A novel magneto-DNA duplex probe for bacterial DNA detection based on exonuclease III-aided cycling amplification.

PubMed

Zeng, Yan; Wan, Yi; Zhang, Dun; Qi, Peng

2015-01-01

A novel magneto-DNA duplex probe for bacterial DNA detection based on exonuclease III (Exo-III) aided cycling amplification has been developed. This magneto-DNA duplex probe contains a partly hybrid fluorophore-modified capture probe and a fluorophore-modified signal probe with magnetic microparticle as carrier. In the presence of a perfectly matched target bacterial DNA, blunt 3'-terminus of the capture probe is formed, activating the Exo-III aided cycling amplification. Thus, Exo-III catalyzes the stepwise removal of mononucleotides from this terminus, releasing both fluorophore-modified signal probe, fluorescent dyes of the capture probe and target DNA. The released target DNA then starts a new cycle, while released fluorescent fragments are recovered with magnetic separation for fluorescence signal collection. This system exhibited sensitive detection of bacterial DNA, with a detection limit of 14 pM because of the unique cleavage function of Exo-III, high fluorescence intensity, and separating function of magneto-DNA duplex probes. Besides this sensitivity, this strategy exhibited excellent selectivity with mismatched bacterial DNA targets and other bacterial species targets and good applicability in real seawater samples, hence, this strategy could be potentially used for qualitative and quantitative analysis of bacteria. Copyright © 2014 Elsevier B.V. All rights reserved.

An accurate bacterial DNA quantification assay for HTS library preparation of human biological samples.

PubMed

Seashols-Williams, Sarah; Green, Raquel; Wohlfahrt, Denise; Brand, Angela; Tan-Torres, Antonio Limjuco; Nogales, Francy; Brooks, J Paul; Singh, Baneshwar

2018-05-17

Sequencing and classification of microbial taxa within forensically relevant biological fluids has the potential for applications in the forensic science and biomedical fields. The quantity of bacterial DNA from human samples is currently estimated based on quantity of total DNA isolated. This method can miscalculate bacterial DNA quantity due to the mixed nature of the sample, and consequently library preparation is often unreliable. We developed an assay that can accurately and specifically quantify bacterial DNA within a mixed sample for reliable 16S ribosomal DNA (16S rDNA) library preparation and high throughput sequencing (HTS). A qPCR method was optimized using universal 16S rDNA primers, and a commercially available bacterial community DNA standard was used to develop a precise standard curve. Following qPCR optimization, 16S rDNA libraries from saliva, vaginal and menstrual secretions, urine, and fecal matter were amplified and evaluated at various DNA concentrations; successful HTS data were generated with as low as 20 pg of bacterial DNA. Changes in bacterial DNA quantity did not impact observed relative abundances of major bacterial taxa, but relative abundance changes of minor taxa were observed. Accurate quantification of microbial DNA resulted in consistent, successful library preparations for HTS analysis. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

ATM Protein Physically and Functionally Interacts with Proliferating Cell Nuclear Antigen to Regulate DNA Synthesis*

PubMed Central

Gamper, Armin M.; Choi, Serah; Matsumoto, Yoshihiro; Banerjee, Dibyendu; Tomkinson, Alan E.; Bakkenist, Christopher J.

2012-01-01

Ataxia telangiectasia (A-T) is a pleiotropic disease, with a characteristic hypersensitivity to ionizing radiation that is caused by biallelic mutations in A-T mutated (ATM), a gene encoding a protein kinase critical for the induction of cellular responses to DNA damage, particularly to DNA double strand breaks. A long known characteristic of A-T cells is their ability to synthesize DNA even in the presence of ionizing radiation-induced DNA damage, a phenomenon termed radioresistant DNA synthesis. We previously reported that ATM kinase inhibition, but not ATM protein disruption, blocks sister chromatid exchange following DNA damage. We now show that ATM kinase inhibition, but not ATM protein disruption, also inhibits DNA synthesis. Investigating a potential physical interaction of ATM with the DNA replication machinery, we found that ATM co-precipitates with proliferating cell nuclear antigen (PCNA) from cellular extracts. Using bacterially purified ATM truncation mutants and in vitro translated PCNA, we showed that the interaction is direct and mediated by the C terminus of ATM. Indeed, a 20-amino acid region close to the kinase domain is sufficient for strong binding to PCNA. This binding is specific to ATM, because the homologous regions of other PIKK members, including the closely related kinase A-T and Rad3-related (ATR), did not bind PCNA. ATM was found to bind two regions in PCNA. To examine the functional significance of the interaction between ATM and PCNA, we tested the ability of ATM to stimulate DNA synthesis by DNA polymerase δ, which is implicated in both DNA replication and DNA repair processes. ATM was observed to stimulate DNA polymerase activity in a PCNA-dependent manner. PMID:22362778

Analysis of bacterial populations in the environment using two-dimensional gel electrophoresis of genomic DNA and complementary DNA.

PubMed

Liu, Guo-Hua; Nakamura, Tatsuo; Amemiya, Takashi; Rajendran, Narasimmalu; Itoh, Kiminori

2011-01-01

Two-dimensional gel electrophoresis (2-DGE) mapping of genomic DNA and complementary DNA (cDNA) amplicons was attempted to analyze total and active bacterial populations within soil and activated sludge samples. Distinct differences in the number and species of bacterial populations and those that were metabolically active at the time of sampling were visually observed especially for the soil community. Statistical analyses and sequencing based on the 2-DGE data further revealed the relationships between total and active bacterial populations within each community. This high-resolution technique would be useful for obtaining a better understanding of bacterial population structures in the environment.

Role of Escherichia coli dnaA gene and its integrative suppression in M13 Coliphage DNA synthesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mitra, S.; Stallions, D.R.

An F/sup +/ derivative of Escherichia coli E508 thermosensitive in dnaA function (involved in DNA synthesis initiation), its revertant and an Hfr derivative of E508(ts) in which the temperature-sensitive phenotype is suppressed by integrative suppression have been compared for their ability to support M13 phage DNA synthesis at the nonpermissive temperature. Upon infection at the nonpermissive temperature, both the revertant and the Hfr strain support normal phage replication while the temperature-sensitive mutant does not. However, when infection is carried out at a permissive temperature and the temperature is shifted up after infection, phage synthesis occurs in the temperature-sensitive mutant also,more » but in lesser quantity than in the revertant strain. Analysis of intracellular labeled phage DNA indicates: (a) parental replicative form DNA synthesis is not dependent on dnaA function; (b) progeny replicative form DNA synthesis is strongly inhibited in the temperature-sensitive dnaA mutant at the nonpermissive temperature; (c) progeny single-strand DNA synthesis does not absolutely require dnaA function; (d) progeny single-strand DNA is present in the circular form. The implication of the host DNA replication in M13 DNA synthesis is discussed.« less

DNA-Encoded Solid-Phase Synthesis: Encoding Language Design and Complex Oligomer Library Synthesis.

PubMed

MacConnell, Andrew B; McEnaney, Patrick J; Cavett, Valerie J; Paegel, Brian M

2015-09-14

The promise of exploiting combinatorial synthesis for small molecule discovery remains unfulfilled due primarily to the "structure elucidation problem": the back-end mass spectrometric analysis that significantly restricts one-bead-one-compound (OBOC) library complexity. The very molecular features that confer binding potency and specificity, such as stereochemistry, regiochemistry, and scaffold rigidity, are conspicuously absent from most libraries because isomerism introduces mass redundancy and diverse scaffolds yield uninterpretable MS fragmentation. Here we present DNA-encoded solid-phase synthesis (DESPS), comprising parallel compound synthesis in organic solvent and aqueous enzymatic ligation of unprotected encoding dsDNA oligonucleotides. Computational encoding language design yielded 148 thermodynamically optimized sequences with Hamming string distance ≥ 3 and total read length <100 bases for facile sequencing. Ligation is efficient (70% yield), specific, and directional over 6 encoding positions. A series of isomers served as a testbed for DESPS's utility in split-and-pool diversification. Single-bead quantitative PCR detected 9 × 10(4) molecules/bead and sequencing allowed for elucidation of each compound's synthetic history. We applied DESPS to the combinatorial synthesis of a 75,645-member OBOC library containing scaffold, stereochemical and regiochemical diversity using mixed-scale resin (160-μm quality control beads and 10-μm screening beads). Tandem DNA sequencing/MALDI-TOF MS analysis of 19 quality control beads showed excellent agreement (<1 ppt) between DNA sequence-predicted mass and the observed mass. DESPS synergistically unites the advantages of solid-phase synthesis and DNA encoding, enabling single-bead structural elucidation of complex compounds and synthesis using reactions normally considered incompatible with unprotected DNA. The widespread availability of inexpensive oligonucleotide synthesis, enzymes, DNA sequencing, and PCR

Intestinal Epithelial Cells Modulate Antigen-Presenting Cell Responses to Bacterial DNA

PubMed Central

Campeau, J. L.; Salim, S. Y.; Albert, E. J.; Hotte, N.

2012-01-01

Intestinal epithelial cells and antigen-presenting cells orchestrate mucosal innate immunity. This study investigated the role of bacterial DNA in modulating epithelial and bone marrow-derived antigen-presenting cells (BM-APCs) and subsequent T-lymphocyte responses. Murine MODE-K epithelial cells and BM-APCs were treated with DNA from either Bifidobacterium breve or Salmonella enterica serovar Dublin directly and under coculture conditions with CD4+ T cells. Apical stimulation of MODE-K cells with S. Dublin DNA enhanced secretion of cytokines from underlying BM-APCs and induced interleukin-17 (IL-17) and gamma interferon (IFN-γ) secretion from CD4+ T cells. Bacterial DNA isolated from either strain induced maturation and increased cytokine secretion from BM-APCs. Conditioned medium from S. Dublin-treated MODE-K cells elicited an increase in cytokine secretion similar to that seen for S. Dublin DNA. Treatment of conditioned medium from MODE-K cells with RNase and protease prevented the S. Dublin-induced increased cytokine secretion. Oral feeding of mice with B. breve DNA resulted in enhanced levels of colonic IL-10 and transforming growth factor β (TGFβ) compared with what was seen for mice treated with S. Dublin DNA. In contrast, feeding mice with S. Dublin DNA increased levels of colonic IL-17 and IL-12p70. T cells from S. Dublin DNA-treated mice secreted high levels of IL-12 and IFN-γ compared to controls and B. breve DNA-treated mice. These results demonstrate that intestinal epithelial cells are able to modulate subsequent antigen-presenting and T-cell responses to bacterial DNA with pathogenic but not commensal bacterial DNA inducing effector CD4+ T lymphocytes. PMID:22615241

Comparison of commercial DNA extraction kits for isolation and purification of bacterial and eukaryotic DNA from PAH-contaminated soils.

PubMed

Mahmoudi, Nagissa; Slater, Greg F; Fulthorpe, Roberta R

2011-08-01

Molecular characterization of the microbial populations of soils and sediments contaminated with polycyclic aromatic hydrocarbons (PAHs) is often a first step in assessing intrinsic biodegradation potential. However, soils are problematic for molecular analysis owing to the presence of organic matter, such as humic acids. Furthermore, the presence of contaminants, such as PAHs, can cause further challenges to DNA extraction, quantification, and amplification. The goal of our study was to compare the effectiveness of four commercial soil DNA extraction kits (UltraClean Soil DNA Isolation kit, PowerSoil DNA Isolation kit, PowerMax Soil DNA Isolation kit, and FastDNA SPIN kit) to extract pure, high-quality bacterial and eukaryotic DNA from PAH-contaminated soils. Six different contaminated soils were used to determine if there were any biases among the kits due to soil properties or level of contamination. Extracted DNA was used as a template for bacterial 16S rDNA and eukaryotic 18S rDNA amplifications, and PCR products were subsequently analyzed using denaturing gel gradient electrophoresis (DGGE). We found that the FastDNA SPIN kit provided significantly higher DNA yields for all soils; however, it also resulted in the highest levels of humic acid contamination. Soil texture and organic carbon content of the soil did not affect the DNA yield of any kit. Moreover, a liquid-liquid extraction of the DNA extracts found no residual PAHs, indicating that all kits were effective at removing contaminants in the extraction process. Although the PowerSoil DNA Isolation kit gave relatively low DNA yields, it provided the highest quality DNA based on successful amplification of both bacterial and eukaryotic DNA for all six soils. DGGE fingerprints among the kits were dramatically different for both bacterial and eukaryotic DNA. The PowerSoil DNA Isolation kit revealed multiple bands for each soil and provided the most consistent DGGE profiles among replicates for both

Effect of DNA extraction and sample preservation method on rumen bacterial population.

PubMed

Fliegerova, Katerina; Tapio, Ilma; Bonin, Aurelie; Mrazek, Jakub; Callegari, Maria Luisa; Bani, Paolo; Bayat, Alireza; Vilkki, Johanna; Kopečný, Jan; Shingfield, Kevin J; Boyer, Frederic; Coissac, Eric; Taberlet, Pierre; Wallace, R John

2014-10-01

The comparison of the bacterial profile of intracellular (iDNA) and extracellular DNA (eDNA) isolated from cow rumen content stored under different conditions was conducted. The influence of rumen fluid treatment (cheesecloth squeezed, centrifuged, filtered), storage temperature (RT, -80 °C) and cryoprotectants (PBS-glycerol, ethanol) on quality and quantity parameters of extracted DNA was evaluated by bacterial DGGE analysis, real-time PCR quantification and metabarcoding approach using high-throughput sequencing. Samples clustered according to the type of extracted DNA due to considerable differences between iDNA and eDNA bacterial profiles, while storage temperature and cryoprotectants additives had little effect on sample clustering. The numbers of Firmicutes and Bacteroidetes were lower (P < 0.01) in eDNA samples. The qPCR indicated significantly higher amount of Firmicutes in iDNA sample frozen with glycerol (P < 0.01). Deep sequencing analysis of iDNA samples revealed the prevalence of Bacteroidetes and similarity of samples frozen with and without cryoprotectants, which differed from sample stored with ethanol at room temperature. Centrifugation and consequent filtration of rumen fluid subjected to the eDNA isolation procedure considerably changed the ratio of molecular operational taxonomic units (MOTUs) of Bacteroidetes and Firmicutes. Intracellular DNA extraction using bead-beating method from cheesecloth sieved rumen content mixed with PBS-glycerol and stored at -80 °C was found as the optimal method to study ruminal bacterial profile. Copyright © 2013 Elsevier Ltd. All rights reserved.

Evaluating bacterial pathogen DNA preservation in museum osteological collections

PubMed Central

Barnes, Ian; Thomas, Mark G

2005-01-01

Reports of bacterial pathogen DNA sequences obtained from archaeological bone specimens raise the possibility of greatly improving our understanding of the history of infectious diseases. However, the survival of pathogen DNA over long time periods is poorly characterized, and scepticism remains about the reliability of these data. In order to explore the survival of bacterial pathogen DNA in bone specimens, we analysed samples from 59 eighteenth and twentieth century individuals known to have been infected with either Mycobacterium tuberculosis or Treponema pallidum. No reproducible evidence of surviving pathogen DNA was obtained, despite the use of extraction and PCR-amplification methods determined to be highly sensitive. These data suggest that previous studies need to be interpreted with caution, and we propose that a much greater emphasis is placed on understanding how pathogen DNA survives in archaeological material, and how its presence can be properly verified and used. PMID:16608682

Mechanism for CCC DNA synthesis in hepadnaviruses.

PubMed

Sohn, Ji A; Litwin, Samuel; Seeger, Christoph

2009-11-30

Hepadnavirus replication requires the synthesis of a covalently closed circular (CCC) DNA from the relaxed circular (RC) viral genome by an unknown mechanism. CCC DNA formation could require enzymatic activities of the viral reverse transcriptase (RT), or cellular DNA repair enzymes, or both. Physical mapping of the 5' and 3' ends of RC DNA and sequence analysis of CCC DNA revealed that CCC DNA synthesis requires the removal of the RT and an RNA oligomer from the 5' ends of minus and plus strand DNA, respectively, removal of sequences from the terminally redundant minus strand, completion of the less than full-length plus strand, and ligation of the ends. Two models have been proposed that could explain CCC DNA formation. The first (model 1) invokes a role for the RT to catalyze a cleavage-ligation reaction leading to the formation of a unit length minus strand in CCC DNA and a DNA repair reaction for the completion and ligation of plus strand DNA; the second (model 2) predicts that CCC DNA formation depends entirely on cellular DNA repair enzymes. To determine which mechanism is utilized, we developed cell lines expressing duck hepatitis B virus genomes carrying mutations permitting us to follow the fate of viral DNA sequences during their conversion from RC to CCC DNA. Our results demonstrated that the oligomer at the 5' end of minus strand DNA is completely or at least partially removed prior to CCC DNA synthesis. The results indicated that both RC DNA strands undergo DNA repair reactions carried out by the cellular DNA repair machinery as predicted by model 2. Thus, our study provided the basis for the identification of the cellular components required for CCC DNA formation.

Estimation of lactic acid bacterial cell number by DNA quantification.

PubMed

Ishii, Masaki; Matsumoto, Yasuhiko; Sekimizu, Kazuhisa

2018-01-01

Lactic acid bacteria are provided by fermented foods, beverages, medicines, and supplements. Because the beneficial effects of medicines and supplements containing functional lactic acid bacteria are related to the bacterial cell number, it is important to establish a simple method for estimating the total number of lactic acid bacterial cells in the products for quality control. Almost all of the lactic acid bacteria in the products are dead, however, making it difficult to estimate the total number of lactic acid bacterial cells in the products using a standard colony-counting method. Here we estimated the total lactic acid bacterial cell number in samples containing dead bacteria by quantifying the DNA. The number of viable Enterococcus faecalis 0831-07 cells decreased to less than 1 × 10 -8 by 15 min of heat treatment at 80°C. The amount of extracted DNA from heat-treated cells was 78% that of non-heated cells. The number of viable Lactobacillus paraplantarum 11-1 cells decreased to 1 × 10 -4 after 4 days culture. The amount of extracted DNA of the long-cultured cells, however, was maintained at 97%. These results suggest that cell number of lactic acid bacteria killed by heat-treatment or long-term culture can be estimated by DNA quantification.

Plasma Bacterial and Mitochondrial DNA Distinguish Bacterial Sepsis from Sterile SIRS and Quantify Inflammatory Tissue Injury in Nonhuman Primates

PubMed Central

Sursal, Tolga; Stearns-Kurosawa, Deborah J; Itagaki, Kiyoshi; Oh, Sun-Young; Sun, Shiqin; Kurosawa, Shinichiro; Hauser, Carl J

2012-01-01

Systemic inflammatory response syndrome (SIRS) is a fundamental host response common to bacterial infection and sterile tissue injury. SIRS can cause organ dysfunction and death but its mechanisms are incompletely understood. Moreover, SIRS can progress to organ failure or death despite being sterile or after control of the inciting infection. Biomarkers discriminating between sepsis, sterile SIRS and post-infective SIRS would therefore help direct care. Circulating mitochondrial DNA (mtDNA) is a damage-associated molecular pattern (DAMP) reflecting cellular injury. Circulating bacterial 16S-DNA (bDNA) is a pathogen-associated pattern (PAMP) reflecting ongoing infection. We developed qPCR assays to quantify these markers and predicted their plasma levels might help distinguish sterile injury from infection. To study these events in primates we assayed banked serum from papio baboons that had undergone a brief challenge of intravenous Bacillus anthracis deltaSterne (modified to remove toxins) followed by antibiotics (anthrax) that causes organ failure and death. To investigate the progression of sepsis to “severe” sepsis and death we studied animals where anthrax was pretreated with drotrecogin alfa (aPC), which attenuates sepsis in baboons. We also contrasted lethal anthrax bacteremia against non-lethal E.coli bacteremia and against sterile tissue injury from Shiga-like toxin-1 (Stx1). bDNA and mtDNA levels in timed samples were correlated with blood culture results and assays of organ function. Sterile injury by Stx1 increased mtDNA but bDNA was undetectable: consistent with the absence of infection. The bacterial challenges caused parallel early bDNA and mtDNA increases, but bDNA detected pathogens even after bacteria were undetectable by culture. Sub-lethal E.coli challenge only caused transient rises in mtDNA consistent with a self-limited injury. In lethal anthrax challenge (n=4) bDNA increased transiently but mtDNA levels remained elevated until death

Strand-Specific Analysis of DNA Synthesis and Proteins Association with DNA Replication Forks in Budding Yeast.

PubMed

Yu, Chuanhe; Gan, Haiyun; Zhang, Zhiguo

2018-01-01

DNA replication initiates at DNA replication origins after unwinding of double-strand DNA(dsDNA) by replicative helicase to generate single-stranded DNA (ssDNA) templates for the continuous synthesis of leading-strand and the discontinuous synthesis of lagging-strand. Therefore, methods capable of detecting strand-specific information will likely yield insight into the association of proteins at leading and lagging strand of DNA replication forks and the regulation of leading and lagging strand synthesis during DNA replication. The enrichment and Sequencing of Protein-Associated Nascent DNA (eSPAN), which measure the relative amounts of proteins at nascent leading and lagging strands of DNA replication forks, is a step-wise procedure involving the chromatin immunoprecipitation (ChIP) of a protein of interest followed by the enrichment of protein-associated nascent DNA through BrdU immunoprecipitation. The isolated ssDNA is then subjected to strand-specific sequencing. This method can detect whether a protein is enriched at leading or lagging strand of DNA replication forks. In addition to eSPAN, two other strand-specific methods, (ChIP-ssSeq), which detects potential protein-ssDNA binding and BrdU-IP-ssSeq, which can measure synthesis of both leading and lagging strand, were developed along the way. These methods can provide strand-specific and complementary information about the association of the target protein with DNA replication forks as well as synthesis of leading and lagging strands genome wide. Below, we describe the detailed eSPAN, ChIP-ssSeq, and BrdU-IP-ssSeq protocols.

DNA synthesis inhibitors for the treatment of gastrointestinal cancer.

PubMed

Yasui, Hiroshi; Tsurita, Giichiro; Imai, Kohzoh

2014-11-01

Intensive laboratory, preclinical and clinical studies have identified and validated molecular targets in cancers, leading to a shift toward the development of novel, rationally designed and specific therapeutic agents. However, gastrointestinal cancers continue to have a poor prognosis, largely due to drug resistance. Here, we discuss the current understanding of DNA synthesis inhibitors and their mechanisms of action for the treatment of gastrointestinal malignancies. Conventional agents, including DNA synthesis inhibitors such as fluoropyrimidines and platinum analogs, remain the most effective therapeutics and are the standards against which new drugs are compared. Novel DNA synthesis inhibitors for the treatment of gastrointestinal malignancies include a combination of the antimetabolite TAS-102, which consists of trifluorothymidine with a thymidine phosphorylase inhibitor, and a novel micellar formulation of cisplatin NC-6004 that uses a nanotechnology-based drug delivery system. The challenges of translational cancer research using DNA synthesis inhibitors include the identification of drugs that are specific to tumor cells to reduce toxicity and increase antitumor efficacy, biomarkers to predict pharmacological responses to chemotherapeutic drugs, identification of ways to overcome drug resistance and development of novel combination therapies with DNA synthesis inhibitors and other cancer therapies, such as targeted molecular therapeutics. Here, we discuss the current understanding of DNA synthesis inhibitors and their mechanisms of action for the treatment of gastrointestinal malignancies.

Heat Induction of Prophage φ105 in Bacillus subtilis: Replication of the Bacterial and Bacteriophage Genomes

PubMed Central

Armentrout, Richard W.; Rutberg, Lars

1971-01-01

A temperature-inducible mutant of temperate Bacillus bacteriophage φ105 was isolated and used to lysogenize a thymine-requiring strain of Bacillus subtilis 168. Synthesis of phage and bacterial deoxyribonucleic acid (DNA) was studied by sucrose gradient centrifugation and density equilibrium centrifugation of DNA extracted from induced bacteria. The distribution of DNA in the gradients was measured by differential isotope and density labeling of DNA before and after induction and by measuring the biological activity of the DNA in genetic transformation, in rescue of phage markers, and in infectivity assays. At early times after induction, but after at least one round of replication, phage DNA remains associated with high-molecular-weight DNA, whereas, later in the infection, phage DNA is associated with material of decreasing molecular weight. Genetic linkage between phage and bacterial markers can be demonstrated in replicated DNA from induced cells. Prophage induction is shown to affect replication of the bacterial chromosome. The overall rate of replication of prelabeled bacterial DNA is identical in temperature-induced lysogenics and in “mock-induced” wild-type φ105 lysogenics. The rate of replication of the bacterial marker phe-1 (and also of nia-38), located close to the prophage in direction of the terminus of the bacterial chromosome, is increased in induced cells, however, relative to other bacterial markers tested. In temperature-inducible lysogenics, where the prophage also carries a ts mutation which blocks phage DNA synthesis, replication of both phage and bacterial DNA stops after about 50% of the phage DNA has replicated once. The results of these experiments suggest that the prophage is not initially excised in induced cells, but rather it is specifically replicated in situ together with adjacent parts of the bacterial chromosome. PMID:5002012

Characterization of human translesion DNA synthesis across a UV-induced DNA lesion

PubMed Central

Hedglin, Mark; Pandey, Binod; Benkovic, Stephen J

2016-01-01

Translesion DNA synthesis (TLS) during S-phase uses specialized TLS DNA polymerases to replicate a DNA lesion, allowing stringent DNA synthesis to resume beyond the offending damage. Human TLS involves the conjugation of ubiquitin to PCNA clamps encircling damaged DNA and the role of this post-translational modification is under scrutiny. A widely-accepted model purports that ubiquitinated PCNA recruits TLS polymerases such as pol η to sites of DNA damage where they may also displace a blocked replicative polymerase. We provide extensive quantitative evidence that the binding of pol η to PCNA and the ensuing TLS are both independent of PCNA ubiquitination. Rather, the unique properties of pols η and δ are attuned to promote an efficient and passive exchange of polymerases during TLS on the lagging strand. DOI: http://dx.doi.org/10.7554/eLife.19788.001 PMID:27770570

Recovery and identification of bacterial DNA from illicit drugs.

PubMed

Cho, Kaymann T; Richardson, Michelle M; Kirkbride, K Paul; McNevin, Dennis; Nelson, Michelle; Pianca, Dennis; Roffey, Paul; Gahan, Michelle E

2014-02-01

Bacterial infections, including Bacillus anthracis (anthrax), are a common risk associated with illicit drug use, particularly among injecting drug users. There is, therefore, an urgent need to survey illicit drugs used for injection for the presence of bacteria and provide valuable information to health and forensic authorities. The objectives of this study were to develop a method for the extraction of bacterial DNA from illicit drugs and conduct a metagenomic survey of heroin and methamphetamine seized in the Australian Capital Territory during 2002-2011 for the presence of pathogens. Trends or patterns in drug contamination and their health implications for injecting drug users were also investigated. Methods based on the ChargeSwitch(®)gDNA mini kit (Invitrogen), QIAamp DNA extraction mini kit (QIAGEN) with and without bead-beating, and an organic phenol/chloroform extraction with ethanol precipitation were assessed for the recovery efficiency of both free and cellular bacterial DNA. Bacteria were identified using polymerase chain reaction and electrospray ionization-mass spectrometry (PCR/ESI-MS). An isopropanol pre-wash to remove traces of the drug and diluents, followed by a modified ChargeSwitch(®) method, was found to efficiently lyse cells and extract free and cellular DNA from Gram-positive and Gram-negative bacteria in heroin and methamphetamine which could then be identified by PCR/ESI-MS. Analysis of 12 heroin samples revealed the presence of DNA from species of Comamonas, Weissella, Bacillus, Streptococcus and Arthrobacter. No organisms were detected in the nine methamphetamine samples analysed. This study develops a method to extract and identify Gram-positive and Gram-negative bacteria from illicit drugs and demonstrates the presence of a range of bacterial pathogens in seized drug samples. These results will prove valuable for future work investigating trends or patterns in drug contamination and their health implications for injecting drug

Bacterial DNA in water and dialysate: detection and significance for patient outcomes.

PubMed

Handelman, Garry J; Megdal, Peter A; Handelman, Samuel K

2009-01-01

The fluid used for hemodialysis may contain DNA fragments from bacteria, which could be harmful for patient outcomes. DNA fragments from bacteria, containing the nonmethylated CpG motif, can trigger inflammation through the monocyte and lymphocyte Toll-like receptor 9, and these DNA fragments have been observed in dialysate. The fragments may transfer across the dialyzer into the patient's bloodstream during hemodialysis treatment. During hemodiafiltration, the fragments would be introduced directly into the bloodstream. The DNA fragments may arise from biofilm in the pipes of the water system, from growth of bacteria in the water, or as contaminants in the bicarbonate and salt mixture used for preparation of dialysate. Current filtration methods, such as Diasafe filters, are not able to remove these fragments. It would be prudent to seek to reduce or eliminate these contaminants. However, the cost and effort of decreasing bacterial DNA content may ultimately require substantial facility improvements; we therefore need to fund research studies to determine if modifications to reduce bacterial DNA content are clinically warranted. This research will require methods to accurately determine the species of bacteria that contribute the DNA, since this information will allow the source to be established as biofilm, bicarbonate mixtures, or other problems in the dialysis system such as bacterial growth or leakage during water preparation. In this review, the evidence for bacterial DNA fragments will be examined and suggestions for further studies will be described.

Autoclave method for rapid preparation of bacterial PCR-template DNA.

PubMed

Simmon, Keith E; Steadman, Dewey D; Durkin, Sarah; Baldwin, Amy; Jeffrey, Wade H; Sheridan, Peter; Horton, Rene; Shields, Malcolm S

2004-02-01

An autoclave method for preparing bacterial DNA for PCR template is presented, it eliminates the use of detergents, organic solvents, and mechanical cellular disruption approaches, thereby significantly reducing processing time and costs while increasing reproducibility. Bacteria are lysed by rapid heating and depressurization in an autoclave. The lysate, cleared by microcentrifugation, was either used directly in the PCR reaction, or concentrated by ultrafiltration. This approach was compared with seven established methods of DNA template preparation from four bacterial sources which included boiling Triton X-100 and SDS, bead beating, lysozyme/proteinase K, and CTAB lysis method components. Bacteria examined were Enterococcus and Escherichia coli, a natural marine bacterial community and an Antarctic cyanobacterial-mat. DNAs were tested for their suitability as PCR templates by repetitive element random amplified polymorphic DNA (RAPD) and denaturing gradient gel electrophoresis (DGGE) analysis. The autoclave method produced PCR amplifiable template comparable or superior to the other methods, with greater reproducibility, much shorter processing time, and at a significantly lower cost.

Structure of human DNA polymerase iota and the mechanism of DNA synthesis.

PubMed

Makarova, A V; Kulbachinskiy, A V

2012-06-01

Cellular DNA polymerases belong to several families and carry out different functions. Highly accurate replicative DNA polymerases play the major role in cell genome replication. A number of new specialized DNA polymerases were discovered at the turn of XX-XXI centuries and have been intensively studied during the last decade. Due to the special structure of the active site, these enzymes efficiently perform synthesis on damaged DNA but are characterized by low fidelity. Human DNA polymerase iota (Pol ι) belongs to the Y-family of specialized DNA polymerases and is one of the most error-prone enzymes involved in DNA synthesis. In contrast to other DNA polymerases, Pol ι is able to use noncanonical Hoogsteen interactions for nucleotide base pairing. This allows it to incorporate nucleotides opposite various lesions in the DNA template that impair Watson-Crick interactions. Based on the data of X-ray structural analysis of Pol ι in complexes with various DNA templates and dNTP substrates, we consider the structural peculiarities of the Pol ι active site and discuss possible mechanisms that ensure the unique behavior of the enzyme on damaged and undamaged DNA.

Electromagnetic signals are produced by aqueous nanostructures derived from bacterial DNA sequences.

PubMed

Montagnier, Luc; Aïssa, Jamal; Ferris, Stéphane; Montagnier, Jean-Luc; Lavallée, Claude

2009-06-01

A novel property of DNA is described: the capacity of some bacterial DNA sequences to induce electromagnetic waves at high aqueous dilutions. It appears to be a resonance phenomenon triggered by the ambient electromagnetic background of very low frequency waves. The genomic DNA of most pathogenic bacteria contains sequences which are able to generate such signals. This opens the way to the development of highly sensitive detection system for chronic bacterial infections in human and animal diseases.

