in domestic ducks. Our novel intradermal delivery system and the application of the cytosine-phosphodiester-guanine (CpG) oligodeoxynucleotide (ODN) adjuvant allowed us to obtain information regarding the sustained vaccine immunity. Compared with the intramuscular route of vaccination, the intradermal route resulted in higher antibody titer as well as lower antibody deviation following secondary vaccination. In addition, the use of a CpG-ODN adjuvant had a dose-sparing effect on antibody titer. Furthermore, when a high dose of antigen was used, the CpG-ODN-adjuvanted vaccine maintained a high mean antibody titer. This data demonstrates that intradermal immunization combined with administration of CpG-ODN as an adjuvant may be a promising strategy for improving vaccine efficacy in domestic ducks. © 2015 Poultry Science Association Inc.

  9. Immune stimulation by a CpG-containing oligodeoxynucleotide is enhanced when encapsulated and delivered in lipid particles.

    PubMed

    Mui, B; Raney, S G; Semple, S C; Hope, M J

    2001-09-01

    The therapeutic benefit from phosphorothioate oligodeoxynucleotides (PS ODN) containing immune stimulatory sequences (ISS) has been demonstrated in animal models of cancer and infection. In particular, when CpG-containing PS ODN are administered to mice, activation of macrophages and dendritic, NK, T, and B cells occurs, resulting in the release of an array of cytokines, including interleukin-12 (IL-12), interferon-gamma (IFN-gamma), and tumor necrosis factor-alpha (TNF-alpha). We have previously described stabilized antisense-lipid particles (SALP) for the i.v. administration of antisense ODN [Biochim Biophys Acta (2001) 1510:152--166]. Given the propensity for SALP to target macrophages in vivo it was of interest to determine whether they could enhance the potency of CpG ODN to induce an immune response. In this report we show that when CpG-containing SALP are administered intravenously to ICR mice the plasma concentrations of IL-12, IFN-gamma, IL-6, monocyte chemoattractant protein-1, and TNF-alpha are greatly increased compared with the same dose of free ODN. The pattern of cytokine induction indicates that the immune response is T helper cell type 1-biased, similar to that observed for PS CpG ODN ISS in general. Furthermore, when phosphodiester (PO) ODN is substituted for PS ODN in the SALP formulation cytokine induction is even greater at the early time points, in marked contrast to free PO ODN, which is inactive. These results demonstrate that the immunogenicity of ISS is not only enhanced by encapsulation in lipid particles, which more closely mimic the way ISS DNA would normally be presented to antigen presenting cells by pathogens in vivo, but also SALP enable unmodified PO CpG ODN to be used as immune stimulants.

  10. Cationic liposomes containing soluble Leishmania antigens (SLA) plus CpG ODNs induce protection against murine model of leishmaniasis.

    PubMed

    Heravi Shargh, Vahid; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jalali, Seyed Amir; Firouzmand, Hengameh; Abbasi, Azam; Badiee, Ali

    2012-07-01

    Development of an effective vaccine against leishmaniasis is possible due to the fact that individuals cured from cutaneous leishmaniasis (CL) are protected from further infection. First generation Leishmania vaccines consisting of whole killed parasites reached to phase 3 clinical trials but failed to show enough efficacies mainly due to the lack of an appropriate adjuvant. In this study, an efficient liposomal protein-based vaccine against Leishmania major infection was developed using soluble Leishmania antigens (SLA) as a first generation vaccine and cytidine phosphate guanosine oligodeoxynucleotides (CpG ODNs) as an immunostimulatory adjuvant. 1, 2-Dioleoyl-3-trimethylammonium-propane was used as a cationic lipid to prepare the liposomes due to its intrinsic adjuvanticity. BALB/c mice were immunized subcutaneously (SC), three times in 2-week intervals, with Lip-SLA-CpG, Lip-SLA, SLA + CpG, SLA, or HEPES buffer. As criteria for protection, footpad swelling at the site of challenge and spleen parasite loads were assessed, and the immune responses were evaluated by determination of IFN-γ and IL-4 levels of cultured splenocytes, and IgG subtypes. The group of mice that received Lip-SLA-CpG showed a significantly smaller footpad swelling, lower spleen parasite burden, higher IgG2a antibody, and lower IL-4 level compared to the control groups. It is concluded that cationic liposomes containing SLA and CpG ODNs are appropriate to induce Th1 type of immune response and protection against leishmaniasis.

  11. The Use of Chlorhexidine/n-Propyl Gallate (CPG) as an Ambient-Temperature Urine Preservative

    NASA Technical Reports Server (NTRS)

    Nillen, Jeannie L.; Smith, Scott M.

    2003-01-01

    A safe, effective ambient temperature urine preservative, chlorhexidine/n-propyl gallate (CPG), has been formulated for use during spacefli ght that reduces the effects of oxidation and bacterial contamination on sample integrity while maintaining urine pH. The ability of this preservative to maintain stability of nine key analytes was evaluated for a period of one year. CPG effectively maintained stability of a mmonia, total nitrogen, 3-methylhistidine, chloride, sodium, potassiu m, and urea; however, creatinine and osmolality were not preserved by CPG. These data indicate that CPG offers prolonged room-temperature storage for multiple urine analytes, reducing the requirements for f rozen urine storage on future spaceflights. Iii medical applications on Earth, this technology can allow urine samples to be collected in remote settings and eliminate the need to ship frozen samples.

  12. Prophylactic Administration of Bacterially Derived Immunomodulators Improves the Outcome of Influenza Virus Infection in a Murine Model▿

    PubMed Central

    Norton, Elizabeth B.; Clements, John D.; Voss, Thomas G.; Cárdenas-Freytag, Lucia

    2010-01-01

    Prophylactic or therapeutic immunomodulation is an antigen-independent strategy that induces nonspecific immune system activation, thereby enhancing host defense to disease. In this study, we investigated the effect of prophylactic immunomodulation on the outcome of influenza virus infection using three bacterially derived immune-enhancing agents known for promoting distinct immunological profiles. BALB/c mice were treated nasally with either cholera toxin (CT), a mutant form of the CT-related Escherichia coli heat-labile enterotoxin designated LT(R192G), or CpG oligodeoxynucleotide. Mice were subsequently challenged with a lethal dose of influenza A/PR/8/34 virus 24 h after the last immunomodulation treatment and either monitored for survival or sacrificed postchallenge for viral and immunological analysis. Treatment with the three immunomodulators prevented or delayed mortality and weight loss, but only CT and LT(R192G) significantly reduced initial lung viral loads as measured by plaque assay. Analysis performed 4 days postinfection indicated that prophylactic treatments with CT, LT(R192G), or CpG resulted in significantly increased numbers of CD4 T cells, B cells, and dendritic cells and altered costimulatory marker expression in the airways of infected mice, coinciding with reduced expression of pulmonary chemokines and the appearance of inducible bronchus-associated lymphoid tissue-like structures in the lungs. Collectively, these results suggest that, despite different immunomodulatory mechanisms, CT, LT(R192G), and CpG induce an initial inflammatory process and enhance the immune response to primary influenza virus challenge while preventing potentially damaging chemokine expression. These studies provide insight into the immunological parameters and immune modulation strategies that have the potential to enhance the nonspecific host response to influenza virus infection. PMID:20053748

  13. Newly identified CpG ODNs, M5-30 and M6-395, stimulate mouse immune cells to secrete TNF-alpha and enhance Th1-mediated immunity.

    PubMed

    Choi, Sun-Shim; Chung, Eunkyung; Jung, Yu-Jin

    2010-08-01

    Bacterial CpG motifs are known to induce both innate and adaptive immunity in infected hosts via toll-like receptor 9 (TLR9). Because small oligonucleotides (ODNs) mimicking bacterial CpG motifs are easily synthesized, they have found use as immunomodulatory agents in a number of disease models. We have developed a novel bioinformatics approach to identify effective CpG ODN sequences and evaluate their function as TLR9 ligands in a murine system. Among the CpG ODNs we identified, M5-30 and M6-395 showed significant ability to stimulate TNF-alpha and IFN-gamma production in a mouse macrophage cell line and mouse splenocytes, respectively. We also found that these CpG ODNs activated cells through the canonical NF-kappa B signaling pathway. Moreover, both CpG ODNs were able to induce Th1-mediated immunity in Mycobacterium tuberculosis (Mtb)-infected mice. Our results demonstrate that M5-30 and M6-395 function as TLR9-specific ligands, making them useful in the study of TLR9 functionality and signaling in mice.

  14. Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

    PubMed

    Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

    2018-05-01

    DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Predicting aberrant CpG island methylation

    PubMed Central

    Feltus, F. A.; Lee, E. K.; Costello, J. F.; Plass, C.; Vertino, P. M.

    2003-01-01

    Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context. PMID:14519846

  16. Predicting aberrant CpG island methylation.

    PubMed

    Feltus, F A; Lee, E K; Costello, J F; Plass, C; Vertino, P M

    2003-10-14

    Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context.

  17. CpG island mapping by epigenome prediction.

    PubMed

    Bock, Christoph; Walter, Jörn; Paulsen, Martina; Lengauer, Thomas

    2007-06-01

    CpG islands were originally identified by epigenetic and functional properties, namely, absence of DNA methylation and frequent promoter association. However, this concept was quickly replaced by simple DNA sequence criteria, which allowed for genome-wide annotation of CpG islands in the absence of large-scale epigenetic datasets. Although widely used, the current CpG island criteria incur significant disadvantages: (1) reliance on arbitrary threshold parameters that bear little biological justification, (2) failure to account for widespread heterogeneity among CpG islands, and (3) apparent lack of specificity when applied to the human genome. This study is driven by the idea that a quantitative score of "CpG island strength" that incorporates epigenetic and functional aspects can help resolve these issues. We construct an epigenome prediction pipeline that links the DNA sequence of CpG islands to their epigenetic states, including DNA methylation, histone modifications, and chromatin accessibility. By training support vector machines on epigenetic data for CpG islands on human Chromosomes 21 and 22, we identify informative DNA attributes that correlate with open versus compact chromatin structures. These DNA attributes are used to predict the epigenetic states of all CpG islands genome-wide. Combining predictions for multiple epigenetic features, we estimate the inherent CpG island strength for each CpG island in the human genome, i.e., its inherent tendency to exhibit an open and transcriptionally competent chromatin structure. We extensively validate our results on independent datasets, showing that the CpG island strength predictions are applicable and informative across different tissues and cell types, and we derive improved maps of predicted "bona fide" CpG islands. The mapping of CpG islands by epigenome prediction is conceptually superior to identifying CpG islands by widely used sequence criteria since it links CpG island detection to their characteristic

  18. Antisense oligodeoxynucleotide to the cystic fibrosis gene inhibits anion transport in normal cultured sweat duct cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sorscher, E.J.; Kirk, K.L.; Weaver, M.L.

    The authors have tested the hypothesis that the cystic fibrosis (CF) gene product, called the CF transmembrane conductance regulator (CFTR), mediates anion transport in normal human sweat duct cells. Sweat duct cells in primary culture were treated with oligodeoxynucleotides that were antisense to the CFTR gene transcript in order to block the expression of the wild-type CFTR. Anion transport in CFTR transcript antisense-treated cells was then assessed with a halide-specific dye, 6-methoxy-N-(3-sulfopropryl)quinolinium, and fluorescent digital imaging microscopy to monitor halide influx and efflux from single sweat duct cells. Antisense oligodeoxynucleotide treatment for 24 hr virtually abolished Cl{sup {minus}} transport inmore » sweat duct cells compared with untreated cells or control cells treated with sense oligodeoxynucleotides. Br{sup {minus}} uptake into sweat duct cells was also blocked after a 24-hr CFTR transcript antisense treatments, but not after treatments for only 4 hr. Lower concentrations of antisense oligodeoxynucleotides were less effective at inhibiting Cl{sup {minus}} transport. These results indicate that oligodeoxynucleotides that are antisense to CFTR transcript inhibit sweat duct Cl{sup {minus}} permeability in both a time-dependent and dose-dependent manner. This approach provides evidence that inhibition of the expression of the wild-type CFTR gene in a normal, untransfected epithelial cell results in an inhibition of Cl{sup {minus}} permeability.« less

  19. In vitro optimization of antisense oligodeoxynucleotide design: an example using the connexin gene family.

    PubMed

    Law, Lee Yong; Zhang, Wei V; Stott, N Susan; Becker, David L; Green, Colin R

    2006-09-01

    The completion of the human and mouse genomes has identified at least 20 connexin isomers in this family of intercellular channel proteins. However, there are no specific gap junction blockers or channel-blocking mimetic peptides available for the study of specific connexins. We designed antisense oligodeoxynucleotides that functionally reduce targeted connexin protein expression and can be used to reveal the biological function of individual connexins in vivo. Connexin mRNA was firstly exposed in vitro to deoxyribozymes complementing the sense coding sequence. Those that cleaved the target connexin mRNA in defined regions were used as the basis to design oligodeoxynucleotides to the accessible sites, thus taking into account tertiary mRNA configurations rather than relying on computed predictions. Antisense oligodeoxynucleotides designed to bind to accessible mRNA sites selectively reduced connexin26 and -43 mRNA expression in a corneal epithelium ex vivo model. Connexin43 protein levels were reduced correlating with the knockdown in mRNA and the protein's rapid turnover; protein levels of connexin26 did not alter, supporting lower turnover rates reported for that protein. We show, for the first time, an inexpensive and empirical approach to the preparation of specific and functional antisense oligodeoxynucleotides against known gene targets in the post-genomic era.

  20. A method to identify and characterize Z-DNA binding proteins using a linear oligodeoxynucleotide

    NASA Technical Reports Server (NTRS)

    Herbert, A. G.; Rich, A.

    1993-01-01

    An oligodeoxynucleotide that readily flips to the Z-DNA conformation in 10mM MgCl2 was produced by using Klenow enzyme to incorporate 5-bromodeoxycytosine and deoxyguanosine into a (dC-dG)22 template. During synthesis the oligomer can be labeled with 32P to high specific activity. The labeled oligodeoxynucleotide can be used in bandshift experiment to detect proteins that bind Z-DNA. This allows the binding specificity of such proteins to be determined with high reliability using unlabeled linear and supercoiled DNA competitors. In addition, because the radioactive oligodeoxynucleotide contains bromine atoms, DNA-protein complexes can be readily crosslinked using UV light. This allows an estimate to be made of the molecular weight of the proteins that bind to the radioactive probe. Both techniques are demonstrated using a goat polyclonal anti-Z-DNA antiserum.

  1. Phase 1 testing of detoxified LPS/group B meningococcal outer membrane protein vaccine with and without synthetic CPG 7909 adjuvant for the prevention and treatment of sepsis.

    PubMed

    Cross, Alan S; Greenberg, Nancy; Billington, Melissa; Zhang, Lei; DeFilippi, Christopher; May, Ryan C; Bajwa, Kanwaldeep K

    2015-11-27

    Gram-negative bacteria (GNB) are a leading cause of nosocomial infection and sepsis. Increasing multi-antibiotic resistance has left clinicians with fewer therapeutic options. Antibodies to GNB lipopolysaccharide (LPS, or endotoxin) have reduced morbidity and mortality as a result of infection and are not subject to the resistance mechanisms deployed by bacteria against antibiotics. In this phase 1 study, we administered a vaccine that elicits antibodies against a highly conserved portion of LPS with and without a CpG oligodeoxynucleotide (ODN) TLR9 agonist as adjuvant. A vaccine composed of the detoxified LPS (dLPS) from E. coli O111:B4 (J5 mutant) non-covalently complexed to group B meningococcal outer membrane protein (OMP). Twenty healthy adult subjects received three doses at 0, 29 and 59 days of antigen (10 μg dLPS) with or without CPG 7909 (250 or 500 μg). Subjects were evaluated for local and systemic adverse effects and laboratory findings. Anti-J5 LPS IgG and IgM antibody levels were measured by electrochemiluminesence. Due to premature study termination, not all subjects received all three doses. All vaccine formulations were well-tolerated with no local or systemic events of greater than moderate severity. The vaccine alone group achieved a ≥ 4-fold "responder" response in IgG and IgM antibody in only one of 6 subjects. In contrast, the vaccine plus CPG 7909 groups appeared to have earlier and more sustained (to 180 days) responses, greater mean-fold increases, and a higher proportion of "responders" achieving ≥ 4-fold increases over baseline. Although the study was halted before all enrolled subjects received all three doses, the J5dLPS/OMP vaccine, with or without CpG adjuvant, was safe and well-tolerated. The inclusion of CpG increased the number of subjects with a ≥ 4-fold antibody response, evident even after the second of three planned doses. A vaccine comprising J5dLPS/OMP antigen with CpG adjuvant merits further investigation. Clinical

  2. The CpG island searcher: a new WWW resource.

    PubMed

    Takai, Daiya; Jones, Peter A

    2003-01-01

    Clusters of CpG dinucleotides in GC rich regions of the genome called "CpG islands" frequently occur in the 5' ends of genes. Methylation of CpG islands plays a role in transcriptional silencing in higher organisms in certain situations. We have established a CpG-island-extraction algorithm, which we previously developed [Takai and Jones, 2002], on a web site which has a simple user interface to identify CpG islands from submitted sequences of up to 50kb. The web site determines the locations of CpG islands using parameters (lower limit of %GC, ObsCpG/ExpCpG, length) set by the user, to display the value of parameters on each CpG island, and provides a graphical map of CpG dinucleotide distribution and borders of CpG islands. A command-line version of the CpG islands searcher has also been developed for larger sequences. The CpG Island Searcher was applied to the latest sequence and mapping information of human chromosomes 20, 21 and 22, and a total of 2345 CpG islands were extracted and 534 (23%) of them contained first coding exons and 650 (28%) contained other exons. The CpG Island Searcher is available on the World Wide Web at http://www.cpgislands.com or http://www.uscnorris.com/cpgislands/cpg.cgi.

  3. Intracerebral CpG Immunotherapy with Carbon Nanotubes Abrogates Growth of Subcutaneous Melanomas in Mice

    PubMed Central

    Fan, Haitao; Zhang, Ian; Chen, Xuebo; Zhang, Leying; Wang, Huaqing; Fonseca, Anna Da; Manuel, Edwin R.; Diamond, Don J.; Raubitschek, Andrew; Badie, Behnam

    2012-01-01

    Purpose Recently, we showed that intratumoral delivery of low-dose, immunostimulatory CpG oligodeoxynucleotides conjugated with carbon nanotubes (CNT-CpG) was more effective than free CpG and not only eradicated intracranial (i.c.) gliomas, but also induced antitumor immunity that protected mice from subsequent i.c. or systemic tumor rechallenge. Here, we examined if the same “intracerebral immunotherapy” strategy could be applied to the treatment of metastatic brain tumors. Experimental Design Mice with both i.c. and subcutaneous (s.c.) melanomas were injected intratumorally with CNT-CpG into either location. Antitumor responses were assessed by flow cytometry, bioluminescent imaging, and animal survival. Results When given s.c., CNT-CpG response was mostly local, and it only modestly inhibited the growth of i.c. melanomas. However, i.c. CNT-CpG abrogated the growth of not only brain, but also s.c. tumors. Furthermore, compared to s.c. injections, i.c. CNT-CpG elicited a stronger inflammatory response that resulted in more potent antitumor cytotoxicity and improved in vivo trafficking of effector cells into both i.c. and s.c. tumors. To investigate factors that accounted for these observations, CNT-CpG biodistribution and cellular inflammatory responses were examined in both tumor locations. Intracranial melanomas retained the CNT-CpG particles longer and were infiltrated by TLR-9-positive microglia. In contrast, myeloid-derived suppressive cells were more abundant in s.c. tumors. Although depletion of these cells prior to s.c. CNT-CpG therapy enhanced its cytotoxic responses, antitumor responses to brain melanomas were unchanged. Conclusions These findings suggest that intracerebral CNT-CpG immunotherapy is more effective than systemic therapy in generating antitumor responses that target both brain and systemic melanomas. PMID:22904105

  4. Intracerebral CpG immunotherapy with carbon nanotubes abrogates growth of subcutaneous melanomas in mice.

    PubMed

    Fan, Haitao; Zhang, Ian; Chen, Xuebo; Zhang, Leying; Wang, Huaqing; Da Fonseca, Anna; Manuel, Edwin R; Diamond, Don J; Raubitschek, Andrew; Badie, Behnam

    2012-10-15

    Recently, we showed that intratumoral delivery of low-dose, immunostimulatory CpG oligodeoxynucleotides conjugated with carbon nanotubes (CNT-CpG) was more effective than free CpG and not only eradicated intracranial (i.c.) gliomas but also induced antitumor immunity that protected mice from subsequent i.c. or systemic tumor rechallenge. Here, we examined whether the same "intracerebral immunotherapy" strategy could be applied to the treatment of metastatic brain tumors. Mice with both i.c. and s.c. melanomas were injected intratumorally with CNT-CpG into either location. Antitumor responses were assessed by flow cytometry, bioluminescent imaging, and animal survival. When given s.c., CNT-CpG response was mostly local, and it only modestly inhibited the growth of i.c. melanomas. However, i.c. CNT-CpG abrogated the growth of not only brain but also s.c. tumors. Furthermore, compared with s.c. injections, i.c. CNT-CpG elicited a stronger inflammatory response that resulted in more potent antitumor cytotoxicity and improved in vivo trafficking of effector cells into both i.c. and s.c. tumors. To investigate factors that accounted for these observations, CNT-CpG biodistribution and cellular inflammatory responses were examined in both tumor locations. Intracranial melanomas retained the CNT-CpG particles longer and were infiltrated by Toll-like receptor (TLR-9)-positive microglia. In contrast, myeloid-derived suppressive cells were more abundant in s.c. tumors. Although depletion of these cells before s.c. CNT-CpG therapy enhanced its cytotoxic responses, antitumor responses to brain melanomas were unchanged. These findings suggest that intracerebral CNT-CpG immunotherapy is more effective than systemic therapy in generating antitumor responses that target both brain and systemic melanomas. ©2012 AACR

  5. A nebulized gelatin nanoparticle-based CpG formulation is effective in immunotherapy of allergic horses.

    PubMed

    Klier, John; Fuchs, Sebastian; May, Anna; Schillinger, Ulrike; Plank, Christian; Winter, Gerhard; Coester, Conrad; Gehlen, Heidrun

    2012-06-01

    In the recent years, nanotechnology has boosted the development of potential drug delivery systems and material engineering on nanoscale basis in order to increase drug specificity and reduce side effects. A potential delivery system for immunostimulating agents such as cytosine-phosphate-guanine-oligodeoxynucleotides (CpG-ODN) needs to be developed to maximize the efficacy of immunotherapy against hypersensitivity. In this study, an aerosol formulation of biodegradable, biocompatible and nontoxic gelatin nanoparticle-bound CpG-ODN 2216 was used to treat equine recurrent airway obstruction in a clinical study. Bronchoalveolar lavage fluid was obtained from healthy and allergic horses to quantify Th1/Th2 cytokine levels before and after inhalation regimen. Full clinical examinations were performed to evaluate the therapeutic potential of this nebulized gelatin nanoparticle-based CpG formulation. Most remarkable was that regulatory anti-inflammatory and anti-allergic cytokine IL-10 expression was significantly triggered by five consecutive inhalations. Thorough assessment of clinical parameters following nanoparticle treatment indicated a partial remission of the allergic condition. Thus this study, for the first time, showed effectiveness of colloidal nanocarrier-mediated immunotherapy in food-producing animals with potential future applicability to other species including humans.

  6. Induction of anti-glioma NK cell response following multiple low-dose intracerebral CpG therapy

    PubMed Central

    Alizadeh, Darya; Zhang, Leying; Brown, Christine E.; Farrukh, Omar; Jensen, Michael C.; Badie, Behnam

    2010-01-01

    Purpose Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG-ODN) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. These studies, however, have used high doses of CpG-ODN which can induce toxicity in a clinical setting. The goal of this study was to evaluate the anti-tumor efficacy of multiple low-dose intratumoral CpG- ODN in a glioma model. Experimental Design Mice bearing four-day old intracranial GL261 gliomas received a single or multiple (two or four) intratumoral injections of CpG-ODN (3 μg) every 4 days. Tumor growth was measured by bioluminescent imaging, brain histology, and animal survival. Flow cytometry and cytotoxicity assays were used to assess anti-glioma immune response. Results Two and four intracranial injections of low-dose CpG-ODN, but not a single injection, eradicated gliomas in 70% of mice. Moreover, surviving animals exhibited durable tumor free remission (> 3 months), and were protected from intracranial rechallenge with GL21 gliomas, demonstrating the capacity for long-term anti-tumor immunity. Although most inflammatory cells appeared to increase, activated NK cells (i.e. NK+CD107a+) were more frequent than CD8+CD107a+ in the brains of rechallenged CpG-ODN-treated animals and demonstrated a stronger in vitro cytotoxicity against GL261 target cells. Leukocyte depletion studies confirmed that NK cells played an important role in the initial CpG-ODN anti-tumor response, but both CD8 and NK cells were equally important in long-term immunity against gliomas. Conclusions These findings suggest that multiple low-dose intratumoral injections of CpG-ODN can eradicate intracranial gliomas possibly through mechanisms involving NK mediated effector function. PMID:20570924

  7. Antagonism of immunostimulatory CpG-oligodeoxynucleotides by quinacrine, chloroquine, and structurally related compounds.

    PubMed

    Macfarlane, D E; Manzel, L

    1998-02-01

    Phosphorothioate oligodeoxynucleotides containing CpG (CpG-ODN) activate immune responses. We report that quinacrine, chloroquine, and structurally related compounds completely inhibit the antiapoptotic effect of CpG-ODN on WEHI 231 murine B lymphoma cells and inhibit CpG-ODN-induced secretion of IL-6 by WEHI 231. They also inhibit IL-6 synthesis and thymidine uptake by human unfractionated PBMC induced by CpG-ODN. The compounds did not inhibit LPS-induced responses. Half-maximal inhibition required 10 nM quinacrine or 100 nM chloroquine. Inhibition was noncompetitive with respect to CpG-ODN. Quinine, quinidine, and primaquine were much less powerful. Quinacrine was effective even when added after the CpG-ODN. Near-toxic concentrations of ammonia plus bafilomycin A1 (used to inhibit vesicular acidification) did not reduce the efficacy of the quinacrine, but the effects of both quinacrine and chloroquine were enhanced by inhibition of the multidrug resistance efflux pump by verapamil. Agents that bind to DNA, including propidium iodide, Hoechst dye 33258, and coralyne chloride did not inhibit CpG-ODN effect, nor did 4-bromophenacyl bromide, an inhibitor of phospholipase A2. Examination of the structure-activity relationship of seventy 4-aminoquinoline and 9-aminoacridine analogues reveals that increased activity was conferred by bulky hydrophobic substituents on positions 2 and 6 of the quinoline nucleus. No correlation was found between published antimalarial activity and ability to block CpG-ODN-induced effects. These results are discussed in the light of the ability of quinacrine and chloroquine to induce remission of rheumatoid arthritis and lupus erythematosus.

  8. Oligodeoxynucleotides as Anti-Cancer Therapeutics and Diagnostics | NCI Technology Transfer Center | TTC

    Cancer.gov

    The National Cancer Institute Laboratory of Experimental Immunology is seeking statements of capability or interest from parties interested in licensing or collaborative research to further develop, evaluate, or commercialize anti-cancer oligodeoxynucleotides.  

  9. Activation of human B cells by phosphorothioate oligodeoxynucleotides.

    PubMed Central

    Liang, H; Nishioka, Y; Reich, C F; Pisetsky, D S; Lipsky, P E

    1996-01-01

    To investigate the potential of DNA to elicit immune responses in man, we examined the capacity of a variety of oligodeoxynucleotides (ODNs) to stimulate highly purified T cell-depleted human peripheral blood B cells. Among 47 ODNs of various sequences tested, 12 phosphorothioate oligodeoxynucleotides (sODNs) induced marked B cell proliferation and Ig production. IL-2 augmented both proliferation and production of IgM, IgG, and IgA, as well as IgM anti-DNA antibodies, but was not necessary for B cell stimulation. Similarly, T cells enhanced stimulation, but were not necessary for B cell activation. After stimulation with the active sODNs, more than 95% of B cells expressed CD25 and CD86. In addition, B cells stimulated with sODNs expressed all six of the major immunoglobulin VH gene families. These results indicate that the human B cell response to sODN is polyclonal. Active sODN coupled to Sepharose beads stimulated B cells as effectively as the free sODN, suggesting that stimulation resulted from engagement of surface receptors. These data indicate that sODNs can directly induce polyclonal activation of human B cells in a T cell-independent manner by engaging as yet unknown B cell surface receptors. PMID:8787674

  10. CpG PatternFinder: a Windows-based utility program for easy and rapid identification of the CpG methylation status of DNA.

    PubMed

    Xu, Yi-Hua; Manoharan, Herbert T; Pitot, Henry C

    2007-09-01

    The bisulfite genomic sequencing technique is one of the most widely used techniques to study sequence-specific DNA methylation because of its unambiguous ability to reveal DNA methylation status to the order of a single nucleotide. One characteristic feature of the bisulfite genomic sequencing technique is that a number of sample sequence files will be produced from a single DNA sample. The PCR products of bisulfite-treated DNA samples cannot be sequenced directly because they are heterogeneous in nature; therefore they should be cloned into suitable plasmids and then sequenced. This procedure generates an enormous number of sample DNA sequence files as well as adding extra bases belonging to the plasmids to the sequence, which will cause problems in the final sequence comparison. Finding the methylation status for each CpG in each sample sequence is not an easy job. As a result CpG PatternFinder was developed for this purpose. The main functions of the CpG PatternFinder are: (i) to analyze the reference sequence to obtain CpG and non-CpG-C residue position information. (ii) To tailor sample sequence files (delete insertions and mark deletions from the sample sequence files) based on a configuration of ClustalW multiple alignment. (iii) To align sample sequence files with a reference file to obtain bisulfite conversion efficiency and CpG methylation status. And, (iv) to produce graphics, highlighted aligned sequence text and a summary report which can be easily exported to Microsoft Office suite. CpG PatternFinder is designed to operate cooperatively with BioEdit, a freeware on the internet. It can handle up to 100 files of sample DNA sequences simultaneously, and the total CpG pattern analysis process can be finished in minutes. CpG PatternFinder is an ideal software tool for DNA methylation studies to determine the differential methylation pattern in a large number of individuals in a population. Previously we developed the CpG Analyzer program; CpG Pattern

  11. CpG- and LPS-activated MAPK signaling in in vitro cultured salmon (Salmo salar) mononuclear phagocytes.

    PubMed

    Iliev, Dimitar B; Hansen, Tom; Jørgensen, Sven Martin; Krasnov, Aleksei; Jørgensen, Jorunn B

    2013-10-01

    The Mitogen-activated protein kinases (MAPK) are involved in transmitting intracellular signals downstream of diverse cell surface receptors and mediate the response to ligands such as growth factors, hormones and cytokines. In addition, MAPK are critically involved in the innate immune response to pathogen-derived substances, commonly referred to as pathogen-associated molecular patterns (PAMPs), such as bacterial lipopolysaccharide (LPS) and bacterial DNA rich in CpG dinucleotides. Currently, a great deal of knowledge is available about the involvement of MAPK in the innate immune response to PAMPs in mammals; however, little is known about the role of the different MAPK classes in the immune response to PAMPs in lower vertebrates. In the current study, p38 phosphorylation was induced by CpG oligonucleotides (ODNs) and LPS in primary salmon mononuclear phagocytes. Pre-treatment of the cells with a p38 inhibitor (SB203580) blocked the PAMP-induced p38 activity and suppressed the upregulation of most of the CpG- and LPS-induced transcripts highlighting the role of this kinase in the salmon innate immune response to PAMPs. In contrast to p38, the phosphorylation of extracellular signal-regulated kinase (ERK), a MAPK involved primarily in response to mitogens, was high in resting cells and, surprisingly, incubation with both CpG and control ODNs downregulated the phospho-ERK levels independently of p38 activation. The basal phospho-ERK level and the CpG-inducible p38 phosphorylation were greatly influenced by the length of in vitro incubation. The basal phospho-ERK level increased gradually throughout a 5-day culture period and was PI3K-dependent as demonstrated by its sensitivity to Wortmannin suggesting it is influenced by growth factors. Overall these data indicate that both basal and PAMP-induced activity of MAPKs might be greatly influenced by the differentiation status of salmon mononuclear phagocytes. Copyright © 2013. Published by Elsevier Ltd.

  12. A simple method for N-15 labelling of exocyclic amino groups in synthetic oligodeoxynucleotides

    PubMed Central

    Acedo, Montse; Fàbrega, Carme; Aviño, Anna; Goodman, Myron; Fagan, Patricia; Wemmer, David; Eritja, Ramon

    1994-01-01

    The use of the ammonia deprotection step to introduce 15N labels at specific exocyclic amino positions of adenine, cytosine, guanine or 2-aminopurine of oligodeoxynucleotides is described. PMID:8065910

  13. DNA motifs associated with aberrant CpG island methylation.

    PubMed

    Feltus, F Alex; Lee, Eva K; Costello, Joseph F; Plass, Christoph; Vertino, Paula M

    2006-05-01

    Epigenetic silencing involving the aberrant methylation of promoter region CpG islands is widely recognized as a tumor suppressor silencing mechanism in cancer. However, the molecular pathways underlying aberrant DNA methylation remain elusive. Recently we showed that, on a genome-wide level, CpG island loci differ in their intrinsic susceptibility to aberrant methylation and that this susceptibility can be predicted based on underlying sequence context. These data suggest that there are sequence/structural features that contribute to the protection from or susceptibility to aberrant methylation. Here we use motif elicitation coupled with classification techniques to identify DNA sequence motifs that selectively define methylation-prone or methylation-resistant CpG islands. Motifs common to 28 methylation-prone or 47 methylation-resistant CpG island-containing genomic fragments were determined using the MEME and MAST algorithms (). The five most discriminatory motifs derived from methylation-prone sequences were found to be associated with CpG islands in general and were nonrandomly distributed throughout the genome. In contrast, the eight most discriminatory motifs derived from the methylation-resistant CpG islands were randomly distributed throughout the genome. Interestingly, this latter group tended to associate with Alu and other repetitive sequences. Used together, the frequency of occurrence of these motifs successfully discriminated methylation-prone and methylation-resistant CpG island groups with an accuracy of 87% after 10-fold cross-validation. The motifs identified here are candidate methylation-targeting or methylation-protection DNA sequences.

  14. CpG island methylator phenotype in colorectal cancer

    PubMed Central

    Toyota, Minoru; Ahuja, Nita; Ohe-Toyota, Mutsumi; Herman, James G.; Baylin, Stephen B.; Issa, Jean-Pierre J.

    1999-01-01

    Aberrant methylation of promoter region CpG islands is associated with transcriptional inactivation of tumor-suppressor genes in neoplasia. To understand global patterns of CpG island methylation in colorectal cancer, we have used a recently developed technique called methylated CpG island amplification to examine 30 newly cloned differentially methylated DNA sequences. Of these 30 clones, 19 (63%) were progressively methylated in an age-dependent manner in normal colon, 7 (23%) were methylated in a cancer-specific manner, and 4 (13%) were methylated only in cell lines. Thus, a majority of CpG islands methylated in colon cancer are also methylated in a subset of normal colonic cells during the process of aging. In contrast, methylation of the cancer-specific clones was found exclusively in a subset of colorectal cancers, which appear to display a CpG island methylator phenotype (CIMP). CIMP+ tumors also have a high incidence of p16 and THBS1 methylation, and they include the majority of sporadic colorectal cancers with microsatellite instability related to hMLH1 methylation. We thus define a pathway in colorectal cancer that appears to be responsible for the majority of sporadic tumors with mismatch repair deficiency. PMID:10411935

  15. Effect of amino groups of mesoporous silica nanoparticles on CpG oligodexynucleotide delivery

    NASA Astrophysics Data System (ADS)

    Xu, Yi; Claiden, Peter; Zhu, Yufang; Morita, Hiromi; Hanagata, Nobutaka

    2015-08-01

    In this study, we proposed to modify mesoporous silica nanoparticles (MSNs) with 3-aminopropyltriethoxysilane (NH2-TES), aminoethylaminopropyltriethoxysilane (2NH2-TES) and 3-[2-(2-aminoethylamino)ethylamino] propyl-trimethoxysilane (3NH2-TES) for binding of cytosine-phosphate-guanosine oligodexynucleotides (CpG ODN), and investigated the effect of different amino groups of MSNs on the CpG ODN delivery. Serum stability, in vitro cytotoxicity, and cytokine interleukin-6 (IL-6) induction by MSN-NH2/CpG, MSN-2NH2/CpG and MSN-3NH2/CpG complexes were investigated in detail. The results showed that three kinds of aminated-MSN-based CpG ODN delivery systems had no cytotoxicity to RAW264.7 cells, and binding of CpG ODN to MSN-NH2, MSN-2NH2 and MSN-3NH2 nanoparticles enhanced the serum stability of CpG ODN due to protection by the nanoparticles. However, three aminated MSN-based CpG ODN delivery systems exhibited different CpG ODN delivery efficiency, and MSN-NH2/CpG complexes had the highest ability to induce IL-6 secretion.

  16. Evaluation of novel adjuvant Eimeria profilin complex on intestinal host immune responses against live E. acervulina challenge infection

    USDA-ARS?s Scientific Manuscript database

    The effects of two novel adjuvants, QCDC (Quil A/cholesterol/DDA/Carbopol) and QCDCRT (QCDC/Bay R1005/cytosine-phosphate-guanosine oligodeoxynucleotides, CpG) emulsified with profilin, a conserved Eimeria recombinant protein, against avian coccidiosis were determined in broiler chickens. Chickens we...

  17. The Antimalarial Artemisinin Synergizes with Antibiotics To Protect against Lethal Live Escherichia coli Challenge by Decreasing Proinflammatory Cytokine Release

    PubMed Central

    Wang, Jun; Zhou, Hong; Zheng, Jiang; Cheng, Juan; Liu, Wei; Ding, Guofu; Wang, Liangxi; Luo, Ping; Lu, Yongling; Cao, Hongwei; Yu, Shuangjiang; Li, Bin; Zhang, Lezhi

    2006-01-01

    In the present study artemisinin (ART) was found to have potent anti-inflammatory effects in animal models of sepsis induced by CpG-containing oligodeoxy-nucleotides (CpG ODN), lipopolysaccharide (LPS), heat-killed Escherichia coli 35218 or live E. coli. Furthermore, we found that ART protected mice from a lethal challenge by CpG ODN, LPS, or heat-killed E. coli in a dose-dependent manner and that the protection was related to a reduction in serum tumor necrosis factor alpha (TNF-α). More significantly, the administration of ART together with ampicillin or unasyn (a complex of ampicillin and sulbactam) decreased mortality from 100 to 66.7% or 33.3%, respectively, in mice subjected to a lethal live E. coli challenge. Together with the observation that ART alone does not inhibit bacterial growth, this result suggests that ART protection is achieved as a result of its anti-inflammatory activity rather than an antimicrobial effect. In RAW264.7 cells, pretreatment with ART potently inhibited TNF-α and interleukin-6 release induced by CpG ODN, LPS, or heat-killed E. coli in a dose- and time-dependent manner. Experiments utilizing affinity sensor technology revealed no direct binding of ART with CpG ODN or LPS. Flow cytometry further showed that ART did not alter binding of CpG ODN to cell surfaces or the internalization of CpG ODN. In addition, upregulated levels of TLR9 and TLR4 mRNA were not attenuated by ART treatment. ART treatment did, however, block the NF-κB activation induced by CpG ODN, LPS, or heat-killed E. coli. These findings provide compelling evidence that ART may be an important potential drug for sepsis treatment. PMID:16801421

  18. In ovo CpG DNA delivery increases innate and adaptive immune cells in respiratory, gastrointestinal and immune systems post-hatch correlating with lower infectious laryngotracheitis virus infection.

    PubMed

    Abdul-Cader, Mohamed Sarjoon; Amarasinghe, Aruna; Palomino-Tapia, Victor; Ahmed-Hassan, Hanaa; Bakhtawar, Khawaja; Nagy, Eva; Sharif, Shayan; Gomis, Susantha; Abdul-Careem, Mohamed Faizal

    2018-01-01

    Cytosine-guanosine deoxynucleotides (CpG) DNA can be delivered in ovo at embryo day (ED)18 for the stimulation of toll-like receptor (TLR)21 signaling pathway that ultimately protects chickens against a number of bacterial and viral infections. There is a dearth of information understanding the mechanisms of protection induced by in ovo delivered CpG DNA. The objective of this study was to determine the immune cell changes post-hatch following in ovo delivery of the TLR21 ligand, CpG DNA. In order to quantify changes of percentage of KUL01+, IgM+ B, cluster of differentiation (CD)4+ and CD8α+ cells, trachea, lung, duodenum, large intestine, spleen and bursa of Fabricius were collected on day 1 post-hatch. We found increased recruitments of KUL01+ cells, in organs of these body systems post-hatch following in ovo delivery of CpG DNA. Although IgM+ B cells, CD4+ and CD8α+ cells were increased in lungs and immune system organs, these cells were not quantifiable from the trachea, duodenum and large intestine immediately following the hatch. Furthermore, when CpG DNA is delivered in ovo and subsequently infected with infectious laryngotracheitis virus (ILTV) post-hatch on day 1, CpG DNA reduces morbidity and mortality resulting from ILTV infection. This study provides insights into the mechanisms of host responses elicited following in ovo delivery of CpG DNA in avian species.

  19. Nuclear translocation of Acinetobacter baumannii transposase induces DNA methylation of CpG regions in the promoters of E-cadherin gene.

    PubMed

    Moon, Dong Chan; Choi, Chul Hee; Lee, Su Man; Lee, Jung Hwa; Kim, Seung Il; Kim, Dong Sun; Lee, Je Chul

    2012-01-01

    Nuclear targeting of bacterial proteins has emerged as a pathogenic mechanism whereby bacterial proteins induce host cell pathology. In this study, we examined nuclear targeting of Acinetobacter baumannii transposase (Tnp) and subsequent epigenetic changes in host cells. Tnp of A. baumannii ATCC 17978 possesses nuclear localization signals (NLSs), (225)RKRKRK(230). Transient expression of A. baumannii Tnp fused with green fluorescent protein (GFP) resulted in the nuclear localization of these proteins in COS-7 cells, whereas the truncated Tnp without NLSs fused with GFP were exclusively localized in the cytoplasm. A. baumannii Tnp was found in outer membrane vesicles, which delivered this protein to the nucleus of host cells. Nuclear expression of A. baumannii Tnp fused with GFP in A549 cells induced DNA methylation of CpG regions in the promoters of E-cadherin (CDH1) gene, whereas the cytoplasmic localization of the truncated Tnp without NLSs fused with GFP did not induce DNA methylation. DNA methylation in the promoters of E-cadherin gene induced by nuclear targeting of A. baumannii Tnp resulted in down-regulation of gene expression. In conclusion, our data show that nuclear traffic of A. baumannii Tnp induces DNA methylation of CpG regions in the promoters of E-cadherin gene, which subsequently down-regulates gene expression. This study provides a new insight into the epigenetic control of host genes by bacterial proteins.

  20. Synthetic Oligodeoxynucleotides (ODN) Containing Suppressive TTAGGG Motifs Inhibit AIM2 Inflammasome Activation

    PubMed Central

    Kaminski, John J.; Schattgen, Stefan A.; Tzeng, Te-Chen; Bode, Christian; Klinman, Dennis M.; Fitzgerald, Katherine A.

    2013-01-01

    Synthetic oligodeoxynucleotides comprised of the immunosuppressive motif TTAGGG block TLR9 signaling, prevent STAT1 and STAT4 phosphorylation and attenuate a variety of inflammatory responses in vivo. Here, we demonstrate that such suppressive oligodeoxynucleotides (sup ODN) abrogate activation of cytosolic nucleic acid sensing pathways. Pretreatment of dendritic cells and macrophages with the suppressive ODN-A151 abrogated type I IFN, TNFα and ISG induction in response to cytosolic dsDNA. In addition, A151 abrogated caspase-1-dependent IL-1β and IL-18 maturation in dendritic cells stimulated with dsDNA and murine cytomegalovirus (MCMV). Inhibition was dependent on A151’s phosphorothioate backbone while substitution of the guanosine residues for adenosine negatively affected potency. A151 mediates these effects by binding to AIM2 in a manner that is competitive with immune-stimulatory DNA and as a consequence prevents AIM2 inflammasome complex formation. Collectively, these findings reveal a new route by which suppressive ODNs modulate the immune system and unveil novel applications for suppressive ODNs in the treatment of infectious and autoimmune diseases. PMID:23986531

  1. CpG Distribution and Methylation Pattern in Porcine Parvovirus

    PubMed Central

    Tóth, Renáta; Mészáros, István; Stefancsik, Rajmund; Bartha, Dániel; Bálint, Ádám; Zádori, Zoltán

    2013-01-01

    Based on GC content and the observed/expected CpG ratio (oCpGr), we found three major groups among the members of subfamily Parvovirinae: Group I parvoviruses with low GC content and low oCpGr values, Group II with low GC content and high oCpGr values and Group III with high GC content and high oCpGr values. Porcine parvovirus belongs to Group I and it features an ascendant CpG distribution by position in its coding regions similarly to the majority of the parvoviruses. The entire PPV genome remains hypomethylated during the viral lifecycle independently from the tissue of origin. In vitro CpG methylation of the genome has a modest inhibitory effect on PPV replication. The in vitro hypermethylation disappears from the replicating PPV genome suggesting that beside the maintenance DNMT1 the de novo DNMT3a and DNMT3b DNA methyltransferases can’t methylate replicating PPV DNA effectively either, despite that the PPV infection does not seem to influence the expression, translation or localization of the DNA methylases. SNP analysis revealed high mutability of the CpG sites in the PPV genome, while introduction of 29 extra CpG sites into the genome has no significant biological effects on PPV replication in vitro. These experiments raise the possibility that beyond natural selection mutational pressure may also significantly contribute to the low level of the CpG sites in the PPV genome. PMID:24392033

  2. Nucleosome dynamics and maintenance of epigenetic states of CpG islands

    NASA Astrophysics Data System (ADS)

    Sneppen, Kim; Dodd, Ian B.

    2016-06-01

    Methylation of mammalian DNA occurs primarily at CG dinucleotides. These CpG sites are located nonrandomly in the genome, tending to occur within high density clusters of CpGs (islands) or within large regions of low CpG density. Cluster methylation tends to be bimodal, being dominantly unmethylated or mostly methylated. For CpG clusters near promoters, low methylation is associated with transcriptional activity, while high methylation is associated with gene silencing. Alternative CpG methylation states are thought to be stable and heritable, conferring localized epigenetic memory that allows transient signals to create long-lived gene expression states. Positive feedback where methylated CpG sites recruit enzymes that methylate nearby CpGs, can produce heritable bistability but does not easily explain that as clusters increase in size or density they change from being primarily methylated to primarily unmethylated. Here, we show that an interaction between the methylation state of a cluster and its occupancy by nucleosomes provides a mechanism to generate these features and explain genome wide systematics of CpG islands.

  3. Direct production of mouse disease models by embryo microinjection of TALENs and oligodeoxynucleotides

    PubMed Central

    Wefers, Benedikt; Meyer, Melanie; Ortiz, Oskar; Hrabé de Angelis, Martin; Hansen, Jens; Wurst, Wolfgang; Kühn, Ralf

    2013-01-01

    The study of genetic disease mechanisms relies mostly on targeted mouse mutants that are derived from engineered embryonic stem (ES) cells. Nevertheless, the establishment of mutant ES cells is laborious and time-consuming, restricting the study of the increasing number of human disease mutations discovered by high-throughput genomic analysis. Here, we present an advanced approach for the production of mouse disease models by microinjection of transcription activator-like effector nucleases (TALENs) and synthetic oligodeoxynucleotides into one-cell embryos. Within 2 d of embryo injection, we created and corrected chocolate missense mutations in the small GTPase RAB38; a regulator of intracellular vesicle trafficking and phenotypic model of Hermansky-Pudlak syndrome. Because ES cell cultures and targeting vectors are not required, this technology enables instant germline modifications, making heterozygous mutants available within 18 wk. The key features of direct mutagenesis by TALENs and oligodeoxynucleotides, minimal effort and high speed, catalyze the generation of future in vivo models for the study of human disease mechanisms and interventions. PMID:23426636

  4. Comprehensive analysis of CpG islands in human chromosomes 21 and 22

    NASA Astrophysics Data System (ADS)

    Takai, Daiya; Jones, Peter A.

    2002-03-01

    CpG islands are useful markers for genes in organisms containing 5-methylcytosine in their genomes. In addition, CpG islands located in the promoter regions of genes can play important roles in gene silencing during processes such as X-chromosome inactivation, imprinting, and silencing of intragenomic parasites. The generally accepted definition of what constitutes a CpG island was proposed in 1987 by Gardiner-Garden and Frommer [Gardiner-Garden, M. & Frommer, M. (1987) J. Mol. Biol. 196, 261-282] as being a 200-bp stretch of DNA with a C+G content of 50% and an observed CpG/expected CpG in excess of 0.6. Any definition of a CpG island is somewhat arbitrary, and this one, which was derived before the sequencing of mammalian genomes, will include many sequences that are not necessarily associated with controlling regions of genes but rather are associated with intragenomic parasites. We have therefore used the complete genomic sequences of human chromosomes 21 and 22 to examine the properties of CpG islands in different sequence classes by using a search algorithm that we have developed. Regions of DNA of greater than 500 bp with a G+C equal to or greater than 55% and observed CpG/expected CpG of 0.65 were more likely to be associated with the 5' regions of genes and this definition excluded most Alu-repetitive elements. We also used genome sequences to show strong CpG suppression in the human genome and slight suppression in Drosophila melanogaster and Saccharomyces cerevisiae. This finding is compatible with the recent detection of 5-methylcytosine in Drosophila, and might suggest that S. cerevisiae has, or once had, CpG methylation.

  5. A Hybrid Approach for CpG Island Detection in the Human Genome.

    PubMed

    Yang, Cheng-Hong; Lin, Yu-Da; Chiang, Yi-Cheng; Chuang, Li-Yeh

    2016-01-01

    CpG islands have been demonstrated to influence local chromatin structures and simplify the regulation of gene activity. However, the accurate and rapid determination of CpG islands for whole DNA sequences remains experimentally and computationally challenging. A novel procedure is proposed to detect CpG islands by combining clustering technology with the sliding-window method (PSO-based). Clustering technology is used to detect the locations of all possible CpG islands and process the data, thus effectively obviating the need for the extensive and unnecessary processing of DNA fragments, and thus improving the efficiency of sliding-window based particle swarm optimization (PSO) search. This proposed approach, named ClusterPSO, provides versatile and highly-sensitive detection of CpG islands in the human genome. In addition, the detection efficiency of ClusterPSO is compared with eight CpG island detection methods in the human genome. Comparison of the detection efficiency for the CpG islands in human genome, including sensitivity, specificity, accuracy, performance coefficient (PC), and correlation coefficient (CC), ClusterPSO revealed superior detection ability among all of the test methods. Moreover, the combination of clustering technology and PSO method can successfully overcome their respective drawbacks while maintaining their advantages. Thus, clustering technology could be hybridized with the optimization algorithm method to optimize CpG island detection. The prediction accuracy of ClusterPSO was quite high, indicating the combination of CpGcluster and PSO has several advantages over CpGcluster and PSO alone. In addition, ClusterPSO significantly reduced implementation time.

  6. Depletion of CpG Dinucleotides in Papillomaviruses and Polyomaviruses: A Role for Divergent Evolutionary Pressures.

    PubMed

    Upadhyay, Mohita; Vivekanandan, Perumal

    2015-01-01

    Papillomaviruses and polyomaviruses are small ds-DNA viruses infecting a wide-range of vertebrate hosts. Evidence supporting co-evolution of the virus with the host does not fully explain the evolutionary path of papillomaviruses and polyomaviruses. Studies analyzing CpG dinucleotide frequencies in virus genomes have provided interesting insights on virus evolution. CpG dinucleotide depletion has not been extensively studied among papillomaviruses and polyomaviruses. We sought to analyze the relative abundance of dinucleotides and the relative roles of evolutionary pressures in papillomaviruses and polyomaviruses. We studied 127 full-length sequences from papillomaviruses and 56 full-length sequences from polyomaviruses. We analyzed the relative abundance of dinucleotides, effective codon number (ENC), differences in synonymous codon usage. We examined the association, if any, between the extent of CpG dinucleotide depletion and the evolutionary lineage of the infected host. We also investigated the contribution of mutational pressure and translational selection to the evolution of papillomaviruses and polyomaviruses. All papillomaviruses and polyomaviruses are CpG depleted. Interestingly, the evolutionary lineage of the infected host determines the extent of CpG depletion among papillomaviruses and polyomaviruses. CpG dinucleotide depletion was more pronounced among papillomaviruses and polyomaviruses infecting human and other mammals as compared to those infecting birds. Our findings demonstrate that CpG depletion among papillomaviruses is linked to mutational pressure; while CpG depletion among polyomaviruses is linked to translational selection. We also present evidence that suggests methylation of CpG dinucleotides may explain, at least in part, the depletion of CpG dinucleotides among papillomaviruses but not polyomaviruses. The extent of CpG depletion among papillomaviruses and polyomaviruses is linked to the evolutionary lineage of the infected host. Our

  7. Stimulation of Chronic Lymphocytic Leukemia (CLL) Cells with CpG Oligodeoxynucleotide (ODN) Gives Consistent Karyotypic Results among Laboratories: a CLL Research Consortium (CRC)h Study

    PubMed Central

    Heerema, Nyla A.; Byrd, John C.; Cin, Paola Dal; Dell’ Aquila, Marie L.; Koduru, Prasad; Aviram, Ayala; Smoley, Stephanie; Rassenti, Laura Z.; Greaves, Andrew W.; Brown, Jennifer R.; Rai, Kanti R.; Kipps, Thomas J.; Kay, Neil E.; van Dyke, Daniel

    2010-01-01

    Cytogenetic abnormalities in CLL are important prognostic indicators. Historically, only interphase cytogenetics was clinically useful in CLL because traditional mitogens are not effective mitotic stimulants. Recently, CpG-oligodeoxynucleotide (ODN) stimulation has shown effectiveness in CLL. The CLL Research Consortium (CRC) tested the effectiveness and reproducibility of CpG-ODN stimulation to detect chromosomally abnormal clones by five laboratories. More clonal abnormalities were observed after culture of CLL cells with CpG-ODN than with pokeweed mitogen (PWM)+12-O-tetradecanoyl-phorobol-13-acetate (TPA). All clonal abnormalities in PWM+TPA cultures were observed in CpG-ODN cultures, whereas CpG-ODN identified some clones not found by PWM+TPA. CpG-ODN stimulation of one normal control and 12 CLL samples showed that excepting clones of del(13q) in low frequencies and one translocation, results in all five laboratories were consistent, and all abnormalities were concordant with FISH. Thus, abnormal clones in CLL are more readily detected with CpG-ODN stimulation than with traditional B-cell mitogens. After CpG-ODN stimulation, abnormalities were reproducible among cytogenetic laboratories. CpG-ODN did not appear to induce aberrations in cell culture and enhanced detection of abnormalities and complexity in CLL. Since karyotypic complexity is prognostic and is not detectable by standard FISH analyses, stimulation with CpG-ODN is useful to identify this additional prognostic factor in CLL. PMID:21156225

  8. Survival of Mice with Gastrointestinal Acute Radiation Syndrome through Control of Bacterial Translocation.

    PubMed

    Suzuki, Fujio; Loucas, Bradford D; Ito, Ichiaki; Asai, Akira; Suzuki, Sumihiro; Kobayashi, Makiko

    2018-07-01

    Macrophages (Mϕ) with the M2b phenotype (Pheno2b-Mϕ) in bacterial translocation sites have been described as cells responsible for the increased susceptibility of mice with gastrointestinal acute radiation syndrome to sepsis caused by gut bacteria. In this study, we tried to reduce the mortality of mice exposed to 7-10 Gy of gamma rays by controlling Pheno2b-Mϕ polarization in bacterial translocation sites. MicroRNA-222 was induced in association with gamma irradiation. Pheno2b-Mϕ polarization was promoted and maintained in gamma-irradiated mice through the reduction of a long noncoding RNA growth arrest-specific transcript 5 (a CCL1 gene silencer) influenced by this microRNA. Therefore, the host resistance of 7-9-Gy gamma-irradiated mice to sepsis caused by bacterial translocation was improved after treatment with CCL1 antisense oligodeoxynucleotide. However, the mortality of 10-Gy gamma-irradiated mice was not alleviated by this treatment. The crypts and villi in the ileum of 10-Gy gamma-irradiated mice were severely damaged, but these were markedly improved after transplantation of intestinal lineage cells differentiated from murine embryonic stem cells. All 10-Gy gamma-irradiated mice given both of the oligodeoxynucleotide and intestinal lineage cells survived, whereas all of the same mice given either of them died. These results indicate that high mortality rates of mice irradiated with 7-10 Gy of gamma rays are reducible by depleting CCL1 in combination with the intestinal lineage cell transplantation. These findings support the novel therapeutic possibility of victims who have gastrointestinal acute radiation syndrome for the reduction of their high mortality rates. Copyright © 2018 by The American Association of Immunologists, Inc.

  9. CpG Dinucleotide Frequencies Reveal the Role of Host Methylation Capabilities in Parvovirus Evolution

    PubMed Central

    Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James

    2013-01-01

    Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to “fractional” methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses. PMID:24109231

  10. CpG dinucleotide frequencies reveal the role of host methylation capabilities in parvovirus evolution.

    PubMed

    Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James; Vivekanandan, Perumal

    2013-12-01

    Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to "fractional" methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses.

  11. Topical CpG enhances the response of murine malignant melanoma to dacarbazine.

    PubMed

    Najar, Hossain M; Dutz, Jan P

    2008-09-01

    Malignant melanoma is a potentially fatal skin cancer that is increasing in incidence. Standard chemoimmunotherapy consisting of dacarbazine (DTIC) given with IFN-alpha has had disappointing results. We describe a chemoimmunotherapy protocol for cutaneous melanoma that combines the administration of DTIC with the topical application of CpG oligodinucleotide (ODN). Subcutaneous B16 melanoma tumors in C57BL/6 mice were treated with intraperitoneal injections of DTIC followed by the topical application of CpG-ODN over the tumors. This therapeutic approach abrogated the growth of established tumors and significantly enhanced survival. Topical CpG application was more effective than intratumoral CpG. Cell depletion studies indicated that the antitumor effect was dependent on both CD4(+) and CD8(+) cells but not on natural killer (NK) cells. Tumor-specific cytotoxic T-lymphocyte activity was generated in treated animals and was highest in topically treated animals. Immunohistochemical analysis revealed that DTIC, but not CpG, enhanced tumor cell apoptosis. Further, topical CpG induced an expansion of a B220(+)CD8(+) subset of dendritic cells and a subset of NK1.1(+) CD11c(+) cells within the tumors. By enhancing both tumor cell death and local immune activation, DTIC/topical CpG chemoimmunotherapy induced an effective T-cell-dependent host-immune response against melanoma.

  12. Prediction of CpG-island function: CpG clustering vs. sliding-window methods

    PubMed Central

    2010-01-01

    Background Unmethylated stretches of CpG dinucleotides (CpG islands) are an outstanding property of mammal genomes. Conventionally, these regions are detected by sliding window approaches using %G + C, CpG observed/expected ratio and length thresholds as main parameters. Recently, clustering methods directly detect clusters of CpG dinucleotides as a statistical property of the genome sequence. Results We compare sliding-window to clustering (i.e. CpGcluster) predictions by applying new ways to detect putative functionality of CpG islands. Analyzing the co-localization with several genomic regions as a function of window size vs. statistical significance (p-value), CpGcluster shows a higher overlap with promoter regions and highly conserved elements, at the same time showing less overlap with Alu retrotransposons. The major difference in the prediction was found for short islands (CpG islets), often exclusively predicted by CpGcluster. Many of these islets seem to be functional, as they are unmethylated, highly conserved and/or located within the promoter region. Finally, we show that window-based islands can spuriously overlap several, differentially regulated promoters as well as different methylation domains, which might indicate a wrong merge of several CpG islands into a single, very long island. The shorter CpGcluster islands seem to be much more specific when concerning the overlap with alternative transcription start sites or the detection of homogenous methylation domains. Conclusions The main difference between sliding-window approaches and clustering methods is the length of the predicted islands. Short islands, often differentially methylated, are almost exclusively predicted by CpGcluster. This suggests that CpGcluster may be the algorithm of choice to explore the function of these short, but putatively functional CpG islands. PMID:20500903

  13. Oligodeoxynucleotide Probes for Detecting Intact Cells

    NASA Technical Reports Server (NTRS)

    Rosson, Reinhardt A.; Maurina-Brunker, Julie; Langley, Kim; Pynnonen, Christine M.

    2004-01-01

    A rapid, sensitive test using chemiluminescent oligodeoxynucleotide probes has been developed for detecting, identifying, and enumerating intact cells. The test is intended especially for use in detecting and enumerating bacteria and yeasts in potable water. As in related tests that have been developed recently for similar purposes, the oligodeoxynucleotide probes used in this test are typically targeted at either singlecopy deoxyribonucleic acid (DNA) genes (such as virulence genes) or the multiple copies (10,000 to 50,000 copies per cell) of 16S ribosomal ribonucleic acids (rRNAs). Some of those tests involve radioisotope or fluorescent labeling of the probes for reporting hybridization of probes to target nucleic acids. Others of those tests involve labeling with enzymes plus the use of chemiluminescent or chromogenic substrates to report hybridization via color or the emission of light, respectively. The present test is of the last-mentioned type. The chemiluminescence in the present test can be detected easily with relatively simple instrumentation. In developing the present test, the hybridization approach was chosen because hybridization techniques are very specific. Hybridization detects stable, inheritable genetic targets within microorganisms. These targets are not dependent on products of gene expression that can vary with growth conditions or physiological states of organisms in test samples. Therefore, unique probes can be designed to detect and identify specific genera or species of bacteria or yeast (in terms of rRNA target sequences) or can be designed to detect and identify virulence genes (genomic target sequences). Because of the inherent specificity of this system, there are few problems of cross-reactivity. Hybridization tests are rapid, but hybridization tests now available commercially lack sensitivity; typically, between 10(exp 6) and 10(exp 7) cells of the target organism are needed to ensure a reliable test. Consequently, the numbers of

  14. Sensitization of B-cell chronic lymphocytic leukemia cells to recombinant immunotoxin by immunostimulatory phosphorothioate oligodeoxynucleotides.

    PubMed

    Decker, Thomas; Hipp, Susanne; Kreitman, Robert J; Pastan, Ira; Peschel, Christian; Licht, Thomas

    2002-02-15

    A recombinant anti-CD25 immunotoxin, LMB-2, has shown clinical efficacy in hairy cell leukemia and T-cell neoplasms. Its activity in B-cell chronic lymphocytic leukemia (B-CLL) is inferior but might be improved if B-CLL cells expressed higher numbers of CD25 binding sites. It was recently reported that DSP30, a phosphorothioate CpG-oligodeoxynucleotide (CpG-ODN) induces immunogenicity of B-CLL cells by up-regulation of CD25 and other antigens. The present study investigated the antitumor activity of LMB-2 in the presence of DSP30. To this end, B-CLL cells from peripheral blood of patients were isolated immunomagnetically to more than 98% purity. Incubation with DSP30 for 48 hours augmented CD25 expression in 14 of 15 B-CLL samples, as assessed by flow cytometry. DSP30 increased LMB-2 cytotoxicity dose dependently whereas a control ODN with no CpG motif did not. LMB-2 displayed no antitumor cell activity in the absence of CpG-ODN as determined colorimetrically with an (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) assay. In contrast, B-CLL growth was inhibited in 12 of 13 samples with 50% inhibition concentrations (IC(50)) in the range of LMB-2 plasma levels achieved in clinical studies. Two samples were not evaluable because of spontaneous B-CLL cell death in the presence of DSP30. Control experiments with an immunotoxin that does not recognize hematopoietic cells, and an anti-CD22 immunotoxin, confirmed that sensitization to LMB-2 was specifically due to up-regulation of CD25. LMB-2 was much less toxic to normal B and T lymphocytes compared with B-CLL cells. In summary, immunostimulatory CpG-ODNs efficiently sensitize B-CLL cells to a recombinant immunotoxin by modulation of its target. This new treatment strategy deserves further attention.

  15. A Simple Procedure for Constructing 5'-Amino-Terminated Oligodeoxynucleotides in Aqueous Solution

    NASA Technical Reports Server (NTRS)

    Bruick, Richard K.; Koppitz, Marcus; Joyce, Gerald F.; Orgel, Leslie E.

    1997-01-01

    A rapid method for the synthesis of oligodeoxynucleotides (ODNs) terminated by 5'-amino-5'-deoxythymidine is described. A 3'-phosphorylated ODN (the donor) is incubated in aqueous solution with 5'-amino- 5'-deoxythymidine in the presence of N-(3-dimethylaminopropyl)-)N'-ethylcarbodiimide hydrochloride (EDC), extending the donor by one residue via a phosphoramidate bond. Template- directed ligation of the extended donor and an acceptor ODN, followed by acid hydrolysis, yields the acceptor ODN extended by a single 5'-amino-5'-deoxythymidine residue at its 5'terminus.

  16. GaussianCpG: a Gaussian model for detection of CpG island in human genome sequences.

    PubMed

    Yu, Ning; Guo, Xuan; Zelikovsky, Alexander; Pan, Yi

    2017-05-24

    As crucial markers in identifying biological elements and processes in mammalian genomes, CpG islands (CGI) play important roles in DNA methylation, gene regulation, epigenetic inheritance, gene mutation, chromosome inactivation and nuclesome retention. The generally accepted criteria of CGI rely on: (a) %G+C content is ≥ 50%, (b) the ratio of the observed CpG content and the expected CpG content is ≥ 0.6, and (c) the general length of CGI is greater than 200 nucleotides. Most existing computational methods for the prediction of CpG island are programmed on these rules. However, many experimentally verified CpG islands deviate from these artificial criteria. Experiments indicate that in many cases %G+C is < 50%, CpG obs /CpG exp varies, and the length of CGI ranges from eight nucleotides to a few thousand of nucleotides. It implies that CGI detection is not just a straightly statistical task and some unrevealed rules probably are hidden. A novel Gaussian model, GaussianCpG, is developed for detection of CpG islands on human genome. We analyze the energy distribution over genomic primary structure for each CpG site and adopt the parameters from statistics of Human genome. The evaluation results show that the new model can predict CpG islands efficiently by balancing both sensitivity and specificity over known human CGI data sets. Compared with other models, GaussianCpG can achieve better performance in CGI detection. Our Gaussian model aims to simplify the complex interaction between nucleotides. The model is computed not by the linear statistical method but by the Gaussian energy distribution and accumulation. The parameters of Gaussian function are not arbitrarily designated but deliberately chosen by optimizing the biological statistics. By using the pseudopotential analysis on CpG islands, the novel model is validated on both the real and artificial data sets.

  17. CpG islands: algorithms and applications in methylation studies.

    PubMed

    Zhao, Zhongming; Han, Leng

    2009-05-15

    Methylation occurs frequently at 5'-cytosine of the CpG dinucleotides in vertebrate genomes; however, this epigenetic feature is rarely observed in CpG islands (CGIs) or CpG clusters in the promoter regions of genes. Aberrant methylation of the promoter-associated CGIs might influence gene expression and cause carcinogenesis. Because of the functional importance, multiple algorithms have been available for identifying CGIs in a genome or a sequence. They can be categorized into the traditional algorithms (e.g., Gardiner-Garden and Frommer (1987), Takai and Jones (2002), and CpGPRoD (2002)) or statistical property based algorithms (CpGcluster (2006) and CG cluster (2007)). We reviewed the features of these algorithms and evaluated their performance on identifying functional CGIs using genome-wide methylation data. Moreover, identification of CGIs is an initial step in many recent studies for predicting methylation status as well as in the design of methylation detection platforms. We reviewed the benchmarks and features used in these studies.

  18. Effect of CpG dinucleotides within IgH switch region repeats on immunoglobulin class switch recombination.

    PubMed

    Zhang, Zheng Z; Hsieh, Chih-Lin; Okitsu, Cindy Yen; Han, Li; Yu, Kefei; Lieber, Michael R

    2015-08-01

    Immunoglobulin (Ig) heavy chains undergo class switch recombination (CSR) to change the heavy chain isotype from IgM to IgG, A or E. The switch regions are several kilobases long, repetitive, and G-rich on the nontemplate strand. They are also relatively depleted of CpG (also called CG) sites for unknown reasons. Here we use synthetic switch regions at the IgH switch alpha (Sα) locus to test the effect of CpG sites and to try to understand why the IgH switch sequences evolved to be relatively depleted of CpG. We find that even just two CpG sites within an 80 bp synthetic switch repeat iterated 15 times (total switch region length of 1200 bp containing 30 CpG sites) are sufficient to dramatically reduce both Ig CSR and transcription through the switch region from the upstream Iα sterile transcript promoter, which is the promoter that directs transcripts through the Sα region. De novo DNA methylation occurs at the four CpG sites in and around the Iα promoter when each 80 bp Iα switch repeat contains the two CpG sites. Thus, a relatively low density of CpG sites within the switch repeats can induce upstream CpG methylation at the IgH alpha locus, and cause a substantial decrease in transcription from the sterile transcript promoter. This effect is likely the reason that switch regions evolved to contain very few CpG sites. We discuss these findings as they relate to DNA methylation and to Ig CSR. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Compositional searching of CpG islands in the human genome

    NASA Astrophysics Data System (ADS)

    Luque-Escamilla, Pedro Luis; Martínez-Aroza, José; Oliver, José L.; Gómez-Lopera, Juan Francisco; Román-Roldán, Ramón

    2005-06-01

    We report on an entropic edge detector based on the local calculation of the Jensen-Shannon divergence with application to the search for CpG islands. CpG islands are pieces of the genome related to gene expression and cell differentiation, and thus to cancer formation. Searching for these CpG islands is a major task in genetics and bioinformatics. Some algorithms have been proposed in the literature, based on moving statistics in a sliding window, but its size may greatly influence the results. The local use of Jensen-Shannon divergence is a completely different strategy: the nucleotide composition inside the islands is different from that in their environment, so a statistical distance—the Jensen-Shannon divergence—between the composition of two adjacent windows may be used as a measure of their dissimilarity. Sliding this double window over the entire sequence allows us to segment it compositionally. The fusion of those segments into greater ones that satisfy certain identification criteria must be achieved in order to obtain the definitive results. We find that the local use of Jensen-Shannon divergence is very suitable in processing DNA sequences for searching for compositionally different structures such as CpG islands, as compared to other algorithms in literature.

  20. Reinforcement learning for a biped robot based on a CPG-actor-critic method.

    PubMed

    Nakamura, Yutaka; Mori, Takeshi; Sato, Masa-aki; Ishii, Shin

    2007-08-01

    Animals' rhythmic movements, such as locomotion, are considered to be controlled by neural circuits called central pattern generators (CPGs), which generate oscillatory signals. Motivated by this biological mechanism, studies have been conducted on the rhythmic movements controlled by CPG. As an autonomous learning framework for a CPG controller, we propose in this article a reinforcement learning method we call the "CPG-actor-critic" method. This method introduces a new architecture to the actor, and its training is roughly based on a stochastic policy gradient algorithm presented recently. We apply this method to an automatic acquisition problem of control for a biped robot. Computer simulations show that training of the CPG can be successfully performed by our method, thus allowing the biped robot to not only walk stably but also adapt to environmental changes.

  1. The evolution of CpG density and lifespan in conserved primate and mammalian promoters

    PubMed Central

    McLain, Adam T.

    2018-01-01

    Gene promoters are evolutionarily conserved across holozoans and enriched in CpG sites, the target for DNA methylation. As animals age, the epigenetic pattern of DNA methylation degrades, with highly methylated CpG sites gradually becoming demethylated while CpG islands increase in methylation. Across vertebrates, aging is a trait that varies among species. We used this variation to determine whether promoter CpG density correlates with species’ maximum lifespan. Human promoter sequences were used to identify conserved regions in 131 mammals and a subset of 28 primate genomes. We identified approximately 1000 gene promoters (5% of the total), that significantly correlated CpG density with lifespan. The correlations were performed via the phylogenetic least squares method to account for trait similarity by common descent using phylogenetic branch lengths. Gene set enrichment analysis revealed no significantly enriched pathways or processes, consistent with the hypothesis that aging is not under positive selection. However, within both mammals and primates, 95% of the promoters showed a positive correlation between increasing CpG density and species lifespan, and two thirds were shared between the primate subset and mammalian datasets. Thus, these genes may require greater buffering capacity against age-related dysregulation of DNA methylation in longer-lived species. PMID:29661983

  2. CpG methylation increases the DNA binding of 9-aminoacridine carboxamide Pt analogues.

    PubMed

    Kava, Hieronimus W; Murray, Vincent

    2016-10-01

    This study investigated the effect of CpG methylation on the DNA binding of cisplatin analogues with an attached aminoacridine intercalator. DNA-targeted 9-aminoacridine carboxamide Pt complexes are known to bind at 5'-CpG sequences. Their binding to methylated and non-methylated 5'-CpG sequences was determined and compared with cisplatin. The damage profiles of each platinum compound were quantified via a polymerase stop assay with fluorescently labelled primers and capillary electrophoresis. Methylation at 5'-CpG was shown to significantly increase the binding intensity for the 9-aminoacridine carboxamide compounds, whereas no significant increase was found for cisplatin. 5'-CpG methylation had the largest effect on the 9-ethanolamine-acridine carboxamide Pt complex, followed by the 9-aminoacridine carboxamide Pt complex and the 7-fluoro complex. The methylation state of a cell's genome is important in maintaining normal gene expression, and is often aberrantly altered in cancer cells. An analogue of cisplatin which differentially targets methylated DNA may be able to improve its therapeutic activity, or alter its range of targets and evade the chemoresistance which hampers cisplatin efficacy in clinical use. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Bacterial DNA induces pulmonary damage via TLR-9 through cross-talk with neutrophils.

    PubMed

    Itagaki, Kiyoshi; Adibnia, Yasaman; Sun, Shiqin; Zhao, Cong; Sursal, Tolga; Chen, Yu; Junger, Wolfgang; Hauser, Carl J

    2011-12-01

    Bacterial DNA (bDNA) contains hypomethylated "CpG" repeats that can be recognized by Toll-like receptor 9 (TLR-9) as a pathogen-associated molecular pattern. The ability of bDNA to initiate lung injury via TLR-9 has been inferred on the basis of studies using artificial CpG DNA. But the role of authentic bDNA in lung injury is still unknown. Moreover, the mechanisms by which CpG DNA species can lead to pulmonary injury are unknown, although neutrophils (PMNs) are thought to play a key role in the genesis of septic acute lung injury. We evaluated the effects of bDNA on PMN-endothelial cell (EC) interactions thought critical for initiation of acute lung injury. Using a biocapacitance system to monitor real-time changes in endothelial permeability, we demonstrate here that bDNA causes EC permeability in a dose-dependent manner uniquely in the presence of PMNs. These permeability changes are inhibited by chloroquine, suggesting TLR-9 dependency. When PMNs were preincubated with bDNA and applied to ECs or when bDNA was applied to ECs without PMNs, no permeability changes were detected. To study the underlying mechanisms, we evaluated the effects of bDNA on PMN-EC adherence. Bacterial DNA significantly increased PMN adherence to ECs in association with upregulated adhesion molecules in both cell types. Taken together, our results strongly support the conclusion that bDNA can initiate lung injury by stimulating PMN-EC adhesive interactions predisposing to endothelial permeability. Bacterial DNA stimulation of TLR-9 appears to promote enhanced gene expression of adhesion molecules in both cell types. This leads to PMN-EC cross-talk, which is required for injury to occur.

  4. Association of the CpG Methylation Pattern of the Proximal Insulin Gene Promoter with Type 1 Diabetes

    PubMed Central

    Fradin, Delphine; Le Fur, Sophie; Mille, Clémence; Naoui, Nadia; Groves, Chris; Zelenika, Diana; McCarthy, Mark I.; Lathrop, Mark; Bougnères, Pierre

    2012-01-01

    The insulin (INS) region is the second most important locus associated with Type 1 Diabetes (T1D). The study of the DNA methylation pattern of the 7 CpGs proximal to the TSS in the INS gene promoter revealed that T1D patients have a lower level of methylation of CpG -19, -135 and -234 (p = 2.10−16) and a higher methylation of CpG -180 than controls, while methylation was comparable for CpG -69, -102, -206. The magnitude of the hypomethylation relative to a control population was 8–15% of the corresponding levels in controls and was correlated in CpGs -19 and -135 (r = 0.77) and CpG -135 and -234 (r = 0.65). 70/485 (14%) of T1D patients had a simultaneous decrease in methylation of CpG -19, -135, -234 versus none in 317 controls. CpG methylation did not correlate with glycated hemoglobin or with T1D duration. The methylation of CpG -69, -102, -180, -206, but not CpG -19, -135, -234 was strongly influenced by the cis-genotype at rs689, a SNP known to show a strong association with T1D. We hypothesize that part of this genetic association could in fact be mediated at the statistical and functional level by the underlying changes in neighboring CpG methylation. Our observation of a CpG-specific, locus-specific methylation pattern, although it can provide an epigenetic biomarker of a multifactorial disease, does not indicate whether the reported epigenetic pattern preexists or follows the establishment of T1D. To explore the effect of chronic hyperglycemia on CpG methylation, we studied non obese patients with type 2 diabetes (T2D) who were found to have decreased CpG-19 methylation versus age-matched controls, similar to T1D (p = 2.10−6) but increased CpG-234 methylation (p = 5.10−8), the opposite of T1D. The causality and natural history of the different epigenetic changes associated with T1D or T2D remain to be determined. PMID:22567146

  5. Collaborations between CpG sites in DNA methylation

    NASA Astrophysics Data System (ADS)

    Song, You; Ren, Honglei; Lei, Jinzhi

    2017-08-01

    DNA methylation patterns have profound impacts on genome stability, gene expression and development. The molecular base of DNA methylation patterns has long been focused at single CpG sites level. Here, we construct a kinetic model of DNA methylation with collaborations between CpG sites, from which a correlation function was established based on experimental data. The function consists of three parts that suggest three possible sources of the correlation: movement of enzymes along DNA, collaboration between DNA methylation and nucleosome modification, and global enzyme concentrations within a cell. Moreover, the collaboration strength between DNA methylation and nucleosome modification is universal for mouse early embryo cells. The obtained correlation function provides insightful understanding for the mechanisms of inheritance of DNA methylation patterns.

