Macrophage defense mechanisms against intracellular bacteria

PubMed Central

Weiss, Günter; Schaible, Ulrich E

2015-01-01

Macrophages and neutrophils play a decisive role in host responses to intracellular bacteria including the agent of tuberculosis (TB), Mycobacterium tuberculosis as they represent the forefront of innate immune defense against bacterial invaders. At the same time, these phagocytes are also primary targets of intracellular bacteria to be abused as host cells. Their efficacy to contain and eliminate intracellular M. tuberculosis decides whether a patient initially becomes infected or not. However, when the infection becomes chronic or even latent (as in the case of TB) despite development of specific immune activation, phagocytes have also important effector functions. Macrophages have evolved a myriad of defense strategies to combat infection with intracellular bacteria such as M. tuberculosis. These include induction of toxic anti-microbial effectors such as nitric oxide and reactive oxygen intermediates, the stimulation of microbe intoxication mechanisms via acidification or metal accumulation in the phagolysosome, the restriction of the microbe's access to essential nutrients such as iron, fatty acids, or amino acids, the production of anti-microbial peptides and cytokines, along with induction of autophagy and efferocytosis to eliminate the pathogen. On the other hand, M. tuberculosis, as a prime example of a well-adapted facultative intracellular bacterium, has learned during evolution to counter-balance the host's immune defense strategies to secure survival or multiplication within this otherwise hostile environment. This review provides an overview of innate immune defense of macrophages directed against intracellular bacteria with a focus on M. tuberculosis. Gaining more insights and knowledge into this complex network of host-pathogen interaction will identify novel target sites of intervention to successfully clear infection at a time of rapidly emerging multi-resistance of M. tuberculosis against conventional antibiotics. PMID:25703560

Defense mechanisms in ethics consultation.

PubMed

Agich, George J

2011-12-01

While there is no denying the relevance of ethical knowledge and analytical and cognitive skills in ethics consultation, such knowledge and skills can be overemphasized. They can be effectively put into practice only by an ethics consultant, who has a broad range of other skills, including interpretive and communicative capacities as well as the capacity effectively to address the psychosocial needs of patients, family members, and healthcare professionals in the context of an ethics consultation case. In this paper, I discuss how emotion can play an important interpretive role in clinical ethics consultation and why attention to the role of defense mechanisms can be helpful. I concentrate on defense mechanisms, arguing first, that the presence of these mechanisms is understandable given the emotional stresses and communicative occlusions that occur between the families of patients and critical care professionals in the circumstances of critical care; second, that identifying these mechanisms is essential for interpreting and managing how these factors influence the way that the "facts" of the case are understood by family members; and, third, that effectively addressing these mechanisms is an important component for effectively doing ethics consultation. Recognizing defense mechanisms, understanding how and why they operate, and knowing how to deal with these defense mechanisms when they pose problems for communication or decision making are thus essential prerequisites for effective ethics consultation, especially in critical care.

The 11S Proteasome Subunit PSME3 Is a Positive Feedforward Regulator of NF-κB and Important for Host Defense against Bacterial Pathogens.

PubMed

Sun, Jinxia; Luan, Yi; Xiang, Dong; Tan, Xiao; Chen, Hui; Deng, Qi; Zhang, Jiaojiao; Chen, Minghui; Huang, Hongjun; Wang, Weichao; Niu, Tingting; Li, Wenjie; Peng, Hu; Li, Shuangxi; Li, Lei; Tang, Wenwen; Li, Xiaotao; Wu, Dianqing; Wang, Ping

2016-02-02

The NF-κB pathway plays important roles in immune responses. Although its regulation has been extensively studied, here, we report an unknown feedforward mechanism for the regulation of this pathway by Toll-like receptor (TLR) ligands in macrophages. During bacterial infections, TLR ligands upregulate the expression of the 11S proteasome subunit PSME3 via NF-κB-mediated transcription in macrophages. PSME3, in turn, enhances the transcriptional activity of NF-κB by directly binding to and destabilizing KLF2, a negative regulator of NF-κB transcriptional activity. Consistent with this positive role of PSME3 in NF-κB regulation and importance of the NF-κB pathway in host defense against bacterial infections, the lack of PSME3 in hematopoietic cells renders the hosts more susceptible to bacterial infections, accompanied by increased bacterial burdens in host tissues. Thus, this study identifies a substrate for PSME3 and elucidates a proteolysis-dependent, but ubiquitin-independent, mechanism for NF-κB regulation that is important for host defense and innate immunity. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

The Identification and Modification of Defense Mechanisms in Counseling.

ERIC Educational Resources Information Center

Clark, Arthur J.

1991-01-01

Suggests considerations and strategies for identifying and modifying a client's defense mechanisms in counseling. Provides definitions of individual defenses and indicators for identifying the mechanisms. Literature review focuses on counseling implications of defenses. Process of defense mechanism modification is illustrated through case example.…

Antiviral Defense Mechanisms in Honey Bees

PubMed Central

Brutscher, Laura M.; Daughenbaugh, Katie F.; Flenniken, Michelle L.

2015-01-01

Honey bees are significant pollinators of agricultural crops and other important plant species. High annual losses of honey bee colonies in North America and in some parts of Europe have profound ecological and economic implications. Colony losses have been attributed to multiple factors including RNA viruses, thus understanding bee antiviral defense mechanisms may result in the development of strategies that mitigate colony losses. Honey bee antiviral defense mechanisms include RNA-interference, pathogen-associated molecular pattern (PAMP) triggered signal transduction cascades, and reactive oxygen species generation. However, the relative importance of these and other pathways is largely uncharacterized. Herein we review the current understanding of honey bee antiviral defense mechanisms and suggest important avenues for future investigation. PMID:26273564

Mechanisms of Defense: Nepenthe Theory and Psychiatric Symptomatology

ERIC Educational Resources Information Center

Azibo, Daudi Ajani ya

2007-01-01

Results of exploratory research on defense mechanisms and psychiatric symptomatology are reported about Black students enrolled in classes on the campus of one Historically Black College and University. Theoretical influences are twofold: ego mechanisms of defense conceptualized hierarchically and a culture-specific view of defense mechanism…

The Defense Mechanisms of Coronary Patients.

ERIC Educational Resources Information Center

Peglar, Marian; Borgen, Fred H.

1984-01-01

Tested 73 male inpatients with coronary heart disease on the Defense Mechanisms Inventory, State-Trait Anxiety Inventory, and a perception of health measure. Subjects were followed for five years. Principalization was discovered to be the most successful and projection the least successful defense. (JAC)

Defense Mechanisms in "Pure" Anxiety and "Pure" Depressive Disorders.

PubMed

Colovic, Olga; Lecic Tosevski, Dusica; Perunicic Mladenovic, Ivana; Milosavljevic, Maja; Munjiza, Ana

2016-10-01

Our study was intended to test whether there are any differences in the way defense mechanisms are used by patients suffering from pure anxiety and those with pure depressive disorders. The sample size was as follows: depressive disorders without psychotic symptoms 30, anxiety disorders 30, and the healthy control group 30. The assessment of defense mechanisms was made using the DSQ-40 questionnaire. Our findings show that "pure" anxiety disorders differ from "pure" depressive disorders only in the use of immature defense mechanisms. The group with depressive disorders was significantly more prone to use immature defense mechanisms than the group with anxiety disorders (p = 0.005), primarily projection (p = 0.001) and devaluation (p = 0.003). These defense mechanisms may therefore be used both to differentiate between anxiety and depressive disorders and also to determine which symptoms (anxiety or depressive disorders) are dominant at any given stage of treatment.

Mechanisms of plant defense against insect herbivores

PubMed Central

War, Abdul Rashid; Paulraj, Michael Gabriel; Ahmad, Tariq; Buhroo, Abdul Ahad; Hussain, Barkat; Ignacimuthu, Savarimuthu; Sharma, Hari Chand

2012-01-01

Plants respond to herbivory through various morphological, biochemicals, and molecular mechanisms to counter/offset the effects of herbivore attack. The biochemical mechanisms of defense against the herbivores are wide-ranging, highly dynamic, and are mediated both by direct and indirect defenses. The defensive compounds are either produced constitutively or in response to plant damage, and affect feeding, growth, and survival of herbivores. In addition, plants also release volatile organic compounds that attract the natural enemies of the herbivores. These strategies either act independently or in conjunction with each other. However, our understanding of these defensive mechanisms is still limited. Induced resistance could be exploited as an important tool for the pest management to minimize the amounts of insecticides used for pest control. Host plant resistance to insects, particularly, induced resistance, can also be manipulated with the use of chemical elicitors of secondary metabolites, which confer resistance to insects. By understanding the mechanisms of induced resistance, we can predict the herbivores that are likely to be affected by induced responses. The elicitors of induced responses can be sprayed on crop plants to build up the natural defense system against damage caused by herbivores. The induced responses can also be engineered genetically, so that the defensive compounds are constitutively produced in plants against are challenged by the herbivory. Induced resistance can be exploited for developing crop cultivars, which readily produce the inducible response upon mild infestation, and can act as one of components of integrated pest management for sustainable crop production. PMID:22895106

Molecular Dynamics Simulation and Statistics Analysis Reveals the Defense Response Mechanism in Plants

NASA Astrophysics Data System (ADS)

Liu, Zhichao; Zhao, Yunjie; Zeng, Chen; Computational Biophysics Lab Team

As the main protein of the bacterial flagella, flagellin plays an important role in perception and defense response. The newly discovered locus, FLS2, is ubiquitously expressed. FLS2 encodes a putative receptor kinase and shares many homologies with some plant resistance genes and even with some components of immune system of mammals and insects. In Arabidopsis, FLS2 perception is achieved by the recognition of epitope flg22, which induces FLS2 heteromerization with BAK1 and finally the plant immunity. Here we use both analytical methods such as Direct Coupling Analysis (DCA) and Molecular Dynamics (MD) Simulations to get a better understanding of the defense mechanism of FLS2. This may facilitate a redesign of flg22 or de-novo design for desired specificity and potency to extend the immune properties of FLS2 to other important crops and vegetables.

Proteome analysis of Arabidopsis seedlings exposed to bacterial volatiles.

PubMed

Kwon, Young Sang; Ryu, Choong-Min; Lee, Soohyun; Park, Hyo Bee; Han, Ki Soo; Lee, Jung Han; Lee, Kyunghee; Chung, Woo Sik; Jeong, Mi-Jeong; Kim, Hee Kyu; Bae, Dong-Won

2010-11-01

Plant root-associated bacteria (rhizobacteria) elicit plant basal immunity referred to as induced systemic resistance (ISR) against multiple pathogens. Among multi-bacterial determinants involving such ISR, the induction of ISR and promotion of growth by bacterial volatile compounds was previously reported. To exploit global de novo expression of plant proteins by bacterial volatiles, proteomic analysis was performed after exposure of Arabidopsis plants to the rhizobacterium Bacillus subtilis GB03. Ethylene biosynthesis enzymes were significantly up-regulated. Analysis by quantitative reverse transcriptase polymerase chain reaction confirmed that ethylene biosynthesis-related genes SAM-2, ACS4, ACS12, and ACO2 as well as ethylene response genes, ERF1, GST2, and CHIB were up-regulated by the exposure to bacterial volatiles. More interestingly, the emission of bacterial volatiles significantly up-regulated both key defense mechanisms mediated by jasmonic acid and salicylic acid signaling pathways. In addition, high accumulation of antioxidant proteins also provided evidence of decreased sensitivity to reactive oxygen species during the elicitation of ISR by bacterial volatiles. The present results suggest that the proteomic analysis of plant defense responses in bacterial volatile-mediated ISR can reveal the mechanisms of plant basal defenses orchestrated by endogenous ethylene production pathways and the generation of reactive oxygen species.

Case series on defense mechanisms in patients for reconstructive hand transplantation: consideration on transplant defense concept.

PubMed

Kumnig, Martin; Jowsey, Sheila G; Moreno, Elisa; Brandacher, Gerald; Azari, Kodi; Rumpold, Gerhard

2014-05-16

The technical demands of reconstructive hand transplantation (RHT) and need for complex multidisciplinary care have led to intense research efforts to improve patient care and outcomes. However, RHT is an extraordinary life event which carries the potential for long-term consequences including psychological distress, which invokes coping and defense mechanisms. Little is known about the relationship between psychological defense mechanisms and health outcomes in RHT patients. In an effort to elucidate this relationship, we studied seven RHT patients who underwent standardized psychological assessment either pre- or post transplantation. No single defense concept was identified as common to all patients, which we suspect was due in part to the varied mechanisms of hand loss. All seven patients demonstrated diverse psychological reactions to RHT. The self-reported defense styles were associated with psychological adjustment. The patients who reported defenses that distorted reality described less adaptive functioning and psychological well-being. These preliminary findings reveal the varied psychological mechanisms invoked in RHT patients. An assessment of defense mechanisms should be part of multicenter evaluation protocols that address unique psychosocial aspects of RHT in large samples, in order to better guide psychological management.

Differentiation of depression and anxiety groups using defense mechanisms.

PubMed

Olson, Trevor R; Presniak, Michelle D; MacGregor, Michael Wm

2009-11-01

We examined whether participants in depressed and anxious groups could be classified correctly using observer and self-report measures of defense mechanisms. A sample of 1182 university students completed the Personality Assessment Inventory and those scoring in the clinical range on either depression or anxiety indices were selected for participation. In total, 25 participants met criteria for the depressed group and 94 met criteria for the anxious group. Individual defense scores from the Defense-Q and the Defense Style Questionnaire were separately entered into 2 stepwise discriminant analyses. After cross-validation, the Defense-Q and Defense Style Questionnaire analyses classified participants with 75.0% and 71.3% accuracy, respectively. The results indicated that depression and anxiety groups can be significantly differentiated by defense use alone. Important differences in defensive functioning between these groups were confirmed and differences between observer and self-report measures of defenses mechanisms and current challenges in defense research were highlighted.

Psychological defense mechanisms among individuals with SCI with adjustment disorder.

PubMed

Yazdanshenas Ghazwin, Manijeh; Tavakoli, Seyed Amir Hossein; Latifi, Sahar; Saberi, Hooshang; Derakhshanrad, Nazi; Yekaninejad, Mir Saeed; Sadeghi, Majid; Emami Razavi, Seyed-Hassan; Norouzi Javidan, Abbas; Ghodsi, Seyed-Mohammad

2017-09-01

The used psychological defense styles among individuals with spinal cord injury (SCI) with adjustment disorders (AJD) have not yet been described. In the present investigation, the prevalence of AJD among people with SCI has been estimated and the pattern of used defense styles has been identified. Cross-sectional investigation. A tertiary rehabilitation center in Iran. Individuals referred to Brain and Spinal Cord Injury Research Center were invited to participate in a screening interview. AJD was diagnosed based on DSM-V criteria. Those with AJD diagnosis were scheduled for another interview to assess defense mechanisms. Demographic and injury-related variables were recorded. Defense mechanisms were assessed by the 40-item version of the Defense-Style Questionnaire (DSQ-40). Among 114 participants, 32 (28%) were diagnosed with AJD among whom 23 subjects attended the second interview. Mean age and time since injury were 29.57 ± 9.29 years and 11.70 ± 6.34 months, respectively. The majority of patients were using idealization defense mechanism (91.3%). In the second and third place, passive aggression (87.0%) and somatization (82.6%) defense mechanisms were observed, respectively. Neurotic style was dominantly used (11.52 ± 2.26). Sex, marital status, educational level, cause of the injury and injury level were not related to defense style (P: 0.38, 0.69, 0.88, 0.73, and P: 0.32, respectively). Prevalence of AJD is estimated to be 28% among individuals with SCI. The most prevalent defense style was neurotic and the dominant used defense mechanism was "idealization." The role of demographic and injury-related variables in determining the used defense mechanisms was insignificant.

Comparative genomics of defense systems in archaea and bacteria

PubMed Central

Makarova, Kira S.; Wolf, Yuri I.; Koonin, Eugene V.

2013-01-01

Our knowledge of prokaryotic defense systems has vastly expanded as the result of comparative genomic analysis, followed by experimental validation. This expansion is both quantitative, including the discovery of diverse new examples of known types of defense systems, such as restriction-modification or toxin-antitoxin systems, and qualitative, including the discovery of fundamentally new defense mechanisms, such as the CRISPR-Cas immunity system. Large-scale statistical analysis reveals that the distribution of different defense systems in bacterial and archaeal taxa is non-uniform, with four groups of organisms distinguishable with respect to the overall abundance and the balance between specific types of defense systems. The genes encoding defense system components in bacterial and archaea typically cluster in defense islands. In addition to genes encoding known defense systems, these islands contain numerous uncharacterized genes, which are candidates for new types of defense systems. The tight association of the genes encoding immunity systems and dormancy- or cell death-inducing defense systems in prokaryotic genomes suggests that these two major types of defense are functionally coupled, providing for effective protection at the population level. PMID:23470997

Molecular Mechanisms of Enhanced Bacterial Growth on Hexadecane with Red Clay.

PubMed

Jung, Jaejoon; Jang, In-Ae; Ahn, Sungeun; Shin, Bora; Kim, Jisun; Park, Chulwoo; Jee, Seung Cheol; Sung, Jung-Suk; Park, Woojun

2015-11-01

Red clay was previously used to enhance bioremediation of diesel-contaminated soil. It was speculated that the enhanced degradation of diesel was due to increased bacterial growth. In this study, we selected Acinetobacter oleivorans DR1, a soil-borne degrader of diesel and alkanes, as a model bacterium and performed transcriptional analysis using RNA sequencing to investigate the cellular response during hexadecane utilization and the mechanism by which red clay promotes hexadecane degradation. We confirmed that red clay promotes the growth of A. oleivorans DR1 on hexadecane, a major component of diesel, as a sole carbon source. Addition of red clay to hexadecane-utilizing DR1 cells highly upregulated β-oxidation, while genes related to alkane oxidation were highly expressed with and without red clay. Red clay also upregulated genes related to oxidative stress defense, such as superoxide dismutase, catalase, and glutaredoxin genes, suggesting that red clay supports the response of DR1 cells to oxidative stress generated during hexadecane utilization. Increased membrane fluidity in the presence of red clay was confirmed by fatty acid methyl ester analysis at different growth phases, suggesting that enhanced growth on hexadecane could be due to increased uptake of hexadecane coupled with upregulation of downstream metabolism and oxidative stress defense. The monitoring of the bacterial community in soil with red clay for a year revealed that red clay stabilized the community structure.

Emotional exhaustion and defense mechanisms in intensive therapy unit nurses.

PubMed

Regan, Anna; Howard, Ruth A; Oyebode, Jan R

2009-05-01

Contrary to its original conceptualization, research has found that emotional demands do not lead to burnout in nurses. According to psychoanalytic theory, unconscious defense mechanisms may protect nurses from conscious awareness of work-related anxiety. This prevents self-report and may explain research findings. The maturity of defense style influences how anxiety is managed. Immature defenses prevent the conscious processing necessary for resolution of anxiety. Therefore, it is hypothesized that the use of immature defenses will lead to emotional exhaustion. This cross-sectional study used questionnaires to explore the defense mechanisms of 87 Intensive Therapy Unit nurses. Although the sample endorsed a predominantly mature defense style, the use of immature defenses predicted emotional exhaustion. Also, lower levels of reported stress associated with emotional demands predicted emotional exhaustion. Although this strongly implies the mediating role of immature defense mechanisms, the results were not statistically significant.

Ego defense mechanisms in Pakistani medical students: a cross sectional analysis.

PubMed

Parekh, Maria A; Majeed, Hina; Khan, Tuba R; Khan, Anum B; Khalid, Salman; Khwaja, Nadia M; Khalid, Roha; Khan, Mohammad A; Rizqui, Ibrahim M; Jehan, Imtiaz

2010-01-29

Ego defense mechanisms (or factors), defined by Freud as unconscious resources used by the ego to reduce conflict between the id and superego, are a reflection of how an individual deals with conflict and stress. This study assesses the prevalence of various ego defense mechanisms employed by medical students of Karachi, which is a group with higher stress levels than the general population. A questionnaire based cross-sectional study was conducted on 682 students from five major medical colleges of Karachi over 4 weeks in November 2006. Ego defense mechanisms were assessed using the Defense Style Questionnaire (DSQ-40) individually and as grouped under Mature, Immature, and Neurotic factors. Lower mean scores of Immature defense mechanisms (4.78) were identified than those for Neurotic (5.62) and Mature (5.60) mechanisms among medical students of Karachi. Immature mechanisms were more commonly employed by males whereas females employed more Neurotic mechanisms than males. Neurotic and Immature defenses were significantly more prevalent in first and second year students. Mature mechanisms were significantly higher in students enrolled in Government colleges than Private institutions (p < 0.05). Immature defense mechanisms were less commonly employed than Neurotic and Mature mechanisms among medical students of Karachi. The greater employment of Neurotic defenses may reflect greater stress levels than the general population. Employment of these mechanisms was associated with female gender, enrollment in a private medical college, and students enrolled in the first 2 years of medical school.

Description of Bacterial Respiratory Infections among Department of Defense Beneficiaries, Utilizing Electronic Clinical Laboratory Data, October 2008-September 2013

DTIC Science & Technology

2014-08-01

i Description of bacterial respiratory infections among Department of Defense beneficiaries, utilizing electronic clinical laboratory...Description of Bacterial Respiratory Infections in the DOD, October 2008-September 2013 Prepared: 12 July 2014 EpiData Center Department ii...Description of Bacterial Respiratory Infections in the DOD, October 2008-September 2013 Prepared: 12 July 2014 EpiData Center Department Abstract

Molecular Mechanisms for Microbe Recognition and Defense by the Red Seaweed Laurencia dendroidea.

PubMed

de Oliveira, Louisi Souza; Tschoeke, Diogo Antonio; Magalhães Lopes, Ana Carolina Rubem; Sudatti, Daniela Bueno; Meirelles, Pedro Milet; Thompson, Cristiane C; Pereira, Renato Crespo; Thompson, Fabiano L

2017-01-01

The ability to recognize and respond to the presence of microbes is an essential strategy for seaweeds to survive in the marine environment, but understanding of molecular seaweed-microbe interactions is limited. Laurencia dendroidea clones were inoculated with the marine bacterium Vibrio madracius . The seaweed RNA was sequenced, providing an unprecedentedly high coverage of the transcriptome of Laurencia , and the gene expression levels were compared between control and inoculated samples after 24, 48, and 72 h. Transcriptomic changes in L. dendroidea in the presence of V. madracius include the upregulation of genes that participate in signaling pathways described here for the first time as a response of seaweeds to microbes. Genes coding for defense-related transcription activators, reactive oxygen species metabolism, terpene biosynthesis, and energy conversion pathways were upregulated in inoculated samples of L. dendroidea , indicating an integrated defensive system in seaweeds. This report contributes significantly to the current knowledge about the molecular mechanisms involved in the highly dynamic seaweed-bacterium interactions. IMPORTANCE Marine bacteria are part of the healthy microbiota associated with seaweeds, but some species, such as Vibrio spp., are frequently associated with disease outbreaks, especially in economically valuable cultures. In this context, the ability of seaweeds to recognize microbes and, when necessary, activate defense mechanisms is essential for their survival. However, studies dedicated to understanding the molecular components of the immune response in seaweeds are rare and restricted to indirect stimulus. This work provides an unprecedentedly large-scale evaluation of the transcriptional changes involved in microbe recognition, cellular signaling, and defense in the red seaweed Laurencia dendroidea in response to the marine bacterium Vibrio madracius . By expanding knowledge about seaweed-bacterium interactions and about the

Protecting the Self: Defense Mechanisms in Action

ERIC Educational Resources Information Center

Cramer, Phebe

2006-01-01

Integrating theory, research, and practical applications, this book provides a comprehensive examination of defense mechanisms and their role in both normal development and psychopathology. The author describes how children and adults mobilize specific kinds of defenses to maintain their psychological equilibrium and preserve self-esteem,…

Defense Mechanisms: Discussions and Bibliographies; General or Multiple, and Specific.

ERIC Educational Resources Information Center

Pedrini, D. T.; Pedrini, Bonnie C.

This publication considers some Freudian ego mechanisms. The first discussion and bibliography concerns defense mechanisms, in general or in multiple; after which, the discussions and bibliographies concern specific defense mechanisms: denial; displacement, substitution, sublimation; fixation; identification, introjection, incorporation,…

Phytohormone priming elevates the accumulation of defense-related gene transcripts and enhances bacterial blight disease resistance in cassava.

PubMed

Yoodee, Sunisa; Kobayashi, Yohko; Songnuan, Wisuwat; Boonchird, Chuenchit; Thitamadee, Siripong; Kobayashi, Issei; Narangajavana, Jarunya

2018-01-01

Cassava bacterial blight (CBB) disease caused by Xanthomonas axonopodis pv. manihotis (Xam) is a severe disease in cassava worldwide. In addition to causing significant cassava yield loss, CBB disease has not been extensively studied, especially in terms of CBB resistance genes. The present research demonstrated the molecular mechanisms underlining the defense response during Xam infection in two cassava cultivars exhibiting different degrees of disease resistance, Huay Bong60 (HB60) and Hanatee (HN). Based on gene expression analysis, ten of twelve putative defense-related genes including, leucine-rich repeat receptor-like kinases (LRR-RLKs), resistance (R), WRKY and pathogenesis-related (PR) genes, were differentially expressed between these two cassava cultivars during Xam infection. The up-regulation of defense-related genes observed in HB60 may be the mechanism required for the reduction of disease severity in the resistant cultivar. Interestingly, priming with salicylic acid (SA) or methyl jasmonate (MeJA) for 24 h before Xam inoculation could enhance the defense response in both cassava cultivars. The disease severity was decreased 10% in the resistant cultivar (HB60) and was remarkably reduced 21% in the susceptible cultivar (HN) by SA/MeJA priming. Priming with Xam inoculation modulated cassava4.1_013417, cassava4.1_030866 and cassava4.1_020555 (highest similarity to MeWRKY59, MePR1 and AtPDF2.2, respectively) expression and led to enhanced resistance of the susceptible cultivar in the second infection. The putative cis-regulatory elements were predicted in an upstream region of these three defense-related genes. The different gene expression levels in these genes between the two cultivars were due to the differences in cis-regulatory elements in their promoter regions. Taken together, our study strongly suggested that the induction of defense-related genes correlated with defense resistance against Xam infection, and exogenous application of SA or Me

Adversity Quotient and Defense Mechanism of Secondary School Students

ERIC Educational Resources Information Center

Nikam, Vibhawari B.; Uplane, Megha M.

2013-01-01

The present study was conducted to explore the relationship between Adversity Quotient (AQ) and Defense Mechanism (DM) of secondary school students. The aim of the study was to ascertain relationship between Adversity Quotient and Defense mechanism i. e. Turning against object (TAO), Projection (PRO), Turning against self (TAS), Principalisation…

[Relationships between defense mechanisms and coping strategies, facing exam anxiety performance].

PubMed

Grebot, E; Paty, B; Girarddephanix, N

2006-01-01

Defence mechanisms and coping strategies rely on different theoretical backgrounds and describe distinct psychological processes. Cramer has based a distinction on the following dimensions: conscious processes vs. not; intentionality vs. not; hierarchical conception vs. not. On the contrary to these distinctions, the two notions of defense mechanisms and coping strategies are defined as similar in the Diagnostical and Statistical Manual (DSM IV). This assimilation between coping and defenses in the DSM IV is not confirmed by some researches, namely the one by Callahan and Chabrol. It indeed proves a relationship between adaptive coping and mature defenses, as well as between maladaptive coping and immature defenses. Similarly, Plutchik offered theoretical correspondences between eight defense mechanisms and eight coping strategies: (a) Defenses: repression, isolation, introjection and Coping escape; (b) Defense denial and Coping minimalization; (c) Defense undoing and coping substitution; (d) Defenses: regression, acting out and coping social support; (e) Defenses: compensation, identification, fantasy and coping replacement; (f) Defenses: intellectualization, sublimation, annulation, rationalisation and coping: planification; (g) Defense projection and coping blame; (h) Defense: reactional formation and coping inversion. this research aims at testing the relations observed by Callahan and Chabrol and some theoretical correspondences proposed by Plutchik between defences and coping strategies in a population of students similar to the one used by Callahan and Chabrol. It also aims at studying the relationships between coping strategies and conscious derives of defense mechanisms, such as defined by Bond (1995). Defenses were evaluated the first day of the examination week. the population includes 184 women students in human sciences (sociology and psychology). defenses were evaluated with the Defense Style Questionnaire by Bond (DSQ 40). Its French version is made

Mechanical influences in bacterial morphogenesis and cell division

NASA Astrophysics Data System (ADS)

Sun, Sean

2010-03-01

Bacterial cells utilize a ring-like organelle (the Z-ring) to accomplish cell division. The Z-ring actively generates a contractile force and influences cell wall growth. We will discuss a general model of bacterial morphogenesis where mechanical forces are coupled to the growth dynamics of the cell wall. The model suggests a physical mechanism that determines the shapes of bacteria cells. The roles of several bacterial cytoskeletal proteins and the Z-ring are discussed. We will also explore molecular mechanisms of force generation by the Z-ring and how cells can generate mechanical forces without molecular motors.

Mechanical Homogenization Increases Bacterial Homogeneity in Sputum

PubMed Central

Stokell, Joshua R.; Khan, Ammad

2014-01-01

Sputum obtained from patients with cystic fibrosis (CF) is highly viscous and often heterogeneous in bacterial distribution. Adding dithiothreitol (DTT) is the standard method for liquefaction prior to processing sputum for molecular detection assays. To determine if DTT treatment homogenizes the bacterial distribution within sputum, we measured the difference in mean total bacterial abundance and abundance of Burkholderia multivorans between aliquots of DTT-treated sputum samples with and without a mechanical homogenization (MH) step using a high-speed dispersing element. Additionally, we measured the effect of MH on bacterial abundance. We found a significant difference between the mean bacterial abundances in aliquots that were subjected to only DTT treatment and those of the aliquots which included an MH step (all bacteria, P = 0.04; B. multivorans, P = 0.05). There was no significant effect of MH on bacterial abundance in sputum. Although our results are from a single CF patient, they indicate that mechanical homogenization increases the homogeneity of bacteria in sputum. PMID:24759710

Defense mechanisms and psychological adjustment in childhood.

PubMed

Sandstrom, Marlene J; Cramer, Phebe

2003-08-01

The association between maturity of defense use and psychological functioning was assessed in a group of 95 elementary school children. Defense mechanisms were measured using a valid and reliable storytelling task, and psychological adjustment was assessed through a combination of parent and self-report questionnaires. Correlational analyses indicated that children who relied on the developmentally immature defense of denial reported higher levels of self-rated social anxiety and depression and received higher ratings of parent-reported internalizing and externalizing behavior problems. However, children who made use of the developmentally mature defense of identification exhibited higher scores on perceived competence in social, academic, conduct, athletic, and global domains. Significantly, there was no relationship between children's use of denial and their level of perceived competence or between children's use of identification and their degree of maladjustment.

Role of defense/stress-related marker genes, proteins and secondary metabolites in defining rice self-defense mechanisms.

PubMed

Jwa, Nam-Soo; Agrawal, Ganesh Kumar; Tamogami, Shigeru; Yonekura, Masami; Han, Oksoo; Iwahashi, Hitoshi; Rakwal, Randeep

2006-01-01

Rice, a first cereal crop whose draft genome sequence from two subspecies (japonica-type cv. Nipponbare and indica-type 93-11) was available in 2002, along with its almost complete genome sequence in 2005, has drawn the attention of researchers worldwide because of its immense impact on human existence. One of the most critical research areas in rice is to discern the self-defense mechanism(s), an innate property of all living organisms. The last few decades have seen scattered research into rice responses to diverse environmental stimuli and stress factors. Our understanding on rice self-defense mechanism has increased considerably with accelerated research during recent years mainly due to identification and characterization of several defense/stress-related components, genes, proteins and secondary metabolites. As these identified components have been used to study the defense/stress pathways, their compilation in this review will undoubtedly help rice (and others) researchers to effectively use them as a potential marker for better understanding, and ultimately, in defining rice (and plant) self-defense response pathways.

Macrophage Autophagy and Bacterial Infections

PubMed Central

Bah, Aïcha; Vergne, Isabelle

2017-01-01

Autophagy is a well-conserved lysosomal degradation pathway that plays key roles in bacterial infections. One of the most studied is probably xenophagy, the selective capture and degradation of intracellular bacteria by lysosomes. However, the impact of autophagy goes beyond xenophagy and involves intensive cross-talks with other host defense mechanisms. In addition, autophagy machinery can have non-canonical functions such as LC3-associated phagocytosis. In this review, we intend to summarize the current knowledge on the many functions of autophagy proteins in cell defenses with a focus on bacteria–macrophage interaction. We also present the strategies developed by pathogens to evade or to exploit this machinery in order to establish a successful infection. Finally, we discuss the opportunities and challenges of autophagy manipulation in improving therapeutics and vaccines against bacterial pathogens. PMID:29163544

Using the Defensive Style Questionnaire to evaluate the impact of sex reassignment surgery on defensive mechanisms in transsexual patients.

PubMed

Lobato, Maria Inês; Koff, Walter José; Crestana, Tiago; Chaves, Camila; Salvador, Jaqueline; Petry, Analídia Rodolpho; Silveira, Esalba; Henriques, Alexandre Annes; Cervo, Fábio; Böhme, Eduardo Siam; Massuda, Raffael

2009-12-01

To evaluate the impact of sex reassignment surgery on the defense mechanisms of 32 transsexual patients at two different points in time using the Defensive Style Questionnaire. The Defensive Style Questionnaire was applied to 32 patients upon their admission to the Gender Identity Disorder Program, and 12 months after they had undergone sex reassignment surgery. There were changes in two defense mechanisms: anticipation and idealization. However, no significant differences were observed in terms of the mature, neurotic and immature categories. One possible explanation for this result is the fact that the procedure does not resolve gender dysphoria, which is a core symptom in such patients. Another aspect is related to the early onset of the gender identity disorder, which determines a more regressive defensive structure in these patients. Sex reassignment surgery did not improve the defensive profile as measured by the Defensive Style Questionnaire.

Adenosine A2B Receptor Deficiency Promotes Host Defenses against Gram-Negative Bacterial Pneumonia

PubMed Central

Barletta, Kathryn E.; Cagnina, R. Elaine; Burdick, Marie D.; Linden, Joel

2012-01-01

Rationale: Activation of the adenosine A2B receptor (A2BR) promotes antiinflammatory effects in diverse biological settings, but the role of this receptor in antimicrobial host defense in the lung has not been established. Gram-negative bacillary pneumonia is a common and serious illness associated with high morbidity and mortality, the treatment of which is complicated by increasing rates of antibiotic resistance. Objectives: To test the hypothesis that absence of adenosine A2B receptor signaling promotes host defense against bacterial pneumonia. Methods: We used a model of Klebsiella pneumoniae pneumonia in wild-type mice and mice with targeted deletion of the A2BR. Host responses were compared in vivo and leukocyte responses to the bacteria were examined in vitro. Measurements and Main Results: A2BR–/– mice demonstrated enhanced bacterial clearance from the lung and improved survival after infection with K. pneumoniae compared with wild-type controls, an effect that was mediated by bone marrow–derived cells. Leukocyte recruitment to the lungs and expression of inflammatory cytokines did not differ between A2BR–/– and wild-type mice, but A2BR–/– neutrophils exhibited sixfold greater bactericidal activity and enhanced production of neutrophil extracellular traps compared with wild-type neutrophils when incubated with K. pneumoniae. Consistent with this finding, bronchoalveolar lavage fluid from A2BR–/– mice with Klebsiella pneumonia contained more extracellular DNA compared with wild-type mice with pneumonia. Conclusions: These data suggest that the absence of A2BR signaling enhances antimicrobial activity in gram-negative bacterial pneumonia. PMID:22997203

DNA-sensing inflammasomes: regulation of bacterial host defense and the gut microbiota.

PubMed

Man, Si Ming; Karki, Rajendra; Kanneganti, Thirumala-Devi

2016-06-01

DNA sensors are formidable immune guardians of the host. At least 14 cytoplasmic DNA sensors have been identified in recent years, each with specialized roles in driving inflammation and/or cell death. Of these, AIM2 is a sensor of dsDNA, and forms an inflammasome complex to activate the cysteine protease caspase-1, mediates the release of the proinflammatory cytokines IL-1β and IL-18, and induces pyroptosis. The inflammasome sensor NLRP3 can also respond to DNA in the forms of oxidized mitochondrial DNA and the DNA derivative RNA:DNA hybrids produced by bacteria, whereas the putative inflammasome sensor IFI16 responds to viral DNA in the nucleus. Although inflammasomes provoke inflammation for anti-microbial host defense, they must also maintain homeostasis with commensal microbiota. Here, we outline recent advances highlighting the complex relationship between DNA-sensing inflammasomes, bacterial host defense and the gut microbiota. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Two volatile organic compounds trigger plant self-defense against a bacterial pathogen and a sucking insect in cucumber under open field conditions.

PubMed

Song, Geun Cheol; Ryu, Choong-Min

2013-05-08

Systemic acquired resistance (SAR) is a plant self-defense mechanism against a broad-range of pathogens and insect pests. Among chemical SAR triggers, plant and bacterial volatiles are promising candidates for use in pest management, as these volatiles are highly effective, inexpensive, and can be employed at relatively low concentrations compared with agrochemicals. However, such volatiles have some drawbacks, including the high evaporation rate of these compounds after application in the open field, their negative effects on plant growth, and their inconsistent levels of effectiveness. Here, we demonstrate the effectiveness of volatile organic compound (VOC)-mediated induced resistance against both the bacterial angular leaf spot pathogen, Pseudononas syringae pv. lachrymans, and the sucking insect aphid, Myzus persicae, in the open field. Using the VOCs 3-pentanol and 2-butanone where fruit yields increased gave unexpectedly, a significant increase in the number of ladybird beetles, Coccinella septempunctata, a natural enemy of aphids. The defense-related gene CsLOX was induced by VOC treatment, indicating that triggering the oxylipin pathway in response to the emission of green leaf volatiles can recruit the natural enemy of aphids. These results demonstrate that VOCs may help prevent plant disease and insect damage by eliciting induced resistance, even in open fields.

Shared and distinct mechanisms of iron acquisition by bacterial and fungal pathogens of humans

PubMed Central

Caza, Mélissa; Kronstad, James W.

2013-01-01

Iron is the most abundant transition metal in the human body and its bioavailability is stringently controlled. In particular, iron is tightly bound to host proteins such as transferrin to maintain homeostasis, to limit potential damage caused by iron toxicity under physiological conditions and to restrict access by pathogens. Therefore, iron acquisition during infection of a human host is a challenge that must be surmounted by every successful pathogenic microorganism. Iron is essential for bacterial and fungal physiological processes such as DNA replication, transcription, metabolism, and energy generation via respiration. Hence, pathogenic bacteria and fungi have developed sophisticated strategies to gain access to iron from host sources. Indeed, siderophore production and transport, iron acquisition from heme and host iron-containing proteins such as hemoglobin and transferrin, and reduction of ferric to ferrous iron with subsequent transport are all strategies found in bacterial and fungal pathogens of humans. This review focuses on a comparison of these strategies between bacterial and fungal pathogens in the context of virulence and the iron limitation that occurs in the human body as a mechanism of innate nutritional defense. PMID:24312900

Defense reactions of bean genotypes to bacterial pathogens in controlled conditions

NASA Astrophysics Data System (ADS)

Uysal, B.; Bastas, K. K.

2018-03-01

This study was focused on the role of antioxidant enzymes and total protein in imparting resistance against common bacterial blight caused by Xanthomonas axonopodis pv. phaseoli (Xap) and halo blight caused by Pseudomonas syringae pv. phaseolicola (Psp) in bean. Activities of Ascorbate peroxidase (APX), Catalase (CAT) and total protein were studied in resistant and susceptible bean genotypes. Five-day-old seedlings were inoculated with a bacterial suspension (108 CFU ml-1) and harvested at different time intervals (0, 12, 24 and 36 up to 72 h) under controlled growing conditions and assayed for antioxidant enzymes and total protein. Temporal increase of CAT, APX enzymes activities showed maximum activity at 12 h after both pathogens inoculation (hpi) in resistant cultivar, whereas in susceptible it increased at 72 h after both pathogens inoculation for CAT and 12, 24 h for APX enzymes. Maximum total protein activities were observed at 12 h and 24 h respectively after Xap, Psp inoculation (hpi) in resistant and maximum activities were observed at 24 h and 72 h respectively after Xap, Psp inoculation (hpi) in susceptible. Increase of antioxidant enzyme and total protein activities might be an important component in the defense strategy of resistance and susceptible bean genotypes against the bacterial infection. These findings suggest that disease protection is proportional to the amount of enhanced CAT, APX enzyme and total protein activity.

Change in children's externalizing and internalizing behavior problems: the role of defense mechanisms.

PubMed

Cramer, Phebe

2015-03-01

This study investigates the relation of defense mechanism to children's externalizing and internalizing behavior problems, as assessed from mothers' report at age 9 and 12 years, based on archival data. The defense mechanisms of denial, projection, and identification were assessed from Thematic Apperception Test stories told by the children at age 9 years, using the Defense Mechanism Manual (Cramer, The development of defense mechanisms: Theory, research and assessment. New York: Springer-Verlag, 1991a; Protecting the self: Defense mechanisms in action. New York: Guilford Press, 2006). The results showed that the use of identification predicted a decrease in externalizing behaviors between age 9 and 12 years. In contrast, change in internalizing behaviors was not predicted by defense use, but the use of projection was related to fewer internalizing behaviors at both ages. These findings are consistent with the idea that behavioral intervention stressing self-regulation can be effective in reducing externalizing problems, but internalizing problems require an intervention that is sensitive to the underlying behavioral inhibition in these children.

Academic cheating as a function of defense mechanisms and object relations.

PubMed

Juni, Samuel; Gross, Julie; Sokolowska, Joanna

2006-06-01

This study examined relationships between academic cheating behaviors by using self-reports of past cheating behavior, providing a situational experiment with the opportunity to cheat, and evaluating defense mechanisms and object relations as measured by the Defense Mechanisms Inventory. Subjects included 75 female and 8 male university students ranging in age from 18 to 51 years (M=25.5, SD=6.9). Analysis showed variations in students' self-reported cheating history relative to their measured object relations status and type of defense mechanisms. Actual cheating in the experimental setting was not significantly related to any of these variables. Findings are discussed based on a critique of heterogeneity of the cheating construct.

Adaptation Mechanisms in the Evolution of Moss Defenses to Microbes

PubMed Central

Ponce de León, Inés; Montesano, Marcos

2017-01-01

Bryophytes, including mosses, liverworts and hornworts are early land plants that have evolved key adaptation mechanisms to cope with abiotic stresses and microorganisms. Microbial symbioses facilitated plant colonization of land by enhancing nutrient uptake leading to improved plant growth and fitness. In addition, early land plants acquired novel defense mechanisms to protect plant tissues from pre-existing microbial pathogens. Due to its evolutionary stage linking unicellular green algae to vascular plants, the non-vascular moss Physcomitrella patens is an interesting organism to explore the adaptation mechanisms developed in the evolution of plant defenses to microbes. Cellular and biochemical approaches, gene expression profiles, and functional analysis of genes by targeted gene disruption have revealed that several defense mechanisms against microbial pathogens are conserved between mosses and flowering plants. P. patens perceives pathogen associated molecular patterns by plasma membrane receptor(s) and transduces the signal through a MAP kinase (MAPK) cascade leading to the activation of cell wall associated defenses and expression of genes that encode proteins with different roles in plant resistance. After pathogen assault, P. patens also activates the production of ROS, induces a HR-like reaction and increases levels of some hormones. Furthermore, alternative metabolic pathways are present in P. patens leading to the production of a distinct metabolic scenario than flowering plants that could contribute to defense. P. patens has acquired genes by horizontal transfer from prokaryotes and fungi, and some of them could represent adaptive benefits for resistance to biotic stress. In this review, the current knowledge related to the evolution of plant defense responses against pathogens will be discussed, focusing on the latest advances made in the model plant P. patens. PMID:28360923

Relative Roles of the Cellular and Humoral Responses in the Drosophila Host Defense against Three Gram-Positive Bacterial Infections

PubMed Central

Cho, Ju Hyun; Lee, Janice; Lafarge, Marie-Céline; Kocks, Christine; Ferrandon, Dominique

2011-01-01

Background Two NF-kappaB signaling pathways, Toll and immune deficiency (imd), are required for survival to bacterial infections in Drosophila. In response to septic injury, these pathways mediate rapid transcriptional activation of distinct sets of effector molecules, including antimicrobial peptides, which are important components of a humoral defense response. However, it is less clear to what extent macrophage-like hemocytes contribute to host defense. Methodology/Principal Findings In order to dissect the relative importance of humoral and cellular defenses after septic injury with three different Gram-positive bacteria (Micrococcus luteus, Enterococcus faecalis, Staphylococcus aureus), we used latex bead pre-injection to ablate macrophage function in flies wildtype or mutant for various Toll and imd pathway components. We found that in all three infection models a compromised phagocytic system impaired fly survival – independently of concomitant Toll or imd pathway activation. Our data failed to confirm a role of the PGRP-SA and GNBP1 Pattern Recognition Receptors for phagocytosis of S. aureus. The Drosophila scavenger receptor Eater mediates the phagocytosis by hemocytes or S2 cells of E. faecalis and S. aureus, but not of M. luteus. In the case of M. luteus and E. faecalis, but not S. aureus, decreased survival due to defective phagocytosis could be compensated for by genetically enhancing the humoral immune response. Conclusions/Significance Our results underscore the fundamental importance of both cellular and humoral mechanisms in Drosophila immunity and shed light on the balance between these two arms of host defense depending on the invading pathogen. PMID:21390224

Defense Mechanisms against Viral Infection in Drosophila: RNAi and Non-RNAi.

PubMed

Swevers, Luc; Liu, Jisheng; Smagghe, Guy

2018-05-01

RNAi is considered a major antiviral defense mechanism in insects, but its relative importance as compared to other antiviral pathways has not been evaluated comprehensively. Here, it is attempted to give an overview of the antiviral defense mechanisms in Drosophila that involve both RNAi and non-RNAi. While RNAi is considered important in most viral infections, many other pathways can exist that confer antiviral resistance. It is noted that very few direct recognition mechanisms of virus infections have been identified in Drosophila and that the activation of immune pathways may be accomplished indirectly through cell damage incurred by viral replication. In several cases, protection against viral infection can be obtained in RNAi mutants by non-RNAi mechanisms, confirming the variability of the RNAi defense mechanism according to the type of infection and the physiological status of the host. This analysis is aimed at more systematically investigating the relative contribution of RNAi in the antiviral response and more specifically, to ask whether RNAi efficiency is affected when other defense mechanisms predominate. While Drosophila can function as a useful model, this issue may be more critical for economically important insects that are either controlled (agricultural pests and vectors of diseases) or protected from parasite infection (beneficial insects as bees) by RNAi products.

Defense Mechanisms against Viral Infection in Drosophila: RNAi and Non-RNAi

PubMed Central

Liu, Jisheng

2018-01-01

RNAi is considered a major antiviral defense mechanism in insects, but its relative importance as compared to other antiviral pathways has not been evaluated comprehensively. Here, it is attempted to give an overview of the antiviral defense mechanisms in Drosophila that involve both RNAi and non-RNAi. While RNAi is considered important in most viral infections, many other pathways can exist that confer antiviral resistance. It is noted that very few direct recognition mechanisms of virus infections have been identified in Drosophila and that the activation of immune pathways may be accomplished indirectly through cell damage incurred by viral replication. In several cases, protection against viral infection can be obtained in RNAi mutants by non-RNAi mechanisms, confirming the variability of the RNAi defense mechanism according to the type of infection and the physiological status of the host. This analysis is aimed at more systematically investigating the relative contribution of RNAi in the antiviral response and more specifically, to ask whether RNAi efficiency is affected when other defense mechanisms predominate. While Drosophila can function as a useful model, this issue may be more critical for economically important insects that are either controlled (agricultural pests and vectors of diseases) or protected from parasite infection (beneficial insects as bees) by RNAi products. PMID:29723993

Change in Coping and Defense Mechanisms across Adulthood: Longitudinal Findings in a European-American Sample

PubMed Central

Diehl, Manfred; Chui, Helena; Hay, Elizabeth L.; Lumley, Mark A.; Grühn, Daniel; Labouvie-Vief, Gisela

2014-01-01

This study examined longitudinal changes in coping and defense mechanisms in an age- and gender-stratified sample of 392 European-American adults. Nonlinear age-related changes were found for the coping mechanisms of sublimation and suppression and the defense mechanisms of intellectualization, doubt, displacement, and regression. The change trajectories for sublimation and suppression showed that their use increased from adolescence to late middle age and early old age, and remained mostly stable into late old age. The change trajectory for intellectualization showed that the use of this defense mechanism increased from adolescence to middle age, remained stable until late midlife, and started to decline thereafter. The defense mechanisms of doubt, displacement, and regression showed decreases from adolescence until early old age, with increases occurring again after the age of 65. Linear age-related decreases were found for the coping mechanism of ego regression and the defense mechanisms of isolation and rationalization. Gender and socioeconomic status were associated with the mean levels of several coping and defense mechanisms, but did not moderate age-related changes. Increases in ego level were associated with increased use of the defense mechanism intellectualization and decreased use of the defense mechanisms of doubt and displacement. Overall, these findings in a European-American sample suggest that most individuals showed development in the direction of more adaptive and less maladaptive coping and defense strategies from adolescence until late middle age or early old age. However, in late old age this development was reversed, presenting potential challenges to the adaptive capacity of older adults. PMID:23834293

The role of defense mechanisms in borderline and antisocial personalities.

PubMed

Presniak, Michelle D; Olson, Trevor R; Macgregor, Michael Wm

2010-03-01

We examined whether borderline personality disorder (BPD) and antisocial personality disorder (APD) could be differentiated based on defense mechanisms as measured by observer (Defense-Q; MacGregor, Olson, Presniak, & Davidson, 2008) and self-report (Defense Style Questionnaire; Andrews, Singh, & Bond, 1993) measures. We conducted 2 studies whereby nonclinical participants were divided into borderline and antisocial groups based on scores from the Personality Assessment Inventory (Morey, 1991). Multivariate analysis of variance results revealed significant overall group differences in defense use. Univariate analyses further showed group differences on several individual defenses (e.g., acting out, denial, and turning against self). Together, the findings suggest that in BPD, the defenses may emphasize interpersonal dependency and a tendency to direct aggression toward the self; whereas in APD, the defenses may emphasize egocentricity, interpersonal exploitation, and a tendency to direct aggression toward others. Overall, this study demonstrates important differences in defense use between borderline and antisocial personality groups across both observer and self-report measures.

How does our brain constitute defense mechanisms? First-person neuroscience and psychoanalysis.

PubMed

Northoff, Georg; Bermpohl, Felix; Schoeneich, Frank; Boeker, Heinz

2007-01-01

Current progress in the cognitive and affective neurosciences is constantly influencing the development of psychoanalytic theory and practice. However, despite the emerging dialogue between neuroscience and psychoanalysis, the neuronal processes underlying psychoanalytic constructs such as defense mechanisms remain unclear. One of the main problems in investigating the psychodynamic-neuronal relationship consists in systematically linking the individual contents of first-person subjective experience to third-person observation of neuronal states. We therefore introduced an appropriate methodological strategy, 'first-person neuroscience', which aims at developing methods for systematically linking first- and third-person data. The utility of first-person neuroscience can be demonstrated by the example of the defense mechanism of sensorimotor regression as paradigmatically observed in catatonia. Combined psychodynamic and imaging studies suggest that sensorimotor regression might be associated with dysfunction in the neural network including the orbitofrontal, the medial prefrontal and the premotor cortices. In general sensorimotor regression and other defense mechanisms are psychoanalytic constructs that are hypothesized to be complex emotional-cognitive constellations. In this paper we suggest that specific functional mechanisms which integrate neuronal activity across several brain regions (i.e. neuronal integration) are the physiological substrates of defense mechanisms. We conclude that first-person neuroscience could be an appropriate methodological strategy for opening the door to a better understanding of the neuronal processes of defense mechanisms and their modulation in psychoanalytic psychotherapy. Copyright 2007 S. Karger AG, Basel.

Serine/threonine protein phosphatases: multi-purpose enzymes in control of defense mechanisms

USDA-ARS?s Scientific Manuscript database

Serine/threonine protein phosphatases are a group of enzymes involved in the regulation of defense mechanisms in plants. This paper describes the effects of an inhibitor of these enzymes on the expression of all of the genes associated with these defense mechanisms. The results suggest that inhibi...

Type III secretion system effector proteins: double agents in bacterial disease and plant defense.

PubMed

Alfano, James R; Collmer, Alan

2004-01-01

Many phytopathogenic bacteria inject virulence effector proteins into plant cells via a Hrp type III secretion system (TTSS). Without the TTSS, these pathogens cannot defeat basal defenses, grow in plants, produce disease lesions in hosts, or elicit the hypersensitive response (HR) in nonhosts. Pathogen genome projects employing bioinformatic methods to identify TTSS Hrp regulon promoters and TTSS pathway targeting signals suggest that phytopathogenic Pseudomonas, Xanthomonas, and Ralstonia spp. harbor large arsenals of effectors. The Hrp TTSS employs customized cytoplasmic chaperones, conserved export components in the bacterial envelope (also used by the TTSS of animal pathogens), and a more specialized set of TTSS-secreted proteins to deliver effectors across the plant cell wall and plasma membrane. Many effectors can act as molecular double agents that betray the pathogen to plant defenses in some interactions and suppress host defenses in others. Investigations of the functions of effectors within plant cells have demonstrated the plasma membrane and nucleus as subcellular sites for several effectors, revealed some effectors to possess cysteine protease or protein tyrosine phosphatase activity, and provided new clues to the coevolution of bacterium-plant interactions.

Vaginal orgasm is associated with less use of immature psychological defense mechanisms.

PubMed

Brody, Stuart; Costa, Rui Miguel

2008-05-01

Freud implied a link between inability to have a vaginal orgasm and psychosexual immaturity. Since Kinsey, many sexologists have asserted that no such link exists. However, empirical testing of the issue has been lacking. The objective was to determine the relationship between different sexual behavior triggers of female orgasm and use of immature psychological defense mechanisms. Women reported their past month frequency of different sexual behaviors and corresponding orgasm rates and completed the Defense Style Questionnaire (DSQ-40). The association between ability to have vaginal intercourse orgasm (versus clitoral orgasm) and the use of DSQ-40 immature psychological defense mechanisms (associated with various psychopathologies) was examined. In a sample of 94 healthy Portuguese women, vaginal orgasm (triggered solely by penile-vaginal intercourse) was associated with less use of DSQ-40 immature defenses. Vaginal orgasm was associated with less somatization, dissociation, displacement, autistic fantasy, devaluation, and isolation of affect. Orgasm from clitoral stimulation or combined clitoral-intercourse stimulation was not associated with less use of immature defenses, and was associated with more use of some immature defenses. In one regression analysis, more masturbation and less vaginal orgasm consistency made independent contributions to the statistical prediction of immature defenses. In another regression analysis, any use of extrinsic clitoral stimulation for intercourse orgasm, and lack of any vaginal orgasm, made independent contributions to the statistical prediction of immature defenses. Vaginally anorgasmic women had immature defenses scores comparable to those of established (depression, social anxiety disorder, panic disorder, and obsessive-compulsive disorder) outpatient psychiatric groups. Results were not confounded by social desirability responding or relationship quality. The results linking penile-vaginal orgasm with less use of immature

An Alternative Form of the Defense Mechanisms Inventory: Assessing Chinese University Students

ERIC Educational Resources Information Center

Zhang, Li-Fang

2016-01-01

To overcome the major weakness in the response format of the Defense Mechanisms Inventory and to use the information most relevant to the population concerned in the present study, an alternative form of the Defense Mechanisms Inventory (DMI-AF) was designed. The 80 Likert-scaled items in the inventory were tested among 385 university students in…

Self-defensive antibiotic-loaded layer-by-layer coatings: Imaging of localized bacterial acidification and pH-triggering of antibiotic release.

PubMed

Albright, Victoria; Zhuk, Iryna; Wang, Yuhao; Selin, Victor; van de Belt-Gritter, Betsy; Busscher, Henk J; van der Mei, Henny C; Sukhishvili, Svetlana A

2017-10-01

Self-defensive antibiotic-loaded coatings have shown promise in inhibiting growth of pathogenic bacteria adhering to biomaterial implants and devices, but direct proof that their antibacterial release is triggered by bacterially-induced acidification of the immediate environment under buffered conditions remained elusive. Here, we demonstrate that Staphylococcus aureus and Escherichia coli adhering to such coatings generate highly localized acidification, even in buffered conditions, to activate pH-triggered, self-defensive antibiotic release. To this end, we utilized chemically crosslinked layer-by-layer hydrogel coatings of poly(methacrylic acid) with a covalently attached pH-sensitive SNARF-1 fluorescent label for imaging, and unlabeled-antibiotic (gentamicin or polymyxin B) loaded coatings for antibacterial studies. Local acidification of the coatings induced by S. aureus and E. coli adhering to the coatings was demonstrated by confocal-laser-scanning-microscopy via wavelength-resolved imaging. pH-triggered antibiotic release under static, small volume conditions yielded high bacterial killing efficiencies for S. aureus and E. coli. Gentamicin-loaded films retained their antibacterial activity against S. aureus under fluid flow in buffered conditions. Antibacterial activity increased with the number of polymer layers in the films. Altogether, pH-triggered, self-defensive antibiotic-loaded coatings become activated by highly localized acidification in the immediate environment of an adhering bacterium, offering potential for clinical application with minimized side-effects. Polymeric coatings were created that are able to uptake and selectively release antibiotics upon stimulus by adhering bacteria in order to understand the fundamental mechanisms behind pH-triggered antibiotic release as a potential way to prevent biomaterial-associated infections. Through fluorescent imaging studies, this work importantly shows that adhering bacteria produce highly localized p

Bacterial flagella grow through an injection-diffusion mechanism

PubMed Central

Renault, Thibaud T; Abraham, Anthony O; Bergmiller, Tobias; Paradis, Guillaume; Rainville, Simon; Charpentier, Emmanuelle; Guet, Călin C; Tu, Yuhai; Namba, Keiichi; Keener, James P; Minamino, Tohru; Erhardt, Marc

2017-01-01

The bacterial flagellum is a self-assembling nanomachine. The external flagellar filament, several times longer than a bacterial cell body, is made of a few tens of thousands subunits of a single protein: flagellin. A fundamental problem concerns the molecular mechanism of how the flagellum grows outside the cell, where no discernible energy source is available. Here, we monitored the dynamic assembly of individual flagella using in situ labelling and real-time immunostaining of elongating flagellar filaments. We report that the rate of flagellum growth, initially ∼1,700 amino acids per second, decreases with length and that the previously proposed chain mechanism does not contribute to the filament elongation dynamics. Inhibition of the proton motive force-dependent export apparatus revealed a major contribution of substrate injection in driving filament elongation. The combination of experimental and mathematical evidence demonstrates that a simple, injection-diffusion mechanism controls bacterial flagella growth outside the cell. DOI: http://dx.doi.org/10.7554/eLife.23136.001 PMID:28262091

Bacterial flagella grow through an injection-diffusion mechanism.

PubMed

Renault, Thibaud T; Abraham, Anthony O; Bergmiller, Tobias; Paradis, Guillaume; Rainville, Simon; Charpentier, Emmanuelle; Guet, Călin C; Tu, Yuhai; Namba, Keiichi; Keener, James P; Minamino, Tohru; Erhardt, Marc

2017-03-06

The bacterial flagellum is a self-assembling nanomachine. The external flagellar filament, several times longer than a bacterial cell body, is made of a few tens of thousands subunits of a single protein: flagellin. A fundamental problem concerns the molecular mechanism of how the flagellum grows outside the cell, where no discernible energy source is available. Here, we monitored the dynamic assembly of individual flagella using in situ labelling and real-time immunostaining of elongating flagellar filaments. We report that the rate of flagellum growth, initially ∼1,700 amino acids per second, decreases with length and that the previously proposed chain mechanism does not contribute to the filament elongation dynamics. Inhibition of the proton motive force-dependent export apparatus revealed a major contribution of substrate injection in driving filament elongation. The combination of experimental and mathematical evidence demonstrates that a simple, injection-diffusion mechanism controls bacterial flagella growth outside the cell.

Bacterial adherence in the pathogenesis of urinary tract infection: a review.

PubMed

Reid, G; Sobel, J D

1987-01-01

Bacterial adherence to the uroepithelium is recognized as an important mechanism in the initiation and pathogenesis of urinary tract infections (UTI). The uropathogens originate predominantly in the intestinal tract and initially colonize the periurethral region and ascend into the bladder, resulting in symptomatic or asymptomatic bacteriuria. Thereafter, depending on host factors and bacterial virulence factors, the organisms may further ascend and give rise to pyelonephritis. Uropathogens are selected by the presence of virulence characteristics that enable them to resist the normally efficient host defense mechanisms. Considerable progress has been made in identifying bacterial adhesins and in demonstrating bacterial receptor sites on uroepithelial surfaces. Recent studies have identified natural anti-adherence mechanisms in humans as well as possible increased susceptibility to UTI when these mechanisms are defective and when receptor density on uroepithelial cells is altered. Knowledge of bacterial adherence mechanisms may permit alternative methods of prevention and management of urinary infection, including the use of subinhibitory concentrations of antibiotics, vaccine development, nonimmune inhibition of bacterial adhesins and receptor sites, and the use of autochthonous flora, such as lactobacilli, to exclude uropathogens from colonizing the urinary tract.

Optimal defense strategies in an idealized microbial food web under trade-off between competition and defense.

PubMed

Våge, Selina; Storesund, Julia E; Giske, Jarl; Thingstad, T Frede

2014-01-01

Trophic mechanisms that can generate biodiversity in food webs include bottom-up (growth rate regulating) and top-down (biomass regulating) factors. The top-down control has traditionally been analyzed using the concepts of "Keystone Predation" (KP) and "Killing-the-Winner" (KtW), predominately occuring in discussions of macro- and micro-biological ecology, respectively. Here we combine the classical diamond-shaped food web structure frequently discussed in KP analyses and the KtW concept by introducing a defense strategist capable of partial defense. A formalized description of a trade-off between the defense-strategist's competitive and defensive ability is included. The analysis reveals a complex topology of the steady state solution with strong relationships between food web structure and the combination of trade-off, defense strategy and the system's nutrient content. Among the results is a difference in defense strategies corresponding to maximum biomass, production, or net growth rate of invading individuals. The analysis thus summons awareness that biomass or production, parameters typically measured in field studies to infer success of particular biota, are not directly acted upon by natural selection. Under coexistence with a competition specialist, a balance of competitive and defensive ability of the defense strategist was found to be evolutionarily stable, whereas stronger defense was optimal under increased nutrient levels in the absence of the pure competition specialist. The findings of success of different defense strategies are discussed with respect to SAR11, a highly successful bacterial clade in the pelagic ocean.

Dead bacteria reverse antibiotic-induced host defense impairment in burns.

PubMed

Chen, Lee-Wei; Chen, Pei-Hsuan; Fung, Chang-Phone; Hsu, Ching-Mei

2014-10-01

Burn patients can incur high rates of hospital-acquired infections. The mechanism of antibiotic exposure on inducing infection vulnerability has not been determined. This study aimed to examine the effects of antibiotic treatment on host defense mechanisms. First we treated C57/BL6 mice with combined antibiotic treatment after 30% to 35% total body surface area burn. Animals were sacrificed at 48 hours after sham or thermal injury treatment. Bacterial counts in intestinal lumen and mucosa were measured. Next, we treated animals with or without oral dead Escherichia coli or Staphylococcus aureus supplementation to stimulate Toll-like receptor in the intestinal mucosa. Toll-like receptor 4, antibacterial protein expression, nuclear factor (NF)-κB DNA-binding activity, and bacteria-killing activity in the intestinal mucosa; intestinal permeability; bacterial translocation to mesenteric lymph nodes; Klebsiella pneumoniae translocation; interleukin-6 in the blood; and phagocytic activity of alveolar macrophages, were assessed. Thermal injury increased microflora and NF-κB DNA-binding activity of the intestine. Systemic antibiotic treatment decreased gut microflora and increased bacterial translocation to mesenteric lymph nodes, intestinal permeability, and interleukin-6 levels in the blood. Antibiotic treatment also decreased bacteria-killing activity in intestinal mucosa and phagocytic activity of alveolar macrophages. Oral dead E coli and S aureus supplementation induced NF-κB DNA-binding activity, Toll-like receptor 4, and antibacterial protein expression of the intestinal mucosa. Taken together with the fact that dead bacteria reversed antibiotic-induced K pneumoniae translocation and intestinal and pulmonary defense impairment, we conclude that combined antibiotic treatment results in systemic host defense impairment in burns through the decrease in intestinal flora. We suggest that dead bacteria supplementation could induce nondefensin protein expression and

Physiological and molecular mechanism of defense in cotton against Verticillium dahliae.