Design and Synthesis of Biaryl DNA-Encoded Libraries.

PubMed

Ding, Yun; Franklin, G Joseph; DeLorey, Jennifer L; Centrella, Paolo A; Mataruse, Sibongile; Clark, Matthew A; Skinner, Steven R; Belyanskaya, Svetlana

2016-10-10

DNA-encoded library technology (ELT) is a powerful tool for the discovery of new small-molecule ligands to various protein targets. Here we report the design and synthesis of biaryl DNA-encoded libraries based on the scaffold of 5-formyl 3-iodobenzoic acid. Three reactions on DNA template, acylation, Suzuki-Miyaura coupling and reductive amination, were applied in the library synthesis. The three cycle library of 3.5 million diversity has delivered potent hits for phosphoinositide 3-kinase α (PI3Kα).

Plasma bacterial and mitochondrial DNA distinguish bacterial sepsis from sterile systemic inflammatory response syndrome and quantify inflammatory tissue injury in nonhuman primates.

PubMed

Sursal, Tolga; Stearns-Kurosawa, Deborah J; Itagaki, Kiyoshi; Oh, Sun-Young; Sun, Shiqin; Kurosawa, Shinichiro; Hauser, Carl J

2013-01-01

Systemic inflammatory response syndrome (SIRS) is a fundamental host response common to bacterial infection and sterile tissue injury. Systemic inflammatory response syndrome can cause organ dysfunction and death, but its mechanisms are incompletely understood. Moreover, SIRS can progress to organ failure or death despite being sterile or after control of the inciting infection. Biomarkers discriminating between sepsis, sterile SIRS, and postinfective SIRS would therefore help direct care. Circulating mitochondrial DNA (mtDNA) is a damage-associated molecular pattern reflecting cellular injury. Circulating bacterial 16S DNA (bDNA) is a pathogen-associated pattern (PAMP) reflecting ongoing infection. We developed quantitative polymerase chain reaction assays to quantify these markers, and predicting their plasma levels might help distinguish sterile injury from infection. To study these events in primates, we assayed banked serum from Papio baboons that had undergone a brief challenge of intravenous Bacillus anthracis delta Sterne (modified to remove toxins) followed by antibiotics (anthrax) that causes organ failure and death. To investigate the progression of sepsis to "severe" sepsis and death, we studied animals where anthrax was pretreated with drotrecogin alfa (activated protein C), which attenuates sepsis in baboons. We also contrasted lethal anthrax bacteremia against nonlethal E. coli bacteremia and against sterile tissue injury from Shiga-like toxin 1. Bacterial DNA and mtDNA levels in timed samples were correlated with blood culture results and assays of organ function. Sterile injury by Shiga-like toxin 1 increased mtDNA, but bDNA was undetectable: consistent with the absence of infection. The bacterial challenges caused parallel early bDNA and mtDNA increases, but bDNA detected pathogens even after bacteria were undetectable by culture. Sublethal E. coli challenge only caused transient rises in mtDNA consistent with a self-limited injury. In lethal

Chemically synthesized silver nanoparticles as cell lysis agent for bacterial genomic DNA isolation

NASA Astrophysics Data System (ADS)

Goswami, Gunajit; Boruah, Himangshu; Gautom, Trishnamoni; Jyoti Hazarika, Dibya; Barooah, Madhumita; Boro, Robin Chandra

2017-12-01

Silver nanoparticles (AgNPs) have seen a recent spurt of use in varied fields of science. In this paper, we showed a novel application of AgNP as a promising microbial cell-lysis agent for genomic DNA isolation. We utilized chemically synthesized AgNPs for lysing bacterial cells to isolate their genomic DNA. The AgNPs efficiently lysed bacterial cells to yield good quality DNA that could be subsequently used for several molecular biology works.

Deep-sea vent phage DNA polymerase specifically initiates DNA synthesis in the absence of primers.

PubMed

Zhu, Bin; Wang, Longfei; Mitsunobu, Hitoshi; Lu, Xueling; Hernandez, Alfredo J; Yoshida-Takashima, Yukari; Nunoura, Takuro; Tabor, Stanley; Richardson, Charles C

2017-03-21

A DNA polymerase is encoded by the deep-sea vent phage NrS-1. NrS-1 has a unique genome organization containing genes that are predicted to encode a helicase and a single-stranded DNA (ssDNA)-binding protein. The gene for an unknown protein shares weak homology with the bifunctional primase-polymerases (prim-pols) from archaeal plasmids but is missing the zinc-binding domain typically found in primases. We show that this gene product has efficient DNA polymerase activity and is processive in DNA synthesis in the presence of the NrS-1 helicase and ssDNA-binding protein. Remarkably, this NrS-1 DNA polymerase initiates DNA synthesis from a specific template DNA sequence in the absence of any primer. The de novo DNA polymerase activity resides in the N-terminal domain of the protein, whereas the C-terminal domain enhances DNA binding.

Initiation and Reinitiation of DNA Synthesis during Replication of Bacteriophage T7*

PubMed Central

Dressler, David; Wolfson, John; Magazin, Marilyn

1972-01-01

In its first round of replication, the T7 chromosome follows a simple pattern, as viewed in the electron microscope. The iniation of DNA synthesis occurs about 17% from the genetic left end of the viral DNA rod. Bidirectional DNA synthesis from this origin then generates a replicating intermediate that we call an “eye form.” In the eye form, when synthesis in the leftward direction reaches the left end of the viral chromosome, the molecule is converted into a Y-shaped replicating rod. The remaining growing point continues synthesis rightward, until presumably it runs off the right end of the DNA rod, thus terminating replication. Numerous T7 chromosomes were found in which a second round of replication had begun before the first round had finished. Analysis of these reinitiated DNA molecules showed that the second round of replication, like the first, began 17% from the end of the chromosome and involved bidirectional DNA synthesis. Images PMID:4554539

Effect of 2',3'-dideoxythymidine-5'-triphosphate on HeLa cell in vitro DNA synthesis: evidence that DNA polymerase alpha is the only polymerase required for cellular DNA replication.

PubMed Central

Waqar, M A; Evans, M J; Huberman, J A

1978-01-01

We have studied the effects of the nucleotide analogue, 2',3'-dideoxythymidine-5'-triphosphate (ddTTP) on replicative DNA synthesis in HeLa cell lysates. As previously demonstrated (1), such lysates carry out extensive DNA synthesis in vitro, at rates and in a fashion similar to in vivo DNA replication. We report here that all aspects of DNA synthesis in such lysates (total dNTP incorporation, elongation of continuous nascent strands, and the initiation, elongation, and joining of Okazaki pieces) are only slightly inhibited by concentrations of ddTTP as high as 100-500 micrometer when the dTTP concentration is maintained at 10 micrometer. This finding is consistent with the report by Edenberg, Anderson, and DePamphilis (2) that all aspects of replicative in vitro simian virus 40 DNA synthesis are also resistant to ddTTP. We also find, in agreement with Edenberg, Anderson, and DePamphilis (2), that DNA synthesis catalyzed by DNA polymerases beta or gamma is easily inhibited by ddTTP, while synthesis catalyzed by DNA polymerase alpha is very resistant. These observations suggest that DNA polymerase alpha may be the only DNA polymerase required for all aspects of cellular DNA synthesis. PMID:673840

DNA polymerase-α regulates type I interferon activation through cytosolic RNA:DNA synthesis

PubMed Central

Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J.; Xing, Chao; Wang, Richard C.; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K.; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R.; Burstein, Ezra

2016-01-01

Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations disrupting nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts expression of POLA1, the gene encoding the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency results in increased type I interferon production. This enzyme is necessary for RNA:DNA primer synthesis during DNA replication and strikingly, POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Altogether, this work identified POLA1 as a critical regulator of the type I interferon response. PMID:27019227

Strand displacement synthesis by yeast DNA polymerase ε.

PubMed

Ganai, Rais A; Zhang, Xiao-Ping; Heyer, Wolf-Dietrich; Johansson, Erik

2016-09-30

DNA polymerase ε (Pol ε) is a replicative DNA polymerase with an associated 3'-5' exonuclease activity. Here, we explored the capacity of Pol ε to perform strand displacement synthesis, a process that influences many DNA transactions in vivo We found that Pol ε is unable to carry out extended strand displacement synthesis unless its 3'-5' exonuclease activity is removed. However, the wild-type Pol ε holoenzyme efficiently displaced one nucleotide when encountering double-stranded DNA after filling a gap or nicked DNA. A flap, mimicking a D-loop or a hairpin structure, on the 5' end of the blocking primer inhibited Pol ε from synthesizing DNA up to the fork junction. This inhibition was observed for Pol ε but not with Pol δ, RB69 gp43 or Pol η. Neither was Pol ε able to extend a D-loop in reconstitution experiments. Finally, we show that the observed strand displacement synthesis by exonuclease-deficient Pol ε is distributive. Our results suggest that Pol ε is unable to extend the invading strand in D-loops during homologous recombination or to add more than two nucleotides during long-patch base excision repair. Our results support the hypothesis that Pol ε participates in short-patch base excision repair and ribonucleotide excision repair. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Strand displacement synthesis by yeast DNA polymerase ε

PubMed Central

Ganai, Rais A.; Zhang, Xiao-Ping; Heyer, Wolf-Dietrich; Johansson, Erik

2016-01-01

DNA polymerase ε (Pol ε) is a replicative DNA polymerase with an associated 3′–5′ exonuclease activity. Here, we explored the capacity of Pol ε to perform strand displacement synthesis, a process that influences many DNA transactions in vivo. We found that Pol ε is unable to carry out extended strand displacement synthesis unless its 3′–5′ exonuclease activity is removed. However, the wild-type Pol ε holoenzyme efficiently displaced one nucleotide when encountering double-stranded DNA after filling a gap or nicked DNA. A flap, mimicking a D-loop or a hairpin structure, on the 5′ end of the blocking primer inhibited Pol ε from synthesizing DNA up to the fork junction. This inhibition was observed for Pol ε but not with Pol δ, RB69 gp43 or Pol η. Neither was Pol ε able to extend a D-loop in reconstitution experiments. Finally, we show that the observed strand displacement synthesis by exonuclease-deficient Pol ε is distributive. Our results suggest that Pol ε is unable to extend the invading strand in D-loops during homologous recombination or to add more than two nucleotides during long-patch base excision repair. Our results support the hypothesis that Pol ε participates in short-patch base excision repair and ribonucleotide excision repair. PMID:27325747

Activation of the immune system by bacterial CpG-DNA

PubMed Central

Häcker, Georg; Redecke, Vanessa; Häcker, Hans

2002-01-01

The past decade has seen a remarkable process of refocusing in immunology. Cells of the innate immune system, especially macrophages and dendritic cells, have been at the centre of this process. These cells had been regarded by some scientists as non-specific, sometimes perhaps even confined to the menial job of serving T cells by scavenging antigen and presenting it to the sophisticated adaptive immune system. Only over the last few years has it become unequivocally clear that cells of the innate immunity hold, by variation of context and mode of antigen presentation, the power of shaping an adaptive immune response. The innate immune response, in turn, is to a significant degree the result of stimulation by so-called pathogen-associated molecular patterns (PAMPs). One compound with high stimulatory potential for the innate immune system is bacterial DNA. Here we will review recent evidence that bacterial DNA should be ranked with other PAMPs such as lipopolysaccharide (LPS) and lipoteichoic acid. We will further review our present knowledge of DNA recognition and DNA-dependent signal transduction in cells of the immune system. PMID:11918685

Computational method and system for modeling, analyzing, and optimizing DNA amplification and synthesis

DOEpatents

Vandersall, Jennifer A.; Gardner, Shea N.; Clague, David S.

2010-05-04

A computational method and computer-based system of modeling DNA synthesis for the design and interpretation of PCR amplification, parallel DNA synthesis, and microarray chip analysis. The method and system include modules that address the bioinformatics, kinetics, and thermodynamics of DNA amplification and synthesis. Specifically, the steps of DNA selection, as well as the kinetics and thermodynamics of DNA hybridization and extensions, are addressed, which enable the optimization of the processing and the prediction of the products as a function of DNA sequence, mixing protocol, time, temperature and concentration of species.

Elasticity-mediated nematiclike bacterial organization in model extracellular DNA matrix.

PubMed

Smalyukh, Ivan I; Butler, John; Shrout, Joshua D; Parsek, Matthew R; Wong, Gerard C L

2008-09-01

DNA is a common extracellular matrix component of bacterial biofilms. We find that bacteria can spontaneously order in a matrix of aligned concentrated DNA, in which rod-shaped cells of Pseudomonas aeruginosa follow the orientation of extended DNA chains. The alignment of bacteria is ensured by elasticity and liquid crystalline properties of the DNA matrix. These findings show how behavior of planktonic bacteria may be modified in extracellular polymeric substances of biofilms and illustrate the potential of using complex fluids to manipulate embedded nanosized and microsized active particles.

Transposon facilitated DNA sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berg, D.E.; Berg, C.M.; Huang, H.V.

1990-01-01

The purpose of this research is to investigate and develop methods that exploit the power of bacterial transposable elements for large scale DNA sequencing: Our premise is that the use of transposons to put primer binding sites randomly in target DNAs should provide access to all portions of large DNA fragments, without the inefficiencies of methods involving random subcloning and attendant repetitive sequencing, or of sequential synthesis of many oligonucleotide primers that are used to match systematically along a DNA molecule. Two unrelated bacterial transposons, Tn5 and {gamma}{delta}, are being used because they have both proven useful for molecular analyses,more » and because they differ sufficiently in mechanism and specificity of transposition to merit parallel development.« less

Identification of Bacterial Species in Kuwaiti Waters Through DNA Sequencing

NASA Astrophysics Data System (ADS)

Chen, K.

2017-01-01

With an objective of identifying the bacterial diversity associated with ecosystem of various Kuwaiti Seas, bacteria were cultured and isolated from 3 water samples. Due to the difficulties for cultured and isolated fecal coliforms on the selective agar plates, bacterial isolates from marine agar plates were selected for molecular identification. 16S rRNA genes were successfully amplified from the genome of the selected isolates using Universal Eubacterial 16S rRNA primers. The resulted amplification products were subjected to automated DNA sequencing. Partial 16S rDNA sequences obtained were compared directly with sequences in the NCBI database using BLAST as well as with the sequences available with Ribosomal Database Project (RDP).

A reproducible and scalable procedure for preparing bacterial extracts for cell-free protein synthesis.

PubMed

Katsura, Kazushige; Matsuda, Takayoshi; Tomabechi, Yuri; Yonemochi, Mayumi; Hanada, Kazuharu; Ohsawa, Noboru; Sakamoto, Kensaku; Takemoto, Chie; Shirouzu, Mikako

2017-11-01

Cell-free protein synthesis is a useful method for preparing proteins for functional or structural analyses. However, batch-to-batch variability with regard to protein synthesis activity remains a problem for large-scale production of cell extract in the laboratory. To address this issue, we have developed a novel procedure for large-scale preparation of bacterial cell extract with high protein synthesis activity. The developed procedure comprises cell cultivation using a fermentor, harvesting and washing of cells by tangential flow filtration, cell disruption with high-pressure homogenizer and continuous diafiltration. By optimizing and combining these methods, ∼100 ml of the cell extract was prepared from 150 g of Escherichia coli cells. The protein synthesis activities, defined as the yield of protein per unit of absorbance at 260 nm of the cell extract, were shown to be reproducible, and the average activity of several batches was twice that obtained using a previously reported method. In addition, combinatorial use of the high-pressure homogenizer and diafiltration increased the scalability, indicating that the cell concentration at disruption varies from 0.04 to 1 g/ml. Furthermore, addition of Gam protein and examinations of the N-terminal sequence rendered the extract prepared here useful for rapid screening with linear DNA templates. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

RNA-primed complementary-sense DNA synthesis of the geminivirus African cassava mosaic virus.

PubMed Central

Saunders, K; Lucy, A; Stanley, J

1992-01-01

The plant DNA virus African cassava mosaic virus (ACMV) is believed to replicate by a rolling circle mechanism. To investigate complementary-sense DNA (lagging strand) synthesis, we have analysed the heterogenous form of complementary-sense DNA (H3 DNA) from infected Nicotiana benthamiana by two-dimensional agarose gel electrophoresis and blot hybridisation. The presence of an RNA moeity is demonstrated by comparison of results for nucleic acids resolved on neutral/alkaline and neutral/formamide gels, suggesting that complementary-sense DNA synthesis on the virus-sense single-stranded DNA template is preceded by the synthesis of an RNA primer. Hybridisation with probes to specific parts of ACMV DNA A genome indicates that synthesis of the putative RNA primer initiates between nucleotides 2581-221, a region that includes intergenic sequences that have been implicated in geminivirus DNA replication and the control of gene expression. Images PMID:1475192

Evaluation of Two Matrices for Long-Term, Ambient Storage of Bacterial DNA.

PubMed

Miernyk, Karen M; DeByle, Carolynn K; Rudolph, Karen M

2017-12-01

Culture-independent molecular analyses allow researchers to identify diverse microorganisms. This approach requires microbiological DNA repositories. The standard for DNA storage is liquid nitrogen or ultralow freezers. These use large amounts of space, are costly to operate, and could fail. Room temperature DNA storage is a viable alternative. In this study, we investigated storage of bacterial DNA using two ambient storage matrices, Biomatrica DNAstable ® Plus and GenTegra ® DNA. We created crude and clean DNA extracts from five Streptococcus pneumoniae isolates. Extracts were stored at -30°C (our usual DNA storage temperature), 25°C (within the range of temperatures recommended for the products), and 50°C (to simulate longer storage time). Samples were stored at -30°C with no product and dried at 25°C and 50°C with no product, in Biomatrica DNAstable Plus or GenTegra DNA. We analyzed the samples after 0, 1, 2, 4, 8, 16, 32, and 64 weeks using the Nanodrop 1000 to determine the amount of DNA in each aliquot and by real-time PCR for the S. pneumoniae genes lytA and psaA. Using a 50°C storage temperature, we simulated 362 weeks of 25°C storage. The average amount of DNA in aliquots stored with a stabilizing matrix was 103%-116% of the original amount added to the tubes. This is similar to samples stored at -30°C (average 102%-121%). With one exception, samples stored with a stabilizing matrix had no change in lytA or psaA cycle threshold (Ct) value over time (Ct range ≤2.9), similar to samples stored at -30°C (Ct range ≤3.0). Samples stored at 25°C with no stabilizing matrix had Ct ranges of 2.2-5.1. DNAstable Plus and GenTegra DNA can protect dried bacterial DNA samples stored at room temperature with similar effectiveness as at -30°C. It is not effective to store bacterial DNA at room temperature without a stabilizing matrix.

Bacterial DNA induces pulmonary damage via TLR-9 through cross-talk with neutrophils.

PubMed

Itagaki, Kiyoshi; Adibnia, Yasaman; Sun, Shiqin; Zhao, Cong; Sursal, Tolga; Chen, Yu; Junger, Wolfgang; Hauser, Carl J

2011-12-01

Bacterial DNA (bDNA) contains hypomethylated "CpG" repeats that can be recognized by Toll-like receptor 9 (TLR-9) as a pathogen-associated molecular pattern. The ability of bDNA to initiate lung injury via TLR-9 has been inferred on the basis of studies using artificial CpG DNA. But the role of authentic bDNA in lung injury is still unknown. Moreover, the mechanisms by which CpG DNA species can lead to pulmonary injury are unknown, although neutrophils (PMNs) are thought to play a key role in the genesis of septic acute lung injury. We evaluated the effects of bDNA on PMN-endothelial cell (EC) interactions thought critical for initiation of acute lung injury. Using a biocapacitance system to monitor real-time changes in endothelial permeability, we demonstrate here that bDNA causes EC permeability in a dose-dependent manner uniquely in the presence of PMNs. These permeability changes are inhibited by chloroquine, suggesting TLR-9 dependency. When PMNs were preincubated with bDNA and applied to ECs or when bDNA was applied to ECs without PMNs, no permeability changes were detected. To study the underlying mechanisms, we evaluated the effects of bDNA on PMN-EC adherence. Bacterial DNA significantly increased PMN adherence to ECs in association with upregulated adhesion molecules in both cell types. Taken together, our results strongly support the conclusion that bDNA can initiate lung injury by stimulating PMN-EC adhesive interactions predisposing to endothelial permeability. Bacterial DNA stimulation of TLR-9 appears to promote enhanced gene expression of adhesion molecules in both cell types. This leads to PMN-EC cross-talk, which is required for injury to occur.

Attenuated Shigella as a DNA Delivery Vehicle for DNA-Mediated Immunization

NASA Astrophysics Data System (ADS)

Sizemore, Donata R.; Branstrom, Arthur A.; Sadoff, Jerald C.

1995-10-01

Direct inoculation of DNA, in the form of purified bacterial plasmids that are unable to replicate in mammalian cells but are able to direct cell synthesis of foreign proteins, is being explored as an approach to vaccine development. Here, a highly attenuated Shigella vector invaded mammalian cells and delivered such plasmids into the cytoplasm of cells, and subsequent production of functional foreign protein was measured. Because this Shigella vector was designed to deliver DNA to colonic mucosa, the method is a potential basis for oral and other mucosal DNA immunization and gene therapy strategies.

Archaeal replicative primases can perform translesion DNA synthesis.

PubMed

Jozwiakowski, Stanislaw K; Borazjani Gholami, Farimah; Doherty, Aidan J

2015-02-17

DNA replicases routinely stall at lesions encountered on the template strand, and translesion DNA synthesis (TLS) is used to rescue progression of stalled replisomes. This process requires specialized polymerases that perform translesion DNA synthesis. Although prokaryotes and eukaryotes possess canonical TLS polymerases (Y-family Pols) capable of traversing blocking DNA lesions, most archaea lack these enzymes. Here, we report that archaeal replicative primases (Pri S, primase small subunit) can also perform TLS. Archaeal Pri S can bypass common oxidative DNA lesions, such as 8-Oxo-2'-deoxyguanosines and UV light-induced DNA damage, faithfully bypassing cyclobutane pyrimidine dimers. Although it is well documented that archaeal replicases specifically arrest at deoxyuracils (dUs) due to recognition and binding to the lesions, a replication restart mechanism has not been identified. Here, we report that Pri S efficiently replicates past dUs, even in the presence of stalled replicase complexes, thus providing a mechanism for maintaining replication bypass of these DNA lesions. Together, these findings establish that some replicative primases, previously considered to be solely involved in priming replication, are also TLS proficient and therefore may play important roles in damage tolerance at replication forks.

Human β-defensin 3 increases the TLR9-dependent response to bacterial DNA.

PubMed

McGlasson, Sarah L; Semple, Fiona; MacPherson, Heather; Gray, Mohini; Davidson, Donald J; Dorin, Julia R

2017-04-01

Human β-defensin 3 (hBD3) is a cationic antimicrobial peptide with potent bactericidal activity in vitro. HBD3 is produced in response to pathogen challenge and can modulate immune responses. The amplified recognition of self-DNA by human plasmacytoid dendritic cells has been previously reported, but we show here that hBD3 preferentially enhances the response to bacterial DNA in mouse Flt-3 induced dendritic cells (FLDCs) and in human peripheral blood mononuclear cells. We show the effect is mediated through TLR9 and although hBD3 significantly increases the cellular uptake of both E. coli and self-DNA in mouse FLDCs, only the response to bacterial DNA is enhanced. Liposome transfection also increases uptake of bacterial DNA and amplifies the TLR9-dependent response. In contrast to hBD3, lipofection of self-DNA enhances inflammatory signaling, but the response is predominantly TLR9-independent. Together, these data show that hBD3 has a role in the innate immune-mediated response to pathogen DNA, increasing inflammatory signaling and promoting activation of the adaptive immune system via antigen presenting cells including dendritic cells. Therefore, our data identify an additional immunomodulatory role for this copy-number variable defensin, of relevance to host defence against infection and indicate a potential for the inclusion of HBD3 in pathogen DNA-based vaccines. © 2017 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DNA Binding Peptide Directed Synthesis of Continuous DNA Nanowires for Analysis of Large DNA Molecules by Scanning Electron Microscope.

PubMed

Kim, Kyung-Il; Lee, Seonghyun; Jin, Xuelin; Kim, Su Ji; Jo, Kyubong; Lee, Jung Heon

2017-01-01

Synthesis of smooth and continuous DNA nanowires, preserving the original structure of native DNA, and allowing its analysis by scanning electron microscope (SEM), is demonstrated. Gold nanoparticles densely assembled on the DNA backbone via thiol-tagged DNA binding peptides work as seeds for metallization of DNA. This method allows whole analysis of DNA molecules with entangled 3D features. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Analytical Devices Based on Direct Synthesis of DNA on Paper.

PubMed

Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M

2016-01-05

This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.

Process of infection with bacteriophage phi chi 174. XL. Viral DNA replication of phi chi 174 mutants blocked in progeny single-stranded DNA synthesis.

PubMed Central

Fukuda, A; Sinsheimer, R L

1976-01-01

Mutation in several different cistrons of bacteriophage phi chi 174 blocks net progeny single-stranded DNA synthesis at the late period of infection (15). For the study of the functions of these cistrons in single-stranded DNA synthesis, asymmetric replication of replicative form DNA was examined at the late period of infection with amber mutants of these cistrons. While the normal, rapid process of asymmetric single-stranded viral DNA synthesis is blocked at the late period of these mutant infections, an asymmetric synthesis of the viral strand of replicative-form DNA is observed in this period, though at a reduced level, together with degradation of prelabeled viral strand. Some intermediate replicative-form molecules were also detected. Asymmetric synthesis of the viral strand of replicative-form DNA at the late period of phi chi infection is completely inhibited in the presence of a low concentration (35mug/ml) of chloramphenicol (which also blocks net single-stranded viral DNA synthesis). These results are discussed in terms of the possible role of the specific viral proteins for normal single-stranded DNA synthesis. PMID:1255871

DNA synthesis arrest sites at the right terminus of rat long interspersed repeated (LINE or L1Rn) DNA family members.

PubMed Central

d'Ambrosio, E; Furano, A V

1987-01-01

An approximately equal to 150-bp GC-rich (approximately equal to 60%) region is at the right end of rat long interspersed repeated DNA (LINE or L1Rn) family members. We report here that one of the DNA strands from this region contains several non-palindromic sites that strongly arrest DNA synthesis in vitro by the prokaryotic Klenow and T4 DNA polymerases, the eukaryotic alpha polymerase, and AMV reverse transcriptase. The strongest arrest sites are G-rich (approximately equal to 70%) homopurine stretches of 18 or more residues. Shorter homopurine stretches (12 residues or fewer) did not arrest DNA synthesis even if the stretch contains 11/12 G residues. Arrest of the prokaryotic polymerases was not affected by their respective single strand binding proteins or polymerase accessory proteins. The region of duplex DNA which contains DNA synthesis arrest sites reacts with bromoacetaldehyde when present in negatively supercoiled molecules. By contrast, homopurine stretches that do not arrest DNA synthesis do not react with bromoacetaldehyde. The presence of bromoacetaldehyde-reactive bases in a G-rich homopurine-containing duplex under torsional stress is thought to be caused by base stacking in the homopurine strand. Therefore, we suggest that base-stacked regions of the template arrest DNA synthesis. Images PMID:2436148

An improved divergent synthesis of comb-type branched oligodeoxyribonucleotides (bDNA) containing multiple secondary sequences.

PubMed

Horn, T; Chang, C A; Urdea, M S

1997-12-01

The divergent synthesis of branched DNA (bDNA) comb structures is described. This new type of bDNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branch network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb structures were assembled on a solid support and several synthesis parameters were investigated and optimized. The bDNA comb molecules were characterized by polyacrylamide gel electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The developed chemistry allows synthesis of bDNA comb molecules containing multiple secondary sequences. In the accompanying article we describe the synthesis and characterization of large bDNA combs containing all four deoxynucleotides for use as signal amplifiers in nucleic acid quantification assays.

An improved divergent synthesis of comb-type branched oligodeoxyribonucleotides (bDNA) containing multiple secondary sequences.

PubMed Central

Horn, T; Chang, C A; Urdea, M S

1997-01-01

The divergent synthesis of branched DNA (bDNA) comb structures is described. This new type of bDNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branch network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb structures were assembled on a solid support and several synthesis parameters were investigated and optimized. The bDNA comb molecules were characterized by polyacrylamide gel electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The developed chemistry allows synthesis of bDNA comb molecules containing multiple secondary sequences. In the accompanying article we describe the synthesis and characterization of large bDNA combs containing all four deoxynucleotides for use as signal amplifiers in nucleic acid quantification assays. PMID:9365265

Inaccurate DNA Synthesis in Cell Extracts of Yeast Producing Active Human DNA Polymerase Iota

PubMed Central

Makarova, Alena V.; Grabow, Corinn; Gening, Leonid V.; Tarantul, Vyacheslav Z.; Tahirov, Tahir H.; Bessho, Tadayoshi; Pavlov, Youri I.

2011-01-01

Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn2+ ions, can bypass some DNA lesions and misincorporates “G” opposite template “T” more frequently than incorporates the correct “A.” We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of “G” versus “A” method of Gening, abbreviated as “misGvA”). We provide unambiguous proof of the “misGvA” approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The “misGvA” activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts. PMID:21304950

Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

PubMed

Makarova, Alena V; Grabow, Corinn; Gening, Leonid V; Tarantul, Vyacheslav Z; Tahirov, Tahir H; Bessho, Tadayoshi; Pavlov, Youri I

2011-01-31

Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+) ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA"). We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

STATIC AND KINETIC SITE-SPECIFIC PROTEIN-DNA PHOTOCROSSLINKING: ANALYSIS OF BACTERIAL TRANSCRIPTION INITIATION COMPLEXES

PubMed Central

Naryshkin, Nikolai; Druzhinin, Sergei; Revyakin, Andrei; Kim, Younggyu; Mekler, Vladimir; Ebright, Richard H.

2009-01-01

Static site-specific protein-DNA photocrosslinking permits identification of protein-DNA interactions within multiprotein-DNA complexes. Kinetic site-specific protein-DNA photocrosslinking--involving rapid-quench-flow mixing and pulsed-laser irradiation--permits elucidation of pathways and kinetics of formation of protein-DNA interactions within multiprotein-DNA complexes. We present detailed protocols for application of static and kinetic site-specific protein-DNA photocrosslinking to bacterial transcription initiation complexes. PMID:19378179

Comparison of commercially-available preservatives for maintaining the integrity of bacterial DNA in human milk.

PubMed

Lackey, Kimberly A; Williams, Janet E; Price, William J; Carrothers, Janae M; Brooker, Sarah L; Shafii, Bahman; McGuire, Mark A; McGuire, Michelle K

2017-10-01

Inhibiting changes to bacteria in human milk between sample collection and analysis is necessary for unbiased characterization of the milk microbiome. Although cold storage is considered optimal, alternative preservation is sometimes necessary. The objective of this study was to compare the effectiveness of several commercially-available preservatives with regard to maintaining bacterial DNA in human milk for delayed microbiome analysis. Specifically, we compared Life Technologies' RNAlater® stabilization solution, Biomatrica's DNAgard® Saliva, Advanced Instruments' Broad Spectrum Microtabs II™, and Norgen Biotek Corporation's Milk DNA Preservation and Isolation Kit. Aliquots of 8 pools of human milk were treated with each preservative. DNA was extracted immediately and at 1, 2, 4, and 6wk, during which time milk was held at 37°C. The V1-V3 region of the bacterial 16S rRNA gene was amplified and sequenced. Changes in bacterial community structure and diversity over time were evaluated. Comparable to other studies, the most abundant genera were Streptococcus (33.3%), Staphylococcus (14.0%), Dyella (6.3%), Pseudomonas (3.0%), Veillonella (2.5%), Hafnia (2.0%), Prevotella (1.7%), Rhodococcus (1.6%), and Granulicatella (1.4%). Overall, use of Norgen's Milk DNA Preservation and Isolation Kit best maintained the consistency of the bacterial community structure. Total DNA, diversity, and evenness metrics were also highest in samples preserved with this method. When collecting human milk for bacterial community analysis in field conditions where cold storage is not available, our results suggest that Norgen's Milk DNA Preservation and Isolation Kit may be a useful method, at least for a period of 2weeks. Copyright © 2017 Elsevier B.V. All rights reserved.

