Kinetics of Bacteriophage λ Deoxyribonucleic Acid Infection of Escherichia coli
Barnhart, Benjamin J.
1965-01-01
Barnhart, Benjamin J. (Los Alamos Scientific Laboratory, University of California, Los Alamos, N.M.). Kinetics of bacteriophage λ deoxyribonucleic acid infection of Escherichia coli. J. Bacteriol. 90:1617–1623. 1965.—The kinetics of Escherichia coli K-12 infection by phage λ deoxyribonucleic acid (DNA) were determined. An initial lag of 55 to 80 sec was found to be the time required for infecting DNA to become deoxyribonuclease-insensitive at 33 C. When cell-DNA interactions were stopped by washing away unbound DNA, the already bound DNA continued to infect the cell at rates described by linear kinetics with no apparent lag. Whereas the lag period was relatively insensitive to DNA and cell concentrations, both the lag and the subsequent linear portions of the rate curves were temperature-sensitive. Cell and DNA dose-response curves prescribed hyperbolic functions. Similarities between λ DNA infection of E. coli and bacterial transformation systems are discussed. PMID:5322721
Radiotherapy Measurements with a Deoxyribonucleic Acid Doublestrand-Break Dosimeter
NASA Astrophysics Data System (ADS)
Obeidat, Mohammad Ali
Many types of dosimeters are used in the clinic to measure radiation dose for therapy but none of them directly measures the biological effect of this dose. The overall purpose of this work was to develop a dosimeter that measures biological damage in the form of double-strand breaks to deoxyribonucleic acid. This dosimeter could provide a more biologically relevant measure of radiation damage than the currently utilized dosimeters. A pair of oligonucleotides was designed to fabricate this dosimeter. One is labeled with a 5'-end biotin and the other with a 5'-end 6 Fluorescein amidite (fluorescent dye excited at 495?nanometer, with a peak emission at 520 nanometer). These were designed to adhere to certain locations on the pRS316 vector and serve as the primers for polymerase chain reactions. The end product of this reaction is a 4 kilo-base pair double strands deoxyribonucleic acid fragment with biotin on one end and 6 Fluorescein amidite oligonucleotide on the other attached to streptavidin beads. The biotin end connects the double strands deoxyribonucleic acid to the streptavidin bead. These bead-connected double strands deoxyribonucleic acid were suspended in 50 microliter of phosphate-buffered saline and placed into a tube for irradiation. Following irradiation of the deoxyribonucleic acid dosimeter, we take advantage of the magnetic properties of the streptavidin bead by placing our sample microtube against a magnet. The magnetic field pulls the streptavidin beads against the side of the tube. If a double-strand-break has occurred for a double strands deoxyribonucleic acid, the fluorescein end of the double strands deoxyribonucleic acid becomes free and is no longer attached to the bead or held against the side of the microtube. The free fluorescein following a double-strand-break in double strands deoxyribonucleic acid is referred to here as supernatant. The supernatant is extracted and placed in another microtube, while the unbroken double strands
Nobunaga, T; Azuma, C; Kimura, T; Tokugawa, Y; Takemura, M; Kamiura, S; Saji, F; Tanizawa, O
1990-08-01
We used a new method of deoxyribonucleic acid fingerprint analysis to obtain the differential diagnosis between complete mole and hydropic abortus. This method with a deoxyribonucleic acid minisatellite probe requires only a small amount of tissue sample and peripheral blood, and presents individual specific restriction fragment length polymorphisms (deoxyribonucleic acid "fingerprints") by simultaneous detection of many hypervariable regions (minisatellite regions) widely dispersed in the human genome. Southern blot hybridization showed that in cases of complete mole, all polymorphic fragments were exclusively inherited from the father. Some of the polymorphic bands of paternal deoxyribonucleic acid were not observed in molar deoxyribonucleic acid. However, in the hydropic abortus, the polymorphic fragments could be traced back to its parent. These results indicate that deoxyribonucleic acid fingerprints could distinguish the abnormal fertilization of complete mole (androgenesis) from the normal fertilization of hydropic abortus by identifying the difference in genetic variations between complete mole and hydropic abortus at the deoxyribonucleic acid level.
tif-Stimulated deoxyribonucleic acid repair in Escherichia coli K-12.
Castellazzi, M; Jacques, M; George, J
1980-01-01
Bacterial survival is significantly increased after ultraviolet irradiation in tif sfi cells, provided that the thermosensitive tif mutation has been expressed at 41 degrees C before irradiation. This tif-mediated "reactivation of ultraviolet irradiated bacteria" needs de novo protein synthesis, as is the case for the tif-mediated reactivation of ultraviolet-irradiated phage lambda. However, in striking contrast to the phage reactivation process, this tif-mediated reactivation is no longer associated with mutagenesis. It also requires the presence of the uvrA+ excision function. These results strongly suggest the existence in Escherichia coli K-12 of a repair pathway acting on bacterial deoxyribonucleic acid which is inducible, error free, and uvr dependent. PMID:6451614
Deoxyribonucleic acid-deficient strains of Candida albicans.
Olaiya, A F; Steed, J R; Sogin, S J
1980-03-01
We analyzed a series of germ tube-negative variants isolated from Candida albicans 3153A for deoxyribonucleic acid content. As analyzed by flow microfluorometry, the deoxyribonucleic acid level in these variant strains was 50% of that of the parental strain and equivalent to that of haploid Saccharomyces cerevisiae. This finding was confirmed by comparison of survival rates when exposed to the mutagens ultraviolet light, ethyl methane sulfonate, and methyl methane sulfonate. The diameter of the variant cells as compared to the diameter of the parental 3153A strain showed a relationship similar to that of the diameters of haploid versus diploid S. cerevisiae. These results indicate that those strains may be representative of the imperfect stage of C. albicans.
Donini, Pierluigi
1970-01-01
Starvation for a required amino acid of normal or RCstrEscherichia coli infected with T-even phages arrests further synthesis of phage deoxyribonucleic acid (DNA). This amino acid control over phage DNA synthesis does not occur in RCrelE. coli mutants. Heat inactivation of a temperature-sensitive aminoacyl-transfer ribonucleic acid (RNA) synthetase similarly causes an arrest of phage DNA synthesis in infected cells of RCstr phenotype but not in cells of RCrel phenotype. Inhibition of phage DNA synthesis in amino acid-starved RCstr host cells can be reversed by addition of chloramphenicol to the culture. Thus, the general features of amino acid control over T-even phage DNA synthesis are entirely analogous to those known for amino acid control over net RNA synthesis of uninfected bacteria. This analogy shows that the bacterial rel locus controls a wider range of macromolecular syntheses than had been previously thought. PMID:4914067
Deoxyribonucleic acid (DNA)-based optical materials
NASA Astrophysics Data System (ADS)
Grote, James G.; Heckman, Emily M.; Hagen, Joshua A.; Yaney, Perry P.; Subramanyam, Guru; Clarson, Stephen J.; Diggs, Darnell E.; Nelson, Robert L.; Zetts, John S.; Hopkins, F. Kenneth; Ogata, Naoya
2004-12-01
Optical materials for waveguiding applications must possess the desired optical and electromagnetic properties for optimal device performance. Purified deoxyribonucleic acid (DNA), derived from salmon sperm, has been investigated for use as an optical waveguide material. In this paper we present the materials processing and optical and electromagnetic characterization of this purified DNA to render a high quality, low loss optical waveguide material.
21 CFR 528.1070 - Bc6 recombinant deoxyribonucleic acid construct.
Code of Federal Regulations, 2014 CFR
2014-04-01
... SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS NEW ANIMAL DRUGS IN GENETICALLY ENGINEERED ANIMALS § 528.1070 Bc6 recombinant deoxyribonucleic acid construct. (a) Specifications and indications for...
21 CFR 528.1070 - Bc6 recombinant deoxyribonucleic acid construct.
Code of Federal Regulations, 2012 CFR
2012-04-01
... SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS NEW ANIMAL DRUGS IN GENETICALLY ENGINEERED ANIMALS § 528.1070 Bc6 recombinant deoxyribonucleic acid construct. (a) Specifications and indications for...
21 CFR 528.1070 - Bc6 recombinant deoxyribonucleic acid construct.
Code of Federal Regulations, 2013 CFR
2013-04-01
... SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS NEW ANIMAL DRUGS IN GENETICALLY ENGINEERED ANIMALS § 528.1070 Bc6 recombinant deoxyribonucleic acid construct. (a) Specifications and indications for...
Miller, Robert C.; Kozinski, Andrzej W.
1970-01-01
Bacteriophage T4 deoxyribonucleic acid (DNA)-protein complexes were retained preferentially on glass fiber filters. DNA polymerase activity in the complex was detected through the incorporation of 3H-labeled DNA precursors. The primer-product DNA hybridized with both phage and Escherichia coli DNA. Density labeling experiments showed that about 30% of incorporated 3H-deoxyadenosine triphosphate was found in DNA which hybridized with phage DNA; this DNA was found to be covalently attached to the primer DNA. PMID:5497903
Deoxyribonucleic Acid Probes Analyses for the Detection of Periodontal Pathogens.
Al Yahfoufi, Zoubeida; Hadchiti, Wahib; Berberi, Antoine
2015-09-01
In clinical microbiology several techniques have been used to identify bacteria. Recently, Deoxyribonucleic acid (DNA)-based techniques have been introduced to detect human microbial pathogens in periodontal diseases. Deoxyribonucleic acid probes can detect bacteria at a very low level if we compared with the culture methods. These probes have shown rapid and cost-effective microbial diagnosis, good sensitivity and specificity for some periodontal pathogens in cases of severe periodontitis. Eighty-five patients were recruited for the study. Twenty-one subjects ranging between 22 and 48 years of age fulfilled the inclusion and exclusion criteria. Seventy-eight samples became available for DNA probe analysis from the deepest pockets in each quadrant. All 21 patients showed positive results for Prevotella intermedia; also, Prevotella gingivalis was identified in 19 subjects, Aggregatibacter actinomycetemcomitans in 6 subjects. P. intermedia was diagnosed positive in 82% of the subgingival samples taken, 79% for P. gingivalis, and 23% for A. actinomycetemcomitans. This study shows a high frequency of putative periodontal pathogens by using DNA probe technology, which is semi-quantitative in this study. Deoxyribonucleic acid probes can detect bacteria at very low level about 10(3) which is below the detection level of culture methods. The detection threshold of cultural methods. The three types of bacteria can be detected rapidly with high sensitivity by using the DNA probe by general practitioners, and thus can help in the diagnosis process and the treatment.
Dragoman, D; Dragoman, M
2009-08-01
In this Brief Report, we present a method for the real-time detection of the bases of the deoxyribonucleic acid using their signatures in negative differential conductance measurements. The present methods of electronic detection of deoxyribonucleic acid bases are based on a statistical analysis because the electrical currents of the four bases are weak and do not differ significantly from one base to another. In contrast, we analyze a device that combines the accumulated knowledge in nanopore and scanning tunneling detection and which is able to provide very distinctive electronic signatures for the four bases.
Ptasekas, R; Matulis, A; Urmonas, V; Graziene, V; Zukiene, G
1980-01-01
Two varieties of peripheral blood lymphocytes have been disclosed in systemic lupus erythematosus (SLE) cases: one showing signs of degradation and nuclear chromatine elimination and the other one manifesting a state of biological activation, possibly of an immunologic nature. This karyostructural lymphocyte heterogeneity in SLE may cause a great scattering of these cells on histograms in respect to their nuclear deoxyribonucleic acid content determined by cytophotometry. On the other hand, the expressiveness of the scattering and the degree of predominance of negative tendency towards proliferation (with a shift to the left from 2 n) may thereby serve as a very objective quantitative indication of nuclear structure degradation and of loss by lymphocytes of chromatine with deoxyribonucleic acid during SLE.
BASE COMPOSITION OF THE DEOXYRIBONUCLEIC ACID OF SULFATE-REDUCING BACTERIA
Sigal, Nicole; Senez, Jacques C.; Le Gall, Jean; Sebald, Madeleine
1963-01-01
Sigal, Nicole (Laboratoire de Chimie Bactérienne du CNRS, Marseille, France), Jacques C. Senez, Jean Le Gall, and Madeleine Sebald. Base composition of the deoxyribonucleic acid of sulfate-reducing bacteria. J. Bacteriol. 85:1315–1318. 1963—The deoxyribonucleic acid constitution of several strains of sulfate-reducing bacteria has been analytically determined. The results of these studies show that this group of microorganisms includes at least four subgroups characterized by significantly different values of the adenine plus thymine to guanine plus cytosine ratio. The nonsporulated forms with polar flagellation, containing both cytochrome c3 and desulfoviridin, are divided into two subgroups. One includes the fresh-water, nonhalophilic strains with base ratio from 0.54 to 0.59, and the other includes the halophilic or halotolerant strains with base ratio from 0.74 to 0.77. The sporulated, peritrichous strains without cytochrome and desulfoviridin (“nigrificans” and “orientis”) are distinct from the above two types and differ from each other, having base ratios of 1.20 and 1.43, respectively. PMID:14047223
BASE COMPOSITION OF THE DEOXYRIBONUCLEIC ACID OF SULFATE-REDUCING BACTERIA.
SIGAL, N; SENEZ, J C; LEGALL, J; SEBALD, M
1963-06-01
Sigal, Nicole (Laboratoire de Chimie Bactérienne du CNRS, Marseille, France), Jacques C. Senez, Jean Le Gall, and Madeleine Sebald. Base composition of the deoxyribonucleic acid of sulfate-reducing bacteria. J. Bacteriol. 85:1315-1318. 1963-The deoxyribonucleic acid constitution of several strains of sulfate-reducing bacteria has been analytically determined. The results of these studies show that this group of microorganisms includes at least four subgroups characterized by significantly different values of the adenine plus thymine to guanine plus cytosine ratio. The nonsporulated forms with polar flagellation, containing both cytochrome c(3) and desulfoviridin, are divided into two subgroups. One includes the fresh-water, nonhalophilic strains with base ratio from 0.54 to 0.59, and the other includes the halophilic or halotolerant strains with base ratio from 0.74 to 0.77. The sporulated, peritrichous strains without cytochrome and desulfoviridin ("nigrificans" and "orientis") are distinct from the above two types and differ from each other, having base ratios of 1.20 and 1.43, respectively.
Effect of Bromouracil-containing Deoxyribonucleic Acid on Bacillus subtilis
Gimlin, Dixie M.; Hardman, Sue D.; Kelley, Betty N.; Butler, Grace C.; Leach, Franklin R.
1966-01-01
Gimlin, Dixie M. (Oklahoma State University, Stillwater), Sue D. Hardman, Betty N. Kelley, Grace C. Butler, and Franklin R. Leach. Effect of bromouracil-containing deoxyribonucleic acid on Bacillus subtilis. J. Bacteriol. 92:366–374. 1966.—Replacement of one-half of the thymine with bromouracil in Bacillus subtilis transforming deoxyribonucleic acid (DNA) resulted in a slight decrease in transforming activity, but, when used at high concentrations, this DNA preparation inhibited cell growth. Acid-hydrolyzed DNA, or addition of equivalent concentrations of the free base bromouracil in a transforming mixture, was without effect on cell growth. Treatment of the DNA preparation with deoxyribonuclease completely destroyed transforming activity and killing effect, whereas treatments with ribonuclease and trypsin were without effect on either transformation or killing activity. Growth of competent B. subtilis cells in test tubes was inhibited by high concentrations of both normal and bromouracil-containing DNA, with the bromouracil-containing DNA being significantly more inhibitory. This type of inhibition was also reflected in the time of division of the cells. The inhibitory effect was not due to viscosity, or to mutagenicity. The time course of killing paralleled transformation, and competency was required. These results can be interpreted as being due to uptake of homologous but imperfect DNA (containing bromouracil instead of thymine) by means of the systems involved in transformation, followed by either integration (resulting in lethal transformation, activation of a defective, nonlytic but lethal prophage) or interference with the recombination mechanism. PMID:16562122
Setlow, R. B.; Setlow, Jane K.; Carrier, W. L.
1970-01-01
An endonuclease purified from Micrococcus luteus makes single-strand breaks in ultraviolet (UV)-irradiated, native deoxyribonucleic acid (DNA). The purified endonuclease is able to reactivate UV-inactivated transforming DNA of Haemophilus influenzae, especially when the DNA is assayed on a UV-sensitive mutant of H. influenzae. After extensive endonuclease action, there is a loss of transforming DNA when assayed on both UV-sensitive and -resistant cells. The endonuclease does not affect unirradiated DNA. The results indicate that the endonuclease function is involved in the repair of biological damage resulting from UV irradiation and that the UV-sensitive mutant is deficient in this step. We interpret the data as indicating that the various steps in the repair of DNA must be well coordinated if repair is to be effective. PMID:4314478
Adansonian Analysis and Deoxyribonucleic Acid Base Composition of Serratia marcescens
Colwell, R. R.; Mandel, M.
1965-01-01
Colwell, R. R. (Georgetown University, Washington, D.C.), and M. Mandel. Adansonian analysis and deoxyribonucleic acid base composition of Serratia marcescens. J. Bacteriol. 89:454–461. 1965.—A total of 33 strains of Serratia marcescens were subjected to Adansonian analysis for which more than 200 coded features for each of the organisms were included. In addition, the base composition [expressed as moles per cent guanine + cytosine (G + C)] of the deoxyribonucleic acid (DNA) prepared from each of the strains was determined. Except for four strains which were intermediate between Serratia and the Hafnia and Aerobacter group C of Edwards and Ewing, the S. marcescens species group proved to be extremely homogeneous, and the different strains showed high affinities for each other (mean similarity, ¯S = 77%). The G + C ratio of the DNA from the Serratia strains ranged from 56.2 to 58.4% G + C. Many species names have been listed for the genus, but only a single clustering of the strains was obtained at the species level, for which the species name S. marcescens was retained. S. kiliensis, S. indica, S. plymuthica, and S. marinorubra could not be distinguished from S. marcescens; it was concluded, therefore, that there is only a single species in the genus. The variety designation kiliensis does not appear to be valid, since no subspecies clustering of strains with negative Voges-Proskauer reactions could be detected. The characteristics of the species are listed, and a description of S. marcescens is presented. PMID:14255714
León, Manuel Ponce-De; Cabrera-Juárez, Emiliano
1970-01-01
The photodynamic inactivation of native or denatured transforming deoxyribonucleic acid (DNA) from Haemophilus influenzae is described. The inactivation at the same pH was higher for denatured than native DNA. At acidic pH, the inactivation both for native and denatured DNA was faster than at alkaline pH. The guanine content of photoinactivated native DNA at neutral pH was less than untreated DNA. The inactivation of biological activity was more extensive than the alteration of guanine. The absorption spectrum of photoinactivated native or denatured DNA was only slightly different than the control DNA at the different experimental conditions. PMID:5309576
Silvestri, L. G.; Hill, L. R.
1965-01-01
Silvestri, L. G. (Università Statale, Milan, Italy), and L. R. Hill. Agreement between deoxyribonucleic acid base composition and taxometric classification of gram-positive cocci. J. Bacteriol. 90:136–140. 1965.—It had been previously proposed, from taxometric analyses, that gram-positive, catalase-positive cocci be divided into two subgroups. Thirteen strains, representative of both subgroups, were examined for deoxyribonucleic acid (DNA) base composition, determined from melting temperatures. Per cent GC (guanine + cytosine/total bases) values fell into two groups: 30.8 to 36.5% GC and 69 to 75% GC. Strains with low per cent GC values belonged to the Staphylococcus aureus–S. saprophyticus–S. lactis taxometric subgroups, and those with high per cent GC values belonged to the S. roseus–S. afermentans subgroup. The hypothetical nature of any classification is emphasized, and, in the present work, the hypothesis derived from taxometric analyses of division into two subgroups is confirmed by the study of DNA base ratios. The two subgroups correspond, respectively, to the genera Staphylococcus and Micrococcus. PMID:16562008
Skyring, G. W.; Jones, H. E.
1972-01-01
Guanine plus cytosine (GC) contents of the deoxyribonucleic acids of Desulfovibrio and Desulfotomaculum have been used as a basis for classification. Some of these data have been incorrectly calculated, resulting in errors of as much as 5% GC. This situation has been corrected by a reanalysis of existing data and by the contribution of new data. PMID:5011245
NASA Astrophysics Data System (ADS)
Gupta, Rohini Bhardwaj; Nagpal, Swati; Arora, Swati; Bhatnagar, Pramod Kumar; Mathur, Parmatma Chandra
2011-01-01
Ultraviolet (UV) light-emitting diode using salmon deoxyribonucleic acid (sDNA)-cetyltrimethylammonium complex as an electron blocking layer and zinc oxide (ZnO) nanorods as emissive material was fabricated. UV emission, which was blue shifted up to 335 nm with respect to the band edge emission of 390 nm, was observed. This blue shift was caused due to accumulation of electrons in the conduction band of ZnO because of a high potential barrier existing at the sDNA/ZnO interface.
Ivarie, Robert D.; Pène, Jacques J.
1970-01-01
Linear density gradients of Renografin have resolved two components of bacterial deoxyribonucleic acid (DNA) in sheared lysates. Component 1, at equilibrium density after 5 hr of centrifugation, is enriched for newly synthesized DNA and markers near the origin and terminus of replication. It contains 5% of total cellular protein, 25% of the phospholipids, 30 to 50% of the DNA, 4 to 11% of unstable ribonucleic acid (RNA), RNA polymerase, and low amounts of DNA polymerase. The material is sensitive to Pronase and Sarkosyl. In unsheared lysates, all of the DNA forms a band at this position. Shearing the lysate generates a slow-sedimenting fraction of DNA (component 2) which contains more uniformly labeled than newly synthesized DNA. These observations suggest that replicating DNA and DNA at the origin and possibly the terminus of replication are associated with membrane. The amount of uniformly labeled DNA in component 1 and an estimate of the number of chromosomal fragments suggest that other parts of the chromosome are possibly associated with the membrane. PMID:4992373
Kreuzer, K N; Cozzarelli, N R
1979-11-01
Temperature-sensitive nalA mutants of Escherichia coli have been used to investigate the structure and functions of deoxyribonucleic acid (DNA) gyrase. Extracts of one such mutant (nalA43) had thermosensitive DNA gyrase subunit A activity but normal gyrase subunit B activity, proving definitively that nalA is the structural gene for subunit A. Extracts of a second nalA (Ts) mutant (nalA45) had a 50-fold deficiency of gyrase subunit A activity. The residual DNA supertwisting was catalyzed by the mutant DNA gyrase rather than by a novel supertwisting enzyme. The nalA45(Ts) extract was also deficient in the nalidixic acid target, which is defined as the protein necessary to confer drug sensitivity to in vitro DNA replication directed by a nalidixic acid-resistant mutant extract. Thus, gyrase subunit A and the nalidixic acid target are one and the same protein, the nalA gene product. Shift of the nalA43(Ts) mutant to a nonpermissive temperature resulted in a precipitous decline in the rate of [(3)H]thymidine incorporation, demonstrating an obligatory role of the nalA gene product in DNA replication. The rates of incorporation of [(3)H]uridine pulses and continuously administered [(3)H]uracil were quickly reduced approximately twofold upon temperature shift of the nalA43(Ts) mutant, and therefore some but not all transcription requires the nalA gene product. The thermosensitive growth of bacteriophages phiX174 and T4 in the nalA43(Ts) host shows that these phages depend on the host nalA gene product. In contrast, the growth of phage T7 was strongly inhibited by nalidixic acid but essentially unaffected by the nalA43(Ts) mutation. The inhibition of T7 growth by nalidixic acid was, however, eliminated by temperature inactivation of the nal43 gene product. Therefore, nalidixic acid may block T7 growth by a corruption rather than a simple elimination of the nalidixic acid target. Possible mechanisms for such a corruption are considered, and their relevance to the puzzling
Amplified spontaneous emission of Rhodamine 6G embedded in pure deoxyribonucleic acid
NASA Astrophysics Data System (ADS)
Rau, Ileana; Szukalski, Adam; Sznitko, Lech; Miniewicz, Andrzej; Bartkiewicz, Stanislaw; Kajzar, Francois; Sahraoui, Bouchta; Mysliwiec, Jaroslaw
2012-10-01
Deoxyribonucleic acid (DNA) is commonly viewed as a genetic information carrier. However, now it is recognized as a nanomaterial, rather than as a biological material, in the research field of nanotechnology. Here, we show that using pure DNA, doped with rhodamine 6G, we are able to observe amplified spontaneous emission (ASE) phenomenon. Moderate ASE threshold, photodegradation, and reasonable gain coefficient observed in this natural host gives some perspectives for practical applications of this system in biophotonics. Obtained results open the way and will be leading to construction of truly bio-lasers using nature made luminophores, such as anthocyanins.
New Deoxyribonucleic Acid Polymerase Induced by Bacillus subtilis Bacteriophage PBS2
Price, Alan R.; Cook, Sandra J.
1972-01-01
The deoxyribonucleic acid (DNA) of Bacillus subtilis phage PBS2 has been confirmed to contain uracil instead of thymine. PBS2 phage infection of wild-type cells or DNA polymerase-deficient cells results in an increase in the specific activity of DNA polymerase. This induction of DNA polymerase activity is prevented by actinomycin D and chloramphenicol. In contrast to the major B. subtilis DNA polymerase, which prefers deoxythymidine triphosphate (dTTP) to deoxyuridine triphosphate (dUTP), the DNA polymerase in crude extracts of PBS2-infected cells is equally active whether dTTP or dUTP is employed. This phage-induced polymerase may be responsible for the synthesis of uracil-containing DNA during PBS2 phage infection. PMID:4623224
Optoelectronic studies on heterocyclic bases of deoxyribonucleic acid for DNA photonics.
El-Diasty, Fouad; Abdel-Wahab, Fathy
2015-10-01
The optoelectronics study of large molecules, particularly π-stacking molecules, such as DNA is really an extremely difficult task. We perform first electronic structure calculations on the heterocyclic bases of 2'-deoxyribonucleic acid based on Lorentz-Fresnel dispersion theory. In the UV-VIS range of spectrum, many of the optoelectronic parameters for DNA four bases namely adenine, guanine, cytosine and thymine are calculated and discussed. The results demonstrate that adenine has the highest hyperpolarizability, whereas thymine has the lowest hyperpolarizability. Cytosine has the lower average oscillator energy and the higher lattice energy. Thymine infers the most stable nucleic base with the lower phonon energy. Thymine also has the highest average oscillator energy and the lower lattice energy. Moreover, the four nucleic acid bases have large band gap energies less than 5 eV with a semiconducting behavior. Guanine shows the smallest band gap and the highest Fermi level energy, whereas adenine elucidates the highest band gap energy. Copyright © 2015. Published by Elsevier B.V.
Features of the damage produced by proflavine on transforming deoxyribonucleic acid.
Cabrera-Juárez, E; Sánchez-Rincón, D A
1979-01-01
Proflavine formed a complex with transforming deoxyribonucleic acid (DNA) from Haemophilus influenzae, with optimal formation at a ratio of proflavine to DNA of 0.06. The rate of dissociation of the complex by dialysis increased in the order: native, denatured, renatured DNA. The transforming activity of the DNA was reduced by its interaction with proflavine. This inactivation was dependent on the physical state of the DNA, the proflavine concentration, and the temperature. DNA that had been denatured and renatured was most sensitive; native DNA was much less sensitive. The inactivation remained after dialysis and was stable to prolonged storage. It is concluded that the inactivation of transforming DNA by proflavine takes place by a mechanism different from that of DNA-proflavine complex formation. PMID:312284
Features of the damage produced by proflavine on transforming deoxyribonucleic acid.
Cabrera-Juárez, E; Sánchez-Rincón, D A
1979-03-01
Proflavine formed a complex with transforming deoxyribonucleic acid (DNA) from Haemophilus influenzae, with optimal formation at a ratio of proflavine to DNA of 0.06. The rate of dissociation of the complex by dialysis increased in the order: native, denatured, renatured DNA. The transforming activity of the DNA was reduced by its interaction with proflavine. This inactivation was dependent on the physical state of the DNA, the proflavine concentration, and the temperature. DNA that had been denatured and renatured was most sensitive; native DNA was much less sensitive. The inactivation remained after dialysis and was stable to prolonged storage. It is concluded that the inactivation of transforming DNA by proflavine takes place by a mechanism different from that of DNA-proflavine complex formation.
Vapnek, Daniel; Spingler, Elizabeth
1974-01-01
Deoxyribonucleic acid-ribonucleic acid (DNA-RNA) hybridization studies have been performed with R-plasmid DNA (R538-1drd) and in vivo-synthesized RNA. R-plasmid DNA was isolated from Escherichia coli K-12, and the complementary strands were separated in cesium chloride-polyuridylic acid-polyguanylic acid gradients. DNA-RNA hybridization was performed with the separated DNA strands and RNA purified from R-plasmid-carrying cells. The results demonstrated that an asymmetric transcription of the R-plasmid DNA occurs in vivo. Hybridization was only detected with the H strand (denser strand in cesium chloride-polyuridylic acid-polyguanylic acid). By determining the density of the RNA-DNA hybrid in CsCl gradients, it was estimated that greater than 60% of the nucleotide sequences in the R-plasmid DNA are transcribed in logarithmically growing E. coli cells. No R-plasmid-specific RNA was detected in E. coli cells that did not carry the plasmid. PMID:4612013
Breaks induced in the deoxyribonucleic acid of aerosolized Escherichia coli by ozonized cyclohexene.
De Mik, G; De Groot, I
1978-01-01
The inactivation of aerosolized Escherichia coli by ozone, cyclohexene, and ozonized cyclohexene was studied. The parameters for damage were loss of reproduction and introduction of breaks in the deoxyribonucleic acid (DNA). Aerosolization of E. coli in clean air at 80 percent relative humidity or in air containing either ozone or cyclohexene hardly affected survival; however, some breaks per DNA molecule were induced, as shown by sucrose gradient sedimentation of the DNA. Aerosolization of E. coli in air containing ozonized cyclohexene at 80 percent relative humidity decreased the survival by a factor of 10(3) or more after 1 h of exposure and induced many breaks in the DNA. PMID:341811
Genetic Control of the Secondary Modification of Deoxyribonucleic Acid in Escherichia coli1
Mamelak, Linda; Boyer, Herbert W.
1970-01-01
The wild-type restriction and modification alleles of Escherichia coli K-12 and B were found to have no measurable effect on the patterns of methylated bases in the deoxyribonucleic acid (DNA) of these strains. The genetic region controlling the methylation of cytosine in E. coli K-12 was mapped close to his, and the presence or absence of this gene in E. coli B or E. coli K had no effect on the restriction and modification properties of these strains. Thus, only a few of the methylated bases in the DNA of these strains are involved in host modification, and the biological role of the remainder remains obscure. PMID:4919756
Linear, Single-Stranded Deoxyribonucleic Acid Isolated from Kilham Rat Virus
Salzman, Lois Ann; White, Wesley L.; Kakefuda, Tsuyoshi
1971-01-01
Kilham rat virus (KRV) was grown in a rat nephroma cell line and was purified by two isopycnic centrifugations in cesium chloride. The virus contains single-stranded deoxyribonucleic acid (DNA) with a molecular weight of approximately 1.6 × 106. The DNA was extracted from the virion by both phenol extraction and by 2% sodium dodecyl sulfate at 50 C. KRV DNA, extracted by both procedures, was observed in an electron microscope by using a cytochrome c or diethylaminoethyldextran monolayer. The DNA was also exposed to exonuclease I, an enzyme which hydrolyzes specifically linear, single-stranded DNA. Hydrolysis of 70 to 80% of the DNA was observed. Both the enzymatic and the electron microscope studies support the conclusion that extracted KRV DNA is a single-stranded, linear molecule. The length of the DNA was measured in the electron microscope and determined to be 1.505 ± 0.206 μm. Images PMID:4327590
Modak, Sohan P.; Setlow, Jane K.
1969-01-01
Synthesis of deoxyribonucleic acid (DNA) has been measured as a function of ultraviolet (UV) radiation dose in wild-type and seven UV-sensitive strains of Haemophilus influenzae. At the UV doses used, all strains were able to resume DNA synthesis, even those which are unable to excise pyrimidine dimers from their DNA. These excisionless strains showed longer UV-induced delays in DNA synthesis than all but one of the other strains. The longest delay was shown by DB117, a strain which can excise dimers but which is recombination deficient and unable to rejoin X ray-induced single-strand breaks. All strains showed a progressive decrease in sensitivity as they approached the stationary phase. PMID:5305934
Muhammed, Amir; Setlow, Jane K.
1970-01-01
The decrease in integration of transforming deoxyribonucleic acid (DNA) caused by ultraviolet irradiation of the DNA was found to be independent of the presence or absence of excision repair in the recipient cell. Much of the ultraviolet-induced inhibition of integration resulted from the presence in the transforming DNA of pyrimidine dimers, as judged by the photoreactivability of the inhibition with yeast photoreactivating enzyme. The inhibition of integration made only a small contribution to the inactivation of transforming ability of the DNA by ultraviolet radiation. PMID:5308769
φX-174 Bacteriophage Structural Mutants Which Affect Deoxyribonucleic Acid Synthesis
Siegel, Jeff E. D.; Hayashi, Masaki
1969-01-01
Seven cistrons in φX-174 were identified and one in particular was studied intensively: cistron A, which is assigned a protein in the mature phage. Amber mutants in this cistron synthesize a new deoxyribonucleic acid (DNA) form in addition to circular phage DNA upon infection of the restrictive host. This DNA is linear, non-infectious, and single-stranded; it is formed from the phage strand of replicative form φX-174 DNA. These mutants produce two different defective particles in the restrictive host. One particle contains circular phage DNA but is not infectious; the other contains the new DNA form and is similar to the 70S particles found in wild-type phage lysates. The mutant A gene product acts independently of normal A protein upon mixed infection of the restrictive host with an A mutant and a mutant from any other cistron or wild type. PMID:5823229
Ultrastructure of Deoxyribonucleic Acid-Membrane Associations in Escherichia coli
Altenburg, B. C.; Suit, Joan C.; Brinkley, B. R.
1970-01-01
Areas of contact between deoxyribonucleic acid (DNA) and intracytoplasmic membrane are frequently seen in the “extra” membrane-forming strain Escherichia coli 0111a1. By examination of serial sections, it has been estimated that these DNA-membrane associations occur in at least 60% of the extra membrane-containing cells. Most of the DNA masses contained only one contact area. Several cells in which the DNA had been stretched revealed individual fibers connecting to the membrane, suggesting a firm attachment of DNA to membrane. The areas of membrane associated with DNA fibers were usually between 100 and 500 nm in diameter, although some smaller areas were seen. Electron microscopic autoradiography of cells in which the replication forks were labeled showed grains over 24% of the profiles containing a contact area, whereas there were grains over only 16% of the profiles without a contact area. Data from autoradiographs of cells in which the label was “chased” away from the replication fork showed the reverse labeling pattern. These data indicate that the areas of contact between DNA and intracytoplasmic membranes seen in electron micrographs contain the DNA replication forks. Images PMID:4919755
Powers, C. D.; Miller, B. A.; Kurtz, H.; Ackermann, W. W.
1969-01-01
Inhibition of HeLa cell deoxyribonucleic acid (DNA) synthesis, which occurred by the 4th to 5th hr after infection with poliovirus, could be blocked completely by guanidine only when it was present before the 2nd hr. At the 2nd hr, there was no significant ribonucleic acid (RNA)-replicase activity, and addition of guanidine inhibited all production of virus but allowed 57% of maximal DNA inhibition to develop. Maximum DNA inhibition developed in cells infected for 4 hr in the presence of guanidine when the guanidine was removed for a 10-min interval. RNA-replicase activity was not enzymatically detectable and viral multiplication did not develop in these cells unless the interval without guanidine was extended to 60 min. The interpretation of the data was that the effect of guanidine on viral-induced inhibition of DNA synthesis was distinct and not a consequence of the inhibition of RNA-replicase. PMID:4305675
Della Valle, G; Fenton, R G; Basilico, C
1981-01-01
To study the mechanism of deoxyribonucleic acid (DNA)-mediated gene transfer, normal rat cells were transfected with total cellular DNA extracted from polyoma virus-transformed cells. This resulted in the appearance of the transformed phenotype in 1 X 10(-6) to 3 X 10(-6) of the transfected cells. Transformation was invariably associated with the acquisition of integrated viral DNA sequences characteristic of the donor DNA. This was caused not by the integration of free DNA molecules, but by the transfer of large DNA fragments (10 to 20 kilobases) containing linked cellular and viral sequences. Although Southern blot analysis showed that integration did not appear to occur in a homologous region of the recipient chromosome, the frequency of transformation was rather high when compared with that of purified polyoma DNA, perhaps due to "position" effects or to the high efficiency of recombination of large DNA fragments. Images PMID:6100965
Kuhl, S J; Brown, L R
1980-01-01
Ribonucleic acid (RNA) synthesis was examined in cold-shocked Bacillus subtilis cells. The cells were grown to mid-log stage, harvested, and cold shocked. RNA synthesis was monitored by the incorporation of [3H]uridine triphosphate or [alpha 32P]adenosine triphosphate into trichloroacetic acid-precipitable material in the presence of all four nucleoside triphosphates. The inhibition of RNA synthesis in cold-shocked cells by lipiarmycin, ethidium bromide, rifampin. or streptolydigin was analyzed using mutant or wild-type cells. Also examined were the effects of temperature, salt concentration, and the addition of polyamines or highly phosphorylated nucleotides. In ultraviolet-irradiated and cold-shocked cells, RNA wynthesis decreased to low levels. The addition of exogenous phi 29 or TSP-1 template to these cells caused a 13- to 20-fold increase in RNA synthesis, as monitored by trichloroacetic acid-precipitable counts. RNA synthesized in the presence of phi 29 deoxyribonucleic acid (DNA) hybridizes mainly to EcoRI fragments A and C of phi 29 DBA, These two fragments direct transcription by purified RNA polymerase in vitro and hybridize to early phi 29 DNA produced in vivo. Our results with TSP-1 DNA in this system indicated that the RNA produced hybridizes to the same fragments as early RNA produced in vivo. Plasmic pUB110 DNA was not transcribed in this system. Images PMID:6157674
Smith, William R.; McAuslan, Brian R.
1969-01-01
Frog virus (FV-3) was banded by isopycnic centrifugation in cesium chloride, sucrose, or potassium tartrate. Two bands of infectivity were regularly found at positions in cesium chloride corresponding to densities of 1.26 and 1.30 g/cm3, respectively. Deoxyribonucleic acid from either band had the following characteristics: double-stranded; a Tm of 76.3 C in 0.1 SSC (0.015 m NaCl plus 0.015 m sodium citrate) and a buoyant density of 1.720 g/cm3 in cesium chloride, corresponding to a guanine plus cytosine content of 56 to 58% and a molecular weight of 130 × 106 daltons, determined by velocity sedimentation. These data, together with electron micrographs of sections of cells infected with material from either band suggest that two types of infectious frog virus particles exists, rather than a second virus in the frog virus stocks. The composition of frog virus was determined. It was found that highly purified preparations of frog virus were composed of 55.8% protein, 30.1% deoxyribonucleic acid, and 14.2% lipid. The kinetics of adsorption and uncoating of FV-3 was studied with radioactive virus. Uncoating is comparatively rapid and in contrast to poxvirus is unaffected by inhibitors of protein synthesis. Images PMID:4980848
NASA Astrophysics Data System (ADS)
Enayatifar, Rasul; Sadaei, Hossein Javedani; Abdullah, Abdul Hanan; Lee, Malrey; Isnin, Ismail Fauzi
2015-08-01
Currently, there are many studies have conducted on developing security of the digital image in order to protect such data while they are sending on the internet. This work aims to propose a new approach based on a hybrid model of the Tinkerbell chaotic map, deoxyribonucleic acid (DNA) and cellular automata (CA). DNA rules, DNA sequence XOR operator and CA rules are used simultaneously to encrypt the plain-image pixels. To determine rule number in DNA sequence and also CA, a 2-dimension Tinkerbell chaotic map is employed. Experimental results and computer simulations, both confirm that the proposed scheme not only demonstrates outstanding encryption, but also resists various typical attacks.
Tunable mechanical properties of green solid films based on deoxyribonucleic acids
NASA Astrophysics Data System (ADS)
Matsuno, Hisao; Morimitsu, Yuma; Ohta, Noboru; Sekiguchi, Hiroshi; Takahara, Atsushi; Tanaka, Keiji
Promoting green innovation to establish a worldwide low-carbon society is an urgent priority. We here show that solid films made from deoxyribonucleic acid (DNA) can be used as a structural material. The great advantage of DNA films over the ones made from synthetic polymers is that the mechanical properties are controllable, from glassy to rubbery, via semicrystalline by simply regulating the water content in the film. Why such unique mechanical properties can be manifested by the DNA films is determined from structural analyses using Fourier-transform infrared spectroscopy and wide-angle X-ray diffraction measurements. With increasing water content, the conformation of DNA was changed from A-form in an amorphous state to B-form in a partially packed one. DNA in the B-form became densely packed as the film was stretched. Also, DNAs were intermolecularly cross-linked using 2,5-hexanedione based on reductive amination induced by 2-picoline borane in aqueous phase. Cross-linking points were directly observed by atomic force microscopy. The tensile properties of cross-linked films were much better than those of non-cross-linked DNA films.
Characteristics of Deoxyribonucleic Acid Polymerase Isolated from Spores of Rhizopus stolonifer1
Gong, Cheng-Shung; Dunkle, Larry D.; Van Etten, James L.
1973-01-01
Deoxyribonucleic acid (DNA)-dependent DNA polymerase was purified several hundredfold from germinated and ungerminated spores of the fungus Rhizopus stolonifer. The partially purified enzymes from both spore stages exhibited identical characteristics; incorporation of [3H]deoxythymidine monophosphate into DNA required Mg2+, DNA, a reducing agent, and the simultaneous presence of deoxyguanosine triphosphate, deoxycytidine triphosphate, and deoxyadenosine triphosphate. Heat-denatured and activated DNAs were better templates than were native DNAs. The buoyant density of the radioactive product of the reaction was similar to that of the template DNA. The enzyme is probably composed of a single polypeptide chain with an S value of 5.12 and an estimated molecular weight of 70,000 to 75,000. During the early stages of purification, the enzyme fraction from ungerminated spores required exogenous DNA for maximum activity, whereas the corresponding enzyme fraction from germinated spores did not require added DNA. Apparently DNA polymerase from germinated spores was more tightly bound to endogenous DNA than was the enzyme from ungerminated spores. PMID:4728271
Pène, Jacques J.; Marmur, Julius
1967-01-01
The role of deoxyribonucleic acid (DNA) replication in the control of the synthesis of deoxycytidylate (dCMP) deaminase and lysozyme in Bacillus subtilis infected with bacteriophage 2C has been studied. These phage-induced enzymes are synthesized at different times during the latent period. It was shown by actinomycin inhibition that the formation of the late enzyme (lysozyme) required messenger ribonucleic acid (mRNA) synthesized de novo after the initiation of translation of mRNA which specifies the early function (dCMP deaminase). The inhibition of phage DNA synthesis by mitomycin C prevented the synthesis of lysozyme only when added before the onset of phage DNA replication, but it did not affect the synthesis or action of dCMP deaminase when added at any time during the latent period. Treatment of infected cells with mitomycin C after phage DNA synthesis had reached 8 to 10% of its maximal rate resulted in the production of normal amounts of lysozyme. These observations suggest that mRNA specifying early enzymes can be transcribed from parental (and probably also from progeny) DNA, whereas late functional messengers can be transcribed only after the formation of progeny DNA. PMID:4990039
Relation Between Deoxyribonucleic Acid and Intracytoplasmic Membranes in Escherichia coli O111a11
Altenburg, Betty C.; Suit, Joan C.
1970-01-01
The possibility of a relationship between intracytoplasmic membranes and deoxyribonucleic acid (DNA) in Escherichia coli O111a1 has been investigated. To facilitate this investigation, a simple enzymatic assay for the amount of internal membrane present in a culture was developed. This assay was then used to show that the appearance of intracytoplasmic membranes is accompanied by an increase in the DNA content of the cells. Electron micrographs have confirmed this observation and have shown DNA to be in contact with the intracytoplasmic membranes. Extensive membranes were observed at sites of apparently unsuccessful attempts at cell division. These observations led to the conclusion that the internal membrane formed by strain O111a1 represents “extra” membrane, which is functional in that it contains sites for DNA replication, but is produced in excess because the organism is somehow defective in its regulation of membrane synthesis. Images PMID:4192984
Deoxyribonucleic acid (DNA) cladding layers for nonlinear-optic-polymer-based electro-optic devices
NASA Astrophysics Data System (ADS)
Grote, James G.; Ogata, Naoya; Diggs, Darnell E.; Hopkins, Frank K.
2003-07-01
Nonlinear optic (NLO) polymer based electro-optic devices have been achieving world record low half wave voltages and high frequencies over the last 2-3 years. Part of the advancement is through the use of relatively more conductive polymers for the cladding layers. Based on the current materials available for these cladding materials, however, the desired optical and electromagnetic properites are being balanced for materials processability. One does not want the solvent present in one layer to dissovle the one deposited underneath, or be dissolved by the one being deposited on top. Optimized polymer cladding materials, to further enhance device performance, are continuing to be investigated. Thin films of deoxyribonucleic acid (DNA), derived from salmon sperm, show promise in providing both the desired optical and magnetic properties, as well as the desired resistance to various solvents used for NLO polymer device fabrication. Thin films of DNA were deposited on glass and silicon substrates and the film quality, optical and electromagnetic properties and resistance to various solvents were characterized.
La Scolea, L J; Dul, M J; Young, F E
1975-01-01
This investigation describes the surveillance of the colonial stability of the pathogenic type 1 from the gonococcal strain F62 to the nonvirulent types 3 and 4 in different liquid media. The maintenance of the colony types was monitored by the parameters of colonial morphology and deoxyribonucleic acid-mediated transformation. During growth in a complex medium, Mueller-Hinton broth, only 46.7% of the gonococcal population remained as type 1 after 12 h. The greatest change in the type 1 colony-forming units correlated with the decline in viable count. The conversion process could not be prevented by the continual maintenance of the gonococcus in logarithmic growth. The frequency of transformation from PRO(minus) (proline) to PRO(plus) was proportional to this decrease in type 1 colony-forming units. In contrast to Mueller-Hinton medium, the chemically defined minimal medium Gonococcal Genetic Medium (GGM) was capable of maintaining approximately 90% of the gonococcal population in the type 1 colonial form after 16 h of growth, despite a decrease in the viable count. Although the percentage of type 1 appeared to remain constant in GGM, the apparent transformation frequency increased approximately 24-fold from 0 to 12 h of growth. GGM appears to stimulate or maintain competence, as evidenced by an eightfold increase in transformation when cells are exposed to deoxyribonucleic acid in GGM as compared to Mueller-Hinton. PMID:809469
NASA Astrophysics Data System (ADS)
Shi, Wei; Han, Shijiao; Huang, Wei; Yu, Junsheng
2015-01-01
High mobility organic field-effect transistors (OFETs) by inserting water-soluble deoxyribonucleic acid (DNA) buffer layer between electrodes and pentacene film through spray coating process were fabricated. Compared with the OFETs incorporated with DNA in the conventional organic solvents of ethanol and methanol: water mixture, the water-soluble DNA based OFET exhibited an over four folds enhancement of field-effect mobility from 0.035 to 0.153 cm2/Vs. By characterizing the surface morphology and the crystalline structure of pentacene active layer through atomic force microscope and X-ray diffraction, it was found that the adoption of water solvent in DNA solution, which played a key role in enhancing the field-effect mobility, was ascribed to both the elimination of the irreversible organic solvent-induced bulk-like phase transition of pentacene film and the diminution of a majority of charge trapping at interfaces in OFETs.
Kuempel, Peter L.
1972-01-01
Alkaline sucrose gradients were used to study the molecular weight of deoxyribonucleic acid (DNA) synthesized during the initiation of chromosome replication in Escherichia coli 15 TAU-bar. The experiments were conducted to determine whether newly synthesized, replication origin DNA is attached to higher-molecular-weight parental DNA. Little of the DNA synthesized after readdition of required amino acids to cells previously deprived of the amino acids was present in DNA with a molecular weight comparable to that of the parental DNA. The newly synthesized, low-molecular-weight DNA rapidly appeared in higher-molecular-weight material, but there was an upper limit to the size of this intermediate-molecular-weight DNA. This limit was not observed when exponentially growing cells converted newly synthesized DNA to higher-molecular-weight material. The size of the intermediate-molecular-weight DNA was related to the age of the replication forks, and the size increased as the replication forks moved further from the replication origin. The results indicate that the newly synthesized replication origin DNA is not attached to parental DNA, but it is rapidly attached to the growing strands that extend from the replication fork to the replication origin, or to the other replication fork if replication is bidirectional. Experiments are reported which demonstrate that the DNA investigated was from the vicinity of the replication origin and was not plasmid DNA or DNA from random positions on the chromosome. PMID:4562387
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shi, Wei; Han, Shijiao; Huang, Wei
High mobility organic field-effect transistors (OFETs) by inserting water-soluble deoxyribonucleic acid (DNA) buffer layer between electrodes and pentacene film through spray coating process were fabricated. Compared with the OFETs incorporated with DNA in the conventional organic solvents of ethanol and methanol: water mixture, the water-soluble DNA based OFET exhibited an over four folds enhancement of field-effect mobility from 0.035 to 0.153 cm{sup 2}/Vs. By characterizing the surface morphology and the crystalline structure of pentacene active layer through atomic force microscope and X-ray diffraction, it was found that the adoption of water solvent in DNA solution, which played a key role inmore » enhancing the field-effect mobility, was ascribed to both the elimination of the irreversible organic solvent-induced bulk-like phase transition of pentacene film and the diminution of a majority of charge trapping at interfaces in OFETs.« less
Bacterial fatty acid metabolism in modern antibiotic discovery.
Yao, Jiangwei; Rock, Charles O
2017-11-01
Bacterial fatty acid synthesis is essential for many pathogens and different from the mammalian counterpart. These features make bacterial fatty acid synthesis a desirable target for antibiotic discovery. The structural divergence of the conserved enzymes and the presence of different isozymes catalyzing the same reactions in the pathway make bacterial fatty acid synthesis a narrow spectrum target rather than the traditional broad spectrum target. Furthermore, bacterial fatty acid synthesis inhibitors are single-targeting, rather than multi-targeting like traditional monotherapeutic, broad-spectrum antibiotics. The single-targeting nature of bacterial fatty acid synthesis inhibitors makes overcoming fast-developing, target-based resistance a necessary consideration for antibiotic development. Target-based resistance can be overcome through multi-targeting inhibitors, a cocktail of single-targeting inhibitors, or by making the single targeting inhibitor sufficiently high affinity through a pathogen selective approach such that target-based mutants are still susceptible to therapeutic concentrations of drug. Many of the pathogens requiring new antibiotic treatment options encode for essential bacterial fatty acid synthesis enzymes. This review will evaluate the most promising targets in bacterial fatty acid metabolism for antibiotic therapeutics development and review the potential and challenges in advancing each of these targets to the clinic and circumventing target-based resistance. This article is part of a Special Issue entitled: Bacterial Lipids edited by Russell E. Bishop. Copyright © 2016 Elsevier B.V. All rights reserved.
Waters, R; Moustacchi, E
1975-01-01
The yield of ultraviolet-induced dimers is similar for a fixed dose in both haploid and diploid Saccharomyces cerevisiae. The excision of these photo-products from the nuclear deoxyribonucleic acids of cells of both ploidies after ultraviolet incident doses of 2 times 10-3 to 4 times 10-3 ergs/mm2 decreased with the corresponding increasing dose. Postirradiation incubation in saline followed by a further incubation in nutrient medium increases the excision as compared to that seen in either nutrient medium or saline alone. Previous data regarding both pyrimidine dimer removal and the survival of haploid and diploid cells after ultraviolet irradiation and either immediate or delayed plating are discussed. PMID:1090608
Use of antibody to membrane adenosine triphosphatase in the study of bacterial relatioships.
Whiteside, T L; De Siervo, A J; Salton, M R
1971-03-01
An antiserum to Ca(2+)-activated adenosine triphosphatase from membranes of Micrococcus lysodeikticus cross-reacted in agar gels with membrane adenosine triphosphatases from other pigmented micrococci and related species. Species of Micrococcus and Sarcina showed different levels of inhibition of adenosine triphosphatase activities in heterologous reactions with antiserum. Inter- and intraspecific relationships based on the inhibition reaction were compared with an independent parameter, namely the quantitative and qualitative composition of the bacterial membrane phospholipids and fatty acids. The guanine plus cytosine contents in the deoxyribonucleic acid of the species studied correlated well with the serological cross-reactivity of adenosine triphosphatases from their membranes. The types of cross-bridges found in the peptidoglycans of these cocci were also compared with the other properties. The results suggest that an antiserum specific for a major membrane protein may be a reliable and most useful adjunct in studying bacterial serotaxonomy.
Use of Antibody to Membrane Adenosine Triphosphatase in the Study of Bacterial Relationships1
Whiteside, Theresa L.; De Siervo, August J.; Salton, Milton R. J.
1971-01-01
An antiserum to Ca2+-activated adenosine triphosphatase from membranes of Micrococcus lysodeikticus cross-reacted in agar gels with membrane adenosine triphosphatases from other pigmented micrococci and related species. Species of Micrococcus and Sarcina showed different levels of inhibition of adenosine triphosphatase activities in heterologous reactions with antiserum. Inter- and intraspecific relationships based on the inhibition reaction were compared with an independent parameter, namely the quantitative and qualitative composition of the bacterial membrane phospholipids and fatty acids. The guanine plus cytosine contents in the deoxyribonucleic acid of the species studied correlated well with the serological cross-reactivity of adenosine triphosphatases from their membranes. The types of cross-bridges found in the peptidoglycans of these cocci were also compared with the other properties. The results suggest that an antiserum specific for a major membrane protein may be a reliable and most useful adjunct in studying bacterial serotaxonomy. Images PMID:4323299
Aslan, O; Hamill, R M; Sweeney, T; Reardon, W; Mullen, A M
2009-01-01
It is essential to isolate high-quality DNA from muscle tissue for PCR-based applications in traceability of animal origin. We wished to examine the impact of cooking meat to a range of core temperatures on the quality and quantity of subsequently isolated genomic (specifically, nuclear) DNA. Triplicate steak samples were cooked in a water bath (100 degrees C) until their final internal temperature was 75, 80, 85, 90, 95, or 100 degrees C, and DNA was extracted. Deoxyribonucleic acid quantity was significantly reduced in cooked meat samples compared with raw (6.5 vs. 56.6 ng/microL; P < 0.001), but there was no relationship with cooking temperature. Quality (A(260)/A(280), i.e., absorbance at 260 and 280 nm) was also affected by cooking (P < 0.001). For all 3 genes, large PCR amplicons (product size >800 bp) were observed only when using DNA from raw meat and steak cooked to lower core temperatures. Small amplicons (<200 bp) were present for all core temperatures. Cooking meat to high temperatures thus resulted in a reduced overall yield and probable fragmentation of DNA to sizes less than 800 bp. Although nuclear DNA is preferable to mitochondrial DNA for food authentication, it is less abundant, and results suggest that analyses should be designed to use small amplicon sizes for meat cooked to high core temperatures.
Method for construction of bacterial strains with increased succinic acid production
Donnelly, Mark I.; Sanville-Millard, Cynthia; Chatterjee, Ranjini
2000-01-01
A fermentation process for producing succinic acid is provided comprising selecting a bacterial strain that does not produce succinic acid in high yield, disrupting the normal regulation of sugar metabolism of said bacterial strain, and combining the mutant bacterial strain and selected sugar in anaerobic conditions to facilitate production of succinic acid. Also provided is a method for changing low yield succinic acid producing bacteria to high yield succinic acid producing bacteria comprising selecting a bacterial strain having a phosphotransferase system and altering the phosphotransferase system so as to allow the bacterial strain to simultaneously metabolize different sugars.
Uracil in formic acid hydrolysates of deoxyribonucleic acid
Schein, Arnold H.
1966-01-01
1. When DNA is hydrolysed with formic acid for 30min. at 175° and the hydrolysate is chromatographed on paper with propan-2-ol–2n-hydrochloric acid, in addition to expected ultraviolet-absorbing spots corresponding to guanine, adenine, cytosine and thymine, an ultraviolet-absorbing region with RF similar to that of uracil can be detected. Uracil was separated from this region and identified by its spectra in acid and alkali, and by its RF in several solvent systems. 2. Cytosine, deoxyribocytidine and deoxyribocytidylic acid similarly treated with formic acid all yielded uracil, as did a mixture of deoxyribonucleotides. 3. Approx. 4% of deoxyribonucleotide cytosine was converted into uracil by the formic acid treatment. ImagesFig. 1. PMID:5949371
Ge, Zhengwei; Wang, Wei; Yang, Chun
2015-02-09
This paper reports rapid microfluidic electrokinetic concentration of deoxyribonucleic acid (DNA) with the Joule heating induced temperature gradient focusing (TGF) by using our proposed combined AC and DC electric field technique. A peak of 480-fold concentration enhancement of DNA sample is achieved within 40s in a simple poly-dimethylsiloxane (PDMS) microfluidic channel of a sudden expansion in cross-section. Compared to a sole DC field, the introduction of an AC field can reduce DC field induced back-pressure and produce sufficient Joule heating effects, resulting in higher concentration enhancement. Within such microfluidic channel structure, negative charged DNA analytes can be concentrated at a location where the DNA electrophoretic motion is balanced with the bulk flow driven by DC electroosmosis under an appropriate temperature gradient field. A numerical model accounting for a combined AC and DC field and back-pressure driven flow effects is developed to describe the complex Joule heating induced TGF processes. The experimental observation of DNA concentration phenomena can be explained by the numerical model. Copyright © 2014 Elsevier B.V. All rights reserved.
Barth, Peter T.; Grinter, Nigel J.
1974-01-01
Bacterial strains showing linked resistance to streptomycin (Sm) and sulfonamides (Su) were chosen representing a wide taxonomic and geographical range. Their SmSu resistances were transferred to Escherichia coli K-12 and then plasmid deoxyribonucleic acid (DNA) was isolated by ethidium bromide CsCl centrifugation. The plasmid DNA was examined by electron microscopy and analyzed by sedimentation through 5 to 20% neutral sucrose gradients. Plasmid DNA from strains having transmissible SmSu resistance consisted of two or three molecular species, one of which had a molecular mass of about 5.7 Mdal (106 daltons), the others varying between 20 to 60 Mdal. By using transformation or F′ mobilization, we isolated the SmSu-resistance determinant from any fellow resident plasmids in each strain and again isolated the plasmid DNA. Cosedimentation of each of these with a differently labeled reference plasmid DNA (R300B) showed 9 out of 12 of the plasmids to have a molecular mass not significantly different from the reference (5.7 Mdal); two others were 6.3 and 9.2 Mdal, but PB165 consisted of three plasmids of 7.4, 14.7, and 21.4 Mdal. Three separate isolations of the SmSu determinant from PB165 gave the same three plasmids, which we conclude may be monomer, dimer, and trimer, respectively. DNA-DNA hybridizations at 75 C demonstrated 80 to 93% homology between reference R300B DNA and each isolated SmSu plasmid DNA, except for the 9.2-Mdal plasmid which had 45% homology and PB165 which had 35%. All the SmSu plasmids were present as multiple copies (about 10) per chromosome. The conjugative plasmid of R300 (present as 1.3 copies per chromosome) has been shown to have negligible effect on the number of copies of its accompanying SmSu plasmid R300B. We conclude that the SmSu plasmids are closely related and probably have a common evolutionary origin. Images PMID:4616941
A MapReduce approach to diminish imbalance parameters for big deoxyribonucleic acid dataset.
Kamal, Sarwar; Ripon, Shamim Hasnat; Dey, Nilanjan; Ashour, Amira S; Santhi, V
2016-07-01
In the age of information superhighway, big data play a significant role in information processing, extractions, retrieving and management. In computational biology, the continuous challenge is to manage the biological data. Data mining techniques are sometimes imperfect for new space and time requirements. Thus, it is critical to process massive amounts of data to retrieve knowledge. The existing software and automated tools to handle big data sets are not sufficient. As a result, an expandable mining technique that enfolds the large storage and processing capability of distributed or parallel processing platforms is essential. In this analysis, a contemporary distributed clustering methodology for imbalance data reduction using k-nearest neighbor (K-NN) classification approach has been introduced. The pivotal objective of this work is to illustrate real training data sets with reduced amount of elements or instances. These reduced amounts of data sets will ensure faster data classification and standard storage management with less sensitivity. However, general data reduction methods cannot manage very big data sets. To minimize these difficulties, a MapReduce-oriented framework is designed using various clusters of automated contents, comprising multiple algorithmic approaches. To test the proposed approach, a real DNA (deoxyribonucleic acid) dataset that consists of 90 million pairs has been used. The proposed model reduces the imbalance data sets from large-scale data sets without loss of its accuracy. The obtained results depict that MapReduce based K-NN classifier provided accurate results for big data of DNA. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Lirk, P; Hollmann, M W; Fleischer, M; Weber, N C; Fiegl, H
2014-07-01
Lidocaine demethylates deoxyribonucleic acid (DNA) in breast cancer cells. This modification of epigenetic information may be of therapeutic relevance in the perioperative period, because a decrease in methylation can reactivate tumour suppressor genes and inhibit tumour growth. The objectives of this study were to determine the effect of two amide local anaesthetics, ropivacaine and bupivacaine, on methylation in two breast cancer cell lines and to detect whether the combination of lidocaine with the chemotherapy agent 5-aza-2'-deoxycytidine (DAC) would result in additive demethylating effects. Breast cancer cell lines BT-20 [oestrogen receptor (ER)-negative] and MCF-7 (ER-positive) were incubated with lidocaine, bupivacaine, and ropivacaine to assess demethylating properties. Then, we tested varying concentrations of lidocaine and DAC to assess whether their demethylating effects were additive. Cell numbers and global methylation status were analysed. Lidocaine decreased methylation in BT-20 and MCF-7 cells, ropivacaine decreased methylation in BT-20 cells, and bupivacaine had no demethylating effect. When combined, lidocaine and DAC had additive demethylating effects. At clinically relevant doses, lidocaine and ropivacaine exert demethylating effects on specific breast cancer cell lines, but bupivacaine does not. The demethylating effects of lidocaine and DAC are indeed additive. © The Author [2014]. Published by Oxford University Press on behalf of the British Journal of Anaesthesia. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
D-amino acids inhibit initial bacterial adhesion: thermodynamic evidence.
Xing, Su-Fang; Sun, Xue-Fei; Taylor, Alicia A; Walker, Sharon L; Wang, Yi-Fu; Wang, Shu-Guang
2015-04-01
Bacterial biofilms are structured communities of cells enclosed in a self-produced hydrated polymeric matrix that can adhere to inert or living surfaces. D-Amino acids were previously identified as self-produced compounds that mediate biofilm disassembly by causing the release of the protein component of the polymeric matrix. However, whether exogenous D-amino acids could inhibit initial bacterial adhesion is still unknown. Here, the effect of the exogenous amino acid D-tyrosine on initial bacterial adhesion was determined by combined use of chemical analysis, force spectroscopic measurement, and theoretical predictions. The surface thermodynamic theory demonstrated that the total interaction energy increased with more D-tyrosine, and the contribution of Lewis acid-base interactions relative to the change in the total interaction energy was much greater than the overall nonspecific interactions. Finally, atomic force microscopy analysis implied that the hydrogen bond numbers and adhesion forces decreased with the increase in D-tyrosine concentrations. D-Tyrosine contributed to the repulsive nature of the cell and ultimately led to the inhibition of bacterial adhesion. This study provides a new way to regulate biofilm formation by manipulating the contents of D-amino acids in natural or engineered systems. © 2014 Wiley Periodicals, Inc.
Ledinko, Nada; Fong, Caroline K. Y.
1969-01-01
Infection of human embryonic kidney (HEK) cell cultures with adenovirus types 2 or 12 resulted in an initial drop in the rate of incorporation of 3H-thymidine into deoxyribonucleic acid (DNA) during the early latent period of virus growth, followed by a marked rise in label uptake. It was shown by cesium chloride isopycnic centrifugation that, after adenovirus 2 infection, there was a decrease in the rate of incorporation of thymidine into cellular DNA. Moreover, DNA-DNA hybridization experiments revealed that, by 28 to 32 hr after infection with either adenovirus 2 or 12, the amount of isolated pulse-labeled DNA capable of hybridizing with HEK cell DNA was reduced by approximately 60 to 70%. Autoradiographic measurements showed that the inhibition of cellular DNA synthesis was due to a decrease in the ability of an infected cell to synthesize DNA. The adenovirus-induced inhibition of host cell DNA synthesis was not due to degradation of cellular DNA. 3H-thymidine incorporated into cellular DNA at the time of infection remained acid-precipitable, and labeled material was not incorporated into viral DNA. Furthermore, when zone sedimentation through neutral or alkaline sucrose density gradients was employed, no detectable change was observed in the sedimentation rate of this cellular DNA at various times after infection with adenovirus 2 or 12. In addition, there was no increase in deoxyribonuclease activity in cells infected with either virus. Cultures infected for 38 hr with adenovirus 2 or 12 incorporated three to four times as much 3H-uridine into ribonucleic acid (RNA) as did non-infected cultures. Furthermore, the net RNA synthesized by infected cultures substantially exceeded that of control cultures. The activity of thymidine kinase was induced, but there was no stimulation of uridine kinase. PMID:5806981
Gephart, J F; Lerner, A M
1981-01-01
In a single line of human foreskin fibroblasts, minimum inhibitory concentrations (MICs) and the minimum intracellular virus inactivation concentrations (MIICs) of arabinosyladenine, arabinosylhypoxanthine, and arabinosyladenine 5'-monophosphate were assayed for a number of recent isolates of herpes simplex virus types 1 and 2 (HSV-1, HSV-2), varicella-zoster virus (VZV), and cytomegalovirus (CMV). (The term MIIC is used here to describe the selective qualitative intracellular inhibition of the virus inoculum in the primary tissue cultures. The inoculum is not recoverable in subcultures free of antiviral agent.) MICs and MIICs of each of the antiviral agents were readily obtained for each strain of HSV-1, HSV-2, and VZV tested, but all seven strains of CMV tested were much more resistant. At the endpoint, there was little variation in the MICs or MIICs among strans of the same virus. Final MIC results for HSV-1 and HSV-2 were complete after 3 days of incubation; CMV and VZV results required as long as 6 days. The MIC for each herpesvirus increased with incubation, but at the endpoint the MIC and MIIC were approximately equal. VZV was most susceptible to each drug, followed by HSV-1 and HSV-2. The latter two viruses were quite similar. There was no difference in antiviral susceptibilities among any of the strains of HSV-1, HSV-2, VZV, or CMV tested. The toxicities of arabinosyladenine, arabinosylhypoxanthine, and arabinosyladenine 5'-monophosphate were simultaneously compared by using both microscopic cytotoxicity and inhibition of uptakes of [14C]thymidine into cellular deoxyribonucleic acid and of 14C-labeled amino acids into protein. The selective inhibition of each antiviral agent against viral and cellular deoxyribonucleic acid polymerases was confirmed. Simultaneous assays of antiviral and anticellular activities of antiviral agents may be useful in projecting further in vivo experiments. PMID:6166244
D-lactic acid measurements in the diagnosis of bacterial infections.
Smith, S M; Eng, R H; Campos, J M; Chmel, H
1989-01-01
Body fluids suspected of bacterial infection were cultured and examined for the presence of D-lactic acid, a specific bacterial metabolite. We examined 206 patients and 264 specimens. D-Lactic acid was found in concentrations of greater than or equal to 0.15 mM in 11 of 11 infected and 6 of 40 noninfected ascitic fluids, 6 of 6 infected and 4 of 33 noninfected pleural fluids, 4 of 4 infected and 0 of 13 noninfected synovial fluids, and 26 of 27 infected and 2 of 130 noninfected cerebrospinal fluids. The overall sensitivity was 79.7%, and the specificity was 99.5% when the D-lactic acid concentration was at least 0.15 mM. The most important clinical utility of the D-lactic acid measurement appears to be for patients with bacterial infection in various body compartments and in patients who have already received antimicrobial therapy. An elevation in D-lactic acid may indicate the presence of bacterial infection even when cultures are negative. PMID:2715313
Estimation of lactic acid bacterial cell number by DNA quantification.
Ishii, Masaki; Matsumoto, Yasuhiko; Sekimizu, Kazuhisa
2018-01-01
Lactic acid bacteria are provided by fermented foods, beverages, medicines, and supplements. Because the beneficial effects of medicines and supplements containing functional lactic acid bacteria are related to the bacterial cell number, it is important to establish a simple method for estimating the total number of lactic acid bacterial cells in the products for quality control. Almost all of the lactic acid bacteria in the products are dead, however, making it difficult to estimate the total number of lactic acid bacterial cells in the products using a standard colony-counting method. Here we estimated the total lactic acid bacterial cell number in samples containing dead bacteria by quantifying the DNA. The number of viable Enterococcus faecalis 0831-07 cells decreased to less than 1 × 10 -8 by 15 min of heat treatment at 80°C. The amount of extracted DNA from heat-treated cells was 78% that of non-heated cells. The number of viable Lactobacillus paraplantarum 11-1 cells decreased to 1 × 10 -4 after 4 days culture. The amount of extracted DNA of the long-cultured cells, however, was maintained at 97%. These results suggest that cell number of lactic acid bacteria killed by heat-treatment or long-term culture can be estimated by DNA quantification.
Litwin, S; Shahn, E; Kozinski, A W
1969-07-01
Mass distribution in a sucrose gradient of deoxyribonucleic acid (DNA) fragments arising as a result of random breaks is predicted by analytical means from which computer evaluations are plotted. The analytical results are compared with the results of verifying experiments: (i) a Monte Carlo computer experiment in which simulated molecules of DNA were individuals of unit length subjected to random "breaks" applied by a random number generator, and (ii) an in vitro experiment in which molecules of T4 DNA, highly labeled with (32)P, were stored in liquid nitrogen for variable periods of time during which a precisely known number of (32)P atoms decayed, causing single-stranded breaks. The distribution of sizes of the resulting fragments was measured in an alkaline sucrose gradient. The profiles obtained in this fashion were compared with the mathematical predictions. Both experiments agree with the analytical approach and thus permit the use of the graphs obtained from the latter as a means of determining the average number of random breaks in DNA from distributions obtained experimentally in a sucrose gradient. An example of the application of this procedure to a previously unresolved problem is provided in the case of DNA from ultraviolet-irradiated phage which undergoes a dose-dependent intracellular breakdown. The relationship between the number of lethal hits and the number of single-stranded breaks was not previously established. A comparison of the calculated number of nicks per strand of DNA with the known dose in phage-lethal hits reveals a relationship closely approximating one lethal hit to one single-stranded break.
Higgins, Michael L.; Daneo-Moore, Lolita
1972-01-01
The application of quantitative electron microscopy to thin sections of cells of Streptococcus faecalis specifically inhibited for deoxyribonucleic acid (DNA), ribonucleic acid, and protein synthesis shows that septal mesosomes (i) increase in size when protein synthesis is inhibited by at least 80% while DNA synthesis proceeds at no less than 50% of the control rate and (ii) decrease in size when DNA synthesis is inhibited 50% or more during the initial 10 min of treatment. This indicates that fluctuations in mesosome size are dependent on the extent of DNA synthesis. The fluctuations in mesosome areas observed on treatment do not correlate with the kinetics of glycerol incorporation per milliliter of a culture. However, when glycerol incorporation is placed on a per cell basis, a strong correlation is observed between increases in (i) the thickness of the electron-transparent layer of the cytoplasmic membrane and (ii) the amount of glycerol incorporated per cell. It seems that the electron-transparent membrane layer may thicken to accommodate changes in lipid content when protein and lipid synthesis are uncoupled. Images PMID:4110926
Watanabe, Takao; Katayama, Yoichi; Ogino, Akiyoshi; Ohta, Takashi; Yoshino, Atsuo; Fukushima, Takao
2006-08-01
O(6)-methylguanine-deoxyribonucleic acid methyltransferase gene (MGMT) methylation is apparently correlated with responsiveness to nitrosourea chemotherapy, suggesting this alkylating agent should be effective against MGMT-methylated tumors. MGMT appears not to be linked to platinum resistance, so platinum chemotherapy should be used for MGMT-unmethylated tumors. This study was a preliminary trial of individualized chemotherapy based on MGMT methylation status in a total of 20 patients with newly diagnosed malignant astrocytomas (9 anaplastic astrocytomas and 11 glioblastomas multiforme). The procarbazine, 1-(4-amino-2-methyl-5-pyrimidinyl)methyl-3-2(2-chloroethyl)-3-nitrosourea, and vincristine (PAV) regimen was administered to seven patients with MGMT-methylated tumors, and the carboplatin and etoposide (CE) regimen was administered to 13 patients with MGMT-unmethylated tumors. Objective response to the PAV therapy was noted in all three patients with measurable residual tumor (2 complete responses and 1 partial response). Five of the seven patients continued to be disease-free after initiation of the PAV therapy. Objective response to the CE therapy was seen in only one of seven patients with measurable residual tumor (1 partial response). Three of the 13 patients were free from progression, whereas the remaining 10 patients showed early progression. The PAV regimen is effective against MGMT-methylated malignant astrocytomas, but the CE regimen is not useful at the given dose and schedule in MGMT-unmethylated tumors.
Úbeda, María; Lario, Margaret; Muñoz, Leticia; Borrero, María-José; Rodríguez-Serrano, Macarena; Sánchez-Díaz, Ana-María; Del Campo, Rosa; Lledó, Lourdes; Pastor, Óscar; García-Bermejo, Laura; Díaz, David; Álvarez-Mon, Melchor; Albillos, Agustín
2016-05-01
In advanced cirrhosis, gut bacterial translocation is the consequence of intestinal barrier disruption and leads to bacterial infection. Bile acid abnormalities in cirrhosis could play a role in the integrity of the intestinal barrier and the control of microbiota, mainly through the farnesoid X receptor. We investigated the long-term effects of the farnesoid X receptor agonist, obeticholic acid, on gut bacterial translocation, intestinal microbiota composition, barrier integrity and inflammation in rats with CCl4-induced cirrhosis with ascites. Cirrhotic rats received a 2-week course of obeticholic acid or vehicle starting once ascites developed. We then determined: bacterial translocation by mesenteric lymph node culture, ileum expression of antimicrobial peptides and tight junction proteins by qPCR, fecal albumin loss, enteric bacterial load and microbiota composition by qPCR and pyrosequencing of ileum mucosa-attached contents, and intestinal inflammation by cytometry of the inflammatory infiltrate. Obeticholic acid reduced bacterial translocation from 78.3% to 33.3% (p<0.01) and upregulated the expression of the farnesoid X receptor-associated gene small heterodimer partner. Treatment improved ileum expression of antimicrobial peptides, angiogenin-1 and alpha-5-defensin, tight junction proteins zonulin-1 and occludin, and reduced fecal albumin loss and liver fibrosis. Enteric bacterial load normalized, and the distinctive mucosal microbiota of cirrhosis was reduced. Gut immune cell infiltration was reduced and inflammatory cytokine and Toll-like receptor 4 expression normalized. In ascitic cirrhotic rats, obeticholic acid reduces gut bacterial translocation via several complementary mechanisms at the intestinal level. This agent could be used as an alternative to antibiotics to prevent bacterial infection in cirrhosis. Copyright © 2016 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.