PubMed

Shaban, Muhammad; Miao, Yuhuan; Ullah, Abid; Khan, Anam Qadir; Menghwar, Hakim; Khan, Aamir Hamid; Ahmed, Muhammad Mahmood; Tabassum, Muhammad Adnan; Zhu, Longfu

2018-04-01

Cotton, a natural fiber producing crop of huge importance for textile industry, has been reckoned as the backbone in the economy of many developing countries. Verticillium wilt caused by Verticillium dahliae reflected as the most devastating disease of cotton crop in several parts of the world. Average losses due to attack of this disease are tremendous every year. There is urgent need to develop strategies for effective control of this disease. In the last decade, progress has been made to understand the interaction between cotton-V. dahliae and several growth and pathogenicity related genes were identified. Still, most of the molecular components and mechanisms of cotton defense against Verticillium wilt are poorly understood. However, from existing knowledge, it is perceived that cotton defense mechanism primarily depends on the pre-formed defense structures including thick cuticle, synthesis of phenolic compounds and delaying or hindering the expansion of the invader through advanced measures such as reinforcement of cell wall structure, accumulation of reactive oxygen species (ROS), release of phytoalexins, the hypersensitive response and the development of broad spectrum resistance named as, systemic acquired resistance (SAR). Investigation of these defense tactics provide valuable information about the improvement of cotton breeding strategies for the development of durable, cost effective, and broad spectrum resistant varieties. Consequently, this management approach will help to reduce the use of fungicides and also minimize other environmental hazards. In the present paper, we summarized the V. dahliae virulence mechanism and comprehensively discussed the cotton molecular mechanisms of defense such as physiological, biochemical responses with the addition of signaling pathways that are implicated towards attaining resistance against Verticillium wilt. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Defense Mechanisms and Utilization in Cancer Patients Undergoing Radiation Therapy: A Pilot Study.

PubMed

Porcerelli, John H; Cramer, Phebe; Porcerelli, Daniel J; Arterbery, V Elayne

2017-06-01

A group of 49 patients who had been diagnosed with cancer during the preceding year and who were receiving radiation therapy were assessed for their use of defense mechanisms, as well as for their level of psychological distress. In addition, their utilization of medical services was determined. It was predicted that the use of services that were under the patients' control-namely, requesting extra outpatient visits and making trips to the emergency department-would be related to the patients' use of defense mechanisms, whereas a treatment option not under the patients' control-overnight hospitalization based on physicians' assessment of condition-would not be related to defense use. The findings confirmed the hypotheses. Outpatient visits were strongly predicted by defense use, whereas hospitalization was determined by psychological distress. However, emergency department visits were determined by both defense use and psychological distress. In addition, an interaction between defense and distress was found to predict hospitalization.

Growth mechanics of bacterial cell wall and morphology of bacteria

NASA Astrophysics Data System (ADS)

Jiang, Hongyuan; Sun, Sean

2010-03-01

The peptidoglycan cell wall of bacteria is responsible for maintaining the cell shape and integrity. During the bacterial life cycle, the growth of the cell wall is affected by mechanical stress and osmotic pressure internal to the cell. We develop a theory to describe cell shape changes under the influence of mechanical forces. We find that the theory predicts a steady state size and shape for bacterial cells ranging from cocci to spirillum. Moreover, the theory suggest a mechanism by which bacterial cytoskeletal proteins such as MreB and crescentin can maintain the shape of the cell. The theory can also explain the several recent experiments on growing bacteria in micro-environments.

The Sinorhizobium (Ensifer) fredii HH103 Type 3 Secretion System Suppresses Early Defense Responses to Effectively Nodulate Soybean.

PubMed

Jiménez-Guerrero, Irene; Pérez-Montaño, Francisco; Monreal, José Antonio; Preston, Gail M; Fones, Helen; Vioque, Blanca; Ollero, Francisco Javier; López-Baena, Francisco Javier

2015-07-01

Plants that interact with pathogenic bacteria in their natural environments have developed barriers to block or contain the infection. Phytopathogenic bacteria have evolved mechanisms to subvert these defenses and promote infection. Thus, the type 3 secretion system (T3SS) delivers bacterial effectors directly into the plant cells to alter host signaling and suppress defenses, providing an appropriate environment for bacterial multiplication. Some rhizobial strains possess a symbiotic T3SS that seems to be involved in the suppression of host defenses to promote nodulation and determine the host range. In this work, we show that the inactivation of the Sinorhizobium (Ensifer) fredii HH103 T3SS negatively affects soybean nodulation in the early stages of the symbiotic process, which is associated with a reduction of the expression of early nodulation genes. This symbiotic phenotype could be the consequence of the bacterial triggering of soybean defense responses associated with the production of salicylic acid (SA) and the impairment of the T3SS mutant to suppress these responses. Interestingly, the early induction of the transcription of GmMPK4, which negatively regulates SA accumulation and defense responses in soybean via WRKY33, could be associated with the differential defense responses induced by the parental and the T3SS mutant strain.

Change in Coping and Defense Mechanisms across Adulthood: Longitudinal Findings in a European American Sample

ERIC Educational Resources Information Center

Diehl, Manfred; Chui, Helena; Hay, Elizabeth L.; Lumley, Mark A.; Grühn, Daniel; Labouvie-Vief, Gisela

2014-01-01

This study examined longitudinal changes in coping and defense mechanisms in an age- and gender-stratified sample of 392 European American adults. Nonlinear age-related changes were found for the coping mechanisms of sublimation and suppression and the defense mechanisms of intellectualization, doubt, displacement, and regression. The change…

[Defense mechanisms of the surface epithelium of the human esophageal mucosa].

PubMed

Bykov, V L; Iseeva, E A

2006-01-01

This review, which is based on the literature data and the results of personal research, contains an analysis of the current concepts on the tissue, cellular and molecular mechanisms, protecting human esophageal epithelium (EE) from gastric juice, bile, hot and rough food, microorganisms, alcohol, carcinogens, drugs and oxidizing agents. The response of EE to concrete environmental factors includes both specific and non-specific components, which depend on the nature of injurious agent. EE is damaged structurally and functionally only when it is exposed to the injurious factors of high intensity and/or long duration, which result in the exhaustion of resources of defense mechanisms. The insufficiency of EE defense mechanisms may be based on various genetic defects.

Mechanism of bacterial membrane poration by Antimicrobial Peptides

NASA Astrophysics Data System (ADS)

Arora, Ankita; Mishra, Abhijit

2015-03-01

Bacterial resistance to conventional antibiotics is a major health concern. Antimicrobial peptides (AMPs), an important component of mammalian immune system, are thought to utilize non-specific interactions to target common features on the outer membranes of pathogens; hence development of resistance to such AMPs may be less pronounced. Most AMPs are amphiphilic and cationic in nature. Most AMPs form pores in the bacterial membranes causing them to lyse, however, the exact mechanism is unknown. Here, we study the AMP CHRG01 (KSSTRGRKSSRRKK), derived from human β defensin 3 (hBD3) with all Cysteine residues substituted with Serine. Circular Dichorism studies indicate that CHRG01 shows helicity and there is change in helicity as it interacts with the lipid membrane. The AMP was effective against different species of bacteria. Leakage of cellular components from bacterial cells observed by SEM and AFM indicates AMP action by pore formation. Confocal microscopy studies on giant vesicles incubated with AMP confirm poration. The effect of this AMP on model bacterial membranes is characterized using Small Angle X-ray scattering and Fluorescence spectroscopy to elucidate the mechanism behind antimicrobial activity.

Optimal Defense Strategies in an Idealized Microbial Food Web under Trade-Off between Competition and Defense

PubMed Central

Våge, Selina; Storesund, Julia E.; Giske, Jarl; Thingstad, T. Frede

2014-01-01

Trophic mechanisms that can generate biodiversity in food webs include bottom-up (growth rate regulating) and top-down (biomass regulating) factors. The top-down control has traditionally been analyzed using the concepts of “Keystone Predation” (KP) and “Killing-the-Winner” (KtW), predominately occuring in discussions of macro- and micro-biological ecology, respectively. Here we combine the classical diamond-shaped food web structure frequently discussed in KP analyses and the KtW concept by introducing a defense strategist capable of partial defense. A formalized description of a trade-off between the defense-strategist's competitive and defensive ability is included. The analysis reveals a complex topology of the steady state solution with strong relationships between food web structure and the combination of trade-off, defense strategy and the system's nutrient content. Among the results is a difference in defense strategies corresponding to maximum biomass, production, or net growth rate of invading individuals. The analysis thus summons awareness that biomass or production, parameters typically measured in field studies to infer success of particular biota, are not directly acted upon by natural selection. Under coexistence with a competition specialist, a balance of competitive and defensive ability of the defense strategist was found to be evolutionarily stable, whereas stronger defense was optimal under increased nutrient levels in the absence of the pure competition specialist. The findings of success of different defense strategies are discussed with respect to SAR11, a highly successful bacterial clade in the pelagic ocean. PMID:24999739

An empirical look at the Defense Mechanism Test (DMT): reliability and construct validity.

PubMed

Ekehammar, Bo; Zuber, Irena; Konstenius, Marja-Liisa

2005-07-01

Although the Defense Mechanism Test (DMT) has been in use for almost half a century, there are still quite contradictory views about whether it is a reliable instrument, and if so, what it really measures. Thus, based on data from 39 female students, we first examined DMT inter-coder reliability by analyzing the agreement among trained judges in their coding of the same DMT protocols. Second, we constructed a "parallel" photographic picture that retained all structural characteristic of the original and analyzed DMT parallel-test reliability. Third, we examined the construct validity of the DMT by (a) employing three self-report defense-mechanism inventories and analyzing the intercorrelations between DMT defense scores and corresponding defenses in these instruments, (b) studying the relationships between DMT responses and scores on trait and state anxiety, and (c) relating DMT-defense scores to measures of self-esteem. The main results showed that the DMT can be coded with high reliability by trained coders, that the parallel-test reliability is unsatisfactory compared to traditional psychometric standards, that there is a certain generalizability in the number of perceptual distortions that people display from one picture to another, and that the construct validation provided meager empirical evidence for the conclusion that the DMT measures what it purports to measure, that is, psychological defense mechanisms.

Induced defense mechanisms in an aquatic angiosperm to insect herbivory.

PubMed

Fornoff, Felix; Gross, Elisabeth M

2014-05-01

In terrestrial angiosperms, defense and resistance mechanisms against herbivores have been studied extensively; yet this topic is poorly understood in aquatic angiosperms. We investigated induced response mechanisms in Myriophyllum spicatum to the generalist insect herbivore Acentria ephemerella in three independent experiments. Various morphological and chemical response variables were examined in grazed apical shoots and compared to undamaged controls. We further estimated plant palatability of induced and non-induced apices in choice assays, and assessed the growth response of Acentria larvae in no-choice feeding assays. Leaves of induced apices were splayed out horizontally and changed in color from green to red. The dry matter content and thus plant toughness increased by up to 19%, but silica levels stayed constant. Induced apices exhibited a decline in chlorophyll content of up to 34%, reflected also by a 10% decrease in nitrogen levels, while nitrogen increased by 14% in lower parts of grazed shoots. Also, herbivore-deterring total phenolic compounds increased by up to 20% in apices. In choice trials, Acentria larvae strongly avoided grazed tips, and growth was reduced by 25% on induced apices. In total, we observed five different induced resistance and defensive traits in grazed apices: changes in appearance, increased plant toughness, delocalization of N-containing metabolites, increased polyphenols, and reduced nutritional value. The observed changes prevent herbivore damage and loss of apical tissue, which are most valuable for plant fitness. Our study presents the first evidence of multiple, parallel defense strategies including constitutive and induced defense mechanisms in a freshwater angiosperm.

Plant innate immunity: an updated insight into defense mechanism.

PubMed

Muthamilarasan, Mehanathan; Prasad, Manoj

2013-06-01

Plants are invaded by an array of pathogens of which only a few succeed in causing disease. The attack by others is countered by a sophisticated immune system possessed by the plants. The plant immune system is broadly divided into two, viz. microbial-associated molecular-patterns-triggered immunity (MTI) and effector-triggered immunity (ETI). MTI confers basal resistance, while ETI confers durable resistance, often resulting in hypersensitive response. Plants also possess systemic acquired resistance (SAR), which provides long-term defense against a broad-spectrum of pathogens. Salicylic-acid-mediated systemic acquired immunity provokes the defense response throughout the plant system during pathogen infection at a particular site. Trans-generational immune priming allows the plant to heritably shield their progeny towards pathogens previously encountered. Plants circumvent the viral infection through RNA interference phenomena by utilizing small RNAs. This review summarizes the molecular mechanisms of plant immune system, and the latest breakthroughs reported in plant defense. We discuss the plant–pathogen interactions and integrated defense responses in the context of presenting an integral understanding in plant molecular immunity.

Xenophagic pathways and their bacterial subversion in cellular self-defense - παντα ρει - everything is in flux.

PubMed

Radomski, Nadine; Rebbig, Annica; Leonhardt, Ralf M; Knittler, Michael R

2017-11-02

Autophagy is an evolutionarily ancient and highly conserved eukaryotic mechanism that targets cytoplasmic material for degradation. Autophagic flux involves the formation of autophagosomes and their degradation by lysosomes. The process plays a crucial role in maintaining cellular homeostasis and responds to various environmental conditions. While autophagy had previously been thought to be a non-selective process, it is now clear that it can also selectively target cellular organelles, such as mitochondria (referred to as mitophagy) and/or invading pathogens (referred to as xenophagy). Selective autophagy is characterized by specific substrate recognition and requires distinct cellular adaptor proteins. Here we review xenophagic mechanisms involved in the recognition and autolysosomal or autophagolysosomal degradation of different intracellular bacteria. In this context, we also discuss a recently discovered cellular self-defense pathway, termed mito-xenophagy, which occurs during bacterial infection of dendritic cells and depends on a TNF-α-mediated metabolic switch from oxidative phosphorylation to glycolysis. Copyright © 2017 Elsevier GmbH. All rights reserved.

Transient Receptor Potential Channel 1 Deficiency Impairs Host Defense and Proinflammatory Responses to Bacterial Infection by Regulating Protein Kinase Cα Signaling.

PubMed

Zhou, Xikun; Ye, Yan; Sun, Yuyang; Li, Xuefeng; Wang, Wenxue; Privratsky, Breanna; Tan, Shirui; Zhou, Zongguang; Huang, Canhua; Wei, Yu-Quan; Birnbaumer, Lutz; Singh, Brij B; Wu, Min

2015-08-01

Transient receptor potential channel 1 (TRPC1) is a nonselective cation channel that is required for Ca(2+) homeostasis necessary for cellular functions. However, whether TRPC1 is involved in infectious disease remains unknown. Here, we report a novel function for TRPC1 in host defense against Gram-negative bacteria. TRPC1(-/-) mice exhibited decreased survival, severe lung injury, and systemic bacterial dissemination upon infection. Furthermore, silencing of TRPC1 showed decreased Ca(2+) entry, reduced proinflammatory cytokines, and lowered bacterial clearance. Importantly, TRPC1 functioned as an endogenous Ca(2+) entry channel critical for proinflammatory cytokine production in both alveolar macrophages and epithelial cells. We further identified that bacterium-mediated activation of TRPC1 was dependent on Toll-like receptor 4 (TLR4), which induced endoplasmic reticulum (ER) store depletion. After activation of phospholipase Cγ (PLC-γ), TRPC1 mediated Ca(2+) entry and triggered protein kinase Cα (PKCα) activity to facilitate nuclear translocation of NF-κB/Jun N-terminal protein kinase (JNK) and augment the proinflammatory response, leading to tissue damage and eventually mortality. These findings reveal that TRPC1 is required for host defense against bacterial infections through the TLR4-TRPC1-PKCα signaling circuit. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Activity of Uncleaved Caspase-8 Controls Anti-bacterial Immune Defense and TLR-Induced Cytokine Production Independent of Cell Death.

PubMed

Philip, Naomi H; DeLaney, Alexandra; Peterson, Lance W; Santos-Marrero, Melanie; Grier, Jennifer T; Sun, Yan; Wynosky-Dolfi, Meghan A; Zwack, Erin E; Hu, Baofeng; Olsen, Tayla M; Rongvaux, Anthony; Pope, Scott D; López, Carolina B; Oberst, Andrew; Beiting, Daniel P; Henao-Mejia, Jorge; Brodsky, Igor E

2016-10-01

Caspases regulate cell death programs in response to environmental stresses, including infection and inflammation, and are therefore critical for the proper operation of the mammalian immune system. Caspase-8 is necessary for optimal production of inflammatory cytokines and host defense against infection by multiple pathogens including Yersinia, but whether this is due to death of infected cells or an intrinsic role of caspase-8 in TLR-induced gene expression is unknown. Caspase-8 activation at death signaling complexes results in its autoprocessing and subsequent cleavage and activation of its downstream apoptotic targets. Whether caspase-8 activity is also important for inflammatory gene expression during bacterial infection has not been investigated. Here, we report that caspase-8 plays an essential cell-intrinsic role in innate inflammatory cytokine production in vivo during Yersinia infection. Unexpectedly, we found that caspase-8 enzymatic activity regulates gene expression in response to bacterial infection as well as TLR signaling independently of apoptosis. Using newly-generated mice in which caspase-8 autoprocessing is ablated (Casp8DA/DA), we now demonstrate that caspase-8 enzymatic activity, but not autoprocessing, mediates induction of inflammatory cytokines by bacterial infection and a wide variety of TLR stimuli. Because unprocessed caspase-8 functions in an enzymatic complex with its homolog cFLIP, our findings implicate the caspase-8/cFLIP heterodimer in control of inflammatory cytokines during microbial infection, and provide new insight into regulation of antibacterial immune defense.

Spontaneous bacterial peritonitis

PubMed Central

Koulaouzidis, Anastasios; Bhat, Shivaram; Saeed, Athar A

2009-01-01

Since its initial description in 1964, research has transformed spontaneous bacterial peritonitis (SBP) from a feared disease (with reported mortality of 90%) to a treatable complication of decompensated cirrhosis, albeit with steady prevalence and a high recurrence rate. Bacterial translocation, the key mechanism in the pathogenesis of SBP, is only possible because of the concurrent failure of defensive mechanisms in cirrhosis. Variants of SBP should be treated. Leucocyte esterase reagent strips have managed to shorten the ‘tap-to-shot’ time, while future studies should look into their combined use with ascitic fluid pH. Third generation cephalosporins are the antibiotic of choice because they have a number of advantages. Renal dysfunction has been shown to be an independent predictor of mortality in patients with SBP. Albumin is felt to reduce the risk of renal impairment by improving effective intravascular volume, and by helping to bind pro-inflammatory molecules. Following a single episode of SBP, patients should have long-term antibiotic prophylaxis and be considered for liver transplantation. PMID:19266595

Molecular mechanisms of cell-cell spread of intracellular bacterial pathogens.

PubMed

Ireton, Keith

2013-07-17

Several bacterial pathogens, including Listeria monocytogenes, Shigella flexneri and Rickettsia spp., have evolved mechanisms to actively spread within human tissues. Spreading is initiated by the pathogen-induced recruitment of host filamentous (F)-actin. F-actin forms a tail behind the microbe, propelling it through the cytoplasm. The motile pathogen then encounters the host plasma membrane, forming a bacterium-containing protrusion that is engulfed by an adjacent cell. Over the past two decades, much progress has been made in elucidating mechanisms of F-actin tail formation. Listeria and Shigella produce tails of branched actin filaments by subverting the host Arp2/3 complex. By contrast, Rickettsia forms tails with linear actin filaments through a bacterial mimic of eukaryotic formins. Compared with F-actin tail formation, mechanisms controlling bacterial protrusions are less well understood. However, recent findings have highlighted the importance of pathogen manipulation of host cell-cell junctions in spread. Listeria produces a soluble protein that enhances bacterial protrusions by perturbing tight junctions. Shigella protrusions are engulfed through a clathrin-mediated pathway at 'tricellular junctions'--specialized membrane regions at the intersection of three epithelial cells. This review summarizes key past findings in pathogen spread, and focuses on recent developments in actin-based motility and the formation and internalization of bacterial protrusions.

Grooming Behavior as a Mechanism of Insect Disease Defense.

PubMed

Zhukovskaya, Marianna; Yanagawa, Aya; Forschler, Brian T

2013-11-04

Grooming is a well-recognized, multipurpose, behavior in arthropods and vertebrates. In this paper, we review the literature to highlight the physical function, neurophysiological mechanisms, and role that grooming plays in insect defense against pathogenic infection. The intricate relationships between the physical, neurological and immunological mechanisms of grooming are discussed to illustrate the importance of this behavior when examining the ecology of insect-pathogen interactions.

Molecular mechanisms of action of bacterial exotoxins.

PubMed

Balfanz, J; Rautenberg, P; Ullmann, U

1996-07-01

Toxins are one of the inventive strategies that bacteria have developed in order to survive. As virulence factors, they play a major role in the pathogenesis of infectious diseases. Recent discoveries have once more highlighted the effectiveness of these precisely adjusted bacterial weapons. Furthermore, toxins have become an invaluable tool in the investigation of fundamental cell processes, including regulation of cellular functions by various G proteins, cytoskeletal dynamics and neural transmission. In this review, the bacterial toxins are presented in a rational classification based on the molecular mechanisms of action.

The physician's quality of life: Relationship with ego defense mechanisms and object relations.

PubMed

Miranda, Benedito; Louzã, Mário Rodrigues

2015-11-01

To assess whether ego defense mechanisms and object relations (the way an individual subjectively experiences his/her relationships with others) are related to quality of life among physicians. In this cross-sectional mail survey, 602 physicians from Botucatu, SP, Brazil, were sent a socio-demographic questionnaire, the Bell Object Relations and Reality Testing Inventory-Form O (BORRTI-O), the Defense Style Questionnaire-40 (DSQ-40), and the World Health Organization Abbreviated Instrument for Quality of Life Assessment (WHOQOL-BREF). 198 questionnaires (33%) with valid responses were obtained. High BORRTI-O scores (indicative of pathology) on the alienation, egocentricity and insecure attachment subscales were associated with reduced WHOQOL-BREF scores for the psychological health and social relationship domains. Immature ego defense mechanisms were associated with lower WHOQOL-BREF scores for all domains. No significant associations of WHOQOL-BREF scores with working hours, workplace or monthly income were observed in the study population WHOQOL-BREF scores correlated with mature defense mechanisms and normal object relations, suggesting an association between psychological maturity and quality of life among physicians. Copyright © 2015 Elsevier Inc. All rights reserved.

Bacterial Surface Glycans: Microarray and QCM Strategies for Glycophenotyping and Exploration of Recognition by Host Receptors.

PubMed

Kalograiaki, Ioanna; Campanero-Rhodes, María A; Proverbio, Davide; Euba, Begoña; Garmendia, Junkal; Aastrup, Teodor; Solís, Dolores

2018-01-01

Bacterial surfaces are decorated with a diversity of carbohydrate structures that play important roles in the bacteria-host relationships. They may offer protection against host defense mechanisms, elicit strong antigenic responses, or serve as ligands for host receptors, including lectins of the innate immune system. Binding by these lectins may trigger defense responses or, alternatively, promote attachment, thereby enhancing infection. The outcome will depend on the particular bacterial surface landscape, which may substantially differ among species and strains. In this chapter, we describe two novel methods for exploring interactions directly on the bacterial surface, based on the generation of bacterial microarrays and quartz crystal microbalance (QCM) sensor chips. Bacterial microarrays enable profiling of accessible carbohydrate structures and screening of their recognition by host receptors, also providing information on binding avidity, while the QCM approach allows determination of binding affinity and kinetics. In both cases, the chief element is the use of entire bacterial cells, so that recognition of the bacterial glycan epitopes is explored in their natural environment. © 2018 Elsevier Inc. All rights reserved.

Field trial of a diagnostic axis for defense mechanisms for DSM-IV.

PubMed

Perry, J C; Hoglend, P; Shear, K; Vaillant, G E; Horowitz, M; Kardos, M E; Bille, H; Kagan, D

1998-01-01

Following critiques that the DSM multiaxial system lacks psychodynamic information useful for treatment, an axis for defense mechanisms was developed for DSM-IV, including up to 7 individual defenses from a glossary of 27, and 3 predominant defense levels from a list of 7. We tested the feasibility, reliability, and discriminability of the proposed axis. Clinician and psychiatric resident volunteers were trained at two U.S. and one Norwegian sites. After conducting initial interviews on 107 patients, they rated the DSM-III-R and defense axes, as did a second blind rater. Median kappa reliabilities were .42 (individual defenses), and .47 (defense levels). A summary measure, Overall Defensive Functioning (ODF), had similar reliability to current GAF (IR .68 vs. .62), similar 1-month stability (.75 vs. .78), but greater 6-month stability (.51 vs. .17). Independent of Axis III, ODF had small to moderate associations with other Axes and symptoms. Our findings indicate that the defense axis is a feasible, acceptably reliable, and nonredundant addition to DSM-IV, which may prove useful for planning and conducting treatment.

Immature psychological defense mechanisms are associated with greater personal importance of junk food, alcohol, and television.

PubMed

Costa, Rui Miguel; Brody, Stuart

2013-10-30

Immature psychological defense mechanisms are psychological processes that play an important role in suppressing emotional awareness and contribute to psychopathology. In addition, unhealthy food, television viewing, and alcohol consumption can be among the means to escape self-awareness. In contrast, engaging in, and responding fully to specifically penile-vaginal intercourse (PVI) is associated with indices of better emotional regulation, including less use of immature defense mechanisms. There was a lack of research on the association of immature defense mechanisms with personal importance of junk food, alcohol, television, PVI, and noncoital sex. In an online survey, 334 primarily Scottish women completed the Defense Style Questionnaire (DSQ-40), and rated the personal importance of junk food, alcohol, television, PVI, and noncoital sex. Immature defense mechanisms correlated with importance of junk food, alcohol, and television. Importance of PVI correlated with mature defenses, and less use of some component immature defenses. Importance of alcohol correlated with importance of junk food, television, and noncoital sex. Importance of junk food was correlated with importance of television and noncoital sex. The findings are discussed in terms of persons with poorer self-regulatory abilities having more interest in junk food, television, and alcohol, and less interest in PVI. © 2013 Elsevier Ireland Ltd. All rights reserved.

Defense Mechanisms, Psychosomatic Symptomatology, and Conjugate Lateral Eye Movements

ERIC Educational Resources Information Center

Gur, Raquel E.; Gur, Ruben C.

1975-01-01

Subjects were classified into left movers, right movers, and bidirectionals according to the characteristic direction of their eye movements in response to questions. The three groups were compared on their preferential use of defense mechanisms and on the number of psychosomatic complaints. (Author)

[Psychometric assessment of defense mechanisms: correlation between questionnaire and expert rating. Initial study of validity].

PubMed

Reister, G; Fellhauer, R F; Franz, M; Wirth, T; Schellberg, D; Schepank, H; Tress, W

1993-01-01

Within the limits of an epidemiological longitudinal field survey on prevalence and course of psychogenic disorders a high-risk-population suffering from medical psychogenic impairment was investigated. The study was conducted in order to verify an etiological multi-level-model of psychogenic disorders in relation to the socialempiric variables "critical life events" and "social support" as well as the depth psychological oriented construct "personality". Besides other instruments a self rating scale based on Vallant's hierarchical model of defense, i.e. the german adaptation of the DSQ (Defense Style Questionnaire) of Bond and coworkers, was used for the accurate measurement of relevant personality parameters. Although defense processes predominantly work unconscious, manifestations of defense mechanisms could be measured indirectly by means of the rating scale. Its essential dimensions separated clinical patients from a group of healthy controls. Furthermore an immature organisation of defense was found to be related to psychogenic impairment. Concerning self- and expert-rating a significant correlation between "immature defense" and the defense mechanisms "schizoid phantasy", "projection" and "acting out" was proved.

Evolution of Caenorhabditis elegans host defense under selection by the bacterial parasite Serratia marcescens.

PubMed

Penley, McKenna J; Ha, Giang T; Morran, Levi T

2017-01-01

Parasites can impose strong selection on hosts. In response, some host populations have adapted via the evolution of defenses that prevent or impede infection by parasites. However, host populations have also evolved life history shifts that maximize host fitness despite infection. Outcrossing and self-fertilization can have contrasting effects on evolutionary trajectories of host populations. While selfing and outcrossing are known to affect the rate at which host populations adapt in response to parasites, these mating systems may also influence the specific traits that underlie adaptation to parasites. Here, we determined the role of evolved host defense versus altered life history,in mixed mating (selfing and outcrossing) and obligately outcrossing C. elegans host populations after experimental evolution with the bacterial parasite, S. marcescens. Similar to previous studies, we found that both mixed mating and obligately outcrossing host populations adapted to S. marcescens exposure, and that the obligately outcrossing populations exhibited the greatest rates of adaptation. Regardless of the host population mating system, exposure to parasites did not significantly alter reproductive timing or total fecundity over the course of experimental evolution. However, both mixed mating and obligately outcrossing host populations exhibited significantly reduced mortality rates in the presence of the parasite after experimental evolution. Therefore, adaptation in both the mixed mating and obligately outcrossing populations was driven, at least in part, by the evolution of increased host defense and not changes in host life history. Thus, the host mating system altered the rate of adaptation, but not the nature of adaptive change in the host populations.

Evolution of Caenorhabditis elegans host defense under selection by the bacterial parasite Serratia marcescens

PubMed Central

Penley, McKenna J.; Ha, Giang T.; Morran, Levi T.

2017-01-01

Parasites can impose strong selection on hosts. In response, some host populations have adapted via the evolution of defenses that prevent or impede infection by parasites. However, host populations have also evolved life history shifts that maximize host fitness despite infection. Outcrossing and self-fertilization can have contrasting effects on evolutionary trajectories of host populations. While selfing and outcrossing are known to affect the rate at which host populations adapt in response to parasites, these mating systems may also influence the specific traits that underlie adaptation to parasites. Here, we determined the role of evolved host defense versus altered life history,in mixed mating (selfing and outcrossing) and obligately outcrossing C. elegans host populations after experimental evolution with the bacterial parasite, S. marcescens. Similar to previous studies, we found that both mixed mating and obligately outcrossing host populations adapted to S. marcescens exposure, and that the obligately outcrossing populations exhibited the greatest rates of adaptation. Regardless of the host population mating system, exposure to parasites did not significantly alter reproductive timing or total fecundity over the course of experimental evolution. However, both mixed mating and obligately outcrossing host populations exhibited significantly reduced mortality rates in the presence of the parasite after experimental evolution. Therefore, adaptation in both the mixed mating and obligately outcrossing populations was driven, at least in part, by the evolution of increased host defense and not changes in host life history. Thus, the host mating system altered the rate of adaptation, but not the nature of adaptive change in the host populations. PMID:28792961

Host Defense Peptide Resistance Contributes to Colonization and Maximal Intestinal Pathology by Crohn's Disease-Associated Adherent-Invasive Escherichia coli

PubMed Central

McPhee, Joseph B.; Small, Cherrie L.; Reid-Yu, Sarah A.; Brannon, John R.; Le Moual, Hervé

2014-01-01

Host defense peptides secreted by colonocytes and Paneth cells play a key role in innate host defenses in the gut. In Crohn's disease, the burden of tissue-associated Escherichia coli commonly increases at epithelial surfaces where host defense peptides concentrate, suggesting that this bacterial population might actively resist this mechanism of bacterial killing. Adherent-invasive E. coli (AIEC) is associated with Crohn's disease; however, the colonization determinants of AIEC in the inflamed gut are undefined. Here, we establish that host defense peptide resistance contributes to host colonization by Crohn's-associated AIEC. We identified a plasmid-encoded genomic island (called PI-6) in AIEC strain NRG857c that confers high-level resistance to α-helical cationic peptides and α- and β-defensins. Deletion of PI-6 sensitized strain NRG857c to these host defense molecules, reduced its competitive fitness in a mouse model of infection, and attenuated its ability to induce cecal pathology. This phenotype is due to two genes in PI-6, arlA, which encodes a Mig-14 family protein implicated in defensin resistance, and arlC, an OmpT family outer membrane protease. Implicit in these findings are new bacterial targets whose inhibition might limit AIEC burden and disease in the gut. PMID:24866805

Transcriptome of American oysters, Crassostrea virginica, in response to bacterial challenge: insights into potential mechanisms of disease resistance.

PubMed

McDowell, Ian C; Nikapitiya, Chamilani; Aguiar, Derek; Lane, Christopher E; Istrail, Sorin; Gomez-Chiarri, Marta

2014-01-01

The American oyster Crassostrea virginica, an ecologically and economically important estuarine organism, can suffer high mortalities in areas in the Northeast United States due to Roseovarius Oyster Disease (ROD), caused by the gram-negative bacterial pathogen Roseovarius crassostreae. The goals of this research were to provide insights into: 1) the responses of American oysters to R. crassostreae, and 2) potential mechanisms of resistance or susceptibility to ROD. The responses of oysters to bacterial challenge were characterized by exposing oysters from ROD-resistant and susceptible families to R. crassostreae, followed by high-throughput sequencing of cDNA samples from various timepoints after disease challenge. Sequence data was assembled into a reference transcriptome and analyzed through differential gene expression and functional enrichment to uncover genes and processes potentially involved in responses to ROD in the American oyster. While susceptible oysters experienced constant levels of mortality when challenged with R. crassostreae, resistant oysters showed levels of mortality similar to non-challenged oysters. Oysters exposed to R. crassostreae showed differential expression of transcripts involved in immune recognition, signaling, protease inhibition, detoxification, and apoptosis. Transcripts involved in metabolism were enriched in susceptible oysters, suggesting that bacterial infection places a large metabolic demand on these oysters. Transcripts differentially expressed in resistant oysters in response to infection included the immune modulators IL-17 and arginase, as well as several genes involved in extracellular matrix remodeling. The identification of potential genes and processes responsible for defense against R. crassostreae in the American oyster provides insights into potential mechanisms of disease resistance.

Transcriptome of American Oysters, Crassostrea virginica, in Response to Bacterial Challenge: Insights into Potential Mechanisms of Disease Resistance

PubMed Central

McDowell, Ian C.; Nikapitiya, Chamilani; Aguiar, Derek; Lane, Christopher E.; Istrail, Sorin; Gomez-Chiarri, Marta

2014-01-01

The American oyster Crassostrea virginica, an ecologically and economically important estuarine organism, can suffer high mortalities in areas in the Northeast United States due to Roseovarius Oyster Disease (ROD), caused by the gram-negative bacterial pathogen Roseovarius crassostreae. The goals of this research were to provide insights into: 1) the responses of American oysters to R. crassostreae, and 2) potential mechanisms of resistance or susceptibility to ROD. The responses of oysters to bacterial challenge were characterized by exposing oysters from ROD-resistant and susceptible families to R. crassostreae, followed by high-throughput sequencing of cDNA samples from various timepoints after disease challenge. Sequence data was assembled into a reference transcriptome and analyzed through differential gene expression and functional enrichment to uncover genes and processes potentially involved in responses to ROD in the American oyster. While susceptible oysters experienced constant levels of mortality when challenged with R. crassostreae, resistant oysters showed levels of mortality similar to non-challenged oysters. Oysters exposed to R. crassostreae showed differential expression of transcripts involved in immune recognition, signaling, protease inhibition, detoxification, and apoptosis. Transcripts involved in metabolism were enriched in susceptible oysters, suggesting that bacterial infection places a large metabolic demand on these oysters. Transcripts differentially expressed in resistant oysters in response to infection included the immune modulators IL-17 and arginase, as well as several genes involved in extracellular matrix remodeling. The identification of potential genes and processes responsible for defense against R. crassostreae in the American oyster provides insights into potential mechanisms of disease resistance. PMID:25122115

Ego Defense Mechanisms and Types of Object Relations in Adults With ADHD.

PubMed

de Almeida Silva, Vanessa; Louzã, Mario Rodrigues; da Silva, Maria Aparecida; Nakano, Eduardo Yoshio

2016-11-01

This research evaluates the personality structure of adults with ADHD from a psychodynamic perspective. The hypothesis was that possible structural characteristics in personality could be correlated with this syndrome. Assessment tools for ego functions (Bell Object Relations and Reality Testing Inventory [BORRTI-Form O], Defense Style Questionnaire ( DSQ-40)) were applied to a sample of 90 adults with ADHD, recruited in a specialized clinic. Among the ADHD sample, 84.4% of the participants were identified as having object relations pathologies. Pathological elevations were observed mainly in the Alienation, Egocentricity, and Insecure Attachment subscales. Statistically, significant differences were found especially in the use of immature and neurotic defense mechanisms, compared with normative data. The findings indicate that adults with ADHD make more use of immature and neurotic defense mechanisms, and presented pathological internalized object relations that are typical of an archaic and poorly structured egoic structure. © The Author(s) 2012.

Memories of paternal relations are associated with coping and defense mechanisms in breast cancer patients: an observational study.

PubMed

Renzi, Chiara; Perinel, Giada; Arnaboldi, Paola; Gandini, Sara; Vadilonga, Valeria; Rotmensz, Nicole; Tagini, Angela; Didier, Florence; Pravettoni, Gabriella

2017-11-09

Breast cancer diagnosis and treatment represent stressful events that demand emotional adjustment, thus recruiting coping strategies and defense mechanisms. As parental relations were shown to influence emotion regulation patterns and adaptive processes in adulthood, the present study investigated whether they are specifically associated to coping and defense mechanisms in patients with breast cancer. One hundred and ten women hospitalized for breast cancer surgery were administered questionnaires assessing coping with cancer, defense mechanisms, and memories of parental bonding in childhood. High levels of paternal overprotection were associated with less mature defenses, withdrawal and fantasy and less adaptive coping mechanisms, such as hopelessness/helplessness. Low levels of paternal care were associated with a greater use of repression. No association was found between maternal care, overprotection, coping and defense mechanisms. Immature defenses correlated positively with less adaptive coping styles, while mature defenses were positively associated to a fighting spirit and to fatalism, and inversely related to less adaptive coping styles. These data suggest that paternal relations in childhood are associated with emotional, cognitive, and behavioral regulation in adjusting to cancer immediately after surgery. Early experiences of bonding may constitute a relevant index for adaptation to cancer, indicating which patients are at risk and should be considered for psychological interventions.

Mechanisms of Antimicrobial Peptide Resistance in Gram-Negative Bacteria

PubMed Central

Band, Victor I.; Weiss, David S.

2014-01-01

Cationic antimicrobial peptides (CAMPs) are important innate immune defenses that inhibit colonization by pathogens and contribute to clearance of infections. Gram-negative bacterial pathogens are a major target, yet many of them have evolved mechanisms to resist these antimicrobials. These resistance mechanisms can be critical contributors to bacterial virulence and are often crucial for survival within the host. Here, we summarize methods used by Gram-negative bacteria to resist CAMPs. Understanding these mechanisms may lead to new therapeutic strategies against pathogens with extensive CAMP resistance. PMID:25927010

Gregarious pupation act as a defensive mechanism against cannibalism and intraguild predation.

PubMed

Roberge, Claudia; Fréchette, Bruno; Labrie, Geneviève; Dumont, François; Lucas, Eric

2016-08-01

Coccinellid pupae use an array of defensive strategies against their natural enemies. This study aims to assess the efficiency of gregarious pupation as a defensive mechanism against intraguild predators and cannibals in coccinellid. The study was designed specifically (i) to determine the natural occurrence of gregarious pupation in the field for different coccinellid species, and (ii) to evaluate the adaptive value of gregarious pupation as a defensive mechanism against 2 types of predators (i.e., cannibals and intraguild predators). In the field, gregarious pupation consisted of a group of 2-5 pupae. The proportion of gregarious pupation observed varied according to species, the highest rate being observed with Harmonia axyridis Pallas (Coccinellidae; 14.17%). Gregarious pupation had no impact on the probability that intraguild predators and cannibals locate pupae. Intraguild predation occurred more often in site with gregarious pupation, while cannibalism occurred as often in site with gregarious pupation as in site with isolated pupa. However, for a specific pupa, the mortality rate was higher for isolated pupae than for pupae located in a gregarious pupation site both in the presence of intraguild predators and in the presence of cannibals. The spatial location of pupae within the group had no impact on mortality rate. Since it reduces the risk of predation, it is proposed that gregarious pupation act as a defensive mechanism for H. axyridis pupae. © 2015 Institute of Zoology, Chinese Academy of Sciences.

An Enrichment of CRISPR and Other Defense-Related Features in Marine Sponge-Associated Microbial Metagenomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Horn, Hannes; Slaby, Beate M.; Jahn, Martin T.

Many marine sponges are populated by dense and taxonomically diverse microbial consortia. We employed a metagenomics approach to unravel the differences in the functional gene repertoire among three Mediterranean sponge species, Petrosia ficiformis, Sarcotragus foetidus, Aplysina aerophoba and seawater. Different signatures were observed between sponge and seawater metagenomes with regard to microbial community composition, GC content, and estimated bacterial genome size. Our analysis showed further a pronounced repertoire for defense systems in sponge metagenomes. Specifically, clustered regularly interspaced short palindromic repeats, restriction modification, DNA phosphorothioation and phage growth limitation systems were enriched in sponge metagenomes. These data suggest that defensemore » is an important functional trait for an existence within sponges that requires mechanisms to defend against foreign DNA from microorganisms and viruses. Furthermore, this study contributes to an understanding of the evolutionary arms race between viruses/phages and bacterial genomes and it sheds light on the bacterial defenses that have evolved in the context of the sponge holobiont.« less

An Enrichment of CRISPR and Other Defense-Related Features in Marine Sponge-Associated Microbial Metagenomes

DOE PAGES

Horn, Hannes; Slaby, Beate M.; Jahn, Martin T.; ...

2016-11-08

Many marine sponges are populated by dense and taxonomically diverse microbial consortia. We employed a metagenomics approach to unravel the differences in the functional gene repertoire among three Mediterranean sponge species, Petrosia ficiformis, Sarcotragus foetidus, Aplysina aerophoba and seawater. Different signatures were observed between sponge and seawater metagenomes with regard to microbial community composition, GC content, and estimated bacterial genome size. Our analysis showed further a pronounced repertoire for defense systems in sponge metagenomes. Specifically, clustered regularly interspaced short palindromic repeats, restriction modification, DNA phosphorothioation and phage growth limitation systems were enriched in sponge metagenomes. These data suggest that defensemore » is an important functional trait for an existence within sponges that requires mechanisms to defend against foreign DNA from microorganisms and viruses. Furthermore, this study contributes to an understanding of the evolutionary arms race between viruses/phages and bacterial genomes and it sheds light on the bacterial defenses that have evolved in the context of the sponge holobiont.« less

Gastrointestinal defense mechanisms.

PubMed

Said, Hyder; Kaunitz, Jonathan D

2016-11-01

To summarize and illuminate the recent findings regarding gastroduodenal mucosal defense mechanisms and the specific biomolecules involved in regulating this process, such as glucagon-like peptides (GLPs). There has been a growing interest in luminal nutrient chemosensing and its physiological effects throughout the digestive system. From the ingestion of food in the oral cavity to the processing and absorption of nutrients in the intestines, nutrient chemosensing receptors signal the production and release of numerous bioactive peptides from enteroendocrine cells, such as the proglucagon-derived peptides. There has been a major emphasis on two proglucagon-derived peptides, namely GLP-1 and GLP-2, due to their apparent beneficial effect on gut structure, function, and on metabolic processes. As an incretin, GLP-1 not only enhances the effect and release of insulin on pancreatic βcells but also has been implicated in having trophic effects on the intestinal epithelium. In addition, GLP-2, the other major proglucagon-derived peptide, has potent intestinotrophic effects, such as increasing the rate of mucosal stem cell proliferation, mucosal blood flow, and fluid absorption, as well as augmenting the rate of duodenal bicarbonate secretion to improve gastric mucosal health and longevity. Understanding the mechanisms underlying nutrient chemosensing and how it relates to GLP release can further elucidate how the gut functions in response to cellular changes and disturbances. Furthermore, a more in-depth comprehension of GLP release and its tissue-specific effects will help improve the utility of GLP-1 and GLP-2 receptor agonists in clinical settings. This, in turn, should help patients suffering from intestinal failure, malabsorption, and mucosal injury.

Chromium in stainless steel welding fume suppresses lung defense responses against bacterial infection in rats.

PubMed

Antonini, James M; Roberts, Jenny R

2007-04-01

Pulmonary infections have been reported to be increased in welders. Previous animal studies have indicated that manual metal arc, stainless steel welding fume (MMA-SS) increased susceptibility to lung infections. MMA-SS is composed of a complex of metals (e.g., iron, chromium, nickel). The objective was to determine which metal component of MMA-SS welding fume alters lung defense responses. At Day 0, rats were intratracheally instilled one time with saline or MMA-SS at a concentration of 2 mg/rat. Additional rats were treated with the metal constituents, Fe(2)O(3), NiO, or Cr(2)Na(2)O(7) alone or in combination, at concentrations that are present in the dose used for MMA-SS treatment. At Day 3, rats were intratracheally inoculated with 5 x 10(3) Listeria monocytogenes. At Days 6, 8 and 10, homogenized left lungs were cultured, and colony-forming units were counted after an overnight incubation to assess pulmonary bacterial clearance. At Day 3 (prior to infection) and at Days 6, 8 and 10, right lungs were lavaged to recover cells and fluid from the airspaces to measure lung injury, inflammation, and cytokine secretion. The production of reactive oxygen species by phagocytes recovered from the lungs was measured. Exposure to MMA-SS, soluble Cr, or the mixture of all three metals before infection significantly increased bacterial lung burden and tissue damage when compared to control. Animals treated with NiO or Fe(2)O(3) did not differ from control. Animals pre-treated with soluble Cr had alterations in inflammation and in the production of different cytokines (TNFalpha, IL-6, IL-2, and IL-12) involved in lung immune responses. This study indicates that soluble Cr present in MMA-SS is likely the primary component responsible for the suppression of lung defense responses associated with stainless steel welding fumes.

Epigenetic Mechanisms: An Emerging Player in Plant-Microbe Interactions.

PubMed

Zhu, Qian-Hao; Shan, Wei-Xing; Ayliffe, Michael A; Wang, Ming-Bo

2016-03-01

Plants have developed diverse molecular and cellular mechanisms to cope with a lifetime of exposure to a variety of pathogens. Host transcriptional reprogramming is a central part of plant defense upon pathogen recognition. Recent studies link DNA methylation and demethylation as well as chromatin remodeling by posttranslational histone modifications, including acetylation, methylation, and ubiquitination, to changes in the expression levels of defense genes upon pathogen challenge. Remarkably these inducible defense mechanisms can be primed prior to pathogen attack by epigenetic modifications and this heightened resistance state can be transmitted to subsequent generations by inheritance of these modification patterns. Beside the plant host, epigenetic mechanisms have also been implicated in virulence development of pathogens. This review highlights recent findings and insights into epigenetic mechanisms associated with interactions between plants and pathogens, in particular bacterial and fungal pathogens, and demonstrates the positive role they can have in promoting plant defense.

Diverse mechanisms evolved by DNA viruses to inhibit early host defenses

PubMed Central

Sheng, Xinlei; Song, Bokai; Cristea, Ileana M.

2016-01-01

In mammalian cells, early defenses against infection by pathogens are mounted through a complex network of signaling pathways shepherded by immune-modulatory pattern-recognition receptors. As obligate parasites, the survival of viruses is dependent upon the evolutionary acquisition of mechanisms that tactfully dismantle and subvert the cellular intrinsic and innate immune responses. Here, we review the diverse mechanisms by which viruses that accommodate DNA genomes are able to circumvent activation of cellular immunity. We start by discussing viral manipulation of host defense protein levels by either transcriptional regulation or protein degradation. We next review viral strategies used to repurpose or inhibit these cellular immune factors by molecular hijacking or by regulating their post-translational modification status. Additionally, we explore the infection-induced temporal modulation of apoptosis to facilitate viral replication and spread. Lastly, the co-evolution of viruses with their hosts is highlighted by the acquisition of elegant mechanisms for suppressing host defenses via viral mimicry of host factors. In closing, we present a perspective on how characterizing these viral evasion tactics both broadens the understanding of virus-host interactions and reveals essential functions of the immune system at the molecular level. This knowledge is critical in understanding the sources of viral pathogenesis, as well as for the design of antiviral therapeutics and autoimmunity treatments. PMID:27650455

Association of Ego Defense Mechanisms with Academic Performance, Anxiety and Depression in Medical Students: A Mixed Methods Study.

PubMed

Waqas, Ahmed; Rehman, Abdul; Malik, Aamenah; Muhammad, Umer; Khan, Sarah; Mahmood, Nadia

2015-09-30

 Ego defense mechanisms are unconscious psychological processes that help an individual to prevent anxiety when exposed to a stressful situation. These mechanisms are important in psychiatric practice to assess an individual's personality dynamics, psychopathologies, and modes of coping with stressful situations, and hence, to design appropriate individualized treatment. Our study delineates the relationship of ego defense mechanisms with anxiety, depression, and academic performance of Pakistani medical students.  This cross-sectional study was done at CMH Lahore Medical College and Fatima Memorial Hospital Medical and Dental College, both in Lahore, Pakistan, from December 1, 2014 to January 15, 2015. Convenience sampling was used and only students who agreed to take part in this study were included. The questionnaire consisted of three sections: 1) Demographics, documenting demographic data and academic scores on participants' most recent exams; 2) Hospital Anxiety and Depression Scale (HADS); and 3) Defense Style Questionnaire-40 (DSQ-40). The data were analyzed with SPSS v. 20. Mean scores and frequencies were calculated for demographic variables and ego defense mechanisms. Bivariate correlations, one-way ANOVA, and multiple linear regression were used to identify associations between academic scores, demographics, ego defense mechanisms, anxiety, and depression.  A total of 409 medical students participated, of whom 286 (70%) were females and 123 (30%) were males. Mean percentage score on the most recent exams was 75.6% in medical students. Bivariate correlation revealed a direct association between mature and neurotic ego defense mechanisms and academic performance, and an indirect association between immature mechanisms and academic performance. One-way ANOVA showed that moderate levels of anxiety (P < .05) and low levels of depression (P < .05) were associated with higher academic performance.  There was a significant association between academic

Association of Ego Defense Mechanisms with Academic Performance, Anxiety and Depression in Medical Students: A Mixed Methods Study

PubMed Central

Waqas, Ahmed; Malik, Aamenah; Muhammad, Umer; Khan, Sarah; Mahmood, Nadia

2015-01-01

Background: Ego defense mechanisms are unconscious psychological processes that help an individual to prevent anxiety when exposed to a stressful situation. These mechanisms are important in psychiatric practice to assess an individual’s personality dynamics, psychopathologies, and modes of coping with stressful situations, and hence, to design appropriate individualized treatment. Our study delineates the relationship of ego defense mechanisms with anxiety, depression, and academic performance of Pakistani medical students. Methods: This cross-sectional study was done at CMH Lahore Medical College and Fatima Memorial Hospital Medical and Dental College, both in Lahore, Pakistan, from December 1, 2014 to January 15, 2015. Convenience sampling was used and only students who agreed to take part in this study were included. The questionnaire consisted of three sections: 1) Demographics, documenting demographic data and academic scores on participants’ most recent exams; 2) Hospital Anxiety and Depression Scale (HADS); and 3) Defense Style Questionnaire-40 (DSQ-40). The data were analyzed with SPSS v. 20. Mean scores and frequencies were calculated for demographic variables and ego defense mechanisms. Bivariate correlations, one-way ANOVA, and multiple linear regression were used to identify associations between academic scores, demographics, ego defense mechanisms, anxiety, and depression. Results: A total of 409 medical students participated, of whom 286 (70%) were females and 123 (30%) were males. Mean percentage score on the most recent exams was 75.6% in medical students. Bivariate correlation revealed a direct association between mature and neurotic ego defense mechanisms and academic performance, and an indirect association between immature mechanisms and academic performance. One-way ANOVA showed that moderate levels of anxiety (P < .05) and low levels of depression (P < .05) were associated with higher academic performance. Conclusion: There was a

Attachment style and defense mechanisms in parents who abuse their children.

PubMed

Cramer, Phebe; Kelly, Francis D

2010-09-01

Adult attachment style, defense mechanisms, and personal history of abuse was studied in a group of abusive parents. As a group, these parents made unusually high use of the defense of denial; this was especially true of those with a Fearful attachment style. However, the use of Identification was characteristic of those with a Preoccupied attachment style. Further, personal abuse history was related to adult attachment style. Those who reported having been abused as a child were less likely to have a Secure attachment style, and a history of physical or sexual abuse was associated with a Preoccupied style. In general, these findings support the deactivating/hyperactivating defensive theory of Mikulincer et al (Emotion Regulation in Couples and Families: Pathways to Dysfunction and Health. 2006; pp 77-99. Washington (WA): American Psychological Association).

Mechanisms of bacterial morphogenesis: evolutionary cell biology approaches provide new insights.

PubMed

Jiang, Chao; Caccamo, Paul D; Brun, Yves V

2015-04-01

How Darwin's "endless forms most beautiful" have evolved remains one of the most exciting questions in biology. The significant variety of bacterial shapes is most likely due to the specific advantages they confer with respect to the diverse environments they occupy. While our understanding of the mechanisms generating relatively simple shapes has improved tremendously in the last few years, the molecular mechanisms underlying the generation of complex shapes and the evolution of shape diversity are largely unknown. The emerging field of bacterial evolutionary cell biology provides a novel strategy to answer this question in a comparative phylogenetic framework. This relatively novel approach provides hypotheses and insights into cell biological mechanisms, such as morphogenesis, and their evolution that would have been difficult to obtain by studying only model organisms. We discuss the necessary steps, challenges, and impact of integrating "evolutionary thinking" into bacterial cell biology in the genomic era. © 2015 WILEY Periodicals, Inc.

A small molecule deubiquitinase inhibitor increases localization of inducible nitric oxide synthase to the macrophage phagosome and enhances bacterial killing.

PubMed

Burkholder, Kristin M; Perry, Jeffrey W; Wobus, Christiane E; Donato, Nicholas J; Showalter, Hollis D; Kapuria, Vaibhav; O'Riordan, Mary X D

2011-12-01

Macrophages are key mediators of antimicrobial defense and innate immunity. Innate intracellular defense mechanisms can be rapidly regulated at the posttranslational level by the coordinated addition and removal of ubiquitin by ubiquitin ligases and deubiquitinases (DUBs). While ubiquitin ligases have been extensively studied, the contribution of DUBs to macrophage innate immune function is incompletely defined. We therefore employed a small molecule DUB inhibitor, WP1130, to probe the role of DUBs in the macrophage response to bacterial infection. Treatment of activated bone marrow-derived macrophages (BMM) with WP1130 significantly augmented killing of the intracellular bacterial pathogen Listeria monocytogenes. WP1130 also induced killing of phagosome-restricted bacteria, implicating a bactericidal mechanism associated with the phagosome, such as the inducible nitric oxide synthase (iNOS). WP1130 had a minimal antimicrobial effect in macrophages lacking iNOS, indicating that iNOS is an effector mechanism for WP1130-mediated bacterial killing. Although overall iNOS levels were not notably different, we found that WP1130 significantly increased colocalization of iNOS with the Listeria-containing phagosome during infection. Taken together, our data indicate that the deubiquitinase inhibitor WP1130 increases bacterial killing in macrophages by enhancing iNOS localization to the phagosome and suggest a potential role for ubiquitin regulation in iNOS trafficking.

Fibrinogen Is at the Interface of Host Defense and Pathogen Virulence in Staphylococcus aureus Infection

PubMed Central

Ko, Ya-Ping; Flick, Matthew J.

2017-01-01

Fibrinogen not only plays a pivotal role in hemostasis but also serves key roles in antimicrobial host defense. As a rapidly assembled provisional matrix protein, fibrin(ogen) can function as an early line of host protection by limiting bacterial growth, suppressing dissemination of microbes to distant sites, and mediating host bacterial killing. Fibrinogen-mediated host antimicrobial activity occurs predominantly through two general mechanisms, namely, fibrin matrices functioning as a protective barrier and fibrin(ogen) directly or indirectly driving host protective immune function. The potential of fibrin to limit bacterial infection and disease has been countered by numerous bacterial species evolving and maintaining virulence factors that engage hemostatic system components within vertebrate hosts. Bacterial factors have been isolated that simply bind fibrinogen or fibrin, promote fibrin polymer formation, or promote fibrin dissolution. Staphylococcus aureus is an opportunistic gram-positive bacterium, the causative agent of a wide range of human infectious diseases, and a prime example of a pathogen exquisitely sensitive to host fibrinogen. Indeed, current data suggest fibrinogen serves as a context-dependent determinant of host defense or pathogen virulence in Staphylococcus infection whose ultimate contribution is dictated by the expression of S. aureus virulence factors, the path of infection, and the tissue microenvironment. PMID:27056151

Transcriptomics of the rice blast fungus Magnaporthe oryzae in response to the bacterial antagonist Lysobacter enzymogenes reveals candidate fungal defense response genes.

PubMed

Mathioni, Sandra M; Patel, Nrupali; Riddick, Bianca; Sweigard, James A; Czymmek, Kirk J; Caplan, Jeffrey L; Kunjeti, Sridhara G; Kunjeti, Saritha; Raman, Vidhyavathi; Hillman, Bradley I; Kobayashi, Donald Y; Donofrio, Nicole M

2013-01-01

Plants and animals have evolved a first line of defense response to pathogens called innate or basal immunity. While basal defenses in these organisms are well studied, there is almost a complete lack of understanding of such systems in fungal species, and more specifically, how they are able to detect and mount a defense response upon pathogen attack. Hence, the goal of the present study was to understand how fungi respond to biotic stress by assessing the transcriptional profile of the rice blast pathogen, Magnaporthe oryzae, when challenged with the bacterial antagonist Lysobacter enzymogenes. Based on microscopic observations of interactions between M. oryzae and wild-type L. enzymogenes strain C3, we selected early and intermediate stages represented by time-points of 3 and 9 hours post-inoculation, respectively, to evaluate the fungal transcriptome using RNA-seq. For comparative purposes, we also challenged the fungus with L. enzymogenes mutant strain DCA, previously demonstrated to be devoid of antifungal activity. A comparison of transcriptional data from fungal interactions with the wild-type bacterial strain C3 and the mutant strain DCA revealed 463 fungal genes that were down-regulated during attack by C3; of these genes, 100 were also found to be up-regulated during the interaction with DCA. Functional categorization of genes in this suite included those with roles in carbohydrate metabolism, cellular transport and stress response. One gene in this suite belongs to the CFEM-domain class of fungal proteins. Another CFEM class protein called PTH11 has been previously characterized, and we found that a deletion in this gene caused advanced lesion development by C3 compared to its growth on the wild-type fungus. We discuss the characterization of this suite of 100 genes with respect to their role in the fungal defense response.

Thermoregulatory defense mechanisms.

PubMed

Sessler, Daniel I

2009-07-01

Core body temperature is normally tightly regulated by an effective thermoregulatory system. Thermoregulatory control is sometimes impaired by serious illness, but more typically remains intact. The primary autonomic defenses against heat are sweating and active precapillary vasodilation; the primary autonomic defenses against cold are arteriovenous shunt vasoconstriction and shivering. The core temperature triggering each response defines its activation threshold. Temperatures between the sweating and vasoconstriction thresholds define the inter-threshold range. The shivering threshold is usually a full 1 degrees C below the vasoconstriction threshold and is therefore a "last resort" response. Both vasoconstriction and shivering are associated with autonomic and hemodynamic activation; and each response is effective, thus impeding induction of therapeutic hypothermia. It is thus helpful to accompany core cooling with drugs that pharmacologically induce a degree of thermal tolerance. No perfect drug or drug combination has been identified. Anesthetics, for example, induce considerable tolerance, but are rarely suitable. Meperidine-especially in combination with buspirone-is especially effective while provoking only modest toxicity. The combination of buspirone and dexmedetomidine is comparably effective while avoiding the respiratory depression association with opioid administration.

Defenses against keratinolytic bacteria in birds living in radioactively contaminated areas

NASA Astrophysics Data System (ADS)

Ruiz-Rodríguez, Magdalena; Møller, Anders Pape; Mousseau, Timothy A.; Soler, Juan J.

2016-10-01

Microorganisms have shaped the evolution of a variety of defense mechanisms against pathogenic infections. Radioactivity modifies bacterial communities and, therefore, bird hosts breeding in contaminated areas are expected to adapt to the new bacterial environment. We tested this hypothesis in populations of barn swallows ( Hirundo rustica) from a gradient of background radiation levels at Chernobyl and uncontaminated controls from Denmark. Investment in defenses against keratinolytic bacteria was measured from feather structure (i.e., susceptibility to degradation) and uropygial secretions. We studied degradability of tail feathers from areas varying in contamination in laboratory experiments using incubation of feathers with a feather-degrading bacterium, Bacillus licheniformis, followed by measurement of the amount of keratin digested. The size of uropygial glands and secretion amounts were quantified, followed by antimicrobial tests against B. licheniformis and quantification of wear of feathers. Feathers of males, but not of females, from highly contaminated areas degraded at a lower rate than those from medium and low contamination areas. However, feathers of both sexes from the Danish populations showed little evidence of degradation. Individual barn swallows from the more contaminated areas of Ukraine produced the largest uropygial secretions with higher antimicrobial activity, although wear of feathers did not differ among males from different populations. In Denmark, swallows produced smaller quantities of uropygial secretion with lower antimicrobial activity, which was similar to swallow populations from uncontaminated areas in Ukraine. Therefore, barn swallows breeding in contaminated areas invested more in all defenses against keratinolytic bacteria than in uncontaminated areas of Ukraine and Denmark, although they had similar levels of feather wear. Strong natural selection exerted by radioactivity may have selected for individuals with higher defense

Defenses against keratinolytic bacteria in birds living in radioactively contaminated areas.

PubMed

Ruiz-Rodríguez, Magdalena; Møller, Anders Pape; Mousseau, Timothy A; Soler, Juan J

2016-10-01

Microorganisms have shaped the evolution of a variety of defense mechanisms against pathogenic infections. Radioactivity modifies bacterial communities and, therefore, bird hosts breeding in contaminated areas are expected to adapt to the new bacterial environment. We tested this hypothesis in populations of barn swallows (Hirundo rustica) from a gradient of background radiation levels at Chernobyl and uncontaminated controls from Denmark. Investment in defenses against keratinolytic bacteria was measured from feather structure (i.e., susceptibility to degradation) and uropygial secretions. We studied degradability of tail feathers from areas varying in contamination in laboratory experiments using incubation of feathers with a feather-degrading bacterium, Bacillus licheniformis, followed by measurement of the amount of keratin digested. The size of uropygial glands and secretion amounts were quantified, followed by antimicrobial tests against B. licheniformis and quantification of wear of feathers. Feathers of males, but not of females, from highly contaminated areas degraded at a lower rate than those from medium and low contamination areas. However, feathers of both sexes from the Danish populations showed little evidence of degradation. Individual barn swallows from the more contaminated areas of Ukraine produced the largest uropygial secretions with higher antimicrobial activity, although wear of feathers did not differ among males from different populations. In Denmark, swallows produced smaller quantities of uropygial secretion with lower antimicrobial activity, which was similar to swallow populations from uncontaminated areas in Ukraine. Therefore, barn swallows breeding in contaminated areas invested more in all defenses against keratinolytic bacteria than in uncontaminated areas of Ukraine and Denmark, although they had similar levels of feather wear. Strong natural selection exerted by radioactivity may have selected for individuals with higher defense

Exposure to Electronic Cigarettes Impairs Pulmonary Anti-Bacterial and Anti-Viral Defenses in a Mouse Model

PubMed Central

Sussan, Thomas E.; Gajghate, Sachin; Thimmulappa, Rajesh K.; Ma, Jinfang; Kim, Jung-Hyun; Sudini, Kuladeep; Consolini, Nicola; Cormier, Stephania A.; Lomnicki, Slawo; Hasan, Farhana; Pekosz, Andrew; Biswal, Shyam

2015-01-01

Electronic cigarettes (E-cigs) have experienced sharp increases in popularity over the past five years due to many factors, including aggressive marketing, increased restrictions on conventional cigarettes, and a perception that E-cigs are healthy alternatives to cigarettes. Despite this perception, studies on health effects in humans are extremely limited and in vivo animal models have not been generated. Presently, we determined that E-cig vapor contains 7x1011 free radicals per puff. To determine whether E-cig exposure impacts pulmonary responses in mice, we developed an inhalation chamber for E-cig exposure. Mice that were exposed to E-cig vapor contained serum cotinine concentrations that are comparable to human E-cig users. E-cig exposure for 2 weeks produced a significant increase in oxidative stress and moderate macrophage-mediated inflammation. Since, COPD patients are susceptible to bacterial and viral infections, we tested effects of E-cigs on immune response. Mice that were exposed to E-cig vapor showed significantly impaired pulmonary bacterial clearance, compared to air-exposed mice, following an intranasal infection with Streptococcus pneumonia. This defective bacterial clearance was partially due to reduced phagocytosis by alveolar macrophages from E-cig exposed mice. In response to Influenza A virus infection, E-cig exposed mice displayed increased lung viral titers and enhanced virus-induced illness and mortality. In summary, this study reports a murine model of E-cig exposure and demonstrates that E-cig exposure elicits impaired pulmonary anti-microbial defenses. Hence, E-cig exposure as an alternative to cigarette smoking must be rigorously tested in users for their effects on immune response and susceptibility to bacterial and viral infections. PMID:25651083

Soft mechanical stimulation induces a defense response against Botrytis cinerea in strawberry.

PubMed

Tomas-Grau, Rodrigo Hernán; Requena-Serra, Fernando José; Hael-Conrad, Verónica; Martínez-Zamora, Martín Gustavo; Guerrero-Molina, María Fernanda; Díaz-Ricci, Juan Carlos

2018-02-01

Genes associated with plant mechanical stimulation were found in strawberry genome. A soft mechanical stimulation (SMS) induces molecular and biochemical changes in strawberry plants, conferring protection against Botrytis cinerea. Plants have the capacity to induce a defense response after exposure to abiotic stresses acquiring resistance towards pathogens. It was reported that when leaves of Arabidopsis thaliana were wounded or treated with a soft mechanical stimulation (SMS), they could resist much better the attack of the fungal pathogen Botrytis cinerea, and this effect was accompanied by an oxidative burst and the expression of touch-inducible genes (TCH). However, no further work was carried out to better characterize the induced defense response. In this paper, we report that TCH genes were identified for first time in the genomes of the strawberry species Fragaria ananassa (e.g. FaTCH2, FaTCH3, FaTCH4 and FaCML39) and Fragaria vesca (e.g. FvTCH2, FvTCH3, FvTCH4 and FvCML39). Phylogenetic studies revealed that F. ananassa TCH genes exhibited high similarity with the orthologous of F. vesca and lower with A. thaliana ones. We also present evidence that after SMS treatment on strawberry leaves, plants activate a rapid oxidative burst, callose deposition, and the up-regulation of TCH genes as well as plant defense genes such as FaPR1, FaCHI2-2, FaCAT, FaACS1 and FaOGBG-5. The latter represents the first report showing that TCH- and defense-induced genes participate in SMS-induced resistance in plants, bringing a rational explanation why plants exposed to a SMS treatment acquired an enhance resistance toward B. cinerea.