  6. Toll-like receptor 9 agonist enhances anti-tumor immunity and inhibits tumor-associated immunosuppressive cells numbers in a mouse cervical cancer model following recombinant lipoprotein therapy.

    PubMed

    Chang, Li-Sheng; Leng, Chih-Hsiang; Yeh, Yi-Chen; Wu, Chiao-Chieh; Chen, Hsin-Wei; Huang, Hai-Mei; Liu, Shih-Jen

    2014-03-19

    Although cytotoxic T lymphocytes (CTLs) play a major role in eradicating cancer cells during immunotherapy, the cancer-associated immunosuppressive microenvironment often limits the success of such therapies. Therefore, the simultaneous induction of cancer-specific CTLs and reversal of the immunosuppressive tumor microenvironment may be more effectively achieved through a single therapeutic vaccine. A recombinant lipoprotein with intrinsic Toll-like receptor 2 (TLR2) agonist activity containing a mutant form of E7 (E7m) and a bacterial lipid moiety (rlipo-E7m) has been demonstrated to induce robust CTL responses against small tumors. This treatment in combination with other TLR agonists is able to eliminate large tumors. Mouse bone marrow-derived dendritic cells (DCs) were employed to determine the synergistic production of pro-inflammatory cytokines upon combination of rlipo-E7m and other TLR agonists. Antigen-specific CTL responses were investigated using immunospots or in vivo cytolytic assays after immunization in mice. Mice bearing various tumor sizes were used to evaluate the anti-tumor effects of the formulation. Specific subpopulations of immunosuppressive cells in the tumor infiltrate were quantitatively determined by flow cytometry. We demonstrate that a TLR9 agonist (unmethylated CpG oligodeoxynucleotide, CpG ODN) enhances CTL responses and eradicates large tumors when combined with rlipo-E7m. Moreover, combined treatment with rlipo-E7m and CpG ODN effectively increases tumor infiltration by CTLs and reduces the numbers of myeloid-derived suppressor cells (MDSCs), tumor-associated macrophages (TAMs) and regulatory T cells (Tregs) in the tumor microenvironment. These findings suggest that the dramatic anti-tumor effects of the recombinant lipoprotein together with CpG ODN may reflect the amplification of CTL responses and the repression of the immunosuppressive environment. This promising approach could be applied for the development of additional

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre

    An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

  8. Parvovirus B19 DNA CpG Dinucleotide Methylation and Epigenetic Regulation of Viral Expression

    PubMed Central

    Bonvicini, Francesca; Manaresi, Elisabetta; Di Furio, Francesca; De Falco, Luisa; Gallinella, Giorgio

    2012-01-01

    CpG DNA methylation is one of the main epigenetic modifications playing a role in the control of gene expression. For DNA viruses whose genome has the ability to integrate in the host genome or to maintain as a latent episome, a correlation has been found between the extent of DNA methylation and viral quiescence. No information is available for Parvovirus B19, a human pathogenic virus, which is capable of both lytic and persistent infections. Within Parvovirus B19 genome, the inverted terminal regions display all the characteristic signatures of a genomic CpG island; therefore we hypothesised a role of CpG dinucleotide methylation in the regulation of viral genome expression. The analysis of CpG dinucleotide methylation of Parvovirus B19 DNA was carried out by an aptly designed quantitative real-time PCR assay on bisulfite-modified DNA. The effects of CpG methylation on the regulation of viral genome expression were first investigated by transfection of either unmethylated or in vitro methylated viral DNA in a model cell line, showing that methylation of viral DNA was correlated to lower expression levels of the viral genome. Then, in the course of in vitro infections in different cellular environments, it was observed that absence of viral expression and genome replication were both correlated to increasing levels of CpG methylation of viral DNA. Finally, the presence of CpG methylation was documented in viral DNA present in bioptic samples, indicating the occurrence and a possible role of this epigenetic modification in the course of natural infections. The presence of an epigenetic level of regulation of viral genome expression, possibly correlated to the silencing of the viral genome and contributing to the maintenance of the virus in tissues, can be relevant to the balance and outcome of the different types of infection associated to Parvovirus B19. PMID:22413013

  9. Oxidative generation of guanine radicals by carbonate radicals and their reactions with nitrogen dioxide to form site specific 5-guanidino-4-nitroimidazole lesions in oligodeoxynucleotides.

    PubMed

    Joffe, Avrum; Mock, Steven; Yun, Byeong Hwa; Kolbanovskiy, Alexander; Geacintov, Nicholas E; Shafirovich, Vladimir

    2003-08-01

    A simple photochemical approach is described for synthesizing site specific, stable 5-guanidino-4-nitroimidazole (NIm) adducts in single- and double-stranded oligodeoxynucleotides containing single and multiple guanine residues. The DNA sequences employed, 5'-d(ACC CG(1)C G(2)TC CG(3)C G(4)CC) and 5'-d(ACC CG(1)C G(2)TC C), were a portion of exon 5 of the p53 tumor suppressor gene, including the codons 157 (G(2)) and 158 (G(3)) mutation hot spots in the former sequence with four Gs and the codon 157 (G(2)) mutation hot spot in the latter sequence with two Gs. The nitration of oligodeoxynucleotides was initiated by the selective photodissociation of persulfate anions to sulfate radicals induced by UV laser pulses (308 nm). In aqueous solutions, of bicarbonate and nitrite anions, the sulfate radicals generate carbonate anion radicals and nitrogen dioxide radicals by one electron oxidation of the respective anions. The guanine residue in the oligodeoxynucleotide is oxidized by the carbonate anion radical to form the neutral guanine radical. While the nitrogen dioxide radicals do not react with any of the intact DNA bases, they readily combine with the guanine radicals at either the C8 or the C5 positions. The C8 addition generates the well-known 8-nitroguanine (8-nitro-G) lesions, whereas the C5 attack produces unstable adducts, which rapidly decompose to NIm lesions. The maximum yields of the nitro products (NIm + 8-nitro-G) were typically in the range of 20-40%, depending on the number of guanine residues in the sequence. The ratio of the NIm to 8-nitro-G lesions gradually decreases from 3.4 in the model compound, 2',3',5'-tri-O-acetylguanosine, to 2.1-2.6 in the single-stranded oligodeoxynucleotides and to 0.8-1.1 in the duplexes. The adduct of the 5'-d(ACC CG(1)C G(2)TC C) oligodeoxynucleotide containing the NIm lesion in codon 157 (G(2)) was isolated in HPLC-pure form. The integrity of this adduct was established by a detailed analysis of exonuclease digestion

  10. Immunostimulatory CpG on Carbon Nanotubes Selectively Inhibits Migration of Brain Tumor Cells.

    PubMed

    Alizadeh, Darya; White, Ethan E; Sanchez, Teresa C; Liu, Shunan; Zhang, Leying; Badie, Behnam; Berlin, Jacob M

    2018-05-16

    Even when treated with aggressive current therapies, patients with glioblastoma usually survive less than two years and exhibit a high rate of recurrence. CpG is an oligonucleotide that activates the innate immune system via Toll-like receptor 9 (TLR9) activation. Injection of CpG into glioblastoma tumors showed promise as an immunotherapy in mouse models but proved disappointing in human trials. One aspect of glioma that is not addressed by CpG therapy alone is the highly invasive nature of glioma cells, which is associated with resistance to radiation and chemotherapy. Here, we demonstrate that single-walled carbon nanotubes noncovalently functionalized with CpG (SWNT/CpG), which retain the immunostimulatory property of the CpG, selectively inhibit the migration of glioma cells and not macrophages without affecting cell viability or proliferation. SWNT/CpG also selectively decreased NF-κB activation in glioma cells, while activating macrophages by induction of the TLR9/NF-κB pathway, as we have previously reported. The migration inhibition of glioma cells was correlated with selective reduction of intracellular levels of reactive oxygen species (ROS), suggesting that an antioxidant-based mechanism mediates the observed effects. To the best of our knowledge, SWNT/CpG is the first nanomaterial that inhibits the migration of cancer cells while stimulating the immune system.

  11. Genome-wide DNA Methylation Profiling of CpG Islands in Hypospadias

    PubMed Central

    Choudhry, Shweta; Deshpande, Archana; Qiao, Liang; Beckman, Kenneth; Sen, Saunak; Baskin, Laurence S.

    2013-01-01

    Purpose Hypospadias is one of the most frequent genital malformations in the male newborn, and results from abnormal penile and urethral development. The etiology of hypospadias remains largely unknown despite intensive investigations. Fetal androgens have a crucial role in genital differentiation. Recent studies have suggested that molecular mechanisms that underlie the effects of androgens on the fetus may involve disruption of epigenetic programming of gene expression during development. We assessed whether epigenetic modification of DNA methylation is associated with hypospadias in a case-control study of 12 hypospadias and 8 control subjects. Materials and Methods Genome-wide DNA methylation profiling was performed on the study subjects using the Illumina Infinium® HumanMethylation450 Bead-Chip, which enables the direct investigation of methylation status of more than 485,000 individual CpG sites throughout the genome. The methylation level at each CpG site was compared between cases and controls using the t test and logistic regression. Results We identified 14 CpG sites that were associated with hypospadias with p <0.00001. These CpG sites were in or near the SCARB1, MYBPH, SORBS1, LAMA4, HOXD11, MYO1D, EGFL7, C10orf41, LMAN1L and SULF1 genes. Two CpG sites in SCARB1 and MYBPH genes remained statistically significant after correction for multiple testing (p = 2.61×10−09, pcorrected = 0.008; p = 3.06×10−08, pcorrected = 0.02, respectively). Conclusions To our knowledge this is the first study to investigate hypospadias using a unique and novel epigenetic approach. Our findings suggest DNA methylation patterns are useful in identifying new genes such as SCARB1 and MYBPH that may be involved in the etiology of hypospadias. PMID:22906644

  12. Induction of anti-glioma natural killer cell response following multiple low-dose intracerebral CpG therapy.

    PubMed

    Alizadeh, Darya; Zhang, Leying; Brown, Christine E; Farrukh, Omar; Jensen, Michael C; Badie, Behnam

    2010-07-01

    Stimulation of toll-like receptor-9 by CpG oligodeoxynucleotides (CpG-ODN) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. These studies, however, have used high doses of CpG-ODN, which can induce toxicity in a clinical setting. The goal of this study was to evaluate the antitumor efficacy of multiple low-dose intratumoral CpG-ODN in a glioma model. Mice bearing 4-day-old intracranial GL261 gliomas received a single or multiple (two or four) intratumoral injections of CpG-ODN (3 microg) every 4 days. Tumor growth was measured by bioluminescent imaging, brain histology, and animal survival. Flow cytometry and cytotoxicity assays were used to assess anti-glioma immune response. Two and four intracranial injections of low-dose CpG-ODN, but not a single injection, eradicated gliomas in 70% of mice. Moreover, surviving animals exhibited durable tumor-free remission (> 3 months) and were protected from intracranial rechallenge with GL261 gliomas, showing the capacity for long-term antitumor immunity. Although most inflammatory cells seemed to increase, activated natural killer (NK) cells (i.e., NK(+)CD107a(+)) were more frequent than CD8(+)CD107a(+) in the brains of rechallenged CpG-ODN-treated animals and showed a stronger in vitro cytotoxicity against GL261 target cells. Leukocyte depletion studies confirmed that NK cells played an important role in the initial CpG-ODN antitumor response, but both CD8 and NK cells were equally important in long-term immunity against gliomas. These findings suggest that multiple low-dose intratumoral injections of CpG-ODN can eradicate intracranial gliomas possibly through mechanisms involving NK-mediated effector function.

  13. CpG Oligodeoxynucleotides Enhance the Efficacy of Adoptive Cell Transfer Using Tumor Infiltrating Lymphocytes by Modifying the Th1 Polarization and Local Infiltration of Th17 Cells

    PubMed Central

    Xu, Lin; Wang, Chunhong; Wen, Zhenke; Zhou, Ya; Liu, Zhongmin; Liang, Yongjie; Xu, Zengguang; Ren, Tao

    2010-01-01

    Adoptive cell transfer immunotherapy using tumor infiltrating lymphocytes (TILs) was an important therapeutic strategy against tumors. But the efficacy remains limited and development of new strategies is urgent. Recent evidence suggested that CpG-ODNs might be a potent candidate for tumor immunotherapy. Here we firstly reported that CpG-ODNs could significantly enhance the antitumor efficacy of adoptively transferred TILs in vivo accompanied by enhanced activity capacity and proliferation of CD8+ T cells and CD8+ T cells, as well as a Th1 polarization immune response. Most importantly, we found that CpG-ODNs could significantly elevate the infiltration of Th17 cells in tumor mass, which contributed to anti-tumor efficacy of TILs in vivo. Our findings suggested that CpG ODNs could enhance the anti-tumor efficacy of adoptively transferred TILs through modifying Th1 polarization and local infiltration of Th17 cells, which might provide a clue for developing a new strategy for ACT based on TILs. PMID:20981279

  14. dbCPG: A web resource for cancer predisposition genes.

    PubMed

    Wei, Ran; Yao, Yao; Yang, Wu; Zheng, Chun-Hou; Zhao, Min; Xia, Junfeng

    2016-06-21

    Cancer predisposition genes (CPGs) are genes in which inherited mutations confer highly or moderately increased risks of developing cancer. Identification of these genes and understanding the biological mechanisms that underlie them is crucial for the prevention, early diagnosis, and optimized management of cancer. Over the past decades, great efforts have been made to identify CPGs through multiple strategies. However, information on these CPGs and their molecular functions is scattered. To address this issue and provide a comprehensive resource for researchers, we developed the Cancer Predisposition Gene Database (dbCPG, Database URL: http://bioinfo.ahu.edu.cn:8080/dbCPG/index.jsp), the first literature-based gene resource for exploring human CPGs. It contains 827 human (724 protein-coding, 23 non-coding, and 80 unknown type genes), 637 rats, and 658 mouse CPGs. Furthermore, data mining was performed to gain insights into the understanding of the CPGs data, including functional annotation, gene prioritization, network analysis of prioritized genes and overlap analysis across multiple cancer types. A user-friendly web interface with multiple browse, search, and upload functions was also developed to facilitate access to the latest information on CPGs. Taken together, the dbCPG database provides a comprehensive data resource for further studies of cancer predisposition genes.

  15. dbCPG: A web resource for cancer predisposition genes

    PubMed Central

    Wei, Ran; Yao, Yao; Yang, Wu; Zheng, Chun-Hou; Zhao, Min; Xia, Junfeng

    2016-01-01

    Cancer predisposition genes (CPGs) are genes in which inherited mutations confer highly or moderately increased risks of developing cancer. Identification of these genes and understanding the biological mechanisms that underlie them is crucial for the prevention, early diagnosis, and optimized management of cancer. Over the past decades, great efforts have been made to identify CPGs through multiple strategies. However, information on these CPGs and their molecular functions is scattered. To address this issue and provide a comprehensive resource for researchers, we developed the Cancer Predisposition Gene Database (dbCPG, Database URL: http://bioinfo.ahu.edu.cn:8080/dbCPG/index.jsp), the first literature-based gene resource for exploring human CPGs. It contains 827 human (724 protein-coding, 23 non-coding, and 80 unknown type genes), 637 rats, and 658 mouse CPGs. Furthermore, data mining was performed to gain insights into the understanding of the CPGs data, including functional annotation, gene prioritization, network analysis of prioritized genes and overlap analysis across multiple cancer types. A user-friendly web interface with multiple browse, search, and upload functions was also developed to facilitate access to the latest information on CPGs. Taken together, the dbCPG database provides a comprehensive data resource for further studies of cancer predisposition genes. PMID:27192119

  16. Role of Replication and CpG Methylation in Fragile X Syndrome CGG Deletions in Primate Cells

    PubMed Central

    Nichol Edamura, Kerrie; Leonard, Michelle R.; Pearson, Christopher E.

    2005-01-01

    Instability of the fragile X CGG repeat involves both maternally derived expansions and deletions in the gametes of full-mutation males. It has also been suggested that the absence of aberrant CpG methylation may enhance repeat deletions through an unknown process. The effect of CGG tract length, DNA replication direction, location of replication initiation, and CpG methylation upon CGG stability were investigated using an SV40 primate replication system. Replication-dependant deletions with 53 CGG repeats were observed when replication was initiated proximal to the repeat, with CGG as the lagging-strand template. When we initiated replication further from the repeat, while maintaining CGG as the lagging-strand template or using CCG as the lagging-strand template, significant instability was not observed. CpG methylation of the unstable template stabilized the repeat, decreasing both the frequency and the magnitude of deletion events. Furthermore, CpG methylation slowed the efficiency of replication for all templates. Interestingly, replication forks displayed no evidence of a block at the CGG repeat tract, regardless of replication direction or CpG methylation status. Templates with 20 CGG repeats were stable under all circumstances. These results reveal that CGG deletions occur during replication and are sensitive to replication-fork dynamics, tract length, and CpG methylation. PMID:15625623

  17. Polycomb-like proteins link the PRC2 complex to CpG islands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Haojie; Liefke, Robert; Jiang, Junyi

    The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood.more » Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.« less

  18. CPG-inspired workspace trajectory generation and adaptive locomotion control for quadruped robots.

    PubMed

    Liu, Chengju; Chen, Qijun; Wang, Danwei

    2011-06-01

    This paper deals with the locomotion control of quadruped robots inspired by the biological concept of central pattern generator (CPG). A control architecture is proposed with a 3-D workspace trajectory generator and a motion engine. The workspace trajectory generator generates adaptive workspace trajectories based on CPGs, and the motion engine realizes joint motion imputes. The proposed architecture is able to generate adaptive workspace trajectories online by tuning the parameters of the CPG network to adapt to various terrains. With feedback information, a quadruped robot can walk through various terrains with adaptive joint control signals. A quadruped platform AIBO is used to validate the proposed locomotion control system. The experimental results confirm the effectiveness of the proposed control architecture. A comparison by experiments shows the superiority of the proposed method against the traditional CPG-joint-space control method.

  19. The Genomic Impact of DNA CpG Methylation on Gene Expression; Relationships in Prostate Cancer.

    PubMed

    Long, Mark D; Smiraglia, Dominic J; Campbell, Moray J

    2017-02-14

    The process of DNA CpG methylation has been extensively investigated for over 50 years and revealed associations between changing methylation status of CpG islands and gene expression. As a result, DNA CpG methylation is implicated in the control of gene expression in developmental and homeostasis processes, as well as being a cancer-driver mechanism. The development of genome-wide technologies and sophisticated statistical analytical approaches has ushered in an era of widespread analyses, for example in the cancer arena, of the relationships between altered DNA CpG methylation, gene expression, and tumor status. The remarkable increase in the volume of such genomic data, for example, through investigators from the Cancer Genome Atlas (TCGA), has allowed dissection of the relationships between DNA CpG methylation density and distribution, gene expression, and tumor outcome. In this manner, it is now possible to test that the genome-wide correlations are measurable between changes in DNA CpG methylation and gene expression. Perhaps surprisingly is that these associations can only be detected for hundreds, but not thousands, of genes, and the direction of the correlations are both positive and negative. This, perhaps, suggests that CpG methylation events in cancer systems can act as disease drivers but the effects are possibly more restricted than suspected. Additionally, the positive and negative correlations suggest direct and indirect events and an incomplete understanding. Within the prostate cancer TCGA cohort, we examined the relationships between expression of genes that control DNA methylation, known targets of DNA methylation and tumor status. This revealed that genes that control the synthesis of S -adenosyl-l-methionine (SAM) associate with altered expression of DNA methylation targets in a subset of aggressive tumors.

  20. CpG island methylator phenotype-low (CIMP-low) colorectal cancer shows not only few methylated CIMP-high-specific CpG islands, but also low-level methylation at individual loci.

    PubMed

    Kawasaki, Takako; Ohnishi, Mutsuko; Nosho, Katsuhiko; Suemoto, Yuko; Kirkner, Gregory J; Meyerhardt, Jeffrey A; Fuchs, Charles S; Ogino, Shuji

    2008-03-01

    The CpG island methylator phenotype (CIMP or CIMP-high) with widespread promoter methylation is a distinct phenotype in colorectal cancer. However, the concept of CIMP-low with less extensive CpG island methylation is still evolving. Our aim is to examine whether density of methylation in individual CpG islands was different between CIMP-low and CIMP-high tumors. Utilizing MethyLight technology and 889 population-based colorectal cancers, we quantified DNA methylation (methylation index, percentage of methylated reference) at 14 CpG islands, including 8 CIMP-high-specific loci (CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3 and SOCS1). Methylation positivity in each locus was defined as methylation index>4. Low-level methylation (methylation index>0, <20) in each CIMP-high-specific locus was significantly more common in 340 CIMP-low tumors (1/8-5/8 methylation-positive loci) than 133 CIMP-high tumors (> or =6/8 methylation-positive loci) and 416 CIMP-0 tumors (0/8 methylation-positive loci) (P< or =0.002). In the other six loci (CHFR, HIC1, IGFBP3, MGMT, MINT31 and WRN), which were not highly specific for CIMP-high, low-level methylation, was not persistently more prevalent in CIMP-low tumors. In conclusion, compared to CIMP-high and CIMP-0 tumors, CIMP-low colorectal cancers show not only few methylated CIMP-high-specific CpG islands, but also more frequent low-level methylation at individual loci. Our data may provide supporting evidence for a difference in pathogenesis of DNA methylation between CIMP-low and CIMP-high tumors.

  1. Methylation detection oligonucleotide microarray analysis: a high-resolution method for detection of CpG island methylation

    PubMed Central

    Kamalakaran, Sitharthan; Kendall, Jude; Zhao, Xiaoyue; Tang, Chunlao; Khan, Sohail; Ravi, Kandasamy; Auletta, Theresa; Riggs, Michael; Wang, Yun; Helland, Åslaug; Naume, Bjørn; Dimitrova, Nevenka; Børresen-Dale, Anne-Lise; Hicks, Jim; Lucito, Robert

    2009-01-01

    Methylation of CpG islands associated with genes can affect the expression of the proximal gene, and methylation of non-associated CpG islands correlates to genomic instability. This epigenetic modification has been shown to be important in many pathologies, from development and disease to cancer. We report the development of a novel high-resolution microarray that detects the methylation status of over 25 000 CpG islands in the human genome. Experiments were performed to demonstrate low system noise in the methodology and that the array probes have a high signal to noise ratio. Methylation measurements between different cell lines were validated demonstrating the accuracy of measurement. We then identified alterations in CpG islands, both those associated with gene promoters, as well as non-promoter-associated islands in a set of breast and ovarian tumors. We demonstrate that this methodology accurately identifies methylation profiles in cancer and in principle it can differentiate any CpG methylation alterations and can be adapted to analyze other species. PMID:19474344

  2. Protective immunity against Megalocytivirus infection in rock bream (Oplegnathus fasciatus) following CpG ODN administration.

    PubMed

    Jung, Myung-Hwa; Lee, Jehee; Ortega-Villaizan, M; Perez, Luis; Jung, Sung-Ju

    2017-06-27

    Rock bream iridovirus (RBIV) disease in rock bream (Oplegnathus fasciatus) remains an unsolved problem in Korea aquaculture farms. CpG ODNs are known as immunostimulant, can improve the innate immune system of fish providing resistance to diseases. In this study, we evaluated the potential of CpG ODNs to induce anti-viral status protecting rock bream from different RBIV infection conditions. We found that, when administered into rock bream, CpG ODN 1668 induces better antiviral immune responses compared to other 5 CpG ODNs (2216, 1826, 2133, 2395 and 1720). All CpG ODN 1668 administered fish (1/5µg) at 2days before infection (1.1×10 7 ) held at 26°C died even though mortality was delayed from 8days (1µg) and 4days (5µg). Similarly, CpG ODN 1668 administered (5µg) at 2days before infection (1.2×10 6 ) held at 23/20°C had 100% mortality; the mortality was delayed from 9days (23°C) and 11days (20°C). Moreover, when CpG ODN 1668 administered (1/5/10µg) at 2/4/7days before infection or virus concentration was decreased to 1.1×10 4 and held at 20°C had mortality rates of 20/60/30% (2days), 30/40/60% (4days) and 60/60/20% (7days), respectively, for the respective administration dose, through 100 dpi. To investigate the development of a protective immune response, survivors were re-infected with RBIV (1.1×10 7 ) at 100 and 400 dpi, respectively. While 100% of the previously unexposed fish died, 100% of the previously infected fish survived. The high survival rate of fish following re-challenge with RBIV indicates that protective immunity was established in the surviving rock bream. Our results showed the possibility of developing preventive measures against RBIV using CpG ODN 1668 by reducing RBIV replication speed (i.e. water temperature of 20°C and infection dose of 1.1×10 4 ). Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. A CpG-containing oligodeoxynucleotide as an efficient adjuvant counterbalancing the Th1/Th2 immune response in diphtheria-tetanus-pertussis vaccine.

    PubMed

    Sugai, Toshiyuki; Mori, Masaaki; Nakazawa, Masatoshi; Ichino, Motohide; Naruto, Takuya; Kobayashi, Naoki; Kobayashi, Yoshinori; Minami, Mutsuhiko; Yokota, Shumpei

    2005-11-16

    Adjuvants in vaccines are immune stimulants that play an important role in the induction of effective and appropriate immune responses to vaccine component(s). Diphtheria-tetanus-pertussis (DPT) vaccine contains not only aluminum hydrate (alum) to enhance the immune response to the vaccine ingredients, but also, both for that purpose and as a principal ingredient, pertussis toxin (PT). However, both adjuvants strongly promote T helper (Th) 2 type immune responses. Th1 and Th2 type immune responses are counterbalanced in vivo, and a Th2-prone immune response is not effective against intracellular infections but promotes IgE production, which is related to allergic disease. In this study, we used the CpG motif contained in oligodeoxynucleotide (CpG-ODN), which has an adjuvant effect and also induces the Th1 response, as an adjuvant to this vaccine, and we investigated its adjuvanticity and its potential to modulate immune responses to DPT vaccine. Administration of DPT vaccine with CpG-ODN (DPT-alum/ODN) to mice significantly reduced the total IgE levels and increased the anti-PT specific IgG2a titer in serum, in comparison with ordinary DPT vaccine (DPT-alum). Moreover, we investigated the antibody response to orally administrated ovalbumin (OVA) after vaccine administration. In the DPT-alum/ODN-administered group, the OVA specific IgE production in serum greatly decreased in comparison with that in the DPT-alum-administered group. These data indicate that CpG-ODN was not useful only as an efficient vaccine adjuvant but also shifted the immune responses substantially toward Th1 and modulated the Th1/Th2 immune response in DPT vaccine. These data suggested new applications of CpG-ODN as adjuvants in DPT vaccine.

  4. 75 FR 13555 - Compliance Policy Guide Sec. 540.375 Canned Salmon - Adulteration Involving Decomposition (CPG...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-22

    ...] (Formerly Docket No. 1998N-0046) Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration... of Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration Involving Decomposition (CPG... relating to decomposition in fish and fishery products, including canned salmon, is provided in CPG Sec...

  5. On the Role of Sensory Feedbacks in Rowat–Selverston CPG to Improve Robot Legged Locomotion

    PubMed Central

    Amrollah, Elmira; Henaff, Patrick

    2010-01-01

    This paper presents the use of Rowat and Selverston-type of central pattern generator (CPG) to control locomotion. It focuses on the role of afferent exteroceptive and proprioceptive signals in the dynamic phase synchronization in CPG legged robots. The sensori-motor neural network architecture is evaluated to control a two-joint planar robot leg that slips on a rail. Then, the closed loop between the CPG and the mechanical system allows to study the modulation of rhythmic patterns and the effect of the sensing loop via sensory neurons during the locomotion task. Firstly simulations show that the proposed architecture easily allows to modulate rhythmic patterns of the leg, and therefore the velocity of the robot. Secondly, simulations show that sensori-feedbacks from foot/ground contact of the leg make the hip velocity smoother and larger. The results show that the Rowat–Selverston-type CPG with sensory feedbacks is an effective choice for building adaptive neural CPGs for legged robots. PMID:21228904

  6. Humanoids Learning to Walk: A Natural CPG-Actor-Critic Architecture.

    PubMed

    Li, Cai; Lowe, Robert; Ziemke, Tom

    2013-01-01

    The identification of learning mechanisms for locomotion has been the subject of much research for some time but many challenges remain. Dynamic systems theory (DST) offers a novel approach to humanoid learning through environmental interaction. Reinforcement learning (RL) has offered a promising method to adaptively link the dynamic system to the environment it interacts with via a reward-based value system. In this paper, we propose a model that integrates the above perspectives and applies it to the case of a humanoid (NAO) robot learning to walk the ability of which emerges from its value-based interaction with the environment. In the model, a simplified central pattern generator (CPG) architecture inspired by neuroscientific research and DST is integrated with an actor-critic approach to RL (cpg-actor-critic). In the cpg-actor-critic architecture, least-square-temporal-difference based learning converges to the optimal solution quickly by using natural gradient learning and balancing exploration and exploitation. Futhermore, rather than using a traditional (designer-specified) reward it uses a dynamic value function as a stability indicator that adapts to the environment. The results obtained are analyzed using a novel DST-based embodied cognition approach. Learning to walk, from this perspective, is a process of integrating levels of sensorimotor activity and value.

  7. Humanoids Learning to Walk: A Natural CPG-Actor-Critic Architecture

    PubMed Central

    Li, Cai; Lowe, Robert; Ziemke, Tom

    2013-01-01

    The identification of learning mechanisms for locomotion has been the subject of much research for some time but many challenges remain. Dynamic systems theory (DST) offers a novel approach to humanoid learning through environmental interaction. Reinforcement learning (RL) has offered a promising method to adaptively link the dynamic system to the environment it interacts with via a reward-based value system. In this paper, we propose a model that integrates the above perspectives and applies it to the case of a humanoid (NAO) robot learning to walk the ability of which emerges from its value-based interaction with the environment. In the model, a simplified central pattern generator (CPG) architecture inspired by neuroscientific research and DST is integrated with an actor-critic approach to RL (cpg-actor-critic). In the cpg-actor-critic architecture, least-square-temporal-difference based learning converges to the optimal solution quickly by using natural gradient learning and balancing exploration and exploitation. Futhermore, rather than using a traditional (designer-specified) reward it uses a dynamic value function as a stability indicator that adapts to the environment. The results obtained are analyzed using a novel DST-based embodied cognition approach. Learning to walk, from this perspective, is a process of integrating levels of sensorimotor activity and value. PMID:23675345

  8. Growth inhibition of N1E-115 mouse neuroblastoma cells by c-myc or N-myc antisense oligodeoxynucleotides causes limited differentiation but is not coupled to neurite formation.

    PubMed

    Larcher, J C; Basseville, M; Vayssiere, J L; Cordeau-Lossouarn, L; Croizat, B; Gros, F

    1992-06-30

    Antisense oligodeoxynucleotides were found to be stable in the culture medium containing fetal calf serum (heat-inactivated 30 minutes at 65 degrees C) and in cells. Antisense oligomer treatment causes cessation of mitoses, but does not lead to morphological differentiation. Under antisense conditions, we have observed an increase in the amount of two neurospecific protein, namely peripherin and gamma-enolase. Comparison of the results obtained with chemical inducers and antisense oligodeoxynucleotides allows us to postulate three phases in N1E-115 differentiation: the first correspond to the arrest of mitosis, the second to the expression of a limited neuronal program, and the third to the morphological and electrophysiological differentiation.

  9. Combinations of various CpG motifs cloned into plasmid backbone modulate and enhance protective immunity of viral replicon DNA anthrax vaccines.

    PubMed

    Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei

    2015-08-01

    DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.

  10. Clinical evaluation of CpG oligonucleotides as adjuvants for vaccines targeting infectious diseases and cancer

    PubMed Central

    Scheiermann, Julia; Klinman, Dennis M.

    2014-01-01

    Synthetic oligonucleotides (ODN) that express unmethylated “CpG motifs” trigger cells that express Toll-like receptor 9. In humans this includes plasmacytoid dendritic cells and B cells. CpG ODN induce an innate immune response characterized by the production of Th1 and pro-inflammatory cytokines. Their utility as vaccine adjuvants was evaluated in a number of clinical trials. Results indicate that CpG ODN improve antigen presentation and the generation of vaccine-specific cellular and humoral responses. This work provides an up-to-date overview of the utility of CpG ODN as adjuvants for vaccines targeting infectious agents and cancer. PMID:24975812

  11. CpG methylation patterns and decitabine treatment response in acute myeloid leukemia cells and normal hematopoietic precursors

    PubMed Central

    Negrotto, Soledad; Ng, Kwok Peng; Jankowska, Ania M.; Bodo, Juraj; Gopalan, Banu; Guinta, Kathryn; Mulloy, James C.; Hsi, Eric; Maciejewski, Jaroslaw; Saunthararajah, Yogen

    2011-01-01

    The DNA hypomethylating drug decitabine maintains normal hematopoietic stem cell (HSC) self-renewal but induces terminal differentiation in acute myeloid leukemia (AML) cells. The basis for these contrasting cell-fates, and for selective CpG hypomethylation by decitabine, is poorly understood. Promoter CpGs, with methylation measured by microarray, were classified by the direction of methylation change with normal myeloid maturation. In AML cells, the methylation pattern at maturation-responsive CpG suggested at least partial maturation. Consistent with partial maturation, in gene expression analyses, AML cells expressed high levels of the key lineage-specifying factor CEBPA, but relatively low levels of the key late-differentiation driver CEBPE. In methylation analysis by mass-spectrometry, CEBPE promoter CpG that are usually hypomethylated during granulocyte maturation were significantly hypermethylated in AML cells. Decitabine treatment induced cellular differentiation of AML cells, and the largest methylation decreases were at CpG that are hypomethylated with myeloid maturation, including CEBPE promoter CpG. In contrast, decitabine-treated normal HSC retained immature morphology, and methylation significantly decreased at CpG that are less methylated in immature cells. High expression of lineage-specifying factor and aberrant epigenetic repression of some key late-differentiation genes distinguishes AML cells from normal HSC and could explain the contrasting differentiation and methylation responses to decitabine. PMID:21836612

  12. Encapsulation of c-myc antisense oligodeoxynucleotides in lipid particles improves antitumoral efficacy in vivo in a human melanoma line.

    PubMed

    Leonetti, C; Biroccio, A; Benassi, B; Stringaro, A; Stoppacciaro, A; Semple, S C; Zupi, G

    2001-06-01

    Phosphorothioate c-myc antisense oligodeoxynucleotides [S]ODNs (free INX-6295) were encapsulated in a new liposome formulation and the antitumor activity was compared to the unencapsulated antisense in a human melanoma xenograft. The systemic administration of INX-6295 encapsulated in stabilized antisense lipid particles (SALP INX-6295) improved plasma AUC (area under the plasma concentration-time curve) and initial half-life of free INX-6295, resulting in a significant enhancement in tumor accumulation and improvement in tumor distribution of antisense oligodeoxynucleotides. Animals treated with SALP INX-6295 exhibited a prolonged reduction of c-myc expression, reduced tumor growth and increased mice survival. When administered in combination with cisplatin (DDP), SALP INX-6295 produced a complete tumor regression in approximately 30% of treated mice, which persisted for at least 60 days following the first cycle of treatment. Finally, the median survival of mice treated with DDP/SALP INX-6295 increased by 105% compared to 84% for animals treated with the combination DDP/free INX-6295. These data indicate that the biological activity and the therapeutic efficacy of c-myc antisense therapy may be improved when these agents are administered in lipid-based delivery systems.

  13. FBXL19 recruits CDK-Mediator to CpG islands of developmental genes priming them for activation during lineage commitment

    PubMed Central

    Dimitrova, Emilia; Nakayama, Manabu; Koseki, Yoko; Konietzny, Rebecca; Kessler, Benedikt M; Koseki, Haruhiko

    2018-01-01

    CpG islands are gene regulatory elements associated with the majority of mammalian promoters, yet how they regulate gene expression remains poorly understood. Here, we identify FBXL19 as a CpG island-binding protein in mouse embryonic stem (ES) cells and show that it associates with the CDK-Mediator complex. We discover that FBXL19 recruits CDK-Mediator to CpG island-associated promoters of non-transcribed developmental genes to prime these genes for activation during cell lineage commitment. We further show that recognition of CpG islands by FBXL19 is essential for mouse development. Together this reveals a new CpG island-centric mechanism for CDK-Mediator recruitment to developmental gene promoters in ES cells and a requirement for CDK-Mediator in priming these developmental genes for activation during cell lineage commitment. PMID:29809150

  14. CpG-B Oligodeoxynucleotides Inhibit TLR-Dependent and -Independent Induction of Type I IFN in Dendritic Cells

    PubMed Central

    Liu, Yi C.; Gray, Reginald C.; Hardy, Gareth A. D.; Kuchtey, John; Abbott, Derek W.; Emancipator, Steven N.; Harding, Clifford V.

    2010-01-01

    CpG oligodeoxynucleotides (ODNs) signal through TLR9 to induce type I IFN (IFN-αβ) in dendritic cells (DCs). CpG-A ODNs are more efficacious than CpG-B ODNs for induction of IFN-αβ. Because IFN-αβ may contribute to autoimmunity, it is important to identify mechanisms to inhibit induction of IFN-αβ. In our studies, CpG-B ODN inhibited induction of IFN-αβ by CpG-A ODN, whereas induction of TNF-α and IL-12p40 by CpG-A ODN was not affected. CpG-B inhibition of IFN-αβ was observed in FLT3 ligand-induced murine DCs, purified murine myeloid DCs, plasmacytoid DCs, and human PBMCs. CpG-B ODN inhibited induction of IFN-αβ by agonists of multiple receptors, including MyD88-dependent TLRs (CpG-AODN signaling via TLR9, or R837 or Sendai virus signaling via TLR7) and MyD88-independent receptors (polyinosinic:polycytidylic acid signaling via TLR3 or ds break-DNA signaling via a cytosolic pathway). CpG-B ODN did not inhibit the IFN-αβ positive feedback loop second-wave IFN-αβ, because IFN-αβ–induced expression of IFN-αβ was unaffected, and CpG-B inhibition of IFN-αβ was manifested in IFN-αβR−/− DCs, which lack the positive feedback mechanism. Rather, CpG-B ODN inhibited early TLR-induced first wave IFN-α4 and IFN-β. Chromatin immunoprecipitation revealed that association of IFN regulatory factor 1 with the IFN-α4 and IFN-β promoters was induced by CpG-A ODN but not CpG-B ODN. Moreover, CpG-A–induced association of IFN regulatory factor 1 with these promoters was inhibited by CpG-B ODN. Our studies demonstrate a novel mechanism of transcriptional regulation of first-wave IFN-αβ that selectively inhibits induction of IFN-αβ downstream of multiple receptors and may provide targets for future therapeutic inhibition of IFN-αβ expression in vivo. PMID:20181884

  15. Rolling Thunder -- Integration of the Solo 161 Stirling engine with the CPG-460 solar concentrator at Ft. Huachuca

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Diver, R.B.; Moss, T.A.; Goldberg, V.

    Project Rolling Thunder is a dish/Stirling demonstration project at Ft. Huachuca, a US Army fort in southeastern Arizona (Huachuca means rolling thunder in Apache). It has been supported by the Strategic Environmental Research and Development Program (SERDP), a cooperative program between the Department of Defense (DoD) and the Department of Energy (DOE). As part of a 1992 SERDP project, Cummins Power Generation, Inc. (CPG) installed a CPG 7 kW(c) dish/Stirling system at the Joint Interoperability Test Command (JITC) in Ft. Huachuca, Arizona. The primary objective of the SERDP Dish/Stirling for DoD Applications project was to demonstrate a CPG 7-kW(c) dish/Stirlingmore » system at a military facility. Unfortunately, Cummins Engine Company decided to divest its solar operations. As a direct result of Ft. Huachuca`s interest in the Cummins dish/Stirling technology, Sandia explored the possibility of installing a SOLO 161 Stirling power conversion unit (PCU) on the Ft. Huachuca CPG-460. In January 1997, a decision was made to retrofit a SOLO 161 Stirling engine on the CPG-460 at Ft. Huachuca. Project Rolling Thunder. The SOLO 161 Demonstration at Ft. Huachuca has been a challenge. Although, the SOLO 161 PCU has operated nearly flawlessly and the CPG-460 has been, for the most part, a solid and reliable component, integration of the SOLO PCU with the CPG-460 has required significant attention. In this paper, the integration issues and technical approaches of project Rolling Thunder are presented. Lessons of the project are also discussed.« less

  16. Oligodeoxynucleotides Can Transiently Up- and Downregulate CHS Gene Expression in Flax by Changing DNA Methylation in a Sequence-Specific Manner

    PubMed Central

    Dzialo, Magdalena; Szopa, Jan; Czuj, Tadeusz; Zuk, Magdalena

    2017-01-01

    Chalcone synthase (CHS) has been recognized as an essential enzyme in the phenylpropanoid biosynthesis pathway. Apart from the leading role in the production of phenolic compounds with many valuable biological activities beneficial to biomedicine, CHS is well appreciated in science. Genetic engineering greatly facilitates expanding knowledge on the function and genetics of CHS in plants. The CHS gene is one of the most intensively studied genes in flax. In our study, we investigated engineering of the CHS gene through genetic and epigenetic approaches. Considering the numerous restrictions concerning the application of genetically modified (GM) crops, the main purpose of this research was optimization of the plant's modulation via epigenetics. In our study, plants modified through two methods were compared: a widely popular agrotransformation and a relatively recent oligodeoxynucleotide (ODN) strategy. It was recently highlighted that the ODN technique can be a rapid and time-serving antecedent in quick analysis of gene function before taking vector-mediated transformation. In order to understand the molecular background of epigenetic variation in more detail and evaluate the use of ODNs as a tool for predictable and stable gene engineering, we concentrated on the integration of gene expression and gene-body methylation. The treatment of flax with a series of short oligonucleotides homologous to a different part of CHS gene isoforms revealed that those directed to regulatory gene regions (5′- and 3′-UTR) activated gene expression, directed to non-coding region (introns) caused gen activity reduction, while those homologous to a coding region may have a variable influence on its activity. Gene expression changes were accompanied by changes in its methylation status. However, only certain (CCGG) motifs along the gene sequence were affected. The analyzed DNA motifs of the CHS flax gene are more accessible for methylation when located within a CpG island. The

  17. Oligodeoxynucleotides Can Transiently Up- and Downregulate CHS Gene Expression in Flax by Changing DNA Methylation in a Sequence-Specific Manner.

    PubMed

    Dzialo, Magdalena; Szopa, Jan; Czuj, Tadeusz; Zuk, Magdalena

    2017-01-01

    Chalcone synthase (CHS) has been recognized as an essential enzyme in the phenylpropanoid biosynthesis pathway. Apart from the leading role in the production of phenolic compounds with many valuable biological activities beneficial to biomedicine, CHS is well appreciated in science. Genetic engineering greatly facilitates expanding knowledge on the function and genetics of CHS in plants. The CHS gene is one of the most intensively studied genes in flax. In our study, we investigated engineering of the CHS gene through genetic and epigenetic approaches. Considering the numerous restrictions concerning the application of genetically modified (GM) crops, the main purpose of this research was optimization of the plant's modulation via epigenetics. In our study, plants modified through two methods were compared: a widely popular agrotransformation and a relatively recent oligodeoxynucleotide (ODN) strategy. It was recently highlighted that the ODN technique can be a rapid and time-serving antecedent in quick analysis of gene function before taking vector-mediated transformation. In order to understand the molecular background of epigenetic variation in more detail and evaluate the use of ODNs as a tool for predictable and stable gene engineering, we concentrated on the integration of gene expression and gene-body methylation. The treatment of flax with a series of short oligonucleotides homologous to a different part of CHS gene isoforms revealed that those directed to regulatory gene regions (5'- and 3'-UTR) activated gene expression, directed to non-coding region (introns) caused gen activity reduction, while those homologous to a coding region may have a variable influence on its activity. Gene expression changes were accompanied by changes in its methylation status. However, only certain (CCGG) motifs along the gene sequence were affected. The analyzed DNA motifs of the CHS flax gene are more accessible for methylation when located within a CpG island. The

  18. Base Excision Repair of Tandem Modifications in a Methylated CpG Dinucleotide*

    PubMed Central

    Sassa, Akira; Çağlayan, Melike; Dyrkheeva, Nadezhda S.; Beard, William A.; Wilson, Samuel H.

    2014-01-01

    Cytosine methylation and demethylation in tracks of CpG dinucleotides is an epigenetic mechanism for control of gene expression. The initial step in the demethylation process can be deamination of 5-methylcytosine producing the TpG alteration and T:G mispair, and this step is followed by thymine DNA glycosylase (TDG) initiated base excision repair (BER). A further consideration is that guanine in the CpG dinucleotide may become oxidized to 7,8-dihydro-8-oxoguanine (8-oxoG), and this could affect the demethylation process involving TDG-initiated BER. However, little is known about the enzymology of BER of altered in-tandem CpG dinucleotides; e.g. Tp8-oxoG. Here, we investigated interactions between this altered dinucleotide and purified BER enzymes, the DNA glycosylases TDG and 8-oxoG DNA glycosylase 1 (OGG1), apurinic/apyrimidinic (AP) endonuclease 1, DNA polymerase β, and DNA ligases. The overall TDG-initiated BER of the Tp8-oxoG dinucleotide is significantly reduced. Specifically, TDG and DNA ligase activities are reduced by a 3′-flanking 8-oxoG. In contrast, the OGG1-initiated BER pathway is blocked due to the 5′-flanking T:G mispair; this reduces OGG1, AP endonuclease 1, and DNA polymerase β activities. Furthermore, in TDG-initiated BER, TDG remains bound to its product AP site blocking OGG1 access to the adjacent 8-oxoG. These results reveal BER enzyme specificities enabling suppression of OGG1-initiated BER and coordination of TDG-initiated BER at this tandem alteration in the CpG dinucleotide. PMID:24695738

  19. Unique DNA methylome profiles in CpG island methylator phenotype colon cancers

    PubMed Central

    Xu, Yaomin; Hu, Bo; Choi, Ae-Jin; Gopalan, Banu; Lee, Byron H.; Kalady, Matthew F.; Church, James M.; Ting, Angela H.

    2012-01-01

    A subset of colorectal cancers was postulated to have the CpG island methylator phenotype (CIMP), a higher propensity for CpG island DNA methylation. The validity of CIMP, its molecular basis, and its prognostic value remain highly controversial. Using MBD-isolated genome sequencing, we mapped and compared genome-wide DNA methylation profiles of normal, non-CIMP, and CIMP colon specimens. Multidimensional scaling analysis revealed that each specimen could be clearly classified as normal, non-CIMP, and CIMP, thus signifying that these three groups have distinctly different global methylation patterns. We discovered 3780 sites in various genomic contexts that were hypermethylated in both non-CIMP and CIMP colon cancers when compared with normal colon. An additional 2026 sites were found to be hypermethylated in CIMP tumors only; and importantly, 80% of these sites were located in CpG islands. These data demonstrate on a genome-wide level that the additional hypermethylation seen in CIMP tumors occurs almost exclusively at CpG islands and support definitively that these tumors were appropriately named. When these sites were examined more closely, we found that 25% were adjacent to sites that were also hypermethylated in non-CIMP tumors. Thus, CIMP is also characterized by more extensive methylation of sites that are already prone to be hypermethylated in colon cancer. These observations indicate that CIMP tumors have specific defects in controlling both DNA methylation seeding and spreading and serve as an important first step in delineating molecular mechanisms that control these processes. PMID:21990380

  20. CpG island methylator phenotype (CIMP) in cancer: causes and implications.

    PubMed

    Teodoridis, Jens M; Hardie, Catriona; Brown, Robert

    2008-09-18

    Strong evidence exists for a subgroup of tumours, from a variety of tissue types, exhibiting concordant tumour specific DNA methylation: the "CpG island methylator phenotype" (CIMP). Occurrence of CIMP is associated with a range of genetic and environmental factors, although the molecular causes are not well-understood. Both increased expression and aberrant targeting of DNA methyltransferases (DNMTs) could contribute to the occurrence of CIMP. One under-explored area is the possibility that DNA damage may induce or select for CIMP during carcinogenesis or treatment of tumours with chemotherapy. DNA damaging agents can induce DNA damage at guanine rich regions throughout the genome, including CpG islands. This DNA damage can result in stalled DNA synthesis, which will lead to localised increased DNMT1 concentration and therefore potentially increased DNA methylation at these sites. Chemotherapy can select for cells which have increased tolerance to DNA damage due to increased lesion bypass, in some cases by mechanisms which involve inactivation of genes by CpG island methylation. CIMP has been associated with worse patient prognosis, probably due to increased epigenetic plasticity. Therefore, further clinical testing of the diagnostic and prognostic value of the current CIMP markers, as well as increasing our understanding of the molecular causes underlying CIMP are required.

  1. Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity.

    PubMed

    Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M; Tinder, Teresa L; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J; Mukherjee, Pinku

    2012-11-01

    Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo.

  2. Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity

    PubMed Central

    Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M.; Tinder, Teresa L.; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J.

    2013-01-01

    Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo. PMID:22543528

  3. Towards autonomous locomotion: CPG-based control of smooth 3D slithering gait transition of a snake-like robot.

    PubMed

    Bing, Zhenshan; Cheng, Long; Chen, Guang; Röhrbein, Florian; Huang, Kai; Knoll, Alois

    2017-04-04

    Snake-like robots with 3D locomotion ability have significant advantages of adaptive travelling in diverse complex terrain over traditional legged or wheeled mobile robots. Despite numerous developed gaits, these snake-like robots suffer from unsmooth gait transitions by changing the locomotion speed, direction, and body shape, which would potentially cause undesired movement and abnormal torque. Hence, there exists a knowledge gap for snake-like robots to achieve autonomous locomotion. To address this problem, this paper presents the smooth slithering gait transition control based on a lightweight central pattern generator (CPG) model for snake-like robots. First, based on the convergence behavior of the gradient system, a lightweight CPG model with fast computing time was designed and compared with other widely adopted CPG models. Then, by reshaping the body into a more stable geometry, the slithering gait was modified, and studied based on the proposed CPG model, including the gait transition of locomotion speed, moving direction, and body shape. In contrast to sinusoid-based method, extensive simulations and prototype experiments finally demonstrated that smooth slithering gait transition can be effectively achieved using the proposed CPG-based control method without generating undesired locomotion and abnormal torque.

  4. Photoregulating RNA digestion using azobenzene linked dumbbell antisense oligodeoxynucleotides.

    PubMed

    Wu, Li; He, Yujian; Tang, Xinjing

    2015-06-17

    Introduction of 4,4'-bis(hydroxymethyl)-azobenzene (azo) to dumbbell hairpin oligonucleotides at the loop position was able to reversibly control the stability of the whole hairpin structure via UV or visible light irradiation. Here, we designed and synthesized a series of azobenzene linked dumbbell antisense oligodeoxynucleotides (asODNs) containing two terminal hairpins that are composed of an asODN and a short inhibitory sense strand. Thermal melting studies of these azobenzene linked dumbbell asODNs indicated that efficient trans to cis photoisomerization of azobenzene moieties induced large difference in thermal stability (ΔTm = 12.1-21.3 °C). In addition, photomodulation of their RNA binding abilities and RNA digestion by RNase H was investigated. The trans-azobenzene linked asODNs with the optimized base pairs between asODN strands and inhibitory sense strands could only bind few percentage of the target RNA, while it was able to recover their binding to the target RNA and degrade it by RNase H after light irradiation. Upon optimization, it is promising to use these azobenzene linked asODNs for reversible spatial and temporal regulation of antisense activities based on both steric binding and RNA digestion by RNase H.

  5. Extended Plasticity of Visual Cortex in Dark-Reared Animals May Result from Prolonged Expression of cpg15-Like Genes

    PubMed Central

    Lee, Wei-Chung Allen; Nedivi, Elly

    2011-01-01

    cpg15 is an activity-regulated gene that encodes a membrane-bound ligand that coordinately regulates growth of apposing dendritic and axonal arbors and the maturation of their synapses. These properties make it an attractive candidate for participating in plasticity of the mammalian visual system. Here we compare cpg15 expression during normal development of the rat visual system with that seen in response to dark rearing, monocular blockade of retinal action potentials, or monocular deprivation. Our results show that the onset of cpg15 expression in the visual cortex is coincident with eye opening, and it increases until the peak of the critical period at postnatal day 28 (P28). This early expression is independent of both retinal activity and visual experience. After P28, a component of cpg15 expression in the visual cortex, lateral geniculate nucleus (LGN), and superior colliculus (SC) develops a progressively stronger dependence on retinally driven action potentials. Dark rearing does not affect cpg15 mRNA expression in the LGN and SC at any age, but it does significantly affect its expression in the visual cortex from the peak of the critical period and into adulthood. In dark-reared rats, the peak level of cpg15 expression in the visual cortex at P28 is lower than in controls. Rather than showing the normal decline with maturation, these levels are maintained in dark-reared animals. We suggest that the prolonged plasticity in the visual cortex that is seen in dark-reared animals may result from failure to downregulate genes such as cpg15 that could promote structural remodeling and synaptic maturation. PMID:11880509

  6. Quantitative, high-resolution epigenetic profiling of CpG loci identifies associations with cord blood plasma homocysteine and birth weight in humans

    PubMed Central

    Ismail, Khaled MK; Haworth, Kim E; Mein, Charles; Carroll, William D

    2011-01-01

    Supplementation with folic acid during pregnancy is known to reduce the risk of neural tube defects and low birth weight. It is thought that folate and other one-carbon intermediates might secure these clinical effects via DNA methylation. We examined the effects of folate on the human methylome using quantitative interrogation of 27,578 CpG loci associated with 14,496 genes at single-nucleotide resolution across 12 fetal cord blood samples. Consistent with previous studies, the majority of CpG dinucleotides located within CpG islands exhibited hypomethylation while those outside CpG islands showed mid-high methylation. However, for the first time in human samples, unbiased analysis of methylation across samples revealed a significant correlation of methylation patterns with plasma homocysteine, LINE-1 methylation and birth weight centile. Additionally, CpG methylation significantly correlated with either birth weight or LINE-1 methylation were predominantly located in CpG islands. These data indicate that levels of folate-associated intermediates in cord blood reflect their influence and consequences for the fetal epigenome and potentially on pregnancy outcome. In these cases, their influence might be exerted during late gestation or reflect those present during the peri-conceptual period. PMID:20864804

  7. Synthesis of peptide nucleic acids containing pyridazine derivatives as cytosine and thymine analogs, and their duplexes with complementary oligodeoxynucleotides.

    PubMed

    Tomori, Takahito; Miyatake, Yuya; Sato, Yuta; Kanamori, Takashi; Masaki, Yoshiaki; Ohkubo, Akihiro; Sekine, Mitsuo; Seio, Kohji

    2015-03-20

    Synthesis of peptide nucleic acids (PNAs) is reported with new pyridazine-type nucleobases: 3-aminopyridazine (aPz) and 1-aminophthalazine (aPh) as cytosine analogs, and pyridazin-3-one (Pz(O)) and phthalazin-1-one (Ph(O)) as thymine analogs. The PNAs having an aPz or a Pz(O) formed duplexes with each complementary oligodeoxynucleotide forming a base pair with G or A, respectively, as evaluated by using UV melting analyses and circular dichroism (CD) spectra.

  8. A CpG Oligonucleotide Can Protect Mice From a Low Aerosol Challenge Dose of Burkholderia mallei

    DTIC Science & Technology

    2006-03-01

    may protect victims of a biological attack from glanders . Burkholderia mallei , the causative agent of glanders , natu- rally infects equines, but it can...attack from glanders . 15. SUBJECT TERMS Burkholderia mallei , glanders , oligonucleotides, CpG motif, efficacy, laboratory animals, mice 16...Society for Microbiology. All Rights Reserved. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei David M

  9. Regulation of glutamate receptor internalization by the spine cytoskeleton is mediated by its PKA-dependent association with CPG2

    PubMed Central

    Loebrich, Sven; Djukic, Biljana; Tong, Zachary J.; Cottrell, Jeffrey R.; Turrigiano, Gina G.; Nedivi, Elly

    2013-01-01

    A key neuronal mechanism for adjusting excitatory synaptic strength is clathrin-mediated endocytosis of postsynaptic glutamate receptors (GluRs). The actin cytoskeleton is critical for clathrin-mediated endocytosis, yet we lack a mechanistic understanding of its interaction with the endocytic process and how it may be regulated. Here we show that F-actin in dendritic spines physically binds the synaptic nuclear envelope 1 gene product candidate plasticity gene 2 (CPG2) in a PKA-dependent manner, and that this association is required for synaptic GluR internalization. Mutating two PKA sites on CPG2 disrupts its cytoskeletal association, attenuating GluR endocytosis and affecting the efficacy of synaptic transmission in vivo. These results identify CPG2 as an F-actin binding partner that functionally mediates interaction of the spine cytoskeleton with postsynaptic endocytosis. Further, the regulation of CPG2/F-actin association by PKA provides a gateway for cellular control of synaptic receptor internalization through second messenger signaling pathways. Recent identification of human synaptic nuclear envelope 1 as a risk locus for bipolar disorder suggests that CPG2 could play a role in synaptic dysfunction underlying neuropsychiatric disease. PMID:24191017

  10. CpG Sites Associated with Cigarette Smoking: Analysis of Epigenome-Wide Data from the Sister Study

    PubMed Central

    Harlid, Sophia; Xu, Zongli; Panduri, Vijayalakshmi; Sandler, Dale P.

    2014-01-01

    Background: Smoking increases the risk of many diseases, and it is also linked to blood DNA methylation changes that may be important in disease etiology. Objectives: We sought to identify novel CpG sites associated with cigarette smoking. Methods: We used two epigenome-wide data sets from the Sister Study to identify and confirm CpG sites associated with smoking. One included 908 women with methylation measurements at 27,578 CpG sites using the HumanMethylation27 BeadChip; the other included 200 women with methylation measurements for 473,844 CpG sites using the HumanMethylation450 BeadChip. Significant CpGs from the second data set that were not included in the 27K assay were validated by pyrosequencing in a subset of 476 samples from the first data set. Results: Our study successfully confirmed smoking associations for 9 previously established CpGs and identified 2 potentially novel CpGs: cg26764244 in GNG12 (p = 9.0 × 10–10) and cg22335340 in PTPN6 (p = 2.9 × 10–05). We also found strong evidence of an association between smoking status and cg02657160 in CPOX (p = 7.3 × 10–7), which has not been previously reported. All 12 CpGs were undermethylated in current smokers and showed an increasing percentage of methylation in former and never-smokers. Conclusions: We identified 2 potentially novel smoking related CpG sites, and provided independent replication of 10 previously reported CpGs sites related to smoking, one of which is situated in the gene CPOX. The corresponding enzyme is involved in heme biosynthesis, and smoking is known to increase heme production. Our study extends the evidence base for smoking-related changes in DNA methylation. Citation: Harlid S, Xu Z, Panduri V, Sandler DP, Taylor JA. 2014. CpG sites associated with cigarette smoking: analysis of epigenome-wide data from the Sister Study. Environ Health Perspect 122:673–678; http://dx.doi.org/10.1289/ehp.1307480 PMID:24704585

  11. CPG2 Recruits Endophilin B2 to the Cytoskeleton for Activity-Dependent Endocytosis of Synaptic Glutamate Receptors.

    PubMed

    Loebrich, Sven; Benoit, Marc Robert; Konopka, Jaclyn Aleksandra; Cottrell, Jeffrey Richard; Gibson, Joanne; Nedivi, Elly

    2016-02-08

    Internalization of glutamate receptors at the postsynaptic membrane via clathrin-mediated endocytosis (CME) is a key mechanism for regulating synaptic strength. A role for the F-actin cytoskeleton in CME is well established, and recently, PKA-dependent association of candidate plasticity gene 2 (CPG2) with the spine-cytoskeleton has been shown to mediate synaptic glutamate receptor internalization. Yet, how the endocytic machinery is physically coupled to the actin cytoskeleton to facilitate glutamate receptor internalization has not been demonstrated. Moreover, there has been no distinction of endocytic-machinery components that are specific to activity-dependent versus constitutive glutamate receptor internalization. Here, we show that CPG2, through a direct physical interaction, recruits endophilin B2 (EndoB2) to F-actin, thus anchoring the endocytic machinery to the spine cytoskeleton and facilitating glutamate receptor internalization. Regulation of CPG2 binding to the actin cytoskeleton by protein kinase A directly impacts recruitment of EndoB2 and clathrin. Specific disruption of EndoB2 or the CPG2-EndoB2 interaction impairs activity-dependent, but not constitutive, internalization of both NMDA- and AMPA-type glutamate receptors. These results demonstrate that, through direct interactions with F-actin and EndoB2, CPG2 physically bridges the spine cytoskeleton and the endocytic machinery, and this tripartite association is critical specifically for activity-dependent CME of synaptic glutamate receptors. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Enhanced early innate and T cell-mediated responses in subjects immunized with Anthrax Vaccine Adsorbed Plus CPG 7909 (AV7909).

    PubMed

    Minang, Jacob T; Inglefield, Jon R; Harris, Andrea M; Lathey, Janet L; Alleva, David G; Sweeney, Diane L; Hopkins, Robert J; Lacy, Michael J; Bernton, Edward W

    2014-11-28

    NuThrax™ (Anthrax Vaccine Adsorbed with CPG 7909 Adjuvant) (AV7909) is in development. Samples obtained in a phase Ib clinical trial were tested to confirm biomarkers of innate immunity and evaluate effects of CPG 7909 (PF-03512676) on adaptive immunity. Subjects received two intramuscular doses of commercial BioThrax(®) (Anthrax Vaccine Adsorbed, AVA), or two intramuscular doses of one of four formulations of AV7909. IP-10, IL-6, and C-reactive protein (CRP) levels were elevated 24-48 h after administration of AV7909 formulations, returning to baseline by Day 7. AVA (no CPG 7909) resulted in elevated IL-6 and CRP, but not IP-10. Another marker of CpG, transiently decreased absolute lymphocyte counts (ALCs), correlated with transiently increased IP-10. Cellular recall responses to anthrax protective antigen (PA) or PA peptides were assessed by IFN-γ ELISpot assay performed on cryopreserved PBMCs obtained from subjects prior to immunization and 7 days following the second immunization (study day 21). One-half of subjects that received AV7909 with low-dose (0.25mg/dose) CPG 7909 possessed positive Day 21 T cell responses to PA. In contrast, positive T cell responses occurred at an 11% average rate (1/9) for AVA-treated subjects. Differences in cellular responses due to dose level of CPG 7909 were not associated with differences in humoral anti-PA IgG responses, which were elevated for recipients of AV7909 compared to recipients of AVA. Serum markers at 24 or 48 h (i.e. % ALC decrease, or increase in IL-6, IP-10, or CRP) correlated with the humoral (antibody) responses 1 month later, but did not correlate with cellular ELISpot responses. In summary, biomarkers of early responses to CPG 7909 were confirmed, and adding a CpG adjuvant to a vaccine administered twice resulted in increased T cell effects relative to vaccine alone. Changes in early biomarkers correlated with subsequent adaptive humoral immunity but not cellular immunity. Copyright © 2014 The Authors

  13. Silencing of GSTP1 gene by CpG island DNA hypermethylation in HBV-associated hepatocellular carcinomas.

    PubMed

    Zhong, Sheng; Tang, Mandy W; Yeo, Winnie; Liu, Cuiling; Lo, Y M Dennis; Johnson, Philip J

    2002-04-01

    Glutathione S-transferases, enzymes that defend cells against damage mediated by oxidant and electrophilic carcinogens, may be critical determinants of cancer pathogenesis. In this report, we assess the role of epigenetic silencing of the GSTP1 gene, a gene encoding the pi-class glutathione S-transferase, in the pathogenesis of hepatitis B virus (HBV)-associated hepatocellular carcinomas (HCC). The cell lines Hep3B, HepG2, and a cohort of 43 HBV-associated HCC tissue specimens and corresponding nontumor tissues were subjected to analysis for GSTP1 epigenetic alteration and expression. GSTP1 "CpG" island DNA hypermethylation in the liver cell lines, and the tissue specimens were determined by methylation-specific PCR and correlated with expression of the gene using reverse-transcription PCR, immunoblotting, and immunohistochemistry. GSTP1 CpG island DNA hypermethylation was detected in 28 of 43 (65.1%) HCC tissues and 4 of 40 (10%) corresponding nontumor tissues. GSTP1 protein was absent in those cases showing hypermethylation of the gene. Similarly, DNA from Hep3B and HepG2 cell lines displayed complete GSTP1 hypermethylation in the CpG island, and they failed to express GSTP1 mRNA and the corresponding protein product. Treatment of the cell lines with the DNA methyltransferase inhibitor 5-aza-deoxycytidine reversed the hypermethylation, and restored GSTP1 mRNA and polypeptide expression. These data indicate that epigenetic silencing of GSTP1 gene expression by CpG island DNA hypermethylation is common in human HBV-associated HCC. In addition, somatic GSTP1 inactivation via CpG island hypermethylation may contribute to the pathogenesis of this malignancy.

  14. Exosome-based tumor antigens-adjuvant co-delivery utilizing genetically engineered tumor cell-derived exosomes with immunostimulatory CpG DNA.

    PubMed

    Morishita, Masaki; Takahashi, Yuki; Matsumoto, Akihiro; Nishikawa, Makiya; Takakura, Yoshinobu

    2016-12-01

    For cancer immunotherapy via tumor antigen vaccination in combination with an adjuvant, major challenges include the identification of a particular tumor antigen and efficient delivery of the antigen as well as adjuvant to antigen-presenting cells. In this study, we proposed an efficient exosome-based tumor antigens-adjuvant co-delivery system using genetically engineered tumor cell-derived exosomes containing endogenous tumor antigens and immunostimulatory CpG DNA. Murine melanoma B16BL6 cells were transfected with a plasmid vector encoding a fusion streptavidin (SAV; a protein that binds to biotin with high affinity)-lactadherin (LA; an exosome-tropic protein) protein, yielding genetically engineered SAV-LA-expressing exosomes (SAV-exo). SAV-exo were combined with biotinylated CpG DNA to prepare CpG DNA-modified exosomes (CpG-SAV-exo). Fluorescent microscopic observation revealed the successful modification of exosomes with CpG DNA by SAV-biotin interaction. CpG-SAV-exo showed efficient and simultaneous delivery of exosomes with CpG DNA to murine dendritic DC2.4 cells in culture. Treatment with CpG-SAV-exo effectively activated DC2.4 cells and enhanced tumor antigen presentation capacity. Immunization with CpG-SAV-exo exhibited stronger in vivo antitumor effects in B16BL6 tumor-bearing mice than simple co-administration of exosomes and CpG DNA. Thus, genetically engineered CpG-SAV-exo is an effective exosome-based tumor antigens-adjuvant co-delivery system that will be useful for cancer immunotherapy. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Use of DNA from human stools to detect aberrant CpG island methylation of genes implicated in colorectal cancer.

    PubMed

    Belshaw, Nigel J; Elliott, Giles O; Williams, Elizabeth A; Bradburn, David M; Mills, Sarah J; Mathers, John C; Johnson, Ian T

    2004-09-01

    Hypermethylation of cytosine residues in the CpG islands of tumor suppressor genes is a key mechanism of colorectal carcinogenesis. Detection and quantification of CpG island methylation in human DNA isolated from stools might provide a novel strategy for the detection and investigation of colorectal neoplasia. To explore the feasibility of this approach, colorectal biopsies and fecal samples were obtained from 32 patients attending for colonoscopy or surgery, who were found to have adenomatous polyps, colorectal cancer, or no evidence of neoplasia. A further 18 fecal samples were obtained from healthy volunteers, with no bowel symptoms. Isolated DNA was modified with sodium bisulfite and analyzed by methylation-specific PCR and combined bisulfite restriction analysis for CpG island methylation of ESR1, MGMT, HPP1, p16(INK4a), APC, and MLH1. CpG island methylation was readily detectable in both mucosal and fecal DNA with methylation-specific PCR. Using combined bisulfite restriction analysis, it was established that, in volunteers from whom biopsies were available, the levels of methylation at two CpG sites within ESR1 assayed using fecal DNA were significantly correlated with methylation in DNA from colorectal mucosa. Thus, noninvasive techniques can be used to obtain quantitative information about the level of CpG island methylation in human colorectal mucosa. The methods described here could be applied to a much expanded range of genes and may be valuable both for screening purposes and to provide greater insight into the functional consequences of epigenetic changes in the colorectal mucosa of free-living individuals.

  16. Intercalation of aflatoxin B sub 1 in two oligodeoxynucleotide adducts: Comparative sup 1 H NMR analysis of d(ATC sup AFB GAT)ter dot d(ATCGAT) and d(AT sup ATB GCAT) sub 2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gopalakrishnan, S.; Harris, T.M.; Stone, M.P.

    8,9-Dihydro-8-(N7-guanyl-(d(ATCGAT)))-9-hydroxyaflatoxin B{sub 1}{center dot}d(ATCGAT) and 8,9-dihydro-8-(N7-guanyl-(d(ATGCAT)))-9-hydroxyafltoxin B{sub 1}{center dot}8,9-dihydro-8-(N7-guanyl-(d(ATGCAT)))-9-hydroxyaflatoxin B{sub 1} were prepared by direct addition of aflatoxin B{sub 1} 8,9-expoxide to d(ATCGAT){sub 2} and d(ATGCAT){sub 2}, respectively. {sup 1}H NOE experiments, nonselective {sup 1}H T{sub 1} relaxation measurements, and {sup 1}H chemical shift perturbations demonstrate that in both modified oligodeoxynucleotides the aflatoxin moiety is intercalated above the 5{prime}-face of the modified guanine. The oligodeoxynucleotides remain right-handed, and perturbation of the B-DNA structure is localized adjacent to the adducted guanine. Aflatoxin-oligodeoxynucleotide {sup 1}H NOEs are observed between aflatoxin and the 5{prime}-neighbor base pair and include both the major groove andmore » the minor groove. The protons at C8 and C9 of the aflatoxin terminal furan ring exhibit slower spin-lattice relaxation as compared to other oligodeoxynucleotide protons, which supports the conclusion that they face into the major groove. Increased shielding is observed for aflatoxin protons. The difference in reaction stoichiometry is consistent with an intercalated transition-state complex between aflatoxin B{sub 1} 8,9-epoxide and B-DNA. Intercalation provides excellent positioning for nucleophilic attack by guanine N7 on aflatoxin B{sub 1} 8,9-epoxide, which probably accounts for the observed efficiency of adduct formation despite the relatively low DNA binding affinity observed for aflatoxin B{sub 1}.« less

  17. Structural impact of complete CpG methylation within target DNA on specific complex formation of the inducible transcription factor Egr-1.

    PubMed

    Zandarashvili, Levani; White, Mark A; Esadze, Alexandre; Iwahara, Junji

    2015-07-08

    The inducible transcription factor Egr-1 binds specifically to 9-bp target sequences containing two CpG sites that can potentially be methylated at four cytosine bases. Although it appears that complete CpG methylation would make an unfavorable steric clash in the previous crystal structures of the complexes with unmethylated or partially methylated DNA, our affinity data suggest that DNA recognition by Egr-1 is insensitive to CpG methylation. We have determined, at a 1.4-Å resolution, the crystal structure of the Egr-1 zinc-finger complex with completely methylated target DNA. Structural comparison of the three different methylation states reveals why Egr-1 can recognize the target sequences regardless of CpG methylation. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  18. Multi-step aberrant CpG island hyper-methylation is associated with the progression of adult T-cell leukemia/lymphoma.

    PubMed

    Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

    2010-01-01

    Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers.

  19. Multi-Step Aberrant CpG Island Hyper-Methylation Is Associated with the Progression of Adult T–Cell Leukemia/Lymphoma

    PubMed Central

    Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

    2010-01-01

    Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers. PMID:20019193

  20. Selective inhibition of alpha1B-adrenergic receptor expression and function using a phosphorothioate antisense oligodeoxynucleotide.

    PubMed

    Gonzalez-Cabrera, P J; Iversen, P L; Liu, M F; Scofield, M A; Jeffries, W B

    1998-06-01

    To investigate alpha1B-adrenoceptor function, we developed a phosphorothioate antisense oligodeoxynucleotide (AO) to inhibit the expression of the alpha1B-adrenoceptor subtype in DDT1 MF2 cells. We measured the cellular uptake of the AO and its effect on alpha1B-adrenoceptor mRNA expression, protein density, and coupling to phospholipase C. Cells treated with either a control oligodeoxynucleotide (CO) or medium alone served as control groups. Confocal microscopy demonstrated that DDT1 MF2 cells internalized carboxyfluorescein-labeled (FAM) AO within 30 min. Analysis of cellular lysates showed that approximately 50% of the intracellular FAM-AO was present as an intact 18-mer for up to 48 hr. Incubation of cells with AO for 48 hr decreased alpha1B-adrenoceptor density ([3H]prazosin Bmax) versus control groups by 12% (1 microM AO) and 72% (10 microM AO). In time course experiments, AO (10 microM) reduced alpha1B-adrenoceptor density by 28, 64, and 68% versus controls after 24, 48, and 72 hr of exposure, respectively. alpha1B-Adrenoceptor mRNA concentration (measured by RT-PCR) was reduced by 25% in cells treated for 48 hr with 10 microM AO versus controls. AO pretreatment (10 microM, 48 hr) reduced the maximum response to agonist-stimulated [3H]inositol phosphate accumulation. The maximal response of the full agonist norepinephrine was reduced by 30% after AO treatment, and by 73% for the partial agonist naphazoline. In contrast, AO did not affect histamine-stimulated total [3H]inositol phosphate accumulation. Thus, AO effectively reduced alpha1B-adrenoceptor subtype expression and function in vitro, suggesting a potential to selectively inhibit alpha1B-adrenoceptor function in vivo.

  1. CpG Methylation Analysis—Current Status of Clinical Assays and Potential Applications in Molecular Diagnostics

    PubMed Central

    Sepulveda, Antonia R.; Jones, Dan; Ogino, Shuji; Samowitz, Wade; Gulley, Margaret L.; Edwards, Robin; Levenson, Victor; Pratt, Victoria M.; Yang, Bin; Nafa, Khedoudja; Yan, Liying; Vitazka, Patrick

    2009-01-01

    Methylation of CpG islands in gene promoter regions is a major molecular mechanism of gene silencing and underlies both cancer development and progression. In molecular oncology, testing for the CpG methylation of tissue DNA has emerged as a clinically useful tool for tumor detection, outcome prediction, and treatment selection, as well as for assessing the efficacy of treatment with the use of demethylating agents and monitoring for tumor recurrence. In addition, because CpG methylation occurs early in pre-neoplastic tissues, methylation tests may be useful as markers of cancer risk in patients with either infectious or inflammatory conditions. The Methylation Working Group of the Clinical Practice Committee of the Association of Molecular Pathology has reviewed the current state of clinical testing in this area. We report here our summary of both the advantages and disadvantages of various methods, as well as the needs for standardization and reporting. We then conclude by summarizing the most promising areas for future clinical testing in cancer molecular diagnostics. PMID:19541921

  2. Decreased interferon-α production in response to CpG DNA dysregulates cytokine responses in patients with multiple sclerosis.