Voon, W W Y; Rukayadi, Y; Meor Hussin, A S
2016-05-01
Biocellulose (BC) is pure extracellular cellulose produced by several species of micro-organisms that has numerous applications in the food, biomedical and paper industries. However, the existing biocellulose-producing bacterial strain with high yield was limited. The aim of this study was to isolate and identify the potential biocellulose-producing bacterial isolates from Malaysian acidic fruits. One hundred and ninety-three bacterial isolates were obtained from 19 local acidic fruits collected in Malaysia and screened for their ability to produce BC. A total of 15 potential bacterial isolates were then cultured in standard Hestrin-Schramm (HS) medium statically at 30°C for 2 weeks to determine the BC production. The most potent bacterial isolates were identified using 16S rRNA gene sequence analysis, morphological and biochemical characteristics. Three new and potent biocellulose-producing bacterial strains were isolated from soursop fruit and identified as Stenotrophomonas maltophilia WAUPM42, Pantoea vagans WAUPM45 and Beijerinckia fluminensis WAUPM53. Stenotrophomonas maltophilia WAUPM42 was the most potent biocellulose-producing bacterial strain that produced the highest amount of BC 0·58 g l(-1) in standard HS medium. Whereas, the isolates P. vagans WAUPM45 and B. fluminensis WAUPM53 showed 0·50 and 0·52 g l(-1) of BC production, respectively. Biocellulose (BC) is pure extracellular cellulose that is formed by many micro-organisms in the presence of carbon source and acidic condition. It can replace plant-based cellulose in multifarious applications due to its unique characteristics. In this study, three potential biocellulose-producing bacterial strains were obtained from Malaysian acidic fruits and identified as Stenotrophomonas maltophilia WAUPM42, Pantoea vagans WAUPM45 and Beijerinckia fluminensis WAUPM53. This study reports for the first time the new biocellulose-producing bacterial strains isolated from Malaysian acidic fruits. © 2016 The
Mendez, Frances; Kozin, Elliott; Bases, Robert
2003-01-01
Base excision repair (BER) of damaged deoxyribonucleic acid (DNA) is a multistep process during which potentially lethal abasic sites temporarily exist. Repair of these lesions is greatly stimulated by heat shock protein 70 (Hsp70), which enhances strand incision and removal of the abasic sites by human apurinic-apyrimidinic endonuclease (HAP1). The resulting single-strand gaps must then be filled in. Here, we show that Hsp70 and its 48- and 43-kDa N-terminal domains greatly stimulated filling in the single-strand gaps by DNA polymerase β, a novel finding that extends the role of Hsps in DNA repair. Incorporation of deoxyguanosine monophosphate (dGMP) to fill in single-strand gaps in DNA phagemid pBKS by DNA polymerase β was stimulated by Hsp70. Truncated proteins derived from the C-terminus of Hsp70 as well as unrelated proteins were less effective, but proteins derived from the N-terminus of Hsp70 remained efficient stimulators of DNA polymerase β repair of DNA single-strand gaps. In agreement with these results, repair of a gap in a 30-bp oligonucleotide by polymerase β also was strongly stimulated by Hsp70 although not by a truncated protein from the C-terminus of Hsp70. Sealing of the repaired site in the oligonucleotide by human DNA ligase 1 was not specifically stimulated by Hsp-related proteins. Results presented here now implicate and extend the role of Hsp70 as a partner in the enzymatic repair of damaged DNA. The participation of Hsp70 jointly with base excision enzymes improves repair efficiency by mechanisms that are not yet understood. PMID:14627201
Yu, Xiaoxue; Zhang, Yafeng; Wang, Dongmei; Jiang, Lin; Xu, Xinjun
2018-01-01
Background: Citri Reticulatae Pericarpium is the dried mature pericarp of Citrus reticulata Blanco which can be divided into “Chenpi” and “Guangchenpi.” “Guangchenpi” is the genuine Chinese medicinal material in Xinhui, Guangdong province; based on the greatest quality and least amount, it is most expensive among others. Hesperidin is used as the marker to identify Citri Reticulatae Pericarpium described in the Chinese Pharmacopoeia 2010. However, both “Chenpi” and “Guangchenpi” contain hesperidin so that it is impossible to differentiate them by measuring hesperidin. Objective: Our study aims to develop an efficient and accurate method to separate and identify “Guangchenpi” from other Citri Reticulatae Pericarpium. Materials and Methods: The genomic deoxyribonucleic acid (DNA) of all the materials was extracted and then the internal transcribed spacer 2 was amplified, sequenced, aligned, and analyzed. The secondary structures were created in terms of the database and website established by Jörg Schultz et al. High-performance liquid chromatography-diode array detection-electrospray Ionization/mass spectrometry (HPLC-DAD-ESI-MS)/MS coupled with chemometric analysis was applied to compare the differences in chemical profiles of the three kinds of Citri Reticulatae Pericarpium. Results: A total of 22 samples were classified into three groups. The results of DNA barcoding were in accordance with principal component analysis and hierarchical cluster analysis. Eight compounds were deduced from HPLC-DAD-ESI-MS/MS. Conclusions: This method is a reliable and effective tool to differentiate the three Citri Reticulatae Pericarpium. SUMMARY The internal transcribed spacer 2 regions and the secondary structure among three kinds of Citri Reticulatae Pericarpium varied considerablyAll the 22 samples were analyzed by high-performance liquid chromatography (HPLC) to obtain the chemical profilesPrincipal component analysis and hierarchical cluster analysis
Vogel-Adghough, Drissia; Stahl, Elia; Návarová, Hana; Zeier, Jürgen
2013-01-01
Distinct amino acid metabolic pathways constitute integral parts of the plant immune system. We have recently identified pipecolic acid (Pip), a lysine-derived non-protein amino acid, as a critical regulator of systemic acquired resistance (SAR) and basal immunity to bacterial infection in Arabidopsis thaliana. In Arabidopsis, Pip acts as an endogenous mediator of defense amplification and priming. For instance, Pip conditions plants for effective biosynthesis of the phenolic defense signal salicylic acid (SA), accumulation of the phytoalexin camalexin, and expression of defense-related genes. Here, we show that tobacco plants respond to leaf infection by the compatible bacterial pathogen Pseudomonas syringae pv tabaci (Pstb) with a significant accumulation of several amino acids, including Lys, branched-chain, aromatic, and amide group amino acids. Moreover, Pstb strongly triggers, alongside the biosynthesis of SA and increases in the defensive alkaloid nicotine, the production of the Lys catabolites Pip and α-aminoadipic acid. Exogenous application of Pip to tobacco plants provides significant protection to infection by adapted Pstb or by non-adapted, hypersensitive cell death-inducing P. syringae pv maculicola. Pip thereby primes tobacco for rapid and strong accumulation of SA and nicotine following bacterial infection. Thus, our study indicates that the role of Pip as an amplifier of immune responses is conserved between members of the rosid and asterid groups of eudicot plants and suggests a broad practical applicability for Pip as a natural enhancer of plant disease resistance. PMID:24025239
Identification of a Herbal Powder by Deoxyribonucleic Acid Barcoding and Structural Analyses.
Sheth, Bhavisha P; Thaker, Vrinda S
2015-10-01
Authentic identification of plants is essential for exploiting their medicinal properties as well as to stop the adulteration and malpractices with the trade of the same. To identify a herbal powder obtained from a herbalist in the local vicinity of Rajkot, Gujarat, using deoxyribonucleic acid (DNA) barcoding and molecular tools. The DNA was extracted from a herbal powder and selected Cassia species, followed by the polymerase chain reaction (PCR) and sequencing of the rbcL barcode locus. Thereafter the sequences were subjected to National Center for Biotechnology Information (NCBI) basic local alignment search tool (BLAST) analysis, followed by the protein three-dimension structure determination of the rbcL protein from the herbal powder and Cassia species namely Cassia fistula, Cassia tora and Cassia javanica (sequences obtained in the present study), Cassia Roxburghii, and Cassia abbreviata (sequences retrieved from Genbank). Further, the multiple and pairwise structural alignment were carried out in order to identify the herbal powder. The nucleotide sequences obtained from the selected species of Cassia were submitted to Genbank (Accession No. JX141397, JX141405, JX141420). The NCBI BLAST analysis of the rbcL protein from the herbal powder showed an equal sequence similarity (with reference to different parameters like E value, maximum identity, total score, query coverage) to C. javanica and C. roxburghii. In order to solve the ambiguities of the BLAST result, a protein structural approach was implemented. The protein homology models obtained in the present study were submitted to the protein model database (PM0079748-PM0079753). The pairwise structural alignment of the herbal powder (as template) and C. javanica and C. roxburghii (as targets individually) revealed a close similarity of the herbal powder with C. javanica. A strategy as used here, incorporating the integrated use of DNA barcoding and protein structural analyses could be adopted, as a novel
Amylolytic bacterial lactic acid fermentation - a review.
Reddy, Gopal; Altaf, Md; Naveena, B J; Venkateshwar, M; Kumar, E Vijay
2008-01-01
Lactic acid, an enigmatic chemical has wide applications in food, pharmaceutical, leather, textile industries and as chemical feed stock. Novel applications in synthesis of biodegradable plastics have increased the demand for lactic acid. Microbial fermentations are preferred over chemical synthesis of lactic acid due to various factors. Refined sugars, though costly, are the choice substrates for lactic acid production using Lactobacillus sps. Complex natural starchy raw materials used for production of lactic acid involve pretreatment by gelatinization and liquefaction followed by enzymatic saccharification to glucose and subsequent conversion of glucose to lactic acid by Lactobacillus fermentation. Direct conversion of starchy biomass to lactic acid by bacteria possessing both amylolytic and lactic acid producing character will eliminate the two step process to make it economical. Very few amylolytic lactic acid bacteria with high potential to produce lactic acid at high substrate concentrations are reported till date. In this view, a search has been made for various amylolytic LAB involved in production of lactic acid and utilization of cheaply available renewable agricultural starchy biomass. Lactobacillus amylophilus GV6 is an efficient and widely studied amylolytic lactic acid producing bacteria capable of utilizing inexpensive carbon and nitrogen substrates with high lactic acid production efficiency. This is the first review on amylolytic bacterial lactic acid fermentations till date.
Deshmukh, Pravin Suryakantrao; Megha, Kanu; Banerjee, Basu Dev; Ahmed, Rafat Sultana; Chandna, Sudhir; Abegaonkar, Mahesh Pandurang; Tripathi, Ashok Kumar
2013-01-01
Background: Non-ionizing radiofrequency radiation has been increasingly used in industry, commerce, medicine and especially in mobile phone technology and has become a matter of serious concern in present time. Objective: The present study was designed to investigate the possible deoxyribonucleic acid (DNA) damaging effects of low-level microwave radiation in brain of Fischer rats. Materials and Methods: Experiments were performed on male Fischer rats exposed to microwave radiation for 30 days at three different frequencies: 900, 1800 and 2450 MHz. Animals were divided into 4 groups: Group I (Sham exposed): Animals not exposed to microwave radiation but kept under same conditions as that of other groups, Group II: Animals exposed to microwave radiation at frequency 900 MHz at specific absorption rate (SAR) 5.953 × 10−4 W/kg, Group III: Animals exposed to 1800 MHz at SAR 5.835 × 10−4 W/kg and Group IV: Animals exposed to 2450 MHz at SAR 6.672 × 10−4 W/kg. At the end of the exposure period animals were sacrificed immediately and DNA damage in brain tissue was assessed using alkaline comet assay. Results: In the present study, we demonstrated DNA damaging effects of low level microwave radiation in brain. Conclusion: We concluded that low SAR microwave radiation exposure at these frequencies may induce DNA strand breaks in brain tissue. PMID:23833433
Davis, R; Vapnek, D
1976-01-01
The amounts of plasmid deoxyribonucleic acid (DNA) and the levels of the in vivo transcription of the Escherichia coli plasmids R538-1 (repressed for conjugal transfer) and R538-1drd (derepressed for transfer) were determined by DNA-DNA hybridization and DNA-ribonucleic acid hybridization, respectively. The results demonstrate that the level of plasmid transcription is increased by two-fold in the strain carrying the derepressed plasmid, compared to an isogenic strain carrying the repressed plasmid, whereas the amount of plasmid DNA is approximately the same, suggesting that the transfer genes are under transcriptional control. Levels of plasmid DNA, plasmid DNA transcription, and chloramphenicol acetyltransferase activity were also compared in a mutant strain that carried the R538-1drd plasmid and was resistant to high levels of antibiotics. This strain produces about 13 copies of plasmid DNA per chromosome compared to five copies for the parent strain. The level of transcription of plasmid DNA was found to be twofold higher in the high-level resistant strain, whereas the level of chloramphenition, acetyltransferase activity was increased by 10-fold. In addition the levels of plasmid DNA transcription and chloramphenicol acetyltransferase activity in the high-level resistant strain were found to be further increased by the presence of high levels of chloramphenicol in the growth medium. The amount of plasmid DNA remained constant under these conditions, indicating that high levels of chloramphenicol can stimulate the expression of plasmid genes at the level of transcription in this strain. PMID:767321
Servais, P
1995-03-01
In aquatic ecosystems, [(3)H]thymidine incorporation into bacterial DNA and [(3)H]leucine incorporation into proteins are usually used to estimate bacterial production. The incorporation rates of four amino acids (leucine, tyrosine, lysine, alanine) into proteins of bacteria were measured in parallel on natural freshwater samples from the basin of the river Meuse (Belgium). Comparison of the incorporation into proteins and into the total macromolecular fraction showed that these different amino acids were incorporated at more than 90% into proteins. From incorporation measurements at four subsaturated concentrations (range, 2-77 nm), the maximum incorporation rates were determined. Strong correlations (r > 0.91 for all the calculated correlations) were found between the maximum incorporation rates of the different tested amino acids over a range of two orders of magnitude of bacterial activity. Bacterial production estimates were calculated using theoretical and experimental conversion factors. The productions calculated from the incorporation rates of the four amino acids were in good concordance, especially when the experimental conversion factors were used (slope range, 0.91-1.11, and r > 0.91). This study suggests that the incorporation of various amino acids into proteins can be used to estimate bacterial production.
Parikh, Sanjai J.; Mukome, Fungai N.D.; Zhang, Xiaoming
2014-01-01
Attenuated total reflectance (ATR) Fourier transform infrared (FTIR) spectroscopy has been used to probe the binding of bacteria to hematite (α-Fe2O3) and goethite (α-FeOOH). In situ ATR-FTIR experiments with bacteria (Pseudomonas putida, P. aeruginosa, Escherichia coli), mixed amino acids, polypeptide extracts, deoxyribonucleic acid (DNA), and a suite of model compounds were conducted. These compounds represent carboxyl, catecholate, amide, and phosphate groups present in siderophores, amino acids, polysaccharides, phospholipids, and DNA. Due in part to the ubiquitous presence of carboxyl groups in biomolecules, numerous IR peaks corresponding to outer-sphere or unbound (1400 cm−1) and inner-sphere (1310-1320 cm−1) coordinated carboxyl groups are noted following reaction of bacteria and biomolecules with α-Fe2O3 and α-FeOOH. However, the data also reveal that the presence of low-level amounts (i.e., 0.45-0.79%) of biomolecular phosphorous groups result in strong IR bands at ~1043 cm−1, corresponding to inner-sphere Fe-O-P bonds, underscoring the importance of bacteria associated P-containing groups in biomolecule and cell adhesion. Spectral comparisons also reveal slightly greater P-O-Fe contributions for bacteria (Pseudomonad, E. coli) deposited on α-FeOOH, as compared to α-Fe2O3. This data demonstrates that slight differences in bacterial adhesion to Fe oxides can be attributed to bacterial species and Fe-oxide minerals. However, more importantly, the strong binding affinity of phosphate in all bacteria samples to both Fe-oxides results in the formation of inner-sphere Fe-O-P bonds, signifying the critical role of biomolecular P in the initiation of bacterial adhesion. PMID:24859052
NASA Astrophysics Data System (ADS)
Zhan, Xiang-Mi; Hao, Mei-Lan; Wang, Quan; Li, Wei; Xiao, Hong-Ling; Feng, Chun; Jiang, Li-Juan; Wang, Cui-Mei; Wang, Xiao-Liang; Wang, Zhan-Guo
2017-03-01
Gallium nitride- (GaN) based high electron mobility transistors (HEMTs) provide a good platform for biological detection. In this work, both Au-gated AlInN/GaN HEMT and AlGaN/GaN HEMT biosensors are fabricated for the detection of deoxyribonucleic acid (DNA) hybridization. The Au-gated AlInN/GaN HEMT biosensor exhibits higher sensitivity in comparison with the AlGaN/GaN HEMT biosensor. For the former, the drain-source current ( {V}{DS}=0.5 V) shows a clear decrease of 69 μA upon the introduction of 1 μmolL {}-1 (μM) complimentary DNA to the probe DNA at the sensor area, while for the latter it is only 38 μA. This current reduction is a notable indication of the hybridization. The high sensitivity can be attributed to the thinner barrier of the AlInN/GaN heterostructure, which makes the two-dimensional electron gas channel more susceptible to a slight change of the surface charge. Supported by the National Key Research and Development Program of China under Grant Nos 2016YFB0400104 and 2016YFB0400301, the National Natural Sciences Foundation of China under Grant No 61334002, and the National Science and Technology Major Project.
Oguz, Yuksel; Guler, Ismail; Erdem, Ahmet; Mutlu, Mehmet Firat; Gumuslu, Seyhan; Oktem, Mesut; Bozkurt, Nuray; Erdem, Mehmet
2018-03-23
To compare the effect of two different sperm preparation techniques, including swim-up and gradient methods on sperm deoxyribonucleic acid (DNA) fragmentation status of semen samples from unexplained and mild male factor subfertile patients undergoing intrauterine insemination (IUI). A prospective randomized study was conducted in 65 subfertile patients, including 34 unexplained and 31 male factor infertility to compare basal and post-procedure DNA fragmentation rates in swim-up and gradient techniques. Sperm DNA fragmentation rates were evaluated by a sperm chromatin dispersion (SCD) test in two portions of each sample of semen that was prepared with either swim-up or gradient techniques. Sperm motility and morphology were also assessed based on WHO 2010 criteria. Swim-up but not gradient method yielded a statistically significant reduction in the DNA fragmented sperm rate after preparation as compared to basal rates, in the semen samples of both unexplained (41.85 ± 22.04 vs. 28.58 ± 21.93, p < 0.001 for swim-up; and 41.85 ± 22.04 vs. 38.79 ± 22.30, p = 0.160 for gradient) and mild male factor (46.61 ± 19.38 vs. 30.32 ± 18.20, p < 0.001 for swim-up and 46.61 ± 19.38 vs. 44.03 ± 20.87, p = 0.470 for gradient) subgroups. Swim-up method significantly reduces sperm DNA fragmentation rates and may have some prognostic value on intrauterine insemination in patients with decreased sperm DNA integrity.
Nawabi, Parwez; Bauer, Stefan; Kyrpides, Nikos; Lykidis, Athanasios
2011-01-01
The production of low-cost biofuels in engineered microorganisms is of great interest due to the continual increase in the world's energy demands. Biodiesel is a renewable fuel that can potentially be produced in microbes cost-effectively. Fatty acid methyl esters (FAMEs) are a common component of biodiesel and can be synthesized from either triacylglycerol or free fatty acids (FFAs). Here we report the identification of a novel bacterial fatty acid methyltransferase (FAMT) that catalyzes the formation of FAMEs and 3-hydroxyl fatty acid methyl esters (3-OH-FAMEs) from the respective free acids and S-adenosylmethionine (AdoMet). FAMT exhibits a higher specificity toward 3-hydroxy free fatty acids (3-OH-FFAs) than FFAs, synthesizing 3-hydroxy fatty acid methyl esters (3-OH-FAMEs) in vivo. We have also identified bacterial members of the fatty acyl-acyl carrier protein (ACP) thioesterase (FAT) enzyme family with distinct acyl chain specificities. These bacterial FATs exhibit increased specificity toward 3-hydroxyacyl-ACP, generating 3-OH-FFAs, which can subsequently be utilized by FAMTs to produce 3-OH-FAMEs. PhaG (3-hydroxyacyl ACP:coenzyme A [CoA] transacylase) constitutes an alternative route to 3-OH-FFA synthesis; the coexpression of PhaG with FAMT led to the highest level of accumulation of 3-OH-FAMEs and FAMEs. The availability of AdoMet, the second substrate for FAMT, is an important factor regulating the amount of methyl esters produced by bacterial cells. Our results indicate that the deletion of the global methionine regulator metJ and the overexpression of methionine adenosyltransferase result in increased methyl ester synthesis. PMID:21926202
NASA Astrophysics Data System (ADS)
Anwar, Budiman; Rosyid, Nurul Huda; Effendi, Devi Bentia; Nandiyanto, Asep Bayu Dani; Mudzakir, Ahmad; Hidayat, Topik
2016-02-01
Isolation of needle-shaped bacterial cellulose nanocrystalline with a diameter of 16-64 nm, a fiber length of 258-806 nm, and a degree of crystallinity of 64% from pineapple peel waste using an acid hydrolysis process was investigated. Experimental showed that selective concentration of acid played important roles in isolating the bacterial cellulose nanocrystalline from the cellulose source. To achieve the successful isolation of bacterial cellulose nanocrystalline, various acid concentrations were tested. To confirm the effect of acid concentration on the successful isolation process, the reaction conditions were fixed at a temperature of 50°C, a hydrolysis time of 30 minutes, and a bacterial cellulose-to-acid ratio of 1:50. Pineapple peel waste was used as a model for a cellulose source because to the best of our knowledge, there is no report on the use of this raw material for producing bacterial cellulose nanocrystalline. In fact, this material can be used as an alternative for ecofriendly and cost-free cellulose sources. Therefore, understanding in how to isolate bacterial cellulose nanocrystalline from pineapple peel waste has the potential for large-scale production of inexpensive cellulose nanocrystalline.
Armentrout, Richard W.; Rutberg, Lars
1971-01-01
A temperature-inducible mutant of temperate Bacillus bacteriophage φ105 was isolated and used to lysogenize a thymine-requiring strain of Bacillus subtilis 168. Synthesis of phage and bacterial deoxyribonucleic acid (DNA) was studied by sucrose gradient centrifugation and density equilibrium centrifugation of DNA extracted from induced bacteria. The distribution of DNA in the gradients was measured by differential isotope and density labeling of DNA before and after induction and by measuring the biological activity of the DNA in genetic transformation, in rescue of phage markers, and in infectivity assays. At early times after induction, but after at least one round of replication, phage DNA remains associated with high-molecular-weight DNA, whereas, later in the infection, phage DNA is associated with material of decreasing molecular weight. Genetic linkage between phage and bacterial markers can be demonstrated in replicated DNA from induced cells. Prophage induction is shown to affect replication of the bacterial chromosome. The overall rate of replication of prelabeled bacterial DNA is identical in temperature-induced lysogenics and in “mock-induced” wild-type φ105 lysogenics. The rate of replication of the bacterial marker phe-1 (and also of nia-38), located close to the prophage in direction of the terminus of the bacterial chromosome, is increased in induced cells, however, relative to other bacterial markers tested. In temperature-inducible lysogenics, where the prophage also carries a ts mutation which blocks phage DNA synthesis, replication of both phage and bacterial DNA stops after about 50% of the phage DNA has replicated once. The results of these experiments suggest that the prophage is not initially excised in induced cells, but rather it is specifically replicated in situ together with adjacent parts of the bacterial chromosome. PMID:5002012
Cellulose-ethylenediaminetetraacetic acid conjugates protect mammalian cells from bacterial cells.
Luo, Jie; Lv, Wei; Deng, Ying; Sun, Yuyu
2013-04-08
Cellulose-ethylenediaminetetraacetic acid (EDTA) conjugates were synthesized by the esterification of cellulose with ethylenediaminetetraacetic dianhydride (EDTAD). The new materials provided potent antimicrobial activities against Staphylococcus aureus (S. aureus, Gram-positive bacteria) and Pseudomonas aeruginosa (P. aeruginosa, Gram-negative bacteria), and inhibited the formation of bacterial biofilms. The biocompatibility of the new cellulose-EDTA conjugates was evaluated with mouse skin fibroblasts for up to 14 days. SEM observation and DNA content analysis suggested that the new materials sustained the viability of fibroblast cells. Moreover, in mouse skin fibroblast-bacteria co-culture systems, the new cellulose-EDTA conjugates prevented bacterial biofilm formation and protected the mammalian cells from the bacterial cells for at least one day.
Is Bacterial Fatty Acid Synthesis a Valid Target for Antibacterial Drug Discovery?
Parsons, Joshua B.; Rock, Charles O.
2011-01-01
The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there isn’t a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements. PMID:21862391
NASA Astrophysics Data System (ADS)
Nadiarnykh, Oleg; Thomas, Giju; Van Voskuilen, Johan; Sterenborg, Henricus J. C. M.; Gerritsen, Hans C.
2012-11-01
Nonlinear optical imaging modalities (multiphoton excited fluorescence, second and third harmonic generation) applied in vivo are increasingly promising for clinical diagnostics and the monitoring of cancer and other disorders, as they can probe tissue with high diffraction-limited resolution at near-infrared (IR) wavelengths. However, high peak intensity of femtosecond laser pulses required for two-photon processes causes formation of cyclobutane-pyrimidine-dimers (CPDs) in cellular deoxyribonucleic acid (DNA) similar to damage from exposure to solar ultraviolet (UV) light. Inaccurate repair of subsequent mutations increases the risk of carcinogenesis. In this study, we investigate CPD damage that results in Chinese hamster ovary cells in vitro from imaging them with two-photon excited autofluorescence. The CPD levels are quantified by immunofluorescent staining. We further evaluate the extent of CPD damage with respect to varied wavelength, pulse width at focal plane, and pixel dwell time as compared with more pronounced damage from UV sources. While CPD damage has been expected to result from three-photon absorption, our results reveal that CPDs are induced by competing two- and three-photon absorption processes, where the former accesses UVA absorption band. This finding is independently confirmed by nonlinear dependencies of damage on laser power, wavelength, and pulse width.
Cost-effective production of bacterial cellulose using acidic food industry by-products.
Revin, Victor; Liyaskina, Elena; Nazarkina, Maria; Bogatyreva, Alena; Shchankin, Mikhail
2018-03-13
To reduce the cost of obtaining bacterial cellulose, acidic by-products of the alcohol and dairy industries were used without any pretreatment or addition of other nitrogen sources. Studies have shown that the greatest accumulation of bacterial cellulose (6.19g/L) occurs on wheat thin stillage for 3 days of cultivation under dynamic conditions, which is almost 3 times higher than on standard Hestrin and Schramm medium (2.14g/L). The use of whey as a nutrient medium makes it possible to obtain 5.45g/L bacterial cellulose under similar conditions of cultivation. It is established that the pH of the medium during the growth of Gluconacetobacter sucrofermentans B-11267 depends on the feedstock used and its initial value. By culturing the bacterium on thin stillage and whey, there is a decrease in the acidity of the waste. It is shown that the infrared spectra of bacterial cellulose obtained in a variety of environments have a similar character, but we found differences in the micromorphology and crystallinity of the resulting biopolymer. Copyright © 2018 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
RIG-I detects infection with live Listeria by sensing secreted bacterial nucleic acids
Abdullah, Zeinab; Schlee, Martin; Roth, Susanne; Mraheil, Mobarak Abu; Barchet, Winfried; Böttcher, Jan; Hain, Torsten; Geiger, Sergej; Hayakawa, Yoshihiro; Fritz, Jörg H; Civril, Filiz; Hopfner, Karl-Peter; Kurts, Christian; Ruland, Jürgen; Hartmann, Gunther; Chakraborty, Trinad; Knolle, Percy A
2012-01-01
Immunity against infection with Listeria monocytogenes is not achieved from innate immune stimulation by contact with killed but requires viable Listeria gaining access to the cytosol of infected cells. It has remained ill-defined how such immune sensing of live Listeria occurs. Here, we report that efficient cytosolic immune sensing requires access of nucleic acids derived from live Listeria to the cytoplasm of infected cells. We found that Listeria released nucleic acids and that such secreted bacterial RNA/DNA was recognized by the cytosolic sensors RIG-I, MDA5 and STING thereby triggering interferon β production. Secreted Listeria nucleic acids also caused RIG-I-dependent IL-1β-production and inflammasome activation. The signalling molecule CARD9 contributed to IL-1β production in response to secreted nucleic acids. In conclusion, cytosolic recognition of secreted bacterial nucleic acids by RIG-I provides a mechanistic explanation for efficient induction of immunity by live bacteria. PMID:23064150
Carrada-Bravo, Teodoro
2016-02-01
The virulence of pneumococci for mice depends on the production of a polysaccharide-capsule, which encloses the bacteria and protects it against phagocytosis. Capsulated pneumococci yield smooth, brilliant colonies designated S, but mutant strains arise frequently which have lost the capacity to sinthetise the capsule, are avirulent and rough designated R. F. Griffith discovery of bacterial "transformation" in 1928, is a landmark in the history of genetics, because hereditary determinants could be transferred from one bacteria to another, and laid the foundation for the subsequent recognition of deoxyribonucleic acid (DNA) as the hereditary material. A systematic analysis of the chemical nature of the "transforming principle", by O. T. Avery and his colleagues during next 10 years, culminated in a formidable weight of evidence that it possessed all properties of DNA. In 1953, J. D. Watson and F. H. C Crick by a brilliant synthesis, fitted the chemical X-ray diffraction data together into a symmetrical double-helix structure, which possessed the inherent properties of genetic material, and carries the information necessary to direct all biochemical-cellular activities and self-replications. This paper describes de early rise and development of bacterial genetics and molecular biology.
Contribution of bacterial cells to lacustrine organic matter based on amino sugars and D-amino acids
NASA Astrophysics Data System (ADS)
Carstens, Dörte; Köllner, Krista E.; Bürgmann, Helmut; Wehrli, Bernhard; Schubert, Carsten J.
2012-07-01
Amino sugars (ASs), D-amino acids (D-AAs), and bacterial cell counts were measured in two Swiss lakes to study the contribution of bacterial cells to organic matter (OM) and the fate of ASs and bacterial amino biomarkers during OM degradation. Concentrations of individual ASs (glucosamine, galactosamine, muramic acid, and mannosamine) in the particulate and total OM pools were analyzed in water-column profiles of Lake Brienz (oligotrophic and oxic throughout the entire water column) and Lake Zug (eutrophic, stratified, and permanently anoxic below 170 m) in spring and in fall. Generally, carbon-normalized AS concentrations decreased with water depth, indicating the preferential decomposition of ASs. For Lake Brienz the relative loss of particulate ASs was higher than in Lake Zug, suggesting enhanced AS turnover in an oligotrophic environment. AS ratio changes in the water column revealed a replacement of plankton biomass with OM from heterotrophic microorganisms with increasing water depth. Similar to the ASs, highest carbon normalized D-AA concentrations were found in the upper water column with decreasing concentrations with depth and an increase close to the sediments. In Lake Zug, an increase in the percentage of D-AAs also showed the involvement of bacteria in OM degradation. Estimations of OM derived from bacterial cells using cell counts and the bacterial biomarkers muramic acid and D-AAs gave similar results. For Lake Brienz 0.2-14% of the organic carbon pool originated from bacterial cells, compared to only 0.1-5% in Lake Zug. Based on our estimates, muramic acid appeared primarily associated with bacterial biomass and not with refractory bacterial necromass. Our study underscores that bacteria are not only important drivers of OM degradation in lacustrine systems, they also represent a significant source of OM themselves, especially in oligotrophic lakes.
Reduction in bacterial load using hypochlorous acid hygiene solution on ocular skin
Stroman, David W; Mintun, Keri; Epstein, Arthur B; Brimer, Crystal M; Patel, Chirag R; Branch, James D; Najafi-Tagol, Kathryn
2017-01-01
Purpose To examine the magnitude of bacterial load reduction on the surface of the periocular skin 20 minutes after application of a saline hygiene solution containing 0.01% pure hypochlorous acid (HOCl). Methods Microbiological specimens were collected immediately prior to applying the hygiene solution and again 20 minutes later. Total microbial colonies were counted and each unique colony morphology was processed to identify the bacterial species and to determine the susceptibility profile to 15 selected antibiotics. Results Specimens were analyzed from the skin samples of 71 eyes from 36 patients. Prior to treatment, 194 unique bacterial isolates belonging to 33 different species were recovered. Twenty minutes after treatment, 138 unique bacterial isolates belonging to 26 different species were identified. Staphylococci accounted for 61% of all strains recovered and Staphylococcus epidermidis strains comprised 60% of the staphylococcal strains. No substantial differences in the distribution of Gram-positive, Gram-negative, or anaerobic species were noted before and after treatment. The quantitative data demonstrated a >99% reduction in the staphylococcal load on the surface of the skin 20 minutes following application of the hygiene solution. The total S. epidermidis colony-forming units were reduced by 99.5%. The HOCl hygiene solution removed staphylococcal isolates that were resistant to multiple antibiotics equally well as those isolates that were susceptible to antibiotics. Conclusion The application of a saline hygiene solution preserved with pure HOCl acid reduced the bacterial load significantly without altering the diversity of bacterial species remaining on the skin under the lower eyelid. PMID:28458509
Protozoan, Bacterial, and Volatile Fatty Acid Changes Associated with Feeding Tylosin
Satapathy, N.; Purser, D. B.
1967-01-01
Tylosin was fed to two of six wethers for 79 days, to a second two for only 28 days, and not at all to a third pair (controls). The addition of tylosin to the daily feed resulted in a rapid twofold increase in protozoal concentration and a change in the composition or characteristics, or both, of the bacterial population. The results indicate that the bacterial population was modified to the extent of about 80%. Total acid concentrations were initially depressed but appeared to be greater than those in control animals at the termination of the experiment. Deletion of tylosin from the ration resulted in a rapid decrease in protozoal concentrations, whereas changes in the bacterial population did not occur for a further 30 days. PMID:16349756
A new regulatory mechanism for bacterial lipoic acid synthesis
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-01
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID
A new regulatory mechanism for bacterial lipoic acid synthesis.
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-22
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015
Miyamoto, M; Inoue, K; Gu, Y; Hoki, M; Haji, S; Ohyanagi, H
1999-01-01
At a number of points in the current procedures of islet isolation and islet culture after the harvesting of donor pancreata, microorganisms could potentially infect the islet preparation. Furthermore, the use of islets from multiple donors can compound the risks of contamination of individual recipients. Acidic oxidative potential water (also termed electrolyzed strong acid solution, function water, or acqua oxidation water), which was developed in Japan, is a strong acid formed on the anode in the electrolysis of water containing a small amount of sodium chloride. It has these physical properties: pH, from 2.3 to 2.7; oxidative-reduction potential, from 1,000 to 1,100 mV; dissolved chlorine, from 30 to 40 ppm; and dissolved oxygen, from 10 to 30 ppm. Because of these properties, acidic oxidative potential water has strong bactericidal effects on all bacteria including methicillin-resistant Staphylococcus aureus (MRSA), viruses including HIV, HBV, HCV, CMV, and fungi as a result of the action of the active oxygen and active chlorine that it contains. We conducted this study to evaluate the effect of acidic oxidative potential water irrigation on bacterial contamination on the harvesting of porcine pancreata from slaughterhouses for islet xenotransplantation by counting the number of pancreatic surface bacteria using the Dip-slide method, and on the results of islet culture; and to evaluate the direct effect on isolated islets when it is used to prevent bacterial contamination by the static incubation test and by morphological examination. Direct irrigation of the pancreas by acidic oxidative potential water was found to be very effective in preventing bacterial contamination, but direct irrigation of isolated islets slightly decreased their viability and function.
Considerable emphasis has been placed on developing watershed-based strategies with the potential to reduce non-point-source fecal contamination. Molecular methods applied used 16S-ribosomal-deoxyribonucleic-acid (rDNA) to try to determine sources of fecal contamination. Objectiv...
Kakiuchi, Toshifumi; Ito, Fuyuki; Nagamura, Toshihiko
2008-04-03
The excitation energy transfer from meso-tetrakis(N-methylpyridinium-4-yl)porphyrin (TMPyP) to 3,3'-diethyl-2,2'-thiatricarbocyanine iodide (DTTCI) along the deoxyribonucleic acid (DNA) double strand was investigated by the steady-state absorption and fluorescence measurements and time-resolved fluorescence measurements. The steady-state fluorescence spectra showed that the near-infrared fluorescence of DTTCI was strongly enhanced up to 86 times due to the energy transfer from the excited TMPyP molecule in DNA buffer solution. Furthermore, we elucidated the mechanism of fluorescence quenching and enhancement by the direct observation of energy transfer using the time-resolved measurements. The fluorescence quenching of TMPyP chiefly consists of a static component due to the formation of complex and dynamic components due to the excitation energy transfer. In a heterogeneous one-dimensional system such as a DNA chain, it was proved that the energy transfer process only carries out within the critical distance based on the Förster theory and within a threshold value estimated from the modified Stern-Volmer equation. The present results showed that DNA chain is one of the most powerful tools for nanoassemblies and will give a novel concepts of material design.
Effect of Thymine Starvation on Messenger Ribonucleic Acid Synthesis in Escherichia coli
Luzzati, Denise
1966-01-01
Luzzati, Denise (Institut de Biologie Physico-Chimique, Paris, France). Effect of thymine starvation on messenger ribonucleic acid synthesis in Escherichia coli. J. Bacteriol. 92:1435–1446. 1966.—During the course of thymine starvation, the rate of synthesis of messenger ribonucleic acid (mRNA, the rapidly labeled fraction of the RNA which decays in the presence of dinitrophenol or which hybridizes with deoxyribonucleic acid) decreases exponentially, in parallel with the viability of the thymine-starved bacteria. The ability of cell-free extracts of starved bacteria to incorporate ribonucleoside triphosphates into RNA was determined; it was found to be inferior to that of extracts from control cells. The analysis of the properties of cell-free extracts of starved cells shows that their decreased RNA polymerase activity is the consequence of a modification of their deoxyribonucleic acid, the ability of which to serve as a template for RNA polymerase decreases during starvation. PMID:5332402
Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I
DOE Office of Scientific and Technical Information (OSTI.GOV)
Enderle, Mathias; Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152 Martinsried; McCarthy, Andrew
Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungalmore » FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution.« less
Higgins, M. L.; Daneo-Moore, L.; Boothby, D.; Shockman, G. D.
1974-01-01
Selective inhibition of protein synthesis in Streptococcus faecalis (ATCC 9790) was accompanied by a rapid and severe inhibition of cell division and a reduction of enlargement of cellular surface area. Continued synthesis of cell wall polymers resulted in rapid thickening of the wall to an extent not seen in exponential-phase populations. Thus, the normal direction of wall growth was changed from a preferential feeding out of new wall surface to that of thickening existing cell surfaces. However, the overall manner in which the wall thickened, from nascent septa toward polar regions, was the same in both exponential-phase and inhibited populations. In contrast, selective inhibition of deoxyribonucleic acid (DNA) synthesis using mitomycin C was accompanied by an increase in cellular surface area and by division of about 80% of the cells in random populations. Little or no wall thickening was observed until the synthesis of macromolecules other than DNA was impaired and further cell division ceased. Concomitant inhibition of both DNA and protein synthesis inhibited cell division but permitted an increase in average cell volume. In such doubly inhibited cells, walls thickened less than in cells inhibited for protein synthesis only. On the basis of the results obtained, a model for cell surface enlargement and cell division is presented. The model proposes that: (i) each wall enlargement site is influenced by an individual chromosome replication cycle; (ii) during chromosome replication peripheral surface enlargement would be favored over thickening (or septation); (iii) a signal associated with chromosome termination would favor thickening (and septation) at the expense of surface enlargement; and (iv) a factor or signal related to protein synthesis would be required for one or more of the near terminal stages of cell division or cell separation, or both. Images PMID:4133352
Alonzo, Francis
2016-01-01
To thrive in diverse environments, bacteria must shift their metabolic output in response to nutrient bioavailability. In many bacterial species, such changes in metabolic flux depend upon lipoic acid, a cofactor required for the activity of enzyme complexes involved in glycolysis, the citric acid cycle, glycine catabolism, and branched chain fatty acid biosynthesis. The requirement of lipoic acid for metabolic enzyme activity necessitates that bacteria synthesize the cofactor and/or scavenge it from environmental sources. Although use of lipoic acid is a conserved phenomenon, the mechanisms behind its biosynthesis and salvage can differ considerably between bacterial species. Furthermore, low levels of circulating free lipoic acid in mammals underscore the importance of lipoic acid acquisition for pathogenic microbes during infection. In this study, we used a genetic approach to characterize the mechanisms of lipoic acid biosynthesis and salvage in the bacterial pathogen Staphylococcus aureus and evaluated the requirements for both pathways during murine sepsis. We determined that S. aureus lipoic acid biosynthesis and salvage genes exist in an arrangement that directly links redox stress response and acetate biosynthesis genes. In addition, we found that lipoic acid salvage is dictated by two ligases that facilitate growth and lipoylation in distinct environmental conditions in vitro, but that are fully compensatory for survival in vivo. Upon infection of mice, we found that de novo biosynthesis or salvage promotes S. aureus survival in a manner that depends upon the infectious site. In addition, when both lipoic acid biosynthesis and salvage are blocked S. aureus is rendered avirulent, implying an inability to induce lipoic acid-independent metabolic programs to promote survival. Together, our results define the major pathways of lipoic acid biosynthesis and salvage in S. aureus and support the notion that bacterial nutrient acquisition schemes are instrumental
Zorzoli, Azul; Grayczyk, James P; Alonzo, Francis
2016-10-01
To thrive in diverse environments, bacteria must shift their metabolic output in response to nutrient bioavailability. In many bacterial species, such changes in metabolic flux depend upon lipoic acid, a cofactor required for the activity of enzyme complexes involved in glycolysis, the citric acid cycle, glycine catabolism, and branched chain fatty acid biosynthesis. The requirement of lipoic acid for metabolic enzyme activity necessitates that bacteria synthesize the cofactor and/or scavenge it from environmental sources. Although use of lipoic acid is a conserved phenomenon, the mechanisms behind its biosynthesis and salvage can differ considerably between bacterial species. Furthermore, low levels of circulating free lipoic acid in mammals underscore the importance of lipoic acid acquisition for pathogenic microbes during infection. In this study, we used a genetic approach to characterize the mechanisms of lipoic acid biosynthesis and salvage in the bacterial pathogen Staphylococcus aureus and evaluated the requirements for both pathways during murine sepsis. We determined that S. aureus lipoic acid biosynthesis and salvage genes exist in an arrangement that directly links redox stress response and acetate biosynthesis genes. In addition, we found that lipoic acid salvage is dictated by two ligases that facilitate growth and lipoylation in distinct environmental conditions in vitro, but that are fully compensatory for survival in vivo. Upon infection of mice, we found that de novo biosynthesis or salvage promotes S. aureus survival in a manner that depends upon the infectious site. In addition, when both lipoic acid biosynthesis and salvage are blocked S. aureus is rendered avirulent, implying an inability to induce lipoic acid-independent metabolic programs to promote survival. Together, our results define the major pathways of lipoic acid biosynthesis and salvage in S. aureus and support the notion that bacterial nutrient acquisition schemes are instrumental
de Oliveira, Sabrina Alves; da Silva, Bruno Campos; Riegel-Vidotti, Izabel Cristina; Urbano, Alexandre; de Sousa Faria-Tischer, Paula Cristina; Tischer, Cesar Augusto
2017-04-01
The bacterial cellulose (BC), from Gluconacetobacter hansenii, is a biofilm with a high degree of crystallinity that can be used for therapeutic purposes and as a candidate for healing wounds. Hyaluronic acid (HA) is a constitutive polysaccharide found in the extracellular matrix and is a material used in tissue engineering and scaffolding for tissue regeneration. In this study, polymeric composites were produced in presence of hyaluronic acid isolated from chicken comb on different days of fermentation, specifically on the first (BCHA-SABT0) and third day (BCHA-SABT3) of fermentation. The structural characteristics, thermal stability and molar mass of hyaluronic acid from chicken comb were evaluated. Native membrane and polymeric composites were characterized with respect to their morphology and crystallinity. The optimized process of extraction and purification of hyaluronic acid resulted in low molar mass hyaluronic acid with structural characteristics similar to the standard commercial hyaluronic acid. The results demonstrate that the polymeric composites (BC/HA-SAB) can be produced in situ. The membranes produced on the third day presented better incorporation of HA-SAB between cellulose microfiber, resulting in membranes with higher thermal stability, higher roughness and lower crystallinity. The biocompatiblily of bacterial cellulose and the importance of hyaluronic acid as a component of extracellular matrix qualify the polymeric composites as promising biomaterials for tissue engineering. Copyright © 2017 Elsevier B.V. All rights reserved.
Effect of simulated acid rain on fluorine mobility and the bacterial community of phosphogypsum.
Wang, Mei; Tang, Ya; Anderson, Christopher W N; Jeyakumar, Paramsothy; Yang, Jinyan
2018-06-01
Contamination of soil and water with fluorine (F) leached from phosphogypsum (PG) stacks is a global environmental issue. Millions of tons of PG is produced each year as a by-product of fertilizer manufacture, and in China, weathering is exacerbated by acid rain. In this work, column leaching experiments using simulated acid rain were run to evaluate the mobility of F and the impact of weathering on native bacterial community composition in PG. After a simulated summer rainfall, 2.42-3.05 wt% of the total F content of PG was leached and the F concentration in leachate was above the quality standard for surface water and groundwater in China. Acid rain had no significant effect on the movement of F in PG. A higher concentration of F was observed at the bottom than the top section of PG columns suggesting mobility and reprecipitation of F. Throughout the simulation, the PG was environmentally safe according the TCLP testing. The dominant bacteria in PG were from the Enterococcus and Bacillus genus. Bacterial community composition in PG leached by simulated acid rain (pH 3.03) was more abundant than at pH 6.88. Information on F mobility and bacterial community in PG under conditions of simulated rain is relevant to management of environmental risk in stockpiled PG waste.
Diverse bacterial PKS sequences derived from okadaic acid-producing dinoflagellates.
Perez, Roberto; Liu, Li; Lopez, Jose; An, Tianying; Rein, Kathleen S
2008-05-22
Okadaic acid (OA) and the related dinophysistoxins are isolated from dinoflagellates of the genus Prorocentrum and Dinophysis. Bacteria of the Roseobacter group have been associated with okadaic acid producing dinoflagellates and have been previously implicated in OA production. Analysis of 16S rRNA libraries reveals that Roseobacter are the most abundant bacteria associated with OA producing dinoflagellates of the genus Prorocentrum and are not found in association with non-toxic dinoflagellates. While some polyketide synthase (PKS) genes form a highly supported Prorocentrum clade, most appear to be bacterial, but unrelated to Roseobacter or Alpha-Proteobacterial PKSs or those derived from other Alveolates Karenia brevis or Crytosporidium parvum.
Diverse Bacterial PKS Sequences Derived From Okadaic Acid-Producing Dinoflagellates
Perez, Roberto; Liu, Li; Lopez, Jose; An, Tianying; Rein, Kathleen S.
2008-01-01
Okadaic acid (OA) and the related dinophysistoxins are isolated from dinoflagellates of the genus Prorocentrum and Dinophysis. Bacteria of the Roseobacter group have been associated with okadaic acid producing dinoflagellates and have been previously implicated in OA production. Analysis of 16S rRNA libraries reveals that Roseobacter are the most abundant bacteria associated with OA producing dinoflagellates of the genus Prorocentrum and are not found in association with non-toxic dinoflagellates. While some polyketide synthase (PKS) genes form a highly supported Prorocentrum clade, most appear to be bacterial, but unrelated to Roseobacter or Alpha-Proteobacterial PKSs or those derived from other Alveolates Karenia brevis or Crytosporidium parvum. PMID:18728765
Nucleic Acid-Induced Resistance to Viral Infection
Takano, Kouichi; Warren, Joel; Jensen, Keith E.; Neal, Alan L.
1965-01-01
Takano, Kouichi (Chas. Pfizer & Co., Inc., Terre Haute, Ind.), Joel Warren, Keith E. Jensen, and Alan L. Neal. Nucleic acid resistance to viral infection. J. Bacteriol. 90:1542–1547. 1965.—Administration of nonviral nucleic acids to mice increased their resistance to a subsequent infection with influenza or encephalomyocarditis viruses. Injection of ribonucleic acid or deoxyribonucleic acid by peripheral routes did not modify susceptibility to intranasal infection. Lung tissue extracts from animals previously treated with yeast nucleic acid inhibited the growth of vaccinia and influenza viruses. The protective effect of exogenous nucleic acids persisted in mice for several days, but gradually diminished to undetectable levels. PMID:4285332
Doornbos, Rogier F; Geraats, Bart P J; Kuramae, Eiko E; Van Loon, L C; Bakker, Peter A H M
2011-04-01
Systemically induced resistance is a promising strategy to control plant diseases, as it affects numerous pathogens. However, since induced resistance reduces one or both growth and activity of plant pathogens, the indigenous microflora may also be affected by an enhanced defensive state of the plant. The aim of this study was to elucidate how much the bacterial rhizosphere microflora of Arabidopsis is affected by induced systemic resistance (ISR) or systemic acquired resistance (SAR). Therefore, the bacterial microflora of wild-type plants and plants affected in their defense signaling was compared. Additionally, ISR was induced by application of methyl jasmonate and SAR by treatment with salicylic acid or benzothiadiazole. As a comparative model, we also used wild type and ethylene-insensitive tobacco. Some of the Arabidopsis genotypes affected in defense signaling showed altered numbers of culturable bacteria in their rhizospheres; however, effects were dependent on soil type. Effects of plant genotype on rhizosphere bacterial community structure could not be related to plant defense because chemical activation of ISR or SAR had no significant effects on density and structure of the rhizosphere bacterial community. These findings support the notion that control of plant diseases by elicitation of systemic resistance will not significantly affect the resident soil bacterial microflora.
Peng, Qian; Yang, Yanping; Guo, Yanyun; Han, Ye
2015-08-01
The vinegar pei harbors complex bacterial communities. Prior studies revealing the bacterial diversity involved were mainly conducted by culture-dependent methods and PCR-DGGE. In this study, 454 pyrosequencing was used to investigate the bacterial communities in vinegar pei during the acetic acid fermentation (AAF) of Tianjin Duliu aged vinegar (TDAV). The results showed that there were 7 phyla and 24 families existing in the vinegar pei, with 2 phyla (Firmicutes, Protebacteria) and 4 families (Lactobacillaceae, Acetobacteracae, Enterobacteriaceae, Chloroplast) predominating. The genus-level identification revealed that 9 genera were the relatively stable, consistent components in different stages of AAF, including the most abundant genus Lactobacillus followed by Acetobacter and Serratia. Additionally, the bacterial community in the early fermentation stage was more complex than those in the later stages, indicating that the accumulation of organic acids provided an appropriate environment to filter unwanted bacteria and to accelerate the growth of required ones. This study provided basic information of bacterial patterns in vinegar pei and relevant changes during AAF of TDAV, and could be used as references in the following study on the implementation of starter culture as well as the improvement of AAF process.
Extraction of Total Nucleic Acids From Ticks for the Detection of Bacterial and Viral Pathogens
Crowder, Chris D.; Rounds, Megan A.; Phillipson, Curtis A.; Picuri, John M.; Matthews, Heather E.; Halverson, Justina; Schutzer, Steven E.; Ecker, David J.; Eshoo, Mark W.
2010-01-01
Ticks harbor numerous bacterial, protozoal, and viral pathogens that can cause serious infections in humans and domestic animals. Active surveillance of the tick vector can provide insight into the frequency and distribution of important pathogens in the environment. Nucleic-acid based detection of tick-borne bacterial, protozoan, and viral pathogens requires the extraction of both DNA and RNA (total nucleic acids) from ticks. Traditional methods for nucleic acid extraction are limited to extraction of either DNA or the RNA from a sample. Here we present a simple bead-beating based protocol for extraction of DNA and RNA from a single tick and show detection of Borrelia burgdorferi and Powassan virus from individual, infected Ixodes scapularis ticks. We determined expected yields for total nucleic acids by this protocol for a variety of adult tick species. The method is applicable to a variety of arthropod vectors, including fleas and mosquitoes, and was partially automated on a liquid handling robot. PMID:20180313
Zeron Mullins, Melinda; Trouton, Konia M
2015-07-26
Bacterial vaginosis is associated with increased transmission of sexually transmitted infections, preterm labor, post-surgical infections, and endometritis. Current treatment for symptomatic bacterial vaginosis includes antibiotics, such as metronidazole, which are 70-80 % effective at one month after treatment and result in high recurrence rates and secondary candida infections. Intravaginal boric acid has been used for over a hundred years to treat vaginal infections, such as bacterial vaginosis. Boric acid is inexpensive, accessible, and has shown to be an effective treatment for other infections, such as vaginal candidiasis. To date, there has been no clinical trial evaluation of boric acid effectiveness to treat bacterial vaginosis. The BASIC (Boric Acid, Alternate Solution for Intravaginal Colonization) trial is a randomized, double-blinded, multicenter study. The study will enroll a minimum of 240 women of 16-50 years of age who are symptomatic with bacterial vaginosis. Eligible participants will have Amsel and Nugent scores confirming bacterial vaginosis. Women who are pregnant or menopausal or have other active co-infections will be excluded. Consenting participants who meet exclusion and inclusion criteria will be randomly assigned to one of three treatment groups: boric acid, metronidazole, or an inert placebo. Self-administration of treatment intravaginally for 10 days will be followed by clinical assessment at 7 and 30 days (days 17 and 40, respectively) after the end of the treatment phase. Primary outcome is a non-inferiority, per-protocol comparison of the effectiveness of boric acid with that of metronidazole at day 17, as measured by the Nugent score in 16-50 year olds. Secondary outcomes include: non-inferiority, intention-to-treat comparison of effectiveness of boric acid with that of metronidazole at day 17, analysis for both per-protocol and intention-to-treat at day 40, and safety considerations, including adverse effects requiring patient
USDA-ARS?s Scientific Manuscript database
Pseudomonas syringae pv. tomato DC3000 is a bacterial pathogen of Arabidopsis and tomato that grows in the apoplast. The non-protein amino acid '-amino butyric acid (GABA) is produced by Arabidopsis and tomato and is the most abundant amino acid in the apoplastic fluid of tomato. The DC3000 genome h...
Severi, Emmanuele; Hosie, Arthur H F; Hawkhead, Judith A; Thomas, Gavin H
2010-03-01
The function of sialic acids in the biology of bacterial pathogens is reflected by the diverse range of solute transporters that can recognize these sugar acids. Here, we use an Escherichia coliDeltananT strain to characterize the function of known and proposed bacterial sialic acid transporters. We discover that the STM1128 gene from Salmonella enterica serovar Typhimurium, which encodes a member of the sodium solute symporter family, is able to restore growth on sialic acid to the DeltananT strain and is able to transport [(14)C]-sialic acid. Using the DeltananT genetic background, we performed a direct in vivo comparison of the transport properties of the STM1128 protein with those of sialic acid transporters of the major facilitator superfamily and tripartite ATP-independent periplasmic families, E. coli NanT and Haemophilus influenzae SiaPQM, respectively. This revealed that both STM1128 and SiaPQM are sodium-dependent and, unlike SiaPQM, both STM1128 and NanT are reversible secondary carriers, demonstrating qualitative functional differences in the properties of sialic acid transporters used by bacteria that colonize humans.
Landa, B B; Montes-Borrego, M; Aranda, S; Soriano, M A; Gómez, J A; Navas-Cortés, J A
2014-04-01
Nowadays, there is a tendency in olive production systems to reduce tillage or keep a vegetative cover to reduce soil erosion and degradation. However, there is scarce information on the effects of different soil management systems (SMS) in soil bacterial community composition of olive groves. In this study, we have evaluated the effects of soil type and different SMS implemented to control weeds in the structure and diversity of bacterial communities of 58 soils in the two geographic areas that best represent the organic olive production systems in Spain. Bacterial community composition assessed by frequency and intensity of occurrence of terminal restriction profiles (TRFs) derived from terminal restriction fragment length polymorphism (T-RFLP) analysis of amplified 16S ribosomal deoxyribonucleic acid were strongly correlated with soil type/field site (Eutric/Calcaric) that differed mainly in soil particle size distribution and soil pH, followed by a strong effect of SMS, in that order. Canonical discriminant (CD) analysis of TRFs properly classified all of the olive orchard soils as belonging to their respective soil type or SMS. Furthermore, only a small set of TRFs were enough to clearly and significantly differentiate soil samples according to soil type or SMS. Those specific TRFs could be used as bioindicators to assess the effect of changes in SMS aimed to enhance soil quality in olive production systems. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
Lactic acid bacterial extract as a biogenic mineral growth modifier
NASA Astrophysics Data System (ADS)
Borah, Ballav M.; Singh, Atul K.; Ramesh, Aiyagari; Das, Gopal
2009-04-01
The formation of minerals and mechanisms by which bacteria could control their formation in natural habitats is now of current interest for material scientists to have an insight of the mechanism of in vivo mineralization, as well as to seek industrial and technological applications. Crystalline uniform structures of calcium and barium minerals formed micron-sized building blocks when synthesized in the presence of an organic matrix consisting of secreted protein extracts from three different lactic acid bacteria (LAB) viz.: Lactobacillus plantarum MTCC 1325, Lactobacillus acidophilus NRRL B4495 and Pediococcus acidilactici CFR K7. LABs are not known to form organic matrix in biological materialization processes. The influence of these bacterial extracts on the crystallization behavior was investigated in details to test the basic coordination behavior of the acidic protein. In this report, varied architecture of the mineral crystals obtained in presence of high molecular weight protein extracts of three different LAB strains has been discussed. The role of native form of high molecular weight bacterial protein extracts in the generation of nucleation centers for crystal growth was clearly established. A model for the formation of organic matrix-cation complex and the subsequent events leading to crystal growth is proposed.
Nielsen, Lene Nørby; Roager, Henrik M; Casas, Mònica Escolà; Frandsen, Henrik L; Gosewinkel, Ulrich; Bester, Kai; Licht, Tine Rask; Hendriksen, Niels Bohse; Bahl, Martin Iain
2018-02-01
Recently, concerns have been raised that residues of glyphosate-based herbicides may interfere with the homeostasis of the intestinal bacterial community and thereby affect the health of humans or animals. The biochemical pathway for aromatic amino acid synthesis (Shikimate pathway), which is specifically inhibited by glyphosate, is shared by plants and numerous bacterial species. Several in vitro studies have shown that various groups of intestinal bacteria may be differently affected by glyphosate. Here, we present results from an animal exposure trial combining deep 16S rRNA gene sequencing of the bacterial community with liquid chromatography mass spectrometry (LC-MS) based metabolic profiling of aromatic amino acids and their downstream metabolites. We found that glyphosate as well as the commercial formulation Glyfonova ® 450 PLUS administered at up to fifty times the established European Acceptable Daily Intake (ADI = 0.5 mg/kg body weight) had very limited effects on bacterial community composition in Sprague Dawley rats during a two-week exposure trial. The effect of glyphosate on prototrophic bacterial growth was highly dependent on the availability of aromatic amino acids, suggesting that the observed limited effect on bacterial composition was due to the presence of sufficient amounts of aromatic amino acids in the intestinal environment. A strong correlation was observed between intestinal concentrations of glyphosate and intestinal pH, which may partly be explained by an observed reduction in acetic acid produced by the gut bacteria. We conclude that sufficient intestinal levels of aromatic amino acids provided by the diet alleviates the need for bacterial synthesis of aromatic amino acids and thus prevents an antimicrobial effect of glyphosate in vivo. It is however possible that the situation is different in cases of human malnutrition or in production animals. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Serra, S; De Simeis, D
2018-03-01
The preparation of the high-value flavour γ-dodecalactone is based on the biotransformation of natural 10-HSA, which is in turn obtained by microbial hydration of oleic acid. We want to establish a reliable baker's yeast-mediated procedure for 10-HSA preparation. The previously reported yeast-mediated hydration procedures are unreliable because bacteria-free baker's yeast is not able to hydrate oleic acid. The actual responsible for performing this reaction are the bacterial contaminants present in baker's yeast. Moreover, we demonstrated that the enantioselectivity in the production of (R)-10-HSA is affected mainly by the temperature used in the biotransformation. We demonstrated that Saccharomyces cerevisiae is not able to hydrate oleic acid, whereas different bacterial strains present in baker's yeast transform oleic acid into (R)-10-HSA. We reported a general procedure for the preparation of (R)-10-HSA starting from oleic acid and using commercially available baker's yeast. This study holds both scientific and industrial interest. It unambiguously establishes that the eukaryote micro-organisms present in baker's yeast are not able to hydrate oleic acid. The isolation of oleic acid hydrating bacterial strains from commercial baker's yeast points to their prospective use for the industrial synthesis of 10-HSA. © 2017 The Society for Applied Microbiology.
Štornik, Aleksandra; Skok, Barbara; Trček, Janja
2016-03-01
Organic apple cider vinegar is produced from apples that go through very restricted treatment in orchard. During the first stage of the process, the sugars from apples are fermented by yeasts to cider. The produced ethanol is used as a substrate by acetic acid bacteria in a second separated bioprocess. In both, the organic and conventional apple cider vinegars the ethanol oxidation to acetic acid is initiated by native microbiota that survived alcohol fermentation. We compared the cultivable acetic acid bacterial microbiota in the production of organic and conventional apple cider vinegars from a smoothly running oxidation cycle of a submerged industrial process. In this way we isolated and characterized 96 bacteria from organic and 72 bacteria from conventional apple cider vinegar. Using the restriction analysis of the PCR-amplified 16S-23S rRNA gene ITS regions, we identified four different Hae III and five different Hpa II restriction profiles for bacterial isolates from organic apple cider vinegar. Each type of restriction profile was further analyzed by sequence analysis of the 16S-23S rRNA gene ITS regions, resulting in identification of the following species: Acetobacter pasteurianus (71.90%), Acetobacter ghanensis (12.50%), Komagataeibacter oboediens (9.35%) and Komagataeibacter saccharivorans (6.25%). Using the same analytical approach in conventional apple cider vinegar, we identified only two different Hae III and two different Hpa II restriction profiles of the 16S‒23S rRNA gene ITS regions, which belong to the species Acetobacter pasteurianus (66.70%) and Komagataeibacter oboediens (33.30%). Yeasts that are able to resist 30 g/L of acetic acid were isolated from the acetic acid production phase and further identified by sequence analysis of the ITS1-5.8S rDNA‒ITS2 region as Candida ethanolica , Pichia membranifaciens and Saccharomycodes ludwigii . This study has shown for the first time that the bacterial microbiota for the industrial production of
Štornik, Aleksandra; Skok, Barbara
2016-01-01
Summary Organic apple cider vinegar is produced from apples that go through very restricted treatment in orchard. During the first stage of the process, the sugars from apples are fermented by yeasts to cider. The produced ethanol is used as a substrate by acetic acid bacteria in a second separated bioprocess. In both, the organic and conventional apple cider vinegars the ethanol oxidation to acetic acid is initiated by native microbiota that survived alcohol fermentation. We compared the cultivable acetic acid bacterial microbiota in the production of organic and conventional apple cider vinegars from a smoothly running oxidation cycle of a submerged industrial process. In this way we isolated and characterized 96 bacteria from organic and 72 bacteria from conventional apple cider vinegar. Using the restriction analysis of the PCR-amplified 16S−23S rRNA gene ITS regions, we identified four different HaeIII and five different HpaII restriction profiles for bacterial isolates from organic apple cider vinegar. Each type of restriction profile was further analyzed by sequence analysis of the 16S−23S rRNA gene ITS regions, resulting in identification of the following species: Acetobacter pasteurianus (71.90%), Acetobacter ghanensis (12.50%), Komagataeibacter oboediens (9.35%) and Komagataeibacter saccharivorans (6.25%). Using the same analytical approach in conventional apple cider vinegar, we identified only two different HaeIII and two different HpaII restriction profiles of the 16S‒23S rRNA gene ITS regions, which belong to the species Acetobacter pasteurianus (66.70%) and Komagataeibacter oboediens (33.30%). Yeasts that are able to resist 30 g/L of acetic acid were isolated from the acetic acid production phase and further identified by sequence analysis of the ITS1−5.8S rDNA‒ITS2 region as Candida ethanolica, Pichia membranifaciens and Saccharomycodes ludwigii. This study has shown for the first time that the bacterial microbiota for the industrial
Negrel, Jonathan; Javelle, Francine; Morandi, Dominique; Lucchi, Géraldine
2016-12-01
A Gram-negative bacterium able to grow using chlorogenic acid (5-caffeoylquinic acid) as sole carbon source has been isolated from the roots of tomato plants inoculated with the arbuscular mycorrhizal fungus Rhizophagus irregularis. An intracellular esterase exhibiting very high affinity (K m = 2 μM) for chlorogenic acid has been extracted and purified by FPLC from the chlorogenate-grown cultures of this bacterium. The molecular mass of the purified esterase determined by SDS-PAGE was 61 kDa and its isoelectric point determined by chromatofocusing was 7.75. The esterase hydrolysed chlorogenic acid analogues (caffeoylshikimate, and the 4- and 3-caffeoylquinic acid isomers), feruloyl esterases substrates (methyl caffeate and methyl ferulate), and even caffeoyl-CoA in vitro but all of them were less active than chlorogenic acid, demonstrating that the esterase is a genuine chlorogenic acid esterase. It was also induced when the bacterial strain was cultured in the presence of hydroxycinnamic acids (caffeic, p-coumaric or ferulic acid) as sole carbon source, but not in the presence of simple phenolics such as catechol or protocatechuic acid, nor in the presence of organic acids such as succinic or quinic acids. The purified esterase was remarkably stable in the presence of methanol, rapid formation of methyl caffeate occurring when its activity was measured in aqueous solutions containing 10-60% methanol. Our results therefore show that this bacterial chlorogenase can catalyse the transesterification reaction previously detected during the methanolic extraction of chlorogenic acid from arbuscular mycorrhizal tomato roots. Data are presented suggesting that colonisation by Rhizophagus irregularis could increase chlorogenic acid exudation from tomato roots, especially in nutrient-deprived plants, and thus favour the growth of chlorogenate-metabolizing bacteria on the root surface or in the mycorhizosphere. Copyright © 2016 Elsevier Masson SAS. All rights
Li, Sha; Li, Pan; Liu, Xiong; Luo, Lixin; Lin, Weifeng
2016-05-01
Solid-state acetic acid fermentation (AAF), a natural or semi-controlled fermentation process driven by reproducible microbial communities, is an important technique to produce traditional Chinese cereal vinegars. Highly complex microbial communities and metabolites are involved in traditional Chinese solid-state AAF, but the association between microbiota and metabolites during this process are still poorly understood. In this study, we performed amplicon 16S rRNA gene sequencing on the Illumina MiSeq platform, PCR-denaturing gradient gel electrophoresis, and metabolite analysis to trace the bacterial dynamics and metabolite changes under AAF process. A succession of bacterial assemblages was observed during the AAF process. Lactobacillales dominated all the stages. However, Acetobacter species in Rhodospirillales were considerably accelerated during AAF until the end of fermentation. Quantitative PCR results indicated that the biomass of total bacteria showed a "system microbe self-domestication" process in the first 3 days, and then peaked at the seventh day before gradually decreasing until the end of AAF. Moreover, a total of 88 metabolites, including 8 organic acids, 16 free amino acids, and 66 aroma compounds were detected during AAF. Principal component analysis and cluster analyses revealed the high correlation between the dynamics of bacterial community and metabolites.
Biochemical Roles for Conserved Residues in the Bacterial Fatty Acid-binding Protein Family*
Broussard, Tyler C.; Miller, Darcie J.; Jackson, Pamela; Nourse, Amanda; White, Stephen W.; Rock, Charles O.
2016-01-01
Fatty acid kinase (Fak) is a ubiquitous Gram-positive bacterial enzyme consisting of an ATP-binding protein (FakA) that phosphorylates the fatty acid bound to FakB. In Staphylococcus aureus, Fak is a global regulator of virulence factor transcription and is essential for the activation of exogenous fatty acids for incorporation into phospholipids. The 1.2-Å x-ray structure of S. aureus FakB2, activity assays, solution studies, site-directed mutagenesis, and in vivo complementation were used to define the functions of the five conserved residues that define the FakB protein family (Pfam02645). The fatty acid tail is buried within the protein, and the exposed carboxyl group is bound by a Ser-93-fatty acid carboxyl-Thr-61-His-266 hydrogen bond network. The guanidinium of the invariant Arg-170 is positioned to potentially interact with a bound acylphosphate. The reduced thermal denaturation temperatures of the T61A, S93A, and H266A FakB2 mutants illustrate the importance of the hydrogen bond network in protein stability. The FakB2 T61A, S93A, and H266A mutants are 1000-fold less active in the Fak assay, and the R170A mutant is completely inactive. All FakB2 mutants form FakA(FakB2)2 complexes except FakB2(R202A), which is deficient in FakA binding. Allelic replacement shows that strains expressing FakB2 mutants are defective in fatty acid incorporation into phospholipids and virulence gene transcription. These conserved residues are likely to perform the same critical functions in all bacterial fatty acid-binding proteins. PMID:26774272
Nanson, Jeffrey D; Forwood, Jade K
2015-01-01
Ketoacyl-acyl carrier protein reductases (FabG) are ubiquitously expressed enzymes that catalyse the reduction of acyl carrier protein (ACP) linked thioesters within the bacterial type II fatty acid synthesis (FASII) pathway. The products of these enzymes, saturated and unsaturated fatty acids, are essential components of the bacterial cell envelope. The FASII reductase enoyl-ACP reductase (FabI) has been the focus of numerous drug discovery efforts, some of which have led to clinical trials, yet few studies have focused on FabG. Like FabI, FabG appears to be essential for survival in many bacteria, similarly indicating the potential of this enzyme as a drug target. FabG enzymes are members of the short-chain alcohol dehydrogenase/reductase (SDR) family, and like other SDRs, exhibit highly conserved secondary and tertiary structures, and contain a number of conserved sequence motifs. Here we describe the crystal structures of FabG from Yersinia pestis (YpFabG), the causative agent of bubonic, pneumonic, and septicaemic plague, and three human pandemics. Y. pestis remains endemic in many parts of North America, South America, Southeast Asia, and Africa, and a threat to human health. YpFabG shares a high degree of structural similarity with bacterial homologues, and the ketoreductase domain of the mammalian fatty acid synthase from both Homo sapiens and Sus scrofa. Structural characterisation of YpFabG, and comparison with other bacterial FabGs and the mammalian fatty acid synthase, provides a strong platform for virtual screening of potential inhibitors, rational drug design, and the development of new antimicrobial agents to combat Y. pestis infections.
Federal Register 2010, 2011, 2012, 2013, 2014
2011-11-28
... Hepatitis B Virus AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food and Drug... Risk of Transmission of Hepatitis B Virus (HBV), and Requalification of Donors Who Test HBV NAT...-licensed nucleic acid tests (NAT) to screen blood donors for hepatitis B virus (HBV) deoxyribonucleic acid...
Effects of remediation on the bacterial community of an acid mine drainage impacted stream.
Ghosh, Suchismita; Moitra, Moumita; Woolverton, Christopher J; Leff, Laura G
2012-11-01
Acid mine drainage (AMD) represents a global threat to water resources, and as such, remediation of AMD-impacted streams is a common practice. During this study, we examined bacterial community structure and environmental conditions in a low-order AMD-impacted stream before, during, and after remediation. Bacterial community structure was examined via polymerase chain reaction amplification of 16S rRNA genes followed by denaturing gradient gel electrophoresis. Also, bacterial abundance and physicochemical data (including metal concentrations) were collected and relationships to bacterial community structure were determined using BIO-ENV analysis. Remediation of the study stream altered environmental conditions, including pH and concentrations of some metals, and consequently, the bacterial community changed. However, remediation did not necessarily restore the stream to conditions found in the unimpacted reference stream; for example, bacterial abundances and concentrations of some elements, such as sulfur, magnesium, and manganese, were different in the remediated stream than in the reference stream. BIO-ENV analysis revealed that changes in pH and iron concentration, associated with remediation, primarily explained temporal alterations in bacterial community structure. Although the sites sampled in the remediated stream were in relatively close proximity to each other, spatial variation in community composition suggests that differences in local environmental conditions may have large impacts on the microbial assemblage.
Netsvyetayeva, Irina; Marusza, Wojciech; Olszanski, Romuald; Szyller, Kamila; Krolak-Ulinska, Aneta; Swoboda-Kopec, Ewa; Sierdzinski, Janusz; Szymonski, Zachary; Mlynarczyk, Grazyna
2018-01-01
Cross-linked hyaluronic acid (HA) gel is widely used in esthetic medicine. Late bacterial infection (LBI) is a rare, but severe complication after HA augmentation. The aim of this study was to determine whether patients who underwent the HA injection procedure and developed LBI had qualitatively different bacterial flora on the skin compared to patients who underwent the procedure without any complications. The study group comprised 10 previously healthy women with recently diagnosed, untreated LBI after HA augmentation. The control group comprised 17 healthy women who had a similar amount of HA injected with no complications. To assess the difference between the two groups, their skin flora was cultured from nasal swabs, both before and after antibiotic treatment in the study group. A significant increase in the incidence of Staphylococcus epidermidis was detected in the control group ( P =0.000) compared to the study group. The study group showed a significantly higher incidence of Staphylococcus aureus ( P =0.005), Klebsiella pneumoniae ( P =0.006), Klebsiella oxytoca ( P =0.048), and Staphylococcus haemolyticus ( P =0.048) compared to the control group. The bacterial flora on the skin differed in patients with LBI from the control group. The control group's bacterial skin flora was dominated by S. epidermidis . Patients with LBI had a bacterial skin flora dominated by potentially pathogenic bacteria.
Yao, Jiangwei; Rock, Charles O.
2015-01-01
Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887
Peltonen, R; Ling, W H; Hänninen, O; Eerola, E
1992-01-01
The effect of an uncooked extreme vegan diet on fecal microflora was studied by direct stool sample gas-liquid chromatography (GLC) of bacterial cellular fatty acids and by quantitative bacterial culture by using classical microbiological techniques of isolation, identification, and enumeration of different bacterial species. Eighteen volunteers were divided randomly into two groups. The test group received an uncooked vegan diet for 1 month and a conventional diet of mixed Western type for the other month of the study. The control group consumed a conventional diet throughout the study period. Stool samples were collected. Bacterial cellular fatty acids were extracted directly from the stool samples and measured by GLC. Computerized analysis of the resulting fatty acid profiles was performed. Such a profile represents all bacterial cellular fatty acids in a sample and thus reflects its microflora and can be used to detect changes, differences, or similarities of bacterial flora between individual samples or sample groups. GLC profiles changed significantly in the test group after the induction and discontinuation of the vegan diet but not in the control group at any time, whereas quantitative bacterial culture did not detect any significant change in fecal bacteriology in either of the groups. The results suggest that an uncooked extreme vegan diet alters the fecal bacterial flora significantly when it is measured by direct stool sample GLC of bacterial fatty acids. PMID:1482187
Tashiro, Yukihiro; Matsumoto, Hiroko; Miyamoto, Hirokuni; Okugawa, Yuki; Pramod, Poudel; Miyamoto, Hisashi; Sakai, Kenji
2013-10-01
We investigated L-lactic acid production in static batch fermentation of kitchen refuse using a bacterial consortium from marine-animal-resource (MAR) composts at temperatures ranging from 30 to 65 °C. At relatively low temperatures butyric acid accumulated, whereas at higher temperatures L-lactic acid was produced. In particular, fermentation at 50 °C produced 34.5 g L(-1) L-lactic acid with 90% lactic acid selectivity and 100% optical purity. Denaturing gradient gel electrophoresis indicated that dominant bacteria present in the original MAR composts diminished rapidly and Bacillus coagulans strains became the dominant contributors to L-lactic acid production at 45, 50 and 55 °C. This is the first report of the achievement of 100% optical purity of L-lactic acid using a bacterial consortium. Copyright © 2013 Elsevier Ltd. All rights reserved.
Hiebert, John M; Robson, Martin C
2016-01-01
Introduction: Wound debridement is considered essential in chronic wound management. Hypochlorous acid has been shown to be an effective agent in reducing wound bacterial counts in open wounds. Ultrasound-enabled wound debridement is an effective and efficient method of debridement. This study compared ultrasound irrigation with hypochlorous acid versus saline irrigation for wound debridement on pre- and postoperative wounds and determined regrowth of bacteria over 1 week period of time. Finally, the outcome of definitive wound closure of the clinically clean-appearing wounds was recorded. Methods: Seventeen consenting adult patients with chronic open wounds were randomly selected for study. The patients were randomly divided into the hypochlorous acid irrigation or saline irrigation group. All patients provided pre- and postoperative tissue samples for qualitative and quantitative bacteriology. For the time (7 days) between the debridement procedure and the definitive closure procedure, the wounds were dressed with a silver-impregnated dressing and a hydroconductive dressing. Results : Both types of irrigation in the ultrasonic system initially lowered the bacterial counts by 4 to 6 logs. However, by the time of definitive closure, the saline-irrigated wounds had bacterial counts back up to 10 5 whereas the hypochlorous acid-irrigated wounds remained at 10 2 or fewer. More than 80% of patients in the saline group had postoperative closure failure compared with 25% of patients in the hypochlorous acid group. Conclusions: Hypochlorous acid irrigation with ultrasound debridement reduced bacterial growth in chronic open wounds more efficiently than saline alone. Postoperative wound closure outcomes suggest a remarkable reduction in wound complications after wound debridement using hypochlorous acid irrigation with ultrasound versus saline alone.