Metal homeostasis in infectious disease: recent advances in bacterial metallophores and the human metal-withholding response.

PubMed

Neumann, Wilma; Gulati, Anmol; Nolan, Elizabeth M

2017-04-01

A tug-of-war between the mammalian host and bacterial pathogen for nutrients, including first-row transition metals (e.g. Mn, Fe, Zn), occurs during infection. Here we present recent advances about three metal-chelating metabolites that bacterial pathogens deploy when invading the host: staphylopine, staphyloferrin B, and enterobactin. These highlights provide new insights into the mechanisms of bacterial metal acquisition and regulation, as well as the contributions of host-defense proteins during the human innate immune response. The studies also underscore that the chemical composition of the microenvironment at an infection site can influence bacterial pathogenesis and the innate immune system. Copyright © 2016 Elsevier Ltd. All rights reserved.

Greater tactile sensitivity and less use of immature psychological defense mechanisms predict women's penile-vaginal intercourse orgasm.

PubMed

Brody, Stuart; Houde, Stephanie; Hess, Ursula

2010-09-01

Previous research has suggested that diminished tactile sensitivity might be associated with reduced sexual activity and function. Research has also demonstrated significant physiological and psychological differences between sexual behaviors, including immature psychological defense mechanisms (associated with various psychopathologies) impairing specifically women's orgasm from penile-vaginal intercourse (PVI). To examine the extent to which orgasm triggered by PVI (distinguished from other sexual activities) is associated with both greater tactile sensitivity and lesser use of immature psychological defenses. Seventy French-Canadian female university students (aged 18-30) had their finger sensitivity measured with von Frey type microfilaments, completed the Defense Style Questionnaire and a short form of the Marlowe-Crowne social desirability scale, and provided details of the 1 month (and ever) frequencies of engaging in, and having an orgasm from, PVI, masturbation, anal intercourse, partner masturbation, and cunnilingus. Logistic and linear regression prediction of orgasm triggered by PVI from tactile sensitivity, age, social desirability responding, and immature psychological defenses. Having a PVI orgasm in the past month was associated with greater tactile sensitivity (odds ratio=4.0 for each filament point) and less use of immature defense mechanisms (odds ratio=5.1 for each scale point). Lifetime PVI orgasm was associated only with less use of immature defense mechanisms (and lower social desirability responding score). Orgasms triggered by other activities were not associated with either tactile sensitivity or immature defense mechanisms. Tactile sensitivity was also associated with greater past month PVI frequency (inclusion of PVI frequency in a logistic regression model displaced tactile sensitivity), and lesser use of immature defenses was associated with greater past month PVI and PVI orgasm frequencies. Both diminished physical sensitivity and the

Systematic discovery of antiphage defense systems in the microbial pangenome.

PubMed

Doron, Shany; Melamed, Sarah; Ofir, Gal; Leavitt, Azita; Lopatina, Anna; Keren, Mai; Amitai, Gil; Sorek, Rotem

2018-03-02

The arms race between bacteria and phages led to the development of sophisticated antiphage defense systems, including CRISPR-Cas and restriction-modification systems. Evidence suggests that known and unknown defense systems are located in "defense islands" in microbial genomes. Here, we comprehensively characterized the bacterial defensive arsenal by examining gene families that are clustered next to known defense genes in prokaryotic genomes. Candidate defense systems were systematically engineered and validated in model bacteria for their antiphage activities. We report nine previously unknown antiphage systems and one antiplasmid system that are widespread in microbes and strongly protect against foreign invaders. These include systems that adopted components of the bacterial flagella and condensin complexes. Our data also suggest a common, ancient ancestry of innate immunity components shared between animals, plants, and bacteria. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

Riboregulation of bacterial and archaeal transposition.

PubMed

Ellis, Michael J; Haniford, David B

2016-05-01

The coexistence of transposons with their hosts depends largely on transposition levels being tightly regulated to limit the mutagenic burden associated with frequent transposition. For 'DNA-based' (class II) bacterial transposons there is growing evidence that regulation through small noncoding RNAs and/or the RNA-binding protein Hfq are prominent mechanisms of defense against transposition. Recent transcriptomics analyses have identified many new cases of antisense RNAs (asRNA) that potentially could regulate the expression of transposon-encoded genes giving the impression that asRNA regulation of DNA-based transposons is much more frequent than previously thought. Hfq is a highly conserved bacterial protein that plays a central role in posttranscriptional gene regulation and stress response pathways in many bacteria. Three different mechanisms for Hfq-directed control of bacterial transposons have been identified to date highlighting the versatility of this protein as a regulator of bacterial transposons. There is also evidence emerging that some DNA-based transposons encode RNAs that could regulate expression of host genes. In the case of IS200, which appears to have lost its ability to transpose, contributing a regulatory RNA to its host could account for the persistence of this mobile element in a wide range of bacterial species. It remains to be seen how prevalent these transposon-encoded RNA regulators are, but given the relatively large amount of intragenic transcription in bacterial genomes, it would not be surprising if new examples are forthcoming. WIREs RNA 2016, 7:382-398. doi: 10.1002/wrna.1341 For further resources related to this article, please visit the WIREs website. © 2016 Wiley Periodicals, Inc.

Bacterial-fungal interactions: ecology, mechanisms and challenges.

PubMed

Deveau, Aurélie; Bonito, Gregory; Uehling, Jessie; Paoletti, Mathieu; Becker, Matthias; Bindschedler, Saskia; Hacquard, Stéphane; Hervé, Vincent; Labbé, Jessy; Lastovetsky, Olga A; Mieszkin, Sophie; Millet, Larry J; Vajna, Balázs; Junier, Pilar; Bonfante, Paola; Krom, Bastiaan P; Olsson, Stefan; van Elsas, Jan Dirk; Wick, Lukas Y

2018-05-01

Fungi and bacteria are found living together in a wide variety of environments. Their interactions are significant drivers of many ecosystem functions and are important for the health of plants and animals. A large number of fungal and bacterial families engage in complex interactions that lead to critical behavioural shifts of the microorganisms ranging from mutualism to antagonism. The importance of bacterial-fungal interactions (BFI) in environmental science, medicine and biotechnology has led to the emergence of a dynamic and multidisciplinary research field that combines highly diverse approaches including molecular biology, genomics, geochemistry, chemical and microbial ecology, biophysics and ecological modelling. In this review, we discuss recent advances that underscore the roles of BFI across relevant habitats and ecosystems. A particular focus is placed on the understanding of BFI within complex microbial communities and in regard of the metaorganism concept. We also discuss recent discoveries that clarify the (molecular) mechanisms involved in bacterial-fungal relationships, and the contribution of new technologies to decipher generic principles of BFI in terms of physical associations and molecular dialogues. Finally, we discuss future directions for research in order to stimulate synergy within the BFI research area and to resolve outstanding questions.

Autophagic clearance of bacterial pathogens: molecular recognition of intracellular microorganisms.

PubMed

Pareja, Maria Eugenia Mansilla; Colombo, Maria I

2013-01-01

Autophagy is involved in several physiological and pathological processes. One of the key roles of the autophagic pathway is to participate in the first line of defense against the invasion of pathogens, as part of the innate immune response. Targeting of intracellular bacteria by the autophagic machinery, either in the cytoplasm or within vacuolar compartments, helps to control bacterial proliferation in the host cell, controlling also the spreading of the infection. In this review we will describe the means used by diverse bacterial pathogens to survive intracellularly and how they are recognized by the autophagic molecular machinery, as well as the mechanisms used to avoid autophagic clearance.

K+ Block Is the Mechanism of Functional Asymmetry in Bacterial Nav Channels

PubMed Central

Ngo, Van; Wang, Yibo; Haas, Stephan; Noskov, Sergei Y.; Farley, Robert A.

2016-01-01

Crystal structures of several bacterial Nav channels have been recently published and molecular dynamics simulations of ion permeation through these channels are consistent with many electrophysiological properties of eukaryotic channels. Bacterial Nav channels have been characterized as functionally asymmetric, and the mechanism of this asymmetry has not been clearly understood. To address this question, we combined non-equilibrium simulation data with two-dimensional equilibrium unperturbed landscapes generated by umbrella sampling and Weighted Histogram Analysis Methods for multiple ions traversing the selectivity filter of bacterial NavAb channel. This approach provided new insight into the mechanism of selective ion permeation in bacterial Nav channels. The non-equilibrium simulations indicate that two or three extracellular K+ ions can block the entrance to the selectivity filter of NavAb in the presence of applied forces in the inward direction, but not in the outward direction. The block state occurs in an unstable local minimum of the equilibrium unperturbed free-energy landscape of two K+ ions that can be ‘locked’ in place by modest applied forces. In contrast to K+, three Na+ ions move favorably through the selectivity filter together as a unit in a loose “knock-on” mechanism of permeation in both inward and outward directions, and there is no similar local minimum in the two-dimensional free-energy landscape of two Na+ ions for a block state. The useful work predicted by the non-equilibrium simulations that is required to break the K+ block is equivalent to large applied potentials experimentally measured for two bacterial Nav channels to induce inward currents of K+ ions. These results illustrate how inclusion of non-equilibrium factors in the simulations can provide detailed information about mechanisms of ion selectivity that is missing from mechanisms derived from either crystal structures or equilibrium unperturbed free-energy landscapes

[Study of defense styles, defenses and coping strategies in alcohol-dependent population].

PubMed

Ribadier, A; Varescon, I

2017-05-01

Defense mechanisms have been seen to greatly change over time and across different definitions made by different theoretical currents. Recently with the definition provided by the DSM IV, defense mechanisms have integrated the concept of coping as a defensive factor. These mechanisms are no longer considered just through a psychodynamic approach but also through a cognitive and behavioral one. In recent years, new theories have therefore integrated these two components of the defensive operation. According to Chabrol and Callahan (2013), defense mechanisms precede coping strategies. In individuals with psychopathological disorders, these authors indicate a relative stability of these mechanisms. Also, we asked about the presence of unique characteristics among people with alcohol dependence. Indeed, studies conducted with people with alcohol dependence highlight the presence of a neurotic defense style and some highly immature defenses (projection, acting out, splitting and somatization). In terms of coping strategies, persons with alcohol dependence preferentially use avoidant strategies and strategies focused on emotion. However, although several studies have been conducted to assess coping strategies and defense styles within a population of individuals with an alcohol problem, at the present time none of them has taken into account all these aspects of defense mechanisms. The aim of this study is therefore to study the defenses and defense styles and coping strategies in an alcohol-dependent population. This multicenter study (3 CHU, 1 center of supportive care and prevention in addiction and 1 clinic) received a favorable opinion of an Institutional Review Board (IRB Registration #: 00001072). Eighty alcohol-dependent individuals responded to a questionnaire assessing sociodemographic characteristics and elements related to the course of consumption. Coping strategies were assessed by means of a questionnaire validated in French: the Brief Cope. The Defense

Key role for scavenger receptor B-I in the integrative physiology of host defense during bacterial pneumonia.

PubMed

Gowdy, K M; Madenspacher, J H; Azzam, K M; Gabor, K A; Janardhan, K S; Aloor, J J; Fessler, M B

2015-05-01

Scavenger receptor B-I (SR-BI) is a multirecognition receptor that regulates cholesterol trafficking and cardiovascular inflammation. Although it is expressed by neutrophils (PMNs) and lung-resident cells, no role for SR-BI has been defined in pulmonary immunity. Herein, we report that, compared with SR-BI(+/+) counterparts, SR-BI(-/-) mice suffer markedly increased mortality during bacterial pneumonia associated with higher bacterial burden in the lung and blood, deficient induction of the stress glucocorticoid corticosterone, higher serum cytokines, and increased organ injury. SR-BI(-/-) mice had significantly increased PMN recruitment and cytokine production in the infected airspace. This was associated with defective hematopoietic cell-dependent clearance of lipopolysaccharide from the airspace and increased cytokine production by SR-BI(-/-) macrophages. Corticosterone replacement normalized alveolar neutrophilia but not alveolar cytokines, bacterial burden, or mortality, suggesting that adrenal insufficiency derepresses PMN trafficking to the SR-BI(-/-) airway in a cytokine-independent manner. Despite enhanced alveolar neutrophilia, SR-BI(-/-) mice displayed impaired phagocytic killing. Bone marrow chimeras revealed this defect to be independent of the dyslipidemia and adrenal insufficiency of SR-BI(-/-) mice. During infection, SR-BI(-/-) PMNs displayed deficient oxidant production and CD11b externalization, and increased surface L-selectin, suggesting defective activation. Taken together, SR-BI coordinates several steps in the integrated neutrophilic host defense response to pneumonia.

The Child's Demystification of Psychological Defense Mechanisms: A Structural and Developmental Analysis.

ERIC Educational Resources Information Center

Chandler, Michael J.; And Others

1978-01-01

Explored the relationships between the cognitive developmental level of preoperational, concrete operational, and formal operational children (N=10) and their success in interpreting and explaining each of eight commonly described mechanisms of psychological defense. (JMB)

Distribution of bacterial endophytes in peanut seeds obtained from axenic and control plant material under field conditions

USDA-ARS?s Scientific Manuscript database

Since endophytic bacteria may play a role in the defense mechanism of peanut from fungal invasion, the internal bacterial colonization of peanut seeds was investigated. Bacteria-free young peanut plants from seed embryos were successfully grown to maturity in the field. Mature seeds from these pla...

Mechanisms and strategies of plant defense against Botrytis cinerea.

PubMed

AbuQamar, Synan; Moustafa, Khaled; Tran, Lam Son

2017-03-01

Biotic factors affect plant immune responses and plant resistance to pathogen infections. Despite the considerable progress made over the past two decades in manipulating genes, proteins and their levels from diverse sources, no complete genetic tolerance to environmental stresses has been developed so far in any crops. Plant defense response to pathogens, including Botrytis cinerea, is a complex biological process involving various changes at the biochemical, molecular (i.e. transcriptional) and physiological levels. Once a pathogen is detected, effective plant resistance activates signaling networks through the generation of small signaling molecules and the balance of hormonal signaling pathways to initiate defense mechanisms to the particular pathogen. Recently, studies using Arabidopsis thaliana and crop plants have shown that many genes are involved in plant responses to B. cinerea infection. In this article, we will review our current understanding of mechanisms regulating plant responses to B. cinerea with a particular interest on hormonal regulatory networks involving phytohormones salicylic acid (SA), jasmonic acid (JA), ethylene (ET) and abscisic acid (ABA). We will also highlight some potential gene targets that are promising for improving crop resistance to B. cinerea through genetic engineering and breeding programs. Finally, the role of biological control as a complementary and alternative disease management will be overviewed.

HLH-30/TFEB-mediated autophagy functions in a cell-autonomous manner for epithelium intrinsic cellular defense against bacterial pore-forming toxin in C. elegans.

PubMed

Chen, Huan-Da; Kao, Cheng-Yuan; Liu, Bang-Yu; Huang, Shin-Whei; Kuo, Cheng-Ju; Ruan, Jhen-Wei; Lin, Yen-Hung; Huang, Cheng-Rung; Chen, Yu-Hung; Wang, Horng-Dar; Aroian, Raffi V; Chen, Chang-Shi

2017-02-01

Autophagy is an evolutionarily conserved intracellular system that maintains cellular homeostasis by degrading and recycling damaged cellular components. The transcription factor HLH-30/TFEB-mediated autophagy has been reported to regulate tolerance to bacterial infection, but less is known about the bona fide bacterial effector that activates HLH-30 and autophagy. Here, we reveal that bacterial membrane pore-forming toxin (PFT) induces autophagy in an HLH-30-dependent manner in Caenorhabditis elegans. Moreover, autophagy controls the susceptibility of animals to PFT toxicity through xenophagic degradation of PFT and repair of membrane-pore cell-autonomously in the PFT-targeted intestinal cells in C. elegans. These results demonstrate that autophagic pathways and autophagy are induced partly at the transcriptional level through HLH-30 activation and are required to protect metazoan upon PFT intoxication. Together, our data show a new and powerful connection between HLH-30-mediated autophagy and epithelium intrinsic cellular defense against the single most common mode of bacterial attack in vivo.

[Cellular defense system of some synanthropic dipterans inhabitant of bacterially aggressive environment].

PubMed

Kind, T V

2014-01-01

The hemocytic count and defense reaction within 4 families of higher Diptera: Tabanidae, Syrphidae, Muscidae and Sarcophagidae, whose larvae inhabit bacterially aggressive environment, were investigated. The least hemocytes types (3) were revealed in Tabanidae and Syrphidae larvae--prohemocytes, plasmatocytes and prophenoloxydase-containing unstable hyaline cells (oenocytoids). In Sarcophaga crassipalpis and Musca domestica stable hyaline cells and thrombocytoids or podocytoid-like cells can be added to this set. At the time of pupariation in Sarcophaga, new generation of prohemocytes is segregated into the hemolymph, which form small round or spindle-shaped hyaline cells. So, the number of plasmatocyte types in Sarcophaga increase to six. Typical to Calliphoridae juvenile plasmatocytes in the members of investigated families are absent. Among the one hemocyte type morphology also can vary, especially in unstable prophenoloxydase hyaline cells. In Drosophila there are crystal cells containing in the cytoplasm paracrystalloidal inclusions. In Calliphoridae there are big hyaline cells with homogenous cytoplasm producing circumferential bubbles. Both in Sarcophaga and Tabanidae they contain in their cytoplasm big globules. However in Sarcophaga they rapidly disintegrate, while in Tabanidae are maintained unchanged during hours. In Muscidae and Syrphidae prophenoloxydase extrusion occurs very early and these cells obtain pycnotic nuclei and very liquid cytoplasm with strings of granules. Thrombocytoids in Musca larvae are represented by big flattened anucleated irregular cytoplasm and "naked" nuclei and cytoplasmic fragments often with fan-like projections. Plasmatocytes in all species studied are the cells with pronounced phylopodies. In larvae they contain cytoplasmic catabolic inclusions and in pupa--ragments of apoptotic tissues. Clearance of hemolymph from alien particles in Sarcophagidae and Muscidae occur by thrombocytoides, while in Tabanidae by plasmatocyte

Proteomic investigation of the effect of salicylic acid on Arabidopsis seed germination and establishment of early defense mechanisms.

PubMed

Rajjou, Loïc; Belghazi, Maya; Huguet, Romain; Robin, Caroline; Moreau, Adrien; Job, Claudette; Job, Dominique

2006-07-01

The influence of salicylic acid (SA) on elicitation of defense mechanisms in Arabidopsis (Arabidopsis thaliana) seeds and seedlings was assessed by physiological measurements combined with global expression profiling (proteomics). Parallel experiments were carried out using the NahG transgenic plants expressing the bacterial gene encoding SA hydroxylase, which cannot accumulate the active form of this plant defense elicitor. SA markedly improved germination under salt stress. Proteomic analyses disclosed a specific accumulation of protein spots regulated by SA as inferred by silver-nitrate staining of two-dimensional gels, detection of carbonylated (oxidized) proteins, and neosynthesized proteins with [35S]-methionine. The combined results revealed several processes potentially affected by SA. This molecule enhanced the reinduction of the late maturation program during early stages of germination, thereby allowing the germinating seeds to reinforce their capacity to mount adaptive responses in environmental water stress. Other processes affected by SA concerned the quality of protein translation, the priming of seed metabolism, the synthesis of antioxidant enzymes, and the mobilization of seed storage proteins. All the observed effects are likely to improve seed vigor. Another aspect revealed by this study concerned the oxidative stress entailed by SA in germinating seeds, as inferred from a characterization of the carbonylated (oxidized) proteome. Finally, the proteomic data revealed a close interplay between abscisic signaling and SA elicitation of seed vigor.

Psychoticism, Immature Defense Mechanisms and a Fearful Attachment Style are Associated with a Higher Homophobic Attitude.

PubMed

Ciocca, Giacomo; Tuziak, Bogdan; Limoncin, Erika; Mollaioli, Daniele; Capuano, Nicolina; Martini, Alessia; Carosa, Eleonora; Fisher, Alessandra D; Maggi, Mario; Niolu, Cinzia; Siracusano, Alberto; Lenzi, Andrea; Jannini, Emmanuele A

2015-09-01

Homophobic behavior and a negative attitude toward homosexuals are prevalent among the population. Despite this, few researches have investigated the psychologic aspects associated with homophobia, as psychopathologic symptoms, the defensive system, and attachment styles. The aim of this study was to investigate the psychologic factors mentioned earlier and their correlation with homophobia. Five hundred fifty-one university students recruited, aged 18-30, were asked to complete several psychometric evaluation. In particular, Homophobia Scale (HS) was used to assess homophobia levels, the Symptoms Check List Revised (SCL-90-R) for the identification of psychopathologic symptoms, the Defence Style Questionnaire (DSQ-40) for the evaluation of defense mechanisms and the Relationship Questionnaire (RQ) for attachment styles. After a regression analysis, we found a significant predictive value of psychoticism (β = 0.142; P = 0.04) and of immature defense mechanisms (β = 0.257; P < 0.0001) for homophobia, while neurotic defense mechanisms (β = -0.123; P = 0.02) and depressive symptoms (β = -0.152; P = 0.04) have an opposite role. Moreover, categorical constructs of the RQ revealed a significant difference between secure and fearful attachments styles in levels of homophobia (secure = 22.09 ± 17.22 vs. fearful = 31.07 ± 25.09; P < 0.05). Finally, a gender difference to HS scores and a significant influence of male sex was found (β = 0.213; P < 0.0001). We demonstrated the involvement of psychoticism and immature defense mechanisms in homophobic attitudes, while a contrasting role is played by neurotic defense mechanisms and depressive symptoms. Moreover, secure attachment is an indicator of low levels of homophobia compared with the subjects demonstrating a fearful style of attachment. Hence, in the assessment of homophobia and in the relevant programs of prevention, it is necessary to consider the

Mechanism of bystander-blaming: defensive attribution, counterfactual thinking, and gender.

PubMed

Levy, Inna; Ben-David, Sarah

2015-01-01

Contemporary victimology recognizes that an understanding of the mechanism of blaming requires a comprehensive approach that includes the victim, the offender, and the bystander. However, most of the existing research on blaming focuses on the victim and the offender, ignoring the issue of bystander-blaming. This study highlights the bystander and investigates bystander-blaming by exploring some theoretical explanations, including counterfactual thinking, defensive attribution, and gender differences. The study included 363 young male and female participants, who read vignettes describing the behavior of the victim and the bystander in a rape scenario and answered questions regarding bystander-blaming. The results show that both counterfactual thinking and defensive attribution play a role in bystander-blaming. This article addresses the theoretical and practical implications of these findings. © The Author(s) 2013.

Hemoadsorption corrects hyperresistinemia and restores anti-bacterial neutrophil function.

PubMed

Bonavia, Anthony; Miller, Lauren; Kellum, John A; Singbartl, Kai

2017-12-01

Mounting evidence suggests that sepsis-induced morbidity and mortality are due to both immune activation and immunosuppression. Resistin is an inflammatory cytokine and uremic toxin. Septic hyperresistinemia (plasma resistin >20 ng/ml) has been associated with greater disease severity and worse outcomes, and it is further exacerbated by concomitant acute kidney injury (AKI). Septic hyperresistinemia disturbs actin polymerization in neutrophils leading to impaired neutrophil migration, a crucial first-line mechanism in host defense to bacterial infection. Our experimental objective was to study the effects of hyperresistinemia on other F-actin-dependent neutrophil defense mechanisms, in particular intracellular bacterial clearance and generation of reactive oxygen species (ROS). We also sought to examine the effects of hemoadsorption on hyperresistinemia and neutrophil dysfunction. Thirteen patients with septic shock and six control patients were analyzed for serum resistin levels and their effects on neutrophil migration. In vitro, following incubation with resistin-spiked serum samples, Pseudomonas aeruginosa clearance and ROS generation in neutrophils were measured. Phosphorylation of 3-phosphoinositide-dependent protein kinase-1 (PDPK1) was assessed using flow cytometry. In vitro hemoadsorption with both Amberchrome™ columns (AC) and CytoSorb® cartridges (CC) were used to test correction of hyperresistinemia. We further tested AC for their effect on cell migration and ROS generation and CC for their effect on bacterial clearance. Patients with septic shock had higher serum resistin levels than control ICU patients and showed a strong, negative correlation between hyperresistinemia and neutrophil transwell migration (ρ= - 0.915, p < 0.001). In vitro, neutrophils exposed to hyperresistinemia exhibited twofold lower intracellular bacterial clearance rates compared to controls. Resistin impaired intracellular signaling and ROS production in a dose

DNA DAMAGE REPAIR AND CELL CYCLE CONTROL: A NATURAL BIO-DEFENSE MECHANISM

EPA Science Inventory

DNA DAMAGE REPAIR AND CELL CYCLE CONTROL: A natural bio-defense mechanism
Anuradha Mudipalli.

Maintenance of genetic information, including the correct sequence of nucleotides in DNA, is essential for replication, gene expression, and protein synthesis. DNA lesions onto...

Normal bacterial flora from vaginas of Criollo Limonero cows.

PubMed

Zambrano-Nava, Sunny; Boscán-Ocando, Julio; Nava, Jexenia

2011-02-01

In order to describe the normal bacterial flora in vaginas of Criollo Limonero cows, 51 healthy multiparous cows, at least 90-day postpartum, were selected. Duplicated swabs (N = 102) were taken from the vaginal fornix of cows to perform aerobic and anaerobic cultures as well as conventional biochemical tests. Out of 102 swabs, bacterial growth was obtained in 55 (53.9%) while the remaining 47 (46.1%) did not exhibited any bacterial growth. Of the 55 bacterial growths, 23 (41.8%) were aerobic whereas 32 (58.1%) were anaerobic. Likewise, 29 (52.72%) of bacterial growths were pure and 26 (47.27%) were mixed. Under both aerobic and anaerobic conditions, Gram positive bacteria were predominant (81.82% and 73.08%, respectively) over Gram negative bacteria (18.18% and 26.92%, respectively). Isolated bacteria were Arcanobacterium pyogenes (22.92%), Staphylococcus aureus (15.63%), Staphylococcus coagulase negative (17.71%), Erysipelothrix rhusiopathiae (6.25%), Bacteroides spp. (13.54%), and Peptostreptococcus spp. (7.29%). In conclusion, normal vaginal bacterial flora of Criollo Limonero cows was predominantly Gram positive and included A. pyogenes, S. aureus, coagulase negative Staphylococcus, E. rhusiopathiae, Bacteroides spp., and Peptostreptococcus spp. In Criollo Limonero cattle, adaptive aspects such as development of humoral and physical mechanisms for defense, and bacterial adaptation to host deserve research attention.

Bacterial self-defense antibiotics release from organic-inorganic hybrid multilayer films for long-term anti-adhesion and biofilm inhibition properties.

PubMed

Xu, Qingwen; Li, Xi; Jin, Yingying; Sun, Lin; Ding, Xiaoxu; Liang, Lin; Wang, Lei; Nan, Kaihui; Ji, Jian; Chen, Hao; Wang, Bailiang

2017-12-14

Implant-associated bacterial infections pose serious medical and financial issues due to the colonization and proliferation of pathogens on the surface of the implant. The as-prepared traditional antibacterial surfaces can neither resist bacterial adhesion nor inhibit the development of biofilm over the long term. Herein, novel (montmorillonite/poly-l-lysine-gentamicin sulfate) 8 ((MMT/PLL-GS) 8 ) organic-inorganic hybrid multilayer films were developed to combine enzymatic degradation PLL for on-demand self-defense antibiotics release. Small molecule GS was loaded into the multilayer films during self-assembly and the multilayer films showed pH-dependent and linear growth behavior. The chymotrypsin- (CMS) and bacterial infections-responsive film degradation led to the peeling of the films and GS release. Enzyme-responsive GS release exhibited CMS concentration dependence as measured by the size of the inhibition zone and SEM images. Notably, the obtained antibacterial films showed highly efficient bactericidal activity which killed more than 99.9% of S. aureus in 12 h. Even after 3 d of incubation in S. aureus, E. coli or S. epidermidis solutions, the multilayer films exhibited inhibition zones of more than 1.5 mm in size. Both in vitro and in vivo antibacterial tests indicated good cell compatibility, and anti-inflammatory, and long-term bacterial anti-adhesion and biofilm inhibition properties.

Chromosome-level genome map provides insights into diverse defense mechanisms in the medicinal fungus Ganoderma sinense

PubMed Central

Zhu, Yingjie; Xu, Jiang; Sun, Chao; Zhou, Shiguo; Xu, Haibin; Nelson, David R.; Qian, Jun; Song, Jingyuan; Luo, Hongmei; Xiang, Li; Li, Ying; Xu, Zhichao; Ji, Aijia; Wang, Lizhi; Lu, Shanfa; Hayward, Alice; Sun, Wei; Li, Xiwen; Schwartz, David C.; Wang, Yitao; Chen, Shilin

2015-01-01

Fungi have evolved powerful genomic and chemical defense systems to protect themselves against genetic destabilization and other organisms. However, the precise molecular basis involved in fungal defense remain largely unknown in Basidiomycetes. Here the complete genome sequence, as well as DNA methylation patterns and small RNA transcriptomes, was analyzed to provide a holistic overview of secondary metabolism and defense processes in the model medicinal fungus, Ganoderma sinense. We reported the 48.96 Mb genome sequence of G. sinense, consisting of 12 chromosomes and encoding 15,688 genes. More than thirty gene clusters involved in the biosynthesis of secondary metabolites, as well as a large array of genes responsible for their transport and regulation were highlighted. In addition, components of genome defense mechanisms, namely repeat-induced point mutation (RIP), DNA methylation and small RNA-mediated gene silencing, were revealed in G. sinense. Systematic bioinformatic investigation of the genome and methylome suggested that RIP and DNA methylation combinatorially maintain G. sinense genome stability by inactivating invasive genetic material and transposable elements. The elucidation of the G. sinense genome and epigenome provides an unparalleled opportunity to advance our understanding of secondary metabolism and fungal defense mechanisms. PMID:26046933

Channel formation by serum amyloid A: a potential mechanism for amyloid pathogenesis and host defense.

PubMed

Hirakura, Yutaka; Carreras, Isabel; Sipe, Jean D; Kagan, Bruce L

2002-03-01

Serum amyloid A (SAA) is a family of closely related apolipoproteins associated with high density lipoprotein (HDL). Subclasses of SAA isoforms are differentially expressed constitutively and during inflammation. During states of infection or inflammation, levels of HDL bound, acute phase isoforms of SAA rise as much as 1000-fold in the serum, suggesting that it might play a role in host defense. Following recurrent or chronic inflammation, an N-terminal peptide fragment of SAA known as amyloid A (AA) assembles into fibrils causing extensive damage to spleen, liver, and kidney, and rapidly progressing to death. In the present paper, we report the novel finding that a recombinant acute phase isoform variant of human SAA 1.1 (SAAp) readily forms ion-channels in planar lipid bilayer membranes at physiologic concentrations. These channels are voltage-independent, poorly selective, and are relatively long-lived This type of channel would place a severe metabolic strain on various kinds of cells. Expression of human SAA 1.1 in bacteria induces lysis of bacterial cells, while expression of the constitutive isoform (human SAA4) does not. Secondary structural analysis of the SAA isoforms in dicates a strong hydrophobicity of the N-terminal of the acute phase isoform relative to the constitutive SAA4 isoform, which may be responsible for the bactericidal activity of the former, in keeping with the notion that SAA 1 targets cell membranes and forms channels in them. Channel formation may thus be related to a host defense role of acute phase SAA isoforms and may also be the mechanism of end organ damage in AA and other amyloidoses.

K + block is the mechanism of functional asymmetry in bacterial Na v channels

DOE PAGES

Ngo, Van; Wang, Yibo; Haas, Stephan; ...

2016-01-04

Crystal structures of several bacterial Na v channels have been recently published and molecular dynamics simulations of ion permeation through these channels are consistent with many electrophysiological properties of eukaryotic channels. Bacterial Na v channels have been characterized as functionally asymmetric, and the mechanism of this asymmetry has not been clearly understood. To address this question, we combined non-equilibrium simulation data with two-dimensional equilibrium unperturbed landscapes generated by umbrella sampling and Weighted Histogram Analysis Methods for multiple ions traversing the selectivity filter of bacterial Na vAb channel. This approach provided new insight into the mechanism of selective ion permeation inmore » bacterial Nav channels. The non-equilibrium simulations indicate that two or three extracellular K + ions can block the entrance to the selectivity filter of Na vAb in the presence of applied forces in the inward direction, but not in the outward direction. The block state occurs in an unstable local minimum of the equilibrium unperturbed free-energy landscape of two K+ ions that can be ‘locked’ in place bymodest applied forces. In contrast to K +, three Na + ions move favorably through the selectivity filter together as a unit in a loose “knock-on” mechanism of permeation in both inward and outward directions, and there is no similar local minimum in the two-dimensional free-energy landscape of two Na + ions for a block state. The useful work predicted by the non-equilibrium simulations that is required to break the K + block is equivalent to large applied potentials experimentally measured for two bacterial Na v channels to induce inward currents of K + ions. Here, these results illustrate how inclusion of non-equilibrium factors in the simulations can provide detailed information about mechanisms of ion selectivity that is missing from mechanisms derived from either crystal structures or equilibrium unperturbed

Novel mechanisms power bacterial gliding motility.

PubMed

Nan, Beiyan; Zusman, David R

2016-07-01

For many bacteria, motility is essential for survival, growth, virulence, biofilm formation and intra/interspecies interactions. Since natural environments differ, bacteria have evolved remarkable motility systems to adapt, including swimming in aqueous media, and swarming, twitching and gliding on solid and semi-solid surfaces. Although tremendous advances have been achieved in understanding swimming and swarming motilities powered by flagella, and twitching motility powered by Type IV pili, little is known about gliding motility. Bacterial gliders are a heterogeneous group containing diverse bacteria that utilize surface motilities that do not depend on traditional flagella or pili, but are powered by mechanisms that are less well understood. Recently, advances in our understanding of the molecular machineries for several gliding bacteria revealed the roles of modified ion channels, secretion systems and unique machinery for surface movements. These novel mechanisms provide rich source materials for studying the function and evolution of complex microbial nanomachines. In this review, we summarize recent findings made on the gliding mechanisms of the myxobacteria, flavobacteria and mycoplasmas. © 2016 John Wiley & Sons Ltd.

Neisseria gonorrhoeae Modulates Iron-Limiting Innate Immune Defenses in Macrophages

PubMed Central

Zughaier, Susu M.; Kandler, Justin L.; Shafer, William M.

2014-01-01

Neisseria gonorrhoeae is a strict human pathogen that causes the sexually transmitted infection termed gonorrhea. The gonococcus can survive extracellularly and intracellularly, but in both environments the bacteria must acquire iron from host proteins for survival. However, upon infection the host uses a defensive response by limiting the bioavailability of iron by a number of mechanisms including the enhanced expression of hepcidin, the master iron-regulating hormone, which reduces iron uptake from the gut and retains iron in macrophages. The host also secretes the antibacterial protein NGAL, which sequesters bacterial siderophores and therefore inhibits bacterial growth. To learn whether intracellular gonococci can subvert this defensive response, we examined expression of host genes that encode proteins involved in modulating levels of intracellular iron. We found that N. gonorrhoeae can survive in association (tightly adherent and intracellular) with monocytes and macrophages and upregulates a panel of its iron-responsive genes in this environment. We also found that gonococcal infection of human monocytes or murine macrophages resulted in the upregulation of hepcidin, NGAL, and NRAMP1 as well as downregulation of the expression of the gene encoding the short chain 3-hydroxybutyrate dehydrogenase (BDH2); BDH2 catalyzes the production of the mammalian siderophore 2,5-DHBA involved in chelating and detoxifying iron. Based on these findings, we propose that N. gonorrhoeae can subvert the iron-limiting innate immune defenses to facilitate iron acquisition and intracellular survival. PMID:24489950

The Mycobacterium marinum mel2 locus displays similarity to bacterial bioluminescence systems and plays a role in defense against reactive oxygen and nitrogen species

PubMed Central

Subbian, Selvakumar; Mehta, Parmod K; Cirillo, Suat LG; Cirillo, Jeffrey D

2007-01-01

Background Mycobacteria have developed a number of pathways that provide partial protection against both reactive oxygen species (ROS) and reactive nitrogen species (RNS). We recently identified a locus in Mycobacterium marinum, mel2, that plays a role during infection of macrophages. The molecular mechanism of mel2 action is not well understood. Results To better understand the role of the M. marinum mel2 locus, we examined these genes for conserved motifs in silico. Striking similarities were observed between the mel2 locus and loci that encode bioluminescence in other bacterial species. Since bioluminescence systems can play a role in resistance to oxidative stress, we postulated that the mel2 locus might be important for mycobacterial resistance to ROS and RNS. We found that an M. marinum mutant in the first gene in this putative operon, melF, confers increased susceptibility to both ROS and RNS. This mutant is more susceptible to ROS and RNS together than either reactive species alone. Conclusion These observations support a role for the M. marinum mel2 locus in resistance to oxidative stress and provide additional evidence that bioluminescence systems may have evolved from oxidative defense mechanisms. PMID:17239244

Bacterial Responses to Reactive Chlorine Species

PubMed Central

Gray, Michael J.; Wholey, Wei-Yun; Jakob, Ursula

2013-01-01

Hypochlorous acid (HOCl), the active ingredient of household bleach, is the most common disinfectant in medical, industrial, and domestic use and plays an important role in microbial killing in the innate immune system. Given the critical importance of the antimicrobial properties of chlorine to public health, it is surprising how little is known about the ways in which bacteria sense and respond to reactive chlorine species (RCS). Although the literature on bacterial responses to reactive oxygen species (ROS) is enormous, work addressing bacterial responses to RCS has begun only recently. Transcriptomic and proteomic studies now provide new insights into how bacteria mount defenses against this important class of antimicrobial compounds. In this review, we summarize the current knowledge, emphasizing the overlaps between RCS stress responses and other more well-characterized bacterial defense systems, and identify outstanding questions that represent productive avenues for future research. PMID:23768204

Apparent synergy among defense mechanisms in subterranean termites (Rhinotermitidae) against epizootic events: limits and potential for biological control.

PubMed

Chouvenc, Thomas; Su, Nan-Yao

2010-08-01

The use of entomopathogens for biological control of subterranean termites (Rhinotermitidae) has attracted attention in the past four decades, and several laboratory studies have shown promising results with fungal agents. This approach was based on the concept of classical biological control with the use of a virulent agent that can self-replicate in a termite nest and be transmitted among individuals, resulting in an epizootic to kill the entire colony. However, the absence of positive results in field studies challenged the potential of fungal pathogens as a realistic approach for subterranean termite control, and the relationship between fungi and subterranean termites remains poorly understood. A multimodal approach of the currently identified defense mechanisms allowed us to show that subterranean termites have the ability to prevent an epizootic from occurring. The defense mechanisms involved in such resistance are reviewed and documented. Finally, the interactions among three major defense mechanisms (grooming, cellular encapsulation, and gut antifungal activity) were analyzed, and it is suggested that these mechanisms act synergistically to produce an efficient defense against the infection of the fungus at the individual and group level so as to protect the colony from epizootics.

Defense Mechanisms of Pregnant Mothers Predict Attachment Security, Social-Emotional Competence, and Behavior Problems in Their Toddlers.

PubMed

Porcerelli, John H; Huth-Bocks, Alissa; Huprich, Steven K; Richardson, Laura

2016-02-01

For at-risk (single parent, low income, low support) mothers, healthy adaptation and the ability to manage stress have clear implications for parenting and the social-emotional well-being of their young offspring. The purpose of this longitudinal study was to examine associations between defense mechanisms in pregnant women and their toddlers' attachment security, social-emotional, and behavioral adjustment. Participants were 84 pregnant women during their last trimester of pregnancy, recruited from community agencies primarily serving low-income families. Women were followed prospectively from pregnancy through 2 years after birth and completed several multimethod assessments during that period. Observations of mother-child interactions were also coded after the postnatal visits. Multiple regression analyses revealed that mothers' defense mechanisms were significantly associated with several toddler outcomes. Mature, healthy defenses were significantly associated with greater toddler attachment security and social-emotional competence and fewer behavior problems, and less mature defenses (disavowal in particular) were associated with lower levels of attachment security and social-emotional competence. Associations remained significant, or were only slightly attenuated, after controlling for demographic variables and partner abuse during pregnancy. The study findings suggest that defensive functioning in parents preparing for and parenting toddlers influences the parent-child attachment relationship and social-emotional adjustment in the earliest years of life. Possible mechanisms for these associations may include parental attunement and mentalization, as well as specific caregiving behavior toward the child. Defensive functioning during times of increased stress (such as the prenatal to postnatal period) may be especially important for understanding parental influences on the child.

Glutathione and fungal elicitor regulation of a plant defense gene promoter in electroporated protoplasts

PubMed Central

Dron, Michel; Clouse, Steven D.; Dixon, Richard A.; Lawton, Michael A.; Lamb, Christopher J.

1988-01-01

To investigate the mechanisms underlying activation of plant defenses against microbial attack we have studied elicitor regulation of a chimeric gene comprising the 5′ flanking region of a defense gene encoding the phytoalexin biosynthetic enzyme chalcone synthase fused to a bacterial chloramphenicol acetyltransferase gene. Glutathione or fungal elicitor caused a rapid, marked but transient expression of the chimeric gene electroporated into soybean protoplasts. The response closely resembled that of endogenous chalcone synthase genes in suspension cultured cells. Functional analysis of 5′ deletions suggests that promoter activity is determined by an elicitor-regulated activator located between the “TATA box” and nucleotide position -173 and an upstream silencer between -173 and -326. These cis-acting elements function in the transduction of the elicitation signal to initiate elaboration of an inducible defense response. Images PMID:16593981

Mechanisms of action of systemic antibiotics used in periodontal treatment and mechanisms of bacterial resistance to these drugs

PubMed Central

SOARES, Geisla Mary Silva; FIGUEIREDO, Luciene Cristina; FAVERI, Marcelo; CORTELLI, Sheila Cavalca; DUARTE, Poliana Mendes; FERES, Magda

2012-01-01

Antibiotics are important adjuncts in the treatment of infectious diseases, including periodontitis. The most severe criticisms to the indiscriminate use of these drugs are their side effects and, especially, the development of bacterial resistance. The knowledge of the biological mechanisms involved with the antibiotic usage would help the medical and dental communities to overcome these two problems. Therefore, the aim of this manuscript was to review the mechanisms of action of the antibiotics most commonly used in the periodontal treatment (i.e. penicillin, tetracycline, macrolide and metronidazole) and the main mechanisms of bacterial resistance to these drugs. Antimicrobial resistance can be classified into three groups: intrinsic, mutational and acquired. Penicillin, tetracycline and erythromycin are broad-spectrum drugs, effective against gram-positive and gram-negative microorganisms. Bacterial resistance to penicillin may occur due to diminished permeability of the bacterial cell to the antibiotic; alteration of the penicillin-binding proteins, or production of β-lactamases. However, a very small proportion of the subgingival microbiota is resistant to penicillins. Bacteria become resistant to tetracyclines or macrolides by limiting their access to the cell, by altering the ribosome in order to prevent effective binding of the drug, or by producing tetracycline/macrolide-inactivating enzymes. Periodontal pathogens may become resistant to these drugs. Finally, metronidazole can be considered a prodrug in the sense that it requires metabolic activation by strict anaerobe microorganisms. Acquired resistance to this drug has rarely been reported. Due to these low rates of resistance and to its high activity against the gram-negative anaerobic bacterial species, metronidazole is a promising drug for treating periodontal infections. PMID:22858695

Anti-Mechanized Defense: A Computerized Simulation for Squad Leader Training.

DTIC Science & Technology

1983-09-01

applicability of cybernetic principles is easily transformed to meet the needs of this research. Specifi- cally, the basic principle governing management...and as in other areas this is better meas- ured in actual field conditions. COMMAND AND CONTROL (S2A.2) Control of Organic Fi repower In general...AD-AI34 962 UNCLASSIFIED ANTI-MECHANIZED DEFENSE: A COMPUTERIZED SQUAD LEADER TRAINING(U) AIR FORCE INST WRIGHT-PATTERSON AFB OH SCHOOL OF SYST

Mechanism of uranium (VI) removal by two anaerobic bacterial communities.

PubMed

Martins, Mónica; Faleiro, Maria Leonor; da Costa, Ana M Rosa; Chaves, Sandra; Tenreiro, Rogério; Matos, António Pedro; Costa, Maria Clara

2010-12-15

The mechanism of uranium (VI) removal by two anaerobic bacterial consortia, recovered from an uncontaminated site (consortium A) and other from an uranium mine (consortium U), was investigated. The highest efficiency of U (VI) removal by both consortia (97%) occurred at room temperature and at pH 7.2. Furthermore, it was found that U (VI) removal by consortium A occurred by enzymatic reduction and bioaccumulation, while the enzymatic process was the only mechanism involved in metal removal by consortium U. FTIR analysis suggested that after U (VI) reduction, U (IV) could be bound to carboxyl, phosphate and amide groups of bacterial cells. Phylogenetic analysis of 16S rRNA showed that community A was mainly composed by bacteria closely related to Sporotalea genus and Rhodocyclaceae family, while community U was mainly composed by bacteria related to Clostridium genus and Rhodocyclaceae family. Copyright © 2010 Elsevier B.V. All rights reserved.

Identifying psychotic defenses in a clinical interview.

PubMed

Berney, Sylvie; de Roten, Yves; Beretta, Véronique; Kramer, Ueli; Despland, Jean-Nicolas

2014-05-01

The Defense Mechanisms Rating Scales (DMRS), one of the most widely used and validated instruments in the study of defense mechanisms, does not include psychotic defenses. The Psychotic-DMRS (P-DMRS) has been developed to include 6 psychotic defense mechanisms: psychotic denial, autistic withdrawal, distortion, delusional projection, fragmentation, and concretization. We discuss psychotic defenses, including the difference between psychotic defenses and psychotic symptoms. Six clinical illustrations demonstrate how the 6 P-DMRS defenses can be identified in patients' narratives selected from the transcripts of dynamic interviews. Implications with respect to patient evaluation and treatment are discussed. © 2014 Wiley Periodicals, Inc.

Defense Mechanisms in Adolescence as Predictors of Adult Personality Disorders.

PubMed

Strandholm, Thea; Kiviruusu, Olli; Karlsson, Linnea; Miettunen, Jouko; Marttunen, Mauri

2016-05-01

Our study examines whether defense styles and separate defenses in depressed adolescent outpatients predict adult personality disorders (PDs). We obtained data from consecutive adolescent outpatients who participated in the Adolescent Depression Study at baseline and at the 8-year follow-up (N = 140). Defense styles were divided into mature, neurotic, image-distorting, and immature and a secondary set of analyses were made with separate defenses as predictors of a PD diagnosis. Neurotic, image-distorting, and immature defense styles in adolescence were associated with adulthood PDs. Neurotic defense style associated with cluster B diagnosis and image-distorting defense style associated with cluster A diagnosis. Separate defenses of displacement, isolation, and reaction formation were independent predictors of adult PD diagnosis even after adjusting for PD diagnosis in adolescence. Defense styles and separate defenses predict later PDs and could be used in the focusing of treatment interventions for adolescents.

Research on offense and defense technology for iOS kernel security mechanism

NASA Astrophysics Data System (ADS)

Chu, Sijun; Wu, Hao

2018-04-01

iOS is a strong and widely used mobile device system. It's annual profits make up about 90% of the total profits of all mobile phone brands. Though it is famous for its security, there have been many attacks on the iOS operating system, such as the Trident apt attack in 2016. So it is important to research the iOS security mechanism and understand its weaknesses and put forward targeted protection and security check framework. By studying these attacks and previous jailbreak tools, we can see that an attacker could only run a ROP code and gain kernel read and write permissions based on the ROP after exploiting kernel and user layer vulnerabilities. However, the iOS operating system is still protected by the code signing mechanism, the sandbox mechanism, and the not-writable mechanism of the system's disk area. This is far from the steady, long-lasting control that attackers expect. Before iOS 9, breaking these security mechanisms was usually done by modifying the kernel's important data structures and security mechanism code logic. However, after iOS 9, the kernel integrity protection mechanism was added to the 64-bit operating system and none of the previous methods were adapted to the new versions of iOS [1]. But this does not mean that attackers can not break through. Therefore, based on the analysis of the vulnerability of KPP security mechanism, this paper implements two possible breakthrough methods for kernel security mechanism for iOS9 and iOS10. Meanwhile, we propose a defense method based on kernel integrity detection and sensitive API call detection to defense breakthrough method mentioned above. And we make experiments to prove that this method can prevent and detect attack attempts or invaders effectively and timely.

PGE2 suppresses intestinal T cell function in thermal injury: a cause of enhanced bacterial translocation.

PubMed

Choudhry, M A; Fazal, N; Namak, S Y; Haque, F; Ravindranath, T; Sayeed, M M

2001-09-01

Increased gut bacterial translocation in burn and trauma patients has been demonstrated in a number of previous studies, however, the mechanism for such an increased gut bacterial translocation in injured patients remains poorly understood. Utilizing a rat model of burn injury, in the present study we examined the role of intestinal immune defense by analyzing the T cell functions. We investigated if intestinal T cells dysfunction contributes to bacterial translocation after burn injury. Also our study determined if burn-mediated alterations in intestinal T cell functions are related to enhanced release of PGE2. Finally, we examined whether or not burn-related alterations in intestinal T cell function are due to inappropriate activation of signaling molecule P59fyn, which is required for T cell activation and proliferation. The results presented here showed an increase in gut bacterial accumulation in mesenteric lymph nodes after thermal injury. This was accompanied by a decrease in the intestinal T cell proliferative responses. Furthermore, the treatments of burn-injured animals with PGE2 synthesis blocker (indomethacin or NS398) prevented both the decrease in intestinal T cell proliferation and enhanced bacterial translocation. Finally, our data suggested that the inhibition of intestinal T cell proliferation could result via PGE2-mediated down-regulation of the T cell activation-signaling molecule P59fyn. These findings support a role of T cell-mediated immune defense against bacterial translocation in burn injury.

Kupffer cell complement receptor clearance function and host defense.

PubMed

Loegering, D J

1986-01-01

Kupffer cells are well known to be important for normal host defense function. The development of methods to evaluate the in vivo function of specific receptors on Kupffer cells has made it possible to assess the role of these receptors in host defense. The rationale for studying complement receptors is based on the proposed important role of these receptors in host defense and on the observation that the hereditary deficiency of a complement receptor is associated with recurrent severe bacterial infections. The studies reviewed here demonstrate that forms of injury that are associated with depressed host defense including thermal injury, hemorrhagic shock, trauma, and surgery also cause a decrease in complement receptor clearance function. This decrease in Kupffer cell receptor clearance function was shown not to be the result of depressed hepatic blood flow or depletion of complement components. Complement receptor function was also depressed following the phagocytosis of particulates that are known to depress Kupffer cell host defense function. Endotoxemia and bacteremia also were associated with a depression of complement receptor function. Complement receptor function was experimentally depressed in uninjured animals by the phagocytosis of IgG-coated erythrocytes. There was a close association between the depression of complement receptor clearance function and increased susceptibility to the lethal effects of endotoxin and bacterial infection. These studies support the hypotheses that complement receptors on Kupffer cells are important for normal host defense and that depression of the function of these receptors impairs host defense.

Pregnane X Receptor Regulates Pathogen-Induced Inflammation and Host Defense against an Intracellular Bacterial Infection through Toll-like Receptor 4.

PubMed

Qiu, Zhijuan; Cervantes, Jorge L; Cicek, Basak B; Mukherjee, Subhajit; Venkatesh, Madhukumar; Maher, Leigh A; Salazar, Juan C; Mani, Sridhar; Khanna, Kamal M

2016-08-23

The nuclear pregnane X receptor (PXR) plays a central role in regulating xenobiotic metabolism. We now report a novel role for PXR as a critical negative regulator of innate immunity after infection. Pxr(-/-) mice exhibited remarkably elevated pro-inflammatory cytokine and chemokine production following infection with Listeria monocytogenes (Lm). Despite the more robust innate immune response, Pxr(-/-) mice were highly susceptible to Lm infection. Surprisingly, disruption of the Toll-like receptor 4 (TLR4) but not TLR2 signaling restored the inflammation to normal levels and the ability to clear Lm in Pxr(-/-) mice. Mechanistically, the heightened inflammation in Pxr(-/-) mice resulted in the death of inflammatory monocytes that led to the enhanced susceptibility to Lm infection. These data demonstrated that PXR regulated pathogen-induced inflammation and host defense against Lm infection through modulating the TLR4 pathway. In summary, we discovered an apical role for PXR in regulating innate immunity. In addition, we uncovered a remarkable negative impact of the TLR4 pathway in controlling the quality of the inflammatory response and host defense against a gram-positive bacterial infection.

Reconstruction of the evolution of microbial defense systems.

PubMed

Puigbò, Pere; Makarova, Kira S; Kristensen, David M; Wolf, Yuri I; Koonin, Eugene V

2017-04-04

Evolution of bacterial and archaeal genomes is a highly dynamic process that involves intensive loss of genes as well as gene gain via horizontal transfer, with a lesser contribution from gene duplication. The rates of these processes can be estimated by comparing genomes that are linked by an evolutionary tree. These estimated rates of genome dynamics events substantially differ for different functional classes of genes. The genes involved in defense against viruses and other invading DNA are among those that are gained and lost at the highest rates. We employed a stochastic birth-and-death model to obtain maximum likelihood estimates of the rates of gain and loss of defense genes in 35 groups of closely related bacterial genomes and one group of archaeal genomes. We find that on average, the defense genes experience 1.4 fold higher flux than the rest of microbial genes. This excessive flux of defense genes over the genomic mean is consistent across diverse microbial groups. The few exceptions include intracellular parasites with small, degraded genomes that possess few defense systems which are more stable than in other microbes. Generally, defense genes follow the previously established pattern of genome dynamics, with gene family loss being about 3 times more common than gain and an order of magnitude more common than expansion or contraction of gene families. Case by case analysis of the evolutionary dynamics of defense genes indicates frequent multiple events in the same locus and widespread involvement of mobile elements in the gain and loss of defense genes. Evolution of microbial defense systems is highly dynamic but, notwithstanding the host-parasite arms race, generally follows the same trends that have been established for the rest of the genes. Apart from the paucity and the low flux of defense genes in parasitic bacteria with deteriorating genomes, there is no clear connection between the evolutionary regime of defense systems and microbial life style.

The defense mechanism of splitting: developmental origins, effects on staff, recommendations for nursing care.

PubMed

Carser, D

1979-03-01

Splitting as a predominant defense mechanism is used by a large number of people. It is characterized by projection of good and bad qualities onto people in the environment and malformed ego functioning. Nurses need to understand the developmental origins, formation of ego deficits and defense mechanism of splitting so that they can care for these people. Effective nursing care is dependent on leadership which anticipates splitting, maintains a cohesive staff group and intervenes appropriately. Limit setting provides the most effective treatment modality as it supplies the missing internal function of the deficient ego. With this use of limit setting staff will prevent splitting and foster socially acceptable behavior. This will have a dual effect of beginning ego reconstruction and increasing self-esteem for the patient and treatment success for the staff.

Interaction between Pseudomonas aeruginosa and host defenses in cystic fibrosis.

PubMed

Marshall, B C; Carroll, K C

1991-03-01

The major causes of morbidity and mortality in cystic fibrosis are chronic pulmonary obstruction and infection. Mucoid Pseudomonas aeruginosa is the primary pathogen in up to 90% of these patients. Once Pseudomonas organisms colonize the airways, they are virtually never eradicated. No defect in systemic host defense has been elucidated, however, several mechanisms contribute to the breakdown in host defenses that allow persistence of this organism in the endobronchial space. These mechanisms involve both bacterial adaptation to an unfavorable host environment and impaired host response. P aeruginosa adapts to the host by expressing excessive mucoid exopolysaccharide and a less virulent form of lipopolysaccharide. These features make it less likely to cause systemic infection, yet still enable it to resist local host defenses. Mucociliary clearance becomes impaired due to abnormal viscoelastic properties of sputum, squamous metaplasia of the respiratory epithelium, and bronchiectasis. Despite a brisk antibody response to a variety of Pseudomonas antigens, several defects in antibody-mediated opsonophagocytosis have been identified. These include (1) development of antibody isotypes that are suboptimal at promoting phagocytosis, (2) formation of immune complexes that inhibit phagocytosis, and (3) proteolytic fragmentation of immunoglobulins in the endobronchial space. Complement-mediated opsonophagocytosis is also compromised by proteolytic cleavage of complement receptors from the cell surface of neutrophils and complement opsonins from the surface of Pseudomonas. The resultant chronic inflammation and infection lead to eventual obliteration of the airways.

Viewing loved faces inhibits defense reactions: a health-promotion mechanism?

PubMed

Guerra, Pedro; Sánchez-Adam, Alicia; Anllo-Vento, Lourdes; Ramírez, Isabel; Vila, Jaime

2012-01-01

We have known for decades that social support is associated with positive health outcomes. And yet, the neurophysiological mechanisms underlying this association remain poorly understood. The link between social support and positive health outcomes is likely to depend on the neurophysiological regulatory mechanisms underlying reward and defensive reactions. The present study examines the hypothesis that emotional social support (love) provides safety cues that activate the appetitive reward system and simultaneously inhibit defense reactions. Using the startle probe paradigm, 54 undergraduate students (24 men) viewed black and white photographs of loved (romantic partner, father, mother, and best friend), neutral (unknown), and unpleasant (mutilated) faces. Eye-blink startle, zygomatic major activity, heart rate, and skin conductance responses to the faces, together with subjective ratings of valence, arousal, and dominance, were obtained. Viewing loved faces induced a marked inhibition of the eye-blink startle response accompanied by a pattern of zygomatic, heart rate, skin conductance, and subjective changes indicative of an intense positive emotional response. Effects were similar for men and women, but the startle inhibition and the zygomatic response were larger in female participants. A comparison between the faces of the romantic partner and the parent who shares the partner's gender further suggests that this effect is not attributable to familiarity or arousal. We conclude that this inhibitory capacity may contribute to the health benefits associated with social support.

Drug Resistance and Gene Transfer Mechanisms in Respiratory/Oral Bacteria.

PubMed

Jiang, S; Zeng, J; Zhou, X; Li, Y

2018-06-01

Growing evidence suggests the existence of new antibiotic resistance mechanisms. Recent studies have revealed that quorum-quenching enzymes, such as MacQ, are involved in both antibiotic resistance and cell-cell communication. Furthermore, some small bacterial regulatory RNAs, classified into RNA attenuators and small RNAs, modulate the expression of resistance genes. For example, small RNA sprX, can shape bacterial resistance to glycopeptide antibiotics via specific downregulation of protein SpoVG. Moreover, some bacterial lipocalins capture antibiotics in the extracellular space, contributing to severe multidrug resistance. But this defense mechanism may be influenced by Agr-regulated toxins and liposoluble vitamins. Outer membrane porin proteins and efflux pumps can influence intracellular concentrations of antibiotics. Alterations in target enzymes or antibiotics prevent binding to targets, which act to confer high levels of resistance in respiratory/oral bacteria. As described recently, horizontal gene transfer, including conjugation, transduction and transformation, is common in respiratory/oral microflora. Many conjugative transposons and plasmids discovered to date encode antibiotic resistance proteins and can be transferred from donor bacteria to transient recipient bacteria. New classes of mobile genetic elements are also being identified. For example, nucleic acids that circulate in the bloodstream (circulating nucleic acids) can integrate into the host cell genome by up-regulation of DNA damage and repair pathways. With multidrug resistant bacteria on the rise, new drugs have been developed to combate bacterial antibiotic resistance, such as innate defense regulators, reactive oxygen species and microbial volatile compounds. This review summaries various aspects and mechanisms of antibiotic resistance in the respiratory/oral microbiota. A better understanding of these mechanisms will facilitate minimization of the emergence of antibiotic resistance.

Effects of Sex, Social Desirability, and Birth Order on the Defense Mechanisms Inventory.

ERIC Educational Resources Information Center

Dudley, Gary E.

1978-01-01

Investigated effects of sex difference, social desirability instructions, and birth order of respondents on defense mechanisms inventory (DMI). Sex difference was found in projection only. Social desirability effects were found in turning-against-others, projection, principalization, and reversal. Thus, an interpretive caution is in order…

Autophagy as a macrophage response to bacterial infection.

PubMed

Gong, Lan; Devenish, Rodney J; Prescott, Mark

2012-09-01

The macrophage is a key component of host defense mechanisms against pathogens. In addition to the phagocytosis of bacteria and secretion of proinflammatory mediators by macrophages, autophagy, a process involved in turnover of cellular material, is a recently identified component of the immune response to bacterial infection. Despite the bactericidal effect of autophagy, some species of intracellular bacteria are able to survive by using one or more strategies to avoid host autophagic attack. Here, we review the latest findings on the interactions between bacteria and autophagy in macrophages. Copyright © 2012 International Union of Biochemistry and Molecular Biology, Inc.

Mechanics of torque generation in the bacterial flagellar motor

PubMed Central

Mandadapu, Kranthi K.; Nirody, Jasmine A.; Berry, Richard M.; Oster, George

2015-01-01

The bacterial flagellar motor (BFM) is responsible for driving bacterial locomotion and chemotaxis, fundamental processes in pathogenesis and biofilm formation. In the BFM, torque is generated at the interface between transmembrane proteins (stators) and a rotor. It is well established that the passage of ions down a transmembrane gradient through the stator complex provides the energy for torque generation. However, the physics involved in this energy conversion remain poorly understood. Here we propose a mechanically specific model for torque generation in the BFM. In particular, we identify roles for two fundamental forces involved in torque generation: electrostatic and steric. We propose that electrostatic forces serve to position the stator, whereas steric forces comprise the actual “power stroke.” Specifically, we propose that ion-induced conformational changes about a proline “hinge” residue in a stator α-helix are directly responsible for generating the power stroke. Our model predictions fit well with recent experiments on a single-stator motor. The proposed model provides a mechanical explanation for several fundamental properties of the flagellar motor, including torque–speed and speed–ion motive force relationships, backstepping, variation in step sizes, and the effects of key mutations in the stator. PMID:26216959

Mechanics of torque generation in the bacterial flagellar motor.

PubMed

Mandadapu, Kranthi K; Nirody, Jasmine A; Berry, Richard M; Oster, George

2015-08-11

The bacterial flagellar motor (BFM) is responsible for driving bacterial locomotion and chemotaxis, fundamental processes in pathogenesis and biofilm formation. In the BFM, torque is generated at the interface between transmembrane proteins (stators) and a rotor. It is well established that the passage of ions down a transmembrane gradient through the stator complex provides the energy for torque generation. However, the physics involved in this energy conversion remain poorly understood. Here we propose a mechanically specific model for torque generation in the BFM. In particular, we identify roles for two fundamental forces involved in torque generation: electrostatic and steric. We propose that electrostatic forces serve to position the stator, whereas steric forces comprise the actual "power stroke." Specifically, we propose that ion-induced conformational changes about a proline "hinge" residue in a stator α-helix are directly responsible for generating the power stroke. Our model predictions fit well with recent experiments on a single-stator motor. The proposed model provides a mechanical explanation for several fundamental properties of the flagellar motor, including torque-speed and speed-ion motive force relationships, backstepping, variation in step sizes, and the effects of key mutations in the stator.

Mechanisms of Bacterial Colonization of the Respiratory Tract

PubMed Central

Siegel, Steven J.; Weiser, Jeffrey N.

2016-01-01

Respiratory tract infections are an important cause of morbidity and mortality worldwide. Chief among these are infections involving the lower airways. The opportunistic bacterial pathogens responsible for most cases of pneumonia can cause a range of local and invasive infections. However, bacterial colonization (or carriage) in the upper airway is the prerequisite of all these infections. Successful colonizers must attach to the epithelial lining, grow on the nutrient-limited mucosal surface, evade the host immune response, and transmit to a susceptible host. Here, we review the molecular mechanisms underlying these conserved stages of carriage. We also examine how the demands of colonization influence progression to disease. A range of bacteria can colonize the upper airway; nevertheless, we focus on strategies shared by many respiratory tract opportunistic pathogens. Understanding colonization opens a window to the evolutionary pressures these pathogens face within their animal hosts and that have selected for attributes that contribute to virulence and pathogenesis. PMID:26488280

Hepcidin as a Major Component of Renal Antibacterial Defenses against Uropathogenic Escherichia coli

PubMed Central

Houamel, Dounia; Ducrot, Nicolas; Lefebvre, Thibaud; Daher, Raed; Moulouel, Boualem; Sari, Marie-Agnes; Letteron, Philippe; Lyoumi, Said; Millot, Sarah; Tourret, Jerome; Bouvet, Odile; Vaulont, Sophie; Vandewalle, Alain; Denamur, Erick; Puy, Hervé; Beaumont, Carole; Gouya, Laurent

2016-01-01

The iron-regulatory peptide hepcidin exhibits antimicrobial activity. Having previously shown hepcidin expression in the kidney, we addressed its role in urinary tract infection (UTI), which remains largely unknown. Experimental UTI was induced in wild-type (WT) and hepcidin-knockout (Hepc−/−) mice using the uropathogenic Escherichia coli CFT073 strain. Compared with infected WT mice, infected Hepc−/− mice showed a dramatic increase in renal bacterial load. Moreover, bacterial invasion was significantly dampened by the pretreatment of WT mice with hepcidin. Infected Hepc−/− mice exhibited decreased iron accumulation in the renal medulla and significant attenuation of the renal inflammatory response. Notably, we demonstrated in vitro bacteriostatic activity of hepcidin against CFT073. Furthermore, CFT073 repressed renal hepcidin, both in vivo and in cultured renal cells, and reduced phosphorylation of SMAD kinase in vivo, suggesting a bacterial strategy to escape the antimicrobial activities of hepcidin. In conclusion, we provide new mechanisms by which hepcidin contributes to renal host defense and suggest that targeting hepcidin offers a strategy to prevent bacterial invasion. PMID:26293821

A Diverse Family of Host-Defense Peptides (Piscidins) Exhibit Specialized Anti-Bacterial and Anti-Protozoal Activities in Fishes.