Terahertz spectroscopy for the isothermal detection of bacterial DNA by magnetic bead-based rolling circle amplification.

PubMed

Yang, Xiang; Yang, Ke; Zhao, Xiang; Lin, Zhongquan; Liu, Zhiyong; Luo, Sha; Zhang, Yang; Wang, Yunxia; Fu, Weiling

2017-12-04

The demand for rapid and sensitive bacterial detection is continuously increasing due to the significant requirements of various applications. In this study, a terahertz (THz) biosensor based on rolling circle amplification (RCA) was developed for the isothermal detection of bacterial DNA. The synthetic bacterium-specific sequence of 16S rDNA hybridized with a padlock probe (PLP) that contains a sequence fully complementary to the target sequence at the 5' and 3' ends. The linear PLP was circularized by ligation to form a circular PLP upon recognition of the target sequence; then the capture probe (CP) immobilized on magnetic beads (MBs) acted as a primer to initialize RCA. As DNA molecules are much less absorptive than water molecules in the THz range, the RCA products on the surface of the MBs cause a significant decrease in THz absorption, which can be sensitively probed by THz spectroscopy. Our results showed that 0.12 fmol of synthetic bacterial DNA and 0.05 ng μL -1 of genomic DNA could be effectively detected using this assay. In addition, the specificity of this strategy was demonstrated by its low signal response to interfering bacteria. The proposed strategy not only represents a new method for the isothermal detection of the target bacterial DNA but also provides a general methodology for sensitive and specific DNA biosensing using THz spectroscopy.

ER-mitochondria contacts couple mtDNA synthesis with mitochondrial division in human cells.

PubMed

Lewis, Samantha C; Uchiyama, Lauren F; Nunnari, Jodi

2016-07-15

Mitochondrial DNA (mtDNA) encodes RNAs and proteins critical for cell function. In human cells, hundreds to thousands of mtDNA copies are replicated asynchronously, packaged into protein-DNA nucleoids, and distributed within a dynamic mitochondrial network. The mechanisms that govern how nucleoids are chosen for replication and distribution are not understood. Mitochondrial distribution depends on division, which occurs at endoplasmic reticulum (ER)-mitochondria contact sites. These sites were spatially linked to a subset of nucleoids selectively marked by mtDNA polymerase and engaged in mtDNA synthesis--events that occurred upstream of mitochondrial constriction and division machine assembly. Our data suggest that ER tubules proximal to nucleoids are necessary but not sufficient for mtDNA synthesis. Thus, ER-mitochondria contacts coordinate licensing of mtDNA synthesis with division to distribute newly replicated nucleoids to daughter mitochondria. Copyright © 2016, American Association for the Advancement of Science.

Differentiation of some species of Neisseriaceae and other bacterial groups by DNA-DNA hybridization.

PubMed

Tønjum, T; Bukholm, G; Bøvre, K

1989-05-01

DNA-DNA hybridization using total genomic DNA probes may represent a way of differentiating between miscellaneous bacterial species. This was studied with type and reference strains of 20 species in Moraxella, Kingella, and other selected Gram-negative groups. Both radioactive and biotin labelling were employed. Most of the species examined were easily distinguished, such as Moraxella (Branhamella) catarrhalis, M.(B.) ovis, M. atlantae, M. phenylpyruvica, M. osloensis, Neisseria elongata, N. meningitidis, Kingella kingae, K. indologenes, K. dentrificans, Oligella urethralis, Eikenella corrodens, Cardiobacterium hominis, Haemophilus aphrophilus, Actinobacillus actinomycetemcomitans, Gardnerella vaginalis, and DF-2. This reflected the extent of the genetic distances between them as a basis for identification by hybridization. There was some clustering in the Moraxella group. Especially the closely related Moraxella nonliquefaciens, M. lacunata and M. bovis showed strong hybridization affinities. This leads to potential problems in distinguishing these three species from each other by DNA-DNA hybridization with total genomic probes alone.

Efficiency and Fidelity of Human DNA Polymerases λ and β during Gap-Filling DNA Synthesis

PubMed Central

Brown, Jessica A.; Pack, Lindsey R.; Sanman, Laura E.; Suo, Zucai

2010-01-01

The base excision repair (BER) pathway coordinates the replacement of 1 to 10 nucleotides at sites of single-base lesions. This process generates DNA substrates with various gap sizes which can alter the catalytic efficiency and fidelity of a DNA polymerase during gap-filling DNA synthesis. Here, we quantitatively determined the substrate specificity and base substitution fidelity of human DNA polymerase λ (Pol λ), an enzyme proposed to support the known BER DNA polymerase β (Pol β), as it filled 1- to 10-nucleotide gaps at 1-nucleotide intervals. Pol λ incorporated a correct nucleotide with relatively high efficiency until the gap size exceeded 9 nucleotides. Unlike Pol λ, Pol β did not have an absolute threshold on gap size as the catalytic efficiency for a correct dNTP gradually decreased as the gap size increased from 2 to 10 nucleotides and then recovered for non-gapped DNA. Surprisingly, an increase in gap size resulted in lower polymerase fidelity for Pol λ, and this downregulation of fidelity was controlled by its non-enzymatic N-terminal domains. Overall, Pol λ was up to 160-fold more error-prone than Pol β, thereby suggesting Pol λ would be more mutagenic during long gap-filling DNA synthesis. In addition, dCTP was the preferred misincorporation for Pol λ and its N-terminal domain truncation mutants. This nucleotide preference was shown to be dependent upon the identity of the adjacent 5′-template base. Our results suggested that both Pol λ and Pol β would catalyze nucleotide incorporation with the highest combination of efficiency and accuracy when the DNA substrate contains a single-nucleotide gap. Thus, Pol λ, like Pol β, is better suited to catalyze gap-filling DNA synthesis during short-patch BER in vivo, although, Pol λ may play a role in long-patch BER. PMID:20961817

Recent advances in synthesis of bacterial rare sugar building blocks and their applications.

PubMed

Emmadi, Madhu; Kulkarni, Suvarn S

2014-07-01

Covering: 1964 to 2013. Bacteria have unusual glycans on their surfaces which distinguish them from the host cells. These unique structures offer avenues for targeting bacteria with specific therapeutics and vaccine. However, these rare sugars are not accessible in acceptable purity and amounts by isolation from natural sources. Thus, procurement of orthogonally protected rare sugar building blocks through efficient chemical synthesis is regarded as a crucial step towards the development of glycoconjugate vaccines. This Highlight focuses on recent advances in the synthesis of the bacterial deoxy amino hexopyranoside building blocks and their application in constructing various biologically important bacterial O-glycans.

Bypassing bacterial infection in phage display by sequencing DNA released from phage particles.

PubMed

Villequey, Camille; Kong, Xu-Dong; Heinis, Christian

2017-11-01

Phage display relies on a bacterial infection step in which the phage particles are replicated to perform multiple affinity selection rounds and to enable the identification of isolated clones by DNA sequencing. While this process is efficient for wild-type phage, the bacterial infection rate of phage with mutant or chemically modified coat proteins can be low. For example, a phage mutant with a disulfide-free p3 coat protein, used for the selection of bicyclic peptides, has a more than 100-fold reduced infection rate compared to the wild-type. A potential strategy for bypassing the bacterial infection step is to directly sequence DNA extracted from phage particles after a single round of phage panning using high-throughput sequencing. In this work, we have quantified the fraction of phage clones that can be identified by directly sequencing DNA from phage particles. The results show that the DNA of essentially all of the phage particles can be 'decoded', and that the sequence coverage for mutants equals that of amplified DNA extracted from cells infected with wild-type phage. This procedure is particularly attractive for selections with phage that have a compromised infection capacity, and it may allow phage display to be performed with particles that are not infective at all. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases

PubMed Central

Pavlov, Andrey R.; Pavlova, Nadejda V.; Kozyavkin, Sergei A.; Slesarev, Alexei I.

2012-01-01

We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases (Pavlov et. al., (2002) Proc. Natl. Acad. Sci. USA 99, 13510–13515). The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various non-specific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting Helix-hairpin-Helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species, but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of TopoV HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105°C by maintaining processivity of DNA synthesis at high temperatures. We also found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding templates to DNA polymerases. PMID:22320201

Unscheduled DNA synthesis in human hair follicles after in vitro exposure to 11 chemicals: comparison with unscheduled DNA synthesis in rat hepatocytes.

PubMed

van Erp, Y H; Koopmans, M J; Heirbaut, P R; van der Hoeven, J C; Weterings, P J

1992-06-01

A new method is described to investigate unscheduled DNA synthesis (UDS) in human tissue after exposure in vitro: the human hair follicle. A histological technique was applied to assess cytotoxicity and UDS in the same hair follicle cells. UDS induction was examined for 11 chemicals and the results were compared with literature findings for UDS in rat hepatocytes. Most chemicals inducing UDS in rat hepatocytes raised DNA repair at comparable concentrations in the hair follicle. However, 1 of 9 chemicals that gave a positive response in the rat hepatocyte UDS test, 2-acetylaminofluorene, failed to induce DNA repair in the hair follicle. Metabolizing potential of hair follicle cells was shown in experiments with indirectly acting compounds, i.e., benzo[a]pyrene, 7,12-dimethylbenz[a]anthracene and dimethylnitrosamine. The results support the conclusion that the test in its present state is valuable as a screening assay for the detection of unscheduled DNA synthesis. Moreover, the use of human tissues may result in a better extrapolation to man.

Is Bacterial Fatty Acid Synthesis a Valid Target for Antibacterial Drug Discovery?

PubMed Central

Parsons, Joshua B.; Rock, Charles O.

2011-01-01

The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there isn’t a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements. PMID:21862391

CyDNA: synthesis and replication of highly Cy-dye substituted DNA by an evolved polymerase.

PubMed

Ramsay, Nicola; Jemth, Ann-Sofie; Brown, Anthony; Crampton, Neal; Dear, Paul; Holliger, Philipp

2010-04-14

DNA not only transmits genetic information but can also serve as a versatile supramolecular scaffold. Here we describe a strategy for the synthesis and replication of DNA displaying hundreds of substituents using directed evolution of polymerase function by short-patch compartmentalized self-replication (spCSR) and the widely used fluorescent dye labeled deoxinucleotide triphosphates Cy3-dCTP and Cy5-dCTP as substrates. In just two rounds of spCSR selection, we have isolated a polymerase that allows the PCR amplification of double stranded DNA fragments up to 1kb, in which all dC bases are substituted by its fluorescent dye-labeled equivalent Cy3- or Cy5-dC. The resulting "CyDNA" displays hundreds of aromatic heterocycles on the outside of the DNA helix and is brightly colored and highly fluorescent. CyDNA also exhibits significantly altered physicochemical properties compared to standard B-form DNA, including loss of silica and intercalating dye binding, resistance to cleavage by some endonucleases, an up to 40% increased apparent diameter as judged by atomic force microscopy and organic phase partitioning during phenol extraction. CyDNA also displays very bright fluorescence enabling significant signal gains in microarray and microfluidic applications. CyDNA represents a step toward a long-term goal of the encoded synthesis of DNA-based polymers of programmable and evolvable sequence and properties.

Enzyme-adenylate structure of a bacterial ATP-dependent DNA ligase with a minimized DNA-binding surface.

PubMed

Williamson, Adele; Rothweiler, Ulli; Leiros, Hanna Kirsti Schrøder

2014-11-01

DNA ligases are a structurally diverse class of enzymes which share a common catalytic core and seal breaks in the phosphodiester backbone of double-stranded DNA via an adenylated intermediate. Here, the structure and activity of a recombinantly produced ATP-dependent DNA ligase from the bacterium Psychromonas sp. strain SP041 is described. This minimal-type ligase, like its close homologues, is able to ligate singly nicked double-stranded DNA with high efficiency and to join cohesive-ended and blunt-ended substrates to a more limited extent. The 1.65 Å resolution crystal structure of the enzyme-adenylate complex reveals no unstructured loops or segments, and suggests that this enzyme binds the DNA without requiring full encirclement of the DNA duplex. This is in contrast to previously characterized minimal DNA ligases from viruses, which use flexible loop regions for DNA interaction. The Psychromonas sp. enzyme is the first structure available for the minimal type of bacterial DNA ligases and is the smallest DNA ligase to be crystallized to date.

Absence of bacterial DNA in culture-negative urine from cats with and without lower urinary tract disease.

PubMed

Lund, Heidi Sjetne; Skogtun, Gaute; Sørum, Henning; Eggertsdóttir, Anna Vigdís

2015-10-01

A diagnosis of bacterial cystitis commonly relies on a positive microbiological culture demonstrating the presence of a significant number of colony-forming units/ml urine, as urine within the upper urinary tract, bladder and proximal urethra generally is considered sterile. Recent studies from human and veterinary medicine indicate the presence of non-culturable bacteria in culture-negative urine samples. The aim of the present study was to determine the occurrence of bacterial DNA in culture-negative urine samples from cats with signs of feline lower urinary tract disease (FLUTD) and healthy control cats by 16S ribosomal DNA PCR and subsequent sequencing. The study sample included 38 culture-negative urine samples from cats with FLUTD and 43 culture-negative samples from control cats. Eight culture-positive urine samples from cats with FLUTD were included as external positive controls in addition to negative reaction controls. Of possible methodological limitations, degradation of DNA due to storage, the use of non-sedimented urine for DNA isolation and lack of internal positive reaction controls should be mentioned. The positive controls were recognised, but occurrence of bacterial DNA in culture-negative urine from cats with or without signs of lower urinary tract disease was not demonstrated. However, considering the possible methodological limitations, the presence of bacterial DNA in the urine of culture-negative FLUTD cats cannot be excluded based on the present results alone. Therefore, a prospective study reducing the possibility of degradation of DNA due to storage, in combination with modifications enhancing the chance of detecting even lower levels of bacterial DNA in culture-negative samples, seems warranted. © ISFM and AAFP 2014.

Improving soil bacterial taxa–area relationships assessment using DNA meta-barcoding

PubMed Central

Terrat, S; Dequiedt, S; Horrigue, W; Lelievre, M; Cruaud, C; Saby, N P A; Jolivet, C; Arrouays, D; Maron, P-A; Ranjard, L; Chemidlin Prévost-Bouré, N

2015-01-01

The evaluation of the taxa–area relationship (TAR) with molecular fingerprinting data demonstrated the spatial structuration of soil microorganisms and provided insights into the processes shaping their diversity. The increasing use of massive sequencing technologies in biodiversity investigations has now raised the question of the advantages of such technologies over the fingerprinting approach for elucidation of the determinism of soil microbial community assembly in broad-scale biogeographic studies. Our objectives in this study were to compare DNA fingerprinting and meta-barcoding approaches for evaluating soil bacterial TAR and the determinism of soil bacterial community assembly on a broad scale. This comparison was performed on 392 soil samples from four French geographic regions with different levels of environmental heterogeneity. Both molecular approaches demonstrated a TAR with a significant slope but, because of its more sensitive description of soil bacterial community richness, meta-barcoding provided significantly higher and more accurate estimates of turnover rates. Both approaches were useful in evidencing the processes shaping bacterial diversity variations on a broad scale. When different taxonomic resolutions were considered for meta-barcoding data, they significantly influenced the estimation of turnover rates but not the relative importance of each component process. Altogether, DNA meta-barcoding provides a more accurate evaluation of the TAR and may lead to re-examination of the processes shaping soil bacterial community assembly. This should provide new insights into soil microbial ecology in the context of sustainable use of soil resources. PMID:25293875

Comparison of different methods for isolation of bacterial DNA from retail oyster tissues

USDA-ARS?s Scientific Manuscript database

Oysters are filter-feeders that bio-accumulate bacteria in water while feeding. To evaluate the bacterial genomic DNA extracted from retail oyster tissues, including the gills and digestive glands, four isolation methods were used. Genomic DNA extraction was performed using the Allmag™ Blood Genomic...

Human homologues of the bacterial heat-shock protein DnaJ are preferentially expressed in neurons.

PubMed Central

Cheetham, M E; Brion, J P; Anderton, B H

1992-01-01

The bacterial heat-shock protein DnaJ has been implicated in protein folding and protein complex dissociation. The DnaJ protein interacts with the prokaryotic analogue of Hsp70, DnaK, and accelerates the rate of ATP hydrolysis by DnaK. Several yeast homologues of DnaJ, with different proposed subcellular localizations and functions, have recently been isolated and are the only eukaryotic forms of DnaJ so far described. We have isolated cDNAs corresponding to two alternatively spliced transcripts of a novel human gene, HSJ1, which show sequence similarity to the bacterial DnaJ protein and the yeast homologues. The cDNA clones were isolated from a human brain-frontal-cortex expression library screened with a polyclonal antiserum raised to paired-helical-filament (PHF) proteins isolated from extracts of the brains of patients suffering from Alzheimer's disease. The similarity between the predicted human protein sequences and the bacterial and yeast proteins is highest at the N-termini, this region also shows a limited similarity to viral T-antigens and is a possible common motif involved in the interaction with DnaK/Hsp70. Northern-blot analysis has shown that human brain contains higher levels of mRNA for the DnaJ homologue than other tissues examined, and hybridization studies with riboprobes in situ show a restricted pattern of expression of the mRNA within the brain, with neuronal layers giving the strongest signal. These findings suggest that the DnaJ-DnaK (Hsp70) interaction is general to eukaryotes and, indeed, to higher organisms. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:1599432

CyDNA: Synthesis and Replication of Highly Cy-Dye Substituted DNA by an Evolved Polymerase

PubMed Central

2010-01-01

DNA not only transmits genetic information but can also serve as a versatile supramolecular scaffold. Here we describe a strategy for the synthesis and replication of DNA displaying hundreds of substituents using directed evolution of polymerase function by short-patch compartmentalized self-replication (spCSR) and the widely used fluorescent dye labeled deoxinucleotide triphosphates Cy3-dCTP and Cy5-dCTP as substrates. In just two rounds of spCSR selection, we have isolated a polymerase that allows the PCR amplification of double stranded DNA fragments up to 1kb, in which all dC bases are substituted by its fluorescent dye-labeled equivalent Cy3- or Cy5-dC. The resulting “CyDNA” displays hundreds of aromatic heterocycles on the outside of the DNA helix and is brightly colored and highly fluorescent. CyDNA also exhibits significantly altered physicochemical properties compared to standard B-form DNA, including loss of silica and intercalating dye binding, resistance to cleavage by some endonucleases, an up to 40% increased apparent diameter as judged by atomic force microscopy and organic phase partitioning during phenol extraction. CyDNA also displays very bright fluorescence enabling significant signal gains in microarray and microfluidic applications. CyDNA represents a step toward a long-term goal of the encoded synthesis of DNA-based polymers of programmable and evolvable sequence and properties. PMID:20235594

Human β‐defensin 3 increases the TLR9‐dependent response to bacterial DNA

PubMed Central

McGlasson, Sarah L.; Semple, Fiona; MacPherson, Heather; Gray, Mohini; Davidson, Donald J.

2017-01-01

Human β‐defensin 3 (hBD3) is a cationic antimicrobial peptide with potent bactericidal activity in vitro. HBD3 is produced in response to pathogen challenge and can modulate immune responses. The amplified recognition of self‐DNA by human plasmacytoid dendritic cells has been previously reported, but we show here that hBD3 preferentially enhances the response to bacterial DNA in mouse Flt‐3 induced dendritic cells (FLDCs) and in human peripheral blood mononuclear cells. We show the effect is mediated through TLR9 and although hBD3 significantly increases the cellular uptake of both E. coli and self‐DNA in mouse FLDCs, only the response to bacterial DNA is enhanced. Liposome transfection also increases uptake of bacterial DNA and amplifies the TLR9‐dependent response. In contrast to hBD3, lipofection of self‐DNA enhances inflammatory signaling, but the response is predominantly TLR9‐independent. Together, these data show that hBD3 has a role in the innate immune‐mediated response to pathogen DNA, increasing inflammatory signaling and promoting activation of the adaptive immune system via antigen presenting cells including dendritic cells. Therefore, our data identify an additional immunomodulatory role for this copy‐number variable defensin, of relevance to host defence against infection and indicate a potential for the inclusion of HBD3 in pathogen DNA‐based vaccines. PMID:28102569

Translesion synthesis DNA polymerases promote error-free replication through the minor-groove DNA adduct 3-deaza-3-methyladenine.

PubMed

Yoon, Jung-Hoon; Roy Choudhury, Jayati; Park, Jeseong; Prakash, Satya; Prakash, Louise

2017-11-10

N3-Methyladenine (3-MeA) is formed in DNA by reaction with S -adenosylmethionine, the reactive methyl donor, and by reaction with alkylating agents. 3-MeA protrudes into the DNA minor groove and strongly blocks synthesis by replicative DNA polymerases (Pols). However, the mechanisms for replicating through this lesion in human cells remain unidentified. Here we analyzed the roles of translesion synthesis (TLS) Pols in the replication of 3-MeA-damaged DNA in human cells. Because 3-MeA has a short half-life in vitro , we used the stable 3-deaza analog, 3-deaza-3-methyladenine (3-dMeA), which blocks the DNA minor groove similarly to 3-MeA. We found that replication through the 3-dMeA adduct is mediated via three different pathways, dependent upon Polι/Polκ, Polθ, and Polζ. As inferred from biochemical studies, in the Polι/Polκ pathway, Polι inserts a nucleotide (nt) opposite 3-dMeA and Polκ extends synthesis from the inserted nt. In the Polθ pathway, Polθ carries out both the insertion and extension steps of TLS opposite 3-dMeA, and in the Polζ pathway, Polζ extends synthesis following nt insertion by an as yet unidentified Pol. Steady-state kinetic analyses indicated that Polι and Polθ insert the correct nt T opposite 3-dMeA with a much reduced catalytic efficiency and that both Pols exhibit a high propensity for inserting a wrong nt opposite this adduct. However, despite their low fidelity of synthesis opposite 3-dMeA, TLS opposite this lesion replicates DNA in a highly error-free manner in human cells. We discuss the implications of these observations for TLS mechanisms in human cells. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

DNA-Compatible Nitro Reduction and Synthesis of Benzimidazoles.

PubMed

Du, Huang-Chi; Huang, Hongbing

2017-10-18

DNA-encoded chemical libraries have emerged as a cost-effective alternative to high-throughput screening (HTS) for hit identification in drug discovery. A key factor for productive DNA-encoded libraries is the chemical diversity of the small molecule moiety attached to an encoding DNA oligomer. The library structure diversity is often limited to DNA-compatible chemical reactions in aqueous media. Herein, we describe a facile process for reducing aryl nitro groups to aryl amines. The new protocol offers simple operation and circumvents the pyrophoric potential of the conventional method (Raney nickel). The reaction is performed in aqueous solution and does not compromise DNA structural integrity. The utility of this method is demonstrated by the versatile synthesis of benzimidazoles on DNA.

Amino Acid Control over Deoxyribonucleic Acid Synthesis in Escherichia coli Infected With T-Even Bacteriophage

PubMed Central

Donini, Pierluigi

1970-01-01

Starvation for a required amino acid of normal or RCstrEscherichia coli infected with T-even phages arrests further synthesis of phage deoxyribonucleic acid (DNA). This amino acid control over phage DNA synthesis does not occur in RCrelE. coli mutants. Heat inactivation of a temperature-sensitive aminoacyl-transfer ribonucleic acid (RNA) synthetase similarly causes an arrest of phage DNA synthesis in infected cells of RCstr phenotype but not in cells of RCrel phenotype. Inhibition of phage DNA synthesis in amino acid-starved RCstr host cells can be reversed by addition of chloramphenicol to the culture. Thus, the general features of amino acid control over T-even phage DNA synthesis are entirely analogous to those known for amino acid control over net RNA synthesis of uninfected bacteria. This analogy shows that the bacterial rel locus controls a wider range of macromolecular syntheses than had been previously thought. PMID:4914067

RuvAB and RecG are not essential for the recovery of DNA synthesis following UV-induced DNA damage in Escherichia coli.

PubMed Central

Donaldson, Janet R; Courcelle, Charmain T; Courcelle, Justin

2004-01-01

Ultraviolet light induces DNA lesions that block the progression of the replication machinery. Several models speculate that the resumption of replication following disruption by UV-induced DNA damage requires regression of the nascent DNA or migration of the replication machinery away from the blocking lesion to allow repair or bypass of the lesion to occur. Both RuvAB and RecG catalyze branch migration of three- and four-stranded DNA junctions in vitro and are proposed to catalyze fork regression in vivo. To examine this possibility, we characterized the recovery of DNA synthesis in ruvAB and recG mutants. We found that in the absence of either RecG or RuvAB, arrested replication forks are maintained and DNA synthesis is resumed with kinetics that are similar to those in wild-type cells. The data presented here indicate that RecG- or RuvAB-catalyzed fork regression is not essential for DNA synthesis to resume following arrest by UV-induced DNA damage in vivo. PMID:15126385

A new regulatory mechanism for bacterial lipoic acid synthesis

PubMed Central

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-01

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

A new regulatory mechanism for bacterial lipoic acid synthesis.

PubMed

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-22

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

Alterations in Synthesis and Repair of DNA during the Development of Loach Misgurnus fossilis

PubMed Central

Gening, Leonid V.; Lakhin, Andrei V.; Makarova, Irina V.; Nenasheva, Valentina V.; Andreeva, Ludmila E.; Tarantul, Vyacheslav Z.

2016-01-01

Using a modified radiolabeled primer extension method (we named this modification misGvA—“misincorporation of G versus A”) we have investigated the DNA synthesis and repair at early and late stages of development of loach Misgurnus fossilis. The misincorporation activity of DNA polymerase iota (Pol ι) in wild-type loach could not be detected by this method at any stage of loach development. In transgenic loach overexpressing human Pol ι we have shown that the bypassing of DNA synthesis arrest after incorporation of mismatched nucleotide by Pol ι (the T-stop) was not associated with this enzyme. Non-transgenic loach larvae are virtually lacking the capacity for error correction of DNA duplex containing a mismatched nucleotide. Such repair activity develops only in the adult fish. It appears that the initial stages of development are characterized by more intensive DNA synthesis, while in terminal stages the repair activities become more prominent. The misGvA approach clearly indicates substantial changes in the DNA synthesis intensity, although the role of particular replicative and repair DNA polymerases in this process requires further study. PMID:29615575

Pyroglutamic acid stimulates DNA synthesis in rat primary hepatocytes through the mitogen-activated protein kinase pathway.

PubMed

Inoue, Shinjiro; Okita, Yoichi; de Toledo, Andreia; Miyazaki, Hiroyuki; Hirano, Eiichi; Morinaga, Tetsuo

2015-01-01

We purified pyroglutamic acid from human placental extract and identified it as a potent stimulator of rat primary hepatocyte DNA synthesis. Pyroglutamic acid dose-dependently stimulated DNA synthesis, and this effect was inhibited by PD98059, a dual specificity mitogen-activated protein kinase kinase 1 (MAP2K1) inhibitor. Therefore, pyroglutamic acid stimulated DNA synthesis in rat primary hepatocytes via MAPK signaling.

Liver nuclear DNA synthesis in mice following carbon tetrachloride administration or partial hepatectomy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gans, J.H.; Korson, R.

1984-02-01

Long-term, continuous (twice per week) administration of CCl/sub 4/ to male mice resulted in a high incidence of liver nodules which appear to be resistant to the necrotizing effects of CCl/sub 4/ but showed no features of malignant neoplasia. Liver nuclear DNA synthesis was compared in mice given CCl/sub 4/ and in mice subjected to partial hepatectomy (PH). Mice were given by gavage corn oil or CCl/sub 4/ in corn oil for periods of 2 to 25 weeks and several mice were subjected to PH after 12 and 25 weeks of corn oil treatment. Mice were given (/sup 3/H)TdR duringmore » liver regeneration and newly synthesized liver nuclear DNA was isolated and separated by BND-cellulose chromatography. Greater than 85% of the labeled DNA from PH mice eluted from BND-cellulose columns as double-stranded (ds) DNA with single-stranded (ss) regions or ends and less than 15% as ds DNA. When mice were treated with CCl/sub 4/ for 8 weeks or longer a significantly greater portion of liver nuclear DNA eluted as ds DNA. Administration of HU and 5-FU with (/sup 3/H)TdR decreased (/sup 3/H)TdR incorporation into DNA to low levels incompatible with unscheduled DNA synthesis. Single doses of CCl/sub 4/ given to mice treated with corn oil for 2 to 12 weeks provided newly synthesized DNA which was primarily (>80%) ds DNA with ss regions or ends, but after 25 weeks of corn oil administration, a single dose of CCl/sub 4/ resulted in newly synthesized DNA with a greater proportion of ds DNA. The high labeling of ds DNA in mice treated with CCl/sub 4/ may have resulted from an alternate pathway of DNA synthesis catalyzed by the enzymes or enzyme complexes associated with semiconservative DNA synthesis or from proliferation of nonparenchymal cells with a rapid turn-over rate.« less

Application of Biocatalysis to on-DNA Carbohydrate Library Synthesis.

PubMed

Thomas, Baptiste; Lu, Xiaojie; Birmingham, William R; Huang, Kun; Both, Peter; Reyes Martinez, Juana Elizabeth; Young, Robert J; Davie, Christopher P; Flitsch, Sabine L

2017-05-04

DNA-encoded libraries are increasingly used for the discovery of bioactive lead compounds in high-throughput screening programs against specific biological targets. Although a number of libraries are now available, they cover limited chemical space due to bias in ease of synthesis and the lack of chemical reactions that are compatible with DNA tagging. For example, compound libraries rarely contain complex biomolecules such as carbohydrates with high levels of functionality, stereochemistry, and hydrophilicity. By using biocatalysis in combination with chemical methods, we aimed to significantly expand chemical space and generate generic libraries with potentially better biocompatibility. For DNA-encoded libraries, biocatalysis is particularly advantageous, as it is highly selective and can be performed in aqueous environments, which is an essential feature for this split-and-mix library technology. In this work, we demonstrated the application of biocatalysis for the on-DNA synthesis of carbohydrate-based libraries by using enzymatic oxidation and glycosylation in combination with traditional organic chemistry. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Synthesis of arborane triterpenols by a bacterial oxidosqualene cyclase

NASA Astrophysics Data System (ADS)

Banta, Amy B.; Wei, Jeremy H.; Gill, Clare C. C.; Giner, José-Luis; Welander, Paula V.

2017-01-01

Cyclic triterpenoids are a broad class of polycyclic lipids produced by bacteria and eukaryotes. They are biologically relevant for their roles in cellular physiology, including membrane structure and function, and biochemically relevant for their exquisite enzymatic cyclization mechanism. Cyclic triterpenoids are also geobiologically significant as they are readily preserved in sediments and are used as biomarkers for ancient life throughout Earth's history. Isoarborinol is one such triterpenoid whose only known biological sources are certain angiosperms and whose diagenetic derivatives (arboranes) are often used as indicators of terrestrial input into aquatic environments. However, the occurrence of arborane biomarkers in Permian and Triassic sediments, which predates the accepted origin of angiosperms, suggests that microbial sources of these lipids may also exist. In this study, we identify two isoarborinol-like lipids, eudoraenol and adriaticol, produced by the aerobic marine heterotrophic bacterium Eudoraea adriatica. Phylogenetic analysis demonstrates that the E. adriatica eudoraenol synthase is an oxidosqualene cyclase homologous to bacterial lanosterol synthases and distinct from plant triterpenoid synthases. Using an Escherichia coli heterologous sterol expression system, we demonstrate that substitution of four amino acid residues in a bacterial lanosterol synthase enabled synthesis of pentacyclic arborinols in addition to tetracyclic sterols. This variant provides valuable mechanistic insight into triterpenoid synthesis and reveals diagnostic amino acid residues to differentiate between sterol and arborinol synthases in genomic and metagenomic datasets. Our data suggest that there may be additional bacterial arborinol producers in marine and freshwater environments that could expand our understanding of these geologically informative lipids.

Synthesis of arborane triterpenols by a bacterial oxidosqualene cyclase

PubMed Central

Banta, Amy B.; Wei, Jeremy H.; Gill, Clare C. C.; Giner, José-Luis; Welander, Paula V.