Price, Christopher T. D.; Richards, Ashley M.; Von Dwingelo, Juanita E.; Samara, Hala A.; Kwaik, Yousef Abu
2013-01-01
Summary Legionella pneumophila, the causative agent of Legionnaires’ disease, invades and proliferates within a diverse range of free-living amoeba in the environment but upon transmission to humans the bacteria hijack alveolar macrophages. Intracellular proliferation of L. pneumophila in two evolutionarily distant hosts is facilitated by bacterial exploitation of conserved host processes that are targeted by bacterial protein effectors injected into the host cell. A key aspect of microbe-host interaction is microbial extraction of nutrients from the host but understanding of this is still limited. AnkB functions as a nutritional virulence factor and promotes host proteasomal degradation of polyubiquitinated proteins generating gratuitous levels of limiting host cellular amino acids. L. pneumophila is auxotrophic for several amino acids including cysteine, which is a metabolically preferred source of carbon and energy during intracellular proliferation, but is limiting in both amoebae and humans. We propose that synchronization of bacterial amino acids auxotrophy with the host is a driving force in pathogenic evolution and nutritional adaptation of L. pneumophila and other intracellular bacteria to life within the host cell. Understanding microbial strategies of nutrient generation and acquisition in the host will provide novel antimicrobial strategies to disrupt pathogen access to essential sources of carbon and energy. PMID:24112119
Martínez-Soto, Juan Carlos; Domingo, Joan Carles; Cordobilla, Begoña; Nicolás, María; Fernández, Laura; Albero, Pilar; Gadea, Joaquín; Landeras, José
2016-12-01
The purpose of this study was to evaluate the effect of docosahexaenoic acid (DHA) dietary supplementation on semen quality, fatty acid composition, antioxidant capacity, and DNA fragmentation. In this randomized, double blind, placebo-controlled, parallel-group study, 74 subjects were recruited and randomly assigned to either the placebo group (n=32) or to the DHA group (n=42) to consume three 500-mg capsules of oil per day over 10 weeks. The placebo group received 1,500 mg/day of sunflower oil and the DHA group 1,500 mg/day of DHA-enriched oil. Seminal parameters (semen volume, sperm concentration, motility, morphology, and vitality), total antioxidant capacity, deoxyribonucleic acid fragmentation, and lipid composition were evaluated prior to the treatment and after 10 weeks. Finally, 57 subjects were included in the study with 25 in the placebo group and 32 in the DHA group. No differences were found in traditional sperm parameters or lipid composition of the sperm membrane after treatment. However, an increase in DHA and Omega-3 fatty acid content in seminal plasma, an improvement in antioxidant status, and a reduction in the percentage of spermatozoa with deoxyribonucleic acid damage were observed in the DHA group after 10 weeks of treatment.
Michelou, Vanessa K.; Cottrell, Matthew T.; Kirchman, David L.
2007-01-01
We examined the contribution of photoheterotrophic microbes—those capable of light-mediated assimilation of organic compounds—to bacterial production and amino acid assimilation along a transect from Florida to Iceland from 28 May to 9 July 2005. Bacterial production (leucine incorporation at a 20 nM final concentration) was on average 30% higher in light than in dark-incubated samples, but the effect varied greatly (3% to 60%). To further characterize this light effect, we examined the abundance of potential photoheterotrophs and measured their contribution to bacterial production and amino acid assimilation (0.5 nM addition) using flow cytometry. Prochlorococcus and Synechococcus were abundant in surface waters where light-dependent leucine incorporation was observed, whereas aerobic anoxygenic phototrophic bacteria were abundant but did not correlate with the light effect. The per-cell assimilation rates of Prochlorococcus and Synechococcus were comparable to or higher than those of other prokaryotes, especially in the light. Picoeukaryotes also took up leucine (20 nM) and other amino acids (0.5 nM), but rates normalized to biovolume were much lower than those of prokaryotes. Prochlorococcus was responsible for 80% of light-stimulated bacterial production and amino acid assimilation in surface waters south of the Azores, while Synechococcus accounted for on average 12% of total assimilation. However, nearly 40% of the light-stimulated leucine assimilation was not accounted for by these groups, suggesting that assimilation by other microbes is also affected by light. Our results clarify the contribution of cyanobacteria to photoheterotrophy and highlight the potential role of other photoheterotrophs in biomass production and dissolved-organic-matter assimilation. PMID:17630296
Wei, Yuquan; Zhao, Yue; Shi, Mingzi; Cao, Zhenyu; Lu, Qian; Yang, Tianxue; Fan, Yuying; Wei, Zimin
2018-01-01
Enriched phosphate-solubilizing bacteria (PSB) agent were acquired by domesticated cultivation, and inoculated into kitchen waste composting in different stages. The effect of different treatments on organic acids production, tricalcium phosphate (TCP) solubilization and their relationship with bacterial community were investigated during composting. Our results pointed out that inoculation affected pH, total acidity and the production of oxalic, lactic, citric, succinic, acetic and formic acids. We also found a strong advantage in the solubilization of TCP and phosphorus (P) availability for PSB inoculation especially in the cooling stage. Redundancy analysis and structural equation models demonstrated inoculation by different methods changed the correlation of the bacterial community composition with P fractions as well as organic acids, and strengthened the cooperative function related to P transformation among species during composting. Finally, we proposed a possible mechanism of P solubilization with enriched PSB inoculation, which was induced by bacterial community and organic acids production. Copyright © 2017 Elsevier Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
A series of experiments were conducted to examine reductions in bacterial contamination of broiler carcasses washed in a spray cabinet with various concentrations of lauric acid (LA)-potassium hydroxide (KOH) solutions. Fifty eviscerated carcasses and 5 ceca were obtained from the processing line of...
Eubacterium rangiferina, a novel usnic acid-resistant bacterium from the reindeer rumen
NASA Astrophysics Data System (ADS)
Sundset, Monica A.; Kohn, Alexandra; Mathiesen, Svein D.; Præsteng, Kirsti E.
2008-08-01
Reindeer are able to eat and utilize lichens as an important source of energy and nutrients. In the current study, the activities of antibiotic secondary metabolites including usnic, antranoric, fumarprotocetraric, and lobaric acid commonly found in lichens were tested against a collection of 26 anaerobic rumen bacterial isolates from reindeer ( Rangifer tarandus tarandus) using the agar diffusion method. The isolates were identified based on their 16S ribosomal ribonucleic acid (rRNA) gene sequences. Usnic acid had a potent antimicrobial effect against 25 of the isolates, belonging to Clostridiales, Enterococci, and Streptococci. Isolates of Clostridia and Streptococci were also susceptible to atranoric and lobaric acid. However, one isolate (R3_91_1) was found to be resistant to usnic, antranoric, fumarprotocetraric, and lobaric acid. R3_91_1 was also seen invading and adhering to lichen particles when grown in a liquid anaerobic culture as demonstrated by transmission electron microscopy. This was a Gram-negative, nonmotile rod (0.2-0.7 × 2.0-3.5 μm) with a deoxyribonucleic acid G + C content of 47.0 mol% and main cellular fatty acids including 15:0 anteiso-dimethyl acetal (DMA), 16:0 iso-fatty acid methyl ester (FAME), 13:0 iso-3OH FAME, and 17:0 anteiso-FAME, not matching any of the presently known profiles in the MIDI database. Combined, the phenotypic and genotypic traits including the 16S rRNA gene sequence show that R3_91_1 is a novel species inside the order Clostridiales within the family Lachnospiraceae, for which we propose the name Eubacterium rangiferina. This is the first record of a rumen bacterium able to tolerate and grow in the presence of usnic acid, indicating that the rumen microorganisms in these animals have adapted mechanisms to deal with lichen secondary metabolites, well known for their antimicrobial and toxic effects.
Ohr plays a central role in bacterial responses against fatty acid hydroperoxides and peroxynitrite
Alegria, Thiago G. P.; Hugo, Martín; Trujillo, Madia; de Oliveira, Marcos Antonio; Miyamoto, Sayuri; Queiroz, Raphael F.; Valadares, Napoleão Fonseca; Garratt, Richard C.; Radi, Rafael; Di Mascio, Paolo; Augusto, Ohara
2017-01-01
Organic hydroperoxide resistance (Ohr) enzymes are unique Cys-based, lipoyl-dependent peroxidases. Here, we investigated the involvement of Ohr in bacterial responses toward distinct hydroperoxides. In silico results indicated that fatty acid (but not cholesterol) hydroperoxides docked well into the active site of Ohr from Xylella fastidiosa and were efficiently reduced by the recombinant enzyme as assessed by a lipoamide-lipoamide dehydrogenase–coupled assay. Indeed, the rate constants between Ohr and several fatty acid hydroperoxides were in the 107–108 M−1⋅s−1 range as determined by a competition assay developed here. Reduction of peroxynitrite by Ohr was also determined to be in the order of 107 M−1⋅s−1 at pH 7.4 through two independent competition assays. A similar trend was observed when studying the sensitivities of a ∆ohr mutant of Pseudomonas aeruginosa toward different hydroperoxides. Fatty acid hydroperoxides, which are readily solubilized by bacterial surfactants, killed the ∆ohr strain most efficiently. In contrast, both wild-type and mutant strains deficient for peroxiredoxins and glutathione peroxidases were equally sensitive to fatty acid hydroperoxides. Ohr also appeared to play a central role in the peroxynitrite response, because the ∆ohr mutant was more sensitive than wild type to 3-morpholinosydnonimine hydrochloride (SIN-1 , a peroxynitrite generator). In the case of H2O2 insult, cells treated with 3-amino-1,2,4-triazole (a catalase inhibitor) were the most sensitive. Furthermore, fatty acid hydroperoxide and SIN-1 both induced Ohr expression in the wild-type strain. In conclusion, Ohr plays a central role in modulating the levels of fatty acid hydroperoxides and peroxynitrite, both of which are involved in host–pathogen interactions. PMID:28028230
Kunihiro, Tadao; Veuger, Bart; Vasquez-Cardenas, Diana; Pozzato, Lara; Le Guitton, Marie; Moriya, Kazuyoshi; Kuwae, Michinobu; Omori, Koji; Boschker, Henricus T S; van Oevelen, Dick
2014-01-01
Phospholipid-derived fatty acids (PLFA) and respiratory quinones (RQ) are microbial compounds that have been utilized as biomarkers to quantify bacterial biomass and to characterize microbial community structure in sediments, waters, and soils. While PLFAs have been widely used as quantitative bacterial biomarkers in marine sediments, applications of quinone analysis in marine sediments are very limited. In this study, we investigated the relation between both groups of bacterial biomarkers in a broad range of marine sediments from the intertidal zone to the deep sea. We found a good log-log correlation between concentrations of bacterial PLFA and RQ over several orders of magnitude. This relationship is probably due to metabolic variation in quinone concentrations in bacterial cells in different environments, whereas PLFA concentrations are relatively stable under different conditions. We also found a good agreement in the community structure classifications based on the bacterial PLFAs and RQs. These results strengthen the application of both compounds as quantitative bacterial biomarkers. Moreover, the bacterial PLFA- and RQ profiles revealed a comparable dissimilarity pattern of the sampled sediments, but with a higher level of dissimilarity for the RQs. This means that the quinone method has a higher resolution for resolving differences in bacterial community composition. Combining PLFA and quinone analysis as a complementary method is a good strategy to yield higher resolving power in bacterial community structure.
Aldunate, Muriel; Srbinovski, Daniela; Hearps, Anna C.; Latham, Catherine F.; Ramsland, Paul A.; Gugasyan, Raffi; Cone, Richard A.; Tachedjian, Gilda
2015-01-01
Lactic acid and short chain fatty acids (SCFAs) produced by vaginal microbiota have reported antimicrobial and immune modulatory activities indicating their potential as biomarkers of disease and/or disease susceptibility. In asymptomatic women of reproductive-age the vaginal microbiota is comprised of lactic acid-producing bacteria that are primarily responsible for the production of lactic acid present at ~110 mM and acidifying the vaginal milieu to pH ~3.5. In contrast, bacterial vaginosis (BV), a dysbiosis of the vaginal microbiota, is characterized by decreased lactic acid-producing microbiota and increased diverse anaerobic bacteria accompanied by an elevated pH>4.5. BV is also characterized by a dramatic loss of lactic acid and greater concentrations of mixed SCFAs including acetate, propionate, butyrate, and succinate. Notably women with lactic acid-producing microbiota have more favorable reproductive and sexual health outcomes compared to women with BV. Regarding the latter, BV is associated with increased susceptibility to sexually transmitted infections (STIs) including HIV. In vitro studies demonstrate that lactic acid produced by vaginal microbiota has microbicidal and virucidal activities that may protect against STIs and endogenous opportunistic bacteria as well as immune modulatory properties that require further characterization with regard to their effects on the vaginal mucosa. In contrast, BV-associated SCFAs have far less antimicrobial activity with the potential to contribute to a pro-inflammatory vaginal environment. Here we review the composition of lactic acid and SCFAs in respective states of eubiosis (non-BV) or dysbiosis (BV), their effects on susceptibility to bacterial/viral STIs and whether they have inherent microbicidal/virucidal and immune modulatory properties. We also explore their potential as biomarkers for the presence and/or increased susceptibility to STIs. PMID:26082720
Bacterial fatty acids enhance recovery from the dauer larva in Caenorhabditis elegans.
Kaul, Tiffany K; Reis Rodrigues, Pedro; Ogungbe, Ifedayo V; Kapahi, Pankaj; Gill, Matthew S
2014-01-01
The dauer larva is a specialized dispersal stage in the nematode Caenorhabditis elegans that allows the animal to survive starvation for an extended period of time. The dauer does not feed, but uses chemosensation to identify new food sources and to determine whether to resume reproductive growth. Bacteria produce food signals that promote recovery of the dauer larva, but the chemical identities of these signals remain poorly defined. We find that bacterial fatty acids in the environment augment recovery from the dauer stage under permissive conditions. The effect of increased fatty acids on different dauer constitutive mutants indicates a role for insulin peptide secretion in coordinating recovery from the dauer stage in response to fatty acids. These data suggest that worms can sense the presence of fatty acids in the environment and that elevated levels can promote recovery from dauer arrest. This may be important in the natural environment where the dauer larva needs to determine whether the environment is appropriate to support reproductive growth following dauer exit.
Price, Christopher T D; Richards, Ashley M; Von Dwingelo, Juanita E; Samara, Hala A; Abu Kwaik, Yousef
2014-02-01
Legionella pneumophila, the causative agent of Legionnaires' disease, invades and proliferates within a diverse range of free-living amoeba in the environment, but upon transmission to humans, the bacteria hijack alveolar macrophages. Intracellular proliferation of L. pneumophila in two evolutionarily distant hosts is facilitated by bacterial exploitation of conserved host processes that are targeted by bacterial protein effectors injected into the host cell. A key aspect of microbe-host interaction is microbial extraction of nutrients from the host, but understanding of this is still limited. AnkB functions as a nutritional virulence factor and promotes host proteasomal degradation of polyubiquitinated proteins generating gratuitous levels of limiting host cellular amino acids. Legionella pneumophila is auxotrophic for several amino acids including cysteine, which is a metabolically preferred source of carbon and energy during intracellular proliferation, but is limiting in both amoebae and humans. We propose that synchronization of bacterial amino acids auxotrophy with the host is a driving force in pathogenic evolution and nutritional adaptation of L. pneumophila and other intracellular bacteria to life within the host cell. Understanding microbial strategies of nutrient generation and acquisition in the host will provide novel antimicrobial strategies to disrupt pathogen access to essential sources of carbon and energy. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.
Bacterial utilization of L-sugars and D-amino acids
NASA Astrophysics Data System (ADS)
Pikuta, Elena V.; Hoover, Richard B.; Klyce, Brig; Davies, Paul C. W.; Davies, Pauline
2006-08-01
The fact that organotrophic organisms on Earth use L-amino acids and D-sugars as an energy source is recognized as one of the universal features of life. The chirality of organic molecules with asymmetric location of group-radicals was described a relatively long time ago. Louis Pasteur observed that abiotic (chemical) processes produced mixtures with equal numbers (racemic) of the two forms but that living organisms possessed a molecular asymmetry that included only one of the enantiomers (homochirality). He speculated that the origin of the asymmetry of chiral biomolecules might hold the key to the nature of life. All of the amino acids in proteins (except for Glycine which is symmetrical) exhibit the same absolute steric configuration as L-glyceraldehyde. D-amino acids are never found in proteins, although they do exist in nature and are often found in polypeptide antibiotics. Constitutional sugars of cells, opposite to the amino acids, are the D-enantiomers, and the appearance of L-sugars in Nature is extremely rare. Notwithstanding this fact, the metabolism of some bacteria does have the capability to use amino acids and sugars with alternative chirality. This property may be caused by the function of specific enzymes belonging to the class of isomerases (racemases, epimerases, isomerases, tautomerases). In our laboratory, we have investigated several anaerobic bacterial strains, and have found that some of these bacteria are capable of using D-amino acids and L-sugars. Strain BK1 is capable of growth on D-arginine, but its growth characteristics on L-arginine are approximately twice as high. Another alkaliphilic strain SCA T (= ATCC BAA-1084 T = JCM 12857 T = DSM 17722 T = CIP 107910 T) was found to be capable of growth on L-ribose and L-arabinose. It is interesting that this strain was incapable of growth on D-arabinose, which suggests the involvement of some alternative mechanism of enzyme activity. In this paper, we describe the preliminary results of
Bacterial, Archaeal, and Eukaryotic Diversity across Distinct Microhabitats in an Acid Mine Drainage
Mesa, Victoria; Gallego, Jose L. R.; González-Gil, Ricardo; Lauga, Béatrice; Sánchez, Jesús; Méndez-García, Celia; Peláez, Ana I.
2017-01-01
Acid mine drainages are characterized by their low pH and the presence of dissolved toxic metallic species. Microorganisms survive in different microhabitats within the ecosystem, namely water, sediments, and biofilms. In this report, we surveyed the microbial diversity within all domains of life in the different microhabitats at Los Rueldos abandoned mercury underground mine (NW Spain), and predicted bacterial function based on community composition. Sediment samples contained higher proportions of soil bacteria (AD3, Acidobacteria), as well as Crenarchaeota and Methanomassiliicoccaceae archaea. Oxic and hypoxic biofilm samples were enriched in bacterial iron oxidizers from the genus Leptospirillum, order Acidithiobacillales, class Betaproteobacteria, and archaea from the class Thermoplasmata. Water samples were enriched in Cyanobacteria and Thermoplasmata archaea at a 3–98% of the sunlight influence, whilst Betaproteobacteria, Thermoplasmata archaea, and Micrarchaea dominated in acid water collected in total darkness. Stalactites hanging from the Fe-rich mine ceiling were dominated by the neutrophilic iron oxidizer Gallionella and other lineages that were absent in the rest of the microhabitats (e.g., Chlorobi, Chloroflexi). Eukaryotes were detected in biofilms and open-air water samples, and belonged mainly to clades SAR (Alveolata and Stramenopiles), and Opisthokonta (Fungi). Oxic and hypoxic biofilms displayed higher proportions of ciliates (Gonostomum, Oxytricha), whereas water samples were enriched in fungi (Paramicrosporidium and unknown microbial Helotiales). Predicted function through bacterial community composition suggested adaptive evolutive convergence of function in heterogeneous communities. Our study showcases a broad description of the microbial diversity across different microhabitats in the same environment and expands the knowledge on the diversity of microbial eukaryotes in AMD habitats. PMID:28955322
NASA Astrophysics Data System (ADS)
Rice, Charles V.; Wickham, Jason R.; Eastman, Margaret A.; Harrison, William; Pereira, Mark P.; Brown, Eric D.
2008-08-01
Numerous chemical additives lower the freezing point of water, but life at sub-zero temperatures is sustained by a limited number of biological cryoprotectants. Antifreeze proteins in fish, plants, and insects provide protection to a few degrees below freezing. Microbes have been found to survive at even lower temperatures, although, with a few exceptions, antifreeze proteins are missing. Survival has been attributed to external factors, such as high salt concentration (brine veins) and adhesion to particulates or ice crystal defects. Teichoic acid is a phosphodiester polymer ubiquitous in Gram positive bacteria, composing 50% of the mass of the bacterial cell wall and excreted into the extracellular space of biofilm communities. We have found that when bound to the peptidoglycan cell wall (wall teichoic acid) or as a free molecule (lipoteichoic acid), teichoic acid is surrounded by liquid water at temperatures significantly below freezing. Using solid-state NMR, we are unable to collect 31P CPMAS spectra for frozen solutions of lipoteichoic acid at temperatures above -60 °C. For wall teichoic acid in D2O, signals are not seen above -30 °C. These results can be explained by the presence of liquid water, which permits rapid molecular motion to remove 1H/31P dipolar coupling. 2H quadrupole echo NMR spectroscopy reveals that both liquid and solid water are present. We suggest that teichoic acids could provide a shell of liquid water around biofilms and planktonic bacteria, removing the need for brine veins to prevent bacterial freezing.
Gu, Qun; David, Frank; Lynen, Frédéric; Rumpel, Klaus; Xu, Guowang; De Vos, Paul; Sandra, Pat
2010-06-25
Comprehensive two-dimensional gas chromatography (GCxGC) offers an interesting tool for profiling bacterial fatty acids. Flow modulated GCxGC using a commercially available system was evaluated, different parameters such as column flows and modulation time were optimized. The method was tested on bacterial fatty acid methyl esters (BAMEs) from Stenotrophomonas maltophilia LMG 958T by using parallel flame ionization detector (FID)/mass spectrometry (MS). The results are compared to data obtained using a thermal modulated GCxGC system. The data show that flow modulated GCxGC-FID/MS method can be applied in a routine environment and offers interesting perspectives for chemotaxonomy of bacteria.
Federal Register 2010, 2011, 2012, 2013, 2014
2012-11-15
... Blood and Blood Components, Including Source Plasma, To Reduce the Risk of Transmission of Hepatitis B... Components, including Source Plasma, to Reduce the Risk of Transmission of Hepatitis B Virus,'' dated October... (NAT) to screen blood donors for hepatitis B virus (HBV) deoxyribonucleic acid (DNA) and...
Mainini, G; Rotondi, M; Scaffa, C
2011-01-01
PURPOSE OF INVESTIGATIONS: The aim of this randomized controlled trial was to evaluate efficacy and tolerability of a new association of lipohydroperoxides and glycyrrhetic acid on topical treatment of bacterial and mycotic vulvovaginitis. One hundred consecutive patients with bacterial or mycotic vulvovaginitis were randomly assigned to a study group treated with vaginal lipohydroperoxides and a derivative of glycyrrhetic acid for three days (n = 50), and a control group using vaginal antibacterial metronidazole (500 mg) or antimycotic econazole (150 mg) for six days (n = 50). A clinical and microbiological response was achieved in 80.4% and 88.9% in investigational and control group, respectively (p > 0.05). Compared to traditional antimicrobial drugs, the effect appears to be faster and safer, even if not significantly. The 6-month recurrence rate was 7.7% and 5.6% in the investigational and control group, respectively. Topical medication based on lipohydroperoxides and glycyrrhetic acid showed a clinical and microbiological efficacy in the first-line treatment of bacterial and mycotic vulvovaginitis, comparable to conventional drugs.
Tücking, Katrin-Stephanie; Grützner, Verena; Unger, Ronald E; Schönherr, Holger
2015-07-01
The synthesis of novel amphiphilic hyaluronic acid (HYA) and poly(lactic acid) (PLA) block copolymers is reported as the key element of a strategy to detect the presence of pathogenic bacterial enzymes. In addition to the formation of defined HYA-block-PLA assemblies, the encapsulation of fluorescent reporter dyes and the selective enzymatic degradation of the capsules by hyaluronidase and proteinase K are studied. The synthesis of the dual enzyme-responsive HYA-b-PLA is carried out by copper-catalyzed Huisgen 1,3-dipolar cycloaddition. The resulting copolymers are assembled in water to form vesicular structures, which are characterized by scanning electron microscopy, transmission electron microscopy, dynamic light scattering (DLS), and fluorescence lifetime imaging microscopy (FLIM). DLS measurements show that both enzymes cause a rapid decrease in the hydrodynamic diameter of the nanocapsules. Fluorescence spectroscopy data confirm the liberation of encapsulated dye, which indicates the disintegration of the capsules and validates the concept of enzymatically triggered payload release. Finally, cytotoxicity assays confirm that the HYA-b-PLA nanocapsules are biocompatible with primary human dermal microvascular endothelial cells. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sousa, Ângela; Pereira, Patrícia; Sousa, Fani; Queiroz, João A
2014-10-31
Histamine and agmatine amino acid derivatives were immobilized into monolithic disks, in order to combine the specificity and selectivity of the ligand with the high mass transfer and binding capacity offered by monolithic supports, to purify potential plasmid DNA biopharmaceuticals. Different elution strategies were explored by changing the type and salt concentration, as well as the pH, in order to understand the retention pattern of different plasmids isoforms The pVAX1-LacZ supercoiled isoform was isolated from a mixture of pDNA isoforms by using NaCl increasing stepwise gradient and also by ammonium sulfate decreasing stepwise gradient, in both histamine and agmatine monoliths. Acidic pH in the binding buffer mainly strengthened ionic interactions with both ligands in the presence of sodium chloride. Otherwise, for histamine ligand, pH values higher than 7 intensified hydrophobic interactions in the presence of ammonium sulfate. In addition, circular dichroism spectroscopy studies revealed that the binding and elution chromatographic conditions, such as the combination of high ionic strength with extreme pH values can reversibly influence the structural stability of the target nucleic acid. Therefore, ascending sodium chloride gradients with pH manipulation can be preferable chromatographic conditions to be explored in the purification of plasmid DNA biopharmaceuticals, in order to avoid the environmental impact of ammonium sulfate. Copyright © 2014. Published by Elsevier B.V.
Acidic pH sensing in the bacterial cytoplasm is required for Salmonella virulence.
Choi, Jeongjoon; Groisman, Eduardo A
2016-09-01
pH regulates gene expression, biochemical activities and cellular behaviors. A mildly acidic pH activates the master virulence regulatory system PhoP/PhoQ in the facultative intracellular pathogen Salmonella enterica serovar Typhimurium. The sensor PhoQ harbors an extracytoplasmic domain implicated in signal sensing, and a cytoplasmic domain controlling activation of the regulator PhoP. We now report that, surprisingly, a decrease in Salmonella's own cytoplasmic pH induces transcription of PhoP-activated genes even when the extracytoplasmic pH remains neutral. Amino acid substitutions in PhoQ's cytoplasmic domain hindered activation by acidic pH and attenuated virulence in mice, but did not abolish activation by low Mg(2+) or the antimicrobial peptide C18G. Conversely, removal of PhoQ's extracytoplasmic domains prevented the response to the latter PhoQ-activating signals but not to acidic pH. PhoP-dependent genes were minimally induced by acidic pH in the non-pathogenic species Salmonella bongori but were activated by low Mg(2+) and C18G as in pathogenic S. enterica. Our findings indicate that the sensor PhoQ enables S. enterica to respond to both host- and bacterial-derived signals that alter its cytoplasmic pH. © 2016 John Wiley & Sons Ltd.
Inhibition of protein synthesis in intact HeLa cells by Shigella dysenteriae 1 toxin.
Brown, J E; Rothman, S W; Doctor, B P
1980-07-01
Shiga toxin purified to near homogeneity from cell lysates of Shigella dysenteriae 1 inhibited protein and deoxyribonucle acid syntheses in intact HeLa cells. Inhibition was dependent on toxin concentration and time of incubation. A minimal latent period of 30 min was observed with saturating doses of toxin. Ribonucleic acid synthesis, uptake of alpha-aminoisobutyric acid, and maintenance of intracellular K+ concentrations were not affected until well after maximal inhibition of protein and deoxyribonucleic acid syntheses. The inhibitory effect of toxin was sensitive to heat inactivation and was prevented by antibody neutralization. Several cytotoxic components were separated by polyacrylamide gel electrophoresis of the purified toxin preparations; all inhibited protein and deoxyribonucleic acid syntheses equally.
Evangelopoulos, Dimitrios; Whittaker, Elizabeth; Honeyborne, Isobella; McHugh, Timothy D; Klein, Nigel; Shingadia, Delane
2017-02-26
Tuberculosis is an infection that requires at least 6 months of chemotherapy in order to clear the bacteria from the patient's lungs. Usually, therapeutic monitoring is dependent on smear microscopy where a decline in acid-fast bacilli is observed. However, this might not be indicative of the actual decline of bacterial load and thus other tools such as culture and molecular assays are required for patient management. Here, we report the case of a 12-year-old Black African boy co-infected with tuberculosis and human immunodeficiency virus who remained smear culture positive and liquid culture negative for a prolonged period of time following chemotherapy. In order to determine whether there was any live bacteria present in his specimens, we applied the newly developed molecular bacterial load assay that detects the presence of 16S ribosomal ribonucleic acid derived from the bacteria. Using this methodology, we were able to quantify his bacterial load and inform the management of his treatment in order to reduce the disease burden. Following this intervention he went on to make a complete recovery. This case report highlights the value of improved biomarkers for monitoring the treatment of tuberculosis and the role of molecular assays such as the molecular bacterial load assay applied here. The molecular bacterial load assay detects bacterial ribonucleic acid which corresponds closely with the number of live bacilli as compared with polymerase chain reaction that detects deoxyribonucleic acid and may include dead bacteria.
Bacterial Utilization of L-sugars and D-amino Acids
NASA Technical Reports Server (NTRS)
Pikuta, Elena; Hoover, Richard B.; Klyce, Brig; Davies, Paul C. W.; Davies, Pauline
2006-01-01
The fact that organotrophic organisms on Earth use L-amino acids and D-sugars as an energy source is recognized as one of the universal features of life. The chirality of organic molecules with asymmetric location of group- radicals was described a relatively long time ago. In 1848, Louis Pasteur discovered chiral molecules when he investigated the way that crystals of sodium ammonium paratartrate rotated the plane of polarization of light. He found that the crystal structures represented the underlying asymmetry of molecules that existed in either lea-handed or right-handed forms (enantiomers). Pasteur observed that abiotic (chemical) processes produced mixtures with equal numbers (racemic) of the two forms but that living organisms possessed a molecular asymmetry that included only one of the enantiomers (homochirality). He speculated that the origin of the asymmetry of chiral biomolecules might hold the key to the nature of life. All of the amino acids in proteins (except for Glycine which is symmetrical) exhibit the same absolute steric configuration as L-glyceraldehyde. D-amino acids are never found in proteins, although they do exist in nature and are often found in polypeptide antibiotics. Constitutional sugars of cells, opposite to the amino acids, are the D-enantiomers, and the appearance of L-sugars in Nature is extremely rare. Notwithstanding this fact, the metabolism of some bacteria does have capability to use amino acids and sugars with alternative chirality. This property may be caused by the function of specific enzymes belonging to the class of isomerases (racemases, epimerases, isomerases, tautomerases). In our laboratory, we have investigated several anaerobic bacterial strains, and have found that some of these bacteria are capable of using D-amino acids and L-sugars. Strain BK1 is capable of growth on D-arginine, but its growth characteristics on L-arginine are approximately twice higher. Another alkaliphilic strain SCAT(sup T) (= ATCC BAA-1084
McDonald, Nathan D.; Lubin, Jean-Bernard; Chowdhury, Nityananda
2016-01-01
ABSTRACT A major challenge facing bacterial intestinal pathogens is competition for nutrient sources with the host microbiota. Vibrio cholerae is an intestinal pathogen that causes cholera, which affects millions each year; however, our knowledge of its nutritional requirements in the intestinal milieu is limited. In this study, we demonstrated that V. cholerae can grow efficiently on intestinal mucus and its component sialic acids and that a tripartite ATP-independent periplasmic SiaPQM strain, transporter-deficient mutant NC1777, was attenuated for colonization using a streptomycin-pretreated adult mouse model. In in vivo competition assays, NC1777 was significantly outcompeted for up to 3 days postinfection. NC1777 was also significantly outcompeted in in vitro competition assays in M9 minimal medium supplemented with intestinal mucus, indicating that sialic acid uptake is essential for fitness. Phylogenetic analyses demonstrated that the ability to utilize sialic acid was distributed among 452 bacterial species from eight phyla. The majority of species belonged to four phyla, Actinobacteria (members of Actinobacillus, Corynebacterium, Mycoplasma, and Streptomyces), Bacteroidetes (mainly Bacteroides, Capnocytophaga, and Prevotella), Firmicutes (members of Streptococcus, Staphylococcus, Clostridium, and Lactobacillus), and Proteobacteria (including Escherichia, Shigella, Salmonella, Citrobacter, Haemophilus, Klebsiella, Pasteurella, Photobacterium, Vibrio, and Yersinia species), mostly commensals and/or pathogens. Overall, our data demonstrate that the ability to take up host-derived sugars and sialic acid specifically allows V. cholerae a competitive advantage in intestinal colonization and that this is a trait that is sporadic in its occurrence and phylogenetic distribution and ancestral in some genera but horizontally acquired in others. PMID:27073099
Marron, Alan O; Akam, Michael; Walker, Giselle
2013-01-01
Cultures of heterotrophic protists often require co-culturing with bacteria to act as a source of nutrition. Such cultures will contain varying levels of intrinsic bacterial contamination that can interfere with molecular research and cause problems with the collection of sufficient material for sequencing. Measuring the levels of bacterial contamination for the purposes of molecular biology research is non-trivial, and can be complicated by the presence of a diverse bacterial flora, or by differences in the relative nucleic acid yield per bacterial or eukaryotic cell. Here we describe a duplex PCR-based assay that can be used to measure the levels of contamination from marine bacteria in a culture of loricate choanoflagellates. By comparison to a standard culture of known target sequence content, the assay can be used to quantify the relative proportions of bacterial and choanoflagellate material in DNA or RNA samples extracted from a culture. We apply the assay to compare methods of purifying choanoflagellate cultures prior to DNA extraction, to determine their effectiveness in reducing bacterial contamination. Together with measurements of the total nucleic acid concentration, the assay can then be used as the basis for determining the absolute amounts of choanoflagellate DNA or RNA present in a sample. The assay protocol we describe here is a simple and relatively inexpensive method of measuring contamination levels in nucleic acid samples. This provides a new way to establish quantification and purification protocols for molecular biology and genomics in novel heterotrophic protist species. Guidelines are provided to develop a similar protocol for use with any protistan culture. This assay method is recommended where qPCR equipment is unavailable, where qPCR is not viable because of the nature of the bacterial contamination or starting material, or where prior sequence information is insufficient to develop qPCR protocols.
The effect of boric acid on bacterial culture of canine and feline urine.
Rowlands, M; Blackwood, L; Mas, A; Cripps, P; Crompton, C; Burrow, R
2011-10-01
To identify the optimal method of submission of canine and feline urine for bacterial culture. Cystocentesis samples from 250 animals (200 dogs, 50 cats) suspected of having urinary tract infections were collected. The reference aliquot, without preservative, was processed on site within 2 hours. Two further aliquots (one without preservative, one with boric acid) were stored at room temperature for up to 7 hours and then posted by guaranteed next day delivery to a commercial laboratory for analysis. Forty-seven of the samples were positive on culture in the reference test. There was no significant difference between reference test results and those of samples posted without preservative (P=0·39), but samples posted in boric acid were significantly less likely to give a positive result (P=0·01). Samples posted without preservative had a sensitivity of 82% and a specificity of 98%; for boric acid, sensitivity was 73% and specificity 99%. Postal urine samples should be submitted to the laboratory in a plain sterile tube. © 2011 British Small Animal Veterinary Association.
Wüst, Pia K.; Nacke, Heiko; Kaiser, Kristin; Marhan, Sven; Sikorski, Johannes; Kandeler, Ellen; Daniel, Rolf
2016-01-01
Modern sequencing technologies allow high-resolution analyses of total and potentially active soil microbial communities based on their DNA and RNA, respectively. In the present study, quantitative PCR and 454 pyrosequencing were used to evaluate the effects of different extraction methods on the abundance and diversity of 16S rRNA genes and transcripts recovered from three different types of soils (leptosol, stagnosol, and gleysol). The quality and yield of nucleic acids varied considerably with respect to both the applied extraction method and the analyzed type of soil. The bacterial ribosome content (calculated as the ratio of 16S rRNA transcripts to 16S rRNA genes) can serve as an indicator of the potential activity of bacterial cells and differed by 2 orders of magnitude between nucleic acid extracts obtained by the various extraction methods. Depending on the extraction method, the relative abundances of dominant soil taxa, in particular Actinobacteria and Proteobacteria, varied by a factor of up to 10. Through this systematic approach, the present study allows guidelines to be deduced for the selection of the appropriate extraction protocol according to the specific soil properties, the nucleic acid of interest, and the target organisms. PMID:26896137
Basu, Anirban; Kumar, Gopinatha Suresh
2016-08-01
Interaction of the food colorant acid red 27 with double stranded DNA was investigated using spectroscopic and calorimetric methods. Absorbance and fluorescence studies suggested an intimate binding interaction between the dye and DNA. The quantum efficiency value testified an effective energy transfer from the DNA base pairs to the dye molecules. Minor groove displacement assay with Hoechst 33258 revealed that the binding occurs in the minor groove of DNA. Circular dichroism studies revealed that acid red 27 induces moderate conformational perturbations in DNA. Results of calorimetric studies suggested that the complexation process was driven largely by positive entropic contribution with a smaller favorable enthalpy contribution. The equilibrium constant of the binding was calculated to be (3.04 ± 0.09) × 10(4) M(-1) at 298.15 K. Negative heat capacity value along with the enthalpy-entropy compensation phenomenon established the involvement of dominant hydrophobic forces in the binding process. Differential scanning calorimetry studies presented evidence for an increased thermal stability of DNA on binding of acid red 27. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Kidd, Haack S.; Garchow, H.; Odelson, D.A.; Forney, L.J.; Klug, M.J.
1994-01-01
We determined the accuracy and reproducibility of whole-community fatty acid methyl ester (FAME) analysis with two model bacterial communities differing in composition by using the Microbial ID, Inc. (MIDI), system. The biomass, taxonomic structure, and expected MIDI-FAME profiles under a variety of environmental conditions were known for these model communities a priori. Not all members of each community could be detected in the composite profile because of lack of fatty acid 'signatures' in some isolates or because of variations (approximately fivefold) in fatty acid yield across taxa. MIDI- FAME profiles of replicate subsamples of a given community were similar in terms of fatty acid yield per unit of community dry weight and relative proportions of specific fatty acids. Principal-components analysis (PCA) of MIDI-FAME profiles resulted in a clear separation of the two different communities and a clustering of replicates of each community from two separate experiments on the first PCA axis. The first PCA axis accounted for 57.1% of the variance in the data and was correlated with fatty acids that varied significantly between communities and reflected the underlying community taxonomic structure. On the basis of our data, community fatty acid profiles can be used to assess the relative similarities and differences of microbial communities that differ in taxonomic composition. However, detailed interpretation of community fatty acid profiles in terms of biomass or community taxonomic composition must be viewed with caution until our knowledge of the quantitative and qualitative distribution of fatty acids over a wide variety of taxa and the effects of growth conditions on fatty acid profiles is more extensive.
Helicase-dependent amplification of nucleic acids.
Cao, Yun; Kim, Hyun-Jin; Li, Ying; Kong, Huimin; Lemieux, Bertrand
2013-10-11
Helicase-dependent amplification (HDA) is a novel method for the isothermal in vitro amplification of nucleic acids. The HDA reaction selectively amplifies a target sequence by extension of two oligonucleotide primers. Unlike the polymerase chain reaction (PCR), HDA uses a helicase enzyme to separate the deoxyribonucleic acid (DNA) strands, rather than heat denaturation. This allows DNA amplification without the need for thermal cycling. The helicase used in HDA is a helicase super family II protein obtained from a thermophilic organism, Thermoanaerobacter tengcongensis (TteUvrD). This thermostable helicase is capable of unwinding blunt-end nucleic acid substrates at elevated temperatures (60° to 65°C). The HDA reaction can also be coupled with reverse transcription for ribonucleic acid (RNA) amplification. The products of this reaction can be detected during the reaction using fluorescent probes when incubations are conducted in a fluorimeter. Alternatively, products can be detected after amplification using a disposable amplicon containment device that contains an embedded lateral flow strip. Copyright © 2013 John Wiley & Sons, Inc.
Raghuwanshi, Shailendra; Dutt, Kakoli; Gupta, Pritesh; Misra, Swati; Saxena, Rajendra Kumar
2011-06-01
An indigenously isolated strain of Bacillus sphaericus was found to produce 1.21 IU/ml of tannase under unoptimized conditions. Optimizing the process one variable at a time resulted in the production of 7.6 IU/ml of tannase in 48 h in the presence of 1.5% tannic acid. A 9.26-fold increase in tannase production was achieved upon further optimization using response surface methodology (RSM), a statistical approach. This increase led to a production level of 11.2I U/ml in medium containing 2.0% tannic acid, 2.5% galactose, 0.25% ammonium chloride, and 0.1% MgSO(4) pH 6.0 incubated at 37°C and 100 rpm for 48 h with a 2.0% inoculum level. Scaling up tannase production in a 30-l bioreactor resulted in the production of 16.54 IU/ml after 36 h. Thus far, this tannase production is the highest reported in this bacterial strain. Partially purified tannase exhibited an optimum pH of 5.0 with activity in the pH range of 3 to 8; 50°C was the optimal temperature for activity. Efficient conversion of tannic acid to purified gallic acid (90.80%) was achieved through crystallization. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Ceccato-Antonini, Sandra Regina
2018-05-25
Ethanol bio-production in Brazil has some unique characteristics that inevitably lead to bacterial contamination, which results in the production of organic acids and biofilms and flocculation that impair the fermentation yield by affecting yeast viability and diverting sugars to metabolites other than ethanol. The ethanol-producing units commonly give an acid treatment to the cells after each fermentative cycle to decrease the bacterial number, which is not always effective. An alternative strategy must be employed to avoid bacterial multiplication but must be compatible with economic, health and environmental aspects. This review analyzes the issue of bacterial contamination in sugarcane-based fuel ethanol fermentation, and the potential strategies that may be utilized to control bacterial growth besides acid treatment and antibiotics. We have emphasized the efficiency and suitability of chemical products other than acids and those derived from natural sources in industrial conditions. In addition, we have also presented bacteriocins, bacteriophages, and beneficial bacteria as non-conventional antimicrobial agents to mitigate bacterial contamination in the bioethanol industry.
Biotechnological Production of Caffeic Acid by Bacterial Cytochrome P450 CYP199A2
Arai, Yuka; Kino, Kuniki
2012-01-01
Caffeic acid is a biologically active molecule that has various beneficial properties, including antioxidant, anticancer, and anti-inflammatory activities. In this study, we explored the catalytic potential of a bacterial cytochrome P450, CYP199A2, for the biotechnological production of caffeic acid. When the CYP199A2 enzyme was reacted with p-coumaric acid, it stoichiometrically produced caffeic acid. The crystal structure of CYP199A2 shows that Phe at position 185 is situated directly above, and only 6.35 Å from, the heme iron. This F185 residue was replaced with hydrophobic or hydroxylated amino acids using site-directed mutagenesis to create mutants with novel and improved catalytic properties. In whole-cell assays with the known substrate of CYP199A2, 2-naphthoic acid, only the wild-type enzyme hydroxylated 2-naphthoic acid at the C-7 and C-8 positions, whereas all of the active F185 mutants exhibited a preference for C-5 hydroxylation. Interestingly, several F185 mutants (F185V, F185L, F185I, F185G, and F185A mutants) also acquired the ability to hydroxylate cinnamic acid, which was not hydroxylated by the wild-type enzyme. These results demonstrate that F185 is an important residue that controls the regioselectivity and the substrate specificity of CYP199A2. Furthermore, Escherichia coli cells expressing the F185L mutant exhibited 5.5 times higher hydroxylation activity for p-coumaric acid than those expressing the wild-type enzyme. By using the F185L whole-cell catalyst, the production of caffeic acid reached 15 mM (2.8 g/liter), which is the highest level so far attained in biotechnological production of this compound. PMID:22729547
The feasibility of using probes directed towards ribosomal DNAs (rDNAs) as a quantitative approach to estimating cell numbers was examined and applied to study the structure of a bacterial community in humic acid-rich salt marsh sediments. Hybridizations were performed with membr...
Homology among tet determinants in conjugative elements of streptococci.
Smith, M D; Hazum, S; Guild, W R
1981-01-01
A mutation to tetracycline sensitivity in a resistant strain of Streptococcus pneumoniae was shown by several criteria to be due to a point mutation in the conjugative omega (cat-tet) element found in the chromosomes of strains derived from BM6001, a clinical strain resistant to tetracycline and chloramphenicol. Strains carrying the mutation were transformed back to tetracycline resistance with the high efficiency of a point marker by donor deoxyribonucleic acids from its ancestral strain and from nine other clinical isolates of pneumococcus and by deoxyribonucleic acids from group D Streptococcus faecalis and group B Streptococcus agalactiae strains that also carry conjugative tet elements in their chromosomes. It was not transformed to resistance by tet plasmid deoxyribonucleic acids from either gram-negative or gram-positive species, except for one that carried transposon Tn916, the conjugative tet element present in the chromosomes of some S. faecalis strains. The results showed that the tet determinants in conjugative elements of several streptococcal species share a high degree of deoxyribonucleic acid sequence homology and suggested that they differ from other tet genes. PMID:6270063
Weber, Heike E; Gottardi, Manuela; Brückner, Christine; Oreb, Mislav; Boles, Eckhard; Tripp, Joanna
2017-05-15
Biotechnological production of cis , cis -muconic acid from renewable feedstocks is an environmentally sustainable alternative to conventional, petroleum-based methods. Even though a heterologous production pathway for cis , cis -muconic acid has already been established in the host organism Saccharomyces cerevisiae , the generation of industrially relevant amounts of cis , cis -muconic acid is hampered by the low activity of the bacterial protocatechuic acid (PCA) decarboxylase AroY isomeric subunit C iso (AroY-C iso ), leading to secretion of large amounts of the intermediate PCA into the medium. In the present study, we show that the activity of AroY-C iso in S. cerevisiae strongly depends on the strain background. We could demonstrate that the strain dependency is caused by the presence or absence of an intact genomic copy of PAD1 , which encodes a mitochondrial enzyme responsible for the biosynthesis of a prenylated form of the cofactor flavin mononucleotide (prFMN). The inactivity of AroY-C iso in strain CEN.PK2-1 could be overcome by plasmid-borne expression of Pad1 or its bacterial homologue AroY subunit B (AroY-B). Our data reveal that the two enzymes perform the same function in decarboxylation of PCA by AroY-C iso , although coexpression of Pad1 led to higher decarboxylase activity. Conversely, AroY-B can replace Pad1 in its function in decarboxylation of phenylacrylic acids by ferulic acid decarboxylase Fdc1. Targeting of the majority of AroY-B to mitochondria by fusion to a heterologous mitochondrial targeting signal did not improve decarboxylase activity of AroY-C iso , suggesting that mitochondrial localization has no major impact on cofactor biosynthesis. IMPORTANCE In Saccharomyces cerevisiae , the decarboxylation of protocatechuic acid (PCA) to catechol is the bottleneck reaction in the heterologous biosynthetic pathway for production of cis , cis -muconic acid, a valuable precursor for the production of bulk chemicals. In our work, we demonstrate
Complementary deoxyribonucleic acid cloning of spermatogonial stem cell renewal factor.
Miura, Takeshi; Ohta, Takashi; Miura, Chiemi I; Yamauchi, Kohei
2003-12-01
Spermatogonial mitosis can be subdivided into two processes: spermatogonial stem cell renewal and spermatogonial proliferation toward meiosis. Recently it has been indicated that estrogen, estradiol-17beta, is involved in regulating the renewal of spermatogonial stem cells in eel. To determine the genes that directly regulate this process, we used expression screening to identify genes whose expression is regulated by estradiol-17beta in testes. We detected a previously unidentified cDNA clone that is up-regulated by estradiol-17beta stimulation and named it eel spermatogenesis-related substances 34 (eSRS34) cDNA. Homology searching showed that eSRS34 shares amino acid sequence similarity with human platelet-derived endothelial cell growth factor. We examined the function of eSRS34 using several in vitro systems. Recombinant eSRS34 produced by a baculovirus system induced spermatogonial mitosis in testicular organ culture. Furthermore, the addition of an antibody specific for eSRS34 prevented spermatogonial mitosis induced by estradiol-17beta stimulation in a germ cell/somatic cell coculture system. We therefore conclude that eSRS34 is a "spermatogonial stem cell renewal factor."
Fu, Liang; Chen, Siqian; Yi, Jiulong; Hou, Zongxia
2014-07-01
A strain of acidogenic bacterium was isolated from the fermentation liquid of Cantonese-style rice vinegar produced by traditional surface fermentation. 16S rDNA identification confirmed the bacterium as Gluconacetobacter xylinus, which synthesizes bacterial cellulose, and the acid productivity of the strain was investigated. In the study, the effects of the membrane integrity and the comparison of the air-liquid interface membrane with immerged membrane on total acidity, cellulose production, alcohol dehydrogenase (ADH) activity and number of bacteria were investigated. The cellulose membrane and the bacteria were observed under SEM for discussing their relationship. The correlations between oxygen consumption and total acid production rate were compared in surface and shake flask fermentation. The results showed the average acid productivity of the strain was 0.02g/(100mL/h), and the integrity of cellulose membrane in surface fermentation had an important effect on total acidity and cellulose production. With a higher membrane integrity, the total acidity after 144 h of fermentation was 3.75 g/100 mL, and the cellulose production was 1.71 g/100 mL after 360 h of fermentation. However, when the membrane was crushed by mechanical force, the total acidity and the cellulose production were as low as 0.36 g/100 mL and 0.14 g/100 mL, respectively. When the cellulose membrane was forced under the surface of fermentation liquid, the total acid production rate was extremely low, but the activity of ADH in the cellulose membrane was basically the same with the one above the liquid surface. The bacteria were mainly distributed in the cellulose membrane during the fermentation. The bacterial counts in surface fermentation were more than in the shake flask fermentation and G. xylinus consumed the substrate faster, in surface fermentation than in shake flask fermentation. The oxygen consumption rate and total acid production rate of surface fermentation were respectively 26
Barrios, Carlos A; Xu, Qingwei; Cutright, Teresa; Newby, Bi-min Zhang
2005-03-25
Biofouling has posed serious problems in maritime industry including increased fuel consumptions, economic loss from ship-hull maintenances, contamination of drinking water, and serious corrosion for mechanical instruments. Minimizing the attachment of bacteria and formation of biofilm could be advantageous in reducing the early stages of biofouling. Zosteric acid, a natural product present in eelgrass, was found to have ability for preventing the attachment of some bacteria and barnacles. In this study, the antifouling ability of zosteric acid during the early stages of fouling was evaluated using attachment studies of fresh water bacteria. Simultaneously, various methods were sought for incorporating zosteric acid into silicone to prolong the release of the compound. The main results from this study were that zosteric acid exhibited anti-bacterial attachment regardless of whether it dispersed in water or incorporated into a coating. In addition, the release rate of zosteric acid from the incorporated coatings, particularly those where zosteric acid was uniformly dispersed with aggregates size of 4 microm or less, was orders of magnitude slower than those of previous reports. The release results indicate that the service life of our coatings could be far extended even with a small amount of zosteric acid incorporated.
Disease notes - Bacterial root rot
USDA-ARS?s Scientific Manuscript database
Bacterial root rot initiated by lactic acid bacteria, particularly Leuconostoc, occurs every year in Idaho sugarbeet fields. Hot fall weather seems to make the problem worse. Although Leuconostoc initiates the rot, other bacteria and yeast frequently invade the tissue as well. The acetic acid bac...
USDA-ARS?s Scientific Manuscript database
We previously reported the apparent formation of matrix adducts of 3,5-dimethoxy-4-hydroxy-cinnamic acid (sinapinic acid or SA) via covalent attachment to disulfide bond-containing proteins (HdeA, HdeB and YbgS) from bacterial cell lysates ionized by matrix-assisted laser desorption/ionization (MALD...
McDonald, Nathan D; Lubin, Jean-Bernard; Chowdhury, Nityananda; Boyd, E Fidelma
2016-04-12
A major challenge facing bacterial intestinal pathogens is competition for nutrient sources with the host microbiota.Vibrio cholerae is an intestinal pathogen that causes cholera, which affects millions each year; however, our knowledge of its nutritional requirements in the intestinal milieu is limited. In this study, we demonstrated that V. cholerae can grow efficiently on intestinal mucus and its component sialic acids and that a tripartite ATP-independent periplasmic SiaPQM strain, transporter-deficient mutant NC1777, was attenuated for colonization using a streptomycin-pretreated adult mouse model. In in vivo competition assays, NC1777 was significantly outcompeted for up to 3 days postinfection. NC1777 was also significantly outcompeted in in vitro competition assays in M9 minimal medium supplemented with intestinal mucus, indicating that sialic acid uptake is essential for fitness. Phylogenetic analyses demonstrated that the ability to utilize sialic acid was distributed among 452 bacterial species from eight phyla. The majority of species belonged to four phyla, Actinobacteria (members of Actinobacillus, Corynebacterium, Mycoplasma, and Streptomyces), Bacteroidetes (mainly Bacteroides, Capnocytophaga, and Prevotella), Firmicutes (members of Streptococcus, Staphylococcus, Clostridium, and Lactobacillus), and Proteobacteria (including Escherichia, Shigella, Salmonella, Citrobacter, Haemophilus, Klebsiella, Pasteurella, Photobacterium, Vibrio, and Yersinia species), mostly commensals and/or pathogens. Overall, our data demonstrate that the ability to take up host-derived sugars and sialic acid specifically allows V. cholerae a competitive advantage in intestinal colonization and that this is a trait that is sporadic in its occurrence and phylogenetic distribution and ancestral in some genera but horizontally acquired in others. Sialic acids are nine carbon amino sugars that are abundant on all mucous surfaces. The deadly human pathogen Vibrio cholerae contains
Genetic Transformation of Streptococcus mutans
Perry, Dennis; Kuramitsu, Howard K.
1981-01-01
Three strains of Streptococcus mutans belonging to serotypes a, c, and f were transformed to streptomycin resistance by deoxyribonucleic acids derived from homologous and heterologous streptomycin-resistant strains of S. mutans and Streptococcus sanguis strain Challis. Homologous transformation of S. mutans was less efficient than heterologous transformation by deoxyribonucleic acids from other strains of S. mutans. PMID:7251168
NASA Astrophysics Data System (ADS)
Fang, J.
2015-12-01
Marine sediments cover more than two-thirds of the Earth's surface and represent a major part of the deep biosphere. Microbial cells and microbial activity appear to be widespread in these sediments. Recently, we reported the isolation of gram-positive anaerobic spore-forming piezophilic bacteria and detection of bacterial endospores in marine subsurface sediment from the Shimokita coalbed, Japan. However, the modern molecular microbiological methods (e.g., DNA-based microbial detection techniques) cannot detect bacterial endospore, because endospores are impermeable and are not stained by fluorescence DNA dyes or by ribosomal RNA staining techniques such as catalysed reporter deposition fluorescence in situ hybridization. Thus, the total microbial cell abundance in the deep biosphere may has been globally underestimated. This emphasizes the need for a new cultivation independent approach for the quantification of bacterial endospores in the deep subsurface. Dipicolinic acid (DPA, pyridine-2,6-dicarboxylic acid) is a universal and specific component of bacterial endospores, representing 5-15wt% of the dry spore, and therefore is a useful indicator and quantifier of bacterial endospores and permits to estimate total spore numbers in the subsurface biosphere. We developed a sensitive analytical method to quantify DPA content in environmental samples using gas chromatography-mass spectrometry. The method is sensitive and more convenient in use than other traditional methods. We applied this method to analyzing sediment samples from the South China Sea (obtained from IODP Exp. 349) to determine the abundance of spore-forming bacteria in the deep marine subsurface sediment. Our results suggest that gram-positive, endospore-forming bacteria may be the "unseen majority" in the deep biosphere.
Crossroads between Bacterial and Mammalian Glycosyltransferases
Brockhausen, Inka
2014-01-01
Bacterial glycosyltransferases (GT) often synthesize the same glycan linkages as mammalian GT; yet, they usually have very little sequence identity. Nevertheless, enzymatic properties, folding, substrate specificities, and catalytic mechanisms of these enzyme proteins may have significant similarity. Thus, bacterial GT can be utilized for the enzymatic synthesis of both bacterial and mammalian types of complex glycan structures. A comparison is made here between mammalian and bacterial enzymes that synthesize epitopes found in mammalian glycoproteins, and those found in the O antigens of Gram-negative bacteria. These epitopes include Thomsen–Friedenreich (TF or T) antigen, blood group O, A, and B, type 1 and 2 chains, Lewis antigens, sialylated and fucosylated structures, and polysialic acids. Many different approaches can be taken to investigate the substrate binding and catalytic mechanisms of GT, including crystal structure analyses, mutations, comparison of amino acid sequences, NMR, and mass spectrometry. Knowledge of the protein structures and functions helps to design GT for specific glycan synthesis and to develop inhibitors. The goals are to develop new strategies to reduce bacterial virulence and to synthesize vaccines and other biologically active glycan structures. PMID:25368613
Ávila Ramírez, Jhon Alejandro; Gómez Hoyos, Catalina; Arroyo, Silvana; Cerrutti, Patricia; Foresti, María Laura
2016-11-20
Bacterial cellulose (BC) nanoribbons were partially acetylated by a simple direct solvent-free route catalyzed by citric acid. The assay of reaction conditions within chosen intervals (i.e. esterification time (0.5-7h), catalyst content (0.08-1.01mmol/mmol AGU), and temperature (90-140°C)), illustrated the flexibility of the methodology proposed, with reaction variables which can be conveniently manipulated to acetylate BC to the required degree of substitution (DS) within the 0.20-0.73 interval. Within this DS interval, characterization results indicated a surface-only process in which acetylated bacterial cellulose with tunable DS, preserved fibrous structure and increased hydrophobicity could be easily obtained. The feasibility of reusing the catalyst/excess acylant in view of potential scale-up was also illustrated. Copyright © 2016 Elsevier Ltd. All rights reserved.
Association of Many Regions of the Bacillus subtilis Chromosome with the Cell Membrane
Ivarie, Robert D.; Pène, Jacques J.
1973-01-01
Unsheared lysates of Bacillus subtilis 168T− containing uniformly labeled deoxyribonucleic acid (DNA) were exposed to varying doses of gamma rays to introduce double-strand scissions in the chromosome. From an estimate of the number-average molecular weight and the amount of DNA bound to membrane after irradiation, about 70 to 90 regions of the bacterial chromosome were detected in membrane fractions. Since this number was independent of the molecular weight of the DNA (i.e., the extent of fragmentation of the chromosome), it is thought to represent an upper limit in the number of membrane-binding sites per chromosome. PMID:4196245
Sarker, Shafiqul A; Ahmed, Tahmeed; Brüssow, Harald
2017-09-01
Underproduction of hydrochloric acid into the stomach is frequently encountered in subjects from developing countries. We explore the hypothesis that hypochlorhydria compromises the gastric barrier and favours bacterial overgrowth in the proximal parts of the small intestine where nutrient absorption takes place. Food calories are thus deviated into bacterial metabolism. In addition to an adequate caloric supply, correcting hypochlorhydria might be needed to decrease childhood malnutrition. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.
Delavat, François; Lett, Marie-Claire; Lièvremont, Didier
2013-10-01
Acid mine drainages (AMDs) are often thought to harbour low biodiversity, yet little is known about the diversity distribution along the drainages. Using culture-dependent approaches, the microbial diversity from the Carnoulès AMD sediment was investigated for the first time along a transect showing progressive environmental stringency decrease. In total, 20 bacterial genera were detected, highlighting a higher bacterial diversity than previously thought. Moreover, this approach led to the discovery of 16 yeast species, demonstrating for the first time the presence of this important phylogenetic group in this AMD. All in all, the location of the microbes along the transect helps to better understand their distribution in a pollution gradient. Copyright © 2013 Elsevier B.V. All rights reserved.
Shahzad, Raheem; Waqas, Muhammad; Khan, Abdul Latif; Al-Hosni, Khadija; Kang, Sang-Mo; Seo, Chang-Woo; Lee, In-Jung
2017-06-01
Bacterial endophytes from the phyllosphere and rhizosphere have been used to produce bioactive metabolites and to promote plant growth. However, little is known about the endophytes residing in seeds. This study aimed to isolate and identify seed-borne bacterial endophytes from rice and elucidate their potential for phytohormone production and growth enhancement. The isolated endophytes included Micrococcus yunnanensis RWL-2, Micrococcus luteus RWL-3, Enterobacter soli RWL-4, Leclercia adecarboxylata RWL-5, Pantoea dispersa RWL-6, and Staphylococcus epidermidis RWL-7, which were identified using 16S rRNA sequencing and phylogenetic analysis. These strains were analyzed for indoleacetic acid (IAA) production by using GC-MS and IAA was found in the range of 11.50 ± 0.77 μg ml -1 to 38.80 ± 1.35 μg ml -1 . We also assessed the strains for plant growth promoting potential because these isolates were able to produce IAA in pure culture. Most of the growth attributes of rice plants (shoot and root length, fresh and dry biomass, and chlorophyll content) were significantly increased by bacterial endophytes compared to the controls. These results show that IAA producing bacterial endophytes can improve hostplant growth traits and can be used as bio-fertilizers.
Lebaron, P; Servais, P; Agogué, H; Courties, C; Joux, F
2001-04-01
The nucleic acid contents of individual bacterial cells as determined with three different nucleic acid-specific fluorescent dyes (SYBR I, SYBR II, and SYTO 13) and flow cytometry were compared for different seawater samples. Similar fluorescence patterns were observed, and bacteria with high apparent nucleic acid contents (HNA) could be discriminated from bacteria with low nucleic acid contents (LNA). The best discrimination between HNA and LNA cells was found when cells were stained with SYBR II. Bacteria in different water samples collected from seven freshwater, brackish water, and seawater ecosystems were prelabeled with tritiated leucine and then stained with SYBR II. After labeling and staining, HNA, LNA, and total cells were sorted by flow cytometry, and the specific activity of each cellular category was determined from leucine incorporation rates. The HNA cells were responsible for most of the total bacterial production, and the specific activities of cells in the HNA population varied between samples by a factor of seven. We suggest that nucleic acid content alone can be a better indicator of the fraction of growing cells than total counts and that this approach should be combined with other fluorescent physiological probes to improve detection of the most active cells in aquatic systems.
Lebaron, Philippe; Servais, Pierre; Agogué, Helene; Courties, Claude; Joux, Fabien
2001-01-01
The nucleic acid contents of individual bacterial cells as determined with three different nucleic acid-specific fluorescent dyes (SYBR I, SYBR II, and SYTO 13) and flow cytometry were compared for different seawater samples. Similar fluorescence patterns were observed, and bacteria with high apparent nucleic acid contents (HNA) could be discriminated from bacteria with low nucleic acid contents (LNA). The best discrimination between HNA and LNA cells was found when cells were stained with SYBR II. Bacteria in different water samples collected from seven freshwater, brackish water, and seawater ecosystems were prelabeled with tritiated leucine and then stained with SYBR II. After labeling and staining, HNA, LNA, and total cells were sorted by flow cytometry, and the specific activity of each cellular category was determined from leucine incorporation rates. The HNA cells were responsible for most of the total bacterial production, and the specific activities of cells in the HNA population varied between samples by a factor of seven. We suggest that nucleic acid content alone can be a better indicator of the fraction of growing cells than total counts and that this approach should be combined with other fluorescent physiological probes to improve detection of the most active cells in aquatic systems. PMID:11282632
Long, M; Feng, W J; Li, P; Zhang, Y; He, R X; Yu, L H; He, J B; Jing, W Y; Li, Y M; Wang, Z; Liu, G W
2014-02-01
The aim of this study was to examine the effects of the acid-tolerant engineered bacterial strain Megasphaera elsdenii H6F32 (M. elsdenii H6F32) on ruminal pH and the lactic acid concentrations in simulated rumen acidosis conditions in vitro. A mixed culture of ruminal bacteria, buffer, and primarily degradable substrates was inoculated with equal numbers of M. elsdenii H6 or M. elsdenii H6F32. The pH and lactic acid concentrations in the mixed culture were determined at 0, 2, 4, 6, 8, 10, 12, 14, 16, and 18 h of incubation. Acid-tolerant M. elsdenii H6F32 reduced the accumulation of lactic acid and increased the pH value. These results indicate that acid-tolerant M. elsdenii H6F32 could be a potential candidate for preventing rumen acidosis. Copyright © 2013 Elsevier Ltd. All rights reserved.
Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J
2007-05-01
Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bisessar, S.; Palmer, K.T.; Kuja, A.L.
Ambient rain in southern Ontario has a volume-weighted average pH of approximately 4.2. Tomato (Lycopersicon esculentum Mill var. 'Chico III') seedlings were exposed to simulated acidic rain in specially designed chambers. The inoculum of Pseudomonas tomato (Okabe) Alstatt, causal agent of bacterial speck, was sprayed on plants before or after exposure to acidic rain of pH 2.5, 3.5, and 4.5, as well as on plants not exposed to the simulated acidic rain. Speck symptoms (small, dark, brown spots with yellow halos) were found on all inoculated plants. Exposure of plants to simulted acidic rain inhibited speck development, but the inhibitionmore » was greater on plants exposed to acidic rain after inoculation. Spot necrosis, a typical response to acid rain, occurred on up to 15 to 20% of the leaf area on all tomato plants treated with acidic rain at pH 2.5. Plants alos showed a decrease in growth (height and fresh and dry weights) with an increase in rain acidity. Leaves injured by simulated acidic rain and examined histopathologically displayed cellular malformations including hyperplasia and hypertrophy. Pseudomonas tomato failed to grow on acidified King B medium or Difco nutrient broth adjusted to pH 3.5 or lower.« less
Falynskova, I N; Leonova, E I; Fedyakina, I T; Makhmudova, N R; Lepekha, L N; Mikhailova, N A; Rasnetsov, L D; Zverev, V V; Leneva, I A
2015-01-01
Study the effectiveness of the substance and various drug formulations of fullerene-(tris-aminocapronic acid) hydrate (FTAAH onwards) in the model of experimental viral-bacterial pneumonia of mice. BALB/c mice were infected with influenza virus A/California/04/2009 and subsequently infected with Staphylococcus aureus. The animals were treated after viral infection with the substance and various drug forms of FTAAH, as well as comparative preparations--oseltamivir and arbidol. Therapy effectiveness was evaluated by clinical indicators (survival, lifespan, animal mass decrease reduction), virological (virus titer), microbiological (density of bacteria in lungs) parameters, confirmed by pathomorphological characteristics of lungs. FTAAH therapy in injectable form was effective in the model of a combined viral-bacterial pneumonia of mice by all the studied criteria: treatment increased mice survival, reduced the decrease of their body weight, resulted in a reduction of virus titers and density of bacteria in lungs, that correlated with the data from morphological study and signs of bronchopneumonia resolution in mice. FTAAH therapy in rectal form depended on animal infection schemes, as well as preparation dose, increasing with its increase. FTAAH substance is effective in the model of experimental viral-bacterial pneumonia of mice.
Bacterial collagen-like proteins that form triple-helical structures
Yu, Zhuoxin; An, Bo; Ramshaw, John A.M.; Brodsky, Barbara
2014-01-01
A large number of collagen-like proteins have been identified in bacteria during the past ten years, principally from analysis of genome databases. These bacterial collagens share the distinctive Gly-Xaa-Yaa repeating amino acid sequence of animal collagens which underlies their unique triple-helical structure. A number of the bacterial collagens have been expressed in E. coli, and they all adopt a triple-helix conformation. Unlike animal collagens, these bacterial proteins do not contain the post-translationally modified amino acid, hydroxyproline, which is known to stabilize the triple-helix structure and may promote self-assembly. Despite the absence of collagen hydroxylation, the triple-helix structures of the bacterial collagens studied exhibit a high thermal stability of 35–39 °C, close to that seen for mammalian collagens. These bacterial collagens are readily produced in large quantities by recombinant methods, either in the original amino acid sequence or in genetically manipulated sequences. This new family of recombinant, easy to modify collagens could provide a novel system for investigating structural and functional motifs in animal collagens and could also form the basis of new biomedical materials with designed structural properties and functions. PMID:24434612
Therapeutic nucleic acids: current clinical status
Sridharan, Kannan
2016-01-01
Abstract Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are simple linear polymers that have been the subject of considerable research in the last two decades and have now moved into the realm of being stand‐alone therapeutic agents. Much of this has stemmed from the appreciation that they carry out myriad functions that go beyond mere storage of genetic information and protein synthesis. Therapy with nucleic acids either uses unmodified DNA or RNA or closely related compounds. From both a development and regulatory perspective, they fall somewhere between small molecules and biologics. Several of these compounds are in clinical development and many have received regulatory approval for human use. This review addresses therapeutic uses of DNA based on antisense oligonucleotides, DNA aptamers and gene therapy; and therapeutic uses of RNA including micro RNAs, short interfering RNAs, ribozymes, RNA decoys and circular RNAs. With their specificity, functional diversity and limited toxicity, therapeutic nucleic acids hold enormous promise. However, challenges that need to be addressed include targeted delivery, mass production at low cost, sustaining efficacy and minimizing off‐target toxicity. Technological developments will hold the key to this and help accelerate drug approvals in the years to come. PMID:27111518
Abd El Razak, Ahmed; Ward, Alan C; Glassey, Jarka
2014-02-01
Water samples from three different environments including Mid Atlantic Ridge, Red Sea and Mediterranean Sea were screened in order to isolate new polyunsaturated fatty acids (PUFAs) bacterial producers especially eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA). Two hundred and fifty-one isolates were screened for PUFA production and among them the highest number of producers was isolated from the Mid-Atlantic Ridge followed by the Red Sea while no producers were found in the Mediterranean Sea samples. The screening strategy included a simple colourimetric method followed by a confirmation via GC/MS. Among the tested producers, an isolate named 66 was found to be a potentially high PUFA producer producing relatively high levels of EPA in particular. A Plackett-Burman statistical design of experiments was applied to screen a wide number of media components identifying glycerol and whey as components of a production medium. The potential low-cost production medium was optimised by applying a response surface methodology to obtain the highest productivity converting industrial by-products into value-added products. The maximum achieved productivity of EPA was 20 mg/g, 45 mg/l, representing 11% of the total fatty acids, which is approximately five times more than the amount produced prior to optimisation. The production medium composition was 10.79 g/l whey and 6.87 g/l glycerol. To our knowledge, this is the first investigation of potential bacteria PUFA producers from Mediterranean and Red Seas providing an evaluation of a colourimetric screening method as means of rapid screening of a large number of isolates.
Kullback Leibler divergence in complete bacterial and phage genomes
Akhter, Sajia; Kashef, Mona T.; Ibrahim, Eslam S.; Bailey, Barbara
2017-01-01
The amino acid content of the proteins encoded by a genome may predict the coding potential of that genome and may reflect lifestyle restrictions of the organism. Here, we calculated the Kullback–Leibler divergence from the mean amino acid content as a metric to compare the amino acid composition for a large set of bacterial and phage genome sequences. Using these data, we demonstrate that (i) there is a significant difference between amino acid utilization in different phylogenetic groups of bacteria and phages; (ii) many of the bacteria with the most skewed amino acid utilization profiles, or the bacteria that host phages with the most skewed profiles, are endosymbionts or parasites; (iii) the skews in the distribution are not restricted to certain metabolic processes but are common across all bacterial genomic subsystems; (iv) amino acid utilization profiles strongly correlate with GC content in bacterial genomes but very weakly correlate with the G+C percent in phage genomes. These findings might be exploited to distinguish coding from non-coding sequences in large data sets, such as metagenomic sequence libraries, to help in prioritizing subsequent analyses. PMID:29204318
Kullback Leibler divergence in complete bacterial and phage genomes.
Akhter, Sajia; Aziz, Ramy K; Kashef, Mona T; Ibrahim, Eslam S; Bailey, Barbara; Edwards, Robert A
2017-01-01
The amino acid content of the proteins encoded by a genome may predict the coding potential of that genome and may reflect lifestyle restrictions of the organism. Here, we calculated the Kullback-Leibler divergence from the mean amino acid content as a metric to compare the amino acid composition for a large set of bacterial and phage genome sequences. Using these data, we demonstrate that (i) there is a significant difference between amino acid utilization in different phylogenetic groups of bacteria and phages; (ii) many of the bacteria with the most skewed amino acid utilization profiles, or the bacteria that host phages with the most skewed profiles, are endosymbionts or parasites; (iii) the skews in the distribution are not restricted to certain metabolic processes but are common across all bacterial genomic subsystems; (iv) amino acid utilization profiles strongly correlate with GC content in bacterial genomes but very weakly correlate with the G+C percent in phage genomes. These findings might be exploited to distinguish coding from non-coding sequences in large data sets, such as metagenomic sequence libraries, to help in prioritizing subsequent analyses.
Fluoroquinolone antimicrobial agents.
Wolfson, J S; Hooper, D C
1989-01-01
The fluoroquinolones, a new class of potent orally absorbed antimicrobial agents, are reviewed, considering structure, mechanisms of action and resistance, spectrum, variables affecting activity in vitro, pharmacokinetic properties, clinical efficacy, emergence of resistance, and tolerability. The primary bacterial target is the enzyme deoxyribonucleic acid gyrase. Bacterial resistance occurs by chromosomal mutations altering deoxyribonucleic acid gyrase and decreasing drug permeation. The drugs are bactericidal and potent in vitro against members of the family Enterobacteriaceae, Haemophilus spp., and Neisseria spp., have good activity against Pseudomonas aeruginosa and staphylococci, and (with several exceptions) are less potent against streptococci and have fair to poor activity against anaerobic species. Potency in vitro decreases in the presence of low pH, magnesium ions, or urine but is little affected by different media, increased inoculum, or serum. The effects of the drugs in combination with a beta-lactam or aminoglycoside are often additive, occasionally synergistic, and rarely antagonistic. The agents are orally absorbed, require at most twice-daily dosing, and achieve high concentrations in urine, feces, and kidney and good concentrations in lung, bone, prostate, and other tissues. The drugs are efficacious in treatment of a variety of bacterial infections, including uncomplicated and complicated urinary tract infections, bacterial gastroenteritis, and gonorrhea, and show promise for therapy of prostatitis, respiratory tract infections, osteomyelitis, and cutaneous infections, particularly when caused by aerobic gram-negative bacilli. Fluoroquinolones have also proved to be efficacious for prophylaxis against travelers' diarrhea and infection with gram-negative bacilli in neutropenic patients. The drugs are effective in eliminating carriage of Neisseria meningitidis. Patient tolerability appears acceptable, with gastrointestinal or central nervous
Lewis, Amanda L; Hensler, Mary E; Varki, Ajit; Nizet, Victor
2006-04-21
Nearly two dozen microbial pathogens have surface polysaccharides or lipo-oligosaccharides that contain sialic acid (Sia), and several Sia-dependent virulence mechanisms are known to enhance bacterial survival or result in host tissue injury. Some pathogens are also known to O-acetylate their Sias, although the role of this modification in pathogenesis remains unclear. We report that neuD, a gene located within the Group B Streptococcus (GBS) Sia biosynthetic gene cluster, encodes a Sia O-acetyltransferase that is itself required for capsular polysaccharide (CPS) sialylation. Homology modeling and site-directed mutagenesis identified Lys-123 as a critical residue for Sia O-acetyltransferase activity. Moreover, a single nucleotide polymorphism in neuD can determine whether GBS displays a "high" or "low" Sia O-acetylation phenotype. Complementation analysis revealed that Escherichia coli K1 NeuD also functions as a Sia O-acetyltransferase in GBS. In fact, NeuD homologs are commonly found within Sia biosynthetic gene clusters. A bioinformatic approach identified 18 bacterial species with a Sia biosynthetic gene cluster that included neuD. Included in this list are the sialylated human pathogens Legionella pneumophila, Vibrio parahemeolyticus, Pseudomonas aeruginosa, and Campylobacter jejuni, as well as an additional 12 bacterial species never before analyzed for Sia expression. Phylogenetic analysis shows that NeuD homologs of sialylated pathogens share a common evolutionary lineage distinct from the poly-Sia O-acetyltransferase of E. coli K1. These studies define a molecular genetic approach for the selective elimination of GBS Sia O-acetylation without concurrent loss of sialylation, a key to further studies addressing the role(s) of this modification in bacterial virulence.