PubMed

Salger, Scott A; Cassady, Katherine R; Reading, Benjamin J; Noga, Edward J

2016-01-01

Conventional antibiotics and other chemical-based drugs are currently one of the most common methods used to control disease-related mortality in animal agriculture. Use of the innate immune system to decrease disease related mortalities is a novel alternative to conventional drugs. One component of the innate immune system is the host-defense peptides, also known as antimicrobial peptides. Host-defense peptides are typically small, amphipathic, α-helical peptides with a broad-spectrum of action against viral, bacterial, fungal, and/or protozoal pathogens. Piscidins are host-defense peptides first discovered in the hybrid striped bass (white bass, Morone chrysops, x striped bass, M. saxatilis). In this paper we identify four new piscidin isoforms in the hybrid striped bass and describe their tissue distributions. We also determine the progenitor species of origin of each piscidin (orthology) and propose a revised nomenclature for this newly described piscidin family based on a three class system. The Class I piscidins (22 amino acids in length; striped bass and white bass piscidin 1 and piscidin 3) show broad-spectrum activity against bacteria and ciliated protozoans, while the Class III piscidins (55 amino acids in length; striped bass and white bass piscidin 6 and striped bass piscidin 7) primarily show anti-protozoal activity. The Class II piscidins (44-46 amino acids in length; striped bass and white bass piscidin 4 and white bass piscidin 5) have a level of activity against bacteria and protozoans intermediate to Classes I and III. Knowledge of piscidin function and activity may help in the future development of disease-resistant lines of striped bass and white bass that could be used to produce superior hybrids for aquaculture.

Hijacking Complement Regulatory Proteins for Bacterial Immune Evasion.

PubMed

Hovingh, Elise S; van den Broek, Bryan; Jongerius, Ilse

2016-01-01

The human complement system plays an important role in the defense against invading pathogens, inflammation and homeostasis. Invading microbes, such as bacteria, directly activate the complement system resulting in the formation of chemoattractants and in effective labeling of the bacteria for phagocytosis. In addition, formation of the membrane attack complex is responsible for direct killing of Gram-negative bacteria. In turn, bacteria have evolved several ways to evade complement activation on their surface in order to be able to colonize and invade the human host. One important mechanism of bacterial escape is attraction of complement regulatory proteins to the microbial surface. These molecules are present in the human body for tight regulation of the complement system to prevent damage to host self-surfaces. Therefore, recruitment of complement regulatory proteins to the bacterial surface results in decreased complement activation on the microbial surface which favors bacterial survival. This review will discuss recent advances in understanding the binding of complement regulatory proteins to the bacterial surface at the molecular level. This includes, new insights that have become available concerning specific conserved motives on complement regulatory proteins that are favorable for microbial binding. Finally, complement evasion molecules are of high importance for vaccine development due to their dominant role in bacterial survival, high immunogenicity and homology as well as their presence on the bacterial surface. Here, the use of complement evasion molecules for vaccine development will be discussed.

Hijacking Complement Regulatory Proteins for Bacterial Immune Evasion

PubMed Central

Hovingh, Elise S.; van den Broek, Bryan; Jongerius, Ilse

2016-01-01

The human complement system plays an important role in the defense against invading pathogens, inflammation and homeostasis. Invading microbes, such as bacteria, directly activate the complement system resulting in the formation of chemoattractants and in effective labeling of the bacteria for phagocytosis. In addition, formation of the membrane attack complex is responsible for direct killing of Gram-negative bacteria. In turn, bacteria have evolved several ways to evade complement activation on their surface in order to be able to colonize and invade the human host. One important mechanism of bacterial escape is attraction of complement regulatory proteins to the microbial surface. These molecules are present in the human body for tight regulation of the complement system to prevent damage to host self-surfaces. Therefore, recruitment of complement regulatory proteins to the bacterial surface results in decreased complement activation on the microbial surface which favors bacterial survival. This review will discuss recent advances in understanding the binding of complement regulatory proteins to the bacterial surface at the molecular level. This includes, new insights that have become available concerning specific conserved motives on complement regulatory proteins that are favorable for microbial binding. Finally, complement evasion molecules are of high importance for vaccine development due to their dominant role in bacterial survival, high immunogenicity and homology as well as their presence on the bacterial surface. Here, the use of complement evasion molecules for vaccine development will be discussed. PMID:28066340

Viral myocarditis: potential defense mechanisms within the cardiomyocyte against virus infection.

PubMed

Yajima, Toshitaka

2011-05-01

Virus infection can inflict significant damage on cardiomyocytes through direct injury and secondary immune reactions, leading to myocarditis and dilated cardiomyopathy. While viral myocarditis or cardiomyopathy is a complication of systemic infection of cardiotropic viruses, most individuals infected with the viruses do not develop significant cardiac disease. However, some individuals proceed to develop severe virus-mediated heart disease. Recent studies have shown that viral infection of cardiomyocytes is required for the development of myocarditis and subsequent cardiomyopathy. This suggests that viral infection of cardiomyocytes can be an important step that determines the pathogenesis of viral myocarditis during systemic infection. Accordingly, this article focuses on potential defense mechanisms within the cardiomyocyte against virus infection. Understanding of the cardiomyocyte defense against invading viruses may give us novel insights into the pathophysiology of viral myocarditis, and enable us to develop innovative strategies of diagnosis and treatment for this challenging clinical entity.

A Systems Biology Approach to the Coordination of Defensive and Offensive Molecular Mechanisms in the Innate and Adaptive Host–Pathogen Interaction Networks

PubMed Central

Wu, Chia-Chou; Chen, Bor-Sen

2016-01-01

Infected zebrafish coordinates defensive and offensive molecular mechanisms in response to Candida albicans infections, and invasive C. albicans coordinates corresponding molecular mechanisms to interact with the host. However, knowledge of the ensuing infection-activated signaling networks in both host and pathogen and their interspecific crosstalk during the innate and adaptive phases of the infection processes remains incomplete. In the present study, dynamic network modeling, protein interaction databases, and dual transcriptome data from zebrafish and C. albicans during infection were used to infer infection-activated host–pathogen dynamic interaction networks. The consideration of host–pathogen dynamic interaction systems as innate and adaptive loops and subsequent comparisons of inferred innate and adaptive networks indicated previously unrecognized crosstalk between known pathways and suggested roles of immunological memory in the coordination of host defensive and offensive molecular mechanisms to achieve specific and powerful defense against pathogens. Moreover, pathogens enhance intraspecific crosstalk and abrogate host apoptosis to accommodate enhanced host defense mechanisms during the adaptive phase. Accordingly, links between physiological phenomena and changes in the coordination of defensive and offensive molecular mechanisms highlight the importance of host–pathogen molecular interaction networks, and consequent inferences of the host–pathogen relationship could be translated into biomedical applications. PMID:26881892

A Systems Biology Approach to the Coordination of Defensive and Offensive Molecular Mechanisms in the Innate and Adaptive Host-Pathogen Interaction Networks.

PubMed

Wu, Chia-Chou; Chen, Bor-Sen

2016-01-01

Infected zebrafish coordinates defensive and offensive molecular mechanisms in response to Candida albicans infections, and invasive C. albicans coordinates corresponding molecular mechanisms to interact with the host. However, knowledge of the ensuing infection-activated signaling networks in both host and pathogen and their interspecific crosstalk during the innate and adaptive phases of the infection processes remains incomplete. In the present study, dynamic network modeling, protein interaction databases, and dual transcriptome data from zebrafish and C. albicans during infection were used to infer infection-activated host-pathogen dynamic interaction networks. The consideration of host-pathogen dynamic interaction systems as innate and adaptive loops and subsequent comparisons of inferred innate and adaptive networks indicated previously unrecognized crosstalk between known pathways and suggested roles of immunological memory in the coordination of host defensive and offensive molecular mechanisms to achieve specific and powerful defense against pathogens. Moreover, pathogens enhance intraspecific crosstalk and abrogate host apoptosis to accommodate enhanced host defense mechanisms during the adaptive phase. Accordingly, links between physiological phenomena and changes in the coordination of defensive and offensive molecular mechanisms highlight the importance of host-pathogen molecular interaction networks, and consequent inferences of the host-pathogen relationship could be translated into biomedical applications.

Phosphoproteomics in bacteria: towards a systemic understanding of bacterial phosphorylation networks.

PubMed

Jers, Carsten; Soufi, Boumediene; Grangeasse, Christophe; Deutscher, Josef; Mijakovic, Ivan

2008-08-01

Bacteria use protein phosphorylation to regulate all kinds of physiological processes. Protein phosphorylation plays a role in several key steps of the infection process of bacterial pathogens, such as adhesion to the host, triggering and regulation of pathogenic functions as well as biochemical warfare; scrambling the host signaling cascades and impairing its defense mechanisms. Recent phosphoproteomic studies indicate that the bacterial protein phosphorylation networks could be more complex than initially expected, comprising promiscuous kinases that regulate several distinct cellular functions by phosphorylating different protein substrates. Recent advances in protein labeling with stable isotopes in the field of quantitative mass spectrometry phosphoproteomics will enable us to chart the global phosphorylation networks and to understand the implication of protein phosphorylation in cellular regulation on the systems scale. For the study of bacterial pathogens, in particular, this research avenue will enable us to dissect phosphorylation-related events during different stages of infection and stimulate our efforts to find inhibitors for key kinases and phosphatases implicated therein.

Molecular mechanisms of CRISPR-mediated microbial immunity.

PubMed

Gasiunas, Giedrius; Sinkunas, Tomas; Siksnys, Virginijus

2014-02-01

Bacteriophages (phages) infect bacteria in order to replicate and burst out of the host, killing the cell, when reproduction is completed. Thus, from a bacterial perspective, phages pose a persistent lethal threat to bacterial populations. Not surprisingly, bacteria evolved multiple defense barriers to interfere with nearly every step of phage life cycles. Phages respond to this selection pressure by counter-evolving their genomes to evade bacterial resistance. The antagonistic interaction between bacteria and rapidly diversifying viruses promotes the evolution and dissemination of bacteriophage-resistance mechanisms in bacteria. Recently, an adaptive microbial immune system, named clustered regularly interspaced short palindromic repeats (CRISPR) and which provides acquired immunity against viruses and plasmids, has been identified. Unlike the restriction–modification anti-phage barrier that subjects to cleavage any foreign DNA lacking a protective methyl-tag in the target site, the CRISPR–Cas systems are invader-specific, adaptive, and heritable. In this review, we focus on the molecular mechanisms of interference/immunity provided by different CRISPR–Cas systems.

Increased Bacterial Load and Expression of Antimicrobial Peptides in Skin of Barrier-Deficient Mice with Reduced Cancer Susceptibility.

PubMed

Natsuga, Ken; Cipolat, Sara; Watt, Fiona M

2016-01-01

Mice lacking three epidermal barrier proteins-envoplakin, periplakin, and involucrin (EPI-/- mice)-have a defective cornified layer, reduced epidermal γδ T cells, and increased dermal CD4(+) T cells. They are also resistant to developing skin tumors. The tumor-protective mechanism involves signaling between Rae-1 expressing keratinocytes and the natural killer group 2D receptor on immune cells, which also plays a role in host defenses against infection. Given the emerging link between bacteria and cancer, we investigated whether EPI-/- mice have an altered skin microbiota. The bacterial phyla were similar in wild-type and EPI-/- skin. However, bacteria were threefold more abundant in EPI-/- skin and penetrated deeper into the epidermis. The major epithelial defense mechanism against bacteria is production of antimicrobial proteins (AMPs). EPI-/- skin exhibited enhanced expression of antimicrobial peptides. However, reducing the bacterial load by antibiotic treatment or breeding mice under specific pathogen-free conditions did not reduce AMP expression or alleviate the abnormalities in T-cell populations. We conclude that the atopic characteristics of EPI-/- skin are a consequence of the defective barrier rather than a response to the increased bacterial load. It is therefore unlikely that the increase in skin microbiota contributes directly to the observed cancer resistance. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Lipocalin 2 Imparts Selective Pressure on Bacterial Growth in the Bladder and Is Elevated in Women with Urinary Tract Infection

PubMed Central

Steigedal, Magnus; Marstad, Anne; Haug, Markus; Damås, Jan K.; Strong, Roland K.; Roberts, Pacita L.; Himpsl, Stephanie D.; Stapleton, Ann; Hooton, Thomas M.; Mobley, Harry L. T.; Hawn, Thomas R.

2014-01-01

Competition for iron is a critical component of successful bacterial infections, but the underlying in vivo mechanisms are poorly understood. We have previously demonstrated that lipocalin 2 (LCN2) is an innate immunity protein that binds to bacterial siderophores and starves them for iron, thus representing a novel host defense mechanism to infection. In the present study we show that LCN2 is secreted by the urinary tract mucosa and protects against urinary tract infection (UTI). We found that LCN2 was expressed in the bladder, ureters, and kidneys of mice subject to UTI. LCN2 was protective with higher bacterial numbers retrieved from bladders of Lcn2-deficient mice than from wild-type mice infected with the LCN2-sensitive Escherichia coli strain H9049. Uropathogenic E. coli mutants in siderophore receptors for salmochelin, aerobactin, or yersiniabactin displayed reduced fitness in wild-type mice, but not in mice deficient of LCN2, demonstrating that LCN2 imparts a selective pressure on bacterial growth in the bladder. In a human cohort of women with recurrent E. coli UTIs, urine LCN2 levels were associated with UTI episodes and with levels of bacteriuria. The number of siderophore systems was associated with increasing bacteriuria during cystitis. Our data demonstrate that LCN2 is secreted by the urinary tract mucosa in response to uropathogenic E. coli challenge and acts in innate immune defenses as a colonization barrier that pathogens must overcome to establish infection. PMID:25398327

Ethylene and 1-Aminocyclopropane-1-carboxylate (ACC) in Plant–Bacterial Interactions

PubMed Central

Nascimento, Francisco X.; Rossi, Márcio J.; Glick, Bernard R.

2018-01-01

Ethylene and its precursor 1-aminocyclopropane-1-carboxylate (ACC) actively participate in plant developmental, defense and symbiotic programs. In this sense, ethylene and ACC play a central role in the regulation of bacterial colonization (rhizospheric, endophytic, and phyllospheric) by the modulation of plant immune responses and symbiotic programs, as well as by modulating several developmental processes, such as root elongation. Plant-associated bacterial communities impact plant growth and development, both negatively (pathogens) and positively (plant-growth promoting and symbiotic bacteria). Some members of the plant-associated bacterial community possess the ability to modulate plant ACC and ethylene levels and, subsequently, modify plant defense responses, symbiotic programs and overall plant development. In this work, we review and discuss the role of ethylene and ACC in several aspects of plant-bacterial interactions. Understanding the impact of ethylene and ACC in both the plant host and its associated bacterial community is key to the development of new strategies aimed at increased plant growth and protection. PMID:29520283

Worm-stars and half-worms: Novel dangers and novel defense.

PubMed

Hodgkin, Jonathan; Clark, Laura C; Gravato-Nobre, Maria J

2014-01-01

In a recent paper, we reported the isolation and surprising effects of two new bacterial pathogens for Caenorhabditis and related nematodes. These two pathogens belong to the genus Leucobacter and were discovered co-infecting a wild isolate of Caenorhabditis that had been collected in Cape Verde. The interactions of these bacteria with C. elegans revealed both unusual mechanisms of pathogenic attack, and an unexpected defense mechanism on the part of the worm. One pathogen, known as Verde1, is able to trap swimming nematodes by sticking their tails together, resulting in the formation of "worm-star" aggregates, within which worms are killed and degraded. Trapped larval worms, but not adults, can sometimes escape by undergoing whole-body autotomy into half-worms. The other pathogen, Verde2, kills worms by a different mechanism associated with rectal infection. Many C. elegans mutants with alterations in surface glycosylation are resistant to Verde2 infection, but hypersensitive to Verde1, being rapidly killed without worm-star formation. Conversely, surface infection of wild-type worms with Verde1 is mildly protective against Verde2. Thus, there are trade-offs in susceptibility to the two bacteria. The Leucobacter pathogens reveal novel nematode biology and provide powerful tools for exploring nematode surface properties and bacterial susceptibility.

Listeria phospholipases subvert host autophagic defenses by stalling pre-autophagosomal structures

PubMed Central

Tattoli, Ivan; Sorbara, Matthew T; Yang, Chloe; Tooze, Sharon A; Philpott, Dana J; Girardin, Stephen E

2013-01-01

Listeria can escape host autophagy defense pathways through mechanisms that remain poorly understood. We show here that in epithelial cells, Listeriolysin (LLO)-dependent cytosolic escape of Listeria triggered a transient amino-acid starvation host response characterized by GCN2 phosphorylation, ATF3 induction and mTOR inhibition, the latter favouring a pro-autophagic cellular environment. Surprisingly, rapid recovery of mTOR signalling was neither sufficient nor necessary for Listeria avoidance of autophagic targeting. Instead, we observed that Listeria phospholipases PlcA and PlcB reduced autophagic flux and phosphatidylinositol 3-phosphate (PI3P) levels, causing pre-autophagosomal structure stalling and preventing efficient targeting of cytosolic bacteria. In co-infection experiments, wild-type Listeria protected PlcA/B-deficient bacteria from autophagy-mediated clearance. Thus, our results uncover a critical role for Listeria phospholipases C in the inhibition of autophagic flux, favouring bacterial escape from host autophagic defense. PMID:24162724

The antigen 43 structure reveals a molecular Velcro-like mechanism of autotransporter-mediated bacterial clumping

PubMed Central

Heras, Begoña; Totsika, Makrina; Peters, Kate M.; Paxman, Jason J.; Gee, Christine L.; Jarrott, Russell J.; Perugini, Matthew A.; Whitten, Andrew E.; Schembri, Mark A.

2014-01-01

Aggregation and biofilm formation are critical mechanisms for bacterial resistance to host immune factors and antibiotics. Autotransporter (AT) proteins, which represent the largest group of outer-membrane and secreted proteins in Gram-negative bacteria, contribute significantly to these phenotypes. Despite their abundance and role in bacterial pathogenesis, most AT proteins have not been structurally characterized, and there is a paucity of detailed information with regard to their mode of action. Here we report the structure–function relationships of Antigen 43 (Ag43a), a prototypic self-associating AT protein from uropathogenic Escherichia coli. The functional domain of Ag43a displays a twisted L-shaped β-helical structure firmly stabilized by a 3D hydrogen-bonded scaffold. Notably, the distinctive Ag43a L shape facilitates self-association and cell aggregation. Combining all our data, we define a molecular “Velcro-like” mechanism of AT-mediated bacterial clumping, which can be tailored to fit different bacterial lifestyles such as the formation of biofilms. PMID:24335802

Ellagitannin HeT obtained from strawberry leaves is oxidized by bacterial membranes and inhibits the respiratory chain.

PubMed

Martos, Gustavo G; Mamani, Alicia; Filippone, María P; Abate, Pedro O; Katz, Néstor E; Castagnaro, Atilio P; Díaz Ricci, Juan C

2018-02-01

Plant secondary metabolism produces a variety of tannins that have a wide range of biological activities, including activation of plant defenses and antimicrobial, anti-inflammatory and antitumoral effects. The ellagitannin HeT (1- O -galloyl-2,3;4,6-bis-hexahydroxydiphenoyl-β-d-glucopyranose) from strawberry leaves elicits a strong plant defense response, and exhibits antimicrobial activity associated to the inhibition of the oxygen consumption, but its mechanism of action is unknown. In this paper we investigate the influence of HeT on bacterial cell membrane integrity and its effect on respiration. A β-galactosidase unmasking experiment showed that HeT does not disrupt membrane integrity. Raman spectroscopy analysis revealed that HeT strongly interacts with the cell membrane. Spectrochemical analysis indicated that HeT is oxidized in contact with bacterial cell membranes, and functional studies showed that HeT inhibits oxygen consumption, NADH and MTT reduction. These results provide evidence that HeT inhibits the respiratory chain.

Hemojuvelin regulates the innate immune response to peritoneal bacterial infection in mice.

PubMed

Wu, Qian; Shen, Yuanyuan; Tao, Yunlong; Wei, Jiayu; Wang, Hao; An, Peng; Zhang, Zhuzhen; Gao, Hong; Zhou, Tianhua; Wang, Fudi; Min, Junxia

2017-01-01

Hereditary hemochromatosis and iron imbalance are associated with susceptibility to bacterial infection; however, the underlying mechanisms are poorly understood. Here, we performed in vivo bacterial infection screening using several mouse models of hemochromatosis, including Hfe ( Hfe -/- ), hemojuvelin ( Hjv -/- ), and macrophage-specific ferroportin-1 ( Fpn1 fl/fl ; LysM-Cre + ) knockout mice. We found that Hjv -/- mice, but not Hfe -/- or Fpn1 fl/fl ; LysM-Cre + mice, are highly susceptible to peritoneal infection by both Gram-negative and Gram-positive bacteria. Interestingly, phagocytic cells in the peritoneum of Hjv -/- mice have reduced bacterial clearance, IFN-γ secretion, and nitric oxide production; in contrast, both cell migration and phagocytosis are normal. Expressing Hjv in RAW264.7 cells increased the level of phosphorylated Stat1 and nitric oxide production. Moreover, macrophage-specific Hjv knockout mice are susceptible to bacterial infection. Finally, we found that Hjv facilitates the secretion of IFN-γ via the IL-12/Jak2/Stat4 signaling pathway. Together, these findings reveal a novel protective role of Hjv in the early stages of antimicrobial defense.

Secured network sensor-based defense system

NASA Astrophysics Data System (ADS)

Wei, Sixiao; Shen, Dan; Ge, Linqiang; Yu, Wei; Blasch, Erik P.; Pham, Khanh D.; Chen, Genshe

2015-05-01

Network sensor-based defense (NSD) systems have been widely used to defend against cyber threats. Nonetheless, if the adversary finds ways to identify the location of monitor sensors, the effectiveness of NSD systems can be reduced. In this paper, we propose both temporal and spatial perturbation based defense mechanisms to secure NSD systems and make the monitor sensor invisible to the adversary. The temporal-perturbation based defense manipulates the timing information of published data so that the probability of successfully recognizing monitor sensors can be reduced. The spatial-perturbation based defense dynamically redeploys monitor sensors in the network so that the adversary cannot obtain the complete information to recognize all of the monitor sensors. We carried out experiments using real-world traffic traces to evaluate the effectiveness of our proposed defense mechanisms. Our data shows that our proposed defense mechanisms can reduce the attack accuracy of recognizing detection sensors.

Error in intensive care: psychological repercussions and defense mechanisms among health professionals.

PubMed

Laurent, Alexandra; Aubert, Laurence; Chahraoui, Khadija; Bioy, Antoine; Mariage, André; Quenot, Jean-Pierre; Capellier, Gilles

2014-11-01

To identify the psychological repercussions of an error on professionals in intensive care and to understand their evolution. To identify the psychological defense mechanisms used by professionals to cope with error. Qualitative study with clinical interviews. We transcribed recordings and analysed the data using an interpretative phenomenological analysis. Two ICUs in the teaching hospitals of Besançon and Dijon (France). Fourteen professionals in intensive care (20 physicians and 20 nurses). None. We conducted 40 individual semistructured interviews. The participants were invited to speak about the experience of error in ICU. The interviews were transcribed and analyzed thematically by three experts. In the month following the error, the professionals described feelings of guilt (53.8%) and shame (42.5%). These feelings were associated with anxiety states with rumination (37.5%) and fear for the patient (23%); a loss of confidence (32.5%); an inability to verbalize one's error (22.5%); questioning oneself at a professional level (20%); and anger toward the team (15%). In the long term, the error remains fixed in memory for many of the subjects (80%); on one hand, for 72.5%, it was associated with an increase in vigilance and verifications in their professional practice, and on the other hand, for three professionals, it was associated with a loss of confidence. Finally, three professionals felt guilt which still persisted at the time of the interview. We also observed different defense mechanisms implemented by the professional to fight against the emotional load inherent in the error: verbalization (70%), developing skills and knowledge (43%), rejecting responsibility (32.5%), and avoidance (23%). We also observed a minimization (60%) of the error during the interviews. It is important to take into account the psychological experience of error and the defense mechanisms developed following an error because they appear to determine the professional's capacity to

Study of the measurement of defense style using Bond's Defense Style Questionnaire.

PubMed

Nishimura, R

1998-08-01

Two hundred and seventy healthy university students were surveyed in December 1995 using Bond's Defense Style Questionnaire (DSQ) to measure the subjects' defense mechanisms. At the same time, a survey using Byrne's R-S Scale (Repression-Sensitization Scale) of the MMPI (Minnesota multiphasic personality inventory) and five psychiatric symptom indexes (anxiety, sense of inadequacy, sensitivity, depression and impulsive anger) selected from the CMI (Cornell Medical Index-Health Questionnaire) was conducted. Three factors were extracted from the DSQ through factor analysis: immature defenses, neurotic defenses, and mature defenses. The results of analysis of variance revealed the following: (i) for anxiety and anxiety related symptoms, both immature defenses and neurotic defenses indicated principal effect; (ii) for impulsive anger and depression, immature defenses presented principal effect; and (iii) for sensitivity and impulsive anger, interaction between a mature defense style and neurotic defense style was noted. The relationship between defense styles and psychiatric symptoms in healthy people is studied in this paper.

Antimicrobial Resistance and Virulence: a Successful or Deleterious Association in the Bacterial World?

PubMed Central

Beceiro, Alejandro; Tomás, María

2013-01-01

SUMMARY Hosts and bacteria have coevolved over millions of years, during which pathogenic bacteria have modified their virulence mechanisms to adapt to host defense systems. Although the spread of pathogens has been hindered by the discovery and widespread use of antimicrobial agents, antimicrobial resistance has increased globally. The emergence of resistant bacteria has accelerated in recent years, mainly as a result of increased selective pressure. However, although antimicrobial resistance and bacterial virulence have developed on different timescales, they share some common characteristics. This review considers how bacterial virulence and fitness are affected by antibiotic resistance and also how the relationship between virulence and resistance is affected by different genetic mechanisms (e.g., coselection and compensatory mutations) and by the most prevalent global responses. The interplay between these factors and the associated biological costs depend on four main factors: the bacterial species involved, virulence and resistance mechanisms, the ecological niche, and the host. The development of new strategies involving new antimicrobials or nonantimicrobial compounds and of novel diagnostic methods that focus on high-risk clones and rapid tests to detect virulence markers may help to resolve the increasing problem of the association between virulence and resistance, which is becoming more beneficial for pathogenic bacteria. PMID:23554414

Mechanisms to Mitigate the Trade-Off between Growth and Defense.

PubMed

Karasov, Talia L; Chae, Eunyoung; Herman, Jacob J; Bergelson, Joy

2017-04-01

Plants have evolved an array of defenses against pathogens. However, mounting a defense response frequently comes with the cost of a reduction in growth and reproduction, carrying critical implications for natural and agricultural populations. This review focuses on how costs are generated and whether and how they can be mitigated. Most well-characterized growth-defense trade-offs stem from antagonistic crosstalk among hormones rather than an identified metabolic expenditure. A primary way plants mitigate such costs is through restricted expression of resistance; this can be achieved through inducible expression of defense genes or by the concentration of defense to particular times or tissues. Defense pathways can be primed for more effective induction, and primed states can be transmitted to offspring. We examine the resistance ( R ) genes as a case study of how the toll of defense can be generated and ameliorated. The fine-scale regulation of R genes is critical to alleviate the burden of their expression, and the genomic organization of R genes into coregulatory modules reduces costs. Plants can also recruit protection from other species. Exciting new evidence indicates that a plant's genotype influences the microbiome composition, lending credence to the hypothesis that plants shape their microbiome to enhance defense. © 2017 American Society of Plant Biologists. All rights reserved.

Mechanisms to Mitigate the Trade-Off between Growth and Defense

PubMed Central

2017-01-01

Plants have evolved an array of defenses against pathogens. However, mounting a defense response frequently comes with the cost of a reduction in growth and reproduction, carrying critical implications for natural and agricultural populations. This review focuses on how costs are generated and whether and how they can be mitigated. Most well-characterized growth-defense trade-offs stem from antagonistic crosstalk among hormones rather than an identified metabolic expenditure. A primary way plants mitigate such costs is through restricted expression of resistance; this can be achieved through inducible expression of defense genes or by the concentration of defense to particular times or tissues. Defense pathways can be primed for more effective induction, and primed states can be transmitted to offspring. We examine the resistance (R) genes as a case study of how the toll of defense can be generated and ameliorated. The fine-scale regulation of R genes is critical to alleviate the burden of their expression, and the genomic organization of R genes into coregulatory modules reduces costs. Plants can also recruit protection from other species. Exciting new evidence indicates that a plant’s genotype influences the microbiome composition, lending credence to the hypothesis that plants shape their microbiome to enhance defense. PMID:28320784

Influenza-induced type I interferon enhances susceptibility to gram-negative and gram-positive bacterial pneumonia in mice.

PubMed

Lee, Benjamin; Robinson, Keven M; McHugh, Kevin J; Scheller, Erich V; Mandalapu, Sivanarayana; Chen, Chen; Di, Y Peter; Clay, Michelle E; Enelow, Richard I; Dubin, Patricia J; Alcorn, John F

2015-07-15

Suppression of type 17 immunity by type I interferon (IFN) during influenza A infection has been shown to enhance susceptibility to secondary bacterial pneumonia. Although this mechanism has been described in coinfection with gram-positive bacteria, it is unclear whether similar mechanisms may impair lung defense against gram-negative infections. Furthermore, precise delineation of the duration of type I IFN-associated susceptibility to bacterial infection remains underexplored. Therefore, we investigated the effects of preceding influenza A virus infection on subsequent challenge with the gram-negative bacteria Escherichia coli or Pseudomonas aeruginosa and the temporal association between IFN expression with susceptibility to Staphylococcus aureus challenge in a mouse model of influenza and bacterial coinfection. Here we demonstrate that preceding influenza A virus led to increased lung E. coli and P. aeruginosa bacterial burden, which was associated with suppression of type 17 immunity and attenuation of antimicrobial peptide expression. Enhanced susceptibility to S. aureus coinfection ceased at day 14 of influenza infection, when influenza-associated type I IFN levels had returned to baseline levels, further suggesting a key role for type I IFN in coinfection pathogenesis. These findings further implicate type I IFN-associated suppression of type 17 immunity and antimicrobial peptide production as a conserved mechanism for enhanced susceptibility to both gram-positive and gram-negative bacterial coinfection during influenza infection. Copyright © 2015 the American Physiological Society.

Brief Report: The Defense Mechanisms of Homophobic Adolescent Males--A Descriptive Discriminant Analysis

ERIC Educational Resources Information Center

Lewis, Andrew J.; White, Jennifer

2009-01-01

The study examined the role of defense mechanisms in homophobic attitudes of older male adolescents aged 17-18 years. A cross-sectional survey collected data from final year high school students (N = 86) attending an all male school in a regional centre in Victoria, Australia. The school was identified by teachers as having a problematic culture…

Cyclic mechanical loading promotes bacterial penetration along composite restoration marginal gaps

PubMed Central

Khvostenko, D.; Salehi, S.; Naleway, S. E.; Hilton, T. J.; Ferracane, J. L.; Mitchell, J. C.; Kruzic, J. J.

2015-01-01

Objectives Secondary caries is the most common reason for composite restoration replacement and usually forms between dentin and the filling. The objective of this study was to investigate the combined effect of cyclic loading and bacterial exposure on bacterial penetration into gaps at the interface between dentin and resin composite restorative material using a novel bioreactor system and test specimen design. Methods Human molars were machined into 3 mm thick disks with 2 mm deep × 5 mm diameter cavity preparations into which composite restorations were placed. A ∼15-30 micrometer (small) or ∼300 micrometer wide (large) dentin-restoration gap was introduced along half of the interface between the dentin and restoration. Streptococcus mutans UA 159 biofilms were grown on each sample prior to testing in a bioreactor both with and without cyclic loading. Both groups of samples were tested for 2 weeks and post-test biofilm viability was confirmed with a live-dead assay. Samples were fixed, mounted and cross-sectioned to reveal the gaps and observe the depth of bacterial penetration. Results It was shown that for large gap samples the bacteria easily penetrated to the full depth of the gap independent of loading or non-loading conditions. The results for all cyclically loaded small gap samples show a consistently deep bacterial penetration down 100% of the gap while the average penetration depth was only 67% for the non-loaded samples with only two of six samples reaching 100%. Significance A new bioreactor was developed that allows combining cyclic mechanical loading and bacterial exposure of restored teeth for bacterial biofilm and demineralization studies. Cyclic loading was shown to aid bacterial penetration into narrow marginal gaps, which could ultimately promote secondary caries formation. PMID:25900624

Immature defense mechanisms are associated with lesser vaginal orgasm consistency and greater alcohol consumption before sex.

PubMed

Costa, Rui Miguel; Brody, Stuart

2010-02-01

Disturbances of emotional and physical awareness can impair female sexual function. Previous research revealed that immature psychological defense mechanisms (impairing emotional awareness) are associated specifically with impaired vaginal orgasm (orgasm triggered solely by penile-vaginal stimulation). Alcohol consumed before sex (ACBS) might impair vaginal orgasm or lead to avoiding the opportunity for it, but research examining immature defenses, ACBS, and specific sexual behaviors has been lacking. To test the hypothesis that greater use of immature defenses and greater ACBS are inversely associated with vaginal orgasm consistency, but unrelated or positively correlated with greater frequency of other sexual behaviors. Three hundred twenty-three coitally experienced women (predominantly Scottish) responded to an online survey reporting their frequency of various sexual activities (and corresponding orgasms) and their ACBS, and completed the Defense Style Questionnaire DSQ-40. Univariate and multivariate correlations of immature defenses, ACBS, and various sexual behaviors. Both immature defenses and ACBS were associated with less vaginal orgasm consistency, but unrelated or positively correlated with frequency of other sexual behaviors (including clitoral masturbation during penile-vaginal intercourse). Immature defenses were associated with more ACBS. Immature defenses explained the association between ACBS and both lack of vaginal orgasm and greater frequency of other sexual behaviors. The results provide further evidence that difficulty in having a vaginal orgasm is associated with immature defenses (and associated disturbances of sensibility), among other indicators of poorer health and relatedness. ACBS might impair vaginal orgasm or increase the likelihood of choosing other sexual activities, but this effect might be somewhat contingent on immature defenses. Based on various empirical studies, we call for examination of the possibility that lack of vaginal

Mechanism of foreign DNA selection in a bacterial adaptive immune system

PubMed Central

Sashital, Dipali G.; Wiedenheft, Blake; Doudna, Jennifer A.

2012-01-01

Summary In bacterial and archaeal CRISPR immune pathways, DNA sequences from invading bacteriophage or plasmids are integrated into CRISPR loci within the host genome, conferring immunity against subsequent infections. The ribonucleoprotein complex Cascade utilizes RNAs generated from these loci to target complementary “non-self” DNA sequences for destruction, while avoiding binding to “self” sequences within the CRISPR locus. Here we show that CasA, the largest protein subunit of Cascade, is required for non-self target recognition and binding. Combining a 2.3 Å crystal structure of CasA with cryo-EM structures of Cascade, we have identified a loop that is required for viral defense. This loop contacts a conserved 3-base pair motif that is required for non-self target selection. Our data suggest a model in which the CasA loop scans DNA for this short motif prior to target destabilization and binding, maximizing the efficiency of DNA surveillance by Cascade. PMID:22521690

Family Defense Mechanisms: The Concept and Its Utility to Family Scientists, Practitioners, and Educators.

ERIC Educational Resources Information Center

Schwebel, Andrew I.

1993-01-01

Notes that interpersonal conflict among family members and between spouses can cause dissatisfaction and threaten feasibility of marriage. Defines Family Defense Mechanisms (FDMs) as fixed patterns of behaviors that, when followed by spouses and other family members, enable them to better manage their interpersonal differences and conflict.…

Suppression in lung defense responses after bacterial infection in rats pretreated with different welding fumes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Antonini, James M.; Taylor, Michael D.; Millecchia, Lyndell

2004-11-01

Epidemiology suggests that inhalation of welding fumes increases the susceptibility to lung infection. The effects of chemically distinct welding fumes on lung defense responses after bacterial infection were compared. Fume was collected during gas metal arc (GMA) or flux-covered manual metal arc (MMA) welding using two consumable electrodes: stainless steel (SS) or mild steel (MS). The fumes were separated into water-soluble and -insoluble fractions. The GMA-SS and GMA-MS fumes were found to be relatively insoluble, whereas the MMA-SS was highly water soluble, with the soluble fraction comprised of 87% Cr and 11% Mn. On day 0, male Sprague-Dawley rats weremore » intratracheally instilled with saline (vehicle control) or the different welding fumes (0.1 or 2 mg/rat). At day 3, the rats were intratracheally inoculated with 5 x 10{sup 3} Listeria monocytogenes. On days 6, 8, and 10, left lungs were removed, homogenized, cultured overnight, and colony-forming units were counted to assess pulmonary bacterial clearance. Bronchoalveolar lavage (BAL) was performed on right lungs to recover phagocytes and BAL fluid to measure the production of nitric oxide (NO) and immunomodulatory cytokines, including tumor necrosis factor-{alpha} (TNF-{alpha}), interleukin (IL)-2, IL-6, and IL-10. In contrast to the GMA-SS, GMA-MS, and saline groups, pretreatment with the highly water soluble MMA-SS fume caused significant body weight loss, extensive lung damage, and a dramatic reduction in pulmonary clearance of L. monocytogenes after infection. NO concentrations in BAL fluid and lung immunostaining of inducible NO synthase were dramatically increased in rats pretreated with MMA-SS before and after infection. MMA-SS treatment caused a significant decrease in IL-2 and significant increases in TNF-{alpha}, IL-6, and IL-10 after infection. In conclusion, pretreatment with MMA-SS increased production of NO and proinflammatory cytokines (TNF-{alpha} and IL-6) after infection, which are

Suppression in lung defense responses after bacterial infection in rats pretreated with different welding fumes.

PubMed

Antonini, James M; Taylor, Michael D; Millecchia, Lyndell; Bebout, Alicia R; Roberts, Jenny R

2004-11-01

Epidemiology suggests that inhalation of welding fumes increases the susceptibility to lung infection. The effects of chemically distinct welding fumes on lung defense responses after bacterial infection were compared. Fume was collected during gas metal arc (GMA) or flux-covered manual metal arc (MMA) welding using two consumable electrodes: stainless steel (SS) or mild steel (MS). The fumes were separated into water-soluble and -insoluble fractions. The GMA-SS and GMA-MS fumes were found to be relatively insoluble, whereas the MMA-SS was highly water soluble, with the soluble fraction comprised of 87% Cr and 11% Mn. On day 0, male Sprague-Dawley rats were intratracheally instilled with saline (vehicle control) or the different welding fumes (0.1 or 2 mg/rat). At day 3, the rats were intratracheally inoculated with 5 x 10(3) Listeria monocytogenes. On days 6, 8, and 10, left lungs were removed, homogenized, cultured overnight, and colony-forming units were counted to assess pulmonary bacterial clearance. Bronchoalveolar lavage (BAL) was performed on right lungs to recover phagocytes and BAL fluid to measure the production of nitric oxide (NO) and immunomodulatory cytokines, including tumor necrosis factor-alpha (TNF-alpha), interleukin (IL)-2, IL-6, and IL-10. In contrast to the GMA-SS, GMA-MS, and saline groups, pretreatment with the highly water soluble MMA-SS fume caused significant body weight loss, extensive lung damage, and a dramatic reduction in pulmonary clearance of L. monocytogenes after infection. NO concentrations in BAL fluid and lung immunostaining of inducible NO synthase were dramatically increased in rats pretreated with MMA-SS before and after infection. MMA-SS treatment caused a significant decrease in IL-2 and significant increases in TNF-alpha, IL-6, and IL-10 after infection. In conclusion, pretreatment with MMA-SS increased production of NO and proinflammatory cytokines (TNF-alpha and IL-6) after infection, which are likely responsible for

Cationic antimicrobial peptide resistance mechanisms of streptococcal pathogens.

PubMed

LaRock, Christopher N; Nizet, Victor

2015-11-01

Cationic antimicrobial peptides (CAMPs) are critical front line contributors to host defense against invasive bacterial infection. These immune factors have direct killing activity toward microbes, but many pathogens are able to resist their effects. Group A Streptococcus, group B Streptococcus and Streptococcus pneumoniae are among the most common pathogens of humans and display a variety of phenotypic adaptations to resist CAMPs. Common themes of CAMP resistance mechanisms among the pathogenic streptococci are repulsion, sequestration, export, and destruction. Each pathogen has a different array of CAMP-resistant mechanisms, with invasive disease potential reflecting the utilization of several mechanisms that may act in synergy. Here we discuss recent progress in identifying the sources of CAMP resistance in the medically important Streptococcus genus. Further study of these mechanisms can contribute to our understanding of streptococcal pathogenesis, and may provide new therapeutic targets for therapy and disease prevention. This article is part of a Special Issue entitled: Bacterial Resistance to Antimicrobial Peptides. Copyright © 2015 Elsevier B.V. All rights reserved.

The pepper GNA-related lectin and PAN domain protein gene, CaGLP1, is required for plant cell death and defense signaling during bacterial infection.

PubMed

Kim, Nak Hyun; Lee, Dong Hyuk; Choi, Du Seok; Hwang, Byung Kook

2015-12-01

Carbohydrate-binding proteins, commonly referred to as lectins or agglutinins, function in defense responses to microbial pathogens. Pepper (Capsicum annuum) GNA-related lectin and PAN-domain protein gene CaGLP1 was isolated and functionally characterized from pepper leaves infected with Xanthomonas campestris pv. vesicatoria (Xcv). CaGLP1 contained an amine-terminus prokaryotic membrane lipoprotein lipid attachment site, a Galanthus nivalis agglutinin (GNA)-related lectin domain responsible for the recognition of high-mannose N-glycans, and a carboxyl-terminus PAN/apple domain. RNA gel blot and immunoblot analyses determined that CaGLP1 was strongly induced in pepper by compatible and incompatible Xcv infection. CaGLP1 protein localized primarily to the plasma membrane and exhibited mannose-binding specificity. CaGLP1-silenced pepper plants were more susceptible to compatible or incompatible Xcv infection compared with that of non-silenced control plants. CaGLP1 silencing in pepper leaves did not accumulate H2O2 and induce cell death during incompatible Xcv infection. Defense-related CaDEF1 (defensin) gene expression was significantly reduced in CaGLP1-silenced pepper plants. CaGLP1-overexpression in Arabidopsis thaliana enhanced resistance to Pseudomonas syringae pv. tomato. Defense-related AtPDF1.2 expression was elevated in CaGLP1-overexpression lines. Together, these results suggest that CaGLP1 is required for plant cell death and defense responses through the reactive oxygen species burst and downstream defense-related gene expression in response to bacterial pathogen challenge. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Antibody blocks acquisition of bacterial colonization through agglutination

PubMed Central

Roche, A. M.; Richard, A. L.; Rahkola, J. T.; Janoff, E. N.; Weiser, J. N.

2014-01-01

Invasive infection often begins with asymptomatic colonization of mucosal surfaces. A murine model of bacterial colonization with Streptococcus pneumoniae was used to study the mechanism for mucosal protection by immunoglobulin. In previously colonized immune mice, bacteria were rapidly sequestered within large aggregates in the nasal lumen. To further examine the role of bacterial agglutination in protection by specific antibodies, mice were passively immunized with IgG purified from anti-pneumococcal sera or pneumococcal type-specific monoclonal human IgA (hIgA1 or hIgA2). Systemically-delivered IgG accessed the mucosal surface and blocked acquisition of colonization and transmission between littermates. Optimal protection by IgG was independent of Fc fragment and complement and, therefore, did not involve an opsonophagocytic mechanism. Enzymatic digestion or reduction of IgG prior to administration showed that protection required divalent binding that maintained its agglutinating effect. Divalent hIgA1 is cleaved by the pneumococcal member of a family of bacterial proteases that generate monovalent Fabα fragments. Thus, passive immunization with hIgA1 blocked colonization by an IgA1-protease deficient mutant (agglutinated), but not the protease-producing wild-type parent (not agglutinated), whereas protease-resistant hIgA2 agglutinated and blocked colonization by both. Our findings highlight the importance of agglutinating antibodies in mucosal defense and reveal how successful pathogens evade this effect. PMID:24962092

Mechanical defenses of plant extrafloral nectaries against herbivory

PubMed Central

Gish, Moshe; Mescher, Mark C.; De Moraes, Consuelo M.

2016-01-01

ABSTRACT Extrafloral nectaries play an important role in plant defense against herbivores by providing nectar rewards that attract ants and other carnivorous insects. However, extrafloral nectaries can themselves be targets of herbivory, in addition to being exploited by nectar-robbing insects that do not provide defensive services. We recently found that the extrafloral nectaries of Vicia faba plants, as well as immediately adjacent tissues, exhibit high concentrations of chemical toxins, apparently as a defense against herbivory. Here we report that the nectary tissues of this plant also exhibit high levels of structural stiffness compared to surrounding tissues, likely due to cell wall lignification and the concentration of calcium oxalate crystals in nectary tissues, which may provide an additional deterrent to herbivore feeding on nectary tissues. PMID:27489584

Effects of jasmonic acid, ethylene, and salicylic acid signaling on the rhizosphere bacterial community of Arabidopsis thaliana.

PubMed

Doornbos, Rogier F; Geraats, Bart P J; Kuramae, Eiko E; Van Loon, L C; Bakker, Peter A H M

2011-04-01

Systemically induced resistance is a promising strategy to control plant diseases, as it affects numerous pathogens. However, since induced resistance reduces one or both growth and activity of plant pathogens, the indigenous microflora may also be affected by an enhanced defensive state of the plant. The aim of this study was to elucidate how much the bacterial rhizosphere microflora of Arabidopsis is affected by induced systemic resistance (ISR) or systemic acquired resistance (SAR). Therefore, the bacterial microflora of wild-type plants and plants affected in their defense signaling was compared. Additionally, ISR was induced by application of methyl jasmonate and SAR by treatment with salicylic acid or benzothiadiazole. As a comparative model, we also used wild type and ethylene-insensitive tobacco. Some of the Arabidopsis genotypes affected in defense signaling showed altered numbers of culturable bacteria in their rhizospheres; however, effects were dependent on soil type. Effects of plant genotype on rhizosphere bacterial community structure could not be related to plant defense because chemical activation of ISR or SAR had no significant effects on density and structure of the rhizosphere bacterial community. These findings support the notion that control of plant diseases by elicitation of systemic resistance will not significantly affect the resident soil bacterial microflora.

Lipocalin 2 imparts selective pressure on bacterial growth in the bladder and is elevated in women with urinary tract infection.

PubMed

Steigedal, Magnus; Marstad, Anne; Haug, Markus; Damås, Jan K; Strong, Roland K; Roberts, Pacita L; Himpsl, Stephanie D; Stapleton, Ann; Hooton, Thomas M; Mobley, Harry L T; Hawn, Thomas R; Flo, Trude H

2014-12-15

Competition for iron is a critical component of successful bacterial infections, but the underlying in vivo mechanisms are poorly understood. We have previously demonstrated that lipocalin 2 (LCN2) is an innate immunity protein that binds to bacterial siderophores and starves them for iron, thus representing a novel host defense mechanism to infection. In the present study we show that LCN2 is secreted by the urinary tract mucosa and protects against urinary tract infection (UTI). We found that LCN2 was expressed in the bladder, ureters, and kidneys of mice subject to UTI. LCN2 was protective with higher bacterial numbers retrieved from bladders of Lcn2-deficient mice than from wild-type mice infected with the LCN2-sensitive Escherichia coli strain H9049. Uropathogenic E. coli mutants in siderophore receptors for salmochelin, aerobactin, or yersiniabactin displayed reduced fitness in wild-type mice, but not in mice deficient of LCN2, demonstrating that LCN2 imparts a selective pressure on bacterial growth in the bladder. In a human cohort of women with recurrent E. coli UTIs, urine LCN2 levels were associated with UTI episodes and with levels of bacteriuria. The number of siderophore systems was associated with increasing bacteriuria during cystitis. Our data demonstrate that LCN2 is secreted by the urinary tract mucosa in response to uropathogenic E. coli challenge and acts in innate immune defenses as a colonization barrier that pathogens must overcome to establish infection. Copyright © 2014 by The American Association of Immunologists, Inc.

A conserved mitochondrial surveillance pathway is required for defense against Pseudomonas aeruginosa.

PubMed

Tjahjono, Elissa; Kirienko, Natalia V

2017-06-01

All living organisms exist in a precarious state of homeostasis that requires constant maintenance. A wide variety of stresses, including hypoxia, heat, and infection by pathogens perpetually threaten to imbalance this state. Organisms use a battery of defenses to mitigate damage and restore normal function. Previously, we described a Caenorhabditis elegans-Pseudomonas aeruginosa assay (Liquid Killing) in which toxicity to the host is dependent upon the secreted bacterial siderophore pyoverdine. Although pyoverdine is also indispensable for virulence in mammals, its cytological effects are unclear. We used genetics, transcriptomics, and a variety of pathogen and chemical exposure assays to study the interactions between P. aeruginosa and C. elegans. Although P. aeruginosa can kill C. elegans through at least 5 different mechanisms, the defense responses activated by Liquid Killing are specific and selective and have little in common with innate defense mechanisms against intestinal colonization. Intriguingly, the defense response utilizes the phylogenetically-conserved ESRE (Ethanol and Stress Response Element) network, which we and others have previously shown to mitigate damage from a variety of abiotic stresses. This is the first report of this networks involvement in innate immunity, and indicates that host innate immune responses overlap with responses to abiotic stresses. The upregulation of the ESRE network in C. elegans is mediated in part by a family of bZIP proteins (including ZIP-2, ZIP-4, CEBP-1, and CEBP-2) that have overlapping and unique functions. Our data convincingly show that, following exposure to P. aeruginosa, the ESRE defense network is activated by mitochondrial damage, and that mitochondrial damage also leads to ESRE activation in mammals. This establishes a role for ESRE in a phylogenetically-conserved mitochondrial surveillance system important for stress response and innate immunity.

Defense styles of pedophilic offenders.

PubMed

Drapeau, Martin; Beretta, Véronique; de Roten, Yves; Koerner, Annett; Despland, Jean-Nicolas

2008-04-01

This pilot study investigated the defense styles of pedophile sexual offenders. Interviews with 20 pedophiles and 20 controls were scored using the Defense Mechanisms Rating Scales. Results showed that pedophiles had a significantly lower overall defensive functioning score than the controls. Pedophiles used significantly fewer obsessional-level defenses but more major image-distorting and action-level defenses. Results also suggested differences in the prevalence of individual defenses where pedophiles used more dissociation, displacement, denial, autistic fantasy, splitting of object, projective identification, acting out, and passive aggressive behavior but less intellectualization and rationalization.

Mechanical forces regulate the reactivity of a thioester bond in a bacterial adhesin

PubMed Central

Echelman, Daniel J.; Lee, Alex Q.; Fernández, Julio M.

2017-01-01

Bacteria must withstand large mechanical shear forces when adhering to and colonizing hosts. Recent structural studies on a class of Gram-positive bacterial adhesins have revealed an intramolecular Cys-Gln thioester bond that can react with surface-associated ligands to covalently anchor to host surfaces. Two other examples of such internal thioester bonds occur in certain anti-proteases and in the immune complement system, both of which react with the ligand only after the thioester bond is exposed by a proteolytic cleavage. We hypothesized that mechanical forces in bacterial adhesion could regulate thioester reactivity to ligand analogously to such proteolytic gating. Studying the pilus tip adhesin Spy0125 of Streptococcus pyogenes, we developed a single molecule assay to unambiguously resolve the state of the thioester bond. We found that when Spy0125 was in a folded state, its thioester bond could be cleaved with the small-molecule nucleophiles methylamine and histamine, but when Spy0125 was mechanically unfolded and subjected to forces of 50–350 piconewtons, thioester cleavage was no longer observed. For folded Spy0125 without mechanical force exposure, thioester cleavage was in equilibrium with spontaneous thioester reformation, which occurred with a half-life of several minutes. Functionally, this equilibrium reactivity allows thioester-containing adhesins to sample potential substrates without irreversible cleavage and inactivation. We propose that such reversible thioester reactivity would circumvent potential soluble inhibitors, such as histamine released at sites of inflammation, and allow the bacterial adhesin to selectively associate with surface-bound ligands. PMID:28348083

Defense styles in Intermittent Explosive Disorder.

PubMed

Puhalla, Alexander A; McCloskey, Michael S; Brickman, Lauren J; Fauber, Robert; Coccaro, Emil F

2016-04-30

The overreliance on immature and/or neurotic defense mechanisms, as opposed to more mature defensive functioning has been linked to several psychiatric disorders. However, to date, the role of defense styles among individuals with Intermittent Explosive Disorder (IED) has not been examined. Given that individuals with IED display difficulties controlling their anger and aggression, one might expect these individuals to exhibit more immature and less mature defense styles. The current study compared participants with IED to a personality disorder (PD) comparison group, as well as to healthy volunteers (HV) on the Defense Style Questionnaire, a self-report measure that assesses the extent to which individuals endorse using mature, immature, and neurotic defense styles. Subjects with IED had significantly higher scores than both comparison groups on immature defense styles and exhibited lower scores on mature defense mechanisms. Hierarchical regression of significant defense style subscales showed that higher levels of acting out and lower levels of sublimation uniquely discriminated participants with IED from the PD and HV comparison groups. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Brief Report: Self-Harm Is Associated with Immature Defense Mechanisms but Not Substance Use in a Nonclinical Scottish Adolescent Sample

ERIC Educational Resources Information Center

Brody, Stuart; Carson, Carron Maryjane

2012-01-01

It has been unclear whether adolescent deliberate self-harm (DSH) is more associated with substance use or with characterological impairments. Multivariate determination of (N = 114 Scottish adolescents) ever engaging in DSH (Youth Risk Behavior Survey) from alcohol use, other substance use, and immature defense mechanism use (Defense Style…

Ultraviolet Radiations: Skin Defense-Damage Mechanism.

PubMed

Mohania, Dheeraj; Chandel, Shikha; Kumar, Parveen; Verma, Vivek; Digvijay, Kumar; Tripathi, Deepika; Choudhury, Khushboo; Mitten, Sandeep Kumar; Shah, Dilip

2017-01-01

UV-radiations are the invisible part of light spectra having a wavelength between visible rays and X-rays. Based on wavelength, UV rays are subdivided into UV-A (320-400 nm), UV-B (280-320 nm) and UV-C (200-280 nm). Ultraviolet rays can have both harmful and beneficial effects. UV-C has the property of ionization thus acting as a strong mutagen, which can cause immune-mediated disease and cancer in adverse cases. Numbers of genetic factors have been identified in human involved in inducing skin cancer from UV-radiations. Certain heredity diseases have been found susceptible to UV-induced skin cancer. UV radiations activate the cutaneous immune system, which led to an inflammatory response by different mechanisms. The first line of defense mechanism against UV radiation is melanin (an epidermal pigment), and UV absorbing pigment of skin, which dissipate UV radiation as heat. Cell surface death receptor (e.g. Fas) of keratinocytes responds to UV-induced injury and elicits apoptosis to avoid malignant transformation. In addition to the formation of photo-dimers in the genome, UV also can induce mutation by generating ROS and nucleotides are highly susceptible to these free radical injuries. Melanocortin 1 receptor (MC1R) has been known to be implicated in different UV-induced damages such as pigmentation, adaptive tanning, and skin cancer. UV-B induces the formation of pre-vitamin D3 in the epidermal layer of skin. UV-induced tans act as a photoprotection by providing a sun protection factor (SPF) of 3-4 and epidermal hyperplasia. There is a need to prevent the harmful effects and harness the useful effects of UV radiations.

Systemic bacterial infection and immune defense phenotypes in Drosophila melanogaster.

PubMed

Khalil, Sarah; Jacobson, Eliana; Chambers, Moria C; Lazzaro, Brian P

2015-05-13

The fruit fly Drosophila melanogaster is one of the premier model organisms for studying the function and evolution of immune defense. Many aspects of innate immunity are conserved between insects and mammals, and since Drosophila can readily be genetically and experimentally manipulated, they are powerful for studying immune system function and the physiological consequences of disease. The procedure demonstrated here allows infection of flies by introduction of bacteria directly into the body cavity, bypassing epithelial barriers and more passive forms of defense and allowing focus on systemic infection. The procedure includes protocols for the measuring rates of host mortality, systemic pathogen load, and degree of induction of the host immune system. This infection procedure is inexpensive, robust and quantitatively repeatable, and can be used in studies of functional genetics, evolutionary life history, and physiology.

An innate defense peptide BPIFA1/SPLUNC1 restricts influenza A virus infection.

PubMed

Akram, K M; Moyo, N A; Leeming, G H; Bingle, L; Jasim, S; Hussain, S; Schorlemmer, A; Kipar, A; Digard, P; Tripp, R A; Shohet, R V; Bingle, C D; Stewart, J P

2018-01-01

The airway epithelium secretes proteins that function in innate defense against infection. Bactericidal/permeability-increasing fold-containing family member A1 (BPIFA1) is secreted into airways and has a protective role during bacterial infections, but it is not known whether it also has an antiviral role. To determine a role in host defense against influenza A virus (IAV) infection and to find the underlying defense mechanism, we developed transgenic mouse models that are deficient in BPIFA1 and used these, in combination with in vitro three-dimensional mouse tracheal epithelial cell (mTEC) cultures, to investigate its antiviral properties. We show that BPIFA1 has a significant role in mucosal defense against IAV infection. BPIFA1 secretion was highly modulated after IAV infection. Mice deficient in BPIFA1 lost more weight after infection, supported a higher viral load and virus reached the peripheral lung earlier, indicative of a defect in the control of infection. Further analysis using mTEC cultures showed that BPIFA1-deficient cells bound more virus particles, displayed increased nuclear import of IAV ribonucleoprotein complexes, and supported higher levels of viral replication. Our results identify a critical role of BPIFA1 in the initial phase of infection by inhibiting the binding and entry of IAV into airway epithelial cells.

Elicitors and defense gene induction in plants with altered lignin compositions.

PubMed

Gallego-Giraldo, Lina; Posé, Sara; Pattathil, Sivakumar; Peralta, Angelo Gabriel; Hahn, Michael G; Ayre, Brian G; Sunuwar, Janak; Hernandez, Jonathan; Patel, Monika; Shah, Jyoti; Rao, Xiaolan; Knox, J Paul; Dixon, Richard A

2018-06-27

A reduction in the lignin content in transgenic plants induces the ectopic expression of defense genes, but the importance of altered lignin composition in such phenomena remains unclear. Two Arabidopsis lines with similar lignin contents, but strikingly different lignin compositions, exhibited different quantitative and qualitative transcriptional responses. Plants with lignin composed primarily of guaiacyl units overexpressed genes responsive to oomycete and bacterial pathogen attack, whereas plants with lignin composed primarily of syringyl units expressed a far greater number of defense genes, including some associated with cis-jasmone-mediated responses to aphids; these plants exhibited altered responsiveness to bacterial and aphid inoculation. Several of the defense genes were differentially induced by water-soluble extracts from cell walls of plants of the two lines. Glycome profiling, fractionation and enzymatic digestion studies indicated that the different lignin compositions led to differential extractability of a range of heterogeneous oligosaccharide epitopes, with elicitor activity originating from different cell wall polymers. Alteration of lignin composition affects interactions with plant cell wall matrix polysaccharides to alter the sequestration of multiple latent defense signal molecules with an impact on biotic stress responses. © 2018 The Authors. New Phytologist © 2018 New Phytologist Trust.

Troubles with self-consciousness. Jervis on introspection and defense mechanisms.

PubMed

Marraffa, Massimo

2012-01-01

Building on Sigmund Freud, Ernesto de Martino and cognitive sciences, Giovanni Jervis has outlined a view of introspective consciousness as primarily an activity of narrative re-appropriation of the outputs of the unconscious cognitive processing, emphasizing that such an activity is ruled by the primary need to construct an identity that is valid as much as possible. Thus Jervis has originally pursued an integration between the anti-introspectionist tradition in cognitive sciences and the psychodynamic investigation on defense mechanisms. This paper outlines Jervis' attempt to integrate these two traditions, and shows that it fits very well with recent developments of the theory-theory approach to self-knowledge.

May We Strengthen the Human Natural Defenses with Bacterial Lysates?

PubMed Central

2010-01-01

During the last twenty years bacterial lysates have gained a new interest and their use has obtained a progressively larger consensus in the medical practice. They are commonly used as immunomodulators, in order to up-regulate immune responses against infectious damages. As a matter of fact, the role of these lysate seems relevant in upper and lower respiratory tract infections prevention, frequently observed both in paediatric and elder ages, and which represent a relevant problem also in terms of socio-economical implications. The effects of bacterial lysates as immunostimulatory agents have become the central point of many studies. The aim of those in vivo and in vitro studies was to understand and evaluate the capacity of this kind of treatments to create a better answer of the immune system against microbial infections, eventually leading to a reduction in their number. All the in vivo and in vitro findings analyzed support the evidence that bacterial lysates are powerful inducers of a specific immune response against bacterial infections. Both in paediatric and adult clinical trials, a positive trend has been found in terms of overall reduction of infection rates and duration, beneficial effect on symptoms, reduction in antibiotics use and possibility to improve the patient's quality of life in several diseases. Further well-designed trials in terms of blinding and randomization procedures and including a higher number of patients, selected according to the disease and its severity, are needed. PMID:23282746

Membrane rafts: a potential gateway for bacterial entry into host cells.

PubMed

Hartlova, Anetta; Cerveny, Lukas; Hubalek, Martin; Krocova, Zuzana; Stulik, Jiri

2010-04-01

Pathogenic bacteria have developed various mechanisms to evade host immune defense systems. Invasion of pathogenic bacteria requires interaction of the pathogen with host receptors, followed by activation of signal transduction pathways and rearrangement of the cytoskeleton to facilitate bacterial entry. Numerous bacteria exploit specialized plasma membrane microdomains, commonly called membrane rafts, which are rich in cholesterol, sphingolipids and a special set of signaling molecules which allow entry to host cells and establishment of a protected niche within the host. This review focuses on the current understanding of the raft hypothesis and the means by which pathogenic bacteria subvert membrane microdomains to promote infection.

Heavy Metal Stress and Some Mechanisms of Plant Defense Response

PubMed Central

Emamverdian, Abolghassem; Ding, Yulong; Mokhberdoran, Farzad; Xie, Yinfeng

2015-01-01

Unprecedented bioaccumulation and biomagnification of heavy metals (HMs) in the environment have become a dilemma for all living organisms including plants. HMs at toxic levels have the capability to interact with several vital cellular biomolecules such as nuclear proteins and DNA, leading to excessive augmentation of reactive oxygen species (ROS). This would inflict serious morphological, metabolic, and physiological anomalies in plants ranging from chlorosis of shoot to lipid peroxidation and protein degradation. In response, plants are equipped with a repertoire of mechanisms to counteract heavy metal (HM) toxicity. The key elements of these are chelating metals by forming phytochelatins (PCs) or metallothioneins (MTs) metal complex at the intra- and intercellular level, which is followed by the removal of HM ions from sensitive sites or vacuolar sequestration of ligand-metal complex. Nonenzymatically synthesized compounds such as proline (Pro) are able to strengthen metal-detoxification capacity of intracellular antioxidant enzymes. Another important additive component of plant defense system is symbiotic association with arbuscular mycorrhizal (AM) fungi. AM can effectively immobilize HMs and reduce their uptake by host plants via binding metal ions to hyphal cell wall and excreting several extracellular biomolecules. Additionally, AM fungi can enhance activities of antioxidant defense machinery of plants. PMID:25688377

Bacterial α2-macroglobulins: colonization factors acquired by horizontal gene transfer from the metazoan genome?