    PubMed

    Hirotani, Makoto; Niino, Masaaki; Fukazawa, Toshiyuki; Yaguchi, Hiroaki; Nakamura, Masakazu; Kikuchi, Seiji; Sasaki, Hidenao

    2012-05-01

    Type I interferons (IFNs), represented by IFN-α and β, activate immune effector cells belonging to the innate and adaptive immune systems. Plasmacytoid dendritic cells (pDCs) produce IFN-α in response to CpG DNA. We aimed to examine the impact of pDC-produced IFN-α on the adaptive immune system in Multiple Sclerosis (MS). Our results demonstrated that CpG DNA-induced IFN-α production was significantly decreased in PBMCs from MS patients. Decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were found in CpG DNA-treated PBMCs of healthy subjects unlike in those from MS patients. In samples pre-treated with IFN-α and IFN-β, decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were detected in PBMCs from MS patients. These results suggest that CpG DNA-induced decreased IFN-α production causes pro-inflammatory cytokine secretion, and either IFN-α or IFN-β induces anti-inflammatory cytokine secretion in the adaptive immune system in MS. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. In Vivo Control of CpG and Non-CpG DNA Methylation by DNA Methyltransferases

    PubMed Central

    Arand, Julia; Spieler, David; Karius, Tommy; Branco, Miguel R.; Meilinger, Daniela; Meissner, Alexander; Jenuwein, Thomas; Xu, Guoliang; Leonhardt, Heinrich; Wolf, Verena; Walter, Jörn

    2012-01-01

    The enzymatic control of the setting and maintenance of symmetric and non-symmetric DNA methylation patterns in a particular genome context is not well understood. Here, we describe a comprehensive analysis of DNA methylation patterns generated by high resolution sequencing of hairpin-bisulfite amplicons of selected single copy genes and repetitive elements (LINE1, B1, IAP-LTR-retrotransposons, and major satellites). The analysis unambiguously identifies a substantial amount of regional incomplete methylation maintenance, i.e. hemimethylated CpG positions, with variant degrees among cell types. Moreover, non-CpG cytosine methylation is confined to ESCs and exclusively catalysed by Dnmt3a and Dnmt3b. This sequence position–, cell type–, and region-dependent non-CpG methylation is strongly linked to neighboring CpG methylation and requires the presence of Dnmt3L. The generation of a comprehensive data set of 146,000 CpG dyads was used to apply and develop parameter estimated hidden Markov models (HMM) to calculate the relative contribution of DNA methyltransferases (Dnmts) for de novo and maintenance DNA methylation. The comparative modelling included wild-type ESCs and mutant ESCs deficient for Dnmt1, Dnmt3a, Dnmt3b, or Dnmt3a/3b, respectively. The HMM analysis identifies a considerable de novo methylation activity for Dnmt1 at certain repetitive elements and single copy sequences. Dnmt3a and Dnmt3b contribute de novo function. However, both enzymes are also essential to maintain symmetrical CpG methylation at distinct repetitive and single copy sequences in ESCs. PMID:22761581

  4. Methylated site display (MSD)-AFLP, a sensitive and affordable method for analysis of CpG methylation profiles.

    PubMed

    Aiba, Toshiki; Saito, Toshiyuki; Hayashi, Akiko; Sato, Shinji; Yunokawa, Harunobu; Maruyama, Toru; Fujibuchi, Wataru; Kurita, Hisaka; Tohyama, Chiharu; Ohsako, Seiichiroh

    2017-03-09

    It has been pointed out that environmental factors or chemicals can cause diseases that are developmental in origin. To detect abnormal epigenetic alterations in DNA methylation, convenient and cost-effective methods are required for such research, in which multiple samples are processed simultaneously. We here present methylated site display (MSD), a unique technique for the preparation of DNA libraries. By combining it with amplified fragment length polymorphism (AFLP) analysis, we developed a new method, MSD-AFLP. Methylated site display libraries consist of only DNAs derived from DNA fragments that are CpG methylated at the 5' end in the original genomic DNA sample. To test the effectiveness of this method, CpG methylation levels in liver, kidney, and hippocampal tissues of mice were compared to examine if MSD-AFLP can detect subtle differences in the levels of tissue-specific differentially methylated CpGs. As a result, many CpG sites suspected to be tissue-specific differentially methylated were detected. Nucleotide sequences adjacent to these methyl-CpG sites were identified and we determined the methylation level by methylation-sensitive restriction endonuclease (MSRE)-PCR analysis to confirm the accuracy of AFLP analysis. The differences of the methylation level among tissues were almost identical among these methods. By MSD-AFLP analysis, we detected many CpGs showing less than 5% statistically significant tissue-specific difference and less than 10% degree of variability. Additionally, MSD-AFLP analysis could be used to identify CpG methylation sites in other organisms including humans. MSD-AFLP analysis can potentially be used to measure slight changes in CpG methylation level. Regarding the remarkable precision, sensitivity, and throughput of MSD-AFLP analysis studies, this method will be advantageous in a variety of epigenetics-based research.

  5. Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration.

    PubMed

    Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu

    2015-01-01

    Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn't affect Egf mRNA expression during the re-organization phase.

  6. Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration

    PubMed Central

    Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu

    2015-01-01

    Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn’t affect Egf mRNA expression during the re-organization phase. PMID:26464832

  7. A quick and simple FISH protocol with hybridization-sensitive fluorescent linear oligodeoxynucleotide probes

    PubMed Central

    Wang, Dan Ohtan; Matsuno, Hitomi; Ikeda, Shuji; Nakamura, Akiko; Yanagisawa, Hiroyuki; Hayashi, Yasunori; Okamoto, Akimitsu

    2012-01-01

    Fluorescence in situ hybridization (FISH) is a powerful tool used in karyotyping, cytogenotyping, cancer diagnosis, species specification, and gene-expression analysis. Although widely used, conventional FISH protocols are cumbersome and time consuming. We have now developed a FISH method using exciton-controlled hybridization-sensitive fluorescent oligodeoxynucleotide (ECHO) probes. ECHO–FISH uses a 25-min protocol from fixation to mounting that includes no stringency washing steps. We use ECHO–FISH to detect both specific DNA and RNA sequences with multicolor probes. ECHO–FISH is highly reproducible, stringent, and compatible with other fluorescent cellular labeling techniques. The resolution allows detection of intranuclear speckles of poly(A) RNA in HeLa cells and dissociated hippocampal primary cultures, and mRNAs in the distal dendrites of hippocampal neurons. We also demonstrate detection of telomeric and centromeric DNA on metaphase mouse chromosomes. The simplicity of the ECHO–FISH method will likely accelerate cytogenetic and gene-expression analysis with high resolution. PMID:22101241

  8. FPGA implementation of a configurable neuromorphic CPG-based locomotion controller.

    PubMed

    Barron-Zambrano, Jose Hugo; Torres-Huitzil, Cesar

    2013-09-01

    Neuromorphic engineering is a discipline devoted to the design and development of computational hardware that mimics the characteristics and capabilities of neuro-biological systems. In recent years, neuromorphic hardware systems have been implemented using a hybrid approach incorporating digital hardware so as to provide flexibility and scalability at the cost of power efficiency and some biological realism. This paper proposes an FPGA-based neuromorphic-like embedded system on a chip to generate locomotion patterns of periodic rhythmic movements inspired by Central Pattern Generators (CPGs). The proposed implementation follows a top-down approach where modularity and hierarchy are two desirable features. The locomotion controller is based on CPG models to produce rhythmic locomotion patterns or gaits for legged robots such as quadrupeds and hexapods. The architecture is configurable and scalable for robots with either different morphologies or different degrees of freedom (DOFs). Experiments performed on a real robot are presented and discussed. The obtained results demonstrate that the CPG-based controller provides the necessary flexibility to generate different rhythmic patterns at run-time suitable for adaptable locomotion. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Improvement of the Immunogenicity of Porcine Circovirus Type 2 DNA Vaccine by Recombinant ORF2 Gene and CpG Motifs.

    PubMed

    Li, Jun; Shi, Jian-Li; Wu, Xiao-Yan; Fu, Fang; Yu, Jiang; Yuan, Xiao-Yuan; Peng, Zhe; Cong, Xiao-Yan; Xu, Shao-Jian; Sun, Wen-Bo; Cheng, Kai-Hui; Du, Yi-Jun; Wu, Jia-Qiang; Wang, Jin-Bao; Huang, Bao-Hua

    2015-06-01

    Nowadays, adjuvant is still important for boosting immunity and improving resistance in animals. In order to boost the immunity of porcine circovirus type 2 (PCV2) DNA vaccine, CpG motifs were inserted. In this study, the dose-effect was studied, and the immunity of PCV2 DNA vaccines by recombinant open reading frame 2 (ORF2) gene and CpG motifs was evaluated. Three-week-old Changbai piglets were inoculated intramuscularly with 200 μg, 400 μg, and 800 μg DNA vaccines containing 14 and 18 CpG motifs, respectively. Average gain and rectum temperature were recorded everyday during the experiments. Blood was collected from the piglets after vaccination to detect the changes of specific antibodies, interleukin-2, and immune cells every week. Tissues were collected for histopathology and polymerase chain reaction. The results indicated that compared to those of the control piglets, all concentrations of two DNA vaccines could induce PCV2-specific antibodies. A cellular immunity test showed that PCV2-specific lymphocytes proliferated the number of TH, TC, and CD3+ positive T-cells raised in the blood of DNA vaccine immune groups. There was no distinct pathological damage and viremia occurring in pigs that were inoculated with DNA vaccines, but there was some minor pathological damage in the control group. The results demonstrated that CpG motifs as an adjuvant could boost the humoral and cellular immunity of pigs to PCV2, especially in terms of cellular immunity. Comparing two DNA vaccines that were constructed, the one containing 18 CpG motifs was more effective. This is the first report that CpG motifs as an adjuvant insert to the PCV2 DNA vaccine could boost immunity.

  10. Targeted-bisulfite sequence analysis of the methylation of CpG islands in genes encoding PNPLA3, SAMM50, and PARVB of patients with non-alcoholic fatty liver disease.

    PubMed

    Kitamoto, Takuya; Kitamoto, Aya; Ogawa, Yuji; Honda, Yasushi; Imajo, Kento; Saito, Satoru; Yoneda, Masato; Nakamura, Takahiro; Nakajima, Atsushi; Hotta, Kikuko

    2015-08-01

    The pathogenesis of non-alcoholic fatty liver disease (NAFLD) is affected by epigenetic factors as well as by genetic variation. We performed targeted-bisulfite sequencing to determine the levels of DNA methylation of 4 CpG islands (CpG99, CpG71, CpG26, and CpG101) in the regulatory regions of PNPLA3, SAMM50, PARVB variant 1, and PARVB variant 2, respectively. We compared the levels of methylation of DNA in the livers of the first and second sets of patients with mild (fibrosis stages 0 and 1) or advanced (fibrosis stages 2 to 4) NAFLD and in those of patients with mild (F0 to F2) or advanced (F3 and F4) chronic hepatitis C infection. The hepatic mRNA levels of PNPLA3, SAMM50, and PARVB were measured using qPCR. CpG26, which resides in the regulatory region of PARVB variant 1, was markedly hypomethylated in the livers of patients with advanced NAFLD. Conversely, CpG99 in the regulatory region of PNPLA3 was substantially hypermethylated in these patients. These differences in DNA methylation were replicated in a second set of patients with NAFLD or chronic hepatitis C. PNPLA3 mRNA levels in the liver of the same section of a biopsy specimen used for genomic DNA preparation were lower in patients with advanced NAFLD compared with those with mild NAFLD and correlated inversely with CpG99 methylation in liver DNA. Moreover, the levels of CpG99 methylation and PNPLA3 mRNA were affected by the rs738409 genotype. Hypomethylation of CpG26 and hypermethylation of CpG99 may contribute to the severity of fibrosis in patients with NAFLD or chronic hepatitis C infection. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  11. Racial Differences in DNA-Methylation of CpG Sites Within Preterm-Promoting Genes and Gene Variants.

    PubMed

    Salihu, H M; Das, R; Morton, L; Huang, H; Paothong, A; Wilson, R E; Aliyu, M H; Salemi, J L; Marty, P J

    2016-08-01

    Objective To evaluate the role DNA methylation may play in genes associated with preterm birth for higher rates of preterm births in African-American women. Methods Fetal cord blood samples from births collected at delivery and maternal demographic and medical information were used in a cross-sectional study to examine fetal DNA methylation of genes implicated in preterm birth among black and non-black infants. Allele-specific DNA methylation analysis was performed using a methylation bead array. Targeted maximum likelihood estimation was applied to examine the relationship between race and fetal DNA methylation of candidate preterm birth genes. Receiver-operating characteristic analyses were then conducted to validate the CpG site methylation marker within the two racial groups. Bootstrapping, a method of validation and replication, was employed. Results 42 CpG sites were screened within 20 candidate gene variants reported consistently in the literature as being associated with preterm birth. Of these, three CpG sites on TNFAIP8 and PON1 genes (corresponding to: cg23917399; cg07086380; and cg07404485, respectively) were significantly differentially methylated between black and non-black individuals. The three CpG sites showed lower methylation status among infants of black women. Bootstrapping validated and replicated results. Conclusion for Practice Our study identified significant differences in levels of methylation on specific genes between black and non-black individuals. Understanding the genetic/epigenetic mechanisms that lead to preterm birth may lead to enhanced prevention strategies to reduce morbidity and mortality by eventually providing a means to identify individuals with a genetic predisposition to preterm labor.

  12. [The effect of entrapment of CpG sequence with cationic PLG nanoparticles on the immune responses of mice to pig paratyphoid vaccine].

    PubMed

    Wu, Mei; Shi, Ling; Liu, Shigui; Li, Jiangling; Wu, Kaiyuan; Wang, Lihuan; Shen, Yi; Liu, Kun; Zheng, Yong; Zhang, Xinshen; Gao, Rong

    2005-10-01

    Cationic PLG nanoparticles and liposome were prepared and used as package molecules to pack up pUC18-CpG. The effects of the packed pUC18-CpG on the cellular and humoral immune responses were detected in the mice that were inoculated with pig paratyphoid vaccine. The results showed that compared with the control, the amount of IgG and the titre of specific antibody were significantly increased in the sera of mice immunized with the CpG plasmid entrapped by cationic PLG nanoparticles; the proliferation and induced IL-2 bioactivity of lymphocytes were significantly enhanced in the spleen of the immunized mice; the stimulatory effect of cationic PLG nanoparticles was similar to or stronger than that of cationic liposome. These indicated that cationic PLG nanoparticle could be employed as an effective package molecule to promote the immunostimulatory effect of pUC18-CpG.

  13. A distinct group of CpG islands shows differential DNA methylation between replicas of the same cell line in vitro

    PubMed Central

    2013-01-01

    Background CpG dinucleotide-rich genomic DNA regions, known as CpG islands (CGIs), can be methylated at their cytosine residues as an epigenetic mark that is stably inherited during cell mitosis. Differentially methylated regions (DMRs) are genomic regions showing different degrees of DNA methylation in multiple samples. In this study, we focused our attention on CGIs showing different DNA methylation between two culture replicas of the same cell line. Results We used methylation data of 35 cell lines from the Encyclopedia of DNA Elements (ENCODE) consortium to identify CpG islands that were differentially methylated between replicas of the same cell line and denoted them Inter Replicas Differentially Methylated CpG islands (IRDM-CGIs). We identified a group of IRDM-CGIs that was consistently shared by different cell lines, and denoted it common IRDM-CGIs. X chromosome CGIs were overrepresented among common IRDM-CGIs. Autosomal IRDM-CGIs were preferentially located in gene bodies and intergenic regions had a lower G + C content, a smaller mean length, and a reduced CpG percentage. Functional analysis of the genes associated with autosomal IRDM-CGIs showed that many of them are involved in DNA binding and development. Conclusions Our results show that several specific functional and structural features characterize common IRDM-CGIs. They may represent a specific subset of CGIs that are more prone to being differentially methylated for their intrinsic characteristics. PMID:24106769

  14. Deletion and aberrant CpG island methylation of Caspase 8 gene in medulloblastoma.

    PubMed

    Gonzalez-Gomez, Pilar; Bello, M Josefa; Inda, M Mar; Alonso, M Eva; Arjona, Dolores; Amiñoso, Cinthia; Lopez-Marin, Isabel; de Campos, Jose M; Sarasa, Jose L; Castresana, Javier S; Rey, Juan A

    2004-09-01

    Aberrant methylation of promoter CpG islands in human genes is an alternative genetic inactivation mechanism that contributes to the development of human tumors. Nevertheless, few studies have analyzed methylation in medulloblastomas. We determined the frequency of aberrant CpG island methylation for Caspase 8 (CASP8) in a group of 24 medulloblastomas arising in 8 adult and 16 pediatric patients. Complete methylation of CASP8 was found in 15 tumors (62%) and one case displayed hemimethylation. Three samples amplified neither of the two primer sets for methylated or unmethylated alleles, suggesting that genomic deletion occurred in the 5' flanking region of CASP8. Our findings suggest that methylation commonly contributes to CASP8 silencing in medulloblastomas and that homozygous deletion or severe sequence changes involving the promoter region may be another mechanism leading to CASP8 inactivation in this neoplasm.

  15. Gene silencing of Nox4 by CpG island methylation during hepatocarcinogenesis in rats

    PubMed Central

    López-Álvarez, Guadalupe S.; Wojdacz, Tomasz K.; García-Cuellar, Claudia M.; Monroy-Ramírez, Hugo C.; Rodríguez-Segura, Miguel A.; Pacheco-Rivera, Ruth A.; Valencia-Antúnez, Carlos A.; Cervantes-Anaya, Nancy; Soto-Reyes, Ernesto; Vásquez-Garzón, Verónica R.; Sánchez-Pérez, Yesennia; Villa-Treviño, Saúl

    2017-01-01

    ABSTRACT The association between the downregulation of genes and DNA methylation in their CpG islands has been extensively studied as a mechanism that favors carcinogenesis. The objective of this study was to analyze the methylation of a set of genes selected based on their microarray expression profiles during the process of hepatocarcinogenesis. Rats were euthanized at: 24 h, 7, 11, 16 and 30 days and 5, 9, 12 and 18 months post-treatment. We evaluated the methylation status in the CpG islands of four deregulated genes (Casp3, Cldn1, Pex11a and Nox4) using methylation-sensitive high-resolution melting technology for the samples obtained from different stages of hepatocarcinogenesis. We did not observe methylation in Casp3, Cldn1 or Pex11a. However, Nox4 exhibited altered methylation patterns, reaching a maximum of 10%, even during the early stages of hepatocarcinogenesis. We observed downregulation of mRNA and protein of Nox4 (97.5% and 40%, respectively) after the first carcinogenic stimulus relative to the untreated samples. Our results suggest that Nox4 downregulation is associated with DNA methylation of the CpG island in its promoter. We propose that methylation is a mechanism that can silence the expression of Nox4, which could contribute to the acquisition of neoplastic characteristics during hepatocarcinogenesis in rats. PMID:27895046

  16. [CpG-oligodeoxynucleotide stimulation improves the success for karyotypic analysis of chronic lymphocytic leukemia cells].

    PubMed

    Liu, Qiong; Xu, Wei; Qiu, Hai-rong; Wang, Rong; Yu, Hui; Fan, Lei; Miao, Kou-rong; Li, Jian-yong

    2009-09-01

    To explore the effect of CpG-oligodeoxynucleotides (ODN) in chromosome study of chronic lymphocytic leukemia (CLL). Blood or bone marrow cells of 70 CLL patients were cultured for 72 h with PHA, CpG-ODN and CpG-ODN combined with IL-2, respectively. Routine karyotype analysis with R banding technique and interphase fluorescence in situ hybridization (FISH) were performed. The metaphase number>or=20 was considered as successful stimulation, which in PHA, CpG-ODN and CpG-ODN combined IL-2 groups were 90.0%, 68.6% and 68.6%, respectively, and the detection rates of chromosome aberrations were 3.2%, 43.6% and 43.6%, respectively. The aberrations rates detected by interphase FISH with a panel of probes was 64.3%. CpG-ODN DSP30 can effectively raise the detection rate of chromosome aberrations in CLL patients.

  17. Adherence to Clinical Practice Guidelines (CPG) management of dengue infection in adults (revised 2nd edition)

    PubMed Central

    Suli, Zailiza; Singh Gill, Balvinder; Rudra Deva, Shanti; Abdullah Sani, Ana Fizalinda; Romli, Erni Zurina; Mohamed Ghazali, Izzuna Mudla; Mohd. Yusof, Mohd. Aminuddin; Ahmad Lutfi, Nafisah; Shuib, Shahril Effendi; Mohd Darus, Noormah; Bakri, Rugayah

    2017-01-01

    The Malaysian Dengue Clinical Practice Guidelines (CPG) have been developed to provide evidence-based guidance in the management of dengue infections. The use of these guidelines is essential to ensure its recommendations are being practiced. However, the adherence to the guidelines for management of dengue (revised 2nd edition) by healthcare providers still remains unknown. Therefore, the aim of this study was to evaluate the proportion among healthcare providers that adhere to this Dengue CPG. A retrospective cohort study of dengue cases registered from 1 January 2014 to 1 June 2015 was conducted in public hospitals and health clinics in Selangor, Putrajaya and Kuala Lumpur. Adherence to the CPG recommendations were recorded by reviewing patients’ case notes. Overall proportion of adherence in clinical components of the recommendation were (7.1 to 100.0% versus 7.7 to 73.8%) in history taking, (6.7 to 100.0% versus 12.3 to 60.0%) in physical examinations, (18.4 to 100.0% versus 23.1 to 83.2%) in assessment of warning signs, (0.6 to 100.0% versus 12.3 to 87.7%) in assessment of haemodynamic status, (60.0 to 100.0% versus 27.7 to 40.0%) in diagnosis, (46.6 to 80.0% versus 52.3%) in case notifications, (73.2 to 100.0% versus 89.2 to 96.9%) in performing specific laboratory investigations and (7.9 to 100.0% versus 21.5%) in monitoring, for outpatient versus inpatient, respectively. Adherence trends were demonstrated to be higher in hospital settings compared to outpatient settings. Adherence to this Dengue CPG varies widely with overall good clinical outcomes observed. PMID:29095822

  18. Vinpocetine Inhibited the CpG Oligodeoxynucleotide-induced Immune Response in Plasmacytoid Dendritic Cells.

    PubMed

    Feng, Xungang; Wang, Yuzhong; Hao, Yanlei; Ma, Qun; Dai, Jun; Liang, Zhibo; Liu, Yantao; Li, Xiangyuan; Song, Yan; Si, Chuanping

    2017-04-01

    Plasmacytoid dendritic cells (pDCs) exert dual roles in immune responses through inducing inflammation and maintaining immune tolerance. A switch of pDC phenotype from pro-inflammation to tolerance has therapeutic promise in the treatment of autoimmune diseases. Vinpocetine, a vasoactive vinca alkaloid extracted from the periwinkle plant, has recently emerged as an immunomodulatory agent. In this study, we evaluated the effect of vinpocetine on phenotype of pDCs isolated from C57BL/6 mice and explored its possible mechanism. Our data showed that vinpocetine significantly downregulated the expression of CD40, CD80, and CD86 on pDCs and increased the expression of translocator protein (TSPO), the specific receptor of vinpocetine, in pDCs. Vinpocetine significantly inhibited the Toll-like receptor 9 signaling pathway and reduced the secretion of related cytokines in pDCs through TSPO. Furthermore, viability of pDCs was significantly promoted by vinpocetine. These findings imply that vinpocetine serves as an immunomodulatory agent for pDCs and may be applied for the treatment of pDCs-related autoimmune diseases.

  19. [The influence of HOXB2 anti-sense oligodeoxynucleotides on the proliferation and expression of human umbilical vein endothelial cells].

    PubMed

    Zhang, X; Liu, X; Liu, L

    2001-12-01

    To explore the effects of HOXB2 anti-sense oligodeoxynucleotides (asodn) on the proliferation and the expression of human umbilical vein endothelial cells (HUVECs). Various concentrations of HOXB2 ASODN modified by thiophosphate were transfected into HUVECs by liposome mediation. MTT and RT-PCR methods were employed to determine the influence of different concentrations of ASODN on endothelial proliferation and the expression level of HOXB2 mRNA. After the transfection of HOXB2 ASODN, the endothelial proliferation was inhibited in dose-dependent manner. Simultaneously, the expression level of HOXB2 mRNA decreased significantly. HOXB2 might play important roles in the proliferation of endothelial cells.

  20. Effect of dietary betaine supplementation on lipogenesis gene expression and CpG methylation of lipoprotein lipase gene in broilers.

    PubMed

    Xing, Jinyi; Kang, Li; Jiang, Yunliang

    2011-03-01

    Experiments were conducted to investigate the effect of betaine supplementation on mRNA expression levels of lipogenesis genes and CpG methylation of lipoprotein lipase gene (LPL) in broilers. From 22 days of age, 78 broilers were feed basal diet without betaine and basal diet supplemented with 0.1% betaine, respectively, and at 56 and 66 days of age, the traits of 15 chickens (7 males and 8 females) of each group were recorded and abdominal fat pads were collected. The mRNA expression levels of several lipogenesis gene were analyzed by semi-quantitative RT-PCR and real-time quantitative RT-PCR (qPCR), respectively. The CpG methylation profile at the promoter region of LPL gene in 66-day-old broilers was determined by bisulfite sequencing. The average daily gain and percent abdominal fat traits were slightly improved in 56-day-old and 66-day-old broilers after dietary supplementation of betaine to diet. After adding 0.1% betaine to diet, the mRNA levels of fatty acid synthase (FAS) and adipocyte-type fatty acid-binding protein genes in abdominal adipose were significantly decreased in 56-day-old broilers, and those of LPL and FAS genes in abdominal adipose were significantly decreased in 66-day-old broilers comparing with the control group (P < 0.05 and P < 0.001). Moreover, in 66-day-old broilers fed 0.1% betaine diet, a different CpG methylation pattern was observed: the CpG dinucleotides of 1st, 6th, 7th, 8th and from 10th to 50th were less methylated; however, those of 2nd, 5th and 9th were more heavily methylated. The results suggest that transcription of some lipogenesis genes was decreased by betaine supplementation and betaine may decrease LPL mRNA expression by altering CpG methylation pattern on LPL promoter region.

  1. Double-stranded RNA transcribed from vector-based oligodeoxynucleotide acts as transcription factor decoy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xiao, Xiao; Gang, Yi; Department of Infectious Diseases, Tangdu Hospital, Fourth Military Medical University, Xi’an 710038, Shaanxi Province

    2015-02-06

    Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself.more » The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity.« less

  2. CpG island methylation profile in non-invasive oral rinse samples is predictive of oral and pharyngeal carcinoma.

    PubMed

    Langevin, Scott M; Eliot, Melissa; Butler, Rondi A; Cheong, Agnes; Zhang, Xiang; McClean, Michael D; Koestler, Devin C; Kelsey, Karl T

    2015-01-01

    There are currently no screening tests in routine use for oral and pharyngeal cancer beyond visual inspection and palpation, which are provided on an opportunistic basis, indicating a need for development of novel methods for early detection, particularly in high-risk populations. We sought to address this need through comprehensive interrogation of CpG island methylation in oral rinse samples. We used the Infinium HumanMethylation450 BeadArray to interrogate DNA methylation in oral rinse samples collected from 154 patients with incident oral or pharyngeal carcinoma prior to treatment and 72 cancer-free control subjects. Subjects were randomly allocated to either a training or a testing set. For each subject, average methylation was calculated for each CpG island represented on the array. We applied a semi-supervised recursively partitioned mixture model to the CpG island methylation data to identify a classifier for prediction of case status in the training set. We then applied the resultant classifier to the testing set for validation and to assess the predictive accuracy. We identified a methylation classifier comprised of 22 CpG islands, which predicted oral and pharyngeal carcinoma with a high degree of accuracy (AUC = 0.92, 95 % CI 0.86, 0.98). This novel methylation panel is a strong predictor of oral and pharyngeal carcinoma case status in oral rinse samples and may have utility in early detection and post-treatment follow-up.

  3. Capillary electrophoretic separation-based approach to determine the labeling kinetics of oligodeoxynucleotides

    PubMed Central

    Kanavarioti, Anastassia; Greenman, Kevin L.; Hamalainen, Mark; Jain, Aakriti; Johns, Adam M.; Melville, Chris R.; Kemmish, Kent; Andregg, William

    2014-01-01

    With the recent advances in electron microscopy (EM), computation, and nanofabrication, the original idea of reading DNA sequence directly from an image can now be tested. One approach is to develop heavy atom labels that can provide the contrast required for EM imaging. While evaluating tentative labels for the respective nucleobases in synthetic oligodeoxynucleotides (oligos), we developed a streamlined capillary electrophoresis (CE) protocol to assess the label stability, reactivity, and selectivity. We report our protocol using osmium tetroxide 2,2′-bipyridine (Osbipy) as a thymidine (T) specific label. The observed rates show that the labeling process is kinetically independent of both the oligo length, and the base composition. The conditions, i.e. temperature, optimal Osbipy concentration, and molar ratio of reagents, to promote 100% conversion of the starting oligo to labeled product were established. Hence the optimized conditions developed with the oligos could be leveraged to allow osmylation of effectively all Ts in single-stranded (ss) DNA, while achieving minimal mislabeling. In addition, the approach and methods employed here may be adapted to the evaluation of other prospective contrasting agents/labels to facilitate next-generation DNA sequencing by EM. PMID:23147698

  4. Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved

    PubMed Central

    Long, Hannah K.; King, Hamish W.; Patient, Roger K.; Odom, Duncan T.; Klose, Robert J.

    2016-01-01

    DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. PMID:27084945

  5. Formaldehyde activation of mitoxantrone yields CpG and CpA specific DNA adducts

    PubMed Central

    Parker, Belinda S.; Cutts, Suzanne M.; Cullinane, Carleen; Phillips, Don R.

    2000-01-01

    Recently we have found that mitoxantrone, like Adriamycin, can be activated by formaldehyde and subsequently form adducts which stabilise double-stranded DNA in vitro. This activation by formaldehyde may be biologically relevant since formaldehyde levels are elevated in those tumours in which mitoxantrone is most cytotoxic. In vitro transcription analysis revealed that these adducts block the progression of RNA polymerase during transcription and cause truncated RNA transcripts. There was an absolute requirement for both mitoxantrone and formaldehyde in transcriptional blockage formation and the activated complex was found to exhibit site specificity, with blockage occurring prior to CpG and CpA sites in the DNA (non-template strand). The stability of the adduct at 37°C was site dependent. The half-lives ranged from 45 min to ~5 h and this was dependent on both the central 2 bp blockage site as well as flanking sequences. The CpG specificity of mitoxantrone adduct sites was also confirmed independently by a λ exonuclease digestion assay. PMID:10648792

  6. Genome-wide methylation analysis identifies differentially methylated CpG loci associated with severe obesity in childhood.

    PubMed

    Huang, R C; Garratt, E S; Pan, H; Wu, Y; Davis, E A; Barton, S J; Burdge, G C; Godfrey, K M; Holbrook, J D; Lillycrop, K A

    2015-01-01

    Childhood obesity is a major public health issue. Here we investigated whether differential DNA methylation was associated with childhood obesity. We studied DNA methylation profiles in whole blood from 78 obese children (mean BMI Z-score: 2.6) and 71 age- and sex-matched controls (mean BMI Z-score: 0.1). DNA samples from obese and control groups were pooled and analyzed using the Infinium HumanMethylation450 BeadChip array. Comparison of the methylation profiles between obese and control subjects revealed 129 differentially methylated CpG (DMCpG) loci associated with 80 unique genes that had a greater than 10% difference in methylation (P-value < 0.05). The top pathways enriched among the DMCpGs included developmental processes, immune system regulation, regulation of cell signaling, and small GTPase-mediated signal transduction. The associations between the methylation of selected DMCpGs with childhood obesity were validated using sodium bisulfite pyrosequencing across loci within the FYN, PIWIL4, and TAOK3 genes in individual subjects. Three CpG loci within FYN were hypermethylated in obese individuals (all P < 0.01), while obesity was associated with lower methylation of CpG loci within PIWIL4 (P = 0.003) and TAOK3 (P = 0.001). After building logistic regression models, we determined that a 1% increase in methylation in TAOK3, multiplicatively decreased the odds of being obese by 0.91 (95% CI: 0.86 - 0.97), and an increase of 1% methylation in FYN CpG3, multiplicatively increased the odds of being obese by 1.03 (95% CI: 0.99 - 1.07). In conclusion, these findings provide evidence that childhood obesity is associated with specific DNA methylation changes in whole blood, which may have utility as biomarkers of obesity risk.

  7. Immunogenicity of porcine circovirus type 2 nucleic acid vaccine containing CpG motif for mice.

    PubMed

    Li, Jun; Yu, Jiang; Xu, Shaojian; Shi, Jianli; Xu, Shengnan; Wu, Xiaoyan; Fu, Fang; Peng, Zhe; Zhang, Lingling; Zheng, Shuxuan; Yuan, Xiaoyuan; Cong, Xiaoyan; Sun, Wenbo; Cheng, Kaihui; Du, Yijun; Wu, Jiaqiang; Wang, Jinbao

    2016-11-14

    This study aimed at reseaching the immune effect of porcine circovirus type 2 (PCV2) DNA vaccine containing CpG motif on mice. A total of 40 6-week-old female BALB/c mice were randomly divided into four groups which were immunized by 18CpG-pVAX1-ORF2, pVAX1-ORF2, pVAX1 and PBS, respectively, and immunized again 2 weeks later. All mice were challenged with 0.2 mL PCV2 cells virulent strain SD (10 6.0 TCID 50 /mL) after 4 weeks. Average daily gain, blood antibody levels, microscopic changes and viremia were detected to estimate the effect of DNA vaccine. The results showed that compared to those of the control mice, groups immunized with pVAX1-ORF2 and 18CpG-pVAX1-ORF2 could induce PCV2-specific antibodies. The PCV2-specific antibodies level of 18 CpG-pVAX1-ORF2 groups was higher significantly than other groups and decreased slowly along with time. There was no distinct pathological damage and viremia occurring in mice that inoculated with CpG motif DNA vaccines. The results demonstrated that the DNA vaccine containing 18 CpG could build up resistibility immunity and reduce immune organ damage on mice.

  8. Distinct genetic profiles in colorectal tumors with or without the CpG island methylator phenotype

    PubMed Central

    Toyota, Minoru; Ohe-Toyota, Mutsumi; Ahuja, Nita; Issa, Jean-Pierre J.

    2000-01-01

    Colorectal cancers (CRCs) are characterized by multiple genetic (mutations) and epigenetic (CpG island methylation) alterations, but it is not known whether these evolve independently through stochastic processes. We have recently described a novel pathway termed CpG island methylator phenotype (CIMP) in CRC, which is characterized by the simultaneous methylation of multiple CpG islands, including several known genes, such as p16, hMLH1, and THBS1. We have now studied mutations in K-RAS, p53, DPC4, and TGFβRII in a panel of colorectal tumors with or without CIMP. We find that CIMP defines two groups of tumors with significantly different genetic lesions: frequent K-RAS mutations were found in CIMP+ CRCs (28/41, 68%) compared with CIMP− cases (14/47, 30%, P = 0.0005). By contrast, p53 mutations were found in 24% (10/41) of CIMP+ CRCs vs. 60% (30/46) of CIMP− cases (P = 0.002). Both of these differences were independent of microsatellite instability. These interactions between CIMP, K-RAS mutations, and p53 mutations were preserved in colorectal adenomas, suggesting that they occur early in carcinogenesis. The distinct combinations of epigenetic and genetic alterations in each group suggest that activation of oncogenes and inactivation of tumor suppressor genes is related to the underlying mechanism of generating molecular diversity in cancer, rather than simply accumulate stochastically during cancer development. PMID:10639144

  9. An Animal Model of Abacavir-Induced HLA-Mediated Liver Injury.

    PubMed

    Song, Binbin; Aoki, Shigeki; Liu, Cong; Susukida, Takeshi; Ito, Kousei

    2018-04-01

    Genome-wide association studies indicate that several idiosyncratic adverse drug reactions are highly associated with specific human leukocyte antigen (HLA) alleles. For instance, abacavir, a human immunodeficiency virus reverse transcriptase inhibitor, induces multiorgan toxicity exclusively in patients carrying the HLA-B*57:01 allele. However, the underlying mechanism is unclear due to a lack of appropriate animal models. Previously, we developed HLA-B*57:01 transgenic mice and found that topical application of abacavir to the ears induced proliferation of CD8+ lymphocytes in local lymph nodes. Here, we attempted to reproduce abacavir-induced liver injury in these mice. However, oral administration of abacavir alone to HLA-B*57:01 transgenic mice did not increase levels of the liver injury marker alanine aminotransferase. Considering the importance of innate immune activation in mouse liver, we treated mice with CpG oligodeoxynucleotide, a toll-like receptor 9 agonist, plus abacavir. This resulted in a marked increase in alanine aminotransferase, pathological changes in liver, increased numbers of activated CD8+ T cells, and tissue infiltration by immune cells exclusively in HLA-B*57:01 transgenic mice. These results indicate that CpG oligodeoxynucleotide-induced inflammatory reactions and/or innate immune activation are necessary for abacavir-induced HLA-mediated liver injury characterized by infiltration of CD8+ T cells. Thus, we developed the first mouse model of HLA-mediated abacavir-induced idiosyncratic liver injury. Further investigation will show that the proposed HLA-mediated liver injury model can be applied to other combinations of drugs and HLA types, thereby improving drug development and contributing to the development of personalized medicine.

  10. Analysis of a Cholera Toxin B Subunit (CTB) and Human Mucin 1 (MUC1) Conjugate Protein in a MUC1 Tolerant Mouse Model

    PubMed Central

    Pinkhasov, Julia; Alvarez, M. Lucrecia; Pathangey, Latha B.; Tinder, Teresa L.; Mason, Hugh S.; Walmsley, Amanda M.; Gendler, Sandra J.; Mukherjee, Pinku

    2011-01-01

    Since epithelial mucin 1 (MUC1) is associated with several adenocarcinomas at mucosal sites, it is pertinent to test the efficacy of a mucosally targeted vaccine formulation. The B subunit of the Vibrio cholerae cholera toxin (CTB) has great potential to act as a mucosal carrier for subunit vaccines. In the present study we evaluated whether a MUC1 tandem repeat (TR) peptide chemically linked to CTB would break self-antigen tolerance in the transgenic MUC1 tolerant mouse model (MUC1.Tg) through oral or parenteral immunizations. We report that oral immunization with the CTB-MUC1 conjugate along with mucosal adjuvant, unmethylated CpG oligodeoxynucleotide (ODN) and interleukin-12 (IL-12), did not break self-antigen tolerance in MUC1.Tg mice, but induced a strong humoral response in wild-type C57BL/6 mice. However, self-antigen tolerance in the MUC1.Tg mouse model was broken after parenteral immunizations with different doses of the CTB-MUC1 conjugate protein and with the adjuvant CpG ODN co-delivered with CTB-MUC1. Importantly, mice immunized systemically with CpG ODN alone and with CTB-MUC1 exhibited decreased tumor burden when challenged with a mammary gland tumor cell line that expresses human MUC1. PMID:20824430

  11. Analysis of a cholera toxin B subunit (CTB) and human mucin 1 (MUC1) conjugate protein in a MUC1-tolerant mouse model.

    PubMed

    Pinkhasov, Julia; Alvarez, M Lucrecia; Pathangey, Latha B; Tinder, Teresa L; Mason, Hugh S; Walmsley, Amanda M; Gendler, Sandra J; Mukherjee, Pinku

    2010-12-01

    Since epithelial mucin 1 (MUC1) is associated with several adenocarcinomas at the mucosal sites, it is pertinent to test the efficacy of a mucosally targeted vaccine formulation. The B subunit of the Vibrio cholerae cholera toxin (CTB) has great potential to act as a mucosal carrier for subunit vaccines. In the present study we evaluated whether a MUC1 tandem repeat (TR) peptide chemically linked to CTB would break self-antigen tolerance in the transgenic MUC1-tolerant mouse model (MUC1.Tg) through oral or parenteral immunizations. We report that oral immunization with the CTB-MUC1 conjugate along with mucosal adjuvant, unmethylated CpG oligodeoxynucleotide (ODN) and interleukin-12 (IL-12) did not break self-antigen tolerance in MUC1.Tg mice, but induced a strong humoral response in wild-type C57BL/6 mice. However, self-antigen tolerance in the MUC1.Tg mouse model was broken after parenteral immunizations with different doses of the CTB-MUC1 conjugate protein and with the adjuvant CpG ODN co-delivered with CTB-MUC1. Importantly, mice immunized systemically with CpG ODN alone and with CTB-MUC1 exhibited decreased tumor burden when challenged with a mammary gland tumor cell line that expresses human MUC1.

  12. Mechanism of Mitochondrial Transcription Factor A Attenuation of CpG-Induced Antibody Production

    PubMed Central

    Saifee, Jessica F.; Torres, Raul M.; Janoff, Edward N.

    2016-01-01

    Mitochondrial transcription factor A (TFAM) had previously been shown to act as a damage associated molecular pattern with the ability to enhance CpG-A phosphorothioate oligodeoxynucleotide (ODN)-mediated stimulation of IFNα production from human plasmacytoid dendritic cells. Examination of the mechanism by which TFAM might influence CpG ODN mediated innate immune responses revealed that TFAM binds directly, tightly and selectively to the structurally related CpG-A, -B, and -C ODN. TFAM also modulated the ability of the CpG-B or -C to stimulate the production of antibodies from human B cells. TFAM showed a dose-dependent modulation of CpG-B, and -C -induced antibody production from human B cells in vitro, with enhancement of high dose and inhibition of low doses of CpG stimulation. This effect was linked to the ability of TFAM to directly inhibit the binding of CpG ODNs to B cells, in a manner consistent with the relative binding affinities of TFAM for the ODNs. These data suggest that TFAM alters the free concentration of the CpG available to stimulate B cells by sequestering this ODN in a TFAM-CpG complex. Thus, TFAM has the potential to decrease the pathogenic consequences of exposure to natural CpG-like hypomethylated DNA in vivo, as well as such as that found in traumatic injury, infection, autoimmune disease and during pregnancy. PMID:27280778

  13. CpG ODN 1668 induce innate and adaptive immune responses in rock bream (Oplegnathus fasciatus) against rock bream iridovirus (RBIV) infection.

    PubMed

    Jung, Myung-Hwa; Jung, Sung-Ju

    2017-10-01

    Rock bream iridovirus (RBIV) causes severe mass mortalities in rock bream in Korea. CpG ODN 1668 showed promise as immunoprotective agents against RBIV infection in rock bream. In this study, we assessed innate/adaptive-related gene expression patterns in RBIV-infected rock bream with and without CpG ODN 1668 administration to determine important immune defense related factors that may affect fish survival. In the CpG ODN 1668+virus-injected group, virus copies were more than 7.4- to 790591-fold lower than in the virus-injected group at 4 d (8.79 × 10 4 and 6.58 × 10 5 /μl, respectively), 7 d (5.30 × 10 2 and 2.29 × 10 7 /μl, respectively) and 10 dpi (7.79 × 10 1 and 6.16 × 10 7 /μl, respectively). Furthermore, in the CpG ODN 1668+virus-injected group, significantly higher levels of MyD88 (6 h, 1 d, 4 d and 7 dpi), IL1β (1 d, 2 d and 7 dpi) and perforin/granzyme (1 dpi) expression were observed, whereas these genes were not significantly expressed in the virus-injected group at that time points. Mx, ISG15 and PKR were significantly highly expressed at 4 d and 7 dpi and reduced when low viral loads at 10 dpi in the CpG ODN 1668+virus-injected group. Conversely, in the virus-injected group, Mx, ISG15 and PKR expression were significantly higher than the control group until 10 dpi. However, MHC class I, CD8, Fas, Fas ligand and caspases (3, 8 and 9) expression levels showed no statistically significant differences between virus- and CpG ODN 1668+virus-injected group. In summary, CpG ODN 1668 administration in fish induces innate immune response or cell death pathway, which could be a major contributing factor to effective fish control over viral transcription on 4 d to 10 dpi. Expression of MyD88, IL1β, perforin and granzyme-related immune gene response is critical factor for inhibition of RBIV replication. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Prognostic implication of the CpG island methylator phenotype in colorectal cancers depends on tumour location

    PubMed Central

    Bae, J M; Kim, J H; Cho, N-Y; Kim, T-Y; Kang, G H

    2013-01-01

    Background: Colorectal cancer (CRC) is usually categorised as proximal or distal CRC. Recently, many researchers have tried to determine the molecular heterogeneity of CRCs along bowel subsites. However, the differential effects of the CpG island methylator phenotype (CIMP) and microsatellite instability (MSI) on the clinical outcome according to tumour location are not well-known. Methods: We analysed clinicopathologic and molecular characteristics, including CIMP, MSI, KRAS and BRAF mutations, in 734 CRCs according to bowel subsites. And the prognostic value of CIMP and MSI was analysed according to tumour location. Results: We found a linear increase of female predominance, T, N category, stage, differentiation, absence of luminal necrosis, tumour -infiltrating lymphocytes, Crohn's-like lymphoid reaction, serration and mucin production from the rectum to caecum. CpG island methylator phenotype -high and MSI-high gradually increased from the rectum to caecum. CpG island methylator phenotype is a poor prognostic factor of overall survival (hazard ratio (HR): 4.13, 95% confidence interval (CI): 1.27–13.46) and disease-free survival (HR: 2.90, 95% CI: 1.04–8.08) in rectal cancers. Conclusion: Clinicopathologic and molecular profiles of CRCs gradually change along bowel subsites, and the prognostic implication of CIMP is different according to tumour location. PMID:23900220

  15. Gold nanoparticle–M2e conjugate coformulated with CpG induces protective immunity against influenza A virus

    PubMed Central

    Tao, Wenqian; Ziemer, Katherine S; Gill, Harvinder S

    2014-01-01

    Aim: This study aimed to develop a novel influenza A vaccine by conjugating the highly conserved extracellular region of the matrix 2 protein (M2e) of influenza A virus to gold nanoparticles (AuNPs) and to test the vaccine in a mouse influenza challenge model. Materials & methods: Citrate-reduced AuNPs (diameter: 12 nm) were synthesized, and characterized by transmission electron microscopy and dynamic light scattering. M2e was conjugated to AuNPs through thiol–gold interactions to form M2e–AuNP conjugates. Particle stability was confirmed by UV–visible spectra, and M2e conjugation was further characterized by x-ray photoelectron spectroscopy. Mice were immunized with M2e–AuNPs with or without CpG (cytosine-guanine rich oligonucleotide) as an adjuvant with appropriate control groups. Sera was collected and M2e-specific immunoglobulin (IgG) was measured, and immunized mice were challenged with PR8-H1N1 influenza virus. Results: M2e-capped AuNPs could be lyophilized and stably resuspended in water. Intranasal vaccination of mice with M2e–AuNP conjugates induced M2e-specific IgG serum antibodies, which significantly increased upon addition of soluble CpG as adjuvant. Upon challenge with lethal PR8, mice vaccinated with M2e-AuNP conjugates were only partially protected, while mice that received soluble CpG as adjuvant in addition to M2e–AuNP were fully protected. Conclusion: Overall, this study demonstrates the potential of using the M2e–AuNP conjugates with CpG as an adjuvant as a platform for developing an influenza A vaccine. PMID:23829488

  16. Prognostication of patients with clear cell renal cell carcinomas based on quantification of DNA methylation levels of CpG island methylator phenotype marker genes.

    PubMed

    Tian, Ying; Arai, Eri; Gotoh, Masahiro; Komiyama, Motokiyo; Fujimoto, Hiroyuki; Kanai, Yae

    2014-10-20

    The CpG island methylator phenotype (CIMP) of clear cell renal cell carcinomas (ccRCCs) is characterized by accumulation of DNA methylation at CpG islands and poorer patient outcome. The aim of this study was to establish criteria for prognostication of patients with ccRCCs using the ccRCC-specific CIMP marker genes. DNA methylation levels at 299 CpG sites in the 14 CIMP marker genes were evaluated quantitatively in tissue specimens of 88 CIMP-negative and 14 CIMP-positive ccRCCs in a learning cohort using the MassARRAY system. An additional 100 ccRCCs were also analyzed as a validation cohort. Receiver operating characteristic curve analysis showed that area under the curve values for the 23 CpG units including the 32 CpG sites in the 7 CIMP-marker genes, i.e. FAM150A, ZNF540, ZNF671, ZNF154, PRAC, TRH and SLC13A5, for discrimination of CIMP-positive from CIMP-negative ccRCCs were larger than 0.95. Criteria combining the 23 CpG units discriminated CIMP-positive from CIMP-negative ccRCCs with 100% sensitivity and specificity in the learning cohort. Cancer-free and overall survival rates of patients with CIMP-positive ccRCCs diagnosed using the criteria combining the 23 CpG units in a validation cohort were significantly lower than those of patients with CIMP-negative ccRCCs (P = 1.41 × 10-5 and 2.43 × 10-13, respectively). Patients with CIMP-positive ccRCCs in the validation cohort had a higher likelihood of disease-related death (hazard ratio, 75.8; 95% confidence interval, 7.81 to 735; P = 1.89 × 10-4) than those with CIMP-negative ccRCCs. The established criteria are able to reproducibly diagnose CIMP-positive ccRCCs and may be useful for personalized medicine for patients with ccRCCs.

  17. Changes in the activity of a CpG neuron after the reinforcement of an operantly conditioned behavior in Lymnaea.

    PubMed

    Spencer, Gaynor E; Kazmi, Mustapha H; Syed, Naweed I; Lukowiak, Ken

    2002-10-01

    We have previously shown that the aerial respiratory behavior of the mollusk Lymnaea stagnalis can be operantly conditioned, and the central pattern generating (CPG) neurons underlying this behavior have been identified. As neural correlates of operant conditioning remain poorly defined in both vertebrates and invertebrates, we have used the Lymnaea respiratory CPG to investigate neuronal changes associated with the change in behavior after conditioning. After operant conditioning of the intact animals, semi-intact preparations were dissected, so that changes in the respiratory behavior (pneumostome openings) and underlying activity of the identified CPG neuron, right pedal dorsal 1 (RPeD1), could be monitored simultaneously. RPeD1 was studied because it initiates the rhythmic activity of the CPG and receives chemo-sensory input from the pneumostome area. Pneumostome openings and RPeD1 activity were monitored both before and after a reinforcing training stimulus applied to the open pneumostome of operantly conditioned and yoked control preparations. After presentation of the reinforcing stimulus, there was a significant reduction in both breathing behavior and RPeD1 activity in operant preparations but not in yoked and naïve controls. Furthermore these changes were only significant in the subgroup of operantly conditioned animals described as good learners and not in poor learners. These data strongly suggest that changes in RPeD1 activity may underlie the behavioral changes associated with the reinforcement of operant conditioning of the respiratory behavior.

  18. Phenotype-specific CpG island methylation events in a murine model of prostate cancer.

    PubMed

    Camoriano, Marta; Kinney, Shannon R Morey; Moser, Michael T; Foster, Barbara A; Mohler, James L; Trump, Donald L; Karpf, Adam R; Smiraglia, Dominic J

    2008-06-01

    Aberrant DNA methylation plays a significant role in nearly all human cancers and may contribute to disease progression to advanced phenotypes. Study of advanced prostate cancer phenotypes in the human disease is hampered by limited availability of tissues. We therefore took advantage of the Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) model to study whether three different phenotypes of TRAMP tumors (PRIM, late-stage primary tumors; AIP, androgen-independent primary tumors; and MET, metastases) displayed specific patterns of CpG island hypermethylation using Restriction Landmark Genomic Scanning. Each tumor phenotype displayed numerous hypermethylation events, with the most homogeneous methylation pattern in AIP and the most heterogeneous pattern in MET. Several loci displayed a phenotype-specific methylation pattern; the most striking pattern being loci methylated at high frequency in PRIM and AIP but rarely in MET. Examination of the mRNA expression of three genes, BC058385, Goosecoid, and Neurexin 2, which exhibited nonpromoter methylation, revealed increased expression associated with downstream methylation. Only methylated samples showed mRNA expression, in which tumor phenotype was a key factor determining the level of expression. The CpG island in the human orthologue of BC058385 was methylated in human AIP but not in primary androgen-stimulated prostate cancer or benign prostate. The clinical data show a proof-of-principle that the TRAMP model can be used to identify targets of aberrant CpG island methylation relevant to human disease. In conclusion, phenotype-specific hypermethylation events were associated with the overexpression of different genes and may provide new markers of prostate tumorigenesis.

  19. Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved.

    PubMed

    Long, Hannah K; King, Hamish W; Patient, Roger K; Odom, Duncan T; Klose, Robert J

    2016-08-19

    DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. A cross-study analysis of prenatal exposures to environmental contaminants and the epigenome: support for stress-responsive transcription factor occupancy as a mediator of gene-specific CpG methylation patterning

    PubMed Central

    Martin, Elizabeth M.; Fry, Rebecca C.

    2016-01-01

    Abstract A biological mechanism by which exposure to environmental contaminants results in gene-specific CpG methylation patterning is currently unknown. We hypothesize that gene-specific CpG methylation is related to environmentally perturbed transcription factor occupancy. To test this hypothesis, a database of 396 genes with altered CpG methylation either in cord blood leukocytes or placental tissue was compiled from 14 studies representing assessments of six environmental contaminants. Subsequently, an in silico approach was used to identify transcription factor binding sites enriched among the genes with altered CpG methylation in relationship to the suite of environmental contaminants. For each study, the sequences of the promoter regions (representing −1000 to +500 bp from the transcription start site) of all genes with altered CpG methylation were analyzed for enrichment of transcription factor binding sites. Binding sites for a total of 56 unique transcription factors were identified to be enriched within the promoter regions of the genes. Binding sites for the Kidney-Enriched Krupple-like Factor 15, a known responder to endogenous stress, were enriched ( P  < 0.001–0.041) among the genes with altered CpG methylation associated for five of the six environmental contaminants. These data support the transcription factor occupancy theory as a potential mechanism underlying environmentally-induced gene-specific CpG methylation. PMID:27066266

  1. Bacterial DNA in water and dialysate: detection and significance for patient outcomes.

    PubMed

    Handelman, Garry J; Megdal, Peter A; Handelman, Samuel K

    2009-01-01

    The fluid used for hemodialysis may contain DNA fragments from bacteria, which could be harmful for patient outcomes. DNA fragments from bacteria, containing the nonmethylated CpG motif, can trigger inflammation through the monocyte and lymphocyte Toll-like receptor 9, and these DNA fragments have been observed in dialysate. The fragments may transfer across the dialyzer into the patient's bloodstream during hemodialysis treatment. During hemodiafiltration, the fragments would be introduced directly into the bloodstream. The DNA fragments may arise from biofilm in the pipes of the water system, from growth of bacteria in the water, or as contaminants in the bicarbonate and salt mixture used for preparation of dialysate. Current filtration methods, such as Diasafe filters, are not able to remove these fragments. It would be prudent to seek to reduce or eliminate these contaminants. However, the cost and effort of decreasing bacterial DNA content may ultimately require substantial facility improvements; we therefore need to fund research studies to determine if modifications to reduce bacterial DNA content are clinically warranted. This research will require methods to accurately determine the species of bacteria that contribute the DNA, since this information will allow the source to be established as biofilm, bicarbonate mixtures, or other problems in the dialysis system such as bacterial growth or leakage during water preparation. In this review, the evidence for bacterial DNA fragments will be examined and suggestions for further studies will be described.

  2. Generation of Adaptive Gait Patterns for Quadruped Robot with CPG Network including Motor Dynamic Model

    NASA Astrophysics Data System (ADS)

    Son, Yurak; Kamano, Takuya; Yasuno, Takashi; Suzuki, Takayuki; Harada, Hironobu

    This paper describes the generation of adaptive gait patterns using new Central Pattern Generators (CPGs) including motor dynamic models for a quadruped robot under various environment. The CPGs act as the flexible oscillators of the joints and make the desired angle of the joints. The CPGs are mutually connected each other, and the sets of their coupling parameters are adjusted by genetic algorithm so that the quadruped robot can realize the stable and adequate gait patterns. As a result of generation, the suitable CPG networks for not only a walking straight gait pattern but also rotation gait patterns are obtained. Experimental results demonstrate that the proposed CPG networks are effective to automatically adjust the adaptive gait patterns for the tested quadruped robot under various environment. Furthermore, the target tracking control based on image processing is achieved by combining the generated gait patterns.

  3. pH-Responsive Nanoparticle Vaccines for Dual-Delivery of Antigens and Immunostimulatory Oligonucleotides

    PubMed Central

    Wilson, John T.; Keller, Salka; Manganiello, Matthew J.; Cheng, Connie; Lee, Chen-Chang; Opara, Chinonso; Convertine, Anthony; Stayton, Patrick S.

    2013-01-01

    Protein subunit vaccines offer important potential advantages over live vaccine vectors, but generally elicit weaker and shorter-lived cellular immune responses. Here we investigate the use of pH-responsive, endosomolytic polymer nanoparticles that were originally developed for RNA delivery as vaccine delivery vehicles for enhancing cellular and humoral immune responses. Micellar nanoparticles were assembled from amphiphilic diblock copolymers composed of an ampholytic core-forming block and a re-designed polycationic corona block doped with thiol-reactive pyridyl disulfide groups to enable dual-delivery of antigens and immunostimulatory CpG oligodeoxynucleotide (CpG ODN) adjuvants. Polymers assembled into 23 nm particles with simultaneous packaging of CpG ODN and a thiolated protein antigen, ovalbumin (ova). Conjugation of ova to nanoparticles significantly enhanced antigen cross-presentation in vitro relative to free ova or an unconjugated, physical mixture of the parent compounds. Subcutaneous vaccination of mice with ova-nanoparticle conjugates elicited a significantly higher CD8+ T cell response (0.5% IFN-ɣ+ of CD8+) compared to mice vaccinated with free ova or a physical mixture of the two components. Significantly, immunization with ova-nanoparticle conjugates electrostatically complexed with CpG ODN (dual-delivery) enhanced CD8+ T cell responses (3.4% IFN-ɣ+ of CD8+) 7-, 18-, and 8-fold relative to immunization with conjugates, ova administered with free CpG, or a formulation containing free ova and CpG complexed to micelles, respectively. Similarly, dual-delivery carriers significantly increased CD4+IFN-ɣ+ (Th1) responses, and elicited a balanced IgG1/IgG2c antibody response. Intradermal administration further augmented cellular immune responses, with dual-delivery carriers inducing ~7% antigen-specific CD8+ T cells. This work demonstrates the ability of pH-responsive, endosomolytic nanoparticles to actively promote antigen cross-presentation and

  4. Nicotine induced CpG methylation of Pax6 binding motif in StAR promoter reduces the gene expression and cortisol production

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Tingting; Department of Pharmacology, Uniformed Services University of the Health Sciences, Bethesda, Maryland; Chen, Man

    Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a singlemore » site CpG methylation at nt -377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. -- Highlights: Black-Right-Pointing-Pointer Nicotine-induced StAR inhibition in two human adrenal cell models. Black-Right-Pointing-Pointer Nicotine-induced single CpG site methylation in StAR promoter. Black-Right-Pointing-Pointer Persistent StAR inhibition and single CpG methylation after nicotine

  5. Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

    PubMed

    Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E

    2016-01-01

    Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in

  6. Methylation of avpr1a in the cortex of wild prairie voles: effects of CpG position and polymorphism

    PubMed Central

    Maguire, S. M.; Phelps, S. M.

    2017-01-01

    DNA methylation can cause stable changes in neuronal gene expression, but we know little about its role in individual differences in the wild. In this study, we focus on the vasopressin 1a receptor (avpr1a), a gene extensively implicated in vertebrate social behaviour, and explore natural variation in DNA methylation, genetic polymorphism and neuronal gene expression among 30 wild prairie voles (Microtus ochrogaster). Examination of CpG density across 8 kb of the locus revealed two distinct CpG islands overlapping promoter and first exon, characterized by few CpG polymorphisms. We used a targeted bisulfite sequencing approach to measure DNA methylation across approximately 3 kb of avpr1a in the retrosplenial cortex, a brain region implicated in male space use and sexual fidelity. We find dramatic variation in methylation across the avrp1a locus, with pronounced diversity near the exon–intron boundary and in a genetically variable putative enhancer within the intron. Among our wild voles, differences in cortical avpr1a expression correlate with DNA methylation in this putative enhancer, but not with the methylation status of the promoter. We also find an unusually high number of polymorphic CpG sites (polyCpGs) in this focal enhancer. One polyCpG within this enhancer (polyCpG 2170) may drive variation in expression either by disrupting transcription factor binding motifs or by changing local DNA methylation and chromatin silencing. Our results contradict some assumptions made within behavioural epigenetics, but are remarkably concordant with genome-wide studies of gene regulation. PMID:28280564

  7. Preparation and quality test of superparamagnetic iron oxide labeled antisense oligodeoxynucleotide probe: a preliminary study.

    PubMed

    Wen, Ming; Li, Bibo; Ouyang, Yu; Luo, Yi; Li, Shaolin

    2009-06-01

    Molecular imaging of tumor antisense gene techniques have been applied to the study of magnetic resonance (MR) gene imaging associated with malignant tumors. In this study, we designed, synthesized, and tested a novel molecular probe, in which the antisense oligodeoxynucleotide (ASODN) was labeled with superparamagnetic iron oxide (SPIO), and its efficiency was examined by in vitro MR imaging after SK-Br-3 mammary carcinoma cell lines (oncocytes) transfection. The SPIO-labeled ASODN probe was prepared through SPIO conjugated to ASODN using a chemical cross linking method. Its morphology and size were detected by atomic force microscope, size distribution were detected by laser granulometer, the conjugating rate and biological activity were determined by high performance liquid chromatography, and the stability was determined by polyacrylamide gel electrophoresis. After that, the probes were transfected into the SK-Br-3 oncocytes, cellular iron uptake was analyzed qualitatively at light and electron microscopy and was quantified at atomic absorption spectrometry, and the signal change of the transfected cells was observed and measured using MR imaging. The morphology of the SPIO-labeled ASODN probe was mostly spherical with well-distributed scattering, and the diameters were between 25 and 40 nm (95%) by atomic force microscope and laser granulometer, the conjugating rate of the probe was 99%. Moreover, this probe kept its activity under physiological conditions and could conjugate with antisense oligodeoxynucleotide. In addition, light microscopy revealed an intracellular uptake of iron oxides in the cytosol and electron microscopic studies revealed a lysosomal deposition of iron oxides in the transfected SK-Br-3 oncocytes by antisense probes, some of them gathered stacks, and the iron content of the group of transfected SK-Br-3 oncocytes by antisense probe is significantly higher (18.37 +/- 0.42 pg) than other contrast groups, the MR imaging showed that

  8. Effect of anti-sense oligodeoxynucleotides homeobox B2 on the proliferation and expression of primary human umbilical vein endothelial cells.

    PubMed

    Liu, Xusheng; Zhang, Xiaoqi

    2002-02-01

    To explore the effect of homeobox B2 (HOXB2) anti sense oligodeoxynucleotides (asodn) on the proliferation and expression of primary human umbilical vein endothelial cells (HUVECs). Various concentrations of HOXB2 asodn modified by thiophosphate transfected the induction of liposome into HUVECs. MTT a nd RT-PCR methods were employed to determine the effect of different conc ent rations of asodn on the endothelial proliferation and the expression level of HOXB2 mRNA. After the transfection of HOXB2 asodn, the endothelial proliferation was inhibited in a dose-dependent fashion. Simultaneously, the expression of HOXB2 mRNA decreased significantly. HOXB2 plays an important role in the proliferation of endothelia.

  9. Physiologic TLR9-CpG-DNA interaction is essential for the homeostasis of the intestinal immune system.

    PubMed

    Hofmann, Claudia; Dunger, Nadja; Doser, Kristina; Lippert, Elisabeth; Siller, Sebastian; Edinger, Matthias; Falk, Werner; Obermeier, Florian

    2014-01-01

    Cytosine-guanosine dinucleotide (CpG) motifs are immunostimulatory components of bacterial DNA and activators of innate immunity through Toll-like receptor 9 (TLR9). Administration of CpG oligodeoxynucleotides before the onset of experimental colitis prevents intestinal inflammation by enforcement of regulatory mechanisms. It was investigated whether physiologic CpG/TLR9 interactions are critical for the homeostasis of the intestinal immune system. Mesenteric lymph node cell and lamina propria mononuclear cell (LPMC) populations from BALB/c wild-type (wt) or TLR9 mice were assessed by flow cytometry and proteome profiling. Cytokine secretion was determined and nuclear extracts were analyzed for nuclear factor kappa B (NF-κB) and cAMP response-element binding protein activity. To assess the colitogenic potential of intestinal T cells, CD4-enriched cells from LPMC of wt or TLR9 donor mice were injected intraperitoneally in recipient CB-17 SCID mice. TLR9 deficiency was accompanied by slight changes in cellular composition and phosphorylation of signaling proteins of mesenteric lymph node cell and LPMC. LPMC from TLR9 mice displayed an increased proinflammatory phenotype compared with wt LPMC. NF-κB activity in cells from TLR9 mice was enhanced, whereas cAMP response-element binding activity was reduced compared with wt. Transfer of lamina propria CD4-enriched T cells from TLR9 mice induced severe colitis, whereas wt lamina propria CD4-enriched T cells displayed an attenuated phenotype. Lack of physiologic CpG/TLR9 interaction impairs the function of the intestinal immune system indicated by enhanced proinflammatory properties. Thus, physiologic CpG/TLR interaction is essential for homeostasis of the intestinal immune system as it is required for the induction of counterregulating anti-inflammatory mechanisms.

  10. A recombinant fusion protein and DNA vaccines against foot-and-mouth disease virus type Asia 1 infection in guinea pigs.

    PubMed

    Zhang, Q; Zhu, M W; Yang, Y Q; Shao, M; Zhang, Z Y; Lan, H Y; Yan, W Y; Wu, J J; Zheng, Z X

    2003-01-01

    On the basis of amino acid (aa) sequence of the tandem repeat 133-158-20-34-133-158 which consisted of aa 133-158 of VP1 and aa 20-34 of VP4 of Foot-and-mouth disease virus (FMDV) type Asia 1 a recombinant prokaryotic expression vector pAS1-P encoding a fusion protein and eukaryotic expression vectors pAS1-E and pAS1-EdeltaCpG-ODN representing DNA vaccines were constructed. Guinea pigs immunized with these vaccines showed both neutralizing antibody and T cell proliferation responses. FMDV challenge tests for the first time showed that the recombinant fusion protein and pAS1-E and pAS1-EdeltaCpG-ODN vaccines protected 86%, 60% and 43% of guinea pigs from FMDV type Asia1 challenge, respectively. The results also indicated that the immune response of animals treated with the vector pAS1-E containing an oligodeoxynucleotide (ODN), which consisted of immunostimulatory cytosine-phosphate-guanosine (CpG) motifs, was augmented by CpG ODN.

  11. MPT-51/CpG DNA vaccine protects mice against Mycobacterium tuberculosis.

    PubMed

    Silva, Bruna Daniella de Souza; da Silva, Ediane Batista; do Nascimento, Ivan Pereira; Dos Reis, Michelle Cristina Guerreiro; Kipnis, André; Junqueira-Kipnis, Ana Paula

    2009-07-16

    Tuberculosis (TB) is a severe infectious disease that kills approximately two million people worldwide every year. Because BCG protection is variable and does not protects adults, there is a great need for a new vaccine against TB that does not represent a risk for immunocompromised patients and that is also capable of protecting adult individuals. MPT-51 is a protein found in the genome of mycobacteria and binds to the fibronectin of the extracellular matrix, which may have a role in host tissue attachment and virulence. In order to test the usefulness of MPT-51 as a subunit vaccine, BALB/c were vaccinated and challenged with Mycobacterium tuberculosis. The infection of BALB/c with M. tuberculosis increased the number of IFN-gamma(+) T lymphocytes specific to MPT-51 in the spleen and lungs. Inoculation with rMPT-51/FIA and with rMPT-51/CpG DNA in non-infected BALB/c increased the amounts of IFN-gamma(+) T lymphocytes. Inoculation with rMPT-51/FIA also induced a humoral response specific to MPT-51. CFU counts of lung tissues done 60 days after infection showed a reduction of about 2 log in the bacteria load in the group of animals inoculated with rMPT-51/CpG DNA. These results make MPT-51 a valuable component to be further evaluated in the development of other subunit vaccines.

  12. Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and "BRCA-Like" Status, in Both Blood and Tumour DNA.

    PubMed

    Daniels, Sarah L; Burghel, George J; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D; Brock, Ian W; Cramp, Helen E; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S; Cox, Angela

    2016-01-01

    Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies.

  13. TET1 Depletion Induces Aberrant CpG Methylation in Colorectal Cancer Cells

    PubMed Central

    Yamamoto, Eiichiro; Harada, Taku; Aoki, Hironori; Maruyama, Reo; Toyota, Mutsumi; Sasaki, Yasushi; Sugai, Tamotsu; Tokino, Takashi; Nakase, Hiroshi

    2016-01-01

    Aberrant DNA methylation is commonly observed in colorectal cancer (CRC), but the underlying mechanism is not fully understood. 5-hydroxymethylcytosine levels and TET1 expression are both reduced in CRC, while epigenetic silencing of TET1 is reportedly associated with the CpG island methylator phenotype. In the present study, we aimed to clarify the relationship between loss of TET1 and aberrant DNA methylation in CRC. Stable TET1 knockdown clones were established using Colo320DM cells, which express high levels of TET1, and HCT116 cells, which express TET1 at a level similar to that in normal colonic tissue. Infinium HumanMethylation450 BeadChip assays revealed increased levels of 5-methylcytosine at more than 10,000 CpG sites in TET1-depleted Colo320DM cells. Changes in DNA methylation were observed at various positions within the genome, including promoters, gene bodies and intergenic regions, and the altered methylation affected expression of a subset of genes. By contrast, TET1 knockdown did not significantly affect DNA methylation in HCT116 cells. However, TET1 depletion was associated with attenuated effects of 5-aza-2’-deoxycytidine on gene expression profiles in both cell lines. These results suggest that loss of TET1 may induce aberrant DNA methylation and may attenuate the effect of 5-aza-2’-deoxycytidine in CRC cells. PMID:27977763

  14. MMASS: an optimized array-based method for assessing CpG island methylation.

    PubMed

    Ibrahim, Ashraf E K; Thorne, Natalie P; Baird, Katie; Barbosa-Morais, Nuno L; Tavaré, Simon; Collins, V Peter; Wyllie, Andrew H; Arends, Mark J; Brenton, James D

    2006-01-01

    We describe an optimized microarray method for identifying genome-wide CpG island methylation called microarray-based methylation assessment of single samples (MMASS) which directly compares methylated to unmethylated sequences within a single sample. To improve previous methods we used bioinformatic analysis to predict an optimized combination of methylation-sensitive enzymes that had the highest utility for CpG-island probes and different methods to produce unmethylated representations of test DNA for more sensitive detection of differential methylation by hybridization. Subtraction or methylation-dependent digestion with McrBC was used with optimized (MMASS-v2) or previously described (MMASS-v1, MMASS-sub) methylation-sensitive enzyme combinations and compared with a published McrBC method. Comparison was performed using DNA from the cell line HCT116. We show that the distribution of methylation microarray data is inherently skewed and requires exogenous spiked controls for normalization and that analysis of digestion of methylated and unmethylated control sequences together with linear fit models of replicate data showed superior statistical power for the MMASS-v2 method. Comparison with previous methylation data for HCT116 and validation of CpG islands from PXMP4, SFRP2, DCC, RARB and TSEN2 confirmed the accuracy of MMASS-v2 results. The MMASS-v2 method offers improved sensitivity and statistical power for high-throughput microarray identification of differential methylation.

  15. Intensive hypermethylation of the CpG island of Ras association domain family 1A in hepatitis B virus-associated hepatocellular carcinomas.

    PubMed

    Zhong, Sheng; Yeo, Winnie; Tang, Mandy W; Wong, Nathalie; Lai, Paul B S; Johnson, Phillip J

    2003-08-15

    The human Ras association domain family 1A gene (RASSF1A) is a newly isolated tumor suppressor gene. In this study, we analyzed the methylation status of the promoter region of RASSF1A using bisulfite sequencing and PCR-RFLP in four liver cancer cell lines (Hep3B, HepG(2), SK-HEP-1, and Huh-7) and a cohort of 43 hepatitis B virus-associated hepatocellular carcinoma (HCC) tissues and their corresponding nontumor tissue specimens. The methylation of the CpG islands in the RASSF1A promoter was not detected in 4 samples of normal liver tissue or 10 samples of peripheral blood mononuclear cells from normal subjects. However, the CpG islands were completely methylated, and transcription of the RASSF1A was silenced in the four cell lines. Treatment with the DNA methylation inhibitor 5-aza-2'-deoxycytidine reactivated the expression of RASSF1A in the Hep3B and HepG2 cells. In 41 of 43 (95%) HCC specimens studied, the promoter region of RASSF1A was intensively methylated at its CpG sites. Although heterogeneous methylation was also detected in 16 of the 23 (70%) corresponding nontumorous tissues analyzed, the level of methylation was significantly lower than in the corresponding tumor tissues. HCC has the highest incidence of promoter methylation of RASSF1A among all malignancies yet reported suggesting that hypermethylation of the CpG island promoter of RASSF1A may play an important pathological role in this tumor.

  16. Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and “BRCA-Like” Status, in Both Blood and Tumour DNA

    PubMed Central

    Burghel, George J.; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D.; Brock, Ian W.; Cramp, Helen E.; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S.; Cox, Angela

    2016-01-01

    Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies. PMID:27463681

  17. CpG methylation in human papillomavirus (HPV) type 31 long control region (LCR) in cervical infections associated with cytological abnormalities.

    PubMed

    László, Brigitta; Ferenczi, Annamária; Madar, László; Gyöngyösi, Eszter; Szalmás, Anita; Szakács, Levente; Veress, György; Kónya, József

    2016-08-01

    The mechanisms that regulate papillomavirus gene expression include DNA methylation. The transcription of papillomavirus oncogenes E6 and E7 is controlled by certain regulatory elements in the LCR, which include binding sites for the E2 protein, a viral regulator of oncogene expression. In HPV-31-infected exfoliated cervical cells, the CpG methylation of the entire LCR was determined by next-generation sequencing after bisulfite modification. Six of the 22 cases had methylated CpG sites in the HPV-31 LCR, including position 7479 and/or 7485, at the promoter distal E2 binding site, thus suggesting a potential regulatory mechanism for papillomavirus transcription.

  18. Regulating gene expression in human leukemia cells using light-activated oligodeoxynucleotides

    PubMed Central

    Tang, XinJing; Swaminathan, Jyothishmathi; Gewirtz, Alan M.; Dmochowski, Ivan J.

    2008-01-01

    Light-activated antisense oligodeoxynucleotides (asODNs) were developed to control the degradation of target mRNA in living cells by RNase H. A 20-mer asODN previously shown to target c-myb, a hematopoietic transcription factor, was covalently attached via a photocleavable linker (PL) to partially complementary 20-mer sense strands (sODNs). In the ‘caged’ state, the sODN blocked hybridization of the asODN to c-myb mRNA. Six asODN-PL-sODN conjugates, C1-C6, were synthesized. C5, with twelve complementary bases, gave the largest decrease in melting temperature (Tm) upon UV irradiation (ΔTm = −29°C). The most thermally stable conjugate, C6 (Tm = 84°C), gave the lowest background RNase H activity, with just 8.6% degradation of an RNA 40-mer after 1 h incubation. In biochemical assays with C6, RNA digestion increased 10-fold 10 min after UV irradiation. Finally, phosphorothioated analogs S-C5 and S-C6 were synthesized to test activity in cultured K562 (human leukemia) cells. No knockdown of c-myb mRNA or protein was observed with intact S-C5 or S-C6, whereas more than half of c-myb mRNA was degraded 24 h after photoactivation. Two-fold photomodulation of c-MYB protein levels was also observed with S-C5. However, no photomodulation of c-MYB protein levels was observed with S-C6, perhaps due to the greater stability of this duplex. PMID:18056083

  19. Comparative inhibition of rabbit globin mRNA translation by modified antisense oligodeoxynucleotides.

    PubMed Central

    Cazenave, C; Stein, C A; Loreau, N; Thuong, N T; Neckers, L M; Subasinghe, C; Hélène, C; Cohen, J S; Toulmé, J J

    1989-01-01

    We have studied the translation of rabbit globin mRNA in cell free systems (reticulocyte lysate and wheat germ extract) and in microinjected Xenopus oocytes in the presence of anti-sense oligodeoxynucleotides. Results obtained with the unmodified all-oxygen compounds were compared with those obtained when phosphorothioate or alpha-DNA was used. In the wheat germ system a 17-mer sequence targeted to the coding region of beta-globin mRNA was specifically inhibitory when either the unmodified phosphodiester oligonucleotide or its phosphorothioate analogue were used. In contrast no effect was observed with the alpha-oligomer. These results were ascribed to the fact that phosphorothioate oligomers elicit an RNase-H activity comparable to the all-oxygen congeners, while alpha-DNA/mRNA hybrids were a poor substrate. Microinjected Xenopus oocytes followed a similar pattern. The phosphorothioate oligomer was more efficient to prevent translation than the unmodified 17-mer. Inhibition of beta-globin synthesis was observed in the nanomolar concentration range. This result can be ascribed to the nuclease resistance of phosphorothioates as compared to natural phosphodiester linkages, alpha-oligomers were devoid of any inhibitory effect up to 30 microM. Phosphorothioate oligodeoxyribonucleotides were shown to be non-specific inhibitors of protein translation, at concentrations in the micromolar range, in both cell-free systems and oocytes. Non-specific inhibition of translation was dependent on the length of the phosphorothioate oligomer. These non-specific effects were not observed with the unmodified or the alpha-oligonucleotides. Images PMID:2472605

  20. Asymmetric DNA methylation of CpG dyads is a feature of secondary DMRs associated with the Dlk1/Gtl2 imprinting cluster in mouse.

    PubMed

    Guntrum, Megan; Vlasova, Ekaterina; Davis, Tamara L

    2017-01-01

    Differential DNA methylation plays a critical role in the regulation of imprinted genes. The differentially methylated state of the imprinting control region is inherited via the gametes at fertilization, and is stably maintained in somatic cells throughout development, influencing the expression of genes across the imprinting cluster. In contrast, DNA methylation patterns are more labile at secondary differentially methylated regions which are established at imprinted loci during post-implantation development. To investigate the nature of these more variably methylated secondary differentially methylated regions, we adopted a hairpin linker bisulfite mutagenesis approach to examine CpG dyad methylation at differentially methylated regions associated with the murine Dlk1/Gtl2 imprinting cluster on both complementary strands. We observed homomethylation at greater than 90% of the methylated CpG dyads at the IG-DMR, which serves as the imprinting control element. In contrast, homomethylation was only observed at 67-78% of the methylated CpG dyads at the secondary differentially methylated regions; the remaining 22-33% of methylated CpG dyads exhibited hemimethylation. We propose that this high degree of hemimethylation could explain the variability in DNA methylation patterns at secondary differentially methylated regions associated with imprinted loci. We further suggest that the presence of 5-hydroxymethylation at secondary differentially methylated regions may result in hemimethylation and methylation variability as a result of passive and/or active demethylation mechanisms.

  1. CpG methylation of a silent controlling element in the murine Avy allele is incomplete and unresponsive to methyl donor supplementation.

    PubMed

    Cropley, Jennifer E; Suter, Catherine M; Beckman, Kenneth B; Martin, David I K

    2010-02-04

    The viable yellow allele of agouti (A(vy)) is remarkable for its unstable and partially heritable epigenetic state, which produces wide variation in phenotypes of isogenic mice. In the A(vy) allele an inserted intracisternal A particle (IAP) acts as a controlling element which deregulates expression of agouti by transcription from the LTR of the IAP; the phenotypic state has been linked to CpG methylation of the LTR. Phenotypic variation between A(vy) mice indicates that the epigenetic state of the IAP is unstable in the germline. We have made a detailed examination of somatic methylation of the IAP using bisulphite allelic sequencing, and find that the promoter is incompletely methylated even when it is transcriptionally silent. In utero exposure to supplementary methyl donors, which alters the spectrum of A(vy) phenotypes, does not increase the density of CpG methylation in the silent LTR. Our findings suggest that, contrary to previous supposition, methyl donor supplementation acts through an indirect mechanism to silence A(vy). The incomplete cytosine methylation we observe at the somatically silent A(vy) allele may reflect its unstable germline state, and the influence of epigenetic modifications underlying CpG methylation.