Giaouris, Efstathios; Briandet, Romain; Meyrand, Mickael; Courtin, Pascal; Chapot-Chartier, Marie-Pierre
2008-01-01
An increase of the degree of d-alanylation of teichoic acids in Lactococcus lactis resulted in a significant increase of bacterial resistance toward the cationic antimicrobials nisin and lysozyme, whereas the absence of d-alanylation led to a decreased resistance toward the same compounds. In contrast, the same variations of the d-alanylation degree did not modify bacterial cell surface charge and hydrophobicity. Bacterial adhesion to polystyrene and glass surfaces was not modified either. PMID:18539809
Taipale, Sami J; Brett, Michael T; Hahn, Martin W; Martin-Creuzburg, Dominik; Yeung, Sean; Hiltunen, Minna; Strandberg, Ursula; Kankaala, Paula
2014-02-01
There is considerable interest in the pathways by which carbon and growth-limiting elemental and biochemical nutrients are supplied to upper trophic levels. Fatty acids and sterols are among the most important molecules transferred across the plant-animal interface of food webs. In lake ecosystems, in addition to phytoplankton, bacteria and terrestrial organic matter are potential trophic resources for zooplankton, especially in those receiving high terrestrial organic matter inputs. We therefore tested carbon, nitrogen, and fatty acid assimilation by the crustacean Daphnia magna when consuming these resources. We fed Daphnia with monospecific diets of high-quality (Cryptomonas marssonii) and intermediate-quality (Chlamydomonas sp. and Scenedesmus gracilis) phytoplankton species, two heterotrophic bacterial strains, and particles from the globally dispersed riparian grass, Phragmites australis, representing terrestrial particulate organic carbon (t-POC). We also fed Daphnia with various mixed diets, and compared Daphnia fatty acid, carbon, and nitrogen assimilation across treatments. Our results suggest that bacteria were nutritionally inadequate diets because they lacked sterols and polyunsaturated omega-3 and omega-6 (omega-3 and omega-6) fatty acids (PUFAs). However, Daphnia were able to effectively use carbon and nitrogen from Actinobacteria, if their basal needs for essential fatty acids and sterols were met by phytoplankton. In contrast to bacteria, t-POC contained sterols and omega-6 and omega-3 fatty acids, but only at 22%, 1.4%, and 0.2% of phytoplankton levels, respectively, which indicated that t-POC food quality was especially restricted with regard to omega-3 PUFAs. Our results also showed higher assimilation of carbon than fatty acids from t-POC and bacteria into Daphnia, based on stable-isotope and fatty acids analysis, respectively. A relatively high (>20%) assimilation of carbon and fatty acids from t-POC was observed only when the proportion of t
Zhao, Yuan; Zhang, Shuncai; Jiang, Li; Jiang, Jie; Liu, Hongchun
2009-11-01
To evaluate the preventive effects of Schistosoma japonicum ova on trinitrobenzenesulfonic acid (TNBS)-induced colitis and bacterial translocation in mice. BALB/c mice were randomly divided into three groups: control group; TNBS(+)Ova(-) group; and TNBS(+)Ova(+) group. Mice of the TNBS(+)Ova(+) group were exposed to 10 000 freeze-killed S. japonicum ova by i.p. injection on day 1 and day 11. On day 15, mice were challenged with TNBS to induce colitis. The following variables were assessed: colon pathological changes; serum expression of tumor necrosis factor-alpha (TNF-alpha), gamma-interferon (IFN-gamma) and interleukin-10 (IL-10); expression of Toll-like receptor 4 (TLR4) in colon; IFN-gamma, IL-10 and TLR4 mRNA expression in colon; and the bacterial translocation rate. Compared to TNBS(+)Ova(-) group, the colonic inflammation in the TNBS(+)Ova(+) group were relieved. A highly significant elevation of IFN-gamma and TNF-alpha were observed in the TNBS-induced colitis group. After exposure to the eggs, IFN-gamma was significantly decreased, while TNF-alpha was similar to that of the TNBS(+)ova(-) group. No obvious variation was seen in IL-10 expression in TNBS-induced colitis, compared to the controls. Exposure to the eggs led to a significant upregulation of IL-10 expression. TLR4 expression was elevated after injected with TNBS and was downregulated in the eggs group. Less intestinal bacterial translocation frequency was observed when exposed to eggs. S. japonicum ova can prevent the TNBS-induced colitis and reduce the bacterial translocation frequency in mice. The mechanisms were supposed to be due to the regulation of T-helper cell 1/2 balance and TLR4 expression.
Cattò, C; James, G; Villa, F; Villa, S; Cappitelli, F
2018-05-04
The active moieties of the anti-biofilm natural compounds zosteric (ZA) and salicylic (SA) acids have been covalently immobilized on a low density polyethylene (LDPE) surface. The grafting procedure provided new non-toxic eco-friendly materials (LDPE-CA and LDPE-SA) with anti-biofilm properties superior to the conventional biocide-based approaches and with features suitable for applications in challenging fields where the use of antimicrobial agents is limited. Microbiological investigation proved that LDPE-CA and LDPE-SA: (1) reduced Escherichia coli biofilm biomass by up to 61% with a mechanism that did not affect bacterial viability; (2) significantly affected biofilm morphology, decreasing biofilm thickness, roughness, substratum coverage, cell and matrix polysaccharide bio-volumes by >80% and increasing the surface to bio-volume ratio; (3) made the biofilm more susceptible to ampicillin and ethanol. Since no molecules were leached from the surface, they remained constantly effective and below the lethal level; therefore, the risk of inducing resistance was minimized.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Senko, John M.; Wanjugi, Pauline; Lucas, Melanie
2008-06-12
We characterized the microbiologically mediated oxidative precipitation of Fe(II) from coalminederived acidic mine drainage (AMD) along flow-paths at two sites in northern Pennsylvania. At the Gum Boot site, dissolved Fe(II) was efficiently removed from AMD whereas minimal Fe(II) removal occurred at the Fridays-2 site. Neither site received human intervention to treat the AMD. Culturable Fe(II) oxidizing bacteria were most abundant at sampling locations along the AMD flow path corresponding to greatest Fe(II) removal and where overlying water contained abundant dissolved O2. Rates of Fe(II) oxidation determined in laboratory-based sediment incubations were also greatest at these sampling locations. Ribosomal RNA intergenicmore » spacer analysis and sequencing of partial 16S rRNA genes recovered from sediment bacterial communities revealed similarities among populations at points receiving regular inputs of Fe(II)-rich AMD and provided evidence for the presence of bacterial lineages capable of Fe(II) oxidation. A notable difference between bacterial communities at the two sites was the abundance of Chloroflexi-affiliated 16S rRNA gene sequences in clone libraries derived from the Gum Boot sediments. Our results suggest that inexpensive and reliable AMD treatment strategies can be implemented by mimicking the conditions present at the Gum Boot field site.« less
Medical Services: Medical Record Administration and Health Care Documentation
1999-05-03
prepared for each patient who must have one. (5) Ensure that a blood sample for deoxyribonucleic acid ( DNA ) identification is on file with the DNA ...degenerative joint disease DM diabetes mellitus DNA deoxyribonucleic acid DNR do not resuscitate DO Doctor of Osteopathy DOA dead on arrival DOB date...vein thrombosis DWI driving while intoxicated Dx diagnosis EBL estimated blood loss EBV Epstein-Barr virus ECG; EKG electrocardiogram E. coli
Auer, George K; Weibel, Douglas B
2017-07-25
Cellular mechanical properties play an integral role in bacterial survival and adaptation. Historically, the bacterial cell wall and, in particular, the layer of polymeric material called the peptidoglycan were the elements to which cell mechanics could be primarily attributed. Disrupting the biochemical machinery that assembles the peptidoglycan (e.g., using the β-lactam family of antibiotics) alters the structure of this material, leads to mechanical defects, and results in cell lysis. Decades after the discovery of peptidoglycan-synthesizing enzymes, the mechanisms that underlie their positioning and regulation are still not entirely understood. In addition, recent evidence suggests a diverse group of other biochemical elements influence bacterial cell mechanics, may be regulated by new cellular mechanisms, and may be triggered in different environmental contexts to enable cell adaptation and survival. This review summarizes the contributions that different biomolecular components of the cell wall (e.g., lipopolysaccharides, wall and lipoteichoic acids, lipid bilayers, peptidoglycan, and proteins) make to Gram-negative and Gram-positive bacterial cell mechanics. We discuss the contribution of individual proteins and macromolecular complexes in cell mechanics and the tools that make it possible to quantitatively decipher the biochemical machinery that contributes to bacterial cell mechanics. Advances in this area may provide insight into new biology and influence the development of antibacterial chemotherapies.
Hischebeth, Gunnar T R; Keil, Vera C; Gentil, Katrin; Boström, Azize; Kuchelmeister, Klaus; Bekeredjian-Ding, Isabelle
2014-06-10
Fusobacterium nucleatum is a strict anaerobic microorganism that causes disease entities such as periodontal and soft tissue abscesses, pulmonary and intraabdominal infections and very rarely intracerebral infections. Here, we report the rare case of a previously healthy 25-year-old German man with a cerebellar abscess caused by Fusobacterium nucleatum that resulted in rapid brain death. Toxicological screening showed positivity for amphetamines and cannabis. The diagnosis was obtained by polymerase chain reaction amplification of bacterial deoxyribonucleic acid in cerebrospinal fluid. In drug users clinicians should think about rare causes of brain abscesses/meningitis. Early diagnosis is necessary and justifies the use of molecular techniques.
2014-01-01
Background Fusobacterium nucleatum is a strict anaerobic microorganism that causes disease entities such as periodontal and soft tissue abscesses, pulmonary and intraabdominal infections and very rarely intracerebral infections. Case presentation Here, we report the rare case of a previously healthy 25-year-old German man with a cerebellar abscess caused by Fusobacterium nucleatum that resulted in rapid brain death. Toxicological screening showed positivity for amphetamines and cannabis. The diagnosis was obtained by polymerase chain reaction amplification of bacterial deoxyribonucleic acid in cerebrospinal fluid. Conclusions In drug users clinicians should think about rare causes of brain abscesses/meningitis. Early diagnosis is necessary and justifies the use of molecular techniques. PMID:24915846
Deoxyribonucleic acid base compositions of dermatophytes.
Davison, F D; Mackenzie, D W; Owen, R J
1980-06-01
DNA was extracted and purified from 55 dermatophyte isolates representing 34 species of Trichophyton, Microsporum and Epidermophyton. The base compositions of the chromosomal DNA were determined by CsCl density gradient centrifugation and were found to be in the narrow range of 48.7 to 50.3 mol % G + C. A satellite DNA component assumed to be of mitochondrial origin was present in most strains, with a G + C content ranging from 14.7 to 30.8 mol % G + C. Heterogeneity in microscopic and colonial characteristics was not reflected in differences in the mean G + C content of the chromosomal DNAs. Strains varied in the G + C contents of satelite DNA, but these did not correlate with traditional species concepts.
The deoxyribonucleic acid of Micrococcus radiodurans
Schein, Arnold H.
1966-01-01
The DNA of Micrococcus radiodurans was prepared by three methods. Although the recovery of DNA varied considerably, the percentage molar base ratios of the DNA from the three preparations were essentially the same: guanine, 33±2; adenine, 18±1; cytosine, 33±2; thymine, 17±1. Base compositions calculated from Tm values and from density in caesium chloride gradients also yielded guanine+cytosine contents of 66 and 68% of total bases respectively. No unusual bases were observed. The S20,w values were characteristic of high-molecular-weight DNA. Electron microscopy showed the purified DNA in long strands; occasionally these were coiled. Images(a)(b)(c)(d)(e)Fig. 1. PMID:16742439
Iyer, Lakshminarayan M.; Zhang, Dapeng; Rogozin, Igor B.; Aravind, L.
2011-01-01
The deaminase-like fold includes, in addition to nucleic acid/nucleotide deaminases, several catalytic domains such as the JAB domain, and others involved in nucleotide and ADP-ribose metabolism. Using sensitive sequence and structural comparison methods, we develop a comprehensive natural classification of the deaminase-like fold and show that its ancestral version was likely to operate on nucleotides or nucleic acids. Consequently, we present evidence that a specific group of JAB domains are likely to possess a DNA repair function, distinct from the previously known deubiquitinating peptidase activity. We also identified numerous previously unknown clades of nucleic acid deaminases. Using inference based on contextual information, we suggest that most of these clades are toxin domains of two distinct classes of bacterial toxin systems, namely polymorphic toxins implicated in bacterial interstrain competition and those that target distantly related cells. Genome context information suggests that these toxins might be delivered via diverse secretory systems, such as Type V, Type VI, PVC and a novel PrsW-like intramembrane peptidase-dependent mechanism. We propose that certain deaminase toxins might be deployed by diverse extracellular and intracellular pathogens as also endosymbionts as effectors targeting nucleic acids of host cells. Our analysis suggests that these toxin deaminases have been acquired by eukaryotes on several independent occasions and recruited as organellar or nucleo-cytoplasmic RNA modifiers, operating on tRNAs, mRNAs and short non-coding RNAs, and also as mutators of hyper-variable genes, viruses and selfish elements. This scenario potentially explains the origin of mutagenic AID/APOBEC-like deaminases, including novel versions from Caenorhabditis, Nematostella and diverse algae and a large class of fast-evolving fungal deaminases. These observations greatly expand the distribution of possible unidentified mutagenic processes catalyzed by
Watling, Helen R.; Shiers, Denis W.; Collinson, David M.
2015-01-01
In heap bioleaching, acidophilic extremophiles contribute to enhanced metal extraction from mineral sulphides through the oxidation of Fe(II) and/or reduced inorganic sulphur compounds (RISC), such as elemental sulphur or mineral sulphides, or the degradation of organic compounds derived from the ore, biota or reagents used during mineral processing. The impacts of variable solution acidity and composition, as well as temperature on the three microbiological functions have been examined for up to four bacterial species found in mineral sulphide heaps. The results indicate that bacteria adapt to sufficiently high metal concentrations (Cu, Ni, Co, Zn, As) to allow them to function in mineral sulphide heaps and, by engaging alternative metabolic pathways, to extend the solution pH range over which growth is sustained. Fluctuating temperatures during start up in sulphide heaps pose the greatest threat to efficient bacterial colonisation. The large masses of ores in bioleaching heaps mean that high temperatures arising from sulphide oxidation are hard to control initially, when the sulphide content of the ore is greatest. During that period, mesophilic and moderately thermophilic bacteria are markedly reduced in both numbers and activity. PMID:27682094
Zanetti, F; De Luca, G; Sacchetti, R; Stampi, S
2007-11-01
The aim of the study was to assess the efficiency of low doses of peracetic acid against viral and bacterial indicators in wastewater and to evaluate if the treatment allows regulatory requirements to be satisfied. A total of 31 samplings were carried out, each involving the collection of secondary effluent and of effluent disinfected with 1.2 or 1.5 mg l(-1) of peracetic acid (contact time 20 minutes). In each sample were measured: somatic coliphages, F-specific RNA bacteriophages, Escherichia coli, total and faecal coliforms, enterococci. Peracetic acid disinfection showed significant differences between the reductions of the microorganisms tested: E. coli showed the highest reduction (1.78 and 2.43 Log respectively with 1.2 and 1.5 mg l(-1) of peracetic acid) and phages the lowest (ranging between 0.52 and 0.60 Log). Only a concentration of 1.5 mg l(-1) of peracetic acid would enable the effluent to be discharged into surface waters in compliance with Italian regulations. The variability of microbial resistance against the peracetic acid disinfection treatment, underlines the importance of assessing disinfection efficiency by using more than one indicator microorganism. The detection of E. coli could be usefully accompanied by tests for more resistant microorganisms such as enterococci or coliphages. In conclusion, peracetic acid can be used for the disinfection of effluents even at low doses, with the advantage of reducing costs and preventing the formation of significant amounts of genotoxic by-products.
Proteome analysis of Arabidopsis seedlings exposed to bacterial volatiles.
Kwon, Young Sang; Ryu, Choong-Min; Lee, Soohyun; Park, Hyo Bee; Han, Ki Soo; Lee, Jung Han; Lee, Kyunghee; Chung, Woo Sik; Jeong, Mi-Jeong; Kim, Hee Kyu; Bae, Dong-Won
2010-11-01
Plant root-associated bacteria (rhizobacteria) elicit plant basal immunity referred to as induced systemic resistance (ISR) against multiple pathogens. Among multi-bacterial determinants involving such ISR, the induction of ISR and promotion of growth by bacterial volatile compounds was previously reported. To exploit global de novo expression of plant proteins by bacterial volatiles, proteomic analysis was performed after exposure of Arabidopsis plants to the rhizobacterium Bacillus subtilis GB03. Ethylene biosynthesis enzymes were significantly up-regulated. Analysis by quantitative reverse transcriptase polymerase chain reaction confirmed that ethylene biosynthesis-related genes SAM-2, ACS4, ACS12, and ACO2 as well as ethylene response genes, ERF1, GST2, and CHIB were up-regulated by the exposure to bacterial volatiles. More interestingly, the emission of bacterial volatiles significantly up-regulated both key defense mechanisms mediated by jasmonic acid and salicylic acid signaling pathways. In addition, high accumulation of antioxidant proteins also provided evidence of decreased sensitivity to reactive oxygen species during the elicitation of ISR by bacterial volatiles. The present results suggest that the proteomic analysis of plant defense responses in bacterial volatile-mediated ISR can reveal the mechanisms of plant basal defenses orchestrated by endogenous ethylene production pathways and the generation of reactive oxygen species.
Re-engineering of Bacterial Luciferase; For New Aspects of Bioluminescence.
Kim, Da-Som; Choi, Jeong-Ran; Ko, Jeong-Ae; Kim, Kangmin
2018-01-01
Bacterial luminescence is the end-product of biochemical reactions catalyzed by the luciferase enzyme. Nowadays, this fascinating phenomenon has been widely used as reporter and/or sensors to detect a variety of biological and environmental processes. The enhancement or diversification of the luciferase activities will increase the versatility of bacterial luminescence. Here, to establish the strategy for luciferase engineering, we summarized the identity and relevant roles of key amino acid residues modulating luciferase in Vibrio harveyi, a model luminous bacterium. The current opinions on crystal structures and the critical amino acid residues involved in the substrate binding sites and unstructured loop have been delineated. Based on these, the potential target residues and/or parameters for enzyme engineering were also suggested in limited scale. In conclusion, even though the accurate knowledge on the bacterial luciferase is yet to be reported, the structure-guided site-directed mutagenesis approaches targeting the regulatory amino acids will provide a useful platform to re-engineer the bacterial luciferase in the future. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
[Study on anti-bacterium activity of ginkgolic acids and their momomers].
Yang, Xiaoming; Zhu, Wei; Chen, Jun; Qian, Zhiyu; Xie, Jimin
2004-09-01
Ginkgolic acids and their three monomers were separated from ginkgo sarcotestas. The anti-bacterium activity of ginkgolic acids were tested. The relation between the anti-bacterium activity and side chain of ginkgolic acid were studied. The MIC of ginkgolic acids and their three monomers and salicylic acid were tested. Ginkgolic acid has strong inhibitive effect on G+-bacterium. Salicylic acid has no side chain, so no anti-bacterial activity. When the length of gingkolic acid side chain is C13:0, it has the strongest anti-bacterial activity in three monomers. The side chain of ginkgolic acid is the key functional group that possessed anti-bacterial activity. The length of Ginkgolic acid was the main effective factor of anti-bacterial activity.
Dhobale, Madhavi; Joshi, Sadhana
2012-04-01
Preterm pregnancies account for approximately 10% of the total pregnancies and are associated with low birth weight (LBW) babies. Recent studies have shown that LBW babies are at an increased risk of developing brain disorders such as cognitive dysfunction and psychiatric disorders. Maternal nutrition, particularly, micronutrients involved in one-carbon metabolism (folic acid, vitamin B(12), and docosahexaenoic acid (DHA)) have a major role during pregnancy for developing fetus and are important determinants of epigenesis. A series of our studies in pregnancy complications have well established the importance of omega 3 fatty acids especially DHA. DHA regulates levels of neurotrophins like brain-derived neurotrophic factor and nerve growth factor, which are required for normal neurological development. We have recently described that in one carbon metabolic pathway, membrane phospholipids are major methyl group acceptors and reduced DHA levels may result in diversion of methyl groups toward deoxyribonucleic acid (DNA) ultimately resulting in DNA methylation. In this review, we propose that altered maternal micronutrients (folic acid, vitamin B(12)), increased homocysteine, and oxidative stress levels that cause epigenetic modifications may be one of the mechanisms that contribute to preterm birth and poor fetal outcome, increasing risk for behavioural disorders in children.
Wang, Jinxing; Liang, Jidong; Gao, Sha
2018-05-10
Many bacterial strains have been demonstrated to biodegrade lignin for contaminant removal or resource regeneration. The goal of this study was to investigate the biodegradation amount and associated pathways of three lignin monomers, vanillic, p-coumaric, and syringic acid by strain Sphingobacterium sp. HY-H. Vanillic, p-coumaric, and syringic acid degradation with strain HY-H was estimated as 88.71, 76.67, and 72.78%, respectively, after 96 h. Correspondingly, the same three monomers were associated with a COD removal efficiency of 87.30, 55.17, and 67.23%, and a TOC removal efficiency of 82.14, 61.03, and 43.86%. The results of GC-MS, HPLC, FTIR, and enzyme activities show that guaiacol and o-dihydroxybenzene are key intermediate metabolites of the vanillic acid and syringic acid degradation. p-Hydroxybenzoic acid is an important intermediate metabolite for p-coumaric and syringic acid degradation. LiP and MnP play an important role in the degradation of lignin monomers and their intermediate metabolites. One possible pathway is that strain HY-H degrades lignin monomers into guaiacol (through decarboxylic and demethoxy reaction) or p-hydroxybenzoic acid (through side-chain oxidation); then guaiacol demethylates to o-dihydroxybenzene. The p-hydroxybenzoic acid and o-dihydroxybenzene are futher through ring cleavage reaction to form small molecule acids (butyric, valproic, oxalic acid, and propionic acid) and alcohols (ethanol and ethanediol), then these acids and alcohols are finally decomposed into CO 2 and H 2 O through the tricarboxylic acid cycle. If properly optimized and controlled, the strain HY-H may play a role in breaking down lignin-related compounds for biofuel and chemical production.
[Spontaneous bacterial peritonitis].
Velkey, Bálint; Vitális, Eszter; Vitális, Zsuzsanna
2017-01-01
Spontaneous bacterial peritonitis occurs most commonly in cirrhotic patients with ascites. Pathogens get into the circulation by intestinal translocation and colonize in peritoneal fluid. Diagnosis of spontaneous bacterial peritonitis is based on elevated polymorphonuclear leukocyte count in the ascites (>0,25 G/L). Ascites culture is often negative but aids to get information about antibiotic sensitivity in positive cases. Treatment in stable patient can be intravenous then orally administrated ciprofloxacin or amoxicillin/clavulanic acid, while in severe cases intravenous III. generation cephalosporin. Nosocomial spontaneous bacterial peritonitis often caused by Gram-positive bacteria and multi-resistant pathogens can also be expected thus carbapenem should be the choice of the empiric treatment. Antibiotic prophylaxis should be considered. Norfloxacin is used most commonly, but changes are expected due to increase in quinolone resistance. As a primary prophylaxis, a short-term antibiotic treatment is recommended after gastrointestinal bleeding for 5 days, while long-term prophylaxis is for patients with low ascites protein, and advanced disease (400 mg/day). Secondary prophylaxis is recommended for all patients recovered from spontaneous bacterial peritonitis. Due to increasing antibiotic use of antibiotics prophylaxis is debated to some degree. Orv. Hetil., 2017, 158(2), 50-57.
Shin, Sang Hyun; Pak, Jung-Hun; Kim, Mi Jin; Kim, Hye Jeong; Oh, Ju Sung; Choi, Hong Kyu; Jung, Ho Won; Chung, Young Soo
2014-01-01
Wild rice, Oryza grandiglumis shows hyper-resistance response to pathogen infection. In order to identify genes necessary for defense response in plants, we have carried out a subtractive hybridization coupled with a cDNA macroarray. An acidic PATHOGENESIS-RELATED1 (PR1) gene of the wild rice is highly identical to the acidic PR1 genes of different plant species. The OgPR1a cDNA has an apparent single open reading frame with a predicted molecular mass 40,621 Da and an isoelectic point of 5.14. Both in silico analysis and a transient expression assay in onion epidermal cells revealed that the OgPR1a protein could be localized in intercellular space in plants. The OgPR1a mRNA was strongly transcribed by the exogenous treatment with ethylene and jasmonic acid as well as protein phosphatase inhibitors. Additionally, ectopic expression of the OgPR1a conferred disease resistance on Arabidopsis to the bacterial and fungal infections. PMID:25289005
NASA Astrophysics Data System (ADS)
Yan, Ge; Kim, Guebuem; Kim, Jeonghyun; Jeong, Yu-Sik; Kim, Young Il
2015-03-01
We analyzed dissolved organic carbon (DOC), dissolved organic nitrogen (DON), and dissolved enantiomeric amino acids in precipitation samples collected at two sites in Korea over a one-year period. The average concentrations of DOC, DON, and total hydrolyzable amino acids at Seoul (an inland urban area) were lower than those at Uljin (a coastal rural area). The different bulk compositions of dissolved organic matter (DOM) at these two sites (reflected by qualitative indicators) were mainly attributed to differences in contributing sources. The D-enantiomers of four individual amino acids (aspartic acid, glutamic acid, serine, and alanine) were ubiquitously present, with average enantiomeric (D/L) ratios of 0.34, 0.26, 0.21, and 0.61 for Seoul, and 0.18, 0.11, 0.09, and 0.31 for Uljin, respectively. The much higher D/L ratios observed at Seoul than at Uljin might result from more advanced diagenetic stages as well as higher contributions from bacteria inhabiting terrestrial environments. The C- and N-normalized yields of D-alanine in DOM of our samples were found to be comparable to literature values reported for aquatic systems, where a significant portion of DOM was suggested to be of bacterial origin. Our study suggests that bacteria and their remnants might constitute an important fraction of OM in the atmosphere, contributing significantly to the quality of atmospheric OM and its post-depositional bioavailability in the surface ecosystems.
Machado, Ana; Bordalo, Adriano A
2014-08-01
Potable water is a resource out of reach for millions worldwide, and the available water may be chemically and microbiologically compromised. This is particularly acute in Africa, where water-networks may be non-existent or restricted to a small fraction of the urban population, as in the case of Guinea-Bissau, West Africa. This study was carried out seasonally in Bolama (11°N), where unprotected hand-dug wells with acidic water are the sole source of water for the population. We inspected the free-living bacterial community dynamics by automated rRNA intergenic spacer analyses, quantitative polymerase chain reaction and cloning approaches. The results revealed a clear seasonal shift in bacterial assemblage composition and microbial abundance within the same sampling site. Temperature, pH and turbidity, together with the infiltration and percolation of surface water, which takes place in the wet season, seemed to be the driving factors in the shaping and selection of the bacterial community and deterioration of water quality. Analysis of 16S rDNA sequences revealed several potential pathogenic bacteria and uncultured bacteria associated with water and sediments, corroborating the importance of a culture-independent approach in drinking water monitoring. Copyright © 2014. Published by Elsevier B.V.
Metal adsorption onto bacterial surfaces: development of a predictive approach
NASA Astrophysics Data System (ADS)
Fein, Jeremy B.; Martin, Aaron M.; Wightman, Peter G.
2001-12-01
Aqueous metal cation adsorption onto bacterial surfaces can be successfully modeled by means of a surface complexation approach. However, relatively few stability constants for metal-bacterial surface complexes have been measured. In order to determine the bacterial adsorption behavior of cations that have not been studied in the laboratory, predictive techniques are required that enable estimation of the stability constants of bacterial surface complexes. In this study, we use a linear free-energy approach to compare previously measured stability constants for Bacillus subtilis metal-carboxyl surface complexes with aqueous metal-organic acid anion stability constants. The organic acids that we consider are acetic, oxalic, citric, and tiron. We add to this limited data set by conducting metal adsorption experiments onto Bacillus subtilis, determining bacterial surface stability constants for Co, Nd, Ni, Sr, and Zn. The adsorption behavior of each of the metals studied here was described well by considering metal-carboxyl bacterial surface complexation only, except for the Zn adsorption behavior, which required carboxyl and phosphoryl complexation to obtain a suitable fit to the data. The best correlation between bacterial carboxyl surface complexes and aqueous organic acid anion stability constants was obtained by means of metal-acetate aqueous complexes, with a linear correlation coefficient of 0.97. This correlation applies only to unhydrolyzed aqueous cations and only to carboxyl binding of those cations, and it does not predict the binding behavior under conditions where metal binding to other bacterial surface site types occurs. However, the relationship derived in this study permits estimation of the carboxyl site adsorption behavior of a wide range of aqueous metal cations for which there is an absence of experimental data. This technique, coupled with the observation of similar adsorption behaviors across bacterial species (Yee and Fein, 2001), enables
The Fate of Marine Bacterial Exopolysaccharide in Natural Marine Microbial Communities
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Zilian; Chen, Yi; Wang, Rui
Most marine bacteria produce exopolysaccharides (EPS), and bacterial EPS represent an important source of dissolved organic carbon in marine ecosystems. It was proposed that bacterial EPS rich in uronic acid is resistant to mineralization by microbes and thus has a long residence time in global oceans. To confirm this hypothesis, bacterial EPS rich in galacturonic acid was isolated from Alteromonas sp. JL2810. The EPS was used to amend natural seawater to investigate the bioavailability of this EPS by native populations, in the presence and absence of ammonium and phosphate amendment. The data indicated that the bacterial EPS could not bemore » completely consumed during the cultivation period and that the bioavailability of EPS was not only determined by its intrinsic properties, but was also determined by other factors such as the availability of inorganic nutrients. During the experiment, the humic-like component of fluorescent dissolved organic matter (FDOM) was freshly produced. Bacterial community structure analysis indicated that the class Flavobacteria of the phylum Bacteroidetes was the major contributor for the utilization of EPS. This report is the first to indicate that Flavobacteria are a major contributor to bacterial EPS degradation. Finally, the fraction of EPS that could not be completely utilized and the FDOM (e.g., humic acid-like substances) produced de novo may be refractory and may contribute to the carbon storage in the oceans.« less
The Fate of Marine Bacterial Exopolysaccharide in Natural Marine Microbial Communities
Zhang, Zilian; Chen, Yi; Wang, Rui; ...
2015-11-16
Most marine bacteria produce exopolysaccharides (EPS), and bacterial EPS represent an important source of dissolved organic carbon in marine ecosystems. It was proposed that bacterial EPS rich in uronic acid is resistant to mineralization by microbes and thus has a long residence time in global oceans. To confirm this hypothesis, bacterial EPS rich in galacturonic acid was isolated from Alteromonas sp. JL2810. The EPS was used to amend natural seawater to investigate the bioavailability of this EPS by native populations, in the presence and absence of ammonium and phosphate amendment. The data indicated that the bacterial EPS could not bemore » completely consumed during the cultivation period and that the bioavailability of EPS was not only determined by its intrinsic properties, but was also determined by other factors such as the availability of inorganic nutrients. During the experiment, the humic-like component of fluorescent dissolved organic matter (FDOM) was freshly produced. Bacterial community structure analysis indicated that the class Flavobacteria of the phylum Bacteroidetes was the major contributor for the utilization of EPS. This report is the first to indicate that Flavobacteria are a major contributor to bacterial EPS degradation. Finally, the fraction of EPS that could not be completely utilized and the FDOM (e.g., humic acid-like substances) produced de novo may be refractory and may contribute to the carbon storage in the oceans.« less
Nucleic Acid Homologies Among Oxidase-Negative Moraxella Species
Johnson, John L.; Anderson, Robert S.; Ordal, Erling J.
1970-01-01
The deoxyribonucleic acid (DNA) base composition and DNA homologies of more than 40 strains of oxidase-negative Moraxella species were determined. These bacteria have also been identified as belonging to the Mima-Herellea-Acinetobacter group and the Bacterium anitratum group, as well as to several other genera including Achromobacter and Alcaligenes. The DNA base content of these strains ranged from 40 to 46% guanine plus cytosine. DNA–DNA competition experiments distinguished five groups whose members were determined by showing 50% or more homology to one of the reference strains: B. anitratum type B5W, Achromobacter haemolyticus var. haemolyticus, Alcaligenes haemolysans, Achromobacter metalcaligenes, and Moraxella lwoffi. A sixth group comprised those strains showing less than 50% homology to any of the reference strains. Negligible homology was found between strains of oxidase-negative and oxidase-positive Moraxella species in DNA–DNA competition experiments. However, evidence of a distant relationship between the two groups was obtained in competition experiments by using ribosomal ribonucleic acid. PMID:5413826
Antibacterial Targets in Fatty Acid Biosynthesis
Wright, H. Tonie; Reynolds, Kevin A.
2008-01-01
Summary The fatty acid biosynthesis pathway is an attractive but still largely unexploited target for development of new anti-bacterial agents. The extended use of the anti-tuberculosis drug isoniazid and the antiseptic triclosan, which are inhibitors of fatty acid biosynthesis, validates this pathway as a target for anti-bacterial development. Differences in subcellular organization of the bacterial and eukaryotic multi-enzyme fatty acid synthase systems offer the prospect of inhibitors with host vs. target specificity. Platensimycin, platencin, and phomallenic acids, newly discovered natural product inhibitors of the condensation steps in fatty acid biosynthesis, represent new classes of compounds with antibiotic potential. An almost complete catalogue of crystal structures for the enzymes of the type II fatty acid biosynthesis pathway can now be exploited in the rational design of new inhibitors, as well as the recently published crystal structures of type I FAS complexes. PMID:17707686
40 CFR 799.9510 - TSCA bacterial reverse mutation test.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 40 Protection of Environment 32 2014-07-01 2014-07-01 false TSCA bacterial reverse mutation test... REQUIREMENTS Health Effects Test Guidelines § 799.9510 TSCA bacterial reverse mutation test. (a) Scope. This... mutation test uses amino-acid requiring strains of Salmonella typhimurium and Escherichia coli to detect...
Ong, Hui San; Rahim, Mohd Syafiq; Firdaus-Raih, Mohd; Ramlan, Effirul Ikhwan
2015-01-01
The unique programmability of nucleic acids offers alternative in constructing excitable and functional nanostructures. This work introduces an autonomous protocol to construct DNA Tetris shapes (L-Shape, B-Shape, T-Shape and I-Shape) using modular DNA blocks. The protocol exploits the rich number of sequence combinations available from the nucleic acid alphabets, thus allowing for diversity to be applied in designing various DNA nanostructures. Instead of a deterministic set of sequences corresponding to a particular design, the protocol promotes a large pool of DNA shapes that can assemble to conform to any desired structures. By utilising evolutionary programming in the design stage, DNA blocks are subjected to processes such as sequence insertion, deletion and base shifting in order to enrich the diversity of the resulting shapes based on a set of cascading filters. The optimisation algorithm allows mutation to be exerted indefinitely on the candidate sequences until these sequences complied with all the four fitness criteria. Generated candidates from the protocol are in agreement with the filter cascades and thermodynamic simulation. Further validation using gel electrophoresis indicated the formation of the designed shapes. Thus, supporting the plausibility of constructing DNA nanostructures in a more hierarchical, modular, and interchangeable manner.
Perdih, Andrej; Hrast, Martina; Barreteau, Hélène; Gobec, Stanislav; Wolber, Gerhard; Solmajer, Tom
2014-08-01
Enzymes catalyzing the biosynthesis of bacterial peptidoglycan represent traditionally a collection of highly selective targets for novel antibacterial drug design. Four members of the bacterial Mur ligase family-MurC, MurD, MurE and MurF-are involved in the intracellular steps of peptidoglycan biosynthesis, catalyzing the synthesis of the peptide moiety of the Park's nucleotide. In our previous virtual screening campaign, a chemical class of benzene-1,3-dicarboxylic acid 2,5-dimethylpyrrole derivatives exhibiting dual MurD/MurE inhibition properties was discovered. In the present study we further investigated this class of compounds by performing inhibition assays on all four Mur ligases (MurC-MurF). Furthermore, molecular dynamics (MD) simulation studies of one of the initially discovered compound 1 were performed to explore its geometry as well as its energetic behavior based on the Linear Interaction Energy (LIE) method. Further in silico virtual screening (VS) experiments based on the parent active compound 1 were conducted to optimize the discovered series. Selected hits were assayed against all Escherichia coli MurC-MurF enzymes in biochemical inhibition assays and molecules 10-14 containing benzene-1,3-dicarboxylic acid 2,5-dimethylpyrrole coupled with five member-ring rhodanine moiety were found to be multiple inhibitors of the whole MurC-MurF cascade of bacterial enzymes in the micromolar range. Steady-state kinetics studies suggested this class to act as competitive inhibitors of the MurD enzyme towards d-Glu. These compounds represent novel valuable starting point in the development of novel antibacterial agents. Copyright © 2014 Elsevier Ltd. All rights reserved.
Longnecker, K.; Sherr, B. F.; Sherr, E. B.
2005-01-01
We evaluated whether bacteria with higher cell-specific nucleic acid content (HNA) or an active electron transport system, i.e., positive for reduction of 5-cyano-2,3-ditolyl tetrazolium chloride (CTC), were responsible for the bulk of bacterioplankton metabolic activity. We also examined whether the phylogenetic diversity of HNA and CTC-positive cells differed from the diversity of Bacteria with low nucleic acid content (LNA). Bacterial assemblages were sampled both in eutrophic shelf waters and in mesotrophic offshore waters in the Oregon coastal upwelling region. Cytometrically sorted HNA, LNA, and CTC-positive cells were assayed for their cell-specific [3H]leucine incorporation rates. Phylogenetic diversity in sorted non-radioactively labeled samples was assayed using denaturing gradient gel electrophoresis (DGGE) of PCR-amplified 16S rRNA genes. Cell-specific rates of leucine incorporation of HNA and CTC-positive cells were on average only slightly greater than the cell-specific rates of LNA cells. HNA cells accounted for most bacterioplankton substrate incorporation due to high abundances, while the low abundances of CTC-positive cells resulted in only a small contribution by these cells to total bacterial activity. The proportion of the total bacterial leucine incorporation attributable to LNA cells was higher in offshore regions than in shelf waters. Sequence data obtained from DGGE bands showed broadly similar phylogenetic diversity across HNA, LNA, and CTC-positive cells, with between-sample and between-region variability in the distribution of phylotypes. Our results suggest that LNA bacteria are not substantially different from HNA bacteria in either cell-specific rates of substrate incorporation or phylogenetic composition and that they can be significant contributors to bacterial metabolism in the sea. PMID:16332746
Longnecker, K; Sherr, B F; Sherr, E B
2005-12-01
We evaluated whether bacteria with higher cell-specific nucleic acid content (HNA) or an active electron transport system, i.e., positive for reduction of 5-cyano-2,3-ditolyl tetrazolium chloride (CTC), were responsible for the bulk of bacterioplankton metabolic activity. We also examined whether the phylogenetic diversity of HNA and CTC-positive cells differed from the diversity of Bacteria with low nucleic acid content (LNA). Bacterial assemblages were sampled both in eutrophic shelf waters and in mesotrophic offshore waters in the Oregon coastal upwelling region. Cytometrically sorted HNA, LNA, and CTC-positive cells were assayed for their cell-specific [3H]leucine incorporation rates. Phylogenetic diversity in sorted non-radioactively labeled samples was assayed using denaturing gradient gel electrophoresis (DGGE) of PCR-amplified 16S rRNA genes. Cell-specific rates of leucine incorporation of HNA and CTC-positive cells were on average only slightly greater than the cell-specific rates of LNA cells. HNA cells accounted for most bacterioplankton substrate incorporation due to high abundances, while the low abundances of CTC-positive cells resulted in only a small contribution by these cells to total bacterial activity. The proportion of the total bacterial leucine incorporation attributable to LNA cells was higher in offshore regions than in shelf waters. Sequence data obtained from DGGE bands showed broadly similar phylogenetic diversity across HNA, LNA, and CTC-positive cells, with between-sample and between-region variability in the distribution of phylotypes. Our results suggest that LNA bacteria are not substantially different from HNA bacteria in either cell-specific rates of substrate incorporation or phylogenetic composition and that they can be significant contributors to bacterial metabolism in the sea.
Antibiofilm Properties of Acetic Acid
Bjarnsholt, Thomas; Alhede, Morten; Jensen, Peter Østrup; Nielsen, Anne K.; Johansen, Helle Krogh; Homøe, Preben; Høiby, Niels; Givskov, Michael; Kirketerp-Møller, Klaus
2015-01-01
Bacterial biofilms are known to be extremely tolerant toward antibiotics and other antimicrobial agents. These biofilms cause the persistence of chronic infections. Since antibiotics rarely resolve these infections, the only effective treatment of chronic infections is surgical removal of the infected implant, tissue, or organ and thereby the biofilm. Acetic acid is known for its antimicrobial effect on bacteria in general, but has never been thoroughly tested for its efficacy against bacterial biofilms. In this article, we describe complete eradication of both Gram-positive and Gram-negative biofilms using acetic acid both as a liquid and as a dry salt. In addition, we present our clinical experience of acetic acid treatment of chronic wounds. In conclusion, we here present the first comprehensive in vitro and in vivo testing of acetic acid against bacterial biofilms. PMID:26155378
NASA Astrophysics Data System (ADS)
Mhatre, S. S.; Braun, S.; Jaussi, M.; Røy, H.; Jørgensen, B. B.; Lomstein, B. A.
2015-12-01
The subsurface realm is colonized by a large number of microorganisms- about 3 × 1029. Microbial cells in these very stable and oligotrophic settings catabolize at a much slower rate than model organisms in nutrient rich cultures. The aim of this work was to use recently developed D:L-amino acid racemization model for studying the turnover times of microbial biomass and microbial necromass in a ~12,000 years old Greenland shelf marine sediment samples. Sediments were analyzed for total hydrolysable amino acids (THAA), the bacterial endospore marker dipicolinic acid (DPA), and amino acid enantiomers of aspartic acid. The percentage amino acid carbon content (%TAAC) and the percentage amino acid nitrogen content (%TAAN) were used for determining the degradation state of the organic matter. Endospores quantified using DPA quantification method were found to be as abundant as vegetative cells. The microbial necromass turnover times were thousand years, and biomass turnover times were in the range of tens to hundred years. Studies with deeper sediment cores will further improve our understanding of the energetic limits of life in the deep biosphere.
Olofsson, Tobias C; Butler, Èile; Markowicz, Pawel; Lindholm, Christina; Larsson, Lennart; Vásquez, Alejandra
2016-10-01
Could honeybees' most valuable contribution to mankind besides pollination services be alternative tools against infections? Today, due to the emerging antibiotic-resistant pathogens, we are facing a new era of searching for alternative tools against infections. Natural products such as honey have been applied against human's infections for millennia without sufficient scientific evidence. A unique lactic acid bacterial (LAB) microbiota was discovered by us, which is in symbiosis with honeybees and present in large amounts in fresh honey across the world. This work investigates if the LAB symbionts are the source to the unknown factors contributing to honey's properties. Hence, we tested the LAB against severe wound pathogens such as methicillin-resistant Staphylococcus aureus (MRSA), Pseudomonas aeruginosa and vancomycin-resistant Enterococcus (VRE) among others. We demonstrate a strong antimicrobial activity from each symbiont and a synergistic effect, which counteracted all the tested pathogens. The mechanisms of action are partly shown by elucidating the production of active compounds such as proteins, fatty acids, anaesthetics, organic acids, volatiles and hydrogen peroxide. We show that the symbionts produce a myriad of active compounds that remain in variable amounts in mature honey. Further studies are now required to investigate if these symbionts have a potential in clinical applications as alternative tools against topical human and animal infections. © 2014 The Authors. International Wound Journal published by Medicalhelplines.com Inc and John Wiley & Sons Ltd.
Choi, Su-In; Park, Jihoon; Kim, Pil
2017-03-28
To investigate the potential applications of bacterial heme, aminolevulinic acid synthase (HemA) was expressed in a Corynebacterium glutamicum HA strain that had been adaptively evolved against oxidative stress. The red pigment from the constructed strain was extracted and it exhibited the typical heme absorbance at 408 nm from the spectrum. To investigate the potential of this strain as an iron additive for swine, a prototype feed additive was manufactured in pilot scale by culturing the strain in a 5 ton fermenter followed by spray-drying the biomass with flour as an excipient (biomass: flour = 1:10 (w/w)). The 10% prototype additive along with regular feed was supplied to a pig, resulting in a 1.1 kg greater increase in weight gain with no diarrhea in 3 weeks as compared with that in a control pig that was fed an additive containing only flour. To verify if C. glutamicum -synthesized heme is a potential electron carrier, lactic acid bacteria were cultured under aerobic conditions with the extracted heme. The biomasses of the aerobically grown Lactococcus lactis , Lactobacillus rhamosus , and Lactobacillus casei were 97%, 15%, and 4% greater, respectively, than those under fermentative growth conditions. As a potential preservative, cultures of the four strains of lactic acid bacteria were stored at 4°C with the extracted heme and living lactic acid bacterial cells were counted. There were more L. lactis and L. plantarum live cells when stored with heme, whereas L. rhamosus and L. casei showed no significant differences in live-cell numbers. The potential uses of the heme from C. glutamicum are further discussed.
Lee, Jen-Jie; Wu, Ying-Chen; Kuo, Chih-Jung; Hsuan, Shih-Ling; Chen, Ter-Hsin
2016-09-25
The outer membrane protein TolC, which is one of the key components of several multidrug efflux pumps, is thought to be involved in various independent systems in Enterobacteriaceae. Since the acidic environment of the stomach is an important protection barrier against foodborne pathogen infections in hosts, we evaluated whether TolC played a role in the acid tolerance of Salmonella enterica serovar Choleraesuis. Comparison of the acid tolerance of the tolC mutant and the parental wild-type strain showed that the absence of TolC limits the ability of Salmonella to sustain life under extreme acidic conditions. Additionally, the mutant exhibited morphological changes during growth in an acidic medium, leading to the conflicting results of cell viability measured by spectrophotometry and colony-forming unit counting. Reverse-transcriptional-PCR analysis indicated that acid-related molecules, apparatus, or enzymes and oxidation-induced factors were significantly affected by the acidic environment in the null-tolC mutant. The elongated cellular morphology was restored by adding antioxidants to the culture medium. Furthermore, we found that increased cellular antioxidative activity provides an overlapping protection against acid killing, demonstrating the complexity of the bacterial acid stress response. Our findings reinforce the multifunctional characteristics of TolC in acid tolerance or oxidative stress resistance and support the correlative protection mechanism between oxygen- and acid-mediated stress responses in Salmonella enterica serovar Choleraesuis. Copyright © 2016 Elsevier B.V. All rights reserved.
Fertilization Shapes Bacterial Community Structure by Alteration of Soil pH.
Zhang, Yuting; Shen, Hong; He, Xinhua; Thomas, Ben W; Lupwayi, Newton Z; Hao, Xiying; Thomas, Matthew C; Shi, Xiaojun
2017-01-01
Application of chemical fertilizer or manure can affect soil microorganisms directly by supplying nutrients and indirectly by altering soil pH. However, it remains uncertain which effect mostly shapes microbial community structure. We determined soil bacterial diversity and community structure by 454 pyrosequencing the V1-V3 regions of 16S rRNA genes after 7-years (2007-2014) of applying chemical nitrogen, phosphorus and potassium (NPK) fertilizers, composted manure or their combination to acidic (pH 5.8), near-neutral (pH 6.8) or alkaline (pH 8.4) Eutric Regosol soil in a maize-vegetable rotation in southwest China. In alkaline soil, nutrient sources did not affect bacterial Operational Taxonomic Unit (OTU) richness or Shannon diversity index, despite higher available N, P, K, and soil organic carbon in fertilized than in unfertilized soil. In contrast, bacterial OTU richness and Shannon diversity index were significantly lower in acidic and near-neutral soils under NPK than under manure or their combination, which corresponded with changes in soil pH. Permutational multivariate analysis of variance showed that bacterial community structure was significantly affected across these three soils, but the PCoA ordination patterns indicated the effect was less distinct among nutrient sources in alkaline than in acidic and near-neural soils. Distance-based redundancy analysis showed that bacterial community structures were significantly altered by soil pH in acidic and near-neutral soils, but not by any soil chemical properties in alkaline soil. The relative abundance (%) of most bacterial phyla was higher in near-neutral than in acidic or alkaline soils. The most dominant phyla were Proteobacteria (24.6%), Actinobacteria (19.7%), Chloroflexi (15.3%) and Acidobacteria (12.6%); the medium dominant phyla were Bacterioidetes (5.3%), Planctomycetes (4.8%), Gemmatimonadetes (4.5%), Firmicutes (3.4%), Cyanobacteria (2.1%), Nitrospirae (1.8%), and candidate division TM7 (1
Cheng, Weixiao; Chen, Hong; Yan, ShuHai; Su, Jianqiang
2014-09-01
Short-chain fatty acids (SCFAs) can be produced by primary and waste activated sludge anaerobic fermentation. The yield and product spectrum distribution of SCFAs can be significantly affected by different initial pH values. However, most studies have focused on the physical and chemical aspects of SCFA production by waste activated sludge fermentation at different pH values. Information on the bacterial community structures during acidogenic fermentation is limited. In this study, comparisons of the bacterial communities during the co-substrate fermentation of food wastes and sewage sludge at different pH values were performed using the barcoded Illumina paired-end sequencing method. The results showed that different pH environments harbored a characteristic bacterial community, including sequences related to Lactobacillus, Prevotella, Mitsuokella, Treponema, Clostridium, and Ureibacillus. The most abundant bacterial operational taxonomic units in the different pH environments were those related to carbohydrate-degrading bacteria, which are associated with constituents of co-substrate fermentation. Further analyses showed that during organic matter fermentation, a core microbiota composed of Firmicutes, Proteobacteria, and Bacteroidetes existed. Comparison analyses revealed that the bacterial community during fermentation was significantly affected by the pH, and that the diverse product distribution was related to the shift in bacterial communities.
Ye, N-F; Lü, F; Shao, L-M; Godon, J-J; He, P-J
2007-10-01
To estimate the effect of pH on the structures of bacterial community during fermentation of vegetable wastes and to investigate the relationship between bacterial community dynamics and product distribution. The bacterial communities in five batch tests controlled at different pH values [uncontrolled (about pH 4), 5, 6, 7 and 8] were monitored by denaturing gradient gel electrophoresis (DGGE) and single-strand conformation polymorphism (SSCP). The two fingerprinting methods provided consistent results and principal component analysis indicated a close similarity of bacterial community at pH 7 and 8 in addition to those at pH 4-6. This clustering also corresponded to dominant metabolic pathway. Thus, pH 7-8 shifted from alcohol-forming to acid-forming, especially butyric acid, whereas both alcohol-forming and acid-forming dominated at pH 5-6, and at pH 4, fermentation was inhibited. Shannon-weaver index was calculated to analyse the DGGE profiles, which revealed that the bacterial diversities at pH 7 and 8 were the highest while those at pH 5 and 4 (uncontrolled) were the lowest. According to sequencing results of the bands excised from DGGE gels, lactic acid bacteria and Clostridium sp. were predominant at all pH values, but varieties in species were observed as pH changed and time prolonged. The bacterial community during fermentation was materially influenced by pH and the diverse product distribution was related to the shift of different bacterial population. The study reveals that the impact of pH on fermentation product distribution is implemented primarily by changes of bacterial community. It also provides information about the comparison of two fingerprinting methods, DGGE and SSCP.
Goossens, D; Jonkers, D; Russel, M; Thijs, A; van den Bogaard, A; Stobberingh, E; Stockbrügger, R
2005-01-01
Probiotic bacteria have to survive passage through the gastrointestinal tract. In this placebo-controlled double-blind study, the effect of Lactobacillus plantarum 299v on the faecal flora was studied with and without gastric acid inhibition. Thirty-two healthy volunteers were given pantoprazole (40 mg/day) or placebo for 3 weeks from week 2 until week 4. In addition, from week 3 until week 4, L. plantarum 299v in an oatmeal-fermented drink (10(9) CFU/ml) was given twice daily to both groups. From each healthy volunteer, faecal samples were collected at the end of week 1, 2, 4 and 8 (4 weeks after cessation of L. plantarum 299v and pantoprazole/placebo). Several aerobically and anaerobically growing bacteria were counted and short chain fatty acid concentrations were determined. In both the pantoprazole and the placebo group, median lactobacilli counts increased significantly in week 4 compared to week 1 (from log 4.5 to 8.0 CFU/g faeces in pantoprazole and from log 4.2 to 7.7 CFU/g faeces in placebo group) and decreased significantly in week 8 (to log 4.5 CFU/g faeces in pantoprazole and log 4.3 CFU/g faeces in placebo group). These lactobacilli were identified as L. plantarum 299v. No significant differences were observed in all other bacterial counts and short chain fatty acid concentrations. The comparable increase of faecal lactobacilli counts in both the pantoprazole and the placebo-treated group demonstrates that L. plantarum 299v survives passage through the gastrointestinal tract irrespective of gastric acidity. The increment of the intra-gastric pH in combination with L. plantarum 299v did not modulate bacterial composition and/or the production of short chain fatty acids.
Streptococcus mutans in a Wild, Sucrose-Eating Rat Population
Coykendall, Alan L.; Specht, Patricia A.; Samol, Harry H.
1974-01-01
Streptococcus mutans, an organism implicated in dental caries and not previously found outside of man and certain laboratory animals, was isolated from the mouths of wild rats which ate sugar cane. The strains isolated fermented mannitol and sorbitol, and failed to grow in 6.5% NaCl or at 45 C. They formed in vitro plaques on nichrome wires when grown in sucrose broth. They also stored intracellular polysaccharide which could be catabolized by washed, resting cells. Deoxyribonucleic acid-deoxyribonucleic acid reassociations revealed two genetic types. One type shared extensive deoxyribonucleic acid base sequences with S. mutans strains HS6 and OMZ61, two members of a genetic type found in man and laboratory hamsters. The other type seemed unrelated to any S. mutans genetic type previously encountered. It is concluded that the ecological triad of tooth-sucrose-S. mutans is not a phenomenon unique to man and experimental animals. Images PMID:4601769
The Amino Acid Valine Is Secreted in Continuous-Flow Bacterial Biofilms▿ ‡
Valle, Jaione; Da Re, Sandra; Schmid, Solveig; Skurnik, David; D'Ari, Richard; Ghigo, Jean-Marc
2008-01-01
Biofilms are structured communities characterized by distinctive gene expression patterns and profound physiological changes compared to those of planktonic cultures. Here, we show that many gram-negative bacterial biofilms secrete high levels of a small-molecular-weight compound, which inhibits the growth of only Escherichia coli K-12 and a rare few other natural isolates. We demonstrate both genetically and biochemically that this molecule is the amino acid valine, and we provide evidence that valine production within biofilms results from metabolic changes occurring within high-density biofilm communities when carbon sources are not limiting. This finding identifies a natural environment in which bacteria can encounter high amounts of valine, and we propose that in-biofilm valine secretion may be the long-sought reason for widespread but unexplained valine resistance found in most enterobacteria. Our results experimentally validate the postulated production of metabolites that is characteristic of the conditions associated with some biofilm environments. The identification of such molecules may lead to new approaches for biofilm monitoring and control. PMID:17981982
Antimicrobial Nanoparticle for the Treatment of Bacterial Infection
NASA Astrophysics Data System (ADS)
Pornpattananangkul, Dissaya
Liposomes are spherical lipid vesicles with bilayered membrane structure, which have been recognized as one of the most widely used carriers for delivering a myriad of pharmaceuticals. Liposomes can carry both hydrophilic and hydrophobic agents with high efficiency and protect them from undesired effects of external conditions. However, the applications of liposomes are usually limited by their instability during storage. They are inclined to fuse with one another immediately after preparation, resulting in undesired mixing, increase in size, and payload loss. To overcome this limitation, this dissertation will focus on the technology to stabilize liposomes during storage and destabilize at specific conditions in order to allow controllable therapeutic release, as well as demonstrate their application to treat one of the bacterial infection diseases, acne vulgaris. The first area of this research is stimuli-responsive liposomes development, where the liposomes are stabilized by introducing gold nanoparticles to adsorb to their surface. As a result, the liposomes are prevented from fusing with one another and undesirable payload release during storage or physiological environments. Moreover, therapeutic is controllably released depending on environment conditions, such as acidic pH and bacterial virulence factor. In case of acid-responsive liposomes, the bound gold nanoparticles can effectively prevent liposomes from fusing with one another at neutral pH value, while at acidic environment (e.g. pH<5), the gold particle stabilizers will fall off from the liposomes, thereby reinstalling the fusion activity of liposomes. The fusion activity of the stabilized liposomes is found to be 25% at pH=7, in contrast to 80% at pH=4. Another stimulus that can activate drug release from liposomes is virulence factor released from bacteria themselves, such as bacterial toxin. When nanoparticle-stabilized liposomes encounter with bacteria that secrete toxin, the toxin will insert
De Marco, P; Murrell, J C; Bordalo, A A; Moradas-Ferreira, P
2000-02-01
Two novel bacterial strains that can utilize methanesulfonic acid as a source of carbon and energy were isolated from a soil sample collected in northern Portugal. Morphological, physiological, biochemical and molecular biological characterization of the two isolates indicate that strain P1 is a pink-pigmented facultative methylotroph belonging to the genus Methylobacterium, while strain P2 is a restricted methylotroph belonging to the genus Hyphomicrobium. Both strains are strictly aerobic, degrade methanesulfonate, and release small quantities of sulfite into the medium. Growth on methanesulfonate induces a specific polypeptide profile in each strain. This, together with the positive hybridization to a DNA probe that carries the msm genes of Methylosulfonomonas methylovora strain M2, strongly endorses the contention that a methanesulfonic acid monooxygenase related to that found in the previously known methanesulfonate-utilizing bacteria is present in strains P1 and P2. The isolation of bacteria containing conserved msm genes from diverse environments and geographical locations supports the hypothesis that a common enzyme may be globally responsible for the oxidation of methanesulfonate by natural methylotrophic communities.
Risk of spontaneous bacterial peritonitis associated with gastric Acid suppression.
Chang, Shy-Shin; Lai, Chih-Cheng; Lee, Meng-tse Gabriel; Lee, Yu-Chien; Tsai, Yi-Wen; Hsu, Wan-Ting; Lee, Chien-Chang
2015-06-01
The primary objective of this study was to determine the association between the use of gastric acid suppressants (GAS) and the risk of developing spontaneous bacterial peritonitis (SBP) in patients with advanced liver cirrhosis (LC). A case-control study nested within a cohort of 480,000 representatives of Taiwan National Health Insurance beneficiaries was carried out. A case was matched with 100 controls on age, gender, and index date of SBP diagnosis. GAS use was identified from the 1-year period before the index date. Conditional logistic regression analysis was used to adjust for various unbalanced covariates between users and nonusers of GAS. A total of 947 cases of SBP were identified among the 86,418 patients with advanced LC. A significant increased risk of developing SBP was found to be associated with current (within 30 days), and recent (within 30-90 day) use of 2 different classes of GAS: proton pump inhibitors (PPIs) and histamine 2 receptor antagonists (H2RAs). The confounder adjusted rate ratio (aRR) for the current use of PPIs was 2.77 (95% CI: 1.90-4.04) and H2RAs was 2.62 (95% CI: 2.00-3.42). The risk of SBP attenuated for the recent use of PPIs (aRR: 2.20, 95%CI: 1.60-3.02) or H2RAs (aRR: 1.72, 95% CI: 1.25-2.37). In addition, sensitivity analysis using hospitalized SBP as the primary outcome showed a similar risk for the current use of PPIs (aRR, 3.24; 95% CI: 2.08-5.05) and H2RAs (aRR 2.43; 95% CI 1.71-3.46). Furthermore, higher cumulative days of gastric acid suppression were associated with a higher risk of SBP (trend P < 0.0001). To conclude, exposure to GAS was associated with an increased risk of SBP in patients with advanced LC. The association was more pronounced in current PPI users compared with nonusers.
Differential signatures of bacterial and mammalian IMP dehydrogenase enzymes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, R.; Evans, G.; Rotella, F.
1999-06-01
IMP dehydrogenase (IMPDH) is an essential enzyme of de novo guanine nucleotide synthesis. IMPDH inhibitors have clinical utility as antiviral, anticancer or immunosuppressive agents. The essential nature of this enzyme suggests its therapeutic applications may be extended to the development of antimicrobial agents. Bacterial IMPDH enzymes show bio- chemical and kinetic characteristics that are different than the mammalian IMPDH enzymes, suggesting IMPDH may be an attractive target for the development of antimicrobial agents. We suggest that the biochemical and kinetic differences between bacterial and mammalian enzymes are a consequence of the variance of specific, identifiable amino acid residues. Identification ofmore » these residues or combination of residues that impart this mammalian or bacterial enzyme signature is a prerequisite for the rational identification of agents that specifically target the bacterial enzyme. We used sequence alignments of IMPDH proteins to identify sequence signatures associated with bacterial or eukaryotic IMPDH enzymes. These selections were further refined to discern those likely to have a role in catalysis using information derived from the bacterial and mammalian IMPDH crystal structures and site-specific mutagenesis. Candidate bacterial sequence signatures identified by this process include regions involved in subunit interactions, the active site flap and the NAD binding region. Analysis of sequence alignments in these regions indicates a pattern of catalytic residues conserved in all enzymes and a secondary pattern of amino acid conservation associated with the major phylogenetic groups. Elucidation of the basis for this mammalian/bacterial IMPDH signature will provide insight into the catalytic mechanism of this enzyme and the foundation for the development of highly specific inhibitors.« less
Changes in rhizosphere bacterial gene expression following glyphosate treatment.
Newman, Molli M; Lorenz, Nicola; Hoilett, Nigel; Lee, Nathan R; Dick, Richard P; Liles, Mark R; Ramsier, Cliff; Kloepper, Joseph W
2016-05-15
In commercial agriculture, populations and interactions of rhizosphere microflora are potentially affected by the use of specific agrichemicals, possibly by affecting gene expression in these organisms. To investigate this, we examined changes in bacterial gene expression within the rhizosphere of glyphosate-tolerant corn (Zea mays) and soybean (Glycine max) in response to long-term glyphosate (PowerMAX™, Monsanto Company, MO, USA) treatment. A long-term glyphosate application study was carried out using rhizoboxes under greenhouse conditions with soil previously having no history of glyphosate exposure. Rhizosphere soil was collected from the rhizoboxes after four growing periods. Soil microbial community composition was analyzed using microbial phospholipid fatty acid (PLFA) analysis. Total RNA was extracted from rhizosphere soil, and samples were analyzed using RNA-Seq analysis. A total of 20-28 million bacterial sequences were obtained for each sample. Transcript abundance was compared between control and glyphosate-treated samples using edgeR. Overall rhizosphere bacterial metatranscriptomes were dominated by transcripts related to RNA and carbohydrate metabolism. We identified 67 differentially expressed bacterial transcripts from the rhizosphere. Transcripts downregulated following glyphosate treatment involved carbohydrate and amino acid metabolism, and upregulated transcripts involved protein metabolism and respiration. Additionally, bacterial transcripts involving nutrients, including iron, nitrogen, phosphorus, and potassium, were also affected by long-term glyphosate application. Overall, most bacterial and all fungal PLFA biomarkers decreased after glyphosate treatment compared to the control. These results demonstrate that long-term glyphosate use can affect rhizosphere bacterial activities and potentially shift bacterial community composition favoring more glyphosate-tolerant bacteria. Copyright © 2016 The Authors. Published by Elsevier B.V. All
Pankratov, Timofey A; Ivanova, Anastasia O; Dedysh, Svetlana N; Liesack, Werner
2011-07-01
Northern peatlands represent a major global carbon store harbouring approximately one-third of the global reserves of soil organic carbon. A large proportion of these peatlands consists of acidic Sphagnum-dominated ombrotrophic bogs, which are characterized by extremely low rates of plant debris decomposition. The degradation of cellulose, the major component of Sphagnum-derived litter, was monitored in long-term incubation experiments with acidic (pH 4.0) peat extracts. This process was almost undetectable at 10°C and occurred at low rates at 20°C, while it was significantly accelerated at both temperature regimes by the addition of available nitrogen. Cellulose breakdown was only partially inhibited in the presence of cycloheximide, suggesting that bacteria participated in this process. We aimed to identify these bacteria by a combination of molecular and cultivation approaches and to determine the factors that limit their activity in situ. The indigenous bacterial community in peat was dominated by Alphaproteobacteria and Acidobacteria. The addition of cellulose induced a clear shift in the community structure towards an increase in the relative abundance of the Bacteroidetes. Increasing temperature and nitrogen availability resulted in a selective development of bacteria phylogenetically related to Cytophaga hutchinsonii (94-95% 16S rRNA gene sequence similarity), which densely colonized microfibrils of cellulose. Among isolates obtained from this community only some subdivision 1 Acidobacteria were capable of degrading cellulose, albeit at a very slow rate. These Acidobacteria represent indigenous cellulolytic members of the microbial community in acidic peat and are easily out-competed by Cytophaga-like bacteria under conditions of increased nitrogen availability. Members of the phylum Firmicutes, known to be key players in cellulose degradation in neutral habitats, were not detected in the cellulolytic community enriched at low pH. © 2011 Society for
Huang, Xing-Feng; Chaparro, Jacqueline M; Reardon, Kenneth F; Judd, Timothy M; Vivanco, Jorge M
2016-10-01
Although it is well known that diet is one of the major modulators of the gut microbiome, how the major components of diet shape the gut microbial community is not well understood. Here, we developed a simple system that allows the investigation of the impact of given compounds as supplements of the diet on the termite gut microbiome. The 16S rRNA pyrosequencing analysis revealed that feeding termites different blends of sugars and amino acids did not majorly impact gut community composition; however, ingestion of blends of secondary metabolites caused shifts in gut bacterial community composition. The supplementation of sugars and amino acids reduced the richness significantly, and sugars alone increased the evenness of the gut bacterial community significantly. Secondary metabolites created the most dramatic effects on the microbial community, potentially overriding the effect of other types of compounds. Furthermore, some microbial groups were stimulated specifically by particular groups of compounds. For instance, termites fed with secondary metabolites contained more Firmicutes and Spirochaetes compared to the other treatments. In conclusion, our results suggest that the termite (Reticulitermes flavipes) can be used as a simple and effective system to test the effects of particular chemical compounds in modulating the gut microbiome.
Lovelock, Sarah L; Turner, Nicholas J
2014-10-15
Phenylalanine ammonia lyases (PALs) catalyse the regio- and stereoselective hydroamination of cinnamic acid analogues to yield optically enriched α-amino acids. Herein, we demonstrate that a bacterial PAL from Anabaena variabilis (AvPAL) displays significantly higher activity towards a series of non-natural substrates than previously described eukaryotic PALs. Biotransformations performed on a preparative scale led to the synthesis of the 2-chloro- and 4-trifluoromethyl-phenylalanine derivatives in excellent ee, highlighting the enormous potential of bacterial PALs as biocatalysts for the synthesis of high value, non-natural amino acids. Copyright © 2014 Elsevier Ltd. All rights reserved.
Bacterial and archaeal diversities in Yunnan and Tibetan hot springs, China.
Song, Zhao-Qi; Wang, Feng-Ping; Zhi, Xiao-Yang; Chen, Jin-Quan; Zhou, En-Min; Liang, Feng; Xiao, Xiang; Tang, Shu-Kun; Jiang, Hong-Chen; Zhang, Chuanlun L; Dong, Hailiang; Li, Wen-Jun
2013-04-01
Thousands of hot springs are located in the north-eastern part of the Yunnan-Tibet geothermal zone, which is one of the most active geothermal areas in the world. However, a comprehensive and detailed understanding of microbial diversity in these hot springs is still lacking. In this study, bacterial and archaeal diversities were investigated in 16 hot springs (pH 3.2-8.6; temperature 47-96°C) in Yunnan Province and Tibet, China by using a barcoded 16S rRNA gene-pyrosequencing approach. Aquificae, Proteobacteria, Firmicutes, Deinococcus-Thermus and Bacteroidetes comprised the large portion of the bacterial communities in acidic hot springs. Non-acidic hot springs harboured more and variable bacterial phyla than acidic springs. Desulfurococcales and unclassified Crenarchaeota were the dominated groups in archaeal populations from most of the non-acidic hot springs; whereas, the archaeal community structure in acidic hot springs was simpler and characterized by Sulfolobales and Thermoplasmata. The phylogenetic analyses showed that Aquificae and Crenarchaeota were predominant in the investigated springs and possessed many phylogenetic lineages that have never been detected in other hot springs in the world. Thus findings from this study significantly improve our understanding of microbial diversity in terrestrial hot springs. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.
Kim, Hye Min; Lee, Min Jin; Jung, Ji Young; Hwang, Chung Yeon; Kim, Mincheol; Ro, Hee-Myong; Chun, Jongsik; Lee, Yoo Kyung
2016-11-01
The increasing temperature in Arctic tundra deepens the active layer, which is the upper layer of permafrost soil that experiences repeated thawing and freezing. The increasing of soil temperature and the deepening of active layer seem to affect soil microbial communities. Therefore, information on soil microbial communities at various soil depths is essential to understand their potential responses to climate change in the active layer soil. We investigated the community structure of soil bacteria in the active layer from moist acidic tundra in Council, Alaska. We also interpreted their relationship with some relevant soil physicochemical characteristics along soil depth with a fine scale (5 cm depth interval). The bacterial community structure was found to change along soil depth. The relative abundances of Acidobacteria, Gammaproteobacteria, Planctomycetes, and candidate phylum WPS-2 rapidly decreased with soil depth, while those of Bacteroidetes, Chloroflexi, Gemmatimonadetes, and candidate AD3 rapidly increased. A structural shift was also found in the soil bacterial communities around 20 cm depth, where two organic (upper Oi and lower Oa) horizons are subdivided. The quality and the decomposition degree of organic matter might have influenced the bacterial community structure. Besides the organic matter quality, the vertical distribution of bacterial communities was also found to be related to soil pH and total phosphorus content. This study showed the vertical change of bacterial community in the active layer with a fine scale resolution and the possible influence of the quality of soil organic matter on shaping bacterial community structure.
Hao, Yi; Ma, Chuanxin; Zhang, Zetian; Song, Youhong; Cao, Weidong; Guo, Jing; Zhou, Guopeng; Rui, Yukui; Liu, Liming; Xing, Baoshan
2018-01-01
The aim of this study was to compare the toxicity effects of carbon nanomaterials (CNMs), namely fullerene (C 60 ), reduced graphene oxide (rGO) and multi-walled carbon nanotubes (MWCNTs), on a mini-ecosystem of rice grown in a loamy potted soil. We measured plant physiological and biochemical parameters and examined bacterial community composition in the CNMs-treated plant-soil system. After 30 days of exposure, all the three CNMs negatively affected the shoot height and root length of rice, significantly decreased root cortical cells diameter and resulted in shrinkage and deformation of cells, regardless of exposure doses (50 or 500 mg/kg). Additionally, at the high exposure dose of CNM, the concentrations of four phytohormones, including auxin, indoleacetic acid, brassinosteroid and gibberellin acid 4 in rice roots significantly increased as compared to the control. At the high exposure dose of MWCNTs and C 60 , activities of the antioxidant enzymes superoxide dismutase (SOD) and peroxidase (POD) in roots increased significantly. High-throughput sequencing showed that three typical CNMs had little effect on shifting the predominant soil bacterial species, but the presence of CNMs significantly altered the composition of the bacterial community. Our results indicate that different CNMs indeed resulted in environmental toxicity to rice and soil bacterial community in the rhizosphere and suggest that CNMs themselves and their incorporated products should be reasonably used to control their release/discharge into the environment to prevent their toxic effects on living organisms and the potential risks to food safety. Copyright © 2017 Elsevier Ltd. All rights reserved.
Cvijetić, Ilija N; Verbić, Tatjana Ž; Ernesto de Resende, Pedro; Stapleton, Paul; Gibbons, Simon; Juranić, Ivan O; Drakulić, Branko J; Zloh, Mire
2018-01-01
Antimicrobial resistance (AMR) is a major health problem worldwide, because of ability of bacteria, fungi and viruses to evade known therapeutic agents used in treatment of infections. Aryldiketo acids (ADK) have shown antimicrobial activity against several resistant strains including Gram-positive Staphylococcus aureus bacteria. Our previous studies revealed that ADK analogues having bulky alkyl group in ortho position on a phenyl ring have up to ten times better activity than norfloxacin against the same strains. Rational modifications of analogues by introduction of hydrophobic substituents on the aromatic ring has led to more than tenfold increase in antibacterial activity against multidrug resistant Gram positive strains. To elucidate a potential mechanism of action for this potentially novel class of antimicrobials, several bacterial enzymes were identified as putative targets according to literature data and pharmacophoric similarity searches for potent ADK analogues. Among the seven bacterial targets chosen, the strongest favorable binding interactions were observed between most active analogue and S. aureus dehydrosqualene synthase and DNA gyrase. Furthermore, the docking results in combination with literature data suggest that these novel molecules could also target several other bacterial enzymes, including prenyl-transferases and methionine aminopeptidase. These results and our statistically significant 3D QSAR model could be used to guide the further design of more potent derivatives as well as in virtual screening for novel antibacterial agents. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
The microbiota and microbiome in aging: potential implications in health and age-related diseases.
Zapata, Heidi J; Quagliarello, Vincent J
2015-04-01
Advances in bacterial deoxyribonucleic acid sequencing allow for characterization of the human commensal bacterial community (microbiota) and its corresponding genome (microbiome). Surveys of healthy adults reveal that a signature composite of bacteria characterizes each unique body habitat (e.g., gut, skin, oral cavity, vagina). A myriad of clinical changes, including a basal proinflammatory state (inflamm-aging), that directly interface with the microbiota of older adults and enhance susceptibility to disease accompany aging. Studies in older adults demonstrate that the gut microbiota correlates with diet, location of residence (e.g., community dwelling, long-term care settings), and basal level of inflammation. Links exist between the microbiota and a variety of clinical problems plaguing older adults, including physical frailty, Clostridium difficile colitis, vulvovaginal atrophy, colorectal carcinoma, and atherosclerotic disease. Manipulation of the microbiota and microbiome of older adults holds promise as an innovative strategy to influence the development of comorbidities associated with aging. © 2015, Copyright the Authors Journal compilation © 2015, The American Geriatrics Society.
Ardizzoni, Andrea; Neglia, Rachele G; Baschieri, Maria C; Cermelli, Claudio; Caratozzolo, Manuela; Righi, Elena; Palmieri, Beniamino; Blasi, Elisabetta
2011-10-01
Hyaluronic acid (HA) has several clinical applications (aesthetic surgery, dermatology, orthopaedics and ophtalmology). Following recent evidence, suggesting antimicrobial and antiviral properties for HA, we investigated its effects on 15 ATCC strains, representative of clinically relevant bacterial and fungal species. The in vitro system employed allowed to assess optical density of broth cultures as a measure of microbial load in a time-dependent manner. The results showed that different microbial species and, sometimes, different strains belonging to the same species, are differently affected by HA. In particular, staphylococci, enterococci, Streptococcus mutans, two Escherichia coli strains, Pseudomonas aeruginosa, Candida glabrata and C. parapsilosis displayed a HA dose-dependent growth inhibition; no HA effects were detected in E. coli ATCC 13768 and C. albicans; S. sanguinis was favoured by the highest HA dose. Therefore, the influence of HA on bacteria and fungi warrants further studies aimed at better establishing its relevance in clinical applications.
Fleischman, R A; Cambell, J L; Richardson, C C
1976-03-25
Using the single-stranded circular DNA of bacteriophage fd as template, double-stranded circular DNA has been prepared in vitro with either 5-hydroxymethylcytosine ([hmdC]DNA) or cytosine ([dC]DNA) in the product strand. Extracts prepared from Escherichia coli cells restrictive to T-even phage containing nonglucosylated DNA degrade [hmdC]DNA to acid-soluble material in vitro, but do not degrade [dC]dna. In contrast, extracts prepared from E. coli K12 rglA- rglB-, a strain permissive to T-even phage containing nonglucosylated DNA, do not degrade [hmdC]DNA or [dC]DNA. In addition, glucosylation of the [hmdC]DNA renders it resistant to degradation by extracts from restrictive strains. The conversion of [hmdC]DNA to acid-soluble material in vitro consists of an HmCyt-specific endonucleolytic cleavage requiring the presence of the RglB gene product to form a linear molecule, followed by a non-HmCyt-specific hydrolysis of the linear DNA to acid-soluble fragments, catalyzed in part by exonuclease V. The RglB protein present in extracts of E. coli K12 rglA- rglB+ has been purified 200-fold by complementation with extracts from E. coli K12 rglA- rglB-. The purified RglB protein does not contain detectable HmCyt-specific endonuclease or exonuclease activity. In vitro endonucleolytic cleavage of [hmdC]DNA thus requires additional factors present in cell extracts.
NASA Astrophysics Data System (ADS)
Mashhadi, Syed Muddassir Ali; Yunus, Uzma; Bhatti, Moazzam Hussain; Ahmed, Imtiaz; Tahir, Muhammad Nawaz
2016-08-01
Isoniazid is an important component used in "triple therapy" to combat tuberculosis. It has reduced Tabletting formulations stability. Anti-oxidants are obligatory to counter oxidative stress, pulmonary inflammation, and free radical burst from macrophages caused in tuberculosis and other diseases. In the present study a hydrate cocrystal of Isoniazid with anti-oxidant and anti-inflammatory and anti-bacterial Protocatechuic acid (3,4-dihydroxybenzoic acid) in 1:1 is reported. This Cocrystal may have improved tabletting stability and anti-oxidant properties. Cocrystal structure analysis confirmed the existence of pyridine-carboxylic acid synthon in the Cocrystal. Other synthons of different graph sets involving Nsbnd H···O and Osbnd H···N bonds are formed between hydrazide group of isoniazid and coformer. Solubility studies revealed that cocrystal is less soluble as compared to isoniazid in buffer at pH 7.4 at 22 °C while stability studies at 80 °C for 24 h period disclosed the fact that cocrystal has higher stability than that of isoniazid.
Huberman, Eliezer [Chicago, IL; Baccam, Mekhine J [Woodridge, IL
2007-02-27
The present invention relates to a nucleic acid sequence and its corresponding protein sequence useful as a dominant selectable marker in eukaryotes. More specifically the invention relates to a nucleic acid encoding a bacterial IMPDH gene that has been engineered into a eukaryotic expression vectors, thereby permitting bacterial IMPDH expression in mammalian cells. Bacterial IMPDH expression confers resistance to MPA which can be used as dominant selectable marker in eukaryotes including mammals. The invention also relates to expression vectors and cells that express the bacterial IMPDH gene as well as gene therapies and protein synthesis.