PubMed Central

Budd, Aidan; Blandin, Stephanie; Levashina, Elena A; Gibson, Toby J

2004-01-01

Background Invasive bacteria are known to have captured and adapted eukaryotic host genes. They also readily acquire colonizing genes from other bacteria by horizontal gene transfer. Closely related species such as Helicobacter pylori and Helicobacter hepaticus, which exploit different host tissues, share almost none of their colonization genes. The protease inhibitor α2-macroglobulin provides a major metazoan defense against invasive bacteria, trapping attacking proteases required by parasites for successful invasion. Results Database searches with metazoan α2-macroglobulin sequences revealed homologous sequences in bacterial proteomes. The bacterial α2-macroglobulin phylogenetic distribution is patchy and violates the vertical descent model. Bacterial α2-macroglobulin genes are found in diverse clades, including purple bacteria (proteobacteria), fusobacteria, spirochetes, bacteroidetes, deinococcids, cyanobacteria, planctomycetes and thermotogae. Most bacterial species with bacterial α2-macroglobulin genes exploit higher eukaryotes (multicellular plants and animals) as hosts. Both pathogenically invasive and saprophytically colonizing species possess bacterial α2-macroglobulins, indicating that bacterial α2-macroglobulin is a colonization rather than a virulence factor. Conclusions Metazoan α2-macroglobulins inhibit proteases of pathogens. The bacterial homologs may function in reverse to block host antimicrobial defenses. α2-macroglobulin was probably acquired one or more times from metazoan hosts and has then spread widely through other colonizing bacterial species by more than 10 independent horizontal gene transfers. yfhM-like bacterial α2-macroglobulin genes are often found tightly linked with pbpC, encoding an atypical peptidoglycan transglycosylase, PBP1C, that does not function in vegetative peptidoglycan synthesis. We suggest that YfhM and PBP1C are coupled together as a periplasmic defense and repair system. Bacterial α2-macroglobulins might

Mechanisms of intracellular defense and activity of free radical oxidation in rat myocardium in the dynamics of chronic fluorine intoxication.

PubMed

Zhukova, A G; Alekhina, D A; Sazontova, T G; Prokop'ev, Yu A; Gorokhova, L G; Stryapko, N V; Mikhailova, N N

2013-12-01

The mechanisms of intracellular defense and activity of free radical oxidation in the myocardium were studied in the dynamics of chronic fluorine intoxication. At the early stages of fluorine intoxication (day 3-week 3), the concentrations of defense proteins HIF-1α, HSC73, and HOx-2 and activity of the main metabolic enzymes increased, which promoted maintenance of cardiomyocyte structure and function at the normal physiological level. At late stages of fluorine intoxication (weeks 6 and 9), metabolic changes in the myocardium attest to high strain of the adaptive mechanisms.

A Defensive Kicking Behavior in Response to Mechanical Stimuli Mediated by Drosophila Wing Margin Bristles.

PubMed

Li, Jiefu; Zhang, Wei; Guo, Zhenhao; Wu, Sophia; Jan, Lily Yeh; Jan, Yuh-Nung

2016-11-02

Mechanosensation, one of the fastest sensory modalities, mediates diverse behaviors including those pertinent for survival. It is important to understand how mechanical stimuli trigger defensive behaviors. Here, we report that Drosophila melanogaster adult flies exhibit a kicking response against invading parasitic mites over their wing margin with ultrafast speed and high spatial precision. Mechanical stimuli that mimic the mites' movement evoke a similar kicking behavior. Further, we identified a TRPV channel, Nanchung, and a specific Nanchung-expressing neuron under each recurved bristle that forms an array along the wing margin as being essential sensory components for this behavior. Our electrophysiological recordings demonstrated that the mechanosensitivity of recurved bristles requires Nanchung and Nanchung-expressing neurons. Together, our results reveal a novel neural mechanism for innate defensive behavior through mechanosensation. We discovered a previously unknown function for recurved bristles on the Drosophila melanogaster wing. We found that when a mite (a parasitic pest for Drosophila) touches the wing margin, the fly initiates a swift and accurate kick to remove the mite. The fly head is dispensable for this behavior. Furthermore, we found that a TRPV channel, Nanchung, and a specific Nanchung-expressing neuron under each recurved bristle are essential for its mechanosensitivity and the kicking behavior. In addition, touching different regions of the wing margin elicits kicking directed precisely at the stimulated region. Our experiments suggest that recurved bristles allow the fly to sense the presence of objects by touch to initiate a defensive behavior (perhaps analogous to touch-evoked scratching; Akiyama et al., 2012). Copyright © 2016 the authors 0270-6474/16/3611275-08$15.00/0.

A shared mechanism of defense against predators and parasites: chitin regulation and its implications for life-history theory.

PubMed

Beckerman, Andrew P; de Roij, Job; Dennis, Stuart R; Little, Tom J

2013-12-01

Defenses against predators and parasites offer excellent illustrations of adaptive phenotypic plasticity. Despite vast knowledge about such induced defenses, they have been studied largely in isolation, which is surprising, given that predation and parasitism are ubiquitous and act simultaneously in the wild. This raises the possibility that victims must trade-off responses to predation versus parasitism. Here, we propose that arthropod responses to predators and parasites will commonly be based on the endocrine regulation of chitin synthesis and degradation. The proposal is compelling because many inducible defenses are centered on temporal or spatial modifications of chitin-rich structures. Moreover, we show how the chitin synthesis pathway ends in a split to carapace or gut chitin, and how this form of molecular regulation can be incorporated into theory on life-history trade-offs, specifically the Y-model. Our hypothesis thus spans several biological scales to address advice from Stearns that "Endocrine mechanisms may prove to be only the tip of an iceberg of physiological mechanisms that modulate the expression of genetic covariance".

Perturbation of bacterial ice nucleation activity by a grass antifreeze protein.

PubMed

Tomalty, Heather E; Walker, Virginia K

2014-09-26

Certain plant-associating bacteria produce ice nucleation proteins (INPs) which allow the crystallization of water at high subzero temperatures. Many of these microbes are considered plant pathogens since the formed ice can damage tissues, allowing access to nutrients. Intriguingly, certain plants that host these bacteria synthesize antifreeze proteins (AFPs). Once freezing has occurred, plant AFPs likely function to inhibit the growth of large damaging ice crystals. However, we postulated that such AFPs might also serve as defensive mechanisms against bacterial-mediated ice nucleation. Recombinant AFP derived from the perennial ryegrass Lolium perenne (LpAFP) was combined with INP preparations originating from the grass epiphyte, Pseudomonas syringae. The presence of INPs had no effect on AFP activity, including thermal hysteresis and ice recrystallization inhibition. Strikingly, the ice nucleation point of the INP was depressed up to 1.9°C in the presence of LpAFP, but a recombinant fish AFP did not lower the INP-imposed freezing point. Assays with mutant LpAFPs and the visualization of bacterially-displayed fluorescent plant AFP suggest that INP and LpAFP can interact. Thus, we postulate that in addition to controlling ice growth, plant AFPs may also function as a defensive strategy against the damaging effects of ice-nucleating bacteria. Crown Copyright © 2014. Published by Elsevier Inc. All rights reserved.

Characterization of the Bacterial Community of the Chemically Defended Hawaiian Sacoglossan Elysia rufescens

PubMed Central

Davis, Jeanette; Fricke, W. Florian; Hamann, Mark T.; Esquenazi, Eduardo; Dorrestein, Pieter C.

2013-01-01

Sacoglossans are characterized by the ability to sequester functional chloroplasts from their algal diet through a process called kleptoplasty, enabling them to photosynthesize. The bacterial diversity associated with sacoglossans is not well understood. In this study, we coupled traditional cultivation-based methods with 454 pyrosequencing to examine the bacterial communities of the chemically defended Hawaiian sacoglossan Elysia rufescens and its secreted mucus. E. rufescens contains a defense molecule, kahalalide F, that is possibly of bacterial origin and is of interest because of its antifungal and anticancer properties. Our results showed that there is a diverse bacterial assemblage associated with E. rufescens and its mucus, with secreted mucus harboring higher bacterial richness than entire-E. rufescens samples. The most-abundant bacterial groups affiliated with E. rufescens and its mucus are Mycoplasma spp. and Vibrio spp., respectively. Our analyses revealed that the Vibrio spp. that were highly represented in the cultivable assemblage were also abundant in the culture-independent community. Epifluorescence microscopy and matrix-assisted laser desorption–ionization mass spectrometry (MALDI-MS) were utilized to detect the chemical defense molecule kahalalide F on a longitudinal section of the sacoglossan. PMID:24014539

Lactobacillus salivarius reverse diabetes-induced intestinal defense impairment in mice through non-defensin protein.

PubMed

Chung, Pei-Hsuan; Wu, Ying-Ying; Chen, Pei-Hsuan; Fung, Chang-Phone; Hsu, Ching-Mei; Chen, Lee-Wei

2016-09-01

Altered intestinal microbiota and subsequent endotoxemia play pathogenic roles in diabetes. We aimed to study the mechanisms of intestinal defense impairment in type 1 diabetes and the effects of Lactobacillus salivarius as well as fructooligosaccharides (FOS) supplementation on diabetes-induced bacterial translocation. Alterations in the enteric microbiome, expression of mucosal antibacterial proteins and bacteria-killing activity of the intestinal mucosa in streptozotocin (STZ)-induced diabetic mice and Ins2(Akita) mice were investigated. The effects of dead L. salivarius (2×10(8)CFU/ml) and FOS (250 mg per day) supplementation for 1 week on endotoxin levels and Klebsiella pneumoniae translocation were also examined. Finally, germ-free mice were cohoused with wild-type or Ins2(Akita) mice for 2 weeks to examine the contribution of microbiota on the antibacterial protein expression. STZ-induced diabetic mice developed intestinal defense impairment as demonstrated by decreased mucosal bacteria-killing activity; reduction of non-defensin family proteins, such as Reg3β, Reg3γ, CRP-ductin and RELMβ, but not the defensin family proteins; and increased bacterial translocation. Intestinal bacteria overgrowth, enteric dysbiosis and increased intestinal bacterial translocation, particularly pathogenic K. pneumoniae in STZ-induced diabetic mice and Ins2(Akita) mice, were noted. Treating diabetic mice with dead L. salivarius or FOS reversed enteric dysbiosis, restored mucosal antibacterial protein and lessened endotoxin levels as well as K. pneumoniae translocation. Moreover, germ-free mice cohoused with wild-type mice demonstrated more intestinal Reg3β and RELMβ expression than those cohoused with Ins2(Akita) mice. These results indicate that hyperglycemia induces enteric dysbiosis, reduction of non-defensin proteins as well as bacteria-killing activity of the intestinal mucosa and intestinal defense impairment. Reversal of enteric dysbiosis with dead L. salivarius or

Hepatocyte-mediated cytotoxicity and host defense mechanisms in the alcohol-injured liver.

PubMed

McVicker, Benita L; Thiele, Geoffrey M; Tuma, Dean J; Casey, Carol A

2014-09-01

The consumption of alcohol is associated with many health issues including alcoholic liver disease (ALD). The natural history of ALD involves the development of steatosis, inflammation (steatohepatitis), fibrosis and cirrhosis. During the stage of steatohepatitis, the combination of inflammation and cellular damage can progress to a severe condition termed alcoholic hepatitis (AH). Unfortunately, the pathogenesis of AH remains uncharacterized. Some modulations have been identified in host defense and liver immunity mechanisms during AH that highlight the role of intrahepatic lymphocyte accumulation and associated inflammatory cytokine responses. Also, it is hypothesized that alcohol-induced injury to liver cells may significantly contribute to the aberrant lymphocytic distribution that is seen in AH. In particular, the regulation of lymphocytes by hepatocytes may be disrupted in the alcoholic liver resulting in altered immunologic homeostasis and perpetuation of disease. In recent studies, it was demonstrated that the direct killing of activated T lymphocytes by hepatocytes is facilitated by the asialoglycoprotein receptor (ASGPR). The ASGPR is a well-characterized glycoprotein receptor that is exclusively expressed by hepatocytes. This hepatic receptor is known for its role in the clearance of desialylated glycoproteins or cells, yet neither its physiological function nor its role in disease states has been determined. Interestingly, alcohol markedly impairs ASGPR function; however, the effect alcohol has on ASGPR-mediated cytotoxicity of lymphocytes remains to be elucidated. This review discusses the contribution of hepatocytes in immunological regulation and, importantly, how pathological effects of ethanol disrupt hepatocellular-mediated defense mechanisms.

Geometry and mechanics of growing bacterial colonies

NASA Astrophysics Data System (ADS)

You, Zhihong; Pearce, Daniel; Sengupta, Anupam; Giomi, Luca

Bacterial colonies are abundant on living and non-living surfaces, and are known to mediate a broad range of processes in ecology, medicine and industry. Although extensively researched - from single cells up to the population levels - a comprehensive biophysical picture, highlighting the cell-to-colony dynamics, is still lacking. Here, using numerical and analytical models, we study the mechanics of self-organization leading to the colony morphology of cells growing on a substrate with free boundary. We consider hard rods to mimic the growth of rod-shaped non-motile cells, and show that the colony, as a whole, does not form an ordered nematic phase, nor does it result in a purely disordered (isotropic) phase. Instead, different sizes of domains, in which cells are highly aligned at specific orientations, are found. The distribution of the domain sizes follows an exponential relation - indicating the existence of a characteristic length scale that determines the domain size relative to that of the colony. A continuum theory, based on the hydrodynamics of liquid crystals, is built to account for these phenomena, and is applied to describe the buckling transition from a planar to three-dimensional (3D) colony. The theory supports preliminary experiments conducted with different strains of rod shaped bacterial cells, and reveals that the buckling transition can be regulated by varying the cell stiffness and aspect ratio. This work proposes that, in addition to biochemical pathways, the spatio-temporal organization in microbial colonies is significantly tuned by the biomechanical and geometric properties of the microbes in consideration.

Bacterial Pathogens versus Autophagy: Implications for Therapeutic Interventions

PubMed Central

Kimmey, Jacqueline M.; Stallings, Christina L.

2016-01-01

Research in recent years has focused significantly on the role of selective macroautophagy in targeting intracellular pathogens for lysosomal degradation, a process termed xenophagy. In this review we evaluate the proposed roles for xenophagy in controlling bacterial infection, highlighting the concept that successful pathogens have evolved ways to subvert or exploit this defense, minimizing the actual effectiveness of xenophagy in innate immunity. Instead, studies in animal models have revealed that autophagy-associated proteins often function outside of xenophagy to influence bacterial pathogenesis. In light of current efforts to manipulate autophagy and the development of host-directed therapies to fight bacterial infections, we also discuss the implications stemming from the complicated relationship that exists between autophagy and bacterial pathogens. PMID:27866924

High-potential defense mechanisms of neocortex in a rat model of transient asphyxia induced cardiac arrest.

PubMed

Keilhoff, Gerburg; Esser, Torben; Titze, Maximilian; Ebmeyer, Uwe; Schild, Lorenz

2017-11-01

Cardiac arrest (CA) is a common cause of disability and mortality and thus an important risk for human health. Circulatory failure has dramatic consequences for the brain as one of the most oxygen-consuming organs. Hippocampus, striatum and neocortex rate among the most vulnerable brain regions. The neocortex is less sensitive to hypoxia/reperfusion in comparison with the hippocampal CA1 region. That implicates the existence of efficient defense mechanisms in the neocortex against hypoxia/reperfusion injury, which we analyzed in a well-established CA rat model. We explored different immunohistochemical markers (NeuN, MAP2, GFAP, IBA1, NOX4, MnSOD, Bax, caspase 3, cfos, nNOS, eNOS, iNOS, TUNEL), amount of mitochondria, activities of respiratory chain complexes and amount/composition of cardiolipin. CA induced a moderate degeneration of cortical neurons. As possible defense mechanisms the study revealed: (i) increased activities of respiratory chain complexes of cortical mitochondria as response to increased energy demand after ACA-induced cell stress; (ii) increase of cardiolipin content as cellular stress response, which might contribute to the promotion of mitochondrial ATP synthesis; (iii) strengthening of the fast, effective and long-lasting mitochondrial MnSOD defense system; (iv) ACA-induced increase in expression of eNOS and nNOS in vasculature being able to reduce ischemic injury by vasodilation. Copyright © 2017 Elsevier B.V. All rights reserved.

Systemic acquired resistance in moss: further evidence for conserved defense mechanisms in plants.

PubMed

Winter, Peter S; Bowman, Collin E; Villani, Philip J; Dolan, Thomas E; Hauck, Nathanael R

2014-01-01

Vascular plants possess multiple mechanisms for defending themselves against pathogens. One well-characterized defense mechanism is systemic acquired resistance (SAR). In SAR, a plant detects the presence of a pathogen and transmits a signal throughout the plant, inducing changes in the expression of various pathogenesis-related (PR) genes. Once SAR is established, the plant is capable of mounting rapid responses to subsequent pathogen attacks. SAR has been characterized in numerous angiosperm and gymnosperm species; however, despite several pieces of evidence suggesting SAR may also exist in non-vascular plants6-8, its presence in non-vascular plants has not been conclusively demonstrated, in part due to the lack of an appropriate culture system. Here, we describe and use a novel culture system to demonstrate that the moss species Amblystegium serpens does initiate a SAR-like reaction upon inoculation with Pythium irregulare, a common soil-borne oomycete. Infection of A. serpens gametophores by P. irregulare is characterized by localized cytoplasmic shrinkage within 34 h and chlorosis and necrosis within 7 d of inoculation. Within 24 h of a primary inoculation (induction), moss gametophores grown in culture became highly resistant to infection following subsequent inoculation (challenge) by the same pathogen. This increased resistance was a response to the pathogen itself and not to physical wounding. Treatment with β-1,3 glucan, a structural component of oomycete cell walls, was equally effective at triggering SAR. Our results demonstrate, for the first time, that this important defense mechanism exists in a non-vascular plant, and, together with previous studies, suggest that SAR arose prior to the divergence of vascular and non-vascular plants. In addition, this novel moss - pathogen culture system will be valuable for future characterization of the mechanism of SAR in moss, which is necessary for a better understanding of the evolutionary history of SAR in

A novel approach for emerging and antibiotic resistant infections: Innate Defense Regulators as an agnostic therapy

PubMed Central

North, John R.; Takenaka, Shunsuke; Rozek, Annett; Kielczewska, Agnieszka; Opal, Steven; Morici, Lisa A.; Finlay, B. Brett; Schaber, Christopher J.; Straube, Richard; Donini, Oreola

2016-01-01

Innate Defense Regulators (IDRs) are short synthetic peptides that target the host innate immune system via an intracellular adaptor protein which functions at key signaling nodes. In this work, further details of the mechanism of action of IDRs have been discovered. The studies reported here show that the lead clinical IDR, SGX94, has broad-spectrum activity against Gram-negative and Gram-positive bacterial infections caused by intracellular or extracellular bacteria and also complements the actions of standard of care antibiotics. Based on in vivo and primary cell culture studies, this activity is shown to result from the primary action of SGX94 on tissue-resident cells and subsequent secondary signaling to activate myeloid-derived cells, resulting in enhanced bacterial clearance and increased survival. Data from non-clinical and clinical studies also show that SGX94 treatment modulates pro-inflammatory and anti-inflammatory cytokine levels, thereby mitigating the deleterious inflammatory consequences of innate immune activation. Since they act through host pathways to provide both broad-spectrum anti-infective capability as well as control of inflammation, IDRs are unlikely to be impacted by resistance mechanisms and offer potential clinical advantages in the fight against emerging and antibiotic resistant bacterial infections. PMID:27015977

A novel approach for emerging and antibiotic resistant infections: Innate defense regulators as an agnostic therapy.

PubMed

North, John R; Takenaka, Shunsuke; Rozek, Annett; Kielczewska, Agnieszka; Opal, Steven; Morici, Lisa A; Finlay, B Brett; Schaber, Christopher J; Straube, Richard; Donini, Oreola

2016-05-20

Innate Defense Regulators (IDRs) are short synthetic peptides that target the host innate immune system via an intracellular adaptor protein which functions at key signaling nodes. In this work, further details of the mechanism of action of IDRs have been discovered. The studies reported here show that the lead clinical IDR, SGX94, has broad-spectrum activity against Gram-negative and Gram-positive bacterial infections caused by intracellular or extracellular bacteria and also complements the actions of standard of care antibiotics. Based on in vivo and primary cell culture studies, this activity is shown to result from the primary action of SGX94 on tissue-resident cells and subsequent secondary signaling to activate myeloid-derived cells, resulting in enhanced bacterial clearance and increased survival. Data from non-clinical and clinical studies also show that SGX94 treatment modulates pro-inflammatory and anti-inflammatory cytokine levels, thereby mitigating the deleterious inflammatory consequences of innate immune activation. Since they act through host pathways to provide both broad-spectrum anti-infective capability as well as control of inflammation, IDRs are unlikely to be impacted by resistance mechanisms and offer potential clinical advantages in the fight against emerging and antibiotic resistant bacterial infections. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Water relations in the interaction of foliar bacterial pathogens with plants.

PubMed

Beattie, Gwyn A

2011-01-01

This review examines the many ways in which water influences the relations between foliar bacterial pathogens and plants. As a limited resource in aerial plant tissues, water is subject to manipulation by both plants and pathogens. A model is emerging that suggests that plants actively promote localized desiccation at the infection site and thus restrict pathogen growth as one component of defense. Similarly, many foliar pathogens manipulate water relations as one component of pathogenesis. Nonvascular pathogens do this using effectors and other molecules to alter hormonal responses and enhance intercellular watersoaking, whereas vascular pathogens use many mechanisms to cause wilt. Because of water limitations on phyllosphere surfaces, bacterial colonists, including pathogens, benefit from the protective effects of cellular aggregation, synthesis of hygroscopic polymers, and uptake and production of osmoprotective compounds. Moreover, these bacteria employ tactics for scavenging and distributing water to overcome water-driven barriers to nutrient acquisition, movement, and signal exchange on plant surfaces. Copyright © 2011 by Annual Reviews. All rights reserved.

Gender differences in defense mechanisms, ways of coping with stress and sense of identity in adolescent suicide attempts.

PubMed

Foto-Özdemir, Dilşad; Akdemir, Devrim; Çuhadaroğlu-Çetin, Füsun

2016-01-01

The main aim of this study was to investigate the gender differences in defense mechanisms, ways of coping with stress and identity formation in relation to adolescent suicidal behavior. This study involved 64 adolescents between 12-17 years of age, who were admitted to the emergency service with a suicide attempt. They were evaluated with a semi-structured clinical interview (K-SADS), Ways of Coping Inventory (WCI), Defense Mechanisms Inventory (DMI) and Sense of Identity Assessment Form (SIAF). 60.9% (n = 39) of the adolescents were female, and 39.1% (n=25) were male. There were no statistically significant differences between the girls and the boys with respect to the clinical characteristics of the suicide attempt and the rate of psychiatric disorders. Of the 64 adolescents with suicide attempt, 47 (73.4%) had at least one, and 26 (40.6%) had more than one psychiatric disorder according to K-SADS. Disruptive behavior disorders were more frequent in males, whereas depression was more frequent in girls. The data indicated the importance of identity confusion, major depression and ADHD in adolescents with suicide attempt in both genders. 43.6% (n=17) of the girls and 36% (n=9) of the boys obtained scores higher than the cut-off point of SIAF indicating identity confusion. Professional help seeking and NSSI behaviors before the suicide attempt were more common in adolescents with identity confusion. While there were differences between genders with respect to the defense mechanisms used, no significant difference was found in terms of ways of coping. Evaluation of DMI scores revealed that the turning against object subscale score was significantly higher in boys compared to girls. While evaluating the adolescents at risk, their defense mechanisms, way of coping and sense of identity, as well as their psychiatric diagnosis should be assessed in detail in order to identify the suicidal thoughts and prevent possible suicide attempts.

The bacteriome-mycobiome interaction and antifungal host defense.

PubMed

Oever, Jaap Ten; Netea, Mihai G

2014-11-01

Large communities of microorganisms, collectively termed the microbiome, inhabit our body surfaces. With the advent of next-generation sequencing, the diversity and abundance of these communities are being unravelled. Besides an imporant role in metabolic processes, the microbiome is essential for proper functioning of our immune system, including the defense against fungi. Despite the progress of the past years, studies aimed at characterizing our fungal colonizers (the mycobiome) are limited; nevertheless fungi are important players of the microbiome, either as a cofactor in disease or as potential pathogens. In this review, we describe the role of the bacterial microbiome in antifungal host defense. On the one hand, bacteria provide colonization resistance to fungi, inhibit Candida virulence by preventing yeast-hyphal transition and contribute to epithelial integrity, all factors are important for the pathogenesis of invasive fungal disease. On the other hand, several bacterial species modulate mucosal (antifungal) immune responses. Murine studies demonstrate important effects of the microbiome on the antifungal responses of T-helper 17 cells, regulatory T cells and innate lymphoid cells. Inferred from these studies, perturbation of the healthy microbiome should be avoided and microbiome manipulation and interventions based on bacteria-derived pathways involved in immunomodulation are attractive options for modulating antifungal host defense. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Selective Chemical Inhibition of agr Quorum Sensing in Staphylococcus aureus Promotes Host Defense with Minimal Impact on Resistance

PubMed Central

Sully, Erin K.; Malachowa, Natalia; Elmore, Bradley O.; Alexander, Susan M.; Femling, Jon K.; Gray, Brian M.; DeLeo, Frank R.; Otto, Michael; Cheung, Ambrose L.; Edwards, Bruce S.; Sklar, Larry A.; Horswill, Alexander R.; Hall, Pamela R.; Gresham, Hattie D.

2014-01-01

Bacterial signaling systems are prime drug targets for combating the global health threat of antibiotic resistant bacterial infections including those caused by Staphylococcus aureus. S. aureus is the primary cause of acute bacterial skin and soft tissue infections (SSTIs) and the quorum sensing operon agr is causally associated with these. Whether efficacious chemical inhibitors of agr signaling can be developed that promote host defense against SSTIs while sparing the normal microbiota of the skin is unknown. In a high throughput screen, we identified a small molecule inhibitor (SMI), savirin (S. aureus virulence inhibitor) that disrupted agr-mediated quorum sensing in this pathogen but not in the important skin commensal Staphylococcus epidermidis. Mechanistic studies employing electrophoretic mobility shift assays and a novel AgrA activation reporter strain revealed the transcriptional regulator AgrA as the target of inhibition within the pathogen, preventing virulence gene upregulation. Consistent with its minimal impact on exponential phase growth, including skin microbiota members, savirin did not provoke stress responses or membrane dysfunction induced by conventional antibiotics as determined by transcriptional profiling and membrane potential and integrity studies. Importantly, savirin was efficacious in two murine skin infection models, abating tissue injury and selectively promoting clearance of agr+ but not Δagr bacteria when administered at the time of infection or delayed until maximal abscess development. The mechanism of enhanced host defense involved in part enhanced intracellular killing of agr+ but not Δagr in macrophages and by low pH. Notably, resistance or tolerance to savirin inhibition of agr was not observed after multiple passages either in vivo or in vitro where under the same conditions resistance to growth inhibition was induced after passage with conventional antibiotics. Therefore, chemical inhibitors can selectively target AgrA in

Mountain pine beetles colonizing historical and naive host trees are associated with a bacterial community highly enriched in genes contributing to terpene metabolism.

PubMed

Adams, Aaron S; Aylward, Frank O; Adams, Sandye M; Erbilgin, Nadir; Aukema, Brian H; Currie, Cameron R; Suen, Garret; Raffa, Kenneth F

2013-06-01

The mountain pine beetle, Dendroctonus ponderosae, is a subcortical herbivore native to western North America that can kill healthy conifers by overcoming host tree defenses, which consist largely of high terpene concentrations. The mechanisms by which these beetles contend with toxic compounds are not well understood. Here, we explore a component of the hypothesis that beetle-associated bacterial symbionts contribute to the ability of D. ponderosae to overcome tree defenses by assisting with terpene detoxification. Such symbionts may facilitate host tree transitions during range expansions currently being driven by climate change. For example, this insect has recently breached the historical geophysical barrier of the Canadian Rocky Mountains, providing access to näive tree hosts and unprecedented connectivity to eastern forests. We use culture-independent techniques to describe the bacterial community associated with D. ponderosae beetles and their galleries from their historical host, Pinus contorta, and their more recent host, hybrid P. contorta-Pinus banksiana. We show that these communities are enriched with genes involved in terpene degradation compared with other plant biomass-processing microbial communities. These pine beetle microbial communities are dominated by members of the genera Pseudomonas, Rahnella, Serratia, and Burkholderia, and the majority of genes involved in terpene degradation belong to these genera. Our work provides the first metagenome of bacterial communities associated with a bark beetle and is consistent with a potential microbial contribution to detoxification of tree defenses needed to survive the subcortical environment.

Bacterial Exopolysaccharide mediated heavy metal removal: A Review on biosynthesis, mechanism and remediation strategies.

PubMed

Gupta, Pratima; Diwan, Batul

2017-03-01

Heavy metal contamination has been recognized as a major public health risk, particularly in developing countries and their toxicological manifestations are well known. Conventional remediation strategies are either expensive or they generate toxic by-products, which adversely affect the environment. Therefore, necessity for an environmentally safe strategy motivates interest towards biological techniques. One of such most profoundly driven approach in recent times is biosorption through microbial biomass and their products. Extracellular polymeric substances are such complex blend of high molecular weight microbial (prokaryotic and eukaryotic) biopolymers. They are mainly composed of proteins, polysaccharides, uronic acids, humic substances, lipids etc. One of its essential constituent is the exopolysaccharide (EPS) released out of self defense against harsh conditions of starvation, pH and temperature, hence it displays exemplary physiological, rheological and physio-chemical properties. Its net anionic makeup allows the biopolymer to effectively sequester positively charged heavy metal ions. The polysaccharide has been expounded deeply in this article with reference to its biosynthesis and emphasizes heavy metal sorption abilities of polymer in terms of mechanism of action and remediation. It reports current investigation and strategic advancements in dealing bacterial cells and their EPS in diverse forms - mixed culture EPS, single cell EPS, live, dead or immobilized EPS. A significant scrutiny is also involved highlighting the existing challenges that still lie in the path of commercialization. The article enlightens the potential of EPS to bring about bio-detoxification of heavy metal contaminated terrestrial and aquatic systems in highly sustainable, economic and eco-friendly manner.

Defense mechanisms against toxic phytochemicals in the diet of domestic animals.

PubMed

Fink-Gremmels, Johanna

2010-02-01

Plant secondary metabolites (PSMs) are non-nutritional components that occur in numerous feed materials and are able to exert toxic effects in animals. The current article aims to summarize innate defense strategies developed by different animal species to avoid excessive exposure to PSMs. These mechanisms include pre-systemic degradation of PSMs by rumen microbiota, the intestinal barrier including efflux transporters of monogastric species, as well as pre-hepatic and intra-hepatic biotransformation processes. These physiological barriers determine systemic exposure and ultimately the dose-dependent adverse effects in the target animal species. Considering the large number of potentially toxic PSMs, which makes an evaluation of all individual PSMs virtually impossible, such a mechanism-oriented approach could improve the predictability of adverse effects and support the interpretation of clinical field observations. Moreover, mechanistic data related to tissue disposition and excretion pathways of PSMs for example into milk, could substantially support the assessment of the risks for consumers of foods derived from PSM-exposed animals.

Systemic Adenosine Triphosphate Impairs Neutrophil Chemotaxis and Host Defense in Sepsis.

PubMed

Li, Xiaoou; Kondo, Yutaka; Bao, Yi; Staudenmaier, Laura; Lee, Albert; Zhang, Jingping; Ledderose, Carola; Junger, Wolfgang G

2017-01-01

Sepsis remains an unresolved clinical problem. Therapeutic strategies focusing on inhibition of neutrophils (polymorphonuclear neutrophils) have failed, which indicates that a more detailed understanding of the underlying pathophysiology of sepsis is required. Polymorphonuclear neutrophil activation and chemotaxis require cellular adenosine triphosphate release via pannexin-1 channels that fuel autocrine feedback via purinergic receptors. In the current study, we examined the roles of endogenous and systemic adenosine triphosphate on polymorphonuclear neutrophil activation and host defense in sepsis. Prospective randomized animal investigation and in vitro studies. Preclinical academic research laboratory. Wild-type C57BL/6 mice, pannexin-1 knockout mice, and healthy human subjects used to obtain polymorphonuclear neutrophils for in vitro studies. Wild-type and pannexin-1 knockout mice were treated with suramin or apyrase to block the endogenous or systemic effects of adenosine triphosphate. Mice were subjected to cecal ligation and puncture and polymorphonuclear neutrophil activation (CD11b integrin expression), organ (liver) injury (plasma aspartate aminotransferase), bacterial spread, and survival were monitored. Human polymorphonuclear neutrophils were used to study the effect of systemic adenosine triphosphate and apyrase on chemotaxis. Inhibiting endogenous adenosine triphosphate reduced polymorphonuclear neutrophil activation and organ injury, but increased the spread of bacteria and mortality in sepsis. By contrast, removal of systemic adenosine triphosphate improved bacterial clearance and survival in sepsis by improving polymorphonuclear neutrophil chemotaxis. Systemic adenosine triphosphate impairs polymorphonuclear neutrophil functions by disrupting the endogenous purinergic signaling mechanisms that regulate cell activation and chemotaxis. Removal of systemic adenosine triphosphate improves polymorphonuclear neutrophil function and host defenses

Defense Styles in Suicide Attempters

ERIC Educational Resources Information Center

Scholz, James A.

1973-01-01

Thirty-five serious suicide attempters, paired to neuropsychiatric controls on relevant variables, were tested within two weeks of their attempt with the Defense Mechanisms Inventory. Attempters revealed more turning-against-self defenses as hypothesized but showed no differences from controls in use of fantasized hostility. Implications for…

From emotional abuse in childhood to psychopathology in adulthood: a path mediated by immature defense mechanisms and self-esteem.

PubMed

Finzi-Dottan, Ricky; Karu, Toby

2006-08-01

The present study examined the course traveled from childhood emotional abuse to adulthood psychopathology. One hundred ninety-six undergraduate students age 20 to 45 (M = 27; SD = 8.17), answered self-report questionnaires assessing emotional abuse in childhood (Childhood Trauma Questionnaire), parental attitudes (Parental Bonding Instrument), psychopathological symptomatology (Brief Symptom Inventory), self-esteem (Rosenberg Self-Esteem Scale), and defense mechanism organization (Defense Style Questionnaire). Results indicated that reported psychopathological symptomatology highly exceeded the Israeli norm. Structure Equation Modeling provided a statistically significant explanation (52%) of the target variable of psychopathological symptomatology. According to the path model, emotional abuse in childhood and perceptions of controlling and noncaring parents had an indirect effect on the psychopathology. This was mediated by immature defenses and low self-esteem. We conclude that the manifest psychopathology among adults who suffered emotional abuse in childhood is produced by the detrimental effect of abuse on personality, and takes the form of immature defense organization and damaged self-representation.

Effect of human milk fortifiers on bacterial growth in human milk.

PubMed

Santiago, Myla S; Codipilly, Champa N; Potak, Debra C; Schanler, Richard J

2005-10-01

As a component in human milk fortifiers (HMF), iron may equilibrate with human milk for as long as 24 hours, bind important bacteriostatic proteins, and potentially affect the host defense properties of human milk. We compared bacterial growth in human milk prepared with each of two HMF differing in their content of iron. Samples of human milk obtained from mothers of premature infants were divided and mixed with one of two HMF and maintained at refrigerator temperature. Refrigerated milk samples were removed at 0, 24, and 72 hours for determination of total bacterial colony counts (TBCC). TBCC did not differ between groups but declined from 0 to 72 hours, p<0.001. These data suggest that differences in iron content, or other nutrients in HMF, do not affect bacterial growth in human milk. Storage of fortified human milk at refrigerator temperature for 72 hours results in decreased bacterial growth. As a component in human milk fortifiers (HMF), iron may equilibrate with human milk for as long as 24 hours, bind important bacteriostatic proteins, and potentially affect the host defense properties of human milk. We compared bacterial growth in human milk prepared with each of two HMF differing in their content of iron. Samples of human milk obtained from mothers of premature infants were divided and mixed with one of two HMF and maintained at refrigerator temperature. Refrigerated milk samples were removed at 0, 24, and 72 hours for determination of total bacterial colony counts (TBCC).

The role and regulation of catalase in respiratory tract opportunistic bacterial pathogens.

PubMed

Eason, Mia M; Fan, Xin

2014-09-01

Respiratory tract bacterial pathogens are the etiologic agents of a variety of illnesses. The ability of these bacteria to cause disease is imparted through survival within the host and avoidance of pathogen clearance by the immune system. Respiratory tract pathogens are continually bombarded by reactive oxygen species (ROS), which may be produced by competing bacteria, normal metabolic function, or host immunological responses. In order to survive and proliferate, bacteria have adapted defense mechanisms to circumvent the effects of ROS. Bacteria employ the use of anti-oxidant enzymes, catalases and catalase-peroxidases, to relieve the effects of the oxidative stressors to which they are continually exposed. The decomposition of ROS has been shown to provide favorable conditions in which respiratory tract opportunistic bacterial pathogens such as Haemophilus influenzae, Mycobacterium tuberculosis, Legionella pneumophila, and Neisseria meningitidis are able to withstand exposure to highly reactive molecules and yet survive. Bacteria possessing mutations in the catalase gene have a decreased survival rate, yet may be able to compensate for the lack of catalatic activity if peroxidatic activity is present. An incomplete knowledge of the mechanisms by which catalase and catalase-peroxidases are regulated still persists, however, in some bacterial species, a regulatory factor known as OxyR has been shown to either up-regulate or down-regulate catalase gene expression. Yet, more research is still needed to increase the knowledge base in relation to this enzyme class. As with this review, we focus on major respiratory tract opportunistic bacterial pathogens in order to elucidate the function and regulation of catalases. The importance of the research could lead to the development of novel treatments against respiratory bacterial infections. Copyright © 2014 Elsevier Ltd. All rights reserved.

Protected by fumigants: beetle perfumes in antimicrobial defense.

PubMed

Gross, Jürgen; Schumacher, Kerstin; Schmidtberg, Henrike; Vilcinskas, Andreas

2008-02-01

Beetles share with other eukaryotes an innate immune system that mediates endogenous defense against pathogens. In addition, larvae of some taxa produce fluid exocrine secretions that contain antimicrobial compounds. In this paper, we provide evidence that larvae of the brassy willow leaf beetle Phratora vitellinae constitutively release volatile glandular secretions that combat pathogens in their microenvironment. We identified salicylaldehyde as the major component of their enveloping perfume cloud, which is emitted by furrow-shaped openings of larval glandular reservoirs and which inhibits in vitro the growth of the bacterial entomopathogen Bacillus thuringiensis. The suggested role of salicylaldehyde as a fumigant in exogenous antimicrobial defense was confirmed in vivo by its removal from glandular reservoirs. This resulted in an enhanced susceptibility of the larvae to infection with the fungal entomopathogens Beauveria bassiana and Metarhizium anisopliae. Consequently, we established the hypothesis that antimicrobial defense in beetles can be expanded beyond innate immunity to include external disinfection of their microenvironment, and we report for the first time the contribution of fumigants to antimicrobial defense in animals.

Bench-to-bedside review: Quorum sensing and the role of cell-to-cell communication during invasive bacterial infection

PubMed Central

Asad, Shadaba; Opal, Steven M

2008-01-01

Bacteria communicate extensively with each other and employ a communal approach to facilitate survival in hostile environments. A hierarchy of cell-to-cell signaling pathways regulates bacterial growth, metabolism, biofilm formation, virulence expression, and a myriad of other essential functions in bacterial populations. The notion that bacteria can signal each other and coordinate their assault patterns against susceptible hosts is now well established. These signaling networks represent a previously unrecognized survival strategy by which bacterial pathogens evade antimicrobial defenses and overwhelm the host. These quorum sensing communication signals can transgress species barriers and even kingdom barriers. Quorum sensing molecules can regulate human transcriptional programs to the advantage of the pathogen. Human stress hormones and cytokines can be detected by bacterial quorum sensing systems. By this mechanism, the pathogen can detect the physiologically stressed host, providing an opportunity to invade when the patient is most vulnerable. These rather sophisticated, microbial communication systems may prove to be a liability to pathogens as they make convenient targets for therapeutic intervention in our continuing struggle to control microbial pathogens. PMID:19040778

Getting to PTI of bacterial RNAs: Triggering plant innate immunity by extracellular RNAs from bacteria.

PubMed

Park, Yong-Soon; Lee, Boyoung; Ryu, Choong-Min

2016-07-02

Defense against diverse biotic and abiotic stresses requires the plant to distinguish between self and non-self signaling molecules. Pathogen/microbe-associated molecular patterns (PAMPs/MAMPs) are pivotal for triggering innate immunity in plants. Unlike in animals and humans, the precise roles of nucleic acids in plant innate immunity are unclear. We therefore investigated the effects of infiltration of total Pseudomonas syringae pv. tomato DC3000 (Pto DC3000) RNAs into Arabidopsis plants. The pathogen population was 10-fold lower in bacterial RNAs pre-treated Arabidopsis plants than in the control. Bacterial RNAs purity was confirmed by physical (sonication) and chemical (RNase A and proteinase K digestion) methods. The perception of bacterial RNAs, especially rRNAs, positively regulated mitogen-activated protein kinase (MAPK) and induced a reactive oxygen species burst, callose deposition, salicylic acid (SA) and jasmonic acid (JA) signaling, and defense-related genes. Therefore, bacterial RNAs function as a new MAMP that activates plant innate immunity, providing a new paradigm for plant-microbe interactions.

RNase H As Gene Modifier, Driver of Evolution and Antiviral Defense.

PubMed

Moelling, Karin; Broecker, Felix; Russo, Giancarlo; Sunagawa, Shinichi

2017-01-01

Retroviral infections are 'mini-symbiotic' events supplying recipient cells with sequences for viral replication, including the reverse transcriptase (RT) and ribonuclease H (RNase H). These proteins and other viral or cellular sequences can provide novel cellular functions including immune defense mechanisms. Their high error rate renders RT-RNases H drivers of evolutionary innovation. Integrated retroviruses and the related transposable elements (TEs) have existed for at least 150 million years, constitute up to 80% of eukaryotic genomes and are also present in prokaryotes. Endogenous retroviruses regulate host genes, have provided novel genes including the syncytins that mediate maternal-fetal immune tolerance and can be experimentally rendered infectious again. The RT and the RNase H are among the most ancient and abundant protein folds. RNases H may have evolved from ribozymes, related to viroids, early in the RNA world, forming ribosomes, RNA replicases and polymerases. Basic RNA-binding peptides enhance ribozyme catalysis. RT and ribozymes or RNases H are present today in bacterial group II introns, the precedents of TEs. Thousands of unique RTs and RNases H are present in eukaryotes, bacteria, and viruses. These enzymes mediate viral and cellular replication and antiviral defense in eukaryotes and prokaryotes, splicing, R-loop resolvation, DNA repair. RNase H-like activities are also required for the activity of small regulatory RNAs. The retroviral replication components share striking similarities with the RNA-induced silencing complex (RISC), the prokaryotic CRISPR-Cas machinery, eukaryotic V(D)J recombination and interferon systems. Viruses supply antiviral defense tools to cellular organisms. TEs are the evolutionary origin of siRNA and miRNA genes that, through RISC, counteract detrimental activities of TEs and chromosomal instability. Moreover, piRNAs, implicated in transgenerational inheritance, suppress TEs in germ cells. Thus, virtually all known

RNase H As Gene Modifier, Driver of Evolution and Antiviral Defense

PubMed Central

Moelling, Karin; Broecker, Felix; Russo, Giancarlo; Sunagawa, Shinichi

2017-01-01

Retroviral infections are ‘mini-symbiotic’ events supplying recipient cells with sequences for viral replication, including the reverse transcriptase (RT) and ribonuclease H (RNase H). These proteins and other viral or cellular sequences can provide novel cellular functions including immune defense mechanisms. Their high error rate renders RT-RNases H drivers of evolutionary innovation. Integrated retroviruses and the related transposable elements (TEs) have existed for at least 150 million years, constitute up to 80% of eukaryotic genomes and are also present in prokaryotes. Endogenous retroviruses regulate host genes, have provided novel genes including the syncytins that mediate maternal-fetal immune tolerance and can be experimentally rendered infectious again. The RT and the RNase H are among the most ancient and abundant protein folds. RNases H may have evolved from ribozymes, related to viroids, early in the RNA world, forming ribosomes, RNA replicases and polymerases. Basic RNA-binding peptides enhance ribozyme catalysis. RT and ribozymes or RNases H are present today in bacterial group II introns, the precedents of TEs. Thousands of unique RTs and RNases H are present in eukaryotes, bacteria, and viruses. These enzymes mediate viral and cellular replication and antiviral defense in eukaryotes and prokaryotes, splicing, R-loop resolvation, DNA repair. RNase H-like activities are also required for the activity of small regulatory RNAs. The retroviral replication components share striking similarities with the RNA-induced silencing complex (RISC), the prokaryotic CRISPR-Cas machinery, eukaryotic V(D)J recombination and interferon systems. Viruses supply antiviral defense tools to cellular organisms. TEs are the evolutionary origin of siRNA and miRNA genes that, through RISC, counteract detrimental activities of TEs and chromosomal instability. Moreover, piRNAs, implicated in transgenerational inheritance, suppress TEs in germ cells. Thus, virtually all

Functional mechanics of the plant defensive Griffonia simplicifolia lectin II: resistance to proteolysis is independent of glycoconjugate binding in the insect gut.

PubMed

Zhu-Salzman, K; Salzman, R A

2001-10-01

Griffonia simplicifolia lectin II (GSII) is a plant defensive protein that significantly delays development of the cowpea bruchid Callosobruchus maculatus (F.). Previous structure/function analysis by site-directed mutagenesis indicated that carbohydrate binding and resistance to insect gut proteolysis are required for the anti-insect activity of this lectin. However, whether there is a causal link between carbohydrate binding and resistance to insect metabolism remains unknown. Two proteases principally responsible for digestive proteolysis in third and fourth instar larvae of C. maculatus were purified by activated thiol sepharose chromatography and resolved as cathepsin L-like proteases, based on N-terminal amino acid sequence analysis. Digestion of bacterially expressed recombinant GSII (rGSII) and its mutant protein variants with the purified gut proteases indicates that carbohydrate binding, presumably to a target ligand in insect gut, and proteolytic resistance are independent properties of rGSII, and that both facilitate its efficacy as a plant defensive molecule.

Unraveling the Molecular Mechanisms Underlying the Nasopharyngeal Bacterial Community Structure.

PubMed

de Steenhuijsen Piters, Wouter A A; Bogaert, Debby

2016-02-02

The upper respiratory tract is colonized by a diverse array of commensal bacteria that harbor potential pathogens, such as Streptococcus pneumoniae. As long as the local microbial ecosystem-also called "microbiome"-is in balance, these potentially pathogenic bacterial residents cause no harm to the host. However, similar to macrobiological ecosystems, when the bacterial community structure gets perturbed, potential pathogens can overtake the niche and cause mild to severe infections. Recent studies using next-generation sequencing show that S. pneumoniae, as well as other potential pathogens, might be kept at bay by certain commensal bacteria, including Corynebacterium and Dolosigranulum spp. Bomar and colleagues are the first to explore a specific biological mechanism contributing to the antagonistic interaction between Corynebacterium accolens and S. pneumoniae in vitro [L. Bomar, S. D. Brugger, B. H. Yost, S. S. Davies, K. P. Lemon, mBio 7(1):e01725-15, 2016, doi:10.1128/mBio.01725-15]. The authors comprehensively show that C. accolens is capable of hydrolyzing host triacylglycerols into free fatty acids, which display antipneumococcal properties, suggesting that these bacteria might contribute to the containment of pneumococcus. This work exemplifies how molecular epidemiological findings can lay the foundation for mechanistic studies to elucidate the host-microbe and microbial interspecies interactions underlying the bacterial community structure. Next, translation of these results to an in vivo setting seems necessary to unveil the magnitude and importance of the observed effect in its natural, polymicrobial setting. Copyright © 2016 de Steenhuijsen Piters and Bogaert.

Unraveling the Molecular Mechanisms Underlying the Nasopharyngeal Bacterial Community Structure

PubMed Central

de Steenhuijsen Piters, Wouter A. A.

2016-01-01

ABSTRACT The upper respiratory tract is colonized by a diverse array of commensal bacteria that harbor potential pathogens, such as Streptococcus pneumoniae. As long as the local microbial ecosystem—also called “microbiome”—is in balance, these potentially pathogenic bacterial residents cause no harm to the host. However, similar to macrobiological ecosystems, when the bacterial community structure gets perturbed, potential pathogens can overtake the niche and cause mild to severe infections. Recent studies using next-generation sequencing show that S. pneumoniae, as well as other potential pathogens, might be kept at bay by certain commensal bacteria, including Corynebacterium and Dolosigranulum spp. Bomar and colleagues are the first to explore a specific biological mechanism contributing to the antagonistic interaction between Corynebacterium accolens and S. pneumoniae in vitro [L. Bomar, S. D. Brugger, B. H. Yost, S. S. Davies, K. P. Lemon, mBio 7(1):e01725-15, 2016, doi:10.1128/mBio.01725-15]. The authors comprehensively show that C. accolens is capable of hydrolyzing host triacylglycerols into free fatty acids, which display antipneumococcal properties, suggesting that these bacteria might contribute to the containment of pneumococcus. This work exemplifies how molecular epidemiological findings can lay the foundation for mechanistic studies to elucidate the host-microbe and microbial interspecies interactions underlying the bacterial community structure. Next, translation of these results to an in vivo setting seems necessary to unveil the magnitude and importance of the observed effect in its natural, polymicrobial setting. PMID:26838716

Protecting muscle ATP: positive roles for peripheral defense mechanisms-introduction.

PubMed

Myburgh, Kathryn H

2004-01-01

Skeletal muscle has evolved an impressive array of mechanisms for peripherally mediated control of ATP homeostasis. Some of these mechanisms are intracellular, and others are extracellular and include influences on the cross-bridge cycle itself and substrate supply. This paper introduces three distinctly different topics that nevertheless all have ATP defense in common. The role of ADP in fatigue is controversial but has recently been more clearly delineated so that an effect on alleviating force declines during extreme fatigue is plausible. AMP plays its role by activating the protein-kinase, AMPK, which is a key sensor of cellular energy stress. AMPK has different isoforms, is not uniformly distributed in the cell, and its activation is carefully controlled. It has multiple effects including improvements in substrate supply for the metabolic pathways producing ATP and inhibition of anabolic processes to further spare ATP. Red blood cells have the capacity to sense hypoxia and to release vasodilators where there is a locally increased demand for blood supply. The papers in this series emphasize the important positive roles of metabolites and sensors of fatigue in the balance between ATP supply and demand.

Systematic approach to in-depth understanding of photoelectrocatalytic bacterial inactivation mechanisms by tracking the decomposed building blocks.

PubMed

Sun, Hongwei; Li, Guiying; Nie, Xin; Shi, Huixian; Wong, Po-Keung; Zhao, Huijun; An, Taicheng

2014-08-19

A systematic approach was developed to understand, in-depth, the mechanisms involved during the inactivation of bacterial cells using photoelectrocatalytic (PEC) processes with Escherichia coli K-12 as the model microorganism. The bacterial cells were found to be inactivated and decomposed primarily due to attack from photogenerated H2O2. Extracellular reactive oxygen species (ROSs), such as H2O2, may penetrate into the bacterial cell and cause dramatically elevated intracellular ROSs levels, which would overwhelm the antioxidative capacity of bacterial protective enzymes such as superoxide dismutase and catalase. The activities of these two enzymes were found to decrease due to the ROSs attacks during PEC inactivation. Bacterial cell wall damage was then observed, including loss of cell membrane integrity and increased permeability, followed by the decomposition of cell envelope (demonstrated by scanning electronic microscope images). One of the bacterial building blocks, protein, was found to be oxidatively damaged due to the ROSs attacks, as well. Leakage of cytoplasm and biomolecules (bacterial building blocks such as proteins and nucleic acids) were evident during prolonged PEC inactivation process. The leaked cytoplasmic substances and cell debris could be further degraded and, ultimately, mineralized with prolonged PEC treatment.

Pathogenic flora composition and overview of the trends used for bacterial pathogenicity identifications.

PubMed

Orji, Frank Anayo; Ugbogu, Ositadinma Chinyere; Ugbogu, Eziuche Amadike; Barbabosa-Pliego, Alberto; Monroy, Jose Cedillo; Elghandour, Mona M M Y; Salem, Abdelfattah Z M

2018-05-05

Over 250 species of resident flora in the class of bacteria are known to be associated with humans. These conventional flora compositions is often determined by factors which may not be limited to genetics, age, sex, stress and nutrition of humans. Man is constantly in contact with bacteria through media such as air, water, soil and food. This paper reviews the concept of bacterial pathogenesis from the sequential point of colonization to tissue injury. The paper in addition to examination of the factors which enhance virulence in bacterial pathogens also x-rayed the concept of pathogenicity islands and the next generation approaches or rather current trends/methods used in the bacterial pathogenicity investigations. In terms of pathogenicity which of course is the capacity to cause disease in animals, requires that the attacking bacterial strain is virulent, and has ability to bypass the host immune defensive mechanisms. In order to achieve or exhibit pathogenicity, the virulence factors required by microorganisms include capsule, pigments, enzymes, iron acquisition through siderophores. Bacterial Pathogenicity Islands as a distinct concept in bacterial pathogenesis are just loci on the chromosome or extra chromosomal units which are acquired by horizontal gene transfer within pathogens in a microbial community or biofilm. In the area of laboratory investigations, bacterial pathogenesis was initially carried out using culture dependent approaches, which can only detect about 1% of human and veterinary-important pathogens. However, in the recent paradigms shift, the use of proteomics, metagenomics, phylogenetic tree analyses, spooligotyping, and finger printing etc. have made it possible that 100% of the bacterial pathogens in nature can be extensively studied. Copyright © 2018 Elsevier Ltd. All rights reserved.

Mechanisms of bacterial membrane permeabilization by crotalicidin (Ctn) and its fragment Ctn(15-34), antimicrobial peptides from rattlesnake venom.

PubMed

Pérez-Peinado, Clara; Dias, Susana Almeida; Domingues, Marco M; Benfield, Aurélie H; Freire, João Miguel; Rádis-Baptista, Gandhi; Gaspar, Diana; Castanho, Miguel A R B; Craik, David J; Henriques, Sónia Troeira; Veiga, Ana Salomé; Andreu, David

2018-02-02

Crotalicidin (Ctn), a cathelicidin-related peptide from the venom of a South American rattlesnake, possesses potent antimicrobial, antitumor, and antifungal properties. Previously, we have shown that its C-terminal fragment, Ctn(15-34), retains the antimicrobial and antitumor activities but is less toxic to healthy cells and has improved serum stability. Here, we investigated the mechanisms of action of Ctn and Ctn(15-34) against Gram-negative bacteria. Both peptides were bactericidal, killing ∼90% of Escherichia coli and Pseudomonas aeruginosa cells within 90-120 and 5-30 min, respectively. Studies of ζ potential at the bacterial cell membrane suggested that both peptides accumulate at and neutralize negative charges on the bacterial surface. Flow cytometry experiments confirmed that both peptides permeabilize the bacterial cell membrane but suggested slightly different mechanisms of action. Ctn(15-34) permeabilized the membrane immediately upon addition to the cells, whereas Ctn had a lag phase before inducing membrane damage and exhibited more complex cell-killing activity, probably because of two different modes of membrane permeabilization. Using surface plasmon resonance and leakage assays with model vesicles, we confirmed that Ctn(15-34) binds to and disrupts lipid membranes and also observed that Ctn(15-34) has a preference for vesicles that mimic bacterial or tumor cell membranes. Atomic force microscopy visualized the effect of these peptides on bacterial cells, and confocal microscopy confirmed their localization on the bacterial surface. Our studies shed light onto the antimicrobial mechanisms of Ctn and Ctn(15-34), suggesting Ctn(15-34) as a promising lead for development as an antibacterial/antitumor agent. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Activated fluid transport regulates bacterial-epithelial interactions and significantly shifts the murine colonic microbiome

PubMed Central

Keely, Simon; Kelly, Caleb J.; Weissmueller, Thomas; Burgess, Adrianne; Wagner, Brandie D.; Robertson, Charles E.; Harris, J. Kirk; Colgan, Sean P.

2012-01-01

Within the intestinal mucosa, epithelial cells serve multiple functions to partition the lumen from the lamina propria. As part of their natural function, intestinal epithelial cells actively transport electrolytes with passive water movement as a mechanism for mucosal hydration. Here, we hypothesized that electrogenic Cl- secretion, and associated mucosal hydration, influences bacterial-epithelial interactions and significantly influences the composition of the intestinal microbiota. An initial screen of different epithelial secretagogues identified lubiprostone as the most potent agonist for which to define these principles. In in vitro studies using cultured T84 cells, lubiprostone decreased E. coli translocation in a concentration-dependent manner (p < 0.001) and decreased S. typhimurium internalization and translocation by as much as 71 ± 6% (p < 0.01). Such decreases in bacterial translocation were abolished by inhibition of electrogenic Cl- secretion and water transport using the Na-K-Cl- antagonist bumetanide (p < 0.01). Extensions of these findings to microbiome analysis in vivo revealed that lubiprostone delivered orally to mice fundamentally shifted the intestinal microbiota, with notable changes within the Firmicutes and Bacteroidetes phyla of resident colonic bacteria. Such findings document a previously unappreciated role for epithelial Cl- secretion and water transport in influencing bacterial-epithelial interactions and suggest that active mucosal hydration functions as a primitive innate epithelial defense mechanism. PMID:22614705

Good neighbors make good defenses: associational refuges reduce defense investment in African savanna plants.

PubMed

Coverdale, Tyler C; Goheen, Jacob R; Palmer, Todd M; Pringle, Robert M

2018-06-25

Intraspecific variation in plant defense phenotype is common and has wide-ranging ecological consequences. Yet prevailing theories of plant defense allocation, which primarily account for interspecific differences in defense phenotype, often fail to predict intraspecific patterns. Furthermore, although individual variation in defense phenotype is often attributed to ecological interactions, few general mechanisms have been proposed to explain the ubiquity of variable defense phenotype within species. Here, we show experimentally that associational refuges and induced resistance interact to create predictable intraspecific variation in defense phenotype in African savanna plants. Physically defended species from four families (Acanthaceae, Asparagaceae, Cactaceae, and Solanaceae) growing in close association with spinescent Acacia trees had 39-78% fewer spines and thorns than did isolated conspecifics. For a subset of these species, we used a series of manipulative experiments to show that this variability is maintained primarily by a reduction in induced responses among individuals that seldom experience mammalian herbivory, whether due to association with Acacia trees or to experimental herbivore exclusion. Unassociated plants incurred 4- to 16-fold more browsing damage than did associated individuals and increased spine density by 16-38% within one month following simulated browsing. In contrast, experimental clipping induced no net change in spine density among plants growing beneath Acacia canopies or inside long-term herbivore exclosures. Associated and unassociated individuals produced similar numbers of flowers and seeds, but seedling recruitment and survival were vastly greater in refuge habitats, suggesting a net fitness benefit of association. We conclude that plant-plant associations consistently decrease defense investment in this system by reducing both the frequency of herbivory and the intensity of induced responses, and that inducible responses

A family of conserved bacterial effectors inhibits salicylic acid-mediated basal immunity and promotes disease necrosis in plants.

PubMed

DebRoy, Sruti; Thilmony, Roger; Kwack, Yong-Bum; Nomura, Kinya; He, Sheng Yang

2004-06-29

Salicylic acid (SA)-mediated host immunity plays a central role in combating microbial pathogens in plants. Inactivation of SA-mediated immunity, therefore, would be a critical step in the evolution of a successful plant pathogen. It is known that mutations in conserved effector loci (CEL) in the plant pathogens Pseudomonas syringae (the Delta CEL mutation), Erwinia amylovora (the dspA/E mutation), and Pantoea stewartii subsp. stewartii (the wtsE mutation) exert particularly strong negative effects on bacterial virulence in their host plants by unknown mechanisms. We found that the loss of virulence in Delta CEL and dspA/E mutants was linked to their inability to suppress cell wall-based defenses and to cause normal disease necrosis in Arabidopsis and apple host plants. The Delta CEL mutant activated SA-dependent callose deposition in wild-type Arabidopsis but failed to elicit high levels of callose-associated defense in Arabidopsis plants blocked in SA accumulation or synthesis. This mutant also multiplied more aggressively in SA-deficient plants than in wild-type plants. The hopPtoM and avrE genes in the CEL of P. syringae were found to encode suppressors of this SA-dependent basal defense. The widespread conservation of the HopPtoM and AvrE families of effectors in various bacteria suggests that suppression of SA-dependent basal immunity and promotion of host cell death are important virulence strategies for bacterial infection of plants.

SG2-Type R2R3-MYB Transcription Factor MYB15 Controls Defense-Induced Lignification and Basal Immunity in Arabidopsis.

PubMed

Chezem, William R; Memon, Altamash; Li, Fu-Shuang; Weng, Jing-Ke; Clay, Nicole K

2017-08-01

Lignification of cell wall appositions is a conserved basal defense mechanism in the plant innate immune response. However, the genetic pathway controlling defense-induced lignification remains unknown. Here, we demonstrate the Arabidopsis thaliana SG2-type R2R3-MYB transcription factor MYB15 as a regulator of defense-induced lignification and basal immunity. Loss of MYB15 reduces the content but not the composition of defense-induced lignin, whereas constitutive expression of MYB15 increases lignin content independently of immune activation. Comparative transcriptional and metabolomics analyses implicate MYB15 as necessary for the defense-induced synthesis of guaiacyl lignin and the basal synthesis of the coumarin metabolite scopoletin. MYB15 directly binds to the secondary wall MYB-responsive element consensus sequence, which encompasses the AC elements, to drive lignification. The myb15 and lignin biosynthetic mutants show increased susceptibility to the bacterial pathogen Pseudomonas syringae , consistent with defense-induced lignin having a major role in basal immunity. A scopoletin biosynthetic mutant also shows increased susceptibility independently of immune activation, consistent with a role in preformed defense. Our results support a role for phenylalanine-derived small molecules in preformed and inducible Arabidopsis defense, a role previously dominated by tryptophan-derived small molecules. Understanding the regulatory network linking lignin biosynthesis to plant growth and defense will help lignin engineering efforts to improve the production of biofuels and aromatic industrial products as well as increase disease resistance in energy and agricultural crops. © 2017 American Society of Plant Biologists. All rights reserved.

Butyrate Enhances Disease Resistance of Chickens by Inducing Antimicrobial Host Defense Peptide Gene Expression

PubMed Central

Sunkara, Lakshmi T.; Achanta, Mallika; Schreiber, Nicole B.; Bommineni, Yugendar R.; Dai, Gan; Jiang, Weiyu; Lamont, Susan; Lillehoj, Hyun S.; Beker, Ali; Teeter, Robert G.; Zhang, Guolong

2011-01-01

Host defense peptides (HDPs) constitute a large group of natural broad-spectrum antimicrobials and an important first line of immunity in virtually all forms of life. Specific augmentation of synthesis of endogenous HDPs may represent a promising antibiotic-alternative approach to disease control. In this study, we tested the hypothesis that exogenous administration of butyrate, a major type of short-chain fatty acids derived from bacterial fermentation of undigested dietary fiber, is capable of inducing HDPs and enhancing disease resistance in chickens. We have found that butyrate is a potent inducer of several, but not all, chicken HDPs in HD11 macrophages as well as in primary monocytes, bone marrow cells, and jejuna and cecal explants. In addition, butyrate treatment enhanced the antibacterial activity of chicken monocytes against Salmonella enteritidis, with a minimum impact on inflammatory cytokine production, phagocytosis, and oxidative burst capacities of the cells. Furthermore, feed supplementation with 0.1% butyrate led to a significant increase in HDP gene expression in the intestinal tract of chickens. More importantly, such a feeding strategy resulted in a nearly 10-fold reduction in the bacterial titer in the cecum following experimental infections with S. enteritidis. Collectively, the results indicated that butyrate-induced synthesis of endogenous HDPs is a phylogenetically conserved mechanism of innate host defense shared by mammals and aves, and that dietary supplementation of butyrate has potential for further development as a convenient antibiotic-alternative strategy to enhance host innate immunity and disease resistance. PMID:22073293

Patterned biofilm formation reveals a mechanism for structural heterogeneity in bacterial biofilms.

PubMed

Gu, Huan; Hou, Shuyu; Yongyat, Chanokpon; De Tore, Suzanne; Ren, Dacheng

2013-09-03

Bacterial biofilms are ubiquitous and are the major cause of chronic infections in humans and persistent biofouling in industry. Despite the significance of bacterial biofilms, the mechanism of biofilm formation and associated drug tolerance is still not fully understood. A major challenge in biofilm research is the intrinsic heterogeneity in the biofilm structure, which leads to temporal and spatial variation in cell density and gene expression. To understand and control such structural heterogeneity, surfaces with patterned functional alkanthiols were used in this study to obtain Escherichia coli cell clusters with systematically varied cluster size and distance between clusters. The results from quantitative imaging analysis revealed an interesting phenomenon in which multicellular connections can be formed between cell clusters depending on the size of interacting clusters and the distance between them. In addition, significant differences in patterned biofilm formation were observed between wild-type E. coli RP437 and some of its isogenic mutants, indicating that certain cellular and genetic factors are involved in interactions among cell clusters. In particular, autoinducer-2-mediated quorum sensing was found to be important. Collectively, these results provide missing information that links cell-to-cell signaling and interaction among cell clusters to the structural organization of bacterial biofilms.