  2. CpG Methylation of a Silent Controlling Element in the Murine Avy Allele Is Incomplete and Unresponsive to Methyl Donor Supplementation

    PubMed Central

    Cropley, Jennifer E.; Suter, Catherine M.; Beckman, Kenneth B.; Martin, David I. K.

    2010-01-01

    Background The viable yellow allele of agouti (Avy) is remarkable for its unstable and partially heritable epigenetic state, which produces wide variation in phenotypes of isogenic mice. In the Avy allele an inserted intracisternal A particle (IAP) acts as a controlling element which deregulates expression of agouti by transcription from the LTR of the IAP; the phenotypic state has been linked to CpG methylation of the LTR. Phenotypic variation between Avy mice indicates that the epigenetic state of the IAP is unstable in the germline. Principal Findings We have made a detailed examination of somatic methylation of the IAP using bisulphite allelic sequencing, and find that the promoter is incompletely methylated even when it is transcriptionally silent. In utero exposure to supplementary methyl donors, which alters the spectrum of Avy phenotypes, does not increase the density of CpG methylation in the silent LTR. Conclusions Our findings suggest that, contrary to previous supposition, methyl donor supplementation acts through an indirect mechanism to silence Avy. The incomplete cytosine methylation we observe at the somatically silent Avy allele may reflect its unstable germline state, and the influence of epigenetic modifications underlying CpG methylation. PMID:20140227

  3. Toll-like receptors 9 and 3 as essential components of innate immune defense against mouse cytomegalovirus infection.

    PubMed

    Tabeta, Koichi; Georgel, Philippe; Janssen, Edith; Du, Xin; Hoebe, Kasper; Crozat, Karine; Mudd, Suzanne; Shamel, Louis; Sovath, Sosathya; Goode, Jason; Alexopoulou, Lena; Flavell, Richard A; Beutler, Bruce

    2004-03-09

    Several subsets of dendritic cells have been shown to produce type I IFN in response to viral infections, thereby assisting the natural killer cell-dependent response that eliminates the pathogen. Type I IFN production can be induced both by unmethylated CpG-oligodeoxynucleotide and by double-stranded RNA. Here, we describe a codominant CpG-ODN unresponsive phenotype that results from an N-ethyl-N-nitrosourea-induced missense mutation in the Tlr9 gene (Tlr9(CpG1)). Mice homozygous for the Tlr9(CpG1) allele are highly susceptible to mouse cytomegalovirus infection and show impaired infection-induced secretion of IFN-alpha/beta and natural killer cell activation. We also demonstrate that both the Toll-like receptor (TLR) 9 --> MyD88 and TLR3 --> Trif signaling pathways are activated in vivo on viral inoculation, and that each pathway contributes to innate defense against systemic viral infection. Whereas both pathways lead to type I IFN production, neither pathway offers full protection against mouse cytomegalovirus infection in the absence of the other. The Tlr9(CpG1) mutation alters a leucine-rich repeat motif and lies within a receptor domain that is conserved within the evolutionary cluster encompassing TLRs 7, 8, and 9. In other TLRs, including three mouse-specific TLRs described in this paper, the affected region is not represented. The phenotypic effect of the Tlr9(CpG1) allele thus points to a critical role for TLR9 in viral sensing and identifies a vulnerable amino acid within the ectodomain of three TLR proteins, essential for a ligand response.

  4. Antisense oligodeoxynucleotide inhibits vascular endothelial growth factor expression in U937 foam cells.

    PubMed

    Yang, Peng-Yuan; Rui, Yao-Cheng; Jin, You-Xin; Li, Tie-Jun; Qiu, Yan; Zhang, Li; Wang, Jie-Song

    2003-06-01

    To study the expression of vascular endothelial growth factor (VEGF) induced by oxidized low density liporotein (ox-LDL) and the inhibitory effects of antisense oligodeoxynucleotide (asODN) on the levels of VEGF protein and mRNA in the U937 foam cells. U937 cells were incubated with ox-LDL 80 mg/L for 48 h, then, the foam cells were treated with asODN (0, 5, 10, and 20 micromol/L). The VEGF concentration in the media was determined by ELISA. The VEGF protein expression level in cells was measured by immuohistochemistry; the positive ratio detected by a morphometrical analysis system was used as the amount of the VEGF expression level. The VEGF mRNA level was examined by Northern blotting. After U937 cells were incubated with ox-LDL, VEGF expression level increased greatly both in the cells and in the media. asODN markedly inhibited the increase of VEGF. After treatment with asODN 20 micromol/L, the VEGF protein concentration in the media decreased by 45.0%, the VEGF positive ratio detected by immuohistochemistry in cells decreased by 64.9%, and the VEGF mRNA level decreased by 47.1%. The expression of VEGF in U937 foam cells was strong. asODN inhibited VEGF expression significantly in U937 foam cells in vitro.

  5. Toll-like receptor prestimulation increases phagocytosis of Escherichia coli DH5alpha and Escherichia coli K1 strains by murine microglial cells.

    PubMed

    Ribes, Sandra; Ebert, Sandra; Czesnik, Dirk; Regen, Tommy; Zeug, Andre; Bukowski, Stephanie; Mildner, Alexander; Eiffert, Helmut; Hanisch, Uwe-Karsten; Hammerschmidt, Sven; Nau, Roland

    2009-01-01

    Meningitis and meningoencephalitis caused by Escherichia coli are associated with high rates of mortality. When an infection occurs, Toll-like receptors (TLRs) expressed by microglial cells can recognize pathogen-associated molecular patterns and activate multiple steps in the inflammatory response that coordinate the brain's local defense, such as phagocytosis of invading pathogens. An upregulation of the phagocytic ability of reactive microglia could improve the host defense in immunocompromised patients against pathogens such as E. coli. Here, murine microglial cultures were stimulated with the TLR agonists Pam(3)CSK(4) (TLR1/TLR2), lipopolysaccharide (TLR4), and CpG oligodeoxynucleotide (TLR9) for 24 h. Upon stimulation, levels of tumor necrosis factor alpha and the neutrophil chemoattractant CXCL1 were increased, indicating microglial activation. Phagocytic activity was studied after adding either E. coli DH5alpha or E. coli K1 strains. After 60 and 90 min of bacterial exposure, the number of ingested bacteria was significantly higher in cells prestimulated with TLR agonists than in unstimulated controls (P < 0.01). Addition of cytochalasin D, an inhibitor of actin polymerization, blocked >90% of phagocytosis. We also analyzed the ability of microglia to kill the ingested E. coli strains. Intracellularly surviving bacteria were quantified at different time points (90, 150, 240, and 360 min) after 90 min of phagocytosis. The number of bacteria killed intracellularly after 6 h was higher in cells primed with the different TLR agonists than in unstimulated microglia. Our data suggest that microglial stimulation by the TLR system can increase bacterial phagocytosis and killing. This approach could improve central nervous system resistance to infections in immunocompromised patients.

  6. MUC1-specific immune therapy generates a strong anti-tumor response in a MUC1-tolerant colon cancer model.

    PubMed

    Mukherjee, P; Pathangey, L B; Bradley, J B; Tinder, T L; Basu, G D; Akporiaye, E T; Gendler, S J

    2007-02-19

    A MUC1-based vaccine was used in a preclinical model of colon cancer. The trial was conducted in a MUC1-tolerant immune competent host injected with MC38 colon cancer cells expressing MUC1. The vaccine included: MHC class I-restricted MUC1 peptides, MHC class II-restricted pan-helper-peptide, unmethylated CpG oligodeoxynucleotide, and granulocyte macrophage-colony stimulating factor. Immunization was successful in breaking MUC1 self-tolerance, and in eliciting a robust anti-tumor response. The vaccine stimulated IFN-gamma-producing CD4(+) helper and CD8(+) cytotoxic T cells against MUC1 and other undefined MC38 tumor antigens. In the prophylactic setting, immunization caused complete rejection of tumor cells, while in the therapeutic regimen, tumor burden was significantly reduced.

  7. In vitro induction of T regulatory cells by a methylated CpG DNA sequence in humans: Potential therapeutic applications in allergic and autoimmune diseases.

    PubMed

    Lawless, Oliver J; Bellanti, Joseph A; Brown, Milton L; Sandberg, Kathryn; Umans, Jason G; Zhou, Li; Chen, Weiqian; Wang, Julie; Wang, Kan; Zheng, Song Guo

    2018-03-01

    Allergic and autoimmune diseases comprise a group of inflammatory disorders caused by aberrant immune responses in which CD25+ Forkhead box P3-positive (FOXP3+) T regulatory (Treg) cells that normally suppress inflammatory events are often poorly functioning. This has stimulated an intensive investigative effort to find ways of increasing Tregs as a method of therapy for these conditions. One such line of investigation includes the study of how ligation of Toll-like receptors (TLRs) by CpG oligonucleotides (ODN) results in an immunostimulatory cascade that leads to induction of T-helper (Th) type 1 and Treg-type immune responses. The present study investigated the mechanisms by which calf thymus mammalian double-stranded DNA (CT-DNA) and a synthetic methylated DNA CpG ODN sequence suppress in vitro lymphoproliferative responses to antigens, mitogens, and alloantigens when measured by [3H]-thymidine incorporation and promote FoxP3 expression in human CD4+ T cells in the presence of transforming growth factor (TGF) beta and interleukin-2 (IL-2). Lymphoproliferative responses of peripheral blood mononuclear cells from four healthy subjects or nine subjects with systemic lupus erythematosus to CT-DNA or phytohemagglutinin (PHA) was measured by tritiated thymidine ([3H]-TdR) incorporation expressed as a stimulation index. Mechanisms of immunosuppressive effects of CT-DNA were evaluated by measurement of the degree of inhibition to lymphoproliferative responses to streptokinase-streptodornase, phytohemagglutinin (PHA), concanavalin A (Con A), pokeweed mitogen (PWM), or alloantigens by a Con A suppressor assay. The effects of CpG methylation on induction of FoxP3 expression in human T cells were measured by comparing inhibitory responses of synthetic methylated and nonmethylated 8-mer CpG ODN sequences by using cell sorting, in vitro stimulation, and suppressor assay. Here, we showed that CT-DNA and a synthetic methylated DNA 8-mer sequence could suppress antigen

  8. Serum and mucosal immune responses to an inactivated influenza virus vaccine induced by epidermal powder immunization.

    PubMed

    Chen, D; Periwal, S B; Larrivee, K; Zuleger, C; Erickson, C A; Endres, R L; Payne, L G

    2001-09-01

    Both circulating and mucosal antibodies are considered important for protection against infection by influenza virus in humans and animals. However, current inactivated vaccines administered by intramuscular injection using a syringe and needle elicit primarily circulating antibodies. In this study, we report that epidermal powder immunization (EPI) via a unique powder delivery system elicits both serum and mucosal antibodies to an inactivated influenza virus vaccine. Serum antibody responses to influenza vaccine following EPI were enhanced by codelivery of cholera toxin (CT), a synthetic oligodeoxynucleotide containing immunostimulatory CpG motifs (CpG DNA), or the combination of these two adjuvants. In addition, secretory immunoglobulin A (sIgA) antibodies were detected in the saliva and mucosal lavages of the small intestine, trachea, and vaginal tract, although the titers were much lower than the IgG titers. The local origin of the sIgA antibodies was further shown by measuring antibodies released from cultured tracheal and small intestinal fragments and by detecting antigen-specific IgA-secreting cells in the lamina propria using ELISPOT assays. EPI with a single dose of influenza vaccine containing CT or CT and CpG DNA conferred complete protection against lethal challenges with an influenza virus isolated 30 years ago, whereas a prime and boost immunizations were required for protection in the absence of an adjuvant. The ability to elicit augmented circulating antibody and mucosal antibody responses makes EPI a promising alternative to needle injection for administering vaccines against influenza and other diseases.

  9. Frequency Modulation and Spatiotemporal Stability of the sCPG in Preterm Infants with RDS

    PubMed Central

    Barlow, Steven M.; Burch, Mimi; Venkatesan, Lalit; Harold, Meredith; Zimmerman, Emily

    2012-01-01

    The nonnutritive suck (NNS) is an observable and accessible motor behavior which is often used to make inference about brain development and pre-feeding skill in preterm and term infants. The purpose of this study was to model NNS burst compression pressure dynamics in the frequency and time domain among two groups of preterm infants, including those with respiratory distress syndrome (RDS, N = 15) and 17 healthy controls. Digitized samples of NNS compression pressure waveforms recorded at a 1-week interval were collected 15 minutes prior to a scheduled feed. Regression analysis and ANOVA revealed that healthy preterm infants produced longer NNS bursts and the mean burst initiation cycle frequencies were higher when compared to the RDS group. Moreover, the initial 5 cycles of the NNS burst manifest a frequency modulated (FM) segment which is a significant feature of the suck central pattern generator (sCPG), and differentially expressed in healthy and RDS infants. The NNS burst structure revealed significantly lower spatiotemporal index values for control versus RDS preterm infants during FM, and provides additional information on the microstructure of the sCPG which may be used to gauge the developmental status and progression of oromotor control systems among these fragile infants. PMID:22888359

  10. MLH1 Region Polymorphisms Show a Significant Association with CpG Island Shore Methylation in a Large Cohort of Healthy Individuals

    PubMed Central

    Savio, Andrea J.; Lemire, Mathieu; Mrkonjic, Miralem; Gallinger, Steven; Zanke, Brent W.; Hudson, Thomas J.; Bapat, Bharati

    2012-01-01

    Single nucleotide polymorphisms (SNPs) are the most common form of genetic variation. We previously demonstrated that SNPs (rs1800734, rs749072, and rs13098279) in the MLH1 gene region are associated with MLH1 promoter island methylation, loss of MLH1 protein expression, and microsatellite instability (MSI) in colorectal cancer (CRC) patients. Recent studies have identified less CpG-dense “shore” regions flanking many CpG islands. These shores often exhibit distinct methylation profiles between different tissues and matched normal versus tumor cells of patients. To date, most epigenetic studies have focused on somatic methylation events occurring within solid tumors; less is known of the contributions of peripheral blood cell (PBC) methylation to processes such as aging and tumorigenesis. To address whether MLH1 methylation in PBCs is correlated with tumorigenesis we utilized the Illumina 450 K microarrays to measure methylation in PBC DNA of 846 healthy controls and 252 CRC patients from Ontario, Canada. Analysis of a region of chromosome 3p21 spanning the MLH1 locus in healthy controls revealed that a CpG island shore 1 kb upstream of the MLH1 gene exhibits different methylation profiles when stratified by SNP genotypes (rs1800734, rs749072, and rs13098279). Individuals with wild-type genotypes incur significantly higher PBC shore methylation than heterozygous or homozygous variant carriers (p<1.1×10−6; ANOVA). This trend is also seen in CRC cases (p<0.096; ANOVA). Shore methylation also decreases significantly with increasing age in cases and controls. This is the first study of its kind to integrate PBC methylation at a CpG island shore with SNP genotype status in CRC cases and controls. These results indicate that CpG island shore methylation in PBCs may be influenced by genotype as well as the normal aging process. PMID:23240038

  11. Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants

    PubMed Central

    Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J.; Shih, J. Wai-Kuo

    2017-01-01

    Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-γ-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biasedpathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-γ demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins. PMID:18675871

  12. Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants.

    PubMed

    Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J; Shih, J Wai-Kuo

    2008-10-09

    Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-gamma-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biased pathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-gamma demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins.

  13. Cryotherapy with concurrent CpG oligonucleotide treatment controls local tumor recurrence and modulates HER2/neu immunity.

    PubMed

    Veenstra, Jesse J; Gibson, Heather M; Littrup, Peter J; Reyes, Joyce D; Cher, Michael L; Takashima, Akira; Wei, Wei-Zen

    2014-10-01

    Percutaneous cryoablation is a minimally invasive procedure for tumor destruction, which can potentially initiate or amplify antitumor immunity through the release of tumor-associated antigens. However, clinically efficacious immunity is lacking and regional recurrences are a limiting factor relative to surgical excision. To understand the mechanism of immune activation by cryoablation, comprehensive analyses of innate immunity and HER2/neu humoral and cellular immunity following cryoablation with or without peritumoral CpG injection were conducted using two HER2/neu(+) tumor systems in wild-type (WT), neu-tolerant, and SCID mice. Cryoablation of neu(+) TUBO tumor in BALB/c mice resulted in systemic immune priming, but not in neu-tolerant BALB NeuT mice. Cryoablation of human HER2(+) D2F2/E2 tumor enabled the functionality of tumor-induced immunity, but secondary tumors were refractory to antitumor immunity if rechallenge occurred during the resolution phase of the cryoablated tumor. A step-wise increase in local recurrence was observed in WT, neu-tolerant, and SCID mice, indicating a role of adaptive immunity in controlling residual tumor foci. Importantly, local recurrences were eliminated or greatly reduced in WT, neu tolerant, and SCID mice when CpG was incorporated in the cryoablation regimen, showing significant local control by innate immunity. For long-term protection, however, adaptive immunity was required because most SCID mice eventually succumbed to local tumor recurrence even with combined cryoablation and CpG treatment. This improved understanding of the mechanisms by which cryoablation affects innate and adaptive immunity will help guide appropriate combination of therapeutic interventions to improve treatment outcomes. ©2014 American Association for Cancer Research.

  14. Cellular uptake and ex vivo urothelial penetration by oligodeoxynucleotides for optimizing treatment of transitional cell carcinoma.

    PubMed

    Bolenz, Christian; Trojan, Lutz; Gabriel, Ute; Honeck, Patrick; Wendt-Nordahl, Gunnar; Schaaf, Axel; Alken, Peter; Michel, Maurice Stephan

    2008-10-01

    To evaluate cellular uptake and urothelial penetration of oligodeoxynucleotides (ODNs) in transitional cell carcinoma (TCC) cell lines and in a porcine ex vivo model, respectively. A panel of human TCC cell lines (RT 112, HT 1197 and UM-UC3) were exposed tofluorescein-labeled ODNs. Transfection rates were assessed byfluorescence microscopy and fluorescence-activated cell sorting (FACS). Intravesical treatment with ODNs was performed in a porcine ex vivo model. Urothelial penetration was evaluated using fluorescence microscopy of cryosections. Treatment with ODNs provided transfection rates of at least 96.8% of TCC cells, irrespective of use of a transfection agent. Effective urothelial penetration by ODNs was detected when compared with controls (p = 0.0325). The addition of a liposomal transfection agent significantly increased the penetration depth, allowing affection of deep urothelial cell layers (p = 0.0082). High transfection rates of ODNs can be achieved in TCC cells. Urothelial penetration of ODNs was observed down to the deepest cell layers when a transfection agent is added, suggesting a high potential for complementing the chemoresection effects on residual tumor areas during intravesical therapy of non-muscle-invasive TCC.

  15. Employment of Oligodeoxynucleotide plus Interleukin-2 Improves Cytogenetic Analysis in Splenic Marginal Zone Lymphoma

    PubMed Central

    Bardi, Antonella; Cavazzini, Francesco; Rigolin, Gian Matteo; Tammiso, Elisa; Volta, Eleonora; Pezzolo, Elisa; Formigaro, Luca; Sofritti, Olga; Daghia, Giulia; Ambrosio, Cristina; Rizzotto, Lara; Abass, Awad E.; D'Auria, Fiorella; Musto, Pellegrino; Cuneo, Antonio

    2011-01-01

    To compare the efficiency of novel mitogenic agents and traditional mitosis inductors, 18 patients with splenic marginal zone lymphoma (SMZL) were studied. Three cultures using oligodeoxynucleotide (ODN) plus interleukin-2 (IL-2), or TPA, or LPS were setup in each patient. Seventeen/18 cases with ODN + IL2 had moderate/good proliferation (94, 4%) as compared with 10/18 cases with TPA and LPS (55%) (P = .015); 14/18 (77, 7%) cases with ODN + IL2 had sufficient good quality of banding as compared with 8/18 cases (44, 4%) with TPA and LPS. The karyotype could be defined from ODN + IL2-stimulated cultures in all 18 patients, 14 of whom (77, 7%) had a cytogenetic aberration, whereas clonal aberrations could be documented in 9 and in 3 cases by stimulation with LPS and TPA, respectively. Recurrent chromosome aberrations in our series were represented by aberrations of chromosome 14q in 5 patients, by trisomy 12 and 7q deletion in 4 cases each, and by abnormalities involving 11q and 13q in two cases each. These findings show that stimulation with ODN + IL2 offers more mitotic figures of better quality and results in an increased rate of clonal aberrations in SMZL, making this method ideal for prospective studies aiming at the definition of the prognostic impact of cytogenetic aberrations in this disorder. PMID:21629757

  16. Zinc-finger Nuclease-induced Gene Repair With Oligodeoxynucleotides: Wanted and Unwanted Target Locus Modifications

    PubMed Central

    Radecke, Sarah; Radecke, Frank; Cathomen, Toni; Schwarz, Klaus

    2010-01-01

    Correcting a mutated gene directly at its endogenous locus represents an alternative to gene therapy protocols based on viral vectors with their risk of insertional mutagenesis. When solely a single-stranded oligodeoxynucleotide (ssODN) is used as a repair matrix, the efficiency of the targeted gene correction is low. However, as shown with the homing endonuclease I-SceI, ssODN-mediated gene correction can be enhanced by concomitantly inducing a DNA double-strand break (DSB) close to the mutation. Because I-SceI is hardly adjustable to cut at any desired position in the human genome, here, customizable zinc-finger nucleases (ZFNs) were used to stimulate ssODN-mediated repair of a mutated single-copy reporter locus stably integrated into human embryonic kidney-293 cells. The ZFNs induced faithful gene repair at a frequency of 0.16%. Six times more often, ZFN-induced DSBs were found to be modified by unfaithful addition of ssODN between the termini and about 60 times more often by nonhomologous end joining-related deletions and insertions. Additionally, ZFN off-target activity based on binding mismatch sites at the locus of interest was detected in in vitro cleavage assays and also in chromosomal DNA isolated from treated cells. Therefore, the specificity of ZFN-induced ssODN-mediated gene repair needs to be improved, especially regarding clinical applications. PMID:20068556

  17. Bioconjugation of Oligodeoxynucleotides Carrying 1,4-Dicarbonyl Groups via Reductive Amination with Lysine Residues.

    PubMed

    Yang, Bo; Jinnouchi, Akiko; Usui, Kazuteru; Katayama, Tsutomu; Fujii, Masayuki; Suemune, Hiroshi; Aso, Mariko

    2015-08-19

    We evaluated the efficacy of bioconjugation of oligodeoxynucleotides (ODNs) containing 1,4-dicarbonyl groups, a C4'-oxidized abasic site (OAS), and a newly designed 2'-methoxy analogue, via reductive amination with lysine residues. Dicarbonyls, aldehyde and ketone at C1- and C4-positions of deoxyribose in the ring-opened form of OAS allowed efficient reaction with amines. Kinetic studies indicated that reductive amination of OAS-containing ODNs with a proximal amine on the complementary strand proceeded 10 times faster than the corresponding reaction of an ODN containing an abasic site with C1-aldehyde. Efficient reductive amination between the DNA-binding domain of Escherichia coli DnaA protein and ODNs carrying OAS in the DnaA-binding sequence proceeded at the lysine residue in proximity to the phosphate group at the 5'-position of the OAS, in contrast to unsuccessful conjugation with abasic site ODNs, even though they have similar aldehydes. Theoretical calculation indicated that the C1-aldehyde of OAS was more accessible to the target lysine than that of the abasic site. These results demonstrate the potential utility of cross-linking strategies that use dicarbonyl-containing ODNs for the study of protein-nucleic acid interactions. Conjugation with a lysine-containing peptide that lacked specific affinity for ODN was also successful, further highlighting the advantages of 1,4-dicarbonyls.

  18. Synthetic Poly(L-Glutamic Acid)-conjugated CpG Exhibits Antitumor Efficacy With Increased Retention in Tumor and Draining Lymph Nodes After Intratumoral Injection in a Mouse Model of Melanoma.

    PubMed

    Ma, Qing; Zhou, Dapeng; DeLyria, Elizabeth S; Wen, Xiaoxia; Lu, Wei; Thapa, Prakash; Liu, Chengwen; Li, Dan; Bassett, Roland L; Overwijk, Willem W; Hwu, Patrick; Li, Chun

    2017-01-01

    There is an urgent need for new clinically applicable drug-delivery methods to enhance accumulation of immune-activating drugs in tumors. We synthesized a poly(L-glutamic acid)-CpG ODN2216 conjugate (PG-CpG) and injected it intratumorally into C57BL/6 mice bearing subcutaneous B16-ovalbumin melanoma. PG-CpG elicited the same potent antitumoral activity as CpG with respect to reducing tumor growth and triggering antigen-specific CD8 T-cell responses in this well-established solid tumor model. Moreover, PG-CpG was retained significantly longer in both tumor and draining lymph nodes than was free CpG after intratumoral injection. Specifically, 48 hours after injection, 26.5%±16.9% of the injected PG-CpG dose versus 4.72%±2.61% of free CpG remained at the tumor, and 1.53%±1.22% of the injected PG-CpG versus 0.37%±0.33% of free CpG was retained in the draining inguinal lymph nodes. These findings indicate that PG is an effective synthetic polymeric carrier for delivery of immunostimulatory agents to tumors and lymph nodes.

  19. Randomized, double-blind, placebo-controlled, safety and immunogenicity study of 4 formulations of Anthrax Vaccine Adsorbed plus CPG 7909 (AV7909) in healthy adult volunteers.

    PubMed

    Hopkins, Robert J; Daczkowski, Nancy F; Kaptur, Paulina E; Muse, Derek; Sheldon, Eric; LaForce, Craig; Sari, Suha; Rudge, Thomas L; Bernton, Edward

    2013-06-26

    A new anthrax vaccine that could accelerate the immune response and possibly reduce the number of injections needed for protection would be desirable in a post-exposure setting. This Phase 1 study compared the safety and immunogenicity of 2 IM doses (Days 0 and 14) of 4 formulations of AV7909 (AVA plus CPG 7909) with 2 IM doses of BioThrax(®) (Anthrax Vaccine Adsorbed) and 2 IM doses of saline placebo administered on Days 0 and 14. A total of 105 healthy adults 18-50 years of age were randomized to 1 of 6 study groups: BioThrax (0.5 mL), AV7909 Formulation 1 (0.5 mL AVA+0.5mg CPG 7909), AV7909 Formulation 2 (0.5 mL AVA+0.25mg CPG 7909), AV7909 Formulation 3 (0.25 mL AVA+0.5mg CPG 7909), AV7909 Formulation 4 (0.25 mL AVA+0.25mg CPG 7909), or saline placebo (0.5 mL). All randomized subjects received at least 1 vaccination, and 100 subjects completed the trial. After 2 doses, mean peak normalized toxin neutralizing antibody responses (TNA NF50) in the AV7909 groups were higher than in the BioThrax group. Differences among the 4 AV7909 groups were not statistically significant. Subjects who received AV7909 reached peak titers on Day 28 vs. Day 35 in the BioThrax group. The most common adverse events (AEs) in the BioThrax and AV7909 groups assessed as related to vaccination were injection site reactions. Transient lymphopenia was observed after the first dose in each AV7909 group. Frequencies of injection site and systemic reactions recorded by subjects in diaries for 7 days after each injection were highest with AV7909 Formulation 1. No AEs of special interest (autoimmune events) were observed in the study. Further studies of doses and dosing regimens are planned to assess the immunogenicity and reactogenicity of AV7909. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Bacterial DNA-induced NK cell IFN-gamma production is dependent on macrophage secretion of IL-12.

    PubMed

    Chace, J H; Hooker, N A; Mildenstein, K L; Krieg, A M; Cowdery, J S

    1997-08-01

    Bacterial DNA (bDNA) activates B cells and macrophages and can augment inflammatory responses by inducing release of proinflammatory cytokines. We found that bDNA stimulation of mouse spleen cells induced NK cell IFN-gamma production that was dependent upon the presence of unmethylated CpG motifs, and oligonucleotides with internal CpG motifs could also induce splenocytes to secrete IFN-gamma. The bDNA-induced IFN-gamma response was strictly macrophages dependent. While splenocytes from SCID mice secreted IFN-gamma in response to bDNA, depletion of macrophages eliminated this response. Additionally, purified NK cells did not respond to bDNA; however, addition of macrophages restored the NK cell IFN-gamma response. Coculture of NK cells with preactivated macrophages further increased bDNA-induced NK cell IFN-gamma production. Anti-IL-12 or IL-10 inhibited bDNA-induced IFN-gamma response. Treatment of purified macrophages with bDNA resulted in IL-12 secretion accompanied by an increase in IL-12 p40 mRNA level. Although isolated NK cells did not make IFN-gamma in response to bDNA, NK cells costimulated with IL-12 gained the ability to respond to bDNA. These experiments show that bDNA induces macrophage IL-12 production which, in turn, stimulates NK cell IFN-gamma production. Macrophage-derived IL-12 renders NK cells responsive to bDNA permitting an even greater IFN-gamma response to bDNA.

  1. Correlation between anthrax lethal toxin neutralizing antibody levels and survival in guinea pigs and nonhuman primates vaccinated with the AV7909 anthrax vaccine candidate.

    PubMed

    Savransky, Vladimir; Shearer, Jeffry D; Gainey, Melicia R; Sanford, Daniel C; Sivko, Gloria S; Stark, Gregory V; Li, Na; Ionin, Boris; Lacy, Michael J; Skiadopoulos, Mario H

    2017-09-05

    The anthrax vaccine candidate AV7909 is being developed as a next generation vaccine for a post-exposure prophylaxis (PEP) indication against anthrax. AV7909 consists of the Anthrax Vaccine Adsorbed (AVA, BioThrax®) bulk drug substance adjuvanted with the immunostimulatory oligodeoxynucleotide (ODN) compound, CPG 7909. The addition of CPG 7909 to AVA enhances both the magnitude and the kinetics of antibody responses in animals and human subjects, making AV7909 a suitable next-generation vaccine for use in a PEP setting. The studies described here provide initial information on AV7909-induced toxin-neutralizing antibody (TNA) levels associated with the protection of animals from lethal Bacillus anthracis challenge. Guinea pigs or nonhuman primates (NHPs) were immunized on Days 0 and 28 with various dilutions of AV7909, AVA or a saline or Alhydrogel+CPG 7909 control. Animals were challenged via the inhalational route with a lethal dose of aerosolized B. anthracis (Ames strain) spores and observed for clinical signs of disease and mortality. The relationship between pre-challenge serum TNA levels and survival following challenge was determined in order to calculate a threshold TNA level associated with protection. Immunisation with AV7909 induced a rapid, highly protective TNA response in guinea pigs and NHPs. Surprisingly, the TNA threshold associated with a 70% probability of survival for AV7909 immunized animals was substantially lower than the threshold which has been established for the licensed AVA vaccine. The results of this study suggest that the TNA threshold of protection against anthrax could be modified by the addition of an immune stimulant such as CPG 7909 and that the TNA levels associated with protection may be vaccine-specific. Copyright © 2017. Published by Elsevier Ltd.

  2. Gold nanocluster-based vaccines for dual-delivery of antigens and immunostimulatory oligonucleotides

    NASA Astrophysics Data System (ADS)

    Tao, Yu; Zhang, Yan; Ju, Enguo; Ren, Hui; Ren, Jinsong

    2015-07-01

    We here report a facile one-pot synthesis of fluorescent gold nanoclusters (AuNCs) via the peptide biomineralization method, which can elicit specific immunological responses. The as-prepared peptide-protected AuNCs (peptide-AuNCs) display strong red fluorescence, and more importantly, as compared to the peptide alone, the immune stimulatory ability of the resulting peptide-AuNCs can not only be retained, but can also be efficaciously enhanced. Moreover, through a dual-delivery of antigen peptides and cytosine-phosphate-guanine (CpG) oligodeoxynucleotides (ODNs), the as-prepared peptide-AuNC-CpG conjugates can also act as smart self-vaccines to assist in the generation of high immunostimulatory activity, and be applied as a probe for intracellular imaging. Both in vitro and in vivo studies provide strong evidence that the AuNC-based vaccines may be utilized as safe and efficient immunostimulatory agents that are able to prevent and/or treat a variety of ailments.We here report a facile one-pot synthesis of fluorescent gold nanoclusters (AuNCs) via the peptide biomineralization method, which can elicit specific immunological responses. The as-prepared peptide-protected AuNCs (peptide-AuNCs) display strong red fluorescence, and more importantly, as compared to the peptide alone, the immune stimulatory ability of the resulting peptide-AuNCs can not only be retained, but can also be efficaciously enhanced. Moreover, through a dual-delivery of antigen peptides and cytosine-phosphate-guanine (CpG) oligodeoxynucleotides (ODNs), the as-prepared peptide-AuNC-CpG conjugates can also act as smart self-vaccines to assist in the generation of high immunostimulatory activity, and be applied as a probe for intracellular imaging. Both in vitro and in vivo studies provide strong evidence that the AuNC-based vaccines may be utilized as safe and efficient immunostimulatory agents that are able to prevent and/or treat a variety of ailments. Electronic supplementary information (ESI

  3. Three SRA-Domain Methylcytosine-Binding Proteins Cooperate to Maintain Global CpG Methylation and Epigenetic Silencing in Arabidopsis

    PubMed Central

    Woo, Hye Ryun; Dittmer, Travis A.; Richards, Eric J.

    2008-01-01

    Methylcytosine-binding proteins decipher the epigenetic information encoded by DNA methylation and provide a link between DNA methylation, modification of chromatin structure, and gene silencing. VARIANT IN METHYLATION 1 (VIM1) encodes an SRA (SET- and RING-associated) domain methylcytosine-binding protein in Arabidopsis thaliana, and loss of VIM1 function causes centromere DNA hypomethylation and centromeric heterochromatin decondensation in interphase. In the Arabidopsis genome, there are five VIM genes that share very high sequence similarity and encode proteins containing a PHD domain, two RING domains, and an SRA domain. To gain further insight into the function and potential redundancy among the VIM proteins, we investigated strains combining different vim mutations and transgenic vim knock-down lines that down-regulate multiple VIM family genes. The vim1 vim3 double mutant and the transgenic vim knock-down lines showed decreased DNA methylation primarily at CpG sites in genic regions, as well as repeated sequences in heterochromatic regions. In addition, transcriptional silencing was released in these plants at most heterochromatin regions examined. Interestingly, the vim1 vim3 mutant and vim knock-down lines gained ectopic CpHpH methylation in the 5S rRNA genes against a background of CpG hypomethylation. The vim1 vim2 vim3 triple mutant displayed abnormal morphological phenotypes including late flowering, which is associated with DNA hypomethylation of the 5′ region of FWA and release of FWA gene silencing. Our findings demonstrate that VIM1, VIM2, and VIM3 have overlapping functions in maintenance of global CpG methylation and epigenetic transcriptional silencing. PMID:18704160

  4. CpG island methylator phenotype in adenocarcinomas from the digestive tract: Methods, conclusions, and controversies

    PubMed Central

    Sánchez-Vega, Francisco; Gotea, Valer; Chen, Yun-Ching; Elnitski, Laura

    2017-01-01

    Over the last two decades, cancer-related alterations in DNA methylation that regulate transcription have been reported for a variety of tumors of the gastrointestinal tract. Due to its relevance for translational research, great emphasis has been placed on the analysis and molecular characterization of the CpG island methylator phenotype (CIMP), defined as widespread hypermethylation of CpG islands in clinically distinct subsets of cancer patients. Here, we present an overview of previous work in this field and also explore some open questions using cross-platform data for esophageal, gastric, and colorectal adenocarcinomas from The Cancer Genome Atlas. We provide a data-driven, pan-gastrointestinal stratification of individual samples based on CIMP status and we investigate correlations with oncogenic alterations, including somatic mutations and epigenetic silencing of tumor suppressor genes. Besides known events in CIMP such as BRAF V600E mutation, CDKN2A silencing or MLH1 inactivation, we discuss the potential role of emerging actors such as Wnt pathway deregulation through truncating mutations in RNF43 and epigenetic silencing of WIF1. Our results highlight the existence of molecular similarities that are superimposed over a larger backbone of tissue-specific features and can be exploited to reduce heterogeneity of response in clinical trials. PMID:28344746

  5. CpG methylation at the USF binding site mediates cell-specific transcription of human ascorbate transporter SVCT2 exon 1a

    PubMed Central

    Qiao, Huan; May, James M.

    2013-01-01

    SVCT2 is the major transporter mediating vitamin C uptake in most organs. Its expression is driven by two promoters (CpG-poor exon 1a promoter and CpG-rich exon 1b promoter). In this work we mapped discrete elements within the proximal CpG-poor promoter responsible for the exon 1a transcription. We identified two E boxes for USF binding and one Y box for NF-Y binding. We further show that the formation of an NFY/USF complex on the exon 1a promoter amplifies each other's ability to bind to the promoter in a cooperativity-dependent manner and is absolutely required for the full activity of the exon 1a promoter. The analysis of the CpG site located at the upstream USF binding site in the promoter showed a strong correlation between expression and demethylation. It was also shown that the exon 1a transcription was induced in cell culture treated with demethylating agent decitabine. The specific methylation of this CpG site impaired both the binding of USF and the formation of the functional NF-Y/USF complex as well as promoter activity, suggesting its importance for the cell-specific transcription. Thus CpG methylation at the upstream USF binding site functions in establishing and maintaining cell-specific transcription from the CpG-poor SVCT2 exon 1a promoter. PMID:21770893

  6. Improved strategies for postoligomerization synthesis of oligodeoxynucleotides bearing structurally defined adducts at the N2 position of deoxyguanosine.

    PubMed

    DeCorte, B L; Tsarouhtsis, D; Kuchimanchi, S; Cooper, M D; Horton, P; Harris, C M; Harris, T M

    1996-01-01

    Improved methodology has been developed for preparation of oligodeoxynucleotides bearing adducts on the N2 position of guanine in which the adduction reaction is carried out in homogeneous solution rather than while the oligonucleotide is immobilized on a solid matrix. The methodology utilizes a new synthon, 2-fluoro-O6-(trimethylsilylethyl)-2'-deoxyinosine (3). Nucleoside 3 is stable to the conditions of oligonucleotide synthesis, but the O6 protection is eliminated under very mild conditions following displacement of the 2-fluoro group by amine nucleophiles. Oligonucleotides containing 3 could be removed from the solid support by treatment with 0.1 M NaOH (8 h, rt) without disruption of 3. Reaction of the crude, partially deprotected oligonucleotide with (R)-2-amino-2-phenylethanol in homogeneous solution, followed by removal of the remaining protective groups with NH4OH (60 degrees C, 8 h) and then 0.1% acetic acid, gave the adducted oligonucleotide in good purity and yield. Alternatively, fully deprotected oligonucleotide containing 3 could be prepared by use of labile phenoxyacetyl-type protecting groups on the exocyclic amino groups.

  7. Dendritic cell-targeting DNA-based mucosal adjuvants for the development of mucosal vaccines

    PubMed Central

    Kataoka, Kosuke; Fujihashi, Kohtaro

    2009-01-01

    In order to establish effective mucosal immunity against various mucosal pathogens, vaccines must be delivered via the mucosal route and contain effective adjuvant(s). Since mucosal adjuvants can simply mix with the antigen, it is relatively easy to adapt them for different types of vaccine development. Even in simple admixture vaccines, the adjuvant itself must be prepared without any complications. Thus, CpG oligodeoxynucleotides or plasmids encoding certain cDNA(s) would be potent mucosal adjuvant candidates when compared with other substances that can be used as mucosal adjuvants. The strategy of a DNA-based mucosal adjuvant facilitates the targeting of mucosal dendritic cells, and thus is an effective and safe approach. It would also provide great flexibility for the development of effective vaccines for various mucosal pathogens. PMID:19722892

  8. MUC1-specific immune therapy generates a strong anti-tumor response in a MUC1-tolerant colon cancer model

    PubMed Central

    Mukherjee, P.; Pathangey, L.B.; Bradley, J.B.; Tinder, T.L.; Basu, G.D.; Akporiaye, E.T.; Gendler, S.J.

    2007-01-01

    A MUC1-based vaccine was used in a preclinical model of colon cancer. The trial was conducted in a MUC1-tolerant immune competent host injected with MC38 colon cancer cells expressing MUC1. The vaccine included: MHC class I-restricted MUC1 peptides, MHC class II-restricted pan helper peptide, unmethylated CpG oligodeoxynucleotide, and granulocyte macrophage-colony stimulating factor. Immunization was successful in breaking MUC1 self-tolerance, and in eliciting a robust anti-tumor response. The vaccine stimulated IFN-γ-producing CD4+ helper and CD8+ cytotoxic T cells against MUC1 and other undefined MC38 tumor antigens. In the prophylactic setting, immunization caused complete rejection of tumor cells, while in the therapeutic regimen, tumor burden was significantly reduced. PMID:17166639

  9. Local Delivery of the Toll-Like Receptor 9 Ligand CpG Downregulates Host Immune and Inflammatory Responses, Ameliorating Established Leishmania (Viannia) panamensis Chronic Infection

    PubMed Central

    Fernández, Olga L.; Rodriguez-Pinto, Daniel; Castilho, Tiago M.; Corral Caridad, Maria J.; Goldsmith-Pestana, Karen; Saravia, Nancy Gore; McMahon-Pratt, Diane

    2017-01-01

    ABSTRACT Infection by Leishmania (Viannia) panamensis, the predominant etiologic agent for cutaneous leishmaniasis in Colombia, is characterized by a chronic mixed inflammatory response. Current treatment options are plagued by toxicity, lengthy treatment regimens, and growing evidence of drug resistance. Immunotherapy, modulating the immune system to mount a protective response, may provide an alternate therapeutic approach. We investigated the ability of the Toll-like receptor 9 (TLR9) ligand CpG to modulate established disease in the L. (V.) panamensis mouse model. Treatment of established infection with a high dose (50 μg) of CpG ameliorated disease and lowered parasite burden. Interestingly, immediately after treatment there was a significant increase in transforming growth factor β (TGF-β) and concomitantly an increase in T regulatory cell (Treg) function. Although a general reduction in cell-mediated immune cytokine and chemokine (gamma interferon [IFN-γ], interleukin 10 [IL-10], IL-13, IL-6, granulocyte-macrophage colony-stimulating factor [GM-CSF], IL-4, and MIP-1α) responses of the treated mice was observed, certain chemokines (RANTES, monocyte chemoattractant protein 1[MCP-1], and IP-10) were increased. Further, in peripheral blood mononuclear cells (PBMCs) from patients with cutaneous leishmaniasis, CpG treatment similarly exhibited a dose-response effect on the production of IFN-γ, IL-17, IL-10, and IL-13, with reductions observed at higher doses. To further understand the underlying mechanisms and cell populations driving the CpG mediated response, we examined the ex vivo dose effects mediated by the TLR9+ cell populations (dendritic cells, macrophages, and B cells) found to accumulate labeled CpG in vivo. Notably, B cells altered the production of IL-17, IL-13, and IFN-γ, supporting a role for B cells functioning as antigen-presenting cells (APCs) and/or regulatory cells during infection. Interestingly, B cells have been previously

  10. Modulation of transcription factor binding and epigenetic regulation of the MLH1 CpG island and shore by polymorphism rs1800734 in colorectal cancer

    PubMed Central

    Savio, Andrea J.; Bapat, Bharati

    2017-01-01

    ABSTRACT The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located. PMID:28304185

  11. Modulation of transcription factor binding and epigenetic regulation of the MLH1 CpG island and shore by polymorphism rs1800734 in colorectal cancer.

    PubMed

    Savio, Andrea J; Bapat, Bharati

    2017-06-03

    The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located.

  12. A guanidine-rich regulatory oligodeoxynucleotide improves type-2 diabetes in obese mice by blocking T-cell differentiation

    PubMed Central

    Cheng, Xiang; Wang, Jing; Xia, Ni; Yan, Xin-Xin; Tang, Ting-Ting; Chen, Han; Zhang, Hong-Jian; Liu, Juan; Kong, Wen; Sjöberg, Sara; Folco, Eduardo; Libby, Peter; Liao, Yu-Hua; Shi, Guo-Ping

    2012-01-01

    T lymphocytes exhibit pro-inflammatory or anti-inflammatory activities in obesity and diabetes, depending on their subtypes. Guanidine-rich immunosuppressive oligodeoxynucleotides (ODNs) effectively control Th1/Th2-cell counterbalance. This study reveals a non-toxic regulatory ODN (ODNR01) that inhibits Th1- and Th17-cell polarization by binding to STAT1/3/4 and blocking their phosphorylation without affecting Th2 and regulatory T cells. ODNR01 improves glucose tolerance and insulin sensitivity in both diet-induced obese (DIO) and genetically generated obese (ob/ob) mice. Mechanistic studies show that ODNR01 suppresses Th1- and Th17-cell differentiation in white adipose tissue, thereby reducing macrophage accumulation and M1 macrophage inflammatory molecule expression without affecting M2 macrophages. While ODNR01 shows no effect on diabetes in lymphocyte-free Rag1-deficient DIO mice, it enhances glucose tolerance and insulin sensitivity in CD4+ T-cell-reconstituted Rag1-deficient DIO mice, suggesting its beneficial effect on insulin resistance is T-cell-dependent. Therefore, regulatory ODNR01 reduces obesity-associated insulin resistance through modulation of T-cell differentiation. PMID:23027613

  13. AP-1 Oligodeoxynucleotides Reduce Aortic Elastolysis in a Murine Model of Marfan Syndrome.

    PubMed

    Arif, Rawa; Zaradzki, Marcin; Remes, Anca; Seppelt, Philipp; Kunze, Reiner; Schröder, Hannes; Schwill, Simon; Ensminger, Stephan M; Robinson, Peter N; Karck, Matthias; Müller, Oliver J; Hecker, Markus; Wagner, Andreas H; Kallenbach, Klaus

    2017-12-15

    Marfan syndrome is characterized by high expression of matrix metalloproteinases (MMPs) in aortic smooth muscle cells (AoSMCs) associated with medial elastolysis and aortic root aneurysm. We aimed to reduce aortic elastolysis through decrease of MMP expression with decoy oligodeoxynucleotides (dODNs) neutralizing the transcription factor activating factor-1 (AP-1). AP-1 abundance in nuclear extracts as well as MMP-2 and MMP-9 expression were significantly increased in isolated mAoSMC of mgR/mgR Marfan mice compared to wild-type cells. Exposure to AP-1 neutralizing dODNs resulted in a significant reduction of basal and interleukin-1β-stimulated MMP expression and activity in mAoSMCs. Moreover, increased migration and formation of superoxide radical anions was substantially decreased in mAoSMCs by AP-1 dODN treatment. Aortic grafts from donor Marfan mice were treated with AP-1- dODN ex vivo and implanted as infrarenal aortic interposition grafts in mgR/mgR mice. Pretreatment of aortic grafts with AP-1 dODN led to reduced elastolysis, macrophage infiltration, and MMP activity. Permeability of the endothelial monolayer was increased for dODN in mgR/mgR aortae with observed loss of tight junction proteins ZO-1 and occludin, enabling dODN to reach the tunica media. Targeting AP-1 activity offers a new potential strategy to treat the vascular phenotype associated with Marfan syndrome. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  14. The CpG island methylator phenotype (CIMP) in colorectal cancer.

    PubMed

    Nazemalhosseini Mojarad, Ehsan; Kuppen, Peter Jk; Aghdaei, Hamid Asadzadeh; Zali, Mohammad Reza

    2013-01-01

    It is clear that colorectal cancer (CRC) develops through multiple genetic and epigenetic pathways. These pathways may be determined on the basis of three molecular features: (i) mutations in DNA mismatch repair genes, leading to a DNA microsatellite instability (MSI) phenotype, (ii) mutations in APC and other genes that activate Wnt pathway, characterized by chromosomal instability (CIN) phenotype, and (iii) global genome hypermethylation, resulting in switch off of tumor suppressor genes, indicated as CpG island methylator phenotype (CIMP). Each of these pathways is characterized by specific pathological features, mechanisms of carcinogenesis and process of tumor development. The molecular aspects of these pathways have been used clinically in the diagnosis, screening and management of patients with colorectal cancer. In this review we especially describe various aspects of CIMP, one of the important and rather recently discovered pathways that lead to colorectal cancer.

  15. HIV Gag protein conjugated to a Toll-like receptor 7/8 agonist improves the magnitude and quality of Th1 and CD8+ T cell responses in nonhuman primates

    NASA Astrophysics Data System (ADS)

    Wille-Reece, Ulrike; Flynn, Barbara J.; Loré, Karin; Koup, Richard A.; Kedl, Ross M.; Mattapallil, Joseph J.; Weiss, Walter R.; Roederer, Mario; Seder, Robert A.

    2005-10-01

    Induction and maintenance of antibody and T cell responses will be critical for developing a successful vaccine against HIV. A rational approach for generating such responses is to design vaccines or adjuvants that have the capacity to activate specific antigen-presenting cells. In this regard, dendritic cells (DCs) are the most potent antigen-presenting cells for generating primary T cell responses. Here, we report that Toll-like receptor (TLR) agonists and ligands that activate DCs in vitro influence the magnitude and quality of the cellular immune response in nonhuman primates (NHPs) when administered with HIV Gag protein. NHPs immunized with HIV Gag protein and a TLR7/8 agonist or a TLR9 ligand [CpG oligodeoxynucleotides (CpG ODN)] had significantly increased Gag-specific T helper 1 and antibody responses, compared with animals immunized with HIV Gag protein alone. Importantly, conjugating the HIV Gag protein to the TLR7/8 agonist (Gag-TLR7/8 conjugate) dramatically enhanced the magnitude and altered the quality of the T helper 1 response, compared with animals immunized with HIV Gag protein and the TLR7/8 agonist or CpG ODN. Furthermore, immunization with the Gag-TLR7/8 conjugate vaccine elicited Gag-specific CD8+ T responses. Collectively, our results show that conjugating HIV Gag protein to a TLR7/8 agonist is an effective way to elicit broad-based adaptive immunity in NHPs. This type of vaccine formulation should have utility in preventive or therapeutic vaccines in which humoral and cellular immunity is required. vaccine | dendritic cell | cross-presentation | cellular immunity

  16. Oligodeoxynucleotide nanostructure formation in the presence of polypropyleneimine dendrimers and their uptake in breast cancer cells

    NASA Astrophysics Data System (ADS)

    Chen, Alex M.; Santhakumaran, Latha M.; Nair, Sandhya K.; Amenta, Peter S.; Thomas, Thresia; He, Huixin; Thomas, T. J.

    2006-11-01

    We studied the efficacy of five generations of polypropyleneimine (PPI) dendrimer to provoke nanostructure formation from a 21-nucleotide antisense oligodeoxynucleotide (ODN). Nanostructure formation was observed with all generations of dendrimer by light scattering and microscopic techniques. The efficacy of the dendrimers increased with generation number. Atomic force microscopy (AFM) was used to study the morphology of the structures at different condensation stages. Based on the observed nanostructures, we propose a zipping condensation mechanism, which is very different from the condensation pathways of high molecular weight DNA polymers. Electron microscopy showed the presence of toroidal nanoparticles. Confocal microscopic analysis showed that the nanostructures formed with G-4 and G-5 dendrimers could undergo facile cellular uptake in a breast cancer cell line, MDA-MB-231, whereas nanostructures formed with G-1 to G-3 dendrimers lacked this ability. Nanoparticles formed with G-1 to G-3 dendrimers showed significantly lower zeta potential (5.2-6.5 mV) than those (12-18 mV) of particles formed with G-4 and G-5 dendrimers. These results show that the structure and charge density of the dendrimers are important in ODN nanoparticle formation and cellular transport and that G-4 and G-5 dendrimers are useful in cellular delivery of antisense ODN.

  17. Effect of Antisense Oligodeoxynucleotides Glucose Transporter-1 on Enhancement of Radiosensitivity of Laryngeal Carcinoma

    PubMed Central

    Yan, Sen-Xiang; Luo, Xing-Mei; Zhou, Shui-Hong; Bao, Yang-Yang; Fan, Jun; Lu, Zhong-Jie; Liao, Xin-Biao; Huang, Ya-Ping; Wu, Ting-Ting; Wang, Qin-Ying

    2013-01-01

    Purpose: Laryngeal carcinomas always resist to radiotherapy. Hypoxia is an important factor in radioresistance of laryngeal carcinoma. Glucose transporter-1 (GLUT-1) is considered to be a possible intrinsic marker of hypoxia in malignant tumors. We speculated that the inhibition of GLUT-1 expression might improve the radiosensitivity of laryngeal carcinoma. Methods: We assessed the effect of GLUT-1 expression on radioresistance of laryngeal carcinoma and the effect of GLUT-1 expressions by antisense oligodeoxynucleotides (AS-ODNs) on the radiosensitivity of laryngeal carcinoma in vitro and in vivo. Results: After transfection of GLUT-1 AS-ODNs: MTS assay showed the survival rates of radiation groups were reduced with the prolongation of culture time (p<0.05); Cell survival rates were significantly reduced along with the increasing of radiation dose (p<0.05). There was significant difference in the expression of GLUT-1mRNA and protein in the same X-ray dose between before and after X-ray radiation (p<0.05). In vivo, the expressions of GLUT-1 mRNA and protein after 8Gy radiation plus transfection of GLUT-1 AS-ODNs were significant decreased compared to 8Gy radiation alone (p<0.001). Conclusion: Radioresistance of laryngeal carcinoma may be associated with increased expression of GLUT-1 mRNA and protein. GLUT-1 AS-ODNs may enhance the radiosensitivity of laryngeal carcinoma mainly by inhibiting the expression of GLUT-1. PMID:23983599

  18. Nano-sized Soluplus® polymeric micelles enhance the induction of tetanus toxin neutralising antibody response following transcutaneous immunisation with tetanus toxoid.

    PubMed

    Saydam, Manolya; Cheng, Woei Ping; Palmer, Nathan; Tierney, Robert; Francis, Robert; MacLellan-Gibson, Kirsty; Khan, Ambreen; Mawas, Fatme

    2017-04-25

    The use of Soluplus® polymeric micelles as a novel adjuvant for tetanus toxoid (TTxd) in transcutaneous immunisation was evaluated. TTxd was added to Soluplus® polymeric micelles to form TTxd-Soluplus® nano-aggregates with a size of 68nm. Non-adjuvanted TTxd commonly induces very poor antibody response by the transcutaneous route. However, in this study, the use of TTxd-Soluplus® resulted in a significant increase in the antibody response to TTxd, which was similar to that induced in the presence of CPG-oligodeoxynucleotides (CPG-ODNs) adjuvant. The toxin neutralising potency of the immune sera induced by TTxd-Soluplus® was also much stronger than that from TTxd alone, in a passive transfer experiment in mice. Soluplus® also enhanced the immunogenicity of the toxoid when TTxd-Soluplus® was stored at 4°C for 4weeks, but not at higher temperatures. Confocal microscopy imaging showed a much higher uptake of TTxd in the epidermis and dermis layers of the skin when it was associated with Soluplus®, suggesting that the mechanism for Soluplus® adjuvanticity is through enhanced uptake of the TTxd through the skin. Overall, our findings demonstrated that Soluplus® is an effective novel adjuvant for transcutaneous immunisation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Determining coding CpG islands by identifying regions significant for pattern statistics on Markov chains.

    PubMed

    Singer, Meromit; Engström, Alexander; Schönhuth, Alexander; Pachter, Lior

    2011-09-23

    Recent experimental and computational work confirms that CpGs can be unmethylated inside coding exons, thereby showing that codons may be subjected to both genomic and epigenomic constraint. It is therefore of interest to identify coding CpG islands (CCGIs) that are regions inside exons enriched for CpGs. The difficulty in identifying such islands is that coding exons exhibit sequence biases determined by codon usage and constraints that must be taken into account. We present a method for finding CCGIs that showcases a novel approach we have developed for identifying regions of interest that are significant (with respect to a Markov chain) for the counts of any pattern. Our method begins with the exact computation of tail probabilities for the number of CpGs in all regions contained in coding exons, and then applies a greedy algorithm for selecting islands from among the regions. We show that the greedy algorithm provably optimizes a biologically motivated criterion for selecting islands while controlling the false discovery rate. We applied this approach to the human genome (hg18) and annotated CpG islands in coding exons. The statistical criterion we apply to evaluating islands reduces the number of false positives in existing annotations, while our approach to defining islands reveals significant numbers of undiscovered CCGIs in coding exons. Many of these appear to be examples of functional epigenetic specialization in coding exons.

  20. eMethylsorb: electrochemical quantification of DNA methylation at CpG resolution using DNA-gold affinity interactions.

    PubMed

    Sina, Abu Ali Ibn; Howell, Sidney; Carrascosa, Laura G; Rauf, Sakandar; Shiddiky, Muhammad J A; Trau, Matt

    2014-11-07

    We report a simple electrochemical method referred to as "eMethylsorb" for the detection of DNA methylation. The method relies on the base dependent affinity interaction of DNA with gold. The methylation status of DNA is quantified by monitoring the electrochemical current as a function of the relative adsorption level of bisulphite treated DNA samples onto a bare gold electrode. This method can successfully distinguish methylated and unmethylated epigenotypes at single CpG resolution.

  1. CpG Island Methylation in Colorectal Cancer: Past, Present and Future

    PubMed Central

    Curtin, Karen; Slattery, Martha L.; Samowitz, Wade S.

    2011-01-01

    The concept of a CpG island methylator phenotype, or CIMP, quickly became the focus of several colorectal cancer studies describing its clinical and pathological features after its introduction in 1999 by Toyota and colleagues. Further characterization of CIMP in tumors lead to widespread acceptance of the concept, as expressed by Shen and Issa in their 2005 editorial, “CIMP, at last.” Since that time, extensive research efforts have brought great insights into the epidemiology and prognosis of CIMP+ tumors and other epigenetic mechanisms underlying tumorigenesis. With the advances in technology and subsequent cataloging of the human methylome in cancer and normal tissue, new directions in research to understand CIMP and its role in complex biological systems yield hope for future epigenetically based diagnostics and treatments. PMID:21559209

  2. The CpG island methylator phenotype (CIMP) in colorectal cancer

    PubMed Central

    Mojarad, Ehsan Nazemalhosseini; Kuppen, Peter JK; Aghdaei, Hamid Asadzadeh

    2013-01-01

    It is clear that colorectal cancer (CRC) develops through multiple genetic and epigenetic pathways. These pathways may be determined on the basis of three molecular features: (i) mutations in DNA mismatch repair genes, leading to a DNA microsatellite instability (MSI) phenotype, (ii) mutations in APC and other genes that activate Wnt pathway, characterized by chromosomal instability (CIN) phenotype, and (iii) global genome hypermethylation, resulting in switch off of tumor suppressor genes, indicated as CpG island methylator phenotype (CIMP). Each of these pathways is characterized by specific pathological features, mechanisms of carcinogenesis and process of tumor development. The molecular aspects of these pathways have been used clinically in the diagnosis, screening and management of patients with colorectal cancer. In this review we especially describe various aspects of CIMP, one of the important and rather recently discovered pathways that lead to colorectal cancer. PMID:24834258

  3. Association between folate levels and CpG island hypermethylation in normal colorectal mucosa

    PubMed Central

    Wallace, Kristin; Grau, Maria V.; Levine, Joan A.; Shen, Lanlan; Hamdan, Randala; Chen, Xinli; Gui, Jiang; Haile, Robert W.; Barry, Elizabeth L.; Ahnen, Dennis; McKeown-Eyssen, Gail; Baron, John A.; Issa, Jean Pierre J.

    2010-01-01

    Background Gene-specific promoter methylation of several genes occurs in aging normal tissues and may predispose to tumorigenesis. In the present study, we investigate the association among blood folate levels, and dietary and lifestyle factors with CpG island methylation in normal colorectal mucosa. Methods Subjects were enrolled in a multi-center chemoprevention trial of aspirin or folic acid for the prevention of large bowel adenomas. We collected 1000 biopsies from 389 patients, 501 samples from the right colon and 499 from the rectum at the follow-up colonoscopy. We measured DNA methylation of estrogen receptor alpha (ERα) and secreted frizzled related protein-1 (SFRP1) using bisulfite pyrosequencing. We used Generalized Estimating Equations regression analysis to examine the association between methylation and selected variables. Results For both ERα and SFRP1, percent methylation was significantly higher in the rectum compared to the right colon (p = 0.001). For each 10 years of age, we observed a 1.7 % increase in methylation level for ERα and a 2.9 % increase for SFRP1 (P < 0.0001). African Americans had a significantly lower level of ERα and SFRP1 methylation compared to Caucasians and Hispanics. Higher RBC folate levels were associated with higher levels of both ERα (p=0.03) and SFRP1 methylation (p=0.01). Conclusions Our results suggest that CpG island methylation in normal colorectal mucosa is related to advancing age, race, rectal location, and RBC folate levels. These data have important implications regarding the safety of supplementary folate administration in healthy adults given the hypothesis that methylation in normal mucosa may predispose to colorectal neoplasia. PMID:21149331

  4. Fundamental differences in promoter CpG island DNA hypermethylation between human cancer and genetically engineered mouse models of cancer.

    PubMed

    Diede, Scott J; Yao, Zizhen; Keyes, C Chip; Tyler, Ashlee E; Dey, Joyoti; Hackett, Christopher S; Elsaesser, Katrina; Kemp, Christopher J; Neiman, Paul E; Weiss, William A; Olson, James M; Tapscott, Stephen J

    2013-12-01

    Genetic and epigenetic alterations are essential for the initiation and progression of human cancer. We previously reported that primary human medulloblastomas showed extensive cancer-specific CpG island DNA hypermethylation in critical developmental pathways. To determine whether genetically engineered mouse models (GEMMs) of medulloblastoma have comparable epigenetic changes, we assessed genome-wide DNA methylation in three mouse models of medulloblastoma. In contrast to human samples, very few loci with cancer-specific DNA hypermethylation were detected, and in almost all cases the degree of methylation was relatively modest compared with the dense hypermethylation in the human cancers. To determine if this finding was common to other GEMMs, we examined a Burkitt lymphoma and breast cancer model and did not detect promoter CpG island DNA hypermethylation, suggesting that human cancers and at least some GEMMs are fundamentally different with respect to this epigenetic modification. These findings provide an opportunity to both better understand the mechanism of aberrant DNA methylation in human cancer and construct better GEMMs to serve as preclinical platforms for therapy development.

  5. CpG Island Methylator Phenotype-High Colorectal Cancers and Their Prognostic Implications and Relationships with the Serrated Neoplasia Pathway

    PubMed Central

    Rhee, Ye-Young; Kim, Kyung-Ju; Kang, Gyeong Hoon

    2017-01-01

    The concept of a CpG island methylator phenotype (CIMP) was first introduced by Toyota and Issa to describe a subset of colorectal cancers (CRCs) with concurrent hypermethylation of multiple CpG island loci. The concept of CIMP as a molecular carcinogenesis mechanism was consolidated by the identification of the serrated neoplasia pathway, in which CIMP participates in the initiation and progression of serrated adenomas. Distinct clinicopathological and molecular features of CIMP-high (CIMP-H) CRCs have been characterized, including proximal colon location, older age of onset, female preponderance, and frequent associations of high-level microsatellite instability and BRAF mutations. CIMP-H CRCs arise in sessile or traditional serrated adenomas and thus tend to display the morphological characteristics of serrated adenomas, including epithelial serration, vesicular nuclei, and abundant cytoplasm. Both the frequent association of CIMP and poor prognosis and different responses of CRCs to adjuvant therapy depending on CIMP status indicate clinical implications. In this review, we present an overview of the literature documenting the relevant findings of CIMP-H CRCs and their relationships with the serrated neoplasia pathway. PMID:27885175

  6. CpG Island Methylator Phenotype-High Colorectal Cancers and Their Prognostic Implications and Relationships with the Serrated Neoplasia Pathway.

    PubMed

    Rhee, Ye-Young; Kim, Kyung-Ju; Kang, Gyeong Hoon

    2017-01-15

    The concept of a CpG island methylator phenotype (CIMP) was first introduced by Toyota and Issa to describe a subset of colorectal cancers (CRCs) with concurrent hypermethylation of multiple CpG island loci. The concept of CIMP as a molecular carcinogenesis mechanism was consolidated by the identification of the serrated neoplasia pathway, in which CIMP participates in the initiation and progression of serrated adenomas. Distinct clinicopathological and molecular features of CIMP-high (CIMP-H) CRCs have been characterized, including proximal colon location, older age of onset, female preponderance, and frequent associations of high-level microsatellite instability and BRAF mutations. CIMP-H CRCs arise in sessile or traditional serrated adenomas and thus tend to display the morphological characteristics of serrated adenomas, including epithelial serration, vesicular nuclei, and abundant cytoplasm. Both the frequent association of CIMP and poor prognosis and different responses of CRCs to adjuvant therapy depending on CIMP status indicate clinical implications. In this review, we present an overview of the literature documenting the relevant findings of CIMP-H CRCs and their relationships with the serrated neoplasia pathway.

  7. Subcutaneous administration CpG-ODNs acts as a potent adjuvant for an HIV-1-tat-based vaccine candidate to elicit cellular immunity in BALB/c mice.

    PubMed

    Panahi, Zeinab; Abdoli, Asghar; Mosayebi, Ghasem; Mahdavi, Mehdi; Bahrami, Fariborz

    2018-03-01

    To evaluate the combined effects of CpG oligodeoxynucleotides (CpG-ODNs) adjuvant and subcutaneous injection route on efficacy of a HIV-1-tat DNA vaccine candidate using BALB/c mice as an animal model. Evaluation of cellular and humoral immunity of mice injected subcutaneously with HIV-1-tat gene cloned into a pcDNA3.1 vector indicated that significant levels of IFN-γ cytokine secretion (900 pg/ml), lymphocyte proliferation (2.5 stimulation index) and IgG 2a (1.45 absorbance 450 nm) production could be achieved. These indicators of stimulated cellular immunity were elicited 2 weeks after the last injection (P < 0.05). Formulation of HIV-1-tat DNA vaccine candidate with CpG-ODNs as an adjuvant while administrated subcutaneously are a promising approach to induce effective cellular immunity responses against HIV-1 infection.

  8. Bisulfite-independent analysis of CpG island methylation enables genome-scale stratification of single cells.

    PubMed

    Han, Lin; Wu, Hua-Jun; Zhu, Haiying; Kim, Kun-Yong; Marjani, Sadie L; Riester, Markus; Euskirchen, Ghia; Zi, Xiaoyuan; Yang, Jennifer; Han, Jasper; Snyder, Michael; Park, In-Hyun; Irizarry, Rafael; Weissman, Sherman M; Michor, Franziska; Fan, Rong; Pan, Xinghua

    2017-06-02

    Conventional DNA bisulfite sequencing has been extended to single cell level, but the coverage consistency is insufficient for parallel comparison. Here we report a novel method for genome-wide CpG island (CGI) methylation sequencing for single cells (scCGI-seq), combining methylation-sensitive restriction enzyme digestion and multiple displacement amplification for selective detection of methylated CGIs. We applied this method to analyzing single cells from two types of hematopoietic cells, K562 and GM12878 and small populations of fibroblasts and induced pluripotent stem cells. The method detected 21 798 CGIs (76% of all CGIs) per cell, and the number of CGIs consistently detected from all 16 profiled single cells was 20 864 (72.7%), with 12 961 promoters covered. This coverage represents a substantial improvement over results obtained using single cell reduced representation bisulfite sequencing, with a 66-fold increase in the fraction of consistently profiled CGIs across individual cells. Single cells of the same type were more similar to each other than to other types, but also displayed epigenetic heterogeneity. The method was further validated by comparing the CpG methylation pattern, methylation profile of CGIs/promoters and repeat regions and 41 classes of known regulatory markers to the ENCODE data. Although not every minor methylation differences between cells are detectable, scCGI-seq provides a solid tool for unsupervised stratification of a heterogeneous cell population. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Bisulfite-independent analysis of CpG island methylation enables genome-scale stratification of single cells

    PubMed Central

    Han, Lin; Wu, Hua-Jun; Zhu, Haiying; Kim, Kun-Yong; Marjani, Sadie L.; Riester, Markus; Euskirchen, Ghia; Zi, Xiaoyuan; Yang, Jennifer; Han, Jasper; Snyder, Michael; Park, In-Hyun; Irizarry, Rafael; Weissman, Sherman M.

    2017-01-01

    Abstract Conventional DNA bisulfite sequencing has been extended to single cell level, but the coverage consistency is insufficient for parallel comparison. Here we report a novel method for genome-wide CpG island (CGI) methylation sequencing for single cells (scCGI-seq), combining methylation-sensitive restriction enzyme digestion and multiple displacement amplification for selective detection of methylated CGIs. We applied this method to analyzing single cells from two types of hematopoietic cells, K562 and GM12878 and small populations of fibroblasts and induced pluripotent stem cells. The method detected 21 798 CGIs (76% of all CGIs) per cell, and the number of CGIs consistently detected from all 16 profiled single cells was 20 864 (72.7%), with 12 961 promoters covered. This coverage represents a substantial improvement over results obtained using single cell reduced representation bisulfite sequencing, with a 66-fold increase in the fraction of consistently profiled CGIs across individual cells. Single cells of the same type were more similar to each other than to other types, but also displayed epigenetic heterogeneity. The method was further validated by comparing the CpG methylation pattern, methylation profile of CGIs/promoters and repeat regions and 41 classes of known regulatory markers to the ENCODE data. Although not every minor methylation differences between cells are detectable, scCGI-seq provides a solid tool for unsupervised stratification of a heterogeneous cell population. PMID:28126923

  10. NF-κB Decoy Oligodeoxynucleotide Enhanced Osteogenesis in Mesenchymal Stem Cells Exposed to Polyethylene Particle

    PubMed Central

    Lin, Tzu-Hua; Sato, Taishi; Barcay, Katherine R.; Waters, Heather; Loi, Florence; Zhang, Ruth; Pajarinen, Jukka; Egashira, Kensuke; Yao, Zhenyu

    2015-01-01

    Excessive generation of wear particles after total joint replacement may lead to local inflammation and periprosthetic osteolysis. Modulation of the key transcription factor NF-κB in immune cells could potentially mitigate the osteolytic process. We previously showed that local delivery of ultrahigh-molecular-weight polyethylene (UHMWPE) particles recruited osteoprogenitor cells and reduced osteolysis. However, the biological effects of modulating the NF-κB signaling pathway on osteoprogenitor/mesenchymal stem cells (MSCs) remain unclear. Here we showed that decoy oligodeoxynucleotide (ODN) increased cell viability when primary murine MSCs were exposed to UHMWPE particles, but had no effects on cellular apoptosis. Decoy ODN increased transforming growth factor-beta 1 (TGF-β1) and osteoprotegerin (OPG) in MSCs exposed to UHMWPE particles. Mechanistic studies showed that decoy ODN upregulated OPG expression through a TGF-β1-dependent pathway. By measuring the alkaline phosphatase activity, osteocalcin levels, Runx2 and osteopontin expression, and performing a bone mineralization assay, we found that decoy ODN increased MSC osteogenic ability when the cells were exposed to UHMWPE particles. Furthermore, the cellular response to decoy ODN and UHMWPE particles with regard to cell phenotype, cell viability, and osteogenic ability was confirmed using primary human MSCs. Our results suggest that modulation of wear particle-induced inflammation by NF-κB decoy ODN had no adverse effects on MSCs and may potentially further mitigate periprosthetic osteolysis by protecting MSC viability and osteogenic ability. PMID:25518013

  11. Analysis of Geologic Parameters on the Performance of CO2-Plume Geothermal (CPG) Systems in a Multi-Layered Reservoirs

    NASA Astrophysics Data System (ADS)

    Garapati, N.; Randolph, J.; Saar, M. O.

    2013-12-01

    CO2-Plume Geothermal (CPG) involves injection of CO2 as a working fluid to extract heat from naturally high permeable sedimentary basins. The injected CO2 forms a large subsurface CO2 plume that absorbs heat from the geothermal reservoir and eventually buoyantly rises to the surface. The heat density of sedimentary basins is typically relatively low.However, this drawback is likely counteracted by the large accessible volume of natural reservoirs compared to artificial, hydrofractured, and thus small-scale, reservoirs. Furthermore, supercritical CO2has a large mobility (inverse kinematic viscosity) and expansibility compared to water resulting in the formation of a strong thermosiphon which eliminates the need for parasitic pumping power requirements and significantly increasing electricity production efficiency. Simultaneously, the life span of the geothermal power plant can be increased by operating the CPG system such that it depletes the geothermal reservoir heat slowly. Because the produced CO2 is reinjected into the ground with the main CO2 sequestration stream coming from a CO2 emitter, all of the CO2 is ultimately geologically sequestered resulting in a CO2 sequestering geothermal power plant with a negative carbon footprint. Conventional geothermal process requires pumping of huge amount of water for the propagation of the fractures in the reservoir, but CPG process eliminates this requirement and conserves water resources. Here, we present results for performance of a CPG system as a function of various geologic properties of multilayered systemsincludingpermeability anisotropy, rock thermal conductivity, geothermal gradient, reservoir depth and initial native brine salinity as well as spacing between the injection and production wells. The model consists of a 50 m thick, radially symmetric grid with a semi-analytic heat exchange and no fluid flow at the top and bottom boundaries and no fluid and heat flow at the lateral boundaries. We design Plackett

  12. Immortalization of T-cells is accompanied by gradual changes in CpG methylation resulting in a profile resembling a subset of T-cell leukemias.

    PubMed

    Degerman, Sofie; Landfors, Mattias; Siwicki, Jan Konrad; Revie, John; Borssén, Magnus; Evelönn, Emma; Forestier, Erik; Chrzanowska, Krystyna H; Rydén, Patrik; Keith, W Nicol; Roos, Göran

    2014-07-01

    We have previously described gene expression changes during spontaneous immortalization of T-cells, thereby identifying cellular processes important for cell growth crisis escape and unlimited proliferation. Here, we analyze the same model to investigate the role of genome-wide methylation in the immortalization process at different time points pre-crisis and post-crisis using high-resolution arrays. We show that over time in culture there is an overall accumulation of methylation alterations, with preferential increased methylation close to transcription start sites (TSSs), islands, and shore regions. Methylation and gene expression alterations did not correlate for the majority of genes, but for the fraction that correlated, gain of methylation close to TSS was associated with decreased gene expression. Interestingly, the pattern of CpG site methylation observed in immortal T-cell cultures was similar to clinical T-cell acute lymphoblastic leukemia (T-ALL) samples classified as CpG island methylator phenotype positive. These sites were highly overrepresented by polycomb target genes and involved in developmental, cell adhesion, and cell signaling processes. The presence of non-random methylation events in in vitro immortalized T-cell cultures and diagnostic T-ALL samples indicates altered methylation of CpG sites with a possible role in malignant hematopoiesis. Copyright © 2014 Neoplasia Press, Inc. Published by Elsevier Inc. All rights reserved.

  13. Glucocorticoid receptor gene expression and promoter CpG modifications throughout the human brain.

    PubMed

    Cao-Lei, Lei; Suwansirikul, Songkiet; Jutavijittum, Prapan; Mériaux, Sophie B; Turner, Jonathan D; Muller, Claude P

    2013-11-01

    Glucocorticoids and the glucocorticoid (GR) and mineralocorticoid (MR) receptors have been implicated in many processes, particularly in negative feedback regulation of the hypothalamic-pituitary-adrenal axis. Epigenetically programmed GR alternative promoter usage underlies transcriptional control of GR levels, generation of GR 3' splice variants, and the overall GC response in the brain. No detailed analysis of GR first exons or GR transcript variants throughout the human brain has been reported. Therefore we investigated post mortem tissues from 28 brain regions of 5 individuals. GR first exons were expressed throughout the healthy human brain with no region-specific usage patterns. First exon levels were highly inter-correlated suggesting that they are co-regulated. GR 3' splice variants (GRα and GR-P) were equally distributed in all regions, and GRβ expression was always low. GR/MR ratios showed significant differences between the 28 tissues with the highest ratio in the pituitary gland. Modification levels of individual CpG dinucleotides, including 5-mC and 5-hmC, in promoters 1D, 1E, 1F, and 1H were low, and diffusely clustered; despite significant heterogeneity between the donors. In agreement with this clustering, sum modification levels rather than individual CpG modifications correlated with GR expression. Two-way ANOVA showed that this sum modification was both promoter and brain region specific, but that there was however no promoter*tissue interaction. The heterogeneity between donors may however hide such an interaction. In both promoters 1F and 1H modification levels correlated with GRα expression suggesting that 5-mC and 5-hmC play an important role in fine tuning GR expression levels throughout the brain. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Systematic CpT (ApG) depletion and CpG excess are unique genomic signatures of large DNA viruses infecting invertebrates.

    PubMed

    Upadhyay, Mohita; Sharma, Neha; Vivekanandan, Perumal

    2014-01-01

    Differences in the relative abundance of dinucleotides, if any may provide important clues on host-driven evolution of viruses. We studied dinucleotide frequencies of large DNA viruses infecting vertebrates (n = 105; viruses infecting mammals = 99; viruses infecting aves = 6; viruses infecting reptiles = 1) and invertebrates (n = 88; viruses infecting insects = 84; viruses infecting crustaceans = 4). We have identified systematic depletion of CpT(ApG) dinucleotides and over-representation of CpG dinucleotides as the unique genomic signature of large DNA viruses infecting invertebrates. Detailed investigation of this unique genomic signature suggests the existence of invertebrate host-induced pressures specifically targeting CpT(ApG) and CpG dinucleotides. The depletion of CpT dinucleotides among large DNA viruses infecting invertebrates is at least in part, explained by non-canonical DNA methylation by the infected host. Our findings highlight the role of invertebrate host-related factors in shaping virus evolution and they also provide the necessary framework for future studies on evolution, epigenetics and molecular biology of viruses infecting this group of hosts.