Wang, Yang; Desai, Janish; Zhang, Yonghui; Malwal, Satish R; Shin, Christopher J; Feng, Xinxin; Sun, Hong; Liu, Guizhi; Guo, Rey-Ting; Oldfield, Eric
2016-10-19
We synthesized a series of benzoic acids and phenylphosphonic acids and investigated their effects on the growth of Staphylococcus aureus and Bacillus subtilis. One of the most active compounds, 5-fluoro-2-(3-(octyloxy)benzamido)benzoic acid (7, ED 50 ∼0.15 μg mL -1 ) acted synergistically with seven antibiotics known to target bacterial cell-wall biosynthesis (a fractional inhibitory concentration index (FICI) of ∼0.35, on average) but had indifferent effects in combinations with six non-cell-wall biosynthesis inhibitors (average FICI∼1.45). The most active compounds were found to inhibit two enzymes involved in isoprenoid/bacterial cell-wall biosynthesis: undecaprenyl diphosphate synthase (UPPS) and undecaprenyl diphosphate phosphatase (UPPP), but not farnesyl diphosphate synthase, and there were good correlations between bacterial cell growth inhibition, UPPS inhibition, and UPPP inhibition. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Pseudomonas oryzihabitans sepsis in a 1-year-old child with multiple skin rashes: a case report.
Owusu, Michael; Owusu-Dabo, Ellis; Acheampong, Godfred; Osei, Isaac; Amuasi, John; Sarpong, Nimako; Annan, Augustina; Chiang, Hsin-Ying; Kuo, Chih-Horng; Park, Se Eun; Marks, Florian; Adu-Sarkodie, Yaw
2017-03-23
Pseudomonas oryzihabitans is a Pseudomonas bacterial organism rarely implicated in human infections. The bacterium has been isolated in a few reported cases of neurosurgical infections and patients with end-stage cirrhosis, sickle cell disease, and community-acquired urinary tract infections. Limited information exists in developing countries, however, because of the lack of advanced microbiological tools for identification and characterization of this bacterium. This case report describes the isolation of a rare Pseudomonas bacterium in a patient presenting with sepsis and skin infection. A 1-year-old girl was presented to a hospital in the northeastern part of Ghana with a 1-week history of pustular rashes on her scalp and neck, which occasionally ruptured, along with discharge of yellowish purulent fluid. The child is of Mole-Dagbon ethnicity and hails from the northern part of Ghana. Pseudomonas oryzihabitans was identified in the patient's blood culture using the 16S ribosomal deoxyribonucleic acid sequencing technique. The rash on the patient's scalp and skin resolved after continuous treatment with gentamicin while her condition improved clinically. This finding suggests the potential of this bacterium to cause disease in unsuspected situations and emphasizes the need to have evidence for the use of the appropriate antibiotic in clinical settings, particularly in rural settings in Africa. It also brings to the fore the unreliability of conventional methods for identification of Pseudomonas bacteria in clinical samples and thus supports the use of 16S ribosomal deoxyribonucleic acid in making the diagnosis.
Zusman, David R.; Carbonell, Augustina; Haga, Juli Y.
1973-01-01
The reorganization of the bacterial nucleoid of an Escherichia coli mutant, MX74T2 ts52, was studied by electron microscopy after protein synthesis inhibition by using whole mounts of cell ghosts, ultrathin-sectioning, and freeze-etching. The bacterial nucleoid showed two morphological changes after chloramphenicol addition: deoxyribonucleic acid (DNA) localization and DNA condensation. DNA localization was observed 10 min after chloramphenicol addition; the DNA appeared as a compact, solid mass. DNA condensation was observed at 25 min; the nucleoid appeared as a cytoplasm-filled sphere, often opened at one end. Ribosomes were observed in the center. Giant nucleoids present in some mutant filaments showed fused, spherical nucleoids arranged linearly, suggesting that the tertiary structure of the nucleoid reflects the number of replicated genomes. Inhibitors which directly or indirectly blocked protein synthesis and caused DNA condensation were chloramphenicol, puromycin, amino acid starvation, rifampicin, or carbonyl cyanide m-chlorophenyl hydrazone. All inhibitors that caused cell division in the mutant also caused condensation, although some inhibitors caused condensation without cell division. Nucleoid condensation appears to be related to chromosome structure rather than to DNA segregation upon cell division. Images PMID:4580561
Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.
2003-01-01
Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643
Thin-layer chromatographic technique for rapid detection of bacterial phospholipases.
Legakis, N J; Papavassiliou, J
1975-11-01
Silica gel thin-layer chromatography was employed to detect lecithinase activity induced from bacterial resting cell preparations induced from bacterial resting cell preparations incubated at 37 C for 4 h in the presence of purified egg yolk lecithin. Bacillus subtilis, Bacillus cereus, Serratia marcescens, and Pseudomonas aeruginosa hydrolyzed lecithin with the formation of free fatty acids as the sole lipid-soluble product. In none of the Escherichia coli and Citrobacter freundii strains tested could lecithinase activity be detected. Four among eight strains of Enterobacter aerogenes and one among 12 strains of Proteus tested produced negligible amounts of free fatty acid.
Structural aspects of catalytic mechanisms of endonucleases and their binding to nucleic acids
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhukhlistova, N. E.; Balaev, V. V.; Lyashenko, A. V.
2012-05-15
Endonucleases (EC 3.1) are enzymes of the hydrolase class that catalyze the hydrolytic cleavage of deoxyribonucleic and ribonucleic acids at any region of the polynucleotide chain. Endonucleases are widely used both in biotechnological processes and in veterinary medicine as antiviral agents. Medical applications of endonucleases in human cancer therapy hold promise. The results of X-ray diffraction studies of the spatial organization of endonucleases and their complexes and the mechanism of their action are analyzed and generalized. An analysis of the structural studies of this class of enzymes showed that the specific binding of enzymes to nucleic acids is characterized bymore » interactions with nitrogen bases and the nucleotide backbone, whereas the nonspecific binding of enzymes is generally characterized by interactions only with the nucleic-acid backbone. It should be taken into account that the specificity can be modulated by metal ions and certain low-molecular-weight organic compounds. To test the hypotheses about specific and nonspecific nucleic-acid-binding proteins, it is necessary to perform additional studies of atomic-resolution three-dimensional structures of enzyme-nucleic-acid complexes by methods of structural biology.« less
Structural aspects of catalytic mechanisms of endonucleases and their binding to nucleic acids
NASA Astrophysics Data System (ADS)
Zhukhlistova, N. E.; Balaev, V. V.; Lyashenko, A. V.; Lashkov, A. A.
2012-05-01
Endonucleases (EC 3.1) are enzymes of the hydrolase class that catalyze the hydrolytic cleavage of deoxyribonucleic and ribonucleic acids at any region of the polynucleotide chain. Endonucleases are widely used both in biotechnological processes and in veterinary medicine as antiviral agents. Medical applications of endonucleases in human cancer therapy hold promise. The results of X-ray diffraction studies of the spatial organization of endonucleases and their complexes and the mechanism of their action are analyzed and generalized. An analysis of the structural studies of this class of enzymes showed that the specific binding of enzymes to nucleic acids is characterized by interactions with nitrogen bases and the nucleotide backbone, whereas the nonspecific binding of enzymes is generally characterized by interactions only with the nucleic-acid backbone. It should be taken into account that the specificity can be modulated by metal ions and certain low-molecular-weight organic compounds. To test the hypotheses about specific and nonspecific nucleic-acid-binding proteins, it is necessary to perform additional studies of atomic-resolution three-dimensional structures of enzyme-nucleic-acid complexes by methods of structural biology.
An optical deoxyribonucleic acid-based half-subtractor.
Yang, Chia-Ning; Chen, Yi-Li; Lin, Hung-Yin; Hsu, Chun-Yu
2013-10-09
This study introduces an optical DNA-based logic circuit that mimics a half-subtractor. The system contains an Au-surface immobilized molecular-beacon molecule that serves as a dual-gate molecule and outputs two series of fluorescence signals following Boolean INH and XOR patterns after interacting with one or two single-stranded DNA molecules as input. To the best of our knowledge, the system reported herein is rather concise compared to other molecular logic gate systems.
Hamamura, Natsuko; Olson, Sarah H.; Ward, David M.; Inskeep, William P.
2005-01-01
In this paper we describe the bacterial communities associated with natural hydrocarbon seeps in nonthermal soils at Rainbow Springs, Yellowstone National Park. Soil chemical analysis revealed high sulfate concentrations and low pH values (pH 2.8 to 3.8), which are characteristic of acid-sulfate geothermal activity. The hydrocarbon composition of the seep soils consisted almost entirely of saturated, acyclic alkanes (e.g., n-alkanes with chain lengths of C15 to C30, as well as branched alkanes, predominately pristane and phytane). Bacterial populations present in the seep soils were phylogenetically characterized by 16S rRNA gene clone library analysis. The majority of the sequences recovered (>75%) were related to sequences of heterotrophic acidophilic bacteria, including Acidisphaera spp. and Acidiphilium spp. of the α-Proteobacteria. Clones related to the iron- and sulfur-oxidizing chemolithotroph Acidithiobacillus spp. were also recovered from one of the seep soils. Hydrocarbon-amended soil-sand mixtures were established to examine [14C]hexadecane mineralization and corresponding changes in the bacterial populations using denaturing gradient gel electrophoresis (DGGE) of 16S rRNA gene fragments. Approximately 50% of the [14C]hexadecane added was recovered as 14CO2 during an 80-day incubation, and this was accompanied by detection of heterotrophic acidophile-related sequences as dominant DGGE bands. An alkane-degrading isolate was cultivated, whose 16S rRNA gene sequence was identical to the sequence of a dominant DGGE band in the soil-sand mixture, as well as the clone sequence recovered most frequently from the original soil. This and the presence of an alkB gene homolog in this isolate confirmed the alkane degradation capability of one population indigenous to acidic hydrocarbon seep soils. PMID:16204508
Hamamura, Natsuko; Olson, Sarah H; Ward, David M; Inskeep, William P
2005-10-01
In this paper we describe the bacterial communities associated with natural hydrocarbon seeps in nonthermal soils at Rainbow Springs, Yellowstone National Park. Soil chemical analysis revealed high sulfate concentrations and low pH values (pH 2.8 to 3.8), which are characteristic of acid-sulfate geothermal activity. The hydrocarbon composition of the seep soils consisted almost entirely of saturated, acyclic alkanes (e.g., n-alkanes with chain lengths of C15 to C30, as well as branched alkanes, predominately pristane and phytane). Bacterial populations present in the seep soils were phylogenetically characterized by 16S rRNA gene clone library analysis. The majority of the sequences recovered (>75%) were related to sequences of heterotrophic acidophilic bacteria, including Acidisphaera spp. and Acidiphilium spp. of the alpha-Proteobacteria. Clones related to the iron- and sulfur-oxidizing chemolithotroph Acidithiobacillus spp. were also recovered from one of the seep soils. Hydrocarbon-amended soil-sand mixtures were established to examine [14C]hexadecane mineralization and corresponding changes in the bacterial populations using denaturing gradient gel electrophoresis (DGGE) of 16S rRNA gene fragments. Approximately 50% of the [14C]hexadecane added was recovered as 14CO2 during an 80-day incubation, and this was accompanied by detection of heterotrophic acidophile-related sequences as dominant DGGE bands. An alkane-degrading isolate was cultivated, whose 16S rRNA gene sequence was identical to the sequence of a dominant DGGE band in the soil-sand mixture, as well as the clone sequence recovered most frequently from the original soil. This and the presence of an alkB gene homolog in this isolate confirmed the alkane degradation capability of one population indigenous to acidic hydrocarbon seep soils.
Real time viability detection of bacterial spores
Vanderberg, Laura A.; Herdendorf, Timothy J.; Obiso, Richard J.
2003-07-29
This invention relates to a process for detecting the presence of viable bacterial spores in a sample and to a spore detection system, the process including placing a sample in a germination medium for a period of time sufficient for commitment of any present viable bacterial spores to occur, mixing the sample with a solution of a lanthanide capable of forming a fluorescent complex with dipicolinic acid, and, measuring the sample for the presence of dipicolinic acid, and the system including a germination chamber having inlets from a sample chamber, a germinant chamber and a bleach chamber, the germination chamber further including an outlet through a filtering means, the outlet connected to a detection chamber, the detection chamber having an inlet from a fluorescence promoting metal chamber and the detection chamber including a spectral excitation source and a means of measuring emission spectra from a sample, the detection chamber further connected to a waste chamber. A germination reaction mixture useful for promoting commitment of any viable bacterial spores in a sample including a combination of L-alanine, L-asparagine and D-glucose is also described.
Sison-Mangus, Marilou P.; Jiang, Sunny; Kudela, Raphael M.; Mehic, Sanjin
2016-01-01
Pseudo-nitzschia blooms often occur in coastal and open ocean environments, sometimes leading to the production of the neurotoxin domoic acid that can cause severe negative impacts to higher trophic levels. Increasing evidence suggests a close relationship between phytoplankton bloom and bacterial assemblages, however, the microbial composition and succession during a bloom process is unknown. Here, we investigate the bacterial assemblages before, during and after toxic and non-toxic Pseudo-nitzschia blooms to determine the patterns of bacterial succession in a natural bloom setting. Opportunistic sampling of bacterial community profiles were determined weekly at Santa Cruz Municipal Wharf by 454 pyrosequencing and analyzed together with domoic acid levels, phytoplankton community and biomass, nutrients and temperature. We asked if the bacterial communities are similar between bloom and non-bloom events and if domoic acid or the presence of toxic algal species acts as a driving force that can significantly structure phytoplankton-associated bacterial communities. We found that bacterial diversity generally increases when Pseudo-nitzschia numbers decline. Furthermore, bacterial diversity is higher when the low-DA producing P. fraudulenta dominates the algal bloom while bacterial diversity is lower when high-DA producing P. australis dominates the algal bloom, suggesting that the presence of algal toxin can structure bacterial community. We also found bloom-related succession patterns among associated bacterial groups; Gamma-proteobacteria, were dominant during low toxic P. fraudulenta blooms comprising mostly of Vibrio spp., which increased in relative abundance (6–65%) as the bloom progresses. On the other hand, Firmicutes bacteria comprising mostly of Planococcus spp. (12–86%) dominate during high toxic P. australis blooms, with the bacterial assemblage showing the same bloom-related successional patterns in three independent bloom events. Other environmental
Anderson, Gregory G; Goller, Carlos C; Justice, Sheryl; Hultgren, Scott J; Seed, Patrick C
2010-03-01
Uropathogenic Escherichia coli (UPEC) is the leading cause of urinary tract infections (UTIs). A murine UTI model has revealed an infection cascade whereby UPEC undergoes cycles of invasion of the bladder epithelium, intracellular proliferation in polysaccharide-containing biofilm-like masses called intracellular bacterial communities (IBC), and then dispersal into the bladder lumen to initiate further rounds of epithelial colonization and invasion. We predicted that the UPEC K1 polysaccharide capsule is a key constituent of the IBC matrix. Compared to prototypic E. coli K1 strain UTI89, a capsule assembly mutant had a fitness defect in functionally TLR4(+) and TLR4(-) mice, suggesting a protective role of capsule in inflamed and noninflamed hosts. K1 capsule assembly and synthesis mutants had dramatically reduced IBC formation, demonstrating the common requirement for K1 polysaccharide in IBC development. The capsule assembly mutant appeared dispersed in the cytoplasm of the bladder epithelial cells and failed to undergo high-density intracellular replication during later stages of infection, when the wild-type strain continued to form serial generations of IBC. Deletion of the sialic acid regulator gene nanR partially restored IBC formation in the capsule assembly mutant. These data suggest that capsule is necessary for efficient IBC formation and that aberrant sialic acid accumulation, resulting from disruption of K1 capsule assembly, produces a NanR-mediated defect in intracellular proliferation and IBC development. Together, these data demonstrate the complex but important roles of UPEC polysaccharide encapsulation and sialic acid signaling in multiple stages of UTI pathogenesis.
Park, Yong-Soon; Lee, Boyoung; Ryu, Choong-Min
2016-07-02
Defense against diverse biotic and abiotic stresses requires the plant to distinguish between self and non-self signaling molecules. Pathogen/microbe-associated molecular patterns (PAMPs/MAMPs) are pivotal for triggering innate immunity in plants. Unlike in animals and humans, the precise roles of nucleic acids in plant innate immunity are unclear. We therefore investigated the effects of infiltration of total Pseudomonas syringae pv. tomato DC3000 (Pto DC3000) RNAs into Arabidopsis plants. The pathogen population was 10-fold lower in bacterial RNAs pre-treated Arabidopsis plants than in the control. Bacterial RNAs purity was confirmed by physical (sonication) and chemical (RNase A and proteinase K digestion) methods. The perception of bacterial RNAs, especially rRNAs, positively regulated mitogen-activated protein kinase (MAPK) and induced a reactive oxygen species burst, callose deposition, salicylic acid (SA) and jasmonic acid (JA) signaling, and defense-related genes. Therefore, bacterial RNAs function as a new MAMP that activates plant innate immunity, providing a new paradigm for plant-microbe interactions.
Garimella, Ravindranath; Halye, Jeffrey L.; Harrison, William; Klebba, Phillip E.; Rice, Charles V.
2009-01-01
The conformation of D-alanine (D-Ala) groups of bacterial teichoic acid is a central, yet untested, paradigm of microbiology. The D-Ala binds via the C-terminus, thereby allowing the amine to exist as a free cationic NH3+ group with the ability to form a contact-ion-pair with the nearby anionic phosphate group. This conformation hinders metal chelation by the phosphate because the zwitterion pair is charge neutral. To the contrary, the repulsion of cationic antimicrobial peptides (CAMPs) is attributed to the presence of the D-Ala cation; thus the ion-pair does not form in this model. Solid-state nuclear magnetic resonance (NMR) spectroscopy has been used to measure the distance between amine and phosphate groups within cell wall fragments of Bacillus subtilis. The bacteria were grown on media containing 15N D-Ala and β-chloroalanine racemase inhibitor. The rotational-echo double-resonance (REDOR) pulse sequence was used to measure the internuclear dipolar coupling and the results demonstrate: 1) the metal-free amine-to-phosphate distance is 4.4 Å and 2) the amine-to-phosphate distance increases to 5.4 Å in the presence of Mg2+ ions. As a result, the zwitterion exists in a nitrogen-oxygen ion-pair configuration providing teichoic acid with a positive charge to repel CAMPs. Additionally, the amine of D-Ala does not prevent magnesium chelation in contradiction to the prevailing view of teichoic acids in metal binding. Thus, the NMR-based description of teichoic acid structure resolves the contradictory models, advances the basic understanding of cell wall biochemistry, and provides possible insight into the creation of new antibiotic therapies. PMID:19746945
Lee, Robert J.; Hariri, Benjamin M.; McMahon, Derek B.; Chen, Bei; Doghramjii, Laurel; Adappa, Nithin D.; Palmer, James N.; Kennedy, David W.; Jiang, Peihua; Margolskee, Robert F.; Cohen, Noam A.
2017-01-01
In the upper respiratory epithelium, bitter and sweet taste receptors present in solitary chemosensory cells influence antimicrobial innate immune defense responses. Whereas activation of the bitter taste receptor (T2R) stimulates surrounding epithelial cells to release antimicrobial peptides, activation of the sweet taste receptor (T1R) in the same cells inhibits this response. It is thought that this mechanism exists to control the magnitude of antimicrobial peptide release based upon the sugar content of airway surface liquid. We hypothesized that D-amino acids, which are produced by various bacteria and activate T1R in taste receptor cells in the mouth, may also activate T1R in the airway. Here, we show that both the T1R2 and T1R3 subunits of the sweet taste receptor (T1R2/3) are present in the same chemosensory cells of primary human sinonasal epithelial cultures. Respiratory isolates of Staphylococcus species, but not Pseudomonas aeruginosa, produced at least two D-amino acids that activate the sweet taste receptor. In addition to inhibiting P. aeruginosa biofilm formation, D-amino acids derived from Staphylococcus inhibited T2R-mediated signaling and defensin secretion in sinonasal cells by activating T1R2/3. D-amino acid–mediated activation of T1R2/3 also enhanced epithelial cell death during challenge with Staphylococcus aureus in the presence of the bitter-receptor–activating compound denatonium benzoate. These data establish a potential mechanism for interkingdom signaling in the airway mediated by bacterial D-amino acids and the mammalian sweet taste receptor in airway chemosensory cells. PMID:28874606
Niessen, Ludwig
2015-01-01
Loop-mediated isothermal amplification is a rather novel method of enzymatic deoxyribonucleic acid amplification which can be applied for the diagnosis of viruses, bacteria, and fungi. Although firmly established in viral and bacterial diagnosis, the technology has only recently been applied to a noteworthy number of species in the filamentous fungi and yeasts. The current review gives an overview of the literature so far published on the topic by discussing the different groups of fungal organisms to which the method has been applied. Moreover, the method is described in detail as well as the different possibilities available for signal detection and quantification and sample preparation. Future perspective of loop-mediated isothermal amplification-based assays is discussed in the light of applicability for fungal diagnostics.
Breazeale, F. W.; Camper, N. D.
1970-01-01
Soil samples were collected from an untreated plot and plots receiving repeated applications of 2,4-dichlorophenoxyacetic acid (2,4-D) and α,α,α-trifluoro-2, 6-dinitro-N,N-dipropyl-p-toluidine (trifluralin); they were then plated on media specific for bacteria, fungi, and actinomycetes. The actinomycete colony count in the trifluralin-treated plot was greater than the control, but the same as the control in the 2,4-D-treated plot. The bacterial count was lower in both treated plots. Fungal colonies in the trifluralin-treated plots were greater than the control, but not different from the control in the 2,4-D-treated plot. PMID:5437308
Antibacterial Performance of Alginic Acid Coating on Polyethylene Film
Karbassi, Elika; Asadinezhad, Ahmad; Lehocký, Marian; Humpolíček, Petr; Vesel, Alenka; Novák, Igor; Sáha, Petr
2014-01-01
Alginic acid coated polyethylene films were examined in terms of surface properties and bacteriostatic performance against two most representative bacterial strains, that is, Escherichia coli and Staphylococcus aureus. Microwave plasma treatment followed by brush formation in vapor state from three distinguished precursors (allylalcohol, allylamine, hydroxyethyl methacrylate) was carried out to deposit alginic acid on the substrate. Surface analyses via various techniques established that alginic acid was immobilized onto the surface where grafting (brush) chemistry influenced the amount of alginic acid coated. Moreover, alginic acid was found to be capable of bacterial growth inhibition which itself was significantly affected by the brush type. The polyanionic character of alginic acid as a carbohydrate polymer was assumed to play the pivotal role in antibacterial activity. The cell wall composition of two bacterial strains along with the substrates physicochemical properties accounted for different levels of bacteriostatic performance. PMID:25196604
Trophosome of the Deep-Sea Tubeworm Riftia pachyptila Inhibits Bacterial Growth.
Klose, Julia; Aistleitner, Karin; Horn, Matthias; Krenn, Liselotte; Dirsch, Verena; Zehl, Martin; Bright, Monika
2016-01-01
The giant tubeworm Riftia pachyptila lives in symbiosis with the chemoautotrophic gammaproteobacterium Cand. Endoriftia persephone. Symbionts are released back into the environment upon host death in high-pressure experiments, while microbial fouling is not involved in trophosome degradation. Therefore, we examined the antimicrobial effect of the tubeworm's trophosome and skin. The growth of all four tested Gram-positive, but only of one of the tested Gram-negative bacterial strains was inhibited by freshly fixed and degrading trophosome (incubated up to ten days at either warm or cold temperature), while no effect on Saccharomyces cerevisiae was observed. The skin did not show antimicrobial effects. A liquid chromatography-mass spectrometric analysis of the ethanol supernatant of fixed trophosomes lead to the tentative identification of the phospholipids 1-palmitoleyl-2-lyso-phosphatidylethanolamine, 2-palmitoleyl-1-lyso-phosphatidylethanolamine and the free fatty acids palmitoleic, palmitic and oleic acid, which are known to have an antimicrobial effect. As a result of tissue autolysis, the abundance of the free fatty acids increased with longer incubation time of trophosome samples. This correlated with an increasing growth inhibition of Bacillus subtilis and Listeria welshimeri, but not of the other bacterial strains. Therefore, the free fatty acids produced upon host degradation could be the cause of inhibition of at least these two bacterial strains.
Two Electrophoresis Experiments for Freshmen in the Health Professions.
ERIC Educational Resources Information Center
Brabson, G. Dana; Waugh, David S.
1986-01-01
Describes procedures involved with paper electrophoresis separation of amino acids, gel electrophoresis separation of DNA, and design of an electrophoresis tank. Describes experiments using paper (amino acids) and gel (deoxyribonucleic acid fragments). Provides material lists, procedures, and discussion. (JM)
Yabuuchi, E; Yano, I; Oyaizu, H; Hashimoto, Y; Ezaki, T; Yamamoto, H
1990-01-01
Based on the partial nucleotide sequence analysis of 16S ribosomal ribonucleic acid (rRNA), presence of unique sphingoglycolipids in cellular lipid, and the major type of ubiquinone (Q10), we propose Sphingomonas gen. nov. with the type species Sphingomonas paucimobilis (Holmes et al, 1977) comb. nov. From the homology values of deoxyribonucleic acid-deoxyribonucleic acid hybridization and the phenotypic characteristics, three new species, Sphingomonas parapaucimobilis, Sphingomonas yanoikuyae, Sphingomonas adhaesiva, and one new combination, Sphingomonas capsulata, are described. S. parapaucimobilis JCM 7510 (= GIFU 11387), S. yanoikuyae JCM 7371 (= GIFU 9882), and S. adhaesiva JCM 7370 (= GIFU 11458) are designated as the type strains of the three new species. Emended description of the type strain of S. capsulata is presented.
Molecular spectroscopic studies on the interaction of ferulic acid with calf thymus DNA
NASA Astrophysics Data System (ADS)
Zhang, Shufang; Sun, Xuejun; Qu, Fengli; Kong, Rongmei
2013-08-01
The interaction between ferulic acid and calf thymus deoxyribonucleic acid (ctDNA) under physiological conditions (Tris-HCl buffer solutions, pH 7.4) was investigated by UV-Vis spectroscopy, fluorescence spectroscopy, DNA melting techniques, and viscosity measurements. Results indicated that a complex of ferulic acid with ctDNA was formed with a binding constant of K290K = 7.60 × 104 L mol-1 and K310K = 4.90 × 104 L mol-1. The thermodynamic parameters enthalpy change (ΔH°), entropy change (ΔS°) and Gibbs free energy (ΔG°) were calculated to be -1.69 × 104 J mol-1, 35.36 J K-1 mol-1 and -2.79 × 104 J mol-1 at 310 K, respectively. The acting forces between ferulic acid and DNA mainly included hydrophobic interaction and hydrogen bonds. Acridine orange displacement studies revealed that ferulic acid can substitute for AO probe in the AO-DNA complex which was indicative of intercalation binding. Thermal denaturation study suggested that the interaction of ferulic acid with DNA could result in the increase of the denaturation temperature, which indicated that the stabilization of the DNA helix was increased in the presence of ferulic acid. Spectroscopic techniques together with melting techniques and viscosity determination provided evidences of intercalation mode of binding for the interaction between ferulic acid and ctDNA.
Effects of humic acid on the interactions between zinc oxide nanoparticles and bacterial biofilms
Ouyang, Kai; Yu, Xiao-Ying; Zhu, Yunlin; ...
2017-08-26
The effects of humic acid (HA) on interactions between ZnO nanoparticles (ZnO NPs) and Pseudomonas putida KT2440 biofilms at different maturity stages were investigated. Three stages of biofilm development were identified according to bacterial adenosine triphosphate (ATP) activity associated with biofilm development process. In the initial biofilm stage 1, the ATP content of bacteria was reduced by more than 90% when biofilms were exposed to ZnO NPs. But, in the mature biofilm stages 2 and 3, the ATP content was only slightly decreased. Biofilms at stage 3 exhibited less susceptibility to ZnO NPs than biofilms at stage 2. These resultsmore » suggest that more mature biofilms have a significantly higher tolerance to ZnO NPs compared to young biofilms. In addition, biofilms with intact extracellular polymeric substances (EPS) showed higher tolerance to ZnO NPs than those without EPS, indicating that EPS play a key role in alleviating the toxic effects of ZnO NPs. In both pure ZnO NPs and ZnO-HA mixtures, dissolved Zn 2+ originating from the NPs significantly contributed to the overall toxicity. The presence of HA dramatically decreased the toxicity of ZnO NPs due to the binding of Zn 2+ on HA. Furthermore, the combined results from this work suggest that the biofilm maturity stages and environmental constituents (such as humic acid) are important factors to consider when evaluating potential risks of NPs to ecological systems.« less
Effects of humic acid on the interactions between zinc oxide nanoparticles and bacterial biofilms
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ouyang, Kai; Yu, Xiao-Ying; Zhu, Yunlin
The effects of humic acid (HA) on interactions between ZnO nanoparticles (ZnO NPs) and Pseudomonas putida KT2440 biofilms at different maturity stages were investigated. Three stages of biofilm development were identified according to bacterial adenosine triphosphate (ATP) activity associated with biofilm development process. In the initial biofilm stage 1, the ATP content of bacteria was reduced by more than 90% when biofilms were exposed to ZnO NPs. However, in the mature biofilm stages 2 and 3, the ATP content was only slightly decreased. Biofilms at stage 3 exhibited less susceptibility to ZnO NPs than biofilms at stage 2. These resultsmore » suggest that more mature biofilms have a significantly higher tolerance to ZnO NPs compared to young biofilms. In addition, biofilms with intact extracellular poly-meric substances (EPS) showed higher tolerance to ZnO NPs than those without EPS, indicating that EPS play a key role in alleviating the toxic effects of ZnO NPs. In both pure ZnO NPs and ZnO-HA mixtures, dissolved Zn 2+ originating from the NPs significantly contributed to the overall toxicity. The presence of HA dramatically decreased the toxicity of ZnO NPs due to the binding of Zn 2+ on HA. The combined results from this work suggest that the biofilm maturity stages and environmental constituents (such as humic acid) are important factors to consider when evaluating potential risks of NPs to ecological systems.« less
Effects of humic acid on the interactions between zinc oxide nanoparticles and bacterial biofilms
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ouyang, Kai; Yu, Xiao-Ying; Zhu, Yunlin
The effects of humic acid (HA) on interactions between ZnO nanoparticles (ZnO NPs) and Pseudomonas putida KT2440 biofilms at different maturity stages were investigated. Three stages of biofilm development were identified according to bacterial adenosine triphosphate (ATP) activity associated with biofilm development process. In the initial biofilm stage 1, the ATP content of bacteria was reduced by more than 90% when biofilms were exposed to ZnO NPs. But, in the mature biofilm stages 2 and 3, the ATP content was only slightly decreased. Biofilms at stage 3 exhibited less susceptibility to ZnO NPs than biofilms at stage 2. These resultsmore » suggest that more mature biofilms have a significantly higher tolerance to ZnO NPs compared to young biofilms. In addition, biofilms with intact extracellular polymeric substances (EPS) showed higher tolerance to ZnO NPs than those without EPS, indicating that EPS play a key role in alleviating the toxic effects of ZnO NPs. In both pure ZnO NPs and ZnO-HA mixtures, dissolved Zn 2+ originating from the NPs significantly contributed to the overall toxicity. The presence of HA dramatically decreased the toxicity of ZnO NPs due to the binding of Zn 2+ on HA. Furthermore, the combined results from this work suggest that the biofilm maturity stages and environmental constituents (such as humic acid) are important factors to consider when evaluating potential risks of NPs to ecological systems.« less
Effects of humic acid on the interactions between zinc oxide nanoparticles and bacterial biofilms.
Ouyang, Kai; Yu, Xiao-Ying; Zhu, Yunlin; Gao, Chunhui; Huang, Qiaoyun; Cai, Peng
2017-12-01
The effects of humic acid (HA) on interactions between ZnO nanoparticles (ZnO NPs) and Pseudomonas putida KT2440 biofilms at different maturity stages were investigated. Three stages of biofilm development were identified according to bacterial adenosine triphosphate (ATP) activity associated with biofilm development process. In the initial biofilm stage 1, the ATP content of bacteria was reduced by more than 90% when biofilms were exposed to ZnO NPs. However, in the mature biofilm stages 2 and 3, the ATP content was only slightly decreased. Biofilms at stage 3 exhibited less susceptibility to ZnO NPs than biofilms at stage 2. These results suggest that more mature biofilms have a significantly higher tolerance to ZnO NPs compared to young biofilms. In addition, biofilms with intact extracellular polymeric substances (EPS) showed higher tolerance to ZnO NPs than those without EPS, indicating that EPS play a key role in alleviating the toxic effects of ZnO NPs. In both pure ZnO NPs and ZnO-HA mixtures, dissolved Zn 2+ originating from the NPs significantly contributed to the overall toxicity. The presence of HA dramatically decreased the toxicity of ZnO NPs due to the binding of Zn 2+ on HA. The combined results from this work suggest that the biofilm maturity stages and environmental constituents (such as humic acid) are important factors to consider when evaluating potential risks of NPs to ecological systems. Copyright © 2017 Elsevier Ltd. All rights reserved.
Inhibition of bacterial activity in acid mine drainage
NASA Astrophysics Data System (ADS)
Singh, Gurdeep; Bhatnagar, Miss Mridula
1988-12-01
Acid mine drainage water give rise to rapid growth and activity of an iron- and sulphur- oxidizing bacterium Thiobacillus ferrooxidians which greatly accelerate acid producing reactions by oxidation of pyrite material associated with coal and adjoining strata. The role of this bacterium in production of acid mine drainage is described. This study presents the data which demonstrate the inhibitory effect of certain organic acids, sodium benzoate, sodium lauryl sulphate, quarternary ammonium compounds on the growth of the acidophilic aerobic autotroph Thiobacillus ferrooxidians. In each experiment, 10 milli-litres of laboratory developed culture of Thiobacillus ferrooxidians was added to 250 milli-litres Erlenmeyer flask containing 90 milli-litres of 9-k media supplemented with FeSO4 7H2O and organic compounds at various concentrations. Control experiments were also carried out. The treated and untreated (control) samples analysed at various time intervals for Ferrous Iron and pH levels. Results from this investigation showed that some organic acids, sodium benzoate, sodium lauryl sulphate and quarternary ammonium compounds at low concentration (10-2 M, 10-50 ppm concentration levels) are effective bactericides and able to inhibit and reduce the Ferrous Iron oxidation and acidity formation by inhibiting the growth of Thiobacillus ferrooxidians is also discussed and presented
Dzhekieva, Liudmila; Kumar, Ish; Pratt, R F
2012-04-03
The DD-peptidases or penicillin-binding proteins (PBPs) catalyze the final steps of bacterial peptidoglycan biosynthesis and are inhibited by the β-lactam antibiotics. There is at present a question of whether the active site structure and activity of these enzymes is the same in the solubilized (truncated) DD-peptidase constructs employed in crystallographic and kinetics studies as in membrane-bound holoenzymes. Recent experiments with peptidoglycan-mimetic boronic acids have suggested that these transition state analogue-generating inhibitors may be able to induce reactive conformations of these enzymes and thus inhibit strongly. We have now, therefore, measured the dissociation constants of peptidoglycan-mimetic boronic acids from Escherichia coli and Bacillus subtilis PBPs in membrane preparations and, in the former case, in vivo, by means of competition experiments with the fluorescent penicillin Bocillin Fl. The experiments showed that the boronic acids bound measurably (K(i) < 1 mM) to the low-molecular mass PBPs but not to the high-molecular mass enzymes, both in membrane preparations and in whole cells. In two cases, E. coli PBP2 and PBP5, the dissociation constants obtained were very similar to those obtained with the pure enzymes in homogeneous solution. The boronic acids, therefore, are unable to induce tightly binding conformations of these enzymes in vivo. There is no evidence from these experiments that DD-peptidase inhibitors are more or less effective in vivo than in homogeneous solution.
California Black Oak Drying Problems and the Bacterial Factor.
1979-01-01
operations in Anderson area and to adjacent kilns by spacing stickers 18 inches apart and Georgia and wondered if bacterial tree drying softwood lumber at...on stickers in a weighted, volatile fatty acids which are the sapwood , and then from the outer, covered pile placed outdoors on the characteristic of...1. JT~~~ Figure 1 —Scanning electron micrographs of nonintected sapwood (A-B) and bacterially infected heartwood (C-D) from
Singh, Ram Sarup; Chauhan, Kanika; Kennedy, John F
2017-03-01
Inulinases are important hydrolysing enzymes which specifically act on β-2, 1 linkages of inulin to produce fructose or fructooligosaccharides. Fungi, yeasts and bacteria are the potent microbial sources of inulinases. The data on bacterial inulinases is scarce as compared to other microbial sources. Inulinases yield from bacteria is very less as compared to fungal and yeast sources of inulinases. Submerged fermentation (SmF) is the method of choice for the production of inulinases from bacterial sources. Moreover, inulin is a potent substrate for the production of inulinases in SmF. Many bacterial inulinases have been reported to display magnificent environment abiding features and variability in their biophysical and biochemical properties. These properties have attracted intention of many researchers towards exploring adverse ecological niches for more distinctive inulinase producing bacterial strains. Inulinases are substantially important in current biotechnological era due to their numerous industrial applications. High fructose syrup and fructooligosaccharides are two major industrial applications of inulinases. Additionally, there are many reports on the production of various metabolites like citric acid, lactic acid, ethanol, biofuels, butanediol etc. using mixed cultures of inulinase producing organisms with other microorganisms. The present review mainly envisages inulinase producing bacterial sources, inulinase production, purification, characterization and their applications. Copyright © 2016 Elsevier B.V. All rights reserved.
Bacterial Responses to Reactive Chlorine Species
Gray, Michael J.; Wholey, Wei-Yun; Jakob, Ursula
2013-01-01
Hypochlorous acid (HOCl), the active ingredient of household bleach, is the most common disinfectant in medical, industrial, and domestic use and plays an important role in microbial killing in the innate immune system. Given the critical importance of the antimicrobial properties of chlorine to public health, it is surprising how little is known about the ways in which bacteria sense and respond to reactive chlorine species (RCS). Although the literature on bacterial responses to reactive oxygen species (ROS) is enormous, work addressing bacterial responses to RCS has begun only recently. Transcriptomic and proteomic studies now provide new insights into how bacteria mount defenses against this important class of antimicrobial compounds. In this review, we summarize the current knowledge, emphasizing the overlaps between RCS stress responses and other more well-characterized bacterial defense systems, and identify outstanding questions that represent productive avenues for future research. PMID:23768204
In Vitro Modeling of Bile Acid Processing by the Human Fecal Microbiota.
Martin, Glynn; Kolida, Sofia; Marchesi, Julian R; Want, Elizabeth; Sidaway, James E; Swann, Jonathan R
2018-01-01
Bile acids, the products of concerted host and gut bacterial metabolism, have important signaling functions within the mammalian metabolic system and a key role in digestion. Given the complexity of the mega-variate bacterial community residing in the gastrointestinal tract, studying associations between individual bacterial genera and bile acid processing remains a challenge. Here, we present a novel in vitro approach to determine the bacterial genera associated with the metabolism of different primary bile acids and their potential to contribute to inter-individual variation in this processing. Anaerobic, pH-controlled batch cultures were inoculated with human fecal microbiota and treated with individual conjugated primary bile acids (500 μg/ml) to serve as the sole substrate for 24 h. Samples were collected throughout the experiment (0, 5, 10, and 24 h) and the bacterial composition was determined by 16S rRNA gene sequencing and the bile acid signatures were characterized using a targeted ultra-performance liquid chromatography-mass spectrometry (UPLC-MS) approach. Data fusion techniques were used to identify statistical bacterial-metabolic linkages. An increase in gut bacteria associated bile acids was observed over 24 h with variation in the rate of bile acid metabolism across the volunteers ( n = 7). Correlation analysis identified a significant association between the Gemmiger genus and the deconjugation of glycine conjugated bile acids while the deconjugation of taurocholic acid was associated with bacteria from the Eubacterium and Ruminococcus genera. A positive correlation between Dorea and deoxycholic acid production suggest a potential role for this genus in cholic acid dehydroxylation. A slower deconjugation of taurocholic acid was observed in individuals with a greater abundance of Parasutterella and Akkermansia . This work demonstrates the utility of integrating compositional (metataxonomics) and functional (metabonomics) systems biology approaches
Deacylation transition states of a bacterial DD-peptidase.
Adediran, S A; Kumar, I; Pratt, R F
2006-10-31
Beta-lactam antibiotics restrict bacterial growth by inhibiting DD-peptidases. These enzymes catalyze the final transpeptidation step in bacterial cell wall biosynthesis. Although much structural information is now available for these enzymes, the mechanism of the actual transpeptidation reaction has not been studied in detail. The reaction is known to involve a double-displacement mechanism with an acyl-enzyme intermediate, which can be attacked by water, specific amino acids, peptides, and other acyl acceptors. We describe in this paper an investigation of acyl acceptor specificity and assess the need for general base catalysis in the deacylation transition state of the Streptomyces R61 DD-peptidase. We show, by the criterion of solvent deuterium kinetic isotope effect measurements and proton inventories, that the transition states of specific and nonspecific substrates are very similar, at least with respect to proton motion. The transition states for attack (tetrahedral intermediate formation) by d-amino acids and Gly-l-Xaa dipeptides do not include a general base catalyst, while such catalysis is essential for reaction with water and d-alpha-hydroxy acids. D-Alpha-hydroxy acids act as acyl acceptors for glycyl substrates but not for more specific d-alanyl substrates; hydroxy acids actually behave, more generally, as mixed inhibitors of the DD-peptidase. The structural and mechanistic bases of these observations are discussed; they should inform transition state analogue design.
Interactions of plaunotol with bacterial membranes.
Koga, T; Watanabe, H; Kawada, H; Takahashi, K; Utsui, Y; Domon, H; Ishii, C; Narita, T; Yasuda, H
1998-08-01
Plaunotol, a cytoprotective antiulcer agent, has a bactericidal effect against Helicobacter pylori, which may result from interaction of this compound with the bacterial cell membrane. The purpose of the present study was to confirm that plaunotol interacts with the H. pylori membrane. Membrane fluidities were measured using two stearic acid spin labels, namely 5-doxyl-stearic acid (in which the nitroxide group is located in the upper portion of the bacterial cell membrane) and 16-doxyl-stearic acid methyl ester (in which the nitroxide group is located deeper in the bacterial cell membrane), by means of electron spin resonance. The membrane fluidities of plaunotol-treated cells were significantly increased in the measurements made using the two spin labels. We also attempted to isolate plaunotol-resistant H. pylori in vitro by two different methods. To assess the level of resistance that could be reached, H. pylori was passaged five times on an agar plate containing subinhibitory concentrations of plaunotol or metronidazole. To measure the rate of development of resistance, H. pylori was grown with subinhibitory concentrations (0.25 x MIC) of plaunotol or metronidazole, and quantitatively plated on to medium containing 4 x MIC of the compounds. This treatment was repeated once more. No plaunotol-resistant colonies were selected by the two methods. H. pylori developed resistance to metronidazole easily and at a relatively high rate. The mechanism by which plaunotol directly fluidizes and destroys the H. pylori membrane might make it difficult for this organism to develop resistance to plaunotol. It was confirmed that the bactericidal effects of plaunotol were also shown against Staphylococcus aureus, Streptococcus pneumoniae, Neisseria gonorrhoeae, Moraxella catarrhalis and Haemophilus influenzae. No such effect was seen against Escherichia coli and Pseudomonas aeruginosa.
A common bacterial metabolite elicits prion-based bypass of glucose repression
Garcia, David M; Dietrich, David; Clardy, Jon; Jarosz, Daniel F
2016-01-01
Robust preference for fermentative glucose metabolism has motivated domestication of the budding yeast Saccharomyces cerevisiae. This program can be circumvented by a protein-based genetic element, the [GAR+] prion, permitting simultaneous metabolism of glucose and other carbon sources. Diverse bacteria can elicit yeast cells to acquire [GAR+], although the molecular details of this interaction remain unknown. Here we identify the common bacterial metabolite lactic acid as a strong [GAR+] inducer. Transient exposure to lactic acid caused yeast cells to heritably circumvent glucose repression. This trait had the defining genetic properties of [GAR+], and did not require utilization of lactic acid as a carbon source. Lactic acid also induced [GAR+]-like epigenetic states in fungi that diverged from S. cerevisiae ~200 million years ago, and in which glucose repression evolved independently. To our knowledge, this is the first study to uncover a bacterial metabolite with the capacity to potently induce a prion. DOI: http://dx.doi.org/10.7554/eLife.17978.001 PMID:27906649
Bacterial endophytes enhance competition by invasive plants.
Rout, Marnie E; Chrzanowski, Thomas H; Westlie, Tara K; DeLuca, Thomas H; Callaway, Ragan M; Holben, William E
2013-09-01
Invasive plants can alter soil microbial communities and profoundly alter ecosystem processes. In the invasive grass Sorghum halepense, these disruptions are consequences of rhizome-associated bacterial endophytes. We describe the effects of N2-fixing bacterial strains from S. halepense (Rout and Chrzanowski, 2009) on plant growth and show that bacteria interact with the plant to alter soil nutrient cycles, enabling persistence of the invasive. • We assessed fluxes in soil nutrients for ∼4 yr across a site invaded by S. halepense. We assayed the N2-fixing bacteria in vitro for phosphate solubilization, iron chelation, and production of the plant-growth hormone indole-3-acetic acid (IAA). We assessed the plant's ability to recruit bacterial partners from substrates and vertically transmit endophytes to seeds and used an antibiotic approach to inhibit bacterial activity in planta and assess microbial contributions to plant growth. • We found persistent alterations to eight biogeochemical cycles (including nitrogen, phosphorus, and iron) in soils invaded by S. halepense. In this context, three bacterial isolates solubilized phosphate, and all produced iron siderophores and IAA in vitro. In growth chamber experiments, bacteria were transmitted vertically, and molecular analysis of bacterial community fingerprints from rhizomes indicated that endophytes are also horizontally recruited. Inhibiting bacterial activity with antibiotics resulted in significant declines in plant growth rate and biomass, with pronounced rhizome reductions. • This work suggests a major role of endophytes on growth and resource allocation of an invasive plant. Indeed, bacterial isolate physiology is correlated with invader effects on biogeochemical cycles of nitrogen, phosphate, and iron.
Sphagnum mosses harbour highly specific bacterial diversity during their whole lifecycle.
Bragina, Anastasia; Berg, Christian; Cardinale, Massimiliano; Shcherbakov, Andrey; Chebotar, Vladimir; Berg, Gabriele
2012-04-01
Knowledge about Sphagnum-associated microbial communities, their structure and their origin is important to understand and maintain climate-relevant Sphagnum-dominated bog ecosystems. We studied bacterial communities of two cosmopolitan Sphagnum species, which are well adapted to different abiotic parameters (Sphagnum magellanicum, which are strongly acidic and ombrotrophic, and Sphagnum fallax, which are weakly acidic and mesotrophic), in three Alpine bogs in Austria by a multifaceted approach. Great differences between bacterial fingerprints of both Sphagna were found independently from the site. This remarkable specificity was confirmed by a cloning and a deep sequencing approach. Besides the common Alphaproteobacteria, we found a discriminative spectrum of bacteria; although Gammaproteobacteria dominated S. magellanicum, S. fallax was mainly colonised by Verrucomicrobia and Planctomycetes. Using this information for fluorescent in situ hybridisation analyses, corresponding colonisation patterns for Alphaproteobacteria and Planctomycetes were detected. Bacterial colonies were found in high abundances inside the dead big hyalocytes, but they were always connected with the living chlorocytes. Using multivariate statistical analysis, the abiotic factors nutrient richness and pH were identified to modulate the composition of Sphagnum-specific bacterial communities. Interestingly, we found that the immense bacterial diversity was transferred via the sporophyte to the gametophyte, which can explain the high specificity of Sphagnum-associated bacteria over long distances. In contrast to higher plants, which acquire their bacteria mainly from the environment, mosses as the phylogenetically oldest land plants maintain their bacterial diversity within the whole lifecycle.
Sphagnum mosses harbour highly specific bacterial diversity during their whole lifecycle
Bragina, Anastasia; Berg, Christian; Cardinale, Massimiliano; Shcherbakov, Andrey; Chebotar, Vladimir; Berg, Gabriele
2012-01-01
Knowledge about Sphagnum-associated microbial communities, their structure and their origin is important to understand and maintain climate-relevant Sphagnum-dominated bog ecosystems. We studied bacterial communities of two cosmopolitan Sphagnum species, which are well adapted to different abiotic parameters (Sphagnum magellanicum, which are strongly acidic and ombrotrophic, and Sphagnum fallax, which are weakly acidic and mesotrophic), in three Alpine bogs in Austria by a multifaceted approach. Great differences between bacterial fingerprints of both Sphagna were found independently from the site. This remarkable specificity was confirmed by a cloning and a deep sequencing approach. Besides the common Alphaproteobacteria, we found a discriminative spectrum of bacteria; although Gammaproteobacteria dominated S. magellanicum, S. fallax was mainly colonised by Verrucomicrobia and Planctomycetes. Using this information for fluorescent in situ hybridisation analyses, corresponding colonisation patterns for Alphaproteobacteria and Planctomycetes were detected. Bacterial colonies were found in high abundances inside the dead big hyalocytes, but they were always connected with the living chlorocytes. Using multivariate statistical analysis, the abiotic factors nutrient richness and pH were identified to modulate the composition of Sphagnum-specific bacterial communities. Interestingly, we found that the immense bacterial diversity was transferred via the sporophyte to the gametophyte, which can explain the high specificity of Sphagnum-associated bacteria over long distances. In contrast to higher plants, which acquire their bacteria mainly from the environment, mosses as the phylogenetically oldest land plants maintain their bacterial diversity within the whole lifecycle. PMID:22094342
Smolina, Irina; Lee, Charles; Frank-Kamenetskii, Maxim
2007-01-01
An approach is proposed for in situ detection of short signature DNA sequences present in single copies per bacterial genome. The site is locally opened by peptide nucleic acids, and a circular oligonucleotide is assembled. The amplicon generated by rolling circle amplification is detected by hybridization with fluorescently labeled decorator probes. PMID:17293504
Akasaka, Kazuyuki; Maeno, Akihiro; Yamazaki, Akira
2017-12-01
A bacterial spore protects itself with an unusually high concentration (~10% in dry weight of spore) of dipicolinic acid (DPA), the release of which is considered the crucial step for inactivating it under mild pressure and temperature conditions. However, the process of how the spore releases DPA in response to pressure remains obscure. Here we apply 1 H high-resolution high-pressure NMR spectroscopy, for the first time, to the spore suspension of Bacillus subtilis natto and monitor directly and in real-time the leaking process of DPA in response to pressure of 200MPa at 20°C. We find that about one third of the total DPA leaks immediately upon applying pressure, but that the rest leaks slowly in hrs upon decreasing the pressure. Once DPA is fully released from the spore, the proteins of the spore become easily denatured at a mild temperature, e.g., 80°C, much below the temperature commonly used to inactivate spores (121°C). The success of the present experiment opens a new avenue for studying bacterial spores and cells at the molecular level in response to pressure, temperature and other perturbations. Copyright © 2017 Elsevier B.V. All rights reserved.
Direct observation of bacterial deposition onto clean and organic-fouled polyamide membranes.
Subramani, Arun; Huang, Xiaofei; Hoek, Eric M V
2009-08-01
Nanofiltration (NF) and reverse osmosis (RO) membranes are commonly applied to produce highly purified water from municipal wastewater effluents. In these applications, biofouling limits overall process performance and increases the cost of operation. Initial bacteria adhesion onto a membrane surface is a critical early step in the overall process of membrane biofouling. However, adsorption of effluent organic matter onto the membrane may precede bacterial deposition and change membrane surface properties. Herein we employed direct microscopic observation to elucidate mechanisms governing bacterial cell deposition onto clean and organic-fouled NF and RO membranes. Bovine serum albumin (BSA) and alginic acid (AA) were used as models for protein and polysaccharide rich organic matter in secondary wastewater effluents. In all experiments, organic fouling increased membrane hydraulic resistance and salt rejection, in addition to interfacial hydrophilicity and roughness. Even though surface hydrophilicity increased, the rougher surfaces presented by organic-fouled membranes produced nano-scale features that promoted localized bacterial deposition. An extended DLVO analysis of bacterial cells and membrane surface properties suggested that bacterial deposition correlated most strongly with the Lewis acid-base free energy of adhesion and root mean square (RMS) roughness, whereas van der Waals and electrostatic free energies were weakly correlated. This was true for both clean and organic-fouled membranes. Bacterial deposition rates were clearly influenced by an antagonistic interplay between macroscopic surface hydrophilicity and nano-scale surface roughness.
Comparison of the structural basis for thermal stability between archaeal and bacterial proteins.
Ding, Yanrui; Cai, Yujie; Han, Yonggang; Zhao, Bingqiang
2012-01-01
In this study, the structural basis for thermal stability in archaeal and bacterial proteins was investigated. There were many common factors that confer resistance to high temperature in both archaeal and bacterial proteins. These factors include increases in the Lys content, the bends and blanks of secondary structure, the Glu content of salt bridge; decreases in the number of main-side chain hydrogen bond and exposed surface area, and changes in the bends and blanks of amino acids. Certainly, the utilization of charged amino acids to form salt bridges is a primary factor. In both heat-resistant archaeal and bacterial proteins, most Glu and Asp participate in the formation of salt bridges. Other factors may influence either archaeal or bacterial protein thermostability, which includes the more frequent occurrence of shorter 3(10)-helices and increased hydrophobicity in heat-resistant archaeal proteins. However, there were increases in average helix length, the Glu content in salt bridges, temperature factors and decreases in the number of main-side chain hydrogen bonds, uncharged-uncharged hydrogen bonds, hydrophobicity, and buried and exposed polar surface area in heat-resistant bacterial proteins. Evidently, there are few similarities and many disparities between the heat-resistant mechanisms of archaeal and bacterial proteins.
Gugliotta, Giorgio; Calagna, Gloria; Adile, Giorgio; Polito, Salvatore; Saitta, Salvatore; Speciale, Patrizia; Palomba, Stefano; Perino, Antonino; Granese, Roberta; Adile, Biagio
2015-10-01
Urinary tract infections (UTIs) are common in the female population and, over a lifetime, about half of women have at least one episode of UTI requiring antibiotic therapy. The aim of the current study was to compare two different strategies for preventing recurrent bacterial cystitis: intravesical instillation of hyaluronic acid (HA) plus chondroitin sulfate (CS), and antibiotic prophylaxis with sulfamethoxazole plus trimethoprim. This was a retrospective review of two different cohorts of women affected by recurrent bacterial cystitis. Cases (experimental group) were women who received intravesical instillations of a sterile solution of high concentration of HA + CS in 50 mL water with calcium chloride every week during the 1(st) month and then once monthly for 4 months. The control group included women who received traditional therapy for recurrent cystitis based on daily antibiotic prophylaxis using sulfamethoxazole 200 mg plus trimethoprim 40 mg for 6 weeks. Ninety-eight and 76 patients were treated with experimental and control treatments, respectively. At 12 months after treatment, 69 and 109 UTIs were detected in the experimental and control groups, respectively. The proportion of patients free from UTIs was significantly higher in the experimental than in the control group (36.7% vs. 21.0%; p = 0.03). Experimental treatment was well tolerated and none of the patients stopped it. The intravesical instillation of HA + CS is more effective than long-term antibiotic prophylaxis for preventing recurrent bacterial cystitis. Copyright © 2015. Published by Elsevier B.V.
Arachidonic Acid Stress Impacts Pneumococcal Fatty Acid Homeostasis
Eijkelkamp, Bart A.; Begg, Stephanie L.; Pederick, Victoria G.; Trapetti, Claudia; Gregory, Melissa K.; Whittall, Jonathan J.; Paton, James C.; McDevitt, Christopher A.
2018-01-01
Free fatty acids hold dual roles during infection, serving to modulate the host immune response while also functioning directly as antimicrobials. Of particular importance are the long chain polyunsaturated fatty acids, which are not commonly found in bacterial organisms, that have been proposed to have antibacterial roles. Arachidonic acid (AA) is a highly abundant long chain polyunsaturated fatty acid and we examined its effect upon Streptococcus pneumoniae. Here, we observed that in a murine model of S. pneumoniae infection the concentration of AA significantly increases in the blood. The impact of AA stress upon the pathogen was then assessed by a combination of biochemical, biophysical and microbiological assays. In vitro bacterial growth and intra-macrophage survival assays revealed that AA has detrimental effects on pneumococcal fitness. Subsequent analyses demonstrated that AA exerts antimicrobial activity via insertion into the pneumococcal membrane, although this did not increase the susceptibility of the bacterium to antibiotic, oxidative or metal ion stress. Transcriptomic profiling showed that AA treatment also resulted in a dramatic down-regulation of the genes involved in fatty acid biosynthesis, in addition to impacts on other metabolic processes, such as carbon-source utilization. Hence, these data reveal that AA has two distinct mechanisms of perturbing the pneumococcal membrane composition. Collectively, this work provides a molecular basis for the antimicrobial contribution of AA to combat pneumococcal infections. PMID:29867785
NASA Astrophysics Data System (ADS)
Vallu, Rama Krishna; Velugula, Krishna; Doshi, Sejal; Chinta, Jugun Prakash
2018-01-01
Colorimetric and fluorimetric detection of toxic metal ions such as Hg2 + and Cr3 + has gained tremendous popularity over the conventional methods due to their operational simplicity, high selectivity, and speediness. Although numerous colorimetric and fluorescent receptors for Hg2 + or Cr3 + were reported in the literature, boronic acid-based receptors for these metal ions are rather scarce in the literature. Hence, in the present study dual function boronic acid conjugated rhodamine derivatives were developed, and their toxic metal ion detection abilities were studied by absorption, emission and visual detection methods. Absorption and emission spectral studies revealed that these derivatives displayed selectivity towards Hg2 +, Cr3 + and Fe3 + among the other metal ions studied by forming new absorption band. Both the derivatives exhibited colorimetric response towards Hg2 + and Cr3 + by the change in color of the solution to pink and reddish pink with Fe3 +. The detailed mechanism involved in the detection of Hg2 + was deduced by 1H NMR and ESI-MS studies. Further, these derivatives were used for fluorescence imaging of Hg2 + and Cr3 + in S. aureus bacterial cells. Thus the present manuscript demonstrated the use of boronic acid conjugated rhodamine derivatives as a dual function (colorimetric and fluorescent) probes and as imaging agents for Hg2 + and Cr3 +, which are known for their toxic influence on bacterial cells.
Park, Hyun Jung; Oh, Sung; Vinod, Nagarajan; Ji, Seongmi; Noh, Han Byul; Koo, Jung Mo; Lee, Su Hyeong; Kim, Sei Chang; Lee, Ki-Sung; Choi, Chang Won
2016-11-15
Acellular bacterial ghosts (BGs) are empty non-living bacterial cell envelopes, commonly generated by controlled expression of the cloned lysis gene E of bacteriophage PhiX174. In this study, Vibrio parahaemolyticus ghosts (VPGs) were generated by chemically-induced lysis and the method is based on minimum inhibitory concentration (MIC) of sodium hydroxide (NaOH), acetic acid, boric acid, citric acid, maleic acid, hydrochloric acid, and sulfuric acid. The MIC values of the respective chemicals were 3.125, 6.25, <50.0, 25.0, 6.25, 1.56, and 0.781 mg/mL. Except for boric acid, the lysis efficiency reached more than 99.99% at 5 min after treatment of all chemicals. Among those chemicals, NaOH-induced VPGs appeared completely DNA-free, which was confirmed by quantitative real-time PCR. Besides, lipopolysaccharides (LPS) extracted from the NaOH-induced VPGs showed no distinctive band on SDS-PAGE gel after silver staining. On the other hand, LPS extracted from wild-type bacterial cells, as well as the organic acids-induced VPGs showed triple major bands and LPS extracted from the inorganic acids-induced VPGs showed double bands. It suggests that some surface structures in LPS of the NaOH-induced VPGs may be lost, weakened, or modified by the MIC of NaOH. Nevertheless, Limulus amoebocyte lysate assay revealed that there is no significant difference in endotoxic activity between the NaOH-induced VPGs and wild-type bacterial cells. Macrophages exposed to the NaOH-induced VPGs at 0.5 × 10⁶ CFU/mL showed cell viability of 97.9%, however, the MIC of NaOH did not reduce the cytotoxic effect of wild-type bacterial cells. Like Escherichia coli LPS, the NaOH-induced VPGs are an excellent activator of pro-inflammatory cytokines (IL-1β and iNOS), anti-inflammatory cytokine (IL-10), and dual activities (IL-6) in the stimulated macrophage cells. On the other hand, the induction of TNF-α mRNA was remarkable in the macrophages exposed with wild-type cells. Scanning electron
Bacteriophages of methanotrophic bacteria.
Tyutikov, F M; Bespalova, I A; Rebentish, B A; Aleksandrushkina, N N; Krivisky, A S
1980-01-01
Bacteriophages of methanotrophic bacteria have been found in 16 out of 88 studied samples (underground waters, pond water, soil, gas and oil installation waters, fermentor cultural fluids, bacterial paste, and rumen of cattle) taken in different geographic zones of the Soviet Union. Altogether, 23 phage strains were isolated: 10 strains that specifically lysed only Methylosinus sporium strains, 2 strains that each lysed 1 of 5 Methylosinus trichosporium strains studied, and 11 strains that lysed Flavobacterium gasotypicum and, at the same time, 1 M. sporium strain. By fine structure, the phages were divided into two types (with very short or long noncontractile tails); by host range and serological properties, they fell into three types. One-step growth characteristics of the phages differed only slightly; the latent period varied from 6 to 8 h, the rise period varied from 4 to 6 h, and the average burst size was 100. All phages had guanine- and cytosine-rich double-stranded deoxyribonucleic acid consisting of common nitrogen bases. The molecular mass of the deoxyribonucleic acid as determined by restriction endonuclease analysis was 29.4 X 10(6) for M. sporium phages and 44 X 10(6) for F. gasotypicum phages. By all of the above-mentioned properties, all phages within each of the groups were completely identical to one another, but differed from phages of other groups. Bacteriophages lysing M. sporium and M. trichosporium GB2 were identical to phages M1 and M4, respectively, which were isolated earlier in the German Democratic Republic on the same methanotrophic species. Images PMID:6774962
Tong, Zongyong; Xie, Can; Ma, Lei; Liu, Liping; Jin, Yongsheng; Dong, Jiangli; Wang, Tao
2014-01-01
Alfalfa (Medicago sativa L.) is one of the most important forage crops used to feed livestock, such as cattle and sheep, and the sulfur amino acid (SAA) content of alfalfa is used as an index of its nutritional value. Aspartate kinase (AK) catalyzes the phosphorylation of aspartate to Asp-phosphate, the first step in the aspartate family biosynthesis pathway, and adenylylsulfate reductase (APR) catalyzes the conversion of activated sulfate to sulfite, providing reduced sulfur for the synthesis of cysteine, methionine, and other essential metabolites and secondary compounds. To reduce the feedback inhibition of other metabolites, we cloned bacterial AK and APR genes, modified AK, and introduced them into alfalfa. Compared to the wild-type alfalfa, the content of cysteine increased by 30% and that of methionine increased substantially by 60%. In addition, a substantial increase in the abundance of essential amino acids (EAAs), such as aspartate and lysine, was found. The results also indicated a close connection between amino acid metabolism and the tricarboxylic acid (TCA) cycle. The total amino acid content and the forage biomass tested showed no significant changes in the transgenic plants. This approach provides a new method for increasing SAAs and allows for the development of new genetically modified crops with enhanced nutritional value.
Tong, Zongyong; Xie, Can; Ma, Lei; Liu, Liping; Jin, Yongsheng; Dong, Jiangli; Wang, Tao
2014-01-01
Alfalfa (Medicago sativa L.) is one of the most important forage crops used to feed livestock, such as cattle and sheep, and the sulfur amino acid (SAA) content of alfalfa is used as an index of its nutritional value. Aspartate kinase (AK) catalyzes the phosphorylation of aspartate to Asp-phosphate, the first step in the aspartate family biosynthesis pathway, and adenylylsulfate reductase (APR) catalyzes the conversion of activated sulfate to sulfite, providing reduced sulfur for the synthesis of cysteine, methionine, and other essential metabolites and secondary compounds. To reduce the feedback inhibition of other metabolites, we cloned bacterial AK and APR genes, modified AK, and introduced them into alfalfa. Compared to the wild-type alfalfa, the content of cysteine increased by 30% and that of methionine increased substantially by 60%. In addition, a substantial increase in the abundance of essential amino acids (EAAs), such as aspartate and lysine, was found. The results also indicated a close connection between amino acid metabolism and the tricarboxylic acid (TCA) cycle. The total amino acid content and the forage biomass tested showed no significant changes in the transgenic plants. This approach provides a new method for increasing SAAs and allows for the development of new genetically modified crops with enhanced nutritional value. PMID:24520364
In Situ Hydrocarbon Degradation by Indigenous Nearshore Bacterial Populations
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cherrier, J.
). Results from these time series experiments demonstrated that short-term exposure of petroleum to UV light enhanced hydrocarbon degradation by 48% over that observed for non-photo-oxidized petroleum. Despite the greater bio-availability of the photo-oxidized over the non-photo-oxidized petroleum, an initial lag in CO{sub 2} production was observed indicating potential phototoxicity of the photo- by-products. {delta}{sup 13}C analysis and mass balance calculations reveal that co-metabolism with pinfish resulted in increased hydrocarbon degradation for both photo-oxidized and non-photo-oxidized petroleum each by over 100%. These results demonstrate the cumulative effect of photo-oxidation and co-metabolism on petroleum hydrocarbon degradation by natural bacterial populations indigenous to systems chronically impacted by hydrocarbon input. To address the second objective of this proposal bacterial concentrates were collected from Bayboro Harbor in April 2001 for nucleic acid extraction and subsequent natural radiocarbon abundance analyses. Unfortunately, however, all of these samples were lost due to a faulty compressor in our -70 freezer. The freezer was subsequently repaired and samples were again collected from Bayboro Harbor in June 2002 and again December 2002. Several attempts were made to extract the nucleic acid samples--however, the student was not able to successfully extract and an adequate amount of uncontaminated nucleic acid samples for subsequent natural radiocarbon abundance measurements of the bacterial carbon by accelerator mass spectrometry (i.e. require at least 50 {micro}g carbon for AMS measurement). Consequently, we were not able to address the second objective of this proposed work.« less
USDA-ARS?s Scientific Manuscript database
The hydroxylation of unsaturated fatty acids by bacterial strains is one type of value-adding bioconversion process. This process generates new hydroxy fatty acids (HFA) carrying special properties such as higher viscosity and reactivity compared with normal fatty acids. Among microbial strains te...
Metronidazole with Lactacyd vaginal gel in bacterial vaginosis.
Decena, Ditas Cristina D; Co, Jennifer T; Manalastas, Ricardo M; Palaypayon, Evelyn P; Padolina, Christia S; Sison, Judith M; Dancel, Louella A; Lelis, Marievi A
2006-04-01
To assess the efficacy and tolerability of lactic acid (Lactacyd vaginal gel; LVG) when given as an adjunct to metronidazole in the treatment of bacterial vaginosis (BV) among Filipino patients. A multicenter, open-labeled, controlled, randomized, three-arm comparative study on 90 women aged 18 years or over with clinically and microbiologically proven BV. The lactobacilli colony count significantly increased over time in all three arms. At day 14, growth of lactobacilli was significantly higher among patients in the lactic acid gel and combination treatment arms. Significant reduction of malodorous vaginal discharge (whiff test) and lowest recurrence of BV were noted in the metronidazole plus lactic acid gel arm. Regarding disappearance of signs of BV, there was significant decrease in the pH level and frequency of clue cell positive patients across time but was not significantly different across treatment groups. Only one patient (3%, 1/60) among those who received lactic acid gel complained of increased curd-like discharge. Six patients (10%, 6/60) who received metronidazole complained of epigastric pain/discomfort, dizziness and dyspnea. Lactic acid gel (LVG) is safe and as efficacious as metronidazole in the treatment of BV. There is evidence that LVG when combined with metronidazole is superior to metronidazole alone in promoting lactobacilli colonization. LVG as an adjunct to metronidazole, having the least number of recurrent BV, appears to result in better long-term treatment effect on bacterial vaginosis.
Novel Prevention Strategies for Bacterial Infections in Cirrhosis
Yan, Kathleen; Garcia-Tsao, Guadalupe
2016-01-01
Introduction Bacterial infections are a serious complication of cirrhosis, as they can lead to decompensation, multiple organ failure, and/or death. Preventing infections is therefore very relevant. Because gut bacterial translocation is their main pathogenic mechanism, prevention of infections is mostly based on the use of orally administered poorly absorbed antibiotics such as norfloxacin (selective intestinal decontamination). However, antibiotic prophylaxis leads to antibiotic resistance, limiting therapy and increasing morbidity and mortality. Prevention of bacterial infections in cirrhosis should therefore move away from antibiotics. Areas Covered This review focuses on various potentially novel methods to prevent infections in cirrhosis focusing on non-antibiotic strategies. The use of probiotics, nonselective intestinal decontamination with rifaximin, prokinetics and beta-blockers or fecal microbiota transplant as means of targeting altered gut microbiota, bile acids and FXR agonists are all potential alternatives to selective intestinal decontamination. Prokinetics and beta-blockers can improve intestinal motility, while bile acids and FXR agonists help by improving the intestinal barrier. Finally, granulocyte colony stimulating factor (G-CSF) and statins are emerging therapeutic strategies that may improve immune dysfunction in cirrhosis. Expert Opinion Evidence for these strategies has been restricted to animal studies and proof-of concept studies but we expect this to change in coming years. PMID:26799197
Dione, N; Khelaifia, S; La Scola, B; Lagier, J C; Raoult, D
2016-01-01
In the mid-19th century, the dichotomy between aerobic and anaerobic bacteria was introduced. Nevertheless, the aerobic growth of strictly anaerobic bacterial species such as Ruminococcus gnavus and Fusobacterium necrophorum, in a culture medium containing antioxidants, was recently demonstrated. We tested aerobically the culture of 623 bacterial strains from 276 bacterial species including 82 strictly anaerobic, 154 facultative anaerobic, 31 aerobic and nine microaerophilic bacterial species as well as ten fungi. The basic culture medium was based on Schaedler agar supplemented with 1 g/L ascorbic acid and 0.1 g/L glutathione (R-medium). We successively optimized this media, adding 0.4 g/L uric acid, using separate autoclaving of the component, or adding haemin 0.1 g/L or α-ketoglutarate 2 g/L. In the basic medium, 237 bacterial species and ten fungal species grew but with no growth of 36 bacterial species, including 22 strict anaerobes. Adding uric acid allowed the growth of 14 further species including eight strict anaerobes, while separate autoclaving allowed the growth of all tested bacterial strains. To extend its potential use for fastidious bacteria, we added haemin for Haemophilus influenzae, Haemophilus parainfluenzae and Eikenella corrodens and α-ketoglutarate for Legionella pneumophila. This medium allowed the growth of all tested strains with the exception of Mycobacterium tuberculosis and Mycobacterium bovis. Testing primoculture and more fastidious species will constitute the main work to be done, but R-medium coupled with a rapid identification method (matrix-assisted laser desorption/ionization time-of-flight mass spectrometry) will facilitate the anaerobic culture in clinical microbiology laboratories. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Zang, Qing-Ce; Wang, Jia-Bo; Kong, Wei-Jun; Jin, Cheng; Ma, Zhi-Jie; Chen, Jing; Gong, Qian-Feng; Xiao, Xiao-He
2011-12-01
The fingerprints of artificial Calculus bovis extracts from different solvents were established by ultra-performance liquid chromatography (UPLC) and the anti-bacterial activities of artificial C. bovis extracts on Staphylococcus aureus (S. aureus) growth were studied by microcalorimetry. The UPLC fingerprints were evaluated using hierarchical clustering analysis. Some quantitative parameters obtained from the thermogenic curves of S. aureus growth affected by artificial C. bovis extracts were analyzed using principal component analysis. The spectrum-effect relationships between UPLC fingerprints and anti-bacterial activities were investigated using multi-linear regression analysis. The results showed that peak 1 (taurocholate sodium), peak 3 (unknown compound), peak 4 (cholic acid), and peak 6 (chenodeoxycholic acid) are more significant than the other peaks with the standard parameter estimate 0.453, -0.166, 0.749, 0.025, respectively. So, compounds cholic acid, taurocholate sodium, and chenodeoxycholic acid might be the major anti-bacterial components in artificial C. bovis. Altogether, this work provides a general model of the combination of UPLC chromatography and anti-bacterial effect to study the spectrum-effect relationships of artificial C. bovis extracts, which can be used to discover the main anti-bacterial components in artificial C. bovis or other Chinese herbal medicines with anti-bacterial effects. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Molecular spectroscopic studies on the interaction of ferulic acid with calf thymus DNA.
Zhang, Shufang; Sun, Xuejun; Qu, Fengli; Kong, Rongmei
2013-08-01
The interaction between ferulic acid and calf thymus deoxyribonucleic acid (ctDNA) under physiological conditions (Tris-HCl buffer solutions, pH 7.4) was investigated by UV-Vis spectroscopy, fluorescence spectroscopy, DNA melting techniques, and viscosity measurements. Results indicated that a complex of ferulic acid with ctDNA was formed with a binding constant of K(290K)=7.60×10(4) L mol(-1) and K(310K)=4.90×10(4) L mol(-1). The thermodynamic parameters enthalpy change (ΔH°), entropy change (ΔS°) and Gibbs free energy (ΔG°) were calculated to be -1.69×10(4) J mol(-1), 35.36 J K(-1) mol(-1) and -2.79×10(4) J mol(-1) at 310 K, respectively. The acting forces between ferulic acid and DNA mainly included hydrophobic interaction and hydrogen bonds. Acridine orange displacement studies revealed that ferulic acid can substitute for AO probe in the AO-DNA complex which was indicative of intercalation binding. Thermal denaturation study suggested that the interaction of ferulic acid with DNA could result in the increase of the denaturation temperature, which indicated that the stabilization of the DNA helix was increased in the presence of ferulic acid. Spectroscopic techniques together with melting techniques and viscosity determination provided evidences of intercalation mode of binding for the interaction between ferulic acid and ctDNA. Copyright © 2013 Elsevier B.V. All rights reserved.
Dreier, Jens; Störmer, Melanie; Kleesiek, Knut
2007-07-01
Bacterial contamination of blood components, particularly of platelet concentrates (PCs), represents the greatest infectious risk in blood transfusion. Although the incidence of platelet bacterial contamination is approximately 1 per 2,000 U, the urgent need for a method for the routine screening of PCs to improve safety for patients had not been considered for a long time. Besides the culturing systems, which will remain the criterion standard, rapid methods for sterility screening will play a more important role in transfusion medicine in the future. In particular, nucleic acid amplification techniques (NATs) are powerful potential tools for bacterial screening assays. The combination of excellent sensitivity and specificity, reduced contamination risk, ease of performance, and speed has made real-time polymerase chain reaction (PCR) technology an appealing alternative to conventional culture-based testing methods. When using real-time PCR for the detection of bacterial contamination, several points have to be considered. The main focus is the choice of the target gene; the assay format; the nucleic acid extraction method, depending on the sample type; and the evaluation of an ideal sampling strategy. However, several factors such as the availability of bacterial-derived nucleic acid amplification reagents, the impracticability, and the cost have limited the use of NATs until now. Attempts to reduce the presence of contaminating nucleic acids from reagents in real-time PCR have been described, but none of these approaches have proven to be very effective or to lower the sensitivity of the assay. Recently, a number of broad-range NAT assays targeting the 16S ribosomal DNA or 23S ribosomal RNA for the detection of bacteria based on real-time technology have been reported. This review will give a short survey of current approaches to and the limitations of the application of real-time PCR for bacterial detection in blood components, with emphasis on the bacterial
Murine cytomegalovirus: detection of latent infection by nucleic acid hybridization technique.
Cheung, K S; Huang, E S; Lang, D J
1980-01-01
The technique of nucleic acid hybridization was used to detect the presence of murine cytomegalovirus (MCMV)-specific deoxyribonucleic acid (DNA) in cell cultures and salivary gland tissues. The presence of approximately 4.5 and 0.2 genome equivalents per cell of MCMV-specific DNA was identified in cultures of salivary (ISG2) and prostate gland (IP) cells, respectively. These cells, derived from animals with experimentally induced latent infections, were negative for virus-specific antigens by immunofluorescence and on electron microscopy revealed no visible evidence of the presence of herpesviruses. A cell line derived from the salivary gland of an uninoculated animal (NSG2) was also found to possess MCMV-specific DNA (0.2 genome equivalents per cell). For this reason, salivary gland tissues from uninoculated animals supplied as "specific pathogen-free" mice by three commercial sources were tested upon arrival for the presence of MCMC-specific DNA. MCMV-specific DNA was detectable in pooled salivary gland extracts from uninoculated animals derived from two commercial sources. All of these animals were seronegative and virus negative by conventional infectivity assays. PMID:6247281
Dynamic bacterial and fungal microbiomes during sweet sorghum ensiling impact bioethanol production.