Interleukin-33 Increases Antibacterial Defense by Activation of Inducible Nitric Oxide Synthase in Skin

PubMed Central

Jiang, Ziwei; Zhang, Tian; Wang, Yue; Li, Zhiheng; Wu, Yelin; Ji, Shizhao; Xiao, Shichu; Ryffel, Bernhard; Radek, Katherine A.; Xia, Zhaofan; Lai, Yuping

2014-01-01

Interleukin-33 (IL-33) is associated with multiple diseases, including asthma, rheumatoid arthritis, tissue injuries and infections. Although IL-33 has been indicated to be involved in Staphylococcus aureus (S. aureus) wound infection, little is known about how IL-33 is regulated as a mechanism to increase host defense against skin bacterial infections. To explore the underlying intricate mechanism we first evaluated the expression of IL-33 in skin from S. aureus-infected human patients. Compared to normal controls, IL-33 was abundantly increased in skin of S. aureus-infected patients. We next developed a S. aureus cutaneous infection mouse model and found that IL-33 was significantly increased in dermal macrophages of infected mouse skin. The expression of IL-33 by macrophages was induced by staphylococcal peptidoglycan (PGN) and lipoteichoic acid (LTA) via activation of toll-like receptor 2(TLR2) –mitogen-activated protein kinase (MAPK)-AKT-signal transducer and activator of transcription 3(STAT3) signaling pathway as PGN and LTA failed to induce IL-33 in Tlr2-deficient peritoneal macrophages, and MAPK,AKT, STAT3 inhibitors significantly decreased PGN- or LTA-induced IL-33. IL-33, in turn, acted on macrophages to induce microbicidal nitric oxygen (NO) release. This induction was dependent on inducible nitric oxide synthase (iNOS) activation, as treatment of macrophages with an inhibitor of iNOS, aminoguanidine, significantly decreased IL-33-induced NO release. Moreover, aminoguanidine significantly blocked the capacity of IL-33 to inhibit the growth of S. aureus, and IL-33 silencing in macrophages significantly increased the survival of S. aureus in macrophages. Furthermore, the administration of IL-33-neutralizing antibody into mouse skin decreased iNOS production but increased the survival of S. aureus in skin. These findings reveal that IL-33 can promote antimicrobial capacity of dermal macrophages, thus enhancing antimicrobial defense against skin bacterial

A new cytogenetic mechanism for bacterial endosymbiont-induced parthenogenesis in Hymenoptera

PubMed Central

Adachi-Hagimori, Tetsuya; Miura, Kazuki; Stouthamer, Richard

2008-01-01

Vertically transmitted endosymbiotic bacteria, such as Wolbachia, Cardinium and Rickettsia, modify host reproduction in several ways to facilitate their own spread. One such modification results in parthenogenesis induction, where males, which are unable to transmit the bacteria, are not produced. In Hymenoptera, the mechanism of diploidization due to Wolbachia infection, known as gamete duplication, is a post-meiotic modification. During gamete duplication, the meiotic mechanism is normal, but in the first mitosis the anaphase is aborted. The two haploid sets of chromosomes do not separate and thus result in a single nucleus containing two identical sets of haploid chromosomes. Here, we outline an alternative cytogenetic mechanism for bacterial endosymbiont-induced parthenogenesis in Hymenoptera. During female gamete formation in Rickettsia-infected Neochrysocharis formosa (Westwood) parasitoids, meiotic cells undergo only a single equational division followed by the expulsion of a single polar body. This absence of meiotic recombination and reduction corresponds well with a non-segregation pattern in the offspring of heterozygous females. We conclude that diploidy in N. formosa is maintained through a functionally apomictic cloning mechanism that differs entirely from the mechanism induced by Wolbachia. PMID:18713719

Molecular mechanics of Staphylococcus aureus adhesin, CNA, and the inhibition of bacterial adhesion by stretching collagen

PubMed Central

Madani, Ali; Garakani, Kiavash

2017-01-01

Bacterial adhesion to collagen, the most abundant protein in humans, is a critical step in the initiation and persistence of numerous bacterial infections. In this study, we explore the collagen binding mechanism of the multi-modular cell wall anchored collagen adhesin (CNA) in Staphylococcus aureus and examine how applied mechanical forces can modulate adhesion ability. The common structural-functional elements and domain organization of CNA are present across over 50 genera of bacteria. Through the use of molecular dynamics models and normal mode analysis, we shed light on the CNA’s structural and conformational dynamics and its interactions with collagen that lead to collagen binding. Our results suggest that the linker region, CNA165-173, acts as a hinge exhibiting bending, extensional, and torsional modes of structural flexibility and its residues are key in the interaction of the CNA-collagen complex. Steered molecular dynamics simulations were conducted with umbrella sampling. During the course of these simulations, the ‘locking’ latch from the CNA N2 domain was dissociated from its groove in the CNA N1 domain, implying the importance of the latch for effective ligand binding. Finally, we observed that the binding efficiency of the CNA N1-N2 domains to collagen decreases greatly with increasing tensile force application to the collagen peptides. Thus, CNA and similar adhesins might preferentially bind to sites in which collagen fibers are cleaved, such as in wounded, injured, or inflamed tissues, or in which the collagenous tissue is less mature. As alternative techniques for control of bacterial infection are in-demand due to the rise of bacterial antibiotic resistance, results from our computational studies with respect to the mechanoregulation of the collagen binding site may inspire new therapeutics and engineering solutions by mechanically preventing colonization and/or further pathogenesis. PMID:28665944

Restructuring of endophytic bacterial communities in grapevine yellows-diseased and recovered Vitis vinifera L. plants.

PubMed

Bulgari, Daniela; Casati, Paola; Crepaldi, Paola; Daffonchio, Daniele; Quaglino, Fabio; Brusetti, Lorenzo; Bianco, Piero Attilio

2011-07-01

Length heterogeneity-PCR assays, combined with statistical analyses, highlighted that the endophytic bacterial community associated with healthy grapevines was characterized by a greater diversity than that present in diseased and recovered plants. The findings suggest that phytoplasmas can restructure the bacterial community by selecting endophytic strains that could elicit a plant defense response.

Biofilm-mediated Antibiotic-resistant Oral Bacterial Infections: Mechanism and Combat Strategies.

PubMed

Kanwar, Indulata; Sah, Abhishek K; Suresh, Preeti K

2017-01-01

Oral diseases like dental caries and periodontal disease are directly associated with the capability of bacteria to form biofilm. Periodontal diseases have been associated to anaerobic Gram-negative bacteria forming a subgingival plaque (Porphyromonas gingivalis, Actinobacillus, Prevotella and Fusobacterium). Biofilm is a complex bacterial community that is highly resistant to antibiotics and human immunity. Biofilm communities are the causative agents of biological developments such as dental caries, periodontitis, peri-implantitis and causing periodontal tissue breakdown. The review recapitulates the latest advancements in treatment of clinical biofilm infections and scientific investigations, while these novel anti-biofilm strategies are still in nascent phases of development, efforts dedicated to these technologies could ultimately lead to anti-biofilm therapies that are superior to the current antibiotic treatment. This paper provides a review of the literature focusing on the studies on biofilm in the oral cavity, formation of dental plaque biofilm, drug resistance of bacterial biofilm and the antibiofilm approaches as biofilm preventive agents in dentistry, and their mechanism of biofilm inhibition. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Irradiation influence on the phenoloxidase pathway and an anti-oxidant defense mechanism in Spodoptera litura (Lepidoptera: Noctuidae) and its implication in radio-genetic 'F 1 sterility' and biorational pest suppression tactics.

PubMed

Sachdev, B; Khan, Z; Zarin, M; Malhotra, P; Seth, R K; Bhatnagar, R K

2017-06-01

The present study was conducted to appraise the ontogenic radio-sensitivity of a serious tropical pest, Spodoptera litura (Fabr.). The molecular responses pertaining to the phenoloxidase (PO) pathway and an anti-oxidant defense mechanism were evaluated in order to understand its implication in pest control at pre-harvest and post-harvest intervals. Irradiation exhibited an inverse relationship with age with respect to impact on developmental and transcriptional responses. Transcript abundance of PO cascade enzymes, prophenoloxidase (slppo-2), its activating enzyme (slppae-1) and free-radical scavenging enzymes, superoxide dismutase (slsod) and catalase (slcat) was evaluated upon gamma irradiation alone and the dual-stress of radiation plus microbial challenge. The slppo-2, slppae-1, slsod and slcat transcripts were significantly up-regulated in F 1 L6 larvae (6th-instar) resulting from 100 Gy sub-sterilized male adults and unirradiated female moths. The extent of upregulation was relatively higher in comparison with L6 survivors (6th-instar larvae) developed from irradiated neonates (L1) treated with 100 Gy. Upon Photorhabdus challenge, the transcripts were down-regulated in irradiated L1 suggesting increased larval susceptibility to bacterial infections. Radioresistance increased with the age of the insect, and molecular responses (transcript abundance) of insect defense mechanism were less influenced when older age (F 1 progeny) were irradiated. These findings will help to optimize the gamma dose to be employed in inherited sterility technique for (pre-harvest) pest suppression and (post-harvest) phytosanitation and quarantine, and suggest compatible integration of biorational tactics including nuclear technology.

CRISPR interference can prevent natural transformation and virulence acquisition during in vivo bacterial infection.

PubMed

Bikard, David; Hatoum-Aslan, Asma; Mucida, Daniel; Marraffini, Luciano A

2012-08-16

Pathogenic bacterial strains emerge largely due to transfer of virulence and antimicrobial resistance genes between bacteria, a process known as horizontal gene transfer (HGT). Clustered, regularly interspaced, short palindromic repeat (CRISPR) loci of bacteria and archaea encode a sequence-specific defense mechanism against bacteriophages and constitute a programmable barrier to HGT. However, the impact of CRISPRs on the emergence of virulence is unknown. We programmed the human pathogen Streptococcus pneumoniae with CRISPR sequences that target capsule genes, an essential pneumococcal virulence factor, and show that CRISPR interference can prevent transformation of nonencapsulated, avirulent pneumococci into capsulated, virulent strains during infection in mice. Further, at low frequencies bacteria can lose CRISPR function, acquire capsule genes, and mount a successful infection. These results demonstrate that CRISPR interference can prevent the emergence of virulence in vivo and that strong selective pressure for virulence or antibiotic resistance can lead to CRISPR loss in bacterial pathogens. Copyright © 2012 Elsevier Inc. All rights reserved.

Role and mechanism of the Hsp70 molecular chaperone machines in bacterial pathogens.

PubMed

Ghazaei, Ciamak

2017-03-01

Heat shock proteins are highly conserved, stress-inducible, ubiquitous proteins that maintain homeostasis in both eukaryotes and prokaryotes. Hsp70 proteins belong to the heat shock protein family and enhance bacterial survival in hostile environments. Hsp70, known as DnaK in prokaryotes, supports numerous processes such as the assembly and disassembly of protein complexes, the refolding of misfolded and clustered proteins, membrane translocation and the regulation of regulatory proteins. The chaperone-based activity of Hsp70 depends on dynamic interactions between its two domains, known as the ATPase domain and the substrate-binding domain. It also depends on interactions between these domains and other co-chaperone molecules such as the Hsp40 protein family member DnaJ and nucleotide exchange factors. DnaJ is the primary chaperone that interacts with nascent polypeptide chains and functions to prevent their premature release from the ribosome and misfolding before it is targeted by DnaK. Adhesion of bacteria to host cells is mediated by both host and bacterial Hsp70. Following infection of the host, bacterial Hsp70 (DnaK) is in a position to initiate bacterial survival processes and trigger an immune response by the host. Any mutations in the dnaK gene have been shown to decrease the viability of bacteria inside the host. This review will give insights into the structure and mechanism of Hsp70 and its role in regulating the protein activity that contributes to pathogenesis.

Insights into the Antimicrobial Mechanism of Action of Human RNase6: Structural Determinants for Bacterial Cell Agglutination and Membrane Permeation

PubMed Central

Pulido, David; Arranz-Trullén, Javier; Prats-Ejarque, Guillem; Velázquez, Diego; Torrent, Marc; Moussaoui, Mohammed; Boix, Ester

2016-01-01

Human Ribonuclease 6 is a secreted protein belonging to the ribonuclease A (RNaseA) superfamily, a vertebrate specific family suggested to arise with an ancestral host defense role. Tissue distribution analysis revealed its expression in innate cell types, showing abundance in monocytes and neutrophils. Recent evidence of induction of the protein expression by bacterial infection suggested an antipathogen function in vivo. In our laboratory, the antimicrobial properties of the protein have been evaluated against Gram-negative and Gram-positive species and its mechanism of action was characterized using a membrane model. Interestingly, our results indicate that RNase6, as previously reported for RNase3, is able to specifically agglutinate Gram-negative bacteria as a main trait of its antimicrobial activity. Moreover, a side by side comparative analysis with the RN6(1–45) derived peptide highlights that the antimicrobial activity is mostly retained at the protein N-terminus. Further work by site directed mutagenesis and structural analysis has identified two residues involved in the protein antimicrobial action (Trp1 and Ile13) that are essential for the cell agglutination properties. This is the first structure-functional characterization of RNase6 antimicrobial properties, supporting its contribution to the infection focus clearance. PMID:27089320

Role of SIRT1 in heat stress- and lipopolysaccharide-induced immune and defense gene expression in human dental pulp cells.

PubMed

Lee, Sang-Im; Min, Kyung-San; Bae, Won-Jung; Lee, Young-Man; Lee, So-Youn; Lee, Eui-Suk; Kim, Eun-Cheol

2011-11-01

Although bacterial infection and heat stress are common causes of injury in human dental pulp cells (HDPCs), little is known about the potential defense mechanisms mediating their effects. This study examined the role of SIRT1 in mediating heat stress and lipopolysaccharide (LPS)-induced immune and defense gene expression in HDPCs. HDPCs were exposed to heat stress (42°C) for 30 minutes after stimulation with LPS (1 μg/mL) for 48 hours. The expression of defense genes was evaluated by reverse-transcriptase polymerase chain reaction, Western blotting, and enzyme-linked immunosorbent assay. LPS and heat stress synergistically increased the expression of SIRT1 and immune and defense genes such as interleukin (IL)-8, hemeoxygenase-1 (HO-1), and human β-defensin 2 (hBD-2). Resveratrol enhanced LPS- and heat stress-induced expression of HO-1 and hBD-2 but reduced IL-8 messenger RNA levels. The stimulation of HO-1 and hBD-2 messenger RNA expression by LPS and heat stress was inhibited by sirtinol; SIRT1 small interfering RNA; and inhibitors of p38, ERK, JNK, and nuclear factor κB. These results show for the first time that SIRT1 mediates the induction of immune and defense gene expression in HDPCs by LPS and heat stress. SIRT1 may play a pivotal role in host immune defense system in HDPCS. Copyright © 2011 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Nuclear factor 45 of tongue sole (Cynoglossus semilaevis): evidence for functional differentiation between two isoforms in immune defense against viral and bacterial pathogens.

PubMed

Chi, Heng; Hu, Yong-hua; Xiao, Zhi-zhong; Sun, Li

2014-02-01

Nuclear factor 45 (NF45) is known to play an important role in regulating interleukin-2 expression in mammals. The function of fish NF45 is largely unknown. In a previous study, we reported the identification of a NF45 (named CsNF45) from half smooth tongue sole (Cynoglossus semilaevis). In the present study, we identified an isoform of CsNF45 (named CsNF45i) from half smooth tongue sole and examined its biological properties in comparison with CsNF45. We found that CsNF45i is a truncated version of CsNF45 and lacks the N-terminal 38 residues of CsNF45. Genetic analysis showed that the CsNF45 gene consists of 14 exons and 13 introns, and that CsNF45 and CsNF45i are the products of alternative splicing. Constitutive expression of CsNF45 and CsNF45i occurred in multiple tissues but differed in patterns. Experimental infection with viral and bacterial pathogens upregulated the expression of both isoforms but to different degrees, with potent induction of CsNF45 being induced by bacterial pathogen, while dramatic induction of CsNF45i being induced by viral pathogen. Transient transfection analysis showed that both isoforms were localized in the nucleus and able to stimulate the activity of IL-2 promoter to comparable extents. To examine their in vivo effects, the two isoforms were overexpressed in tongue sole. Subsequent analysis showed that following viral and bacterial infection, the viral loads in CsNF45i-overexpressing fish were significantly lower than those in CsNF45-overexpressing fish, whereas the bacterial loads in CsNF45-overexpressing fish were significantly lower than those in CsNF45i-overexpressing fish. These results indicate that both CsNF45 and CsNF45i possess immunoregulatory properties, however, the two isoforms most likely participate in different aspects of host immune defense that target different pathogens. Copyright © 2013 Elsevier Ltd. All rights reserved.

Involvement of Pacific oyster CgPGRP-S1S in bacterial recognition, agglutination and granulocyte degranulation.

PubMed

Iizuka, Masao; Nagasaki, Toshihiro; Takahashi, Keisuke G; Osada, Makoto; Itoh, Naoki

2014-03-01

Peptidoglycan recognition protein (PGRP) recognizes invading bacteria through their peptidoglycans (PGN), a component of the bacterial cell wall. Insect PGRPs contribute to effective immune systems as inducers of other host defense responses, while this function has not been reported from PGRP of bivalves. In this study, recombinant CgPGRP-S1S (rCgPGRP-S1S), produced in the mantle and the gill, was synthesized and used to elucidate the immunological function of CgPGRP-S1S. rCgPGRP-S1S bound specifically to DAP-type PGN and to Escherichia coli cells, but not to other DAP-type PGN-containing bacterial species, Vibrio anguillarum, or Bacillus subtilis. Antibacterial activity was not detected, but E. coli cells were agglutinated. Moreover, in addition to these direct interactions with bacterial cells, rCgPGRP-S1S induced secretion of granular contents by hemocyte degranulation. Taken together, these results suggest for the first time that a PGRP of bivalves is, just as in insects, involved in host defense, not only by direct interaction with bacteria, but also by triggering other defense pathways. Copyright © 2013 Elsevier Ltd. All rights reserved.

Bacterial metabolism of environmental arsenic--mechanisms and biotechnological applications.

PubMed

Kruger, Martin C; Bertin, Philippe N; Heipieper, Hermann J; Arsène-Ploetze, Florence

2013-05-01

Arsenic causes threats for environmental and human health in numerous places around the world mainly due to its carcinogenic potential at low doses. Removing arsenic from contaminated sites is hampered by the occurrence of several oxidation states with different physicochemical properties. The actual state of arsenic strongly depends on its environment whereby microorganisms play important roles in its geochemical cycle. Due to its toxicity, nearly all organisms possess metabolic mechanisms to resist its hazardous effects, mainly by active extrusion, but also by extracellular precipitation, chelation, and intracellular sequestration. Some microbes are even able to actively use various arsenic compounds in their metabolism, either as an electron donor or as a terminal electron acceptor for anaerobic respiration. Some microorganisms can also methylate inorganic arsenic, probably as a resistance mechanism, or demethylate organic arsenicals. Bioavailability of arsenic in water and sediments is strongly influenced by such microbial activities. Therefore, understanding microbial reactions to arsenic is of importance for the development of technologies for improved bioremediation of arsenic-contaminated waters and environments. This review gives an overview of the current knowledge on bacterial interactions with arsenic and on biotechnologies for its detoxification and removal.

Combined effects of zooplankton grazing and dispersal on the diversity and assembly mechanisms of bacterial metacommunities.

PubMed

Berga, Mercè; Östman, Örjan; Lindström, Eva S; Langenheder, Silke

2015-07-01

Effects of dispersal and the presence of predators on diversity, assembly and functioning of bacterial communities are well studied in isolation. In reality, however, dispersal and trophic interactions act simultaneously and can therefore have combined effects, which are poorly investigated. We performed an experiment with aquatic metacommunities consisting of three environmentally different patches and manipulated dispersal rates among them as well as the presence or absence of the keystone species Daphnia magna. Daphnia magna reduced both local and regional diversity, whereas dispersal increased local diversity but decreased beta-diversity having no net effect on regional diversity. Dispersal modified the assembly mechanisms of bacterial communities by increasing the degree of determinism. Additionally, the combination of the D. magna and dispersal increased the importance of deterministic processes, presumably because predator-tolerant taxa were spread in the metacommunity via dispersal. Moreover, the presence of D. magna affected community composition, increased community respiration rates but did not affect bacterial production or abundance, whereas dispersal slightly increased bacterial production. In conclusion, our study suggests that predation by a keystone species such as D. magna and dispersal additively influence bacterial diversity, assembly processes and ecosystem functioning. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

Regulation of defensive function on gingival epithelial cells can prevent periodontal disease.

PubMed

Fujita, Tsuyoshi; Yoshimoto, Tetsuya; Kajiya, Mikihito; Ouhara, Kazuhisa; Matsuda, Shinji; Takemura, Tasuku; Akutagawa, Keiichi; Takeda, Katsuhiro; Mizuno, Noriyoshi; Kurihara, Hidemi

2018-05-01

Periodontal disease is a bacterial biofilm-associated inflammatory disease that has been implicated in many systemic diseases. A new preventive method for periodontal disease needs to be developed in order to promote the health of the elderly in a super-aged society. The gingival epithelium plays an important role as a mechanical barrier against bacterial invasion and a part of the innate immune response to infectious inflammation in periodontal tissue. The disorganization of cell-cell interactions and subsequent inflammation contribute to the initiation of periodontal disease. These make us consider that regulation of host defensive functions, epithelial barrier and neutrophil activity, may become novel preventive methods for periodontal inflammation. Based on this concept, we have found that several agents regulate the barrier function of gingival epithelial cells and suppress the accumulation of neutrophils in the gingival epithelium. We herein introduce the actions of irsogladine maleate, azithromycin, amphotericin B, and Houttuynia cordata (dokudami in Japanese), which is commonly used in traditional medicine, on the epithelial barrier and neutrophil migration in gingival epithelial cells in vivo and in vitro , in order to provide support for the clinical application of these agents to the prevention of periodontal inflammation.

OsLYP4 and OsLYP6 play critical roles in rice defense signal transduction.

PubMed

Liu, Bing; Li, Jian-Feng; Ao, Ying; Li, Zhangqun; Liu, Jun; Feng, Dongru; Qi, Kangbiao; He, Yanming; Zeng, Liexian; Wang, Jinfa; Wang, Hong-Bin

2013-02-01

Plant innate immunity relies on successful detection of trespassing pathogens through recognizing their microbe-associated molecular patterns (MAMPs) by pattern recognition receptors (PRRs) at the cell surface. We recently reported two rice lysin motif (LysM)-containing proteins, OsLYP4 and OsLYP6, as dual functional PRRs sensing bacterial peptidoglycan (PGN) and fungal chitin. Here we further demonstrated the important roles of OsLYP4 and OsLYP6 in rice defense signaling, as silencing of either LYP impaired the defense marker gene activation induced by either bacterial pathogen Xanthomonas oryzaecola or fungal pathogen Magnaporthe oryzae. Moreover, we found that OsLYP4 and OsLYP6 could form homo- and hetero-dimers, and could interact with CEBiP, suggesting an unexpected complexity of chitin perception in rice.

Restructuring of Endophytic Bacterial Communities in Grapevine Yellows-Diseased and Recovered Vitis vinifera L. Plants ▿

PubMed Central

Bulgari, Daniela; Casati, Paola; Crepaldi, Paola; Daffonchio, Daniele; Quaglino, Fabio; Brusetti, Lorenzo; Bianco, Piero Attilio

2011-01-01

Length heterogeneity-PCR assays, combined with statistical analyses, highlighted that the endophytic bacterial community associated with healthy grapevines was characterized by a greater diversity than that present in diseased and recovered plants. The findings suggest that phytoplasmas can restructure the bacterial community by selecting endophytic strains that could elicit a plant defense response. PMID:21622794

Pipecolic acid, an endogenous mediator of defense amplification and priming, is a critical regulator of inducible plant immunity.

PubMed

Návarová, Hana; Bernsdorff, Friederike; Döring, Anne-Christin; Zeier, Jürgen

2012-12-01

Metabolic signals orchestrate plant defenses against microbial pathogen invasion. Here, we report the identification of the non-protein amino acid pipecolic acid (Pip), a common Lys catabolite in plants and animals, as a critical regulator of inducible plant immunity. Following pathogen recognition, Pip accumulates in inoculated Arabidopsis thaliana leaves, in leaves distal from the site of inoculation, and, most specifically, in petiole exudates from inoculated leaves. Defects of mutants in AGD2-LIKE DEFENSE RESPONSE PROTEIN1 (ALD1) in systemic acquired resistance (SAR) and in basal, specific, and β-aminobutyric acid-induced resistance to bacterial infection are associated with a lack of Pip production. Exogenous Pip complements these resistance defects and increases pathogen resistance of wild-type plants. We conclude that Pip accumulation is critical for SAR and local resistance to bacterial pathogens. Our data indicate that biologically induced SAR conditions plants to more effectively synthesize the phytoalexin camalexin, Pip, and salicylic acid and primes plants for early defense gene expression. Biological priming is absent in the pipecolate-deficient ald1 mutants. Exogenous pipecolate induces SAR-related defense priming and partly restores priming responses in ald1. We conclude that Pip orchestrates defense amplification, positive regulation of salicylic acid biosynthesis, and priming to guarantee effective local resistance induction and the establishment of SAR.

Marijuana usage in relation to harmfulness ratings, perceived likelihood of negative consequences, and defense mechanisms in high school students.

PubMed

Como-Lesko, N; Primavera, L H; Szeszko, P R

1994-08-01

This study investigated high school students' marijuana usage patterns in relation to their harmfulness ratings of 15 licit and illicit drugs, perceived negative consequences from using marijuana, and types of defense mechanisms employed. Subjects were classified into one of five pattern-of-use groups based on marijuana usage: principled nonusers, nonusers, light users, moderate users, and heavy users. Principled nonusers (individuals who have never used marijuana and would not do so if it was legalized) rated marijuana, hashish, cocaine, and alcohol as significantly more harmful than heavy users. A cluster analysis of the drugs' harmfulness ratings best fit a three cluster solution and were named medicinal drugs, recreational drugs, and hard drugs. In general, principled nonusers rated negative consequences from using marijuana as significantly more likely to occur than other groups. Principled nonusers and heavy users utilized reversal from the Defense Mechanism Inventory, which includes repression and denial, significantly more than nonusers, indicating some trait common to the two extreme pattern-of-use groups.

Roles of small RNAs in the immune defense mechanisms of crustaceans.

PubMed

He, Yaodong; Ju, Chenyu; Zhang, Xiaobo

2015-12-01

Small RNAs, 21-24 nucleotides in length, are non-coding RNAs found in most multicellular organisms, as well as in some viruses. There are three main types of small RNAs including microRNA (miRNA), small-interfering RNA (siRNA), and piwi-interacting RNA (piRNA). Small RNAs play key roles in the genetic regulation of eukaryotes; at least 50% of all eukaryote genes are the targets of small RNAs. In recent years, studies have shown that some unique small RNAs are involved in the immune response of crustaceans, leading to lower or higher immune responses to infections and diseases. SiRNAs could be used as therapy for virus infection. In this review, we provide an overview of the diverse roles of small RNAs in the immune defense mechanisms of crustaceans. Copyright © 2015 Elsevier Ltd. All rights reserved.

Pipecolic acid enhances resistance to bacterial infection and primes salicylic acid and nicotine accumulation in tobacco

PubMed Central

Vogel-Adghough, Drissia; Stahl, Elia; Návarová, Hana; Zeier, Jürgen

2013-01-01

Distinct amino acid metabolic pathways constitute integral parts of the plant immune system. We have recently identified pipecolic acid (Pip), a lysine-derived non-protein amino acid, as a critical regulator of systemic acquired resistance (SAR) and basal immunity to bacterial infection in Arabidopsis thaliana. In Arabidopsis, Pip acts as an endogenous mediator of defense amplification and priming. For instance, Pip conditions plants for effective biosynthesis of the phenolic defense signal salicylic acid (SA), accumulation of the phytoalexin camalexin, and expression of defense-related genes. Here, we show that tobacco plants respond to leaf infection by the compatible bacterial pathogen Pseudomonas syringae pv tabaci (Pstb) with a significant accumulation of several amino acids, including Lys, branched-chain, aromatic, and amide group amino acids. Moreover, Pstb strongly triggers, alongside the biosynthesis of SA and increases in the defensive alkaloid nicotine, the production of the Lys catabolites Pip and α-aminoadipic acid. Exogenous application of Pip to tobacco plants provides significant protection to infection by adapted Pstb or by non-adapted, hypersensitive cell death-inducing P. syringae pv maculicola. Pip thereby primes tobacco for rapid and strong accumulation of SA and nicotine following bacterial infection. Thus, our study indicates that the role of Pip as an amplifier of immune responses is conserved between members of the rosid and asterid groups of eudicot plants and suggests a broad practical applicability for Pip as a natural enhancer of plant disease resistance. PMID:24025239

Association between enzymatic and non-enzymatic antioxidant defense mechanism with apolipoprotein E genotypes in Alzheimer disease.

PubMed

Kharrazi, Hadi; Vaisi-Raygani, Asad; Rahimi, Zohreh; Tavilani, Haidar; Aminian, Mahdi; Pourmotabbed, Tayebeh

2008-08-01

There are evidence suggesting that APOE-varepsilon4 allele play an important role in the pathogenesis of Alzheimer's disease (AD) by reducing peripheral levels and activities of a broad spectrum of nonenzymatic and enzymatic antioxidants systems. However, the link between APOE genotype, oxidative stress, and AD has yet to be established. In this study we examined whether antioxidant defense mechanism exacerbates the risk of AD in individual carrying APOE-varepsilon4 allele in a population from Tehran, Iran. We determined the enzymatic activities of the erythrocyte Cu-Zn superoxide dismutase (Cu-Zn SOD), glutathione peroxidase (GSH-Px), catalase (CAT) and serum level of total antioxidant status(TAS) in various APOE genotypes in 91 patients with AD and 91 healthy subjects as control group (age and sex-matched). The results showed that the TAS level and the activities of enzymatic antioxidants CAT and GSH-Px were significantly lower and the SOD activity was significantly higher in AD patients compared to controls. The AD patients with APOE-varepsilon4 allele genotype had significantly lower serum TAS concentration and lower erythrocytes GSH-Px and CAT activities (p=0.001) but significantly higher erythrocytes Cu-Zn SOD activity (p=0.001) than the non-APOE-varepsilon4 carrier AD and the control group. In addition, the association observed between the factors involved in an antioxidant defense mechanism and APOE-varepsilon4 allele in AD increased with age of the subjects. These data indicate that the reduced serum level of TAS and activity of CAT, GSH-Px and increased SOD exacerbate the risk of AD in individuals carrying APOE-varepsilon4 allele. The reduced antioxidants defense in APOE-varepsilon4 allele carrier may contribute to beta-amyloidosis. This effect, however, is more pronounced in the AD patients older than 75 years of age. This suggests that a therapeutic modality should be considered for these subjects.

Endophyte-Mediated Modulation of Defense-Related Genes and Systemic Resistance in Withania somnifera (L.) Dunal under Alternaria alternata Stress.

PubMed

Mishra, Aradhana; Singh, Satyendra Pratap; Mahfooz, Sahil; Singh, Surendra Pratap; Bhattacharya, Arpita; Mishra, Nishtha; Nautiyal, C S

2018-04-15

Endophytes have been explored and found to perform an important role in plant health. However, their effects on the host physiological function and disease management remain elusive. The present study aimed to assess the potential effects of endophytes, singly as well as in combination, in Withania somnifera (L.) Dunal, on various physiological parameters and systemic defense mechanisms against Alternaria alternata Seeds primed with the endophytic bacteria Bacillus amyloliquefaciens and Pseudomonas fluorescens individually and in combination demonstrated an enhanced vigor index and germination rate. Interestingly, plants treated with the two-microbe combination showed the lowest plant mortality rate (28%) under A. alternata stress. Physiological profiling of treated plants showed improved photosynthesis, respiration, transpiration, and stomatal conductance under pathogenic stress. Additionally, these endophytes not only augmented defense enzymes and antioxidant activity in treated plants but also enhanced the expression of salicylic acid- and jasmonic acid-responsive genes in the stressed plants. Reductions in reactive oxygen species (ROS) and reactive nitrogen species (RNS) along with enhanced callose deposition in host plant leaves corroborated well with the above findings. Altogether, the study provides novel insights into the underlying mechanisms behind the tripartite interaction of endophyte- A. alternata - W. somnifera and underscores their ability to boost plant health under pathogen stress. IMPORTANCE W. somnifera is well known for producing several medicinally important secondary metabolites. These secondary metabolites are required by various pharmaceutical sectors to produce life-saving drugs. However, the cultivation of W. somnifera faces severe challenge from leaf spot disease caused by A. alternata To keep pace with the rising demand for this plant and considering its capacity for cultivation under field conditions, the present study was undertaken

Bacterial Serine/Threonine Protein Kinases in Host-Pathogen Interactions*

PubMed Central

Canova, Marc J.; Molle, Virginie

2014-01-01

In bacterial pathogenesis, monitoring and adapting to the dynamically changing environment in the host and an ability to disrupt host immune responses are critical. The virulence determinants of pathogenic bacteria include the sensor/signaling proteins of the serine/threonine protein kinase (STPK) family that have a dual role of sensing the environment and subverting specific host defense processes. STPKs can sense a wide range of signals and coordinate multiple cellular processes to mount an appropriate response. Here, we review some of the well studied bacterial STPKs that are essential virulence factors and that modify global host responses during infection. PMID:24554701

Bacterial serine/threonine protein kinases in host-pathogen interactions.

PubMed

Canova, Marc J; Molle, Virginie

2014-04-04

In bacterial pathogenesis, monitoring and adapting to the dynamically changing environment in the host and an ability to disrupt host immune responses are critical. The virulence determinants of pathogenic bacteria include the sensor/signaling proteins of the serine/threonine protein kinase (STPK) family that have a dual role of sensing the environment and subverting specific host defense processes. STPKs can sense a wide range of signals and coordinate multiple cellular processes to mount an appropriate response. Here, we review some of the well studied bacterial STPKs that are essential virulence factors and that modify global host responses during infection.

Self-defense of Escherichia coli against damages caused by nanoalumina.

PubMed

Ma, Jing; Kang, Meiling; Zhang, Yingxia; Guo, Xuan; Tian, Zhongjing; Ding, Chengshi; Wang, Hongmei

2017-10-01

Although studies showed effects of nanoalumina (nano-Al 2 O 3 ) on Escherichia coli, no study completely provides understanding on how bacterial cells respond to damages, especially on how they initiate self-defense. In this study, we showed three types of responses of E. coli to damages caused by nano-Al 2 O 3 . Live, dead, and injured, bacteria showed improved survival rates reaching 104%, 116%, and 104% after exposure to 0.1, 1, and 10mmol/L of nano-Al 2 O 3 respectively. Survival rates improved from 100% to 114%, corresponding to an exposure time of 0-9h, and from 100% to 127%, corresponding to 0-1000μg/L Al 3+ . Improvements were noted in survival rates of E. coli K12 MG1655, HB101, DH5α, and K12 MG1655 △lexA treated by nano-Al 2 O 3 in Luria-Bertani (LB) exposure system or K12 MG1655 in LB, normal saline(NS) and H 2 O exposure system. Bacterial cells transformed from long rods to ellipsoidal or nearly spherical as form of self-preservation mechanism; this phenomenon may be related to changes in membrane potential induced by free Al 3+ released from nano-Al 2 O 3 particles. Molecular mechanism of this response involved inhibited gene expression of sythesis and metabolism of carbohydrates, lipids and proteins. Findings presented in this study may improve understanding of potential danger of nanomaterials and control their spread to environmen. Copyright © 2017 Elsevier B.V. All rights reserved.

Survival and interaction of Escherichia coli O104:H4 on Arabidopsis thaliana and lettuce (Lactuca sativa) in comparison to E. coli O157:H7: Influence of plant defense response and bacterial capsular polysaccharide.

PubMed

Jang, Hyein; Matthews, Karl R

2018-06-01

Shiga toxin-producing Escherichia coli (STEC) has been associated with illnesses and outbreaks linked to fresh vegetables, prompting a growing public health concern. Most studies regarding interactions of STEC on fresh produce focused on E. coli O157:H7. Limited information is available about survival or fitness of E. coli O104:H4, non-O157 pathogen that was linked to one of the largest outbreaks of hemolytic uremic syndrome in 2011. In this study, survival of E. coli O104:H4 was evaluated on Arabidopsis thaliana plant and lettuce for 5 days compared with E. coli O157:H7, and expression of pathogenesis-realted gene (PR1; induction of plant defense response) was examined by reverse transcription quantitative PCR, and potential influence of capsular polysaccharide (CPS) on the bacterial fitness on plant was investigated. Populations of E. coli O104:H4 strains (RG1, C3493, and LpfA) on Arabidopsis and lettuce were significantly (P < 0.05) greater than those of E. coli O157:H7 strains (7386 and sakai) at day 5 post-inoculation, indicating E. coli O104:H4 may have better survival ability on the plants. In addition, the E. coli O104:H4 strains produced significantly (P < 0.05) higher amounts of CPS compared with the E. coli O157:H7 strains. RG1 strain (1.5-fold) initiated significantly (P < 0.05) lower expression of PR1 gene indicating induction of plant defense response compared with E. coli O157:H7 strains 7386 (2.9-fold) and sakai (2.7-fold). Collectively, the results in this study suggests that different level of CPS production and plant defense response initiated by each STEC strain might influence the bacterial survival or persistence on plants. The present study provides better understanding of survival behavior of STEC, particularly E. coli O104:H4, using a model plant and vegetable under pre-harvest conditions with plant defense response. Copyright © 2018 Elsevier Ltd. All rights reserved.

Chemical and Mechanical Defenses Vary among Maternal Lines and Leaf Ages in Verbascum thapsus L. (Scrophulariaceae) and Reduce Palatability to a Generalist Insect

PubMed Central

Alba, Christina; Bowers, M. Deane; Blumenthal, Dana; Hufbauer, Ruth A.

2014-01-01

Intra-specific variation in host-plant quality affects herbivore foraging decisions and, in turn, herbivore foraging decisions mediate plant fitness. In particular, variation in defenses against herbivores, both among and within plants, shapes herbivore behavior. If variation in defenses is genetically based, it can respond to natural selection by herbivores. We quantified intra-specific variation in iridoid glycosides, trichome length, and leaf strength in common mullein (Verbascum thapsus L, Scrophulariaceae) among maternal lines within a population and among leaves within plants, and related this variation to feeding preferences of a generalist herbivore, Trichopulsia ni Hübner. We found significant variation in all three defenses among maternal lines, with T. ni preferring plants with lower investment in chemical, but not mechanical, defense. Within plants, old leaves had lower levels of all defenses than young leaves, and were strongly preferred by T. ni. Caterpillars also preferred leaves with trichomes removed to leaves with trichomes intact. Differences among maternal lines indicate that phenotypic variation in defenses likely has a genetic basis. Furthermore, these results reveal that the feeding behaviors of T. ni map onto variation in plant defense in a predictable way. This work highlights the importance of variation in host-plant quality in driving interactions between plants and their herbivores. PMID:25127229

Receptors, mediators, and mechanisms involved in bacterial sepsis and septic shock.

PubMed

Van Amersfoort, Edwin S; Van Berkel, Theo J C; Kuiper, Johan

2003-07-01

Bacterial sepsis and septic shock result from the overproduction of inflammatory mediators as a consequence of the interaction of the immune system with bacteria and bacterial wall constituents in the body. Bacterial cell wall constituents such as lipopolysaccharide, peptidoglycans, and lipoteichoic acid are particularly responsible for the deleterious effects of bacteria. These constituents interact in the body with a large number of proteins and receptors, and this interaction determines the eventual inflammatory effect of the compounds. Within the circulation bacterial constituents interact with proteins such as plasma lipoproteins and lipopolysaccharide binding protein. The interaction of the bacterial constituents with receptors on the surface of mononuclear cells is mainly responsible for the induction of proinflammatory mediators by the bacterial constituents. The role of individual receptors such as the toll-like receptors and CD14 in the induction of proinflammatory cytokines and adhesion molecules is discussed in detail. In addition, the roles of a number of other receptors that bind bacterial compounds such as scavenger receptors and their modulating role in inflammation are described. Finally, the therapies for the treatment of bacterial sepsis and septic shock are discussed in relation to the action of the aforementioned receptors and proteins.

Bacterial colonization of penile prosthesis after its withdrawal due to mechanical failure.

PubMed

Etcheverry-Giadrosich, B; Torremadé-Barreda, J; Pujol-Galarza, L; Vigués-Julià, F

2017-12-01

Prosthetic surgery to treat erectile dysfunction has a risk of infection of up to 3%, but this risk can increase to 18% when the surgery involves replacement. This increased risk of infection is attributed to the bacterial colonization of the prosthesis during the initial surgery. To analyse the presence of germs in the prosthesis that is withdrawn due to mechanical failure (not infection), as well as the surgical results and its progression. A retrospective study was conducted of all replacements performed between 2013 and 2016 at a single centre. We analysed demographic data, prior type of prosthesis, surgical procedure, microbiological study and follow-up. Of the 12 replacement procedures, a microbiological study of the extracted prosthesis was performed in a total of 10 cases. Of the 10 replacements, the cultures were positive in 5 cases (50%). Staphylococcus epidermidis was the most prevalent germ. All patients underwent a flushing procedure, and an antibiotic-coated prosthesis was implanted. We recorded no infections with the new implanted device after a mean follow-up of 27.33 months (SD 4.13; 95% CI 18.22-36.43). In our study population, we observed a high rate of bacterial colonization of the prostheses that were replaced due to mechanical failure. When a flushing procedure was performed during the replacement surgery, there were no more infections than those reported in treatment-naive cases. Copyright © 2017 AEU. Publicado por Elsevier España, S.L.U. All rights reserved.

Defensive functioning of homeless youth in relation to experiences of child maltreatment and cumulative victimization.

PubMed

Mounier, Carrie; Andujo, Estela

2003-10-01

To determine the relationship between use of defense mechanisms and experiences of child maltreatment and cumulative victimization among homeless youth. Twenty-five homeless youth were individually interviewed regarding their victimization experiences and coping strategies. Use of defense mechanisms was assessed using the Defense Mechanism Rating Scale. Relationships were demonstrated between use of defenses and specific as well as cumulative victimization experiences. All levels of defenses became more pervasive in response to victimization, but this was not a predictor of overall immature defensive functioning. Clinical and program interventions to engage homeless youth need to incorporate an understanding of the relationship between defenses and victimization in order to be effective in maximizing upon the strengths of this population.

Evolution of antibiotic resistance is linked to any genetic mechanism affecting bacterial duration of carriage

PubMed Central

Lehtinen, Sonja; Blanquart, François; Croucher, Nicholas J.; Turner, Paul; Lipsitch, Marc; Fraser, Christophe

2017-01-01

Understanding how changes in antibiotic consumption affect the prevalence of antibiotic resistance in bacterial pathogens is important for public health. In a number of bacterial species, including Streptococcus pneumoniae, the prevalence of resistance has remained relatively stable despite prolonged selection pressure from antibiotics. The evolutionary processes allowing the robust coexistence of antibiotic sensitive and resistant strains are not fully understood. While allelic diversity can be maintained at a locus by direct balancing selection, there is no evidence for such selection acting in the case of resistance. In this work, we propose a mechanism for maintaining coexistence at the resistance locus: linkage to a second locus that is under balancing selection and that modulates the fitness effect of resistance. We show that duration of carriage plays such a role, with long duration of carriage increasing the fitness advantage gained from resistance. We therefore predict that resistance will be more common in strains with a long duration of carriage and that mechanisms maintaining diversity in duration of carriage will also maintain diversity in antibiotic resistance. We test these predictions in S. pneumoniae and find that the duration of carriage of a serotype is indeed positively correlated with the prevalence of resistance in that serotype. These findings suggest heterogeneity in duration of carriage is a partial explanation for the coexistence of sensitive and resistant strains and that factors determining bacterial duration of carriage will also affect the prevalence of resistance. PMID:28096340

Iron metabolism at the host pathogen interface: lipocalin 2 and the pathogen-associated iroA gene cluster.

PubMed

Smith, Kelly D

2007-01-01

The host innate immune defense protein lipocalin 2 binds bacterial enterobactin siderophores to limit bacterial iron acquisition. To counteract this host defense mechanism bacteria have acquired the iroA gene cluster, which encodes enzymatic machinery and transporters that revitalize enterobactin in the form of salmochelin. The iroB enzyme introduces glucosyl residues at the C5 site on 2,3-dihydroxybenzoylserine moieties of enterobactin and thereby prevents lipocalin 2 binding. Additional strategies to evade lipocalin 2 have evolved in other bacteria, such as Mycobacteria tuberculosis and Bacillus anthracis. Targeting these specialized bacterial evasion strategy may provide a mechanism to reinvigorate lipocalin 2 in defense against specific pathogens.

Light-dependent expression of flg22-induced defense genes in Arabidopsis.

PubMed

Sano, Satoshi; Aoyama, Mayu; Nakai, Kana; Shimotani, Koji; Yamasaki, Kanako; Sato, Masa H; Tojo, Daisuke; Suwastika, I Nengah; Nomura, Hironari; Shiina, Takashi

2014-01-01

Chloroplasts have been reported to generate retrograde immune signals that activate defense gene expression in the nucleus. However, the roles of light and photosynthesis in plant immunity remain largely elusive. In this study, we evaluated the effects of light on the expression of defense genes induced by flg22, a peptide derived from bacterial flagellins which acts as a potent elicitor in plants. Whole-transcriptome analysis of flg22-treated Arabidopsis thaliana seedlings under light and dark conditions for 30 min revealed that a number of (30%) genes strongly induced by flg22 (>4.0) require light for their rapid expression, whereas flg22-repressed genes include a significant number of genes that are down-regulated by light. Furthermore, light is responsible for the flg22-induced accumulation of salicylic acid (SA), indicating that light is indispensable for basal defense responses in plants. To elucidate the role of photosynthesis in defense, we further examined flg22-induced defense gene expression in the presence of specific inhibitors of photosynthetic electron transport: 3-(3,4-dichlorophenyl)-1,1-dimethylurea (DCMU) and 2,5-dibromo-3-methyl-6-isopropyl-benzoquinone (DBMIB). Light-dependent expression of defense genes was largely suppressed by DBMIB, but only partially suppressed by DCMU. These findings suggest that photosynthetic electron flow plays a role in controlling the light-dependent expression of flg22-inducible defense genes.

Quantum mechanical hydrogen tunneling in bacterial copper amine oxidase reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murakawa, Takeshi; Okajima, Toshihide; Kuroda, Shun'ichi

A key step decisively affecting the catalytic efficiency of copper amine oxidase is stereospecific abstraction of substrate {alpha}-proton by a conserved Asp residue. We analyzed this step by pre-steady-state kinetics using a bacterial enzyme and stereospecifically deuterium-labeled substrates, 2-phenylethylamine and tyramine. A small and temperature-dependent kinetic isotope effect (KIE) was observed with 2-phenylethylamine, whereas a large and temperature-independent KIE was observed with tyramine in the {alpha}-proton abstraction step, showing that this step is driven by quantum mechanical hydrogen tunneling rather than the classical transition-state mechanism. Furthermore, an Arrhenius-type preexponential factor ratio approaching a transition-state value was obtained in the reactionmore » of a mutant enzyme lacking the critical Asp. These results provide strong evidence for enzyme-enhanced hydrogen tunneling. X-ray crystallographic structures of the reaction intermediates revealed a small difference in the binding mode of distal parts of substrates, which would modulate hydrogen tunneling proceeding through either active or passive dynamics.« less

Exploring the Caste-Specific Multi-Layer Defense Mechanism of Formosan Subterranean Termites, Coptotermes formosanus Shiraki.

PubMed

Hussain, Abid; Tian, Ming-Yi; Wen, Shuo-Yang

2017-12-12

The survival and foraging of Coptotermes formosanus Shiraki in a microbe-rich environment reflect the adaptation of an extraordinary, sophisticated defense mechanism by the nest-mates. We aimed to explore the host pathogen interaction by studying caste-specific volatile chemistry and genes encoding the antioxidant defense of winged imagoes, nymphs, soldiers and workers of Formosan subterranean termites. Qualitative analyses of C. formosanus Shiraki performed by HS-SPME/GC-MS showed considerable variations in the chemical composition of volatile organic compounds (VOCs) and their proportions among all the castes. Winged imagoes produced the most important compounds such as naphthalene and n- hexanoic acid. The antifungal activity of these compounds along with nonanal, n -pentadecane, n- tetradecane, n -heptadecane and methyl octanoate against the conidial suspensions of Metarhizium anisopliae and Beauveria bassiana isolates enable us to suggest that the failure of natural fungal infection in the nest is due to the antiseptic environment of the nest, which is mainly controlled by the VOCs of nest-mates. In addition, conidial germination of M. anisopliae and B. bassiana isolates evaluated on the cuticle of each caste showed significant variations among isolates and different castes. Our results showed that the conidia of M. anisopliae 02049 exhibited the highest germination on the cuticle of all the inoculated castes. Moreover, we recorded the lowest germination of the conidia of B. bassiana 200436. Caste-specific germination variations enabled us to report for the first time that the cuticle of winged imagoes was found to be the most resistant cuticle. The analysis of the transcriptome of C. formosanus Shiraki revealed the identification of 17 genes directly involved in antioxidant defense. Expression patterns of the identified antioxidant genes by quantitative real-time PCR (qPCR) revealed the significantly highest upregulation of CAT , GST , PRXSL , Cu/Zn-SOD2

How phloem-feeding insects face the challenge of phloem-located defenses

PubMed Central

Will, Torsten; Furch, Alexandra C. U.; Zimmermann, Matthias R.

2013-01-01

Due to the high content of nutrient, sieve tubes are a primary target for pests, e.g., most phytophagous hemipteran. To protect the integrity of the sieve tubes as well as their content, plants possess diverse chemical and physical defense mechanisms. The latter mechanisms are important because they can potentially interfere with the food source accession of phloem-feeding insects. Physical defense mechanisms are based on callose as well as on proteins and often plug the sieve tube. Insects that feed from sieve tubes are potentially able to overwhelm these defense mechanisms using their saliva. Gel saliva forms a sheath in the apoplast around the stylet and is suggested to seal the stylet penetration site in the cell plasma membrane. In addition, watery saliva is secreted into penetrated cells including sieve elements; the presence of specific enzymes/effectors in this saliva is thought to interfere with plant defense responses. Here we detail several aspects of plant defense and discuss the interaction of plants and phloem-feeding insects. Recent agro-biotechnological phloem-located aphid control strategies are presented. PMID:24009620

Cationic Antimicrobial Peptide Resistance Mechanisms of Streptococcal Pathogens

PubMed Central

LaRock, Christopher N.; Nizet, Victor

2015-01-01

Cationic antimicrobial peptides (CAMPs) are critical front line contributors to host defense against invasive bacterial infection. These immune factors have direct killing activity toward microbes, but many pathogens are able to resist their effects. Group A Streptococcus, group B Streptococcus and Streptococcus pneumoniae are among the most common pathogens of humans and display a variety of phenotypic adaptations to resist CAMPs. Common themes of CAMP resistance mechanisms among the pathogenic streptococci are repulsion, sequestration, export, and destruction. Each pathogen has a different array of CAMP-resistant mechanisms, with invasive disease potential reflecting the utilization of several mechanisms that may act in synergy. Here we discuss recent progress in identifying the sources of CAMP resistance in the medically important Streptococcus genus. Further study of these mechanisms can contribute to our understanding of streptococcal pathogenesis, and may provide new therapeutic targets for therapy and disease prevention. PMID:25701232

Arsenic alters transcriptional responses to Pseudomonas aeruginosa infection and decreases antimicrobial defense of human airway epithelial cells.

PubMed

Goodale, Britton C; Rayack, Erica J; Stanton, Bruce A

2017-09-15

Arsenic contamination of drinking water and food threatens the health of hundreds of millions of people worldwide by increasing the risk of numerous diseases. Arsenic exposure has been associated with infectious lung disease in epidemiological studies, but it is not yet understood how ingestion of low levels of arsenic increases susceptibility to bacterial infection. Accordingly, the goal of this study was to examine the effect of arsenic on gene expression in primary human bronchial epithelial (HBE) cells and to determine if arsenic altered epithelial cell responses to Pseudomonas aeruginosa, an opportunistic pathogen. Bronchial epithelial cells line the airway surface, providing a physical barrier and serving critical roles in antimicrobial defense and signaling to professional immune cells. We used RNA-seq to define the transcriptional response of HBE cells to Pseudomonas aeruginosa, and investigated how arsenic affected HBE gene networks in the presence and absence of the bacterial challenge. Environmentally relevant levels of arsenic significantly changed the expression of genes involved in cellular redox homeostasis and host defense to bacterial infection, and decreased genes that code for secreted antimicrobial factors such as lysozyme. Using pathway analysis, we identified Sox4 and Nrf2-regulated gene networks that are predicted to mediate the arsenic-induced decrease in lysozyme secretion. In addition, we demonstrated that arsenic decreased lysozyme in the airway surface liquid, resulting in reduced lysis of Microccocus luteus. Thus, arsenic alters the expression of genes and proteins in innate host defense pathways, thereby decreasing the ability of the lung epithelium to fight bacterial infection. Copyright © 2017 Elsevier Inc. All rights reserved.

Understanding the Mechanism of Bacterial Biofilms Resistance to Antimicrobial Agents

PubMed Central

Singh, Shriti; Singh, Santosh Kumar; Chowdhury, Indrajit; Singh, Rajesh

2017-01-01

A biofilm is a group of microorganisms, that causes health problems for the patients with indwelling medical devices via attachment of cells to the surface matrix. It increases the resistance of a microorganism for antimicrobial agents and developed the human infection. Current strategies are removed or prevent the microbial colonies from the medical devices, which are attached to the surfaces. This will improve the clinical outcomes in favor of the patients suffering from serious infectious diseases. Moreover, the identification and inhibition of genes, which have the major role in biofilm formation, could be the effective approach for health care systems. In a current review article, we are highlighting the biofilm matrix and molecular mechanism of antimicrobial resistance in bacterial biofilms. PMID:28553416

Crystal structure of the Haemophilus influenzae Hap adhesin reveals an intercellular oligomerization mechanism for bacterial aggregation

PubMed Central

Meng, Guoyu; Spahich, Nicole; Kenjale, Roma; Waksman, Gabriel; St Geme, Joseph W

2011-01-01

Bacterial biofilms are complex microbial communities that are common in nature and are being recognized increasingly as an important determinant of bacterial virulence. However, the structural determinants of bacterial aggregation and eventual biofilm formation have been poorly defined. In Gram-negative bacteria, a major subgroup of extracellular proteins called self-associating autotransporters (SAATs) can mediate cell–cell adhesion and facilitate biofilm formation. In this study, we used the Haemophilus influenzae Hap autotransporter as a prototype SAAT to understand how bacteria associate with each other. The crystal structure of the H. influenzae HapS passenger domain (harbouring the SAAT domain) was determined to 2.2 Å by X-ray crystallography, revealing an unprecedented intercellular oligomerization mechanism for cell–cell interaction. The C-terminal SAAT domain folds into a triangular-prism-like structure that can mediate Hap–Hap dimerization and higher degrees of multimerization through its F1–F2 edge and F2 face. The intercellular multimerization can give rise to massive buried surfaces that are required for overcoming the repulsive force between cells, leading to bacterial cell–cell interaction and formation of complex microcolonies. PMID:21841773

Augmenting Sulfur Metabolism and Herbivore Defense in Arabidopsis by Bacterial Volatile Signaling.

PubMed

Aziz, Mina; Nadipalli, Ranjith K; Xie, Xitao; Sun, Yan; Surowiec, Kazimierz; Zhang, Jin-Lin; Paré, Paul W

2016-01-01

Sulfur is an element necessary for the life cycle of higher plants. Its assimilation and reduction into essential biomolecules are pivotal factors determining a plant's growth and vigor as well as resistance to environmental stress. While certain soil microbes can enhance ion solubility via chelating agents or oxidation, microbial regulation of plant-sulfur assimilation has not been reported. With an increasing understanding that soil microbes can activate growth and stress tolerance in plants via chemical signaling, the question arises as to whether such beneficial bacteria also regulate sulfur assimilation. Here we report a previously unidentified mechanism by which the growth-promoting rhizobacterium Bacillus amyloliquefaciens (GB03) transcriptionally activates genes responsible for sulfur assimilation, increasing sulfur uptake and accumulation in Arabidopsis. Transcripts encoding for sulfur-rich aliphatic and indolic glucosinolates are also GB03 induced. As a result, GB03-exposed plants with elevated glucosinolates exhibit greater protection against the generalist herbivore, Spodoptera exigua (beet armyworm, BAW). In contrast, a previously characterized glucosinolate mutant compromised in the production of both aliphatic and indolic glucosinolates is also compromised in terms of GB03-induced protection against insect herbivory. As with in vitro studies, soil-grown plants show enhanced glucosinolate accumulation and protection against BAW feeding with GB03 exposure. These results demonstrate the potential of microbes to enhance plant sulfur assimilation and emphasize the sophisticated integration of microbial signaling in plant defense.

Conifer defenses and xylophagous insects

Treesearch

Alexandr S. Rozhkov; Galina I. Massel

1991-01-01

The resistance of woody plants to phytophage damage consists of a universal system of mechanisms: 1) repellent chemicals, 2) defensive reactions both mechanical and chemical, 3) retention of viability under disturbed metabolism and low biomass accumulation, and 4) recuperative capacity. Siberian coniferous tree species, with the exception of Larix...

Induction of plant defense gene expression by plant activators and Pseudomonas syringae pv. tomato in greenhouse-grown tomatoes.

PubMed

Herman, M A B; Davidson, J K; Smart, C D

2008-11-01

Plant activators provide an appealing management option for bacterial diseases of greenhouse-grown tomatoes. Two types of plant activators, one that induces systemic acquired resistance (SAR) and a second that activates induced systemic resistance (ISR), were evaluated for control of Pseudomonas syringae pv. tomato and effect on plant defense gene activation. Benzothiadiazole (BTH, SAR-inducing compound) effectively reduced bacterial speck incidence and severity, both alone and in combination with the ISR-inducing product. Application of BTH also led to elevated activation of salicylic acid and ethylene-mediated responses, based on real-time polymerase chain reaction analysis of marker gene expression levels. In contrast, the ISR-inducing product (made up of plant growth-promoting rhizobacteria) inconsistently modified defense gene expression and did not provide disease control to the same level as did BTH. No antagonism was observed by combining the two activators as control of bacterial speck was similar to or better than BTH alone.

Proteomic approaches to understanding the role of the cytoskeleton in host-defense mechanisms

PubMed Central

Radulovic, Marko; Godovac-Zimmermann, Jasminka

2014-01-01

The cytoskeleton is a cellular scaffolding system whose functions include maintenance of cellular shape, enabling cellular migration, division, intracellular transport, signaling and membrane organization. In addition, in immune cells, the cytoskeleton is essential for phagocytosis. Following the advances in proteomics technology over the past two decades, cytoskeleton proteome analysis in resting and activated immune cells has emerged as a possible powerful approach to expand our understanding of cytoskeletal composition and function. However, so far there have only been a handful of studies of the cytoskeleton proteome in immune cells. This article considers promising proteomics strategies that could augment our understanding of the role of the cytoskeleton in host-defense mechanisms. PMID:21329431

Salicylic acid binding of mitochondrial alpha-ketoglutarate dehydrogenase E2 affects mitochondrial oxidative phosphorylation and electron transport chain components and plays a role in basal defense against tobacco mosaic virus in tomato.

PubMed

Liao, Yangwenke; Tian, Miaoying; Zhang, Huan; Li, Xin; Wang, Yu; Xia, Xiaojian; Zhou, Jie; Zhou, Yanhong; Yu, Jingquan; Shi, Kai; Klessig, Daniel F

2015-02-01

Salicylic acid (SA) plays a critical role in plant defense against pathogen invasion. SA-induced viral defense in plants is distinct from the pathways mediating bacterial and fungal defense and involves a specific pathway mediated by mitochondria; however, the underlying mechanisms remain largely unknown. The SA-binding activity of the recombinant tomato (Solanum lycopersicum) alpha-ketoglutarate dehydrogenase (Slα-kGDH) E2 subunit of the tricarboxylic acid (TCA) cycle was characterized. The biological role of this binding in plant defenses against tobacco mosaic virus (TMV) was further investigated via Slα-kGDH E2 silencing and transient overexpression in plants. Slα-kGDH E2 was found to bind SA in two independent assays. SA treatment, as well as Slα-kGDH E2 silencing, increased resistance to TMV. SA did not further enhance TMV defense in Slα-kGDH E2-silenced tomato plants but did reduce TMV susceptibility in Nicotiana benthamiana plants transiently overexpressing Slα-kGDH E2. Furthermore, Slα-kGDH E2-silencing-induced TMV resistance was fully blocked by bongkrekic acid application and alternative oxidase 1a silencing. These results indicated that binding by Slα-kGDH E2 of SA acts upstream of and affects the mitochondrial electron transport chain, which plays an important role in basal defense against TMV. The findings of this study help to elucidate the mechanisms of SA-induced viral defense. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

Dynamic chemical communication between plants and bacteria through airborne signals: induced resistance by bacterial volatiles.

PubMed

Farag, Mohamed A; Zhang, Huiming; Ryu, Choong-Min

2013-07-01

Certain plant growth-promoting rhizobacteria (PGPR) elicit induced systemic resistance (ISR) and plant growth promotion in the absence of physical contact with plants via volatile organic compound (VOC) emissions. In this article, we review the recent progess made by research into the interactions between PGPR VOCs and plants, focusing on VOC emission by PGPR strains in plants. Particular attention is given to the mechanisms by which these bacterial VOCs elicit ISR. We provide an overview of recent progress in the elucidation of PGPR VOC interactions from studies utilizing transcriptome, metabolome, and proteome analyses. By monitoring defense gene expression patterns, performing 2-dimensional electrophoresis, and studying defense signaling null mutants, salicylic acid and ethylene have been found to be key players in plant signaling pathways involved in the ISR response. Bacterial VOCs also confer induced systemic tolerance to abiotic stresses, such as drought and heavy metals. A review of current analytical approaches for PGPR volatile profiling is also provided with needed future developments emphasized. To assess potential utilization of PGPR VOCs for crop plants, volatile suspensions have been applied to pepper and cucumber roots and found to be effective at protecting plants against plant pathogens and insect pests in the field. Taken together, these studies provide further insight into the biological and ecological potential of PGPR VOCs for enhancing plant self-immunity and/or adaptation to biotic and abiotic stresses in modern agriculture.

Variation in plant defense suppresses herbivore performance

USGS Publications Warehouse

Pearse, Ian; Paul, Ryan; Ode, Paul J.

2018-01-01

Defensive variability of crops and natural systems can alter herbivore communities and reduce herbivory. However, it is still unknown how defense variability translates into herbivore suppression. Nonlinear averaging and constraints in physiological tracking (also more generally called time-dependent effects) are the two mechanisms by which defense variability might impact herbivores. We conducted a set of experiments manipulating the mean and variability of a plant defense, showing that defense variability does suppress herbivore performance and that it does so through physiological tracking effects that cannot be explained by nonlinear averaging. While nonlinear averaging predicted higher or the same herbivore performance on a variable defense than on an invariable defense, we show that variability actually decreased herbivore performance and population growth rate. Defense variability reduces herbivore performance in a way that is more than the average of its parts. This is consistent with constraints in physiological matching of detoxification systems for herbivores experiencing variable toxin levels in their diet and represents a more generalizable way of understanding the impacts of variability on herbivory. Increasing defense variability in croplands at a scale encountered by individual herbivores can suppress herbivory, even if that is not anticipated by nonlinear averaging.

Effector-triggered immunity: from pathogen perception to robust defense.

PubMed

Cui, Haitao; Tsuda, Kenichi; Parker, Jane E

2015-01-01

In plant innate immunity, individual cells have the capacity to sense and respond to pathogen attack. Intracellular recognition mechanisms have evolved to intercept perturbations by pathogen virulence factors (effectors) early in host infection and convert it to rapid defense. One key to resistance success is a polymorphic family of intracellular nucleotide-binding/leucine-rich-repeat (NLR) receptors that detect effector interference in different parts of the cell. Effector-activated NLRs connect, in various ways, to a conserved basal resistance network in order to transcriptionally boost defense programs. Effector-triggered immunity displays remarkable robustness against pathogen disturbance, in part by employing compensatory mechanisms within the defense network. Also, the mobility of some NLRs and coordination of resistance pathways across cell compartments provides flexibility to fine-tune immune outputs. Furthermore, a number of NLRs function close to the nuclear chromatin by balancing actions of defense-repressing and defense-activating transcription factors to program cells dynamically for effective disease resistance.

Novel mechanism for scavenging of hypochlorite involving a periplasmic methionine-rich peptide and methionine sulfoxide reductase

DOE PAGES

Melnyk, Ryan A.; Youngblut, Matthew D.; Clark, Iain C.; ...

2015-05-12

Reactive chlorine species (RCS) defense mechanisms are important for bacterial fitness in diverse environments. In addition to the anthropogenic use of RCS in the form of bleach, these compounds are also produced naturally through photochemical reactions of natural organic matter and in vivo by the mammalian immune system in response to invading microorganisms. To gain insight into bacterial RCS defense mechanisms, we investigated Azospira suillum strain PS, which produces periplasmic RCS as an intermediate of perchlorate respiration. Our studies identified an RCS response involving an RCS stress-sensing sigma/anti-sigma factor system (SigF/NrsF), a soluble hypochlorite-scavenging methionine-rich periplasmic protein (MrpX), and amore » putative periplasmic methionine sulfoxide reductase (YedY1). We investigated the underlying mechanism by phenotypic characterization of appropriate gene deletions, chemogenomic profiling of barcoded transposon pools, transcriptome sequencing, and biochemical assessment of methionine oxidation. Our results demonstrated that SigF was specifically activated by RCS and initiated the transcription of a small regulon centering around yedY1 and mrpX. A yedY1 paralog ( yedY2) was found to have a similar fitness to yedY1 despite not being regulated by SigF. Markerless deletions of yedY2 confirmed its synergy with the SigF regulon. MrpX was strongly induced and rapidly oxidized by RCS, especially hypochlorite. Our results suggest a mechanism involving hypochlorite scavenging by sacrificial oxidation of the MrpX in the periplasm. Reduced MrpX is regenerated by the YedY methionine sulfoxide reductase activity. The phylogenomic distribution of this system revealed conservation in several Proteobacteria of clinical importance, including uropathogenic Escherichia coli and Brucella spp., implying a putative role in immune response evasion in vivo. In addition, bacteria are often stressed in the environment by reactive chlorine species (RCS) of

Novel mechanism for scavenging of hypochlorite involving a periplasmic methionine-rich peptide and methionine sulfoxide reductase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Melnyk, Ryan A.; Youngblut, Matthew D.; Clark, Iain C.