  15. Systematic CpT (ApG) Depletion and CpG Excess Are Unique Genomic Signatures of Large DNA Viruses Infecting Invertebrates

    PubMed Central

    Upadhyay, Mohita; Sharma, Neha; Vivekanandan, Perumal

    2014-01-01

    Differences in the relative abundance of dinucleotides, if any may provide important clues on host-driven evolution of viruses. We studied dinucleotide frequencies of large DNA viruses infecting vertebrates (n = 105; viruses infecting mammals = 99; viruses infecting aves = 6; viruses infecting reptiles = 1) and invertebrates (n = 88; viruses infecting insects = 84; viruses infecting crustaceans = 4). We have identified systematic depletion of CpT(ApG) dinucleotides and over-representation of CpG dinucleotides as the unique genomic signature of large DNA viruses infecting invertebrates. Detailed investigation of this unique genomic signature suggests the existence of invertebrate host-induced pressures specifically targeting CpT(ApG) and CpG dinucleotides. The depletion of CpT dinucleotides among large DNA viruses infecting invertebrates is at least in part, explained by non-canonical DNA methylation by the infected host. Our findings highlight the role of invertebrate host-related factors in shaping virus evolution and they also provide the necessary framework for future studies on evolution, epigenetics and molecular biology of viruses infecting this group of hosts. PMID:25369195

  16. Oral immunization with F4 fimbriae and CpG formulated with carboxymethyl starch enhances F4-specific mucosal immune response and modulates Th1 and Th2 cytokines in weaned pigs.

    PubMed

    Delisle, Benjamin; Calinescu, Carmen; Mateescu, Mircea Alexandru; Fairbrother, John Morris; Nadeau, Éric

    2012-01-01

    F4 fimbriae are a potential candidate for an oral subunit vaccine for prevention of post-weaning diarrhea in swine due to infection with F4-positive enterotoxigenic Escherichia coli. However, large quantities of F4 fimbriae are required to induce a specific antibody response. The aim of the present study was to evaluate the effect of supplementation of F4 fimbriae with Cytosine-phosphate-Guanosine-oligodeoxynucleotide (CpG-A D19) or with complete cholera toxin (CT) as adjuvants on the F4-specific antibody response and cytokine production in weaned pigs following oral administration of F4 fimbrial antigen formulated with Carboxymethyl Starch (CMS). Oral dosage forms of F4 fimbriae alone or supplemented with CpG-A D19 or with CT were formulated with CMS as monolithic tablets, obtained by direct compression, and administered to weaned pigs. Blood and faecal samples were collected to determine the systemic and mucosal immune status of animals at various times until necropsy. During necropsy, contents of the jejunum and ileum were collected for determination of mucosal F4 specific antibodies. Segments of jejunum and ileum were also used to measure mRNA cytokine production. The presence of CpG in the formulation of the fimbriae significantly increased F4-specific immunoglobulin (Ig) IgM and IgG levels in intestinal secretions, and enhanced Th1 (Interferon-gamma / IFN-γ, Tumour Necrosis Factor-alpha / TNF-α, Interleukin-12p40 / IL-12p40, IL-1β) and Th2 (IL-4, IL-6) cytokine production in intestinal tissues. Supplementation with CT did not result in induction of F4-specific antibodies in secretions, although a significant Th1 response (IFN-α, IFN-γ, IL-18) was detected in tissues. Neither F4-specific systemic antibodies, nor intestinally secreted IgA were detected throughout the immunization trial for all groups. CpG-A D19 appeared to be a promising adjuvant for an oral F4 subunit vaccine formulated with CMS excipient as monolithic tablets. This matrix afforded gastro

  17. Beta-Glucan Activated Human B-Lymphocytes Participate in Innate Immune Responses by Releasing Pro-inflammatory Cytokines and Stimulating Neutrophil Chemotaxis

    PubMed Central

    Ali, Mohamed F.; Driscoll, Christopher B.; Walters, Paula R.; Limper, Andrew H.; Carmona, Eva M.

    2015-01-01

    B-lymphocytes play an essential regulatory role in the adaptive immune response through antibody production during infection. A less known function of B-lymphocytes is their ability to respond directly to infectious antigens through stimulation of pattern recognition receptors expressed on their surfaces. β-glucans are carbohydrates present in the cell wall of many pathogenic fungi that can be detected in the peripheral blood of patients during infection. They have been shown to participate in the innate inflammatory response as they can directly activate peripheral macrophages and dendritic cells. However, their effect as direct stimulators of B-lymphocytes has not been yet fully elucidated. The aim of this study was to examine the molecular mechanisms and cytokine profiles generated following β-glucan stimulation of B-lymphocytes, compared with the well-established TLR-9 agonist CpG-oligodeoxynucleotide (CpG) and study the participation of β-glucan stimulated B-cells in the innate immune response. Herein, we demonstrate that β-glucan activated B-lymphocytes upregulate pro-inflammatory cytokines (TNFα, IL-6 and IL-8). Interestingly, β-glucan, unlike CpG, had no effect on B-lymphocyte proliferation or IgM production. When compared with CpG (TLR9 agonist), β-glucan-activated cells secreted significantly higher levels of IL-8. Furthermore, IL-8 secretion was partially mediated by Dectin-1 and required SYK, MAPKs and the transcription factors NF-κB and AP-1. Moreover, we observed that conditioned media from β-glucan stimulated B-lymphocytes elicited neutrophil chemotaxis. These studies suggest that β-glucan activated B-lymphocytes have an important and novel role in fungal innate immune responses. PMID:26519534

  18. MSH6 G39E Polymorphism and CpG Island Methylator Phenotype in Colon Cancer

    PubMed Central

    Curtin, Karen; Samowitz, Wade S.; Wolff, Roger K.; Caan, Bette J.; Ulrich, Cornelia M.; Potter, John D.; Slattery, Martha L.

    2010-01-01

    The MSH6 G39E germline polymorphism is not associated with an increased risk of either microsatellite stable or unstable sporadic colorectal cancer. Other than microsatellite instability, however, most genetic and epigenetic changes of tumors associated with this common variant have not been studied. The objective of our investigation was to evaluate associations between the MSH6 G39E (116G>A) polymorphism and CpG island methylator phenotype (CIMP) and BRAF V600E mutations in tumors from a sample of 1048 individuals with colon cancer and 1964 controls from Utah, Northern California, and Minnesota. The G39E polymorphism (rs1042821) was determined by the five prime nuclease assay. CIMP was determined by methylation-specific polymerase chain reaction (PCR) of CpG islands in MLH1, methylated in tumors (MINT)1, MINT2, MINT31, and CDKN2A. The BRAF V600E mutation was determined by sequencing exon 15. In microsatellite stable tumors, homozygous carriers of the G39E polymorphism had an increased risk of CIMP+ colon cancer (odds ratio (OR) 2.2, 95% confidence interval (CI) 1.1, 4.2) and BRAF V600E mutation (OR 3.1, 95% CI 1.01, 9.7) in a case–control comparison. This finding was not observed in unstable tumors; however, power may have been low to detect an association. Age at diagnosis, family history, and alcohol use did not interact with MSH6 G39E and CIMP. The MSH6 G39E germline polymorphism may be associated with CIMP+ colon cancer. PMID:19582761

  19. Targeted Blockage of Signal Transducer and Activator of Transcription 5 Signaling Pathway with Decoy Oligodeoxynucleotides Suppresses Leukemic K562 Cell Growth

    PubMed Central

    Wang, Xiaozhong; Zeng, Jianming; Shi, Mei; Zhao, Shiqiao; Bai, Weijun; Cao, Weixi; Tu, Zhiguang; Huang, Zonggan

    2011-01-01

    The protein signal transducer and activator of transcription 5 (STAT5) of the JAK/STAT pathway is constitutively activated because of its phosphorylation by tyrosine kinase activity of fusion protein BCR-ABL in chronic myelogenous leukemia (CML) cells. This study investigated the potential therapeutic effect of STAT5 decoy oligodeoxynucleotides (ODN) using leukemia K562 cells as a model. Our results showed that transfection of 21-mer-long STAT5 decoy ODN into K562 cells effectively inhibited cell proliferation and induced cell apoptosis. Further, STAT5 decoy ODN downregulated STAT5 targets bcl-xL, cyclinD1, and c-myc at both mRNA and protein levels in a sequence-specific manner. Collectively, these data demonstrate the therapeutic effect of blocking the STAT5 signal pathway by cis-element decoy for cancer characterized by constitutive STAT5 activation. Thus, our study provides support for STAT5 as a potential target downstream of BCR-ABL for CML treatment and helps establish the concept of targeting STAT5 by decoy ODN as a novel therapy approach for imatinib-resistant CML. PMID:21091189

  20. The Control Region of Mitochondrial DNA Shows an Unusual CpG and Non-CpG Methylation Pattern

    PubMed Central

    Bellizzi, Dina; D'Aquila, Patrizia; Scafone, Teresa; Giordano, Marco; Riso, Vincenzo; Riccio, Andrea; Passarino, Giuseppe

    2013-01-01

    DNA methylation is a common epigenetic modification of the mammalian genome. Conflicting data regarding the possible presence of methylated cytosines within mitochondrial DNA (mtDNA) have been reported. To clarify this point, we analysed the methylation status of mtDNA control region (D-loop) on human and murine DNA samples from blood and cultured cells by bisulphite sequencing and methylated/hydroxymethylated DNA immunoprecipitation assays. We found methylated and hydroxymethylated cytosines in the L-strand of all samples analysed. MtDNA methylation particularly occurs within non-C-phosphate-G (non-CpG) nucleotides, mainly in the promoter region of the heavy strand and in conserved sequence blocks, suggesting its involvement in regulating mtDNA replication and/or transcription. We observed DNA methyltransferases within the mitochondria, but the inactivation of Dnmt1, Dnmt3a, and Dnmt3b in mouse embryonic stem (ES) cells results in a reduction of the CpG methylation, while the non-CpG methylation shows to be not affected. This suggests that D-loop epigenetic modification is only partially established by these enzymes. Our data show that DNA methylation occurs in the mtDNA control region of mammals, not only at symmetrical CpG dinucleotides, typical of nuclear genome, but in a peculiar non-CpG pattern previously reported for plants and fungi. The molecular mechanisms responsible for this pattern remain an open question. PMID:23804556

  1. B-cell activation with CD40L or CpG measures the function of B-cell subsets and identifies specific defects in immunodeficient patients.

    PubMed

    Marasco, Emiliano; Farroni, Chiara; Cascioli, Simona; Marcellini, Valentina; Scarsella, Marco; Giorda, Ezio; Piano Mortari, Eva; Leonardi, Lucia; Scarselli, Alessia; Valentini, Diletta; Cancrini, Caterina; Duse, Marzia; Grimsholm, Ola; Carsetti, Rita

    2017-01-01

    Around 65% of primary immunodeficiencies are antibody deficiencies. Functional tests are useful tools to study B-cell functions in vitro. However, no accepted guidelines for performing and evaluating functional tests have been issued yet. Here, we report our experience on the study of B-cell functions in infancy and throughout childhood. We show that T-independent stimulation with CpG measures proliferation and differentiation potential of memory B cells. Switched memory B cells respond better than IgM memory B cells. On the other hand, CD40L, a T-dependent stimulus, does not induce plasma cell differentiation, but causes proliferation of naïve and memory B cells. During childhood, the production of plasmablasts in response to CpG increases with age mirroring the development of memory B cells. The response to CD40L does not change with age. In patients with selective IgA deficiency (SIgAD), we observed that switched memory B cells are reduced due to the absence of IgA memory B cells. In agreement, IgA plasma cells are not generated in response to CpG. Unexpectedly, B cells from SIgAD patients show a reduced proliferative response to CD40L. Our results demonstrate that functional tests are an important tool to assess the functions of the humoral immune system. © 2016 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Modification of antisense phosphodiester oligodeoxynucleotides by a 5' cholesteryl moiety increases cellular association and improves efficacy.

    PubMed

    Krieg, A M; Tonkinson, J; Matson, S; Zhao, Q; Saxon, M; Zhang, L M; Bhanja, U; Yakubov, L; Stein, C A

    1993-02-01

    Phosphodiester oligodeoxynucleotides bearing a 5' cholesteryl (chol) modification bind to low density lipoprotein (LDL), apparently by partitioning the chol-modified oligonucleotides into the lipid layer. Both HL60 cells and primary mouse spleen T and B cells incubated with fluorescently labeled chol-modified oligonucleotide showed substantially increased cellular association by flow cytometry and increased internalization by confocal microscopy compared to an identical molecule not bearing the chol group. Cellular internalization of chol-modified oligonucleotide occurred at least partially through the LDL receptor; it was increased in mouse spleen cells by cell culture in lipoprotein-deficient medium and/or lovastatin, and it was decreased by culture in high serum medium. To determine whether chol-modified oligonucleotides are more potent antisense agents, we titered antisense unmodified phosphodiester and chol-modified oligonucleotides targeted against a mouse immunosuppressive protein. Murine spleen cells cultured with 20 microM phosphodiester antisense oligonucleotides had a 2-fold increase in RNA synthesis, indicating the expected lymphocyte activation. Antisense chol-modified oligonucleotides showed an 8-fold increase in relative potency: they caused a 2-fold increase in RNA synthesis at just 2.5 microM. The increased efficacy was blocked by heparin and was further increased by cell culture in 1% (vs. 10%) fetal bovine serum, suggesting that the effect may, at least in part, be mediated via the LDL receptor. Antisense chol-modified oligonucleotides are sequence specific and have increased potency as compared to unmodified oligonucleotides.

  3. Impaired capacity for upregulation of MHC class II in tumor-associated microglia.

    PubMed

    Schartner, Jill M; Hagar, Aaron R; Van Handel, Michelle; Zhang, Leying; Nadkarni, Nivedita; Badie, Behnam

    2005-09-01

    Immunotherapy for malignant gliomas is being studied as a possible adjunctive therapy for this highly fatal disease. Thus far, inadequate understanding of brain tumor immunology has hindered the design of such therapies. For instance, the role of microglia and macrophages, which comprise a significant proportion of tumor-infiltrating inflammatory cells, in the regulation of the local anti-tumor immune response is poorly understood. To study the response of microglia and macrophages to known activators in brain tumors, we injected CpG oligodeoxynucleotide (ODN), interferon-gamma (IFN-gamma), and IFN-gamma/LPS into normal and intracranial RG2 glioma-bearing rodents. Microglia/macrophage infiltration and their surface expression of MHC class II B7.1 and B7.2 was examined by flow cytometry. Each agent evaluated yielded a distinct microglia/macrophage response: CpG ODN was the most potent inducer of microglia/macrophage infiltration and B7.1 expression, while IFN-gamma resulted in the highest MHC-II expression in both normal and tumors. Regardless of the agent injected, however, MHC-II induction was significantly muted in tumor microglia/macrophage as compared with normal brain. These data suggest that microglia/macrophage responsiveness to activators can vary in brain tumors when compared with normal brain. Understanding the mechanism of these differences may be critical in the development of novel immunotherapies for malignant glioma. (c) 2005 Wiley-Liss, Inc.

  4. Nicotine Induced CpG methylation of Pax6 binding motif in StAR promoter reduces the gene expression and cortisol production

    PubMed Central

    Wang, Tingting; Chen, Man; Liu, Lian; Cheng, Huaiyan; Yan, You-E; Feng, Ying-Hong; Wang, Hui

    2011-01-01

    Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a single site CpG methylation at nt −377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. PMID:21971485

  5. Hypermethylation of the Human Glutathione S-Transferase-π Gene (GSTP1) CpG Island Is Present in a Subset of Proliferative Inflammatory Atrophy Lesions but Not in Normal or Hyperplastic Epithelium of the Prostate

    PubMed Central

    Nakayama, Masashi; Bennett, Christina J.; Hicks, Jessica L.; Epstein, Jonathan I.; Platz, Elizabeth A.; Nelson, William G.; De Marzo, Angelo M.

    2003-01-01

    Somatic inactivation of the glutathione S-transferase-π gene (GSTP1) via CpG island hypermethylation occurs early during prostate carcinogenesis, present in ∼70% of high-grade prostatic intraepithelial neoplasia (high-grade PIN) lesions and more than 90% of adenocarcinomas. Recently, there has been a resurgence of the concept that foci of prostatic atrophy (referred to as proliferative inflammatory atrophy or PIA) may be precursor lesions for the development of prostate cancer and/or high-grade PIN. Many of the cells within PIA lesions contain elevated levels of GSTP1, glutathione S-transferase-α (GSTA1), and cyclooxygenase-II proteins, suggesting a stress response. Because not all PIA cells are positive for GSTP1 protein, we hypothesized that some of the cells within these regions acquire GSTP1 CpG island hypermethylation, increasing the chance of progression to high-grade PIN and/or adenocarcinoma. Separate regions (n =199) from 27 formalin-fixed paraffin-embedded prostates were microdissected by laser-capture microdissection (Arcturus PixCell II). These regions included normal epithelium (n = 48), hyperplasticepithelium from benign prostatic hyperplasia nodules (n = 22), PIA (n = 64), high-grade PIN (n = 32), and adenocarcinoma (n = 33). Genomic DNA was isolated and assessed for GSTP1 CpG island hypermethylation by methylation-specific polymerase chain reaction. GSTP1 CpG island hypermethylation was not detected in normal epithelium (0 of 48) or in hyperplastic epithelium (0 of 22), but was found in 4 of 64 (6.3%) PIA lesions. The difference in the frequency of GSTP1 CpG island hypermethylation between normal or hyperplastic epithelium and PIA was statistically significant (P = 0.049). Similar to studies using nonmicrodissected cases, hypermethylation was found in 22 of 32 (68.8%) high-grade PIN lesions and in 30 of 33 (90.9%) adenocarcinoma lesions. Unlike normal or hyperplastic epithelium, GSTP1 CpG island hypermethylation can be detected in some PIA

  6. The protein DIIIC-2, aggregated with a specific oligodeoxynucleotide and adjuvanted in alum, protects mice and monkeys against DENV-2.

    PubMed

    Gil, Lázaro; Marcos, Ernesto; Izquierdo, Alienys; Lazo, Laura; Valdés, Iris; Ambala, Peris; Ochola, Lucy; Hitler, Rikoi; Suzarte, Edith; Álvarez, Mayling; Kimiti, Prisilla; Ndung'u, James; Kariuki, Thomas; Guzmán, María Guadalupe; Guillén, Gerardo; Hermida, Lisset

    2015-01-01

    Previously, we reported the ability of the chimeric protein DIIIC-2 (domain III of the dengue envelope protein fused to the capsid protein of dengue-2 virus), to induce immunity and protection in mice, when it is highly aggregated with a non-defined oligodeoxynucleotide (ODN) and adjuvanted in alum. In this work, three different defined ODNs were studied as aggregating agents. Our results suggest that the nature of the ODN influences the capacity of protein DIIIC-2 to activate cell-mediated immunity in mice. Consequently, the ODN 39M was selected to perform further experiments in mice and nonhuman primates. Mice receiving the preparation 39M-DIIIC-2 were solidly protected against dengue virus (DENV) challenge. Moreover, monkeys immunized with the same preparation developed neutralizing antibodies, as measured by four different neutralization tests varying the virus strains and the cell lines used. Two of the immunized monkeys were completely protected against challenge, whereas the third animal had a single day of low-titer viremia. This is the first work describing the induction of short-term protection in monkeys by a formulation that is suitable for human use combining a recombinant protein from DENV with alum.

  7. Correlation of CpG Island Methylation of the Cytochrome P450 2E1/2D6 Genes with Liver Injury Induced by Anti-Tuberculosis Drugs: A Nested Case-Control Study.

    PubMed

    Zhang, Jinling; Zhu, Xuebin; Li, Yuhong; Zhu, Lingyan; Li, Shiming; Zheng, Guoying; Ren, Qi; Xiao, Yonghong; Feng, Fumin

    2016-08-01

    This study investigated the role of CpG island methylation of the CYP2E1 and CYP2D6 genes in liver injury induced by anti-TB drugs from an epigenetic perspective in a Chinese cohort. A 1:1 matched nested case-control study design was applied. Pulmonary tuberculosis (TB) patients, who underwent standard anti-TB therapy and developed liver injury were defined as cases, while those who did not develop liver injury were defined as control. The two groups were matched in terms of sex, treatment regimen, and age. In 114 pairs of cases, CpG island methylation levels of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA were found to be significantly correlated with the occurrence of anti-TB drug-induced liver injury (ADLI), with odds ratio (OR) values of 2.429 and 3.500, respectively (p < 0.01). Moreover, through multivariate logistic regression analysis, CpG island methylation of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA were found to be significantly correlated with the occurrence of ADLI, with adjusted OR values of 4.390 (95% confidence interval (CI): 1.982-9.724) and 9.193 (95% CI: 3.624-25.888), respectively (p < 0.001). These results suggest that aberrantly elevated methylation of CpG islands of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA may increase the risk of ADLI in Chinese TB patients.

  8. Antisense oligodeoxynucleotide inhibition of a swelling-activated cation channel in osteoblast-like osteosarcoma cells

    NASA Technical Reports Server (NTRS)

    Duncan, R. L.; Kizer, N.; Barry, E. L.; Friedman, P. A.; Hruska, K. A.

    1996-01-01

    By patch-clamp analysis, we have shown that chronic, intermittent mechanical strain (CMS) increases the activity of stretch-activated cation channels of osteoblast-like UMR-106.01 cells. CMS also produces a swelling-activated whole-cell conductance (Gm) regulated by varying strain levels. We questioned whether the swelling-activated conductance was produced by stretch-activated cation channel activity. We have identified a gene involved in the increase in conductance by using antisense oligodeoxynucleotides (ODN) derived from the alpha 1-subunit genes of calcium channels found in UMR-106.01 cells (alpha1S, alpha1C, and alpha1D). We demonstrate that alpha 1C antisense ODNs abolish the increase in Gm in response to hypotonic swelling following CMS. Antisense ODNs to alpha1S and alpha1D, sense ODNs to alpha1C, and sham permeabilization had no effect on the conductance increase. In addition, during cell-attached patch-clamp studies, antisense ODNs to alpha1c completely blocked the swelling-activated and stretch-activated nonselective cation channel response to strain. Antisense ODNs to alpha1S treatment produced no effect on either swelling-activated or stretch-activated cation channel activity. There were differences in the stretch-activated and swelling-activated cation channel activity, but whether they represent different channels could not be determined from our data. Our data indicate that the alpha1C gene product is involved in the Gm and the activation of the swelling-activated cation channels induced by CMS. The possibility that swelling-activated cation channel genes are members of the calcium channel superfamily exists, but if alpha1c is not the swelling-activated cation channel itself, then its expression is required for induction of swelling-activated cation channel activity by CMS.

  9. Combining Single Strand Oligodeoxynucleotides and CRISPR/Cas9 to Correct Gene Mutations in β-Thalassemia-induced Pluripotent Stem Cells.

    PubMed

    Niu, Xiaohua; He, Wenyin; Song, Bing; Ou, Zhanhui; Fan, Di; Chen, Yuchang; Fan, Yong; Sun, Xiaofang

    2016-08-05

    β-Thalassemia (β-Thal) is one of the most common genetic diseases in the world. The generation of patient-specific β-Thal-induced pluripotent stem cells (iPSCs), correction of the disease-causing mutations in those cells, and then differentiation into hematopoietic stem cells offers a new therapeutic strategy for this disease. Here, we designed a CRISPR/Cas9 to specifically target the Homo sapiens hemoglobin β (HBB) gene CD41/42(-CTTT) mutation. We demonstrated that the combination of single strand oligodeoxynucleotides with CRISPR/Cas9 was capable of correcting the HBB gene CD41/42 mutation in β-Thal iPSCs. After applying a correction-specific PCR assay to purify the corrected clones followed by sequencing to confirm mutation correction, we verified that the purified clones retained full pluripotency and exhibited normal karyotyping. Additionally, whole-exome sequencing showed that the mutation load to the exomes was minimal after CRISPR/Cas9 targeting. Furthermore, the corrected iPSCs were selected for erythroblast differentiation and restored the expression of HBB protein compared with the parental iPSCs. This method provides an efficient and safe strategy to correct the HBB gene mutation in β-Thal iPSCs. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Ultrasound microbubble-mediated transfection of NF-κB decoy oligodeoxynucleotide into gingival tissues inhibits periodontitis in rats in vivo

    PubMed Central

    Yamaguchi, Hiroyuki; Hosomichi, Jun; Suzuki, Jun-ichi; Hatano, Kasumi; Usumi-Fujita, Risa; Shimizu, Yasuhiro; Kaneko, Sawa; Ono, Takashi

    2017-01-01

    Periodontitis is a chronic infectious disease for which the fundamental treatment is to reduce the load of subgingival pathogenic bacteria by debridement. However, previous investigators attempted to implement a nuclear factor kappa B (NF-κB) decoy oligodeoxynucleotide (ODN) as a suppressor of periodontitis progression. Although we recently reported the effectiveness of the ultrasound-microbubble method as a tool for transfecting the NF-κB decoy ODN into healthy rodent gingival tissue, this technique has not yet been applied to the pathological gingiva of periodontitis animal models. Therefore, the aim of this study was to investigate the effectiveness of the technique in transfecting the NF-κB decoy ODN into rats with ligature-induced periodontitis. Micro computed tomography (micro-CT) analysis demonstrated a significant reduction in alveolar bone loss following treatment with the NF-κB decoy ODN in the experimental group. RT-PCR showed that NF-κB decoy ODN treatment resulted in significantly reduced expression of inflammatory cytokine transcripts within rat gingival tissues. Thus, we established a transcutaneous transfection model of NF-κB decoy ODN treatment of periodontal tissues using the ultrasound-microbubble technique. Our findings suggest that the NF-κB decoy ODN could be used as a significant suppressor of gingival inflammation and periodontal disease progression. PMID:29091721

  11. A limited CpG-containing oligodeoxynucleotide therapy regimen induces sustained suppression of allergic airway inflammation in mice

    PubMed Central

    Kozy, Heather M.; Lum, Jeremy A.; Sweetwood, Rosemary; Chu, Mabel; Cunningham, Cameron R.; Salamon, Hugh; Lloyd, Clare M.; Coffman, Robert L.; Hessel, Edith M.

    2015-01-01

    Background CpG-containing oligodeoxynucleotides (CpG-ODN) are potent inhibitors of Th2-mediated allergic airway disease in sensitized mice challenged with allergen. A single treatment has transient effects but a limited series of treatments has potential to achieve clinically meaningful sustained inhibition of allergic airway disease. Objective To optimize the treatment regimen and determine the mechanisms of action in mice of an inhaled form of CpG-ODN being developed for human asthma treatment. Methods A limited series of weekly intranasal 1018 ISS (CpG-ODN; B-class) treatments were given to ragweed allergen-sensitized mice chronically exposed to allergen during and after the 1018 ISS treatment regimen. Treatment effects were evaluated by measuring effect on lung Th2 cytokines and eosinophilia as well as lung dendritic cell function and T cell responses. Results Twelve intranasal 1018 ISS treatments induced significant suppression of BAL eosinophilia and IL-4, IL-5, and IL-13 levels and suppression was maintained through 13 weekly ragweed exposures administered after treatment cessation. At least 5 treatments were required for lasting Th2 suppression. CpG-ODN induced moderate Th1 responses but Th2 suppression did not require IFN-γ. Th2 suppression was associated with induction of a regulatory T cell response. Conclusion A short series of CpG-ODN treatments results in sustained suppression of allergic lung inflammation induced by a clinically relevant allergen. PMID:24464743

  12. Amelioration of collagen-induced arthritis using antigen-loaded dendritic cells modified with NF-κB decoy oligodeoxynucleotides

    PubMed Central

    Jiang, Hongmei; Hu, Henggui; Zhang, Yali; Yue, Ping; Ning, Lichang; Zhou, Yan; Shi, Ping; Yuan, Rui

    2017-01-01

    Dendritic cells (DCs) play an important role in the initiation of autoimmunity in rheumatoid arthritis (RA); therefore, the use of DCs needs to be explored to develop new therapeutic approaches for RA. Here, we investigated the therapeutic effect of bovine type II collagen (BIIC)-loaded DCs modified with NF-κB decoy oligodeoxynucleotides (ODNs) on collagen-induced arthritis (CIA) in rats and explored the underlying mechanisms. DCs treated with BIIC and NF-κB decoy ODNs exhibited features of immature DCs with low levels of costimulatory molecule (CD80 and CD86) expression. The development of arthritis in rats with CIA injected with BIIC + NF-κB decoy ODN-propagated DCs (BIIC–decoy DCs) was significantly ameliorated compared to that in rats injected with BIIC-propagated DCs or phosphate-buffered saline. We also found that the BIIC–decoy DCs exerted antiarthritis effects by inhibiting self-lymphocyte proliferative response and suppressing IFN-γ and anti-BIIC antibody production and inducing IL-10 antibody production. Additionally, antihuman serum antibodies were successfully produced in the rats treated with BIIC–decoy DCs but not in those treated with NF-κB decoy ODN-propagated DCs; moreover, the BIIC–decoy DCs did not affect immune function in the normal rats. These findings suggested that NF-κB decoy ODN-modified DCs loaded with a specific antigen might offer a practical method for the treatment of human RA. PMID:29075103

  13. Co-delivery of Dual Toll-Like Receptor Agonists and Antigen in Poly(Lactic-Co-Glycolic) Acid/Polyethylenimine Cationic Hybrid Nanoparticles Promote Efficient In Vivo Immune Responses.

    PubMed

    Ebrahimian, Mahboubeh; Hashemi, Maryam; Maleki, Mohsen; Hashemitabar, Gholamreza; Abnous, Khalil; Ramezani, Mohammad; Haghparast, Alireza

    2017-01-01

    Strategies to design delivery vehicles are critical in modern vaccine-adjuvant development. Nanoparticles (NPs) encapsulating antigen(s) and adjuvant(s) are promising vehicles to deliver antigen(s) and adjuvant(s) to antigen-presenting cells (APCs), allowing optimal immune responses against a specific pathogen. In this study, we developed a novel adjuvant delivery approach for induction of efficient in vivo immune responses. Polyethylenimine (PEI) was physically conjugated to poly(lactic-co-glycolic) acid (PLGA) to form PLGA/PEI NPs. This complex was encapsulated with resiquimod (R848) as toll-like receptor (TLR) 7/8 agonist, or monophosphoryl lipid A (MPLA) as TLR4 agonist and co-assembled with cytosine-phosphorothioate-guanine oligodeoxynucleotide (CpG ODN) as TLR9 agonist to form a tripartite formulation [two TLR agonists (inside and outside NPs) and PLGA/PEI NPs as delivery system]. The physicochemical characteristics, cytotoxicity and cellular uptake of these synthesized delivery vehicles were investigated. Cellular viability test revealed no pronounced cytotoxicity as well as increased cellular uptake compared to control groups in murine macrophage cells (J774 cell line). In the next step, PLGA (MPLA or R848)/PEI (CpG ODN) were co-delivered with ovalbumin (OVA) encapsulated into PLGA NPs to enhance the induction of immune responses. The immunogenicity properties of these co-delivery formulations were examined in vivo by evaluating the cytokine (IFN-γ, IL-4, and IL-1β) secretion and antibody (IgG1, IgG2a) production. Robust and efficient immune responses were achieved after in vivo administration of PLGA (MPLA or R848)/PEI (CpG ODN) co-delivered with OVA encapsulated in PLGA NPs in BALB/c mice. Our results demonstrate a rational design of using dual TLR agonists in a context-dependent manner for efficient nanoparticulate adjuvant-vaccine development.

  14. Enhanced mucosal immune responses induced by a combined candidate mucosal vaccine based on Hepatitis A virus and Hepatitis E virus structural proteins linked to tuftsin.

    PubMed

    Gao, Yan; Su, Qiudong; Yi, Yao; Jia, Zhiyuan; Wang, Hao; Lu, Xuexin; Qiu, Feng; Bi, Shengli

    2015-01-01

    Hepatitis A virus (HAV) and Hepatitis E virus (HEV) are the most common causes of infectious hepatitis. These viruses are spread largely by the fecal-oral route and lead to clinically important disease in developing countries. To evaluate the potential of targeting hepatitis A and E infection simultaneously, a combined mucosal candidate vaccine was developed with the partial open reading frame 2 (ORF2) sequence (aa 368-607) of HEV (HE-ORF2) and partial virus protein 1 (VP1) sequence (aa 1-198) of HAV (HA-VP1), which included the viral neutralization epitopes. Tuftsin is an immunostimulatory peptide which can enhance the immunogenicity of a protein by targeting it to macrophages and dendritic cells. Here, we developed a novel combined protein vaccine by conjugating tuftsin to HE-ORF2 and HA-VP1 and used synthetic CpG oligodeoxynucleotides (ODNs) as the adjuvant. Subsequent experiments in BALB/c mice demonstrated that tuftsin enhanced the serum-specific IgG and IgA antibodies against HEV and HAV at the intestinal, vaginal and pulmonary interface when delivered intranasally. Moreover, mice from the intranasally immunized tuftsin group (HE-ORF2-tuftsin + HA-VP1-tuftsin + CpG) showed higher levels of IFN-γ-secreting splenocytes (Th1 response) and ratio of CD4+/CD8+ T cells than those of the no-tuftsin group (HE-ORF2 + HA-VP1 + CpG). Thus, the tuftsin group generated stronger humoral and cellular immune responses compared with the no-tuftsin group. Moreover, enhanced responses to the combined protein vaccine were obtained by intranasal immunization compared with intramuscular injection. By integrating HE-ORF2, HA-VP1 and tuftsin in a vaccine, this study validated an important concept for further development of a combined mucosal vaccine against hepatitis A and E infection.

  15. Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing

    PubMed Central

    Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L.

    2016-01-01

    Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1, an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from −938 to −337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1. We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34+ selected hematopoietic stem and progenitor cells. PMID:27570841

  16. Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing.

    PubMed

    Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L

    Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1 , an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from -938 to -337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1 . We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34 + selected hematopoietic stem and progenitor cells.

  17. No association of CpG island methylator phenotype and colorectal cancer survival: population-based study.

    PubMed

    Jia, Min; Jansen, Lina; Walter, Viola; Tagscherer, Katrin; Roth, Wilfried; Herpel, Esther; Kloor, Matthias; Bläker, Hendrik; Chang-Claude, Jenny; Brenner, Hermann; Hoffmeister, Michael

    2016-11-22

    Previous studies have shown adverse effects of CpG island methylator phenotype (CIMP) on colorectal cancer (CRC) prognosis. However, sample sizes were often limited and only few studies were able to adjust for relevant molecular features associated with CIMP. The aim of this study was to investigate the impact of CIMP on CRC survival in a large population-based study with comprehensive adjustment. The CIMP status and other molecular tumour features were analysed in 1385 CRC patients diagnosed between 2003 and 2010. Detailed information were obtained from standardised personal interviews and medical records. During follow-up (median: 4.9 years), we assessed vital status, cause of death and therapy details. Cox proportional hazard regression models were used to estimate adjusted hazard ratios (HRs) and 95% confidence intervals (CIs) of survival after CRC. The CIMP-H occurred more frequently in patients with older age, female gender, cancer in the proximal colon, BRAF mutation and microsatellite instability-high (MSI-H). However, CIMP status was not associated with CRC prognosis in CRC patients (HR=1.00; 95% CI=0.72-1.40 for overall survival; HR=0.96; 95% CI=0.65-1.41 for disease-specific survival) or in any of the subgroups. Although CIMP status was associated with the presence of MSI-H and BRAF mutation, the prognostic effects of MSI-H (HR=0.49; 95% CI=0.27-0.90) and BRAF mutation (HR=1.78; 95% CI=1.10-2.84) were independent of CIMP status. Similar benefit of chemotherapy was found for CRC outcomes in both the CIMP-low/negative group and the CIMP-high group. CpG island methylator phenotype was not associated with CRC prognosis after adjusting for other important clinical factors and associated mutations.

  18. No association of CpG island methylator phenotype and colorectal cancer survival: population-based study

    PubMed Central

    Jia, Min; Jansen, Lina; Walter, Viola; Tagscherer, Katrin; Roth, Wilfried; Herpel, Esther; Kloor, Matthias; Bläker, Hendrik; Chang-Claude, Jenny; Brenner, Hermann; Hoffmeister, Michael

    2016-01-01

    Background: Previous studies have shown adverse effects of CpG island methylator phenotype (CIMP) on colorectal cancer (CRC) prognosis. However, sample sizes were often limited and only few studies were able to adjust for relevant molecular features associated with CIMP. The aim of this study was to investigate the impact of CIMP on CRC survival in a large population-based study with comprehensive adjustment. Methods: The CIMP status and other molecular tumour features were analysed in 1385 CRC patients diagnosed between 2003 and 2010. Detailed information were obtained from standardised personal interviews and medical records. During follow-up (median: 4.9 years), we assessed vital status, cause of death and therapy details. Cox proportional hazard regression models were used to estimate adjusted hazard ratios (HRs) and 95% confidence intervals (CIs) of survival after CRC. Results: The CIMP-H occurred more frequently in patients with older age, female gender, cancer in the proximal colon, BRAF mutation and microsatellite instability-high (MSI-H). However, CIMP status was not associated with CRC prognosis in CRC patients (HR=1.00; 95% CI=0.72–1.40 for overall survival; HR=0.96; 95% CI=0.65–1.41 for disease-specific survival) or in any of the subgroups. Although CIMP status was associated with the presence of MSI-H and BRAF mutation, the prognostic effects of MSI-H (HR=0.49; 95% CI=0.27–0.90) and BRAF mutation (HR=1.78; 95% CI=1.10–2.84) were independent of CIMP status. Similar benefit of chemotherapy was found for CRC outcomes in both the CIMP-low/negative group and the CIMP-high group. Conclusions: CpG island methylator phenotype was not associated with CRC prognosis after adjusting for other important clinical factors and associated mutations. PMID:27811854

  19. CpG in Combination with an Inhibitor of Notch Signaling Suppresses Formalin-Inactivated Respiratory Syncytial Virus-Enhanced Airway Hyperresponsiveness and Inflammation by Inhibiting Th17 Memory Responses and Promoting Tissue-Resident Memory Cells in Lungs

    PubMed Central

    Zhang, Lei; Li, Hongyong; Hai, Yan; Yin, Wei; Li, Wenjian; Zheng, Boyang; Du, Xiaomin; Li, Na; Zhang, Zhengzheng; Deng, Yuqing

    2017-01-01

    ABSTRACT Respiratory syncytial virus (RSV) is the leading cause of childhood hospitalizations. The formalin-inactivated RSV (FI-RSV) vaccine-enhanced respiratory disease (ERD) has been an obstacle to the development of a safe and effective killed RSV vaccine. Agonists of Toll-like receptor (TLR) have been shown to regulate immune responses induced by FI-RSV. Notch signaling plays critical roles during the differentiation and effector function phases of innate and adaptive immune responses. Cross talk between TLR and Notch signaling pathways results in fine-tuning of TLR-triggered innate inflammatory responses. We evaluated the impact of TLR and Notch signaling on ERD in a murine model by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling during FI-RSV immunization. Activation with CpG or deficiency of MyD88-dependent TLR signaling did not alleviate airway inflammation in FI-RSV-immunized mice. Activation or inhibition of Notch signaling with Dll4, one of the Notch ligands, or L685,458 did not suppress FI-RSV-enhanced airway inflammation either. However, the CpG together with L685,458 markedly inhibited FI-RSV-enhanced airway hyperresponsiveness, weight loss, and lung inflammation. Interestingly, CpG plus L685,458 completely inhibited FI-RSV-associated Th17 and Th17-associated proinflammatory chemokine responses in lungs following RSV challenge but not Th1 or Th2, memory responses. In addition, FI-RSV plus CpG plus L685,458 promoted protective CD8+ lung tissue-resident memory (TRM) cells. These results indicate that activation of TLR signaling combined with inhibition of Notch signaling prevent FI-RSV ERD, and the mechanism appears to involve suppressing proinflammatory Th17 memory responses and promoting protective TRM in lungs. IMPORTANCE RSV is the most important cause of lower respiratory tract infections in infants. The FI-RSV-enhanced respiratory disease (ERD) is a major impediment to the development of a safe

  20. CpG in Combination with an Inhibitor of Notch Signaling Suppresses Formalin-Inactivated Respiratory Syncytial Virus-Enhanced Airway Hyperresponsiveness and Inflammation by Inhibiting Th17 Memory Responses and Promoting Tissue-Resident Memory Cells in Lungs.

    PubMed

    Zhang, Lei; Li, Hongyong; Hai, Yan; Yin, Wei; Li, Wenjian; Zheng, Boyang; Du, Xiaomin; Li, Na; Zhang, Zhengzheng; Deng, Yuqing; Zeng, Ruihong; Wei, Lin

    2017-05-15

    Respiratory syncytial virus (RSV) is the leading cause of childhood hospitalizations. The formalin-inactivated RSV (FI-RSV) vaccine-enhanced respiratory disease (ERD) has been an obstacle to the development of a safe and effective killed RSV vaccine. Agonists of Toll-like receptor (TLR) have been shown to regulate immune responses induced by FI-RSV. Notch signaling plays critical roles during the differentiation and effector function phases of innate and adaptive immune responses. Cross talk between TLR and Notch signaling pathways results in fine-tuning of TLR-triggered innate inflammatory responses. We evaluated the impact of TLR and Notch signaling on ERD in a murine model by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling during FI-RSV immunization. Activation with CpG or deficiency of MyD88-dependent TLR signaling did not alleviate airway inflammation in FI-RSV-immunized mice. Activation or inhibition of Notch signaling with Dll4, one of the Notch ligands, or L685,458 did not suppress FI-RSV-enhanced airway inflammation either. However, the CpG together with L685,458 markedly inhibited FI-RSV-enhanced airway hyperresponsiveness, weight loss, and lung inflammation. Interestingly, CpG plus L685,458 completely inhibited FI-RSV-associated Th17 and Th17-associated proinflammatory chemokine responses in lungs following RSV challenge but not Th1 or Th2, memory responses. In addition, FI-RSV plus CpG plus L685,458 promoted protective CD8 + lung tissue-resident memory (TRM) cells. These results indicate that activation of TLR signaling combined with inhibition of Notch signaling prevent FI-RSV ERD, and the mechanism appears to involve suppressing proinflammatory Th17 memory responses and promoting protective TRM in lungs. IMPORTANCE RSV is the most important cause of lower respiratory tract infections in infants. The FI-RSV-enhanced respiratory disease (ERD) is a major impediment to the development of a safe and

  1. Association between the CpG island methylator phenotype and its prognostic significance in primary pulmonary adenocarcinoma.

    PubMed

    Koh, Young Wha; Chun, Sung-Min; Park, Young-Soo; Song, Joon Seon; Lee, Geon Kook; Khang, Shin Kwang; Jang, Se Jin

    2016-08-01

    Aberrant methylation of promoter CpG islands is one of the most important inactivation mechanisms for tumor suppressor and tumor-related genes. Previous studies using genome-wide DNA methylation microarray analysis have suggested the existence of a CpG island methylator phenotype (CIMP) in lung adenocarcinomas. Although the biological behavior of these tumors varies according to tumor stage, no large-scale study has examined the CIMP in lung adenocarcinoma patients according to tumor stage. Furthermore, there have been no reported results regarding the clinical significance of each of the six CIMP markers. To examine the CIMP in patients with pulmonary adenocarcinoma after a surgical resection, we performed methylation analysis of six genes (CCNA1, ACAN, GFRA1, EDARADD, MGC45800, and p16 (INK4A)) in 230 pulmonary adenocarcinoma cases using the SEQUENOM MassARRAY platform. Fifty-four patients (28 %, 54/191) were in the CIMP-high (CIMP-H) group associated with high nodal stage (P = 0.007), the presence of micropapillary or solid histology (P = 0.003), and the absence of an epidermal growth factor receptor (EGFR) mutation (P = 0.002). By multivariate analysis, CIMP was an independent prognostic marker for overall survival (OS) and disease-specific survival (P = 0.03 and P = 0.43, respectively). In the stage I subgroups alone, CIMP-H patients had lower OS rates than the CIMP-low (CIMP-L) group (P = 0.041). Of the six CIMP markers, ACAN alone was significantly associated with patient survival. CIMP predicted the risk of progression independently of clinicopathological variables and enables the stratification of pulmonary adenocarcinoma patients, particularly among stage I cases.

  2. Epicutaneous immunization with ovalbumin and CpG induces TH1/TH17 cytokines, which regulate IgE and IgG2a production

    PubMed Central

    Majewska-Szczepanik, Monika; Askenase, Philip W.; Lobo, Francis M.; Marcińska, Katarzyna; Wen, Li; Szczepanik, Marian

    2017-01-01

    Background Subcutaneous allergen-specific immunotherapy is a standard route for the immunotherapy of allergic diseases. It modulates the course of allergy and can generate long-term remission. However, subcutaneous allergen-specific immunotherapy can also induce anaphylaxis in some patients, and therefore additional routes of administration should be investigated to improve the safety and tolerability of immunotherapy. Objective We sought to determine whether epicutaneous treatment with antigen in the presence of a Toll-like receptor 9 agonist can suppress TH2-mediated responses in an antigen-specific manner. Methods Epicutaneous immunization was performed by applying a skin patch soaked with ovalbumin (OVA) plus CpG, and its suppressor activity was determined by using the mouse model of atopic dermatitis. Finally, adoptive cell transfers were implemented to characterize the regulatory cells that are induced by epicutaneous immunization. Results Epicutaneous immunization with OVA and CpG reduces the production of OVA-specific IgE and increases the synthesis of OVA-specific IgG2a antibodies in an antigen-specific manner. Moreover, eosinophil peroxidase activity in the skin and production of IL-4, IL-5, IL-10, and IL-13 are suppressed. The observed reduction of IgE synthesis is transferable with T-cell receptor (TCR) αβ+CD4+CD25− cells, whereas IgG2a production is dependent on both TCRαβ+ and TCRγδ+ T cells. Further experiments show that the described phenomenon is myeloid differentiation primary response 88, IFN-γ, and IL-17A dependent. Finally, the results suggest that epicutaneous immunization with OVA and CpG decreases the synthesis of OVA-specific IgE and skin eosinophil peroxidase activity in mice with ongoing skin allergy. Conclusion Epicutaneous application of protein antigen in the presence of adjuvant could be an attractive needle-free and self-administered immunotherapy for allergic diseases. PMID:26810716

  3. Uracil Accumulation and Mutagenesis Dominated by Cytosine Deamination in CpG Dinucleotides in Mice Lacking UNG and SMUG1

    DOE PAGES

    Alsøe, Lene; Sarno, Antonio; Carracedo, Sergio; ...

    2017-08-03

    Both a DNA lesion and an intermediate for antibody maturation, uracil is primarily processed by base excision repair (BER), either initiated by uracil-DNA glycosylase (UNG) or by single-strand selective monofunctional uracil DNA glycosylase (SMUG1). The relative in vivo contributions of each glycosylase remain elusive. To assess the impact of SMUG1 deficiency, we measured uracil and 5-hydroxymethyluracil, another SMUG1 substrate, in Smug1 -/ - mice. Here, we found that 5-hydroxymethyluracil accumulated in Smug1 -/ - tissues and correlated with 5-hydroxymethylcytosine levels. The highest increase was found in brain, which contained about 26-fold higher genomic 5-hydroxymethyluracil levels than the wild type. Smug1more » -/ - mice did not accumulate uracil in their genome and Ung -/ - mice showed slightly elevated uracil levels. Contrastingly, Ung -/ -Smug1 -/ - mice showed a synergistic increase in uracil levels with up to 25-fold higher uracil levels than wild type. Whole genome sequencing of UNG/SMUG1-deficient tumours revealed that combined UNG and SMUG1 deficiency leads to the accumulation of mutations, primarily C to T transitions within CpG sequences. This unexpected sequence bias suggests that CpG dinucleotides are intrinsically more mutation prone. In conclusion, we showed that SMUG1 efficiently prevent genomic uracil accumulation, even in the presence of UNG, and identified mutational signatures associated with combined UNG and SMUG1 deficiency.« less

  4. ampliMethProfiler: a pipeline for the analysis of CpG methylation profiles of targeted deep bisulfite sequenced amplicons.

    PubMed

    Scala, Giovanni; Affinito, Ornella; Palumbo, Domenico; Florio, Ermanno; Monticelli, Antonella; Miele, Gennaro; Chiariotti, Lorenzo; Cocozza, Sergio

    2016-11-25

    CpG sites in an individual molecule may exist in a binary state (methylated or unmethylated) and each individual DNA molecule, containing a certain number of CpGs, is a combination of these states defining an epihaplotype. Classic quantification based approaches to study DNA methylation are intrinsically unable to fully represent the complexity of the underlying methylation substrate. Epihaplotype based approaches, on the other hand, allow methylation profiles of cell populations to be studied at the single molecule level. For such investigations, next-generation sequencing techniques can be used, both for quantitative and for epihaplotype analysis. Currently available tools for methylation analysis lack output formats that explicitly report CpG methylation profiles at the single molecule level and that have suited statistical tools for their interpretation. Here we present ampliMethProfiler, a python-based pipeline for the extraction and statistical epihaplotype analysis of amplicons from targeted deep bisulfite sequencing of multiple DNA regions. ampliMethProfiler tool provides an easy and user friendly way to extract and analyze the epihaplotype composition of reads from targeted bisulfite sequencing experiments. ampliMethProfiler is written in python language and requires a local installation of BLAST and (optionally) QIIME tools. It can be run on Linux and OS X platforms. The software is open source and freely available at http://amplimethprofiler.sourceforge.net .

  5. Uracil Accumulation and Mutagenesis Dominated by Cytosine Deamination in CpG Dinucleotides in Mice Lacking UNG and SMUG1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alsøe, Lene; Sarno, Antonio; Carracedo, Sergio

    Both a DNA lesion and an intermediate for antibody maturation, uracil is primarily processed by base excision repair (BER), either initiated by uracil-DNA glycosylase (UNG) or by single-strand selective monofunctional uracil DNA glycosylase (SMUG1). The relative in vivo contributions of each glycosylase remain elusive. To assess the impact of SMUG1 deficiency, we measured uracil and 5-hydroxymethyluracil, another SMUG1 substrate, in Smug1 -/ - mice. Here, we found that 5-hydroxymethyluracil accumulated in Smug1 -/ - tissues and correlated with 5-hydroxymethylcytosine levels. The highest increase was found in brain, which contained about 26-fold higher genomic 5-hydroxymethyluracil levels than the wild type. Smug1more » -/ - mice did not accumulate uracil in their genome and Ung -/ - mice showed slightly elevated uracil levels. Contrastingly, Ung -/ -Smug1 -/ - mice showed a synergistic increase in uracil levels with up to 25-fold higher uracil levels than wild type. Whole genome sequencing of UNG/SMUG1-deficient tumours revealed that combined UNG and SMUG1 deficiency leads to the accumulation of mutations, primarily C to T transitions within CpG sequences. This unexpected sequence bias suggests that CpG dinucleotides are intrinsically more mutation prone. In conclusion, we showed that SMUG1 efficiently prevent genomic uracil accumulation, even in the presence of UNG, and identified mutational signatures associated with combined UNG and SMUG1 deficiency.« less

  6. Role of Confinement on Adsorption and Dynamics of Ethane and an Ethane–CO 2 Mixture in Mesoporous CPG Silica

    DOE PAGES

    Patankar, Sumant; Gautam, Siddharth; Rother, Gernot; ...

    2016-02-10

    It was found that ethane is confined to mineral and organic pores in certain shale formations. Effects of confinement on structural and dynamic properties of ethane in mesoporous controlled pore glass (CPG) were studied by gravimetric adsorption and quasi-elastic neutron scattering (QENS) measurements. The obtained isotherms and scattering data complement each other by quantifying the relative strength of the solid–fluid interactions and the transport properties of the fluid under confinement, respectively. We used a magnetic suspension balance to measure the adsorption isotherms at two temperatures and over a range of pressures corresponding to a bulk density range of 0.01–0.35 g/cmmore » 3. Key confinement effects were highlighted through differences between isotherms for the two pore sizes. A comparison was made with previously published isotherms for CO 2 on the same CPG materials. Behavior of ethane in the smaller pore size was probed further using quasi-elastic neutron scattering. By extracting the self-diffusivity and residence time, we were able to study the effect of pressure and transition from gaseous to supercritical densities on the dynamics of confined ethane. Moreover, a temperature variation QENS study was also completed with pure ethane and a CO 2–ethane mixture. Activation energies extracted from the Arrhenius plots show the effects of CO 2 addition on ethane mobility.« less

  7. Reversal of human allergen-specific CRTH2+ T(H)2 cells by IL-12 or the PS-DSP30 oligodeoxynucleotide.

    PubMed

    Annunziato, F; Cosmi, L; Manetti, R; Brugnolo, F; Parronchi, P; Maggi, E; Nagata, K; Romagnani, S

    2001-11-01

    The chemoattractant receptor homologous molecule expressed on T(H)2 cells (CRTH2) is a receptor for prostaglandin D(2), which among human T cells is selectively expressed by T(H)2 and type 2 cytotoxic effectors. Our purpose was to assess whether the cytokine production profile of T(H)2 effectors could be reversed by exploiting their selective expression of CRTH2. CRTH2(+) T cells were purified from the blood of allergic subjects, stimulated with the specific allergen in the absence or presence of IL-12, and assessed by flow cytometry at the single-cell level for their ability to produce IL-4 and/or IFN-gamma after antigen or polyclonal stimulation. Both IL-12 and the PS-DSP30 oligodeoxynucleotide enabled CRTH2(+) allergen-stimulated T(H)2 cells to produce IFN-gamma. This change in the profile of cytokine production by T(H)2 cells from allergic subjects was related to the upregulation of IL-12 receptor beta2 chain and was associated with the loss of CRTH2. These data demonstrate that the cytokine production pattern of fully differentiated T(H)2 effectors can be changed to a less polarized profile, thus providing the physiologic basis for new immunotherapeutic strategies in allergic disorders.

  8. CpG Oligodeoxynucleotide and Montanide ISA 51 Adjuvant Combination Enhanced the Protective Efficacy of a Subunit Malaria Vaccine

    DTIC Science & Technology

    2004-02-01

    Doolan, D. L., and S. L. Hoffman. 2002. Nucleic acid vaccines against ma- laria. Chem. Immunol. 80, p. 308–320. In P. Perlman and M. Troye - Bloomberg (ed...and M. T. Troye - Blomberg (ed.), Malaria immunology. Karger, Basel, Switzerland, Germany. 30. Kumar, S., F. Villinger, M. Oakley, J. C. Aguiar, T. R...and pathology, p. 204–221. In P. Perlman and M. T. Troye -Blomberg (ed.), Malaria immunology. Karger, Basel, Switzerland. 32. Ling, I. T., S. A. Ogun

  9. The left end of rat L1 (L1Rn, long interspersed repeated) DNA which is a CpG island can function as a promoter.

    PubMed Central

    Nur, I; Pascale, E; Furano, A V

    1988-01-01

    Here we report that the 600 bp promoter-like region at the left end of a newly isolated and characterized rat L1 DNA element can activate the prokaryotic chloramphenicol acyltransferase gene in a rat cell line. Activation only occurs when the promoter region is oriented to the transferase gene as it is to the L1 protein encoding sequences and is 75% inhibited by methylation of just 5 of the 22 CpGs present in the promoter. The G + C rich promoter contains enough CpGs to qualify it as a CpG island, but in contrast to other CpG islands, genomic L1 promoters are fully methylated in both somatic cell and sperm DNA as judged by restriction enzyme analysis. Partial demethylation of the genomic promoters by treatment with 5-azacytidine failed to produce discrete L1 transcripts. The relationship of methylation to the evolutionary history and fate of the rat L1 promoter is discussed. Images PMID:2459662

  10. Analysis of RET promoter CpG island methylation using methylation-specific PCR (MSP), pyrosequencing, and methylation-sensitive high-resolution melting (MS-HRM): impact on stage II colon cancer patient outcome.

    PubMed

    Draht, Muriel X G; Smits, Kim M; Jooste, Valérie; Tournier, Benjamin; Vervoort, Martijn; Ramaekers, Chantal; Chapusot, Caroline; Weijenberg, Matty P; van Engeland, Manon; Melotte, Veerle

    2016-01-01

    Already since the 1990s, promoter CpG island methylation markers have been considered promising diagnostic, prognostic, and predictive cancer biomarkers. However, so far, only a limited number of DNA methylation markers have been introduced into clinical practice. One reason why the vast majority of methylation markers do not translate into clinical applications is lack of independent validation of methylation markers, often caused by differences in methylation analysis techniques. We recently described RET promoter CpG island methylation as a potential prognostic marker in stage II colorectal cancer (CRC) patients of two independent series. In the current study, we analyzed the RET promoter CpG island methylation of 241 stage II colon cancer patients by direct methylation-specific PCR (MSP), nested-MSP, pyrosequencing, and methylation-sensitive high-resolution melting (MS-HRM). All primers were designed as close as possible to the same genomic region. In order to investigate the effect of different DNA methylation assays on patient outcome, we assessed the clinical sensitivity and specificity as well as the association of RET methylation with overall survival for three and five years of follow-up. Using direct-MSP and nested-MSP, 12.0 % (25/209) and 29.6 % (71/240) of the patients showed RET promoter CpG island methylation. Methylation frequencies detected by pyrosequencing were related to the threshold for positivity that defined RET methylation. Methylation frequencies obtained by pyrosequencing (threshold for positivity at 20 %) and MS-HRM were 13.3 % (32/240) and 13.8 % (33/239), respectively. The pyrosequencing threshold for positivity of 20 % showed the best correlation with MS-HRM and direct-MSP results. Nested-MSP detected RET promoter CpG island methylation in deceased patients with a higher sensitivity (33.1 %) compared to direct-MSP (10.7 %), pyrosequencing (14.4 %), and MS-HRM (15.4 %). While RET methylation frequencies detected by nested

  11. Clinical Significance of MLH1 Methylation and CpG Island Methylator Phenotype as Prognostic Markers in Patients with Gastric Cancer

    PubMed Central

    Shigeyasu, Kunitoshi; Nagasaka, Takeshi; Mori, Yoshiko; Yokomichi, Naosuke; Kawai, Takashi; Fuji, Tomokazu; Kimura, Keisuke; Umeda, Yuzo; Kagawa, Shunsuke; Goel, Ajay; Fujiwara, Toshiyoshi

    2015-01-01

    Background To improve the outcome of patients suffering from gastric cancer, a better understanding of underlying genetic and epigenetic events in this malignancy is required. Although CpG island methylator phenotype (CIMP) and microsatellite instability (MSI) have been shown to play pivotal roles in gastric cancer pathogenesis, the clinical significance of these events on survival outcomes in patients with gastric cancer remains unknown. Methods This study included a patient cohort with pathologically confirmed gastric cancer who had surgical resections. A cohort of 68 gastric cancers was analyzed. CIMP and MSI statuses were determined by analyzing promoter CpG island methylation status of 28 genes/loci, and genomic instability at 10 microsatellite markers, respectively. A Cox’s proportional hazards model was performed for multivariate analysis including age, stage, tumor differentiation, KRAS mutation status, and combined CIMP/MLH1 methylation status in relation to overall survival (OS). Results By multivariate analysis, longer OS was significantly correlated with lower pathologic stage (P = 0.0088), better tumor differentiation (P = 0.0267) and CIMP-high and MLH1 3' methylated status (P = 0.0312). Stratification of CIMP status with regards to MLH1 methylation status further enabled prediction of gastric cancer prognosis. Conclusions CIMP and/or MLH1 methylation status may have a potential to be prognostic biomarkers for patients with gastric cancer. PMID:26121593

  12. Influence of homeobox B2 antisense oligodeoxynucleotides on the biological characteristics of in vitro cultured primary human umbilical vein endothelial cells.

    PubMed

    Liu, X S; Zhang, X Q; Tian, T; Liu, L; Ming, J

    2008-01-01

    This study aims to explore the influence of homeobox B2 (HOXB2) antisense oligodeoxynucleotides (asodn) on the biological characteristics of in vitro cultured primary human umbilical vein endothelial cells (HUVECs). The distribution of HOXB2 asodn in the HUVECs was observed by fluorescent labelling, and the influence of different concentrations of HOXB2 asodn on the DNA synthesis of HUVECs was assessed. Flow cytometry and a reverse transcriptase-polymerase chain reaction (RT- PCR) method were employed to observe the influence of HOXB2 asodn on HOXB2 expression and the HUVEC cell cycle. After the induction of liposome, the nuclear fluorescent staining of HOXB2 asodn was weaker 15 min after transfection and the staining reached the strongest level at 4-8 h but then weakened and disappeared by 16 h after transfection. This indicated that endothelial DNA synthesis could be inhibited by HOXB2 asodn in a dose-dependent manner. Furthermore, the HUVECs could be delayed in their passage from G1 to S. Simultaneously, expression of HOXB2 mRNA had decreased significantly by 24-48 h after transfection. Clearly, HOXB2 plays important roles in the proliferation of endothelial cells and also affects the cell cycle.

  13. Metronomic Doses of Temozolomide Enhance the Efficacy of Carbon Nanotube CpG Immunotherapy in an Invasive Glioma Model.

    PubMed

    Ouyang, Mao; White, Ethan E; Ren, Hui; Guo, Qin; Zhang, Ian; Gao, Hang; Yanyan, Song; Chen, Xuebo; Weng, Yiming; Da Fonseca, Anna; Shah, Sunny; Manuel, Edwin R; Zhang, Leying; Vonderfecht, Steven L; Alizadeh, Darya; Berlin, Jacob M; Badie, Behnam

    2016-01-01

    Even when treated with aggressive current therapies, most patients with glioblastoma survive less than two years. Rapid tumor growth, an invasive nature, and the blood-brain barrier, which limits the penetration of large molecules into the brain, all contribute to the poor tumor response associated with conventional therapies. Immunotherapy has emerged as a therapeutic approach that may overcome these challenges. We recently reported that single-walled carbon nanotubes (SWCNTs) can be used to dramatically increase the immunotherapeutic efficacy of CpG oligonucleotides in a mouse model of glioma. Following implantation in the mouse brain, the tumor cell line used in these previous studies (GL261) tends to form a spherical tumor with limited invasion into healthy brain. In order to evaluate SWCNT/CpG therapy under more clinically-relevant conditions, here we report the treatment of a more invasive mouse glioma model (K-Luc) that better recapitulates human disease. In addition, a CpG sequence previously tested in humans was used to formulate the SWCNT/CpG which was combined with temozolomide, the standard of care chemotherapy for glioblastoma patients. We found that, following two intracranial administrations, SWCNT/CpG is well-tolerated and improves the survival of mice bearing invasive gliomas. Interestingly, the efficacy of SWCNT/CpG was enhanced when combined with temozolomide. This enhanced anti-tumor efficacy was correlated to an increase of tumor-specific cytotoxic activity in splenocytes. These results reinforce the emerging understanding that immunotherapy can be enhanced by combining it with chemotherapy and support the continued development of SWCNT/CpG.

  14. Bacterial prostatitis.

    PubMed

    Gill, Bradley C; Shoskes, Daniel A

    2016-02-01

    The review provides the infectious disease community with a urologic perspective on bacterial prostatitis. Specifically, the article briefly reviews the categorization of prostatitis by type and provides a distillation of new findings published on bacterial prostatitis over the past year. It also highlights key points from the established literature. Cross-sectional prostate imaging is becoming more common and may lead to more incidental diagnoses of acute bacterial prostatitis. As drug resistance remains problematic in this condition, the reemergence of older antibiotics such as fosfomycin, has proven beneficial. With regard to chronic bacterial prostatitis, no clear clinical risk factors emerged in a large epidemiological study. However, bacterial biofilm formation has been associated with more severe cases. Surgery has a limited role in bacterial prostatitis and should be reserved for draining of a prostatic abscess or the removal of infected prostatic stones. Prostatitis remains a common and bothersome clinical condition. Antibiotic therapy remains the basis of treatment for both acute and chronic bacterial prostatitis. Further research into improving prostatitis treatment is indicated.

  15. Effect of antisense oligodeoxynucleotides for ICAM-1 on renal ischaemia–reperfusion injury in the anaesthetised rat

    PubMed Central

    Kiew, Lik Voon; Munavvar, Abdul Sattar; Law, Chung Hiong; Azizan, Abdullah Nor; Nazarina, Abdul Rahman; Sidik, Khalifah; Johns, Edward J

    2004-01-01

    An antisense oligodeoxynucleotide (As-ODN) to the 3′ untranslated region of the mRNA sequence expressing the intracellular adhesion molecule-1 (ICAM-1) was employed to determine ICAM-1's role in renal ischaemia–reperfusion injury in the rat. Wistar-Kyoto rats receiving i.v. either lipofectin–As-ODN (As-ODN group), lipofectin–reverse ODN (Rv-ODN group) or lipofectin (ischaemia control group) 8 h prior to study were anaesthetized and subjected to 30 min of renal artery occlusion. Renal haemodynamic and excretory parameters were monitored before and after renal ischaemia. On termination of the study renal tissue was subjected to histological and Western blot analysis. Renal blood flow decreased in the 3 h post-ischaemia period in the ischaemia control and Rv-ODN groups, but was maintained in the As-ODN group. Glomerular filtration rate was depressed initially but gradually increased to 10% above basal levels in the ischaemia control and Rv-ODN groups, but was below basal levels (20%) in the As-ODN group. There was a three- to fourfold increase in sodium and water excretion following ischaemia in the ischaemia control and reverse-ODN groups but not in the As-ODN treated group. The As-ODN ameliorated the histological evidence of ischaemic damage and reduced ICAM-1 protein levels to a greater extent in the medulla than cortex. These observations suggested that in the post-ischaemic period afferent and efferent arteriolar tone was increased with a loss of reabsorptive capacity which was in part due to ICAM-1. The possibility arises that the action of ICAM-1 at vascular and tubular sites in the deeper regions of the kidney contributes to the ischaemia–reperfusion injury. PMID:15047774

  16. Bacterial Sialidase

    NASA Technical Reports Server (NTRS)

    2004-01-01

    Data shows that elevated sialidase in bacterial vaginosis patients correlates to premature births in women. Bacterial sialidase also plays a significant role in the unusual colonization of Pseudomonas aeruginosa in cystic fibrosis patients. Crystals of Salmonella sialidase have been reproduced and are used for studying the inhibitor-enzyme complexes. These inhibitors may also be used to inhibit a trans-sialidase of Trypanosome cruzi, a very similar enzyme to bacterial sialidase, therefore preventing T. cruzi infection, the causitive agent of Chagas' disease. The Center for Macromolecular Crystallography suggests that inhibitors of bacterial sialidases can be used as prophylactic drugs to prevent bacterial infections in these critical cases.

  17. Prevention of Asthma Exacerbation in a Mouse Model by Simultaneous Inhibition of NF-κB and STAT6 Activation Using a Chimeric Decoy Strategy.

    PubMed

    Miyake, Tetsuo; Miyake, Takashi; Sakaguchi, Makoto; Nankai, Hirokazu; Nakazawa, Takahiro; Morishita, Ryuichi

    2018-03-02

    Transactivation of inflammatory and immune mediators in asthma is tightly regulated by nuclear factor κB (NF-κB) and signal transducer and activator of transcription 6 (STAT6). Therefore, we investigated the efficacy of simultaneous inhibition of NF-κB and STAT6 using a chimeric decoy strategy to prevent asthma exacerbation. The effects of decoy oligodeoxynucleotides were evaluated using an ovalbumin-induced mouse asthma model. Ovalbumin-sensitized mice received intratracheal administration of decoy oligodeoxynucleotides 3 days before ovalbumin challenge. Fluorescent-dye-labeled decoy oligodeoxynucleotides could be detected in lymphocytes and macrophages in the lung, and activation of NF-κB and STAT6 was inhibited by chimeric decoy oligodeoxynucleotide transfer. Consequently, treatment with chimeric or NF-κB decoy oligodeoxynucleotides protected against methacholine-induced airway hyperresponsiveness, whereas the effect of chimeric decoy oligodeoxynucleotides was significantly greater than that of NF-κB decoy oligodeoxynucleotides. Treatment with chimeric decoy oligodeoxynucleotides suppressed airway inflammation through inhibition of overexpression of interleukin-4 (IL-4), IL-5, and IL-13 and inflammatory infiltrates. Histamine levels in the lung were reduced via suppression of mast cell accumulation. A significant reduction in mucin secretion was observed due to suppression of MUC5AC gene expression. Interestingly, the inhibitory effects on IL-5, IL-13, and histamine secretion were achieved by transfer of chimeric decoy oligodeoxynucleotides only. This novel therapeutic approach could be useful to treat patients with various types of asthma. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Association of the Colorectal CpG Island Methylator Phenotype with molecular features, risk factors and family history

    PubMed Central

    Long, Tiffany I.; Buchanan, Daniel D.; Walters, Rhiannon; Clendenning, Mark; Rosty, Christophe; Joshi, Amit D.; Stern, Mariana C.; LeMarchand, Loic; Lindor, Noralane M.; Daftary, Darshana; Gallinger, Steven; Selander, Teresa; Bapat, Bharati; Newcomb, Polly A.; Campbell, Peter T.; Casey, Graham; Ahnen, Dennis J.; Baron, John A.; Haile, Robert W.; Hopper, John L.; Young, Joanne P.; Laird, Peter W.; Siegmund, Kimberly D.

    2015-01-01

    Background The CpG Island Methylator Phenotype (CIMP) represents a subset of colorectal cancers (CRCs) characterized by widespread aberrant DNA hypermethylation at select CpG islands. The risk factors and environmental exposures contributing to etiologic heterogeneity between CIMP and non-CIMP tumors are not known. Methods We measured the CIMP status of 3,119 primary population-based CRC tumors from the multinational Colon Cancer Family Registry. Etiologic heterogeneity was assessed by a case-case study comparing risk factor frequency of CRC cases with CIMP and non-CIMP tumors using logistic regression to estimate the case-case odds ratio (ccOR). Results We found associations between tumor CIMP status and MSI-H (ccOR=7.6), BRAF V600E mutation (ccOR=59.8), proximal tumor site (ccOR=9) (all p<0.0001), female sex (ccOR=1.8; 95% CI=1.5-2.1), older age (ccOR=4.0 comparing over 70 years vs under 50; 95% CI=3.0-5.5) and family history of CRC (ccOR=0.6, 95% CI=0.5-0.7). While use of NSAIDs varied by tumor CIMP status for both males and females (p=0.0001 and p=0.02, respectively), use of multi-vitamin or calcium supplements did not. Only for female CRCs was CIMP status associated with increased pack-years of smoking (trend p < 0.001) and body mass index (BMI) (trend p = 0.03). Conclusions The frequency of several CRC risk factors varied by CIMP status, and the associations of smoking and obesity with tumor subtype were evident only for females. Impact Differences in the associations of a unique DNA methylation-based subgroup of CRC with important lifestyle and environmental exposures increase understanding of the molecular pathologic epidemiology of this heavily methylated subset of CRCs. PMID:25587051

  19. A simple algorithm for quantifying DNA methylation levels on multiple independent CpG sites in bisulfite genomic sequencing electropherograms.

    PubMed

    Leakey, Tatiana I; Zielinski, Jerzy; Siegfried, Rachel N; Siegel, Eric R; Fan, Chun-Yang; Cooney, Craig A

    2008-06-01

    DNA methylation at cytosines is a widely studied epigenetic modification. Methylation is commonly detected using bisulfite modification of DNA followed by PCR and additional techniques such as restriction digestion or sequencing. These additional techniques are either laborious, require specialized equipment, or are not quantitative. Here we describe a simple algorithm that yields quantitative results from analysis of conventional four-dye-trace sequencing. We call this method Mquant and we compare it with the established laboratory method of combined bisulfite restriction assay (COBRA). This analysis of sequencing electropherograms provides a simple, easily applied method to quantify DNA methylation at specific CpG sites.

  20. Conformational characteristics of dimeric subunits of RNA from energy minimization studies. Mixed sugar-puckered ApG, ApU, CpG, and CpU.

    PubMed

    Thiyagarajan, P; Ponnuswamy, P K

    1981-09-01

    Following the procedure described in the preceding article, the low energy conformations located for the four dimeric subunits of RNA, ApG, ApU, CpG, and CpU are presented. The A-RNA type and Watson-Crick type helical conformations and a number of different kinds of loop promoting ones were identified as low energy in all the units. The 3E-3E and 3E-2E pucker sequences are found to be more or less equally preferred; the 2E-2E sequence is occasionally preferred, while the 2E-3E is highly prohibited in all the units. A conformation similar to the one observed in the drug-dinucleoside monophosphate complex crystals becomes a low energy case only for the CpG unit. The low energy conformations obtained for the four model units were used to assess the stability of the conformational states of the dinucleotide segments in the four crystal models of the tRNAPhe molecule. Information on the occurrence of the less preferred sugar-pucker sequences in the various loop regions in the tRNAPhe molecule has been obtained. A detailed comparison of the conformational characteristics of DNA and RNA subunits at the dimeric level is presented on the basis of the results.

  1. Conformational characteristics of dimeric subunits of RNA from energy minimization studies. Mixed sugar-puckered ApG, ApU, CpG, and CpU.

    PubMed Central

    Thiyagarajan, P; Ponnuswamy, P K

    1981-01-01

    Following the procedure described in the preceding article, the low energy conformations located for the four dimeric subunits of RNA, ApG, ApU, CpG, and CpU are presented. The A-RNA type and Watson-Crick type helical conformations and a number of different kinds of loop promoting ones were identified as low energy in all the units. The 3E-3E and 3E-2E pucker sequences are found to be more or less equally preferred; the 2E-2E sequence is occasionally preferred, while the 2E-3E is highly prohibited in all the units. A conformation similar to the one observed in the drug-dinucleoside monophosphate complex crystals becomes a low energy case only for the CpG unit. The low energy conformations obtained for the four model units were used to assess the stability of the conformational states of the dinucleotide segments in the four crystal models of the tRNAPhe molecule. Information on the occurrence of the less preferred sugar-pucker sequences in the various loop regions in the tRNAPhe molecule has been obtained. A detailed comparison of the conformational characteristics of DNA and RNA subunits at the dimeric level is presented on the basis of the results. PMID:6168312

  2. Experimental iron-inactivated Pasteurella multocida A: 1 vaccine adjuvanted with bacterial DNA is safe and protects chickens from fowl cholera.

    PubMed

    Herath, Chitra; Kumar, Pankaj; Singh, Mithilesh; Kumar, Devender; Ramakrishnan, Saravanan; Goswami, Tapas Kumar; Singh, Ajit; Ram, G C

    2010-03-08

    Fowl cholera is a serious problem in large and small scale poultry production. The present study describes the development and testing of an inactivated whole-cell, low-cost, safe, and effective vaccine for fowl cholera based on a previous work (Vaccine 23:5590-5598). Pasteurella multocida A: 1 grown in the presence of low FeCl(3) concentrations, inactivated with higher concentrations of FeCl(3), and adjuvanted with bacterial DNA from P. multocida B: 2 containing immunostimulatory CpG motifs protect chickens with a lethal P. multocida A: 1 challenge. Chickens were immunized with two whole-cell inactivated vaccine doses at 4 weeks apart and challenged 4 weeks after booster immunization. Experimental vaccines were pure, easy injectable, and caused very little distress in chickens due to their aqueous consistency. Vaccines and bacterial DNA (bDNA) posed no safety problems when chickens were injected subcutaneously (s.c.) with a single, double, and overdose of these preparations. Immunized chickens produced systemic IgY antibodies (Ab) responses and vaccine adjuvanted with bDNA protected 100% chickens from lethal intrapertoneal (i.p.) P. multocida A: 1 challenge. This work suggests that use of bDNA as an adjuvant can improve the cost-effectiveness of inactivated veterinary vaccines for their use in developing countries. Our future studies will focus on safety and potency evaluation of experimental and current vaccines using bDNA as an adjuvant. Copyright 2010 Elsevier Ltd. All rights reserved.

  3. Bacterially-Associated Transcriptional Remodelling in a Distinct Genomic Subtype of Colorectal Cancer Provides a Plausible Molecular Basis for Disease Development

    PubMed Central

    Goosen, Ryan W.

    2016-01-01

    The relevance of specific microbial colonisation to colorectal cancer (CRC) disease pathogenesis is increasingly recognised, but our understanding of possible underlying molecular mechanisms that may link colonisation to disease in vivo remains limited. Here, we investigate the relationships between the most commonly studied CRC-associated bacteria (Enterotoxigenic Bacteroides fragilis, pks+ Escherichia coli, Fusobacterium spp., afaC+ E. coli, Enterococcus faecalis & Enteropathogenic E. coli) and altered transcriptomic and methylation profiles of CRC patients, in order to gain insight into the potential contribution of these bacteria in the aetiopathogenesis of CRC. We show that colonisation by E. faecalis and high levels of Fusobacterium is associated with a specific transcriptomic subtype of CRC that is characterised by CpG island methylation, microsatellite instability and a significant increase in inflammatory and DNA damage pathways. Analysis of the significant, bacterially-associated changes in host gene expression, both at the level of individual genes as well as pathways, revealed a transcriptional remodeling that provides a plausible mechanistic link between specific bacterial colonisation and colorectal cancer disease development and progression in this subtype; these included upregulation of REG3A, REG1A and REG1P in the case of high-level colonization by Fusobacterium, and CXCL10 and BMI1 in the case of colonisation by E. faecalis. The enrichment of both E. faecalis and Fusobacterium in this CRC subtype suggests that polymicrobial colonisation of the colonic epithelium may well be an important aspect of colonic tumourigenesis. PMID:27846243

  4. Spirodi(iminohydantoin) Products from Oxidation of 2′-Deoxyguanosine in the Presence of NH4Cl in Nucleoside and Oligodeoxynucleotide Contexts

    PubMed Central

    2015-01-01

    Upon oxidation of the heterocyclic ring in 2′-deoxyguanosine (dG), the initial electrophilic intermediate displays a wide range of reactivities with nucleophiles leading to many downstream products. In the present study, the product profiles were mapped when aqueous solutions of dG were allowed to react with NH4Cl in the presence of the photooxidants riboflavin and Rose Bengal as well as the diffusible one-electron oxidant Na2IrCl6. Product characterization identified the 2′-deoxyribonucleosides of spiroiminodihydantoin, 5-guanidinohydantoin, and oxazolone resulting from H2O as the nucleophile. When NH3 was the nucleophile, a set of constitutional isomers that are diastereotopic were also observed, giving characteristic masses of dG + 31. ESI+-MS/MS of these NH3 adducts identified them to be spirocycles with substitution of either the C5 or C8 carbonyl with an amine. The NH3 adducts exhibit acid-catalyzed hydrolysis to spiroiminodihydantoin. Quantification of the NH3 and H2O adducts resulting from oxidation of dG in the nucleoside, single-stranded, and duplex oligodeoxynucleotide contexts were monitored allowing mechanisms for product formation to be proposed. These data also provide a cautionary note to those who purify their oligonucleotide samples with ammonium salts before oxidation because this will lead to unwanted side reactions in which ammonia participates in product formation. PMID:25539403

  5. [Bacterial meningitis].