Gallagher, Daniella; Parker, David; Allen, Damian J; Tsesmetzis, Nicolas
2018-05-23
Significant low-cost biofuel production volumes could be achieved from commercial-scale silage by redirecting lactic acid fermentation to ethanol production. A temporal metagenomic analysis on ensiled sweet sorghum inoculated with an ethanologenic yeast has been conducted to understand the underlying microbial processes during bioethanol production. Individual silage buckets approximating silage piles were prepared with freshly harvested material and supplemented with ethanologenic yeast, sulfuric acid or both. The ensiling progress was assessed using high performance liquid chromatography, microbial taxonomic identification and abundance. The combined treatment with Saccharomyces and acid led to a steady reduction of bacterial abundance and microbial diversity with Lactobacillus becoming the dominant genus during the late timepoints. Furthermore, the addition of acid to inhibit bacterial growth hindered Saccharomyces ability to compete with native yeasts like Candida. Knowledge of the response of the in-situ microbial community to the various treatments during ensiling will help improve current methodologies for bioethanol production. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Evaluating the potential of immobilized bacterial consortium for black liquor biodegradation.
Paliwal, Rashmi; Uniyal, Shivani; Rai, J P N
2015-05-01
Two indigenous bacterial strains, Bacillus megaterium ETLB-1 (accession no. KC767548) and Pseudomonas plecoglossicida ETLB-3 (accession no. KC767547), isolated from soil contaminated with paper mill effluent, were co-immobilized on corncob cubes to investigate their biodegradation potential against black liquor (BL). Results exhibit conspicuous reduction in color and lignin of BL upto 913.46 Co-Pt and 531.45 mg l(-1), respectively. Reduction in chlorophenols up to 12 mg l(-1) was recorded with highest release of chloride ions, i.e., 1290 mg l(-1). Maximum enzyme activity for lignin peroxidase (LiP), manganese peroxidase (MnP), and laccase (LAC) was recorded as 5.06, 8.13, and 8.23 U ml(-1), respectively, during the treatment. Scanning electron microscopy (SEM) revealed successful immobilization of bacterial strains in porous structures of biomaterial. Gas chromatography/mass spectroscopy (GC/MS) showed formation of certain low molecular weight metabolites such as 4-hydroxy-benzoic acid, 3-hydroxy-4-methoxybenzaldehyde, ferulic acid, and t-cinnamic acid and removal of majority of the compounds (such as teratogenic phthalate derivatives) during the period of treatment. Results demonstrated that the indigenous bacterial consortium possesses excellent decolorization and lignin degradation capability which enables its commercial utilization in effluents treatment system.
Berggren, Martin; Laudon, Hjalmar; Haei, Mahsa; Ström, Lena; Jansson, Mats
2010-03-01
Carboxylic acids (CAs), amino acids (AAs) and carbohydrates (CHs) in dissolved free forms can be readily assimilated by aquatic bacteria and metabolized at high growth efficiencies. Previous studies have shown that these low-molecular-weight (LMW) substrates are released by phytoplankton but also that unidentified LMW compounds of terrestrial origin is a subsidy for bacterial metabolism in unproductive freshwater systems. We tested the hypothesis that different terrestrially derived CA, AA and CH compounds can offer substantial support for aquatic bacterial metabolism in fresh waters that are dominated by allochthonous dissolved organic matter (DOM). Drainage water from three catchments of different characters in the Krycklan experimental area in Northern Sweden were studied at the rising and falling limb of the spring flood, using a 2-week bioassay approach. A variety of CA, AA and CH compounds were significantly assimilated by bacteria, meeting 15-100% of the bacterial carbon demand and explaining most of the observed variation in bacterial growth efficiency (BGE; R(2)=0.66). Of the 29 chemical species that was detected, acetate was the most important, representing 45% of the total bacterial consumption of all LMW compounds. We suggest that LMW organic compounds in boreal spring flood drainage could potentially support all in situ bacterial production in receiving lake waters during periods of weeks to months after the spring flood.
Metabolic Signatures of Bacterial Vaginosis
Morgan, Martin T.; Fiedler, Tina L.; Djukovic, Danijel; Hoffman, Noah G.; Raftery, Daniel; Marrazzo, Jeanne M.
2015-01-01
ABSTRACT Bacterial vaginosis (BV) is characterized by shifts in the vaginal microbiota from Lactobacillus dominant to a microbiota with diverse anaerobic bacteria. Few studies have linked specific metabolites with bacteria found in the human vagina. Here, we report dramatic differences in metabolite compositions and concentrations associated with BV using a global metabolomics approach. We further validated important metabolites using samples from a second cohort of women and a different platform to measure metabolites. In the primary study, we compared metabolite profiles in cervicovaginal lavage fluid from 40 women with BV and 20 women without BV. Vaginal bacterial representation was determined using broad-range PCR with pyrosequencing and concentrations of bacteria by quantitative PCR. We detected 279 named biochemicals; levels of 62% of metabolites were significantly different in women with BV. Unsupervised clustering of metabolites separated women with and without BV. Women with BV have metabolite profiles marked by lower concentrations of amino acids and dipeptides, concomitant with higher levels of amino acid catabolites and polyamines. Higher levels of the signaling eicosanoid 12-hydroxyeicosatetraenoic acid (12-HETE), a biomarker for inflammation, were noted in BV. Lactobacillus crispatus and Lactobacillus jensenii exhibited similar metabolite correlation patterns, which were distinct from correlation patterns exhibited by BV-associated bacteria. Several metabolites were significantly associated with clinical signs and symptoms (Amsel criteria) used to diagnose BV, and no metabolite was associated with all four clinical criteria. BV has strong metabolic signatures across multiple metabolic pathways, and these signatures are associated with the presence and concentrations of particular bacteria. PMID:25873373
Legionella Pneumophila and Dendrimers-Mediated Antisense Therapy.
Pashaei-Asl, Roghiyeh; Khodadadi, Khodadad; Pashaei-Asl, Fatima; Haqshenas, Gholamreza; Ahmadian, Nasser; Pashaiasl, Maryam; Hajihosseini Baghdadabadi, Reza
2017-06-01
Finding novel and effective antibiotics for treatment of Legionella disease is a challenging field. Treatment with antibiotics usually cures Legionella infection; however, if the resultant disease is not timely recognized and treated properly, it leads to poor prognosis and high case fatality rate. Legionella pneumophila DrrA protein (Defects in Rab1 recruitment protein A)/also known as SidM affects host cell vesicular trafficking through modification of the activity of cellular small guanosine triphosphatase )GTPase( Rab (Ras-related in brain) function which facilitates intracellular bacterial replication within a supporter vacuole. Also, Legionella pneumophila LepA and LepB (Legionella effector protein A and B) proteins suppress host-cell Rab1 protein's function resulting in the cell lysis and release of bacteria that subsequently infect neighbour cells. Legionella readily develops resistant to antibiotics and, therefore, new drugs with different modes of action and therapeutic strategic approaches are urgently required among antimicrobial drug therapies;gene therapy is a novel approach for Legionnaires disease treatment. On the contrary to the conventional treatment approaches that target bacterial proteins, new treatment interventions target DNA (Deoxyribonucleic acid), RNA (Ribonucleic acid) species, and different protein families or macromolecular complexes of these components. The above approaches can overcome the problems in therapy of Legionella infections caused by antibiotics resistance pathogens. Targeting Legionella genes involved in manipulating cellular vesicular trafficking using a dendrimer-mediated antisense therapy is a promising approach to inhibit bacterial replication within the target cells.
Perdih, Andrej; Hrast, Martina; Pureber, Kaja; Barreteau, Hélène; Grdadolnik, Simona Golič; Kocjan, Darko; Gobec, Stanislav; Solmajer, Tom; Wolber, Gerhard
2015-06-01
Bacterial resistance to the available antibiotic agents underlines an urgent need for the discovery of novel antibacterial agents. Members of the bacterial Mur ligase family MurC-MurF involved in the intracellular stages of the bacterial peptidoglycan biosynthesis have recently emerged as a collection of attractive targets for novel antibacterial drug design. In this study, we have first extended the knowledge of the class of furan-based benzene-1,3-dicarboxylic acid derivatives by first showing a multiple MurC-MurF ligase inhibition for representatives of the extended series of this class. Steady-state kinetics studies on the MurD enzyme were performed for compound 1, suggesting a competitive inhibition with respect to ATP. To the best of our knowledge, compound 1 represents the first ATP-competitive MurD inhibitor reported to date with concurrent multiple inhibition of all four Mur ligases (MurC-MurF). Subsequent molecular dynamic (MD) simulations coupled with interaction energy calculations were performed for two alternative in silico models of compound 1 in the UMA/D-Glu- and ATP-binding sites of MurD, identifying binding in the ATP-binding site as energetically more favorable in comparison to the UMA/D-Glu-binding site, which was in agreement with steady-state kinetic data. In the final stage, based on the obtained MD data novel furan-based benzene monocarboxylic acid derivatives 8-11, exhibiting multiple Mur ligase (MurC-MurF) inhibition with predominantly superior ligase inhibition over the original series, were discovered and for compound 10 it was shown to possess promising antibacterial activity against S. aureus. These compounds represent novel leads that could by further optimization pave the way to novel antibacterial agents.
NASA Astrophysics Data System (ADS)
Perdih, Andrej; Hrast, Martina; Pureber, Kaja; Barreteau, Hélène; Grdadolnik, Simona Golič; Kocjan, Darko; Gobec, Stanislav; Solmajer, Tom; Wolber, Gerhard
2015-06-01
Bacterial resistance to the available antibiotic agents underlines an urgent need for the discovery of novel antibacterial agents. Members of the bacterial Mur ligase family MurC-MurF involved in the intracellular stages of the bacterial peptidoglycan biosynthesis have recently emerged as a collection of attractive targets for novel antibacterial drug design. In this study, we have first extended the knowledge of the class of furan-based benzene-1,3-dicarboxylic acid derivatives by first showing a multiple MurC-MurF ligase inhibition for representatives of the extended series of this class. Steady-state kinetics studies on the MurD enzyme were performed for compound 1, suggesting a competitive inhibition with respect to ATP. To the best of our knowledge, compound 1 represents the first ATP-competitive MurD inhibitor reported to date with concurrent multiple inhibition of all four Mur ligases (MurC-MurF). Subsequent molecular dynamic (MD) simulations coupled with interaction energy calculations were performed for two alternative in silico models of compound 1 in the UMA/ d-Glu- and ATP-binding sites of MurD, identifying binding in the ATP-binding site as energetically more favorable in comparison to the UMA/ d-Glu-binding site, which was in agreement with steady-state kinetic data. In the final stage, based on the obtained MD data novel furan-based benzene monocarboxylic acid derivatives 8- 11, exhibiting multiple Mur ligase (MurC-MurF) inhibition with predominantly superior ligase inhibition over the original series, were discovered and for compound 10 it was shown to possess promising antibacterial activity against S. aureus. These compounds represent novel leads that could by further optimization pave the way to novel antibacterial agents.
Emerging Role of D-Amino Acid Metabolism in the Innate Defense.
Sasabe, Jumpei; Suzuki, Masataka
2018-01-01
Mammalian innate and adaptive immune systems use the pattern recognition receptors, such as toll-like receptors, to detect conserved bacterial and viral components. Bacteria synthesize diverse D-amino acids while eukaryotes and archaea generally produce two D-amino acids, raising the possibility that many of bacterial D-amino acids are bacteria-specific metabolites. Although D-amino acids have not been identified to bind to any known pattern recognition receptors, D-amino acids are enantioselectively recognized by some other receptors and enzymes including a flavoenzyme D-amino acid oxidase (DAO) in mammals. At host-microbe interfaces in the neutrophils and intestinal mucosa, DAO catalyzes oxidation of bacterial D-amino acids, such as D-alanine, and generates H 2 O 2 , which is linked to antimicrobial activity. Intestinal DAO also modifies the composition of microbiota through modulation of growth for some bacteria that are dependent on host nutrition. Furthermore, regulation and recognition of D-amino acids in mammals have additional meanings at various host-microbe interfaces; D-phenylalanine and D-tryptophan regulate chemotaxis of neutrophils through a G-coupled protein receptor, D-serine has a bacteriostatic role in the urinary tract, D-phenylalanine and D-leucine inhibit innate immunity through the sweet taste receptor in the upper airway, and D-tryptophan modulates immune tolerance in the lower airway. This mini-review highlights recent evidence supporting the hypothesis that D-amino acids are utilized as inter-kingdom communication at host-microbe interface to modulate bacterial colonization and host defense.
Szakiel, Anna; Ruszkowski, Dariusz; Grudniak, Anna; Kurek, Anna; Wolska, Krystyna I; Doligalska, Maria; Janiszowska, Wirginia
2008-11-01
The antibacterial and antiparasitic activities of free oleanolic acid and its glucosides and glucuronides isolated from marigold (Calendula officinalis) were investigated. The MIC of oleanolic acid and the effect on bacterial growth were estimated by A600 measurements. Oleanolic acid's influence on bacterial survival and the ability to induce autolysis were measured by counting the number of cfu. Cell morphology and the presence of endospores were observed under electron and light microscopy, respectively. Oleanolic acid inhibited bacterial growth and survival, influenced cell morphology and enhanced the autolysis of Gram-positive bacteria suggesting that bacterial envelopes are the target of its activity. On the other hand, glycosides of oleanolic acid inhibited the development of L3 Heligmosomoides polygyrus larvae, the infective stage of this intestinal parasitic nematode. In addition, both oleanolic acid and its glycosides reduced the rate of L3 survival during prolonged storage, but only oleanolic acid glucuronides affected nematode infectivity. The presented results suggest that oleanolic acid and its glycosides can be considered as potential therapeutic agents.
Hara, Shintaro; Isoda, Reika; Tahvanainen, Teemu; Hashidoko, Yasuyuki
2012-01-01
Background Many investigators have recognised that a significant proportion of environmental bacteria exist in a viable but non-culturable state on agar plates, and some researchers have also noticed that some of such bacteria clearly recover their growth on matrices other than agar. However, the reason why agar is unsuitable for the growth of some bacteria has not been addressed. Methodology/Principal Findings According to the guide of a bioassay for swarming inhibition, we identified 5-hydroxymethylfuran-2-carboxylic acid (5-HMFA) and furan-2-carboxylic acid (FA) as factors that inhibit bacterial swarming and likely inhibit extracellular polysaccharide production on agar. The furan-2-carboxylic acids 5-HMFA and FA effectively inhibited the swarming and swimming of several environmental bacteria at concentrations of 1.8 and 2.3 µg L−1 (13 and 21 nmol L−1), respectively, which are equivalent to the concentrations of these compounds in 0.3% agar. On Luria-Bertani (LB) plates containing 1.0% agar that had been previously washed with MeOH, a mixture of 5-HMFA and FA in amounts equivalent to their original concentrations in the unwashed agar repressed the swarming of Escherichia coli K12 strain W3110, a representative swarming bacterium. Conclusions/Significance Agar that contains trace amounts of 5-HMFA and FA inhibits the proliferation of some slow-growing or difficult-to-culture bacteria on the plates, but it is useful for single colony isolation due to the ease of identification of swarmable bacteria as the non-swarmed colonies. PMID:22848437
Wang, Han; Zeng, Yufei; Guo, Chuling; Bao, Yanping; Lu, Guining; Reinfelder, John R; Dang, Zhi
2018-03-01
Lacking sufficient clean water, the paddy soils along the Hengshi River have suffered from long-term acid mine drainage (AMD) contamination. The impacted cropland is too heavily contaminated to grow food safely. The microbial communities inhabiting the environment play pivotal roles in the crop growth, health, and ecological services. In this study, the bacterial, archaeal, and fungal communities in the impacted paddy soil were examined using high-throughput Illumina MiSeq sequencing. The results showed that AMD irrigation considerably enriched the bacterial phylum Acidobacteria and the archaeal phylum Crenarchaeota, while the fungal community was more stable. The abundances of Acidobacteria and Crenarchaeota were significantly positively correlated with the AMD-related environmental factors of pH and heavy metals (Cu, Pb, and Zn). In the most contaminated samples, communities were dominated by the bacteria Candidatus Solibacter and Candidatus Koribacter from the Acidobacteria family. Functional gene profile analysis demonstrated that the energy metabolic processes of the microbial communities, especially C/N related pathways, have adjusted and are well-adapted to tolerating AMD contamination. The present study described the structural and functional differentiation of microbial communities in the rice paddy soil under AMD irrigation. The results are useful for the development of bioremediation strategies using native microbes in the cleanup and biorestoration of AMD-contaminated agriculture soil. Copyright © 2017 Elsevier B.V. All rights reserved.
Sousa, A; Almeida, A M; Černigoj, U; Sousa, F; Queiroz, J A
2014-08-15
Preparation of high quantities of supercoiled plasmid DNA of pharmaceutical grade purity is a research area where intensive investigation is being performed. From this standpoint, several downstream methods have been proposed, among them the monolithic chromatographic strategies owing to excellent mass transfer properties of monolithic supports and their high binding capacity for large biomolecules. The present study explores the physicochemical properties of histamine ligand in a supercoiled plasmid DNA purification process from an Escherichia coli clarified lysate, where the emphasis is given to the elution strategy that allows higher selectivity and efficient removal of other impurities besides the open circular isoform. The combination of high NaCl concentration and acidic pH allowed the elimination of 89% of RNA during the preparative loading of the lysate sample. The results of the purification strategy with ascending sodium chloride gradient revealed that 97% of supercoiled plasmid DNA was recovered with a purity degree of 99%. In addition, using a combined purification strategy with ascending sodium chloride (capture step) and then descending ammonium sulfate (polishing step) gradient, it was achieved a lower supercoiled plasmid DNA recovery yield of 79% with a purity degree of 92%, although the dynamic binding capacity under these conditions was higher than in the previous strategy. A significant reduction of host contents, such as proteins, RNA and genomic DNA, was obtained in both purification strategies. Accordingly, histamine is a useful and versatile ligand that allows the desirable supercoiled plasmid purification with high yield and purity level. Copyright © 2014. Published by Elsevier B.V.
Receptors, mediators, and mechanisms involved in bacterial sepsis and septic shock.
Van Amersfoort, Edwin S; Van Berkel, Theo J C; Kuiper, Johan
2003-07-01
Bacterial sepsis and septic shock result from the overproduction of inflammatory mediators as a consequence of the interaction of the immune system with bacteria and bacterial wall constituents in the body. Bacterial cell wall constituents such as lipopolysaccharide, peptidoglycans, and lipoteichoic acid are particularly responsible for the deleterious effects of bacteria. These constituents interact in the body with a large number of proteins and receptors, and this interaction determines the eventual inflammatory effect of the compounds. Within the circulation bacterial constituents interact with proteins such as plasma lipoproteins and lipopolysaccharide binding protein. The interaction of the bacterial constituents with receptors on the surface of mononuclear cells is mainly responsible for the induction of proinflammatory mediators by the bacterial constituents. The role of individual receptors such as the toll-like receptors and CD14 in the induction of proinflammatory cytokines and adhesion molecules is discussed in detail. In addition, the roles of a number of other receptors that bind bacterial compounds such as scavenger receptors and their modulating role in inflammation are described. Finally, the therapies for the treatment of bacterial sepsis and septic shock are discussed in relation to the action of the aforementioned receptors and proteins.
Primordial soup was edible: abiotically produced Miller-Urey mixture supports bacterial growth.
Xie, Xueshu; Backman, Daniel; Lebedev, Albert T; Artaev, Viatcheslav B; Jiang, Liying; Ilag, Leopold L; Zubarev, Roman A
2015-09-28
Sixty years after the seminal Miller-Urey experiment that abiotically produced a mixture of racemized amino acids, we provide a definite proof that this primordial soup, when properly cooked, was edible for primitive organisms. Direct admixture of even small amounts of Miller-Urey mixture strongly inhibits E. coli bacteria growth due to the toxicity of abundant components, such as cyanides. However, these toxic compounds are both volatile and extremely reactive, while bacteria are highly capable of adaptation. Consequently, after bacterial adaptation to a mixture of the two most abundant abiotic amino acids, glycine and racemized alanine, dried and reconstituted MU soup was found to support bacterial growth and even accelerate it compared to a simple mixture of the two amino acids. Therefore, primordial Miller-Urey soup was perfectly suitable as a growth media for early life forms.
Antarctic ice core samples: culturable bacterial diversity.
Shivaji, Sisinthy; Begum, Zareena; Shiva Nageswara Rao, Singireesu Soma; Vishnu Vardhan Reddy, Puram V; Manasa, Poorna; Sailaja, Buddi; Prathiba, Mambatta S; Thamban, Meloth; Krishnan, Kottekkatu P; Singh, Shiv M; Srinivas, Tanuku N R
2013-01-01
Culturable bacterial abundance at 11 different depths of a 50.26 m ice core from the Tallaksenvarden Nunatak, Antarctica, varied from 0.02 to 5.8 × 10(3) CFU ml(-1) of the melt water. A total of 138 bacterial strains were recovered from the 11 different depths of the ice core. Based on 16S rRNA gene sequence analyses, the 138 isolates could be categorized into 25 phylotypes belonging to phyla Actinobacteria, Bacteroidetes, Firmicutes and Proteobacteria. All isolates had 16S rRNA sequences similar to previously determined sequences (97.2-100%). No correlation was observed in the distribution of the isolates at the various depths either at the phylum, genus or species level. The 25 phylotypes varied in growth temperature range, tolerance to NaCl, growth pH range and ability to produce eight different extracellular enzymes at either 4 or 18 °C. Iso-, anteiso-, unsaturated and saturated fatty acids together constituted a significant proportion of the total fatty acid composition. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Improving survival of probiotic bacteria using bacterial poly-γ-glutamic acid.
Bhat, A R; Irorere, V U; Bartlett, T; Hill, D; Kedia, G; Charalampopoulos, D; Nualkaekul, S; Radecka, I
2015-03-02
A major hurdle in producing a useful probiotic food product is bacterial survival during storage and ingestion. The aim of this study was to test the effect of γ-PGA immobilisation on the survival of probiotic bacteria when stored in acidic fruit juice. Fruit juices provide an alternative means of probiotic delivery, especially to lactose intolerant individuals. In addition, the survival of γ-PGA-immobilised cells in simulated gastric juice was also assessed. Bifidobacteria strains (Bifidobacteria longum, Bifidobacteria breve), immobilised on 2.5% γ-PGA, survived significantly better (P<0.05) in orange and pomegranate juice for 39 and 11 days respectively, compared to free cells. However, cells survived significantly better (P<0.05) when stored in orange juice compared to pomegranate juice. Moreover, both strains, when protected with 2.5% γ-PGA, survived in simulated gastric juice (pH2.0) with a marginal reduction (<0.47 log CFU/ml) or no significant reduction in viable cells after 4h, whereas free cells died within 2h. In conclusion, this research indicates that γ-PGA can be used to protect Bifidobacteria cells in fruit juice, and could also help improve the survival of cells as they pass through the harsh conditions of the gastrointestinal tract (GIT). Following our previous report on the use of γ-PGA as a cryoprotectant for probiotic bacteria, this research further suggests that γ-PGA could be used to improve probiotic survival during the various stages of preparation, storage and ingestion of probiotic cells. Copyright © 2014 Elsevier B.V. All rights reserved.
Singh, U B; Verma, D N; Varma, A; Ranjhan, S K
1977-11-01
1. The production rates of bacteria in the rumen of buffalo (Bos bubalis) calves were estimated using an isotope-dilution technique. A series of fifteen experiments was done with animals given green maize and nine experiments with animals given cowpea (Vigna unguiculata). 2. The turnover time ranged from 205 to 567 min in the group given green maize and from 330 to 648 min in animals offered cowpea. The production rates of bacteria were (mean +/- SE; g/d) 145.77 +/- 7.240 and 237.09 +/- 11.847 in animals given green maize and cowpea respectively. 3. There was a significant correlation between bacterial production rates and dry matter intake, digestible organic matter and total volatile fatty acids formed in the rumen. 4. Regression equations obtained for the two foodstuffs were different suggesting that the bacterial growth rate may vary depending upon the quantity and quality of foodstuff digested and possibly the ratio nitrogen:energy of the foodstuff.
Leone, Laura; Ferri, Diego; Manfredi, Carla; Persson, Per; Shchukarev, Andrei; Sjöberg, Staffan; Loring, John
2007-09-15
In this study, macroscopic and spectroscopic data were combined to develop a surface complexation model that describes the acid-base properties of Bacillus subtilis. The bacteria were freeze-dried and then resuspended in 0.1 M NaCl ionic medium. Macroscopic measurements included potentiometric acid-base titrations and electrophoretic mobility measurements. In addition, ATR-FTIR spectra of wet pastes from suspensions of Bacillus subtilis at different pH values were collected. The least-squares program MAGPIE was used to generate a surface complexation model that takes into account the presence of three acid-base sites on the surface: tripple bond COOH, tripple bond NH+, and tripple bond PO-, which were identified previously by XPS measurements. Both potentiometric titration data and ATR-FTIR spectra were used quantitatively, and electrostatic effects at the charged bacterial surface were accounted for using the constant capacitance model. The model was calculated using two different approaches: in the first one XPS data were used to constrain the ratio of the total concentrations of all three surface sites. The capacitance of the double layer, the total buffer capacity, and the deprotonation constants of the tripple bond NH+, tripple bond POH, and tripple bond COOH species were determined in the fit. A second approach is presented in which the ratio determined by XPS of the total concentrations of tripple bond NH+ to tripple bond PO- sites is relaxed. The total concentration of tripple bond PO- sites was determined in the fit, while the deprotonation constant for tripple bond POH was manually varied until the minimization led to a model which predicted an isoelectric point that resulted in consistency with electrophoretic mobility data. The model explains well the buffering capacity of Bacillus subtilis suspensions in a wide pH range (between pH=3 and pH=9) which is of considerable environmental interest. In particular, a similar quantitative use of the IR data
Abrigo, Martina; Kingshott, Peter; McArthur, Sally L
2015-12-06
Control over bacterial attachment and proliferation onto nanofibrous materials constitutes a major challenge for a variety of applications, including filtration membranes, protective clothing, wound dressings, and tissue engineering scaffolds. To develop effective devices, the interactions that occur between bacteria and nanofibers with different morphological and physicochemical properties need to be investigated. This paper explores the influence of fiber surface chemistry on bacterial behavior. Different chemical functionalities were generated on the surface of electrospun polystyrene nanofibers through plasma polymerization of four monomers (acrylic acid, allylamine, 1,7-octadiene, and 1,8-cineole). The interactions of Escherichia coli with the surface modified fibers were investigated through a combination of scanning electron microscopy and confocal laser scanning microscopy. Fiber wettability, surface charge, and chemistry were found to affect the ability of bacterial cells to attach and proliferate throughout the nanofiber meshes. The highest proportion of viable cells attachment occurred on the hydrophilic amine rich coating, followed by the hydrophobic octadiene. The acrylic acid coating rich in carboxyl groups showed a significantly lower attraction of bacterial cells. The 1,8-cineole retained the antibacterial activity of the monomer, resulting with a high proportion of dead isolated cells attached onto the fibers. Results showed that the surface chemistry properties of nanofibrous membranes can be strategically tuned to control bacterial behavior.
Fermentation of aqueous plant seed extracts by lactic acid bacteria
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schafner, D.W.; Beuchat, R.L.
1986-05-01
The effects of lactic acid bacterial fermentation on chemical and physical changes in aqueous extracts of cowpea (Vigna unguiculata), peanut (Arachis hypogea), soybean (Glycine max), and sorghum (Sorghum vulgare) were studied. The bacteria investigated were Lactobacillus helveticus, L. delbrueckii, L. casei, L. bulgaricus, L. acidophilus, and Streptococcus thermophilus. Organisms were inoculated individually into all of the seed extracts; L. bulgaricus and S. thermophilus were also evaluated together as inocula for fermenting the legume extracts. During fermentation, bacterial population and changes in titratable acidity, pH, viscosity, and color were measured over a 72 h period at 37 degrees C. Maximum bacterialmore » populations, titratable acidity, pH, and viscosity varied depending upon the type of extract and bacterial strain. The maximum population of each organism was influenced by fermentable carbohydrates, which, in turn, influenced acid production and change in pH. Change in viscosity was correlated with the amount of protein and titratable acidity of products. Color was affected by pasteurization treatment and fermentation as well as the source of extract. In the extracts inoculated simultaneously with L. bulgaricus and S. thermophilus, a synergistic effect resulted in increased bacterial populations, titratable acidity, and viscosity, and decreased pH in all the legume extracts when compared to the extracts fermented with either of these organisms individually. Fermented extracts offer potential as substitutes for cultured dairy products. 24 references.« less
Saido-Sakanaka, H; Ishibashi, J; Sagisaka, A; Momotani, E; Yamakawa, M
1999-01-01
Defensin from a beetle, Allomyrina dichotoma, is known to have anti-bacterial activity against Gram-positive bacteria. This peptide, which comprises 43 amino acid residues, was effective against methicillin-resistant Staphylococcus aureus. We identified the active site of beetle defensin by measuring anti-bacterial activity against S. aureus of 64 overlapping 12-mer peptides with either a free carboxylate or a free amide group at their C-termini. An LCAAHCLAIGRR-NH2 (19L-30R-NH2) fragment showed the greatest activity of the synthetic oligopeptides. The 19L-30R-NH2 fragment was effective against both Gram-positive and Gram-negative bacteria. CD spectra showed that the 19L-30R-NH2 fragment formed an alpha-helical structure in the lipidic environment. The anti-bacterial effect of the 19L-30R-NH2 fragment was due to its interaction with bacterial membranes, judging from the leakage of liposome-entrapped glucose. Its anti-bacterial activity was increased when certain amino acid residues were replaced. Truncated peptides having had some amino acids removed from the N-terminus of the 19L-30R-NH2 fragment (8-10-mer peptides) still had strong anti-bacterial activity. Deleting some amino acids from the C-terminal region of the fragment dramatically reduced activity, indicating that the C-terminal region of the 19L-30R-NH2 fragment, i.e. RR-NH2, is important for exerting anti-bacterial activity. The AHCLAIGRR-NH2 (22A-30R-NH2) fragment and its analogues exhibited about 3-fold and 9-12-fold higher activity against S. aureus than did the 19L-30R-NH2 fragment, and these analogues were effective against methicillin-resistant S. aureus and Pseudomonas aeruginosa isolated from patients. These oligopeptides showed no haemolytic activity and did not inhibit the growth of murine fibroblast cells. PMID:9931294
Zheng, Jia; Wu, Chongde; Huang, Jun; Zhou, Rongqing; Liao, Xuepin
2014-12-01
Grain fermenting with separate layers in a fermentation pit is the typical and experiential brewing technology for Chinese Luzhou-flavor liquor. However, it is still unclear to what extent the bacterial communities in the different layers of fermented grains (FG) effects the liquor's quality. In this study, the spatial distributions of bacterial communities in Luzhou-flavor liquor FG (top, middle, and bottom layers) from 2 distinctive factories (Jiannanchun and Fenggu) were investigated using culture-independent approaches (phospholipid fatty acid [PLFA] and polymerase chain reaction-denaturing gel electrophoresis [DGGE]). The relationship between bacterial community and biochemical properties was also assessed by Canonical correspondence analysis (CCA). No significant variation in moisture was observed in spatial samples, and the highest content of acidity and total ester was detected in the bottom layer (P < 0.05). A high level of ethanol was observed in the top and middle layers of Fenggu and Jiannanchun, respectively. Significant spatial distribution of the total PLFA was only shown in the 50-y-old pits (P < 0.05), and Gram negative bacteria was the prominent community. Bacterial 16S rDNA DGGE analysis revealed that the most abundant bacterial community was in the top layers of the FG both from Fenggu and Jiannanchun, with Lactobacillaceae accounting for 30% of the total DGGE bands and Lactobacillus acetotolerans was the dominant species. FG samples from the same pit had a highly similar bacterial community structure according to the hierarchal cluster tree. CCA suggested that the moisture, acidity, ethanol, and reducing sugar were the main factors affecting the distribution of L. acetotolerans. Our results will facilitate the knowledge about the spatial distribution of bacterial communities and the relationship with their living environment. © 2014 Institute of Food Technologists®
Batta, A K; Salen, G; Shefer, S
1985-01-01
We have examined the mechanism for the bacterial transformation of chenodeoxycholic acid and lithocholic acid into the corresponding 3 beta-hydroxy epimers with the use of 3 alpha- and 3 beta-tritiated bile acids. The 3-oxo bile acids were transformed into the 3 alpha- (85%) and 3 beta- (15%) hydroxy bile acids after 20-hr incubation with Clostridium perfringens. Approximately 75% radioactivity was recovered in the aqueous medium when [3 beta-3H]chenodeoxycholic acid or [3 beta-3H]lithocholic acid was incubated with the bacteria, and approximately 15% of radioactivity in the bile acid fraction was associated with the 3 alpha-position of the iso-bile acids. When [3 beta-3H]chenodeoxycholic acid was incubated with unlabeled 3-oxo-5 beta-cholanoic acid, tritiated litho- and iso-lithocholic acids were recovered. These results can be explained only when a 3-oxo intermediate is postulated, and the 3 beta-hydrogen in the bile acids is transferred by the bacterial coenzyme (NAD+ or NADP+) to the 3 alpha-position in the iso-bile acids during the reduction of the 3-oxo compounds.
USDA-ARS?s Scientific Manuscript database
Microbial conversions of unsaturated fatty acids often generate polyhydroxy fatty acids rendering them to have new properties such as higher viscosity and reactivity. A bacterial strain Pseudomonas aeruginosa (PR3) has been intensively studied to produce mono-, di-, and tri-hydroxy fatty acids from...
Bacterial expression of self-assembling peptide hydrogelators
NASA Astrophysics Data System (ADS)
Sonmez, Cem
For tissue regeneration and drug delivery applications, various architectures are explored to serve as biomaterial tools. Via de novo design, functional peptide hydrogel materials have been developed as scaffolds for biomedical applications. The objective of this study is to investigate bacterial expression as an alternative method to chemical synthesis for the recombinant production of self-assembling peptides that can form rigid hydrogels under physiological conditions. The Schneider and Pochan Labs have designed and characterized a 20 amino acid beta-hairpin forming amphiphilic peptide containing a D-residue in its turn region (MAX1). As a result, this peptide must be prepared chemically. Peptide engineering, using the sequence of MAX1 as a template, afforded a small family of peptides for expression (EX peptides) that have different turn sequences consisting of natural amino acids and amenable to bacterial expression. Each sequence was initially chemically synthesized to quickly assess the material properties of its corresponding gel. One model peptide EX1, was chosen to start the bacterial expression studies. DNA constructs facilitating the expression of EX1 were designed in such that the peptide could be expressed with different fusion partners and subsequently cleaved by enzymatic or chemical means to afford the free peptide. Optimization studies were performed to increase the yield of pure peptide that ultimately allowed 50 mg of pure peptide to be harvested from one liter of culture, providing an alternate means to produce this hydrogel-forming peptide. Recombinant production of other self-assembling hairpins with different turn sequences was also successful using this optimized protocol. The studies demonstrate that new beta-hairpin self-assembling peptides that are amenable to bacterial production and form rigid hydrogels at physiological conditions can be designed and produced by fermentation in good yield at significantly reduced cost when compared to
{sup 252}Cf-plasma desorption mass spectra of bacterial oligosaccharides
DOE Office of Scientific and Technical Information (OSTI.GOV)
Elkin, Y.N.; Komandrova, N.A.; Tomshich, S.V.
1994-07-20
The possibility has been investigated of using the MSBKh instrument ({sup 252}Cf plasma desorption mass spectrometer) for studying the oligosaccharides of the O-specific chains of bacterial lipopolysaccharides. Experimental results on the ionization of galacturonic acid and of neutral and bacterial oligosaccharides containing NHR and COOH groups have been obtained and are discussed. The instrument has been used for estimating the compositions of fractions in the separation of degradation products of O-specific polysaccharide chains and establishing their structures.
Arginine Metabolism in Bacterial Pathogenesis and Cancer Therapy
Xiong, Lifeng; Teng, Jade L. L.; Botelho, Michael G.; Lo, Regina C.; Lau, Susanna K. P.; Woo, Patrick C. Y.
2016-01-01
Antibacterial resistance to infectious diseases is a significant global concern for health care organizations; along with aging populations and increasing cancer rates, it represents a great burden for government healthcare systems. Therefore, the development of therapies against bacterial infection and cancer is an important strategy for healthcare research. Pathogenic bacteria and cancer have developed a broad range of sophisticated strategies to survive or propagate inside a host and cause infection or spread disease. Bacteria can employ their own metabolism pathways to obtain nutrients from the host cells in order to survive. Similarly, cancer cells can dysregulate normal human cell metabolic pathways so that they can grow and spread. One common feature of the adaption and disruption of metabolic pathways observed in bacterial and cancer cell growth is amino acid pathways; these have recently been targeted as a novel approach to manage bacterial infections and cancer therapy. In particular, arginine metabolism has been illustrated to be important not only for bacterial pathogenesis but also for cancer therapy. Therefore, greater insights into arginine metabolism of pathogenic bacteria and cancer cells would provide possible targets for controlling of bacterial infection and cancer treatment. This review will summarize the recent progress on the relationship of arginine metabolism with bacterial pathogenesis and cancer therapy, with a particular focus on arginase and arginine deiminase pathways of arginine catabolism. PMID:26978353
Effect of fatty acids on growth of conjugated-linoleic-acids-producing bacteria in rumen.
Koppová, I; Lukás, F; Kopecný, J
2006-01-01
Microorganisms with high activity of linoleic acid delta12-cis,delta11-trans-isomerase were isolated from the digestive tract of ruminants and characterized. The isolate with the highest isomerase activity was identified as Pseudobutyrivibrio ruminis. The susceptibility of this strain to 3 fatty acids added to the grow medium was determined. A significant inhibition of bacterial growth (during a 3-d period) by linoleic acid (0.1 %) and oleic acid (5 ppm) was observed; no inhibition was found in the presence of stearic acid.
Processing of micro-nano bacterial cellulose with hydrolysis method as a reinforcing bioplastic
NASA Astrophysics Data System (ADS)
Maryam, Maryam; Dedy, Rahmad; Yunizurwan, Yunizurwan
2017-01-01
Nanotechnology is the ability to create and manipulate atoms and molecules on the smallest of scales. Their size allows them to exhibit novel and significantly improved physical, chemical, biological properties, phenomena, and processes because of their size. The purpose of this research is obtaining micro-nano bacterial cellulose as reinforcing bioplastics. Bacterial cellulose (BC) was made from coconut water for two weeks. BC was dried and grinded. Bacterial cellulose was given purification process with NaOH 5% for 6 hours. Making the micro-nano bacterial cellulose with hydrolysis method. Hydrolysis process with hydrochloric acid (HCl) at the conditions 3,5M, 55°C, 6 hours. Drying process used spray dryer. The hydrolysis process was obtained bacterial cellulose with ±7 μm. The addition 2% micro-nano bacterial cellulose as reinforcing in bioplastics composite can improve the physical characteristics.
Philippeau, C; Lettat, A; Martin, C; Silberberg, M; Morgavi, D P; Ferlay, A; Berger, C; Nozière, P
2017-04-01
This study investigated the effects of bacterial direct-fed microbials (DFM) on ruminal fermentation and microbial characteristics, methane (CH 4 ) emission, diet digestibility, and milk fatty acid (FA) composition in dairy cows fed diets formulated to induce different ruminal volatile fatty acid (VFA) profiles. Eight ruminally cannulated dairy cows were divided into 2 groups based on parity, days in milk, milk production, and body weight. Cows in each group were fed either a high-starch (38%, HS) or a low-starch (2%, LS) diet in a 55:45 forage-to-concentrate ratio on a dry matter (DM) basis. For each diet, cows were randomly assigned to 1 of 4 treatments in a Latin square design of (1) control (CON); (2) Propionibacterium P63 (P63); (3) P63 plus Lactobacillus plantarum 115 (P63+Lp); (4) P63 plus Lactobacillus rhamnosus 32 (P63+Lr). Strains of DFM were administered at 10 10 cfu/d. Methane emission (using the sulfur hexafluoride tracer technique), total-tract digestibility, dry matter intake, and milk production and composition were quantified in wk 3. Ruminal fermentation and microbial characteristics were measured in wk 4. Data were analyzed using the mixed procedure of SAS (SAS Institute Inc., Cary, NC). The 2 diets induced different ruminal VFA profiles, with a greater proportion of propionate at the expense of acetate and butyrate for the HS diet. Greater concentrations of total bacteria and selected bacterial species of methanogenic Archaea were reported for the HS diet, whereas the protozoa concentration in HS decreased. For both diets, bacterial DFM supplementation raised ruminal pH (+0.18 pH units, on average) compared with CON. Irrespective of diet, P63+Lp and P63+Lr increased ruminal cellulase activity (3.8-fold, on average) compared with CON, but this effect was not associated with variations in ruminal microbial numbers. Irrespective of diet, no effect of bacterial DFM on ruminal VFA was observed. For the LS diet, supplementing cows with P63+Lr tended
Bacterial dehalogenases: biochemistry, genetics, and biotechnological applications.
Fetzner, S; Lingens, F
1994-01-01
This review is a survey of bacterial dehalogenases that catalyze the cleavage of halogen substituents from haloaromatics, haloalkanes, haloalcohols, and haloalkanoic acids. Concerning the enzymatic cleavage of the carbon-halogen bond, seven mechanisms of dehalogenation are known, namely, reductive, oxygenolytic, hydrolytic, and thiolytic dehalogenation; intramolecular nucleophilic displacement; dehydrohalogenation; and hydration. Spontaneous dehalogenation reactions may occur as a result of chemical decomposition of unstable primary products of an unassociated enzyme reaction, and fortuitous dehalogenation can result from the action of broad-specificity enzymes converting halogenated analogs of their natural substrate. Reductive dehalogenation either is catalyzed by a specific dehalogenase or may be mediated by free or enzyme-bound transition metal cofactors (porphyrins, corrins). Desulfomonile tiedjei DCB-1 couples energy conservation to a reductive dechlorination reaction. The biochemistry and genetics of oxygenolytic and hydrolytic haloaromatic dehalogenases are discussed. Concerning the haloalkanes, oxygenases, glutathione S-transferases, halidohydrolases, and dehydrohalogenases are involved in the dehalogenation of different haloalkane compounds. The epoxide-forming halohydrin hydrogen halide lyases form a distinct class of dehalogenases. The dehalogenation of alpha-halosubstituted alkanoic acids is catalyzed by halidohydrolases, which, according to their substrate and inhibitor specificity and mode of product formation, are placed into distinct mechanistic groups. beta-Halosubstituted alkanoic acids are dehalogenated by halidohydrolases acting on the coenzyme A ester of the beta-haloalkanoic acid. Microbial systems offer a versatile potential for biotechnological applications. Because of their enantiomer selectivity, some dehalogenases are used as industrial biocatalysts for the synthesis of chiral compounds. The application of dehalogenases or bacterial
Emerging Role of D-Amino Acid Metabolism in the Innate Defense
Sasabe, Jumpei; Suzuki, Masataka
2018-01-01
Mammalian innate and adaptive immune systems use the pattern recognition receptors, such as toll-like receptors, to detect conserved bacterial and viral components. Bacteria synthesize diverse D-amino acids while eukaryotes and archaea generally produce two D-amino acids, raising the possibility that many of bacterial D-amino acids are bacteria-specific metabolites. Although D-amino acids have not been identified to bind to any known pattern recognition receptors, D-amino acids are enantioselectively recognized by some other receptors and enzymes including a flavoenzyme D-amino acid oxidase (DAO) in mammals. At host–microbe interfaces in the neutrophils and intestinal mucosa, DAO catalyzes oxidation of bacterial D-amino acids, such as D-alanine, and generates H2O2, which is linked to antimicrobial activity. Intestinal DAO also modifies the composition of microbiota through modulation of growth for some bacteria that are dependent on host nutrition. Furthermore, regulation and recognition of D-amino acids in mammals have additional meanings at various host–microbe interfaces; D-phenylalanine and D-tryptophan regulate chemotaxis of neutrophils through a G-coupled protein receptor, D-serine has a bacteriostatic role in the urinary tract, D-phenylalanine and D-leucine inhibit innate immunity through the sweet taste receptor in the upper airway, and D-tryptophan modulates immune tolerance in the lower airway. This mini-review highlights recent evidence supporting the hypothesis that D-amino acids are utilized as inter-kingdom communication at host–microbe interface to modulate bacterial colonization and host defense. PMID:29867842
Direct Isolation of Purines and Pyrimidines from Nucleic Acids Using Sublimation
NASA Technical Reports Server (NTRS)
Glavin, Daniel P.; Schubert, Michael; Bada, Jeffrey L.
2003-01-01
A sublimation technique was developed to isolate purines and pyrimidines directly from lambda-deoxyribonucleic acid (lambda-DNA) and Escherichia coli cells. The sublimation of adenine, cytosine, guanine, and thymine from lambda-DNA was tested under reduced pressure (approx. 0.5 Torr) at temperatures of >150 C. With the exception of guanine, approximately 60 -75% of each base was sublimed directly from the lambda-DNA and recovered on a coldfinger of the sublimation apparatus after heating to 450 C. Several nucleobases including adenine, cytosine, thymine, and uracil were also recovered from E. coli bacteria after heating the cells to the same temperature, although some thermal decomposition of the bases also occurred. These results demonstrate the feasibility of using sublimation to isolate purines and pyrimidines from native E. coli DNA and RNA without any chemical treatment of the cells.
Restriction of a bacteriophage of Streptomyces albus G involving endonuclease SalI.
Chater, K F; Wilde, L C
1976-01-01
The bacteriophage Pa16, isolated from soil on Streptomyces albus G, was restricted when transferred from an alternative host back to S. albus G. Extracted unmodified Pa16 deoxyribonucleic acid was cleaved at a single site by a cell-free extract of S. albus G. Fractions cleaving Pal6 deoxyribonucleic acid contained the endonuclease SalI first described by J. Arrand, P. Myers, and R. J. Roberts (unpublished data). A mutant of S. albus G was isolated which was defective in both restriction and modification of Pal6. This mutant lacked SalI activity. It is concluded that SalI is the agent of restriction of Pal6 by S. albus G. Images PMID:977549
Isolation, characterization, and aggregation of a structured bacterial matrix precursor.
Chai, Liraz; Romero, Diego; Kayatekin, Can; Akabayov, Barak; Vlamakis, Hera; Losick, Richard; Kolter, Roberto
2013-06-14
Biofilms are surface-associated groups of microbial cells that are embedded in an extracellular matrix (ECM). The ECM is a network of biopolymers, mainly polysaccharides, proteins, and nucleic acids. ECM proteins serve a variety of structural roles and often form amyloid-like fibers. Despite the extensive study of the formation of amyloid fibers from their constituent subunits in humans, much less is known about the assembly of bacterial functional amyloid-like precursors into fibers. Using dynamic light scattering, atomic force microscopy, circular dichroism, and infrared spectroscopy, we show that our unique purification method of a Bacillus subtilis major matrix protein component results in stable oligomers that retain their native α-helical structure. The stability of these oligomers enabled us to control the external conditions that triggered their aggregation. In particular, we show that stretched fibers are formed on a hydrophobic surface, whereas plaque-like aggregates are formed in solution under acidic pH conditions. TasA is also shown to change conformation upon aggregation and gain some β-sheet structure. Our studies of the aggregation of a bacterial matrix protein from its subunits shed new light on assembly processes of the ECM within bacterial biofilms.
Truong-Bolduc, Q C; Khan, N S; Vyas, J M; Hooper, D C
2017-02-01
We previously reported that the Tet38 efflux pump is involved in internalization of Staphylococcus aureus by A549 lung epithelial cells. A lack of tet38 reduced bacterial uptake by A549 cells to 36% of that of the parental strain RN6390. Using invasion assays coupled with confocal microscopy imaging, we studied the host cell receptor(s) responsible for bacterial uptake via interaction with Tet38. We also assessed the ability of S. aureus to survive following alkalinization of the phagolysosomes by chloroquine. Antibody to the scavenger receptor CD36 reduced the internalization of S. aureus RN6390 by A549 cells, but the dependence on CD36 was reduced in QT7 tet38, suggesting that an interaction between Tet38 and CD36 contributed to S. aureus internalization. Following fusion of the S. aureus-associated endosomes with lysosomes, alkalinization of the acidic environment with chloroquine led to a rapid increase in the number of S. aureus RN6390 bacteria in the cytosol, followed by a decrease shortly thereafter. This effect of chloroquine was not seen in the absence of intact Tet38 in mutant QT7. These data taken together suggest that Tet38 plays a role both in bacterial internalization via interaction with CD36 and in bacterial escape from the phagolysosomes. Copyright © 2017 American Society for Microbiology.
Truong-Bolduc, Q. C.; Khan, N. S.
2016-01-01
ABSTRACT We previously reported that the Tet38 efflux pump is involved in internalization of Staphylococcus aureus by A549 lung epithelial cells. A lack of tet38 reduced bacterial uptake by A549 cells to 36% of that of the parental strain RN6390. Using invasion assays coupled with confocal microscopy imaging, we studied the host cell receptor(s) responsible for bacterial uptake via interaction with Tet38. We also assessed the ability of S. aureus to survive following alkalinization of the phagolysosomes by chloroquine. Antibody to the scavenger receptor CD36 reduced the internalization of S. aureus RN6390 by A549 cells, but the dependence on CD36 was reduced in QT7 tet38, suggesting that an interaction between Tet38 and CD36 contributed to S. aureus internalization. Following fusion of the S. aureus-associated endosomes with lysosomes, alkalinization of the acidic environment with chloroquine led to a rapid increase in the number of S. aureus RN6390 bacteria in the cytosol, followed by a decrease shortly thereafter. This effect of chloroquine was not seen in the absence of intact Tet38 in mutant QT7. These data taken together suggest that Tet38 plays a role both in bacterial internalization via interaction with CD36 and in bacterial escape from the phagolysosomes. PMID:27956597
2011-01-01
Background Hydrogen peroxide (H2O2) produced by vaginal lactobacilli is generally believed to protect against bacteria associated with bacterial vaginosis (BV), and strains of lactobacilli that can produce H2O2 are being developed as vaginal probiotics. However, evidence that led to this belief was based in part on non-physiological conditions, antioxidant-free aerobic conditions selected to maximize both production and microbicidal activity of H2O2. Here we used conditions more like those in vivo to compare the effects of physiologically plausible concentrations of H2O2 and lactic acid on a broad range of BV-associated bacteria and vaginal lactobacilli. Methods Anaerobic cultures of seventeen species of BV-associated bacteria and four species of vaginal lactobacilli were exposed to H2O2, lactic acid, or acetic acid at pH 7.0 and pH 4.5. After two hours, the remaining viable bacteria were enumerated by growth on agar media plates. The effect of vaginal fluid (VF) on the microbicidal activities of H2O2 and lactic acid was also measured. Results Physiological concentrations of H2O2 (< 100 μM) failed to inactivate any of the BV-associated bacteria tested, even in the presence of human myeloperoxidase (MPO) that increases the microbicidal activity of H2O2. At 10 mM, H2O2 inactivated all four species of vaginal lactobacilli but only one of seventeen species of BV-associated bacteria. Moreover, the addition of just 1% vaginal fluid (VF) blocked the microbicidal activity of 1 M H2O2. In contrast, lactic acid at physiological concentrations (55-111 mM) and pH (4.5) inactivated all the BV-associated bacteria tested, and had no detectable effect on the vaginal lactobacilli. Also, the addition of 10% VF did not block the microbicidal activity of lactic acid. Conclusions Under optimal, anaerobic growth conditions, physiological concentrations of lactic acid inactivated BV-associated bacteria without affecting vaginal lactobacilli, whereas physiological concentrations of H2O2
[Analysis of the bacterial community developing in the course of Sphagnum moss decomposition].
Kulichevskaia, I S; Belova, S E; Kevbrin, V V; Dedysh, S N; Zavarzin, G A
2007-01-01
Slow degradation of organic matter in acidic Sphagnum peat bogs suggests a limited activity of organotrophic microorganisms. Monitoring of the Sphagnum debris decomposition in a laboratory simulation experiment showed that this process was accompanied by a shift in the water color to brownish due to accumulation of humic substances and by the development of a specific bacterial community with a density of 2.4 x 10(7) cells ml(-1). About half of these organisms are metabolically active and detectable with rRNA-specific oligonucleotide probes. Molecular identification of the components of this microbial community showed the numerical dominance of bacteria affiliated with the phyla Alphaproteobacteria, Actinobacteria, and Phanctomycetes. The population sizes of Firmicutes and Bacteroidetes, which are believed to be the main agents of bacterially-mediated decomposition in eutrophic wetlands, were low. The numbers of planctomycetes increased at the final stage of Sphagnum decomposition. The representative isolates of Alphaproteobacteria were able to utilize galacturonic acid, the only low-molecular-weight organic compound detected in the water samples; the representatives of Planctomycetes were able to decompose some heteropolysaccharides, which points to the possible functional role of these groups of microorganisms in the community under study. Thus, the composition of the bacterial community responsible for Sphagnum decomposition in acidic and low-mineral oligotrophic conditions seems to be fundamentally different from that of the bacterial community which decomposes plant debris in eutrophic ecosystems at neutral pH.
Hallberg, Kevin B.; Coupland, Kris; Kimura, Sakurako; Johnson, D. Barrie
2006-01-01
The microbial composition of acid streamers (macroscopic biofilms) in acidic, metal-rich waters in two locations (an abandoned copper mine and a chalybeate spa) in north Wales was studied using cultivation-based and biomolecular techniques. Known chemolithotrophic and heterotrophic acidophiles were readily isolated from disrupted streamers, but they accounted for only <1 to 7% of the total microorganisms present. Fluorescent in situ hybridization (FISH) revealed that 80 to 90% of the microbes in both types of streamers were β-Proteobacteria. Terminal restriction fragment length polymorphism analysis of the streamers suggested that a single bacterial species was dominant in the copper mine streamers, while two distinct bacteria (one of which was identical to the bacterium found in the copper mine streamers) accounted for about 90% of the streamers in the spa water. 16S rRNA gene clone libraries showed that the β-proteobacterium found in both locations was closely related to a clone detected previously in acid mine drainage in California and that its closest characterized relatives were neutrophilic ammonium oxidizers. Using a modified isolation technique, this bacterium was isolated from the copper mine streamers and shown to be a novel acidophilic autotrophic iron oxidizer. The β-proteobacterium found only in the spa streamers was closely related to the neutrophilic iron oxidizer Gallionella ferruginea. FISH analysis using oligonucleotide probes that targeted the two β-proteobacteria confirmed that the biodiversity of the streamers in both locations was very limited. The microbial compositions of the acid streamers found at the two north Wales sites are very different from the microbial compositions of the previously described acid streamers found at Iron Mountain, California, and the Rio Tinto, Spain. PMID:16517651
Wang, Yingchao; Gagnon, Carl A.; Savard, Christian; Music, Nedzad; Srednik, Mariela; Segura, Mariela; Lachance, Claude; Bellehumeur, Christian
2013-01-01
Streptococcus suis serotype 2 is an important swine bacterial pathogen, and it is also an emerging zoonotic agent. It is unknown how S. suis virulent strains, which are usually found in low quantities in pig tonsils, manage to cross the first host defense lines to initiate systemic disease. Influenza virus produces a contagious infection in pigs which is frequently complicated by bacterial coinfections, leading to significant economic impacts. In this study, the effect of a preceding swine influenza H1N1 virus (swH1N1) infection of swine tracheal epithelial cells (NTPr) on the ability of S. suis serotype 2 to adhere to, invade, and activate these cells was evaluated. Cells preinfected with swH1N1 showed bacterial adhesion and invasion levels that were increased more than 100-fold compared to those of normal cells. Inhibition studies confirmed that the capsular sialic acid moiety is responsible for the binding to virus-infected cell surfaces. Also, preincubation of S. suis with swH1N1 significantly increased bacterial adhesion to/invasion of epithelial cells, suggesting that S. suis also uses swH1N1 as a vehicle to invade epithelial cells when the two infections occur simultaneously. Influenza virus infection may facilitate the transient passage of S. suis at the respiratory tract to reach the bloodstream and cause bacteremia and septicemia. S. suis may also increase the local inflammation at the respiratory tract during influenza infection, as suggested by an exacerbated expression of proinflammatory mediators in coinfected cells. These results give new insight into the complex interactions between influenza virus and S. suis in a coinfection model. PMID:24082069
Pritt, Bobbi S; Patel, Robin; Kirn, Thomas J; Thomson, Richard B
2016-10-01
Nucleic acid amplification tests (NAATs) have frequently been the standard diagnostic approach when specific infectious agents are sought in a clinic specimen. They can be applied for specific agents such as S. pyogenes, or commercial multiplex NAATs for detection of a variety of pathogens in gastrointestinal, bloodstream, and respiratory infections may be used. NAATs are both rapid and sensitive. For many years, S. pyogenes testing algorithms used a rapid and specific group A streptococcal antigen test to screen throat specimens, followed, in some clinical settings, by a throat culture for S. pyogenes to increase the sensitivity of its detection. Now S. pyogenes NAATs are being used with increasing frequency. Given their accuracy, rapidity, and ease of use, should they replace antigen detection and culture for the detection of bacterial pharyngitis? Bobbi Pritt and Robin Patel of the Mayo Clinic, where S. pyogenes NAATs have been used for well over a decade with great success, will explain the advantages of this approach, while Richard (Tom) Thomson and Tom Kirn of the NorthShore University HealthSystem will discuss their concerns about this approach to diagnosing bacterial pharyngitis. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
NASA Astrophysics Data System (ADS)
Huguet, Arnaud; Meador, Travis B.; Laggoun-Défarge, Fatima; Könneke, Martin; Wu, Weichao; Derenne, Sylvie; Hinrichs, Kai-Uwe
2017-04-01
Interpretations of the abundance and distribution of branched glycerol dialkyl glycerol tetraether (brGDGT) lipids have been increasingly applied to infer changes in paleoenvironment and to estimate terrigenous organic matter inputs into estuarine and marine sediments. However, only preliminary information is known regarding the ecology and physiology of the source organisms of these biomarkers. We assessed the production rates of brGDGTs under different redox conditions in peat, where these lipids are found in high concentrations, particularly at greater depths below the fluctuating water table. The incorporation of hydrogen relative to carbon into lipids observed in our dual stable isotope probing assay indicates that brGDGTs were produced by heterotrophic bacteria. Unexpectedly, incubations with stable isotope tracers of the surface horizon (5-20 cm) initiated under oxic conditions before turning suboxic and eventually anoxic exhibited up to one order of magnitude higher rates of brGDGT production (16-87 ng cm-3 y-1) relative to the deeper, anoxic zone (20-35 cm; ca. 7 ng cm-3 y-1), and anoxic incubations of the surface horizon (<3 ng cm-3 y-1). Turnover times of brGDGTs in the surface horizon ranged between 8 and 41 years in the incubations initiated under oxic conditions, in contrast to 123-742 years in anoxic incubations. As brGDGTs were actively produced during both anoxic incubations and those exposed to oxygen, we conclude that their source organisms are likely facultative aerobic heterotrophs that are particularly active in the peat acrotelm. Production rates of bacterial fatty acids (ca. 2 μg cm-3 y-1) were roughly two orders of magnitude higher than those of brGDGTs, suggesting that brGDGT producers are a minor constituent of the microbial community or that brGDGTs are a small component of the microbial cell membrane in comparison to fatty acids, despite the typically high brGDGT concentrations observed in peat. Multivariate analysis identified two
Production and transformation of dissolved neutral sugars and amino acids by bacteria in seawater
NASA Astrophysics Data System (ADS)
Jørgensen, L.; Lechtenfeld, O. J.; Benner, R.; Middelboe, M.; Stedmon, C. A.
2014-10-01
Dissolved organic matter (DOM) in the ocean consists of a heterogeneous mixture of molecules, most of which are of unknown origin. Neutral sugars and amino acids are among the few recognizable biomolecules in DOM, and the molecular composition of these biomolecules is shaped primarily by biological production and degradation processes. This study provides insight into the bioavailability of biomolecules as well as the chemical composition of DOM produced by bacteria. The molecular compositions of combined neutral sugars and amino acids were investigated in DOM produced by bacteria and in DOM remaining after 32 days of bacterial degradation. Results from bioassay incubations with natural seawater (sampled from water masses originating from the surface waters of the Arctic Ocean and the North Atlantic Ocean) and artificial seawater indicate that the molecular compositions following bacterial degradation are not strongly influenced by the initial substrate or bacterial community. The molecular composition of neutral sugars released by bacteria was characterized by a high glucose content (47 mol %) and heterogeneous contributions from other neutral sugars (3-14 mol %). DOM remaining after bacterial degradation was characterized by a high galactose content (33 mol %), followed by glucose (22 mol %) and the remaining neutral sugars (7-11 mol %). The ratio of D-amino acids to L-amino acids increased during the experiments as a response to bacterial degradation, and after 32 days, the D/L ratios of aspartic acid, glutamic acid, serine and alanine reached around 0.79, 0.32, 0.30 and 0.51 in all treatments, respectively. The striking similarity in neutral sugar and amino acid compositions between natural (representing marine semi-labile and refractory DOM) and artificial (representing bacterially produced DOM) seawater samples, suggests that microbes transform bioavailable neutral sugars and amino acids into a common, more persistent form.
Senthilvelan, T; Kanagaraj, J; Panda, R C
2014-11-01
"Dyeing" is a common practice used to color the hides during the post-tanning operations in leather processing generating plenty of wastewater. The waste stream containing dye as pollutant is severely harmful to living beings. An azo dye (C.I. Acid Blue 113) has been biodegraded effectively by bacterial culture mediated with azoreductase enzyme to reduce the pollution load in the present investigation. The maximum rate of dye degradation was found to be 96 ± 4 and 92 ± 4 % for the initial concentrations of 100 and 200 mg/l, respectively. The enzyme activity was measured using NADH as a substrate. Fourier transform infrared spectroscopy (FT-IR) analysis was confirmed that the transformation of azo linkage could be transformed into N2 or NH3 or incorporated into complete biomass. Breaking down of dye molecules to various metabolites (such as aniline, naphthalene-1,4-diamine, 3-aminobenzenesulfonic acid, naphthalene-1-sulfonic acid, 8-aminonaphthalene-1-sulfonic acid, 5,8-diaminonaphthalene-1-sulfonic acid) was confirmed by gas chromatography and mass spectra (GC-MS) and mass (electrospray ionization (ESI)) spectra analysis. The treated wastewater could be reused for dyeing operation in the leather processing, and the properties of produced leather were evaluated by conventional methods that revealed to have improved dye penetration into the grain layer of experimental leather sample and resulted in high levelness of dyeing, which helps to obtain the desired smoothness and soft leather properties.
DebRoy, Sruti; Thilmony, Roger; Kwack, Yong-Bum; Nomura, Kinya; He, Sheng Yang
2004-06-29
Salicylic acid (SA)-mediated host immunity plays a central role in combating microbial pathogens in plants. Inactivation of SA-mediated immunity, therefore, would be a critical step in the evolution of a successful plant pathogen. It is known that mutations in conserved effector loci (CEL) in the plant pathogens Pseudomonas syringae (the Delta CEL mutation), Erwinia amylovora (the dspA/E mutation), and Pantoea stewartii subsp. stewartii (the wtsE mutation) exert particularly strong negative effects on bacterial virulence in their host plants by unknown mechanisms. We found that the loss of virulence in Delta CEL and dspA/E mutants was linked to their inability to suppress cell wall-based defenses and to cause normal disease necrosis in Arabidopsis and apple host plants. The Delta CEL mutant activated SA-dependent callose deposition in wild-type Arabidopsis but failed to elicit high levels of callose-associated defense in Arabidopsis plants blocked in SA accumulation or synthesis. This mutant also multiplied more aggressively in SA-deficient plants than in wild-type plants. The hopPtoM and avrE genes in the CEL of P. syringae were found to encode suppressors of this SA-dependent basal defense. The widespread conservation of the HopPtoM and AvrE families of effectors in various bacteria suggests that suppression of SA-dependent basal immunity and promotion of host cell death are important virulence strategies for bacterial infection of plants.
21 CFR 866.5820 - Systemic lupus erythema-tosus immunological test system.
Code of Federal Regulations, 2011 CFR
2011-04-01
... with cellular nuclear double-stranded deoxyribonucleic acid (DNA) or other nuclear constituents that are specifically diagnostic of SLE. Measurement of nuclear double-stranded DNA antibodies aids in the...
21 CFR 866.5820 - Systemic lupus erythema-tosus immunological test system.
Code of Federal Regulations, 2012 CFR
2012-04-01
... with cellular nuclear double-stranded deoxyribonucleic acid (DNA) or other nuclear constituents that are specifically diagnostic of SLE. Measurement of nuclear double-stranded DNA antibodies aids in the...
21 CFR 866.5820 - Systemic lupus erythema-tosus immunological test system.
Code of Federal Regulations, 2014 CFR
2014-04-01
... with cellular nuclear double-stranded deoxyribonucleic acid (DNA) or other nuclear constituents that are specifically diagnostic of SLE. Measurement of nuclear double-stranded DNA antibodies aids in the...
21 CFR 866.5820 - Systemic lupus erythema-tosus immunological test system.
Code of Federal Regulations, 2013 CFR
2013-04-01
... with cellular nuclear double-stranded deoxyribonucleic acid (DNA) or other nuclear constituents that are specifically diagnostic of SLE. Measurement of nuclear double-stranded DNA antibodies aids in the...
Dynamic metabolic exchange governs a marine algal-bacterial interaction.
Segev, Einat; Wyche, Thomas P; Kim, Ki Hyun; Petersen, Jörn; Ellebrandt, Claire; Vlamakis, Hera; Barteneva, Natasha; Paulson, Joseph N; Chai, Liraz; Clardy, Jon; Kolter, Roberto
2016-11-18
Emiliania huxleyi is a model coccolithophore micro-alga that generates vast blooms in the ocean. Bacteria are not considered among the major factors influencing coccolithophore physiology. Here we show through a laboratory model system that the bacterium Phaeobacter inhibens , a well-studied member of the Roseobacter group, intimately interacts with E. huxleyi. While attached to the algal cell, bacteria initially promote algal growth but ultimately kill their algal host. Both algal growth enhancement and algal death are driven by the bacterially-produced phytohormone indole-3-acetic acid. Bacterial production of indole-3-acetic acid and attachment to algae are significantly increased by tryptophan, which is exuded from the algal cell. Algal death triggered by bacteria involves activation of pathways unique to oxidative stress response and programmed cell death. Our observations suggest that bacteria greatly influence the physiology and metabolism of E. huxleyi. Coccolithophore-bacteria interactions should be further studied in the environment to determine whether they impact micro-algal population dynamics on a global scale.
Hensel, Karol; Kučerová, Katarína; Tarabová, Barbora; Janda, Mário; Machala, Zdenko; Sano, Kaori; Mihai, Cosmin Teodor; Ciorpac, Mitică; Gorgan, Lucian Dragos; Jijie, Roxana; Pohoata, Valentin; Topala, Ionut
2015-06-06
Atmospheric pressure DC-driven self-pulsing transient spark (TS) discharge operated in air and pulse-driven dielectric barrier discharge plasma jet (PJ) operated in helium in contact with water solutions were used for inducing chemical effects in water solutions, and the treatment of bacteria (Escherichia coli), mammalian cells (Vero line normal cells, HeLa line cancerous cells), deoxyribonucleic acid (dsDNA), and protein (bovine serum albumin). Two different methods of water solution supply were used in the TS: water electrode system and water spray system. The effects of both TS systems and the PJ were compared, as well as a direct exposure of the solution to the discharge with an indirect exposure to the discharge activated gas flow. The chemical analysis of water solutions was performed by using colorimetric methods of UV-VIS absorption spectrophotometry. The bactericidal effects of the discharges on bacteria were evaluated by standard microbiological plate count method. Viability, apoptosis and cell cycle were assessed in normal and cancerous cells. Viability of cells was evaluated by trypan blue exclusion test, apoptosis by Annexin V-FITC/propidium iodide assay, and cell cycle progression by propidium iodide/RNase test. The effect of the discharges on deoxyribonucleic acid and protein were evaluated by fluorescence and UV absorption spectroscopy. The results of bacterial and mammalian cell viability, apoptosis, and cell cycle clearly show that cold plasma can inactivate bacteria and selectively target cancerous cells, which is very important for possible future development of new plasma therapeutic strategies in biomedicine. The authors found that all investigated bio-effects were stronger with the air TS discharge than with the He PJ, even in indirect exposure.
Swainsbury, David J K; Scheidelaar, Stefan; van Grondelle, Rienk; Killian, J Antoinette; Jones, Michael R
2014-01-01
Integral membrane proteins often present daunting challenges for biophysical characterization, a fundamental issue being how to select a surfactant that will optimally preserve the individual structure and functional properties of a given membrane protein. Bacterial reaction centers offer a rare opportunity to compare the properties of an integral membrane protein in different artificial lipid/surfactant environments with those in the native bilayer. Here, we demonstrate that reaction centers purified using a styrene maleic acid copolymer remain associated with a complement of native lipids and do not display the modified functional properties that typically result from detergent solubilization. Direct comparisons show that reaction centers are more stable in this copolymer/lipid environment than in a detergent micelle or even in the native membrane, suggesting a promising new route to exploitation of such photovoltaic integral membrane proteins in device applications. PMID:25212490
Zhang, Y; Liu, K; Hao, X; Xin, H
2017-12-01
The objectives of this study were to investigate the effect of different dietary ratios of forage and concentrate (F:C) on ruminal odd- and branched-chain fatty acids (OBCFAs) contents and to evaluate the relationships between OBCFA and ruminal fermentation parameters as well as bacterial populations tested by real-time PCR technique. The experimental design was a 3 × 3 Latin square. Three rumen-fistulated dry Holstein cows were fed three rations with different dietary F:C ratios (F:C; 30:70, 50:50 and 70:30). The rumen samples were collected every two hours (0600, 0800, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 0200 and 0400 h) over three consecutive days in each sampling period. The results showed that rumen OBCFA profiles are significantly (p < 0.05) affected by the dietary F:C ratios. The concentrations of C11:0, C13:0, iso-C15:0, iso-C16:0, iso-C17:0 and C17:0 were higher in the cows fed dietary F:C ratio of 70:30 than those fed with other two rations. However, the concentrations of anteiso-C15:0, C15:0 and total OBCFA were on the lowest level in the high forage diet. Correlation and regression analysis showed that ruminal OBCFAs had strong relationships with ruminal fermentation parameters and bacterial populations. In particular, the iso-fatty acids had potential power to predict butyrate and isoacids metabolized in the rumen, whereas the fatty acids with 17 carbon atoms correlated with ruminal NH 3 -N content. The OBCFA contents have different relationships with fibrolytic and starch bacteria in the rumen. C17:0 and its isomers might be used to predict populations of fibrolytic bacteria. Journal of Animal Physiology and Animal Nutrition © 2016 Blackwell Verlag GmbH.
Biodegradation of resin acid sodium salts
Richard W. Hemingway; H. Greaves
1973-01-01
The sodium salts of resin acids were readily degraded by microflora from two types of river water and from an activated sewage sludge. A lag phase with little or no resin acid salt degradation but rapid bacterial development occurred which was greatly extended by a decrease in incubation temperature. After this initial lag phase, the resin acid salts were rapidly...
De Filippis, Francesca; Troise, Antonio Dario; Vitaglione, Paola; Ercolini, Danilo
2018-08-01
Kombucha is a traditional beverage produced by tea fermentation, carried out by a symbiotic consortium of bacteria and yeasts. Acetic Acid Bacteria (AAB) usually dominate the bacterial community of Kombucha, driving the fermentative process. The consumption of this beverage was often associated to beneficial effects for the health, due to its antioxidant and detoxifying properties. We characterized bacterial populations of Kombucha tea fermented at 20 or 30 °C by using culture-dependent and -independent methods and monitored the concentration of gluconic and glucuronic acids, as well as of total polyphenols. We found significant differences in the microbiota at the two temperatures. Moreover, different species of Gluconacetobacter were selected, leading to a differential abundance of gluconic and glucuronic acids. Copyright © 2018 Elsevier Ltd. All rights reserved.
Amin, Aatif; Latif, Zakia
2017-03-01
Mercury resistant (Hg R ) bacteria were screened from industrial effluents and effluents-polluted rhizosphere soils near to districts Kasur and Sheikhupura, Pakistan. Out of 60 isolates, three bacterial strains, Bacillus sp. AZ-1, Bacillus cereus AZ-2, and Enterobacter cloacae AZ-3 showed Hg-resistance as 20 μg ml -1 of HgCl 2 and indole-3-acetic acid (IAA) production as 8-38 μg ml -1 . Biochemical and molecular characterization of selected bacteria was confirmed by 16S ribotyping. Mercury resistant genes merA, merB, and merE of mer operon in Bacillus spp. were checked by PCR amplification. The merE gene involved in the transportation of elemental mercury (Hg 0 ) via cell membrane was first time cloned into pHLV vector and transformed in C43(DE3) Escherichia coli cells. The recombinant plasmid (pHLMerE) was expressed and purified by nickel (Ni +2 ) affinity chromatography. Chromatographic techniques viz. thin layer chromatography (TLC), high performance liquid chromatography (HPLC), and Gas chromatography-mass spectrometry (GC-MS) confirmed the presence of Indole-3-acetic acid (IAA) in supernatant of selected bacteria. The strain E. cloacae AZ-3 detoxified 88% of mercury (Hg +2 ) from industrial effluent (p < 0.05) after immobilization in Na-alginate beads. Finally, Hg-resistant and IAA producing bacterial consortium of two strains, Bacillus sp. AZ-1 and E. cloacae AZ-3, inoculated in mercury amended soil with 20 μg ml -1 HgCl 2 resulted 80, 22, 64, 116, 50, 75, 30, and 100% increase as compared to control plants in seed germination, shoot and root length, shoot and root fresh weight, number of pods per plant, number of seeds and weight of seeds, respectively, of chickpea (Cicer arietinum L.) in pot experiments (p < 0.05). © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bile Acids Improve the Antimicrobial Effect of Rifaximin▿ †
Darkoh, Charles; Lichtenberger, Lenard M.; Ajami, Nadim; Dial, Elizabeth J.; Jiang, Zhi-Dong; DuPont, Herbert L.
2010-01-01
Diarrhea is one of the most common infirmities affecting international travelers, occurring in 20 to 50% of persons from industrialized countries visiting developing regions. Enterotoxigenic Escherichia coli (ETEC) is the most common causative agent and is isolated from approximately half of the cases of traveler's diarrhea. Rifaximin, a largely water-insoluble, nonabsorbable (<0.4%) antibiotic that inhibits bacterial RNA synthesis, is approved for use for the treatment of traveler's diarrhea caused by diarrheagenic E. coli. However, the drug has minimal effect on the bacterial flora or the infecting E. coli strain in the aqueous environment of the colon. The purpose of the present study was to evaluate the antimicrobial effect and bioavailability of rifaximin in aqueous solution in the presence and absence of physiologic concentrations of bile acids. The methods used included growth measurement of ETEC (strain H10407), rifaximin solubility measurements, total bacterial protein determination, and assessment of the functional activity of rifaximin by monitoring inhibition of bacterial β-galactosidase expression. Solubility studies showed rifaximin to be 70- to 120-fold more soluble in bile acids (approximately 30% in 4 mM bile acids) than in aqueous solution. Addition of both purified bile acids and human bile to rifaximin at subinhibitory and inhibitory concentrations significantly improved the drug's anti-ETEC effect by 71% and 73%, respectively, after 4 h. This observation was confirmed by showing a decrease in the overall amount of total bacterial protein expressed during incubation of rifaximin plus bile acids. Rifaximin-treated samples containing bile acids inhibited the expression of ETEC β-galactosidase at a higher magnitude than samples that did not contain bile acids. The study provides data showing that bile acids solubilize rifaximin on a dose-response basis, increasing the drug's bioavailability and antimicrobial effect. These observations suggest
Bacterial Cellular Materials as Precursors of Chloroform
NASA Astrophysics Data System (ADS)
Wang, J.; Ng, T.; Zhang, Q.; Chow, A. T.; Wong, P.