Reactive chlorine species (RCS) defense mechanisms are important for bacterial fitness in diverse environments. In addition to the anthropogenic use of RCS in the form of bleach, these compounds are also produced naturally through photochemical reactions of natural organic matter and in vivo by the mammalian immune system in response to invading microorganisms. To gain insight into bacterial RCS defense mechanisms, we investigated Azospira suillum strain PS, which produces periplasmic RCS as an intermediate of perchlorate respiration. Our studies identified an RCS response involving an RCS stress-sensing sigma/anti-sigma factor system (SigF/NrsF), a soluble hypochlorite-scavenging methionine-rich periplasmic protein (MrpX), and amore » putative periplasmic methionine sulfoxide reductase (YedY1). We investigated the underlying mechanism by phenotypic characterization of appropriate gene deletions, chemogenomic profiling of barcoded transposon pools, transcriptome sequencing, and biochemical assessment of methionine oxidation. Our results demonstrated that SigF was specifically activated by RCS and initiated the transcription of a small regulon centering around yedY1 and mrpX. A yedY1 paralog ( yedY2) was found to have a similar fitness to yedY1 despite not being regulated by SigF. Markerless deletions of yedY2 confirmed its synergy with the SigF regulon. MrpX was strongly induced and rapidly oxidized by RCS, especially hypochlorite. Our results suggest a mechanism involving hypochlorite scavenging by sacrificial oxidation of the MrpX in the periplasm. Reduced MrpX is regenerated by the YedY methionine sulfoxide reductase activity. The phylogenomic distribution of this system revealed conservation in several Proteobacteria of clinical importance, including uropathogenic Escherichia coli and Brucella spp., implying a putative role in immune response evasion in vivo. In addition, bacteria are often stressed in the environment by reactive chlorine species (RCS) of

Growth–Defense Tradeoffs in Plants: A Balancing Act to Optimize Fitness

PubMed Central

Huot, Bethany; Yao, Jian; Montgomery, Beronda L.; He, Sheng Yang

2014-01-01

Growth–defense tradeoffs are thought to occur in plants due to resource restrictions, which demand prioritization towards either growth or defense, depending on external and internal factors. These tradeoffs have profound implications in agriculture and natural ecosystems, as both processes are vital for plant survival, reproduction, and, ultimately, plant fitness. While many of the molecular mechanisms underlying growth and defense tradeoffs remain to be elucidated, hormone crosstalk has emerged as a major player in regulating tradeoffs needed to achieve a balance. In this review, we cover recent advances in understanding growth–defense tradeoffs in plants as well as what is known regarding the underlying molecular mechanisms. Specifically, we address evidence supporting the growth–defense tradeoff concept, as well as known interactions between defense signaling and growth signaling. Understanding the molecular basis of these tradeoffs in plants should provide a foundation for the development of breeding strategies that optimize the growth–defense balance to maximize crop yield to meet rising global food and biofuel demands. PMID:24777989

Defense.gov Special Report: Defense Intelligence

Science.gov Websites

Department of Defense Submit Search Defense intelligence is critical to the Defense Department's role in and conduct successful military and security operations that protect America. Defense Intelligence News Story Intelligence Chief Describes 'Pervasive Uncertainty' of Worldwide Threats "

[Study on psychiatric disorders and defensive process assessed by the "defense style questionnaire" in sterile males SAMPLE consulting in andrology].

PubMed

Bellone, M; Cottencin, O; Rigot, J M; Goudemand, M

2005-01-01

collect some general information about infertility and a self questionnaire about the sexual, conjugal and social effects of infertility. The DSQ and the interviews took place in the andrology department with the same investigator trained for this job. We found in our sample 26.2% of psychiatric disorders according to the DSM IV with a significant over-representation of generalized anxious disorder and somatization disorder. The comparison between azoospermic males and oligoazoospermic males patients showed the absence of significative difference as far as psychiatric morbidity rate and the use of defense styles are concerned. Our sample defended himself in accordance with modalities similar to the general population and used defense mechanisms preferentially belonging to the mature defense style, such as humor, repression and anticipation. The psychiatric pathology was significantly correlated to the preferential use of withdrawal, consumption, reaction formation and lack of humor use. We also confirm in our study the fact that the subjects using especially neurotic defense styles are more likely to develop a psychiatric disorder than the others. Our male sample is a waiting population and threatened by failure. The situation of wait creates anxiety. We also know that infertility is one of the most stressful situations a couple might face. However, our study did not enable us to know the precise relations between generalized anxious disorder and infertility, especially whether the generalized anxious disorder preceded this pathology or not. The over-representation of a somatization disorder only allows us to acknowledge its existence. We can also deduce from that a possible link between infertility and psychic disorder, even if no research permitted to affirm to date the existence of interrelations linking infertility and psychic life. On the whole, this population was suffering despite 73.8% of the patients had no confirmed psychiatric disorder. It is the reason why a

An orthologue of the host-defense protein psoriasin (S100A7) is expressed in frog skin.

PubMed

Matthijs, Severine; Hernalsteens, Jean-Pierre; Roelants, Kim

2017-02-01

Host-defense peptides and proteins are vital for first line protection against bacteria. Most host-defense peptides and proteins common in vertebrates have been studied primarily in mammals, while their orthologues in non-mammalian vertebrates received less attention. We found that the European Common Frog Rana temporaria expresses a protein in its skin that is evolutionarily related to the host-defense protein S100A7. This prompted us to test if the encoded protein, which is an important microbicidal protein in human skin, shows similar activity in frogs. The R. temporaria protein lacks the zinc-binding sites that are key to the antimicrobial activity of human S100A7 at neutral pH. However, despite being less potent, the R. temporaria protein does compromise bacterial membranes at low pH, similar to its human counterpart. We postulate that, while amphibian S100A7 likely serves other functions, the capacity to compromise bacterial cell membranes evolved early in tetrapod evolution. Copyright © 2016 Elsevier Ltd. All rights reserved.

Diet quality can play a critical role in defense efficacy against parasitoids and pathogens in the Glanville fritillary (Melitaea cinxia).

PubMed

Laurentz, Minna; Reudler, Joanneke H; Mappes, Johanna; Friman, Ville; Ikonen, Suvi; Lindstedt, Carita

2012-01-01

Numerous herbivorous insect species sequester noxious chemicals from host plants that effectively defend against predators, and against parasitoids and pathogens. Sequestration of these chemicals may be expensive and involve a trade off with other fitness traits. Here, we tested this hypothesis. We reared Glanville fritillary butterfly (Melitaea cinxia L.) larvae on plant diets containing low- and high-levels of iridoid glycosides (IGs) (mainly aucubin and catalpol) and tested: 1) whether IGs affect the herbivore's defense against parasitoids (measured as encapsulation rate) and bacterial pathogens (measured as herbivore survival); 2) whether parasitoid and bacterial defenses interact; and 3) whether sequestration of the plant's defense chemicals incurs any life history costs. Encapsulation rates were stronger when there were higher percentages of catalpol in the diet. Implanted individuals had greater amounts of IGs in their bodies as adults. This suggests that parasitized individuals may sequester more IGs, increase their feeding rate after parasitism, or that there is a trade off between detoxification efficiency and encapsulation rate. Larval survival after bacterial infection was influenced by diet, but probably not by diet IG content, as changes in survival did not correlate linearly with the levels of IGs in the diet. However, M. cinxia larvae with good encapsulation abilities were better defended against bacteria. We did not find any life history costs of diet IG concentration for larvae. These results suggest that the sequestering of plant defense chemicals can help herbivorous insects to defend against parasitoids.

Fibrin facilitates both innate and T cell-mediated defense against Yersinia pestis.1

PubMed Central

Luo, Deyan; Lin, Shiuan; Parent, Michelle A.; Kanevsky, Isis Mullarky; Szaba, Frank M.; Kummer, Lawrence W.; Duso, Debra K.; Tighe, Michael; Hill, Jim; Gruber, Andras; Mackman, Nigel; Gailani, David; Smiley, Stephen T.

2013-01-01

The gram-negative bacterium Yersinia pestis causes plague, a rapidly progressing and often fatal disease. The formation of fibrin at sites of Y. pestis infection supports innate host defense against plague, perhaps by providing a non-diffusible spatial cue that promotes the accumulation of inflammatory cells expressing fibrin-binding integrins. This report demonstrates that fibrin is an essential component of T cell-mediated defense against plague but can be dispensable for antibody-mediated defense. Genetic or pharmacologic depletion of fibrin abrogated innate and T cell-mediated defense in mice challenged intranasally with Y. pestis. The fibrin-deficient mice displayed reduced survival, increased bacterial burden, and exacerbated hemorrhagic pathology. They also showed fewer neutrophils within infected lung tissue and reduced neutrophil viability at sites of liver infection. Depletion of neutrophils from wild type mice weakened T cell-mediated defense against plague. The data suggest that T cells combat plague in conjunction with neutrophils, which require help from fibrin in order to withstand Y. pestis encounters and effectively clear bacteria. PMID:23487423

Microbial modulation of bacoside A biosynthetic pathway and systemic defense mechanism in Bacopa monnieri under Meloidogyne incognita stress.

PubMed

Gupta, Rupali; Singh, Akanksha; Srivastava, Madhumita; Singh, Vivek; Gupta, M M; Pandey, Rakesh

2017-02-03

Plant-associated beneficial microbes have been explored to fulfill the imperative function for plant health. However, their impact on the host secondary metabolite production and nematode disease management remains elusive. Our present work has shown that chitinolytic microbes viz., Chitiniphilus sp. MTN22 and Streptomyces sp. MTN14 singly as well as in combination modulated the biosynthetic pathway of bacoside A and systemic defense mechanism against Meloidogyne incognita in Bacopa monnieri. Interestingly, expression of bacoside biosynthetic pathway genes (3-Hydroxy-3-methylglutaryl coenzyme A reductase, mevalonate diphosphate decarboxylase, and squalene synthase) were upregulated in plants treated with the microbial combination in the presence as well as in absence of M. incognita stress. These microbes not only augmented bacoside A production (1.5 fold) but also strengthened host resistance via enhancement in chlorophyll a, defense enzymes and phenolic compounds like gallic acid, syringic acid, ferulic acid and cinnamic acid. Furthermore, elevated lignification and callose deposition in the microbial combination treated plants corroborate well with the above findings. Overall, the results provide novel insights into the underlying mechanisms of priming by beneficial microbes and underscore their capacity to trigger bacoside A production in B. monnieri under biotic stress.

Microbial modulation of bacoside A biosynthetic pathway and systemic defense mechanism in Bacopa monnieri under Meloidogyne incognita stress

PubMed Central

Gupta, Rupali; Singh, Akanksha; Srivastava, Madhumita; Singh, Vivek; Gupta, M. M.; Pandey, Rakesh

2017-01-01

Plant-associated beneficial microbes have been explored to fulfill the imperative function for plant health. However, their impact on the host secondary metabolite production and nematode disease management remains elusive. Our present work has shown that chitinolytic microbes viz., Chitiniphilus sp. MTN22 and Streptomyces sp. MTN14 singly as well as in combination modulated the biosynthetic pathway of bacoside A and systemic defense mechanism against Meloidogyne incognita in Bacopa monnieri. Interestingly, expression of bacoside biosynthetic pathway genes (3-Hydroxy-3-methylglutaryl coenzyme A reductase, mevalonate diphosphate decarboxylase, and squalene synthase) were upregulated in plants treated with the microbial combination in the presence as well as in absence of M. incognita stress. These microbes not only augmented bacoside A production (1.5 fold) but also strengthened host resistance via enhancement in chlorophyll a, defense enzymes and phenolic compounds like gallic acid, syringic acid, ferulic acid and cinnamic acid. Furthermore, elevated lignification and callose deposition in the microbial combination treated plants corroborate well with the above findings. Overall, the results provide novel insights into the underlying mechanisms of priming by beneficial microbes and underscore their capacity to trigger bacoside A production in B. monnieri under biotic stress. PMID:28157221

The relationship between the plant-encoded RNA-dependent RNA polymerase 1 and alternative oxidase in tomato basal defense against Tobacco mosaic virus.

PubMed

Liao, Yang-Wen-Ke; Liu, Ya-Ru; Liang, Jia-Yang; Wang, Wen-Ping; Zhou, Jie; Xia, Xiao-Jian; Zhou, Yan-Hong; Yu, Jing-Quan; Shi, Kai

2015-03-01

Salicylic acid (SA) plays a critical role in plant defense against pathogen attack. The SA-induced viral defense in plants is distinct from the pathways mediating bacterial and fungal defense, which is pathogenesis-related protein-independent but involves an RNA-dependent RNA polymerase 1 (RDR1)-mediated RNA silencing mechanism and/or an alternative oxidase (AOX)-associated defense pathway. However, the relationship between these two viral defense-related pathways remains unclear. In this study, Tobacco mosaic virus (TMV) inoculation onto Solanum lycopersicum (tomato) leaves induced a rapid induction of the SlAOX1a transcript level as well as the total and CN-resistant respiration at 0.5 dpi, followed by an increase in SlRDR1 gene expression at 1 dpi in the upper uninoculated leaves. Silencing SlRDR1 using virus-induced gene silencing system significantly reduced SlRDR1 expression and tomato defense against TMV but had no evident effect on SlAOX1a transcription. Conversely, silencing SlAOX1a not only effectively reduced the AOX1a transcript level, but also blocked the TMV-induced SlRDR1 expression and decreased the basal defense against TMV. Furthermore, the application of an exogenous AOX activator on empty vector-silenced control plants greatly induced the accumulation of SlRDR1 and SlAOX1a transcript and reduced TMV viral RNA accumulation, but failed to have such effects on SlRDR1-silenced plants. Moreover, RDR1-overexpressed transgenic Nicotiana benthamiana plants enhanced defense against TMV than the empty vector-transformed plants, but these effects were not affected by the exogenous AOX activator or inhibitor. These results indicate that RDR1 is involved in the AOX-mediated defense pathway against TMV infection and plays a crucial role in enhancing RNA silencing to limit virus systemic spread.

Proline-rich antimicrobial peptides: converging to a non-lytic mechanism of action.

PubMed

Scocchi, Marco; Tossi, Alessandro; Gennaro, Renato

2011-07-01

Proline-rich antimicrobial peptides are a group of cationic host defense peptides of vertebrates and invertebrates characterized by a high content of proline residues, often associated with arginine residues in repeated motifs. Those isolated from some mammalian and insect species, although not evolutionarily related, use a similar mechanism to selectively kill Gram-negative bacteria, with a low toxicity to animals. Unlike other types of antimicrobial peptides, their mode of action does not involve the lysis of bacterial membranes but entails penetration into susceptible cells, where they then act intracellularly. Some aspects of the transport system and cytoplasmic targets have been elucidated. These features make them attractive both as anti-infective lead compounds and as a new class of potential cell-penetrating peptides capable of internalising membrane-impermeant drugs into both bacterial and eukaryotic cells.

Defense Acquisition and the Case of the Joint Capabilities Technology Demonstration Office: Ad Hoc Problem Solving as a Mechanism for Adaptive Change

DTIC Science & Technology

2013-04-01

Capabilities Technology Demonstration Office: Ad Hoc Problem Solving as a Mechanism for Adaptive Change Kathryn Aten and John T. Dillard Naval...Defense Acquisition and the Case of the Joint Capabilities Technology Demonstration Office: Ad Hoc Problem Solving as a Mechanism for Adaptive Change...describes the preliminary analysis and findings of our study exploring what drives successful organizational adaptation in the context of technology

2-methoxylated fatty acids in marine sponges: defense mechanism against mycobacteria?

PubMed

Carballeira, Néstor M; Cruz, Heidyleen; Kwong, Cecil D; Wan, Baojie; Franzblau, Scott

2004-07-01

A series of saturated 2-methoxylated FA having even-numbered chains with 8-14 carbons were synthesized, and their spectroscopic data are presented for the first time. The 2-methoxylated C10-C14 acids were prepared from the corresponding 2-hydroxylated FA, whereas the 2-methoxyoctanoic acid was synthesized starting with heptaldehyde. All of the methoxylated FA displayed some degree of inhibition (between 2 and 99%) of Mycobacterium tuberculosis H(37)Rv at 6.25 microg/mL. The most inhibitory FA was 2-methoxydecanoic acid, with a minimum inhibitory concentration of 200-239 microM against M. tuberculosis H(37)Rv as determined by both the microplate Alamar Blue assay and the green fluorescent protein microplate assay. These results are discussed in terms of the possible role of the 2-methoxylated FA as antimicrobial lipids produced either by marine sponges, or the associated marine symbiotic bacteria, as a defense mechanism in a highly competitive environment.

NOD2, an Intracellular Innate Immune Sensor Involved in Host Defense and Crohn's Disease

PubMed Central

Strober, Warren; Watanabe, Tomohiro

2013-01-01

Nucleotide binding oligomerization domain 2 (NOD2) is an intracellular sensor for small peptides derived from the bacterial cell wall component, peptidoglycan. Recent studies have uncovered unexpected functions of NOD2 in innate immune responses such as induction of type I IFN and facilitation of autophagy; moreover, they have disclosed extensive cross-talk between NOD2 and Toll-like receptors which plays an indispensable role both in host defense against microbial infection and in the development of autoimmunity. Of particular interest, polymorphisms of CARD15 encoding NOD2 are associated with Crohn's disease and other autoimmune states such as graft versus host disease. In this review, we summarize recent findings regarding normal functions of NOD2 and discuss the mechanisms by which NOD2 polymorphisms associated with Crohn's disease lead to intestinal inflammation. PMID:21750585

Interplay of Pathogen-Induced Defense Responses and Symbiotic Establishment in Medicago truncatula

PubMed Central

Chen, Tao; Duan, Liujian; Zhou, Bo; Yu, Haixiang; Zhu, Hui; Cao, Yangrong; Zhang, Zhongming

2017-01-01

Suppression of host innate immunity appears to be required for the establishment of symbiosis between rhizobia and host plants. In this study, we established a system that included a host plant, a bacterial pathogen and a symbiotic rhizobium to study the role of innate immunity during symbiotic interactions. A pathogenic bacterium, Pseudomonas syringae pv. tomato strain DC3000 (Pst DC3000), was shown to cause chlorosis in Medicago truncatula A17. Sinorhizobium meliloti strain Sm2011 (Sm2011) and Pst DC3000 strain alone induced similar defense responses in M. truncatula. However, when co-inoculated, Sm2011 specifically suppressed the defense responses induced by Pst DC3000, such as MAPK activation and ROS production. Inoculation with Sm2011 suppressed the transcription of defense-related genes triggered by Pst DC3000 infection, including the receptor of bacterial flagellin (FLS2), pathogenesis-related protein 10 (PR10), and the transcription factor WRKY33. Interestingly, inoculation with Pst DC3000 specifically inhibited the expression of the symbiosis marker genes nodule inception and nodulation pectate lyase and reduced the numbers of infection threads and nodules on M. truncatula A17 roots, indicating that Pst DC3000 inhibits the establishment of symbiosis in M. truncatula. In addition, defense-related genes, such as MAPK3/6, RbohC, and WRKY33, exhibited a transient increase in their expression in the early stage of symbiosis with Sm2011, but the expression dropped down to normal levels at later symbiotic stages. Our results suggest that plant innate immunity plays an antagonistic role in symbiosis by directly reducing the numbers of infection threads and nodules. PMID:28611764

Coordination of frontline defense mechanisms under severe oxidative stress.

PubMed

Kaur, Amardeep; Van, Phu T; Busch, Courtney R; Robinson, Courtney K; Pan, Min; Pang, Wyming Lee; Reiss, David J; DiRuggiero, Jocelyne; Baliga, Nitin S

2010-07-01

Complexity of cellular response to oxidative stress (OS) stems from its wide-ranging damage to nucleic acids, proteins, carbohydrates, and lipids. We have constructed a systems model of OS response (OSR) for Halobacterium salinarum NRC-1 in an attempt to understand the architecture of its regulatory network that coordinates this complex response. This has revealed a multi-tiered OS-management program to transcriptionally coordinate three peroxidase/catalase enzymes, two superoxide dismutases, production of rhodopsins, carotenoids and gas vesicles, metal trafficking, and various other aspects of metabolism. Through experimental validation of interactions within the OSR regulatory network, we show that despite their inability to directly sense reactive oxygen species, general transcription factors have an important function in coordinating this response. Remarkably, a significant fraction of this OSR was accurately recapitulated by a model that was earlier constructed from cellular responses to diverse environmental perturbations--this constitutes the general stress response component. Notwithstanding this observation, comparison of the two models has identified the coordination of frontline defense and repair systems by regulatory mechanisms that are triggered uniquely by severe OS and not by other environmental stressors, including sub-inhibitory levels of redox-active metals, extreme changes in oxygen tension, and a sub-lethal dose of gamma rays.

Coordination of frontline defense mechanisms under severe oxidative stress

PubMed Central

Kaur, Amardeep; Van, Phu T; Busch, Courtney R; Robinson, Courtney K; Pan, Min; Pang, Wyming Lee; Reiss, David J; DiRuggiero, Jocelyne; Baliga, Nitin S

2010-01-01

Complexity of cellular response to oxidative stress (OS) stems from its wide-ranging damage to nucleic acids, proteins, carbohydrates, and lipids. We have constructed a systems model of OS response (OSR) for Halobacterium salinarum NRC-1 in an attempt to understand the architecture of its regulatory network that coordinates this complex response. This has revealed a multi-tiered OS-management program to transcriptionally coordinate three peroxidase/catalase enzymes, two superoxide dismutases, production of rhodopsins, carotenoids and gas vesicles, metal trafficking, and various other aspects of metabolism. Through experimental validation of interactions within the OSR regulatory network, we show that despite their inability to directly sense reactive oxygen species, general transcription factors have an important function in coordinating this response. Remarkably, a significant fraction of this OSR was accurately recapitulated by a model that was earlier constructed from cellular responses to diverse environmental perturbations—this constitutes the general stress response component. Notwithstanding this observation, comparison of the two models has identified the coordination of frontline defense and repair systems by regulatory mechanisms that are triggered uniquely by severe OS and not by other environmental stressors, including sub-inhibitory levels of redox-active metals, extreme changes in oxygen tension, and a sub-lethal dose of γ rays. PMID:20664639

Are Bacterial Volatile Compounds Poisonous Odors to a Fungal Pathogen Botrytis cinerea, Alarm Signals to Arabidopsis Seedlings for Eliciting Induced Resistance, or Both?

PubMed Central

Sharifi, Rouhallah; Ryu, Choong-Min

2016-01-01

Biological control (biocontrol) agents act on plants via numerous mechanisms, and can be used to protect plants from pathogens. Biocontrol agents can act directly as pathogen antagonists or competitors or indirectly to promote plant induced systemic resistance (ISR). Whether a biocontrol agent acts directly or indirectly depends on the specific strain and the pathosystem type. We reported previously that bacterial volatile organic compounds (VOCs) are determinants for eliciting plant ISR. Emerging data suggest that bacterial VOCs also can directly inhibit fungal and plant growth. The aim of the current study was to differentiate direct and indirect mechanisms of bacterial VOC effects against Botrytis cinerea infection of Arabidopsis. Volatile emissions from Bacillus subtilis GB03 successfully protected Arabidopsis seedlings against B. cinerea. First, we investigated the direct effects of bacterial VOCs on symptom development and different phenological stages of B. cinerea including spore germination, mycelial attachment to the leaf surface, mycelial growth, and sporulation in vitro and in planta. Volatile emissions inhibited hyphal growth in a dose-dependent manner in vitro, and interfered with fungal attachment on the hydrophobic leaf surface. Second, the optimized bacterial concentration that did not directly inhibit fungal growth successfully protected Arabidopsis from fungal infection, which indicates that bacterial VOC-elicited plant ISR has a more important role in biocontrol than direct inhibition of fungal growth on Arabidopsis. We performed qRT-PCR to investigate the priming of the defense-related genes PR1, PDF1.2, and ChiB at 0, 12, 24, and 36 h post-infection and 14 days after the start of plant exposure to bacterial VOCs. The results indicate that bacterial VOCs potentiate expression of PR1 and PDF1.2 but not ChiB, which stimulates SA- and JA-dependent signaling pathways in plant ISR and protects plants against pathogen colonization. This study

Correlates of immune defenses in golden eagle nestlings

USGS Publications Warehouse

MacColl, Elisabeth; Vanesky, Kris; Buck, Jeremy A.; Dudek, Benjamin; Eagles-Smith, Collin A.; Heath, Julie A.; Herring, Garth; Vennum, Chris; Downs, Cynthia J.

2017-01-01

An individual's investment in constitutive immune defenses depends on both intrinsic and extrinsic factors. We examined how Leucocytozoon parasite presence, body condition (scaled mass), heterophil-to-lymphocyte (H:L) ratio, sex, and age affected immune defenses in golden eagle (Aquila chrysaetos) nestlings from three regions: California, Oregon, and Idaho. We quantified hemolytic-complement activity and bacterial killing ability, two measures of constitutive immunity. Body condition and age did not affect immune defenses. However, eagles with lower H:L ratios had lower complement activity, corroborating other findings that animals in better condition sometimes invest less in constitutive immunity. In addition, eagles with Leucocytozoon infections had higher concentrations of circulating complement proteins but not elevated opsonizing proteins for all microbes, and eagles from Oregon had significantly higher constitutive immunity than those from California or Idaho. We posit that Oregon eagles might have elevated immune defenses because they are exposed to more endoparasites than eagles from California or Idaho, and our results confirmed that the OR region has the highest rate of Leucocytozoon infections. Our study examined immune function in a free-living, long-lived raptor species, whereas most avian ecoimmunological research focuses on passerines. Thus, our research informs a broad perspective regarding the evolutionary and environmental pressures on immune function in birds.

GTPase activity, structure, and mechanical properties of filaments assembled from bacterial cytoskeleton protein MreB.

PubMed

Esue, Osigwe; Wirtz, Denis; Tseng, Yiider

2006-02-01

MreB, a major component of the recently discovered bacterial cytoskeleton, displays a structure homologous to its eukaryotic counterpart actin. Here, we study the assembly and mechanical properties of Thermotoga maritima MreB in the presence of different nucleotides in vitro. We found that GTP, not ADP or GDP, can mediate MreB assembly into filamentous structures as effectively as ATP. Upon MreB assembly, both GTP and ATP release the gamma phosphate at similar rates. Therefore, MreB is an equally effective ATPase and GTPase. Electron microscopy and quantitative rheology suggest that the morphologies and micromechanical properties of filamentous ATP-MreB and GTP-MreB are similar. In contrast, mammalian actin assembly is favored in the presence of ATP over GTP. These results indicate that, despite high structural homology of their monomers, T. maritima MreB and actin filaments display different assembly, morphology, micromechanics, and nucleotide-binding specificity. Furthermore, the biophysical properties of T. maritima MreB filaments, including high rigidity and propensity to form bundles, suggest a mechanism by which MreB helical structure may be involved in imposing a cylindrical architecture on rod-shaped bacterial cells.

Vertebrate defense against parasites: Interactions between avoidance, resistance, and tolerance.

PubMed

Klemme, Ines; Karvonen, Anssi

2017-01-01

Hosts can utilize different types of defense against the effects of parasitism, including avoidance, resistance, and tolerance. Typically, there is tremendous heterogeneity among hosts in these defense mechanisms that may be rooted in the costs associated with defense and lead to trade-offs with other life-history traits. Trade-offs may also exist between the defense mechanisms, but the relationships between avoidance, resistance, and tolerance have rarely been studied. Here, we assessed these three defense traits under common garden conditions in a natural host-parasite system, the trematode eye-fluke Diplostomum pseudospathaceum and its second intermediate fish host. We looked at host individuals originating from four genetically distinct populations of two closely related salmonid species (Atlantic salmon, Salmo salar and sea trout, Salmo trutta trutta ) to estimate the magnitude of variation in these defense traits and the relationships among them. We show species-specific variation in resistance and tolerance and population-specific variation in resistance. Further, we demonstrate evidence for a trade-off between resistance and tolerance. Our results suggest that the variation in host defense can at least partly result from a compromise between different interacting defense traits, the relative importance of which is likely to be shaped by environmental components. Overall, this study emphasizes the importance of considering different components of the host defense system when making predictions on the outcome of host-parasite interactions.

A structural mechanism for bacterial autotransporter glycosylation by a dodecameric heptosyltransferase family

PubMed Central

Yao, Qing; Lu, Qiuhe; Wan, Xiaobo; Song, Feng; Xu, Yue; Hu, Mo; Zamyatina, Alla; Liu, Xiaoyun; Huang, Niu; Zhu, Ping; Shao, Feng

2014-01-01

A large group of bacterial virulence autotransporters including AIDA-I from diffusely adhering E. coli (DAEC) and TibA from enterotoxigenic E. coli (ETEC) require hyperglycosylation for functioning. Here we demonstrate that TibC from ETEC harbors a heptosyltransferase activity on TibA and AIDA-I, defining a large family of bacterial autotransporter heptosyltransferases (BAHTs). The crystal structure of TibC reveals a characteristic ring-shape dodecamer. The protomer features an N-terminal β-barrel, a catalytic domain, a β-hairpin thumb, and a unique iron-finger motif. The iron-finger motif contributes to back-to-back dimerization; six dimers form the ring through β-hairpin thumb-mediated hand-in-hand contact. The structure of ADP-D-glycero-β-D-manno-heptose (ADP-D,D-heptose)-bound TibC reveals a sugar transfer mechanism and also the ligand stereoselectivity determinant. Electron-cryomicroscopy analyses uncover a TibC–TibA dodecamer/hexamer assembly with two enzyme molecules binding to one TibA substrate. The complex structure also highlights a high efficient hyperglycosylation of six autotransporter substrates simultaneously by the dodecamer enzyme complex. DOI: http://dx.doi.org/10.7554/eLife.03714.001 PMID:25310236

Metagenomic binning of a marine sponge microbiome reveals unity in defense but metabolic specialization.

PubMed

Slaby, Beate M; Hackl, Thomas; Horn, Hannes; Bayer, Kristina; Hentschel, Ute

2017-11-01

Marine sponges are ancient metazoans that are populated by distinct and highly diverse microbial communities. In order to obtain deeper insights into the functional gene repertoire of the Mediterranean sponge Aplysina aerophoba, we combined Illumina short-read and PacBio long-read sequencing followed by un-targeted metagenomic binning. We identified a total of 37 high-quality bins representing 11 bacterial phyla and two candidate phyla. Statistical comparison of symbiont genomes with selected reference genomes revealed a significant enrichment of genes related to bacterial defense (restriction-modification systems, toxin-antitoxin systems) as well as genes involved in host colonization and extracellular matrix utilization in sponge symbionts. A within-symbionts genome comparison revealed a nutritional specialization of at least two symbiont guilds, where one appears to metabolize carnitine and the other sulfated polysaccharides, both of which are abundant molecules in the sponge extracellular matrix. A third guild of symbionts may be viewed as nutritional generalists that perform largely the same metabolic pathways but lack such extraordinary numbers of the relevant genes. This study characterizes the genomic repertoire of sponge symbionts at an unprecedented resolution and it provides greater insights into the molecular mechanisms underlying microbial-sponge symbiosis.

Bacterial infection and acute lung injury in hamsters.

PubMed

Seidenfeld, J J; Mullins, R C; Fowler, S R; Johanson, W G

1986-07-01

Bacterial pneumonia is a common complication of lung injury that can be an important determinant of outcome. We studied experimental lung injury produced in hamsters by injecting 20 mg/kg paraquat (PQ) intraperitoneally; control animals received saline vehicle. Three days later, Pseudomonas aeruginosa (PAO1), 10(8) organisms in 0.25 ml, or saline, 0.25 ml, was inoculated intratracheally. Lung and systemic antibacterial defenses were studied at death 24 h later. Paraquat alone produced focal interstitial pneumonitis and neutrophilic alveolitis, and resulted in a 12% (3 of 26) mortality. PAO1 alone caused focal pneumonias and no deaths. Animals receiving both agents (PAO1/PQ) had extensive diffuse alveolar damage characterized by alveolar hemorrhage, edema, influx of neutrophils, and vasculitis; 50% (16 of 32) died within 96 h of PQ injection. Mean lung counts of PAO1 at death were 7.6 X 10(4) colony forming units/g in PAO1 and 2.8 X 10(7) in PAO1/PQ animals (p less than 0.05). PAO1 colony counts in liver were increased nearly 100-fold in PAO1/PQ animals (p less than 0.05). Half-time of clearance of P. aeruginosa from the blood was prolonged in PAO1 and in PAO1/PQ animals (p less than 0.05) but not in PQ animals. Phagocytosis of Staphylococcus aureus by leukocytes lavaged from the lung was not impaired in any group compared with that in control animals, but intracellular killing was impaired in PAO1 and PAO1/PQ but not in PQ animals. Paraquat injury impairs lung antibacterial defenses by uncertain mechanisms. Superinfection of PQ-injured lungs by PAO1 appears responsible for defects in intrapulmonary and systemic antibacterial defenses.

Variation in Plant Defense Suppresses Herbivore Performance.

PubMed

Pearse, Ian S; Paul, Ryan; Ode, Paul J

2018-06-18

Defensive variability of crops and natural systems can alter herbivore communities and reduce herbivory [1, 2]. However, it is still unknown how defense variability translates into herbivore suppression. Nonlinear averaging and constraints in physiological tracking (also more generally called time-dependent effects) are the two mechanisms by which defense variability might impact herbivores [3, 4]. We conducted a set of experiments manipulating the mean and variability of a plant defense, showing that defense variability does suppress herbivore performance and that it does so through physiological tracking effects that cannot be explained by nonlinear averaging. While nonlinear averaging predicted higher or the same herbivore performance on a variable defense than on an invariable defense, we show that variability actually decreased herbivore performance and population growth rate. Defense variability reduces herbivore performance in a way that is more than the average of its parts. This is consistent with constraints in physiological matching of detoxification systems for herbivores experiencing variable toxin levels in their diet and represents a more generalizable way of understanding the impacts of variability on herbivory [5]. Increasing defense variability in croplands at a scale encountered by individual herbivores can suppress herbivory, even if that is not anticipated by nonlinear averaging. Published by Elsevier Ltd.

Methylated glycans as conserved targets of animal and fungal innate defense

PubMed Central

Wohlschlager, Therese; Butschi, Alex; Grassi, Paola; Sutov, Grigorij; Gauss, Robert; Hauck, Dirk; Schmieder, Stefanie S.; Knobel, Martin; Titz, Alexander; Dell, Anne; Haslam, Stuart M.; Hengartner, Michael O.; Aebi, Markus; Künzler, Markus

2014-01-01

Effector proteins of innate immune systems recognize specific non-self epitopes. Tectonins are a family of β-propeller lectins conserved from bacteria to mammals that have been shown to bind bacterial lipopolysaccharide (LPS). We present experimental evidence that two Tectonins of fungal and animal origin have a specificity for O-methylated glycans. We show that Tectonin 2 of the mushroom Laccaria bicolor (Lb-Tec2) agglutinates Gram-negative bacteria and exerts toxicity toward the model nematode Caenorhabditis elegans, suggesting a role in fungal defense against bacteria and nematodes. Biochemical and genetic analysis of these interactions revealed that both bacterial agglutination and nematotoxicity of Lb-Tec2 depend on the recognition of methylated glycans, namely O-methylated mannose and fucose residues, as part of bacterial LPS and nematode cell-surface glycans. In addition, a C. elegans gene, termed samt-1, coding for a candidate membrane transport protein for the presumptive donor substrate of glycan methylation, S-adenosyl-methionine, from the cytoplasm to the Golgi was identified. Intriguingly, limulus lectin L6, a structurally related antibacterial protein of the Japanese horseshoe crab Tachypleus tridentatus, showed properties identical to the mushroom lectin. These results suggest that O-methylated glycans constitute a conserved target of the fungal and animal innate immune system. The broad phylogenetic distribution of O-methylated glycans increases the spectrum of potential antagonists recognized by Tectonins, rendering this conserved protein family a universal defense armor. PMID:24879441

Pipecolic Acid, an Endogenous Mediator of Defense Amplification and Priming, Is a Critical Regulator of Inducible Plant Immunity[W

PubMed Central

Návarová, Hana; Bernsdorff, Friederike; Döring, Anne-Christin; Zeier, Jürgen

2012-01-01

Metabolic signals orchestrate plant defenses against microbial pathogen invasion. Here, we report the identification of the non-protein amino acid pipecolic acid (Pip), a common Lys catabolite in plants and animals, as a critical regulator of inducible plant immunity. Following pathogen recognition, Pip accumulates in inoculated Arabidopsis thaliana leaves, in leaves distal from the site of inoculation, and, most specifically, in petiole exudates from inoculated leaves. Defects of mutants in AGD2-LIKE DEFENSE RESPONSE PROTEIN1 (ALD1) in systemic acquired resistance (SAR) and in basal, specific, and β-aminobutyric acid–induced resistance to bacterial infection are associated with a lack of Pip production. Exogenous Pip complements these resistance defects and increases pathogen resistance of wild-type plants. We conclude that Pip accumulation is critical for SAR and local resistance to bacterial pathogens. Our data indicate that biologically induced SAR conditions plants to more effectively synthesize the phytoalexin camalexin, Pip, and salicylic acid and primes plants for early defense gene expression. Biological priming is absent in the pipecolate-deficient ald1 mutants. Exogenous pipecolate induces SAR-related defense priming and partly restores priming responses in ald1. We conclude that Pip orchestrates defense amplification, positive regulation of salicylic acid biosynthesis, and priming to guarantee effective local resistance induction and the establishment of SAR. PMID:23221596

Structural Studies of Bacterial Enzymes and their Relation to Antibiotic Resistance Mechanisms - Final Paper

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maltz, Lauren

By using protein crystallography and X-ray diffraction, structures of bacterial enzymes were solved to gain a better understanding of how enzymatic modification acts as an antibacterial resistance mechanism. Aminoglycoside phosphotransferases (APHs) are one of three aminoglycoside modifying enzymes that confer resistance to the aminoglycoside antibiotics via enzymatic modification, rendering many drugs obsolete. Specifically, the APH(2”) family vary in their substrate specificities and also in their preference for the phosphate donor (ADP versus GDP). By solving the structures of members of the APH(2”) family of enzymes, we can see how domain movements are important to their substrate specificity. Our structure ofmore » the ternary complex of APH(2”)-IIIa with GDP and kanamycin, when compared to the known structures of APH(2”)-IVa, reveals that there are real physical differences between these two enzymes, a structural finding that explains why the two enzymes differ in their preferences for certain aminoglycosides. Another important group of bacterial resistance enzymes are the Class D β- lactamases. Oxacillinase carbapenemases (OXAs) are part of this enzyme class and have begun to confer resistance to ‘last resort’ drugs, most notably carbapenems. Our structure of OXA-143 shows that the conformational flexibility of a conserved hydrophobic residue in the active site (Val130) serves to control the entry of a transient water molecule responsible for a key step in the enzyme’s mechanism. Our results provide insight into the structural mechanisms of these two different enzymes« less

A study of the face validity of the 40 item version of the Defense Style Questionnaire (DSQ-40).

PubMed

Chabrol, Henri; Rousseau, Amélie; Rodgers, Rachel; Callahan, Stacey; Pirlot, Gérard; Sztulman, Henri

2005-11-01

There are few studies examining the face validity of the 40-item version of the Defense Style Questionnaire (DSQ-40). Moreover, the existing studies have provided conflicting results. The present study provides an in-depth examination of the face validity of the DSQ-40. Eight clinicians independently attributed each item of the DSQ-40 to a defense mechanism. The defense mechanisms listed in the DSM-IV Defensive Functioning Scale and their definitions were provided as a guide, along with the definition of those defense mechanisms investigated by the DSQ that are not included. It was further specified that the raters could attribute the items to defense mechanisms other than those listed or coping mechanisms. Twelve items out of 40 (30%) were attributed to the defense mechanisms they were supposed to investigate by fewer than four out of the eight raters. This result suggests that a substantial part of the DSQ-40 is lacking in face validity.

Differential validity of the Defense Mechanism Manual for the TAT between Asian Americans and Whites. Thematic Apperception Test.

PubMed

Hibbard, S; Tang, P C; Latko, R; Park, J H; Munn, S; Bolz, S; Somerville, A

2000-12-01

Thematic Apperception Test (Murray, 1943) responses of 69 Asian American (hereafter, Asian) and 83 White students were coded for defenses according to the Defense Mechanism Manual (Cramer, 1991b) and studied for differential validity in predicting paper-and-pencil measures of relevant constructs. Three tests for differential validity were used: (a) differences between validity coefficients, (b) interactions between predictor and ethnicity in criterion prediction, and (c) differences between groups in mean prediction errors using a common regression equation. Modest differential validity was found. It was surprising that the DMM scales were slightly stronger predictors of their criteria among Asians than among Whites and when a common predictor was used, desirable criteria were overpredicted for Asians, whereas undesirable ones were overpredicted for Whites. The results were not affected by acculturation level or English vocabulary among the Asians.

Local–global overlap in diversity informs mechanisms of bacterial biogeography

PubMed Central

Livermore, Joshua A; Jones, Stuart E

2015-01-01

Spatial variation in environmental conditions and barriers to organism movement are thought to be important factors for generating endemic species, thus enhancing global diversity. Recent microbial ecology research suggested that the entire diversity of bacteria in the global oceans could be recovered at a single site, thus inferring a lack of bacterial endemism. We argue this is not the case in the global ocean, but might be in other bacterial ecosystems with higher dispersal rates and lower global diversity, like the human gut. We quantified the degree to which local and global bacterial diversity overlap in a diverse set of ecosystems. Upon comparison of observed local–global diversity overlap with predictions from a neutral biogeography model, human-associated microbiomes (gut, skin, mouth) behaved much closer to neutral expectations whereas soil, lake and marine communities deviated strongly from the neutral expectations. This is likely a result of differences in dispersal rate among ‘patches', global diversity of these systems, and local densities of bacterial cells. It appears that overlap of local and global bacterial diversity is surprisingly large (but likely not one-hundred percent), and most importantly this overlap appears to be predictable based upon traditional biogeographic parameters like community size, global diversity, inter-patch environmental heterogeneity and patch connectivity. PMID:25848869

A new look at cardiac defense: attention or emotion?

PubMed

Vila, Jaime; Fernández, María Carmen; Pegalajar, Joaquín; Nieves Vera, María; Robles, Humbelina; Pérez, Nieves; Sánchez, María B; Ramírez, Isabel; Ruiz-Padial, Elisabeth

2003-05-01

The study of cardiac defense has a long tradition in psychological research both within the cognitive approach--linked to Pavlov, Sokolov, and Graham's work on sensory reflexes--and within the motivational one--linked to the work of Cannon and subsequent researchers on the concepts of activation and stress. These two approaches have been difficult to reconcile in the past. We summarize a series of studies on cardiac defense from a different perspective, which allows integration of the traditional approaches. This new perspective emphasizes a sequential process interpretation of the cardiac defense response. Results of descriptive and parametric studies, as well as those of studies examining the physiological and psychological mechanisms underlying the response, show a complex response pattern with both accelerative and decelerative components, with both sympathetic and parasympathetic influences, and with both attentional and emotional significance. The implications of this new look at cardiac defense are discussed in relation to defensive reactions in natural settings, the brain mechanisms controlling such reactions, and their effects on health and illness.

Host plant species determines symbiotic bacterial community mediating suppression of plant defenses

USDA-ARS?s Scientific Manuscript database

Herbivore associated bacteria are vital mediators of plant and insect interactions. Host plants play an important role in shaping the gut bacterial community of insects. Colorado potato beetles (CPB; Leptinotarsa decemlineata) use several Solanum plants as hosts in their natural environment. We prev...

Microbial pathogens trigger host DNA double-strand breaks whose abundance is reduced by plant defense responses.

PubMed

Song, Junqi; Bent, Andrew F

2014-04-01

Immune responses and DNA damage repair are two fundamental processes that have been characterized extensively, but the links between them remain largely unknown. We report that multiple bacterial, fungal and oomycete plant pathogen species induce double-strand breaks (DSBs) in host plant DNA. DNA damage detected by histone γ-H2AX abundance or DNA comet assays arose hours before the disease-associated necrosis caused by virulent Pseudomonas syringae pv. tomato. Necrosis-inducing paraquat did not cause detectable DSBs at similar stages after application. Non-pathogenic E. coli and Pseudomonas fluorescens bacteria also did not induce DSBs. Elevation of reactive oxygen species (ROS) is common during plant immune responses, ROS are known DNA damaging agents, and the infection-induced host ROS burst has been implicated as a cause of host DNA damage in animal studies. However, we found that DSB formation in Arabidopsis in response to P. syringae infection still occurs in the absence of the infection-associated oxidative burst mediated by AtrbohD and AtrbohF. Plant MAMP receptor stimulation or application of defense-activating salicylic acid or jasmonic acid failed to induce a detectable level of DSBs in the absence of introduced pathogens, further suggesting that pathogen activities beyond host defense activation cause infection-induced DNA damage. The abundance of infection-induced DSBs was reduced by salicylic acid and NPR1-mediated defenses, and by certain R gene-mediated defenses. Infection-induced formation of γ-H2AX still occurred in Arabidopsis atr/atm double mutants, suggesting the presence of an alternative mediator of pathogen-induced H2AX phosphorylation. In summary, pathogenic microorganisms can induce plant DNA damage. Plant defense mechanisms help to suppress rather than promote this damage, thereby contributing to the maintenance of genome integrity in somatic tissues.

Psychopathological symptoms, defense mechanisms and time perspectives among subjects with alcohol dependence (AD) presenting different patterns of coping with stress.

PubMed

Iwanicka, Katarzyna; Gerhant, Aneta; Olajossy, Marcin

2017-01-01

The problem of coping with stress is an important one in the context of development and persistence of alcohol dependence. In the literature to date very little attention has been paid to coping patterns construed as a configuration of specific coping styles, particularly as regards the functioning of addicted individuals. The aim of the study was to verify whether individuals with alcohol dependence characterized by different coping patterns differ with respect to the severity of psychopathological symptoms, defense mechanisms and time perspectives. Participants were given a battery of psychological tests-Coping Inventory for Stresfull Situations (CISS), Defense Style Questionnaire (DSQ 40), Syndrom Checklist (SCL-90) and Short Zimbardo Time Perspective Inventory (SZPTI-PL). The sample comprised 112 individuals with alcohol dependence, aged 20 to 63 years old, the average age was 37.86; 78 percent were men. There were identified three sub-groups of individuals characterized by a distinctive patterns of coping with stress -"emotional-avoidant", "task oriented" and a "mixed one". Individuals with the predominant emotional-avoidant coping pattern are characterized by significantly higher severity of psychopathological symptoms, less mature defense mechanisms and past time perspectives. Subjects reliant on task-oriented coping pattern were characterized by the highest level of adaptation and the most constructive way of functioning in the face of difficulties. It is worth regarding the examination of patterns of coping as an indispensable element of collecting medical history from alcohol dependent individuals.

Increased Sleep Promotes Survival during a Bacterial Infection in Drosophila

PubMed Central

Kuo, Tzu-Hsing; Williams, Julie A.

2014-01-01

Study Objectives: The relationship between sleep and immune function is not well understood at a functional or molecular level. We therefore used a genetic approach in Drosophila to manipulate sleep and evaluated effects on the ability of flies to fight bacterial infection. Setting: Laboratory. Participants: Drosophila melanogaster. Methods and Results: We used a genetic approach to transiently alter neuronal excitability in the mushroom body, a region in the central brain that is known to regulate sleep. Flies with increased sleep for up to two days prior to a bacterial infection showed increased resistance to the infection and improved survival. These flies also had increased expression levels of a subset of anti-microbial peptide mRNA prior to infection, as well as increased NFκB activity during infection as indicated by in vivo luciferase reporter activity. In contrast, flies that experienced reduced sleep for up to two days prior to infection had no effect on survival or on NFκB activity during infection. However, flies with reduced sleep showed an altered defense mechanism, such that resistance to infection was increased, but at the expense of reduced tolerance. This effect was dependent on environmental condition. Conclusions: Increasing sleep enhanced activity of an NFκB transcription factor, increased resistance to infection, and strongly promoted survival. Together, these findings support the hypothesis that sleep is beneficial to the host by maintaining a robust immune system. Citation: Kuo TH, Williams JA. Increased sleep promotes survival during a bacterial infection in Drosophila. SLEEP 2014;37(6):1077-1086. PMID:24882902

Plant growth-promoting bacterial endophytes.

PubMed

Santoyo, Gustavo; Moreno-Hagelsieb, Gabriel; Orozco-Mosqueda, Ma del Carmen; Glick, Bernard R

2016-02-01

Bacterial endophytes ubiquitously colonize the internal tissues of plants, being found in nearly every plant worldwide. Some endophytes are able to promote the growth of plants. For those strains the mechanisms of plant growth-promotion known to be employed by bacterial endophytes are similar to the mechanisms used by rhizospheric bacteria, e.g., the acquisition of resources needed for plant growth and modulation of plant growth and development. Similar to rhizospheric plant growth-promoting bacteria, endophytic plant growth-promoting bacteria can act to facilitate plant growth in agriculture, horticulture and silviculture as well as in strategies for environmental cleanup (i.e., phytoremediation). Genome comparisons between bacterial endophytes and the genomes of rhizospheric plant growth-promoting bacteria are starting to unveil potential genetic factors involved in an endophytic lifestyle, which should facilitate a better understanding of the functioning of bacterial endophytes. Copyright © 2015 Elsevier GmbH. All rights reserved.

Structure of the bacterial flagellar hook and implication for the molecular universal joint mechanism.

PubMed

Samatey, Fadel A; Matsunami, Hideyuki; Imada, Katsumi; Nagashima, Shigehiro; Shaikh, Tanvir R; Thomas, Dennis R; Chen, James Z; Derosier, David J; Kitao, Akio; Namba, Keiichi

2004-10-28

The bacterial flagellum is a motile organelle, and the flagellar hook is a short, highly curved tubular structure that connects the flagellar motor to the long filament acting as a helical propeller. The hook is made of about 120 copies of a single protein, FlgE, and its function as a nano-sized universal joint is essential for dynamic and efficient bacterial motility and taxis. It transmits the motor torque to the helical propeller over a wide range of its orientation for swimming and tumbling. Here we report a partial atomic model of the hook obtained by X-ray crystallography of FlgE31, a major proteolytic fragment of FlgE lacking unfolded terminal regions, and by electron cryomicroscopy and three-dimensional helical image reconstruction of the hook. The model reveals the intricate molecular interactions and a plausible switching mechanism for the hook to be flexible in bending but rigid against twisting for its universal joint function.

Progranulin Plays a Central Role in Host Defense during Sepsis by Promoting Macrophage Recruitment.

PubMed

Song, Zhixin; Zhang, Xuemei; Zhang, Liping; Xu, Fang; Tao, Xintong; Zhang, Hua; Lin, Xue; Kang, Lihua; Xiang, Yu; Lai, Xaiofei; Zhang, Qun; Huang, Kun; Dai, Yubing; Yin, Yibing; Cao, Ju

2016-11-15

Progranulin, a widely expressed protein, has multiple physiological functions. The functional role of progranulin in the host response to sepsis remains unknown. To assess the role of progranulin in the host response to sepsis. Effects of progranulin on host response to sepsis were determined. Progranulin concentrations were significantly elevated in adult (n = 74) and pediatric (n = 26) patients with sepsis relative to corresponding healthy adult (n = 36) and pediatric (n = 17) control subjects, respectively. By using a low-lethality model of nonsevere sepsis, we observed that progranulin deficiency not only increased mortality but also decreased bacterial clearance during sepsis. The decreased host defense to sepsis in progranulin-deficient mice was associated with reduced macrophage recruitment, with correspondingly impaired chemokine CC receptor ligand 2 (CCL2) production in peritoneal lavages during the early phase of sepsis. Progranulin derived from hematopoietic cells contributed to host defense in sepsis. Therapeutic administration of recombinant progranulin not only rescued impaired host defense in progranulin-deficient mice after nonsevere sepsis but also protected wild-type mice against a high-lethality model of severe sepsis. Progranulin-mediated protection against sepsis was closely linked to improved peritoneal macrophage recruitment. In addition, CCL2 treatment of progranulin-deficient mice improved survival and decreased peritoneal bacterial loads during sepsis, at least in part through promotion of peritoneal macrophage recruitment. This proof-of-concept study supports a central role of progranulin-dependent macrophage recruitment in host defense to sepsis, opening new opportunities to host-directed therapeutic strategy that manipulate host immune response in the treatment of sepsis.

Systemic acquired tolerance to virulent bacterial pathogens in tomato.

PubMed

Block, Anna; Schmelz, Eric; O'Donnell, Phillip J; Jones, Jeffrey B; Klee, Harry J

2005-07-01

Recent studies on the interactions between plants and pathogenic microorganisms indicate that the processes of disease symptom development and pathogen growth can be uncoupled. Thus, in many instances, the symptoms associated with disease represent an active host response to the presence of a pathogen. These host responses are frequently mediated by phytohormones. For example, ethylene and salicylic acid (SA) mediate symptom development but do not influence bacterial growth in the interaction between tomato (Lycopersicon esculentum) and virulent Xanthomonas campestris pv vesicatoria (Xcv). It is not apparent why extensive tissue death is integral to a defense response if it does not have the effect of limiting pathogen proliferation. One possible function for this hormone-mediated response is to induce a systemic defense response. We therefore assessed the systemic responses of tomato to Xcv. SA- and ethylene-deficient transgenic lines were used to investigate the roles of these phytohormones in systemic signaling. Virulent and avirulent Xcv did induce a systemic response as evidenced by expression of defense-associated pathogenesis-related genes in an ethylene- and SA-dependent manner. This systemic response reduced cell death but not bacterial growth during subsequent challenge with virulent Xcv. This systemic acquired tolerance (SAT) consists of reduced tissue damage in response to secondary challenge with a virulent pathogen with no effect upon pathogen growth. SAT was associated with a rapid ethylene and pathogenesis-related gene induction upon challenge. SAT was also induced by infection with Pseudomonas syringae pv tomato. These data show that SAT resembles systemic acquired resistance without inhibition of pathogen growth.

Defense styles explain psychiatric symptoms: an empirical study.

PubMed

Holi, M M; Sammallahti, P R; Aalberg, V A

1999-11-01

To examine the relation between psychiatric symptoms and defense mechanisms, we administered two questionnaires, the Symptom Check-list 90 (SCL-90) and the Defense Style Questionnaire (DSQ) to 122 psychiatric out-patients and to a community sample of 337 subjects. Using regression analysis, we found that 51.8% of the variation in subject's Global Severity Index value could be explained by his defense style. Of the three defense styles, the immature style explained most of the variation in the symptoms. We found little overall evidence for specific connections between particular defenses and symptoms. Projection and dissociation were central in most of the symptom dimensions. We compared patients and controls with the same level of general symptom severity and found that patients used significantly more devaluation and splitting, and controls used significantly more altruism and idealization. Whether defenses predispose to certain symptomatology or are one of its aspects is discussed.

Nitrate, nitrite and nitric oxide reductases: from the last universal common ancestor to modern bacterial pathogens

PubMed Central

Vázquez-Torres, Andrés; Bäumler, Andreas

2016-01-01

The electrochemical gradient that ensues from the enzymatic activity of cytochromes such as nitrate reductase, nitric oxide reductase, and quinol oxidase contributes to the bioenergetics of the bacterial cell. Reduction of nitrogen oxides by bacterial pathogens can, however, be uncoupled from proton translocation and biosynthesis of ATP or NH4+, but still linked to quinol and NADH oxidation. Ancestral nitric oxide reductases, as well as cytochrome coxidases and quinol bo oxidases evolved from the former, are capable of binding and detoxifying nitric oxide to nitrous oxide. The NO-metabolizing activity associated with these cytochromes can be a sizable source of antinitrosative defense in bacteria during their associations with host cells. Nitrosylation of terminal cytochromes arrests respiration, reprograms bacterial metabolism, stimulates antioxidant defenses and alters antibiotic cytotoxicity. Collectively, the bioenergetics and regulation of redox homeostasis that accompanies the utilization of nitrogen oxides and detoxification of nitric oxide by cytochromes of the electron transport chain increases fitness of many Gram-positive and –negative pathogens during their associations with invertebrate and vertebrate hosts. PMID:26426528

Physics of Bacterial Morphogenesis

PubMed Central

Sun, Sean X.; Jiang, Hongyuan

2011-01-01

Summary: Bacterial cells utilize three-dimensional (3D) protein assemblies to perform important cellular functions such as growth, division, chemoreception, and motility. These assemblies are composed of mechanoproteins that can mechanically deform and exert force. Sometimes, small-nucleotide hydrolysis is coupled to mechanical deformations. In this review, we describe the general principle for an understanding of the coupling of mechanics with chemistry in mechanochemical systems. We apply this principle to understand bacterial cell shape and morphogenesis and how mechanical forces can influence peptidoglycan cell wall growth. We review a model that can potentially reconcile the growth dynamics of the cell wall with the role of cytoskeletal proteins such as MreB and crescentin. We also review the application of mechanochemical principles to understand the assembly and constriction of the FtsZ ring. A number of potential mechanisms are proposed, and important questions are discussed. PMID:22126993

The Impact of Emerging MEMS-Based Microsystems on US Defense Applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

STAPLE,BEVAN D.; JAKUBCZAK II,JEROME F.

2000-01-20

This paper examines the impact of inserting Micro-Electro-Mechanical Systems (MEMS) into US defense applications. As specific examples, the impacts of micro Inertial Measurement Units (IMUs), radio frequency MEMS (RF MEMS), and Micro-Opto-Electro-Mechanical Systems (MOEMS) to provide integrated intelligence, communication, and control to the defense infrastructure with increased affordability, functionality, and performance are highlighted.

Estimating Herd Immunity to Amphibian Chytridiomycosis in Madagascar Based on the Defensive Function of Amphibian Skin Bacteria

PubMed Central

Bletz, Molly C.; Myers, Jillian; Woodhams, Douglas C.; Rabemananjara, Falitiana C. E.; Rakotonirina, Angela; Weldon, Che; Edmonds, Devin; Vences, Miguel; Harris, Reid N.

2017-01-01

For decades, Amphibians have been globally threatened by the still expanding infectious disease, chytridiomycosis. Madagascar is an amphibian biodiversity hotspot where Batrachochytrium dendrobatidis (Bd) has only recently been detected. While no Bd-associated population declines have been reported, the risk of declines is high when invasive virulent lineages become involved. Cutaneous bacteria contribute to host innate immunity by providing defense against pathogens for numerous animals, including amphibians. Little is known, however, about the cutaneous bacterial residents of Malagasy amphibians and the functional capacity they have against Bd. We cultured 3179 skin bacterial isolates from over 90 frog species across Madagascar, identified them via Sanger sequencing of approximately 700 bp of the 16S rRNA gene, and characterized their functional capacity against Bd. A subset of isolates was also tested against multiple Bd genotypes. In addition, we applied the concept of herd immunity to estimate Bd-associated risk for amphibian communities across Madagascar based on bacterial antifungal activity. We found that multiple bacterial isolates (39% of all isolates) cultured from the skin of Malagasy frogs were able to inhibit Bd. Mean inhibition was weakly correlated with bacterial phylogeny, and certain taxonomic groups appear to have a high proportion of inhibitory isolates, such as the Enterobacteriaceae, Pseudomonadaceae, and Xanthamonadaceae (84, 80, and 75% respectively). Functional capacity of bacteria against Bd varied among Bd genotypes; however, there were some bacteria that showed broad spectrum inhibition against all tested Bd genotypes, suggesting that these bacteria would be good candidates for probiotic therapies. We estimated Bd-associated risk for sampled amphibian communities based on the concept of herd immunity. Multiple amphibian communities, including those in the amphibian diversity hotspots, Andasibe and Ranomafana, were estimated to be below

Ego mechanisms of defense are associated with patients' preference of treatment modality independent of psychological distress in end-stage renal disease.

PubMed

Hyphantis, Thomas; Katsoudas, Spiros; Voudiclari, Sonia

2010-03-24

Several parameters mediate the selection of treatment modality in end-stage renal disease (ESRD). The nephrology community suggests that patient preference should be the prime determinant of modality choice. We aimed to test whether ego mechanisms of defense are associated with patients' treatment modality preferences, independent of psychological distress. In 58 eligible ESRD patients who had themselves chosen their treatment modality, we administered the Symptom Distress Checklist-90-R and the Defense Style Questionnaire. Thirty-seven patients (53.4%) had chosen hemodialysis and 21 (46.6%) peritoneal dialysis. Patients who preferred peritoneal dialysis were younger (odds ratio [OR], 0.89; 95% confidence interval [CI]: 0.804-0.988), had received more education (OR, 8.84; 95% CI: 1.301-60.161), and were twice as likely to adopt an adaptive defense style as compared to patients who preferred hemodialysis (57.1% vs 27.0%, respectively; P < 0.033). On the contrary, the latter were more likely to adopt an image-distorting defense style (35.1% vs 14.3%; P = 0.038) and passive-aggressive defenses (OR, 0.73: 95% CI: 0.504-1.006). These results were independent of psychological distress. Our findings indicate that the patient's personality should be taken into account, if we are to better define which modalities are best suited to which patients. Also, physicians should bear in mind passive-aggressive behaviors that warrant attention and intervention in patients who preferred hemodialysis.

Defense mechanisms of sargassacean species against the epiphytic red alga Neosiphonia harveyi.

PubMed

Nakajima, Noboru; Ohki, Kaori; Kamiya, Mitsunobu

2015-08-01

Flora diversity and abundance of epiphytes are specific to their basiphyte species and may relate to variations in the defensive abilities of basiphytes. Thus, investigating the interactions between epiphytes and basiphytes is useful for a better understanding of the biological impact of epiphytism and the survival strategies of basiphytes. We examined the epiphyte density on five sargassacean species at six locations between two study sites, which showed that the epiphytic red alga Neosiphonia harveyi was remarkably less abundant on Sargassum siliquastrum at all locations. To assess its defense mechanism against N. harveyi, we performed bioassays of phlorotannins, which are considered effective in deterring fouling, by culturing sargassacean blades with N. harveyi carpospores and observed the process by which sargassacean blades remove epiphytes. When the carpospores were incubated with various concentrations of dissolved phlorotannins, settlement and germination were inhibited only at the highest concentrations (>0.1 g · L(-1) ), and this effect did not significantly differ among the five sargassacean species. When the carpospores were combined with blades from the five species, many of the spores attached and germinated on every blade. Because N. harveyi penetrated rhizoids into basiphyte tissues, cuticle peeling observed in all five sargassacean species could not remove this epiphyte after germination. However, in S. siliquastrum, the blade tissues around the germlings became swollen and disintegrative, and were removed together with the germlings. The spores normally grew on the dead blades, suggesting that the tissue degradation of S. siliquastrum is triggered by the infection of N. harveyi. © 2015 Phycological Society of America.

Bacterial endosymbionts of the psyllid Cacopsylla pyricola in the Pacific Northwestern United States (Hemiptera: Psyllidae)

USDA-ARS?s Scientific Manuscript database

Insects often have facultative associations with bacterial endosymbionts, which can alter the insects' susceptibility to parasitism, pathogens, plant defenses, and certain classes of insecticides. We collected pear psylla, Cacopsylla pyricola (Förster) (Hemiptera: Psyllidae), from pear orchards in W...

22 CFR 130.4 - Defense articles and defense services.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 22 Foreign Relations 1 2012-04-01 2012-04-01 false Defense articles and defense services. 130.4 Section 130.4 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL TRAFFIC IN ARMS REGULATIONS POLITICAL CONTRIBUTIONS, FEES AND COMMISSIONS § 130.4 Defense articles and defense services. Defense articles and defense...

22 CFR 130.4 - Defense articles and defense services.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 22 Foreign Relations 1 2013-04-01 2013-04-01 false Defense articles and defense services. 130.4 Section 130.4 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL TRAFFIC IN ARMS REGULATIONS POLITICAL CONTRIBUTIONS, FEES AND COMMISSIONS § 130.4 Defense articles and defense services. Defense articles and defense...

22 CFR 130.4 - Defense articles and defense services.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Defense articles and defense services. 130.4 Section 130.4 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL TRAFFIC IN ARMS REGULATIONS POLITICAL CONTRIBUTIONS, FEES AND COMMISSIONS § 130.4 Defense articles and defense services. Defense articles and defense...

22 CFR 130.4 - Defense articles and defense services.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 22 Foreign Relations 1 2011-04-01 2011-04-01 false Defense articles and defense services. 130.4 Section 130.4 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL TRAFFIC IN ARMS REGULATIONS POLITICAL CONTRIBUTIONS, FEES AND COMMISSIONS § 130.4 Defense articles and defense services. Defense articles and defense...

Understanding brassinosteroid-regulated mechanisms to improve stress tolerance in plants: a critical review.