    PubMed

    Brouwer, M C; van de Beek, D

    2012-05-01

    Bacterial meningitis is a severe disease which affects 35.000 Europeans each year and has a mortality rate of about 20%. During the past 25 years the epidemiology of bacterial meningitis has changed significantly due to the implementation of vaccination against Haemophilus influenzae, Neisseria meningtidis group C and Streptococcus pneumoniae. Due to these vaccines, meningitis is now predominantly a disease occurring in adults, caused especially by Streptococcus pneumoniae, while it was formerly a child disease which was largely caused by Haemophilus influenzae. Bacterial meningitis is often difficult to recognize since the classical presentation with neck stiffness, reduced awareness and fever occurs in less than half of the patients. The only way to diagnose or exclude bacterial meningitis is by performing low-threshold cerebrospinal fluid examination with a suspicion of bacterial meningitis. The treatment consists of the prescription of antibiotics and dexamethasone.

  6. Antibody-Antigen-Adjuvant Conjugates Enable Co-Delivery of Antigen and Adjuvant to Dendritic Cells in Cis but Only Have Partial Targeting Specificity

    PubMed Central

    Abuknesha, Ram; Uematsu, Satoshi; Akira, Shizuo; Nestle, Frank O.; Diebold, Sandra S.

    2012-01-01

    Antibody-antigen conjugates, which promote antigen-presentation by dendritic cells (DC) by means of targeted delivery of antigen to particular DC subsets, represent a powerful vaccination approach. To ensure immunity rather than tolerance induction the co-administration of a suitable adjuvant is paramount. However, co-administration of unlinked adjuvant cannot ensure that all cells targeted by the antibody conjugates are appropriately activated. Furthermore, antigen-presenting cells (APC) that do not present the desired antigen are equally strongly activated and could prime undesired responses against self-antigens. We, therefore, were interested in exploring targeted co-delivery of antigen and adjuvant in cis in form of antibody-antigen-adjuvant conjugates for the induction of anti-tumour immunity. In this study, we report on the assembly and characterization of conjugates consisting of DEC205-specific antibody, the model antigen ovalbumin (OVA) and CpG oligodeoxynucleotides (ODN). We show that such conjugates are more potent at inducing cytotoxic T lymphocyte (CTL) responses than control conjugates mixed with soluble CpG. However, our study also reveals that the nucleic acid moiety of such antibody-antigen-adjuvant conjugates alters their binding and uptake and allows delivery of the antigen and the adjuvant to cells partially independently of DEC205. Nevertheless, antibody-antigen-adjuvant conjugates are superior to antibody-free antigen-adjuvant conjugates in priming CTL responses and efficiently induce anti-tumour immunity in the murine B16 pseudo-metastasis model. A better understanding of the role of the antibody moiety is required to inform future conjugate vaccination strategies for efficient induction of anti-tumour responses. PMID:22808118

  7. Identification of the physiological promoter for spinocerebellar ataxia 2 gene reveals a CpG island for promoter activity situated into the exon 1 of this gene and provides data about the origin of the nonmethylated state of these types of islands.

    PubMed

    Aguiar, J; Santurlidis, S; Nowok, J; Alexander, C; Rudnicki, D; Gispert, S; Schulz, W; Auburger, G

    1999-01-19

    In order to further use the spinocerebellar ataxia 2 (SCA2) promoter for transgenic mice models of "CAG repeat" neurodegeneration, different fragments of this 5' end were ligated into pGL3-Luc plasmid to obtain the better promoter-activity of the physiological promoter for SCA2. Base-par composition of the SCA2-5' region, and promoter prediction algorithms such as TSSW and TSSG, together with the high firefly luciferase expression after 48 hours of transient transfection in mammalian cells lines, showed a typical CpG island for promoter-activity. The promoter activity was specifically localized into the exon 1 of the SCA2 gene. The higher expression of firefly luciferase in the embryonal F9 cells by the use of SCA2 promoter, rather than by the use of CMV promoter may be related with the origin of the nonmethylated CpG island during the early embryogenesis. Analysis of the 5' region from HD gene revealed to a CpG island, which could be containing the physiological promoter for this gene. Copyright 1999 Academic Press.

  8. Immunostimulation of bronchoalveolar lavage cells from recurrent airway obstruction-affected horses by different CpG-classes bound to gelatin nanoparticles.

    PubMed

    Klier, John; May, Anna; Fuchs, Sebastian; Schillinger, Ulrike; Plank, Christian; Winter, Gerhard; Gehlen, Heidrun; Coester, Conrad

    2011-11-15

    Recurrent airway obstruction (RAO) in horses has become a common problem in stabled horses in industrialized countries and deserves new therapeutic strategies. CpG-oligodeoxynucleotides (CpG-ODNs) were developed as effective immunostimulating agents to induce a Th2/Th1 shift. These agents showed a beneficial therapeutic effect in allergic diseases with predominant Th2 immunoresponse. CpG-ODN delivery by gelatin nanoparticles (GNPs) resulted in enhanced cellular uptake in murine and human in vitro studies and was a starting point for the present trial. The aim of this study was to identify an optimal stimulating CpG motif in horses with regard to species specificity on equine bronchoalveolar lavage (BAL) cells, in terms of a possible specific immunomodulation effect (Th2/Th1 shift) by used CpG-ODN. Accordingly, GNPs were evaluated as a delivery system to improve CpG-ODN immunostimulation in equine BAL cells. BAL fluid (BALF) was obtained from seven horses with moderate RAO and from four healthy horses and was subsequently incubated with five different CpG-ODN sequences (from A-, B- and C-class) and one ODN without any CpG motif. Release of three key cytokines (IL-4, IL-10 and IFN-γ) was quantified by ELISA to detect an allergy mediated Th2 immunoresponse (IL-4) as well as a proinflammatory Th1 response (IFN-γ). Due to its specific anti-inflammatory and anti-allergic effects, IL-10 was considered as a beneficial agent in pathophysiology of RAO. Results showed a significant upregulation of IL-10 and IFN-γ on the one hand and a downregulation of IL-4 on the other hand in RAO affected horses. Cell cultures from healthy horses had a significantly stronger response in cytokine release to all the applied stimuli in contrast to RAO derived cells. Comparing all five CpG sequences, A-class 2216 significantly showed the highest immunomodulatory effects on equine BALF cells and, hence, was chosen for follow-up preliminary clinical studies. Copyright © 2011 Elsevier B.V. All

  9. Effect of Interleukins on Antibody Production by Epstein-Barr Virus Transformed B Cells.

    PubMed

    Ali, Aisheh I; Badran, Yousef R; Hassuneh, Mona R; Sanber, Khaled S; Ismail, Said I

    2015-06-01

    During the past few decades, monoclonal antibodies (MAbs) have become an increasingly used tool in diagnostics, therapeutics, and biomedical research. Several methods have been employed to produce MAbs, one of which is the immortalization of B cells by Epstein-Barr virus (EBV). Despite its simplicity, this procedure was never routinely adopted due to its poor efficiency and short-lived antibody (Ab) production. Various adjustments to the basic procedure were introduced, including the addition of certain cytokines and CpG oligodeoxynucleotides, which were shown to improve EBV infectivity and cloning efficiency. The objective of this study was to manipulate culture conditions of the EBV-transformed human lymphocytes, lymphoblastoid cell lines (LCLs), by the timely addition of stimuli including CpG and various interleukins. Such manipulations are aimed at improving LCL proliferative activity and enhancing the cell lines' immortalization potential as well as their Ab production. To accomplish this, IgG(+) B cells were isolated from peripheral blood of a hepatitis B vaccinated, anti-HB Ab-positive volunteer. These cells were infected with EBV and incubated in the presence of CpG DNA 2006 motifs, recombinant human interleukin-2 (rhIL-2), rhIL-4, rhIL-6, and rhIL-21, individually and in combinations. Cells were then restimulated for 2 weeks with the same ILs. The effect of these ILs on anti-HB Ab production and the proliferation of the EBV-transformed lymphocytes were investigated. The current study demonstrates that treatment of LCL cultures with rhIL-2, rh-IL4, rhIL-6, and rhIL-21, individually and in combination, increased to varying degrees the proliferative activity and Ab production of these cells. The addition of IL-4 alone was able to sustain increase in anti-HB Ab despite IL-4 withdrawal. This study suggests that with further optimization ILs can have an enhancing effect on LCL immortalization potential and Ab production capacity.

  10. CpG island methylation phenotype (CIMP) in oral cancer: associated with a marked inflammatory response and less aggressive tumour biology.

    PubMed

    Shaw, Richard J; Hall, Gillian L; Lowe, Derek; Bowers, Naomi L; Liloglou, Triantafillos; Field, John K; Woolgar, Julia A; Risk, Janet M

    2007-10-01

    Studies in several tumour sites highlight the significance of the CpG island methylation phenotype (CIMP), with distinct features of histology, biological aggression and outcome. We utilise pyrosequencing techniques of quantitative methylation analysis to investigate the presence of CIMP in oral squamous cell carcinoma (OSCC) for the first time, and evaluate its correlation with allelic imbalance, pathology and clinical behaviour. Tumour tissue, control tissue and PBLs were obtained from 74 patients with oral squamous cell carcinoma. Pyrosequencing was used to analyse methylation patterns in 75-200 bp regions of the CpG rich gene promoters of 10 genes with a broad range of cellular functions. Allelic imbalance was investigated using a multiplexed panel of 11 microsatellite markers. Corresponding variables, histopathological staging and grading were correlated with these genetic and epigenetic aberrations. A cluster of tumours with a greater degree of promoter methylation than would be predicted by chance alone (P=0.001) were designated CIMP+ve. This group had less aggressive tumour biology in terms of tumour thickness (p=0.015) and nodal metastasis (P=0.012), this being apparently independent of tumour diameter. Further, it seems that these CIMP+ve tumours excited a greater host inflammatory response (P=0.019). The exact mechanisms underlying CIMP remain obscure but the association with a greater inflammatory host response supports existing theories relating these features in other tumour sites. As CIMP has significant associations with other well documented prognostic indicators, it may prove beneficial to include methylation analyses in molecular risk modelling of tumours.

  11. Pan-cancer stratification of solid human epithelial tumors and cancer cell lines reveals commonalities and tissue-specific features of the CpG island methylator phenotype.

    PubMed

    Sánchez-Vega, Francisco; Gotea, Valer; Margolin, Gennady; Elnitski, Laura

    2015-01-01

    The term CpG island methylator phenotype (CIMP) has been used to describe widespread DNA hypermethylation at CpG-rich genomic regions affecting clinically distinct subsets of cancer patients. Even though there have been numerous studies of CIMP in individual cancer types, a uniform analysis across tissues is still lacking. We analyze genome-wide patterns of CpG island hypermethylation in 5,253 solid epithelial tumors from 15 cancer types from TCGA and 23 cancer cell lines from ENCODE. We identify differentially methylated loci that define CIMP+ and CIMP- samples, and we use unsupervised clustering to provide a robust molecular stratification of tumor methylomes for 12 cancer types and all cancer cell lines. With a minimal set of 89 discriminative loci, we demonstrate accurate pan-cancer separation of the 12 CIMP+/- subpopulations, based on their average levels of methylation. Tumor samples in different CIMP subclasses show distinctive correlations with gene expression profiles and recurrence of somatic mutations, copy number variations, and epigenetic silencing. Enrichment analyses indicate shared canonical pathways and upstream regulators for CIMP-targeted regions across cancer types. Furthermore, genomic alterations showing consistent associations with CIMP+/- status include genes involved in DNA repair, chromatin remodeling genes, and several histone methyltransferases. Associations of CIMP status with specific clinical features, including overall survival in several cancer types, highlight the importance of the CIMP+/- designation for individual tumor evaluation and personalized medicine. We present a comprehensive computational study of CIMP that reveals pan-cancer commonalities and tissue-specific differences underlying concurrent hypermethylation of CpG islands across tumors. Our stratification of solid tumors and cancer cell lines based on CIMP status is data-driven and agnostic to tumor type by design, which protects against known biases that have hindered

  12. DNA nanotechnology-based composite-type gold nanoparticle-immunostimulatory DNA hydrogel for tumor photothermal immunotherapy.

    PubMed

    Yata, Tomoya; Takahashi, Yuki; Tan, Mengmeng; Nakatsuji, Hirotaka; Ohtsuki, Shozo; Murakami, Tatsuya; Imahori, Hiroshi; Umeki, Yuka; Shiomi, Tomoki; Takakura, Yoshinobu; Nishikawa, Makiya

    2017-11-01

    Success of tumor photothermal immunotherapy requires a system that induces heat stress in cancer cells and enhances strong anti-tumor immune responses. Here, we designed a composite-type immunostimulatory DNA hydrogel consisting of a hexapod-like structured DNA (hexapodna) with CpG sequences and gold nanoparticles. Mixing of the properly designed hexapodna and oligodeoxynucleotide-modified gold nanoparticles resulted in the formation of composite-type gold nanoparticle-DNA hydrogels. Laser irradiation of the hydrogel resulted in the release of hexapodna, which efficiently stimulated immune cells to release proinflammatory cytokines. Then, EG7-OVA tumor-bearing mice received an intratumoral injection of a gold nanoparticle-DNA hydrogel, followed by laser irradiation at 780 nm. This treatment increased the local temperature and the mRNA expression of heat shock protein 70 in the tumor tissue, increased tumor-associated antigen-specific IgG levels in the serum, and induced tumor-associated antigen-specific interferon-γ production from splenocytes. Moreover, the treatment significantly retarded the tumor growth and extended the survival of the tumor-bearing mice. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Radiation and Anti-Cancer Vaccines: A Winning Combination.

    PubMed

    Cadena, Alexandra; Cushman, Taylor R; Anderson, Clark; Barsoumian, Hampartsoum B; Welsh, James W; Cortez, Maria Angelica

    2018-01-30

    The emerging combination of radiation therapy with vaccines is a promising new treatment plan in the fight against cancer. While many cancer vaccines such as MUC1, p53 CpG oligodeoxynucleotide, and SOX2 may be great candidates for antitumor vaccination, there still remain many investigations to be done into possible vaccine combinations. One fruitful partnership that has emerged are anti-tumor vaccines in combination with radiation. Radiation therapy was previously thought to be only a tool for directly or indirectly damaging DNA and therefore causing cancer cell death. Now, with much preclinical and clinical data, radiation has taken on the role of an in situ vaccine. With both cancer vaccines and radiation at our disposal, more and more studies are looking to combining vaccine types such as toll-like receptors, viral components, dendritic-cell-based, and subunit vaccines with radiation. While the outcomes of these combinatory efforts are promising, there is still much work to be covered. This review sheds light on the current state of affairs in cancer vaccines and how radiation will bring its story into the future.

  14. Suppression of wear particle induced pro-inflammatory cytokine and chemokine production in macrophages via NF-κB decoy oligodeoxynucleotide: A preliminary report

    PubMed Central

    Lin, Tzu-hua; Yao, Zhenyu; Sato, Taishi; Keeney, Michael; Li, Chenguang; Pajarinen, Jukka; Yang, Fan; Egashira, Kensuke; Goodman, Stuart B.

    2014-01-01

    Total joint replacement (TJR) is a very cost-effective surgery for end-stage arthritis. One important goal is to decrease the revision rate especially because TJR has been extended to younger patients. Continuous production of ultra-high molecular weight polyethylene (UHMWPE) wear particles induces macrophage infiltration and chronic inflammation, which can lead to peri-prosthetic osteolysis. Targeting individual pro-inflammatory cytokines directly has not reversed the osteolytic process in clinical trials, due to compensatory upregulation of other pro-inflammatory factors. We hypothesized that targeting the important transcription factor NF-κB could mitigate the inflammatory response to wear particles, potentially diminishing osteolysis. In the current study, we suppressed NF-κB activity in mouse RAW264.7 and human THP1 macrophage cell lines, as well as primary mouse and human macrophages, via competitive binding with double strand decoy oligodeoxynucleotide (ODN) containing an NF-κB binding element. We found that macrophage exposure to UHMWPE particles induced multiple pro-inflammatory cytokine and chemokine expression including TNF-α, MCP1, MIP1α and others. Importantly, the decoy ODN significantly suppressed the induced cytokine and chemokine expression in both murine and human macrophages, and resulted in suppression of macrophage recruitment. The strategic use of decoy NF-κB ODN, delivered locally, could potentially diminish particle-induced peri-prosthetic osteolysis. PMID:24814879

  15. Association of the colorectal CpG island methylator phenotype with molecular features, risk factors, and family history.

    PubMed

    Weisenberger, Daniel J; Levine, A Joan; Long, Tiffany I; Buchanan, Daniel D; Walters, Rhiannon; Clendenning, Mark; Rosty, Christophe; Joshi, Amit D; Stern, Mariana C; LeMarchand, Loic; Lindor, Noralane M; Daftary, Darshana; Gallinger, Steven; Selander, Teresa; Bapat, Bharati; Newcomb, Polly A; Campbell, Peter T; Casey, Graham; Ahnen, Dennis J; Baron, John A; Haile, Robert W; Hopper, John L; Young, Joanne P; Laird, Peter W; Siegmund, Kimberly D

    2015-03-01

    The CpG island methylator phenotype (CIMP) represents a subset of colorectal cancers characterized by widespread aberrant DNA hypermethylation at select CpG islands. The risk factors and environmental exposures contributing to etiologic heterogeneity between CIMP and non-CIMP tumors are not known. We measured the CIMP status of 3,119 primary population-based colorectal cancer tumors from the multinational Colon Cancer Family Registry. Etiologic heterogeneity was assessed by a case-case study comparing risk factor frequency of colorectal cancer cases with CIMP and non-CIMP tumors using logistic regression to estimate the case-case odds ratio (ccOR). We found associations between tumor CIMP status and MSI-H (ccOR = 7.6), BRAF V600E mutation (ccOR = 59.8), proximal tumor site (ccOR = 9; all P < 0.0001), female sex [ccOR = 1.8; 95% confidence interval (CI), 1.5-2.1], older age (ccOR = 4.0 comparing over 70 years vs. under 50; 95% CI, 3.0-5.5), and family history of CRC (ccOR = 0.6; 95% CI, 0.5-0.7). While use of NSAIDs varied by tumor CIMP status for both males and females (P = 0.0001 and P = 0.02, respectively), use of multivitamin or calcium supplements did not. Only for female colorectal cancer was CIMP status associated with increased pack-years of smoking (Ptrend < 0.001) and body mass index (BMI; Ptrend = 0.03). The frequency of several colorectal cancer risk factors varied by CIMP status, and the associations of smoking and obesity with tumor subtype were evident only for females. Differences in the associations of a unique DNA methylation-based subgroup of colorectal cancer with important lifestyle and environmental exposures increase understanding of the molecular pathologic epidemiology of this heavily methylated subset of colorectal cancer. Cancer Epidemiol Biomarkers Prev; 24(3); 512-9. ©2015 AACR. ©2015 American Association for Cancer Research.

  16. Orthopaedic wear particle-induced bone loss and exogenous macrophage infiltration is mitigated by local infusion of NF-κB decoy oligodeoxynucleotide.

    PubMed

    Lin, Tzuhua; Pajarinen, Jukka; Nabeshima, Akira; Córdova, Luis A; Loi, Florence; Gibon, Emmanuel; Lu, Laura; Nathan, Karthik; Jämsen, Eemeli; Yao, Zhenyu; Goodman, Stuart B

    2017-11-01

    Excessive production of wear particles from total joint replacements induces chronic inflammation, macrophage infiltration, and consequent bone loss (periprosthetic osteolysis). This inflammation and bone remodeling are critically regulated by the transcription factor NF-κB. We previously demonstrated that inhibition of NF-κB signaling by using the decoy oligodeoxynucleotide (ODN) mitigates polyethylene wear particle-induced bone loss using in vitro and in vivo models. However, the mechanisms of NF-κB decoy ODN action, and in particular its impact on systemic macrophage recruitment, remain unknown. In the current study, this systemic macrophage infiltration was examined in our established murine femoral continuous particle infusion model. RAW264.7 murine macrophages expressing a luciferase reporter gene were injected into the systemic circulation. Quantification of bioluminescence showed that NF-κB decoy ODN reduced the homing of these reporter macrophages into the distal femurs exposed to continuous particle delivery. Particle-induced reduction in bone mineral density at the distal diaphysis of the femur was also mitigated by infusion of decoy ODN. Histological staining showed that the decoy ODN infusion decreased osteoclast and macrophage numbers, but had no significant effects on osteoblasts. Local infusion of NF-κB decoy ODN reduced systemic macrophage infiltration and mitigated particle-induced bone loss, thus providing a potential strategy to treat periprosthetic osteolysis. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 3169-3175, 2017. © 2017 Wiley Periodicals, Inc.

  17. Environment, diet and CpG island methylation: epigenetic signals in gastrointestinal neoplasia.

    PubMed

    Johnson, Ian T; Belshaw, Nigel J

    2008-04-01

    The epithelial surfaces of the mammalian alimentary tract are characterised by very high rates of cell proliferation and DNA synthesis, and in humans they are highly susceptible to cancer. The role of somatic mutations as drivers of carcinogenesis in the alimentary tract is well established, but the importance of gene silencing by epigenetic mechanisms is increasingly recognised. Methylation of CpG islands is an important component of the epigenetic code that regulates gene expression during development and normal cellular differentiation, and a number of genes are well known to become abnormally methylated during the development of tumours of the oesophagus, stomach and colorectum. Aberrant patterns of DNA methylation develop as a result of pathological processes such as chronic inflammation, and in response to various dietary factors, including imbalances in the supply of methyl donors, particularly folates, and exposure to DNA methyltransferase inhibitors, which include polyphenols and possibly isothiocyanates from plant foods. However the importance of these environmental interactions in human health and disease remains to be established. Recent moves to modify the exposure of human populations to folate, by mandatory supplementation of cereal foods, emphasise the importance of understanding the susceptibility of the human epigenome to dietary and other environmental effects.

  18. Regulation of a mammalian gene bearing a CpG island promoter and a distal enhancer.

    PubMed

    Berrozpe, Georgina; Bryant, Gene O; Warpinski, Katherine; Ptashne, Mark

    2013-08-15

    A quantitative nucleosome occupancy assay revealed rules for nucleosome disposition in yeast and showed how disposition affects regulation of the GAL genes. Here, we show how those findings apply to the control of Kit, a mammalian gene. The Kit promoter lies in a CpG island, and its enhancer (active in mast cells) lies some 150 kb upstream. Nucleosomes form with especially high avidities at the Kit promoter, a reaction that, we surmise, ensures extremely low basal expression. In mast cells, transcriptional activators displace nucleosomes that are less tightly formed at the Kit enhancer. In turn, the active enhancer replaces a single Kit promoter nucleosome with the transcriptional machinery, thereby inducing transcription over 1,000-fold. As at the yeast GAL genes, the inhibitory effects of nucleosomes facilitate high factors of induction by mammalian activators working in the absence of specific repressors. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Bacterial meningitis.

    PubMed

    Heckenberg, Sebastiaan G B; Brouwer, Matthijs C; van de Beek, Diederik

    2014-01-01

    Bacterial meningitis is a neurologic emergency. Vaccination against common pathogens has decreased the burden of disease. Early diagnosis and rapid initiation of empiric antimicrobial and adjunctive therapy are vital. Therapy should be initiated as soon as blood cultures have been obtained, preceding any imaging studies. Clinical signs suggestive of bacterial meningitis include fever, headache, meningismus, and an altered level of consciousness but signs may be scarce in children, in the elderly, and in meningococcal disease. Host genetic factors are major determinants of susceptibility to meningococcal and pneumococcal disease. Dexamethasone therapy has been implemented as adjunctive treatment of adults with pneumococcal meningitis. Adequate and prompt treatment of bacterial meningitis is critical to outcome. In this chapter we review the epidemiology, pathophysiology, and management of bacterial meningitis. © 2014 Elsevier B.V. All rights reserved.

  20. Poly(U) and CpG ameliorate the unbalanced T cell immunity and pneumonia of mice with RSV vaccine-enhanced disease.

    PubMed

    Jia, Ran; Lu, Lu; Liang, Xiaozhen; Sun, Zhiwu; Tan, Lingbing; Xu, Menghua; Su, Liyun; Xu, Jin

    2017-09-12

    Respiratory Syncycial Virus (RSV) is the most important pathogen responsible for children's severe lower respiratory tract infection. So far no RSV vaccine has yet been authorized for clinical use. The main impediment that blocked development of RSV vaccine is that inactivated RSV vaccine could cause RSV vaccine-enhanced disease (RVED). The mechanism of RVED remains unclear. Recently some researchers found that insufficient activation of innate immunity, including Toll-like receptors (TLRs), might be associated with the onset of RVED. Based on the above findings, this research was conducted to further study the mechanism of RVED. We first vaccinated mice with formalin-inactivated RSV vaccine (FIRSV) and then exposed them to RSV to establish a RVED mouse model. Consequently, we found that mice previously inoculated with FIRSV showed obvious weight loss and extensive pneumonia, as well as T helper 2 cells (Th2)-biased immunity and suppressed CD8 + T cell immunity after viral exposure, suggesting that we have successfully established a RVED mouse model. Then based on this model, we further added Poly(U) (TLR7/8 agonist) and CpG (TLR9 agonist) in FIRSV to see if RVED could be ameliorated. As a result, mice inoculated with FIRSV supplemented with Poly(U) and CpG had a much relieved weight loss and pneumonia, as well as suppressed Th2-biased immunity and strengthened CD8 + T cell function. Thus, the insufficient stimulation of TLR7/8 and (or) TLR9 might play a role in the development of RVED, which could provide evidence for using TLR agonists as vaccine adjuvants to confer a protective immune response against RSV.

  1. Anxiety Associated Increased CpG Methylation in the Promoter of Asb1: A Translational Approach Evidenced by Epidemiological and Clinical Studies and a Murine Model.

    PubMed

    Emeny, Rebecca T; Baumert, Jens; Zannas, Anthony S; Kunze, Sonja; Wahl, Simone; Iurato, Stella; Arloth, Janine; Erhardt, Angelika; Balsevich, Georgia; Schmidt, Mathias V; Weber, Peter; Kretschmer, Anja; Pfeiffer, Liliane; Kruse, Johannes; Strauch, Konstantin; Roden, Michael; Herder, Christian; Koenig, Wolfgang; Gieger, Christian; Waldenberger, Melanie; Peters, Annette; Binder, Elisabeth B; Ladwig, Karl-Heinz

    2018-01-01

    Epigenetic regulation in anxiety is suggested, but evidence from large studies is needed. We conducted an epigenome-wide association study (EWAS) on anxiety in a population-based cohort and validated our finding in a clinical cohort as well as a murine model. In the KORA cohort, participants (n=1522, age 32-72 years) were administered the Generalized Anxiety Disorder (GAD-7) instrument, whole blood DNA methylation was measured (Illumina 450K BeadChip), and circulating levels of hs-CRP and IL-18 were assessed in the association between anxiety and methylation. DNA methylation was measured using the same instrument in a study of patients with anxiety disorders recruited at the Max Planck Institute of Psychiatry (MPIP, 131 non-medicated cases and 169 controls). To expand our mechanistic understanding, these findings were reverse translated in a mouse model of acute social defeat stress. In the KORA study, participants were classified according to mild, moderate, or severe levels of anxiety (29.4%/6.0%/1.5%, respectively). Severe anxiety was associated with 48.5% increased methylation at a single CpG site (cg12701571) located in the promoter of the gene encoding Asb1 (β-coefficient=0.56 standard error (SE)=0.10, p (Bonferroni)=0.005), a protein hypothetically involved in regulation of cytokine signaling. An interaction between IL-18 and severe anxiety with methylation of this CpG cite showed a tendency towards significance in the total population (p=0.083) and a significant interaction among women (p=0.014). Methylation of the same CpG was positively associated with Panic and Agoraphobia scale (PAS) scores (β=0.005, SE=0.002, p=0.021, n=131) among cases in the MPIP study. In a murine model of acute social defeat stress, Asb1 gene expression was significantly upregulated in a tissue-specific manner (p=0.006), which correlated with upregulation of the neuroimmunomodulating cytokine interleukin 1 beta. Our findings suggest epigenetic regulation of the stress

  2. Anxiety Associated Increased CpG Methylation in the Promoter of Asb1: A Translational Approach Evidenced by Epidemiological and Clinical Studies and a Murine Model

    PubMed Central

    Emeny, Rebecca T; Baumert, Jens; Zannas, Anthony S; Kunze, Sonja; Wahl, Simone; Iurato, Stella; Arloth, Janine; Erhardt, Angelika; Balsevich, Georgia; Schmidt, Mathias V; Weber, Peter; Kretschmer, Anja; Pfeiffer, Liliane; Kruse, Johannes; Strauch, Konstantin; Roden, Michael; Herder, Christian; Koenig, Wolfgang; Gieger, Christian; Waldenberger, Melanie; Peters, Annette; Binder, Elisabeth B; Ladwig, Karl-Heinz

    2018-01-01

    Epigenetic regulation in anxiety is suggested, but evidence from large studies is needed. We conducted an epigenome-wide association study (EWAS) on anxiety in a population-based cohort and validated our finding in a clinical cohort as well as a murine model. In the KORA cohort, participants (n=1522, age 32–72 years) were administered the Generalized Anxiety Disorder (GAD-7) instrument, whole blood DNA methylation was measured (Illumina 450K BeadChip), and circulating levels of hs-CRP and IL-18 were assessed in the association between anxiety and methylation. DNA methylation was measured using the same instrument in a study of patients with anxiety disorders recruited at the Max Planck Institute of Psychiatry (MPIP, 131 non-medicated cases and 169 controls). To expand our mechanistic understanding, these findings were reverse translated in a mouse model of acute social defeat stress. In the KORA study, participants were classified according to mild, moderate, or severe levels of anxiety (29.4%/6.0%/1.5%, respectively). Severe anxiety was associated with 48.5% increased methylation at a single CpG site (cg12701571) located in the promoter of the gene encoding Asb1 (β-coefficient=0.56 standard error (SE)=0.10, p (Bonferroni)=0.005), a protein hypothetically involved in regulation of cytokine signaling. An interaction between IL-18 and severe anxiety with methylation of this CpG cite showed a tendency towards significance in the total population (p=0.083) and a significant interaction among women (p=0.014). Methylation of the same CpG was positively associated with Panic and Agoraphobia scale (PAS) scores (β=0.005, SE=0.002, p=0.021, n=131) among cases in the MPIP study. In a murine model of acute social defeat stress, Asb1 gene expression was significantly upregulated in a tissue-specific manner (p=0.006), which correlated with upregulation of the neuroimmunomodulating cytokine interleukin 1 beta. Our findings suggest epigenetic regulation of the stress

  3. Radiolabelling of glycosylated MFE-23::CPG2 fusion protein (MFECP1) with 99mTc for quantitation of tumour antibody-enzyme localisation in antibody-directed enzyme pro-drug therapy (ADEPT).

    PubMed

    Francis, R J; Mather, S J; Chester, K; Sharma, S K; Bhatia, J; Pedley, R B; Waibel, R; Green, A J; Begent, R H J

    2004-08-01

    MFECP1 is a glycosylated recombinant fusion protein composed of MFE-23, a high-affinity anti-carcinoembryonic antigen (CEA) single chain Fv (scFv), fused to the enzyme carboxypeptidase G2 (CPG2), and has been constructed for use in antibody-directed enzyme pro-drug therapy (ADEPT). Radiolabelling of glycosylated MFECP1 with technetium-99m was developed for the purpose of determining tumour localisation of MFECP1 in a phase I ADEPT clinical study. The method used was 99mTc-carbonyl [99mTc(H2O)3(CO)3]+ (abbreviated to TcCO) mediated labelling of 99mTc to the hexahistidine (His) tag of MFECP1. MFECP1 fusion protein was labelled with TcCO under a variety of conditions, and this was shown to be a relatively simple and robust method. Tissue biodistribution was assessed in a CEA-expressing LS174T (human colon carcinoma) nude mouse xenograft model. Tissues were taken at 1, 4 and 6 h for assessment of distribution of radioactivity and for measurement of CPG2 enzyme levels. The amount of radioactivity retained by the tumour proved to be an accurate estimation of actual measured enzyme activity, indicating that this radiolabelling method does not appear to damage the antibody-antigen binding or the enzyme activity of MFECP1. However, correlation between CPG2 enzyme activity and measured radioactivity in liver, spleen and kidney was poor, indicating retention of radioactivity in non-tumour sites but loss of enzyme activity. The high retention of technetium radioisotope in normal tissues may limit the clinical applicability of this radiolabelling method for MFECP1; however, these results suggest that this technique does have applicability for measuring the biodistribution of His-tagged recombinant proteins.

  4. Poly-L-arginine synergizes with oligodeoxynucleotides containing CpG-motifs (CpG-ODN) for enhanced and prolonged immune responses and prevents the CpG-ODN-induced systemic release of pro-inflammatory cytokines.

    PubMed

    Lingnau, Karen; Egyed, Alena; Schellack, Carola; Mattner, Frank; Buschle, Michael; Schmidt, Walter

    2002-10-04

    This study describes an entirely synthetic vaccine composed of antigenic peptides (T cell epitopes), oligodeoxynucleotides containing CpG-motifs (CpG-ODN) and poly-L-arginine (pR). CpG-ODN are known to be potent inducers of predominantly type 1-like immune responses, while polycationic amino acids, like pR, facilitate the uptake of antigens into antigen presenting cells (APCs). We demonstrate that the application of peptides and pR/CpG-ODN results in strongly enhanced peptide-specific immune responses as compared to the application of peptides with either of the immunomodulators alone. High numbers of antigen-specific T cells can be observed even after only one injection of the vaccine for a remarkably long period of time (at least 372 days). Furthermore, the potentially harmful systemic release of pro-inflammatory cytokines induced upon injection of CpG-ODN is inhibited. Thus, the combined application of CpG-ODN and pR may represent a novel vaccine strategy in humans.

  5. Development of TRAIL Resistance by Radiation-Induced Hypermethylation of DR4 CpG Island in Recurrent Laryngeal Squamous Cell Carcinoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Jong Cheol; Department of Biomedical Research Center, Ulsan University Hospital, University of Ulsan College of Medicine, Ulsan; Lee, Won Hyeok

    2014-04-01

    Purpose: There are limited therapeutic options for patients with recurrent head and neck cancer after radiation therapy failure. To assess the use of tumor necrosis factor–related apoptosis-inducing ligand (TRAIL) as a salvage chemotherapeutic agent for recurrent cancer after radiation failure, we investigated the effect of clinically relevant cumulative irradiation on TRAIL-induced apoptosis. Methods and Materials: Using a previously established HN3 cell line from a laryngeal carcinoma patient, we generated a chronically irradiated HN3R isogenic cell line. Viability and apoptosis in HN3 and HN3R cells treated with TRAIL were analyzed with MTS and PI/annexin V-FITC assays. Western blotting and flow cytometry weremore » used to determine the underlying mechanism of TRAIL resistance. DR4 expression was semiquantitatively scored in a tissue microarray with 107 laryngeal cancer specimens. Methylation-specific polymerase chain reaction and bisulfite sequencing for DR4 were performed for genomic DNA isolated from each cell line. Results: HN3R cells were more resistant than HN3 cells to TRAIL-induced apoptosis because of significantly reduced levels of the DR4 receptor. The DR4 staining score in 37 salvage surgical specimens after radiation failure was lower in 70 surgical specimens without radiation treatment (3.03 ± 2.75 vs 5.46 ± 3.30, respectively; P<.001). HN3R cells had a methylated DR4 CpG island that was partially demethylated by the DNA demethylating agent 5-aza-2′-deoxycytidine. Conclusion: Epigenetic silencing of the TRAIL receptor by hypermethylation of a DR4 CpG island might be an underlying mechanism for TRAIL resistance in recurrent laryngeal carcinoma treated with radiation.« less

  6. In vitro CpG methylation increases the transformation efficiency of Borrelia burgdorferi strains harboring the endogenous linear plasmid lp56.

    PubMed

    Chen, Qiang; Fischer, Joshua R; Benoit, Vivian M; Dufour, Nicholas P; Youderian, Philip; Leong, John M

    2008-12-01

    Borrelia burgdorferi is the causative agent of Lyme disease, the most common vector-borne illness in the Northern hemisphere. Low-passage-number infectious strains of B. burgdorferi exhibit extremely low transformation efficiencies-so low, in fact, as to hinder the genetic study of putative virulence factors. Two putative restriction-modification (R-M) systems, BBE02 contained on linear plasmid 25 (lp25) and BBQ67 contained on lp56, have been postulated to contribute to this poor transformability. Restriction barriers posed by other bacteria have been overcome by the in vitro methylation of DNA prior to transformation. To test whether a methylation-sensitive restriction system contributes to poor B. burgdorferi transformability, shuttle plasmids were treated with the CpG methylase M.SssI prior to the electroporation of a variety of strains harboring different putative R-M systems. We found that for B. burgdorferi strains that harbor lp56, in vitro methylation increased transformation by at least 1 order of magnitude. These results suggest that in vitro CpG methylation protects exogenous DNA from degradation by an lp56-contained R-M system, presumably BBQ67. The utility of in vitro methylation for the genetic manipulation of B. burgdorferi was exemplified by the ease of plasmid complementation of a B. burgdorferi B31 A3 BBK32 kanamycin-resistant (B31 A3 BBK32::Kan(r)) mutant, deficient in the expression of the fibronectin- and glycosaminoglycan (GAG)-binding adhesin BBK32. Consistent with the observation that several surface proteins may promote GAG binding, the B. burgdorferi B31 A3 BBK32::Kan(r) mutant demonstrated no defect in the ability to bind purified GAGs or GAGs expressed on the surfaces of cultured cells.

  7. A recombinant plasmid containing CpG motifs as a novel vaccine adjuvant for immune protection against herpes simplex virus 2.

    PubMed

    He, Zhuojing; Xu, Juan; Tao, Wei; Fu, Ting; He, Fang; Hu, Ruxi; Jia, Lan; Hong, Yan

    2016-08-01

    The aim of the present study was to evaluate the efficacy of a herpes simplex virus type 2 (HSV-2) DNA vaccine co‑immunized with a plasmid adjuvant containing CpG motifs. A novel eukaryotic expression plasmid vector containing kanamycin resistance gene (pcDNA3Kan) was acquired from pET‑28a(+) and pcDNA3 plasmids. A gene encoding full length HSV‑2 glycoprotein D (gD) was amplified from the pcDNA3‑gD plasmid, which was cloned into pcDNA3Kan resulting in the construction of the recombinant plasmid pcDNA3Kan‑gD (pgD). A DNA segment containing 8 CpG motifs was synthesized, and cloned into pcDNA3Kan, resulting in the recombinant plasmid pcDNA3Kan‑CpG (pCpG). Mice were co‑inoculated with pgD (used as a DNA vaccine) and pCpG (used as an adjuvant) by bilateral intramuscular injection. Mice inoculated with pgD+pCpG showed higher titers of antibodies than those inoculated with the DNA vaccine alone (P<0.05). In addition, mice inoculated with pgD+pCpG showed the highest percentage of CD4+ T cells in the blood of all the groups (P﹤0.05). Thus, the present study demonstrated that pCpG could stimulate the HSV‑2 DNA vaccine to induce a stronger cell‑mediated immune response than the DNA vaccine alone. The aim of the present study was to evaluate the efficacy of a HSV‑2 DNA vaccine (pgD) co‑immunized with a plasmid adjuvant containing CpG motifs (pCpG). Whether the pCpG would be able to stimulate the pgD to induce a stronger immune response compared with pgD alone.

  8. Glioma CpG island methylator phenotype (G-CIMP): biological and clinical implications.

    PubMed

    Malta, Tathiane M; de Souza, Camila F; Sabedot, Thais S; Silva, Tiago C; Mosella, Maritza S; Kalkanis, Steven N; Snyder, James; Castro, Ana Valeria B; Noushmehr, Houtan

    2018-04-09

    Gliomas are a heterogeneous group of brain tumors with distinct biological and clinical properties. Despite advances in surgical techniques and clinical regimens, treatment of high-grade glioma remains challenging and carries dismal rates of therapeutic success and overall survival. Challenges include the molecular complexity of gliomas, as well as inconsistencies in histopathological grading, resulting in an inaccurate prediction of disease progression and failure in the use of standard therapy. The updated 2016 World Health Organization (WHO) classification of tumors of the central nervous system reflects a refinement of tumor diagnostics by integrating the genotypic and phenotypic features, thereby narrowing the defined subgroups. The new classification recommends molecular diagnosis of isocitrate dehydrogenase (IDH) mutational status in gliomas. IDH-mutant gliomas manifest the cytosine-phosphate-guanine (CpG) island methylator phenotype (G-CIMP). Notably, the recent identification of clinically relevant subsets of G-CIMP tumors (G-CIMP-high and G-CIMP-low) provides a further refinement in glioma classification that is independent of grade and histology. This scheme may be useful for predicting patient outcome and may be translated into effective therapeutic strategies tailored to each patient. In this review, we highlight the evolution of our understanding of the G-CIMP subsets and how recent advances in characterizing the genome and epigenome of gliomas may influence future basic and translational research.

  9. Structural differences in the bacterial flagellar motor among bacterial species.

    PubMed

    Terashima, Hiroyuki; Kawamoto, Akihiro; Morimoto, Yusuke V; Imada, Katsumi; Minamino, Tohru

    2017-01-01

    The bacterial flagellum is a supramolecular motility machine consisting of the basal body as a rotary motor, the hook as a universal joint, and the filament as a helical propeller. Intact structures of the bacterial flagella have been observed for different bacterial species by electron cryotomography and subtomogram averaging. The core structures of the basal body consisting of the C ring, the MS ring, the rod and the protein export apparatus, and their organization are well conserved, but novel and divergent structures have also been visualized to surround the conserved structure of the basal body. This suggests that the flagellar motors have adapted to function in various environments where bacteria live and survive. In this review, we will summarize our current findings on the divergent structures of the bacterial flagellar motor.

  10. CpG Methylation Analysis of HPV16 in Laser Capture Microdissected Archival Tissue and Whole Tissue Sections from High Grade Anal Squamous Intraepithelial Lesions: A Potential Disease Biomarker

    PubMed Central

    Molano, Monica; Tabrizi, Sepehr N.; Garland, Suzanne M.; Roberts, Jennifer M.; Machalek, Dorothy A.; Phillips, Samuel; Chandler, David; Hillman, Richard J.; Grulich, Andrew E.; Jin, Fengyi; Poynten, I. Mary; Templeton, David J.; Cornall, Alyssa M.

    2016-01-01

    Incidence and mortality rates of anal cancer are increasing globally. More than 90% of anal squamous cell carcinomas (ASCC) are associated with human papillomavirus (HPV). Studies on HPV-related anogenital lesions have shown that patterns of methylation of viral and cellular DNA targets could potentially be developed as disease biomarkers. Lesion-specific DNA isolated from formalin-fixed paraffin-embedded (FFPE) tissues from existing or prospective patient cohorts may constitute a valuable resource for methylation analysis. However, low concentrations of DNA make these samples technically challenging to analyse using existing methods. We therefore set out to develop a sensitive and reproducible nested PCR-pyrosequencing based method to accurately quantify methylation at 10 CpG sites within the E2BS1, E2BS2,3,4 and Sp1 binding sites in the viral upstream regulatory region of HPV16 genome. Methylation analyses using primary and nested PCR-pyrosequencing on 52 FFPE tissue [26 paired whole tissue sections (WTS) and laser capture microdissected (LCM) tissues] from patients with anal squamous intraepithelial lesions was performed. Using nested PCR, methylation results were obtained for the E2BS1, E2BS2,3,4 and Sp1 binding sites in 86.4% of the WTS and 81.8% of the LCM samples. Methylation patterns were strongly correlated within median values of matched pairs of WTS and LCM sections, but overall methylation was higher in LCM samples at different CpG sites. High grade lesions showed low methylation levels in the E2BS1 and E2BS2 regions, with increased methylation detected in the E2BS,3,4/Sp1 regions, showing the highest methylation at CpG site 37. The method developed is highly sensitive in samples with low amounts of DNA and demonstrated to be suitable for archival samples. Our data shows a possible role of specific methylation in the HPV16 URR for detection of HSIL. PMID:27529629

  11. CpG Methylation Analysis of HPV16 in Laser Capture Microdissected Archival Tissue and Whole Tissue Sections from High Grade Anal Squamous Intraepithelial Lesions: A Potential Disease Biomarker.

    PubMed

    Molano, Monica; Tabrizi, Sepehr N; Garland, Suzanne M; Roberts, Jennifer M; Machalek, Dorothy A; Phillips, Samuel; Chandler, David; Hillman, Richard J; Grulich, Andrew E; Jin, Fengyi; Poynten, I Mary; Templeton, David J; Cornall, Alyssa M

    2016-01-01

    Incidence and mortality rates of anal cancer are increasing globally. More than 90% of anal squamous cell carcinomas (ASCC) are associated with human papillomavirus (HPV). Studies on HPV-related anogenital lesions have shown that patterns of methylation of viral and cellular DNA targets could potentially be developed as disease biomarkers. Lesion-specific DNA isolated from formalin-fixed paraffin-embedded (FFPE) tissues from existing or prospective patient cohorts may constitute a valuable resource for methylation analysis. However, low concentrations of DNA make these samples technically challenging to analyse using existing methods. We therefore set out to develop a sensitive and reproducible nested PCR-pyrosequencing based method to accurately quantify methylation at 10 CpG sites within the E2BS1, E2BS2,3,4 and Sp1 binding sites in the viral upstream regulatory region of HPV16 genome. Methylation analyses using primary and nested PCR-pyrosequencing on 52 FFPE tissue [26 paired whole tissue sections (WTS) and laser capture microdissected (LCM) tissues] from patients with anal squamous intraepithelial lesions was performed. Using nested PCR, methylation results were obtained for the E2BS1, E2BS2,3,4 and Sp1 binding sites in 86.4% of the WTS and 81.8% of the LCM samples. Methylation patterns were strongly correlated within median values of matched pairs of WTS and LCM sections, but overall methylation was higher in LCM samples at different CpG sites. High grade lesions showed low methylation levels in the E2BS1 and E2BS2 regions, with increased methylation detected in the E2BS,3,4/Sp1 regions, showing the highest methylation at CpG site 37. The method developed is highly sensitive in samples with low amounts of DNA and demonstrated to be suitable for archival samples. Our data shows a possible role of specific methylation in the HPV16 URR for detection of HSIL.

  12. Bacterial mycophagy: definition and diagnosis of a unique bacterial-fungal interaction.

    PubMed

    Leveau, Johan H J; Preston, Gail M

    2008-01-01

    This review analyses the phenomenon of bacterial mycophagy, which we define as a set of phenotypic behaviours that enable bacteria to obtain nutrients from living fungi and thus allow the conversion of fungal into bacterial biomass. We recognize three types of bacterial strategies to derive nutrition from fungi: necrotrophy, extracellular biotrophy and endocellular biotrophy. Each is characterized by a set of uniquely sequential and differently overlapping interactions with the fungal target. We offer a detailed analysis of the nature of these interactions, as well as a comprehensive overview of methodologies for assessing and quantifying their individual contributions to the mycophagy phenotype. Furthermore, we discuss future prospects for the study and exploitation of bacterial mycophagy, including the need for appropriate tools to detect bacterial mycophagy in situ in order to be able to understand, predict and possibly manipulate the way in which mycophagous bacteria affect fungal activity, turnover, and community structure in soils and other ecosystems.

  13. Genome-wide CpG island methylation and intergenic demethylation propensities vary among different tumor sites.

    PubMed

    Lee, Seung-Tae; Wiemels, Joseph L

    2016-02-18

    The epigenetic landscape of cancer includes both focal hypermethylation and broader hypomethylation in a genome-wide manner. By means of a comprehensive genomic analysis on 6637 tissues of 21 tumor types, we here show that the degrees of overall methylation in CpG island (CGI) and demethylation in intergenic regions, defined as 'backbone', largely vary among different tumors. Depending on tumor type, both CGI methylation and backbone demethylation are often associated with clinical, epidemiological and biological features such as age, sex, smoking history, anatomic location, histological type and grade, stage, molecular subtype and biological pathways. We found connections between CGI methylation and hypermutability, microsatellite instability, IDH1 mutation, 19p gain and polycomb features, and backbone demethylation with chromosomal instability, NSD1 and TP53 mutations, 5q and 19p loss and long repressive domains. These broad epigenetic patterns add a new dimension to our understanding of tumor biology and its clinical implications. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Cellular damage in bacterial meningitis: an interplay of bacterial and host driven toxicity.

    PubMed

    Weber, Joerg R; Tuomanen, Elaine I

    2007-03-01

    Bacterial meningitis is still an important infectious disease causing death and disability. Invasive bacterial infections of the CNS generate some of the most powerful inflammatory responses known in medicine. Although the components of bacterial cell surfaces are now chemically defined in exquisite detail and the interaction with several receptor pathways has been discovered, it is only very recently that studies combining these advanced biochemical and cell biological tools have been done. Additional to the immunological response direct bacterial toxicity has been identified as an important contributor to neuronal damage. A detailed understanding of the complex interaction of bacterial toxicity and host response may generate opportunities for innovative and specific neuroprotective therapies.

  15. CpG island methylator phenotype and its association with malignancy in sporadic duodenal adenomas.

    PubMed

    Sun, Lifeng; Guzzetta, Angela A; Fu, Tao; Chen, Jinming; Jeschke, Jana; Kwak, Ruby; Vatapalli, Rajita; Baylin, Stephen B; Iacobuzio-Donahue, Christine A; Wolfgang, Christopher L; Ahuja, Nita

    2014-05-01

    CpG island methylator phenotype (CIMP) has been found in multiple precancerous and cancerous lesions, including colorectal adenomas, colorectal cancers, and duodenal adenocarcinomas. There are no reports in the literature of a relationship between CIMP status and clinicopathologic features of sporadic duodenal adenomas. This study sought to elucidate the role of methylation in duodenal adenomas and correlate it with KRAS and BRAF mutations. CIMP+ (with more than 2 markers methylated) was seen in 33.3% of duodenal adenomas; 61% of these CIMP+ adenomas were CIMP-high (with more than 3 markers methylated). Furthermore, CIMP+ status significantly correlated with older age of patients, larger size and villous type of tumor, coexistent dysplasia and periampullary location. MLH1 methylation was seen in 11.1% of duodenal adenomas and was significantly associated with CIMP+ tumors, while p16 methylation was an infrequent event. KRAS mutations were frequent and seen in 26.3% of adenomas; however, no BRAF mutations were detected. Furthermore, CIMP-high status was associated with larger size and villous type of tumor and race (non-white). These results suggest that CIMP+ duodenal adenomas may have a higher risk for developing malignancy and may require more aggressive management and surveillance.

  16. Genome-Wide Estimates of Mutation Rates and Spectrum in Schizosaccharomyces pombe Indicate CpG Sites are Highly Mutagenic Despite the Absence of DNA Methylation

    PubMed Central

    Behringer, Megan G.; Hall, David W.

    2015-01-01

    We accumulated mutations for 1952 generations in 79 initially identical, haploid lines of the fission yeast Schizosaccharomyces pombe, and then performed whole-genome sequencing to determine the mutation rates and spectrum. We captured 696 spontaneous mutations across the 79 mutation accumulation (MA) lines. We compared the mutation spectrum and rate to a recently published equivalent experiment on the same species, and to another model ascomycetous yeast, the budding yeast Saccharomyces cerevisiae. While the two species are approximately 600 million years diverged from each other, they share similar life histories, genome size and genomic G/C content. We found that Sc. pombe and S. cerevisiae have similar mutation rates, but Sc. pombe exhibits a stronger insertion bias. Intriguingly, we observed an increased mutation rate at cytosine nucleotides, specifically CpG nucleotides, which is also seen in S. cerevisiae. However, the absence of methylation in Sc. pombe and the pattern of mutation at these sites, primarily C → A as opposed to C → T, strongly suggest that the increased mutation rate is not caused by deamination of methylated cytosines. This result implies that the high mutability of CpG dinucleotides in other species may be caused in part by a methylation-independent mechanism. Many of our findings mirror those seen in the recent study, despite the use of different passaging conditions, indicating that MA is a reliable method for estimating mutation rates and spectra. PMID:26564949

  17. Bacterial surface adaptation

    NASA Astrophysics Data System (ADS)

    Utada, Andrew

    2014-03-01

    Biofilms are structured multi-cellular communities that are fundamental to the biology and ecology of bacteria. Parasitic bacterial biofilms can cause lethal infections and biofouling, but commensal bacterial biofilms, such as those found in the gut, can break down otherwise indigestible plant polysaccharides and allow us to enjoy vegetables. The first step in biofilm formation, adaptation to life on a surface, requires a working knowledge of low Reynolds number fluid physics, and the coordination of biochemical signaling, polysaccharide production, and molecular motility motors. These crucial early stages of biofilm formation are at present poorly understood. By adapting methods from soft matter physics, we dissect bacterial social behavior at the single cell level for several prototypical bacterial species, including Pseudomonas aeruginosa and Vibrio cholerae.

  18. C-reactive Protein Versus Neutrophil/lymphocyte Ratio in Differentiating Bacterial and Non-bacterial Pneumonia in Children.

    PubMed

    Gauchan, E; Adhikari, S

    2016-09-01

    Pneumonia is a leading cause of childhood mortality in a low resource country. Simple laboratory markers can help differentiate between bacterial and non-bacterial pneumonias for appropriate management. In children aged one to 60 months with features of lower respiratory infection, C-reactive protein (CRP) and neutrophil-lymphocyte ratio (NLR) were used to differentiate between bacterial and non-bacterial pneumonias. The cutoff values for detecting bacterial pneumonias were evaluated by statistical tools. Bacterial pneumonia was diagnosed in 285 (43.6%) children out of 654 studied. At a cut-off value of 36 mg/L CRP was predictive of bacterial pneumonias with sensitivity and specificity of 61.8% and 91.3% respectively while the sensitivity and specificity for predicting bacterial pneumonia using NLR was 45.6% and 64% respectively with 1.28 used as a cut-off. Our study shows that CRP is superior to NLR in differentiating bacterial from non-bacterial pneumonias in children.

  19. [Chromosome study on chronic lymphocytic leukemia using CpG-oligodeoxynucleotide as immunostimulant agent].

    PubMed

    Wu, Yafang; Xue, Yongquan; Chen, Suning; Yao, Li; Jiang, Hui; Zhang, Jun; Shen, Juan; Pan, Jinlan; Wang, Yong; Bai, Shuxiao

    2010-02-01

    To investigate whether CpG-oligodeoxynucleotide (CpG-ODN) can improve the detection rate of the karyotypic abnormalities in chronic lymphocytic leukemia (CLL). The bone marrow (BM) or peripheral blood (PB) cells from 57 cases of CLL were collected and cultured with CpG-ODN DSP30+interleukin-2 (IL-2), phytohemagglutinin (PHA), pokeweed (PWM) or IL-2, respectively. Five days later cells were harvested for chromosome preparation. Karyotypic analysis was done using R banding technique. Panel fluorescence in situ hybridization (FISH) was carried out on 19 cases of CLL with normal karyotypes using the following probes: Cen12, D13S25, Rb1, ATM, p53, MYB and IgH. Genomic DNA from 21 cases of them was extracted from BM or PB leukocytes. The immunoglobulin variable heavy chain (IgVH) was amplified by polymerase chain reaction (PCR) and sequenced. CD38 and ZAP70 expressions in the leukemic cells were determined by flow cytometry (FCM). The detection rate of karyotypic abnormalities in the CpG-ODN+IL-2 group (43.85%) was obviously higher than that in the PHA (15.09%), PWM (17.31%) and IL-2 (3.13%) groups (P<0.01). Fifty-two types of karyotypic abnormalities were found. Among them, trisomy12 (+12) or +12 with other abnormalities were the most common, while translocations were the most frequent structural abnormalities including 3 unbalanced and 11 balanced translocations, among them 7 had rearrangements involving 14q32. Thirteen cases showed one or more abnormalities on FISH including trisomy 12 and p53 deletion each in one case, IgH rearrangement and partial deletion each in one case, 13q14.3 deletion in 11 cases of which 5 cases also had Rb1 deletion, 1 case had Rb1 partial deletion. No case with ATM or MYB deletions was found. PCR detected IgVH mutations in 10/21 cases. FCM showed 10/45 cases were CD38 positive, but 35 /45 were CD38 negative, 11/27 cases expressed ZAP70, but 16/27 did not. Among the 26 cases examined for CD38 and ZAP70 expressions simultaneously, 5 cases

  20. [Optimizing condition for oligofectamine-mediated SP1 decoy oligodeoxynucleotides transfection into SV-40-PED cells].

    PubMed

    Huang, Yabing; Xu, Jing; Chen, Song

    2007-08-01

    To determine the optimizing parameters in transfecting the SV-40-PED cells mediated by oligofectamine. With a change of Decoy oligodeoxynucleotides (ODNs)/oligofectamine in ratio and the transfection time, the uptake rate and the mean fluorescence intensity of SP1 ODNs in the SV-40-PED cells were measured by flow cytometry to evaluate the transfection efficiencies. 4 microl oligofectamine with different concentrations of ODNs(2.5, 5.0, 7.5, 10.0 and 12.5 microl) were put into 100 microl of DMEM without serum and antibiotics. the (SV-40-PED) cells were transfected after 20 min at room temperature. the final concentration of SP1 decay ODNs were 50,100, 150, 200 and 250 nmol/L. Transfection effieiency was detected at 26 h after transfection. The intracellular distribution of SP1 ODNs was determined with a fluorescence microscope. The lactate dehydrogenase (LDH) activity in the supernatant was measured to assess the cytotoxicity. The uptake of SP1 ODNs into the SV-40-PED cells was significantly improved by oligofectamine. The cell appearance did not change much in the groups of 50, 100 and 150 nmol/L. In the groups of 200 and 250 nmol/L, the cell reverted after being shrinked and altered to round. At 26 h after the transfection, there was no marked change in the cell form at the concentration of 250 nmol/L. There was floatation at 48 and 72 h after the transfection. Under the fluorescence microscope, we observed fluorescent materials distributed in the cell nucleus in the successfully-transferred groups. We could see the nucleoli clearly in the groups of 200 nmol/L and 250 nmol/L. There was a stronger fluorescence intensity with a higher concentration and the fluorescent materials gathered at the cell nucleus. At the final concentration of 250 nmol/L, the LDH level was 137.12+/-3.92 U/L in the 72-h group, which was significantly higher those that in the 26-h group (49.61+/-17.13 U/L) and the 48-h group (120.26 +/- 8.42 U/L) (P<0.01). At 26 h after the transfection

  1. Immunostimulation by cytosine-phosphate-guanine oligodeoxynucleotides in combination with IL-2 can improve the success rate of karyotype analysis in chronic lymphocytic leukaemia.

    PubMed

    Lin, Xiaolan; Chen, Jiadi; Huang, Huifang

    2016-07-01

    To assess whether immunostimulatory cytosine-phosphate-guanine oligodeoxynucleotides (CpG-ODN) combined with interleukin-2 (IL-2) improves the number of mitotic metaphases and the detection rate of chromosomal abnormalities in chronic lymphocytic leukaemia (CLL). Bone marrow specimens were collected from 36 patients with CLL. CLL cells were cultured with CpG-ODN type DSP30 plus IL-2 for 72 h, following which R-banding analysis was conducted. Conventional culture without the immunostimulant served as the control group. The incidence of genetic abnormalities was measured by fluorescence in situ hybridisation (FISH) using a panel of five specific probes: D13S25 (13q14.3), RB1 (13q14), P53 (17p13), ATM (11q22.3) and CSP12 (trisomy 12, +12). In the control group, chromosome analysis achieved a success rate of only 22.2, and 11.1% of abnormal karyotypes were detected. After immunostimulation with DSP30 plus IL-2, chromosome analysis achieved a success rate of up to 91.6, and 41.6% of abnormal karyotypes were detected. FISH analysis detected 77.7% of abnormalities. FISH combined with CpG-ODN DSP30 plus IL-2 improved the detection rate of chromosomal abnormalities in CLL to 83.3%. CpG-ODN DSP30 combined with IL-2 is effective in improving the detection rate of chromosomal abnormalities in CLL cells. This combination with FISH analysis is conducive to increasing the detection rate of genetic abnormalities in CLL.

  2. Low doses of killed parasite in CpG elicit vigorous CD4+ T cell responses against blood-stage malaria in mice

    PubMed Central

    Pinzon-Charry, Alberto; McPhun, Virginia; Kienzle, Vivian; Hirunpetcharat, Chakrit; Engwerda, Christian; McCarthy, James; Good, Michael F.

    2010-01-01

    Development of a vaccine that targets blood-stage malaria parasites is imperative if we are to sustainably reduce the morbidity and mortality caused by this infection. Such a vaccine should elicit long-lasting immune responses against conserved determinants in the parasite population. Most blood-stage vaccines, however, induce protective antibodies against surface antigens, which tend to be polymorphic. Cell-mediated responses, on the other hand, offer the theoretical advantage of targeting internal antigens that are more likely to be conserved. Nonetheless, few of the current blood-stage vaccine candidates are able to harness vigorous T cell immunity. Here, we present what we believe to be a novel blood-stage whole-organism vaccine that, by combining low doses of killed parasite with CpG-oligodeoxynucleotide (CpG-ODN) adjuvant, was able to elicit strong and cross-reactive T cell responses in mice. Our data demonstrate that immunization of mice with 1,000 killed parasites in CpG-ODN engendered durable and cross-strain protection by inducing a vigorous response that was dependent on CD4+ T cells, IFN-γ, and nitric oxide. If applicable to humans, this approach should facilitate the generation of robust, cross-reactive T cell responses against malaria as well as antigen availability for vaccine manufacture. PMID:20628205

  3. Bacterial Prostatitis: Bacterial Virulence, Clinical Outcomes, and New Directions.

    PubMed

    Krieger, John N; Thumbikat, Praveen

    2016-02-01

    Four prostatitis syndromes are recognized clinically: acute bacterial prostatitis, chronic bacterial prostatitis, chronic prostatitis/chronic pelvic pain syndrome, and asymptomatic prostatitis. Because Escherichia coli represents the most common cause of bacterial prostatitis, we investigated the importance of bacterial virulence factors and antimicrobial resistance in E. coli strains causing prostatitis and the potential association of these characteristics with clinical outcomes. A structured literature review revealed that we have limited understanding of the virulence-associated characteristics of E. coli causing acute prostatitis. Therefore, we completed a comprehensive microbiological and molecular investigation of a unique strain collection isolated from healthy young men. We also considered new data from an animal model system suggesting certain E. coli might prove important in the etiology of chronic prostatitis/chronic pelvic pain syndrome. Our human data suggest that E. coli needs multiple pathogenicity-associated traits to overcome anatomic and immune responses in healthy young men without urological risk factors. The phylogenetic background and accumulation of an exceptional repertoire of extraintestinal pathogenic virulence-associated genes indicate that these E. coli strains belong to a highly virulent subset of uropathogenic variants. In contrast, antibiotic resistance confers little added advantage to E. coli strains in these healthy outpatients. Our animal model data also suggest that certain pathogenic E. coli may be important in the etiology of chronic prostatitis/chronic pelvic pain syndrome through mechanisms that are dependent on the host genetic background and the virulence of the bacterial strain.

  4. Hebbian Plasticity in CPG Controllers Facilitates Self-Synchronization for Human-Robot Handshaking.

    PubMed

    Jouaiti, Melanie; Caron, Lancelot; Hénaff, Patrick

    2018-01-01

    It is well-known that human social interactions generate synchrony phenomena which are often unconscious. If the interaction between individuals is based on rhythmic movements, synchronized and coordinated movements will emerge from the social synchrony. This paper proposes a plausible model of plastic neural controllers that allows the emergence of synchronized movements in physical and rhythmical interactions. The controller is designed with central pattern generators (CPG) based on rhythmic Rowat-Selverston neurons endowed with neuronal and synaptic Hebbian plasticity. To demonstrate the interest of the proposed model, the case of handshaking is considered because it is a very common, both physically and socially, but also, a very complex act in the point of view of robotics, neuroscience and psychology. Plastic CPGs controllers are implemented in the joints of a simulated robotic arm that has to learn the frequency and amplitude of an external force applied to its effector, thus reproducing the act of handshaking with a human. Results show that the neural and synaptic Hebbian plasticity are working together leading to a natural and autonomous synchronization between the arm and the external force even if the frequency is changing during the movement. Moreover, a power consumption analysis shows that, by offering emergence of synchronized and coordinated movements, the plasticity mechanisms lead to a significant decrease in the energy spend by the robot actuators thus generating a more adaptive and natural human/robot handshake.

  5. Probable Chemical Hypoxia Effects on Progress of CNV Through Induction of Promoter CpG Demethylation and Overexpression of IL17RC in Human RPE Cells.

    PubMed

    Alivand, Mohammad Reza; Sabouni, Farzaneh; Soheili, Zahra-Soheila

    2016-09-01

    To survey the changes of promoter CpG methylation status and mRNA expression of IL17RC (interleukin 17 receptor C) gene in retinal pigment epithelium (RPE) cells under chemical hypoxia condition for choroidal neovascularization (CNV) modeling in vitro. RPE cells were cultured in both untreated as a control group and treated by cobalt chloride media as a hypoxia group for various concentrations (100-150μM) and times (24-36 hrs.) To confirm chemical hypoxia condition, mRNA expression of HIF (Hypoxia Inducible Factor) -1α, -2α, and Vascular Endothelial Growth Factor (VEGF) was compared between two groups by Real-time PCR. Also, in normoxia and hypoxia conditions, IL17RC expression changes and promoter CpG methylation status were evaluated by Real-time PCR and methylation-specific PCR (MSP) techniques, respectively. Overexpression of HIF-1α, HIF-2α, and VEGF was significant in hypoxia versus normoxia conditions. Our data showed overexpression of IL17RC (2.1- to 6.3-fold) and decreasing of its promoter methylation in comparison with hypoxia and normoxia conditions. It was found that there are significant association between promoter methylation status and expression of IL17RC in chemical hypoxia condition. Therefore, methylation of IL17RC could play as a marker in CNV and degeneration of RPE cells in vitro. Additionally, HIF-α and methylation phenomena may be considered as critical targets for blocking in angiogenesis of age-related degeneration in future studies.

  6. Egr-1 antisense oligodeoxynucleotide administration into the olfactory bulb impairs olfactory learning in the greater short-nosed fruit bat Cynopterus sphinx.

    PubMed

    Ganesh, Ambigapathy; Bogdanowicz, Wieslaw; Balamurugan, Krishnaswamy; Ragu Varman, Durairaj; Rajan, Koilmani Emmanuvel

    2012-08-30

    Postsynaptic densities (PSDs) contain proteins that regulate synaptic transmission. We examined two important examples of these, calcium/calmodulin-dependent protein kinase II (CaMKII) and PSD-95, in regard to the functional role of early growth response gene-1 (egr-1) in regulation of olfactory learning in the greater short-nosed fruit bat Cynopterus sphinx (family Pteropodidae). To test whether activation of egr-1 in the olfactory bulb (OB) is required for olfactory memory of these bats, bilaterally canulated individuals were infused with antisense (AS) or non-sense (NS)-oligodeoxynucleotides (ODN) of egr-1, or with phosphate buffer saline (PBS), 2h before the olfactory training. Our results showed that behavioral training significantly up-regulates immediate early gene (IEG) EGR-1 and key synaptic proteins Synaptotagmin-1(SYT-1), CaMKII and PSD-95, and phosphorylation of CaMKII in the OB at the protein level per se. Subsequently, we observed that egr-1 antisense-ODN infusion in the OB impaired olfactory memory and down regulates the expression of CaMKII and PSD-95, and the phosphorylation of CaMKII but not SYT-1. In contrast, NS-ODN or PBS had no effect on the expression of the PSDs CaMKII or PSD-95, or on the phosphorylation of CaMKII. When the egr-1 NS-ODN was infused in the OB after training for the novel odor there was no effect on olfactory memory. These findings suggest that egr-1 control the activation of CaMKII and PSD-95 during the process of olfactory memory formation. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. A Toll-Like Receptor 9 Antagonist Improves Bladder Function and White Matter Sparing in Spinal Cord Injury

    PubMed Central

    David, Brian T.; Sampath, Sujitha; Dong, Wei; Heiman, Adee; Rella, Courtney E.; Elkabes, Stella

    2014-01-01

    Abstract Spinal cord injury (SCI) affects motor, sensory, and autonomic functions. As current therapies do not adequately alleviate functional deficits, the development of new and more effective approaches is of critical importance. Our earlier investigations indicated that intrathecal administration of a toll-like receptor 9 (TLR9) antagonist, cytidine-phosphate-guanosine oligodeoxynucleotide 2088 (CpG ODN 2088), to mice sustaining a severe, mid-thoracic contusion injury diminished neuropathic pain but did not alter locomotor deficits. These changes were paralleled by a decrease in the pro-inflammatory response at the injury epicenter. Using the same SCI paradigm and treatment regimen, the current studies investigated the effects of the TLR9 antagonist on bladder function. We report that the TLR9 antagonist decreases SCI-elicited urinary retention and ameliorates bladder morphopathology without affecting kidney function. A significant improvement in white matter sparing was also observed, most likely due to alterations in the inflammatory milieu. These findings indicate that the TLR9 antagonist has beneficial effects not only in reducing sensory deficits, but also on bladder dysfunction and tissue preservation. Thus, modulation of innate immune receptor signaling in the spinal cord can impact the effects of SCI. PMID:24936867

  8. A toll-like receptor 9 antagonist improves bladder function and white matter sparing in spinal cord injury.

    PubMed

    David, Brian T; Sampath, Sujitha; Dong, Wei; Heiman, Adee; Rella, Courtney E; Elkabes, Stella; Heary, Robert F

    2014-11-01

    Spinal cord injury (SCI) affects motor, sensory, and autonomic functions. As current therapies do not adequately alleviate functional deficits, the development of new and more effective approaches is of critical importance. Our earlier investigations indicated that intrathecal administration of a toll-like receptor 9 (TLR9) antagonist, cytidine-phosphate-guanosine oligodeoxynucleotide 2088 (CpG ODN 2088), to mice sustaining a severe, mid-thoracic contusion injury diminished neuropathic pain but did not alter locomotor deficits. These changes were paralleled by a decrease in the pro-inflammatory response at the injury epicenter. Using the same SCI paradigm and treatment regimen, the current studies investigated the effects of the TLR9 antagonist on bladder function. We report that the TLR9 antagonist decreases SCI-elicited urinary retention and ameliorates bladder morphopathology without affecting kidney function. A significant improvement in white matter sparing was also observed, most likely due to alterations in the inflammatory milieu. These findings indicate that the TLR9 antagonist has beneficial effects not only in reducing sensory deficits, but also on bladder dysfunction and tissue preservation. Thus, modulation of innate immune receptor signaling in the spinal cord can impact the effects of SCI.

  9. Conformationally restricted analogs of BD1008 and an antisense oligodeoxynucleotide targeting sigma1 receptors produce anti-cocaine effects in mice.

    PubMed

    Matsumoto, R R; McCracken, K A; Friedman, M J; Pouw, B; De Costa, B R; Bowen, W D

    2001-05-11

    Cocaine's ability to interact with sigma receptors suggests that these proteins mediate some of its behavioral effects. Therefore, three novel sigma receptor ligands with antagonist activity were evaluated in Swiss Webster mice: BD1018 (3S-1-[2-(3,4-dichlorophenyl)ethyl]-1,4-diazabicyclo[4.3.0]nonane), BD1063 (1-[2-(3,4-dichlorophenyl)ethyl]-4-methylpiperazine), and LR132 (1R,2S-(+)-cis-N-[2-(3,4-dichlorophenyl)ethyl]-2-(1-pyrrolidinyl)cyclohexylamine). Competition binding assays demonstrated that all three compounds have high affinities for sigma1 receptors. The three compounds vary in their affinities for sigma2 receptors and exhibit negligible affinities for dopamine, opioid, GABA(A) and NMDA receptors. In behavioral studies, pre-treatment of mice with BD1018, BD1063, or LR132 significantly attenuated cocaine-induced convulsions and lethality. Moreover, post-treatment with LR132 prevented cocaine-induced lethality in a significant proportion of animals. In contrast to the protection provided by the putative antagonists, the well-characterized sigma receptor agonist di-o-tolylguanidine (DTG) and the novel sigma receptor agonist BD1031 (3R-1-[2-(3,4-dichlorophenyl)ethyl]-1,4-diazabicyclo[4.3.0]nonane) each worsened the behavioral toxicity of cocaine. At doses where alone, they produced no significant effects on locomotion, BD1018, BD1063 and LR132 significantly attenuated the locomotor stimulatory effects of cocaine. To further validate the hypothesis that the anti-cocaine effects of the novel ligands involved antagonism of sigma receptors, an antisense oligodeoxynucleotide against sigma1 receptors was also shown to significantly attenuate the convulsive and locomotor stimulatory effects of cocaine. Together, the data suggests that functional antagonism of sigma receptors is capable of attenuating a number of cocaine-induced behaviors.

  10. Modification of the plasma clearance and liver uptake of steroid ester-conjugated oligodeoxynucleotides by association with (lactosylated) low-density lipoprotein.

    PubMed

    Rump, E T; de Vrueh, R L; Manoharan, M; Waarlo, I H; van Veghel, R; Biessen, E A; van Berkel, T J; Bijsterbosch, M K

    2000-06-01

    Low-density lipoprotein (LDL) has been proposed as carrier for the selective delivery of anticancer drugs to tumor cells. We reported earlier the association of several lipidic steroid-conjugated anticancer oligodeoxynucleotides (ODNs) with LDL. In the present study, we determined the stability of these complexes. When the complexes were incubated with a mixture of high-density lipoprotein and albumin, or with rat plasma, the oleoyl steroid-conjugated ODNs appeared to be more stably associated with LDL than the cholesteryl-conjugated ODN. Intravenously injected free lipid-ODNs were very rapidly cleared from the circulation of rats. The area under the curve (AUC) of the lipid-ODNs in plasma was <0.4 microg x min/mL. After complexation with LDL, plasma clearance of the lipid-ODNs was delayed. This was most evident for ODN-5, the ODN conjugated with the oleoyl ester of lithocholic acid (AUC = 6.82 +/- 1.34 microg x min/mL). The AUC of ODN-4, a cholesteryl-conjugated ODN, was 1.49 +/- 0.37 microg x min/mL. In addition, the liver uptake of the LDL-complexed lipid-ODNs was reduced. The lipid-ODNs were also administered as a complex with lactosylated LDL, a modified LDL particle that is selectively taken up by the liver. A high proportion of ODN-5 was transported to the liver along with lactosylated LDL (69.1 +/- 8.1% of the dose at 15 min after injection), whereas much less ODN-4 was transported (36.6 +/- 0.1% of the dose at 15 min after injection). We conclude that the oleoyl ester of lithocholic acid is a more potent lipid anchor than the other steroid lipid anchors. Because of the stable association, the oleoyl ester of lithocholic acid is an interesting candidate for tumor targeting of anticancer ODNs with lipoproteins.

  11. [Current treatment of bacterial vaginosis].

    PubMed

    Borisov, I

    1999-01-01

    Therapeutic options for the treatment of accurately diagnosed bacterial vaginosis are reviewed on the basis of current concepts for treatment of bacterial vaginosis. The importance for screening for bacterial vaginosis is pointed out especially before intrauterine procedures and in pregnant women at risk for premature deliveries. Treatment regimens for pregnant women are discussed as well. Emphasis is given to treatment modalities for recurrent bacterial vaginosis.

  12. Bacterial Cell Mechanics.

    PubMed

    Auer, George K; Weibel, Douglas B

    2017-07-25

    Cellular mechanical properties play an integral role in bacterial survival and adaptation. Historically, the bacterial cell wall and, in particular, the layer of polymeric material called the peptidoglycan were the elements to which cell mechanics could be primarily attributed. Disrupting the biochemical machinery that assembles the peptidoglycan (e.g., using the β-lactam family of antibiotics) alters the structure of this material, leads to mechanical defects, and results in cell lysis. Decades after the discovery of peptidoglycan-synthesizing enzymes, the mechanisms that underlie their positioning and regulation are still not entirely understood. In addition, recent evidence suggests a diverse group of other biochemical elements influence bacterial cell mechanics, may be regulated by new cellular mechanisms, and may be triggered in different environmental contexts to enable cell adaptation and survival. This review summarizes the contributions that different biomolecular components of the cell wall (e.g., lipopolysaccharides, wall and lipoteichoic acids, lipid bilayers, peptidoglycan, and proteins) make to Gram-negative and Gram-positive bacterial cell mechanics. We discuss the contribution of individual proteins and macromolecular complexes in cell mechanics and the tools that make it possible to quantitatively decipher the biochemical machinery that contributes to bacterial cell mechanics. Advances in this area may provide insight into new biology and influence the development of antibacterial chemotherapies.