2017-01-01

Cyclic triterpenoids are a broad class of polycyclic lipids produced by bacteria and eukaryotes. They are biologically relevant for their roles in cellular physiology, including membrane structure and function, and biochemically relevant for their exquisite enzymatic cyclization mechanism. Cyclic triterpenoids are also geobiologically significant as they are readily preserved in sediments and are used as biomarkers for ancient life throughout Earth's history. Isoarborinol is one such triterpenoid whose only known biological sources are certain angiosperms and whose diagenetic derivatives (arboranes) are often used as indicators of terrestrial input into aquatic environments. However, the occurrence of arborane biomarkers in Permian and Triassic sediments, which predates the accepted origin of angiosperms, suggests that microbial sources of these lipids may also exist. In this study, we identify two isoarborinol-like lipids, eudoraenol and adriaticol, produced by the aerobic marine heterotrophic bacterium Eudoraea adriatica. Phylogenetic analysis demonstrates that the E. adriatica eudoraenol synthase is an oxidosqualene cyclase homologous to bacterial lanosterol synthases and distinct from plant triterpenoid synthases. Using an Escherichia coli heterologous sterol expression system, we demonstrate that substitution of four amino acid residues in a bacterial lanosterol synthase enabled synthesis of pentacyclic arborinols in addition to tetracyclic sterols. This variant provides valuable mechanistic insight into triterpenoid synthesis and reveals diagnostic amino acid residues to differentiate between sterol and arborinol synthases in genomic and metagenomic datasets. Our data suggest that there may be additional bacterial arborinol producers in marine and freshwater environments that could expand our understanding of these geologically informative lipids. PMID:28028245

Inhibition of adenovirus DNA synthesis in vitro by sera from patients with systemic lupus erythematosus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Horwitz, M.S.; Friefeld, B.R.; Keiser, H.D.

1982-12-01

Sera containing antinuclear antibodies from patients with systemic lupus erythematosus (SLE) and related disorders were tested for their effect on the synthesis of adenovirus (Ad) DNA in an in vitro replication system. After being heated at 60/sup 0/C for 1 h, some sera from patients with SLE inhibited Ad DNA synthesis by 60 to 100%. Antibodies to double-stranded DNA were present in 15 of the 16 inhibitory sera, and inhibitory activity copurified with anti-double-stranded DNA in the immunoglobulin G fraction. These SLE sera did not inhibit the DNA polymerases ..cap alpha.., BETA, ..gamma.. and had no antibody to the 72,000-daltonmore » DNA-binding protein necessary for Ad DNA synthesis. The presence of antibodies to single-stranded DNA and a variety of saline-extractable antigens (Sm, Ha, nRNP, and rRNP) did not correlate with SLE serum inhibitory activity. Methods previously developed for studying the individual steps in Ad DNA replication were used to determine the site of inhibition by the SLE sera that contained antibody to double-stranded DNA. Concentrations of the SLE inhibitor that decreased the elongation of Ad DNA by greater than 85% had no effect on either the initiation of Ad DNA synthesis or the polymerization of the first 26 deoxyribonucleotides.« less

A redox-based mechanism for nitric oxide-induced inhibition of DNA synthesis in human vascular smooth muscle cells

PubMed Central

Bundy, Ruth E; Marczin, Nándor; Chester, Adrian H; Yacoub, Magdi

2000-01-01

The current study explored potential redox mechanisms of nitric oxide (NO)-induced inhibition of DNA synthesis in cultured human and rat aortic smooth muscle cells.Exposure to S-nitrosothiols, DETA-NONOate and NO itself inhibited ongoing DNA synthesis and S phase progression in a concentration-dependent manner, as measured by thymidine incorporation and flow cytometry. Inhibition by NO donors occurred by release of NO, as detected by chemiluminescence and judged by the effects of NO scavengers, haemoglobin and cPTIO.Co-incubation with redox compounds, N-acetyl-L-cysteine, glutathione and L-ascorbic acid prevented NO inhibition of DNA synthesis. These observations suggest that redox agents may alternatively attenuate NO bioactivity extracellularly, interfere with intracellular actions of NO on the DNA synthesis machinery or restore DNA synthesis after established inhibition by NO.Recovery of DNA synthesis after inhibition by NO was similar with and without redox agents suggesting that augmented restoration of DNA synthesis is an unlikely mechanism to explain redox regulation.Study of extracellular interactions revealed that all redox agents potentiated S-nitrosothiol decomposition and NO release.Examination of intracellular NO bioactivity showed that as opposed to attenuation of NO inhibition of DNA synthesis by redox agents, there was no inhibition (potentiation in the presence of ascorbic acid) of soluble guanylate cyclase (sGC) activation judged by cyclic GMP accumulation in rat cells.These data provide evidence that NO-induced inhibition of ongoing DNA synthesis is sensitive to redox environment. Redox processes might protect the DNA synthesis machinery from inhibition by NO, in the setting of augmented liberation of biologically active NO from NO donors. PMID:10742309

DNA synthesis in the pituitary gland of the rat: effect of sulpiride and clomiphene.

PubMed

Burdman, J A; Szijan, I; Jahn, G A; Machiavelli, G; Kalbermann, L E

1979-09-15

Sulpiride administration to rats releases prolactin and increases DNA replication in the anterior pituitary gland. Clomiphene prevents the stimulation of DNA synthesis produced by sulpiride, but does not affect prolactin release from the gland. These findings suggest that the intracellular prolactin content of the anterior pituitary gland plays a role in the regulation of DNA synthesis through a mechanism mediated by oestrogens.

Developing Inhibitors of Translesion DNA Synthesis as Therapeutic Agents against Lung Cancer

DTIC Science & Technology

2015-12-01

normal DNA synthesis. In contrast, pol eta shows a combination of high efficiency and low fidelity when replicating 8-oxo-G. These combined properties...are consistent with a pro- mutagenic role for pol eta when replicating this DNA lesion under cellular conditions. Studies with modified nucleotide...analogs indicate that pol eta relies heavily on hydrogen-bonding interactions during normal and translesion synthesis. However, some nucleobase

Direct on-chip DNA synthesis using electrochemically modified gold electrodes as solid support

NASA Astrophysics Data System (ADS)

Levrie, Karen; Jans, Karolien; Schepers, Guy; Vos, Rita; Van Dorpe, Pol; Lagae, Liesbet; Van Hoof, Chris; Van Aerschot, Arthur; Stakenborg, Tim

2018-04-01

DNA microarrays have propelled important advancements in the field of genomic research by enabling the monitoring of thousands of genes in parallel. The throughput can be increased even further by scaling down the microarray feature size. In this respect, microelectronics-based DNA arrays are promising as they can leverage semiconductor processing techniques with lithographic resolutions. We propose a method that enables the use of metal electrodes for de novo DNA synthesis without the need for an insulating support. By electrochemically functionalizing gold electrodes, these electrodes can act as solid support for phosphoramidite-based synthesis. The proposed method relies on the electrochemical reduction of diazonium salts, enabling site-specific incorporation of hydroxyl groups onto the metal electrodes. An automated DNA synthesizer was used to couple phosphoramidite moieties directly onto the OH-modified electrodes to obtain the desired oligonucleotide sequence. Characterization was done via cyclic voltammetry and fluorescence microscopy. Our results present a valuable proof-of-concept for the integration of solid-phase DNA synthesis with microelectronics.

A dual switch controls bacterial enhancer-dependent transcription

PubMed Central

Wiesler, Simone C.; Burrows, Patricia C.; Buck, Martin

2012-01-01

Bacterial RNA polymerases (RNAPs) are targets for antibiotics. Myxopyronin binds to the RNAP switch regions to block structural rearrangements needed for formation of open promoter complexes. Bacterial RNAPs containing the major variant σ54 factor are activated by enhancer-binding proteins (bEBPs) and transcribe genes whose products are needed in pathogenicity and stress responses. We show that (i) enhancer-dependent RNAPs help Escherichia coli to survive in the presence of myxopyronin, (ii) enhancer-dependent RNAPs partially resist inhibition by myxopyronin and (iii) ATP hydrolysis catalysed by bEBPs is obligatory for functional interaction of the RNAP switch regions with the transcription start site. We demonstrate that enhancer-dependent promoters contain two barriers to full DNA opening, allowing tight regulation of transcription initiation. bEBPs engage in a dual switch to (i) allow propagation of nucleated DNA melting from an upstream DNA fork junction and (ii) complete the formation of the transcription bubble and downstream DNA fork junction at the RNA synthesis start site, resulting in switch region-dependent RNAP clamp closure and open promoter complex formation. PMID:22965125

The Experimental Study of Bacterial Evolution and Its Implications for the Modern Synthesis of Evolutionary Biology.

PubMed

O'Malley, Maureen A

2018-06-01

Since the 1940s, microbiologists, biochemists and population geneticists have experimented with the genetic mechanisms of microorganisms in order to investigate evolutionary processes. These evolutionary studies of bacteria and other microorganisms gained some recognition from the standard-bearers of the modern synthesis of evolutionary biology, especially Theodosius Dobzhansky and Ledyard Stebbins. A further period of post-synthesis bacterial evolutionary research occurred between the 1950s and 1980s. These experimental analyses focused on the evolution of population and genetic structure, the adaptive gain of new functions, and the evolutionary consequences of competition dynamics. This large body of research aimed to make evolutionary theory testable and predictive, by giving it mechanistic underpinnings. Although evolutionary microbiologists promoted bacterial experiments as methodologically advantageous and a source of general insight into evolution, they also acknowledged the biological differences of bacteria. My historical overview concludes with reflections on what bacterial evolutionary research achieved in this period, and its implications for the still-developing modern synthesis.

Light-switchable polymer from cationic to zwitterionic form: synthesis, characterization, and interactions with DNA and bacterial cells.

PubMed

Sobolčiak, Patrik; Spírek, Mário; Katrlík, Jaroslav; Gemeiner, Peter; Lacík, Igor; Kasák, Peter

2013-04-25

A novel cationic polymer poly(N,N-dimethyl-N-[3-(methacroylamino) propyl]-N-[2-[(2-nitrophenyl)methoxy]-2-oxo-ethyl]ammonium chloride) is synthesized by free-radical polymerization of N-[3-(dimethylamino)propyl] methacrylamide and subsequent quaternization with o-nitrobenzyl 2-chloroacetate. The photolabile o-nitrobenzyl carboxymethyl pendant moiety is transformed to the zwitterionic carboxybetaine form upon the irradiation at 365 nm. This feature is used to condense and, upon the light irradiation, to release double-strand DNA tested by gel electrophoresis and surface plasmon resonance experiments as well as to switch the antibacterial activity to non-toxic character demonstrated for Escherichia coli bacterial cells in solution and at the surface using the self-assembled monolayers. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Facile synthesis of cobalt ferrite nanotubes using bacterial nanocellulose as template.

PubMed

Menchaca-Nal, S; Londoño-Calderón, C L; Cerrutti, P; Foresti, M L; Pampillo, L; Bilovol, V; Candal, R; Martínez-García, R

2016-02-10

A facile method for the preparation of cobalt ferrite nanotubes by use of bacterial cellulose nanoribbons as a template is described. The proposed method relays on a simple coprecipitation operation, which is a technique extensively used for the synthesis of nanoparticles (either isolated or as aggregates) but not for the synthesis of nanotubes. The precursors employed in the synthesis are chlorides, and the procedure is carried out at low temperature (90 °C). By the method proposed a homogeneous distribution of cobalt ferrite nanotubes with an average diameter of 217 nm in the bacterial nanocellulose (BC) aerogel (3%) was obtained. The obtained nanotubes are formed by 26-102 nm cobalt ferrite clusters of cobalt ferrite nanoparticles with diameters in the 9-13 nm interval. The nanoparticles that form the nanotubes showed to have a certain crystalline disorder, which could be attributed in a greater extent to the small crystallite size, and, in a lesser extent, to microstrains existing in the crystalline lattice. The BC-templated-CoFe2O4 nanotubes exhibited magnetic behavior at room temperature. The magnetic properties showed to be influenced by a fraction of nanoparticles in superparamagnetic state. Copyright © 2015 Elsevier Ltd. All rights reserved.

Wheat DNA Primase (RNA Primer Synthesis in Vitro, Structural Studies by Photochemical Cross-Linking, and Modulation of Primase Activity by DNA Polymerases).

PubMed Central

Laquel, P.; Litvak, S.; Castroviejo, M.

1994-01-01

DNA primase synthesizes short RNA primers used by DNA polymerases to initiate DNA synthesis. Two proteins of approximately 60 and 50 kD were recognized by specific antibodies raised against yeast primase subunits, suggesting a high degree of analogy between wheat and yeast primase subunits. Gel-filtration chromatography of wheat primase showed two active forms of 60 and 110 to 120 kD. Ultraviolet-induced cross-linking with radioactive oligothymidilate revealed a highly labeled protein of 60 kD. After limited trypsin digestion of wheat (Triticum aestivum L.) primase, a major band of 48 kD and two minor bands of 38 and 17 kD were observed. In the absence of DNA polymerases, the purified primase synthesizes long RNA products. The size of the RNA product synthesized by wheat primase is considerably reduced by the presence of DNA polymerases, suggesting a modulatory effect of the association between these two enzymes. Lowering the primase concentration in the assay also favored short RNA primer synthesis. Several properties of the wheat DNA primase using oligoadenylate [oligo(rA)]-primed or unprimed polythymidilate templates were studied. The ability of wheat primase, without DNA polymerases, to elongate an oligo(rA) primer to long RNA products depends on the primer size, temperature, and the divalent cation concentration. Thus, Mn2+ ions led to long RNA products in a very wide range of concentrations, whereas with Mg2+ long products were observed around 15 mM. We studied the ability of purified wheat DNA polymerases to initiate DNA synthesis from an RNA primer: wheat DNA polymerase A showed the highest activity, followed by DNA polymerases B and CII, whereas DNA polymerase CI was unable to initiate DNA synthesis from an RNA primer. Results are discussed in terms of understanding the role of these polymerases in DNA replication in plants. PMID:12232187

Synthesis of amino-rich silica-coated magnetic nanoparticles for the efficient capture of DNA for PCR.

PubMed

Bai, Yalong; Cui, Yan; Paoli, George C; Shi, Chunlei; Wang, Dapeng; Zhou, Min; Zhang, Lida; Shi, Xianming

2016-09-01

Magnetic separation has great advantages over traditional bio-separation methods and has become popular in the development of methods for the detection of bacterial pathogens, viruses, and transgenic crops. Functionalization of magnetic nanoparticles is a key factor for efficient capture of the target analytes. In this paper, we report the synthesis of amino-rich silica-coated magnetic nanoparticles using a one-pot method. This type of magnetic nanoparticle has a rough surface and a higher density of amino groups than the nanoparticles prepared by a post-modification method. Furthermore, the results of hydrochloric acid treatment indicated that the magnetic nanoparticles were stably coated. The developed amino-rich silica-coated magnetic nanoparticles were used to directly adsorb DNA. After magnetic separation and blocking, the magnetic nanoparticles and DNA complexes were used directly for the polymerase chain reaction (PCR), without onerous and time-consuming purification and elution steps. The results of real-time quantitative PCR showed that the nanoparticles with higher amino group density resulted in improved DNA capture efficiency. The results suggest that amino-rich silica-coated magnetic nanoparticles are of great potential for efficient bio-separation of DNA prior to detection by PCR. Copyright © 2016. Published by Elsevier B.V.

Bacterial DNA indicated as an important inducer of fish cathelicidins.

PubMed

Maier, Valerie Helene; Schmitt, Clemens Nikolaus Zeno; Gudmundsdottir, Sigridur; Gudmundsson, Gudmundur Hrafn

2008-04-01

Cathelicidins are antimicrobial peptides indicated as important in the control of the natural microflora as well as in the fight against bacterial invasion in mammals. Little is known about cathelicidins in fish and here the Chinook salmon (Oncorhynchus tshawytscha) embryo cell line (CHSE-214) was used as a model system to study the expression of cathelicidins due to fish pathogenic bacteria. The cDNA of cathelicidin from CHSE-214 cells (csCath) was cloned and shown to be closely related to gene 2 of both rainbow trout and Atlantic salmon. The deducted amino acid sequence showed highest sequence identity to rtCath2 with 95% and 72% for the cathelin and the antibacterial part, respectively. Cathelicidin gene expression was studied and various Gram positive and Gram negative bacteria caused the upregulation of the gene (csCath). Bacterial DNA and protein were shown important for the induction of cathelicidin expression in these cells. LPS (Escherichia coli) also causes the upregulation of cathelicidins, but digestion of the LPS with DNase I before incubation of the cells, totally abolished the upregulation of cathelicidin and suggests DNA contamination in the LPS to be the trigger for this effect. These results could explain the limited responsiveness of fish cells towards pure LPS and confirm previous suggestions that fish cells are less sensitive to LPS than mammalian cells.

DNA-sensing inflammasomes: regulation of bacterial host defense and the gut microbiota.

PubMed

Man, Si Ming; Karki, Rajendra; Kanneganti, Thirumala-Devi

2016-06-01

DNA sensors are formidable immune guardians of the host. At least 14 cytoplasmic DNA sensors have been identified in recent years, each with specialized roles in driving inflammation and/or cell death. Of these, AIM2 is a sensor of dsDNA, and forms an inflammasome complex to activate the cysteine protease caspase-1, mediates the release of the proinflammatory cytokines IL-1β and IL-18, and induces pyroptosis. The inflammasome sensor NLRP3 can also respond to DNA in the forms of oxidized mitochondrial DNA and the DNA derivative RNA:DNA hybrids produced by bacteria, whereas the putative inflammasome sensor IFI16 responds to viral DNA in the nucleus. Although inflammasomes provoke inflammation for anti-microbial host defense, they must also maintain homeostasis with commensal microbiota. Here, we outline recent advances highlighting the complex relationship between DNA-sensing inflammasomes, bacterial host defense and the gut microbiota. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Improved deoxyribozymes for synthesis of covalently branched DNA and RNA.

PubMed

Lee, Christine S; Mui, Timothy P; Silverman, Scott K

2011-01-01

A covalently branched nucleic acid can be synthesized by joining the 2'-hydroxyl of the branch-site ribonucleotide of a DNA or RNA strand to the activated 5'-phosphorus of a separate DNA or RNA strand. We have previously used deoxyribozymes to synthesize several types of branched nucleic acids for experiments in biotechnology and biochemistry. Here, we report in vitro selection experiments to identify improved deoxyribozymes for synthesis of branched DNA and RNA. Each of the new deoxyribozymes requires Mn²(+) as a cofactor, rather than Mg²(+) as used by our previous branch-forming deoxyribozymes, and each has an initially random region of 40 rather than 22 or fewer combined nucleotides. The deoxyribozymes all function by forming a three-helix-junction (3HJ) complex with their two oligonucleotide substrates. For synthesis of branched DNA, the best new deoxyribozyme, 8LV13, has k(obs) on the order of 0.1 min⁻¹, which is about two orders of magnitude faster than our previously identified 15HA9 deoxyribozyme. 8LV13 also functions at closer-to-neutral pH than does 15HA9 (pH 7.5 versus 9.0) and has useful tolerance for many DNA substrate sequences. For synthesis of branched RNA, two new deoxyribozymes, 8LX1 and 8LX6, were identified with broad sequence tolerances and substantial activity at pH 7.5, versus pH 9.0 for many of our previous deoxyribozymes that form branched RNA. These experiments provide new, and in key aspects improved, practical catalysts for preparation of synthetic branched DNA and RNA.

A study of deoxyribonucleotide metabolism and its relation to DNA synthesis. Supercomputer simulation and model-system analysis.

PubMed

Heinmets, F; Leary, R H

1991-06-01

A model system (1) was established to analyze purine and pyrimidine metabolism. This system has been expanded to include macrosimulation of DNA synthesis and the study of its regulation by terminal deoxynucleoside triphosphates (dNTPs) via a complex set of interactions. Computer experiments reveal that our model exhibits adequate and reasonable sensitivity in terms of dNTP pool levels and rates of DNA synthesis when inputs to the system are varied. These simulation experiments reveal that in order to achieve maximum DNA synthesis (in terms of purine metabolism), a proper balance is required in guanine and adenine input into this metabolic system. Excessive inputs will become inhibitory to DNA synthesis. In addition, studies are carried out on rates of DNA synthesis when various parameters are changed quantitatively. The current system is formulated by 110 differential equations.

Contribution of permeability and sensitivity to inhibition of DNA synthesis in determining susceptibilities of Escherichia coli, Pseudomonas aeruginosa, and Alcaligenes faecalis to ciprofloxacin.

PubMed Central

Bedard, J; Chamberland, S; Wong, S; Schollaardt, T; Bryan, L E

1989-01-01

To examine the correlation between bacterial cell susceptibility to ciprofloxacin and the magnitude of uptake and cell target sensitivity, the relative contribution of ciprofloxacin accumulation in intact cells and its ability to inhibit DNA synthesis were investigated among strains of Escherichia coli, Pseudomonas aeruginosa, and Alcaligenes faecalis. Uptake studies of [14C]ciprofloxacin demonstrated diffusion kinetics for P. aeruginosa and E. coli. Ciprofloxacin was more readily removed from E. coli J53 and A. faecalis ATCC 19018 by washing than from P. aeruginosa PAO503. These results indicate that the process of cell accumulation is different for P. aeruginosa in that the drug is firmly bound at an extracellular site. Whatever the washing conditions, A. faecalis accumulated less drug than either of the other two bacteria. Magnesium chloride (10 mM) caused a substantial decrease of ciprofloxacin accumulated and an increase in the MIC, depending upon the nature of the medium. The addition of carbonyl cyanide m-chlorophenylhydrazone caused a variable increase in drug accumulated, depending on the medium and the bacterial strain. The concentration of ciprofloxacin required to obtain 50% inhibition (ID50) of DNA synthesis for P. aeruginosa PAO503 and A. faecalis ATCC 19018 did not correlate with their corresponding MICs but did for E. coli J53. Treatment with EDTA decreased the ID50 of ciprofloxacin for P. aeruginosa PAO503 and its gyrA derivative by 5- and 2-fold, respectively, and decreased the ID50 for E. coli JB5R, a strain with a known decrease in OmpF, by 1.4-fold but did not decrease the ID50 for the normally susceptible E. coli J53. The ID(50) for P. aeruginosa obtained after EDTA treatment or in ether-permeabilized cells was higher than that obtained for the other two strains. The protonophore carbonyl cyanide m-chlorophenylhydrazone prevented killing by low ciprofloxacin concentrtaions, but sodium azide did not. The latter compound did not enhance killing

Synthesis of eukaryotic lipid biomarkers in the bacterial domain

NASA Astrophysics Data System (ADS)

Welander, P. V.; Banta, A. B.; Lee, A. K.; Wei, J. H.

2017-12-01

Lipid biomarkers are organic molecules preserved in sediments and sedimentary rocks that can function as geological proxies for certain microbial taxa or for specific environmental conditions. These molecular fossils provide a link between organisms and their environments in both modern and ancient settings and have afforded significant insight into ancient climatic events, mass extinctions, and various evolutionary transitions throughout Earth's history. However, the proper interpretation of lipid biomarkers is dependent on a broad understanding of their diagenetic precursors in modern systems. This includes understanding the taphonomic transformations that these molecules undergo, their biosynthetic pathways, and the ecological conditions that affect their cellular production. In this study, we focus on one group of lipid biomarkers - the sterols. These are polycyclic isoprenoidal lipids that have a high preservation potential and play a critical role in the physiology of most eukaryotes. However, the synthesis and function of these lipids in the bacterial domain has not been fully explored. Here we utilize a combination of bioinformatics, microbial genetics, and biochemistry to demonstrate that bacterial sterol producers are more prevalent in environmental metagenomic samples than in the genomic databases of cultured organisms and to identify novel proteins required to synthesize and modify sterols in bacteria. These proteins represent a distinct pathway for sterol synthesis exclusive to bacteria and indicate that sterol synthesis in bacteria may have evolved independently of eukaryotic sterol biosynthesis. Taken together, these results demonstrate how studies in extant bacteria can provide insight into the biological sources and the biosynthetic pathways of specific lipid biomarkers and in turn may allow for more robust interpretation of biomarker signatures.

The difference in the stimulation by putrescine of DNA synthesis using DNA polymerase extracts of normal rat liver or of tumour tissue or host liver from tumour-bearing rats.

PubMed

Taguchi, Takahiko; Kurata, Sumiko; Ohashi, Mochihiko

2002-09-01

Putrescine biosynthesis is elevated before DNA replication, and a stimulation of DNA synthesis by 20 mM putrescine has been found using an in vitro DNA synthesizing system. Furthermore, this stimulation of DNA synthesis by putrescine involves a particular factor (factor PA). This factor PA stimulates DNA polymerases alpha, beta, and gamma, and is present in nuclei and mitochondria but not in cytoplasm. Factor PA loses about 80% of its activity by heating at 45 degrees C for 15 min or by hydrolysis with 100 mg ml(-1) Enzygel trypsin. These properties indicate that factor PA is a protein. Its size is estimated to be about 2.1 S. DNA synthesis in nuclear and mitochondrial DNA polymerase extracts from tumour tissues and host livers of tumour-bearing rats are not stimulated by 20 mM putrescine. However, the addition of excess factor PA to DNA synthesizing systems using DNA polymerase extracts from proliferative tissues again results in a stimulation of DNA synthesis by exogenous putrescine. These findings indicate that the stimulatory effect of DNA synthesis in vitro by exogenous putrescine is controlled by the ratio between factor PA and endogenously synthesized putrescine in proliferative tissues or that sent by the bloodstream from proliferative tissues. These results suggest that a non-stimulatory effect of putrescine on DNA synthesis may be diagnostic in tumour-bearing patients. Copyright 2002 John Wiley & Sons, Ltd.

4-Hydroxy-2-pyridones: Discovery and evaluation of a novel class of antibacterial agents targeting DNA synthesis.

PubMed

Arnold, Michael A; Gerasyuto, Aleksey I; Wang, Jiashi; Du, Wu; Gorske, Yi Jin Kim; Arasu, Tamil; Baird, John; Almstead, Neil G; Narasimhan, Jana; Peddi, Srinivasa; Ginzburg, Olya; Lue, Stanley W; Hedrick, Jean; Sheedy, Josephine; Lagaud, Guy; Branstrom, Arthur A; Weetall, Marla; Prasad, J V N Vara; Karp, Gary M

2017-11-15

The continued emergence of bacteria resistant to current standard of care antibiotics presents a rapidly growing threat to public health. New chemical entities (NCEs) to treat these serious infections are desperately needed. Herein we report the discovery, synthesis, SAR and in vivo efficacy of a novel series of 4-hydroxy-2-pyridones exhibiting activity against Gram-negative pathogens. Compound 1c, derived from the N-debenzylation of 1b, preferentially inhibits bacterial DNA synthesis as determined by standard macromolecular synthesis assays. The structural features of the 4-hydroxy-2-pyridone scaffold required for antibacterial activity were explored and compound 6q, identified through further optimization of the series, had an MIC 90 value of 8 μg/mL against a panel of highly resistant strains of E. coli. In a murine septicemia model, compound 6q exhibited a PD 50 of 8 mg/kg in mice infected with a lethal dose of E. coli. This novel series of 4-hydroxy-2-pyridones serves as an excellent starting point for the identification of NCEs treating Gram-negative infections. Copyright © 2017 Elsevier Ltd. All rights reserved.

The effects of a low-intensity red laser on bacterial growth, filamentation and plasmid DNA

NASA Astrophysics Data System (ADS)

Roos, C.; Santos, J. N.; Guimarães, O. R.; Geller, M.; Paoli, F.; Fonseca, A. S.

2013-07-01

Exposure of nonphotosynthesizing microorganisms to light could increase cell division in cultures, a phenomenon denominated as biostimulation. However, data concerning the importance of the genetic characteristics of cells on this effect are as yet scarce. The aim of this work was to evaluate the effects of a low-intensity red laser on the growth, filamentation and plasmids in Escherichia coli cells proficient and deficient in DNA repair. E. coli cultures were exposed to a laser (658 nm, 10 mW, 1 and 8 J cm-2) to study bacterial growth and filamentation. Also, bacterial cultures hosting pBSK plasmids were exposed to the laser to study DNA topological forms from the electrophoretic profile in agarose gels. Data indicate the low-intensity red laser: (i) had no effect on the growth of E. coli wild type and exonuclease III deficient cells; (ii) induced bacterial filamentation, (iii) led to no alteration in the electrophoretic profile of plasmids from exonuclease III deficient cells, but plasmids from wild type cells were altered. A low-intensity red laser at the low fluences used in phototherapy has no effect on growth, but induces filamentation and alters the topological forms of plasmid DNA in E. coli cultures depending on the DNA repair mechanisms.

Effects of ultrasonic pretreatment on quantity and composition of bacterial DNA recovered from granular activated carbon used for drinking water treatment.

PubMed

Kim, Tae Gwan; Kim, Sun-Hye; Cho, Kyung-Suk

2014-01-01

Effects of ultrasonic pretreatment on bacterial DNA recovery from granular activated carbon (GAC) were investigated. GAC (Calgon F400), biologically activated, was sampled from an actual drinking water plant. Different ultrasonic energy densities (0-400 J·cm(-3)) were applied with agitation (250 rpm for 30 min), and recovered bacterial DNA was quantified using quantitative PCR. Energy density was linearly correlated with the concentration of carbon fines produced from GAC during ultrasonication. Ultrasonication alone had no effect on DNA recovery at ≤60 J·cm(-3), but a strongly adverse effect at >67 J·cm(-3) due to the produced carbon fines. Agitation along with ultrasonication strongly enhanced the bacterial DNA recovery when ≤40 J·cm(-3) was applied, although it did not affect the production of carbon fines. Ribosomal tag pyrosequencing was used to compare recovered bacterial communities (0, 20 and 30 J·cm(-3) with or without agitation). Ultrasonication allowed for obtaining a more diverse and richer bacterial community from GAC, compared with the control. Agitation did not show a positive effect on community organization (richness and diversity). Consistently, canonical correspondence analysis indicated that the energy density was associated with the relative abundances of particular bacterial members (P < 0.05), while agitation did not. Correspondence analysis revealed that the recovered bacterial communities were grouped according to the applied energy densities. In conclusion, ultrasonication and agitation influence the recovered DNA in quality and quantity, respectively, and carbon fines as a by-product by ultrasonication interfere with the DNA recovery.

Zinc-binding Domain of the Bacteriophage T7 DNA Primase Modulates Binding to the DNA Template*

PubMed Central

Lee, Seung-Joo; Zhu, Bin; Akabayov, Barak; Richardson, Charles C.

2012-01-01

The zinc-binding domain (ZBD) of prokaryotic DNA primases has been postulated to be crucial for recognition of specific sequences in the single-stranded DNA template. To determine the molecular basis for this role in recognition, we carried out homolog-scanning mutagenesis of the zinc-binding domain of DNA primase of bacteriophage T7 using a bacterial homolog from Geobacillus stearothermophilus. The ability of T7 DNA primase to catalyze template-directed oligoribonucleotide synthesis is eliminated by substitution of any five-amino acid residue-long segment within the ZBD. The most significant defect occurs upon substitution of a region (Pro-16 to Cys-20) spanning two cysteines that coordinate the zinc ion. The role of this region in primase function was further investigated by generating a protein library composed of multiple amino acid substitutions for Pro-16, Asp-18, and Asn-19 followed by genetic screening for functional proteins. Examination of proteins selected from the screening reveals no change in sequence-specific recognition. However, the more positively charged residues in the region facilitate DNA binding, leading to more efficient oligoribonucleotide synthesis on short templates. The results suggest that the zinc-binding mode alone is not responsible for sequence recognition, but rather its interaction with the RNA polymerase domain is critical for DNA binding and for sequence recognition. Consequently, any alteration in the ZBD that disturbs its conformation leads to loss of DNA-dependent oligoribonucleotide synthesis. PMID:23024359

Automated DNA extraction from genetically modified maize using aminosilane-modified bacterial magnetic particles.