PubMed

Nawaz, Fahim; Naeem, Muhammad; Zulfiqar, Bilal; Akram, Asim; Ashraf, Muhammad Yasin; Raheel, Muhammad; Shabbir, Rana Nauman; Hussain, Rai Altaf; Anwar, Irfan; Aurangzaib, Muhammad

2017-07-01

Brassinosteroids (BRs) are steroidal plant hormones involved in regulation of physiological and molecular processes to ameliorate various biotic and abiotic stresses. Exogenous application of BRs to improve stress tolerance in plants has recently become a high research priority. Several studies have revealed the involvement of these steroidal hormones in upregulation of stress-related defense genes and their cross talk with other metabolic pathways. This is likely to stimulate research on many unanswered questions regarding their role in enhancing the ability of plants to tolerate adverse environmental conditions. Thus, this review appraises new insights on mechanisms mediating BR-regulated changes in plants, focused mainly on their involvement in regulation of physiological and molecular mechanisms under stress conditions. Herein, examples of BR-stimulated modulation of antioxidant defense system and upregulation of transcription factors in plants exposed to various biotic (bacterial, viral, and fungal attack) and abiotic stresses (drought, salinity, heat, low temperature, and heavy metal stress) are discussed. Based on these insights, future research in the current direction can be helpful to increase our understanding of BR-mediated complex and interrelated processes under stress conditions.

Growth-defense tradeoffs in plants: a balancing act to optimize fitness.

PubMed

Huot, Bethany; Yao, Jian; Montgomery, Beronda L; He, Sheng Yang

2014-08-01

Growth-defense tradeoffs are thought to occur in plants due to resource restrictions, which demand prioritization towards either growth or defense, depending on external and internal factors. These tradeoffs have profound implications in agriculture and natural ecosystems, as both processes are vital for plant survival, reproduction, and, ultimately, plant fitness. While many of the molecular mechanisms underlying growth and defense tradeoffs remain to be elucidated, hormone crosstalk has emerged as a major player in regulating tradeoffs needed to achieve a balance. In this review, we cover recent advances in understanding growth-defense tradeoffs in plants as well as what is known regarding the underlying molecular mechanisms. Specifically, we address evidence supporting the growth-defense tradeoff concept, as well as known interactions between defense signaling and growth signaling. Understanding the molecular basis of these tradeoffs in plants should provide a foundation for the development of breeding strategies that optimize the growth-defense balance to maximize crop yield to meet rising global food and biofuel demands. © The Author 2014. Published by the Molecular Plant Shanghai Editorial Office in association with Oxford University Press on behalf of CSPB and IPPE, SIBS, CAS.

Mechanical interactions in bacterial colonies and the surfing probability of beneficial mutations

PubMed Central

Farrell, Fred D.

2017-01-01

Bacterial conglomerates such as biofilms and microcolonies are ubiquitous in nature and play an important role in industry and medicine. In contrast to well-mixed cultures routinely used in microbial research, bacteria in a microcolony interact mechanically with one another and with the substrate to which they are attached. Here, we use a computer model of a microbial colony of rod-shaped cells to investigate how physical interactions between cells determine their motion in the colony and how this affects biological evolution. We show that the probability that a faster-growing mutant ‘surfs’ at the colony's frontier and creates a macroscopic sector depends on physical properties of cells (shape, elasticity and friction). Although all these factors contribute to the surfing probability in seemingly different ways, their effects can be summarized by two summary statistics that characterize the front roughness and cell alignment. Our predictions are confirmed by experiments in which we measure the surfing probability for colonies of different front roughness. Our results show that physical interactions between bacterial cells play an important role in biological evolution of new traits, and suggest that these interactions may be relevant to processes such as de novo evolution of antibiotic resistance. PMID:28592660

Mechanical interactions in bacterial colonies and the surfing probability of beneficial mutations.

PubMed

Farrell, Fred D; Gralka, Matti; Hallatschek, Oskar; Waclaw, Bartlomiej

2017-06-01

Bacterial conglomerates such as biofilms and microcolonies are ubiquitous in nature and play an important role in industry and medicine. In contrast to well-mixed cultures routinely used in microbial research, bacteria in a microcolony interact mechanically with one another and with the substrate to which they are attached. Here, we use a computer model of a microbial colony of rod-shaped cells to investigate how physical interactions between cells determine their motion in the colony and how this affects biological evolution. We show that the probability that a faster-growing mutant 'surfs' at the colony's frontier and creates a macroscopic sector depends on physical properties of cells (shape, elasticity and friction). Although all these factors contribute to the surfing probability in seemingly different ways, their effects can be summarized by two summary statistics that characterize the front roughness and cell alignment. Our predictions are confirmed by experiments in which we measure the surfing probability for colonies of different front roughness. Our results show that physical interactions between bacterial cells play an important role in biological evolution of new traits, and suggest that these interactions may be relevant to processes such as de novo evolution of antibiotic resistance. © 2017 The Author(s).

Bacterial Degradation of Aromatic Compounds

PubMed Central

Seo, Jong-Su; Keum, Young-Soo; Li, Qing X.

2009-01-01

Aromatic compounds are among the most prevalent and persistent pollutants in the environment. Petroleum-contaminated soil and sediment commonly contain a mixture of polycyclic aromatic hydrocarbons (PAHs) and heterocyclic aromatics. Aromatics derived from industrial activities often have functional groups such as alkyls, halogens and nitro groups. Biodegradation is a major mechanism of removal of organic pollutants from a contaminated site. This review focuses on bacterial degradation pathways of selected aromatic compounds. Catabolic pathways of naphthalene, fluorene, phenanthrene, fluoranthene, pyrene, and benzo[a]pyrene are described in detail. Bacterial catabolism of the heterocycles dibenzofuran, carbazole, dibenzothiophene, and dibenzodioxin is discussed. Bacterial catabolism of alkylated PAHs is summarized, followed by a brief discussion of proteomics and metabolomics as powerful tools for elucidation of biodegradation mechanisms. PMID:19440284

Fungal Innate Immunity Induced by Bacterial Microbe-Associated Molecular Patterns (MAMPs)

PubMed Central

Ipcho, Simon; Sundelin, Thomas; Erbs, Gitte; Kistler, H. Corby; Newman, Mari-Anne; Olsson, Stefan

2016-01-01

Plants and animals detect bacterial presence through Microbe-Associated Molecular Patterns (MAMPs) which induce an innate immune response. The field of fungal–bacterial interaction at the molecular level is still in its infancy and little is known about MAMPs and their detection by fungi. Exposing Fusarium graminearum to bacterial MAMPs led to increased fungal membrane hyperpolarization, a putative defense response, and a range of transcriptional responses. The fungus reacted with a different transcript profile to each of the three tested MAMPs, although a core set of genes related to energy generation, transport, amino acid production, secondary metabolism, and especially iron uptake were detected for all three. Half of the genes related to iron uptake were predicted MirA type transporters that potentially take up bacterial siderophores. These quick responses can be viewed as a preparation for further interactions with beneficial or pathogenic bacteria, and constitute a fungal innate immune response with similarities to those of plants and animals. PMID:27172188

Dynamic Shaping of the Defensive Peripersonal Space through Predictive Motor Mechanisms: When the "Near" Becomes "Far".

PubMed

Bisio, Ambra; Garbarini, Francesca; Biggio, Monica; Fossataro, Carlotta; Ruggeri, Piero; Bove, Marco

2017-03-01

The hand blink reflex is a subcortical defensive response, known to dramatically increase when the stimulated hand is statically positioned inside the defensive peripersonal space (DPPS) of the face. Here, we tested in a group of healthy human subjects the hand blink reflex in dynamic conditions, investigating whether the direction of the hand movements (up-to/down-from the face) could modulate it. We found that, on equal hand position, the response enhancement was present only when the hand approached to (and not receded from) the DPPS of the face. This means that, when the hand is close to the face but the subject is planning to move the hand down, the predictive motor system can anticipate the consequence of the movement: the "near" becomes "far." We found similar results both in passive movement condition, when only afferent (visual and proprioceptive) information can be used to estimate the final state of the system, and in motor imagery task, when only efferent (intentional) information is available to predict the consequences of the movement. All these findings provide evidence that the DPPS is dynamically shaped by predictive mechanisms run by the motor system and based on the integration of feedforward and sensory feedback signals. SIGNIFICANCE STATEMENT The defensive peripersonal space (DPPS) has a crucial role for survival, and its modulation is fundamental when we interact with the environment, as when we move our arms. Here, we focused on a defensive response, the hand blink reflex, known to increase when a static hand is stimulated inside the DPPS of the face. We tested the hand blink reflex in dynamic conditions (voluntary, passive, and imagined movements) and we found that, on equal hand position, the response enhancement was present only when the hand approached to (and not receded from) the DPPS of the face. This suggests that, through the integration of efferent and afferent signals, the safety boundary around the body is continuously shaped by

Chemical and genetic defenses against disease in insect societies.

PubMed

Stow, Adam; Beattie, Andrew

2008-10-01

The colonies of ants, bees, wasps and termites, the social insects, consist of large numbers of closely related individuals; circumstances ideal for contagious diseases. Antimicrobial assays of these animals have demonstrated a wide variety of chemical defenses against both bacteria and fungi that can be broadly classified as either external antiseptic compounds or internal immune molecules. Reducing the disease risks inherent in colonies of social insects is also achieved by behaviors, such as multiple mating or dispersal, that lower genetic relatedness both within- and among colonies. The interactions between social insects and their pathogens are complex, as illustrated by some ants that require antimicrobial and behavioral defenses against highly specialized fungi, such as those in the genus Cordyceps that attack larvae and adults and species in the genus Escovopsis that attack their food supplies. Studies of these defenses, especially in ants, have revealed remarkably sophisticated immune systems, including peptides induced by, and specific to, individual bacterial strains. The latter may be the result of the recruitment by the ants of antibiotic-producing bacteria but the extent of such three-way interactions remains unknown. There is strong experimental evidence that the evolution of sociality required dramatic increases in antimicrobial defenses and that microbes have been powerful selective agents. The antimicrobial chemicals and the insect-killing fungi may be useful in medicine and agriculture, respectively.

Anti-bacterial activity of Achatina CRP and its mechanism of action.

PubMed

Mukherjee, Sandip; Barman, Soma; Mandal, Narayan Chandra; Bhattacharya, Shelley

2014-07-01

The physiological role of C-reactive protein (CRP), the classical acute-phase protein, is not well documented, despite many reports on biological effects of CRP in vitro and in model systems in vivo. It has been suggested that CRP protects mice against lethal toxicity of bacterial infections by implementing immunological responses. In Achatina fulica CRP is a constitutive multifunctional protein in haemolymph and considered responsible for their survival in the environment for millions of years. The efficacy of Achatina CRP (ACRP) was tested against both Salmonella typhimurium and Bacillus subtilis infections in mice where endogenous CRP level is negligible even after inflammatory stimulus. Further, growth curves of the bacteria revealed that ACRP (50 microg/mL) is bacteriostatic against gram negative salmonellae and bactericidal against gram positive bacilli. ACRP induced energy crises in bacterial cells, inhibited key carbohydrate metabolic enzymes such as phosphofructokinase in glycolysis, isocitrate dehydrogenase in TCA cycle, isocitrate lyase in glyoxylate cycle and fructose-1,6-bisphosphatase in gluconeogenesis. ACRP disturbed the homeostasis of cellular redox potential as well as reduced glutathione status, which is accompanied by an enhanced rate of lipid peroxidation. Annexin V-Cy3/CFDA dual staining clearly showed ACRP induced apoptosis-like death in bacterial cell population. Moreover, immunoblot analyses also indicated apoptosis-like death in ACRP treated bacterial cells, where activation of poly (ADP-ribose) polymerase-1 (PARP) and caspase-3 was noteworthy. It is concluded that metabolic impairment by ACRP in bacterial cells is primarily due to generation of reactive oxygen species and ACRP induced anti-bacterial effect is mediated by metabolic impairment leading to apoptosis-like death in bacterial cells.

An operon for production of bioactive gibberellin A4 phytohormone with wide distribution in the bacterial rice leaf streak pathogen Xanthomonas oryzae pv. oryzicola

PubMed Central

Nagel, Raimund; Turrini, Paula C. G.; Nett, Ryan S.; Leach, Jan E.; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J.

2016-01-01

Summary Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the gibberellin (GA) phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid (JA) mediated defense response.Here the function of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae investigated in over 100 isolates.The Xoc operon leads to production of the bioactive GA4, an additional step beyond production of the penultimate precursor GA9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (>90%), but absent in the other major oryzae pathovar.These results indicate selective pressure for production of GA4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. PMID:28134995

Melatonin as a signal molecule triggering defense responses against pathogen attack in Arabidopsis and tobacco.

PubMed

Lee, Hyoung Yool; Byeon, Yeong; Back, Kyoungwhan

2014-10-01

Melatonin plays pleiotropic roles in both animals and plants. The possible role of melatonin in plant innate immune responses was recently discovered. As an initial study, we employed Arabidopsis to determine whether melatonin is involved in defense against the virulent bacterial pathogen Pseudomonas syringae DC3000. The application of a 10 μM concentration of melatonin on Arabidopsis and tobacco leaves induced various pathogenesis-related (PR) genes, as well as a series of defense genes activated by salicylic acid (SA) and ethylene (ET), two key factors involved in plant defense response, compared to mock-treated leaves. The induction of these defense-related genes in melatonin-treated Arabidopsis matched an increase in resistance against the bacterium by suppressing its multiplication about ten-fold relative to the mock-treated Arabidopsis. Like melatonin, N-acetylserotonin also plays a role in inducing a series of defense genes, although serotonin does not. Furthermore, melatonin-induced PR genes were almost completely or partially suppressed in the npr1, ein2, and mpk6 Arabidopsis mutants, indicative of SA and ET dependency in melatonin-induced plant defense signaling. This suggests that melatonin may be a novel defense signaling molecule in plant-pathogen interactions. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Molecular defense mechanisms of Barrett's metaplasia estimated by an integrative genomics.

PubMed

Ostrowski, Jerzy; Mikula, Michal; Karczmarski, Jakub; Rubel, Tymon; Wyrwicz, Lucjan S; Bragoszewski, Piotr; Gaj, Pawel; Dadlez, Michal; Butruk, Eugeniusz; Regula, Jaroslaw

2007-07-01

Barrett's esophagus is characterized by the replacement of squamous epithelium with specialized intestinal metaplastic mucosa. The exact mechanisms of initiation and development of Barrett's metaplasia remain unknown, but a hypothesis of "successful adaptation" against noxious reflux components has been proposed. To search for the repertoire of adaptation mechanisms of Barrett's metaplasia, we employed high-throughput functional genomic and proteomic methods that defined the molecular background of metaplastic mucosa resistance to reflux. Transcriptional profiling was established for 23 pairs of esophageal squamous epithelium and Barrett's metaplasia tissue samples using Affymetrix U133A 2.0 GeneChips and validated by quantitative real-time polymerase chain reaction. Differences in protein composition were assessed by electrophoretic and mass-spectrometry-based methods. Among 2,822 genes differentially expressed between Barrett's metaplasia and squamous epithelium, we observed significantly overexpressed metaplastic mucosa genes that encode cytokines and growth factors, constituents of extracellular matrix, basement membrane and tight junctions, and proteins involved in prostaglandin and phosphoinositol metabolism, nitric oxide production, and bioenergetics. Their expression likely reflects defense and repair responses of metaplastic mucosa, whereas overexpression of genes encoding heat shock proteins and several protein kinases in squamous epithelium may reflect lower resistance of normal esophageal epithelium than Barrett's metaplasia to reflux components. Despite the methodological and interpretative difficulties in data analyses discussed in this paper, our studies confirm that Barrett's metaplasia may be regarded as a specific microevolution allowing for accumulation of mucosal morphological and physiological changes that better protect against reflux injury.

Preventive role of lens antioxidant defense mechanism against riboflavin-mediated sunlight damaging of lens crystallins.

PubMed

Anbaraki, Afrooz; Khoshaman, Kazem; Ghasemi, Younes; Yousefi, Reza

2016-10-01

The main components of sunlight reaching the eye lens are UVA and visible light exerting their photo-damaging effects indirectly by the aid of endogenous photosensitizer molecules such as riboflavin (RF). In this study, lens proteins solutions were incubated with RF and exposed to the sunlight. Then, gel mobility shift analysis and different spectroscopic assessments were applied to examine the structural damaging effects of solar radiation on these proteins. Exposure of lens proteins to direct sunlight, in the presence of RF, leads to marked structural crosslinking, oligomerization and proteolytic instability. These structural damages were also accompanied with reduction in the emission fluorescence of Trp and Tyr and appearance of a new absorption peak between 300 and 400nm which can be related to formation of new chromophores. Also, photo-oxidation of lens crystallins increases their oligomeric size distribution as examined by dynamic light scattering analysis. The above mentioned structural insults, as potential sources of sunlight-induced senile cataract and blindness, were significantly attenuated in the presence of ascorbic acid and glutathione which are two important components of lens antioxidant defense system. Therefore, the powerful antioxidant defense mechanism of eye lens is an important barrier against molecular photo-damaging effects of solar radiations during the life span. Copyright © 2016 Elsevier B.V. All rights reserved.

Relationship between lactobacilli and opportunistic bacterial pathogens associated with vaginitis.

PubMed

Razzak, Mohammad Sabri A; Al-Charrakh, Alaa H; Al-Greitty, Bara Hamid

2011-04-01

Vaginitis, is an infectious inflammation of the vaginal mucosa, which sometimes involves the vulva. The balance of the vaginal flora is maintained by the Lactobacilli and its protective and probiotic role in treating and preventing vaginal infection by producing antagonizing compounds which are regarded as safe for humans. The aim of this study was to evaluate the protective role of Lactobacilli against common bacterial opportunistic pathogens in vaginitis and study the effects of some antibiotics on Lactobacilli isolates. In this study (110) vaginal swabs were obtained from women suffering from vaginitis who admitted to Babylon Hospital of Maternity and Paediatrics in Babylon province, Iraq. The study involved the role of intrauterine device among married women with vaginitis and also involved isolation of opportunistic bacterial isolates among pregnant and non pregnant women. This study also involved studying probiotic role of Lactobacilli by production of some defense factors like hydrogen peroxide, bacteriocin, and lactic acid. Results revealed that a total of 130 bacterial isolates were obtained. Intrauterine device was a predisposing factor for vaginitis. The most common opportunistic bacterial isolates were Staphylococcus aureus, Escherichia coli, Streptococcus agalactiae, and Klebsiella pneumoniae. All Lactobacilli were hydrogen peroxide producers while some isolates were bacteriocin producers that inhibited some of opportunistic pathogens (S. aureus, E. coli). Lactobacilli were sensitive to erythromycin while 93.3% of them were resistant to ciprofloxacin and (40%, 53.3%) of them were resistant to amoxicillin and gentamycin respectively. Results revealed that there was an inverse relationship between Lactobacilli presence and organisms causing vaginitis. This may be attributed to the production of defense factors by Lactobacilli. The types of antibiotics used to treat vaginitis must be very selective in order not to kill the beneficial bacteria

Relationship between lactobacilli and opportunistic bacterial pathogens associated with vaginitis

PubMed Central

Razzak, Mohammad Sabri A.; Al-Charrakh, Alaa H.; AL-Greitty, Bara Hamid

2011-01-01

Background: Vaginitis, is an infectious inflammation of the vaginal mucosa, which sometimes involves the vulva. The balance of the vaginal flora is maintained by the Lactobacilli and its protective and probiotic role in treating and preventing vaginal infection by producing antagonizing compounds which are regarded as safe for humans. Aim: The aim of this study was to evaluate the protective role of Lactobacilli against common bacterial opportunistic pathogens in vaginitis and study the effects of some antibiotics on Lactobacilli isolates. Materials and Methods: In this study (110) vaginal swabs were obtained from women suffering from vaginitis who admitted to Babylon Hospital of Maternity and Paediatrics in Babylon province, Iraq. The study involved the role of intrauterine device among married women with vaginitis and also involved isolation of opportunistic bacterial isolates among pregnant and non pregnant women. This study also involved studying probiotic role of Lactobacilli by production of some defense factors like hydrogen peroxide, bacteriocin, and lactic acid. Results: Results revealed that a total of 130 bacterial isolates were obtained. Intrauterine device was a predisposing factor for vaginitis. The most common opportunistic bacterial isolates were Staphylococcus aureus, Escherichia coli, Streptococcus agalactiae, and Klebsiella pneumoniae. All Lactobacilli were hydrogen peroxide producers while some isolates were bacteriocin producers that inhibited some of opportunistic pathogens (S. aureus, E. coli). Lactobacilli were sensitive to erythromycin while 93.3% of them were resistant to ciprofloxacin and (40%, 53.3%) of them were resistant to amoxicillin and gentamycin respectively. Results revealed that there was an inverse relationship between Lactobacilli presence and organisms causing vaginitis. This may be attributed to the production of defense factors by Lactobacilli. Conclusion: The types of antibiotics used to treat vaginitis must be very

The biocontrol agent Pseudomonas chlororaphis PA23 primes Brassica napus defenses through distinct gene networks.

PubMed

Duke, Kelly A; Becker, Michael G; Girard, Ian J; Millar, Jenna L; Dilantha Fernando, W G; Belmonte, Mark F; de Kievit, Teresa R

2017-06-19

The biological control agent Pseudomonas chlororaphis PA23 is capable of protecting Brassica napus (canola) from the necrotrophic fungus Sclerotinia sclerotiorum via direct antagonism. While we have elucidated bacterial genes and gene products responsible biocontrol, little is known about how the host plant responds to bacterial priming on the leaf surface, including global changes in gene activity in the presence and absence of S. sclerotiorum. Application of PA23 to the aerial surfaces of canola plants reduced the number of S. sclerotiorum lesion-forming petals by 91.1%. RNA sequencing of the host pathogen interface showed that pretreatment with PA23 reduced the number of genes upregulated in response to S. sclerotiorum by 16-fold. By itself, PA23 activated unique defense networks indicative of defense priming. Genes encoding MAMP-triggered immunity receptors detecting flagellin and peptidoglycan were downregulated in PA23 only-treated plants, consistent with post-stimulus desensitization. Downstream, we observed reactive oxygen species (ROS) production involving low levels of H 2 O 2 and overexpression of genes associated with glycerol-3-phosphate (G3P)-mediated systemic acquired resistance (SAR). Leaf chloroplasts exhibited increased thylakoid membrane structures and chlorophyll content, while lipid metabolic processes were upregulated. In addition to directly antagonizing S. sclerotiorum, PA23 primes the plant defense response through induction of unique local and systemic defense networks. This study provides novel insight into the effects of biocontrol agents applied to the plant phyllosphere. Understanding these interactions will aid in the development of biocontrol systems as an alternative to chemical pesticides for protection of important crop systems.

Interaction of antimicrobial peptides with bacterial polysaccharides from lung pathogens.

PubMed

Herasimenka, Yury; Benincasa, Monica; Mattiuzzo, Maura; Cescutti, Paola; Gennaro, Renato; Rizzo, Roberto

2005-07-01

The interaction of two cathelicidin antimicrobial peptides, LL-37 and SMAP-29, with three bacterial polysaccharides, respectively, produced by Pseudomonas aeruginosa, Burkholderia cepacia and Klebsiella pneumoniae, was investigated to identify possible mechanisms adopted by lung pathogens to escape the action of innate immunity effectors. In vitro assays indicated that the antibacterial activity of both peptides was inhibited to a variable extent by the three polysaccharides. Circular dichroism experiments showed that these induced an alpha-helical conformation in the two peptides, with the polysaccharides from K. pneumoniae and B. cepacia showing, respectively, the highest and the lowest effect. Fluorescence measurements also indicated the presence of peptide-polysaccharide interactions. A model is proposed in which the binding of peptides to the polysaccharide molecules induces, at low polysaccharide to peptide ratios, a higher order of aggregation, due to peptide-peptide interactions. Overall, these results suggest that binding of the peptides by the polysaccharides produced by lung pathogens can contribute to the impairment of peptide-based innate defenses of airway surface.

Salicylic acid potentiates an agonist-dependent gain control that amplifies pathogen signals in the activation of defense mechanisms.

PubMed

Shirasu, K; Nakajima, H; Rajasekhar, V K; Dixon, R A; Lamb, C

1997-02-01

The phenylpropanoid-derived natural product salicylic acid (SA) plays a key role in disease resistance. However, SA administered in the absence of a pathogen is a paradoxically weak inductive signal, often requiring concentrations of 0.5 to 5 mM to induce acquired resistance or related defense mechanisms or to precondition signal systems. In contrast, endogenous SA accumulates to concentrations of < 70 microM at the site of attempted infection. Here, we show that although 10 to 100 microM SA had negligible effects when administered to soybean cell suspensions in the absence of a pathogen, physiological concentrations of SA markedly enhanced the induction of defense gene transcripts, H2O2 accumulation, and hypersensitive cell death by an avirulent strain of Pseudomonas syringae pv glycinea, with optimal effects being at approximately 50 microM. SA also synergistically enhanced H2O2 accumulation in response to the protein phosphatase type 2A inhibitor cantharidin in the absence of a pathogen. The synergistic effect of SA was potent, rapid, and insensitive to the protein synthesis inhibitor cycloheximide, and we conclude that SA stimulates an agonist-dependent gain control operating at an early step in the signal pathway for induction of the hypersensitive response. This fine control mechanism differs from previously described time-dependent, inductive coarse control mechanisms for SA action in the absence of a pathogen. Induction of H2O2 accumulation and hypersensitive cell death by avirulent P. s. glycinea was blocked by the phenylpropanoid synthesis inhibitor alpha-aminooxy-beta-phenylpropionic acid, and these responses could be rescued by exogenous SA. Because the agonist-dependent gain control operates at physiological levels of SA, we propose that rapid fine control signal amplification makes an important contribution to SA function in the induction of disease resistance mechanisms.

Molecular mechanism of mast cell–mediated innate defense against endothelin and snake venom sarafotoxin

PubMed Central

Schneider, Lars A.; Schlenner, Susan M.; Feyerabend, Thorsten B.; Wunderlin, Markus; Rodewald, Hans-Reimer

2007-01-01

Mast cells are protective against snake venom sarafotoxins that belong to the endothelin (ET) peptide family. The molecular mechanism underlying this recently recognized innate defense pathway is unknown, but secretory granule proteases have been invoked. To specifically disrupt a single protease function without affecting expression of other proteases, we have generated a mouse mutant selectively lacking mast cell carboxypeptidase A (Mc-cpa) activity. Using this mutant, we have now identified Mc-cpa as the essential protective mast cell enzyme. Mass spectrometry of peptide substrates after cleavage by normal or mutant mast cells showed that removal of a single amino acid, the C-terminal tryptophan, from ET and sarafotoxin by Mc-cpa is the principle molecular mechanism underlying this very rapid mast cell response. Mast cell proteases can also cleave ET and sarafotoxin internally, but such “nicking” is not protective because intramolecular disulfide bridges maintain peptide function. We conclude that mast cells attack ET and sarafotoxin exactly at the structure required for toxicity, and hence sarafotoxins could not “evade” Mc-cpa's substrate specificity without loss of toxicity. PMID:17923505

[Officer in charge, that unknown being - an explorative, qualitative study of unconscious fears, wishes, and defense mechanisms].

PubMed

Beck, Thomas; Kumnig, Martin; Breuss, Margit; Mitmansgruber, Horst; Schusser, Sandra; Andreatta, Pia; Mader, Maria; Schüßler, Gerhard

2013-01-01

The stress and coping strategies found among emergency relief personnel have been studied in detail but without considering their function in the team. However, specifically officers in charge have to be addressed and investigated separately. This study focuses on the unconscious desires, fears, and defense mechanisms present in order to improve our understanding of the stress experienced during operations. Four officers in charge were interviewed concerning their stressful experiences during operations. These interviews were then coded and analysed using the JAKOB Narrative Analysis ("Klinische Erzählanalyse JAKOB", Boothe et al. 2002). The recorded unconscious desires included solidarity, phallic integrity, generativity, unconscious fears destruction, loss of power/influence, and social hostility, and as defense strategies rationalism, repression/denial, and idealization. The analysis of the interviews shows a high reliability between the raters (0.74-0.79). The greatest burden for officers in charge is a loss of safety. Especially being confronted with strains in their own team leads to stress, which shows that the methods used for stress management following critical incidents is not sufficient.

[Bacterial Translocation from Intestine: Microbiological, Immunological and Pathophysiological Aspects].

PubMed

Podoprigora, G I; Kafarskaya, L I; Bainov, N A; Shkoporov, A N

2015-01-01

Bacterial translocation (BT) is both pathology and physiology phenomenon. In healthy newborns it accompanies the process of establishing the autochthonous intestinal microbiota and the host microbiome. In immunodeficiency it can be an aethio-pathogenetic link and a manifestation of infection or septic complications. The host colonization resistance to exogenous microbic colonizers is provided by gastrointestinal microbiota in concert with complex constitutional and adaptive defense mechanisms. BT may be result of barrier dysfunction and self-purification mechanisms involving the host myeloid cell phagocytic system and opsonins. Dynamic cell humoral response to microbial molecular patterns that occurs on the mucous membranes initiates receptorsignalingpathways and cascade ofreactions. Their vector and results are largely determined by cross-reactivity between microbiome and the host genome. Enterocyte barriers interacting with microbiota play leading role in providing adaptive, homeostatic and stress host reactivity. Microcirculatory ischemic tissue alterations and inflammatory reactions increase the intestinal barrier permeability and BT These processes a well as mechanisms for apoptotic cells and bacteria clearance are justified to be of prospective research interest. The inflammatory and related diseases caused by alteration and dysfunction of the intestinal barrier are reasonably considered as diseases of single origin. Maternal microbiota affects theformation of the innate immune system and the microbiota of the newborn, including intestinal commensal translocation during lactation. Deeper understanding of intestinal barrier mechanisms needs complex microbiological, immunological, pathophysiological, etc. investigations using adequate biomodels, including gnotobiotic animals.

Bacterial pathogen manipulation of host membrane trafficking.

PubMed

Asrat, Seblewongel; de Jesús, Dennise A; Hempstead, Andrew D; Ramabhadran, Vinay; Isberg, Ralph R

2014-01-01

Pathogens use a vast number of strategies to alter host membrane dynamics. Targeting the host membrane machinery is important for the survival and pathogenesis of several extracellular, vacuolar, and cytosolic bacteria. Membrane manipulation promotes bacterial replication while suppressing host responses, allowing the bacterium to thrive in a hostile environment. This review provides a comprehensive summary of various strategies used by both extracellular and intracellular bacteria to hijack host membrane trafficking machinery. We start with mechanisms used by bacteria to alter the plasma membrane, delve into the hijacking of various vesicle trafficking pathways, and conclude by summarizing bacterial adaptation to host immune responses. Understanding bacterial manipulation of host membrane trafficking provides insights into bacterial pathogenesis and uncovers the molecular mechanisms behind various processes within a eukaryotic cell.

Postviral Complications: Bacterial Pneumonia.

PubMed

Prasso, Jason E; Deng, Jane C

2017-03-01

Secondary bacterial pneumonia after viral respiratory infection remains a significant source of morbidity and mortality. Susceptibility is mediated by a variety of viral and bacterial factors, and complex interactions with the host immune system. Prevention and treatment strategies are limited to influenza vaccination and antibiotics/antivirals respectively. Novel approaches to identifying the individuals with influenza who are at increased risk for secondary bacterial pneumonias are urgently needed. Given the threat of further pandemics and the heightened prevalence of these viruses, more research into the immunologic mechanisms of this disease is warranted with the hope of discovering new potential therapies. Published by Elsevier Inc.

Mechanisms of Bacterial (Serratia marcescens) Attachment to, Migration along, and Killing of Fungal Hyphae

PubMed Central

Hover, Tal; Maya, Tal; Ron, Sapir; Sandovsky, Hani; Shadkchan, Yana; Kijner, Nitzan; Mitiagin, Yulia; Fichtman, Boris; Harel, Amnon; Shanks, Robert M. Q.; Bruna, Roberto E.; García-Véscovi, Eleonora

2016-01-01

We have found a remarkable capacity for the ubiquitous Gram-negative rod bacterium Serratia marcescens to migrate along and kill the mycelia of zygomycete molds. This migration was restricted to zygomycete molds and several basidiomycete species. No migration was seen on any molds of the phylum Ascomycota. S. marcescens migration did not require fungal viability or surrounding growth medium, as bacteria migrated along aerial hyphae as well. S. marcescens did not exhibit growth tropism toward zygomycete mycelium. Bacterial migration along hyphae proceeded only when the hyphae grew into the bacterial colony. S. marcescens cells initially migrated along the hyphae, forming attached microcolonies that grew and coalesced to generate a biofilm that covered and killed the mycelium. Flagellum-defective strains of S. marcescens were able to migrate along zygomycete hyphae, although they were significantly slower than the wild-type strain and were delayed in fungal killing. Bacterial attachment to the mycelium does not necessitate type 1 fimbrial adhesion, since mutants defective in this adhesin migrated equally well as or faster than the wild-type strain. Killing does not depend on the secretion of S. marcescens chitinases, as mutants in which all three chitinase genes were deleted retained wild-type killing abilities. A better understanding of the mechanisms by which S. marcescens binds to, spreads on, and kills fungal hyphae might serve as an excellent model system for such interactions in general; fungal killing could be employed in agricultural fungal biocontrol. PMID:26896140

Plant antiherbivore defenses in Fabaceae species of the Chaco.

PubMed

Lima, T E; Sartori, A L B; Rodrigues, M L M

2017-01-01

The establishment and maintenance of plant species in the Chaco, one of the widest continuous areas of forests in the South American with sharp climatic variations, are possibly related to biological features favoring plants with particular defenses. This study assesses the physical and chemical defenses mechanisms against herbivores of vegetative and reproductive organs. Its analyses of 12 species of Fabaceae (Leguminosae) collected in remnants of Brazilian Chaco shows that 75% present structural defense characters and 50% have chemical defense - defense proteins in their seeds, like protease inhibitors and lectins. Physical defenses occur mainly on branches (78% of the species), leaves (67%), and reproductive organs (56%). The most common physical characters are trichomes and thorns, whose color represents a cryptic character since it does not contrast with the other plant structures. Defense proteins occur in different concentrations and molecular weight classes in the seeds of most species. Protease inhibitors are reported for the first time in seeds of: Albizia niopoides, Anadenanthera colubrina, Mimosa glutinosa, Prosopis rubriflora, and Poincianella pluviosa. The occurrence of physical and chemical defenses in members of Fabaceae indicate no associations between defense characters in these plant species of the Chaco.

PPARγ in Bacterial Infections: A Friend or Foe?

PubMed

Reddy, Aravind T; Lakshmi, Sowmya P; Reddy, Raju C

2016-01-01

Peroxisome proliferator-activated receptor γ (PPAR γ ) is now recognized as an important modulator of leukocyte inflammatory responses and function. Its immunoregulatory function has been studied in a variety of contexts, including bacterial infections of the lungs and central nervous system, sepsis, and conditions such as chronic granulomatous disease. Although it is generally believed that PPAR γ activation is beneficial for the host during bacterial infections via its anti-inflammatory and antibacterial properties, PPAR γ agonists have also been shown to dampen the host immune response and in some cases exacerbate infection by promoting leukocyte apoptosis and interfering with leukocyte migration and infiltration. In this review we discuss the role of PPAR γ and its activation during bacterial infections, with focus on the potential of PPAR γ agonists and perhaps antagonists as novel therapeutic modalities. We conclude that adjustment in the dosage and timing of PPAR γ agonist administration, based on the competence of host antimicrobial defenses and the extent of inflammatory response and tissue injury, is critical for achieving the essential balance between pro- and anti-inflammatory effects on the immune system.

PPARγ in Bacterial Infections: A Friend or Foe?

PubMed Central

2016-01-01

Peroxisome proliferator-activated receptor γ (PPARγ) is now recognized as an important modulator of leukocyte inflammatory responses and function. Its immunoregulatory function has been studied in a variety of contexts, including bacterial infections of the lungs and central nervous system, sepsis, and conditions such as chronic granulomatous disease. Although it is generally believed that PPARγ activation is beneficial for the host during bacterial infections via its anti-inflammatory and antibacterial properties, PPARγ agonists have also been shown to dampen the host immune response and in some cases exacerbate infection by promoting leukocyte apoptosis and interfering with leukocyte migration and infiltration. In this review we discuss the role of PPARγ and its activation during bacterial infections, with focus on the potential of PPARγ agonists and perhaps antagonists as novel therapeutic modalities. We conclude that adjustment in the dosage and timing of PPARγ agonist administration, based on the competence of host antimicrobial defenses and the extent of inflammatory response and tissue injury, is critical for achieving the essential balance between pro- and anti-inflammatory effects on the immune system. PMID:27774097

Graves' disease: a host defense mechanism gone awry.

PubMed

Kohn, L D; Napolitano, G; Singer, D S; Molteni, M; Scorza, R; Shimojo, N; Kohno, Y; Mozes, E; Nakazato, M; Ulianich, L; Chung, H K; Matoba, H; Saunier, B; Suzuki, K; Schuppert, F; Saji, M

2000-01-01

In this report we summarize evidence to support a model for the development of Graves' disease. The model suggests that Graves' disease is initiated by an insult to the thyrocyte in an individual with a normal immune system. The insult, infectious or otherwise, causes double strand DNA or RNA to enter the cytoplasm of the cell. This causes abnormal expression of major histocompatibility (MHC) class I as a dominant feature, but also aberrant expression of MHC class II, as well as changes in genes or gene products needed for the thyrocyte to become an antigen presenting cell (APC). These include increased expression of proteasome processing proteins (LMP2), transporters of antigen peptides (TAP), invariant chain (Ii), HLA-DM, and the co-stimulatory molecule, B7, as well as STAT and NF-kappaB activation. A critical factor in these changes is the loss of normal negative regulation of MHC class I, class II, and thyrotropin receptor (TSHR) gene expression, which is necessary to maintain self-tolerance during the normal changes in gene expression involved in hormonally-increased growth and function of the cell. Self-tolerance to the TSHR is maintained in normals because there is a population of CD8- cells which normally suppresses a population of CD4+ cells that can interact with the TSHR if thyrocytes become APCs. This is a host self-defense mechanism that we hypothesize leads to autoimmune disease in persons, for example, with a specific viral infection, a genetic predisposition, or even, possibly, a TSHR polymorphism. The model is suggested to be important to explain the development of other autoimmune diseases including systemic lupus or diabetes.

The Transcriptome and Terpene Profile of Eucalyptus grandis Reveals Mechanisms of Defense Against the Insect Pest, Leptocybe invasa.

PubMed

Oates, Caryn N; Külheim, Carsten; Myburg, Alexander A; Slippers, Bernard; Naidoo, Sanushka

2015-07-01

Plants have evolved complex defenses that allow them to protect themselves against pests and pathogens. However, there is relatively little information regarding the Eucalyptus defensome. Leptocybe invasa is one of the most damaging pests in global Eucalyptus forestry, and essentially nothing is known regarding the molecular mechanisms governing the interaction between the pest and host. The aim of the study was to investigate changes in the transcriptional landscape and terpene profile of a resistant and susceptible Eucalyptus genotype in an effort to improve our understanding of this interaction. We used RNA-seqencing to investigate transcriptional changes following L. invasa oviposition. Expression levels were validated using real-time quantitative PCR. Terpene profiles were investigated using gas chromatography coupled to mass spectometry on uninfested and oviposited leaves. We found 698 and 1,115 significantly differentially expressed genes from the resistant and susceptible interactions, respectively. Gene Ontology enrichment and Mapman analyses identified putative defense mechanisms including cell wall reinforcement, protease inhibitors, cell cycle suppression and regulatory hormone signaling pathways. There were significant differences in the mono- and sesquiterpene profiles between genotypes and between control and infested material. A model of the interaction between Eucalyptus and L. invasa was proposed from the transcriptomic and chemical data. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

INFLUENCE OF ROOT COLONIZING BACTERIA ON THE DEFENSE RESPONSES OF BEAN

EPA Science Inventory

Colonization of plant roots by fluorescent pseudomonads has been correlated with disease suppression. ne mechanism may involve altered defense responses in the plant upon colonization. ltered defense responses were observed in bean (Phaseolus vulgaris) inoculated with fluorescent...

Evolution of Host Defense against Multiple Enemy Populations.

PubMed

Toor, Jaspreet; Best, Alex

2016-03-01

Natural and managed populations are embedded within complex ecological communities, where they face multiple enemies. Experimental studies have shown that the evolution of host defense mechanisms to a focal enemy is impacted by the surrounding enemy community. Theoretically, the evolution of host defenses against a single enemy population, typically parasites, has been widely studied, but only recently has the impact of community interactions on host-parasite evolution been looked at. In this article, we theoretically examine the evolutionary behavior of a host population that must allocate defenses between two enemy populations, parasites and predators, with defense against one enemy constraining defense against the other. We show that in simpler models the composition of the enemy community plays the key role in determining the defense strategy of the hosts, with the hosts building up defenses against the enemy population posing a larger threat. However, this simple driver is shown to break down when there is significant recovery and reproduction from infected hosts. Additionally, we find that most host diversity is likely to occur when there is a combined high risk of infection and predation, in common with experimental studies. Our results therefore provide vital insight into the ecological feedbacks that drive the evolution of host defense against multiple enemy populations.

A new regulatory mechanism for bacterial lipoic acid synthesis

PubMed Central

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-01

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

A new regulatory mechanism for bacterial lipoic acid synthesis.

PubMed

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-22

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

Early-Life Diet Affects Host Microbiota and Later-Life Defenses Against Parasites in Frogs.

PubMed

Knutie, Sarah A; Shea, Lauren A; Kupselaitis, Marinna; Wilkinson, Christina L; Kohl, Kevin D; Rohr, Jason R

2017-10-01

Food resources can affect the health of organisms by altering their symbiotic microbiota and affecting energy reserves for host defenses against parasites. Different diets can vary in their macronutrient content and therefore they might favor certain bacterial communities of the host and affect the development and maintenance of the immune system, such as the inflammatory or antibody responses. Thus, testing the effect of diet, especially for animals with wide diet breadths, on host-associated microbiota and defenses against parasites might be important in determining infection and disease risk. Here, we test whether the early-life diet of Cuban tree frogs (Osteopilus septentrionalis) affects early- and later-life microbiota as well as later-life defenses against skin-penetrating, gut worms (Aplectana hamatospicula). We fed tadpoles two ecologically common diets: a diet of conspecifics or a diet of algae (Arthrospira sp.). We then: (1) characterized the gut microbiota of tadpoles and adults; and (2) challenged adult frogs with parasitic worms and measured host resistance (including the antibody-mediated immune response) and tolerance of infections. Tadpole diet affected bacterial communities in the guts of tadpoles but did not have enduring effects on the bacterial communities of adults. In contrast, tadpole diet had enduring effects on host resistance and tolerance of infections in adult frogs. Frogs that were fed a conspecific-based diet as tadpoles were more resistant to worm penetration compared with frogs that were fed an alga-based diet as tadpoles, but less resistant to worm establishment, which may be related to their suppressed antibody response during worm establishment. Furthermore, frogs that were fed a conspecific-based diet as tadpoles were more tolerant to the effect of parasite abundance on host mass during worm establishment. Overall, our study demonstrates that the diet of Cuban tree frog tadpoles affects the gut microbiota and defenses against

Exploiting Quorum Sensing To Confuse Bacterial Pathogens

PubMed Central

LaSarre, Breah

2013-01-01

SUMMARY Cell-cell communication, or quorum sensing, is a widespread phenomenon in bacteria that is used to coordinate gene expression among local populations. Its use by bacterial pathogens to regulate genes that promote invasion, defense, and spread has been particularly well documented. With the ongoing emergence of antibiotic-resistant pathogens, there is a current need for development of alternative therapeutic strategies. An antivirulence approach by which quorum sensing is impeded has caught on as a viable means to manipulate bacterial processes, especially pathogenic traits that are harmful to human and animal health and agricultural productivity. The identification and development of chemical compounds and enzymes that facilitate quorum-sensing inhibition (QSI) by targeting signaling molecules, signal biogenesis, or signal detection are reviewed here. Overall, the evidence suggests that QSI therapy may be efficacious against some, but not necessarily all, bacterial pathogens, and several failures and ongoing concerns that may steer future studies in productive directions are discussed. Nevertheless, various QSI successes have rightfully perpetuated excitement surrounding new potential therapies, and this review highlights promising QSI leads in disrupting pathogenesis in both plants and animals. PMID:23471618

Second-Hand Cigarette Smoke Impairs Bacterial Phagocytosis in Macrophages by Modulating CFTR Dependent Lipid-Rafts

PubMed Central

Ni, Inzer; Ji, Changhoon; Vij, Neeraj

2015-01-01

Introduction First/Second-hand cigarette-smoke (FHS/SHS) exposure weakens immune defenses inducing chronic obstructive pulmonary disease (COPD) but the underlying mechanisms are not fully understood. Hence, we evaluated if SHS induced changes in membrane/lipid-raft (m-/r)-CFTR (cystic fibrosis transmembrane conductance regulator) expression/activity is a potential mechanism for impaired bacterial phagocytosis in COPD. Methods RAW264.7 murine macrophages were exposed to freshly prepared CS-extract (CSE) containing culture media and/or Pseudomonas-aeruginosa-PA01-GFP for phagocytosis (fluorescence-microscopy), bacterial survival (colony-forming-units-CFU), and immunoblotting assays. The CFTR-expression/activity and lipid-rafts were modulated by transient-transfection or inhibitors/inducers. Next, mice were exposed to acute/sub-chronic-SHS or room-air (5-days/3-weeks) and infected with PA01-GFP, followed by quantification of bacterial survival by CFU-assay. Results We investigated the effect of CSE treatment on RAW264.7 cells infected by PA01-GFP and observed that CSE treatment significantly (p<0.01) inhibits PA01-GFP phagocytosis as compared to the controls. We also verified this in murine model, exposed to acute/sub-chronic-SHS and found significant (p<0.05, p<0.02) increase in bacterial survival in the SHS-exposed lungs as compared to the room-air controls. Next, we examined the effect of impaired CFTR ion-channel-activity on PA01-GFP infection of RAW264.7 cells using CFTR172-inhibitor and found no significant change in phagocytosis. We also similarly evaluated the effect of a CFTR corrector-potentiator compound, VRT-532, and observed no significant rescue of CSE impaired PA01-GFP phagocytosis although it significantly (p<0.05) decreases CSE induced bacterial survival. Moreover, induction of CFTR expression in macrophages significantly (p<0.03) improves CSE impaired PA01-GFP phagocytosis as compared to the control. Next, we verified the link between m

Should bioengineering graduates seek employment in the defense industry?

PubMed

Johnson, Arthur T

2014-01-01

They say that the difference between a mechanical engineer and a civil engineer is that the mechanical engineer develops weapons whereas a civil engineer designs targets. The implication is that some engineers are involved with building peaceful infrastructure whereas others contribute to destruction. This brings to mind the question: what is the proper role for engineers in the creation of weapons and defenses against them? In particular, should engineers specializing in biology or medicine be involved in the defense industry? After all, bioengineers are supposed to be builders or healers rather than warriors or destroyers.

Strategic defense initiative: critical issues

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nuckolls, J.H.

The objectives of the Strategic Defense Initiative (SDI) as outlined by President Reagan are discussed. The principal objective for SDI is as a defense against ballistic missiles. Soviet objections and a summary of US-USSR dialogue on the subject are reviewed. Most US studies have been critical of SDI. Four critical issues are addressed in depth: are defense weapons technologically feasible which have high economic leverage relative to offensive ballistic missiles; would the defense feasibility and leverage be degraded or enhanced in the technological race between weapons innovation and countermeasures; could stability be achieved during and after the transition to themore » defense dominated world envisioned by SDI proponents; would the deployment of high leverage defensive weapons increase or decrease the security of NATO Europe, and the probability of major conventional or nuclear wars. The issue of SDI may lead to a paradox that contains the seeds of catastrophe. The author concludes by warning that nuclear disarmament may eliminate the highly successful deterrent mechanism for avoiding another major world war. In a world made safe for major conventional wars by the apparent ''elimination'' of nuclear weapons, the leaders in a conventional World War III - involving unimaginable suffering, hatred, terror, and death - would be strongly motivated to introduce nuclear weapons in the crucial decisive battles. Even if diplomacy could ''eliminate'' nuclear weapons, man's knowledge of nuclear weapons can never be eliminated. The paradox is the attempt to eliminate nuclear weapons may maximize the probability of their use. (DMC)« less

Anti-CRISPR proteins: Counterattack of phages on bacterial defense (CRISPR/Cas) system.

PubMed

Chaudhary, Kulbhushan; Chattopadhyay, Anirudha; Pratap, Dharmendra

2018-01-01

Since the dawn of life there is a never ending strife between bacteria and phages. Both are perpetually changing their strategies to take over each other. CRISPR/Cas is the most widespread defense system used by bacteria against mobile genetic elements (MGEs) such as phages, cojugative palsmids, transoposons, and pathogenicity islands. This system utilizes small guide RNA molecules to protect against phages infection and invasion by MGEs. Phages circumvent to these antiviral barriers by point mutation in PAM (protospacer-adjacent motif) sequence, genome rearrangements and by using anti-CRISPR proteins. © 2017 Wiley Periodicals, Inc.

Nest Material Shapes Eggs Bacterial Environment.

PubMed

Ruiz-Castellano, Cristina; Tomás, Gustavo; Ruiz-Rodríguez, Magdalena; Martín-Gálvez, David; Soler, Juan José

2016-01-01

Selective pressures imposed by pathogenic microorganisms to embryos have selected in hosts for a battery of antimicrobial lines of defenses that includes physical and chemical barriers. Due to the antimicrobial properties of volatile compounds of green plants and of chemicals of feather degrading bacteria, the use of aromatic plants and feathers for nest building has been suggested as one of these barriers. However, experimental evidence suggesting such effects is scarce in the literature. During two consecutive years, we explored experimentally the effects of these nest materials on loads of different groups of bacteria (mesophilic bacteria, Enterobacteriaceae, Staphylococcus and Enterococcus) of eggshells in nests of spotless starlings (Sturnus unicolor) at the beginning and at the end of the incubation period. This was also explored in artificial nests without incubation activity. We also experimentally increased bacterial density of eggs in natural and artificial nests and explored the effects of nest lining treatments on eggshell bacterial load. Support for the hypothetical antimicrobial function of nest materials was mainly detected for the year and location with larger average values of eggshell bacterial density. The beneficial effects of feathers and plants were more easily detected in artificial nests with no incubation activity, suggesting an active role of incubation against bacterial colonization of eggshells. Pigmented and unpigmented feathers reduced eggshell bacterial load in starling nests and artificial nest boxes. Results from artificial nests allowed us to discuss and discard alternative scenarios explaining the detected association, particularly those related to the possible sexual role of feathers and aromatic plants in starling nests. All these results considered together confirm the antimicrobial functionality mainly of feathers but also of plants used as nest materials, and highlight the importance of temporally and geographically

Nest Material Shapes Eggs Bacterial Environment

PubMed Central

Ruiz-Castellano, Cristina; Tomás, Gustavo; Ruiz-Rodríguez, Magdalena; Martín-Gálvez, David; Soler, Juan José

2016-01-01

Selective pressures imposed by pathogenic microorganisms to embryos have selected in hosts for a battery of antimicrobial lines of defenses that includes physical and chemical barriers. Due to the antimicrobial properties of volatile compounds of green plants and of chemicals of feather degrading bacteria, the use of aromatic plants and feathers for nest building has been suggested as one of these barriers. However, experimental evidence suggesting such effects is scarce in the literature. During two consecutive years, we explored experimentally the effects of these nest materials on loads of different groups of bacteria (mesophilic bacteria, Enterobacteriaceae, Staphylococcus and Enterococcus) of eggshells in nests of spotless starlings (Sturnus unicolor) at the beginning and at the end of the incubation period. This was also explored in artificial nests without incubation activity. We also experimentally increased bacterial density of eggs in natural and artificial nests and explored the effects of nest lining treatments on eggshell bacterial load. Support for the hypothetical antimicrobial function of nest materials was mainly detected for the year and location with larger average values of eggshell bacterial density. The beneficial effects of feathers and plants were more easily detected in artificial nests with no incubation activity, suggesting an active role of incubation against bacterial colonization of eggshells. Pigmented and unpigmented feathers reduced eggshell bacterial load in starling nests and artificial nest boxes. Results from artificial nests allowed us to discuss and discard alternative scenarios explaining the detected association, particularly those related to the possible sexual role of feathers and aromatic plants in starling nests. All these results considered together confirm the antimicrobial functionality mainly of feathers but also of plants used as nest materials, and highlight the importance of temporally and geographically

Inducible defenses against herbivory and fouling in seaweeds

NASA Astrophysics Data System (ADS)

Pereira, Renato Crespo; Costa, Erica da Silva; Sudatti, Daniela Bueno; da Gama, Bernardo Antonio Perez

2017-04-01

Secondary metabolites play an important ecological role as a defense mechanism in seaweeds. Chemical defenses are well known to change in response to herbivory, but other driving factors, either biotic or abiotic, are often neglected. Epibiosis may not only reduce seaweed fitness, but also increase attractiveness to consumers, and thus defense production should also be triggered by epibionts. In this study, three Southwestern Atlantic seaweeds, Gracilaria cearensis, Pterocladiella capillacea (Rhodophyceae) and Codium decorticatum (Chlorophyceae) were investigated in laboratory bioassays designed to test whether the action of herbivory or simulated epibiosis influences chemical defenses. Crossed induction experiments were also performed in order to assess whether herbivore induction influences antifouling chemical defense, as well as whether epibiont induction would affect defense against herbivores. The effect of laboratory conditions on seaweeds in the absence of field stimuli was also investigated by comparing consumption of artificial food with extracts from acclimatized and non-acclimatized seaweeds (i.e., natural defense levels). Only the green seaweed C. decorticatum exhibited inducible antifouling defenses triggered by simulated epibiosis, but not by herbivores. In the other seaweeds there was no induction either by herbivory or simulated epibiosis. Acclimatization did not affect C. decorticatum defenses. However, non-acclimatized G. cearensis artificial foods were preferred over acclimatized ones, while extracts from acclimatized P. capillacea increased herbivore consumption, highlighting the need to acclimatize seaweeds before the main induction experiments. This is the first report of inducible defenses due to simulated fouling in seaweeds.

Vascular defense responses in rice: peroxidase accumulation in xylem parenchyma cells and xylem wall thickening

NASA Technical Reports Server (NTRS)

Hilaire, E.; Young, S. A.; Willard, L. H.; McGee, J. D.; Sweat, T.; Chittoor, J. M.; Guikema, J. A.; Leach, J. E.

2001-01-01

The rice bacterial blight pathogen Xanthomonas oryzae pv. oryzae is a vascular pathogen that elicits a defensive response through interaction with metabolically active rice cells. In leaves of 12-day-old rice seedlings, the exposed pit membrane separating the xylem lumen from the associated parenchyma cells allows contact with bacterial cells. During resistant responses, the xylem secondary walls thicken within 48 h and the pit diameter decreases, effectively reducing the area of pit membrane exposed for access by bacteria. In susceptible interactions and mock-inoculated controls, the xylem walls do not thicken within 48 h. Xylem secondary wall thickening is developmental and, in untreated 65-day-old rice plants, the size of the pit also is reduced. Activity and accumulation of a secreted cationic peroxidase, PO-C1, were previously shown to increase in xylem vessel walls and lumen. Peptide-specific antibodies and immunogold-labeling were used to demonstrate that PO-C1 is produced in the xylem parenchyma and secreted to the xylem lumen and walls. The timing of the accumulation is consistent with vessel secondary wall thickening. The PO-C1 gene is distinct but shares a high level of similarity with previously cloned pathogen-induced peroxidases in rice. PO-C1 gene expression was induced as early as 12 h during resistant interactions and peaked between 18 and 24 h after inoculation. Expression during susceptible interactions was lower than that observed in resistant interactions and was undetectable after infiltration with water, after mechanical wounding, or in mature leaves. These data are consistent with a role for vessel secondary wall thickening and peroxidase PO-C1 accumulation in the defense response in rice to X. oryzae pv. oryzae.

Multifaceted Defense against Listeria monocytogenes in the Gastro-Intestinal Lumen

PubMed Central

Becattini, Simone; Pamer, Eric G.

2017-01-01

Listeria monocytogenes is a foodborne pathogen that can cause febrile gastroenteritis in healthy subjects and systemic infections in immunocompromised individuals. Despite the high prevalence of L. monocytogenes in the environment and frequent contamination of uncooked meat and poultry products, infections with this pathogen are relatively uncommon, suggesting that protective defenses in the general population are effective. In the mammalian gastrointestinal tract, a variety of defense mechanisms prevent L. monocytogenes growth, epithelial penetration and systemic dissemination. Among these defenses, colonization resistance mediated by the gut microbiota is crucial in protection against a range of intestinal pathogens, including L. monocytogenes. Here we review defined mechanisms of defense against L. monocytogenes in the lumen of the gastro-intestinal tract, with particular emphasis on protection conferred by the autochthonous microbiota. We suggest that selected probiotic species derived from the microbiota may be developed for eventual clinical use to enhance resistance against L. monocytogenes infections. PMID:29271903

Radiolabel ratio method for measuring pulmonary clearance of intratracheal bacterial challenges

DOE Office of Scientific and Technical Information (OSTI.GOV)

LaForce, F.M.; Boose, D.S.

Calculation of bacterial clearance is a fundamental step in any study of in situ lung antibacterial defenses. A method is described whereby about 85% of a radiolabeled bacterial inoculum was consistently introduced into the bronchopulmonary tree of a mouse by the intratracheal route. Mice were then killed 1 and 4 hours later; their lungs were removed aseptically and homogenized, and viable bacteria and radiolabel counts were determined. Radiolabel counts fell slowly, and more than 80% of the original radiolabel was still present in homogenized lung samples from animals sacrificed 4 hours after challenge. Bacteria/isotope ratios for the bacterial inoculum andmore » homogenized lung samples from animals sacrificed immediately after challenge were very similar. Bacterial clearance values were the same whether computed from bacterial counts alone or according to a radiolabel ratio method whereby the change in the bacteria/isotope ratio in ground lung aliquots was divided by a similar ratio from bacteria used to inoculate animals. Some contamination resulted from oral streptococci being swept into the bronchopulmonary free during the aspiration process. This contamination was not a problem when penicillin was incorporated into the agar and penicillin-resistant strains were used for the bacterial challenges.« less

Bacterial strategies of resistance to antimicrobial peptides.

PubMed

Joo, Hwang-Soo; Fu, Chih-Iung; Otto, Michael

2016-05-26

Antimicrobial peptides (AMPs) are a key component of the host's innate immune system, targeting invasive and colonizing bacteria. For successful survival and colonization of the host, bacteria have a series of mechanisms to interfere with AMP activity, and AMP resistance is intimately connected with the virulence potential of bacterial pathogens. In particular, because AMPs are considered as potential novel antimicrobial drugs, it is vital to understand bacterial AMP resistance mechanisms. This review gives a comparative overview of Gram-positive and Gram-negative bacterial strategies of resistance to various AMPs, such as repulsion or sequestration by bacterial surface structures, alteration of membrane charge or fluidity, degradation and removal by efflux pumps.This article is part of the themed issue 'Evolutionary ecology of arthropod antimicrobial peptides'. © 2016 The Author(s).

Defense of the lungs in oxygen-injured baboons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fowler, S.R.; Rawlinson, W.K.; Roach, F.M.

1986-03-05

Pneumonia and subsequent sepsis have been linked with multiple organ failure and death in patients with adult respiratory distress syndrome. This suggests that lung defense may be impaired. In a model of ARDS, 13 baboons were intubated and ventilated with 80% O/sub 2/ for 6 days, following which 7 were inoculated intratracheally with Pseudomonas aeruginosa (PA) strain DGI-RI30. After 5 days on 50% O/sub 2/ the animals were sacrificed. Bronchoalveolar lavage (BAL) was performed before O/sub 2/ exposure, after 6 days of 80% O/sub 2/, and at sacrifice. Total WBC and differential counts were determined for BAL cells. Mononuclear BALmore » cells were isolated for in vitro phagocytosis assays. BAL fluid (BALF) was tested for in vitro PMN chemotactic activity. An index of bacterial infection (sum of log CFU/g lung homogenate) was greater for infected animals (p < 0.01). Percentage of PMN in BALF was significantly increased at sacrifice in PA-inoculated animals. BALF from PA-inoculated animals at sacrifice elicited increased in vitro PMN chemotaxis, which was destroyed at 100/sup 0/C but not 56/sup 0/C, extracted by ether, and not degraded by proteases. Mononuclear BAL cells from inoculated animals at sacrifice were phagocytially more active than baseline cells. These data suggest that oxygen injury does not inhibit recruitment of PMN or phagocytosis of bacteria by alveolar macrophages in baboons; however, the addition of bacterial inoculation results in clinical deterioration despite unimpaired local defense.« less

A porin-like protein from oral secretions of Spodoptera littoralis larvae induces defense-related early events in plant leaves.

PubMed

Guo, Huijuan; Wielsch, Natalie; Hafke, Jens B; Svatoš, Aleš; Mithöfer, Axel; Boland, Wilhelm

2013-09-01

Insect herbivory on plants is a complex incident consisting of at least two different aspects, namely mechanical damage and chemical challenge, as feeding insects introduce oral secretions (OS) into the wounded tissue of the attacked plant. Mechanical wounding alone is sufficient to induce a set of defense-related reactions in host plants, but some early events such as membrane potential (Vm) changes and cytosolic Ca²⁺-elevations can be triggered only by herbivores suggesting that OS-derived molecules are involved in those processes. Following an assay-guided purification based on planar lipid bilayer membrane technique in combination with proteomic analysis, a porin-like protein (PLP) of most likely bacterial origin was determined from collected OS of Spodoptera littoralis larvae. PLP exhibited channel-forming activity. Further, early defense-related events in plant-insect interaction were evaluated by using a purified fraction and α-hemolysin (α-HL) as a commercial pore-forming compound. Both up-regulated the calmodulin-like CML42 in Arabidopsis thaliana, which only responds to oral secretion and not to wounding. An elevation of in vivo [Ca²⁺](cyt) was not observed. Because membrane channel formation is a widespread phenomenon in plant-insect interactions, this PLP might represent an example for microbial compounds from the insect gut which are initially involved in plant-insect interactions. Copyright © 2013 Elsevier Ltd. All rights reserved.

Involvement of metabolites in early defense mechanism of oil palm (Elaeis guineensis Jacq.) against Ganoderma disease.

PubMed

Nusaibah, S A; Siti Nor Akmar, A; Idris, A S; Sariah, M; Mohamad Pauzi, Z

2016-12-01

Understanding the mechanism of interaction between the oil palm and its key pathogen, Ganoderma spp. is crucial as the disease caused by this fungal pathogen leads to a major loss of revenue in leading palm oil producing countries in Southeast Asia. Here in this study, we assess the morphological and biochemical changes in Ganoderma disease infected oil palm seedling roots in both resistant and susceptible progenies. Rubber woodblocks fully colonized by G. boninense were applied as a source of inoculum to artificially infect the roots of resistant and susceptible oil palm progenies. Gas chromatography-mass spectrometry was used to measure an array of plant metabolites in 100 resistant and susceptible oil palm seedling roots treated with pathogenic Ganoderma boninense fungus. Statistical effects, univariate and multivariate analyses were used to identify key-Ganoderma disease associated metabolic agitations in both resistant and susceptible oil palm root tissues. Ganoderma disease related defense shifts were characterized based on (i) increased antifungal activity in crude extracts, (ii) increased lipid levels, beta- and gamma-sitosterol particularly in the resistant progeny, (iii) detection of heterocyclic aromatic organic compounds, benzo [h] quinoline, pyridine, pyrimidine (iv) elevation in antioxidants, alpha- and beta-tocopherol (iv) degraded cortical cell wall layers, possibly resulting from fungal hydrolytic enzyme activity needed for initial penetration. The present study suggested that plant metabolites mainly lipids and heterocyclic aromatic organic metabolites could be potentially involved in early oil palm defense mechanism against G. boninense infection, which may also highlight biomarkers for disease detection, treatment, development of resistant variety and monitoring. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Effects of copper nanoparticle exposure on host defense in a murine pulmonary infection model

PubMed Central

2011-01-01

Background Human exposure to nanoparticles (NPs) and environmental bacteria can occur simultaneously. NPs induce inflammatory responses and oxidative stress but may also have immune-suppressive effects, impairing macrophage function and altering epithelial barrier functions. The purpose of this study was to assess the potential pulmonary effects of inhalation and instillation exposure to copper (Cu) NPs using a model of lung inflammation and host defense. Methods We used Klebsiella pneumoniae (K.p.) in a murine lung infection model to determine if pulmonary bacterial clearance is enhanced or impaired by Cu NP exposure. Two different exposure modes were tested: sub-acute inhalation (4 hr/day, 5 d/week for 2 weeks, 3.5 mg/m3) and intratracheal instillation (24 hr post-exposure, 3, 35, and 100 μg/mouse). Pulmonary responses were evaluated by lung histopathology plus measurement of differential cell counts, total protein, lactate dehydrogenase (LDH) activity, and inflammatory cytokines in bronchoalveolar lavage (BAL) fluid. Results Cu NP exposure induced inflammatory responses with increased recruitment of total cells and neutrophils to the lungs as well as increased total protein and LDH activity in BAL fluid. Both inhalation and instillation exposure to Cu NPs significantly decreased the pulmonary clearance of K.p.-exposed mice measured 24 hr after bacterial infection following Cu NP exposure versus sham-exposed mice also challenged with K.p (1.4 × 105 bacteria/mouse). Conclusions Cu NP exposure impaired host defense against bacterial lung infections and induced a dose-dependent decrease in bacterial clearance in which even our lowest dose demonstrated significantly lower clearance than observed in sham-exposed mice. Thus, exposure to Cu NPs may increase the risk of pulmonary infection. PMID:21943386

Role of proline and pyrroline-5-carboxylate metabolism in plant defense against invading pathogens

PubMed Central

Qamar, Aarzoo; Mysore, Kirankumar S.; Senthil-Kumar, Muthappa

2015-01-01