  13. CpG island methylator phenotype and its association with malignancy in sporadic duodenal adenomas

    PubMed Central

    Sun, Lifeng; Guzzetta, Angela A; Fu, Tao; Chen, Jinming; Jeschke, Jana; Kwak, Ruby; Vatapalli, Rajita; Baylin, Stephen B; Iacobuzio-Donahue, Christine A; Wolfgang, Christopher L; Ahuja, Nita

    2014-01-01

    CpG island methylator phenotype (CIMP) has been found in multiple precancerous and cancerous lesions, including colorectal adenomas, colorectal cancers, and duodenal adenocarcinomas. There are no reports in the literature of a relationship between CIMP status and clinicopathologic features of sporadic duodenal adenomas. This study sought to elucidate the role of methylation in duodenal adenomas and correlate it with KRAS and BRAF mutations. CIMP+ (with more than 2 markers methylated) was seen in 33.3% of duodenal adenomas; 61% of these CIMP+ adenomas were CIMP-high (with more than 3 markers methylated). Furthermore, CIMP+ status significantly correlated with older age of patients, larger size and villous type of tumor, coexistent dysplasia and periampullary location. MLH1 methylation was seen in 11.1% of duodenal adenomas and was significantly associated with CIMP+ tumors, while p16 methylation was an infrequent event. KRAS mutations were frequent and seen in 26.3% of adenomas; however, no BRAF mutations were detected. Furthermore, CIMP-high status was associated with larger size and villous type of tumor and race (non-white). These results suggest that CIMP+ duodenal adenomas may have a higher risk for developing malignancy and may require more aggressive management and surveillance. PMID:24518818

  14. Quantitative DNA Methylation Analysis Identifies a Single CpG Dinucleotide Important for ZAP-70 Expression and Predictive of Prognosis in Chronic Lymphocytic Leukemia

    PubMed Central

    Claus, Rainer; Lucas, David M.; Stilgenbauer, Stephan; Ruppert, Amy S.; Yu, Lianbo; Zucknick, Manuela; Mertens, Daniel; Bühler, Andreas; Oakes, Christopher C.; Larson, Richard A.; Kay, Neil E.; Jelinek, Diane F.; Kipps, Thomas J.; Rassenti, Laura Z.; Gribben, John G.; Döhner, Hartmut; Heerema, Nyla A.; Marcucci, Guido; Plass, Christoph; Byrd, John C.

    2012-01-01

    Purpose Increased ZAP-70 expression predicts poor prognosis in chronic lymphocytic leukemia (CLL). Current methods for accurately measuring ZAP-70 expression are problematic, preventing widespread application of these tests in clinical decision making. We therefore used comprehensive DNA methylation profiling of the ZAP-70 regulatory region to identify sites important for transcriptional control. Patients and Methods High-resolution quantitative DNA methylation analysis of the entire ZAP-70 gene regulatory regions was conducted on 247 samples from patients with CLL from four independent clinical studies. Results Through this comprehensive analysis, we identified a small area in the 5′ regulatory region of ZAP-70 that showed large variability in methylation in CLL samples but was universally methylated in normal B cells. High correlation with mRNA and protein expression, as well as activity in promoter reporter assays, revealed that within this differentially methylated region, a single CpG dinucleotide and neighboring nucleotides are particularly important in ZAP-70 transcriptional regulation. Furthermore, by using clustering approaches, we identified a prognostic role for this site in four independent data sets of patients with CLL using time to treatment, progression-free survival, and overall survival as clinical end points. Conclusion Comprehensive quantitative DNA methylation analysis of the ZAP-70 gene in CLL identified important regions responsible for transcriptional regulation. In addition, loss of methylation at a specific single CpG dinucleotide in the ZAP-70 5′ regulatory sequence is a highly predictive and reproducible biomarker of poor prognosis in this disease. This work demonstrates the feasibility of using quantitative specific ZAP-70 methylation analysis as a relevant clinically applicable prognostic test in CLL. PMID:22564988

  15. In vitro bacterial isolate susceptibility to empirically selected antimicrobials in 111 dogs with bacterial pneumonia.

    PubMed

    Proulx, Alexandre; Hume, Daniel Z; Drobatz, Kenneth J; Reineke, Erica L

    2014-01-01

    To determine the proportion of airway bacterial isolates resistant to both empirically selected and recently administered antimicrobials, and to assess the impact of inappropriate initial empiric antimicrobials selection on length of hospital stay and survival to discharge in dogs with bacterial pneumonia. Retrospective study. University veterinary teaching hospital. One hundred and eleven dogs with a clinical diagnosis of bacterial pneumonia that had aerobic bacterial culture and susceptibility testing performed from a tracheal wash sample. None. Overall, 26% (29/111) of the dogs had at least 1 bacterial isolate that was resistant to empirically selected antimicrobials. In dogs with a history of antimicrobial administration within the preceding 4 weeks, a high incidence (57.4%, 31/54) of in vitro bacterial resistance to those antimicrobials was found: 64.7% (11/17) in the community-acquired pneumonia group, 55.2% (16/29) in the aspiration pneumonia group, and 50.0% (4/8) in the other causes of bacterial pneumonia group. No statistically significant association was found between bacterial isolate resistance to empirically selected antimicrobials and length of hospital stay or mortality. The high proportion of in vitro airway bacterial resistance to empiric antimicrobials would suggest that airway sampling for bacterial culture and susceptibility testing may be helpful in guiding antimicrobial therapy and recently administered antimicrobials should be avoided when empirically selecting antimicrobials. Although no relationship was found between inappropriate initial empiric antimicrobial selection and length of hospital stay or mortality, future prospective studies using standardized airway-sampling techniques, treatment modalities, and stratification of disease severity based on objective values, such as arterial blood gas analysis in all dogs with pneumonia, would be needed to determine if a clinical effect of in vitro bacterial resistance to empirically

  16. Complex formation and vectorization of a phosphorothioate oligonucleotide with an amphipathic leucine- and lysine-rich peptide: study at molecular and cellular levels.

    PubMed

    Boukhalfa-Heniche, Fatima-Zohra; Hernández, Belén; Gaillard, Stéphane; Coïc, Yves-Marie; Huynh-Dinh, Tam; Lecouvey, Marc; Seksek, Olivier; Ghomi, Mahmoud

    2004-04-15

    Optical spectroscopic techniques such as CD, Raman scattering, and fluorescence imaging allowed us to analyze the complex formation and vectorization of a single-stranded 20-mer phosphorothioate oligodeoxynucleotide with a 15-mer amphipathic peptide at molecular and cellular levels. Different solvent mixtures (methanol and water) and molecular ratios of peptide/oligodeoxynucleotide complexes were tested in order to overcome the problems related to solubility. Optimal conditions for both spectroscopic and cellular experiments were obtained with the molecular ratio peptide/oligodeoxynucleotide equal to 21:4, corresponding to a 7:5 ratio for their respective +/- charge ratio. At the molecular level, CD and Raman spectra were consistent with a alpha-helix conformation of the peptide in water or in a methanol-water mixture. The presence of methanol increased considerably the solubility of the peptide without altering its alpha-helix conformation, as evidenced by CD and Raman spectroscopies. UV absorption melting profile of the oligodeoxynucleotide gave rise to a flat melting profile, corresponding to its random structure in solution. Raman spectra of oligodeoxynucleotide/peptide complexes could only be studied in methanol/water mixture solutions. Drastic changes observed in Raman spectra have undoubtedly shown: (a) the perturbation occurred in the peptide secondary structure, and (b) possible interaction between the lysine residues of the peptide and the oligodeoxynucleotide. At the cellular level, the complex was prepared in a mixture of 10% methanol and 90% cell medium. Cellular uptake in optimal conditions for the oligodeoxynucleotide delivery with low cytotoxicity was controlled by fluorescence imaging allowing to specifically locate the compacted oligonucleotide labeled with fluorescein at its 5'-terminus with the peptide into human glioma cells after 1 h of incubation at 37 degrees C. Copyright 2004 Wiley Periodicals, Inc.

  17. Conserved nonsense-prone CpG sites in apoptosis-regulatory genes: conditional stop signs on the road to cell death.

    PubMed

    Zhao, Yongzhong; Epstein, Richard J

    2013-01-01

    Methylation-prone CpG dinucleotides are strongly conserved in the germline, yet are also predisposed to somatic mutation. Here we quantify the relationship between germline codon mutability and somatic carcinogenesis by comparing usage of the nonsense-prone CGA (→TGA) codons in gene groups that differ in apoptotic function; to this end, suppressor genes were subclassified as either apoptotic (gatekeepers) or repair (caretakers). Mutations affecting CGA codons in sporadic tumors proved to be highly asymmetric. Moreover, nonsense mutations were 3-fold more likely to affect gatekeepers than caretakers. In addition, intragenic CGA clustering nonrandomly affected functionally critical regions of gatekeepers. We conclude that human gatekeeper suppressor genes are enriched for nonsense-prone codons, and submit that this germline vulnerability to tumors could reflect in utero selection for a methylation-dependent capability to short-circuit environmental insults that otherwise trigger apoptosis and fetal loss.

  18. Mercuric ion reduction and resistance in transgenic Arabidopsis thaliana plants expressing a modified bacterial merA gene.

    PubMed Central

    Rugh, C L; Wilde, H D; Stack, N M; Thompson, D M; Summers, A O; Meagher, R B

    1996-01-01

    With global heavy metal contamination increasing, plants that can process heavy metals might provide efficient and ecologically sound approaches to sequestration and removal. Mercuric ion reductase, MerA, converts toxic Hg2+ to the less toxic, relatively inert metallic mercury (Hg0) The bacterial merA sequence is rich in CpG dinucleotides and has a highly skewed codon usage, both of which are particularly unfavorable to efficient expression in plants. We constructed a mutagenized merA sequence, merApe9, modifying the flanking region and 9% of the coding region and placing this sequence under control of plant regulatory elements. Transgenic Arabidopsis thaliana seeds expressing merApe9 germinated, and these seedlings grew, flowered, and set seed on medium containing HgCl2 concentrations of 25-100 microM (5-20 ppm), levels toxic to several controls. Transgenic merApe9 seedlings evolved considerable amounts of Hg0 relative to control plants. The rate of mercury evolution and the level of resistance were proportional to the steady-state mRNA level, confirming that resistance was due to expression of the MerApe9 enzyme. Plants and bacteria expressing merApe9 were also resistant to toxic levels of Au3+. These and other data suggest that there are potentially viable molecular genetic approaches to the phytoremediation of metal ion pollution. Images Fig. 2 Fig. 3 Fig. 4 PMID:8622910

  19. Facial bacterial infections: folliculitis.

    PubMed

    Laureano, Ana Cristina; Schwartz, Robert A; Cohen, Philip J

    2014-01-01

    Facial bacterial infections are most commonly caused by infections of the hair follicles. Wherever pilosebaceous units are found folliculitis can occur, with the most frequent bacterial culprit being Staphylococcus aureus. We review different origins of facial folliculitis, distinguishing bacterial forms from other infectious and non-infectious mimickers. We distinguish folliculitis from pseudofolliculitis and perifolliculitis. Clinical features, etiology, pathology, and management options are also discussed. Copyright © 2014. Published by Elsevier Inc.

  20. Treatment of bacterial meningitis: an update.

    PubMed

    Shin, Seon Hee; Kim, Kwang Sik

    2012-10-01

    The introduction of protein conjugate vaccines for Haemophilus influenzae type b (Hib), Streptococcus pneumoniae (S. pneumoniae) and Neisseria meningitidis (N. menigitidis) has changed the epidemiology of bacterial meningitis. Bacterial meningitis continues to be an important cause of mortality and morbidity, and our incomplete knowledge of its pathogenesis and emergence of antimicrobial resistant bacteria contribute to such mortality and morbidity. An early empiric antibiotic treatment is critical for the management of patients with bacterial meningitis. This article gives an overview on optimal treatment strategies of bacterial meningitis, along with considerations of new insights on epidemiology, clinical and laboratory findings supportive of bacterial meningitis, chemoprophylaxis, selection of initial antimicrobial agents for suspected bacterial meningitis, antimicrobial resistance and utility of new antibiotics, status on anti-inflammatory agents and adjunctive therapy, and pathogenesis of bacterial meningitis. Prompt treatment of bacterial meningitis with an appropriate antibiotic is essential. Optimal antimicrobial treatment of bacterial meningitis requires bactericidal agents able to penetrate the blood-brain barrier (BBB), with efficacy in cerebrospinal fluid (CSF). Several new antibiotics have been introduced for the treatment of meningitis caused by resistant bacteria, but their use in human studies has been limited. More complete understanding of the microbial and host interactions that are involved in the pathogenesis of bacterial meningitis and associated neurologic sequelae is likely to help in developing new strategies for the prevention and therapy of bacterial meningitis.

  1. Small bowel bacterial overgrowth

    MedlinePlus

    Overgrowth - intestinal bacteria; Bacterial overgrowth - intestine; Small intestinal bacterial overgrowth; SIBO ... intestine does not have a high number of bacteria. Excess bacteria in the small intestine may use ...

  2. Inhibition of cytokine response to TLR stimulation and alleviation of collagen-induced arthritis in mice by Schistosoma japonicum peptide SJMHE1.

    PubMed

    Wang, Xuefeng; Li, Li; Wang, Jun; Dong, Liyang; Shu, Yang; Liang, Yong; Shi, Liang; Xu, Chengcheng; Zhou, Yuepeng; Wang, Yi; Chen, Deyu; Mao, Chaoming

    2017-03-01

    Helminth-derived products have recently been shown to prevent the development of inflammatory diseases in mouse models. However, most identified immunomodulators from helminthes are mixtures or macromolecules with potentially immunogenic side effects. We previously identified an immunomodulatory peptide called SJMHE1 from the HSP60 protein of Schistosoma japonicum. In this study, we assessed the ability of SJMHE1 to affect murine splenocytes and human peripheral blood mononuclear cells (PBMCs) stimulated by toll-like receptor (TLR) ligands in vitro and its treatment effect on mice with collagen-induced arthritis (CIA). We show that SJMHE1 not only modulates the cytokine production of murine macrophage (MΦ) and dendritic cell but also affects cytokine production upon coculturing with allogeneic CD4 + T cell. SJMHE1 potently inhibits the cytokine response to TLR ligands lipopolysaccharide (LPS), CpG oligodeoxynucleotides (CpG) or resiquimod (R848) from mouse splenocytes, and human PBMCs stimulated by LPS. Furthermore, SJMHE1 suppressed clinical signs of CIA in mice and blocked joint erosion progression. This effect was mediated by downregulation of key cytokines involved in the pathogenesis of CIA, such as interferon-γ (IFN-γ), tumour necrosis factor-α (TNF-α), interleukin (IL)-6, IL-17, and IL-22 and up-regulation of the inhibitory cytokine IL-10, Tgf-β1 mRNA, and CD4 + CD25 + Foxp3 + Tregs. This study provides new evidence that the peptide from S. japonicum, which is the 'safe' selective generation of small molecule peptide that has evolved during host-parasite interactions, is of great value in the search for novel anti-inflammatory agents and therapeutic targets for autoimmune diseases. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  3. CTA1-DD adjuvant promotes strong immunity against human immunodeficiency virus type 1 envelope glycoproteins following mucosal immunization.

    PubMed

    Sundling, Christopher; Schön, Karin; Mörner, Andreas; Forsell, Mattias N E; Wyatt, Richard T; Thorstensson, Rigmor; Karlsson Hedestam, Gunilla B; Lycke, Nils Y

    2008-12-01

    Strategies to induce potent and broad antibody responses against the human immunodeficiency virus type 1 (HIV-1) envelope glycoproteins (Env) at both systemic and mucosal sites represent a central goal for HIV-1 vaccine development. Here, we show that the non-toxic CTA1-DD adjuvant promoted mucosal and systemic humoral and cell-mediated immune responses following intranasal (i.n.) immunizations with trimeric or monomeric forms of HIV-1 Env in mice and in non-human primates. Env-specific IgG subclasses in the serum of immunized mice reflected a balanced Th1/Th2 type of response. Strikingly, i.n. immunizations with Env and the CTA1-DD adjuvant induced substantial levels of mucosal anti-Env IgA in bronchial alveolar lavage and also detectable levels in vaginal secretions. By contrast, parenteral immunizations of Env formulated in Ribi did not stimulate mucosal IgA responses, while the two adjuvants induced a similar distribution of Env-specific IgG-subclasses in serum. A single parenteral boost with Env in Ribi adjuvant into mice previously primed i.n. with Env and CTA1-DD, augmented the serum anti-Env IgG levels to similar magnitudes as those observed after three intraperitoneal immunizations with Env in Ribi. The augmenting potency of CTA1-DD was similar to that of LTK63 or CpG oligodeoxynucleotides (ODN). However, in contrast to CpG ODN, the effect of CTA1-DD and LTK63 appeared to be independent of MyD88 and toll-like receptor signalling. This is the first demonstration that CTA1-DD augments specific immune responses also in non-human primates, suggesting that this adjuvant could be explored further as a clinically safe mucosal vaccine adjuvant for humoral and cell-mediated immunity against HIV-1 Env.

  4. Exploring bacterial infections: theoretical and experimental studies of the bacterial population dynamics and antibiotic treatment

    NASA Astrophysics Data System (ADS)

    Shao, Xinxian

    Bacterial infections are very common in human society. Thus extensive research has been conducted to reveal the molecular mechanisms of the pathogenesis and to evaluate the antibiotics' efficacy against bacteria. Little is known, however, about the population dynamics of bacterial populations and their interactions with the host's immune system. In this dissertation, a stochatic model is developed featuring stochastic phenotypic switching of bacterial individuals to explain the single-variant bottleneck discovered in multi strain bacterial infections. I explored early events in a bacterial infection establishment using classical experiments of Moxon and Murphy on neonatal rats. I showed that the minimal model and its simple variants do not work. I proposed modifications to the model that could explain the data quantitatively. The bacterial infections are also commonly established in physical structures, as biofilms or 3-d colonies. In contrast, most research on antibiotic treatment of bacterial infections has been conducted in well-mixed liquid cultures. I explored the efficacy of antibiotics to treat such bacterial colonies, a broadly applicable method is designed and evaluated where discrete bacterial colonies on 2-d surfaces were exposed to antibiotics. I discuss possible explanations and hypotheses for the experimental results. To verify these hypotheses, we investigated the dynamics of bacterial population as 3-d colonies. We showed that a minimal mathematical model of bacterial colony growth in 3-d was able to account for the experimentally observed presence of a diffusion-limited regime. The model further revealed highly loose packing of the cells in 3-d colonies and smaller cell sizes in colonies than plancktonic cells in corresponding liquid culture. Further experimental tests of the model predictions have revealed that the ratio of the cell size in liquid culture to that in colony cultures was consistent with the model prediction, that the dead cells

  5. The CpG island encompassing the promoter and first exon of human DNMT3L gene is a PcG/TrX response element (PRE).

    PubMed

    Basu, Amitava; Dasari, Vasanthi; Mishra, Rakesh K; Khosla, Sanjeev

    2014-01-01

    DNMT3L, a member of DNA methyltransferases family, is present only in mammals. As it provides specificity to the action of de novo methyltransferases, DNMT3A and DNMT3B and interacts with histone H3, DNMT3L has been invoked as the molecule that can read the histone code and translate it into DNA methylation. It plays an important role in the initiation of genomic imprints during gametogenesis and in nuclear reprogramming. With important functions attributed to it, it is imperative that the DNMT3L expression is tightly controlled. Previously, we had identified a CpG island within the human DNMT3L promoter and first exon that showed loss of DNA methylation in cancer samples. Here we show that this Differentially Methylated CpG island within DNMT3L (DNMT3L DMC) acts to repress transcription, is a Polycomb/Trithorax Response Element (PRE) and interacts with both PRC1 and PRC2 Polycomb repressive complexes. In addition, it adopts inactive chromatin conformation and is associated with other inactive chromatin-specific proteins like SUV39H1 and HP1. The presence of DNMT3L DMC also influences the adjacent promoter to adopt repressive histone post-translational modifications. Due to its association with multiple layers of repressive epigenetic modifications, we believe that PRE within the DNMT3L DMC is responsible for the tight regulation of DNMT3L expression and the aberrant epigenetic modifications of this region leading to DNMT3L overexpression could be the reason of nuclear programming during carcinogenesis.

  6. Human Papillomavirus Virus-Like Particles Are Efficient Oral Immunogens when Coadministered with Escherichia coli Heat-Labile Enterotoxin Mutant R192G or CpG DNA

    PubMed Central

    Gerber, S.; Lane, C.; Brown, D. M.; Lord, E.; DiLorenzo, M.; Clements, J. D.; Rybicki, E.; Williamson, A.-L.; Rose, R. C.

    2001-01-01

    Certain human papillomaviruses (HPVs) cause most cervical cancer, which remains a significant source of morbidity and mortality among women worldwide. HPV recombinant virus-like particles (VLPs) are promising vaccine candidates for controlling anogenital HPV disease and are now being evaluated as a parenteral vaccine modality in human subjects. Vaccines formulated for injection generally are more costly, more difficult to administer, and less acceptable to recipients than are mucosally administered vaccines. Since oral delivery represents an attractive alternative to parenteral injection for large-scale human vaccination, the oral immunogenicity of HPV type 11 (HPV-11) VLPs in mice was previously investigated; it was found that a modest systemic neutralizing antibody response was induced (R. C. Rose, C. Lane, S. Wilson, J. A. Suzich, E. Rybicki, and A. L. Williamson, Vaccine 17:2129–2135, 1999). Here we examine whether VLPs of other genotypes may also be immunogenic when administered orally and whether mucosal adjuvants can be used to enhance VLP oral immunogenicity. We show that HPV-16 and HPV-18 VLPs are immunogenic when administered orally and that oral coadministration of these antigens with Escherichia coli heat-labile enterotoxin (LT) mutant R192G (LT R192G) or CpG DNA can significantly improve anti-VLP humoral responses in peripheral blood and in genital mucosal secretions. Our results also suggest that LT R192G may be superior to CpG DNA in this ability. These findings support the concept of oral immunization against anogenital HPV disease and suggest that clinical studies involving this approach may be warranted. PMID:11312347

  7. Effect of injection of antisense oligodeoxynucleotides of GAD isozymes into rat ventromedial hypothalamus on food intake and locomotor activity.

    PubMed

    Bannai, M; Ichikawa, M; Nishihara, M; Takahashi, M

    1998-02-16

    In the ventromedial hypothalamus (VMH), gamma-aminobutyric acid (GABA) plays a role in regulating feeding and running behaviors. The GABA synthetic enzyme, glutamic acid decarboxylase (GAD), consists of two isozymes, GAD65 and GAD67. In the present study, the phosphorothioated antisense oligodeoxynucleotides (ODNs) of each GAD isozyme were injected bilaterally into the VMH of male rats, and food intake, body weight and locomotor activity were monitored. ODNs were incorporated in the water-absorbent polymer (WAP, 0.2 nmol/microliter) so that ODNs were retained at the injection site. Each antisense ODN of GAD65 or GAD67 tended to reduce food intake on day 1 (day of injection=day 0) though not significantly. An injection combining both antisense ODNs significantly decreased food intake only on day 1, but body weight remained significantly lower than the control for 5 days. This suppression of body weight gain could be attributed to a significant increase in locomotor activity between days 3 and 5. Individual treatment with either ODNs did not change locomotor activity. The increase in daily locomotor activity in the group receiving the combined antisense ODNs occurred mainly during the light phase. Neither vehicle (WAP) nor control ODN affected food intake, body weight and locomotor activity. Histological studies indicated that antisense ODN distributed within 800 micron from the edge of the area where WAP was located 24 h after the injection gradually disappeared within days, but still remained within 300 micron m distance even 7 days after the injection. Antisense ODN was effectively incorporated by all the cell types examined, i.e., neurons, astrocytes and microglias. Further, HPLC analysis revealed that antisense ODNs of GAD isozymes, either alone or combined, decreased the content of GABA by 50% in VMH 24 h after the injection. These results indicate that suppression of GABA synthesis by either of the GAD isozymes is synergistically involved in suppressing food

  8. Integrative DNA methylation and gene expression analysis to assess the universality of the CpG island methylator phenotype.

    PubMed

    Moarii, Matahi; Reyal, Fabien; Vert, Jean-Philippe

    2015-10-13

    The CpG island methylator phenotype (CIMP) was first characterized in colorectal cancer but since has been extensively studied in several other tumor types such as breast, bladder, lung, and gastric. CIMP is of clinical importance as it has been reported to be associated with prognosis or response to treatment. However, the identification of a universal molecular basis to define CIMP across tumors has remained elusive. We perform a genome-wide methylation analysis of over 2000 tumor samples from 5 cancer sites to assess the existence of a CIMP with common molecular basis across cancers. We then show that the CIMP phenotype is associated with specific gene expression variations. However, we do not find a common genetic signature in all tissues associated with CIMP. Our results suggest the existence of a universal epigenetic and transcriptomic signature that defines the CIMP across several tumor types but does not indicate the existence of a common genetic signature of CIMP.

  9. CpG Island Methylator Phenotype and Prognosis of Colorectal Cancer in Northeast China

    PubMed Central

    Li, Xia; Hu, Fulan; Yao, Xiaoping; Zhang, Zuoming; Wang, Fan; Sun, Guizhi; Cui, Bin-Bin; Dong, Xinshu; Zhao, Yashuang

    2014-01-01

    Purpose. To investigate the association between CpG island methylator phenotype (CIMP) and the overall survival of sporadic colorectal cancer (CRC) in Northeast China. Methods. 282 sporadic CRC patients were recruited in this study. We selected MLH1, MGMT, p16, APC, MINT1, MINT31, and RUNX3 as the CIMP panel markers. The promoter methylation was assessed by methylation sensitive high resolution melting (MS-HRM). Proportional hazards-regression models were fitted with computing hazard ratios (HR) and the corresponding 95% confidence intervals (95% CI). Results. 12.77% (36/282) of patients were CIMP-0, 74.1% (209/282) of patients were CIMP-L, and 13.12% (37/282) of patients were CIMP-H. The five-year survival of the 282 CRC patients was 58%. There was significant association between APC gene promoter methylation and CRC overall survival (HR = 1.61; 95% CI: 1.05–2.46; P = 0.03). CIMP-H was significantly associated with worse prognosis compared to CIMP-0 (HR = 3.06; 95% CI: 1.19–7.89; P = 0.02) and CIMP-L (HR = 1.97; 95% CI: 1.11–3.48; P = 0.02), respectively. While comparing with the combine of CIMP-L and CIMP-0 (CIMP-L/0), CIMP-H also presented a worse prognosis (HR = 2.31; 95% CI: 1.02–5.24; P = 0.04). Conclusion. CIMP-H may be a predictor of a poor prognosis of CRC in Northeast China patients. PMID:25243122

  10. CpG island methylator phenotype and prognosis of colorectal cancer in Northeast China.

    PubMed

    Li, Xia; Hu, Fulan; Wang, Yibaina; Yao, Xiaoping; Zhang, Zuoming; Wang, Fan; Sun, Guizhi; Cui, Bin-Bin; Dong, Xinshu; Zhao, Yashuang

    2014-01-01

    To investigate the association between CpG island methylator phenotype (CIMP) and the overall survival of sporadic colorectal cancer (CRC) in Northeast China. 282 sporadic CRC patients were recruited in this study. We selected MLH1, MGMT, p16, APC, MINT1, MINT31, and RUNX3 as the CIMP panel markers. The promoter methylation was assessed by methylation sensitive high resolution melting (MS-HRM). Proportional hazards-regression models were fitted with computing hazard ratios (HR) and the corresponding 95% confidence intervals (95% CI). 12.77% (36/282) of patients were CIMP-0, 74.1% (209/282) of patients were CIMP-L, and 13.12% (37/282) of patients were CIMP-H. The five-year survival of the 282 CRC patients was 58%. There was significant association between APC gene promoter methylation and CRC overall survival (HR = 1.61; 95% CI: 1.05-2.46; P = 0.03). CIMP-H was significantly associated with worse prognosis compared to CIMP-0 (HR = 3.06; 95% CI: 1.19-7.89; P = 0.02) and CIMP-L (HR = 1.97; 95% CI: 1.11-3.48; P = 0.02), respectively. While comparing with the combine of CIMP-L and CIMP-0 (CIMP-L/0), CIMP-H also presented a worse prognosis (HR = 2.31; 95% CI: 1.02-5.24; P = 0.04). CIMP-H may be a predictor of a poor prognosis of CRC in Northeast China patients.

  11. Genetic polymorphisms in one-carbon metabolism: associations with CpG island methylator phenotype (CIMP) in colon cancer and the modifying effects of diet

    PubMed Central

    Curtin, Karen; Slattery, Martha L.; Ulrich, Cornelia M.; Bigler, Jeannette; Levin, Theodore R.; Wolff, Roger K.; Albertsen, Hans; Potter, John D.; Samowitz, Wade S.

    2008-01-01

    This study investigated associations between CpG island methylator phenotype (CIMP) colon cancer and genetic polymorphisms relevant to one-carbon metabolism and thus, potentially the provision of methyl groups and risk of colon cancer. Data from a large, population-based case–control study (916 incident colon cancer cases and 1972 matched controls) were used. Candidate polymorphisms in methylenetetrahydrofolate reductase (MTHFR), thymidylate synthase (TS), transcobalamin II (TCNII), methionine synthase (MTR), reduced folate carrier (RFC), methylene-tetrahydrofolate dehydrogenase 1 (MTHFD1), dihydrofolate reductase (DHFR) and alcohol dehydrogenase 3 (ADH3) were evaluated. CIMP− or CIMP+ phenotype was based on five CpG island markers: MINT1, MINT2, MINT31, p16 and MLH1. The influence of specific dietary factors (folate, methionine, vitamin B12 and alcohol) on these associations was also analyzed. We hypothesized that polymorphisms involved in the provision of methyl groups would be associated with CIMP+ tumors (two or more of five markers methylated), potentially modified by diet. Few associations specific to CIMP+ tumors were observed overall, which does not support the hypothesis that the provision of methyl groups is important in defining a methylator phenotype. However, our data suggest that genetic polymorphisms in MTHFR 1298A > C, interacting with diet, may be involved in the development of highly CpG-methylated colon cancers. AC and CC genotypes in conjunction with a high-risk dietary pattern (low folate and methionine intake and high alcohol use) were associated with CIMP+ (OR = 2.1, 95% CI = 1.3–3.4 versus AA/high risk; P-interaction = 0.03). These results provide only limited support for a role of polymorphisms in one-carbon metabolism in the etiology of CIMP colon cancer. PMID:17449906

  12. Genetic polymorphisms in one-carbon metabolism: associations with CpG island methylator phenotype (CIMP) in colon cancer and the modifying effects of diet.

    PubMed

    Curtin, Karen; Slattery, Martha L; Ulrich, Cornelia M; Bigler, Jeannette; Levin, Theodore R; Wolff, Roger K; Albertsen, Hans; Potter, John D; Samowitz, Wade S

    2007-08-01

    This study investigated associations between CpG island methylator phenotype (CIMP) colon cancer and genetic polymorphisms relevant to one-carbon metabolism and thus, potentially the provision of methyl groups and risk of colon cancer. Data from a large, population-based case-control study (916 incident colon cancer cases and 1,972 matched controls) were used. Candidate polymorphisms in methylenetetrahydrofolate reductase (MTHFR), thymidylate synthase (TS), transcobalamin II (TCNII), methionine synthase (MTR), reduced folate carrier (RFC), methylenetetrahydrofolate dehydrogenase 1 (MTHFD1), dihydrofolate reductase (DHFR) and alcohol dehydrogenase 3 (ADH3) were evaluated. CIMP- or CIMP+ phenotype was based on five CpG island markers: MINT1, MINT2, MINT31, p16 and MLH1. The influence of specific dietary factors (folate, methionine, vitamin B(12) and alcohol) on these associations was also analyzed. We hypothesized that polymorphisms involved in the provision of methyl groups would be associated with CIMP+ tumors (two or more of five markers methylated), potentially modified by diet. Few associations specific to CIMP+ tumors were observed overall, which does not support the hypothesis that the provision of methyl groups is important in defining a methylator phenotype. However, our data suggest that genetic polymorphisms in MTHFR 1,298A > C, interacting with diet, may be involved in the development of highly CpG-methylated colon cancers. AC and CC genotypes in conjunction with a high-risk dietary pattern (low folate and methionine intake and high alcohol use) were associated with CIMP+ (OR = 2.1, 95% CI = 1.3-3.4 versus AA/high risk; P-interaction = 0.03). These results provide only limited support for a role of polymorphisms in one-carbon metabolism in the etiology of CIMP colon cancer.

  13. DNA methylation at a bovine alpha satellite I repeat CpG site during development following fertilization and somatic cell nuclear transfer.

    PubMed

    Couldrey, Christine; Wells, David N

    2013-01-01

    Incomplete epigenetic reprogramming is postulated to contribute to the low developmental success following somatic cell nuclear transfer (SCNT). Here, we describe the epigenetic reprogramming of DNA methylation at an alpha satellite I CpG site (αsatI-5) during development of cattle generated either by artificial insemination (AI) or in vitro fertilization (IVF) and SCNT. Quantitative methylation analysis identified that SCNT donor cells were highly methylated at αsatI-5 and resulting SCNT blastocysts showed significantly more methylation than IVF blastocysts. At implantation, no difference in methylation was observed between SCNT and AI in trophoblast tissue at αsatI-5, however, SCNT embryos were significantly hyper-methylated compared to AI controls at this time point. Following implantation, DNA methylation at αsatI-5 decreased in AI but not SCNT placental tissues. In contrast to placenta, the proportion of methylation at αsatI-5 remained high in adrenal, kidney and muscle tissues during development. Differences in the average proportion of methylation were smaller in somatic tissues than placental tissues but, on average, SCNT somatic tissues were hyper-methylated at αsatI-5. Although sperm from all bulls was less methylated than somatic tissues at αsatI-5, on average this site remained hyper-methylated in sperm from cloned bulls compared with control bulls. This developmental time course confirms that epigenetic reprogramming does occur, at least to some extent, following SCNT. However, the elevated methylation levels observed in SCNT blastocysts and cellular derivatives implies that there is either insufficient time or abundance of appropriate reprogramming factors in oocytes to ensure complete reprogramming. Incomplete reprogramming at this CpG site may be a contributing factor to low SCNT success rates, but more likely represents the tip of the iceberg in terms of incompletely reprogramming. Until protocols ensure the epigenetic signature of a

  14. DNA Methylation at a Bovine Alpha Satellite I Repeat CpG Site during Development following Fertilization and Somatic Cell Nuclear Transfer

    PubMed Central

    Couldrey, Christine; Wells, David N.

    2013-01-01

    Incomplete epigenetic reprogramming is postulated to contribute to the low developmental success following somatic cell nuclear transfer (SCNT). Here, we describe the epigenetic reprogramming of DNA methylation at an alpha satellite I CpG site (αsatI-5) during development of cattle generated either by artificial insemination (AI) or in vitro fertilization (IVF) and SCNT. Quantitative methylation analysis identified that SCNT donor cells were highly methylated at αsatI-5 and resulting SCNT blastocysts showed significantly more methylation than IVF blastocysts. At implantation, no difference in methylation was observed between SCNT and AI in trophoblast tissue at αsatI-5, however, SCNT embryos were significantly hyper-methylated compared to AI controls at this time point. Following implantation, DNA methylation at αsatI-5 decreased in AI but not SCNT placental tissues. In contrast to placenta, the proportion of methylation at αsatI-5 remained high in adrenal, kidney and muscle tissues during development. Differences in the average proportion of methylation were smaller in somatic tissues than placental tissues but, on average, SCNT somatic tissues were hyper-methylated at αsatI-5. Although sperm from all bulls was less methylated than somatic tissues at αsatI-5, on average this site remained hyper-methylated in sperm from cloned bulls compared with control bulls. This developmental time course confirms that epigenetic reprogramming does occur, at least to some extent, following SCNT. However, the elevated methylation levels observed in SCNT blastocysts and cellular derivatives implies that there is either insufficient time or abundance of appropriate reprogramming factors in oocytes to ensure complete reprogramming. Incomplete reprogramming at this CpG site may be a contributing factor to low SCNT success rates, but more likely represents the tip of the iceberg in terms of incompletely reprogramming. Until protocols ensure the epigenetic signature of a

  15. Cpg-ODN, a TLR9 Agonist, Aggravates Myocardial Ischemia/Reperfusion Injury by Activation of TLR9-P38 MAPK Signaling.

    PubMed

    Xie, Liang; He, Songqing; Kong, Na; Zhu, Ying; Tang, Yi; Li, Jianhua; Liu, Zhengbing; Liu, Jing; Gong, Jianbin

    2018-06-19

    Toll-like receptors (TLRs) have been implicated in myocardial ischemia/ reperfusion (I/R) injury. We examined the effect of CpG-oligodeoxynucleotide (ODN) on myocardial I/R injury. Male Sprague-Dawley rats were treated with either CpG-ODN or control ODN 1 h prior to myocardial ischemia (30 min) followed by reperfusion. Rats treated with phosphate-buffered saline (PBS) served as I/R controls (n = 8/group). Infarct size was determined by 2,3,5-triphenyltetrazolium chloride and Evans blue straining. Cardiac function was examined by echocardiography before and up to 14 days after myocardial I/R. CpG-ODN administration significantly increased infarct size and reduced cardiac function and survival rate after myocardial I/R, compared to the PBS-treated I/R group. Control-ODN did not alter I/R-induced myocardial infarct size, cardiac dysfunction, and survival rate. Additionally, CpG-ODN promoted I/R-induced myocardial apoptosis and cleaved caspase-3 levels in the myocardium. CpG-ODN increased TLR9 activation and p38 phosphorylation in the myocardium. In vitro data also suggested that CpG-ODN treatment induced TLR9 activation and p38 phosphorylation. Importantly, p38 mitogen-activated protein kinase (MAPK) inhibition abolished CpG-ODN-induced cardiac injury. CpG-ODN, the TLR9 ligand, accelerates myocardial I/R injury. The mechanisms involve activation of the TLR9-p38 MAPK signaling pathway. © 2018 The Author(s). Published by S. Karger AG, Basel.

  16. Bacterial avirulence genes.

    PubMed

    Leach, J E; White, F F

    1996-01-01

    Although more than 30 bacterial avirulence genes have been cloned and characterized, the function of the gene products in the elictitation of resistance is unknown in all cases but one. The product of avrD from Pseudomonas syringae pv. glycinea likely functions indirectly to elicit resistance in soybean, that is, evidence suggests the gene product is an enzyme involved in elicitor production. In most if not all cases, bacterial avirulence gene function is dependent on interactions with the hypersensitive response and pathogenicity (hrp) genes. Many hrp genes are similar to genes involved in delivery of pathogenicity factors in mammalian bacterial pathogens. Thus, analogies between mammalian and plant pathogens may provide needed clues to elucidate how virulence gene products control induction of resistance.

  17. Seamless Genetic Conversion of SMN2 to SMN1 via CRISPR/Cpf1 and Single-Stranded Oligodeoxynucleotides in Spinal Muscular Atrophy Patient-Specific Induced Pluripotent Stem Cells.

    PubMed

    Zhou, Miaojin; Hu, Zhiqing; Qiu, Liyan; Zhou, Tao; Feng, Mai; Hu, Qian; Zeng, Baitao; Li, Zhuo; Sun, Qianru; Wu, Yong; Liu, Xionghao; Wu, Lingqian; Liang, Desheng

    2018-05-09

    Spinal muscular atrophy (SMA) is a kind of neuromuscular disease characterized by progressive motor neuron loss in the spinal cord. It is caused by mutations in the survival motor neuron 1 (SMN1) gene. SMN1 has a paralogous gene, survival motor neuron 2 (SMN2), in humans that is present in almost all SMA patients. The generation and genetic correction of SMA patient-specific induced pluripotent stem cells (iPSCs) is a viable, autologous therapeutic strategy for the disease. Here, c-Myc-free and non-integrating iPSCs were generated from the urine cells of an SMA patient using an episomal iPSC reprogramming vector, and a unique crRNA was designed that does not have similar sequences (≤3 mismatches) anywhere in the human reference genome. In situ gene conversion of the SMN2 gene to an SMN1-like gene in SMA-iPSCs was achieved using CRISPR/Cpf1 and single-stranded oligodeoxynucleotide with a high efficiency of 4/36. Seamlessly gene-converted iPSC lines contained no exogenous sequences and retained a normal karyotype. Significantly, the SMN expression and gems localization were rescued in the gene-converted iPSCs and their derived motor neurons. This is the first report of an efficient gene conversion mediated by Cpf1 homology-directed repair in human cells and may provide a universal gene therapeutic approach for most SMA patients.

  18. Bacterial pneumonia as an influenza complication.

    PubMed

    Martin-Loeches, Ignacio; van Someren Gréve, Frank; Schultz, Marcus J

    2017-04-01

    The pathogenesis and impact of coinfection, in particular bacterial coinfection, in influenza are incompletely understood. This review summarizes results from studies on bacterial coinfection in the recent pandemic influenza outbreak. Systemic immune mechanisms play a key role in the development of coinfection based on the complexity of the interaction of the host and the viral and bacterial pathogens. Several studies were performed to determine the point prevalence of bacterial coinfection in influenza. Coinfection in influenza is frequent in critically ill patients with Streptococcus pneumoniae being the most frequent bacterial pathogen and higher rates of potentially resistant pathogens over the years. Bacterial pneumonia is certainly an influenza complication. The recent epidemiology findings have helped to partially resolve the contribution of different pathogens. Immunosuppression is a risk factor for bacterial coinfection in influenza, and the epidemiology of coinfection has changed over the years during the last influenza pandemic, and these recent findings should be taken into account during present outbreaks.

  19. Zoonotic bacterial meningitis in human adults.

    PubMed

    van Samkar, Anusha; Brouwer, Matthijs C; van der Ende, Arie; van de Beek, Diederik

    2016-09-13

    To describe the epidemiology, etiology, clinical characteristics, treatment, outcome, and prevention of zoonotic bacterial meningitis in human adults. We identified 16 zoonotic bacteria causing meningitis in adults. Zoonotic bacterial meningitis is uncommon compared to bacterial meningitis caused by human pathogens, and the incidence has a strong regional distribution. Zoonotic bacterial meningitis is mainly associated with animal contact, consumption of animal products, and an immunocompromised state of the patient. In a high proportion of zoonotic bacterial meningitis cases, CSF analysis showed only a mildly elevated leukocyte count. The recommended antibiotic therapy differs per pathogen, and the overall mortality is low. Zoonotic bacterial meningitis is uncommon but is associated with specific complications. The suspicion should be raised in patients with bacterial meningitis who have recreational or professional contact with animals and in patients living in regions endemic for specific zoonotic pathogens. An immunocompromised state is associated with a worse prognosis. Identification of risk factors and underlying disease is necessary to improve treatment. © 2016 American Academy of Neurology.

  20. Community-acquired bacterial meningitis.

    PubMed

    Costerus, Joost M; Brouwer, Matthijs C; Bijlsma, Merijn W; van de Beek, Diederik

    2017-02-01

    Bacterial meningitis is a medical emergency and is associated with a high disease burden. We reviewed recent progress in the management of patients with community-acquired bacterial meningitis. The worldwide burden of disease of bacterial meningitis remains high, despite the decreasing incidence following introduction of routine vaccination campaigns. Delay in diagnosis and treatment remain major concerns in the management of acute bacterial meningitis. European Society of Clinical Microbiology and Infectious Diseases guidelines strive for a door-to-antibiotic-time less than 1 h. Polymerase chain reaction (PCR) has emerged as an important diagnostic tool to identify the causative organism. Point-of-care tests using fast multiplex PCR have been developed, but additional value has not been proven. Although anecdotal observations advocate pressure-based management, a randomized controlled trial will need to be performed first to determine efficacy and safety of such an aggressive treatment approach. Adjunctive dexamethasone remains the only adjunctive therapy with proven efficacy. The incidence of bacterial meningitis has been decreasing after the implementation of effective vaccines. Treatment should be administered as soon as possible and time to treatment should not exceed 1 h.

  1. [Spontaneous bacterial peritonitis].

    PubMed

    Velkey, Bálint; Vitális, Eszter; Vitális, Zsuzsanna

    2017-01-01

    Spontaneous bacterial peritonitis occurs most commonly in cirrhotic patients with ascites. Pathogens get into the circulation by intestinal translocation and colonize in peritoneal fluid. Diagnosis of spontaneous bacterial peritonitis is based on elevated polymorphonuclear leukocyte count in the ascites (>0,25 G/L). Ascites culture is often negative but aids to get information about antibiotic sensitivity in positive cases. Treatment in stable patient can be intravenous then orally administrated ciprofloxacin or amoxicillin/clavulanic acid, while in severe cases intravenous III. generation cephalosporin. Nosocomial spontaneous bacterial peritonitis often caused by Gram-positive bacteria and multi-resistant pathogens can also be expected thus carbapenem should be the choice of the empiric treatment. Antibiotic prophylaxis should be considered. Norfloxacin is used most commonly, but changes are expected due to increase in quinolone resistance. As a primary prophylaxis, a short-term antibiotic treatment is recommended after gastrointestinal bleeding for 5 days, while long-term prophylaxis is for patients with low ascites protein, and advanced disease (400 mg/day). Secondary prophylaxis is recommended for all patients recovered from spontaneous bacterial peritonitis. Due to increasing antibiotic use of antibiotics prophylaxis is debated to some degree. Orv. Hetil., 2017, 158(2), 50-57.

  2. DNA methylation of intragenic CpG islands depends on their transcriptional activity during differentiation and disease

    PubMed Central

    Jeziorska, Danuta M.; Murray, Robert J. S.; De Gobbi, Marco; Gaentzsch, Ricarda; Garrick, David; Ayyub, Helena; Chen, Taiping; Li, En; Telenius, Jelena; Lynch, Magnus; Graham, Bryony; Smith, Andrew J. H.; Lund, Jonathan N.; Hughes, Jim R.; Higgs, Douglas R.

    2017-01-01

    The human genome contains ∼30,000 CpG islands (CGIs). While CGIs associated with promoters nearly always remain unmethylated, many of the ∼9,000 CGIs lying within gene bodies become methylated during development and differentiation. Both promoter and intragenic CGIs may also become abnormally methylated as a result of genome rearrangements and in malignancy. The epigenetic mechanisms by which some CGIs become methylated but others, in the same cell, remain unmethylated in these situations are poorly understood. Analyzing specific loci and using a genome-wide analysis, we show that transcription running across CGIs, associated with specific chromatin modifications, is required for DNA methyltransferase 3B (DNMT3B)-mediated DNA methylation of many naturally occurring intragenic CGIs. Importantly, we also show that a subgroup of intragenic CGIs is not sensitive to this process of transcription-mediated methylation and that this correlates with their individual intrinsic capacity to initiate transcription in vivo. We propose a general model of how transcription could act as a primary determinant of the patterns of CGI methylation in normal development and differentiation, and in human disease. PMID:28827334

  3. Effects of low-dose aspirin on maternal blood pressure and vascular function in an experimental model of gestational hypertension.

    PubMed

    Osikoya, Oluwatobiloba; Jaini, Paresh A; Nguyen, An; Valdes, Melissa; Goulopoulou, Styliani

    2017-06-01

    Daily intake of low-dose aspirin after 12weeks of gestation is currently recommended as a preventative intervention in pregnancies in high risk of developing preeclampsia. This recommendation is based on epidemiological evidence, whereas experimental studies investigating the exact mechanisms of aspirin action during pregnancy are lacking. We previously showed that treating pregnant rats with a synthetic mimetic of unmethylated CpG DNA (bacterial DNA) caused preeclampsia-like characteristics such as maternal hypertension and increased cyclooxygenase (COX) expression and activity. In this study, we tested the hypothesis that daily maternal treatment with low-dose aspirin would prevent the development of maternal hypertension, reduce COX activity and thromboxane A 2 (TxA 2 ) production, and improve maternal vascular function in pregnant rats exposed to CpG ODN during gestation. Pregnant rats were treated with ODN2395 (synthetic CpG DNA) or saline (vehicle) on gestational days (GD) 14, 16, 18. Daily low-dose aspirin treatment (1.5mg/kgBW) started on GD10 and continued throughout gestation. Pregnant rats treated with ODN2395 had greater systolic blood pressure compared to controls (120±4mmHg vs. 100±5mmHg, p=0.03) and aspirin did not prevent this increase (p=0.86). Aspirin prevented ODN2395-induced increases of TxB 2 (TxA 2 metabolite) in serum and mesenteric arteries. ODN2395 increased expression of COX-1 and COX-2 in mesenteric and uterine arteries and aspirin abolished these effects. Aspirin reduced contractile responses to phenylephrine and U46619 (TxA 2 mimetic) in mesenteric arteries from control rats but not from ODN2395-treated rats. In conclusion, treatment with low-dose aspirin reduced systemic and vascular COX expression and activity but did not prevent the development of maternal hypertension induced by exposure to unmethylated CpG DNA (bacterial DNA). Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Studies into the microbial spectrum of apical periodontitis.

    PubMed

    Brauner, A W; Conrads, G

    1995-09-01

    This study examined the variety of obligate and facultative anaerobic bacterial species recovered from cases of acute apical periodontitis. A total of 19 root canal samples and 24 periapical granuloma samples were taken from patients suffering pain and discomfort. Bacteria were identified by applying the following techniques: culturing on various media, Gram-staining and using commercially available biochemical test strips. In addition, Prevotella intermedia and Porphyromonas endodontalis were differentiated on a molecular genetic level using species-specific oligodeoxynucleotide probes. The most frequently identified bacteria were Prevotella intermedia, Bifidobacterium spp., Streptococcus sanguis, Streptococcus milleri-group and Bacteroides spp. Obligate anaerobes occurred at a rate of 82.3%, and the average number of isolates was 6.4 per sample.

  5. Diagnosis of bacterial vaginosis by wet mount identification of bacterial morphotypes in vaginal fluid.

    PubMed

    Schmidt, H; Hansen, J G

    2000-03-01

    In order to develop a more practical way of diagnosing bacterial vaginosis (BV), we evaluated a scoring system, weighting small bacterial morphotypes versus lactobacillary morphotypes in wet mounts, assessed criteria for BV and normalcy from this scoring, and then evaluated their reproducibility and accuracy. We examined 754 women for pH, homogeneous vaginal discharge, amine odour, clue cells and the composite clinical diagnosis. We also examined wet mounts for small bacterial morphotypes and lactobacillary morphotypes, and weighted their quantitative presence as a bacterial morphotype score. The term 'small bacterial morphotypes' denotes a group of small bacillary forms comprising coccobacilli, tiny rods, and mobile curved rods. The different characteristics of BV were all gradually associated with increased bacterial morphotype scoring. We deemed a score of 0-1 as normal, 2-4 as intermediate phase, grade I, 5-6 as intermediate phase, grade II, and 7-8 indicative of BV. Reproducibility of the interpretation was high, both for the new grading system (weighted Kappa 0.90 in women perceiving and 0.81 in women not perceiving abnormal vaginal discharge) and for the new criterion for BV (non-weighted Kappa 0.91 and 0.84 in the 2 groups of women). The new criterion also proved highly concurrent with the composite clinical diagnosis (Kappa 0.91 and 0.81 in the 2 groups). In conclusion, the wet mount bacterial morphotype scoring is valid for grading of the disorder of the vaginal microbial ecosystem, and the new criterion for BV a more practical option than existing diagnostic methods.

  6. Insight into the effects of different cropping systems on soil bacterial community and tobacco bacterial wilt rate.

    PubMed

    Niu, Jiaojiao; Chao, Jin; Xiao, Yunhua; Chen, Wu; Zhang, Chao; Liu, Xueduan; Rang, Zhongwen; Yin, Huaqun; Dai, Linjian

    2017-01-01

    Rotation is an effective strategy to control crop disease and improve plant health. However, the effects of crop rotation on soil bacterial community composition and structure, and crop health remain unclear. In this study, using 16S rRNA gene sequencing, we explored the soil bacterial communities under four different cropping systems, continuous tobacco cropping (control group), tobacco-maize rotation, tobacco-lily rotation, and tobacco-turnip rotation. Results of detrended correspondence analysis and dissimilarity tests showed that soil bacterial community composition and structure changed significantly among the four groups, such that Acidobacteria and Actinobacteria were more abundant in the maize rotation group (16.6 and 11.5%, respectively) than in the control (8.5 and 7.1%, respectively). Compared with the control group (57.78%), maize and lily were effective rotation crops in controlling tobacco bacterial wilt (about 23.54 and 48.67%). On the other hand, tobacco bacterial wilt rate was increased in the turnip rotation (59.62%) relative to the control. Further study revealed that the abundances of several bacterial populations were directly correlated with tobacco bacterial wilt. For example, Acidobacteria and Actinobacteria were significantly negatively correlated to the tobacco bacterial wilt rate, so they may be probiotic bacteria. Canonical correspondence analysis showed that soil pH and calcium content were key factors in determining soil bacterial communities. In conclusion, our study revealed the composition and structure of bacterial communities under four different cropping systems and may unveil molecular mechanisms for the interactions between soil microorganisms and crop health. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Growth of Bacterial Colonies

    NASA Astrophysics Data System (ADS)

    Warren, Mya; Hwa, Terence

    2013-03-01

    On hard agar gel, there is insufficient surface hydration for bacteria to swim or swarm. Instead, growth occurs in colonies of close-packed cells, which expand purely due to repulsive interactions: individual bacteria push each other out of the way through the force of their growth. In this way, bacterial colonies represent a new type of ``active'' granular matter. In this study, we investigate the physical, biochemical, and genetic elements that determine the static and dynamic aspects of this mode of bacterial growth for E. coli. We characterize the process of colony expansion empirically, and use discrete and continuum models to examine the extent to which our observations can be explained by the growth characteristics of non-communicating cells, coupled together by physical forces, nutrients, and waste products. Our results challenge the commonly accepted modes of bacterial colony growth and provide insight into sources of growth limitation in crowded bacterial communities.

  8. Periodic growth of bacterial colonies

    NASA Astrophysics Data System (ADS)

    Yamazaki, Yoshihiro; Ikeda, Takemasa; Shimada, Hirotoshi; Hiramatsu, Fumiko; Kobayashi, Naoki; Wakita, Jun-ichi; Itoh, Hiroto; Kurosu, Sayuri; Nakatsuchi, Michio; Matsuyama, Tohey; Matsushita, Mitsugu

    2005-06-01

    The formation of concentric ring colonies by bacterial species Bacillus subtilis and Proteus mirabilis has been investigated experimentally, focusing our attention on the dependence of local cell density upon the bacterial motility. It has been confirmed that these concentric ring colonies reflect the periodic change of the bacterial motility between motile cell state and immotile cell state. We conclude that this periodic change is macroscopically determined neither by biological factors (i.e., biological clock) nor by chemical factors (chemotaxis as inhibitor). And our experimental results strongly suggest that the essential factor for the change of the bacterial motility during concentric ring formation is the local cell density.

  9. Nanoparticle Approaches against Bacterial Infections

    PubMed Central

    Gao, Weiwei; Thamphiwatana, Soracha; Angsantikul, Pavimol; Zhang, Liangfang

    2014-01-01

    Despite the wide success of antibiotics, the treatment of bacterial infection still faces significant challenges, particularly the emergence of antibiotic resistance. As a result, nanoparticle drug delivery platforms including liposomes, polymeric nanoparticles, dendrimers, and various inorganic nanoparticles have been increasingly exploited to enhance the therapeutic effectiveness of existing antibiotics. This review focuses on areas where nanoparticle approaches hold significant potential to advance the treatment of bacterial infection. These areas include targeted antibiotic delivery, environmentally responsive antibiotic delivery, combinatorial antibiotic delivery, nanoparticle-enabled antibacterial vaccination, and nanoparticle-based bacterial detection. In each area we highlight the innovative antimicrobial nanoparticle platforms and review their progress made against bacterial infections. PMID:25044325

  10. Bacterial symbionts and natural products.

    PubMed

    Crawford, Jason M; Clardy, Jon

    2011-07-21

    The study of bacterial symbionts of eukaryotic hosts has become a powerful discovery engine for chemistry. This highlight looks at four case studies that exemplify the range of chemistry and biology involved in these symbioses: a bacterial symbiont of a fungus and a marine invertebrate that produce compounds with significant anticancer activity, and bacterial symbionts of insects and nematodes that produce compounds that regulate multilateral symbioses.

  11. Postviral Complications: Bacterial Pneumonia.

    PubMed

    Prasso, Jason E; Deng, Jane C

    2017-03-01

    Secondary bacterial pneumonia after viral respiratory infection remains a significant source of morbidity and mortality. Susceptibility is mediated by a variety of viral and bacterial factors, and complex interactions with the host immune system. Prevention and treatment strategies are limited to influenza vaccination and antibiotics/antivirals respectively. Novel approaches to identifying the individuals with influenza who are at increased risk for secondary bacterial pneumonias are urgently needed. Given the threat of further pandemics and the heightened prevalence of these viruses, more research into the immunologic mechanisms of this disease is warranted with the hope of discovering new potential therapies. Published by Elsevier Inc.

  12. Community-acquired bacterial meningitis.

    PubMed

    van de Beek, Diederik; Brouwer, Matthijs; Hasbun, Rodrigo; Koedel, Uwe; Whitney, Cynthia G; Wijdicks, Eelco

    2016-11-03

    Meningitis is an inflammation of the meninges and subarachnoid space that can also involve the brain cortex and parenchyma. It can be acquired spontaneously in the community - community-acquired bacterial meningitis - or in the hospital as a complication of invasive procedures or head trauma (nosocomial bacterial meningitis). Despite advances in treatment and vaccinations, community-acquired bacterial meningitis remains one of the most important infectious diseases worldwide. Streptococcus pneumoniae and Neisseria meningitidis are the most common causative bacteria and are associated with high mortality and morbidity; vaccines targeting these organisms, which have designs similar to the successful vaccine that targets Haemophilus influenzae type b meningitis, are now being used in many routine vaccination programmes. Experimental and genetic association studies have increased our knowledge about the pathogenesis of bacterial meningitis. Early antibiotic treatment improves the outcome, but the growing emergence of drug resistance as well as shifts in the distribution of serotypes and groups are fuelling further development of new vaccines and treatment strategies. Corticosteroids were found to be beneficial in high-income countries depending on the bacterial species. Further improvements in the outcome are likely to come from dampening the host inflammatory response and implementing preventive measures, especially the development of new vaccines.

  13. Messing with Bacterial Quorum Sensing

    PubMed Central

    González, Juan E.; Keshavan, Neela D.

    2006-01-01

    Quorum sensing is widely recognized as an efficient mechanism to regulate expression of specific genes responsible for communal behavior in bacteria. Several bacterial phenotypes essential for the successful establishment of symbiotic, pathogenic, or commensal relationships with eukaryotic hosts, including motility, exopolysaccharide production, biofilm formation, and toxin production, are often regulated by quorum sensing. Interestingly, eukaryotes produce quorum-sensing-interfering (QSI) compounds that have a positive or negative influence on the bacterial signaling network. This eukaryotic interference could result in further fine-tuning of bacterial quorum sensing. Furthermore, recent work involving the synthesis of structural homologs to the various quorum-sensing signal molecules has resulted in the development of additional QSI compounds that could be used to control pathogenic bacteria. The creation of transgenic plants that express bacterial quorum-sensing genes is yet another strategy to interfere with bacterial behavior. Further investigation on the manipulation of quorum-sensing systems could provide us with powerful tools against harmful bacteria. PMID:17158701

  14. Expression of metastasis suppressor gene AES driven by a Yin Yang (YY) element in a CpG island promoter and transcription factor YY2.

    PubMed

    Kakizaki, Fumihiko; Sonoshita, Masahiro; Miyoshi, Hiroyuki; Itatani, Yoshiro; Ito, Shinji; Kawada, Kenji; Sakai, Yoshiharu; Taketo, M Mark

    2016-11-01

    We recently found that the product of the AES gene functions as a metastasis suppressor of colorectal cancer (CRC) in both humans and mice. Expression of amino-terminal enhancer of split (AES) protein is significantly decreased in liver metastatic lesions compared with primary colon tumors. To investigate its downregulation mechanism in metastases, we searched for transcriptional regulators of AES in human CRC and found that its expression is reduced mainly by transcriptional dysregulation and, in some cases, by additional haploidization of its coding gene. The AES promoter-enhancer is in a typical CpG island, and contains a Yin-Yang transcription factor recognition sequence (YY element). In human epithelial cells of normal colon and primary tumors, transcription factor YY2, a member of the YY family, binds directly to the YY element, and stimulates expression of AES. In a transplantation mouse model of liver metastases, however, expression of Yy2 (and therefore of Aes) is downregulated. In human CRC metastases to the liver, the levels of AES protein are correlated with those of YY2. In addition, we noticed copy-number reduction for the AES coding gene in chromosome 19p13.3 in 12% (5/42) of human CRC cell lines. We excluded other mechanisms such as point or indel mutations in the coding or regulatory regions of the AES gene, CpG methylation in the AES promoter enhancer, expression of microRNAs, and chromatin histone modifications. These results indicate that Aes may belong to a novel family of metastasis suppressors with a CpG-island promoter enhancer, and it is regulated transcriptionally. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  15. Bacterial 'immunity' against bacteriophages.

    PubMed

    Abedon, Stephen T

    2012-01-01

    Vertebrate animals possess multiple anti-pathogen defenses. Individual mechanisms usually are differentiated into those that are immunologically adaptive vs. more "primitive" anti-pathogen phenomena described as innate responses. Here I frame defenses used by bacteria against bacteriophages as analogous to these animal immune functions. Included are numerous anti-phage defenses in addition to the adaptive immunity associated with CRISPR/cas systems. As these other anti-pathogen mechanisms are non-adaptive they can be described as making up an innate bacterial immunity. This exercise was undertaken in light of the recent excitement over the discovery that CRISPR/cas systems can serve, as noted, as a form of bacterial adaptive immunity. The broader goal, however, is to gain novel insight into bacterial defenses against phages by fitting these mechanisms into considerations of how multicellular organisms also defend themselves against pathogens. This commentary can be viewed in addition as a bid toward integrating these numerous bacterial anti-phage defenses into a more unified immunology.

  16. Bacterial meningitis - principles of antimicrobial treatment.

    PubMed

    Jawień, Miroslaw; Garlicki, Aleksander M

    2013-01-01

    Bacterial meningitis is associated with significant morbidity and mortality despite the availability of effective antimicrobial therapy. The management approach to patients with suspected or proven bacterial meningitis includes emergent cerebrospinal fluid analysis and initiation of appropriate antimicrobial and adjunctive therapies. The choice of empirical antimicrobial therapy is based on the patient's age and underlying disease status; once the infecting pathogen is isolated, antimicrobial therapy can be modified for optimal treatment. Successful treatment of bacterial meningitis requires the knowledge on epidemiology including prevalence of antimicrobial resistant pathogens, pathogenesis of meningitis, pharmacokinetics and pharmacodynamics of antimicrobial agents. The emergence of antibiotic-resistant bacterial strains in recent years has necessitated the development of new strategies for empiric antimicrobial therapy for bacterial meningitis.

  17. Sequence-Specific Affinity Chromatography of Bacterial Small Regulatory RNA-Binding Proteins from Bacterial Cells.

    PubMed

    Gans, Jonathan; Osborne, Jonathan; Cheng, Juliet; Djapgne, Louise; Oglesby-Sherrouse, Amanda G

    2018-01-01

    Bacterial small RNA molecules (sRNAs) are increasingly recognized as central regulators of bacterial stress responses and pathogenesis. In many cases, RNA-binding proteins are critical for the stability and function of sRNAs. Previous studies have adopted strategies to genetically tag an sRNA of interest, allowing isolation of RNA-protein complexes from cells. Here we present a sequence-specific affinity purification protocol that requires no prior genetic manipulation of bacterial cells, allowing isolation of RNA-binding proteins bound to native RNA molecules.

  18. Gut-derived commensal bacterial products inhibit liver dendritic cell maturation by stimulating hepatic interleukin-6/signal transducer and activator of transcription 3 activity.

    PubMed

    Lunz, John G; Specht, Susan M; Murase, Noriko; Isse, Kumiko; Demetris, Anthony J

    2007-12-01

    Intraorgan dendritic cells (DCs) monitor the environment and help translate triggers of innate immunity into adaptive immune responses. Liver-based DCs are continually exposed, via gut-derived portal venous blood, to potential antigens and bacterial products that can trigger innate immunity. However, somehow the liver avoids a state of perpetual inflammation and protects central immune organs from overstimulation. In this study, we tested the hypothesis that hepatic interleukin-6 (IL-6)/signal transducer and activator of transcription 3 (STAT3) activity increases the activation/maturation threshold of hepatic DCs toward innate immune signals. The results show that the liver nuclear STAT3 activity is significantly higher than that of other organs and is IL-6-dependent. Hepatic DCs in normal IL-6 wild-type (IL-6(+/+)) mice are phenotypically and functionally less mature than DCs from IL-6-deficient (IL-6(-/-)) or STAT3-inhibited IL-6(+/+) mice, as determined by surface marker expression, proinflammatory cytokine secretion, and allogeneic T-cell stimulation. IL-6(+/+) liver DCs produce IL-6 in response to exposure to lipopolysaccharide (LPS) and cytidine phosphate guanosine oligonucleotides (CpG) but are resistant to maturation compared with IL-6(-/-) liver DCs. Conversely, exogenous IL-6 inhibits LPS-induced IL-6(-/-) liver DC maturation. IL-6/STAT3 signaling influences the liver DC expression of toll-like receptor 9 and IL-1 receptor associated kinase-M. The depletion of gut commensal bacteria in IL-6(+/+) mice with oral antibiotics decreased portal blood endotoxin levels, lowered the expression of IL-6 and phospho-STAT3, and significantly increased liver DC maturation. Gut-derived bacterial products, by stimulating hepatic IL-6/STAT3 signaling, inhibit hepatic DC activation/maturation and thereby elevate the threshold needed for translating triggers of innate immunity into adaptive immune responses. Manipulating gut bacteria may therefore be an effective strategy

  19. Bacterial detection: from microscope to smartphone.

    PubMed

    Gopinath, Subash C B; Tang, Thean-Hock; Chen, Yeng; Citartan, Marimuthu; Lakshmipriya, Thangavel

    2014-10-15

    The ubiquitous nature of bacteria enables them to survive in a wide variety of environments. Hence, the rise of various pathogenic species that are harmful to human health raises the need for the development of accurate sensing systems. Sensing systems are necessary for diagnosis and epidemiological control of pathogenic organism, especially in the food-borne pathogen and sanitary water treatment facility' bacterial populations. Bacterial sensing for the purpose of diagnosis can function in three ways: bacterial morphological visualization, specific detection of bacterial component and whole cell detection. This paper provides an overview of the currently available bacterial detection systems that ranges from microscopic observation to state-of-the-art smartphone-based detection. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Spatial distribution of marine airborne bacterial communities

    PubMed Central

    Seifried, Jasmin S; Wichels, Antje; Gerdts, Gunnar

    2015-01-01

    The spatial distribution of bacterial populations in marine bioaerosol samples was investigated during a cruise from the North Sea to the Baltic Sea via Skagerrak and Kattegat. The analysis of the sampled bacterial communities with a pyrosequencing approach revealed that the most abundant phyla were represented by the Proteobacteria (49.3%), Bacteroidetes (22.9%), Actinobacteria (16.3%), and Firmicutes (8.3%). Cyanobacteria were assigned to 1.5% of all bacterial reads. A core of 37 bacterial OTUs made up more than 75% of all bacterial sequences. The most abundant OTU was Sphingomonas sp. which comprised 17% of all bacterial sequences. The most abundant bacterial genera were attributed to distinctly different areas of origin, suggesting highly heterogeneous sources for bioaerosols of marine and coastal environments. Furthermore, the bacterial community was clearly affected by two environmental parameters – temperature as a function of wind direction and the sampling location itself. However, a comparison of the wind directions during the sampling and calculated backward trajectories underlined the need for more detailed information on environmental parameters for bioaerosol investigations. The current findings support the assumption of a bacterial core community in the atmosphere. They may be emitted from strong aerosolizing sources, probably being mixed and dispersed over long distances. PMID:25800495

  1. Bacterial membrane proteomics.

    PubMed

    Poetsch, Ansgar; Wolters, Dirk

    2008-10-01

    About one quarter to one third of all bacterial genes encode proteins of the inner or outer bacterial membrane. These proteins perform essential physiological functions, such as the import or export of metabolites, the homeostasis of metal ions, the extrusion of toxic substances or antibiotics, and the generation or conversion of energy. The last years have witnessed completion of a plethora of whole-genome sequences of bacteria important for biotechnology or medicine, which is the foundation for proteome and other functional genome analyses. In this review, we discuss the challenges in membrane proteome analysis, starting from sample preparation and leading to MS-data analysis and quantification. The current state of available proteomics technologies as well as their advantages and disadvantages will be described with a focus on shotgun proteomics. Then, we will briefly introduce the most abundant proteins and protein families present in bacterial membranes before bacterial membrane proteomics studies of the last years will be presented. It will be shown how these works enlarged our knowledge about the physiological adaptations that take place in bacteria during fine chemical production, bioremediation, protein overexpression, and during infections. Furthermore, several examples from literature demonstrate the suitability of membrane proteomics for the identification of antigens and different pathogenic strains, as well as the elucidation of membrane protein structure and function.

  2. Molecular diagnosis of bacterial vaginosis: Does adjustment for total bacterial load or human cellular content improve diagnostic performance?

    PubMed

    Plummer, E L; Garland, S M; Bradshaw, C S; Law, M G; Vodstrcil, L A; Hocking, J S; Fairley, C K; Tabrizi, S N

    2017-02-01

    We investigated the utility of quantitative PCR assays for diagnosis of bacterial vaginosis and found that while the best model utilized bacterial copy number adjusted for total bacterial load (sensitivity=98%, specificity=93%, AUC=0.95[95%CI=0.93,0.97]), adjusting for total bacterial or human cell load did not consistently increase the diagnostic performance of the assays. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Arsenic uptake in bacterial calcite

    NASA Astrophysics Data System (ADS)

    Catelani, Tiziano; Perito, Brunella; Bellucci, Francesco; Lee, Sang Soo; Fenter, Paul; Newville, Matthew; Rimondi, Valentina; Pratesi, Giovanni; Costagliola, Pilario

    2018-02-01

    Bio-mediated processes for arsenic (As) uptake in calcite were investigated by means of X-ray Diffraction (XRD) and X-ray Absorption Spectroscopy (XAS) coupled with X-ray Fluorescence measurements. The environmental bacterial strain Bacillus licheniformis BD5, sampled at the Bullicame Hot Springs (Viterbo, Central Italy), was used to synthesize calcite from As-enriched growth media. Both liquid and solid cultures were applied to simulate planktonic and biofilm community environments, respectively. Bacterial calcite samples cultured in liquid media had an As enrichment factor (Kd) 50 times higher than that from solid media. The XRD analysis revealed an elongation of the crystal lattice along the c axis (by 0.03 Å) for biogenic calcite, which likely resulted from the substitution of larger arsenate for carbonate in the crystal. The XAS data also showed a clear difference in the oxidation state of sorbed As between bacterial and abiotic calcite. Abiotic chemical processes yielded predominantly As(V) uptake whereas bacterial precipitation processes led to the uptake of both As(III) and As(V). The presence of As(III) in bacterial calcite is proposed to result from subsequent reduction of arsenate to arsenite by bacterial activities. To the best of our knowledge, this is the first experimental observation of the incorporation of As(III) in the calcite crystal lattice, revealing a critical role of biochemical processes for the As cycling in nature.

  4. Profile analysis and prediction of tissue-specific CpG island methylation classes

    PubMed Central

    2009-01-01

    Background The computational prediction of DNA methylation has become an important topic in the recent years due to its role in the epigenetic control of normal and cancer-related processes. While previous prediction approaches focused merely on differences between methylated and unmethylated DNA sequences, recent experimental results have shown the presence of much more complex patterns of methylation across tissues and time in the human genome. These patterns are only partially described by a binary model of DNA methylation. In this work we propose a novel approach, based on profile analysis of tissue-specific methylation that uncovers significant differences in the sequences of CpG islands (CGIs) that predispose them to a tissue- specific methylation pattern. Results We defined CGI methylation profiles that separate not only between constitutively methylated and unmethylated CGIs, but also identify CGIs showing a differential degree of methylation across tissues and cell-types or a lack of methylation exclusively in sperm. These profiles are clearly distinguished by a number of CGI attributes including their evolutionary conservation, their significance, as well as the evolutionary evidence of prior methylation. Additionally, we assess profile functionality with respect to the different compartments of protein coding genes and their possible use in the prediction of DNA methylation. Conclusion Our approach provides new insights into the biological features that determine if a CGI has a functional role in the epigenetic control of gene expression and the features associated with CGI methylation susceptibility. Moreover, we show that the ability to predict CGI methylation is based primarily on the quality of the biological information used and the relationships uncovered between different sources of knowledge. The strategy presented here is able to predict, besides the constitutively methylated and unmethylated classes, two more tissue specific methylation classes

  5. Bacterial interactions in dental biofilm development.

    PubMed

    Hojo, K; Nagaoka, S; Ohshima, T; Maeda, N

    2009-11-01

    Recent analyses with ribosomal RNA-based technologies have revealed the diversity of bacterial populations within dental biofilms, and have highlighted their important contributions to oral health and disease. Dental biofilms are exceedingly complex and multispecies ecosystems, where oral bacteria interact cooperatively or competitively with other members. Bacterial interactions that influence dental biofilm communities include various different mechanisms. During the early stage of biofilm formation, it is known that planktonic bacterial cells directly attach to surfaces of the oral cavity or indirectly bind to other bacterial cells that have already colonized. Adherence through co-aggregation may be critical for the temporary retention of bacteria on dental surfaces, and may facilitate eventual bacterial colonization. It is likely that metabolic communication, genetic exchange, production of inhibitory factors (e.g., bacteriocins, hydrogen peroxide, etc.), and quorum-sensing are pivotal regulatory factors that determine the bacterial composition and/or metabolism. Since each bacterium can easily access a neighboring bacterial cell and its metabolites, genetic exchanges and metabolic communication may occur frequently in dental biofilms. Quorum-sensing is defined as gene regulation in response to cell density, which influences various functions, e.g., virulence and bacteriocin production. In this review, we discuss these important interactions among oral bacteria within the dental biofilm communities.

  6. KDM2B links the Polycomb Repressive Complex 1 (PRC1) to recognition of CpG islands

    PubMed Central

    Farcas, Anca M; Blackledge, Neil P; Sudbery, Ian; Long, Hannah K; McGouran, Joanna F; Rose, Nathan R; Lee, Sheena; Sims, David; Cerase, Andrea; Sheahan, Thomas W; Koseki, Haruhiko; Brockdorff, Neil; Ponting, Chris P; Kessler, Benedikt M; Klose, Robert J

    2012-01-01

    CpG islands (CGIs) are associated with most mammalian gene promoters. A subset of CGIs act as polycomb response elements (PREs) and are recognized by the polycomb silencing systems to regulate expression of genes involved in early development. How CGIs function mechanistically as nucleation sites for polycomb repressive complexes remains unknown. Here we discover that KDM2B (FBXL10) specifically recognizes non-methylated DNA in CGIs and recruits the polycomb repressive complex 1 (PRC1). This contributes to histone H2A lysine 119 ubiquitylation (H2AK119ub1) and gene repression. Unexpectedly, we also find that CGIs are occupied by low levels of PRC1 throughout the genome, suggesting that the KDM2B-PRC1 complex may sample CGI-associated genes for susceptibility to polycomb-mediated silencing. These observations demonstrate an unexpected and direct link between recognition of CGIs by KDM2B and targeting of the polycomb repressive system. This provides the basis for a new model describing the functionality of CGIs as mammalian PREs. DOI: http://dx.doi.org/10.7554/eLife.00205.001 PMID:23256043

  7. DNA-based approaches to the treatment of allergies.

    PubMed

    Spiegelberg, Hans L; Raz, Eyal

    2002-02-01

    Although excellent pharmacological treatments for allergies exist, they do not change the underlying pathogenesis of allergic diseases and do not cure the disease. Only allergen-specific immunotherapy, the injection of small but increasing amounts of allergen, has been shown to change a pre-existing allergic Th2 immune response to a non-allergic Th1 response. However, since injection of allergen is associated with the risk of allergic and sometimes even life-threatening anaphylactic reactions, immunotherapy is no longer used as extensively as in the past. In the search for a novel immunotherapy having a low risk-to-benefit ratio, immunostimulatory CpG motif DNA sequences have recently been shown to provide an excellent tool for designing safer and more efficient forms of allergen immunotherapy. These DNA-based immunotherapeutics include allergen gene vaccines, immunization with allergen-DNA conjugates and immunomodulation with immunostimulatory oligodeoxynucleotides. All three DNA-based immunotherapeutics have been shown to be very effective in animal models of allergic diseases and, at present, allergen-DNA conjugates are being tested for their safety and efficacy in allergic patients. This review describes the preclinical findings and the data of the first clinical trials in allergic patients of DNA-based immunotherapeutics for allergic disorders.

  8. Antibody response in silver catfish (Rhamdia quelen) immunized with a model antigen associated with different adjuvants

    PubMed Central

    Pavan, T.R.; Di Domenico, J.; Kirsten, K.S.; Nied, C.O.; Frandoloso, R.; Kreutz, L.C.