2011-12-01
The environmental sources of chloroform and other halocarbons have been intensively investigated because their effects of stratospheric ozone destruction and environmental toxicity. It has been demonstrated that microorganisms could facilitate the biotic generation of chloroform from natural organic matters in soil, but whether the cellular materials itself also serves as an important precursor due to photo-disinfection is poorly known. Herein, seven common pure bacterial cultures (Acinetobacter junii, Aeromonas hydrophila, Bacillus cereus, Bacillus substilis, Escherichia coli, Shigella sonnei, Staphylococcus sciuri) were chlorinated to evaluate the yields of chloroform, dibromochloromethane, dichlorobromomethane, and bromoform. The effects of bromide on these chemical productions and speciations were also investigated. Results showed that, on average, 5.64-36.42 μg-chloroform /mg-C were generated during the bacterial chlorination, in similar order of magnitude to that generated by humic acid (previously reported as 78 μg-chloroform/mg-C). However, unlike humic acid in water chlorination, chloroform concentration did not simply increase with the total organic carbon in water mixture. In the presence of bromide, the yield of brominated species responded linearly to the bromide concentration. This study provides useful information to understand the contributions of chloroform from photodisinfection processes in coastal environments.
Goto, Hiroko; Qadis, Abdul Qadir; Kim, Yo-Han; Ikuta, Kentaro; Ichijo, Toshihiro; Sato, Shigeru
2016-11-01
Effects of a bacterial probiotic (BP) on ruminal fermentation and plasma metabolites were evaluated in four Holstein cattle (body weight, 645 ± 62 kg; mean ± SD) with induced subacute ruminal acidosis (SARA). SARA was induced by feeding a SARA-inducing diet, and thereafter, 20, 50 or 100 g per head of a commercial BP was administered for 7 consecutive days during the morning feeding. Cattle without BP served as the control. The 24-hr mean ruminal pH in the control was lower, whereas those in the BP groups administered 20 or 50 g were significantly higher compared to the control from days 2 to 7. Circadian patterns of the 1-hr mean ruminal pH were identical (6.4-6.8) among all cattle receiving BP. Although the mean minimum pH in the control on day -7 and day 0 was <5.8, the pH in the treatment groups on day 7 was >5.8 and significantly higher than that of the control group ( >5.2). Ruminal volatile fatty acid (VFA) concentrations were not affected by BP treatment; however, the BP groups had lower lactic acid levels compared with the control group at 20:00 on day 7. Additionally, non-esterified fatty acid levels decreased from 8:00 to 20:00 in all BP groups on day 7. These results suggest that administration of 20 to 50 g of a multi-strain BP for 7 days might improve the low pH and high lactic acid level of the ruminal fluid in SARA cattle.
GOTO, Hiroko; QADIS, Abdul Qadir; KIM, Yo-Han; IKUTA, Kentaro; ICHIJO, Toshihiro; SATO, Shigeru
2016-01-01
Effects of a bacterial probiotic (BP) on ruminal fermentation and plasma metabolites were evaluated in four Holstein cattle (body weight, 645 ± 62 kg; mean ± SD) with induced subacute ruminal acidosis (SARA). SARA was induced by feeding a SARA-inducing diet, and thereafter, 20, 50 or 100 g per head of a commercial BP was administered for 7 consecutive days during the morning feeding. Cattle without BP served as the control. The 24-hr mean ruminal pH in the control was lower, whereas those in the BP groups administered 20 or 50 g were significantly higher compared to the control from days 2 to 7. Circadian patterns of the 1-hr mean ruminal pH were identical (6.4–6.8) among all cattle receiving BP. Although the mean minimum pH in the control on day –7 and day 0 was <5.8, the pH in the treatment groups on day 7 was >5.8 and significantly higher than that of the control group ( >5.2). Ruminal volatile fatty acid (VFA) concentrations were not affected by BP treatment; however, the BP groups had lower lactic acid levels compared with the control group at 20:00 on day 7. Additionally, non-esterified fatty acid levels decreased from 8:00 to 20:00 in all BP groups on day 7. These results suggest that administration of 20 to 50 g of a multi-strain BP for 7 days might improve the low pH and high lactic acid level of the ruminal fluid in SARA cattle. PMID:27430197
A role for bacterial urease in gut dysbiosis and Crohn’s disease
Ni, Josephine; Shen, Ting-Chin David; Chen, Eric Z.; Bittinger, Kyle; Bailey, Aubrey; Roggiani, Manuela; Sirota-Madi, Alexandra; Friedman, Elliot S.; Chau, Lillian; Lin, Andrew; Nissim, Ilana; Scott, Justin; Lauder, Abigail; Hoffmann, Christian; Rivas, Gloriany; Albenberg, Lindsey; Baldassano, Robert N.; Braun, Jonathan; Xavier, Ramnik J.; Clish, Clary B.; Yudkoff, Marc; Li, Hongzhe; Goulian, Mark; Bushman, Frederic D.; Lewis, James D.; Wu, Gary D.
2018-01-01
Gut dysbiosis during inflammatory bowel disease involves alterations in the gut microbiota associated with inflammation of the host gut. We used a combination of shotgun metagenomic sequencing and metabolomics to analyze fecal samples from pediatric patients with Crohn’s disease and found an association between disease severity, gut dysbiosis, and bacterial production of free amino acids. Nitrogen flux studies using 15N in mice showed that activity of bacterial urease, an enzyme that releases ammonia by hydrolysis of host urea, led to the transfer of murine host-derived nitrogen to the gutmicrobiota where it was used for amino acid synthesis. Inoculation of a conventional murine host (pretreated with antibiotics and polyethylene glycol) with commensal Escherichia coli engineered to express urease led to dysbiosis of the gut microbiota, resulting in a predominance of Proteobacteria species. This was associated with a worsening of immune-mediated colitis in these animals. A potential role for altered urease expression and nitrogen flux in the development of gut dysbiosis suggests that bacterial urease may be a potential therapeutic target for inflammatory bowel diseases. PMID:29141885
Schenk, Sebastian T.; Hernández-Reyes, Casandra; Samans, Birgit; Stein, Elke; Neumann, Christina; Schikora, Marek; Reichelt, Michael; Mithöfer, Axel; Becker, Annette; Kogel, Karl-Heinz; Schikora, Adam
2014-01-01
The ability of plants to monitor their surroundings, for instance the perception of bacteria, is of crucial importance. The perception of microorganism-derived molecules and their effector proteins is the best understood of these monitoring processes. In addition, plants perceive bacterial quorum sensing (QS) molecules used for cell-to-cell communication between bacteria. Here, we propose a mechanism for how N-acyl-homoserine lactones (AHLs), a group of QS molecules, influence host defense and fortify resistance in Arabidopsis thaliana against bacterial pathogens. N-3-oxo-tetradecanoyl-l-homoserine lactone (oxo-C14-HSL) primed plants for enhanced callose deposition, accumulation of phenolic compounds, and lignification of cell walls. Moreover, increased levels of oxylipins and salicylic acid favored closure of stomata in response to Pseudomonas syringae infection. The AHL-induced resistance seems to differ from the systemic acquired and the induced systemic resistances, providing new insight into inter-kingdom communication. Consistent with the observation that short-chain AHLs, unlike oxo-C14-HSL, promote plant growth, treatments with C6-HSL, oxo-C10-HSL, or oxo-C14-HSL resulted in different transcriptional profiles in Arabidopsis. Understanding the priming induced by bacterial QS molecules augments our knowledge of plant reactions to bacteria and suggests strategies for using beneficial bacteria in plant protection. PMID:24963057
Haug, W; Schmidt, A; Nörtemann, B; Hempel, D C; Stolz, A; Knackmuss, H J
1991-01-01
Under anaerobic conditions the sulfonated azo dye Mordant Yellow 3 was reduced by the biomass of a bacterial consortium grown aerobically with 6-aminonaphthalene-2-sulfonic acid. Stoichiometric amounts of the aromatic amines 6-aminonaphthalene-2-sulfonate and 5-aminosalicylate were generated and excreted into the medium. After re-aeration of the culture, these amines were mineralized by different members of the bacterial culture. Thus, total degradation of a sulfonated azo dye was achieved by using an alternating anaerobic-aerobic treatment. The ability of the mixed bacterial culture to reduce the azo dye was correlated with the presence of strain BN6, which possessed the ability to oxidize various naphthalenesulfonic acids. It is suggested that strain BN6 has a transport system for naphthalenesulfonic acids which also catalyzes uptake of sulfonated azo dyes. These dyes are then gratuitously reduced in the cytoplasm by unspecific reductases. PMID:1781678
Kulkarni, G B; Nayak, A S; Sajjan, S S; Oblesha, A; Karegoudar, T B
2013-05-01
This investigation deals with the production of IAA by a bacterial isolate Pantoea dispersa strain GPK (PDG) identified by 16S rRNA gene sequence analysis. HPLC and Mass spectral analysis of metabolites from bacterial spent medium revealed that, IAA production by PDG is Trp-dependent and follows indole-3-pyruvic acid (IPyA) pathway. Substrate specificity study of aromatic amino acid aminotransferase (AAT) showed high activities, only when tryptophan (Trp) and α-ketoglutarate (α-kg) were used as substrates. AAT is highly specific for Trp and α-kg as amino group donor and acceptor, respectively. The effect of exogenous IAA on bacterial growth was established. Low concentration of exogenous IAA induced the growth, whereas high concentration decreased the growth of bacterium. PDG treatment significantly increased the root length, shoot length and dry mass of the chickpea and pigeon pea plants. © 2013 The Society for Applied Microbiology.
Bacterial streamers in curved microchannels
NASA Astrophysics Data System (ADS)
Rusconi, Roberto; Lecuyer, Sigolene; Guglielmini, Laura; Stone, Howard
2009-11-01
Biofilms, generally identified as microbial communities embedded in a self-produced matrix of extracellular polymeric substances, are involved in a wide variety of health-related problems ranging from implant-associated infections to disease transmissions and dental plaque. The usual picture of these bacterial films is that they grow and develop on surfaces. However, suspended biofilm structures, or streamers, have been found in natural environments (e.g., rivers, acid mines, hydrothermal hot springs) and are always suggested to stem from a turbulent flow. We report the formation of bacterial streamers in curved microfluidic channels. By using confocal laser microscopy we are able to directly image and characterize the spatial and temporal evolution of these filamentous structures. Such streamers, which always connect the inner corners of opposite sides of the channel, are always located in the middle plane. Numerical simulations of the flow provide evidences for an underlying hydrodynamic mechanism behind the formation of the streamers.
Leaf shedding as an anti-bacterial defense in Arabidopsis cauline leaves
2017-01-01
Plants utilize an innate immune system to protect themselves from disease. While many molecular components of plant innate immunity resemble the innate immunity of animals, plants also have evolved a number of truly unique defense mechanisms, particularly at the physiological level. Plant’s flexible developmental program allows them the unique ability to simply produce new organs as needed, affording them the ability to replace damaged organs. Here we develop a system to study pathogen-triggered leaf abscission in Arabidopsis. Cauline leaves infected with the bacterial pathogen Pseudomonas syringae abscise as part of the defense mechanism. Pseudomonas syringae lacking a functional type III secretion system fail to elicit an abscission response, suggesting that the abscission response is a novel form of immunity triggered by effectors. HAESA/HAESA-like 2, INFLORESCENCE DEFICIENT IN ABSCISSION, and NEVERSHED are all required for pathogen-triggered abscission to occur. Additionally phytoalexin deficient 4, enhanced disease susceptibility 1, salicylic acid induction-deficient 2, and senescence-associated gene 101 plants with mutations in genes necessary for bacterial defense and salicylic acid signaling, and NahG transgenic plants with low levels of salicylic acid fail to abscise cauline leaves normally. Bacteria that physically contact abscission zones trigger a strong abscission response; however, long-distance signals are also sent from distal infected tissue to the abscission zone, alerting the abscission zone of looming danger. We propose a threshold model regulating cauline leaf defense where minor infections are handled by limiting bacterial growth, but when an infection is deemed out of control, cauline leaves are shed. Together with previous results, our findings suggest that salicylic acid may regulate both pathogen- and drought-triggered leaf abscission. PMID:29253890
Zhou, Renwu; Zhou, Rusen; Zhuang, Jinxing; Zong, Zichao; Zhang, Xianhui; Liu, Dongping; Bazaka, Kateryna; Ostrikov, Kostya
2016-01-01
Plasma medicine is a relatively new field that investigates potential applications of cold atmospheric-pressure plasmas in bioengineering, such as for bacterial inactivation and degradation of organic molecules in water. In order to enunciate mechanisms of bacterial inactivation at molecular or atomic levels, we investigated the interaction of atmospheric-pressure air microplasmas with amino acids in aqueous solution by using high-resolution mass spectrometry (HRMS). Results show that the oxidation effect of plasma-induced species on the side chains of the amino acids can be categorized into four types, namely hydroxylation, nitration, dehydrogenation and dimerization. In addition, relative activities of amino acids resulting from plasma treatment come in descending order as follows: sulfur-containing carbon-chain amino acids > aromatic amino acids > five-membered ring amino acids > basic carbon-chain amino acids. Since amino acids are building blocks of proteins vital to the growth and reproduction of bacteria, these results provide an insight into the mechanism of bacterial inactivation by plasma. PMID:27183129
Bacterial flagella grow through an injection-diffusion mechanism
Renault, Thibaud T; Abraham, Anthony O; Bergmiller, Tobias; Paradis, Guillaume; Rainville, Simon; Charpentier, Emmanuelle; Guet, Călin C; Tu, Yuhai; Namba, Keiichi; Keener, James P; Minamino, Tohru; Erhardt, Marc
2017-01-01
The bacterial flagellum is a self-assembling nanomachine. The external flagellar filament, several times longer than a bacterial cell body, is made of a few tens of thousands subunits of a single protein: flagellin. A fundamental problem concerns the molecular mechanism of how the flagellum grows outside the cell, where no discernible energy source is available. Here, we monitored the dynamic assembly of individual flagella using in situ labelling and real-time immunostaining of elongating flagellar filaments. We report that the rate of flagellum growth, initially ∼1,700 amino acids per second, decreases with length and that the previously proposed chain mechanism does not contribute to the filament elongation dynamics. Inhibition of the proton motive force-dependent export apparatus revealed a major contribution of substrate injection in driving filament elongation. The combination of experimental and mathematical evidence demonstrates that a simple, injection-diffusion mechanism controls bacterial flagella growth outside the cell. DOI: http://dx.doi.org/10.7554/eLife.23136.001 PMID:28262091
Bacterial flagella grow through an injection-diffusion mechanism.
Renault, Thibaud T; Abraham, Anthony O; Bergmiller, Tobias; Paradis, Guillaume; Rainville, Simon; Charpentier, Emmanuelle; Guet, Călin C; Tu, Yuhai; Namba, Keiichi; Keener, James P; Minamino, Tohru; Erhardt, Marc
2017-03-06
The bacterial flagellum is a self-assembling nanomachine. The external flagellar filament, several times longer than a bacterial cell body, is made of a few tens of thousands subunits of a single protein: flagellin. A fundamental problem concerns the molecular mechanism of how the flagellum grows outside the cell, where no discernible energy source is available. Here, we monitored the dynamic assembly of individual flagella using in situ labelling and real-time immunostaining of elongating flagellar filaments. We report that the rate of flagellum growth, initially ∼1,700 amino acids per second, decreases with length and that the previously proposed chain mechanism does not contribute to the filament elongation dynamics. Inhibition of the proton motive force-dependent export apparatus revealed a major contribution of substrate injection in driving filament elongation. The combination of experimental and mathematical evidence demonstrates that a simple, injection-diffusion mechanism controls bacterial flagella growth outside the cell.
Rifaximin Modulates the Vaginal Microbiome and Metabolome in Women Affected by Bacterial Vaginosis
Picone, Gianfranco; Cruciani, Federica; Brigidi, Patrizia; Calanni, Fiorella; Donders, Gilbert; Capozzi, Francesco; Vitali, Beatrice
2014-01-01
Bacterial vaginosis (BV) is a common vaginal disorder characterized by the decrease of lactobacilli and overgrowth of Gardnerella vaginalis and resident anaerobic vaginal bacteria. In the present work, the effects of rifaximin vaginal tablets on vaginal microbiota and metabolome of women affected by BV were investigated by combining quantitative PCR and a metabolomic approach based on 1H nuclear magnetic resonance. To highlight the general trends of the bacterial communities and metabolomic profiles in response to the antibiotic/placebo therapy, a multivariate statistical strategy was set up based on the trajectories traced by vaginal samples in a principal component analysis space. Our data demonstrated the efficacy of rifaximin in restoring a health-like condition in terms of both bacterial communities and metabolomic features. In particular, rifaximin treatment was significantly associated with an increase in the lactobacillus/BV-related bacteria ratio, as well as with an increase in lactic acid concentration and a decrease of a pool of metabolites typically produced by BV-related bacteria (acetic acid, succinate, short-chain fatty acids, and biogenic amines). Among the tested dosages of rifaximin (100 and 25 mg for 5 days and 100 mg for 2 days), 25 mg for 5 days was found to be the most effective. PMID:24709255
NASA Technical Reports Server (NTRS)
Joyce, Gerald F. (Inventor); Breaker, Ronald R. (Inventor)
1998-01-01
The present invention discloses deoxyribonucleic acid enzymes--catalytic or enzymatic DNA molecules--capable of cleaving nucleic acid sequences or molecules, particularly RNA, in a site-specific manner, as well as compositions including same. Methods of making and using the disclosed enzymes and compositions are also disclosed.
Fundamental Approaches in Molecular Biology for Communication Sciences and Disorders
ERIC Educational Resources Information Center
Bartlett, Rebecca S.; Jette, Marie E.; King, Suzanne N.; Schaser, Allison; Thibeault, Susan L.
2012-01-01
Purpose: This contemporary tutorial will introduce general principles of molecular biology, common deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and protein assays and their relevance in the field of communication sciences and disorders. Method: Over the past 2 decades, knowledge of the molecular pathophysiology of human disease has…
Tu, Xiang; Li, Jianjun; Feng, Rongfang; Sun, Guoping; Guo, Jun
2016-01-01
Although biotrickling filters (BTFs) applied under acidic condition to remove H2S from waste gases have been reported, the removal behavior of the acidic BTF under transient condition which was normal in most industry processes, and corresponding bacterial community have not been thoroughly studied. In the present study, two BTFs were run under neutral (BTFn) and acidic (BTFa) conditions, respectively. The results revealed that the removal performance of BTFa under transient condition was superior to that of BTFn; the maximum H2S eliminating capacities (ECs) achieved by BTFa and BTFn were 489.9 g/m3 h and 443.6 g/m3 h, respectively. High-throughput sequencing suggested that pH was the critical factor and several other factors including nutrient and the inlet loadings also had roles in shaping bacterial community structure. Acidithiobacillus was the most abundant bacterial group. The results indicated that BTF acclimation under acidic condition may facilitate generating microbial community with high H2S-degrading capability. PMID:27196300
In a previously described study, only 15% of the bacterial strains isolated from a water distribution system (WDS) grown on R2A agar were identifiable using fatty acid methyl esthers (FAME) profiling. The lack of success was attributed to the use of fatty acid databases of bacter...
Hetler, D M; Bronfenbrenner, J
1928-07-31
1. During the process of lysis by bacteriophage, there is an appreciable increase in the amount of free amino acid present in the culture. 2. The increase of free amino acid is due to hydrolysis of bacterial protein.
Synthesis of racemic 9-methyl-10-hexadecenoic acid.
Carballeira, N M; Sostre, A; Restituyo, J A
1999-02-01
The marine bacterial fatty acid 9-methyl-10-hexadecenoic acid was conveniently prepared in 6 steps and in a 22% overall yield, starting from commercially available methyl 10-hydroxydecanoate. The naturally occurring fatty acid has the E double bond configuration as confirmed by gas chromatographic co-elution experiments.
Next-Generation Sequencing Reveals Significant Bacterial Diversity of Botrytized Wine
Bokulich, Nicholas A.; Joseph, C. M. Lucy; Allen, Greg; Benson, Andrew K.; Mills, David A.
2012-01-01
While wine fermentation has long been known to involve complex microbial communities, the composition and role of bacteria other than a select set of lactic acid bacteria (LAB) has often been assumed either negligible or detrimental. This study served as a pilot study for using barcoded amplicon next-generation sequencing to profile bacterial community structure in wines and grape musts, comparing the taxonomic depth achieved by sequencing two different domains of prokaryotic 16S rDNA (V4 and V5). This study was designed to serve two goals: 1) to empirically determine the most taxonomically informative 16S rDNA target region for barcoded amplicon sequencing of wine, comparing V4 and V5 domains of bacterial 16S rDNA to terminal restriction fragment length polymorphism (TRFLP) of LAB communities; and 2) to explore the bacterial communities of wine fermentation to better understand the biodiversity of wine at a depth previously unattainable using other techniques. Analysis of amplicons from the V4 and V5 provided similar views of the bacterial communities of botrytized wine fermentations, revealing a broad diversity of low-abundance taxa not traditionally associated with wine, as well as atypical LAB communities initially detected by TRFLP. The V4 domain was determined as the more suitable read for wine ecology studies, as it provided greater taxonomic depth for profiling LAB communities. In addition, targeted enrichment was used to isolate two species of Alphaproteobacteria from a finished fermentation. Significant differences in diversity between inoculated and uninoculated samples suggest that Saccharomyces inoculation exerts selective pressure on bacterial diversity in these fermentations, most notably suppressing abundance of acetic acid bacteria. These results determine the bacterial diversity of botrytized wines to be far higher than previously realized, providing further insight into the fermentation dynamics of these wines, and demonstrate the utility of next
... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...
... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...
... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...
... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...
... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...
Brief Guide to Genomics: DNA, Genes and Genomes
... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...
... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...
Wang, Haoyong; Cao, Shangzhi; Wang, William Tianshuo; Wang, Kaven Tianyv; Jia, Xianhui
2016-06-01
Very high gravity (VHG) fermentation is the mainstream technology in ethanol industry, which requires the strains be resistant to multiple stresses such as high glucose concentration, high ethanol concentration, high temperature and harsh acidic conditions. To our knowledge, it was not reported previously that any ethanol-producing microbe showed a high performance in VHG fermentations without amino acid and vitamin. Here we demonstrate the engineering of a xylose utilizing recombinant Zymomonas mobilis for VHG ethanol fermentations. The recombinant strain can produce ethanol up to 136 g/L without amino acid and vitamin with a theoretical yield of 90 %, which is significantly superior to that produced by all the reported ethanol-producing strains. The intracellular fatty acids of the bacterial were about 16 % of the bacterial dry biomass, with the ratio of ethanol:fatty acids was about 273:1 (g/g). The recombinant strain was achieved by a multivariate-modular strategy tackles with the multiple stresses which are closely linked to the ethanol productivity of Z. mobilis. The over-expression of metB/yfdZ operon enabled the growth of the recombinant Z. mobilis in a chemically defined medium without amino acid and vitamin; and the fatty acids overproduction significantly increased ethanol tolerance and ethanol production. The coupled production of ethanol with fatty acids of the Z. mobilis without amino acid and vitamin under VHG fermentation conditions may permit a significant reduction of the production cost of ethanol and microbial fatty acids.
Lu, J F; Zhu, Y; Sun, H L; Liang, S; Leng, F F; Li, H Y
2016-04-01
During Streptococcus zooepidemicus fermentation, most carbon sources are used to synthesize lactic acid, which can inhibit strain growth and hyaluronic acid production. Here, we expressed bacterial haemoglobin (Vhb) in Strep. zooepidemicus. Due to highly efficient oxygen use, only 15·26 g l(-1) lactic acid was produced, which is 0·73 times the quantity produced by the control strain. Compared with the control strain (1·61 g l(-1) ), hyaluronic acid (HA) production in this strain did not substantially increase, only to 2·16 g l(-1) . Next, we used a series of N-methyl-N'-nitro-N-nitroso-guanidine (NTG) treatments and selection programmes. Finally, we generated a hyaluronidase-negative and rifampin-resistant mutant strain that produces high levels of HA. The optimum carbon concentration for maximum hyaluronic acid production is only 30 g l(-1) of sucrose, which is lower than the control strain (60 g l(-1) ). The oxygen transfer rate coefficient KL a increased significantly to 372 ± 53 h(-1) from 18 ± 4 h(-1) of the control. The optimum carbon source for this strain is 21 g l(-1) of sucrose, 9 g l(-1) of maltose and 5 g l(-1) of glutamic acid. Hyaluronic acid accumulated at 6·7 g l(-1) in the culture broth. However, the molecular weight of HA decreased from 1835 KDa (Control) to 429 kDa. The prepared low-molecular weight HA could function as potential antiangiogenic substances, antiviral and antitumour agents to possibly be used as functional food ingredients. Hyaluronic acid (HA) has been used for a wide range of applications in health, cosmetic and clinical fields. During fermentation of Streptococcus to produce HA, 80-85% of the carbon source is used to produce lactic acid and acetic acid, and only approx. 5 and 10% of the carbon source is used to produce HA and biomass respectively. Here, we expressed bacteria haemoglobin (Vhb) in Streptococcus zooepidemicus, which can dramatically inhibit lactic acid production. After NTG
Novel approach for the use of dairy industry wastes for bacterial growth media production.
Kasmi, Mariam; Elleuch, Lobna; Dahmeni, Ameni; Hamdi, Moktar; Trabelsi, Ismail; Snoussi, Mejdi
2018-04-15
This work proposes a novel approach for the reuse and the recovery of dairy wastes valuable components. Thermal coagulation was performed for dairy effluents and the main responsible fraction for the organic matter content (protein and fat) was separated. Dairy curds were prepared for the formulation of bacterial growth media. Protein, sugar, fat and fatty acids contents have been assessed. Samples treated at 100 °C exhibited marked improvement in terms of protein (25-50%) recovery compared to those treated at 80 °C. Fatty acid analysis revealed the presence of unsaturated fatty acids (mainly oleic acid) that are essential to promote Lactobacillus growth. Previously isolated and identified bacterial strains from dairy wastes (Lactobacillus paracasei, Lactobacillus plantarum, Lactococcus lactis and Lactobacillus brevis) were investigated for their ability to grow on the formulated media. All the tested lactic acid bacteria exhibited greater bacterial growth on the formulated media supplemented with glucose only or with both glucose and yeast extract compared to the control media. By reference to the commercial growth medium, the productivity ratio of the supplemented bactofugate (B) and decreaming (D) formulated media exceeded 0.6 for L. paracasei culture. Whereas, the productivity ratio of the supplemented B medium was greater than 1 compared to the control medium for all the tested strains. As for the supplemented D medium, its productivity ratio was greater than 1 compared to the control medium for both L. paracasei and L. plantarum strains. Copyright © 2018 Elsevier Ltd. All rights reserved.
Alper, M D; Ames, B N
1975-01-01
We have developed a convenient and specific positive selection for long deletions through the gal region of the chromosomes of Salmonella typhimurium and Escherichia coli. Through simultaneous selection for mutations in the two closely linked genes, gal and chlA, a variety of deletions of varying length, some extending through as much as 1 min of the chromosome, could be readily obtained. Many of these deletions resulted in the loss of a gene, which we named dhb, concerned with the ability of the bacterium to synthesize the iron chelating agent enterobactin. The selection was adapted for the screening of mutagens for their ability to generate long deletions in the bacterial deoxyribonucleic acid. Forty agents were screened for this capability. Nitrous acid, previously reported to be an efficient mutagen for this purpose, increased the frequency of deletion mutations 50-fold in our system. Three others, nitrogen mustard, mitomycin C, and fast neutrons, were shown to increase the frequency of long deletions between five- and eightfold. The remainder were found to be incapable of generating these deletions. PMID:1090571
Intestinal bile acid malabsorption in cystic fibrosis.
O'Brien, S; Mulcahy, H; Fenlon, H; O'Broin, A; Casey, M; Burke, A; FitzGerald, M X; Hegarty, J E
1993-08-01
This study aimed at examining the mechanisms participating in excessive faecal bile acid loss in cystic fibrosis. The study was designed to define the relation between faecal fat and faecal bile acid loss in patients with and without cystic fibrosis related liver disease; to assess terminal ileal bile acid absorption by a seven day whole body retention of selenium labelled homotaurocholic acid (SeHCAT); and to determine if small intestinal bacterial overgrowth contributes to faecal bile acid loss. The study population comprised 40 patients (27 men; median age 18 years) with cystic fibrosis (n = 8) and without (n = 32) liver disease and eight control subjects. Faecal bile acid excretion was significantly higher in cystic fibrosis patients without liver disease compared with control subjects (mean (SEM) 21.5 (2.4) and 7.3 (1.2) micromoles/kg/24 hours respectively; p < 0.01) and patients with liver disease (7.9 (1.3) micromoles/kg/24 hours; p < 0.01). No correlation was found between faecal fat (g fat/24 hours) and faecal bile acid (micromoles 24 hours) excretion. Eight (33%) of cystic fibrosis patients had seven day SeHCAT retention < 10% (normal retention > 20%). SeHCAT retention in cystic fibrosis patients with liver disease was comparable with control subjects (30.0 (SEM) 8.3% v 36.8 (5.9)%; p = NS) while SeHCAT retention in cystic fibrosis patients who did not have liver disease was significantly reduced (19.9 (3.8); p < 0.05). Although evidence of small bowel bacterial overgrowth was present in 40% of patients no relation was found between breath hydrogen excretion, faecal fat, and faecal bile acid loss. The results are consistent with the presence of an abnormality in terminal ideal function in patients with cystic fibrosis who do not have liver disease and that a defect in the ileal absorption of bile acids may be a contributory factor to excessive faecal bile acid loss. Faecal bile acid loss in cystic fibrosis is unrelated to the presence of intraluminal fat
Intestinal bile acid malabsorption in cystic fibrosis.
O'Brien, S; Mulcahy, H; Fenlon, H; O'Broin, A; Casey, M; Burke, A; FitzGerald, M X; Hegarty, J E
1993-01-01
This study aimed at examining the mechanisms participating in excessive faecal bile acid loss in cystic fibrosis. The study was designed to define the relation between faecal fat and faecal bile acid loss in patients with and without cystic fibrosis related liver disease; to assess terminal ileal bile acid absorption by a seven day whole body retention of selenium labelled homotaurocholic acid (SeHCAT); and to determine if small intestinal bacterial overgrowth contributes to faecal bile acid loss. The study population comprised 40 patients (27 men; median age 18 years) with cystic fibrosis (n = 8) and without (n = 32) liver disease and eight control subjects. Faecal bile acid excretion was significantly higher in cystic fibrosis patients without liver disease compared with control subjects (mean (SEM) 21.5 (2.4) and 7.3 (1.2) micromoles/kg/24 hours respectively; p < 0.01) and patients with liver disease (7.9 (1.3) micromoles/kg/24 hours; p < 0.01). No correlation was found between faecal fat (g fat/24 hours) and faecal bile acid (micromoles 24 hours) excretion. Eight (33%) of cystic fibrosis patients had seven day SeHCAT retention < 10% (normal retention > 20%). SeHCAT retention in cystic fibrosis patients with liver disease was comparable with control subjects (30.0 (SEM) 8.3% v 36.8 (5.9)%; p = NS) while SeHCAT retention in cystic fibrosis patients who did not have liver disease was significantly reduced (19.9 (3.8); p < 0.05). Although evidence of small bowel bacterial overgrowth was present in 40% of patients no relation was found between breath hydrogen excretion, faecal fat, and faecal bile acid loss. The results are consistent with the presence of an abnormality in terminal ideal function in patients with cystic fibrosis who do not have liver disease and that a defect in the ileal absorption of bile acids may be a contributory factor to excessive faecal bile acid loss. Faecal bile acid loss in cystic fibrosis is unrelated to the presence of intraluminal fat
Feiner, Rose R.; Coward, Joe E.; Rosenkranz, Herbert S.
1973-01-01
Hydroxyurea-sensitive strains of Staphylococcus epidermidis and Micrococcus lysodeikticus showed marked thickening of cell walls and reduction in deoxyribonucleic acid synthesis when grown in the presence of hydroxyurea. Images PMID:4790602
Song, Geun C; Choi, Hye K; Ryu, Choong-Min
2015-01-01
3-Pentanol is an active organic compound produced by plants and is a component of emitted insect sex pheromones. A previous study reported that drench application of 3-pentanol elicited plant immunity against microbial pathogens and an insect pest in crop plants. Here, we evaluated whether 3-pentanol and the derivatives 1-pentanol and 2-pentanol induced plant systemic resistance using the in vitro I-plate system. Exposure of Arabidopsis seedlings to 10 μM and 100 nM 3-pentanol evaporate elicited an immune response to Pseudomonas syringae pv. tomato DC3000. We performed quantitative real-time PCR to investigate the 3-pentanol-mediated Arabidopsis immune responses by determining Pathogenesis-Related (PR) gene expression levels associated with defense signaling through salicylic acid (SA), jasmonic acid (JA), and ethylene signaling pathways. The results show that exposure to 3-pentanol and subsequent pathogen challenge upregulated PDF1.2 and PR1 expression. Selected Arabidopsis mutants confirmed that the 3-pentanol-mediated immune response involved SA and JA signaling pathways and the NPR1 gene. Taken together, this study indicates that gaseous 3-pentanol triggers induced resistance in Arabidopsis by priming SA and JA signaling pathways. To our knowledge, this is the first report that a volatile compound of an insect sex pheromone triggers plant systemic resistance against a bacterial pathogen.
[Effect of Gram-negative bacteria on fatty acids].
Vuillemin, N; Dupeyron, C; Leluan, G; Bory, J
1981-01-01
The gram-negative bacteria investigated exert various effects on fatty acids. P. aeruginosa and A. calcoaceticus catabolize any of the fatty acids tested. S. marcescens is effective upon all fatty acids excepting butyric acid. The long chain fatty acids only are degraded by E. coli, meanwhile the other fatty acids present a bacteriostatic or bactericidal activity on it. The authors propose a simple and original method for testing the capability of degradation of fatty acids by some bacterial species.
Bacterial decontamination using ambient pressure nonthermal discharges
DOE Office of Scientific and Technical Information (OSTI.GOV)
Birmingham, J.G.; Hammerstrom, D.J.
2000-02-01
Atmospheric pressure nonthermal plasmas can efficiently deactivate bacteria in gases, liquids, and on surfaces, as well as can decompose hazardous chemicals. This paper focuses on the changes to bacterial spores and toxic biochemical compounds, such as mycotoxins, after their treatment in ambient pressure discharges. The ability of nonthermal plasmas to decompose toxic chemicals and deactivate hazardous biological materials has been applied to sterilizing medical instruments, ozonating water, and purifying air. In addition, the fast lysis of bacterial spores and other cells has led us to include plasma devices within pathogen detection instruments, where nucleic acids must be accessed. Decontaminating chemicalmore » and biological warfare materials from large, high value targets such as building surfaces, after a terrorist attack, are especially challenging. A large area plasma decontamination technology is described.« less
Inhibition of Hsp27 Radiosensitizes Head-and-Neck Cancer by Modulating Deoxyribonucleic Acid Repair
DOE Office of Scientific and Technical Information (OSTI.GOV)
Guttmann, David M.; Hart, Lori; Du, Kevin
Purpose: To present a novel method of tumor radiosensitization through Hsp27 knockdown using locked nucleic acid (LNA) and to investigate the role of Hsp27 in DNA double strand break (DSB) repair. Methods and Materials: Clonogenic survival assays, immunoblotting, the proximity ligation assay, and γH2AX foci analysis were conducted in SQ20B and FaDu human head-and-neck cancer cell lines treated with Hsp27 LNA and Hsp27 short hairpin RNA (shRNA). Additionally, nude mice with FaDu flank tumors were treated with fractionated radiation therapy after pretreatment with Hsp27 LNA and monitored for tumor growth. Results: Hsp27 LNA and Hsp27 shRNA radiosensitized head-and-neck cancer cellmore » lines in an Hsp27-dependent manner. Ataxia-Telangectasia Mutated-mediated DNA repair signaling was impaired in irradiated cells with Hsp27 knockdown. ATM kinase inhibition abrogated the radiosensitizing effect of Hsp27. Furthermore, Hsp27 LNA and shRNA both attenuated DNA repair kinetics after radiation, and Hsp27 was found to colocalize with ATM in both untreated and irradiated cells. Last, combined radiation and Hsp27 LNA treatment in tumor xenografts in nude mice suppressed tumor growth compared with either treatment alone. Conclusions: These results support a radiosensitizing property of Hsp27 LNA in vitro and in vivo, implicate Hsp27 in double strand break repair, and suggest that Hsp27 LNA might eventually serve as an effective clinical agent in the radiotherapy of head-and-neck cancer.« less
Inhibition of Hsp27 radiosensitizes head-and-neck cancer by modulating deoxyribonucleic acid repair.
Guttmann, David M; Hart, Lori; Du, Kevin; Seletsky, Andrew; Koumenis, Constantinos
2013-09-01
To present a novel method of tumor radiosensitization through Hsp27 knockdown using locked nucleic acid (LNA) and to investigate the role of Hsp27 in DNA double strand break (DSB) repair. Clonogenic survival assays, immunoblotting, the proximity ligation assay, and γH2AX foci analysis were conducted in SQ20B and FaDu human head-and-neck cancer cell lines treated with Hsp27 LNA and Hsp27 short hairpin RNA (shRNA). Additionally, nude mice with FaDu flank tumors were treated with fractionated radiation therapy after pretreatment with Hsp27 LNA and monitored for tumor growth. Hsp27 LNA and Hsp27 shRNA radiosensitized head-and-neck cancer cell lines in an Hsp27-dependent manner. Ataxia-Telangectasia Mutated-mediated DNA repair signaling was impaired in irradiated cells with Hsp27 knockdown. ATM kinase inhibition abrogated the radiosensitizing effect of Hsp27. Furthermore, Hsp27 LNA and shRNA both attenuated DNA repair kinetics after radiation, and Hsp27 was found to colocalize with ATM in both untreated and irradiated cells. Last, combined radiation and Hsp27 LNA treatment in tumor xenografts in nude mice suppressed tumor growth compared with either treatment alone. These results support a radiosensitizing property of Hsp27 LNA in vitro and in vivo, implicate Hsp27 in double strand break repair, and suggest that Hsp27 LNA might eventually serve as an effective clinical agent in the radiotherapy of head-and-neck cancer. Copyright © 2013. Published by Elsevier Inc.
Carpenter, C E; Broadbent, J R
2009-01-01
Although the mechanisms by which organic acids inhibit growth of bacteria in mildly acidic foods are not fully understood, it is clear that intracellular accumulation of anions is a primary contributor to inhibition of bacterial growth. We hypothesize that intracellular accumulation of anions is driven by 2 factors, external anion concentration and external acidity. This hypothesis follows from basic chemistry principles that heretofore have not been fully applied to studies in the field, and it has led us to develop a novel approach for predicting internal anion concentration by controlling the external concentration of anions and pH. This approach overcomes critical flaws in contemporary experimental design that invariably target concentration of either protonated acid or total acid in the growth media thereby leaving anion concentration to vary depending on the pK(a) of the acids involved. Failure to control external concentration of anions has undoubtedly confounded results, and it has likely led to misleading conclusions regarding the antimicrobial action of organic acids. In summary, we advocate an approach for directing internal anion levels by controlling external concentration of anions and pH because it presents an additional opportunity to study the mechanisms by which organic acids inhibit bacterial growth. Knowledge gained from such studies would have important application in the control of important foodborne pathogens such as Listeria monocytogenes, and may also facilitate efforts to promote the survival in foods or beverages of desirable probiotic bacteria.
NASA Astrophysics Data System (ADS)
Trujillo, W.; Zarria, J.; Pino, J.; Menacho, L.; Coca, M.; Bustamante, A.
2018-03-01
Magnetic iron oxides nanoparticles (NPs) functionalized with lysine (Lys) and arginine (Arg) was obtained by following chemical co-precipitation route in basic medium. The synthesis was performed by mixing ferrous chloride (FeCl2•4H2O), ferric chloride (FeCl3•6H2O) and the specific amino acid in a molar ratio of 1: 2: 0.5, respectively. High pH sample was washed several times with distilled water to reach a pH similar to distilled water (Ph=7) after the synthesis process, part of the NPs obtained was dried. Of the measurements of XRD and MS was obtained that the samples are magnetic nanoparticles of maghemite of about 9 nm in diameter. Of the FTIR and zeta potential measures was obtained that the amino acids Lys and Arg were correctly functionalized at magnetic nanoparticles, referred to herein as M@Lys and M@Arg. In order to demonstrate the capture and adhesion of the nanoparticles to the bacteria, scanning electron microscopy (SEM) was performed. The obtained visualization of both bacteria shows that they are coated by the magnetic particles. In addition, M@Lys (B. sutilis) were cultured to verify the inhibition of growth measured by colony forming units (CFU), the concentrations of M@Lys were 1.75x102 g/mL and 0.875x102 g/mL. After the confrontation obtained efficiencies of 75.63% and 98.75% respectively for the third dilution. While for the fourth dilution were 90% and 98.57% respectively were obtained for each concentration of nanoparticles. Hinting that a high efficiency of bacterial capture at very low concentrations of NPs, which gives us a tool to capture nanobiotechnology bacteria in liquid cultures with application to capture them in wastewater. Based on our results we concluded that NPS functionalized with the amino acids Lys and Arg adhere to the bacteria efficiently in low concentrations.
Goacher, Robyn E; Braham, Erick J; Michienzi, Courtney L; Flick, Robert M; Yakunin, Alexander F; Master, Emma R
2017-12-29
The modification and degradation of lignin play a vital role in carbon cycling as well as production of biofuels and bioproducts. The possibility of using bacterial laccases for the oxidation of lignin offers a route to utilize existing industrial protein expression techniques. However, bacterial laccases are most frequently studied on small model compounds that do not capture the complexity of lignocellulosic materials. This work studied the action of laccases from Bacillus subtilis and Salmonella typhimurium (EC 1.10.3.2) on ground wood samples from yellow birch (Betula alleghaniensis) and red spruce (Picea rubens). The ability of bacterial laccases to modify wood can be facilitated by small molecule mediators. Herein, 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS), gallic acid and sinapic acid mediators were tested. Direct analysis of the wood samples was achieved by time-of-flight secondary ion mass spectrometry (ToF-SIMS), a surface sensitive mass spectrometry technique that has characteristic peaks for H, G and S lignin. The action of the bacterial laccases on both wood samples was demonstrated and revealed a strong mediator influence. The ABTS mediator led to delignification, evident in an overall increase of polysaccharide peaks in the residual solid, along with equal loss of G and S-lignin peaks. The gallic acid mediator demonstrated minimal laccase activity. Meanwhile, the sinapic acid mediator altered the S/G peak ratio consistent with mediator attaching to the wood solids. The current investigation demonstrates the action of bacterial laccase-mediator systems directly on woody materials, and the potential of using ToF-SIMS to uncover the fundamental and applied role of bacterial enzymes in lignocellulose conversion. © 2017 Scandinavian Plant Physiology Society.
Process to Selectively Distinguish Viable from Non-Viable Bacterial Cells
NASA Technical Reports Server (NTRS)
LaDuc, Myron T.; Bernardini, Jame N.; Stam, Christina N.
2010-01-01
The combination of ethidium monoazide (EMA) and post-fragmentation, randomly primed DNA amplification technologies will enhance the analytical capability to discern viable from non-viable bacterial cells in spacecraft-related samples. Intercalating agents have been widely used since the inception of molecular biology to stain and visualize nucleic acids. Only recently, intercalating agents such as EMA have been exploited to selectively distinguish viable from dead bacterial cells. Intercalating dyes can only penetrate the membranes of dead cells. Once through the membrane and actually inside the cell, they intercalate DNA and, upon photolysis with visible light, produce stable DNA monoadducts. Once the DNA is crosslinked, it becomes insoluble and unable to be fragmented for post-fragmentation, randomly primed DNA library formation. Viable organisms DNA remains unaffected by the intercalating agents, allowing for amplification via post-fragmentation, randomly primed technologies. This results in the ability to carry out downstream nucleic acid-based analyses on viable microbes to the exclusion of all non-viable cells.
Adhikari, Dinesh; Jiang, Tianyi; Kawagoe, Taiki; Kai, Takamitsu; Kubota, Kenzo; Araki, Kiwako S; Kubo, Motoki
2017-12-04
Improvement of phosphorus circulation in the soil is necessary to enhance phosphorus availability to plants. Phosphorus circulation activity is an index of soil's ability to supply soluble phosphorus from organic phosphorus in the soil solution. To understand the relationship among phosphorus circulation activity; bacterial biomass; pH; and Fe, Al, and Ca concentrations (described as mineral concentration in this paper) in agricultural soil, 232 soil samples from various agricultural fields were collected and analyzed. A weak relationship between phosphorus circulation activity and bacterial biomass was observed in all soil samples ( R ² = 0.25), and this relationship became significantly stronger at near-neutral pH (6.0-7.3; R ² = 0.67). No relationship between phosphorus circulation activity and bacterial biomass was observed at acidic (pH < 6.0) or alkaline (pH > 7.3) pH. A negative correlation between Fe and Al concentrations and phosphorus circulation activity was observed at acidic pH ( R ² = 0.72 and 0.73, respectively), as well as for Ca at alkaline pH ( R ² = 0.64). Therefore, bacterial biomass, pH, and mineral concentration should be considered together for activation of phosphorus circulation activity in the soil. A relationship model was proposed based on the effects of bacterial biomass and mineral concentration on phosphorus circulation activity. The suitable conditions of bacterial biomass, pH, and mineral concentration for phosphorus circulation activity could be estimated from the relationship model.
QADIS, Abdul Qadir; GOYA, Satoru; IKUTA, Kentaro; YATSU, Minoru; KIMURA, Atsushi; NAKANISHI, Shusuke; SATO, Shigeru
2014-01-01
ABSTRACT Twelve ruminally cannulated Holstein calves (age, 12 ± 3 weeks) were used to identify the effect of a probiotic comprised of Lactobacillus plantarum, Enterococcus faecium and Clostridium butyricum on ruminal components. The calves were adapted to a diet containing a 50% high-concentrate (standard diet) for 1 week, and then, the probiotic was given once daily for 5 days (day 1–5) at 1.5 or 3.0 g/100 kg body weight to groups of four calves each. Four additional calves fed the standard diet without probiotic served as the corresponding control. Ruminal pH was measured continuously throughout the 15-day experimental period. Ruminal fluid was collected via a fistula at a defined time predose and on days 7 and 14 to assess volatile fatty acid (VFA), lactic acid and ammonia-nitrogen concentrations, as well as the bacterial community. The probiotic at either dose improved the reduced 24-hr mean ruminal pH in calves. The circadian patterns of the 1 hr mean ruminal pH were identical between the probiotic doses. In both probiotic groups, ruminal lactic acid concentrations remained significantly lower than that of the control. Probiotic did not affect ruminal VFA concentrations. L. plantarum and C. butyricum were not detected in the rumen of calves given the high-dose probiotic, whereas Enterococcus spp. remained unchanged. These results suggest that calves given a probiotic had stable ruminal pH levels (6.6–6.8), presumably due to the effects of the probiotic on stabilizing rumen-predominant bacteria, which consume greater lactate in the rumen. PMID:24614603
Qadis, Abdul Qadir; Goya, Satoru; Ikuta, Kentaro; Yatsu, Minoru; Kimura, Atsushi; Nakanishi, Shusuke; Sato, Shigeru
2014-06-01
Twelve ruminally cannulated Holstein calves (age, 12 ± 3 weeks) were used to identify the effect of a probiotic comprised of Lactobacillus plantarum, Enterococcus faecium and Clostridium butyricum on ruminal components. The calves were adapted to a diet containing a 50% high-concentrate (standard diet) for 1 week, and then, the probiotic was given once daily for 5 days (day 1-5) at 1.5 or 3.0 g/100 kg body weight to groups of four calves each. Four additional calves fed the standard diet without probiotic served as the corresponding control. Ruminal pH was measured continuously throughout the 15-day experimental period. Ruminal fluid was collected via a fistula at a defined time predose and on days 7 and 14 to assess volatile fatty acid (VFA), lactic acid and ammonia-nitrogen concentrations, as well as the bacterial community. The probiotic at either dose improved the reduced 24-hr mean ruminal pH in calves. The circadian patterns of the 1 hr mean ruminal pH were identical between the probiotic doses. In both probiotic groups, ruminal lactic acid concentrations remained significantly lower than that of the control. Probiotic did not affect ruminal VFA concentrations. L. plantarum and C. butyricum were not detected in the rumen of calves given the high-dose probiotic, whereas Enterococcus spp. remained unchanged. These results suggest that calves given a probiotic had stable ruminal pH levels (6.6-6.8), presumably due to the effects of the probiotic on stabilizing rumen-predominant bacteria, which consume greater lactate in the rumen.
Ramautar, Arianne E; Halse, Tanya A; Arakaki, Lola; Antwi, Mike; Del Rosso, Paula; Dorsinville, Marie; Nazarian, Elizabeth; Steiner-Sichel, Linda; Lee, Lillian; Dickinson, Michelle; Wroblewski, Danielle; Dumas, Nellie; Musser, Kimberlee; Isaac, Beth; Rakeman, Jennifer; Weiss, Don
2015-11-01
Confirmed and probable cases of invasive Neisseria meningitidis (Nm) infection are reportable in New York City. We conducted a study to identify Nm among culture-negative reports of bacterial and viral meningitis. During the study period, 262 reports of suspected meningitis were eligible. Cerebrospinal fluid (CSF) specimens from 138 patients were obtained for testing. No Nm cases were detected. Results from real-time polymerase chain reaction and 16S on CSF specimens were concordant with hospital microbiology findings in 80%; however, other pathogenic organisms were detected in 14 culture-negative specimens. New York City's surveillance system appears to be effective at capturing cases of Nm meningitis. Nucleic acid testing is useful for detecting the presence of bacterial DNA when antibiotic therapy precedes lumbar puncture or bacterial cultures are negative. It remains unanswered whether culture-negative cases of Nm bacteremia are being missed by reportable disease surveillance. Copyright © 2015 Elsevier Inc. All rights reserved.
Determination of Dornic acidity as a method to select donor milk in a milk bank.
Vázquez-Román, Sara; Garcia-Lara, Nadia Raquel; Escuder-Vieco, Diana; Chaves-Sánchez, Fernando; De la Cruz-Bertolo, Javier; Pallas-Alonso, Carmen Rosa
2013-02-01
Dornic acidity may be an indirect measurement of milk's bacteria content and its quality. There are no uniform criteria among different human milk banks on milk acceptance criteria. The main aim of this study is to report the correlation between Dornic acidity and bacterial growth in donor milk in order to validate the Dornic acidity value as an adequate method to select milk prior to its pasteurization. From 105 pools, 4-mL samples of human milk were collected. Dornic acidity measurement and culture in blood and McConkey's agar cultures were performed. Based on Dornic acidity degrees, we classified milk into three quality categories: top quality (acidity <4°D), intermediate (acidity between 4°D and 7°D), and milk unsuitable to be consumed (acidity ≥ 8°D). Spearman's correlation coefficient was used to perform statistical analysis. Seventy percent of the samples had Dornic acidity under 4°D, and 88% had a value under 8°D. A weak positive correlation was observed between the bacterial growth in milk and Dornic acidity. The overall discrimination performance of Dornic acidity was higher for predicting growth of Gram-negative organisms. In milk with Dornic acidity of ≥ 4°D, such a measurement has a sensitivity of 100% for detecting all the samples with bacterial growth with Gram-negative bacteria of over 10(5) colony-forming units/mL. The correlation between Dornic acidity and bacterial growth in donor milk is weak but positive. The measurement of Dornic acidity could be considered as a simple and economical method to select milk to pasteurize in a human milk bank based in quality and safety criteria.
Zhai, Zhengyuan; An, Haoran; Wang, Guohong; Luo, Yunbo; Hao, Yanling
2015-01-01
Lactobacillus delbrueckii subsp. bulgaricus develops acid tolerance response when subjected to acid stress conditions, such as the induction of enzymes associated with carbohydrate metabolism. In this study, pyk gene encoding pyruvate kinase was over-expressed in heterologous host Lactococcus lactis NZ9000, and SDS-PAGE analysis revealed the successful expression of this gene in NZ9000. The survival rate of Pyk-overproducing strain was 45-fold higher than the control under acid stress condition (pH 4.0). In order to determine the transcription factor (TF) which regulates the expression of pyk by bacterial one-hybrid, we constructed a TF library including 65 TFs of L. bulgaricus. Western blotting indicated that TFs in this library could be successfully expressed in host strains. Subsequently, the promoter of pfk-pyk operon in L. bulgaricus was identified by 5′-RACE PCR. The bait plasmid pH3U3-p01 carrying the deletion fragment of pfk-pyk promoter captured catabolite control protein A (CcpA) which could regulate the expression of pyk by binding to a putative catabolite-responsive element (5′-TGTAAGCCCTAACA-3′) upstream the -35 region. Real-time qPCR analysis revealed the transcription of pyk was positively regulated by CcpA. This is the first report about identifying the TF of pyk in L. bulgaricus, which will provide new insight into the regulatory network. PMID:26581248
Human papilloma virus prevalence in laryngeal squamous cell carcinoma.
Gungor, A; Cincik, H; Baloglu, H; Cekin, E; Dogru, S; Dursun, E
2007-08-01
To determine the prevalence and type of human papilloma virus deoxyribonucleic acid (DNA) in cases of laryngeal squamous cell carcinoma. We analysed the prevalence of human papilloma virus infection in archived paraffin block specimens taken from 99 cases of laryngeal squamous cell carcinoma between 1990 and 2005, using polymerase chain reaction techniques. Biopsy specimens from five proven verrucous skin lesions were used as positive controls, and peripheral blood samples from five healthy volunteers were used as negative controls. Four test samples were found to have inadequate deoxyribonucleic acid purity and were therefore excluded from the study. Human papilloma virus deoxyribonucleic acid was detected in seven of 95 cases of laryngeal squamous cell carcinoma (7.36 per cent). Human papilloma virus genotyping revealed double human papilloma virus infection in three cases and single human papilloma virus infection in the remaining four cases. The human papilloma virus genotypes detected were 6, 11 and 16 (the latter detected in only one case). In our series, a very low human papilloma virus prevalence was found among laryngeal squamous cell carcinoma cases. The human papilloma virus genotypes detected were mostly 6 and/or 11, and 16 in only one case. To the best of our knowledge, this is the first report of human papilloma virus prevalence in laryngeal squamous cell carcinoma, based on polymerase chain reaction genotyping in a Turkish population.
Fungal Innate Immunity Induced by Bacterial Microbe-Associated Molecular Patterns (MAMPs)
Ipcho, Simon; Sundelin, Thomas; Erbs, Gitte; Kistler, H. Corby; Newman, Mari-Anne; Olsson, Stefan
2016-01-01
Plants and animals detect bacterial presence through Microbe-Associated Molecular Patterns (MAMPs) which induce an innate immune response. The field of fungal–bacterial interaction at the molecular level is still in its infancy and little is known about MAMPs and their detection by fungi. Exposing Fusarium graminearum to bacterial MAMPs led to increased fungal membrane hyperpolarization, a putative defense response, and a range of transcriptional responses. The fungus reacted with a different transcript profile to each of the three tested MAMPs, although a core set of genes related to energy generation, transport, amino acid production, secondary metabolism, and especially iron uptake were detected for all three. Half of the genes related to iron uptake were predicted MirA type transporters that potentially take up bacterial siderophores. These quick responses can be viewed as a preparation for further interactions with beneficial or pathogenic bacteria, and constitute a fungal innate immune response with similarities to those of plants and animals. PMID:27172188
Dynamic metabolic exchange governs a marine algal-bacterial interaction
Segev, Einat; Wyche, Thomas P; Kim, Ki Hyun; Petersen, Jörn; Ellebrandt, Claire; Vlamakis, Hera; Barteneva, Natasha; Paulson, Joseph N; Chai, Liraz; Clardy, Jon; Kolter, Roberto
2016-01-01
Emiliania huxleyi is a model coccolithophore micro-alga that generates vast blooms in the ocean. Bacteria are not considered among the major factors influencing coccolithophore physiology. Here we show through a laboratory model system that the bacterium Phaeobacter inhibens, a well-studied member of the Roseobacter group, intimately interacts with E. huxleyi. While attached to the algal cell, bacteria initially promote algal growth but ultimately kill their algal host. Both algal growth enhancement and algal death are driven by the bacterially-produced phytohormone indole-3-acetic acid. Bacterial production of indole-3-acetic acid and attachment to algae are significantly increased by tryptophan, which is exuded from the algal cell. Algal death triggered by bacteria involves activation of pathways unique to oxidative stress response and programmed cell death. Our observations suggest that bacteria greatly influence the physiology and metabolism of E. huxleyi. Coccolithophore-bacteria interactions should be further studied in the environment to determine whether they impact micro-algal population dynamics on a global scale. DOI: http://dx.doi.org/10.7554/eLife.17473.001 PMID:27855786
Kim, Man Deok; Song, Minkyung; Jo, Minho; Shin, Seung Gu; Khim, Jee Hyeong; Hwang, Seokhwan
2010-02-01
This paper reports the effects of changing pH (5-7) and temperature (T, 40-60 degrees C) on the efficiencies of bacterial hydrolysis of suspended organic matter (SOM) in wastewater from food waste recycling (FWR) and the changes in the bacterial community responsible for this hydrolysis. Maximum hydrolysis efficiency (i.e., 50.5% reduction of volatile suspended solids) was predicted to occur at pH 5.7 and T = 44.5 degrees C. Changes in short-chain volatile organic acid profiles and in acidogenic bacterial communities were investigated under these conditions. Propionic and butyric acids concentrations increased rapidly during the first 2 days of incubation. Several band sequences consistent with Clostridium spp. were detected using denaturing gel gradient electrophoresis. Clostridium thermopalmarium and Clostridium novyi seemed to contribute to butyric acid production during the first 1.5 days of acidification of FWR wastewater, and C. thermopalmarium was a major butyric acid producer afterward. C. novyi was an important propionic acid producer. These two species appear to be important contributors to hydrolysis of SOM in the wastewater. Other acidogenic anaerobes, Aeromonas sharmana, Bacillus coagulans, and Pseudomonas plecoglossicida, were also indentified.
ASSAY OF POLY-β-HYDROXYBUTYRIC ACID
Law, John H.; Slepecky, Ralph A.
1961-01-01
Law, John H. (Harvard University, Cambridge, Mass.) and Ralph A. Splepecky. Assay of poly-β-hydroxybutyric acid. J. Bacteriol. 82:33–36. 1961—A convenient spectrophotometric assay of bacterial poly-β-hydroxybutyric acid has been devised. Quantitative conversion of poly-β-hydroxybutyric acid to crotonic acid by heating in concentrated sulfuric acid and determination of the ultraviolet absorption of the produce permits an accurate determination of this material in quantities down to 5 μg. This method has been used to follow the production of poly-β-hydroxybutyric acid by Bacillus megaterium strain KM. PMID:13759651
Changes in the rumen bacterial microbiome of cattle exposed to ponderosa pine needles.
Welch, K D; Stonecipher, C A; Gardner, D R; Cook, D; Pfister, J A
2017-05-01
Consumption of ponderosa pine needles, as well as needles and bark from a number of other trees, can cause abortions in cattle. The abortifacient compounds in these trees are labdane resin acids, including isocupressic acid and agathic acid. Previous research has demonstrated that cattle conditioned to pine needles metabolize the labdane resin acids more quickly than naïve cattle. The results from that study indicated that changes had occurred in the rumen of conditioned cattle. Therefore, in this study, the changes that occurred in the rumen bacterial microflora of cattle during exposure to ponderosa pine needles were evaluated. Cattle were dosed with ground pine needles twice daily for 7 d. Rumen samples were collected on d 0, 3, 7, and 14 (7 d after treatment stopped) and ruminal bacterial microbiome analyses were performed. There were 372 different genera of bacteria identified in the rumen samples. Principal coordinate analysis indicated that there was a significant difference in the rumen bacterial composition between the time points. There were 18 genera that increased in abundance from d 0 to d 7. Twenty three genera decreased in abundance from d 0 to d 7. The results from this study demonstrated that exposure of cattle to pine needles caused a clear shift in the rumen microbiome composition. In general, this shift lasted less than 1 wk post exposure, which indicates that any prophylactic treatment to manipulate the ruminal metabolism of the abortifacient compounds in pine needles would need to be continuously administered to maintain the necessary microbial composition in the rumen.
Effect of humic substance photodegradation on bacterial growth and respiration in lake water
Anesio, A.M.; Graneli, W.; Aiken, G.R.; Kieber, D.J.; Mopper, K.
2005-01-01
This study addresses how humic substance (HS) chemical composition and photoreactivity affect bacterial growth, respiration, and growth efficiency (BGE) in lake water. Aqueous solutions of HSs from diverse aquatic environments representing different dissolved organic matter sources (autochthonous and allochthonous) were exposed to artificial solar UV radiation. These solutions were added to lake water passed through a 0.7-??m-pore-size filter (containing grazer-free lake bacteria) followed by dark incubation for 5, 43, and 65 h. For the 5-h incubation, several irradiated HSs inhibited bacterial carbon production (BCP) and this inhibition was highly correlated with H 2O2 photoproduction. The H2O2 decayed in the dark, and after 43 h, nearly all irradiated HSs enhanced BCP (average 39% increase relative to nonirradiated controls, standard error = 7.5%, n = 16). UV exposure of HSs also increased bacterial respiration (by ???18%, standard error = 5%, n = 4), but less than BCP, resulting in an average increase in BGE of 32% (standard error = 10%, n = 4). Photoenhancement of BCP did not correlate to HS bulk properties (i.e., elemental and chemical composition). However, when the photoenhancement of BCP was normalized to absorbance, several trends with HS origin and extraction method emerged. Absorbance-normalized hydrophilic acid and humic acid samples showed greater enhancement of BCP than hydrophobic acid and fulvic acid samples. Furthermore, absorbance-normalized autochthonous samples showed ???10-fold greater enhancement of BCP than allochthonous-dominated samples, indicating that the former are more efficient photoproducers of biological substrates. Copyright ?? 2005, American Society for Microbiology. All Rights Reserved.
Grison, Claire M; Renard, Brice-Loïc; Grison, Claude
2014-02-01
2-Keto-3-deoxy-D-erythro-hexonic acid (KDG) is the key intermediate metabolite of the Entner Doudoroff (ED) pathway. A simple, efficient and stereoselective synthesis of KDG isopropyl ester is described in five steps from 2,3-O-isopropylidene-D-threitol with an overall yield of 47%. KDG isopropyl ester is studied as an attractive marker of a functional Entner Doudoroff pathway. KDG isopropyl ester is used to promote growth of ammonium producing bacterial strains, showing interesting features in the remediation of heavy-metal polluted soils. Copyright © 2013 Elsevier Inc. All rights reserved.
Contribution of Fe3O4 nanoparticles to the fouling of ultrafiltration with coagulation pre-treatment
Yu, Wenzheng; Xu, Lei; Graham, Nigel; Qu, Jiuhui
2015-01-01
A coagulation (FeCl3)-ultrafiltration process was used to treat two different raw waters with/without the presence of Fe3O4 nanoparticle contaminants. The existence of Fe3O4 nanoparticles in the raw water was found to increase both irreversible and reversible membrane fouling. The trans-membrane pressure (TMP) increase was similar in the early stages of the membrane runs for both raw waters, while it increased rapidly after about 15 days in the raw water with Fe3O4 nanoparticles, suggesting the involvement of biological effects. Enhanced microbial activity with the presence of Fe3O4 nanoparticles was evident from the measured concentrations of extracellular polymeric substances (EPS) and deoxyribonucleic acid (DNA), and fluorescence intensities. It is speculated that Fe3O4 nanoparticles accumulated in the cake layer and increased bacterial growth. Associated with the bacterial growth is the production of EPS which enhances the bonding with, and between, the coagulant flocs; EPS together with smaller sizes of the nano-scale primary particles of the Fe3O4-CUF cake layer, led to the formation of a lower porosity, more resilient cake layer and membrane pore blockage. PMID:26268589
Discrimination of Spore-Forming Bacilli Using spoIVA
NASA Technical Reports Server (NTRS)
Venkateswaran, Kasthuri; LaDuc, Myron; Stuecker, Tara
2009-01-01
A method of discriminating between spore-forming and non-spore-forming bacteria is based on a combination of simultaneous sporulation-specific and non-sporulation-specific quantitative polymerase chain reactions (Q-PCRs). The method was invented partly in response to the observation that for the purposes of preventing or reducing biological contamination affecting many human endeavors, ultimately, only the spore-forming portions of bacterial populations are the ones that are problematic (or, at least, more problematic than are the non-spore-forming portions). In some environments, spore-forming bacteria constitute small fractions of the total bacterial populations. The use of sporulation-specific primers in Q-PCR affords the ability to assess the spore-forming fraction of a bacterial population present in an environment of interest. This assessment can provide a more thorough and accurate understanding of the bacterial contamination in the environment, thereby making it possible to focus contamination- testing, contamination-prevention, sterilization, and decontamination resources more economically and efficiently. The method includes the use of sporulation-specific primers in the form of designed, optimized deoxyribonucleic acid (DNA) oligonucleotides specific for the bacterial spoIVA gene (see table). [In "spoIVA," "IV" signifies Roman numeral four and the entire quoted name refers to gene A for the fourth stage of sporulation.] These primers are mixed into a PCR cocktail with a given sample of bacterial cells. A control PCR cocktail into which are mixed universal 16S rRNA primers is also prepared. ["16S rRNA" denotes a ribosomal ribonucleic acid (rRNA) sequence that is common to all organisms.] Following several cycles of heating and cooling according to the PCR protocol to amplify amounts of DNA molecules, the amplification products can be analyzed to determine the types of bacterial cells present within the samples. If the amplification product is strong
Code of Federal Regulations, 2014 CFR
2014-10-01
... segmented configuration and may be positive sense (same polarity as mRNA), negative sense, or ambisense... material. Deoxyribonucleic acid (DNA) or Ribonucleic acid (RNA) comprising the genome or organism's... threat to public health and safety as listed in 42 CFR 73.3 and 73.4. Vector. Any animals (vertebrate or...
Code of Federal Regulations, 2013 CFR
2013-10-01
... segmented configuration and may be positive sense (same polarity as mRNA), negative sense, or ambisense... material. Deoxyribonucleic acid (DNA) or Ribonucleic acid (RNA) comprising the genome or organism's... threat to public health and safety as listed in 42 CFR 73.3 and 73.4. Vector. Any animals (vertebrate or...
Enzyme structures of the bacterial peptidoglycan and wall teichoic acid biogenesis pathways.
Caveney, Nathanael A; Li, Franco Kk; Strynadka, Natalie Cj
2018-06-06
The bacterial cell wall is a complex polymeric structure with essential roles in defence, survival and pathogenesis. Common to both Gram-positive and Gram-negative bacteria is the mesh-like peptidoglycan sacculus that surrounds the outer leaflet of the cytoplasmic membrane. Recent crystallographic studies of enzymes that comprise the peptidoglycan biosynthetic pathway have led to significant new understanding of all stages. These include initial multi-step cytosolic formation of sugar-pentapeptide precursors, transfer of the precursors to activated polyprenyl lipids at the membrane inner leaflet and flippase mediated relocalization of the resulting lipid II precursors to the outer leaflet where glycopolymerization and subsequent peptide crosslinking are finalized. Additional, species-specific enzymes allow customized peptidoglycan modifications and biosynthetic regulation that are important to bacterial virulence and survival. These studies have reinforced the unique and specific catalytic mechanisms at play in cell wall biogenesis and expanded the atomic foundation to develop novel, structure guided, antibacterial agents. Copyright © 2018 Elsevier Ltd. All rights reserved.
2009-01-01
citric acid , or ethanol have been used in field applications, and it may be possible to use mobile forms of emulsified vegetable oil, methyl esters and...70 5.7.5 Results of Volatile Fatty Acids Analysis .................................................................. 77 5.7.6 Results of...gases DNA deoxyribonucleic acid do dissolved oxygen DoD Department of Defense DOE Department of Energy DOT Department of Transportation EISB
Jensen, Heidi D; Struve, Carsten; Christensen, Søren B; Krogfelt, Karen A
2017-01-01
The antibacterial effect of cranberry juice and the organic acids therein on infection by uropathogenic Escherichia coli was studied in an experimental mouse model of urinary tract infection (UTI). Reduced bacterial counts were found in the bladder ( P < 0.01) of mice drinking fresh cranberry juice. Commercially available cranberry juice cocktail also significantly reduced ( P < 0.01) bacterial populations in the bladder, as did the hydrophilic fraction of cranberry juice ( P < 0.05). Quinic, malic, shikimic, and citric acid, the preponderant organic acids in cranberry juice, were tested in combination and individually. The four organic acids also decreased bacterial levels in the bladder when administered together ( P < 0.001), and so did the combination of malic plus citric acid ( P < 0.01) and malic plus quinic acid ( P < 0.05). The other tested combinations of the organic acids, and the acids administered singly, did not have any effect in the UTI model. Apparently, the antibacterial effect of the organic acids from cranberry juice on UTI can be obtained by administering a combination of malic acid and either citric or quinic acid. This study show for the first time that cranberry juice reduce E. coli colonization of the bladder in an experimental mouse model of urinary tract infection and that the organic acids are active agents.
Gill, Bradley C; Shoskes, Daniel A
2016-02-01
The review provides the infectious disease community with a urologic perspective on bacterial prostatitis. Specifically, the article briefly reviews the categorization of prostatitis by type and provides a distillation of new findings published on bacterial prostatitis over the past year. It also highlights key points from the established literature. Cross-sectional prostate imaging is becoming more common and may lead to more incidental diagnoses of acute bacterial prostatitis. As drug resistance remains problematic in this condition, the reemergence of older antibiotics such as fosfomycin, has proven beneficial. With regard to chronic bacterial prostatitis, no clear clinical risk factors emerged in a large epidemiological study. However, bacterial biofilm formation has been associated with more severe cases. Surgery has a limited role in bacterial prostatitis and should be reserved for draining of a prostatic abscess or the removal of infected prostatic stones. Prostatitis remains a common and bothersome clinical condition. Antibiotic therapy remains the basis of treatment for both acute and chronic bacterial prostatitis. Further research into improving prostatitis treatment is indicated.
Evaluation of free-stall mattress bedding treatments to reduce mastitis bacterial growth.
Kristula, M A; Dou, Z; Toth, J D; Smith, B I; Harvey, N; Sabo, M
2008-05-01
Bacterial counts were compared in free-stall mattresses and teat ends exposed to 5 treatments in a factorial study design on 1 dairy farm. Mattresses in five 30-cow groups were subjected to 1 of 5 bedding treatments every other day: 0.5 kg of hydrated limestone, 120 mL of commercial acidic conditioner, 1 kg of coal fly ash, 1 kg of kiln-dried wood shavings, and control (no bedding). Counts of coliforms, Klebsiella spp., Escherichia coli, and Streptococcus spp. were lowest on mattresses bedded with lime. Mattresses bedded with the commercial acidic conditioner had the next lowest counts for coliforms, Klebsiella spp., and Streptococcus spp. Wood shavings and the no-bedding control had the highest counts for coliform and Klebsiella spp. Compared with wood shavings or control, fly ash reduced the counts of coliforms, whereas for the other 3 bacterial groups, the reduction was not always significant. Streptococcus spp. counts were greatest in the control group and did not differ among the shavings and fly ash groups. Teat swab results indicated that hydrated lime was the only bedding treatment that significantly decreased the counts of both coliforms and Klebsiella spp. There were no differences in Streptococcus spp. numbers on the teats between any of the bedding treatments. Bacterial populations grew steadily on mattresses and were generally higher at 36 to 48 h than at 12 to 24 h, whereas bacterial populations on teats grew rapidly by 12 h and then remained constant. Hydrated lime was the only treatment that significantly reduced bacterial counts on both mattresses and teat ends, but it caused some skin irritation.
Evaluation of free-stall mattress bedding treatments to reduce mastitis bacterial growth
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kristula, M.A.; Dou, Z.; Toth, J.D.
2008-05-15
Bacterial counts were compared in free-stall mattresses and teat ends exposed to 5 treatments in a factorial study design on 1 dairy farm. Mattresses in five 30-cow groups were subjected to 1 of 5 bedding treatments every other day: 0.5 kg of hydrated limestone, 120 mL of commercial acidic conditioner, 1 kg of coal fly ash, 1 kg of kiln-dried wood shavings, and control (no bedding). Counts of coliforms, Klebsiella spp., Escherichia coli, and Streptococcus spp. were lowest on mattresses bedded with lime. Mattresses bedded with the commercial acidic conditioner had the next lowest counts for coliforms, Klebsiella spp., andmore » Streptococcus spp. Wood shavings and the no-bedding control had the highest counts for coliform and Klebsiella spp. Compared with wood shavings or control, fly ash reduced the counts of coliforms, whereas for the other 3 bacterial groups, the reduction was not always significant. Streptococcus spp. counts were greatest in the control group and did not differ among the shavings and fly ash groups. Teat swab results indicated that hydrated lime was the only bedding treatment that significantly decreased the counts of both coliforms and Klebsiella spp. There were no differences in Streptococcus spp. numbers on the teats between any of the bedding treatments. Bacterial populations grew steadily on mattresses and were generally higher at 36 to 48 h than at 12 to 24 h, whereas bacterial populations on teats grew rapidly by 12 h and then remained constant. Hydrated lime was the only treatment that significantly reduced bacterial counts on both mattresses and teat ends, but it caused some skin irritation.« less
NASA Technical Reports Server (NTRS)
2004-01-01
Data shows that elevated sialidase in bacterial vaginosis patients correlates to premature births in women. Bacterial sialidase also plays a significant role in the unusual colonization of Pseudomonas aeruginosa in cystic fibrosis patients. Crystals of Salmonella sialidase have been reproduced and are used for studying the inhibitor-enzyme complexes. These inhibitors may also be used to inhibit a trans-sialidase of Trypanosome cruzi, a very similar enzyme to bacterial sialidase, therefore preventing T. cruzi infection, the causitive agent of Chagas' disease. The Center for Macromolecular Crystallography suggests that inhibitors of bacterial sialidases can be used as prophylactic drugs to prevent bacterial infections in these critical cases.
Rosa, Fabio B; Older, Caitlin E; Meason-Smith, Courtney; Suchodolski, Jan S; Lingsweiler, Sonia; Mansell, Joanne E; Hoffmann, Aline Rodrigues
2018-01-01
Next generation sequencing (NGS) studies are revealing a diverse microbiota on the skin of dogs. The skin microbiota of canine sterile granulomatous and pyogranulomatous dermatitis (SGPD) has yet to be investigated using NGS techniques. NGS targeting the 16S rRNA and ITS-1 region of bacterial and fungal DNA, respectively, were used to investigate if bacterial and fungal DNA were associated with skin lesions in cases of canine SGPD. The study included 20 formalin-fixed paraffin-embedded (FFPE) skin samples and 12 fresh samples from SGPD-affected dogs, and 10 FFPE and 10 fresh samples from healthy dogs. DNA was extracted from deep dermis and panniculus, and microbial DNA was amplified using primers targeting the bacterial 16S rRNA V1-V3 and fungal ITS-1 regions. The amplified DNA was utilized for NGS on an Illumina MiSeq instrument. The sequences were processed using QIIME. No differences in fungal or bacterial alpha diversity were observed between the SGPD and control samples. Beta diversity analysis demonstrated differences in the bacterial communities between SGPD and control, but not in the fungal communities. Compared to controls, the family Erysipelotrichaceae and genus Staphylococcus were significantly more abundant in the SGPD FFPE samples, and genus Corynebacterium were more abundant in fresh samples. The bacteria found to be more abundant in SGPD are common inhabitants of skin surfaces, and likely secondary contaminants in SGPD cases. This study provides additional evidence that SGPD lesions are likely sterile.
Wang, Chao-Min; Jhan, Yun-Lian; Tsai, Shang-Jie; Chou, Chang-Hung
2016-07-07
(1) BACKGROUND: Several triterpenoids were found to act synergistically with classes of antibiotic, indicating that plant-derived chemicals have potential to be used as therapeutics to enhance the activity of antibiotics against multidrug-resistant pathogens. However, the mode of action of triterpenoids against bacterial pathogens remains unclear. The objective of this study is to evaluate the interaction between ursolic acid against methicillin-resistant Staphylococcus aureus (MRSA); (2) METHODS: The ability of ursolic acid to damage mammalian and bacterial membranes was examined. The proteomic response of methicillin-resistant S. aureus in ursolic acid treatment was investigated using two-dimensional (2D) proteomic analysis; (3) RESULTS: Ursolic acid caused the loss of staphylococcal membrane integrity without hemolytic activity. The comparison of the protein pattern of ursolic acid-treated and normal MRSA cells revealed that ursolic acid affected a variety of proteins involved in the translation process with translational accuracy, ribonuclease and chaperon subunits, glycolysis and oxidative responses; (4) CONCLUSION: The mode of action of ursolic acid appears to be the influence on the integrity of the bacterial membrane initially, followed by inhibition of protein synthesis and the metabolic pathway. These findings reflect that the pleiotropic effects of ursolic acid against MRSA make it a promising antibacterial agent in pharmaceutical research.
N-METHYL GROUPS IN BACTERIAL LIPIDS
Goldfine, Howard; Ellis, Martha E.