PubMed

Ota, Hiroyuki; Lim, Tae-Kyu; Tanaka, Tsuyoshi; Yoshino, Tomoko; Harada, Manabu; Matsunaga, Tadashi

2006-09-18

A novel, automated system, PNE-1080, equipped with eight automated pestle units and a spectrophotometer was developed for genomic DNA extraction from maize using aminosilane-modified bacterial magnetic particles (BMPs). The use of aminosilane-modified BMPs allowed highly accurate DNA recovery. The (A(260)-A(320)):(A(280)-A(320)) ratio of the extracted DNA was 1.9+/-0.1. The DNA quality was sufficiently pure for PCR analysis. The PNE-1080 offered rapid assay completion (30 min) with high accuracy. Furthermore, the results of real-time PCR confirmed that our proposed method permitted the accurate determination of genetically modified DNA composition and correlated well with results obtained by conventional cetyltrimethylammonium bromide (CTAB)-based methods.

Reducing DNA context dependence in bacterial promoters

PubMed Central

Carr, Swati B.; Densmore, Douglas M.

2017-01-01

Variation in the DNA sequence upstream of bacterial promoters is known to affect the expression levels of the products they regulate, sometimes dramatically. While neutral synthetic insulator sequences have been found to buffer promoters from upstream DNA context, there are no established methods for designing effective insulator sequences with predictable effects on expression levels. We address this problem with Degenerate Insulation Screening (DIS), a novel method based on a randomized 36-nucleotide insulator library and a simple, high-throughput, flow-cytometry-based screen that randomly samples from a library of 436 potential insulated promoters. The results of this screen can then be compared against a reference uninsulated device to select a set of insulated promoters providing a precise level of expression. We verify this method by insulating the constitutive, inducible, and repressible promotors of a four transcriptional-unit inverter (NOT-gate) circuit, finding both that order dependence is largely eliminated by insulation and that circuit performance is also significantly improved, with a 5.8-fold mean improvement in on/off ratio. PMID:28422998

Comparison of bacterial DNA profiles of footwear insoles and soles of feet for the forensic discrimination of footwear owners.

PubMed

Goga, Haruhisa

2012-09-01

It is crucial to identify the owner of unattended footwear left at a crime scene. However, retrieving enough DNA for DNA profiling from the owner's foot skin (plantar skin) cells from inside the footwear is often unsuccessful. This is sometimes because footwear that is used on a daily basis contains an abundance of bacteria that degrade DNA. Further, numerous other factors related to the inside of the shoe, such as high humidity and temperature, can encourage bacterial growth inside the footwear and enhance DNA degradation. This project sought to determine if bacteria from inside footwear could be used for footwear trace evidence. The plantar skins and insoles of shoes of volunteers were swabbed for bacteria, and their bacterial community profiles were compared using bacterial 16S rRNA terminal restriction fragment length polymorphism analysis. Sufficient bacteria were recovered from both footwear insoles and the plantar skins of the volunteers. The profiling identified that each volunteer's plantar skins harbored unique bacterial communities, as did the individuals' footwear insoles. In most cases, a significant similarity in the bacterial community was identified for the matched foot/insole swabs from each volunteer, as compared with those profiles from different volunteers. These observations indicate the probability to discriminate the owner of footwear by comparing the microbial DNA fingerprint from inside footwear with that of the skin from the soles of the feet of the suspected owner. This novel strategy will offer auxiliary forensic footwear evidence for human DNA identification, although further investigations into this technique are required.

The action of the bacterial toxin, microcin B17, on DNA gyrase.

PubMed

Parks, William M; Bottrill, Andrew R; Pierrat, Olivier A; Durrant, Marcus C; Maxwell, Anthony

2007-04-01

Microcin B17 (MccB17) is a peptide-based bacterial toxin that targets DNA gyrase, the bacterial enzyme that introduces supercoils into DNA. The site and mode of action of MccB17 on gyrase are unclear. We review what is currently known about MccB17-gyrase interactions and summarise approaches to understanding its mode of action that involve modification of the toxin. We describe experiments in which treatment of the toxin at high pH leads to the deamidation of two asparagine residues to aspartates. The modified toxin was found to be inactive in vivo and in vitro, suggesting that the Asn residues are essential for activity. Following on from these studies we have used molecular modelling to suggest a 3D structure for microcin B17. We discuss the implications of this model for MccB17 action and investigate the possibility that it binds metal ions.

Subnuclear systems for synthesis of simian virus 40 DNA in vitro.

PubMed Central

Edenberg, H J; Waqar, M A; Huberman, J A

1976-01-01

We have developed two subnuclear systems for synthesis of DNA of simian virus 40 in vitro. We prepare chromatin from infected cells by the method of Hancock [(1974) J. Mol. Biol. 86, 649-663]; these "chromatin bodies" can be disrupted and large debris can be pelleted, leaving a supernatant ("soluble system"). Both chromatin bodies and the soluble system incorporate deoxyribonucleoside triphosphates into nucleoprotein complexes that contain simian virus 40 DNA. The DNA labeled in short pulses sediments in neutral sucrose gradients slightly faster than mature simian virus 40 DNA, as expected for replicating intermediate. When rebanded in alkaline sucrose gradients, about half of the radioactivity is found in short strands (200-300 nucleotides) and half in longer strands (up to full viral size). When these systems are supplemented with a cytoplasmic preparation from HeLa cells, synthesis is stimulated about 5-fold, and the short strands are converted into strands of up to full viral length as well as into covalently closed circles. These subnuclear DNA-replicating systems should be useful for biochemical fractionation and characterization of some of the proteins required for DNA replication. PMID:188037

Multiple regulatory systems coordinate DNA replication with cell growth in Bacillus subtilis.

PubMed

Murray, Heath; Koh, Alan

2014-10-01

In many bacteria the rate of DNA replication is linked with cellular physiology to ensure that genome duplication is coordinated with growth. Nutrient-mediated growth rate control of DNA replication initiation has been appreciated for decades, however the mechanism(s) that connects these cell cycle activities has eluded understanding. In order to help address this fundamental question we have investigated regulation of DNA replication in the model organism Bacillus subtilis. Contrary to the prevailing view we find that changes in DnaA protein level are not sufficient to account for nutrient-mediated growth rate control of DNA replication initiation, although this regulation does require both DnaA and the endogenous replication origin. We go on to report connections between DNA replication and several essential cellular activities required for rapid bacterial growth, including respiration, central carbon metabolism, fatty acid synthesis, phospholipid synthesis, and protein synthesis. Unexpectedly, the results indicate that multiple regulatory systems are involved in coordinating DNA replication with cell physiology, with some of the regulatory systems targeting oriC while others act in a oriC-independent manner. We propose that distinct regulatory systems are utilized to control DNA replication in response to diverse physiological and chemical changes.

A BAC-bacterial recombination method to generate physically linked multiple gene reporter DNA constructs.

PubMed

Maye, Peter; Stover, Mary Louise; Liu, Yaling; Rowe, David W; Gong, Shiaochin; Lichtler, Alexander C

2009-03-13

Reporter gene mice are valuable animal models for biological research providing a gene expression readout that can contribute to cellular characterization within the context of a developmental process. With the advancement of bacterial recombination techniques to engineer reporter gene constructs from BAC genomic clones and the generation of optically distinguishable fluorescent protein reporter genes, there is an unprecedented capability to engineer more informative transgenic reporter mouse models relative to what has been traditionally available. We demonstrate here our first effort on the development of a three stage bacterial recombination strategy to physically link multiple genes together with their respective fluorescent protein (FP) reporters in one DNA fragment. This strategy uses bacterial recombination techniques to: (1) subclone genes of interest into BAC linking vectors, (2) insert desired reporter genes into respective genes and (3) link different gene-reporters together. As proof of concept, we have generated a single DNA fragment containing the genes Trap, Dmp1, and Ibsp driving the expression of ECFP, mCherry, and Topaz FP reporter genes, respectively. Using this DNA construct, we have successfully generated transgenic reporter mice that retain two to three gene readouts. The three stage methodology to link multiple genes with their respective fluorescent protein reporter works with reasonable efficiency. Moreover, gene linkage allows for their common chromosomal integration into a single locus. However, the testing of this multi-reporter DNA construct by transgenesis does suggest that the linkage of two different genes together, despite their large size, can still create a positional effect. We believe that gene choice, genomic DNA fragment size and the presence of endogenous insulator elements are critical variables.

Distinct summer and winter bacterial communities in the active layer of Svalbard permafrost revealed by DNA- and RNA-based analyses

DOE PAGES

Schostag, Morten; Stibal, Marek; Jacobsen, Carsten S.; ...

2015-04-30

The active layer of soil overlaying permafrost in the Arctic is subjected to dramatic annual changes in temperature and soil chemistry, which likely affect bacterial activity and community structure. We studied seasonal variations in the bacterial community of active layer soil from Svalbard (78°N) by co-extracting DNA and RNA from 12 soil cores collected monthly over a year. PCR amplicons of 16S rRNA genes (DNA) and reverse transcribed transcripts (cDNA) were quantified and sequenced to test for the effect of low winter temperature and seasonal variation in concentration of easily degradable organic matter on the bacterial communities. The copy numbermore » of 16S rRNA genes and transcripts revealed no distinct seasonal changes indicating potential bacterial activity during winter despite soil temperatures well below -10°C. Multivariate statistical analysis of the bacterial diversity data (DNA and cDNA libraries) revealed a season-based clustering of the samples, and, e.g., the relative abundance of potentially active Cyanobacteria peaked in June and Alphaproteobacteria increased over the summer and then declined from October to November. The structure of the bulk (DNA-based) community was significantly correlated with pH and dissolved organic carbon, while the potentially active (RNA-based) community structure was not significantly correlated with any of the measured soil parameters. A large fraction of the 16S rRNA transcripts was assigned to nitrogen-fixing bacteria (up to 24% in June) and phototrophic organisms (up to 48% in June) illustrating the potential importance of nitrogen fixation in otherwise nitrogen poor Arctic ecosystems and of phototrophic bacterial activity on the soil surface.« less

Distinct summer and winter bacterial communities in the active layer of Svalbard permafrost revealed by DNA- and RNA-based analyses

PubMed Central

Schostag, Morten; Stibal, Marek; Jacobsen, Carsten S.; Bælum, Jacob; Taş, Neslihan; Elberling, Bo; Jansson, Janet K.; Semenchuk, Philipp; Priemé, Anders

2015-01-01

The active layer of soil overlaying permafrost in the Arctic is subjected to dramatic annual changes in temperature and soil chemistry, which likely affect bacterial activity and community structure. We studied seasonal variations in the bacterial community of active layer soil from Svalbard (78°N) by co-extracting DNA and RNA from 12 soil cores collected monthly over a year. PCR amplicons of 16S rRNA genes (DNA) and reverse transcribed transcripts (cDNA) were quantified and sequenced to test for the effect of low winter temperature and seasonal variation in concentration of easily degradable organic matter on the bacterial communities. The copy number of 16S rRNA genes and transcripts revealed no distinct seasonal changes indicating potential bacterial activity during winter despite soil temperatures well below −10°C. Multivariate statistical analysis of the bacterial diversity data (DNA and cDNA libraries) revealed a season-based clustering of the samples, and, e.g., the relative abundance of potentially active Cyanobacteria peaked in June and Alphaproteobacteria increased over the summer and then declined from October to November. The structure of the bulk (DNA-based) community was significantly correlated with pH and dissolved organic carbon, while the potentially active (RNA-based) community structure was not significantly correlated with any of the measured soil parameters. A large fraction of the 16S rRNA transcripts was assigned to nitrogen-fixing bacteria (up to 24% in June) and phototrophic organisms (up to 48% in June) illustrating the potential importance of nitrogen fixation in otherwise nitrogen poor Arctic ecosystems and of phototrophic bacterial activity on the soil surface. PMID:25983731

Iron Reverses Impermeable Chelator Inhibition of DNA Synthesis in CCl39 Cells

NASA Astrophysics Data System (ADS)

Alcain, Francisco J.; Low, Hans; Crane, Frederick L.

1994-08-01

Treatment of Chinese hamster lung fibro-blasts (CCl 39 cells) with the impermeable iron(II) chelator bathophenanthroline disulfonate (BPS) inhibits DNA synthesis when cell growth is initiated with growth factors including epidermal growth factor plus insulin, thrombin, or ceruloplasmin, but not with 10% fetal calf serum. The BPS treatment inhibits transplasma membrane electron transport. The treatment leads to release of iron from the cells as determined by BPS iron(II) complex formation over 90 min. Growth factor stimulation of DNA synthesis and electron transport are restored by addition of di- or trivalent iron to the cells in the form of ferric ammonium citrate, ferrous ammonium sulfate, or diferric transferrin. The effect with BPS differs from the inhibition of growth by hydroxyurea, which acts on the ribonucleotide reductase, or diethylenetriaminepentaacetic acid, which is another impermeable chelating agent, in that these agents inhibit growth in 10% fetal calf serum. The BPS effect is consistent with removal of iron from a site on the cell surface that controls DNA synthesis.

DNA hydrogel as a template for synthesis of ultrasmall gold nanoparticles for catalytic applications.

PubMed

Zinchenko, Anatoly; Miwa, Yasuyuki; Lopatina, Larisa I; Sergeyev, Vladimir G; Murata, Shizuaki

2014-03-12

DNA cross-linked hydrogel was used as a matrix for synthesis of gold nanoparticles. DNA possesses a strong affinity to transition metals such as gold, which allows for the concentration of Au precursor inside a hydrogel. Further reduction of HAuCl4 inside DNA hydrogel yields well dispersed, non-aggregated spherical Au nanoparticles of 2-3 nm size. The average size of these Au nanoparticles synthesized in DNA hydrogel is the smallest reported so far for in-gel metal nanoparticles synthesis. DNA hybrid hydrogel containing gold nanoparticles showed high catalytic activity in the hydrogenation reaction of nitrophenol to aminophenol. The proposed soft hybrid material is promising as environmentally friendly and sustainable material for catalytic applications.

Evaluating the Impact of DNA Extraction Method on the Representation of Human Oral Bacterial and Fungal Communities

PubMed Central

Biswas, Kristi; Taylor, Michael W.; Gear, Kim

2017-01-01

The application of high-throughput, next-generation sequencing technologies has greatly improved our understanding of the human oral microbiome. While deciphering this diverse microbial community using such approaches is more accurate than traditional culture-based methods, experimental bias introduced during critical steps such as DNA extraction may compromise the results obtained. Here, we systematically evaluate four commonly used microbial DNA extraction methods (MoBio PowerSoil® DNA Isolation Kit, QIAamp® DNA Mini Kit, Zymo Bacterial/Fungal DNA Mini PrepTM, phenol:chloroform-based DNA isolation) based on the following criteria: DNA quality and yield, and microbial community structure based on Illumina amplicon sequencing of the V3–V4 region of the 16S rRNA gene of bacteria and the internal transcribed spacer (ITS) 1 region of fungi. Our results indicate that DNA quality and yield varied significantly with DNA extraction method. Representation of bacterial genera in plaque and saliva samples did not significantly differ across DNA extraction methods and DNA extraction method showed no effect on the recovery of fungal genera from plaque. By contrast, fungal diversity from saliva was affected by DNA extraction method, suggesting that not all protocols are suitable to study the salivary mycobiome. PMID:28099455

DNA synthesis in HeLa cells and isolated nuclei after treatment with an inhibitor of spermidine synthesis, methyl glyoxal bis(guanylhydrazone).

PubMed

Krokan, H; Eriksen, A

1977-02-01

Addition of methyl glyoxal bis(guanylhydrazone) to HeLa S3 suspension cultures resulted in increased putrescine levels and decreased spermidine and spermine levels preceding a drop in incorporation of [3H]thymidine, [3H]uridine and [14C]leucine into macromolecules. When putrescine, spermidine, spermine or cadaverine was added simultaneously with methyl glyoxal bis(guanylhydrazone), the drug had no detectable effect on the synthesis of macromolecules. In nuclei isolated from cells treated with methyl glyoxal bis(guanylhydrazone) the reduction in the rate of DNA synthesis was equal to the reduction of [3H]thymidine incorporation in the corresponding whole cells. The capability of the nuclei to synthesize DNA could not be restored by adding spermidine or spermine to the system in vitro. The rate of DNA chain elongation was only reduced slightly by methyl glyoxal bis(guanylhydrazone) indicating that decreased levels of spermidine and spermine lead to a decrease in the number of replication units active in DNA synthesis within each cell.

Three-step Channel Conformational Changes Common to DNA Packaging Motors of Bacterial Viruses T3, T4, SPP1, and Phi29

PubMed Central

Wang, Shaoying; Ji, Zhouxiang; Yan, Erfu; Haque, Farzin; Guo, Peixuan

2016-01-01

The DNA packaging motor of dsDNA bacterial viruses contains a head-tail connector with a channel for genome to enter during assembly and to exit during host infection. The DNA packaging motor of bacterial virus phi29 was recently reported to use the “One-way Revolution” mechanism for DNA packaging. This raises a question of how dsDNA is ejected during infection if the channel acts as a one-way inward valve. Here we report a three step conformational change of the portal channel that is common among DNA translocation motors of bacterial viruses T3, T4, SPP1, and phi29. The channels of these motors exercise three discrete steps of gating, as revealed by electrophysiological assays. It is proposed that the three step channel conformational changes occur during DNA entry process, resulting in a structural transition in preparation of DNA movement in the reverse direction during ejection. PMID:27181501

Bacterial inosine 5'-monophosphate dehydrogenase ("IMPDH") DNA as a dominant selectable marker in mammals and other eukaryotes

DOEpatents

Huberman, Eliezer [Chicago, IL; Baccam, Mekhine J [Woodridge, IL

2007-02-27

The present invention relates to a nucleic acid sequence and its corresponding protein sequence useful as a dominant selectable marker in eukaryotes. More specifically the invention relates to a nucleic acid encoding a bacterial IMPDH gene that has been engineered into a eukaryotic expression vectors, thereby permitting bacterial IMPDH expression in mammalian cells. Bacterial IMPDH expression confers resistance to MPA which can be used as dominant selectable marker in eukaryotes including mammals. The invention also relates to expression vectors and cells that express the bacterial IMPDH gene as well as gene therapies and protein synthesis.

CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

NASA Astrophysics Data System (ADS)

Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

2018-03-01

CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of <220>. Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

Inhibition of DNA synthesis by chemical carcinogens in cultures of initiated and normal proliferating rat hepatocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Novicki, D.L.; Rosenberg, M.R.; Michalopoulos, G.

1985-01-01

Rat hepatocytes in primary culture can be stimulated to replicate under the influence of rat serum and sparse plating conditions. Higher replication rates are induced by serum from two-thirds partially hepatectomized rats. The effects of carcinogens and noncarcinogens on the ability of hepatocytes to synthesize DNA were examined by measuring the incorporation of (3H)thymidine by liquid scintillation counting and autoradiography. Hepatocyte DNA synthesis was not decreased by ethanol or dimethyl sulfoxide at concentrations less than 0.5%. No effect was observed when 0.1 mM ketamine, Nembutal, hypoxanthine, sucrose, ascorbic acid, or benzo(e)pyrene was added to cultures of replicating hepatocytes. Estrogen, testosterone,more » tryptophan, and vitamin E inhibited DNA synthesis by approximately 50% at 0.1 mM, a concentration at which toxicity was noticeable. Several carcinogens requiring metabolic activation as well as the direct-acting carcinogen N-methyl-N'-nitro-N-nitrosoguanidine interfered with DNA synthesis. Aflatoxin B1 inhibited DNA synthesis by 50% (ID50) at concentrations between 1 X 10(-8) and 1 X 10(-7) M. The ID50 for 2-acetylaminofluorene was between 1 X 10(-7) and 1 X 10(-6) M. Benzo(a)pyrene and 3'-methyl-4-dimethylaminoazobenzene inhibited DNA synthesis 50% between 1 X 10(-5) and 1 X 10(-4) M. Diethylnitrosamine and dimethylnitrosamine (ID50 between 1 X 10(-4) and 5 X 10(-4) M) and 1- and 2-naphthylamine (ID50 between 1 X 10(-5) and 5 X 10(-4) M) caused inhibition of DNA synthesis at concentrations which overlapped with concentrations that caused measurable toxicity.« less

Environmental Stress-Induced Bacterial Lysis and Extracellular DNA Release Contribute to Campylobacter jejuni Biofilm Formation.

PubMed

Feng, Jinsong; Ma, Lina; Nie, Jiatong; Konkel, Michael E; Lu, Xiaonan

2018-03-01

Campylobacter jejuni is a microaerophilic bacterium and is believed to persist in a biofilm to antagonize environmental stress. This study investigated the influence of environmental conditions on the formation of C. jejuni biofilm. We report an extracellular DNA (eDNA)-mediated mechanism of biofilm formation in response to aerobic and starvation stress. The eDNA was determined to represent a major form of constitutional material of C. jejuni biofilms and to be closely associated with bacterial lysis. Deletion mutation of the stress response genes spoT and recA enhanced the aerobic influence by stimulating lysis and increasing eDNA release. Flagella were also involved in biofilm formation but mainly contributed to attachment rather than induction of lysis. The addition of genomic DNA from either Campylobacter or Salmonella resulted in a concentration-dependent stimulation effect on biofilm formation, but the effect was not due to forming a precoating DNA layer. Enzymatic degradation of DNA by DNase I disrupted C. jejuni biofilm. In a dual-species biofilm, eDNA allocated Campylobacter and Salmonella at distinct spatial locations that protect Campylobacter from oxygen stress. Our findings demonstrated an essential role and multiple functions of eDNA in biofilm formation of C. jejuni , including facilitating initial attachment, establishing and maintaining biofilm, and allocating bacterial cells. IMPORTANCE Campylobacter jejuni is a major cause of foodborne illness worldwide. In the natural environment, the growth of C. jejuni is greatly inhibited by various forms of environmental stress, such as aerobic stress and starvation stress. Biofilm formation can facilitate the distribution of C. jejuni by enabling the survival of this fragile microorganism under unfavorable conditions. However, the mechanism of C. jejuni biofilm formation in response to environmental stress has been investigated only partially. The significance of our research is in identifying extracellular

Synthesis of the Tellurium-Derivatized Phosphoramidites and their Incorporation into DNA Oligonucleotides

PubMed Central

Jiang, Sibo; Sheng, Jia

2015-01-01

Introduction In this unit, an efficient method for the synthesis of 2’-tellerium modified phosphoramidite and its incorporation into oligonucleotide are presented. We choose 5’-O-DMTr-2,2’-anhydro-uridine and -thymidine nucleosides (S.1, S.2) as starting materials due to their easy preparation. The 5’-O-DMTr-2,2’-anhydro-uridine and -thymidine can be converted to corresponding the 2’-tellerium-derivatized nucleosides by treating with the telluride nucleophiles. Subsequently, the 2’-Te-nucleosides can be transformed into 3’-phosphoramidites, which are the building blocks for DNA/RNA synthesis. The DNA synthesis, purification and applications of oligonucleotides containing 2’-Te-U or 2’-Te-T are described in this protocol. PMID:22147418

DNA (DEOXYRIBONUCLEIC ACID) SYNTHESIS FOLLOWING MICROINJECTION OF HETEROLOGOUS SPERM AND SOMATIC CELL NUCLEI INTO HAMSTER OOCYTES

EPA Science Inventory

The authors have investigated the ability of the hamster oocyte to initiate DNA synthesis in nuclei differing in basic protein content. DNA synthesis was studied by autoradiography in oocytes that had been incubated in 3H-thymidine after being parthenogenetically activated by sha...

Low-energy plasma immersion ion implantation to induce DNA transfer into bacterial E. coli

NASA Astrophysics Data System (ADS)

Sangwijit, K.; Yu, L. D.; Sarapirom, S.; Pitakrattananukool, S.; Anuntalabhochai, S.

2015-12-01

Plasma immersion ion implantation (PIII) at low energy was for the first time applied as a novel biotechnology to induce DNA transfer into bacterial cells. Argon or nitrogen PIII at low bias voltages of 2.5, 5 and 10 kV and fluences ranging from 1 × 1012 to 1 × 1017 ions/cm2 treated cells of Escherichia coli (E. coli). Subsequently, DNA transfer was operated by mixing the PIII-treated cells with DNA. Successes in PIII-induced DNA transfer were demonstrated by marker gene expressions. The induction of DNA transfer was ion-energy, fluence and DNA-size dependent. The DNA transferred in the cells was confirmed functioning. Mechanisms of the PIII-induced DNA transfer were investigated and discussed in terms of the E. coli cell envelope anatomy. Compared with conventional ion-beam-induced DNA transfer, PIII-induced DNA transfer was simpler with lower cost but higher efficiency.

Mechanism of foreign DNA selection in a bacterial adaptive immune system

PubMed Central

Sashital, Dipali G.; Wiedenheft, Blake; Doudna, Jennifer A.

2012-01-01

Summary In bacterial and archaeal CRISPR immune pathways, DNA sequences from invading bacteriophage or plasmids are integrated into CRISPR loci within the host genome, conferring immunity against subsequent infections. The ribonucleoprotein complex Cascade utilizes RNAs generated from these loci to target complementary “non-self” DNA sequences for destruction, while avoiding binding to “self” sequences within the CRISPR locus. Here we show that CasA, the largest protein subunit of Cascade, is required for non-self target recognition and binding. Combining a 2.3 Å crystal structure of CasA with cryo-EM structures of Cascade, we have identified a loop that is required for viral defense. This loop contacts a conserved 3-base pair motif that is required for non-self target selection. Our data suggest a model in which the CasA loop scans DNA for this short motif prior to target destabilization and binding, maximizing the efficiency of DNA surveillance by Cascade. PMID:22521690

Novel Bacterial Proteins and Lipids Reveal the Diversity of Triterpenoid Biomarker Synthesis

NASA Astrophysics Data System (ADS)

Wei, J. H.; Banta, A. B.; Gill, C. C. C.; Giner, J. L.; Welander, P. V.

2017-12-01

Lipids preserved in sediments and rocks function as organic biomarkers providing evidence for the types of organisms that lived in ancient environments. We use a combined approach utilizing comparative genomics, molecular biology, and lipid analysis to discover novel cyclic triteprenoid lipids and their biosynthetic pathways in bacteria. Here, we present two cases of bacterial synthesis of pentacylic triterpenols previously thought to be indicative of eukaryotes, which address current incongruities in the fossil record. Cyclic triterpenoid lipids, such as hopanoids and sterols, are generally associated with bacteria and eukaryotes, respectively. The pentacyclic triterpenoid tetrahymanol, first discovered in the ciliate Tetrahymena pyriformis, and its diagenetic product gammacerane, have been previously interpreted as markers for eukaryotes and linked to water column stratification. Yet the occurrence of tetrahymanol in bacteria implies our knowledge of extant tetrahymanol producers is not complete. Through comparative genomics we identified a new gene required for tetrahymanol synthesis in the bacterium Methylomicrobium alcaliphilum. This gene encodes a novel enzyme, Tetrahymanol synthase (THS), that synthesizes tetrahymanol from the hopanoid diploptene demonstrating a pathway for tetrahymanol production in bacteria distinct from that in eukaryotes. We bionformatically identified THS homologs in 104 bacterial genomes and 472 metagenomes, implying a great diversity of tetrahymanol producers. Lipids of the arborane class, such as iso-arborinol, are commonly found in modern angiosperms. Arobranes are synthesized by the enzyme oxidosqualene cyclase (OSC), which in plants can form both tetra and pentacyclic molecules. While bacteria are known to produce tetracyclic sterol compounds, bacterial synthesis of pentacyclic arborane class triterpenols of this class were previously undiscovered. We have identified a bacterium, Eudoraea adriatica, whose OSC synthesizes

Powerful bacterial killing by buckwheat honeys is concentration-dependent, involves complete DNA degradation and requires hydrogen peroxide.

PubMed

Brudzynski, Katrina; Abubaker, Kamal; Wang, Tony

2012-01-01

Exposure of bacterial cells to honey inhibits their growth and may cause cell death. Our previous studies showed a cause-effect relationship between hydroxyl radical generated from honey hydrogen peroxide and growth arrest. Here we explored the role of hydroxyl radicals as inducers of bacterial cells death. The bactericidal effect of ·OH on antibiotic-resistant clinical isolates of MRSA and VRE and standard bacterial strains of E. coli and B. subtiles was examined using a broth microdilution assay supplemented with 3'-(p-aminophenyl) fluorescein (APF) as the ·OH trap, followed by colony enumeration. Bactericidal activities of eight honeys (six varieties of buckwheat, blueberry and manuka honeys) were analyzed. The MBC/MIC ratio ≤4 and the killing curves indicated that honeys exhibited powerful, concentration-dependent bactericidal effect. The extent of killing depended on the ratio of honey concentration to bacterial load, indicating that honey dose was critical for its bactericidal efficacy. The killing rate and potency varied between honeys and ranged from over a 6-log(10) to 4-log(10) CFU/ml reduction of viable cells, equivalent to complete bacterial eradication. The maximal killing was associated with the extensive degradation of bacterial DNA. Honey concentration at which DNA degradation occurred correlated with cell death observed in the concentration-dependent cell-kill on agar plates. There was no quantitative relationship between the ·OH generation by honey and bactericidal effect. At the MBC, where there was no surviving cells and no DNA was visible on agarose gels, the ·OH levels were on average 2-3x lower than at Minimum Inhibitory Concentration (MICs) (p < 0.0001). Pre-treatment of honey with catalase, abolished the bactericidal effect. This raised possibilities that either the abrupt killing prevented accumulation of ·OH (dead cells did not generate ·OH) or that DNA degradation and killing is the actual footprint of ·OH action. In conclusion

Adaptation of the neutral bacterial comet assay to assess antimicrobial-mediated DNA double-strand breaks in Escherichia coli

PubMed Central

SOLANKY, DIPESH; HAYDEL, SHELLEY E.

2012-01-01

This study aimed to determine the mechanism of action of a natural antibacterial clay mineral mixture, designated CB, by investigating the induction of DNA double-strand breaks (DSBs) in Escherichia coli. To quantify DNA damage upon exposure to soluble antimicrobial compounds, we modified a bacterial neutral comet assay, which primarily associates the general length of an electrophoresed chromosome, or comet, with the degree of DSB-associated DNA damage. To appropriately account for antimicrobial-mediated strand fragmentation, suitable control reactions consisting of exposures to water, ethanol, kanamycin, and bleomycin were developed and optimized for the assay. Bacterial exposure to the CB clay resulted in significantly longer comet lengths, compared to water and kanamycin exposures, suggesting that the induction of DNA DSBs contributes to the killing activity of this antibacterial clay mineral mixture. The comet assay protocol described herein provides a general technique for evaluating soluble antimicrobial-derived DNA damage and for comparing DNA fragmentation between experimental and control assays. PMID:22940101

Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay

PubMed Central

Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.

2011-01-01

The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207

The Extraction and Partial Purification of Bacterial DNA as a Practical Exercise for GCE Advanced Level Students.

ERIC Educational Resources Information Center

Falconer, A. C.; Hayes, L. J.

1986-01-01

Describes a relatively simple method of extraction and purification of bacterial DNA. This technique permits advanced secondary-level science students to obtain adequate amounts of DNA from very small pellets of bacteria and to observe some of its polymer properties. (ML)

Multiple Regulatory Systems Coordinate DNA Replication with Cell Growth in Bacillus subtilis

PubMed Central

Murray, Heath; Koh, Alan

2014-01-01

In many bacteria the rate of DNA replication is linked with cellular physiology to ensure that genome duplication is coordinated with growth. Nutrient-mediated growth rate control of DNA replication initiation has been appreciated for decades, however the mechanism(s) that connects these cell cycle activities has eluded understanding. In order to help address this fundamental question we have investigated regulation of DNA replication in the model organism Bacillus subtilis. Contrary to the prevailing view we find that changes in DnaA protein level are not sufficient to account for nutrient-mediated growth rate control of DNA replication initiation, although this regulation does require both DnaA and the endogenous replication origin. We go on to report connections between DNA replication and several essential cellular activities required for rapid bacterial growth, including respiration, central carbon metabolism, fatty acid synthesis, phospholipid synthesis, and protein synthesis. Unexpectedly, the results indicate that multiple regulatory systems are involved in coordinating DNA replication with cell physiology, with some of the regulatory systems targeting oriC while others act in a oriC-independent manner. We propose that distinct regulatory systems are utilized to control DNA replication in response to diverse physiological and chemical changes. PMID:25340815

Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.