    2016-01-01

    Adjuvants are essential to boost the immune response to inoculated antigen and play a central role in vaccine development. In this study, we investigated the efficacy of several adjuvants in the production of anti-bovine serum albumin (BSA) antibodies in silver catfish. Two hundred and seventy juvenile silver catfish (60–80 g) of both sexes were intraperitoneally vaccinated with BSA (200 µg/fish) alone or mixed to the following adjuvants: Freund’s complete adjuvant (FCA), Freund’s incomplete adjuvant (FIA), aluminum hydroxide (AlOH), Montanide, four types of cytosine-phosphate-guanine (CpG) oligodeoxynucleotides (ODNs) and three concentrations of β-glucan, and the immune enhancing property was evaluated by measuring anti-BSA antibodies in blood samples at biweekly intervals. Our results demonstrated that CpGs ODNs and β-glucan were as effective as classical adjuvants (FCA, FIA, AlOH and Montanide) in promoting anti-BSA antibodies and that the kinetics of antibody production induced by all adjuvants used in our study had a similar trend to that observed in other fish species, with a peak at 28 days post-vaccination. These results may be useful for the selection of adjuvants for vaccine formulation intended for silver catfish and for the development of vaccine and vaccination strategies to other fish species. PMID:27464022

  9. Predicting DNA Methylation State of CpG Dinucleotide Using Genome Topological Features and Deep Networks

    NASA Astrophysics Data System (ADS)

    Wang, Yiheng; Liu, Tong; Xu, Dong; Shi, Huidong; Zhang, Chaoyang; Mo, Yin-Yuan; Wang, Zheng

    2016-01-01

    The hypo- or hyper-methylation of the human genome is one of the epigenetic features of leukemia. However, experimental approaches have only determined the methylation state of a small portion of the human genome. We developed deep learning based (stacked denoising autoencoders, or SdAs) software named “DeepMethyl” to predict the methylation state of DNA CpG dinucleotides using features inferred from three-dimensional genome topology (based on Hi-C) and DNA sequence patterns. We used the experimental data from immortalised myelogenous leukemia (K562) and healthy lymphoblastoid (GM12878) cell lines to train the learning models and assess prediction performance. We have tested various SdA architectures with different configurations of hidden layer(s) and amount of pre-training data and compared the performance of deep networks relative to support vector machines (SVMs). Using the methylation states of sequentially neighboring regions as one of the learning features, an SdA achieved a blind test accuracy of 89.7% for GM12878 and 88.6% for K562. When the methylation states of sequentially neighboring regions are unknown, the accuracies are 84.82% for GM12878 and 72.01% for K562. We also analyzed the contribution of genome topological features inferred from Hi-C. DeepMethyl can be accessed at http://dna.cs.usm.edu/deepmethyl/.

  10. Predicting DNA Methylation State of CpG Dinucleotide Using Genome Topological Features and Deep Networks.

    PubMed

    Wang, Yiheng; Liu, Tong; Xu, Dong; Shi, Huidong; Zhang, Chaoyang; Mo, Yin-Yuan; Wang, Zheng

    2016-01-22

    The hypo- or hyper-methylation of the human genome is one of the epigenetic features of leukemia. However, experimental approaches have only determined the methylation state of a small portion of the human genome. We developed deep learning based (stacked denoising autoencoders, or SdAs) software named "DeepMethyl" to predict the methylation state of DNA CpG dinucleotides using features inferred from three-dimensional genome topology (based on Hi-C) and DNA sequence patterns. We used the experimental data from immortalised myelogenous leukemia (K562) and healthy lymphoblastoid (GM12878) cell lines to train the learning models and assess prediction performance. We have tested various SdA architectures with different configurations of hidden layer(s) and amount of pre-training data and compared the performance of deep networks relative to support vector machines (SVMs). Using the methylation states of sequentially neighboring regions as one of the learning features, an SdA achieved a blind test accuracy of 89.7% for GM12878 and 88.6% for K562. When the methylation states of sequentially neighboring regions are unknown, the accuracies are 84.82% for GM12878 and 72.01% for K562. We also analyzed the contribution of genome topological features inferred from Hi-C. DeepMethyl can be accessed at http://dna.cs.usm.edu/deepmethyl/.

  11. Evaluation of Different Oligonucleotide Base Substitutions at CpG Binding sites in Multiplex Bisulfite-PCR sequencing.

    PubMed

    Lu, Jennifer; Ru, Kelin; Candiloro, Ida; Dobrovic, Alexander; Korbie, Darren; Trau, Matt

    2017-03-22

    Multiplex bisulfite-PCR sequencing is a convenient and scalable method for the quantitative determination of the methylation state of target DNA regions. A challenge of this application is the presence of CpGs in the same region where primers are being placed. A common solution to the presence of CpGs within a primer-binding region is to substitute a base degeneracy at the cytosine position. However, the efficacy of different substitutions and the extent to which bias towards methylated or unmethylated templates may occur has never been evaluated in bisulfite multiplex sequencing applications. In response, we examined the performance of four different primer substitutions at the cytosine position of CpG's contained within the PCR primers. In this study, deoxyinosine-, 5-nitroindole-, mixed-base primers and primers with an abasic site were evaluated across a series of methylated controls. Primers that contained mixed- or deoxyinosine- base modifications performed most robustly. Mixed-base primers were further selected to determine the conditions that induce bias towards methylated templates. This identified an optimized set of conditions where the methylated state of bisulfite DNA templates can be accurately assessed using mixed-base primers, and expands the scope of bisulfite resequencing assays when working with challenging templates.

  12. Enhanced Detection of Chromosomal Abnormalities in Chronic Lymphocytic Leukemia by Conventional Cytogenetics Using CpG Oligonucleotide in Combination with Pokeweed Mitogen and Phorbol Myristate Acetate

    PubMed Central

    Muthusamy, Natarajan; Breidenbach, Heather; Andritsos, Leslie; Flynn, Joseph; Jones, Jeffrey; Ramanunni, Asha; Mo, Xiaokui; Jarjoura, David; Byrd, John C.; Heerema, Nyla A.

    2011-01-01

    Reproducible cytogenetic analysis in CLL has been limited by the inability to obtain reliable metaphase cells for analysis. CpG oligonucleotide and cytokine stimulation have been shown to improve metaphase analysis of CLL cytogenetic abnormalities, but is limited by variability in the cytokine receptor levels, stability and biological activity of the cytokine in culture conditions and high costs associated with these reagents. We report here use of a novel, stable CpG, GNKG168 along with pokeweed mitogen (PWM) and phorbol 12-myristate 13-acetate (PMA) for conventional cytogenetic assessment in CLL. We demonstrate that the combined use of GNKG168+PWM/PMA increased the sensitivity of detection of chromosomal abnormalities compared to PWM/PMA (n=207, odds ratio=2.2, p=0.0002) and GNKG168 (n=219, odds ratio=1.5, p=0.0452). Further, a significant increase in sensitivity to detect complexity ≥3 with GNKG168+PWM/PMA compared to GNKG168 alone (odds ratio 8.0, p=0.0022) or PWM/PMA alone (odds ratio 9.6, p=0.0007) was observed. The trend toward detection of higher complexity was significantly greater with GNKG168+PWM/PMA compared to GNKG168 alone (p=0.0412). The increased sensitivity was mainly attributed to the addition of PWM/PMA with GNKG168 because GNKG168 alone showed no difference in sensitivity for detection of complex abnormalities (p=0.17). Comparison of fluorescence in situ hybridization (FISH) results with karyotypic results showed a high degree of consistency, although some complex karyotypes were present in cases with no adverse FISH abnormality. These studies provide evidence for potential use of GNKG168 in combination with PWM and PMA in karyotypic analysis of CLL patient samples to better identify chromosomal abnormalities for risk stratification. PMID:21494579

  13. Identification and expression analysis of cobia (Rachycentron canadum) Toll-like receptor 9 gene.

    PubMed

    Byadgi, Omkar; Puteri, Dinda; Lee, Yan-Horn; Lee, Jai-Wei; Cheng, Ta-Chih

    2014-02-01

    Cobia culture is hindered by bacterial infection (Photobacterium damselae subsp. piscicida) and in order to study the effect of P. damselae subsp. piscicida challenge and CpG ODN stimulation on cobia Toll like receptor 9 (RCTLR9), we used PCR to clone RCTLR9 gene and qRT-PCR to quantify gene expression. The results indicated that RCTLR9 cDNA contains 3141 bp. It encodes 1047 amino acids containing 16 typical structures of leucine-rich repeats (LRRs) including an LRRTYP, LRRCT and a motif involved in PAMP binding was identified at position 240-253 amino acid. Broad expression of RCTLR9 was found in larval, juvenile and adult stages irrespective of the tissues. In larval stage, RCTLR9 mRNA expression decreased at 5 d and then increased at 10 dph. At juvenile stage cobia, the expression was significantly high (p < 0.05) in spleen and intestine compared to gill, kidney, liver and skin. However, at adult stage, the significant high expression was found in gill and intestine. Cobia challenged with P. damselae subsp. piscicida showed significant increase in RCTLR9 expression at 24 h post challenge in intestine, spleen and liver, while in kidney the expression was peak at 12 h and later it decreased at 24 h. The highest expression was 40 fold increase in spleen and the lowest expression was ∼3.6 fold increase in liver. Cobia stimulated with CpG oligonucleotides showed that the induction of these genes was CpG ODN type and time dependent. In spleen and liver, CpG ODNs 1668 and 2006 injected group showed high expression of RCTLR9, IL-1β, chemokine CC compared to other groups. Meanwhile, CpG ODN 2006 has induced high expression of IgM. The CpG ODNs 2395 have induced significant high expression of Mx in spleen and liver. These results demonstrates the potential of using CpG ODN to enhance cobia resistance to P. damselae subsp. piscicida infection and use as an adjuvant in vaccine development. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Volatiles in Inter-Specific Bacterial Interactions

    PubMed Central

    Tyc, Olaf; Zweers, Hans; de Boer, Wietse; Garbeva, Paolina

    2015-01-01

    The importance of volatile organic compounds for functioning of microbes is receiving increased research attention. However, to date very little is known on how inter-specific bacterial interactions effect volatiles production as most studies have been focused on volatiles produced by monocultures of well-described bacterial genera. In this study we aimed to understand how inter-specific bacterial interactions affect the composition, production and activity of volatiles. Four phylogenetically different bacterial species namely: Chryseobacterium, Dyella, Janthinobacterium, and Tsukamurella were selected. Earlier results had shown that pairwise combinations of these bacteria induced antimicrobial activity in agar media whereas this was not the case for monocultures. In the current study, we examined if these observations were also reflected by the production of antimicrobial volatiles. Thus, the identity and antimicrobial activity of volatiles produced by the bacteria were determined in monoculture as well in pairwise combinations. Antimicrobial activity of the volatiles was assessed against fungal, oomycetal, and bacterial model organisms. Our results revealed that inter-specific bacterial interactions affected volatiles blend composition. Fungi and oomycetes showed high sensitivity to bacterial volatiles whereas the effect of volatiles on bacteria varied between no effects, growth inhibition to growth promotion depending on the volatile blend composition. In total 35 volatile compounds were detected most of which were sulfur-containing compounds. Two commonly produced sulfur-containing volatile compounds (dimethyl disulfide and dimethyl trisulfide) were tested for their effect on three target bacteria. Here, we display the importance of inter-specific interactions on bacterial volatiles production and their antimicrobial activities. PMID:26733959

  15. Elucidating Duramycin's Bacterial Selectivity and Mode of Action on the Bacterial Cell Envelope.

    PubMed

    Hasim, Sahar; Allison, David P; Mendez, Berlin; Farmer, Abigail T; Pelletier, Dale A; Retterer, Scott T; Campagna, Shawn R; Reynolds, Todd B; Doktycz, Mitchel J

    2018-01-01

    The use of naturally occurring antimicrobial peptides provides a promising route to selectively target pathogenic agents and to shape microbiome structure. Lantibiotics, such as duramycin, are one class of bacterially produced peptidic natural products that can selectively inhibit the growth of other bacteria. However, despite longstanding characterization efforts, the microbial selectivity and mode of action of duramycin are still obscure. We describe here a suite of biological, chemical, and physical characterizations that shed new light on the selective and mechanistic aspects of duramycin activity. Bacterial screening assays have been performed using duramycin and Populus -derived bacterial isolates to determine species selectivity. Lipidomic profiles of selected resistant and sensitive strains show that the sensitivity of Gram-positive bacteria depends on the presence of phosphatidylethanolamine (PE) in the cell membrane. Further the surface and interface morphology were studied by high resolution atomic force microscopy and showed a progression of cellular changes in the cell envelope after treatment with duramycin for the susceptible bacterial strains. Together, these molecular and cellular level analyses provide insight into duramycin's mode of action and a better understanding of its selectivity.

  16. C-fos mediates antipsychotic-induced neurotensin gene expression in the rodent striatum.

    PubMed

    Robertson, G S; Tetzlaff, W; Bedard, A; St-Jean, M; Wigle, N

    1995-07-01

    The ubiquitous inducibility of the immediate-early gene c-fos in the central nervous system has led to the search for downstream genes which are regulated by its product, Fos. Recent evidence suggests that c-fos induction by a single injection of the classical antipsychotic haloperidol may contribute to the subsequent increase in neurotensin gene expression in the rodent striatum. Consistent with this proposal, in the present study haloperidol-induced Fos-like immunoreactivity and neurotensin/neuromedin N messenger RNA were found to be expressed by the same population of striatal neurons. Moreover, inhibition of haloperidol-induced c-fos expression by intrastriatal injection of antisense phosphorothioate oligodeoxynucleotides complimentary either to bases 109-126 or 127-144 of c-fos attenuated the subsequent increase in neurotensin/neuromedin N messenger RNA. However, injection of a sense phosphorothioate oligodeoxynucleotide corresponding to bases 127-144 of c-fos did not reduce haloperidol-induced c-fos or neurotensin/neuromedin N expression. Furthermore, constitutive expression of Jun-like immunoreactivity in the striatum was not reduced by either the sense or antisense phosphorothioate oligodeoxynucleotides. Similarly, the sense and antisense phosphorothioate oligodeoxynucleotide failed to reduce proenkephalin messenger RNA, which is located in the same striatal neurons that express haloperidol-induced neurotensin/neuromedin N messenger RNA, which is located in the same striatal neurons that express haloperidol-induced neurotensin/neuromedin N messenger RNA. Lastly, haloperidol-induced increases in nerve growth factor I-A-, JunB- and FosB-like immunoreactivity and fosB messenger RNA were not decreased by intrastriatal injection of either the sense or antisense phosphorothioate oligodeoxynucleotides. These results indicate that the antisense phosphorothioate oligodeoxynucleotides attenuated haloperidol-induced neurotensin/neuromedin N expression by selectively

  17. Vulvovaginal symptoms in women with bacterial vaginosis.

    PubMed

    Klebanoff, Mark A; Schwebke, Jane R; Zhang, Jun; Nansel, Tonja R; Yu, Kai-Fun; Andrews, William W

    2004-08-01

    A substantial, but highly variable, percentage of women with bacterial vaginosis are said to be asymptomatic. The purpose of this study was to estimate the prevalence of symptoms among women with bacterial vaginosis compared with women without bacterial vaginosis by direct, explicit, and detailed questioning of these women. Women presenting for a routine health care visit at 12 health department clinics in Birmingham, Alabama, were recruited to participate in a longitudinal study of vaginal flora. At the first visit, they underwent a pelvic examination, lower genital tract microbiological evaluation, and an interview that included detailed questions regarding lower genital tract symptoms. The prevalence of symptoms among women with and without bacterial vaginosis (Gram stain score 7 or higher) was compared. Among 2,888 women without gonorrhea, Chlamydia, or trichomonas, 75% of women with and 82% of women without bacterial vaginosis never noted any vaginal odor in the past 6 months (P <.001). The corresponding values were 63% and 65% for never noting vaginal "wetness" (P =.02); 58% and 57% for vaginal discharge (P =.65); 91% and 86% for irritation (P =.004); 88% and 85% for itching (P =.64); and 96% and 94% for dysuria (P =.002), respectively. Cumulatively, 58% of women with bacterial vaginosis noted odor, discharge, and/or wetness in the past 6 months compared with 57% of women without bacterial vaginosis (P =.70). The 2 classic symptoms of bacterial vaginosis discharge and odor are each reported by a minority of women with bacterial vaginosis and are only slightly more prevalent than among women without bacterial vaginosis.

  18. Viral-bacterial associations in acute apical abscesses.

    PubMed

    Ferreira, Dennis C; Rôças, Isabela N; Paiva, Simone S M; Carmo, Flávia L; Cavalcante, Fernanda S; Rosado, Alexandre S; Santos, Kátia R N; Siqueira, José F

    2011-08-01

    Viral-bacterial and bacterial synergism have been suggested to contribute to the pathogenesis of several human diseases. This study sought to investigate the possible associations between 9 candidate endodontic bacterial pathogens and 9 human viruses in samples from acute apical abscesses. DNA extracts from purulent exudate aspirates of 33 cases of acute apical abscess were surveyed for the presence of 9 selected bacterial species using a 16S ribosomal RNA gene-based nested polymerase chain reaction (PCR) approach. Single or nested PCR assays were used for detection of the human papillomavirus (HPV) and herpesviruses types 1 to 8. Two-thirds of the abscess samples were positive for at least one of the target viruses. Specifically, the most frequently detected viruses were HHV-8 (54.5%); HPV (9%); and varicella zoster virus (VZV), Epstein-Barr virus (EBV), and HHV-6 (6%). Bacterial DNA was present in all cases and the most prevalent bacterial species were Treponema denticola (70%), Tannerella forsythia (67%), Porphyromonas endodontalis (67%), Dialister invisus (61%), and Dialister pneumosintes (57.5%). HHV-8 was positively associated with 7 of the target bacterial species and HPV with 4, but all these associations were weak. Several bacterial pairs showed a moderate positive association. Viral coinfection was found in 6 abscess cases, but no significant viral association could be determined. Findings demonstrated that bacterial and viral DNA occurred concomitantly in two-thirds of the samples from endodontic abscesses. Although this may suggest a role for viruses in the etiology of apical abscesses, the possibility also exists that the presence of viruses in abscess samples is merely a consequence of the bacterially induced disease process. Further studies are necessary to clarify the role of these viral-bacterial interactions, if any, in the pathogenesis of acute apical abscesses. Copyright © 2011 Mosby, Inc. All rights reserved.

  19. Intrinsic neuromodulation in the Tritonia swim CPG: serotonin mediates both neuromodulation and neurotransmission by the dorsal swim interneurons.

    PubMed

    Katz, P S; Frost, W N

    1995-12-01

    1. Neuromodulation has previously been shown to be intrinsic to the central pattern generator (CPG) circuit that generates the escape swim of the nudibranch mollusk Tritonia diomedea; the dorsal swim interneurons (DSIs) make conventional monosynaptic connections and evoke neuromodulatory effects within the swim motor circuit. The conventional synaptic potentials evoked by a DSI onto cerebral neuron 2 (C2) and onto the dorsal flexion neurons (DFNs) consist of a fast excitatory postsynaptic potential (EPSP) followed by a prolonged slow EPSP. In their neuromodulatory role, the DSIs produce an enhancement of the monosynaptic connections made by C2 onto other CPG circuit interneurons and onto efferent flexion neurons. Previous work showed that the DSIs are immunoreactive for serotonin. Here we provide evidence that both the neurotransmission and the neuromodulation evoked by the DSIs are produced by serotonin, and that these effects may be pharmacologically separable. 2. Previously it was shown that bath-applied serotonin both mimics and occludes the modulation of the C2 synapses by the DSIs. Here we find that pressure-applied puffs of serotonin mimic both the fast and slow EPSPs evoked by a DSI onto a DFN, whereas high concentrations of bath-applied serotonin occlude both of these synaptic components. 3. Consistent with the hypothesis that serotonin mediates the actions of the DSIs, the serotonin reuptake inhibitor imipramine prolongs the duration of the fast DSI-DFN EPSP, increases the amplitude of the slow DSI-DFN EPSP, and increases both the amplitude and duration of the modulation of the C2-DFN synapse by the DSIs. 4. Two serotonergic antagonists were found that block the actions of the DSIs. Gramine blocks the fast DSI-DFN EPSP, and has far less of an effect on the slow EPSP and the modulation. Gramine also diminishes the depolarization evoked by pressure-applied serotonin, showing that it is a serotonin antagonist in this system. In contrast, methysergide greatly

  20. Phase II study of nab-paclitaxel in refractory small bowel adenocarcinoma and CpG island methylator phenotype (CIMP)-high colorectal cancer.

    PubMed

    Overman, M J; Adam, L; Raghav, K; Wang, J; Kee, B; Fogelman, D; Eng, C; Vilar, E; Shroff, R; Dasari, A; Wolff, R; Morris, J; Karunasena, E; Pisanic, R; Azad, N; Kopetz, S

    2018-01-01

    Hypermethylation of promoter CpG islands [CpG island methylator phenotype (CIMP)] represents a unique pathway for the development of colorectal cancer (CRC), characterized by lack of chromosomal instability and a low rate of adenomatous polyposis coli (APC) mutations, which have both been correlated with taxane resistance. Similarly, small bowel adenocarcinoma (SBA), a rare tumor, also has a low rate of APC mutations. This phase II study evaluated taxane sensitivity in SBA and CIMP-high CRC. The primary objective was Response Evaluation Criteria in Solid Tumors version 1.1 response rate. Eligibility included Eastern Cooperative Oncology Group performance status 0/1, refractory disease, and SBA or CIMP-high metastatic CRC. Nab-paclitaxel was initially administered at a dose of 260 mg/m2 every 3 weeks but was reduced to 220 mg/m2 owing to toxicity. A total of 21 patients with CIMP-high CRC and 13 with SBA were enrolled from November 2012 to October 2014. The efficacy-assessable population (patients who received at least three doses of the treatment) comprised 15 CIMP-high CRC patients and 10 SBA patients. Common grade 3 or 4 toxicities were fatigue (12%), neutropenia (9%), febrile neutropenia (9%), dehydration (6%), and thrombocytopenia (6%). No responses were seen in the CIMP-high CRC cohort and two partial responses were seen in the SBA cohort. Median progression-free survival was significantly greater in the SBA cohort than in the CIMP-high CRC cohort (3.2 months compared with 2.1 months, P = 0.03). Neither APC mutation status nor CHFR methylation status correlated with efficacy in the CIMP-high CRC cohort. In vivo testing of paclitaxel in an SBA patient-derived xenograft validated the activity of taxanes in this disease type. Although preclinical studies suggested taxane sensitivity was associated with chromosomal stability and wild-type APC, we found that nab-paclitaxel was inactive in CIMP-high metastatic CRC. Nab-paclitaxel may represent a novel

  1. An evaluation of bacterial contamination of barriers used in periapical tissue regeneration: Part 1--Bacterial adherence.

    PubMed

    Sharma, Priya; Mickel, André K; Chogle, Sami; Sharma, Prem Nath; Han, Yiping W; Jones, Jefferson J

    2008-02-01

    To compare the adherence of Prevotella melaninogenica and Enterococcus faecalis to 3 guided tissue regeneration membranes: Atrisorb, Lambone, and OsseoQuest. It was hypothesized that OsseoQuest would show increased bacterial adherence compared to Lambone and Atrisorb. The barriers were suspended in trypticase soy broth containing an inoculum of either P melaninogenica or E faecalis. The samples were incubated under appropriate conditions for 6, 24, and 48 hours. Following incubation, each membrane was mixed in fresh media in a vortex machine to dislodge adherent bacteria. The vortexed media was quantitatively assessed using serial dilutions for viable cell count. E faecalis exhibited higher adherence compared to P melaninogenica with time. Of the membranes tested, Lambone displayed the least bacterial adherence. An analysis of the results indicated that bacterial adherence was time-dependent for all membranes. Membrane structure, chemical configuration, hydrophobicity, and bacterial cell surface structure were suggested as factors contributing to variance in bacterial adherence.

  2. Arsenic uptake in bacterial calcite

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Catelani, Tiziano; Perito, Brunella; Bellucci, Francesco

    Bio-mediated processes for arsenic (As) uptake in calcite were investigated by means of X-ray Diffraction (XRD) and Xray Absorption Spectroscopy (XAS) coupled with X-ray Fluorescence measurements. The environmental bacterial strain Bacillus licheniformis BD5, sampled at the Bullicame Hot Springs (Viterbo, Central Italy), was used to synthesize calcite from As-enriched growth media. Both liquid and solid cultures were applied to simulate planktonic and biofilm community environments, respectively. Bacterial calcite samples cultured in liquid media had an As enrichment factor (Kd) 50 times higher than that from solid media. The XRD analysis revealed an elongation of the crystal lattice along the cmore » axis (by 0.03Å) for biogenic calcite, which likely resulted from the substitution of larger arsenate for carbonate in the crystal. The XAS data also showed a clear difference in the oxidation state of sorbed As between bacterial and abiotic calcite. Abiotic chemical processes yielded predominantly As(V) uptake whereas bacterial precipitation processes led to the uptake of both As(III) and As(V). The presence of As(III) in bacterial calcite is proposed to result from subsequent reduction of arsenate to arsenite by bacterial activities. To the best of our knowledge, this is the first experimental observation of the incorporation of As(III) in the calcite crystal lattice, revealing a critical role of biochemical processes for the As cycling in nature.« less

  3. Impact of the Location of CpG Methylation within the GSTP1 Gene on Its Specificity as a DNA Marker for Hepatocellular Carcinoma

    PubMed Central

    Jain, Surbhi; Boldbaatar, Batbold; Hamilton, James P.; Lin, Selena Y.; Chang, Ting-Tsung; Chen, Shun-Hua; Song, Wei; Meltzer, Stephen J.; Block, Timothy M.; Su, Ying-Hsiu

    2012-01-01

    Hypermethylation of the glutathione S-transferase π 1 (GSTP1) gene promoter region has been reported to be a potential biomarker to distinguish hepatocellular carcinoma (HCC) from other liver diseases. However, reports regarding how specific a marker it is have ranged from 100% to 0%. We hypothesized that, to a large extent, the variation of specificity depends on the location of the CpG sites analyzed. To test this hypothesis, we compared the methylation status of the GSTP1 promoter region of the DNA isolated from HCC, cirrhosis, hepatitis, and normal liver tissues by bisulfite–PCR sequencing. We found that the 5′ region of the position −48 nt from the transcription start site of the GSTP1 gene is selectively methylated in HCC, whereas the 3′ region is methylated in all liver tissues examined, including normal liver and the HCC tissue. Interestingly, when DNA derived from fetal liver and 11 nonhepatic normal tissue was also examined by bisulfite-PCR sequencing, we found that methylation of the 3′ region of the promoter appeared to be liver-specific. A methylation-specific PCR assay targeting the 5′ region of the promoter was developed and used to quantify the methylated GSTP1 gene in various diseased liver tissues including HCC. When we used an assay targeting the 3′ region, we found that the methylation of the 5′-end of the GSTP1 promoter was significantly more specific than that of the 3′-end (97.1% vs. 60%, p<0.0001 by Fisher's exact test) for distinguishing HCC (n = 120) from hepatitis (n = 35) and cirrhosis (n = 35). Encouragingly, 33.8% of the AFP-negative HCC contained the methylated GSTP1 gene. This study clearly demonstrates the importance of the location of CpG site methylation for HCC specificity and how liver-specific DNA methylation should be considered when an epigenetic DNA marker is studied for detection of HCC. PMID:22536438

  4. Promoter CpG island methylation in ion transport mechanisms and associated dietary intakes jointly influence the risk of clear-cell renal cell cancer.

    PubMed

    Deckers, Ivette Ag; van Engeland, Manon; van den Brandt, Piet A; Van Neste, Leander; Soetekouw, Patricia Mmb; Aarts, Maureen Jb; Baldewijns, Marcella Mll; Keszei, András P; Schouten, Leo J

    2017-04-01

    Sodium intake, but not potassium or fluid intake, has been associated with higher renal cell cancer (RCC) risk. However, risk factors may differ by molecular subtypes of the tumour. In renal physiology, electrolyte and water homeostasis is facilitated by ion transport mechanisms (ITM). Aberrant regulation of ITM genes, for example by promoter CpG island methylation, may modify associations between sodium, potassium and fluid intake and RCC risk. We identified ARHGDIG , ATP1A1 , SCNN1B and SLC8A3 as ITM genes exhibiting RCC-specific promoter methylation and down-regulation. Methylation-specific polymerase chain reaction (PCR) was used to analyse promoter CpG island methylation in tumour DNA of 453 RCC cases from the Netherlands Cohort Study ( n = 120 852) after 20.3 years of follow-up. Diet was measured at baseline using food-frequency questionnaires. Cox regression analyses were restricted to clear-cell (cc)RCC ( n = 306) and stratified by tumours with no, low (1 gene) and high (≥ 2 genes) methylation. Sodium intake (high vs low) increased ccRCC risk particularly in tumours with a high methylation index: hazard ratio (HR) [95% confidence interval (CI)]: 2.04 (1.16-3.58), whereas heterogeneity across the methylation index was not significant ( P -heterogeneity = 0.26). Potassium intake was differentially associated with ccRCC risk ( P -heterogeneity = 0.008); the risk for high (vs low) potassium intake was low for unmethylated tumours [HR (95% CI): 0.60 (0.36-1.01)], but high for tumours with a high methylation index [HR (95% CI): 1.60 (0.96-2.65)]. Risks similarly differed for fluid intake, though not significantly ( P -heterogeneity = 0.54). Our findings suggest for the first time that dietary intakes are differentially associated with ccRCC risk according to molecular subtypes defined by ITM gene-specific promoter methylation. © The Author 2016; all rights reserved. Published by Oxford University Press on behalf of the International Epidemiological

  5. B vitamins, methionine and alcohol intake and risk of colon cancer in relation to BRAF mutation and CpG island methylator phenotype (CIMP).

    PubMed

    Schernhammer, Eva S; Giovannucci, Edward; Baba, Yoshifumi; Fuchs, Charles S; Ogino, Shuji

    2011-01-01

    One-carbon metabolism appears to play an important role in DNA methylation reaction. Evidence suggests that a low intake of B vitamins or high alcohol consumption increases colorectal cancer risk. How one-carbon nutrients affect the CpG island methylator phenotype (CIMP) or BRAF mutation status in colon cancer remains uncertain. Utilizing incident colon cancers in a large prospective cohort of women (the Nurses' Health Study), we determined BRAF status (N = 386) and CIMP status (N = 375) by 8 CIMP-specific markers [CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3, and SOCS1], and 8 other CpG islands (CHFR, HIC1, IGFBP3, MGMT, MINT-1, MINT-31, p14, and WRN). We examined the relationship between intake of one-carbon nutrients and alcohol and colon cancer risk, by BRAF mutation or CIMP status. Higher folate intake was associated with a trend towards low risk of CIMP-low/0 tumors [total folate intake ≥400 µg/day vs. <200 µg/day; the multivariate relative risk = 0.73; 95% CI = 0.53-1.02], whereas total folate intake had no influence on CIMP-high tumor risks (P(heterogeneity) = 0.73). Neither vitamin B(6), methionine or alcohol intake appeared to differentially influence risks for CIMP-high and CIMP-low/0 tumors. Using the 16-marker CIMP panel did not substantially alter our results. B vitamins, methionine or alcohol intake did not affect colon cancer risk differentially by BRAF status. This molecular pathological epidemiology study suggests that low level intake of folate may be associated with an increased risk of CIMP-low/0 colon tumors, but not that of CIMP-high tumors. However, the difference between CIMP-high and CIMP-low/0 cancer risks was not statistically significant, and additional studies are necessary to confirm these observations.

  6. Gamma-irradiated bacterial preparation having anti-tumor activity

    DOEpatents

    Vass, Arpad A.; Tyndall, Richard L.; Terzaghi-Howe, Peggy

    1999-01-01

    A bacterial preparation from Pseudomonas species isolated #15 ATCC 55638 that has been exposed to gamma radiation exhibits cytotoxicity that is specific for neoplastic carcinoma cells. A method for obtaining a bacterial preparation having antitumor activity consists of suspending a bacterial isolate in media and exposing the suspension to gamma radiation. A bacterial preparation of an aged culture of an amoeba-associated bacteria exhibits anti-reverse transcriptase activity. A method for obtaining a bacterial preparation having anti-reverse transcriptase activity from an amoeba-associated bacterial isolate grown to stationary phase is disclosed.

  7. Bacteriophages and Bacterial Plant Diseases

    PubMed Central

    Buttimer, Colin; McAuliffe, Olivia; Ross, R. P.; Hill, Colin; O’Mahony, Jim; Coffey, Aidan

    2017-01-01

    Losses in crop yields due to disease need to be reduced in order to meet increasing global food demands associated with growth in the human population. There is a well-recognized need to develop new environmentally friendly control strategies to combat bacterial crop disease. Current control measures involving the use of traditional chemicals or antibiotics are losing their efficacy due to the natural development of bacterial resistance to these agents. In addition, there is an increasing awareness that their use is environmentally unfriendly. Bacteriophages, the viruses of bacteria, have received increased research interest in recent years as a realistic environmentally friendly means of controlling bacterial diseases. Their use presents a viable control measure for a number of destructive bacterial crop diseases, with some phage-based products already becoming available on the market. Phage biocontrol possesses advantages over chemical controls in that tailor-made phage cocktails can be adapted to target specific disease-causing bacteria. Unlike chemical control measures, phage mixtures can be easily adapted for bacterial resistance which may develop over time. In this review, we will examine the progress and challenges for phage-based disease biocontrol in food crops. PMID:28163700

  8. Bacterial symbionts and natural products

    PubMed Central

    Crawford, Jason M.; Clardy, Jon

    2011-01-01

    The study of bacterial symbionts of eukaryotic hosts has become a powerful discovery engine for chemistry. This highlight looks at four case studies that exemplify the range of chemistry and biology involved in these symbioses: a bacterial symbiont of a fungus and a marine invertebrate that produce compounds with significant anticancer activity, and bacterial symbionts of insects and nematodes that produce compounds that regulate multilateral symbioses. In the last ten years, a series of shocking revelations – the molecular equivalents of a reality TV show’s uncovering the true parents of a well known individual or a deeply hidden family secret – altered the study of genetically encoded small molecules, natural products for short. These revelations all involved natural products produced by bacterial symbionts, and while details differed, two main plot lines emerged: parentage, in which the real producers of well known natural products with medical potential were not the organisms from which they were originally discovered, and hidden relationships, in which bacterially produced small molecules turned out to be the unsuspected regulators of complex interactions. For chemists, these studies led to new molecules, new biosynthetic pathways, and an understanding of the biological functions these molecules fulfill. PMID:21594283

  9. Evolution of bacterial virulence.

    PubMed

    Diard, Médéric; Hardt, Wolf-Dietrich

    2017-09-01

    Bacterial virulence is highly dynamic and context-dependent. For this reason, it is challenging to predict how molecular changes affect the growth of a pathogen in a host and its spread in host population. Two schools of thought have taken quite different directions to decipher the underlying principles of bacterial virulence. While molecular infection biology is focusing on the basic mechanisms of the pathogen-host interaction, evolution biology takes virulence as one of several parameters affecting pathogen spread in a host population. We review both approaches and discuss how they can complement each other in order to obtain a comprehensive understanding of bacterial virulence, its emergence, maintenance and evolution. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  10. Enhancement of anti-tumor effect of particulate vaccine delivery system by 'bacteriomimetic' CpG functionalization of poly-lactic-co-glycolic acid nanoparticles.

    PubMed

    Kokate, Rutika A; Thamake, Sanjay I; Chaudhary, Pankaj; Mott, Brittney; Raut, Sangram; Vishwanatha, Jamboor K; Jones, Harlan P

    2015-01-01

    Low immunogenicity remains a major obstacle in realizing the full potential of cancer vaccines. In this study, we evaluated CpG-coated tumor antigen (Tag)-encapsulating 'bacteriomimetic' nanoparticles (CpG-nanoparticle [NP]-Tag NPs) as an approach to enhance anti-tumor immunity. CpG-NP-Tag NPs were synthesized, characterized for their physicochemical properties and tested in vivo. We found CpG predosing followed by intraperitoneal (IP) immunization with CpG-NP-Tag NPs significantly attenuated tumor growth in female BALB/c mice compared with respective controls. Histopathological and Immunofluorescence data revealed CpG-NP-Tag tumors had lower proliferation, higher apoptotic activity, greater CD4(+) and CD8(+) T cell infiltration as well as higher IFN-γ levels as compared with control groups. Our findings suggest CpG-NP-Tag NPs can enhance anti-tumor effect of nanoparticulate tumor vaccination system.

  11. Endocarditis in adults with bacterial meningitis.

    PubMed

    Lucas, Marjolein J; Brouwer, Matthijs C; van der Ende, Arie; van de Beek, Diederik

    2013-05-21

    Endocarditis may precede or complicate bacterial meningitis, but the incidence and impact of endocarditis in bacterial meningitis are unknown. We assessed the incidence and clinical characteristics of patients with meningitis and endocarditis from a nationwide cohort study of adults with community-acquired bacterial meningitis in the Netherlands from 2006 to 2012. Endocarditis was identified in 24 of 1025 episodes (2%) of bacterial meningitis. Cultures yielded Streptococcus pneumoniae in 13 patients, Staphylococcus aureus in 8 patients, and Streptococcus agalactiae, Streptococcus pyogenes, and Streptococcus salivarius in 1 patient each. Clues leading to the diagnosis of endocarditis were cardiac murmurs, persistent or recurrent fever, a history of heart valve disease, and S aureus as the causative pathogen of bacterial meningitis. Treatment consisted of prolonged antibiotic therapy in all patients and surgical valve replacement in 10 patients (42%). Two patients were treated with oral anticoagulants, and both developed life-threatening intracerebral hemorrhage. Systemic (70%) and neurological (54%) complications occurred frequently, leading to a high proportion of patients with unfavorable outcome (63%). Seven of 24 patients (29%) with meningitis and endocarditis died. Endocarditis is an uncommon coexisting condition in bacterial meningitis but is associated with a high rate of unfavorable outcome.

  12. Phenotypic Signatures Arising from Unbalanced Bacterial Growth

    PubMed Central

    Tan, Cheemeng; Smith, Robert Phillip; Tsai, Ming-Chi; Schwartz, Russell; You, Lingchong

    2014-01-01

    Fluctuations in the growth rate of a bacterial culture during unbalanced growth are generally considered undesirable in quantitative studies of bacterial physiology. Under well-controlled experimental conditions, however, these fluctuations are not random but instead reflect the interplay between intra-cellular networks underlying bacterial growth and the growth environment. Therefore, these fluctuations could be considered quantitative phenotypes of the bacteria under a specific growth condition. Here, we present a method to identify “phenotypic signatures” by time-frequency analysis of unbalanced growth curves measured with high temporal resolution. The signatures are then applied to differentiate amongst different bacterial strains or the same strain under different growth conditions, and to identify the essential architecture of the gene network underlying the observed growth dynamics. Our method has implications for both basic understanding of bacterial physiology and for the classification of bacterial strains. PMID:25101949

  13. Phenotypic signatures arising from unbalanced bacterial growth.

    PubMed

    Tan, Cheemeng; Smith, Robert Phillip; Tsai, Ming-Chi; Schwartz, Russell; You, Lingchong

    2014-08-01

    Fluctuations in the growth rate of a bacterial culture during unbalanced growth are generally considered undesirable in quantitative studies of bacterial physiology. Under well-controlled experimental conditions, however, these fluctuations are not random but instead reflect the interplay between intra-cellular networks underlying bacterial growth and the growth environment. Therefore, these fluctuations could be considered quantitative phenotypes of the bacteria under a specific growth condition. Here, we present a method to identify "phenotypic signatures" by time-frequency analysis of unbalanced growth curves measured with high temporal resolution. The signatures are then applied to differentiate amongst different bacterial strains or the same strain under different growth conditions, and to identify the essential architecture of the gene network underlying the observed growth dynamics. Our method has implications for both basic understanding of bacterial physiology and for the classification of bacterial strains.

  14. Modeling Intraocular Bacterial Infections

    PubMed Central

    Astley, Roger A.; Coburn, Phillip S.; Parkunan, Salai Madhumathi; Callegan, Michelle C.

    2016-01-01

    Bacterial endophthalmitis is an infection and inflammation of the posterior segment of the eye which can result in significant loss of visual acuity. Even with prompt antibiotic, anti-inflammatory and surgical intervention, vision and even the eye itself may be lost. For the past century, experimental animal models have been used to examine various aspects of the pathogenesis and pathophysiology of bacterial endophthalmitis, to further the development of anti-inflammatory treatment strategies, and to evaluate the pharmacokinetics and efficacies of antibiotics. Experimental models allow independent control of many parameters of infection and facilitate systematic examination of infection outcomes. While no single animal model perfectly reproduces the human pathology of bacterial endophthalmitis, investigators have successfully used these models to understand the infectious process and the host response, and have provided new information regarding therapeutic options for the treatment of bacterial endophthalmitis. This review highlights experimental animal models of endophthalmitis and correlates this information with the clinical setting. The goal is to identify knowledge gaps that may be addressed in future experimental and clinical studies focused on improvements in the therapeutic preservation of vision during and after this disease. PMID:27154427

  15. [The composition of the gastrointestinal bacterial flora of mouse embryos and the placenta tissue bacterial flora].

    PubMed

    Lei, D; Lin, Y; Jiang, X; Lan, L; Zhang, W; Wang, B X

    2017-03-02

    Objective: To explore the composition of the gastrointestinal bacterial flora of mouse embryos and the placenta tissue bacterial flora. Method: Twenty-four specimens were collected from pregnant Kunming mouse including 8 mice of early embryonic (12-13 days) gastrointestinal tissues, 8 cases of late embryonic (19-20 days)gastrointestinal tissues, 8 of late pregnancy placental tissues.The 24 samples were extracted by DNeasy Blood & Tissue kit for high-throughput DNA sequencing. Result: The level of Proteobacteria, Bacteroidetes, Actino-bacteria and Firmicutes were predominantin all specimens.The relative content of predominant bacterial phyla in each group: Proteobacteria (95.00%, 88.14%, 87.26%), Bacteroidetes(1.71%, 2.15%, 2.63%), Actino-Bacteria(1.16%, 4.10%, 3.38%), Firmicutes(0.75%, 2.62%, 2.01%). At the level of family, there were nine predominant bacterial families in which Enterobacteriaeae , Shewanel laceae and Moraxellaceae were dominant.The relative content of dominant bacterial family in eachgroup: Enterobacteriaeae (46.99%, 44.34%, 41.08%), Shewanellaceae (21.99%, 21.10%, 19.05%), Moraxellaceae (9.18%, 7.09%, 5.64%). From the species of flora, the flora from fetal gastrointestinal in early pregnancy and late pregnancy (65.44% and 62.73%) were the same as that from placenta tissue in the late pregnancy.From the abundance of bacteria, at the level of family, the same content of bacteria in three groups accounted for 78.16%, 72.53% and 65.78% respectively. Conclusion: It was proved that the gastrointestinal bacterial flora of mouse embryos and the placenta tissue bacterial flora were colonized. At the same time the bacteria are classified.

  16. Gamma-irradiated bacterial preparation having anti-tumor activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vass, A.A.; Tyndall, R.L.; Terzaghi-Howe, P.

    1999-11-16

    This application describes a bacterial preparation from Pseudomonas species isolated {number{underscore}sign}15 ATCC 55638 that has been exposed to gamma radiation exhibits cytotoxicity that is specific for neoplastic carcinoma cells. A method for obtaining a bacterial preparation having antitumor activity consists of suspending a bacterial isolate in media and exposing the suspension to gamma radiation. A bacterial preparation of an aged culture of an amoeba-associated bacteria exhibits anti-reverse transcriptase activity. A method for obtaining a bacterial preparation having anti-reverse transcriptase activity from an amoeba-associated bacterial isolate grown to stationary phase is disclosed.

  17. Plant growth-promoting bacterial endophytes.

    PubMed

    Santoyo, Gustavo; Moreno-Hagelsieb, Gabriel; Orozco-Mosqueda, Ma del Carmen; Glick, Bernard R

    2016-02-01

    Bacterial endophytes ubiquitously colonize the internal tissues of plants, being found in nearly every plant worldwide. Some endophytes are able to promote the growth of plants. For those strains the mechanisms of plant growth-promotion known to be employed by bacterial endophytes are similar to the mechanisms used by rhizospheric bacteria, e.g., the acquisition of resources needed for plant growth and modulation of plant growth and development. Similar to rhizospheric plant growth-promoting bacteria, endophytic plant growth-promoting bacteria can act to facilitate plant growth in agriculture, horticulture and silviculture as well as in strategies for environmental cleanup (i.e., phytoremediation). Genome comparisons between bacterial endophytes and the genomes of rhizospheric plant growth-promoting bacteria are starting to unveil potential genetic factors involved in an endophytic lifestyle, which should facilitate a better understanding of the functioning of bacterial endophytes. Copyright © 2015 Elsevier GmbH. All rights reserved.

  18. [Bacterial vaginosis].

    PubMed

    Romero Herrero, Daniel; Andreu Domingo, Antonia

    2016-07-01

    Bacterial vaginosis (BV) is the main cause of vaginal dysbacteriosis in the women during the reproductive age. It is an entity in which many studies have focused for years and which is still open for discussion topics. This is due to the diversity of microorganisms that cause it and therefore, its difficult treatment. Bacterial vaginosis is probably the result of vaginal colonization by complex bacterial communities, many of them non-cultivable and with interdependent metabolism where anaerobic populations most likely play an important role in its pathogenesis. The main symptoms are an increase of vaginal discharge and the unpleasant smell of it. It can lead to serious consequences for women, such as an increased risk of contracting sexually transmitted infections including human immunodeficiency virus and upper genital tract and pregnancy complications. Gram stain is the gold standard for microbiological diagnosis of BV, but can also be diagnosed using the Amsel clinical criteria. It should not be considered a sexually transmitted disease but it is highly related to sex. Recurrence is the main problem of medical treatment. Apart from BV, there are other dysbacteriosis less characterized like aerobic vaginitis of which further studies are coming slowly but are achieving more attention and consensus among specialists. Copyright © 2016 Elsevier España, S.L.U. All rights reserved.

  19. Advances in Bacterial Methionine Aminopeptidase Inhibition

    PubMed Central

    Helgren, Travis R.; Wangtrakuldee, Phumvadee; Staker, Bart L.; Hagen, Timothy J.

    2016-01-01

    Methionine aminopeptidases (MetAPs) are metalloenzymes that cleave the N-terminal methionine from newly synthesized peptides and proteins. These MetAP enzymes are present in bacteria, and knockout experiments have shown that MetAP activity is essential for cell life, suggesting that MetAPs are good antibacterial drug targets. MetAP enzymes are also present in the human host and selectivity is essential. There have been significant structural biology efforts and over 65 protein crystal structures of bacterial MetAPs are deposited into the PDB. This review highlights the available crystallographic data for bacterial MetAPs. Structural comparison of bacterial MetAPs with human MetAPs highlights differences that can lead to selectivity. In addition, this review includes the chemical diversity of molecules that bind and inhibit the bacterial MetAP enzymes. Analysis of the structural biology and chemical space of known bacterial MetAP inhibitors leads to a greater understanding of this antibacterial target and the likely development of potential antibacterial agents. PMID:26268344

  20. Are clinicopathological features of colorectal cancers with methylation in half of CpG island methylator phenotype panel markers different from those of CpG island methylator phenotype-high colorectal cancers?

    PubMed

    Bae, Jeong Mo; Rhee, Ye-Young; Kim, Kyung Ju; Wen, Xianyu; Song, Young Seok; Cho, Nam-Yun; Kim, Jung Ho; Kang, Gyeong Hoon

    2016-01-01

    CpG island methylator phenotype (CIMP)-high (CIMP-H) colorectal cancer (CRC) is defined when a tumor shows methylation at greater than or equal to 60% of CIMP panel markers. Although CRCs with methylation at 50% of panel markers are classified as CIMP-low/CIMP-0 tumors, little is known regarding the clinicopathological and molecular features of CRCs with methylation at 4/8 panel markers (4/8 methylated markers) and whether they are akin to CIMP-H or CIMP-low/CIMP-0 CRCs in terms of their clinicopathological or molecular features. A total of 1164 cases of surgically resected CRC were analyzed for their methylation status in 8 CIMP panel markers, and the frequencies of various clinicopathological and molecular features were compared between CRCs with 0/8, 1/8 to 3/8, 4/8, and 5/8 to 8/8 methylated markers. CRCs with 4/8 methylated markers were closer to CRCs with 5/8 to 8/8 methylated markers in terms of sex distribution, mucin production, serration, nodal metastasis, CK7 expression, CK20 loss, and CDX2 loss frequencies and overall survival rate. CRCs with methylation at 4/8 markers were closer to CRCs with 1/8 to 3/8 methylated markers in terms of less frequent right colon location and poor differentiation. CRCs with 4/8 methylated markers showed the shortest overall survival time compared with CRCs with 0/8, 1/8 to 3/8, 4/8, or 5/8 to 8/8 methylated markers. In terms of clinicopathological and molecular features, CRCs with 4/8 methylated markers appeared to be closer to CIMP-H than to CIMP-low/CIMP-0 and would thus be better classified as CIMP-H if the CRCs require classification into either CIMP-H or CIMP-low/CIMP-0. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Despite Increased Type 1 IFN, Autoimmune Nonobese Diabetic Mice Display Impaired Dendritic Cell Response to CpG and Decreased Nuclear Localization of IFN-Activated STAT1.

    PubMed

    Rahman, M Jubayer; Rahir, Gwendoline; Dong, Matthew B; Zhao, Yongge; Rodrigues, Kameron B; Hotta-Iwamura, Chie; Chen, Ye; Guerrero, Alan; Tarbell, Kristin V

    2016-03-01

    Innate immune signals help break self-tolerance to initiate autoimmune diseases such as type 1 diabetes, but innate contributions to subsequent regulation of disease progression are less clear. Most studies have measured in vitro innate responses of GM-CSF dendritic cells (DCs) that are functionally distinct from conventional DCs (cDCs) and do not reflect in vivo DC subsets. To determine whether autoimmune NOD mice have alterations in type 1 IFN innate responsiveness, we compared cDCs from prediabetic NOD and control C57BL/6 (B6) mice stimulated in vivo with the TLR9 ligand CpG, a strong type 1 IFN inducer. In response to CpG, NOD mice produce more type 1 IFN and express higher levels of CD40, and NOD monocyte DCs make more TNF. However, the overall CpG-induced transcriptional response is muted in NOD cDCs. Of relevance the costimulatory proteins CD80/CD86, signals needed for regulatory T cell homeostasis, are upregulated less on NOD cDCs. Interestingly, NOD Rag1(-/-) mice also display a defect in CpG-induced CD86 upregulation compared with B6 Rag1(-/-), indicating this particular innate alteration precedes adaptive autoimmunity. The impaired response in NOD DCs is likely downstream of the IFN-α/β receptor because DCs from NOD and B6 mice show similar CpG-induced CD86 levels when anti-IFN-α/β receptor Ab is added. IFN-α-induced nuclear localization of activated STAT1 is markedly reduced in NOD CD11c(+) cells, consistent with lower type 1 IFN responsiveness. In conclusion, NOD DCs display altered innate responses characterized by enhanced type 1 IFN and activation of monocyte-derived DCs but diminished cDC type 1 IFN response.

  2. [Bacterial translocation: gap in the shield].

    PubMed

    Rosero, Olivér; Kovács, Tibor; Onody, Péter; Harsányi, László; Szijártó, Attila

    2014-02-23

    The gastrointestinal tract is not only regarded as a system where nutrient absorption takes place, but also as a vital barrier against intraluminal pathogens entering the circulation and the maintenance of immune homeostasis. Bacterial translocation is defined as the penetration of viable bacteria or bacterial compounds from the gastrointestinal tract to extraintestinal sites. This disorder has been described in several clinical conditions. The main promoting factors for bacterial translocation have been proposed to be changes in the intestinal microflora, mucosal barrier failure and defects in host immunity. The presence of bacterial translocation has been associated with higher complications and mortality rates; therefore it should be taken into account in the therapeutic strategies of patients with predisposing factors.

  3. Host Biomarkers for Distinguishing Bacterial from Non-Bacterial Causes of Acute Febrile Illness: A Comprehensive Review

    PubMed Central

    Kapasi, Anokhi J.; Dittrich, Sabine; González, Iveth J.; Rodwell, Timothy C.

    2016-01-01

    Background In resource limited settings acute febrile illnesses are often treated empirically due to a lack of reliable, rapid point-of-care diagnostics. This contributes to the indiscriminate use of antimicrobial drugs and poor treatment outcomes. The aim of this comprehensive review was to summarize the diagnostic performance of host biomarkers capable of differentiating bacterial from non-bacterial infections to guide the use of antibiotics. Methods Online databases of published literature were searched from January 2010 through April 2015. English language studies that evaluated the performance of one or more host biomarker in differentiating bacterial from non-bacterial infection in patients were included. Key information extracted included author information, study methods, population, pathogens, clinical information, and biomarker performance data. Study quality was assessed using a combination of validated criteria from the QUADAS and Lijmer checklists. Biomarkers were categorized as hematologic factors, inflammatory molecules, cytokines, cell surface or metabolic markers, other host biomarkers, host transcripts, clinical biometrics, and combinations of markers. Findings Of the 193 citations identified, 59 studies that evaluated over 112 host biomarkers were selected. Most studies involved patient populations from high-income countries, while 19% involved populations from low- and middle-income countries. The most frequently evaluated host biomarkers were C-reactive protein (61%), white blood cell count (44%) and procalcitonin (34%). Study quality scores ranged from 23.1% to 92.3%. There were 9 high performance host biomarkers or combinations, with sensitivity and specificity of ≥85% or either sensitivity or specificity was reported to be 100%. Five host biomarkers were considered weak markers as they lacked statistically significant performance in discriminating between bacterial and non-bacterial infections. Discussion This manuscript provides a summary

  4. The intrinsic resistome of bacterial pathogens

    PubMed Central

    Olivares, Jorge; Bernardini, Alejandra; Garcia-Leon, Guillermo; Corona, Fernando; B. Sanchez, Maria; Martinez, Jose L.

    2013-01-01

    Intrinsically resistant bacteria have emerged as a relevant health problem in the last years. Those bacterial species, several of them with an environmental origin, present naturally low-level susceptibility to several drugs. It has been proposed that intrinsic resistance is mainly the consequence of the impermeability of cellular envelopes, the activity of multidrug efflux pumps or the lack of appropriate targets for a given family of drugs. However, recently published articles indicate that the characteristic phenotype of susceptibility to antibiotics of a given bacterial species depends on the concerted activity of several elements, what has been named as intrinsic resistome. These determinants comprise not just classical resistance genes. Other elements, several of them involved in basic bacterial metabolic processes, are of relevance for the intrinsic resistance of bacterial pathogens. In the present review we analyze recent publications on the intrinsic resistomes of Escherichia coli and Pseudomonas aeruginosa. We present as well information on the role that global regulators of bacterial metabolism, as Crc from P. aeruginosa, may have on modulating bacterial susceptibility to antibiotics. Finally, we discuss the possibility of searching inhibitors of the intrinsic resistome in the aim of improving the activity of drugs currently in use for clinical practice. PMID:23641241

  5. The intrinsic resistome of bacterial pathogens.

    PubMed

    Olivares, Jorge; Bernardini, Alejandra; Garcia-Leon, Guillermo; Corona, Fernando; B Sanchez, Maria; Martinez, Jose L

    2013-01-01

    Intrinsically resistant bacteria have emerged as a relevant health problem in the last years. Those bacterial species, several of them with an environmental origin, present naturally low-level susceptibility to several drugs. It has been proposed that intrinsic resistance is mainly the consequence of the impermeability of cellular envelopes, the activity of multidrug efflux pumps or the lack of appropriate targets for a given family of drugs. However, recently published articles indicate that the characteristic phenotype of susceptibility to antibiotics of a given bacterial species depends on the concerted activity of several elements, what has been named as intrinsic resistome. These determinants comprise not just classical resistance genes. Other elements, several of them involved in basic bacterial metabolic processes, are of relevance for the intrinsic resistance of bacterial pathogens. In the present review we analyze recent publications on the intrinsic resistomes of Escherichia coli and Pseudomonas aeruginosa. We present as well information on the role that global regulators of bacterial metabolism, as Crc from P. aeruginosa, may have on modulating bacterial susceptibility to antibiotics. Finally, we discuss the possibility of searching inhibitors of the intrinsic resistome in the aim of improving the activity of drugs currently in use for clinical practice.

  6. Statistical analysis of the Bacterial Carbohydrate Structure Data Base (BCSDB): Characteristics and diversity of bacterial carbohydrates in comparison with mammalian glycans

    PubMed Central

    Herget, Stephan; Toukach, Philip V; Ranzinger, René; Hull, William E; Knirel, Yuriy A; von der Lieth, Claus-Wilhelm

    2008-01-01

    Background There are considerable differences between bacterial and mammalian glycans. In contrast to most eukaryotic carbohydrates, bacterial glycans are often composed of repeating units with diverse functions ranging from structural reinforcement to adhesion, colonization and camouflage. Since bacterial glycans are typically displayed at the cell surface, they can interact with the environment and, therefore, have significant biomedical importance. Results The sequence characteristics of glycans (monosaccharide composition, modifications, and linkage patterns) for the higher bacterial taxonomic classes have been examined and compared with the data for mammals, with both similarities and unique features becoming evident. Compared to mammalian glycans, the bacterial glycans deposited in the current databases have a more than ten-fold greater diversity at the monosaccharide level, and the disaccharide pattern space is approximately nine times larger. Specific bacterial subclasses exhibit characteristic glycans which can be distinguished on the basis of distinctive structural features or sequence properties. Conclusion For the first time a systematic database analysis of the bacterial glycome has been performed. This study summarizes the current knowledge of bacterial glycan architecture and diversity and reveals putative targets for the rational design and development of therapeutic intervention strategies by comparing bacterial and mammalian glycans. PMID:18694500

  7. The quest for bacterial allergens.

    PubMed

    Nordengrün, Maria; Michalik, Stephan; Völker, Uwe; Bröker, Barbara M; Gómez-Gascón, Lidia

    2018-04-26

    Allergies are complex diseases featuring local tissue inflammation, which is characterized by an exaggerated type 2 immune response to environmental compounds known as allergens. Pollens, environmental fungi, and house dust mites are examples of common allergens. Bacteria have a dual role in allergy. Usually, they are associated with protection, however, certain bacterial species promote the development and exacerbation of allergic inflammation. Notably, IgE antibodies specific for bacterial antigens are found in the sera of allergic individuals. This implies that some bacterial factors are allergens, eliciting a specific type 2 immune response. However, to date, only a few of these are molecularly defined. This review summarizes the current knowledge about known bacterial allergens, and it provides an overview of the available techniques for the discovery of new allergens as well as for measuring the immune responses directed against them. Copyright © 2018 The Authors. Published by Elsevier GmbH.. All rights reserved.

  8. Characterisation of the gill mucosal bacterial communities of four butterflyfish species: a reservoir of bacterial diversity in coral reef ecosystems.

    PubMed

    Reverter, Miriam; Sasal, Pierre; Tapissier-Bontemps, N; Lecchini, D; Suzuki, M

    2017-06-01

    While recent studies have suggested that fish mucus microbiota play an important role in homeostasis and prevention of infections, very few studies have investigated the bacterial communities of gill mucus. We characterised the gill mucus bacterial communities of four butterflyfish species and although the bacterial diversity of gill mucus varied significantly between species, Shannon diversities were high (H = 3.7-5.7) in all species. Microbiota composition differed between butterflyfishes, with Chaetodon lunulatus and C. ornatissimus having the most similar bacterial communities, which differed significantly from C. vagabundus and C. reticulatus. The core bacterial community of all species consisted of mainly Proteobacteria followed by Actinobacteria and Firmicutes. Chaetodonlunulatus and C. ornatissimus bacterial communities were mostly dominated by Gammaproteobacteria with Vibrio as the most abundant genus. Chaetodonvagabundus and C. reticulatus presented similar abundances of Gammaproteobacteria and Alphaproteobacteria, which were well represented by Acinetobacter and Paracoccus, respectively. In conclusion, our results indicate that different fish species present specific bacterial assemblages. Finally, as mucus layers are nutrient hotspots for heterotrophic bacteria living in oligotrophic environments, such as coral reef waters, the high bacterial diversity found in butterflyfish gill mucus might indicate external fish mucus surfaces act as a reservoir of coral reef bacterial diversity. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. Mechanical Homogenization Increases Bacterial Homogeneity in Sputum

    PubMed Central

    Stokell, Joshua R.; Khan, Ammad

    2014-01-01

    Sputum obtained from patients with cystic fibrosis (CF) is highly viscous and often heterogeneous in bacterial distribution. Adding dithiothreitol (DTT) is the standard method for liquefaction prior to processing sputum for molecular detection assays. To determine if DTT treatment homogenizes the bacterial distribution within sputum, we measured the difference in mean total bacterial abundance and abundance of Burkholderia multivorans between aliquots of DTT-treated sputum samples with and without a mechanical homogenization (MH) step using a high-speed dispersing element. Additionally, we measured the effect of MH on bacterial abundance. We found a significant difference between the mean bacterial abundances in aliquots that were subjected to only DTT treatment and those of the aliquots which included an MH step (all bacteria, P = 0.04; B. multivorans, P = 0.05). There was no significant effect of MH on bacterial abundance in sputum. Although our results are from a single CF patient, they indicate that mechanical homogenization increases the homogeneity of bacteria in sputum. PMID:24759710

  10. Profiling CpG island field methylation in both morphologically normal and neoplastic human colonic mucosa.

    PubMed

    Belshaw, N J; Elliott, G O; Foxall, R J; Dainty, J R; Pal, N; Coupe, A; Garg, D; Bradburn, D M; Mathers, J C; Johnson, I T

    2008-07-08

    Aberrant CpG island (CGI) methylation occurs early in colorectal neoplasia. Quantitative methylation-specific PCR profiling applied to biopsies was used to quantify low levels of CGI methylation of 18 genes in the morphologically normal colonic mucosa of neoplasia-free subjects, adenomatous polyp patients, cancer patients and their tumours. Multivariate statistical analyses distinguished tumour from mucosa with a sensitivity of 78.9% and a specificity of 100% (P=3 x 10(-7)). In morphologically normal mucosa, age-dependent CGI methylation was observed for APC, AXIN2, DKK1, HPP1, N33, p16, SFRP1, SFRP2 and SFRP4 genes, and significant differences in CGI methylation levels were detected between groups. Multinomial logistic regression models based on the CGI methylation profiles from normal mucosa correctly identified 78.9% of cancer patients and 87.9% of non-cancer (neoplasia-free+polyp) patients (P=4.93 x 10(-7)) using APC, HPP1, p16, SFRP4, WIF1 and ESR1 methylation as the most informative variables. Similarly, CGI methylation of SFRP4, SFRP5 and WIF1 correctly identified 61.5% of polyp patients and 78.9% of neoplasia-free subjects (P=0.0167). The apparently normal mucosal field of patients presenting with neoplasia has evidently undergone significant epigenetic modification. Methylation of the genes selected by the models may play a role in the earliest stages of the development of colorectal neoplasia.

  11. The role of the CpG island methylator phenotype on survival outcome in colon cancer.

    PubMed

    Kang, Ki Joo; Min, Byung Hoon; Ryu, Kyung Ju; Kim, Kyoung Mee; Chang, Dong Kyung; Kim, Jae J; Rhee, Jong Chul; Kim, Young Ho

    2015-03-01

    CpG island methylator phenotype (CIMP)- high colorectal cancers (CRCs) have distinct clinicopathologi-cal features from their CIMP-low/negative CRC counterparts. However, controversy exists regarding the prognosis of CRC according to the CIMP status. Therefore, this study examined the prognosis of Korean patients with colon cancer according to the CIMP status. Among a previous cohort pop-ulation with CRC, a total of 154 patients with colon cancer who had available tissue for DNA extraction were included in the study. CIMP-high was defined as ≥3/5 methylated mark-ers using the five-marker panel (CACNA1G, IGF2, NEUROG1, RUNX3, and SOCS1). CIMP-high and CIMP-low/neg-ative cancers were observed in 27 patients (17.5%) and 127 patients (82.5%), respectively. Multivariate analysis adjust-ing for age, gender, tumor location, tumor stage and CIMP and microsatellite instability (MSI) statuses indicated that CIMP-high colon cancers were associated with a significant increase in colon cancer-specific mortality (hazard ratio [HR], 3.23; 95% confidence interval [CI], 1.20 to 8.69; p=0.02). In microsatellite stable cancers, CIMP-high cancer had a poor survival outcome compared to CIMP-low/negative cancer (HR, 2.91; 95% CI, 1.02 to 8.27; p=0.04). Re-gardless of the MSI status, CIMP-high cancers had poor sur-vival outcomes in Korean patients. (Gut Liver, 2015;9202-207).

  12. CpG island methylation of TMS1/ASC and CASP8 genes in cervical cancer

    PubMed Central

    2009-01-01

    Background Gene silencing associated with aberrant methylation of promoter region CpG islands is an acquired epigenetic alteration that serves as an alternative to genetic defects in the inactivation of tumor suppressor and other genes in human cancers. Aims This study describes the methylation status of TMS1/ASC and CASP8 genes in cervical cancer. We also examined the prevalence of TMS1/ASC and CASP8 genes methylation in cervical cancer tissue and none - neo plastic samples in an effort to correlate with smoking habit and clinicopathological features. Method Target DNA was modified by sodium bisulfite, converting all unmethylated, but not methylated, cytosines to uracil, and subsequently amplified by Methylation Specific (MS) PCR with primers specific for methylated versus unmethylated DNA. The PCR product was detected by gel electrophoresis and combined with the clinical records of patients. Results The methylation pattern of the TMS1/ASC and CASP8 genes in specimens of cervical cancer and adjacent normal tissues were detected [5/80 (6.2%), 3/80 (3.75%)-2/80 (2.5%), 1/80 (1.2%) respectively]. No statistical differences were seen in the extent of differentiation, invasion, pathological type and smoking habit between the methylated and unmethylated tissues (P > 0.05). Conclusion The present study conclude that the frequency of TMS1/ASC and CASP8 genes methylation in cervical cancer are rare (< 6%), and have no any critical role in development of cervical cancer. PMID:19258216

  13. Temperate bacterial viruses as double-edged swords in bacterial warfare.

    PubMed

    Gama, João Alves; Reis, Ana Maria; Domingues, Iolanda; Mendes-Soares, Helena; Matos, Ana Margarida; Dionisio, Francisco

    2013-01-01

    It has been argued that bacterial cells may use their temperate viruses as biological weapons. For instance, a few bacterial cells among a population of lysogenic cells could release the virus and kill susceptible non-lysogenic competitors, while their clone mates would be immune. Because viruses replicate inside their victims upon infection, this process would amplify their number in the arena. Sometimes, however, temperate viruses spare recipient cells from death by establishing themselves in a dormant state inside cells. This phenomenon is called lysogenization and, for some viruses such as the λ virus, the probability of lysogenization increases with the multiplicity of infection. Therefore, the amplification of viruses leads to conflicting predictions about the efficacy of temperate viruses as biological weapons: amplification can increase the relative advantage of clone mates of lysogens but also the likelihood of saving susceptible cells from death, because the probability of lysogenization is higher. To test the usefulness of viruses as biological weapons, we performed competition experiments between lysogenic Escherichia coli cells carrying the λ virus and susceptible λ-free E. coli cells, either in a structured or unstructured habitat. In structured and sometimes in unstructured habitats, the λ virus qualitatively behaved as a "replicating toxin". However, such toxic effect of λ viruses ceased after a few days of competition. This was due to the fact that many of initially susceptible cells became lysogenic. Massive lysogenization of susceptible cells occurred precisely under the conditions where the amplification of the virus was substantial. From then on, these cells and their descendants became immune to the λ virus. In conclusion, if at short term bacterial cells may use temperate viruses as biological weapons, after a few days only the classical view of temperate bacterial viruses as parasitic agents prevails.

  14. Temperate Bacterial Viruses as Double-Edged Swords in Bacterial Warfare

    PubMed Central

    Gama, João Alves; Reis, Ana Maria; Domingues, Iolanda; Mendes-Soares, Helena; Matos, Ana Margarida; Dionisio, Francisco

    2013-01-01

    It has been argued that bacterial cells may use their temperate viruses as biological weapons. For instance, a few bacterial cells among a population of lysogenic cells could release the virus and kill susceptible non-lysogenic competitors, while their clone mates would be immune. Because viruses replicate inside their victims upon infection, this process would amplify their number in the arena. Sometimes, however, temperate viruses spare recipient cells from death by establishing themselves in a dormant state inside cells. This phenomenon is called lysogenization and, for some viruses such as the λ virus, the probability of lysogenization increases with the multiplicity of infection. Therefore, the amplification of viruses leads to conflicting predictions about the efficacy of temperate viruses as biological weapons: amplification can increase the relative advantage of clone mates of lysogens but also the likelihood of saving susceptible cells from death, because the probability of lysogenization is higher. To test the usefulness of viruses as biological weapons, we performed competition experiments between lysogenic Escherichia coli cells carrying the λ virus and susceptible λ-free E. coli cells, either in a structured or unstructured habitat. In structured and sometimes in unstructured habitats, the λ virus qualitatively behaved as a “replicating toxin”. However, such toxic effect of λ viruses ceased after a few days of competition. This was due to the fact that many of initially susceptible cells became lysogenic. Massive lysogenization of susceptible cells occurred precisely under the conditions where the amplification of the virus was substantial. From then on, these cells and their descendants became immune to the λ virus. In conclusion, if at short term bacterial cells may use temperate viruses as biological weapons, after a few days only the classical view of temperate bacterial viruses as parasitic agents prevails. PMID:23536852

  15. A varying T cell subtype explains apparent tobacco smoking induced single CpG hypomethylation in whole blood.

    PubMed

    Bauer, Mario; Linsel, Gunter; Fink, Beate; Offenberg, Kirsten; Hahn, Anne Maria; Sack, Ulrich; Knaack, Heike; Eszlinger, Markus; Herberth, Gunda

    2015-01-01

    Many recent epigenetic studies report that cigarette smoking reduces DNA methylation in whole blood at the single CpG site cg19859270 within the GPR15 gene. Within two independent cohorts, we confirmed the differentially expression of the GPR15 gene when smokers and non-smokers subjects are compared. By validating the GPR15 protein expression at the cellular level, we found that the observed decreased methylation at this site in white blood cells (WBC) of smokers is mainly caused by the high proportion of CD3+GPR15+ expressing T cells in peripheral blood. In current smokers, the percentage of GPR15+ cells among CD3+ T cells in peripheral blood is significantly higher (15.5 ± 7.2 %, mean ± standard deviation) compared to non-smokers (3.7 ± 1.6 %). Treatment of peripheral blood mononuclear cell (PBMC) cultures with aqueous cigarette smoke extract did not induce a higher proportion of this T cell subtype. Our results underline that DNA hypomethylation at cg19859270 site, observed in WBCs of smokers, did not arise by direct effect of tobacco smoking compounds on methylation of DNA but rather by the enrichment of a tobacco-smoking-induced lymphocyte population in the peripheral blood.

  16. Steroids in bacterial meningitis: yes.

    PubMed

    Benninger, Felix; Steiner, Israel

    2013-02-01

    Bacterial meningitis is an infectious condition associated with severe morbidity and mortality, even with rapid diagnosis and appropriate antibiotic therapy. Despite decrease in the rate of bacterial meningitis brought about by vaccination programs against Haemophilus influenzae type-B and Streptococcus pneumonia, the incidence of meningitis is still unacceptably high and acute treatment remains the mainstay of therapy. The infection is accompanied by intense inflammatory response, which may carry deleterious effects upon the tissue. This led to the possibility of adjuvant corticosteroid therapy, as an anti-inflammatory agent, in bacterial meningitis. The debate focuses on the rational and evidence supporting and refuting such an approach.

  17. Bacterial disease management: challenges, experience, innovation and future prospects: Challenges in Bacterial Molecular Plant Pathology.

    PubMed

    Sundin, George W; Castiblanco, Luisa F; Yuan, Xiaochen; Zeng, Quan; Yang, Ching-Hong

    2016-12-01

    Plant diseases caused by bacterial pathogens place major constraints on crop production and cause significant annual losses on a global scale. The attainment of consistent effective management of these diseases can be extremely difficult, and management potential is often affected by grower reliance on highly disease-susceptible cultivars because of consumer preferences, and by environmental conditions favouring pathogen development. New and emerging bacterial disease problems (e.g. zebra chip of potato) and established problems in new geographical regions (e.g. bacterial canker of kiwifruit in New Zealand) grab the headlines, but the list of bacterial disease problems with few effective management options is long. The ever-increasing global human population requires the continued stable production of a safe food supply with greater yields because of the shrinking areas of arable land. One major facet in the maintenance of the sustainability of crop production systems with predictable yields involves the identification and deployment of sustainable disease management solutions for bacterial diseases. In addition, the identification of novel management tactics has also come to the fore because of the increasing evolution of resistance to existing bactericides. A number of central research foci, involving basic research to identify critical pathogen targets for control, novel methodologies and methods of delivery, are emerging that will provide a strong basis for bacterial disease management into the future. Near-term solutions are desperately needed. Are there replacement materials for existing bactericides that can provide effective disease management under field conditions? Experience should inform the future. With prior knowledge of bactericide resistance issues evolving in pathogens, how will this affect the deployment of newer compounds and biological controls? Knowledge is critical. A comprehensive understanding of bacterial pathosystems is required to not

  18. Electrical conductivity measurements of bacterial nanowires from Pseudomonas aeruginosa

    NASA Astrophysics Data System (ADS)

    Maruthupandy, Muthusamy; Anand, Muthusamy; Maduraiveeran, Govindhan; Sait Hameedha Beevi, Akbar; Jeeva Priya, Radhakrishnan

    2015-12-01

    The extracellular appendages of bacteria (flagella) that transfer electrons to electrodes are called bacterial nanowires. This study focuses on the isolation and separation of nanowires that are attached via Pseudomonas aeruginosa bacterial culture. The size and roughness of separated nanowires were measured using transmission electron microscopy (TEM) and atomic force microscopy (AFM), respectively. The obtained bacterial nanowires indicated a clear image of bacterial nanowires measuring 16 nm in diameter. The formation of bacterial nanowires was confirmed by microscopic studies (AFM and TEM) and the conductivity nature of bacterial nanowire was investigated by electrochemical techniques. Cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS), which are nondestructive voltammetry techniques, suggest that bacterial nanowires could be the source of electrons—which may be used in various applications, for example, microbial fuel cells, biosensors, organic solar cells, and bioelectronic devices. Routine analysis of electron transfer between bacterial nanowires and the electrode was performed, providing insight into the extracellular electron transfer (EET) to the electrode. CV revealed the catalytic electron transferability of bacterial nanowires and electrodes and showed excellent redox activities. CV and EIS studies showed that bacterial nanowires can charge the surface by producing and storing sufficient electrons, behave as a capacitor, and have features consistent with EET. Finally, electrochemical studies confirmed the development of bacterial nanowires with EET. This study suggests that bacterial nanowires can be used to fabricate biomolecular sensors and nanoelectronic devices.

  19. Induction of anti-aging gene klotho with a small chemical compound that demethylates CpG islands

    PubMed Central

    Jung, Dongju; Xu, Yuechi; Sun, Zhongjie

    2017-01-01

    Klotho (KL) is described as an anti-aging gene because mutation of Kl gene leads to multiple pre-mature aging phenotypes and shortens lifespan in mice. Growing evidence suggests that an increase in KL expression may be beneficial for age-related diseases such as arteriosclerosis and diabetes. It remains largely unknown, however, how Kl expression could be induced. Here we discovered novel molecular mechanism for induction of Kl expression with a small molecule ‘Compound H’, N-(2-chlorophenyl)-1H-indole-3-caboxamide. Compound H was originally identified through a high-throughput screening of small molecules for identifying Kl inducers. However, how Compound H induces Kl expression has never been investigated. We found that Compound H increased Kl expression via demethylation in CpG islands of the Kl gene. The demethylation was accomplished by activating demethylases rather than inhibiting methylases. Due to demethylation, Compound H enhanced binding of transcription factors, Pax4 and Kid3, to the promoter of the Kl gene. Pax4 and Kid3 regulated Kl promoter activity positively and negatively, respectively. Thus, our results show that demethylation is an important molecular mechanism that mediates Compound H-induced Kl expression. Further investigation is warranted to determine whether Compound H demethylates the Kl gene in vivo and whether it can serve as a therapeutic agent for repressing or delaying the onset of age-related diseases. PMID:28657902

  20. Developmentally Programmed 3′ CpG Island Methylation Confers Tissue- and Cell-Type-Specific Transcriptional Activation

    PubMed Central

    Yu, Da-Hai; Ware, Carol; Waterland, Robert A.; Zhang, Jiexin; Chen, Miao-Hsueh; Gadkari, Manasi; Kunde-Ramamoorthy, Govindarajan; Nosavanh, Lagina M.

    2013-01-01

    During development, a small but significant number of CpG islands (CGIs) become methylated. The timing of developmentally programmed CGI methylation and associated mechanisms of transcriptional regulation during cellular differentiation, however, remain poorly characterized. Here, we used genome-wide DNA methylation microarrays to identify epigenetic changes during human embryonic stem cell (hESC) differentiation. We discovered a group of CGIs associated with developmental genes that gain methylation after hESCs differentiate. Conversely, erasure of methylation was observed at the identified CGIs during subsequent reprogramming to induced pluripotent stem cells (iPSCs), further supporting a functional role for the CGI methylation. Both global gene expression profiling and quantitative reverse transcription-PCR (RT-PCR) validation indicated opposing effects of CGI methylation in transcriptional regulation during differentiation, with promoter CGI methylation repressing and 3′ CGI methylation activating transcription. By studying diverse human tissues and mouse models, we further confirmed that developmentally programmed 3′ CGI methylation confers tissue- and cell-type-specific gene activation in vivo. Importantly, luciferase reporter assays provided evidence that 3′ CGI methylation regulates transcriptional activation via a CTCF-dependent enhancer-blocking mechanism. These findings expand the classic view of mammalian CGI methylation as a mechanism for transcriptional silencing and indicate a functional role for 3′ CGI methylation in developmental gene regulation. PMID:23459939