1964-01-01
Goldfine, Howard (Harvard Medical School, Boston, Mass.), and Martha E. Ellis. N-methyl groups in bacterial lipids. J. Bacteriol. 87:8–15. 1964.—The ability of bacteria to synthesize lecithin was examined by measuring the incorporation of the methyl group of methionine into the water-soluble moieties obtained on acid hydrolysis of bacterial lipids. Of 21 species examined, mostly of the order Eubacteriales, only 2, Agrobacterium radiobacter and A. rhizogenes, incorporated the methyl group of methionine into lipid-bound choline. Evidence was also obtained for the formation of lipid-bound N-methylethanolamine and N,N′-dimethylethanolamine in these two organisms. Two other species, Clostridium butyricum and Proteus vulgaris, incorporated the methyl group of methionine into lipid-bound N-methylethanolamine, but did not appear to be able to further methylate these lipids to form lecithin. The results of this study lend further strength to the generalization that bacteria, with the exception of the genus Agrobacterium, are unable to synthesize lecithin. PMID:14102879
Chiaraviglio, Lucius; Kang, Yoon-Suk; Kirby, James E.
2016-01-01
Traditional measures of intracellular antimicrobial activity and eukaryotic cell cytotoxicity rely on endpoint assays. Such endpoint assays require several additional experimental steps prior to readout, such as cell lysis, colony forming unit determination, or reagent addition. When performing thousands of assays, for example, during high-throughput screening, the downstream effort required for these types of assays is considerable. Therefore, to facilitate high-throughput antimicrobial discovery, we developed a real-time assay to simultaneously identify inhibitors of intracellular bacterial growth and assess eukaryotic cell cytotoxicity. Specifically, real-time intracellular bacterial growth detection was enabled by marking bacterial screening strains with either a bacterial lux operon (1st generation assay) or fluorescent protein reporters (2nd generation, orthogonal assay). A non-toxic, cell membrane-impermeant, nucleic acid-binding dye was also added during initial infection of macrophages. These dyes are excluded from viable cells. However, non-viable host cells lose membrane integrity permitting entry and fluorescent labeling of nuclear DNA (deoxyribonucleic acid). Notably, DNA binding is associated with a large increase in fluorescent quantum yield that provides a solution-based readout of host cell death. We have used this combined assay to perform a high-throughput screen in microplate format, and to assess intracellular growth and cytotoxicity by microscopy. Notably, antimicrobials may demonstrate synergy in which the combined effect of two or more antimicrobials when applied together is greater than when applied separately. Testing for in vitro synergy against intracellular pathogens is normally a prodigious task as combinatorial permutations of antibiotics at different concentrations must be assessed. However, we found that our real-time assay combined with automated, digital dispensing technology permitted facile synergy testing. Using these
Uric acid disrupts hypochlorous acid production and the bactericidal activity of HL-60 cells.
Carvalho, Larissa A C; Lopes, João P P B; Kaihami, Gilberto H; Silva, Railmara P; Bruni-Cardoso, Alexandre; Baldini, Regina L; Meotti, Flavia C
2018-06-01
Uric acid is the end product of purine metabolism in humans and is an alternative physiological substrate for myeloperoxidase. Oxidation of uric acid by this enzyme generates uric acid free radical and urate hydroperoxide, a strong oxidant and potentially bactericide agent. In this study, we investigated whether the oxidation of uric acid and production of urate hydroperoxide would affect the killing activity of HL-60 cells differentiated into neutrophil-like cells (dHL-60) against a highly virulent strain (PA14) of the opportunistic pathogen Pseudomonas aeruginosa. While bacterial cell counts decrease due to dHL-60 killing, incubation with uric acid inhibits this activity, also decreasing the release of the inflammatory cytokines interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF- α). In a myeloperoxidase/Cl - /H 2 O 2 cell-free system, uric acid inhibited the production of HOCl and bacterial killing. Fluorescence microscopy showed that uric acid also decreased the levels of HOCl produced by dHL-60 cells, while significantly increased superoxide production. Uric acid did not alter the overall oxidative status of dHL-60 cells as measured by the ratio of reduced (GSH) and oxidized (GSSG) glutathione. Our data show that uric acid impairs the killing activity of dHL-60 cells likely by competing with chloride by myeloperoxidase catalysis, decreasing HOCl production. Despite diminishing HOCl, uric acid probably stimulates the formation of other oxidants, maintaining the overall oxidative status of the cells. Altogether, our results demonstrated that HOCl is, indeed, the main relevant oxidant against bacteria and deviation of myeloperoxidase activity to produce other oxidants hampers dHL-60 killing activity. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Determination of Dornic Acidity as a Method to Select Donor Milk in a Milk Bank
Garcia-Lara, Nadia Raquel; Escuder-Vieco, Diana; Chaves-Sánchez, Fernando; De la Cruz-Bertolo, Javier; Pallas-Alonso, Carmen Rosa
2013-01-01
Abstract Background Dornic acidity may be an indirect measurement of milk's bacteria content and its quality. There are no uniform criteria among different human milk banks on milk acceptance criteria. The main aim of this study is to report the correlation between Dornic acidity and bacterial growth in donor milk in order to validate the Dornic acidity value as an adequate method to select milk prior to its pasteurization. Materials and Methods From 105 pools, 4-mL samples of human milk were collected. Dornic acidity measurement and culture in blood and McConkey's agar cultures were performed. Based on Dornic acidity degrees, we classified milk into three quality categories: top quality (acidity <4°D), intermediate (acidity between 4°D and 7°D), and milk unsuitable to be consumed (acidity ≥8°D). Spearman's correlation coefficient was used to perform statistical analysis. Results Seventy percent of the samples had Dornic acidity under 4°D, and 88% had a value under 8°D. A weak positive correlation was observed between the bacterial growth in milk and Dornic acidity. The overall discrimination performance of Dornic acidity was higher for predicting growth of Gram-negative organisms. In milk with Dornic acidity of ≥4°D, such a measurement has a sensitivity of 100% for detecting all the samples with bacterial growth with Gram-negative bacteria of over 105 colony-forming units/mL. Conclusions The correlation between Dornic acidity and bacterial growth in donor milk is weak but positive. The measurement of Dornic acidity could be considered as a simple and economical method to select milk to pasteurize in a human milk bank based in quality and safety criteria. PMID:23373435
Bacterial Succession in the Broiler Gastrointestinal Tract
Lawley, Blair; Tannock, Gerald; Engberg, Ricarda M.
2016-01-01
A feeding trial was performed with broilers receiving a diet of wheat-based feed (WBF), maize-based feed (MBF), or maize-based concentrates supplemented with 15% or 30% crimped kernel maize silage (CKMS-15 or CKMS-30, respectively). The aim of the study was to investigate the bacterial community compositions of the crop, gizzard, ileum, and cecum contents in relation to the feeding strategy and age (8, 15, 22, 25, 29, or 36 days). Among the four dietary treatments, bacterial diversity was analyzed for MBF and CKMS-30 by 454 pyrosequencing of the 16S rRNA gene. Since the diets had no significant influence on bacterial diversity, data were pooled for downstream analysis. With increasing age, a clear succession of bacterial communities and increased bacterial diversity were observed. Lactobacillaceae (belonging mainly to the genus Lactobacillus) represented most of the Firmicutes at all ages and in all segments of the gut except the cecum. The development of a “mature” microbiota in broilers occurred during the period from days 15 to 22. Striking increases in the relative abundances of Lactobacillus salivarius (17 to 36%) and clostridia (11 to 18%), and a concomitant decrease in the relative abundance of Lactobacillus reuteri, were found in the ileum after day 15. The concentration of deconjugated bile salts increased in association with the increased populations of L. salivarius and clostridia. Both L. salivarius and clostridia deconjugate bile acids, and increases in the abundances of these bacteria might be associated with growth reduction and gastrointestinal (GI) disorders occurring in the critical period of broiler life between days 20 and 30. PMID:26873323
Costerousse, Benjamin; Schönholzer-Mauclaire, Laurie; Frossard, Emmanuel; Thonar, Cécile
2018-01-01
Soil and plant inoculation with heterotrophic zinc-solubilizing bacteria (ZSB) is considered a promising approach for increasing zinc (Zn) phytoavailability and enhancing crop growth and nutritional quality. Nevertheless, it is necessary to understand the underlying bacterial solubilization processes to predict their repeatability in inoculation strategies. Acidification via gluconic acid production remains the most reported process. In this study, wheat rhizosphere soil serial dilutions were plated on several solid microbiological media supplemented with scarcely soluble Zn oxide (ZnO), and 115 putative Zn-solubilizing isolates were directly detected based on the formation of solubilization halos around the colonies. Eight strains were selected based on their Zn solubilization efficiency and siderophore production capacity. These included one strain of Curtobacterium , two of Plantibacter , three strains of Pseudomonas , one of Stenotrophomonas , and one strain of Streptomyces In ZnO liquid solubilization assays, the presence of glucose clearly stimulated organic acid production, leading to medium acidification and ZnO solubilization. While solubilization by Streptomyces and Curtobacterium was attributed to the accumulated production of six and seven different organic acids, respectively, the other strains solubilized Zn via gluconic, malonic, and oxalic acids exclusively. In contrast, in the absence of glucose, ZnO dissolution resulted from proton extrusion (e.g., via ammonia consumption by Plantibacter strains) and complexation processes (i.e., complexation with glutamic acid in cultures of Curtobacterium ). Therefore, while gluconic acid production was described as a major Zn solubilization mechanism in the literature, this study goes beyond and shows that solubilization mechanisms vary among ZSB and are strongly affected by growth conditions. IMPORTANCE Barriers toward a better understanding of the mechanisms underlying zinc (Zn) solubilization by bacteria
Yao, Yongpeng; Li, Shanshan; Cao, Jiaqian; Liu, Weiwei; Fan, Keqiang; Xiang, Wensheng; Yang, Keqian; Kong, Deming; Wang, Weishan
2018-05-08
Here, we demonstrate an easy-to-implement and general biosensing strategy by coupling the small-molecule recognition of the bacterial allosteric transcription factor (aTF) with isothermal strand displacement amplification (SDA) in vitro. Based on this strategy, we developed two biosensors for the detection of an antiseptic, p-hydroxybenzoic acid, and a disease marker, uric acid, using bacterial aTF HosA and HucR, respectively, highlighting the great potential of this strategy for the development of small-molecule biosensors.
Duodenal bacterial overgrowth during treatment in outpatients with omeprazole.
Fried, M; Siegrist, H; Frei, R; Froehlich, F; Duroux, P; Thorens, J; Blum, A; Bille, J; Gonvers, J J; Gyr, K
1994-01-01
The extent of duodenal bacterial overgrowth during the pronounced inhibition of acid secretion that occurs with omeprazole treatment is unknown. The bacterial content of duodenal juice of patients treated with omeprazole was therefore examined in a controlled prospective study. Duodenal juice was obtained under sterile conditions during diagnostic upper endoscopy. Aspirates were plated quantitatively for anaerobic and aerobic organisms. Twenty five outpatients with peptic ulcer disease were investigated after a 5.7 (0.5) weeks (mean (SEM)) treatment course with 20 mg (nine patients) or 40 mg (16 patients). The control group consisted of 15 outpatients referred for diagnostic endoscopy without prior antisecretory treatment. No patient in the control group had duodenal bacterial overgrowth. In the omeprazole group bacterial overgrowth (> or = 10(5) cfu/ml) was found in 14 (56%) patients (p = 0.0003). The number of bacteria (log10) in duodenal juice in patients treated with omeprazole was distinctly higher (median 5.7; range < 2-8.7) when compared with the control group (median < 2; range < 2-5.0; p = 0.0004). As well as orally derived bacteria, faecal type bacteria were found in seven of 14 and anaerobic bacteria in three of 14 patients. Bacterial overgrowth was similar with the two doses of omeprazole. These results indicate that duodenal bacterial overgrowth of both oral and faecal type bacteria occurs often in ambulatory patients treated with omeprazole. Further studies are needed to determine the clinical significance of these findings, particularly in high risk groups during long term treatment with omeprazole. PMID:8307444
The fluorimetric microdetermination of glyoxylic acid in blood, urine and bacterial extracts
Zarembski, P. M.; Hodgkinson, A.
1965-01-01
1. A spectrophotofluorimetric method for the determination of glyoxylic acid in biological materials is described. 2. The method is based on the reaction between glyoxylic acid and resorcinol in acid solution, a fluorescent complex being obtained on the subsequent addition of alkali. 3. The reaction was found to be sensitive and highly specific, the minimum detectable amount of glyoxylic acid being 1·35×10−8 mole. 4. The urinary excretion of glyoxylic acid by ten normal adults ranged from 1·4 to 4·7mg./24hr. Small but measurable amounts of glyoxylic acid were found in cell-free extracts of Pseudomonas oxalaticus OX1 grown on oxalic acid as a source of carbon. No glyoxylic acid was detected in human serum. PMID:14343135
Uhlik, Ondrej; Musilova, Lucie; Ridl, Jakub; Hroudova, Miluse; Vlcek, Cestmir; Koubek, Jiri; Holeckova, Marcela; Mackova, Martina; Macek, Tomas
2013-10-01
The aim of the study was to investigate how selected natural compounds (naringin, caffeic acid, and limonene) induce shifts in both bacterial community structure and degradative activity in long-term polychlorinated biphenyl (PCB)-contaminated soil and how these changes correlate with changes in chlorobiphenyl degradation capacity. In order to address this issue, we have integrated analytical methods of determining PCB degradation with pyrosequencing of 16S rRNA gene tag-encoded amplicons and DNA-stable isotope probing (SIP). Our model system was set in laboratory microcosms with PCB-contaminated soil, which was enriched for 8 weeks with the suspensions of flavonoid naringin, terpene limonene, and phenolic caffeic acid. Our results show that application of selected plant secondary metabolites resulted in bacterial community structure far different from the control one (no natural compound amendment). The community in soil treated with caffeic acid is almost solely represented by Proteobacteria, Acidobacteria, and Verrucomicrobia (together over 99 %). Treatment with naringin resulted in an enrichment of Firmicutes to the exclusion of Acidobacteria and Verrucomicrobia. SIP was applied in order to identify populations actively participating in 4-chlorobiphenyl catabolism. We observed that naringin and limonene in soil foster mainly populations of Hydrogenophaga spp., caffeic acid Burkholderia spp. and Pseudoxanthomonas spp. None of these populations were detected among 4-chlorobiphenyl utilizers in non-amended soil. Similarly, the degradation of individual PCB congeners was influenced by the addition of different plant compounds. Residual content of PCBs was lowest after treating the soil with naringin. Addition of caffeic acid resulted in comparable decrease of total PCBs with non-amended soil; however, higher substituted congeners were more degraded after caffeic acid treatment compared to all other treatments. Finally, it appears that plant secondary metabolites
Impact of humic acids on the colonic microbiome in healthy volunteers.
Swidsinski, Alexander; Dörffel, Yvonne; Loening-Baucke, Vera; Gille, Christoph; Reißhauer, Anne; Göktas, Onder; Krüger, Monika; Neuhaus, Jürgen; Schrödl, Wieland
2017-02-07
To test the effects of humic acids on innate microbial communities of the colon. We followed the effects of oral supplementation with humic acids (Activomin ® ) on concentrations and composition of colonic microbiome in 14 healthy volunteers for 45 d. 3 × 800 mg Activomin ® were taken orally for 10 d followed by 3 × 400 mg for 35 d. Colonic microbiota were investigated using multicolor fluorescence in situ hybridization (FISH) of Carnoy fixated and paraffin embedded stool cylinders. Two stool samples were collected a week prior to therapy and one stool sample on days 10, 31 and 45. Forty-one FISH probes representing different bacterial groups were used. The sum concentration of colonic microbiota increased from 20% at day 10 to 30% by day 31 and remained stable until day 45 (32%) of humic acid supplementation ( P < 0.001). The increase in the concentrations in each person was due to growth of preexisting groups. The individual microbial profile of the patients remained unchanged. Similarly, the bacterial diversity remained stable. Concentrations of 24 of the 35 substantial groups increased from 20% to 96%. Two bacterial groups detected with Bac303 ( Bacteroides ) and Myc657 (mycolic acid-containing Actinomycetes ) FISH probes decreased ( P > 0.05). The others remained unaffected. Bacterial groups with initially marginal concentrations (< 0.1 × 10 9 /mL) demonstrated no response to humic acids. The concentrations of pioneer groups of Bifidobacteriaceae , Enterobacteriaceae and Clostridium difficile increased but the observed differences were statistically not significant. Humic acids have a profound effect on healthy colonic microbiome and may be potentially interesting substances for the development of drugs that control the innate colonic microbiome.
Rasmussen, Mary L; Koziel, Jacek A; Jane, Jay-lin; Pometto, Anthony L
2015-06-03
Ozonation of uncooked corn mash from the POET BPX process was investigated as a potential disinfection method for reducing bacterial contamination prior to ethanol fermentation. Corn mash (200 g) was prepared from POET ground corn and POET corn slurry and was ozonated in 250 mL polypropylene bottles. Lactic and acetic acid levels were monitored daily during the fermentation of ozonated, aerated, and nontreated corn mash samples to evaluate bacterial activity. Glycerol and ethanol contents of fermentation samples were checked daily to assess yeast activity. No yeast supplementation, no addition of other antimicrobial agents (such as antibiotics), and spiking with a common lactic acid bacterium found in corn ethanol plants, Lactobacillus plantarum, amplified the treatment effects. The laboratory-scale ozone dosages ranged from 26-188 mg/L, with very low estimated costs of $0.0008-0.006/gal ($0.21-1.6/m(3)) of ethanol. Ozonation was found to decrease the initial pH of ground corn mash samples, which could reduce the sulfuric acid required to adjust the pH prior to ethanol fermentation. Lactic and acetic acid levels tended to be lower for samples subjected to increasing ozone dosages, indicating less bacterial activity. The lower ozone dosages in the range applied achieved higher ethanol yields. Preliminary experiments on ozonating POET corn slurry at low ozone dosages were not as effective as using POET ground corn, possibly because corn slurry samples contained recycled antimicrobials from the backset. The data suggest additional dissolved and suspended organic materials from the backset consumed the ozone or shielded the bacteria.
Billen, Daniel; Bruns, Laura
1970-01-01
Prestarvation of Escherichia coli for required amino acids results in a marked enhancement in both ultraviolet light (UV) or X-ray resistance for selective strains. Preventing protein synthesis by starvation for required amino acids results in completion of the cycle of chromosomal replication then underway. We have investigated the relationship between starvation-induced resistance enhancement (SIRE) and the excision-repair (Hcr) system in several E. coli strains including E. coli B/r hcr+ and its isogenic mutant E. coli B/r hcr−. The following observations were made. (i) The Hcr system is the major component of SIRE in UV-irradiated strain B/r. By using the Hcr+ strain, SIRE increases the 10% survival dose from ∼400 ergs to ∼1,200 ergs/mm2. With the Hcr cells, the increase is from ∼45 ergs to 60 ergs/mm2. (ii) Although prestarvation leads to a moderate enhancement of resistance to X irradiation, this effect is not dependent on the Hcr system. (iii) The double mutant, E. coli Bs–1 (hcr−exr−) is completely unable to express SIRE whether studied with UV or X irradiation. It is concluded that the Hcr system is the major system responsible for SIRE in UV-treated cells, whereas Exr (resistance to X rays) may be involved to a minor extent. The Exr character appears to be required for SIRE expression in X-ray exposed cells. PMID:4914566
NASA Astrophysics Data System (ADS)
Veuger, Bart; van Oevelen, Dick; Middelburg, Jack J.
2012-04-01
The fate of microbial carbon, nitrogen, hydrolysable amino acids (HAAs), monosaccharides, and fatty acids in sediment was investigated experimentally. The microbial community of a tidal flat sediment was labeled with 13C-enriched glucose and 15N-enriched ammonium, and sediment was incubated for up to 371 days. Analysis of total concentrations and 13C- and 15N content of bulk sediment, hydrolysable amino acids (including D-alanine), monosaccharides, total fatty acids (TFAs), and phospholipid-derived fatty acids (PLFAs) allowed us to trace the fate of microbial biomass and -detritus and the major biochemical groups therein (proteins, carbohydrates, and lipids) over intermediate time scales (weeks-months). Moreover, the unidentified fraction of the labeled material (i.e. not analyzed as HAA, FA, or carbohydrate) provided information on the formation and fate of molecularly uncharacterizable organic matter. Loss of 13C and 15N from the sediment was slow (half live of 433 days) which may have been due to the permanently anoxic conditions in the experiment. Loss rates for the different biochemical groups were also low with the following order of loss rate constants: PLFA > TFA > HAA > monosaccharides. The unidentified 13C-pool was rapidly formed (within days) and then decreased relatively slowly, resulting in a gradual relative accumulation of this pool over time. Degradation and microbial reworking of the labeled material resulted in subtle, yet consistent, diagenetic changes within the different biochemical groups. In the HAA pool, glycine, lysine, and proline were lost relatively slowly (i.e. best preserved) while there was no accumulation of D-alanine relative to L-alanine, indicating no relative accumulation of bacterial macromolecules rich in D-alanine. In the fatty acid pool, there was very little difference between PLFAs and TFAs, indicating a very similar lability of these pools. Differences between individual fatty acids included a relatively slow loss of i15
Park, Doo Hyun
2018-04-24
Bacterial communities and metabolites in kimchi fermented under conventional conditions (CC) compared to CO 2 -rich environments (CO 2 ) were analyzed. After a 20-day fermentation, lactic and acetic acid productions were 54 and 69 mM under CC, and 19 and 12 mM under CO 2 , respectively. The final pH of kimchi fermented under CC (CC-fermenting) and CO 2 (CO 2 -fermenting) were 4.1 and 4.7, respectively. For bacterial communities, OTU and Chao1 indices were both 35 in fresh kimchi, 10 and 15 in CC-fermenting kimchi, and 8 and 24 in CO 2 -fermenting kimchi, respectively. Shannon and Simpson indices were 3.47 and 0.93 in fresh kimchi, 1.87-0.06 and 0.46-0.01 in CC-fermenting kimchi, and 1.65-0.44 and 0.63-0.12 in CO 2 -fermenting kimchi, respectively. Non-lactic acid bacteria were eliminated in fermenting kimchi after 12 days under CC and 6 days under CO 2 . I conclude that carbon dioxide can alter bacterial communities, reduce metabolite production, and improve fermented kimchi quality.
Huang, Mei-Yun; Zha, Qing-Bing; Zhao, Gao-Xiang; Hou, Xiao-Feng; Shi, Zi-Jian; Lin, Qiu-Ru; Ouyang, Dong-Yun; He, Xian-Hui
2015-01-01
Pepper, a daily-used seasoning for promoting appetite, is widely used in folk medicine for treating gastrointestinal diseases. Piperine is the major alkaloid in pepper and possesses a wide range of pharmacological activities. However, the mechanism for linking metabolic and medicinal activities of piperine remains unknown. Here we report that piperine robustly boosts mTORC1 activity by recruiting more system L1 amino acid transporter (SLC7A5/SLC3A2) to the cell membrane, thus promoting amino acid metabolism. Piperine-induced increase of mTORC1 activity in resident peritoneal macrophages (pMΦs) is correlated with enhanced production of IL-6 and TNF-α upon LPS stimulation. Such an enhancement of cytokine production could be abrogated by inhibitors of the mTOR signaling pathway, indicating mTOR's action in this process. Moreover, piperine treatment protected resident pMΦs from bacterium-induced apoptosis and disappearance, and increased their bacterial phagocytic ability. Consequently, piperine administration conferred mice resistance against bacterial infection and even sepsis. Our data highlight that piperine has the capacity to metabolically reprogram peritoneal resident macrophages to fortify their innate functions against bacterial infection. PMID:26439699
Onysko, Steven J.; Kleinmann, Robert L. P.; Erickson, Patricia M.
1984-01-01
Benzoic acid, sorbic acid, and sodium lauryl sulfate at low concentrations (5 to 10 mg/liter) each effectively inhibited bacterial oxidation of ferrous iron in batch cultures of Thiobacillus ferrooxidans. The rate of chemical oxidation of ferrous iron in low-pH, sterile batch reactors was not substantially affected at the tested concentrations (5 to 50 mg/liter) of any of the compounds. PMID:16346592
Wood Ash Induced pH Changes Strongly Affect Soil Bacterial Numbers and Community Composition
Bang-Andreasen, Toke; Nielsen, Jeppe T.; Voriskova, Jana; Heise, Janine; Rønn, Regin; Kjøller, Rasmus; Hansen, Hans C. B.; Jacobsen, Carsten S.
2017-01-01
Recirculation of wood ash from energy production to forest soil improves the sustainability of this energy production form as recycled wood ash contains nutrients that otherwise would be lost at harvest. In addition, wood-ash is beneficial to many soils due to its inherent acid-neutralizing capabilities. However, wood ash has several ecosystem-perturbing effects like increased soil pH and pore water electrical conductivity both known to strongly impact soil bacterial numbers and community composition. Studies investigating soil bacterial community responses to wood ash application remain sparse and the available results are ambiguous and remain at a general taxonomic level. Here we investigate the response of bacterial communities in a spruce forest soil to wood ash addition corresponding to 0, 5, 22, and 167 t wood ash ha-1. We used culture-based enumerations of general bacteria, Pseudomonas and sporeforming bacteria combined with 16S rRNA gene amplicon sequencing to valuate soil bacterial responses to wood ash application. Results showed that wood ash addition strongly increased soil pH and electrical conductivity. Soil pH increased from acidic through neutral at 22 t ha-1 to alkaline at 167 t ha-1. Bacterial numbers significantly increased up to a wood ash dose of 22 t ha-1 followed by significant decrease at 167 t ha-1 wood ash. The soil bacterial community composition changed after wood ash application with copiotrophic bacteria responding positively up to a wood ash dose of 22 t ha-1 while the adverse effect was seen for oligotrophic bacteria. Marked changes in bacterial community composition occurred at a wood ash dose of 167 t ha-1 with a single alkaliphilic genus dominating. Additionally, spore-formers became abundant at an ash dose of 167 t ha-1 whereas this was not the case at lower ash doses. Lastly, bacterial richness and diversity strongly decreased with increasing amount of wood ash applied. All of the observed bacterial responses can be directly
Wood Ash Induced pH Changes Strongly Affect Soil Bacterial Numbers and Community Composition.
Bang-Andreasen, Toke; Nielsen, Jeppe T; Voriskova, Jana; Heise, Janine; Rønn, Regin; Kjøller, Rasmus; Hansen, Hans C B; Jacobsen, Carsten S
2017-01-01
Recirculation of wood ash from energy production to forest soil improves the sustainability of this energy production form as recycled wood ash contains nutrients that otherwise would be lost at harvest. In addition, wood-ash is beneficial to many soils due to its inherent acid-neutralizing capabilities. However, wood ash has several ecosystem-perturbing effects like increased soil pH and pore water electrical conductivity both known to strongly impact soil bacterial numbers and community composition. Studies investigating soil bacterial community responses to wood ash application remain sparse and the available results are ambiguous and remain at a general taxonomic level. Here we investigate the response of bacterial communities in a spruce forest soil to wood ash addition corresponding to 0, 5, 22, and 167 t wood ash ha -1 . We used culture-based enumerations of general bacteria, Pseudomonas and sporeforming bacteria combined with 16S rRNA gene amplicon sequencing to valuate soil bacterial responses to wood ash application. Results showed that wood ash addition strongly increased soil pH and electrical conductivity. Soil pH increased from acidic through neutral at 22 t ha -1 to alkaline at 167 t ha -1 . Bacterial numbers significantly increased up to a wood ash dose of 22 t ha -1 followed by significant decrease at 167 t ha -1 wood ash. The soil bacterial community composition changed after wood ash application with copiotrophic bacteria responding positively up to a wood ash dose of 22 t ha -1 while the adverse effect was seen for oligotrophic bacteria. Marked changes in bacterial community composition occurred at a wood ash dose of 167 t ha -1 with a single alkaliphilic genus dominating. Additionally, spore-formers became abundant at an ash dose of 167 t ha -1 whereas this was not the case at lower ash doses. Lastly, bacterial richness and diversity strongly decreased with increasing amount of wood ash applied. All of the observed bacterial responses can be
Jensen, Heidi D.; Struve, Carsten; Christensen, Søren B.; Krogfelt, Karen A.
2017-01-01
The antibacterial effect of cranberry juice and the organic acids therein on infection by uropathogenic Escherichia coli was studied in an experimental mouse model of urinary tract infection (UTI). Reduced bacterial counts were found in the bladder (P < 0.01) of mice drinking fresh cranberry juice. Commercially available cranberry juice cocktail also significantly reduced (P < 0.01) bacterial populations in the bladder, as did the hydrophilic fraction of cranberry juice (P < 0.05). Quinic, malic, shikimic, and citric acid, the preponderant organic acids in cranberry juice, were tested in combination and individually. The four organic acids also decreased bacterial levels in the bladder when administered together (P < 0.001), and so did the combination of malic plus citric acid (P < 0.01) and malic plus quinic acid (P < 0.05). The other tested combinations of the organic acids, and the acids administered singly, did not have any effect in the UTI model. Apparently, the antibacterial effect of the organic acids from cranberry juice on UTI can be obtained by administering a combination of malic acid and either citric or quinic acid. This study show for the first time that cranberry juice reduce E. coli colonization of the bladder in an experimental mouse model of urinary tract infection and that the organic acids are active agents. PMID:28421045
Biodiversity of Bacterial Ecosystems in Traditional Egyptian Domiati Cheese▿
El-Baradei, Gaber; Delacroix-Buchet, Agnès; Ogier, Jean-Claude
2007-01-01
Bacterial biodiversity occurring in traditional Egyptian soft Domiati cheese was studied by PCR-temporal temperature gel electrophoresis (TTGE) and PCR-denaturing gradient gel electrophoresis (DGGE). Bands were identified using a reference species database (J.-C. Ogier et al., Appl. Environ. Microbiol. 70:5628-5643, 2004); de novo bands having nonidentified migration patterns were identified by DNA sequencing. Results reveal a novel bacterial profile and extensive bacterial biodiversity in Domiati cheeses, as reflected by the numerous bands present in TTGE and DGGE patterns. The dominant lactic acid bacteria (LAB) identified were as follows: Leuconostoc mesenteroides, Lactococcus garvieae, Aerococcus viridans, Lactobacillus versmoldensis, Pediococcus inopinatus, and Lactococcus lactis. Frequent non-LAB species included numerous coagulase-negative staphylococci, Vibrio spp., Kocuria rhizophila, Kocuria kristinae, Kocuria halotolerans, Arthrobacter spp./Brachybacterium tyrofermentans. This is the first time that the majority of these species has been identified in Domiati cheese. Nearly all the dominant and frequent bacterial species are salt tolerant, and several correspond to known marine bacteria. As Domiati cheese contains 5.4 to 9.5% NaCl, we suggest that these bacteria are likely to have an important role in the ripening process. This first systematic study of the microbial composition of Domiati cheeses reveals great biodiversity and evokes a role for marine bacteria in determining cheese type. PMID:17189434
Biodiversity of bacterial ecosystems in traditional Egyptian Domiati cheese.
El-Baradei, Gaber; Delacroix-Buchet, Agnès; Ogier, Jean-Claude
2007-02-01
Bacterial biodiversity occurring in traditional Egyptian soft Domiati cheese was studied by PCR-temporal temperature gel electrophoresis (TTGE) and PCR-denaturing gradient gel electrophoresis (DGGE). Bands were identified using a reference species database (J.-C. Ogier et al., Appl. Environ. Microbiol. 70:5628-5643, 2004); de novo bands having nonidentified migration patterns were identified by DNA sequencing. Results reveal a novel bacterial profile and extensive bacterial biodiversity in Domiati cheeses, as reflected by the numerous bands present in TTGE and DGGE patterns. The dominant lactic acid bacteria (LAB) identified were as follows: Leuconostoc mesenteroides, Lactococcus garvieae, Aerococcus viridans, Lactobacillus versmoldensis, Pediococcus inopinatus, and Lactococcus lactis. Frequent non-LAB species included numerous coagulase-negative staphylococci, Vibrio spp., Kocuria rhizophila, Kocuria kristinae, Kocuria halotolerans, Arthrobacter spp./Brachybacterium tyrofermentans. This is the first time that the majority of these species has been identified in Domiati cheese. Nearly all the dominant and frequent bacterial species are salt tolerant, and several correspond to known marine bacteria. As Domiati cheese contains 5.4 to 9.5% NaCl, we suggest that these bacteria are likely to have an important role in the ripening process. This first systematic study of the microbial composition of Domiati cheeses reveals great biodiversity and evokes a role for marine bacteria in determining cheese type.
Detoxification of mercury pollutant leached from spent fluorescent lamps using bacterial strains.
Al-Ghouti, Mohammad A; Abuqaoud, Reem H; Abu-Dieyeh, Mohammed H
2016-03-01
The spent fluorescent lamps (SFLs) are being classified as a hazardous waste due to having mercury as one of its main components. Mercury is considered the second most toxic heavy metal (arsenic is the first) with harmful effects on animal nervous system as it causes different neurological disorders. In this research, the mercury from phosphor powder was leached, then bioremediated using bacterial strains isolated from Qatari environment. Leaching of mercury was carried out with nitric and hydrochloric acid solutions using two approaches: leaching at ambient conditions and microwave-assisted leaching. The results obtained from this research showed that microwave-assisted leaching method was significantly better in leaching mercury than the acid leaching where the mercury leaching efficiency reached 76.4%. For mercury bio-uptake, twenty bacterial strains (previously isolated and purified from petroleum oil contaminated soils) were sub-cultured on Luria Bertani (LB) plates with mercury chloride to check the bacterial tolerance to mercury. Seven of these twenty strains showed a degree of tolerance to mercury. The bio-uptake capacities of the promising strains were investigated using the mercury leached from the fluorescent lamps. Three of the strains (Enterobacter helveticus, Citrobacter amalonaticus, and Cronobacter muytjensii) showed bio-uptake efficiency ranged from 28.8% to 63.6%. Copyright © 2015 Elsevier Ltd. All rights reserved.
Regulation of antibacterial defense in the small intestine by the nuclear bile acid receptor.
Inagaki, Takeshi; Moschetta, Antonio; Lee, Youn-Kyoung; Peng, Li; Zhao, Guixiang; Downes, Michael; Yu, Ruth T; Shelton, John M; Richardson, James A; Repa, Joyce J; Mangelsdorf, David J; Kliewer, Steven A
2006-03-07
Obstruction of bile flow results in bacterial proliferation and mucosal injury in the small intestine that can lead to the translocation of bacteria across the epithelial barrier and systemic infection. These adverse effects of biliary obstruction can be inhibited by administration of bile acids. Here we show that the farnesoid X receptor (FXR), a nuclear receptor for bile acids, induces genes involved in enteroprotection and inhibits bacterial overgrowth and mucosal injury in ileum caused by bile duct ligation. Mice lacking FXR have increased ileal levels of bacteria and a compromised epithelial barrier. These findings reveal a central role for FXR in protecting the distal small intestine from bacterial invasion and suggest that FXR agonists may prevent epithelial deterioration and bacterial translocation in patients with impaired bile flow.
Synthesis of arborane triterpenols by a bacterial oxidosqualene cyclase
NASA Astrophysics Data System (ADS)
Banta, Amy B.; Wei, Jeremy H.; Gill, Clare C. C.; Giner, José-Luis; Welander, Paula V.
2017-01-01
Cyclic triterpenoids are a broad class of polycyclic lipids produced by bacteria and eukaryotes. They are biologically relevant for their roles in cellular physiology, including membrane structure and function, and biochemically relevant for their exquisite enzymatic cyclization mechanism. Cyclic triterpenoids are also geobiologically significant as they are readily preserved in sediments and are used as biomarkers for ancient life throughout Earth's history. Isoarborinol is one such triterpenoid whose only known biological sources are certain angiosperms and whose diagenetic derivatives (arboranes) are often used as indicators of terrestrial input into aquatic environments. However, the occurrence of arborane biomarkers in Permian and Triassic sediments, which predates the accepted origin of angiosperms, suggests that microbial sources of these lipids may also exist. In this study, we identify two isoarborinol-like lipids, eudoraenol and adriaticol, produced by the aerobic marine heterotrophic bacterium Eudoraea adriatica. Phylogenetic analysis demonstrates that the E. adriatica eudoraenol synthase is an oxidosqualene cyclase homologous to bacterial lanosterol synthases and distinct from plant triterpenoid synthases. Using an Escherichia coli heterologous sterol expression system, we demonstrate that substitution of four amino acid residues in a bacterial lanosterol synthase enabled synthesis of pentacyclic arborinols in addition to tetracyclic sterols. This variant provides valuable mechanistic insight into triterpenoid synthesis and reveals diagnostic amino acid residues to differentiate between sterol and arborinol synthases in genomic and metagenomic datasets. Our data suggest that there may be additional bacterial arborinol producers in marine and freshwater environments that could expand our understanding of these geologically informative lipids.
Synthesis of arborane triterpenols by a bacterial oxidosqualene cyclase
Banta, Amy B.; Wei, Jeremy H.; Gill, Clare C. C.; Giner, José-Luis; Welander, Paula V.
2017-01-01
Cyclic triterpenoids are a broad class of polycyclic lipids produced by bacteria and eukaryotes. They are biologically relevant for their roles in cellular physiology, including membrane structure and function, and biochemically relevant for their exquisite enzymatic cyclization mechanism. Cyclic triterpenoids are also geobiologically significant as they are readily preserved in sediments and are used as biomarkers for ancient life throughout Earth's history. Isoarborinol is one such triterpenoid whose only known biological sources are certain angiosperms and whose diagenetic derivatives (arboranes) are often used as indicators of terrestrial input into aquatic environments. However, the occurrence of arborane biomarkers in Permian and Triassic sediments, which predates the accepted origin of angiosperms, suggests that microbial sources of these lipids may also exist. In this study, we identify two isoarborinol-like lipids, eudoraenol and adriaticol, produced by the aerobic marine heterotrophic bacterium Eudoraea adriatica. Phylogenetic analysis demonstrates that the E. adriatica eudoraenol synthase is an oxidosqualene cyclase homologous to bacterial lanosterol synthases and distinct from plant triterpenoid synthases. Using an Escherichia coli heterologous sterol expression system, we demonstrate that substitution of four amino acid residues in a bacterial lanosterol synthase enabled synthesis of pentacyclic arborinols in addition to tetracyclic sterols. This variant provides valuable mechanistic insight into triterpenoid synthesis and reveals diagnostic amino acid residues to differentiate between sterol and arborinol synthases in genomic and metagenomic datasets. Our data suggest that there may be additional bacterial arborinol producers in marine and freshwater environments that could expand our understanding of these geologically informative lipids. PMID:28028245
NASA Astrophysics Data System (ADS)
Qiao, Hai; Hu, Na; Bai, Jin; Ren, Lili; Liu, Qing; Fang, Liaoqiong; Wang, Zhibiao
2017-12-01
Protocells are believed to consist of a lipid membrane and encapsulated nucleic acid. As the lipid membrane is impermeable to macromolecules like nucleic acids, the processes by which nucleic acids become encapsulated inside lipid membrane compartments are still unknown. In this paper, a freeze-thaw method was modified and applied to giant unilamellar vesicles (GUVs) and deoxyribonucleic acid (DNA) in mixed solution resulting in the efficient encapsulation of 6.4 kb plasmid DNA and similar length linear DNA into GUVs. The mechanism of encapsulation was followed by observing the effect of freeze-thaw temperatures on GUV morphological change, DNA encapsulation and ice crystal formation, and analyzing their correlation. Following ice crystal formation, the shape of spherical GUVs was altered and membrane integrity was damaged and this was found to be a necessary condition for encapsulation. Heating alone had no effects on DNA encapsulation, but was helpful for restoring the spherical shape and membrane integrity of GUVs damaged during freezing. These results suggested that freeze-thaw could promote the encapsulation of DNA into GUVs by a mechanism: the vesicle membrane was breached by ice crystal formation during freezing, DNA entered into damaged GUVs through these membrane gaps and was encapsulated after the membrane was resealed during the thawing process. The process described herein therefore describes a simple way for the encapsulation of nucleic acids and potentially other macromolecules into lipid vesicles, a process by which early protocells might have formed.
Firmicutes dominate the bacterial taxa within sugar-cane processing plants
Sharmin, Farhana; Wakelin, Steve; Huygens, Flavia; Hargreaves, Megan
2013-01-01
Sugar cane processing sites are characterised by high sugar/hemicellulose levels, available moisture and warm conditions, and are relatively unexplored unique microbial environments. The PhyloChip microarray was used to investigate bacterial diversity and community composition in three Australian sugar cane processing plants. These ecosystems were highly complex and dominated by four main Phyla, Firmicutes (the most dominant), followed by Proteobacteria, Bacteroidetes, and Chloroflexi. Significant variation (p < 0.05) in community structure occurred between samples collected from ‘floor dump sediment’, ‘cooling tower water’, and ‘bagasse leachate’. Many bacterial Classes contributed to these differences, however most were of low numerical abundance. Separation in community composition was also linked to Classes of Firmicutes, particularly Bacillales, Lactobacillales and Clostridiales, whose dominance is likely to be linked to their physiology as ‘lactic acid bacteria’, capable of fermenting the sugars present. This process may help displace other bacterial taxa, providing a competitive advantage for Firmicutes bacteria. PMID:24177592
Ramseier, Maaike K; von Gunten, Urs; Freihofer, Pietro; Hammes, Frederik
2011-01-01
Drinking water was treated with ozone, chlorine, chlorine dioxide, monochloramine, ferrate(VI), and permanganate to investigate the kinetics of membrane damage of native drinking water bacterial cells. Membrane damage was measured by flow cytometry using a combination of SYBR Green I and propidium iodide (SGI+PI) staining as indicator for cells with permeabilized membranes and SGI alone to measure total cell concentration. SGI+PI staining revealed that the cells were permeabilized upon relatively low oxidant exposures of all tested oxidants without a detectable lag phase. However, only ozonation resulted in a decrease of the total cell concentrations for the investigated reaction times. Rate constants for the membrane damage reaction varied over seven orders of magnitude in the following order: ozone > chlorine > chlorine dioxide ≈ ferrate > permanganate > chloramine. The rate constants were compared to literature data and were in general smaller than previously measured rate constants. This confirmed that membrane integrity is a conservative and therefore safe parameter for disinfection control. Interestingly, the cell membranes of high nucleic acid (HNA) content bacteria were damaged much faster than those of low nucleic acid (LNA) content bacteria during treatment with chlorine dioxide and permanganate. However, only small differences were observed during treatment with chlorine and chloramine, and no difference was observed for ferrate treatment. Based on the different reactivity of these oxidants it was suggested that HNA and LNA bacterial cell membranes have a different chemical constitution. Copyright © 2010 Elsevier Ltd. All rights reserved.
Brouwer, M C; van de Beek, D
2012-05-01
Bacterial meningitis is a severe disease which affects 35.000 Europeans each year and has a mortality rate of about 20%. During the past 25 years the epidemiology of bacterial meningitis has changed significantly due to the implementation of vaccination against Haemophilus influenzae, Neisseria meningtidis group C and Streptococcus pneumoniae. Due to these vaccines, meningitis is now predominantly a disease occurring in adults, caused especially by Streptococcus pneumoniae, while it was formerly a child disease which was largely caused by Haemophilus influenzae. Bacterial meningitis is often difficult to recognize since the classical presentation with neck stiffness, reduced awareness and fever occurs in less than half of the patients. The only way to diagnose or exclude bacterial meningitis is by performing low-threshold cerebrospinal fluid examination with a suspicion of bacterial meningitis. The treatment consists of the prescription of antibiotics and dexamethasone.
Butyric acid in irritable bowel syndrome.
Załęski, Andrzej; Banaszkiewicz, Aleksandra; Walkowiak, Jarosław
2013-01-01
Butyric acid (butanoic acid) belongs to a group of short-chain fatty acids and is thought to play several beneficial roles in the gastrointestinal tract. Butyric anion is easily absorbed by enteric cells and used as a main source of energy. Moreover, butyric acid is an important regulator of colonocyte proliferation and apoptosis, gastrointestinal tract motility and bacterial microflora composition in addition to its involvement in many other processes including immunoregulation and anti-inflammatory activity. The pathogenesis of irritable bowel syndrome (IBS), the most commonly diagnosed functional gastrointestinal condition, is complex, and its precise mechanisms are still unclear. This article describes the potential benefits of butyric acid in IBS.
Limitation of Bacterial Growth by Dissolved Organic Matter and Iron in the Southern Ocean†
Church, Matthew J.; Hutchins, David A.; Ducklow, Hugh W.
2000-01-01
The importance of resource limitation in controlling bacterial growth in the high-nutrient, low-chlorophyll (HNLC) region of the Southern Ocean was experimentally determined during February and March 1998. Organic- and inorganic-nutrient enrichment experiments were performed between 42°S and 55°S along 141°E. Bacterial abundance, mean cell volume, and [3H]thymidine and [3H]leucine incorporation were measured during 4- to 5-day incubations. Bacterial biomass, production, and rates of growth all responded to organic enrichments in three of the four experiments. These results indicate that bacterial growth was constrained primarily by the availability of dissolved organic matter. Bacterial growth in the subtropical front, subantarctic zone, and subantarctic front responded most favorably to additions of dissolved free amino acids or glucose plus ammonium. Bacterial growth in these regions may be limited by input of both organic matter and reduced nitrogen. Unlike similar experimental results in other HNLC regions (subarctic and equatorial Pacific), growth stimulation of bacteria in the Southern Ocean resulted in significant biomass accumulation, apparently by stimulating bacterial growth in excess of removal processes. Bacterial growth was relatively unchanged by additions of iron alone; however, additions of glucose plus iron resulted in substantial increases in rates of bacterial growth and biomass accumulation. These results imply that bacterial growth efficiency and nitrogen utilization may be partly constrained by iron availability in the HNLC Southern Ocean. PMID:10653704
Anaerobic microbial dissolution of lead and production of organic acids
Francis, Arokiasamy J.; Dodge, Cleveland; Chendrayan, Krishnachetty; Quinby, Helen L.
1988-01-01
The present invention relates to an anaerobic bacterial culture of Clostridium sp. ATCC No. 53464 which solubilizes lead oxide under anaerobic conditions in coal and industrial wastes and therefore presents a method of removing lead from such wastes before they are dumped into the environment. The rate of lead dissolution during logarithmic growth of the bacteria in 40 ml medium containing 3.32 .mu.moles of lead as lead oxide was 0.042 .mu.moles ml.sup.-1 hr.sup.-1. Dissolution of lead oxide by the bacterial isolate is due to the production of metabolites and acidity in the culture medium. The major metabolites are acetic, butyric and lactic acid. Clostridium sp. ATCC No. 53464 can be used in the recovery of strategic metals from ores and wastes and also for the production of lactic acid for commercial purposes. The process yields large quantities of lactic acid as well as lead complexed in a stable form with said acids.
Species delimitation (grouping individuals into distinct taxonomic groups) is an essential part of evolutionary, conservation, and molecular ecology. Deoxyribonucleic acid (DNA) barcodes, short fragments of the cytochrome c oxidase subunit I (COI) gene, are being used in environm...
Lathe, R
1977-09-01
The firA (Ts)200 mutation not only eliminates the resistance to rifampin of certain genetically resistant strains, but, moreover, renders ribonucleic acid synthesis thermolabile. The firA gene has been mapped by P1 tranduction and is located extremely close to the structural gene for deoxyribonucleic acid polymerase III at 4 min on the Escherichia coli linkage map.
NASA Astrophysics Data System (ADS)
Hwang, Geelsu; Liu, Yuan; Kim, Dongyeop; Sun, Victor; Aviles-Reyes, Alejandro; Kajfasz, Jessica K.; Lemos, Jose A.; Koo, Hyun
2016-09-01
Biofilms are comprised of bacterial-clusters (microcolonies) enmeshed in an extracellular matrix. Streptococcus mutans can produce exopolysaccharides (EPS)-matrix and assemble microcolonies with acidic microenvironments that can cause tooth-decay despite the surrounding neutral-pH found in oral cavity. How the matrix influences the pH and bacterial activity locally remains unclear. Here, we simultaneously analyzed in situ pH and gene expression within intact biofilms and measured the impact of damage to the surrounding EPS-matrix. The spatiotemporal changes of these properties were characterized at a single-microcolony level following incubation in neutral-pH buffer. The middle and bottom-regions as well as inner-section within the microcolony 3D structure were resistant to neutralization (vs. upper and peripheral-region), forming an acidic core. Concomitantly, we used a green fluorescent protein (GFP) reporter to monitor expression of the pH-responsive atpB (PatpB::gfp) by S. mutans within microcolonies. The atpB expression was induced in the acidic core, but sharply decreased at peripheral/upper microcolony regions, congruent with local pH microenvironment. Enzymatic digestion of the surrounding matrix resulted in nearly complete neutralization of microcolony interior and down-regulation of atpB. Altogether, our data reveal that biofilm matrix facilitates formation of an acidic core within microcolonies which in turn activates S. mutans acid-stress response, mediating both the local environment and bacterial activity in situ.
Nakatsuji, Teruaki; Tang, De-chu C.; Zhang, Liangfang; Gallo, Richard L.; Huang, Chun-Ming
2011-01-01
Background In the progression of acne vulgaris, the disruption of follicular epithelia by an over-growth of Propionibacterium acnes (P. acnes) permits the bacteria to spread and become in contact with various skin and immune cells. Methodology/Principal Findings We have demonstrated in the present study that the Christie, Atkins, Munch-Peterson (CAMP) factor of P. acnes is a secretory protein with co-hemolytic activity with sphingomyelinase that can confer cytotoxicity to HaCaT keratinocytes and RAW264.7 macrophages. The CAMP factor from bacteria and acid sphingomyelinase (ASMase) from the host cells were simultaneously present in the culture supernatant only when the cells were co-cultured with P. acnes. Either anti-CAMP factor serum or desipramine, a selective ASMase inhibitor, significantly abrogated the P. acnes-induced cell death of HaCaT and RAW264.7 cells. Intradermal injection of ICR mouse ears with live P. acnes induced considerable ear inflammation, macrophage infiltration, and an increase in cellular soluble ASMase. Suppression of ASMase by systemic treatment with desipramine significantly reduced inflammatory reaction induced by intradermal injection with P. acnes, suggesting the contribution of host ASMase in P. acnes-induced inflammatory reaction in vivo. Vaccination of mice with CAMP factor elicited a protective immunity against P. acnes-induced ear inflammation, indicating the involvement of CAMP factor in P. acnes-induced inflammation. Most notably, suppression of both bacterial CAMP factor and host ASMase using vaccination and specific antibody injection, respectively, cooperatively alleviated P. acnes-induced inflammation. Conclusions/Significance These findings envision a novel infectious mechanism by which P. acnes CAMP factor may hijack host ASMase to amplify bacterial virulence to degrade and invade host cells. This work has identified both CAMP factor and ASMase as potential molecular targets for the development of drugs and vaccines against
Impact of humic acids on the colonic microbiome in healthy volunteers
Swidsinski, Alexander; Dörffel, Yvonne; Loening-Baucke, Vera; Gille, Christoph; Reißhauer, Anne; Göktas, Onder; Krüger, Monika; Neuhaus, Jürgen; Schrödl, Wieland
2017-01-01
AIM To test the effects of humic acids on innate microbial communities of the colon. METHODS We followed the effects of oral supplementation with humic acids (Activomin®) on concentrations and composition of colonic microbiome in 14 healthy volunteers for 45 d. 3 × 800 mg Activomin® were taken orally for 10 d followed by 3 × 400 mg for 35 d. Colonic microbiota were investigated using multicolor fluorescence in situ hybridization (FISH) of Carnoy fixated and paraffin embedded stool cylinders. Two stool samples were collected a week prior to therapy and one stool sample on days 10, 31 and 45. Forty-one FISH probes representing different bacterial groups were used. RESULTS The sum concentration of colonic microbiota increased from 20% at day 10 to 30% by day 31 and remained stable until day 45 (32%) of humic acid supplementation (P < 0.001). The increase in the concentrations in each person was due to growth of preexisting groups. The individual microbial profile of the patients remained unchanged. Similarly, the bacterial diversity remained stable. Concentrations of 24 of the 35 substantial groups increased from 20% to 96%. Two bacterial groups detected with Bac303 (Bacteroides) and Myc657 (mycolic acid-containing Actinomycetes) FISH probes decreased (P > 0.05). The others remained unaffected. Bacterial groups with initially marginal concentrations (< 0.1 × 109/mL) demonstrated no response to humic acids. The concentrations of pioneer groups of Bifidobacteriaceae, Enterobacteriaceae and Clostridium difficile increased but the observed differences were statistically not significant. CONCLUSION Humic acids have a profound effect on healthy colonic microbiome and may be potentially interesting substances for the development of drugs that control the innate colonic microbiome. PMID:28223733
Papalexandratou, Zoi; Vrancken, Gino; De Bruyne, Katrien; Vandamme, Peter; De Vuyst, Luc
2011-10-01
Spontaneous organic cocoa bean box fermentations were carried out on two different farms in Brazil. Physical parameters, microbial growth, bacterial species diversity [mainly lactic acid bacteria (LAB) and acetic acid bacteria (AAB)], and metabolite kinetics were monitored, and chocolates were produced from the fermented dry cocoa beans. The main end-products of the catabolism of the pulp substrates (glucose, fructose, and citric acid) by yeasts, LAB, and AAB were ethanol, lactic acid, mannitol, and/or acetic acid. Lactobacillus fermentum and Acetobacter pasteurianus were the predominating bacterial species of the fermentations as revealed through (GTG)(5)-PCR fingerprinting of isolates and PCR-DGGE of 16S rRNA gene PCR amplicons of DNA directly extracted from fermentation samples. Fructobacillus pseudoficulneus, Lactobacillus plantarum, and Acetobacter senegalensis were among the prevailing species during the initial phase of the fermentations. Also, three novel LAB species were found. This study emphasized the possible participation of Enterobacteriaceae in the cocoa bean fermentation process. Tatumella ptyseos and Tatumella citrea were the prevailing enterobacterial species in the beginning of the fermentations as revealed by 16S rRNA gene-PCR-DGGE. Finally, it turned out that control over a restricted bacterial species diversity during fermentation through an ideal post-harvest handling of the cocoa beans will allow the production of high-quality cocoa and chocolates produced thereof, independent of the fermentation method or farm. Copyright © 2011 Elsevier Ltd. All rights reserved.
BacDive--The Bacterial Diversity Metadatabase in 2016.
Söhngen, Carola; Podstawka, Adam; Bunk, Boyke; Gleim, Dorothea; Vetcininova, Anna; Reimer, Lorenz Christian; Ebeling, Christian; Pendarovski, Cezar; Overmann, Jörg
2016-01-04
BacDive-the Bacterial Diversity Metadatabase (http://bacdive.dsmz.de) provides strain-linked information about bacterial and archaeal biodiversity. The range of data encompasses taxonomy, morphology, physiology, sampling and concomitant environmental conditions as well as molecular biology. The majority of data is manually annotated and curated. Currently (with release 9/2015), BacDive covers 53 978 strains. Newly implemented RESTful web services provide instant access to the content in machine-readable XML and JSON format. Besides an overall increase of data content, BacDive offers new data fields and features, e.g. the search for gene names, plasmids or 16S rRNA in the advanced search, as well as improved linkage of entries to external life science web resources. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Chandra, Ram; Kumar, Vineet
2017-01-01
Sugarcane-molasses-based post-methanated distillery waste is well known for its toxicity, causing adverse effects on aquatic flora and fauna. Here, it has been demonstrated that there is an abundant mixture of androgenic and mutagenic compounds both in distillery sludge and leachate. Gas chromatography-mass spectrometry (GC-MS) analysis showed dodecanoic acid, octadecanoic acid, n-pentadecanoic acid, hexadecanoic acid, β-sitosterol, stigmasterol, β-sitosterol trimethyl ether, heptacosane, dotriacontane, lanosta-8, 24-dien-3-one, 1-methylene-3-methyl butanol, 1-phenyl-1-propanol, 5-methyl-2-(1-methylethyl) cyclohexanol, and 2-ethylthio-10-hydroxy-9-methoxy-1,4 anthraquinone as major organic pollutants along with heavy metals (all mg kg-1): Fe (2403), Zn (210.15), Mn (126.30, Cu (73.62), Cr (21.825), Pb (16.33) and Ni (13.425). In a simultaneous analysis of bacterial communities using the restriction fragment length polymorphism (RFLP) method the dominance of Bacillus sp. followed by Enterococcus sp. as autochthonous bacterial communities growing in this extremely toxic environment was shown, indicating a primary community for bioremediation. A toxicity evaluation showed a reduction of toxicity in degraded samples of sludge and leachate, confirming the role of autochthonous bacterial communities in the bioremediation of distillery waste in situ. PMID:28567033
Toxicity of nalidixic acid on candida albicans, Saccharomyces cerevisiae, and Kluyveromyces lactis.
Sobieski, R J; Brewer, A R
1976-03-01
The antibacterial drug nalidixic acid (Nal) can suppress the growth of Candida albicans at levels of the drug normally found in urine. Growth suppression increases as drug levels are increased, and Nal also causes a similar proportional inhibition of the synthesis of all cellular macromolecules. However, growth temperature (25 versus 37 C) and the divalent cations Mg(2+) and Mn(2+) can increase C. albicans resistance to Nal. Also, nitrogen depletion of Candida shows that Nal-treated and untreated cells exhibit no difference in leucine uptake during readaptation to nitrogen. In Nal-treated, nitrogen-starved cells, ribonucleic acid and deoxyribonucleic acid (DNA) biosynthesis are less affected than in unstarved Nal-treated cells, but of the two nucleic acids DNA synthesis is the most affected. Nal-resistant strains of C. albicans exhibit a slight toxicity for macromolecular synthesis. Nal treatment of a synchronized population of Saccharomyces cerevisiae results in an increase in the culture mean doubling time of, at most, 20%, but Nal causes the loss of synchronous cell division. With a synchronized population of Kluyveromyces lactis, Nal causes an increase in the mean doubling time of upwards of 300%, with synchrony of cell division being maintained. It is known that S. cerevisiae asynchronously synthesizes mitochondrial DNA during the cell cycle, whereas with K. lactis it is synchronous. Thus, with C. albicans Nal toxicity is dependent both on the dose and the physiological state of the cell. Furthermore, Nal inhibits growth of yeast with synchronous mitochondrial DNA synthesis more adversely than yeast with asynchronous mitochondrial DNA synthesis.
Modeling bacterial contamination of fuel ethanol fermentation.
Bischoff, Kenneth M; Liu, Siqing; Leathers, Timothy D; Worthington, Ronald E; Rich, Joseph O
2009-05-01
The emergence of antibiotic-resistant bacteria may limit the effectiveness of antibiotics to treat bacterial contamination in fuel ethanol plants, and therefore, new antibacterial intervention methods and tools to test their application are needed. Using shake-flask cultures of Saccharomyces cerevisiae grown on saccharified corn mash and strains of lactic acid bacteria isolated from a dry-grind ethanol facility, a simple model to simulate bacterial contamination and infection was developed. Challenging the model with 10(8) CFU/mL Lactobacillus fermentum decreased ethanol yield by 27% and increased residual glucose from 6.2 to 45.5 g/L. The magnitude of the effect was proportional to the initial bacterial load, with 10(5) CFU/mL L. fermentum still producing an 8% decrease in ethanol and a 3.2-fold increase in residual glucose. Infection was also dependent on the bacterial species used to challenge the fermentation, as neither L. delbrueckii ATCC 4797 nor L. amylovorus 0315-7B produced a significant decrease in ethanol when inoculated at a density of 10(8) CFU/mL. In the shake-flask model, treatment with 2 microg/mL virginiamycin mitigated the infection when challenged with a susceptible strain of L. fermentum (MIC for virginiamycin < or =2 ppm), but treatment was ineffective at treating infection by a resistant strain of L. fermentum (MIC = 16 ppm). The model may find application in developing new antibacterial agents and management practices for use in controlling contamination in the fuel ethanol industry. Copyright 2008 Wiley Periodicals, Inc.
Anti-Biofilm Performance of Three Natural Products against Initial Bacterial Attachment
Salta, Maria; Wharton, Julian A.; Dennington, Simon P.; Stoodley, Paul; Stokes, Keith R.
2013-01-01
Marine bacteria contribute significantly towards the fouling consortium, both directly (modern foul release coatings fail to prevent “slime” attachment) and indirectly (biofilms often excrete chemical cues that attract macrofouling settlement). This study assessed the natural product anti-biofilm performance of an extract of the seaweed, Chondrus crispus, and two isolated compounds from terrestrial sources, (+)-usnic acid and juglone, against two marine biofilm forming bacteria, Cobetia marina and Marinobacter hydrocarbonoclasticus. Bioassays were developed using quantitative imaging and fluorescent labelling to test the natural products over a range of concentrations against initial bacterial attachment. All natural products affected bacterial attachment; however, juglone demonstrated the best anti-biofilm performance against both bacterial species at a concentration range between 5–20 ppm. In addition, for the first time, a dose-dependent inhibition (hormetic) response was observed for natural products against marine biofilm forming bacteria. PMID:24192819
Attenuation of Streptococcus suis virulence by the alteration of bacterial surface architecture
Feng, Youjun; Cao, Min; Shi, Jie; Zhang, Huimin; Hu, Dan; Zhu, Jing; Zhang, Xianyun; Geng, Meiling; Zheng, Feng; Pan, Xiuzhen; Li, Xianfu; Hu, Fuquan; Tang, Jiaqi; Wang, Changjun
2012-01-01
NeuB, a sialic acid synthase catalyzes the last committed step of the de novo biosynthetic pathway of sialic acid, a major element of bacterial surface structure. Here we report a functional NeuB homologue of Streptococcus suis, a zoonotic agent, and systematically address its molecular and immunological role in bacterial virulence. Disruption of neuB led to thinner capsules and more susceptibility to pH, and cps2B inactivation resulted in complete absence of capsular polysaccharides. These two mutants both exhibited increased adhesion and invasion to Hep-2 cells and improved sensibility to phagocytosis. Not only do they retain the capability of inducing the release of host pro-inflammatory cytokines, but also result in the faster secretion of IL-8. Easier cleaning up of the mutant strains in whole blood is consistent with virulence attenuation seen with experimental infections of both mice and SPF-piglets. Therefore we concluded that altered architecture of S. suis surface attenuates its virulence. PMID:23050094
Functional microdomains in bacterial membranes.
López, Daniel; Kolter, Roberto
2010-09-01
The membranes of eukaryotic cells harbor microdomains known as lipid rafts that contain a variety of signaling and transport proteins. Here we show that bacterial membranes contain microdomains functionally similar to those of eukaryotic cells. These membrane microdomains from diverse bacteria harbor homologs of Flotillin-1, a eukaryotic protein found exclusively in lipid rafts, along with proteins involved in signaling and transport. Inhibition of lipid raft formation through the action of zaragozic acid--a known inhibitor of squalene synthases--impaired biofilm formation and protein secretion but not cell viability. The orchestration of physiological processes in microdomains may be a more widespread feature of membranes than previously appreciated.
Influence of Calcium in Extracellular DNA Mediated Bacterial Aggregation and Biofilm Formation
Koop, Leena; Wong, Yie Kuan; Ahmed, Safia; Siddiqui, Khawar Sohail; Manefield, Mike
2014-01-01
Calcium (Ca2+) has an important structural role in guaranteeing the integrity of the outer lipopolysaccharide layer and cell walls of bacterial cells. Extracellular DNA (eDNA) being part of the slimy matrix produced by bacteria promotes biofilm formation through enhanced structural integrity of the matrix. Here, the concurrent role of Ca2+ and eDNA in mediating bacterial aggregation and biofilm formation was studied for the first time using a variety of bacterial strains and the thermodynamics of DNA to Ca2+ binding. It was found that the eDNA concentrations under both planktonic and biofilm growth conditions were different among bacterial strains. Whilst Ca2+ had no influence on eDNA release, presence of eDNA by itself favours bacterial aggregation via attractive acid-base interactions in addition, its binding with Ca2+ at biologically relevant concentrations was shown further increase in bacterial aggregation via cationic bridging. Negative Gibbs free energy (ΔG) values in iTC data confirmed that the interaction between DNA and Ca2+ is thermodynamically favourable and that the binding process is spontaneous and exothermic owing to its highly negative enthalpy. Removal of eDNA through DNase I treatment revealed that Ca2+ alone did not enhance cell aggregation and biofilm formation. This discovery signifies the importance of eDNA and concludes that existence of eDNA on bacterial cell surfaces is a key facilitator in binding of Ca2+ to eDNA thereby mediating bacterial aggregation and biofilm formation. PMID:24651318
Anaerobic microbial dissolution of lead and production of organic acids
Francis, A.J.; Dodge, C.; Chendrayan, K.; Quinby, H.L.
1987-04-16
The present invention related to an anaerobic bacterial culture of Clostridium sp. ATCC No. 53464 which solubilizes lead oxide under anaerobic conditions in coal and industrial wastes and therefore presents a method of removing lead from such wastes before they are dumped into the environment. The rat of lead dissolution during logarithmic growth of the bacteria in 40 ml medium containing 3.32 ..mu..moles of lead as lead oxide was 0.042 ..mu..moles m1/sup /-/1/ hr/sup /-/1/. Dissolution of lead oxide by the bacterial isolate is due to the production of metabolites and acidity in the culture medium. The major metabolites are acetic, butyric and lactic acid. The major metabolites are acetic, butyric and lactic acid. Clostridium sp. ATCC No. 53464 can be used in the recovery of the strategic metals from ores and wastes and also for the production of lactic acid for commercial purposes. The process yields large quantities of lactic acid as well as lead complexed in a stable form with said acids. 4 figs., 3 tabs.
Durack, Juliana; Lynch, Susan V; Nariya, Snehal; Bhakta, Nirav R; Beigelman, Avraham; Castro, Mario; Dyer, Anne-Marie; Israel, Elliot; Kraft, Monica; Martin, Richard J; Mauger, David T; Rosenberg, Sharon R; Sharp-King, Tonya; White, Steven R; Woodruff, Prescott G; Avila, Pedro C; Denlinger, Loren C; Holguin, Fernando; Lazarus, Stephen C; Lugogo, Njira; Moore, Wendy C; Peters, Stephen P; Que, Loretta; Smith, Lewis J; Sorkness, Christine A; Wechsler, Michael E; Wenzel, Sally E; Boushey, Homer A; Huang, Yvonne J
2017-07-01
Compositional differences in the bronchial bacterial microbiota have been associated with asthma, but it remains unclear whether the findings are attributable to asthma, to aeroallergen sensitization, or to inhaled corticosteroid treatment. We sought to compare the bronchial bacterial microbiota in adults with steroid-naive atopic asthma, subjects with atopy but no asthma, and nonatopic healthy control subjects and to determine relationships of the bronchial microbiota to phenotypic features of asthma. Bacterial communities in protected bronchial brushings from 42 atopic asthmatic subjects, 21 subjects with atopy but no asthma, and 21 healthy control subjects were profiled by using 16S rRNA gene sequencing. Bacterial composition and community-level functions inferred from sequence profiles were analyzed for between-group differences. Associations with clinical and inflammatory variables were examined, including markers of type 2-related inflammation and change in airway hyperresponsiveness after 6 weeks of fluticasone treatment. The bronchial microbiome differed significantly among the 3 groups. Asthmatic subjects were uniquely enriched in members of the Haemophilus, Neisseria, Fusobacterium, and Porphyromonas species and the Sphingomonodaceae family and depleted in members of the Mogibacteriaceae family and Lactobacillales order. Asthma-associated differences in predicted bacterial functions included involvement of amino acid and short-chain fatty acid metabolism pathways. Subjects with type 2-high asthma harbored significantly lower bronchial bacterial burden. Distinct changes in specific microbiota members were seen after fluticasone treatment. Steroid responsiveness was linked to differences in baseline compositional and functional features of the bacterial microbiome. Even in subjects with mild steroid-naive asthma, differences in the bronchial microbiome are associated with immunologic and clinical features of the disease. The specific differences identified
Synthetic Fatty Acids Prevent Plasmid-Mediated Horizontal Gene Transfer
Getino, María; Sanabria-Ríos, David J.; Fernández-López, Raúl; Campos-Gómez, Javier; Sánchez-López, José M.; Fernández, Antonio; Carballeira, Néstor M.
2015-01-01
ABSTRACT Bacterial conjugation constitutes a major horizontal gene transfer mechanism for the dissemination of antibiotic resistance genes among human pathogens. Antibiotic resistance spread could be halted or diminished by molecules that interfere with the conjugation process. In this work, synthetic 2-alkynoic fatty acids were identified as a novel class of conjugation inhibitors. Their chemical properties were investigated by using the prototype 2-hexadecynoic acid and its derivatives. Essential features of effective inhibitors were the carboxylic group, an optimal long aliphatic chain of 16 carbon atoms, and one unsaturation. Chemical modification of these groups led to inactive or less-active derivatives. Conjugation inhibitors were found to act on the donor cell, affecting a wide number of pathogenic bacterial hosts, including Escherichia, Salmonella, Pseudomonas, and Acinetobacter spp. Conjugation inhibitors were active in inhibiting transfer of IncF, IncW, and IncH plasmids, moderately active against IncI, IncL/M, and IncX plasmids, and inactive against IncP and IncN plasmids. Importantly, the use of 2-hexadecynoic acid avoided the spread of a derepressed IncF plasmid into a recipient population, demonstrating the feasibility of abolishing the dissemination of antimicrobial resistances by blocking bacterial conjugation. PMID:26330514
Huang, Wen-Cheng; Tsai, Tsung-Hsien; Chuang, Lu-Te; Li, You-Yi; Zouboulis, Christos C; Tsai, Po-Jung
2014-03-01
Propionibacterium acnes (P. acnes) is a commensal bacterium which is possibly involved in acne inflammation. The saturated fatty acid, lauric acid (C12:0) has been shown to possess antibacterial and anti-inflammatory properties against P. acnes. Little is known concerning the potential effects of its decanoic counterpart, capric acid (C10:0). To examine the antibacterial and anti-inflammatory activities of capric acid against P. acnes and to investigate the mechanism of the anti-inflammatory action. The antimicrobial activity of fatty acids was detected using the broth dilution method. An evaluation of P. acnes-induced ear edema in mice was conducted to evaluate the in vivo anti-inflammatory effect. To elucidate the in vitro anti-inflammatory effect, human SZ95 sebocytes and monocytic THP-1 cells were treated with P. acnes alone or in the presence of a fatty acid. The mRNA levels and secretion of pro-inflammatory cytokines were measured by qRT-PCR and enzyme immunoassay, respectively. NF-κB activation and MAPK expression were analyzed by ELISA and Western blot, respectively. Lauric acid had stronger antimicrobial activity against P. acnes than capric acid in vitro and in vivo. However, both fatty acids attenuated P. acnes-induced ear swelling in mice along with microabscess and significantly reduced interleukin (IL)-6 and CXCL8 (also known as IL-8) production in P. acnes-stimulated SZ95 sebocytes. P. acnes-induced mRNA levels and secretion of IL-8 and TNF-α in THP-1 cells were suppressed by both fatty acids, which inhibited NF-κB activation and the phosphorylation of MAP kinases. Our data demonstrate that both capric acid and lauric acid exert bactericidal and anti-inflammatory activities against P. acnes. The anti-inflammatory effect may partially occur through the inhibition of NF-κB activation and the phosphorylation of MAP kinases. Copyright © 2013 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
Dubois-Brissonnet, Florence; Naïtali, Murielle; Mafu, Akier Assanta; Briandet, Romain
2011-01-01
To enhance food safety and stability, the food industry tends to use natural antimicrobials such as plant-derived compounds as an attractive alternative to chemical preservatives. Nonetheless, caution must be exercised in light of the potential for bacterial adaptation to these molecules, a phenomenon previously observed with other antimicrobials. The aim of this study was to characterize the adaptation of Salmonella enterica serovar Typhimurium to sublethal concentrations of four terpenes extracted from aromatic plants: thymol, carvacrol, citral, and eugenol, or combinations thereof. Bacterial adaptation in these conditions was demonstrated by changes in membrane fatty acid composition showing (i) limitation of the cyclization of unsaturated fatty acids to cyclopropane fatty acids when cells entered the stationary phase and (ii) bacterial membrane saturation. Furthermore, we demonstrated an increased cell resistance to the bactericidal activity of two biocides (peracetic acid and didecyl dimethyl ammonium bromide). The implications of membrane modifications in terms of hindering the penetration of antimicrobials through the bacterial membrane are discussed. PMID:21131520
Weingarden, Alexa R; Chen, Chi; Bobr, Aleh; Yao, Dan; Lu, Yuwei; Nelson, Valerie M; Sadowsky, Michael J; Khoruts, Alexander
2014-02-15
Fecal microbiota transplantation (FMT) has emerged as a highly effective therapy for refractory, recurrent Clostridium difficile infection (CDI), which develops following antibiotic treatments. Intestinal microbiota play a critical role in the metabolism of bile acids in the colon, which in turn have major effects on the lifecycle of C. difficile bacteria. We hypothesized that fecal bile acid composition is altered in patients with recurrent CDI and that FMT results in its normalization. General metabolomics and targeted bile acid analyses were performed on fecal extracts from patients with recurrent CDI treated with FMT and their donors. In addition, 16S rRNA gene sequencing was used to determine the bacterial composition of pre- and post-FMT fecal samples. Taxonomic bacterial composition of fecal samples from FMT recipients showed rapid change and became similar to the donor after the procedure. Pre-FMT fecal samples contained high concentrations of primary bile acids and bile salts, while secondary bile acids were nearly undetectable. In contrast, post-FMT fecal samples contained mostly secondary bile acids, as did non-CDI donor samples. Therefore, our analysis showed that FMT resulted in normalization of fecal bacterial community structure and metabolic composition. Importantly, metabolism of bile salts and primary bile acids to secondary bile acids is disrupted in patients with recurrent CDI, and FMT corrects this abnormality. Since individual bile salts and bile acids have pro-germinant and inhibitory activities, the changes suggest that correction of bile acid metabolism is likely a major mechanism by which FMT results in a cure and prevents recurrence of CDI.
Tunaz, H; Bedick, J C.; Miller, J S.; Hoback, W W.; Rana, R L.; Stanley, D W.
1999-10-01
Nodulation is the first and quantitatively most important cellular defense reaction to bacterial infections in insects. Treating adults of the 17-year periodical cicadas, Magicicada septendecim and M. cassini, with eicosanoid biosynthesis inhibitors immediately prior to intrahemocoelic injections of the bacterium, Serratia marcescens, sharply reduced the nodulation response to bacterial challenges. Separate treatments with specific inhibitors of phospholipase A(2), cyclooxygenase, and lipoxygenase reduced nodulation, supporting our view that nodule formation is a multi-step process in which individual steps are separately mediated by lipoxygenase and cyclooxygenase products. The inhibitory influence of dexamethasone was apparent by 2 h after injection, and nodulation was significantly reduced, relative to control insects, over the following 14 h. The dexamethasone effects were reversed by treating bacteria-challenged insects with the eicosanoid-precursor polyunsaturated fatty acid, arachidonic acid. Low levels of arachidonic acid were detected in fat body phospholipids. These findings in adults of an exopterygote insect species with an unusual life history pattern broaden our hypothesis that eicosanoids mediate cellular immune reactions to bacterial infections in most, if not all, insects.
Bacterial keratitis: a prospective clinical and microbiological study
Schaefer, F.; Bruttin, O.; Zografos, L.; Guex-Crosier, Y.
2001-01-01
AIM—To define the clinical and microbiological profile of bacterial keratitis at the Jules Gonin Eye Hospital and to test the in vitro bacterial resistance. METHODS—Patients presenting with bacterial keratitis were prospectively followed; clinical features (age, risk factors, visual acuity) and response to therapy were analysed. Bacteriological profile was determined and the sensitivity/resistance of isolated strains were tested towards 12 ocular antibiotics (NCCLS disc diffusion test). RESULTS—85 consecutive patients (mean age 44.3 (SD 20.7) years) were prospectively enrolled from 1 March 1997 to 30 November 1998. The following risk factors were identified: contact lens wear, 36%; blepharitis, 21%; trauma, 20%; xerophthalmia, 15%; keratopathies, 8%; and eyelid abnormalities, 6%. The most commonly isolated bacteria were Staphylococcus epidermidis, 40%; Staphylococcus aureus, 22%; Streptococcus pneumoniae, 8%; others Streptococcus species, 5%; Pseudomonas, 9%; Moraxella and Serratia marcescens, 5% each; Bacillus, Corynebacterium, Alcaligenes xyloxidans, Morganella morganii, and Haemophilus influenza, 1% each. 1-15% of strains were resistant to fluoroquinolones, 13-22% to aminoglycosides, 37% to cefazolin, 18% to chloramphenicol, 54% to polymyxin B, 51% to fusidic acid, and 45% to bacitracin. Five of the 85 patients (5.8%) had a poor clinical outcome with a visual loss of one or more lines of visual acuity. CONCLUSION—Fluoroquinolones appear to be the therapy of choice for bacterial keratitis, but, based upon these in vitro studies, some strains may be resistant. PMID:11423460