PubMed

Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal

2014-05-01

Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.

Identification of the Dimer Exchange Interface of the Bacterial DNA Damage Response Protein UmuD.

PubMed

Murison, David A; Timson, Rebecca C; Koleva, Bilyana N; Ordazzo, Michael; Beuning, Penny J

2017-09-12

The Escherichia coli SOS response, an induced DNA damage response pathway, confers survival on bacterial cells by providing accurate repair mechanisms as well as the potentially mutagenic pathway translesion synthesis (TLS). The umuD gene products are upregulated after DNA damage and play roles in both nonmutagenic and mutagenic aspects of the SOS response. Full-length UmuD is expressed as a homodimer of 139-amino-acid subunits, which eventually cleaves its N-terminal 24 amino acids to form UmuD'. The cleavage product UmuD' and UmuC form the Y-family polymerase DNA Pol V (UmuD' 2 C) capable of performing TLS. UmuD and UmuD' exist as homodimers, but their subunits can readily exchange to form UmuDD' heterodimers preferentially. Heterodimer formation is an essential step in the degradation pathway of UmuD'. The recognition sequence for ClpXP protease is located within the first 24 amino acids of full-length UmuD, and the partner of full-length UmuD, whether UmuD or UmuD', is degraded by ClpXP. To better understand the mechanism by which UmuD subunits exchange, we measured the kinetics of exchange of a number of fluorescently labeled single-cysteine UmuD variants as detected by Förster resonance energy transfer. Labeling sites near the dimer interface correlate with increased rates of exchange, indicating that weakening the dimer interface facilitates exchange, whereas labeling sites on the exterior decrease the rate of exchange. In most but not all cases, homodimer and heterodimer exchange exhibit similar rates, indicating that somewhat different molecular surfaces mediate homodimer exchange and heterodimer formation.

Nucleotides with altered hydrogen bonding capacities impede human DNA polymerase η by reducing synthesis in the presence of the major cisplatin DNA adduct.

PubMed

Nilforoushan, Arman; Furrer, Antonia; Wyss, Laura A; van Loon, Barbara; Sturla, Shana J

2015-04-15

Human DNA polymerase η (hPol η) contributes to anticancer drug resistance by catalyzing the replicative bypass of DNA adducts formed by the widely used chemotherapeutic agent cis-diamminedichloroplatinum (cisplatin). A chemical basis for overcoming bypass-associated resistance requires greater knowledge of how small molecules influence the hPol η-catalyzed bypass of DNA adducts. In this study, we demonstrated how synthetic nucleoside triphosphates act as hPol η substrates and characterized their influence on hPol η-mediated DNA synthesis over unmodified and platinated DNA. The single nucleotide incorporation efficiency of the altered nucleotides varied by more than 10-fold and the higher incorporation rates appeared to be attributable to the presence of an additional hydrogen bond between incoming dNTP and templating base. Finally, full-length DNA synthesis in the presence of increasing concentrations of synthetic nucleotides reduced the amount of DNA product independent of the template, representing the first example of hPol η inhibition in the presence of a platinated DNA template.

Conditions Determining Initiation of DNA Synthesis in 3T3 Cells*

PubMed Central

Dulbecco, R.; Stoker, M. G. P.

1970-01-01

Experiments were designed to discriminate between inhibition of growth due to contacts or exhaustion of serum factors. The cell layer was wounded and the migrating cells were followed by time-lapse cinematography; DNA synthesis in the same cells was recognized by means of 3H-thymidine labeling and radioautography. In this way, the complete history of individual cells migrating to the wound could be described. The results show that topographical relationships between cells play an important role in controlling initiation of DNA synthesis. It is still unclear whether initiation is promoted by release from contacts or by the increased ability of the cells to utilize serum factors because of their changes in shapes and activities. PMID:5273897

VUV absorption spectroscopy of bacterial spores and DNA components

NASA Astrophysics Data System (ADS)

Fiebrandt, Marcel; Lackmann, Jan-Wilm; Raguse, Marina; Moeller, Ralf; Awakowicz, Peter; Stapelmann, Katharina

2017-01-01

Low-pressure plasmas can be used to inactivate bacterial spores and sterilize goods for medical and pharmaceutical applications. A crucial factor are damages induced by UV and VUV radiation emitted by the plasma. To analyze inactivation processes and protection strategies of spores, absorption spectra of two B. subtilis strains are measured. The results indicate, that the inner and outer coat of the spore significantly contribute to the absorption of UV-C and also of the VUV, protecting the spore against radiation based damages. As the sample preparation can significantly influence the absorption spectra due to salt residues, the cleaning procedure and sample deposition is tested for its reproducibility by measuring DNA oligomers and pUC18 plasmid DNA. The measurements are compared and discussed with results from the literature, showing a strong decrease of the salt content enabling the detection of absorption structures in the samples.

Programmable autonomous synthesis of single-stranded DNA

NASA Astrophysics Data System (ADS)

Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng

2018-02-01

DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

Programmable autonomous synthesis of single-stranded DNA.

PubMed

Kishi, Jocelyn Y; Schaus, Thomas E; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng

2018-02-01

DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

Evaluation of Lysis Methods for the Extraction of Bacterial DNA for Analysis of the Vaginal Microbiota

PubMed Central

Gill, Christina; Blow, Frances; Darby, Alistair C.

2016-01-01

Background Recent studies on the vaginal microbiota have employed molecular techniques such as 16S rRNA gene sequencing to describe the bacterial community as a whole. These techniques require the lysis of bacterial cells to release DNA before purification and PCR amplification of the 16S rRNA gene. Currently, methods for the lysis of bacterial cells are not standardised and there is potential for introducing bias into the results if some bacterial species are lysed less efficiently than others. This study aimed to compare the results of vaginal microbiota profiling using four different pretreatment methods for the lysis of bacterial samples (30 min of lysis with lysozyme, 16 hours of lysis with lysozyme, 60 min of lysis with a mixture of lysozyme, mutanolysin and lysostaphin and 30 min of lysis with lysozyme followed by bead beating) prior to chemical and enzyme-based DNA extraction with a commercial kit. Results After extraction, DNA yield did not significantly differ between methods with the exception of lysis with lysozyme combined with bead beating which produced significantly lower yields when compared to lysis with the enzyme cocktail or 30 min lysis with lysozyme only. However, this did not result in a statistically significant difference in the observed alpha diversity of samples. The beta diversity (Bray-Curtis dissimilarity) between different lysis methods was statistically significantly different, but this difference was small compared to differences between samples, and did not affect the grouping of samples with similar vaginal bacterial community structure by hierarchical clustering. Conclusions An understanding of how laboratory methods affect the results of microbiota studies is vital in order to accurately interpret the results and make valid comparisons between studies. Our results indicate that the choice of lysis method does not prevent the detection of effects relating to the type of vaginal bacterial community one of the main outcome measures

Evaluation of Lysis Methods for the Extraction of Bacterial DNA for Analysis of the Vaginal Microbiota.

PubMed

Gill, Christina; van de Wijgert, Janneke H H M; Blow, Frances; Darby, Alistair C

2016-01-01

Recent studies on the vaginal microbiota have employed molecular techniques such as 16S rRNA gene sequencing to describe the bacterial community as a whole. These techniques require the lysis of bacterial cells to release DNA before purification and PCR amplification of the 16S rRNA gene. Currently, methods for the lysis of bacterial cells are not standardised and there is potential for introducing bias into the results if some bacterial species are lysed less efficiently than others. This study aimed to compare the results of vaginal microbiota profiling using four different pretreatment methods for the lysis of bacterial samples (30 min of lysis with lysozyme, 16 hours of lysis with lysozyme, 60 min of lysis with a mixture of lysozyme, mutanolysin and lysostaphin and 30 min of lysis with lysozyme followed by bead beating) prior to chemical and enzyme-based DNA extraction with a commercial kit. After extraction, DNA yield did not significantly differ between methods with the exception of lysis with lysozyme combined with bead beating which produced significantly lower yields when compared to lysis with the enzyme cocktail or 30 min lysis with lysozyme only. However, this did not result in a statistically significant difference in the observed alpha diversity of samples. The beta diversity (Bray-Curtis dissimilarity) between different lysis methods was statistically significantly different, but this difference was small compared to differences between samples, and did not affect the grouping of samples with similar vaginal bacterial community structure by hierarchical clustering. An understanding of how laboratory methods affect the results of microbiota studies is vital in order to accurately interpret the results and make valid comparisons between studies. Our results indicate that the choice of lysis method does not prevent the detection of effects relating to the type of vaginal bacterial community one of the main outcome measures of epidemiological studies

A simple, rapid, high-fidelity and cost-effective PCR-based two-step DNA synthesis method for long gene sequences.

PubMed

Xiong, Ai-Sheng; Yao, Quan-Hong; Peng, Ri-He; Li, Xian; Fan, Hui-Qin; Cheng, Zong-Ming; Li, Yi

2004-07-07

Chemical synthesis of DNA sequences provides a powerful tool for modifying genes and for studying gene function, structure and expression. Here, we report a simple, high-fidelity and cost-effective PCR-based two-step DNA synthesis (PTDS) method for synthesis of long segments of DNA. The method involves two steps. (i) Synthesis of individual fragments of the DNA of interest: ten to twelve 60mer oligonucleotides with 20 bp overlap are mixed and a PCR reaction is carried out with high-fidelity DNA polymerase Pfu to produce DNA fragments that are approximately 500 bp in length. (ii) Synthesis of the entire sequence of the DNA of interest: five to ten PCR products from the first step are combined and used as the template for a second PCR reaction using high-fidelity DNA polymerase pyrobest, with the two outermost oligonucleotides as primers. Compared with the previously published methods, the PTDS method is rapid (5-7 days) and suitable for synthesizing long segments of DNA (5-6 kb) with high G + C contents, repetitive sequences or complex secondary structures. Thus, the PTDS method provides an alternative tool for synthesizing and assembling long genes with complex structures. Using the newly developed PTDS method, we have successfully obtained several genes of interest with sizes ranging from 1.0 to 5.4 kb.

Self-assembled catalytic DNA nanostructures for synthesis of para-directed polyaniline.

PubMed

Wang, Zhen-Gang; Zhan, Pengfei; Ding, Baoquan

2013-02-26

Templated synthesis has been considered as an efficient approach to produce polyaniline (PANI) nanostructures. The features of DNA molecules enable a DNA template to be an intriguing template for fabrication of emeraldine PANI. In this work, we assembled HRP-mimicking DNAzyme with different artificial DNA nanostructures, aiming to manipulate the molecular structures and morphologies of PANI nanostructures through the controlled DNA self-assembly. UV-vis absorption spectra were used to investigate the molecular structures of PANI and monitor kinetic growth of PANI. It was found that PANI was well-doped at neutral pH and the redox behaviors of the resultant PANI were dependent on the charge density of the template, which was controlled by the template configurations. CD spectra indicated that the PANI threaded tightly around the helical DNA backbone, resulting in the right handedness of PANI. These reveal the formation of the emeraldine form of PANI that was doped by the DNA. The morphologies of the resultant PANI were studied by AFM and SEM. It was concluded from the imaging and spectroscopic kinetic results that PANI grew preferably from the DNAzyme sites and then expanded over the template to form 1D PANI nanostructures. The strategy of the DNAzyme-DNA template assembly brings several advantages in the synthesis of para-coupling PANI, including the region-selective growth of PANI, facilitating the formation of a para-coupling structure and facile regulation. We believe this study contributes significantly to the fabrication of doped PANI nanopatterns with controlled complexity, and the development of DNA nanotechnology.

Exploiting bacterial DNA gyrase as a drug target: current state and perspectives.

PubMed

Collin, Frédéric; Karkare, Shantanu; Maxwell, Anthony

2011-11-01

DNA gyrase is a type II topoisomerase that can introduce negative supercoils into DNA at the expense of ATP hydrolysis. It is essential in all bacteria but absent from higher eukaryotes, making it an attractive target for antibacterials. The fluoroquinolones are examples of very successful gyrase-targeted drugs, but the rise in bacterial resistance to these agents means that we not only need to seek new compounds, but also new modes of inhibition of this enzyme. We review known gyrase-specific drugs and toxins and assess the prospects for developing new antibacterials targeted to this enzyme.

Synthesis of base-modified 2'-deoxyribonucleoside triphosphates and their use in enzymatic synthesis of modified DNA for applications in bioanalysis and chemical biology.

PubMed

Hocek, Michal

2014-11-07

The synthesis of 2'-deoxyribonucleoside triphosphates (dNTPs) either by classical triphosphorylation of nucleosides or by aqueous cross-coupling reactions of halogenated dNTPs is discussed. Different enzymatic methods for synthesis of modified oligonucleotides and DNA by polymerase incorporation of modified nucleotides are summarized, and the applications in redox or fluorescent labeling, as well as in bioconjugations and modulation of interactions of DNA with proteins, are outlined.

A Hybrid DNA Extraction Method for the Qualitative and Quantitative Assessment of Bacterial Communities from Poultry Production Samples

PubMed Central

Rothrock, Michael J.; Hiett, Kelli L.; Gamble, John; Caudill, Andrew C.; Cicconi-Hogan, Kellie M.; Caporaso, J. Gregory

2014-01-01

The efficacy of DNA extraction protocols can be highly dependent upon both the type of sample being investigated and the types of downstream analyses performed. Considering that the use of new bacterial community analysis techniques (e.g., microbiomics, metagenomics) is becoming more prevalent in the agricultural and environmental sciences and many environmental samples within these disciplines can be physiochemically and microbiologically unique (e.g., fecal and litter/bedding samples from the poultry production spectrum), appropriate and effective DNA extraction methods need to be carefully chosen. Therefore, a novel semi-automated hybrid DNA extraction method was developed specifically for use with environmental poultry production samples. This method is a combination of the two major types of DNA extraction: mechanical and enzymatic. A two-step intense mechanical homogenization step (using bead-beating specifically formulated for environmental samples) was added to the beginning of the “gold standard” enzymatic DNA extraction method for fecal samples to enhance the removal of bacteria and DNA from the sample matrix and improve the recovery of Gram-positive bacterial community members. Once the enzymatic extraction portion of the hybrid method was initiated, the remaining purification process was automated using a robotic workstation to increase sample throughput and decrease sample processing error. In comparison to the strict mechanical and enzymatic DNA extraction methods, this novel hybrid method provided the best overall combined performance when considering quantitative (using 16S rRNA qPCR) and qualitative (using microbiomics) estimates of the total bacterial communities when processing poultry feces and litter samples. PMID:25548939

Assessing genetic structure and diversity of airborne bacterial communities by DNA fingerprinting and 16S rDNA clone library

NASA Astrophysics Data System (ADS)

Maron, Pierre-Alain; Lejon, David P. H.; Carvalho, Esmeralda; Bizet, Karine; Lemanceau, Philippe; Ranjard, Lionel; Mougel, Christophe

The density, genetic structure and diversity of airborne bacterial communities were assessed in the outdoor atmosphere. Two air samples were collected on the same location (north of France) at two dates (March 2003 (sample1) and May 2003 (sample 2)). Molecular culture -independent methods were used to characterise airborne bacterial communities regardless of the cell culturability. The automated-ribosomal intergenic spacer analysis (A-RISA) was performed to characterise the community structure in each sample. For both sampling dates, complex A-RISA patterns were observed suggesting a highly diverse community structure, comparable to those found in soil, water or sediment environments. Furthermore, differences in the genetic structure of airborne bacterial communities were observed between samples 1 and 2 suggesting an important variability in time. A clone library of 16S rDNA directly amplified from air DNA of sample 1 was constructed and sequenced to analyse the community composition and diversity. The Proteobacteria group had the greatest representation (60%), with bacteria belonging to the different subdivisions α- (19%), β-(21%), γ-(12%) and δ-(8%). Firmicute and Actinobacteria were also well represented with 14% and 12%, respectively. Most of the identified bacteria are known to be commonly associated with soil or plant environments suggesting that the atmosphere is mainly colonised transiently by microorganisms from local sources, depending on air fluxes.

Regulation of yeast DNA polymerase δ-mediated strand displacement synthesis by 5′-flaps

PubMed Central

Koc, Katrina N.; Stodola, Joseph L.; Burgers, Peter M.; Galletto, Roberto

2015-01-01

The strand displacement activity of DNA polymerase δ is strongly stimulated by its interaction with proliferating cell nuclear antigen (PCNA). However, inactivation of the 3′–5′ exonuclease activity is sufficient to allow the polymerase to carry out strand displacement even in the absence of PCNA. We have examined in vitro the basic biochemical properties that allow Pol δ-exo− to carry out strand displacement synthesis and discovered that it is regulated by the 5′-flaps in the DNA strand to be displaced. Under conditions where Pol δ carries out strand displacement synthesis, the presence of long 5′-flaps or addition in trans of ssDNA suppress this activity. This suggests the presence of a secondary DNA binding site on the enzyme that is responsible for modulation of strand displacement activity. The inhibitory effect of a long 5′-flap can be suppressed by its interaction with single-stranded DNA binding proteins. However, this relief of flap-inhibition does not simply originate from binding of Replication Protein A to the flap and sequestering it. Interaction of Pol δ with PCNA eliminates flap-mediated inhibition of strand displacement synthesis by masking the secondary DNA site on the polymerase. These data suggest that in addition to enhancing the processivity of the polymerase PCNA is an allosteric modulator of other Pol δ activities. PMID:25813050

Diversity of ribosomal 16S DNA- and RNA-based bacterial community in an office building drinking water system.

PubMed

Inkinen, J; Jayaprakash, B; Santo Domingo, J W; Keinänen-Toivola, M M; Ryu, H; Pitkänen, T

2016-06-01

Next-generation sequencing of 16S ribosomal RNA genes (rDNA) and ribosomal RNA (rRNA) was used to characterize water and biofilm microbiome collected from a drinking water distribution system of an office building after its first year of operation. The total bacterial community (rDNA) and active bacterial members (rRNA) sequencing databases were generated by Illumina MiSeq PE250 platform. As estimated by Chao1 index, species richness in cold water system was lower (180-260) in biofilms (Sphingomonas spp., Methylobacterium spp., Limnohabitans spp., Rhizobiales order) than in waters (250-580), (also Methylotenera spp.) (P = 0·005, n = 20). Similarly species richness (Chao1) was slightly higher (210-580) in rDNA libraries compared to rRNA libraries (150-400; P = 0·054, n = 24). Active Mycobacterium spp. was found in cross-linked polyethylene (PEX), but not in corresponding copper pipeline biofilm. Nonpathogenic Legionella spp. was found in rDNA libraries but not in rRNA libraries. Microbial communities differed between water and biofilms, between cold and hot water systems, locations in the building and between water rRNA and rDNA libraries, as shown by clear clusters in principal component analysis (PcoA). By using the rRNA method, we found that not all bacterial community members were active (e.g. Legionella spp.), whereas other members showed increased activity in some locations; for example, Pseudomonas spp. in hot water circulations' biofilm and order Rhizobiales and Limnohabitans spp. in stagnated locations' water and biofilm. rRNA-based methods may be better than rDNA-based methods for evaluating human health implications as rRNA methods can be used to describe the active bacterial fraction. This study indicates that copper as a pipeline material might have an adverse impact on the occurrence of Mycobacterium spp. The activity of Legionella spp. maybe questionable when detected solely by using DNA-based methods. © 2016 The Society for Applied

Effect of TPA on ion fluxes and DNA synthesis in vascular smooth muscle cells

PubMed Central

1985-01-01

Previous reports have suggested that phorbol esters can decrease the affinity of epidermal growth factor (EGF) for its cellular receptors. Investigations of the consequences of the interaction between phorbol esters and EGF, however, have been limited to EGF-stimulated Na/H exchange in A431 cells (Whitely, B., D. Cassel, Y.-X. Zuang, and L. Glaser, 1984, J. Cell Biol., 99:1162-1166). In the present study, the effect of the phorbol ester 12-O-tetradecanoyl phorbol-13-acetate (TPA) on EGF-stimulated ion transport and DNA synthesis was determined in cultured vascular smooth muscle cells (A7r5). It was found that TPA stimulated Na/H exchange when added alone (half-maximal stimulatory concentration, 25 nM). However, when cells were pretreated with TPA and then challenged with EGF, TPA significantly inhibited EGF-stimulated Na/H exchange (78%; half-maximal inhibition [Ki] at 2.5 nM). Subsequently the effects of TPA on Na/K/Cl co-transport were measured. TPA was observed to inhibit Na/K/Cl co-transport (half-maximal inhibitory concentration, 50 nM) and also to inhibit EGF-stimulated Na/K/Cl co-transport (100%; Ki at 5 nM). Finally, the effects of TPA on DNA synthesis were assessed. TPA had a modest stimulatory effect on DNA synthesis (half-maximal stimulatory concentration, 6 nM), but had a significant inhibitory effect on EGF-stimulated DNA synthesis (56%; Ki at 5 nM). These findings suggest that the inhibitory effect of TPA on EGF-receptor functions goes beyond previously reported effects on Na/H exchange in A431 cells and extends to EGF-stimulation of Na/K/Cl co- transport and DNA synthesis in vascular smooth muscle cells. PMID:2410432

Coordinating DNA polymerase traffic during high and low fidelity synthesis.

PubMed

Sutton, Mark D

2010-05-01

With the discovery that organisms possess multiple DNA polymerases (Pols) displaying different fidelities, processivities, and activities came the realization that mechanisms must exist to manage the actions of these diverse enzymes to prevent gratuitous mutations. Although many of the Pols encoded by most organisms are largely accurate, and participate in DNA replication and DNA repair, a sizeable fraction display a reduced fidelity, and act to catalyze potentially error-prone translesion DNA synthesis (TLS) past lesions that persist in the DNA. Striking the proper balance between use of these different enzymes during DNA replication, DNA repair, and TLS is essential for ensuring accurate duplication of the cell's genome. This review highlights mechanisms that organisms utilize to manage the actions of their different Pols. A particular emphasis is placed on discussion of current models for how different Pols switch places with each other at the replication fork during high fidelity replication and potentially error-pone TLS. Copyright (c) 2010 Elsevier B.V. All rights reserved.

Cdt2-mediated XPG degradation promotes gap-filling DNA synthesis in nucleotide excision repair

PubMed Central

Han, Chunhua; Wani, Gulzar; Zhao, Ran; Qian, Jiang; Sharma, Nidhi; He, Jinshan; Zhu, Qianzheng; Wang, Qi-En; Wani, Altaf A

2015-01-01

Xeroderma pigmentosum group G (XPG) protein is a structure-specific repair endonuclease, which cleaves DNA strands on the 3′ side of the DNA damage during nucleotide excision repair (NER). XPG also plays a crucial role in initiating DNA repair synthesis through recruitment of PCNA to the repair sites. However, the fate of XPG protein subsequent to the excision of DNA damage has remained unresolved. Here, we show that XPG, following its action on bulky lesions resulting from exposures to UV irradiation and cisplatin, is subjected to proteasome-mediated proteolytic degradation. Productive NER processing is required for XPG degradation as both UV and cisplatin treatment-induced XPG degradation is compromised in NER-deficient XP-A, XP-B, XP-C, and XP-F cells. In addition, the NER-related XPG degradation requires Cdt2, a component of an E3 ubiquitin ligase, CRL4Cdt2. Micropore local UV irradiation and in situ Proximity Ligation assays demonstrated that Cdt2 is recruited to the UV-damage sites and interacts with XPG in the presence of PCNA. Importantly, Cdt2-mediated XPG degradation is crucial to the subsequent recruitment of DNA polymerase δ and DNA repair synthesis. Collectively, our data support the idea of PCNA recruitment to damage sites which occurs in conjunction with XPG, recognition of the PCNA-bound XPG by CRL4Cdt2 for specific ubiquitylation and finally the protein degradation. In essence, XPG elimination from DNA damage sites clears the chromatin space needed for the subsequent recruitment of DNA polymerase δ to the damage site and completion of gap-filling DNA synthesis during the final stage of NER. PMID:25483071

Bacterial abundance and activity in deep-sea sediments from the eastern North Atlantic

NASA Astrophysics Data System (ADS)

Eardly, D. F.; Carton, M. W.; Gallagher, J. M.; Patching, J. W.

Results are presented from four cruises to the Porcupine Abyssal Plain (PAP site) that took place during the BENGAL project from September 1996 to March 1998, and two cruises to the PAP and an oligotrophic site (EUMELI) that took place during the DEEPSEAS project between September 1993 and March 1994. Bacterial abundances in sediment and sediment contact water were measured by epifluorescence microscopy. Bacterial activity was determined by 3H-thymidine incorporation as a measure of DNA synthesis, and by 3H-leucine incorporation as a measure of protein synthesis. Activities were measured under atmospheric and in situ pressures and temperatures. Bacterial activity was usually higher in samples incubated at in situ pressure than those incubated at atmospheric pressure indicating that a barophilic community was dominant. Inter-cruise comparisons of abundance and activity during the BENGAL project showed no firm evidence of there being a seasonal response in the benthic microbial community to any episodic phytodetritus event. This was probably because of inter-annual variations in the quality and quantity of phytodetritus deposition at the PAP site, the rapid remineralization of fresh organic material by the microbial communities and the timing of cruises to the study area. 3H-thymidine and 3H-leucine incorporation in sediments was higher during the BENGAL period than the DEEPSEAS programme. A methodological change in the 3H-thymidine incorporation technique for sediments may explain the differences in DNA synthesis observed between the two projects, whereas the lower levels of protein synthesis observed during the DEEPSEAS programme probably reflected both inter-annual variations in activity at the PAP site and the lower productivity that prevailed at surface at the EUMELI oligotrophic site. Rates of 3H-thymidine incorporation in sediment contact water were similar during both projects.

Characterization of SIS1, a Saccharomyces cerevisiae homologue of bacterial dnaJ proteins

PubMed Central

1991-01-01

The Saccharomyces cerevisiae SIS1 gene was identified as a high copy number suppressor of the slow growth phenotype of strains containing mutations in the SIT4 gene, which encodes a predicted serine/threonine protein phosphatase. The SIS1 protein is similar to bacterial dnaJ proteins in the amino-terminal third and carboxyl-terminal third of the proteins. In contrast, the middle third of SIS1 is not similar to dnaJ proteins. This region of SIS1 contains a glycine/methionine-rich region which, along with more amino-terminal sequences, is required for SIS1 to associate with a protein of apparent molecular mass of 40 kD. The SIS1 gene is essential. Strains limited for the SIS1 protein accumulate cells that appear blocked for migration of the nucleus from the mother cell into the daughter cell. In addition, many of the cells become very large and contain a large vacuole. The SIS1 protein is localized throughout the cell but is more concentrated at the nucleus. About one- fourth of the SIS1 protein is released from a nuclear fraction upon treatment with RNase. We also show that overexpression of YDJ1, another yeast protein with similarity to bacterial dnaJ proteins, can not substitute for SIS1. PMID:1714460

Harnessing cell-to-cell variations to probe bacterial structure and biophysics

NASA Astrophysics Data System (ADS)

Cass, Julie A.

Advances in microscopy and biotechnology have given us novel insights into cellular biology and physics. While bacteria were long considered to be relatively unstructured, the development of fluorescence microscopy techniques, and spatially and temporally resolved high-throughput quantitative studies, have uncovered that the bacterial cell is highly organized, and its structure rigorously maintained. In this thesis I will describe our gateTool software, designed to harness cell-to-cell variations to probe bacterial structure, and discuss two exciting aspects of structure that we have employed gateTool to investigate: (i) chromosome organization and the cellular mechanisms for controlling DNA dynamics, and (ii) the study of cell wall synthesis, and how the genes in the synthesis pathway impact cellular shape. In the first project, we develop a spatial and temporal mapping of cell-cycle-dependent chromosomal organization, and use this quantitative map to discover that chromosomal loci segregate from midcell with universal dynamics. In the second project, I describe preliminary time- lapse and snapshot imaging analysis suggesting phentoypical coherence across peptidoglycan synthesis pathways.

Nucleoid Condensation and Cell Division in Escherichia coli MX74T2 ts52 After Inhibition of Protein Synthesis

PubMed Central

Zusman, David R.; Carbonell, Augustina; Haga, Juli Y.

1973-01-01

The reorganization of the bacterial nucleoid of an Escherichia coli mutant, MX74T2 ts52, was studied by electron microscopy after protein synthesis inhibition by using whole mounts of cell ghosts, ultrathin-sectioning, and freeze-etching. The bacterial nucleoid showed two morphological changes after chloramphenicol addition: deoxyribonucleic acid (DNA) localization and DNA condensation. DNA localization was observed 10 min after chloramphenicol addition; the DNA appeared as a compact, solid mass. DNA condensation was observed at 25 min; the nucleoid appeared as a cytoplasm-filled sphere, often opened at one end. Ribosomes were observed in the center. Giant nucleoids present in some mutant filaments showed fused, spherical nucleoids arranged linearly, suggesting that the tertiary structure of the nucleoid reflects the number of replicated genomes. Inhibitors which directly or indirectly blocked protein synthesis and caused DNA condensation were chloramphenicol, puromycin, amino acid starvation, rifampicin, or carbonyl cyanide m-chlorophenyl hydrazone. All inhibitors that caused cell division in the mutant also caused condensation, although some inhibitors caused condensation without cell division. Nucleoid condensation appears to be related to chromosome structure rather than to DNA segregation upon cell division. Images PMID:4580561

Arachidonic acid stimulates DNA synthesis in brown preadipocytes through the activation of protein kinase C and MAPK.

PubMed

Garcia, Bibian; Martinez-de-Mena, Raquel; Obregon, Maria-Jesus

2012-10-01

Arachidonic acid (AA) is a polyunsaturated fatty acid that stimulates the proliferation of many cellular types. We studied the mitogenic potential of AA in rat brown preadipocytes in culture and the signaling pathways involved. AA is a potent mitogen which induces 4-fold DNA synthesis in brown preadipocytes. The AA mitogenic effect increases by NE addition. AA also increases the mitogenic action of different growth factor combinations. Other unsaturated and saturated fatty acids do not stimulate DNA synthesis to the same extent as AA. We analyzed the role of PKC and MEK/MAPK signaling pathways. PKC inhibition by bisindolilmaleimide I (BIS) abolishes AA and phorbol ester stimulation of DNA synthesis and reduces the mitogenic activity of different growth factors in brown preadipocytes. Brown preadipocytes in culture express PKC α, δ, ε and ζ isoforms. Pretreatment with high doses of the phorbol ester PDBu, induces downregulation of PKCs ε and δ and reproduces the effect of BIS indicating that AA-dependent induction of DNA synthesis requires PKC activity. AA also activates MEK/MAPK pathway and the inhibition of MEK activity inhibits AA stimulation of DNA synthesis and brown adipocyte proliferation. Inhibition of PKC δ by rottlerin abolishes AA-dependent stimulation of DNA synthesis and MAPK activation, whereas PKC ε inhibition does not produce any effect. In conclusion, our results identify AA as a potent mitogen for brown adipocytes and demonstrate the involvement of the PDBu-sensitive PKC δ isoform and MEK/MAPK pathway in AA-induced proliferation of brown adipocytes. Increased proliferative activity might increase the thermogenic capacity of brown fat. Copyright © 2012 Elsevier B.V. All rights reserved.

Bacterial community composition in different sediments from the Eastern Mediterranean Sea: a comparison of four 16S ribosomal DNA clone libraries.

PubMed

Polymenakou, Paraskevi N; Bertilsson, Stefan; Tselepides, Anastasios; Stephanou, Euripides G

2005-10-01

The regional variability of sediment bacterial community composition and diversity was studied by comparative analysis of four large 16S ribosomal DNA (rDNA) clone libraries from sediments in different regions of the Eastern Mediterranean Sea (Thermaikos Gulf, Cretan Sea, and South lonian Sea). Amplified rDNA restriction analysis of 664 clones from the libraries indicate that the rDNA richness and evenness was high: for example, a near-1:1 relationship among screened clones and number of unique restriction patterns when up to 190 clones were screened for each library. Phylogenetic analysis of 207 bacterial 16S rDNA sequences from the sediment libraries demonstrated that Gamma-, Delta-, and Alphaproteobacteria, Holophaga/Acidobacteria, Planctomycetales, Actinobacteria, Bacteroidetes, and Verrucomicrobia were represented in all four libraries. A few clones also grouped with the Betaproteobacteria, Nitrospirae, Spirochaetales, Chlamydiae, Firmicutes, and candidate division OPl 1. The abundance of sequences affiliated with Gammaproteobacteria was higher in libraries from shallow sediments in the Thermaikos Gulf (30 m) and the Cretan Sea (100 m) compared to the deeper South Ionian station (2790 m). Most sequences in the four sediment libraries clustered with uncultured 16S rDNA phylotypes from marine habitats, and many of the closest matches were clones from hydrocarbon seeps, benzene-mineralizing consortia, sulfate reducers, sulk oxidizers, and ammonia oxidizers. LIBSHUFF statistics of 16S rDNA gene sequences from the four libraries revealed major differences, indicating either a very high richness in the sediment bacterial communities or considerable variability in bacterial community composition among regions, or both.

The mitochondrial outer membrane protein MDI promotes local protein synthesis and mtDNA replication.

PubMed

Zhang, Yi; Chen, Yong; Gucek, Marjan; Xu, Hong

2016-05-17

Early embryonic development features rapid nuclear DNA replication cycles, but lacks mtDNA replication. To meet the high-energy demands of embryogenesis, mature oocytes are furnished with vast amounts of mitochondria and mtDNA However, the cellular machinery driving massive mtDNA replication in ovaries remains unknown. Here, we describe a Drosophila AKAP protein, MDI that recruits a translation stimulator, La-related protein (Larp), to the mitochondrial outer membrane in ovaries. The MDI-Larp complex promotes the synthesis of a subset of nuclear-encoded mitochondrial proteins by cytosolic ribosomes on the mitochondrial surface. MDI-Larp's targets include mtDNA replication factors, mitochondrial ribosomal proteins, and electron-transport chain subunits. Lack of MDI abolishes mtDNA replication in ovaries, which leads to mtDNA deficiency in mature eggs. Targeting Larp to the mitochondrial outer membrane independently of MDI restores local protein synthesis and rescues the phenotypes of mdi mutant flies. Our work suggests that a selective translational boost by the MDI-Larp complex on the outer mitochondrial membrane might be essential for mtDNA replication and mitochondrial biogenesis during oogenesis. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

CYTOPLASMIC DNA SYNTHESIS IN AMOEBA PROTEUS

PubMed Central

Rabinovitch, M.; Plaut, W.

1962-01-01

The incorporation of tritiated thymidine in Amoeba proteus was reinvestigated in order to see if it could be associated with microscopically detectable structures. Staining experiments with basic dyes, including the fluorochrome acridine orange, revealed the presence of large numbers of 0.3 to 0.5 µ particles in the cytoplasm of all cells studied. The effect of nuclease digestion on the dye affinity of the particles suggests that they contain DNA as well as RNA. Centrifugation of living cells at 10,000 g leads to the sedimentation of the particles in the centrifugal third of the ameba near the nucleus. Analysis of centrifuged cells which had been incubated with H3-thymidine showed a very high degree of correlation between the location of the nucleic acid-containing granules and that of acid-insoluble, deoxyribonuclease-sensitive labeled molecules and leads to the conclusion that cytoplasmic DNA synthesis in Amoeba proteus occurs in association with these particles. PMID:13972870

Chromatin Controls DNA Replication Origin Selection, Lagging-Strand Synthesis, and Replication Fork Rates.

PubMed

Kurat, Christoph F; Yeeles, Joseph T P; Patel, Harshil; Early, Anne; Diffley, John F X

2017-01-05

The integrity of eukaryotic genomes requires rapid and regulated chromatin replication. How this is accomplished is still poorly understood. Using purified yeast replication proteins and fully chromatinized templates, we have reconstituted this process in vitro. We show that chromatin enforces DNA replication origin specificity by preventing non-specific MCM helicase loading. Helicase activation occurs efficiently in the context of chromatin, but subsequent replisome progression requires the histone chaperone FACT (facilitates chromatin transcription). The FACT-associated Nhp6 protein, the nucleosome remodelers INO80 or ISW1A, and the lysine acetyltransferases Gcn5 and Esa1 each contribute separately to maximum DNA synthesis rates. Chromatin promotes the regular priming of lagging-strand DNA synthesis by facilitating DNA polymerase α function at replication forks. Finally, nucleosomes disrupted during replication are efficiently re-assembled into regular arrays on nascent DNA. Our work defines the minimum requirements for chromatin replication in vitro and shows how multiple chromatin factors might modulate replication fork rates in vivo. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Synthesis of Bipartite Tetracysteine PNA Probes for DNA In Situ Fluorescent Labeling.

PubMed

Fang, Ge-Min; Seitz, Oliver

2017-12-24

"Label-free" fluorescent probes that avoid additional steps or building blocks for conjugation of fluorescent dyes with oligonucleotides can significantly reduce the time and cost of parallel bioanalysis of a large number of nucleic acid samples. A method for the synthesis of "label-free" bicysteine-modified PNA probes using solid-phase synthesis and procedures for sequence-specific DNA in situ fluorescent labeling is described here. The concept is based on the adjacent alignment of two bicysteine-modified peptide nucleic acids on a DNA target to form a structurally optimized bipartite tetracysteine motif, which induces a sequence-specific fluorogenic reaction with commercially available biarsenic dyes, even in complex media such as cell lysate. This unit will help researchers to quickly synthesize bipartite tetracysteine PNA probes and carry out low-cost DNA in situ fluorescent labeling experiments. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

Alternative Lengthening of Telomeres Mediated by Mitotic DNA Synthesis Engages Break-Induced Replication Processes

PubMed Central

Min, Jaewon; Wright, Woodring E.

2017-01-01

ABSTRACT Alternative lengthening of telomeres (ALT) is a telomerase-independent telomere maintenance mechanism that occurs in a subset of cancers. By analyzing telomerase-positive cells and their human TERC knockout-derived ALT human cell lines, we show that ALT cells harbor more fragile telomeres representing telomere replication problems. ALT-associated replication defects trigger mitotic DNA synthesis (MiDAS) at telomeres in a RAD52-dependent, but RAD51-independent, manner. Telomeric MiDAS is a conservative DNA synthesis process, potentially mediated by break-induced replication, similar to type II ALT survivors in Saccharomyces cerevisiae. Replication stresses induced by ectopic oncogenic expression of cyclin E, G-quadruplexes, or R-loop formation facilitate the ALT pathway and lead to telomere clustering, a hallmark of ALT cancers. The TIMELESS/TIPIN complex suppresses telomere clustering and telomeric MiDAS, whereas the SMC5/6 complex promotes them. In summary, ALT cells exhibit more telomere replication defects that result in persistent DNA damage responses at telomeres, leading to the engagement of telomeric MiDAS (spontaneous mitotic telomere synthesis) that is triggered by DNA replication stress, a potential driver of genomic duplications in cancer. PMID:28760773

Multiply Intercalator-Substituted Cu(II) Cyclen Complexes as DNA Condensers and DNA/RNA Synthesis Inhibitors.

PubMed

Hormann, Jan; Malina, Jaroslav; Lemke, Oliver; Hülsey, Max J; Wedepohl, Stefanie; Potthoff, Jan; Schmidt, Claudia; Ott, Ingo; Keller, Bettina G; Brabec, Viktor; Kulak, Nora

2018-05-07

Many drugs that are applied in anticancer therapy such as the anthracycline doxorubicin contain DNA-intercalating 9,10-anthraquinone (AQ) moieties. When Cu(II) cyclen complexes were functionalized with up to three (2-anthraquinonyl)methyl substituents, they efficiently inhibited DNA and RNA synthesis resulting in high cytotoxicity (selective for cancer cells) accompanied by DNA condensation/aggregation phenomena. Molecular modeling suggests an unusual bisintercalation mode with only one base pair between the two AQ moieties and the metal complex as a linker. A regioisomer, in which the AQ moieties point in directions unfavorable for such an interaction, had a much weaker biological activity. The ligands alone and corresponding Zn(II) complexes (used as redox inert control compounds) also exhibited lower activity.

Rapid synthesis of DNA-cysteine conjugates for expressed protein ligation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lovrinovic, Marina; Niemeyer, Christof M.

2005-09-30

We report a rapid method for the covalent modification of commercially available amino-modified DNA oligonucleotides with a cysteine moiety. The resulting DNA-cysteine conjugates are versatile reagents for the efficient preparation of covalent DNA-protein conjugates by means of expressed protein ligation (EPL). The EPL method allows for the site-specific coupling of cysteine-modified DNA oligomers with recombinant intein-fusion proteins, the latter of which contain a C-terminal thioester enabling the mild and highly specific reaction with N-terminal cysteine compounds. We prepared a cysteine-modifier reagent in a single-step reaction which allows for the rapid and near quantitative synthesis of cysteine-DNA conjugates. The latter weremore » ligated with the green fluorescent protein mutant EYFP, recombinantly expressed as an intein-fusion protein, allowing for the mild and selective formation of EYFP-DNA conjugates in high yields of about 60%. We anticipate many applications of our approach, ranging from protein microarrays to the arising field of nanobiotechnology.« less

Chemical synthesis and characterization of branched oligodeoxyribonucleotides (bDNA) for use as signal amplifiers in nucleic acid quantification assays.

PubMed

Horn, T; Chang, C A; Urdea, M S

1997-12-01

The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology.

Chemical synthesis and characterization of branched oligodeoxyribonucleotides (bDNA) for use as signal amplifiers in nucleic acid quantification assays.

PubMed Central

Horn, T; Chang, C A; Urdea, M S

1997-01-01

The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology. PMID:9365266

The development and application of a molecular community profiling strategy to identify polymicrobial bacterial DNA in the whole blood of septic patients.

PubMed

Faria, M M P; Conly, J M; Surette, M G

2015-10-16

The application of molecular based diagnostics in sepsis has had limited success to date. Molecular community profiling methods have indicated that polymicrobial infections are more common than suggested by standard clinical culture. A molecular profiling approach was developed to investigate the propensity for polymicrobial infections in patients predicted to have bacterial sepsis. Disruption of blood cells with saponin and hypotonic shock enabled the recovery of microbial cells with no significant changes in microbial growth when compared to CFU/ml values immediately prior to the addition of saponin. DNA extraction included a cell-wall digestion step with both lysozyme and mutanolysin, which increased the recovery of terminal restriction fragments by 2.4 fold from diverse organisms. Efficiencies of recovery and limits of detection using Illumina sequencing of the 16S rRNA V3 region were determined for both viable cells and DNA using mock bacterial communities inoculated into whole blood. Bacteria from pre-defined communities could be recovered following lysis and removal of host cells with >97% recovery of total DNA present. Applying the molecular profiling methodology to three septic patients in the intensive care unit revealed microbial DNA from blood had consistent alignment with cultured organisms from the primary infection site providing evidence for a bloodstream infection in the absence of a clinical lab positive blood culture result in two of the three cases. In addition, the molecular profiling indicated greater diversity was present in the primary infection sample when compared to clinical diagnostic culture. A method for analyzing bacterial DNA from whole blood was developed in order to characterize the bacterial DNA profile of sepsis infections. Preliminary results indicated that sepsis infections were polymicrobial in nature with the bacterial DNA recovered suggesting a more complex etiology when compared to blood culture data.

Bacterial CRISPR/Cas DNA endonucleases: A revolutionary technology that could dramatically impact viral research and treatment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kennedy, Edward M.; Cullen, Bryan R., E-mail: bryan.cullen@duke.edu

CRISPR/Cas systems mediate bacterial adaptive immune responses that evolved to protect bacteria from bacteriophage and other horizontally transmitted genetic elements. Several CRISPR/Cas systems exist but the simplest variant, referred to as Type II, has a single effector DNA endonuclease, called Cas9, which is guided to its viral DNA target by two small RNAs, the crRNA and the tracrRNA. Initial efforts to adapt the CRISPR/Cas system for DNA editing in mammalian cells, which focused on the Cas9 protein from Streptococcus pyogenes (Spy), demonstrated that Spy Cas9 can be directed to DNA targets in mammalian cells by tracrRNA:crRNA fusion transcripts called singlemore » guide RNAs (sgRNA). Upon binding, Cas9 induces DNA cleavage leading to mutagenesis as a result of error prone non-homologous end joining (NHEJ). Recently, the Spy Cas9 system has been adapted for high throughput screening of genes in human cells for their relevance to a particular phenotype and, more generally, for the targeted inactivation of specific genes, in cell lines and in vivo in a number of model organisms. The latter aim seems likely to be greatly enhanced by the recent development of Cas9 proteins from bacterial species such as Neisseria meningitidis and Staphyloccus aureus that are small enough to be expressed using adeno-associated (AAV)-based vectors that can be readily prepared at very high titers. The evolving Cas9-based DNA editing systems therefore appear likely to not only impact virology by allowing researchers to screen for human genes that affect the replication of pathogenic human viruses of all types but also to derive clonal human cell lines that lack individual gene products that either facilitate or restrict viral replication. Moreover, high titer AAV-based vectors offer the possibility of directly targeting DNA viruses that infect discrete sites in the human body, such as herpes simplex virus and hepatitis B virus, with the hope that the entire population of viral DNA

Vasopressin stimulates DNA synthesis and ion transport in quiescent epithelial cells.

PubMed

Reznik, V M; Shapiro, R J; Mendoza, S A

1985-09-01

The mitogenic effect of vasopressin was studied in subconfluent quiescent renal epithelial cells (MDCK). Vasopressin stimulated DNA synthesis in the presence of low concentrations of serum. Vasopressin increased the entry of Na into the cells and increased ouabain-sensitive 86Rb uptake, a measure of Na-K pump activity. Because the activity of the Na-K pump in MDCK cells is steeply dependent on intracellular Na, it is likely that stimulation of the Na-K pump by vasopressin was mediated by the increase in Na entry into the cells. Thus both serum and vasopressin stimulate Na uptake and Na-K pump activity in quiescent MDCK cells with a subsequent increase in DNA synthesis. It is concluded that growth regulation in epithelial cells may be mediated in part by changes in monovalent ion transport.

Antibacterial activity of lichen secondary metabolite usnic acid is primarily caused by inhibition of RNA and DNA synthesis.

PubMed

Maciąg-Dorszyńska, Monika; Węgrzyn, Grzegorz; Guzow-Krzemińska, Beata

2014-04-01

Usnic acid, a compound produced by various lichen species, has been demonstrated previously to inhibit growth of different bacteria and fungi; however, mechanism of its antimicrobial activity remained unknown. In this report, we demonstrate that usnic acid causes rapid and strong inhibition of RNA and DNA synthesis in Gram-positive bacteria, represented by Bacillus subtilis and Staphylococcus aureus, while it does not inhibit production of macromolecules (DNA, RNA, and proteins) in Escherichia coli, which is resistant to even high doses of this compound. However, we also observed slight inhibition of RNA synthesis in a Gram-negative bacterium, Vibrio harveyi. Inhibition of protein synthesis in B. subtilis and S. aureus was delayed, which suggest indirect action (possibly through impairment of transcription) of usnic acid on translation. Interestingly, DNA synthesis was halted rapidly in B. subtilis and S. aureus, suggesting interference of usnic acid with elongation of DNA replication. We propose that inhibition of RNA synthesis may be a general mechanism of antibacterial action of usnic acid, with additional direct mechanisms, such as impairment of DNA replication in B. subtilis and S. aureus. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Ribozyme-mediated cleavage of c-fos mRNA reduces gene expression of DNA synthesis enzymes and metallothionein.

PubMed Central

Scanlon, K J; Jiao, L; Funato, T; Wang, W; Tone, T; Rossi, J J; Kashani-Sabet, M

1991-01-01

The c-fos gene product Fos has been implicated in many cellular processes, including signal transduction, DNA synthesis, and resistance to antineoplastic agents. A fos ribozyme (catalytic RNA) was designed to evaluate the effects of suppressing Fos protein synthesis on expression of enzymes involved in DNA synthesis, DNA repair, and drug resistance. DNA encoding the fos ribozyme (fosRb) was cloned into the pMAMneo expression plasmid, and the resultant vector was transfected into A2780DDP cells resistant to the chemotherapeutic agent cisplatin. The parental drug-sensitive A2780S cells were transfected with the pMMV vector containing the c-fos gene. Morphological alterations were accompanied by significant changes in pharmacological sensitivity in both c-fos- and fosRb-transfected cells. pMAMneo fosRb transfectants revealed decreased c-fos gene expression, concomitant with reduced thymidylate (dTMP) synthase, DNA polymerase beta, topoisomerase I, and metallothionein IIA mRNAs. In contrast, c-myc expression was elevated after fos ribozyme action. Insertion of a mutant ribozyme, mainly capable of antisense activity, into A2780DDP cells resulted in smaller reductions in c-fos gene expression and in cisplatin resistance than the active ribozyme. These studies establish a role for c-fos in drug resistance and in mediating DNA synthesis and repair processes by modulating expression of genes such as dTMP synthase, DNA polymerase beta, and topoisomerase I. These studies also suggest the utility of ribozymes in the analysis of cellular gene expression. Images PMID:1660142

Identification of the bacterial community of maple sap by using amplified ribosomal DNA (rDNA) restriction analysis and rDNA sequencing.

PubMed

Lagacé, L; Pitre, M; Jacques, M; Roy, D

2004-04-01

The bacterial community of maple sap was characterized by analysis of samples obtained at the taphole of maple trees for the 2001 and 2002 seasons. Among the 190 bacterial isolates, 32 groups were formed according to the similarity of the banding patterns obtained by amplified ribosomal DNA restriction analysis (ARDRA). A subset of representative isolates for each ARDRA group was identified by 16S rRNA gene fragment sequencing. Results showed a wide variety of organisms, with 22 different genera encountered. Pseudomonas and Ralstonia, of the gamma- and beta-Proteobacteria, respectively, were the most frequently encountered genera. Gram-positive bacteria were also observed, and Staphylococcus, Plantibacter, and Bacillus were the most highly represented genera. The sampling period corresponding to 50% of the cumulative sap flow percentage presented the greatest bacterial diversity according to its Shannon diversity index value (1.1). gamma-Proteobacteria were found to be dominant almost from the beginning of the season to the end. These results are providing interesting insights on maple sap microflora that will be useful for further investigation related to microbial contamination and quality of maple products and also for guiding new strategies on taphole contamination control.

Identification of the Bacterial Community of Maple Sap by Using Amplified Ribosomal DNA (rDNA) Restriction Analysis and rDNA Sequencing

PubMed Central

Lagacé, L.; Pitre, M.; Jacques, M.; Roy, D.

2004-01-01

The bacterial community of maple sap was characterized by analysis of samples obtained at the taphole of maple trees for the 2001 and 2002 seasons. Among the 190 bacterial isolates, 32 groups were formed according to the similarity of the banding patterns obtained by amplified ribosomal DNA restriction analysis (ARDRA). A subset of representative isolates for each ARDRA group was identified by 16S rRNA gene fragment sequencing. Results showed a wide variety of organisms, with 22 different genera encountered. Pseudomonas and Ralstonia, of the γ- and β-Proteobacteria, respectively, were the most frequently encountered genera. Gram-positive bacteria were also observed, and Staphylococcus, Plantibacter, and Bacillus were the most highly represented genera. The sampling period corresponding to 50% of the cumulative sap flow percentage presented the greatest bacterial diversity according to its Shannon diversity index value (1.1). γ-Proteobacteria were found to be dominant almost from the beginning of the season to the end. These results are providing interesting insights on maple sap microflora that will be useful for further investigation related to microbial contamination and quality of maple products and also for guiding new strategies on taphole contamination control. PMID:15066796

Ab initio DNA synthesis by Bst polymerase in the presence of nicking endonucleases Nt.AlwI, Nb.BbvCI, and Nb.BsmI.

PubMed

Antipova, Valeriya N; Zheleznaya, Lyudmila A; Zyrina, Nadezhda V

2014-08-01

In the absence of added DNA, thermophilic DNA polymerases synthesize double-stranded DNA from free dNTPs, which consist of numerous repetitive units (ab initio DNA synthesis). The addition of thermophilic restriction endonuclease (REase), or nicking endonuclease (NEase), effectively stimulates ab initio DNA synthesis and determines the nucleotide sequence of reaction products. We have found that NEases Nt.AlwI, Nb.BbvCI, and Nb.BsmI with non-palindromic recognition sites stimulate the synthesis of sequences organized mainly as palindromes. Moreover, the nucleotide sequence of the palindromes appeared to be dependent on NEase recognition/cleavage modes. Thus, the heterodimeric Nb.BbvCI stimulated the synthesis of palindromes composed of two recognition sites of this NEase, which were separated by AT-reach sequences or (A)n (T)m spacers. Palindromic DNA sequences obtained in the ab initio DNA synthesis with the monomeric NEases Nb.BsmI and Nt.AlwI contained, along with the sites of these NEases, randomly synthesized sequences consisted of blocks of short repeats. These findings could help investigation of the potential abilities of highly productive ab initio DNA synthesis for the creation of DNA molecules with desirable sequence. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Macrophage activation induced by Brucella DNA suppresses bacterial intracellular replication via enhancing NO production.

PubMed

Liu, Ning; Wang, Lin; Sun, Changjiang; Yang, Li; Tang, Bin; Sun, Wanchun; Peng, Qisheng

2015-12-01

Brucella DNA can be sensed by TLR9 on endosomal membrane and by cytosolic AIM2-inflammasome to induce proinflammatory cytokine production that contributes to partially activate innate immunity. Additionally, Brucella DNA has been identified to be able to act as a major bacterial component to induce type I IFN. However, the role of Brucella DNA in Brucella intracellular growth remains unknown. Here, we showed that stimulation with Brucella DNA promote macrophage activation in TLR9-dependent manner. Activated macrophages can suppresses wild type Brucella intracellular replication at early stage of infection via enhancing NO production. We also reported that activated macrophage promotes bactericidal function of macrophages infected with VirB-deficient Brucella at the early or late stage of infection. This study uncovers a novel function of Brucella DNA, which can help us further elucidate the mechanism of Brucella intracellular survival. Copyright © 2015 Elsevier Ltd. All rights reserved.

Co-opting the Fanconi Anemia Genomic Stability Pathway Enables Herpesvirus DNA Synthesis and Productive Growth

PubMed Central

Karttunen, Heidi; Savas, Jeffrey N.; McKinney, Caleb; Chen, Yu-Hung; Yates, John R.; Hukkanen, Veijo; Huang, Tony T.; Mohr, Ian

2015-01-01

SUMMARY DNA damage associated with viral DNA synthesis can result in double strand breaks that threaten genome integrity and must be repaired. Here, we establish that the cellular Fanconi Anemia (FA) genomic stability pathway is exploited by HSV1 to promote viral DNA synthesis and enable its productive growth. Potent FA pathway activation in HSV1-infected cells resulted in monoubiquitination of FA effector proteins, FANCI and FANCD2 (FANCI-D2) and required the viral DNA polymerase. FANCD2 relocalized to viral replication compartments and FANCI-D2 interacted with a multi-subunit complex containing the virus-encoded single-stranded DNA-binding protein ICP8. Significantly, while HSV1 productive growth was impaired in monoubiquitination-defective FA patient cells, this restriction was partially surmounted by antagonizing the DNA-dependent protein kinase (DNA-PK), a critical enzyme required for non-homologous end-joining (NHEJ). This identifies the FA-pathway as a new cellular factor required for herpesvirus productive growth and suggests that FA-mediated suppression of NHEJ is a fundamental step in the viral lifecycle. PMID:24954902

Hydrophobic ionic liquids for quantitative bacterial cell lysis with subsequent DNA quantification.

PubMed

Fuchs-Telka, Sabine; Fister, Susanne; Mester, Patrick-Julian; Wagner, Martin; Rossmanith, Peter

2017-02-01

DNA is one of the most frequently analyzed molecules in the life sciences. In this article we describe a simple and fast protocol for quantitative DNA isolation from bacteria based on hydrophobic ionic liquid supported cell lysis at elevated temperatures (120-150 °C) for subsequent PCR-based analysis. From a set of five hydrophobic ionic liquids, 1-butyl-1-methylpyrrolidinium bis(trifluoromethylsulfonyl)imide was identified as the most suitable for quantitative cell lysis and DNA extraction because of limited quantitative PCR inhibition by the aqueous eluate as well as no detectable DNA uptake. The newly developed method was able to efficiently lyse Gram-negative bacterial cells, whereas Gram-positive cells were protected by their thick cell wall. The performance of the final protocol resulted in quantitative DNA extraction efficiencies for Gram-negative bacteria similar to those obtained with a commercial kit, whereas the number of handling steps, and especially the time required, was dramatically reduced. Graphical Abstract After careful evaluation of five hydrophobic ionic liquids, 1-butyl-1-methylpyrrolidinium bis(trifluoromethylsulfonyl)imide ([BMPyr + ][Ntf 2 - ]) was identified as the most suitable ionic liquid for quantitative cell lysis and DNA extraction. When used for Gram-negative bacteria, the protocol presented is simple and very fast and achieves DNA extraction efficiencies similar to those obtained with a commercial kit. ddH 2 O double-distilled water, qPCR quantitative PCR.

Efficient synthesis of supercoiled M13 DNA molecule containing a site specifically placed psoralen adduct and its use as a substrate for DNA replication

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kodadek, T.; Gamper, H.

The authors report a simple method for the in vitro synthesis of large quantities of site specifically modified DNA. The protocol involves extension of an oligonucleotide primer annealed to M13 single-stranded DNA using part of the T4 DNA polymerase holoenzyme. The resulting nicked double-stranded circles are ligated and supercoiled in the same tube, producing good yields of form I DNA. When the oligonucleotide primer is chemically modified, the resultant product contains a site-specific lesion. In this study, they report the synthesis of an M13 mp19 form I DNA which contains a psoralen monoadduct or cross-link at the KpnI site. Theymore » demonstrate the utility of these modified substrates by assessing the ability of the bacteriophage T4 DNA replication complex to bypass the damage and show that the psoralen monoadduct poses a severe block to the holoenzyme when attached to the template strand.« less

Effect of diet and absence of protozoa on the rumen microbial community and on the representativeness of bacterial fractions used in the determination of microbial protein synthesis.

PubMed

Belanche, A; de la Fuente, G; Pinloche, E; Newbold, C J; Balcells, J

2012-11-01

Accurate estimates of microbial synthesis in the rumen are vital to optimize ruminant nutrition. Liquid- (LAB) and solid-associated bacterial fractions (SAB) harvested from the rumen are generally considered as microbial references when microbial yield is calculated; however, factors that determine their composition are not completely understood. The aim of this study was to evaluate the effect of diet and absence or presence of rumen protozoa on the rumen microbial community. It was hypothesized that these treatments could modify the composition and representativeness of LAB and SAB. Twenty twin lambs (Ovis aries) were used; one-half of the twins were kept protozoa-free, and each respective twin sibling was faunated. At 6 mo of age, 5 animals from each group were randomly allocated to the experimental diets consisting of either alfalfa hay as the sole diet, or 50:50 mixed with ground barley grain. After 15 d of adaptation to the diet, animals were euthanized, rumen and abomasum contents were sampled, and LAB and SAB isolated. The presence of protozoa buffered the effect of diet on the rumen bacterial population. Faunated animals fed alfalfa hay had a greater abundance of F. succinogenes, anaerobic fungi and methanogens, as well as an enhanced rumen bacterial diversity. Cellulolytic bacteria were more abundant in SAB, whereas the abomasal abundance of most of the microorganisms studied was closer to those values observed in LAB. Rumen and abomasal samples showed similar bacterial DNA concentrations, but the fungal and protozoal DNA concentration in the abomasum was only 69% and 13% of that observed in the rumen, respectively, suggesting fungal and protozoal sequestration in the rumen or possible preferential degradation of fungal and protozoal DNA in the abomasum, or both. In conclusion, absence of protozoa and type of diet extensively modified the chemical composition of LAB and SAB as a consequence of changes in the microbial composition of these fractions.

Identification of Fic-1 as an enzyme that inhibits bacterial DNA replication by AMPylating GyrB, promoting filament formation.

PubMed

Lu, Canhua; Nakayasu, Ernesto S; Zhang, Li-Qun; Luo, Zhao-Qing

2016-01-26

The morphology of bacterial cells is important for virulence, evasion of the host immune system, and coping with environmental stresses. The widely distributed Fic proteins (filamentation induced by cAMP) are annotated as proteins involved in cell division because of the presence of the HPFx[D/E]GN[G/K]R motif. We showed that the presence of Fic-1 from Pseudomonas fluorescens significantly reduced the yield of plasmid DNA when expressed in Escherichia coli or P. fluorescens. Fic-1 interacted with GyrB, a subunit of DNA gyrase, which is essential for bacterial DNA replication. Fic-1 catalyzed the AMPylation of GyrB at Tyr(109), a residue critical for binding ATP, and exhibited auto-AMPylation activity. Mutation of the Fic-1 auto-AMPylated site greatly reduced AMPylation activity toward itself and toward GyrB. Fic-1-dependent AMPylation of GyrB triggered the SOS response, indicative of DNA replication stress or DNA damage. Fic-1 also promoted the formation of elongated cells when the SOS response was blocked. We identified an α-inhibitor protein that we named anti-Fic-1 (AntF), encoded by a gene immediately upstream of Fic-1. AntF interacted with Fic-1, inhibited the AMPylation activity of Fic-1 for GyrB in vitro, and blocked Fic-1-mediated inhibition of DNA replication in bacteria, suggesting that Fic-1 and AntF comprise a toxin-antitoxin module. Our work establishes Fic-1 as an AMPylating enzyme that targets GyrB to inhibit DNA replication and may target other proteins to regulate bacterial morphology. Copyright © 2016, American Association for the Advancement of Science.

FANCJ promotes DNA synthesis through G-quadruplex structures

PubMed Central

Castillo Bosch, Pau; Segura-Bayona, Sandra; Koole, Wouter; van Heteren, Jane T; Dewar, James M; Tijsterman, Marcel; Knipscheer, Puck

2014-01-01

Our genome contains many G-rich sequences, which have the propensity to fold into stable secondary DNA structures called G4 or G-quadruplex structures. These structures have been implicated in cellular processes such as gene regulation and telomere maintenance. However, G4 sequences are prone to mutations particularly upon replication stress or in the absence of specific helicases. To investigate how G-quadruplex structures are resolved during DNA replication, we developed a model system using ssDNA templates and Xenopus egg extracts that recapitulates eukaryotic G4 replication. Here, we show that G-quadruplex structures form a barrier for DNA replication. Nascent strand synthesis is blocked at one or two nucleotides from the G4. After transient stalling, G-quadruplexes are efficiently unwound and replicated. In contrast, depletion of the FANCJ/BRIP1 helicase causes persistent replication stalling at G-quadruplex structures, demonstrating a vital role for this helicase in resolving these structures. FANCJ performs this function independently of the classical Fanconi anemia pathway. These data provide evidence that the G4 sequence instability in FANCJ−/− cells and Fancj/dog1 deficient C. elegans is caused by replication stalling at G-quadruplexes. PMID:25193968

Bacterial fatty acid metabolism in modern antibiotic discovery.

PubMed

Yao, Jiangwei; Rock, Charles O

2017-11-01

Bacterial fatty acid synthesis is essential for many pathogens and different from the mammalian counterpart. These features make bacterial fatty acid synthesis a desirable target for antibiotic discovery. The structural divergence of the conserved enzymes and the presence of different isozymes catalyzing the same reactions in the pathway make bacterial fatty acid synthesis a narrow spectrum target rather than the traditional broad spectrum target. Furthermore, bacterial fatty acid synthesis inhibitors are single-targeting, rather than multi-targeting like traditional monotherapeutic, broad-spectrum antibiotics. The single-targeting nature of bacterial fatty acid synthesis inhibitors makes overcoming fast-developing, target-based resistance a necessary consideration for antibiotic development. Target-based resistance can be overcome through multi-targeting inhibitors, a cocktail of single-targeting inhibitors, or by making the single targeting inhibitor sufficiently high affinity through a pathogen selective approach such that target-based mutants are still susceptible to therapeutic concentrations of drug. Many of the pathogens requiring new antibiotic treatment options encode for essential bacterial fatty acid synthesis enzymes. This review will evaluate the most promising targets in bacterial fatty acid metabolism for antibiotic therapeutics development and review the potential and challenges in advancing each of these targets to the clinic and circumventing target-based resistance. This article is part of a Special Issue entitled: Bacterial Lipids edited by Russell E. Bishop. Copyright © 2016 Elsevier B.V. All rights reserved.

NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A-T phosphoramidite building blocks.

PubMed

Schmidtgall, Boris; Höbartner, Claudia; Ducho, Christian

2015-01-01

Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T-T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X-T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A-T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues.

CDK1 promotes nascent DNA synthesis and induces resistance of cancer cells to DNA-damaging therapeutic agents

PubMed Central

Liao, Hongwei; Ji, Fang; Geng, Xinwei; Xing, Meichun; Li, Wen; Chen, Zhihua; Shen, Huahao; Ying, Songmin

2017-01-01

Cyclin dependent kinase 1 (CDK1) is essential for cell viability and plays a vital role in many biological events including cell cycle control, DNA damage repair, and checkpoint activation. Here, we identify an unanticipated role for CDK1 in promoting nascent DNA synthesis during S-phase. We report that a short duration of CDK1 inhibition, which does not perturb cell cycle progression, triggers a replication-associated DNA damage response (DDR). This DDR is associated with a disruption of replication fork progression and leads to genome instability. Moreover, we show that compromised CDK1 activity dramatically increases the efficacy of chemotherapeutic agents that kill cancer cells through perturbing DNA replication, including Olaparib, an FDA approved PARP inhibitor. Our study has revealed an important role for CDK1 in the DNA replication program, and suggests that the therapeutic targeting CDK1 may be a novel approach for combination chemotherapy. PMID:29207595

Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing

PubMed Central

Eastman, Alexander W.; Yuan, Ze-Chun

2015-01-01

Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing projects. PMID

Comprehensive analysis of DNA polymerase III α subunits and their homologs in bacterial genomes

PubMed Central

Timinskas, Kęstutis; Balvočiūtė, Monika; Timinskas, Albertas; Venclovas, Česlovas

2014-01-01

The analysis of ∼2000 bacterial genomes revealed that they all, without a single exception, encode one or more DNA polymerase III α-subunit (PolIIIα) homologs. Classified into C-family of DNA polymerases they come in two major forms, PolC and DnaE, related by ancient duplication. While PolC represents an evolutionary compact group, DnaE can be further subdivided into at least three groups (DnaE1-3). We performed an extensive analysis of various sequence, structure and surface properties of all four polymerase groups. Our analysis suggests a specific evolutionary pathway leading to PolC and DnaE from the last common ancestor and reveals important differences between extant polymerase groups. Among them, DnaE1 and PolC show the highest conservation of the analyzed properties. DnaE3 polymerases apparently represent an ‘impaired’ version of DnaE1. Nonessential DnaE2 polymerases, typical for oxygen-using bacteria with large GC-rich genomes, have a number of features in common with DnaE3 polymerases. The analysis of polymerase distribution in genomes revealed three major combinations: DnaE1 either alone or accompanied by one or more DnaE2s, PolC + DnaE3 and PolC + DnaE1. The first two combinations are present in Escherichia coli and Bacillus subtilis, respectively. The third one (PolC + DnaE1), found in Clostridia, represents a novel, so far experimentally uncharacterized, set. PMID:24106089

Serine hydroxymethyltransferase anchors de novo thymidylate synthesis pathway to nuclear lamina for DNA synthesis.

PubMed

Anderson, Donald D; Woeller, Collynn F; Chiang, En-Pei; Shane, Barry; Stover, Patrick J

2012-03-02

The de novo thymidylate biosynthetic pathway in mammalian cells translocates to the nucleus for DNA replication and repair and consists of the enzymes serine hydroxymethyltransferase 1 and 2α (SHMT1 and SHMT2α), thymidylate synthase, and dihydrofolate reductase. In this study, we demonstrate that this pathway forms a multienzyme complex that is associated with the nuclear lamina. SHMT1 or SHMT2α is required for co-localization of dihydrofolate reductase, SHMT, and thymidylate synthase to the nuclear lamina, indicating that SHMT serves as scaffold protein that is essential for complex formation. The metabolic complex is enriched at sites of DNA replication initiation and associated with proliferating cell nuclear antigen and other components of the DNA replication machinery. These data provide a mechanism for previous studies demonstrating that SHMT expression is rate-limiting for de novo thymidylate synthesis and indicate that de novo thymidylate biosynthesis occurs at replication forks.

Zinc-oxide-silica-silver nanocomposite: Unique one-pot synthesis and enhanced catalytic and anti-bacterial performance.

PubMed

Kokate, Mangesh; Garadkar, Kalyanrao; Gole, Anand

2016-12-01

We describe herein a unique approach to synthesize zinc oxide-silica-silver (ZnO-SiO2-Ag) nanocomposite, in a simple, one-pot process. The typical process for ZnO synthesis by alkaline precipitation of zinc salts has been tweaked to replace alkali by alkaline sodium silicate. The free acid from zinc salts helps in the synthesis of silica nanoparticles, whereas the alkalinity of sodium silicate precipitates the zinc salts. Addition of silver ions into the reaction pot prior to addition of sodium silicate, and subsequent reduction by borohydride, gives additional functionality of metallic centres for catalytic applications. The synthesis strategy is based on our recent work typically involving acid-base type of cross-reactions and demonstrates a novel strategy to synthesize nanocomposites in a one-pot approach. Each component in the composite offers a unique feature. ZnO besides displaying mild catalytic and anti-bacterial behaviour is an excellent and a cheap 3-D support for heterogeneous catalysis. Silver nanoparticles enhance the catalytic & anti-bacterial properties of ZnO. Silica is an important part of the composite; which not only "glues" the two nanoparticles thereby stabilizing the nanocomposite, but also significantly enhances the surface area of the composite; which is an attractive feature of any catalyst composite. The nanocomposite is found to show excellent catalytic performance with very high turnover frequencies (TOFs) when studied for catalytic reduction of Rhodamine B (RhB) and 4-Nitrophenol (4-NP). Additionally, the composite has been tested for its anti-bacterial properties on three different bacterial strains i.e. E. coli, B. Cereus and Bacillus firmus. The mechanism for enhancement of catalytic performance has been probed by understanding the role of silica in offering accessibility to the catalyst via its porous high surface area network. The nanocomposite has been characterized by a host of different analytical techniques. The uniqueness of

An integrative model links multiple inputs and signaling pathways to the onset of DNA synthesis in hepatocytes

PubMed Central

Huard, Jérémy; Mueller, Stephanie; Gilles, Ernst D; Klingmüller, Ursula; Klamt, Steffen

2012-01-01

During liver regeneration, quiescent hepatocytes re-enter the cell cycle to proliferate and compensate for lost tissue. Multiple signals including hepatocyte growth factor, epidermal growth factor, tumor necrosis factor α, interleukin-6, insulin and transforming growth factor β orchestrate these responses and are integrated during the G1 phase of the cell cycle. To investigate how these inputs influence DNA synthesis as a measure for proliferation, we established a large-scale integrated logical model connecting multiple signaling pathways and the cell cycle. We constructed our model based upon established literature knowledge, and successively improved and validated its structure using hepatocyte-specific literature as well as experimental DNA synthesis data. Model analyses showed that activation of the mitogen-activated protein kinase and phosphatidylinositol 3-kinase pathways was sufficient and necessary for triggering DNA synthesis. In addition, we identified key species in these pathways that mediate DNA replication. Our model predicted oncogenic mutations that were compared with the COSMIC database, and proposed intervention targets to block hepatocyte growth factor-induced DNA synthesis, which we validated experimentally. Our integrative approach demonstrates that, despite the complexity and size of the underlying interlaced network, logical modeling enables an integrative understanding of signaling-controlled proliferation at the cellular level, and thus can provide intervention strategies for distinct perturbation scenarios at various regulatory levels. PMID:22443451

Secreted bacterial effectors that inhibit host protein synthesis are critical for induction of the innate immune response to virulent Legionella pneumophila.

PubMed

Fontana, Mary F; Banga, Simran; Barry, Kevin C; Shen, Xihui; Tan, Yunhao; Luo, Zhao-Qing; Vance, Russell E

2011-02-01

The intracellular bacterial pathogen Legionella pneumophila causes an inflammatory pneumonia called Legionnaires' Disease. For virulence, L. pneumophila requires a Dot/Icm type IV secretion system that translocates bacterial effectors to the host cytosol. L. pneumophila lacking the Dot/Icm system is recognized by Toll-like receptors (TLRs), leading to a canonical NF-κB-dependent transcriptional response. In addition, L. pneumophila expressing a functional Dot/Icm system potently induces unique transcriptional targets, including proinflammatory genes such as Il23a and Csf2. Here we demonstrate that this Dot/Icm-dependent response, which we term the effector-triggered response (ETR), requires five translocated bacterial effectors that inhibit host protein synthesis. Upon infection of macrophages with virulent L. pneumophila, these five effectors caused a global decrease in host translation, thereby preventing synthesis of IκB, an inhibitor of the NF-κB transcription factor. Thus, macrophages infected with wildtype L. pneumophila exhibited prolonged activation of NF-κB, which was associated with transcription of ETR target genes such as Il23a and Csf2. L. pneumophila mutants lacking the five effectors still activated TLRs and NF-κB, but because the mutants permitted normal IκB synthesis, NF-κB activation was more transient and was not sufficient to fully induce the ETR. L. pneumophila mutants expressing enzymatically inactive effectors were also unable to fully induce the ETR, whereas multiple compounds or bacterial toxins that inhibit host protein synthesis via distinct mechanisms recapitulated the ETR when administered with TLR ligands. Previous studies have demonstrated that the host response to bacterial infection is induced primarily by specific microbial molecules that activate TLRs or cytosolic pattern recognition receptors. Our results add to this model by providing a striking illustration of how the host immune response to a virulent pathogen can also

Synthesis and DNA cleavage activity of Bis-3-chloropiperidines as alkylating agents.

PubMed

Zuravka, Ivonne; Roesmann, Rolf; Sosic, Alice; Wende, Wolfgang; Pingoud, Alfred; Gatto, Barbara; Göttlich, Richard

2014-09-01

Nitrogen mustards are an important class of bifunctional alkylating agents routinely used in chemotherapy. They react with DNA as electrophiles through the formation of highly reactive aziridinium ion intermediates. The antibiotic 593A, with potential antitumor activity, can be considered a naturally occurring piperidine mustard containing a unique 3-chloropiperidine ring. However, the total synthesis of this antibiotic proved to be rather challenging. With the aim of designing simplified analogues of this natural product, we developed an efficient bidirectional synthetic route to bis-3-chloropiperidines joined by flexible, conformationally restricted, or rigid diamine linkers. The key step involves an iodide-catalyzed double cyclization of unsaturated bis-N-chloroamines to simultaneously generate both piperidine rings. Herein we describe the synthesis and subsequent evaluation of a series of novel nitrogen-bridged bis-3-chloropiperidines, enabling the study of the impact of the linker structure on DNA alkylation properties. Our studies reveal that the synthesized compounds possess DNA alkylating abilities and induce strand cleavage, with a strong preference for guanine residues. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Multiple two-polymerase mechanisms in mammalian translesion DNA synthesis.

PubMed

Livneh, Zvi; Ziv, Omer; Shachar, Sigal

2010-02-15

The encounter of replication forks with DNA lesions may lead to fork arrest and/or the formation of single-stranded gaps. A major strategy to cope with these replication irregularities is translesion DNA synthesis (TLS), in which specialized error-prone DNA polymerases bypass the blocking lesions. Recent studies suggest that TLS across a particular DNA lesion may involve as many as four different TLS polymerases, acting in two-polymerase reactions in which insertion by a particular polymerase is followed by extension by another polymerase. Insertion determines the accuracy and mutagenic specificity of the TLS reaction, and is carried out by one of several polymerases such as poleta, polkappa or poliota. In contrast, extension is carried out primarily by polzeta. In cells from XPV patients, which are deficient in TLS across cyclobutane pyrimidine dimers (CPD) due to a deficiency in poleta, TLS is carried out by at least two backup reactions each involving two polymerases: One reaction involves polkappa and polzeta, and the other poliota and polzeta. These mechanisms may also assist poleta in normal cells under an excessive amount of UV lesions.

H3-THYMIDINE DERIVATIVE POOLS IN RELATION TO MACRONUCLEAR DNA SYNTHESIS IN TETRAHYMENA PYRIFORMIS

PubMed Central

Stone, G. E.; Miller, O. L.; Prescott, D. M.

1965-01-01

The formation of a soluble H3-thymidine derivative pool has been examined in Tetrahymena pyriformis as a function of macronuclear DNA synthesis during the cell life cycle. An autoradiographic technique which allows the detection of water-soluble materials within a cell has shown that these cells do not take up and retain exogenous H3-thymidine during G1 or G2. Uptake of H3-thymidine is restricted to the S period of the cell cycle. Additional autoradiographic experiments show, however, that a soluble pool of H3-thymidine derivatives persists from the end of one DNA synthesis period to the beginning of the next synthesis period in the subsequent cell cycle. Since this persisting pool cannot be labeled with H3-thymidine, the pool does not turn over during non-S periods. PMID:19866660

Inhibition of the synthesis of polyamines and DNA in activated lymphocytes by a combination of alpha-methylornithine and methylglyoxal bis(guanylhydrazone).

PubMed

Morris, D R; Jorstad, C M; Seyfried, C E

1977-09-01

The cancer chemotherapeutic drug, methylglyoxal bis(guanylhydrazone), inhibits the synthesis of spermidine and spermine, but allows continued putrescine production in small lymphocytes stimulated by concanavalin A. DNA replication in these cells is inhibited 50% while the synthesis of protein and RNA continues normally. When excess putrescine accumulation in the presence of methylglyoxal bis(guanylhydrazone) was inhibited with alpha-methylornithine, a competitive inhibitor of ornithine decarboxylase, the inhibition of DNA replication was accentuated, with still no effect on protein or RNA synthesis. No inhibition of DNA synthesis by the combination of alpha-methylornithine and methylglyoxal bis(guanylhydrazone) was observed when the inhibitors were added after accumulation of cellular polyamines. In addition, inhibition was reversed by exogenous putrescine, spermidine, or spermine. We conclude that putrescine can fulfill in part the role normally played by spermidine and spermine in DNA replication, and that blocking putrescine synthesis in the presence of methylglyoxal bis(guanylhydrazone) amplifies the polyamine requirement. The implications of this with regard to polyamine synthesis as a site of chemotherapy are discussed.

Effect of haloperidol on the synthesis of DNA in the pituitary gland of the rat.

PubMed

Machiavelli, G A; Jahn, G A; Kalbermann, L E; Szijan, I; Alonso, G E; Burdman, J A

1982-03-01

The administration of haloperidol increased serum prolactin and decreased the pituitary concentration of prolactin 15 min after its administration. Concomitantly there was a stimulation in the synthesis of DNA and the activity of DNA polymerase alpha in the anterior pituitary gland that was greater in oestrogenized than in non-oestrogenized male rats. Both these effects were greatly reduced by clomiphene in the oestrogenized male rats, although it did not affect the release of prolactin produced by haloperidol. In non-oestrogenized animals clomiphene abolished the stimulatory effect of haloperidol on the synthesis of DNA. These results suggest that the reduction in the intracellular levels of prolactin are a primary event in the oestrogen mediated stimulation of cell proliferation by prolactin releasing agents.

Assembling the bacterial segrosome.

PubMed

Hayes, Finbarr; Barillà, Daniela

2006-05-01

Genome segregation in prokaryotes is a highly ordered process that integrates with DNA replication, cytokinesis and other fundamental facets of the bacterial cell cycle. The segrosome is the nucleoprotein complex that mediates DNA segregation in bacteria, its assembly and organization is best understood for plasmid partition. The recent elucidation of structures of the ParB plasmid segregation protein bound to centromeric DNA, and of the tertiary structures of other segregation proteins, are key milestones in the path to deciphering the molecular basis of bacterial DNA segregation.

DNA methylation differentially regulates cytokine secretion in gingival epithelia in response to bacterial challenges.

PubMed

Drury, Jeanie L; Chung, Whasun Oh

2015-03-01

Epigenetic modifications are changes in gene expression without altering DNA sequence. We previously reported that bacteria-specific innate immune responses are regulated by epigenetic modifications. Our hypothesis is that DNA methylation affects gingival cytokine secretion in response to bacterial stimulation. Gingival epithelial cells (GECs) were treated with DNMT-1 inhibitors prior to Porphyromonas gingivalis (Pg) or Fusobacterium nucleatum (Fn) exposure. Protein secretion was assessed using ELISA. Gene expression was quantified using qRT-PCR. The ability of bacteria to invade inhibitor pretreated GECs was assessed utilizing flow cytometry. Changes were compared to unstimulated GECs. GEC upregulation of IL-6 and CXCL1 by Pg or Fn stimulation was significantly diminished by inhibitor pretreatment. Pg stimulated IL-1α secretion and inhibitor pretreatment significantly enhanced this upregulation, while Fn alone or with inhibitor pretreatment had no effect on IL-1α expression. GEC upregulation of human beta-definsin-2 in response to Pg and Fn exposure was enhanced following the inhibitor pretreatment. GEC susceptibility to bacterial invasion was unaltered. These results suggest that DNA methylation differentially affects gingival cytokine secretion in response to Pg or Fn. Our data provide basis for better understanding of how epigenetic modifications, brought on by exposure to oral bacteria, will subsequently affect host susceptibility to oral diseases. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Template-switching during DNA synthesis by Thermus aquaticus DNA polymerase I.

PubMed Central

Odelberg, S J; Weiss, R B; Hata, A; White, R

1995-01-01

Recombinant DNA molecules are often generated during the polymerase chain reaction (PCR) when partially homologous templates are available [e.g., see Pääbo et al. (1990) J. Biol. Chem. 265, 4718-4721]. It has been suggested that these recombinant molecules are a consequence of truncated extension products annealing to partially homologous templates on subsequent PCR cycles. However, we demonstrate here that recombinants can be generated during a single round of primer extension in the absence of subsequent heat denaturation, indicating that template-switching produces some of these recombinant molecules. Two types of template-switches were observed: (i) switches to pre-existing templates and (ii) switches to the complementary nascent strand. Recombination is reduced several fold when the complementary template strands are physically separated by attachment to streptavidin magnetic beads. This result supports the hypothesis that either the polymerase or at least one of the two extending strands switches templates during DNA synthesis and that interaction between the complementary template strands is necessary for efficient template-switching. Images PMID:7596836

The Evolution of DNA-Templated Synthesis as a Tool for Materials Discovery.

PubMed

O'Reilly, Rachel K; Turberfield, Andrew J; Wilks, Thomas R

2017-10-17

Precise control over reactivity and molecular structure is a fundamental goal of the chemical sciences. Billions of years of evolution by natural selection have resulted in chemical systems capable of information storage, self-replication, catalysis, capture and production of light, and even cognition. In all these cases, control over molecular structure is required to achieve a particular function: without structural control, function may be impaired, unpredictable, or impossible. The search for molecules with a desired function is often achieved by synthesizing a combinatorial library, which contains many or all possible combinations of a set of chemical building blocks (BBs), and then screening this library to identify "successful" structures. The largest libraries made by conventional synthesis are currently of the order of 10 8 distinct molecules. To put this in context, there are 10 13 ways of arranging the 21 proteinogenic amino acids in chains up to 10 units long. Given that we know that a number of these compounds have potent biological activity, it would be highly desirable to be able to search them all to identify leads for new drug molecules. Large libraries of oligonucleotides can be synthesized combinatorially and translated into peptides using systems based on biological replication such as mRNA display, with selected molecules identified by DNA sequencing; but these methods are limited to BBs that are compatible with cellular machinery. In order to search the vast tracts of chemical space beyond nucleic acids and natural peptides, an alternative approach is required. DNA-templated synthesis (DTS) could enable us to meet this challenge. DTS controls chemical product formation by using the specificity of DNA hybridization to bring selected reactants into close proximity, and is capable of the programmed synthesis of many distinct products in the same reaction vessel. By making use of dynamic, programmable DNA processes, it is possible to engineer a

The Evolution of DNA-Templated Synthesis as a Tool for Materials Discovery

PubMed Central

2017-01-01

Conspectus Precise control over reactivity and molecular structure is a fundamental goal of the chemical sciences. Billions of years of evolution by natural selection have resulted in chemical systems capable of information storage, self-replication, catalysis, capture and production of light, and even cognition. In all these cases, control over molecular structure is required to achieve a particular function: without structural control, function may be impaired, unpredictable, or impossible. The search for molecules with a desired function is often achieved by synthesizing a combinatorial library, which contains many or all possible combinations of a set of chemical building blocks (BBs), and then screening this library to identify “successful” structures. The largest libraries made by conventional synthesis are currently of the order of 108 distinct molecules. To put this in context, there are 1013 ways of arranging the 21 proteinogenic amino acids in chains up to 10 units long. Given that we know that a number of these compounds have potent biological activity, it would be highly desirable to be able to search them all to identify leads for new drug molecules. Large libraries of oligonucleotides can be synthesized combinatorially and translated into peptides using systems based on biological replication such as mRNA display, with selected molecules identified by DNA sequencing; but these methods are limited to BBs that are compatible with cellular machinery. In order to search the vast tracts of chemical space beyond nucleic acids and natural peptides, an alternative approach is required. DNA-templated synthesis (DTS) could enable us to meet this challenge. DTS controls chemical product formation by using the specificity of DNA hybridization to bring selected reactants into close proximity, and is capable of the programmed synthesis of many distinct products in the same reaction vessel. By making use of dynamic, programmable DNA processes, it is possible to

Synthesis of [18F]-labelled Maltose Derivatives as PET Tracers for Imaging Bacterial Infection

PubMed Central

Namavari, Mohammad; Gowrishankar, Gayatri; Hoehne, Aileen; Jouannot, Erwan; Gambhir, Sanjiv S

2015-01-01

Purpose To develop novel positron emission tomography (PET) agents for visualization and therapy monitoring of bacterial infections. Procedures It is known that maltose and maltodextrins are energy sources for bacteria. Hence, 18F-labelled maltose derivatives could be a valuable tool for imaging bacterial infections. We have developed methods to synthesize 4-O-(α-D-glucopyranosyl)-6-deoxy-6-[18F]fluoro-D-glucopyranoside (6-[18F]fluoromaltose) and 4-O-(α-D-glucopyranosyl)-1-deoxy-1-[18F]fluoro-D-glucopyranoside (1-[18F]fluoromaltose) as bacterial infection PET imaging agents. 6-[18F]fluoromaltose was prepared from precursor 1,2,3-tri-O-acetyl-4-O-(2′,3′,-di-O-acetyl-4′,6′-benzylidene-α-D-glucopyranosyl)-6-deoxy-6-nosyl-D-glucopranoside (5). The synthesis involved the radio-fluorination of 5 followed by acidic and basic hydrolysis to give 6-[18F]fluoromaltose. In an analogous procedure, 1-[18F]fluoromaltose was synthesized from 2,3, 6-tri-O-acetyl-4-O-(2′,3′,4′,6-tetra-O-acetyl-α-D-glucopyranosyl)-1-deoxy-1-O-triflyl-D-glucopranoside (9). Stability of 6-[18F]fluoromaltose in phosphate-buffered saline (PBS) and human and mouse serum at 37 °C was determined. Escherichia coli uptake of 6-[18F]fluoromaltose was examined. Results A reliable synthesis of 1- and 6-[18F]fluoromaltose has been accomplished with 4–6 and 5–8 % radiochemical yields, respectively (decay-corrected with 95 % radiochemical purity). 6-[18F]fluoromaltose was sufficiently stable over the time span needed for PET studies (~96 % intact compound after 1-h and ~65 % after 2-h incubation in serum). Bacterial uptake experiments indicated that E. coli transports 6-[18F]fluoromaltose. Competition assays showed that the uptake of 6-[18F]fluoromaltose was completely blocked by co-incubation with 1 mM of the natural substrate maltose. Conclusion We have successfully synthesized 1- and 6-[18F]fluoromaltose via direct fluorination of appropriate protected maltose precursors. Bacterial uptake

Thermodynamic impact of abasic sites on simulated translesion DNA synthesis.

PubMed

Malina, Jaroslav; Brabec, Viktor

2014-06-16

Loss of a base in DNA and the creation of an abasic (apurinic/apyrimidinic, AP) site is a frequent lesion that may occur spontaneously, or as a consequence of the action of DNA-damaging agents. The AP lesion is mutagenic or lethal if not repaired. We report a systematic thermodynamic investigation by differential scanning calorimetry on the evolution, during primer extension, of a model AP site in chemically simulated DNA translesion synthesis. Incorporation of dAMP (deoxyadenosine monophosphate), as well as dTMP (deoxythymidine monophosphate), opposite an AP site is enthalpically unfavorable, although incorporation of dTMP is more enthalpically unfavorable than that of dAMP. This finding is in a good agreement with experimental data showing that AP sites block various DNA polymerases of eukaryotic and prokaryotic origin and that, if bypassed, dAMP is preferentially inserted, whereas insertion of dTMP is less likely. The results emphasize the importance of thermodynamic contributions to the insertion of nucleotides opposite an AP site by DNA polymerases. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Bacteria and bacterial DNA in atherosclerotic plaque and aneurysmal wall biopsies from patients with and without periodontitis

PubMed Central

Armingohar, Zahra; Jørgensen, Jørgen J.; Kristoffersen, Anne Karin; Abesha-Belay, Emnet; Olsen, Ingar

2014-01-01

Background Several studies have reported an association between chronic periodontitis (CP) and cardiovascular diseases. Detection of periodontopathogens, including red complex bacteria (RCB), in vascular lesions has suggested these bacteria to be involved in the pathogenesis of atherosclerosis and abdominal aortic aneurysms. Objective In this study, we investigate bacteria and their DNA in vascular biopsies from patients with vascular diseases (VD; i.e. abdominal aortic aneurysms, atherosclerotic carotid, and common femoral arteries), with and without CP. Methods DNA was extracted from vascular biopsies selected from 40 VD patients: 30 with CP and 10 without CP. The V3-V5 region of the 16S rDNA (V3-V5) was polymerase chain reaction (PCR)-amplified, and the amplicons were cloned into Escherichia coli, sequenced, and classified (GenBank and the Human Oral Microbiome database). Species-specific primers were used for the detection of Porphyromonas gingivalis. In addition, 10 randomly selected vascular biopsies from the CP group were subjected to scanning electron microscopy (SEM) for visualization of bacteria. Checkerboard DNA–DNA hybridization was performed to assess the presence of RCB in 10 randomly selected subgingival plaque samples from CP patients. Results A higher load and mean diversity of bacteria were detected in vascular biopsies from VD patients with CP compared to those without CP. Enterobacteriaceae were frequently detected in vascular biopsies together with cultivable, commensal oral, and not-yet-cultured bacterial species. While 70% of the subgingival plaque samples from CP patients showed presence of RCB, only P. gingivalis was detected in one vascular biopsy. Bacterial cells were seen in all 10 vascular biopsies examined by SEM. Conclusions A higher bacterial load and more diverse colonization were detected in VD lesions of CP patients as compared to patients without CP. This indicated that a multitude of bacterial species both from the gut and the

Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides.

PubMed

Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M; Högberg, Björn

2013-07-01

Single-stranded oligonucleotides are important as research tools, as diagnostic probes, in gene therapy and in DNA nanotechnology. Oligonucleotides are typically produced via solid-phase synthesis, using polymer chemistries that are limited relative to what biological systems produce. The number of errors in synthetic DNA increases with oligonucleotide length, and the resulting diversity of sequences can be a problem. Here we present the 'monoclonal stoichiometric' (MOSIC) method for enzyme-mediated production of DNA oligonucleotides. We amplified oligonucleotides from clonal templates derived from single bacterial colonies and then digested cutter hairpins in the products, which released pools of oligonucleotides with precisely controlled relative stoichiometric ratios. We prepared 14-378-nucleotide MOSIC oligonucleotides either by in vitro rolling-circle amplification or by amplification of phagemid DNA in Escherichia coli. Analyses of the formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides.

Bacillus subtilis DNA polymerases, PolC and DnaE, are required for both leading and lagging strand synthesis in SPP1 origin-dependent DNA replication

PubMed Central

Seco, Elena M.

2017-01-01

Abstract Firmicutes have two distinct replicative DNA polymerases, the PolC leading strand polymerase, and PolC and DnaE synthesizing the lagging strand. We have reconstituted in vitro Bacillus subtilis bacteriophage SPP1 θ-type DNA replication, which initiates unidirectionally at oriL. With this system we show that DnaE is not only restricted to lagging strand synthesis as previously suggested. DnaG primase and DnaE polymerase are required for initiation of DNA replication on both strands. DnaE and DnaG synthesize in concert a hybrid RNA/DNA ‘initiation primer’ on both leading and lagging strands at the SPP1 oriL region, as it does the eukaryotic Pol α complex. DnaE, as a RNA-primed DNA polymerase, extends this initial primer in a reaction modulated by DnaG and one single-strand binding protein (SSB, SsbA or G36P), and hands off the initiation primer to PolC, a DNA-primed DNA polymerase. Then, PolC, stimulated by DnaG and the SSBs, performs the bulk of DNA chain elongation at both leading and lagging strands. Overall, these modulations by the SSBs and DnaG may contribute to the mechanism of polymerase switch at Firmicutes replisomes. PMID:28575448

Design, synthesis and selection of DNA-encoded small-molecule libraries.

PubMed

Clark, Matthew A; Acharya, Raksha A; Arico-Muendel, Christopher C; Belyanskaya, Svetlana L; Benjamin, Dennis R; Carlson, Neil R; Centrella, Paolo A; Chiu, Cynthia H; Creaser, Steffen P; Cuozzo, John W; Davie, Christopher P; Ding, Yun; Franklin, G Joseph; Franzen, Kurt D; Gefter, Malcolm L; Hale, Steven P; Hansen, Nils J V; Israel, David I; Jiang, Jinwei; Kavarana, Malcolm J; Kelley, Michael S; Kollmann, Christopher S; Li, Fan; Lind, Kenneth; Mataruse, Sibongile; Medeiros, Patricia F; Messer, Jeffrey A; Myers, Paul; O'Keefe, Heather; Oliff, Matthew C; Rise, Cecil E; Satz, Alexander L; Skinner, Steven R; Svendsen, Jennifer L; Tang, Lujia; van Vloten, Kurt; Wagner, Richard W; Yao, Gang; Zhao, Baoguang; Morgan, Barry A

2009-09-01

Biochemical combinatorial techniques such as phage display, RNA display and oligonucleotide aptamers have proven to be reliable methods for generation of ligands to protein targets. Adapting these techniques to small synthetic molecules has been a long-sought goal. We report the synthesis and interrogation of an 800-million-member DNA-encoded library in which small molecules are covalently attached to an encoding oligonucleotide. The library was assembled by a combination of chemical and enzymatic synthesis, and interrogated by affinity selection. We describe methods for the selection and deconvolution of the chemical display library, and the discovery of inhibitors for two enzymes: Aurora A kinase and p38 MAP kinase.

Bacterial DNA detected on pathologically changed heart valves using 16S rRNA gene amplification.

PubMed

Chalupova, Miroslava; Skalova, Anna; Hajek, Tomas; Geigerova, Lenka; Kralova, Dana; Liska, Pavel; Hecova, Hana; Molacek, Jiri; Hrabak, Jaroslav

2018-05-22

Nowadays, dental diseases are one of the most common illnesses in the world. Some of them can lead to translocation of oral bacteria to the bloodstream causing intermittent bacteraemia. Therefore, a potential association between oral infection and cardiovascular diseases has been discussed in recent years as a result of adhesion of oral microbes to the heart valves. The aim of this study was to detect oral bacteria on pathologically changed heart valves not caused by infective endocarditis. In the study, patients with pathologically changed heart valves were involved. Samples of heart valves removed during heart valve replacement surgery were cut into two parts. One aliquot was cultivated aerobically and anaerobically. Bacterial DNA was extracted using Ultra-Deep Microbiome Prep (Molzym GmbH, Bremen, Germany) followed by a 16S rRNA gene PCR amplification using Mastermix 16S Complete kit (Molzym GmbH, Bremen, Germany). Positive PCR products were sequenced and the sequences were analyzed using BLAST database ( http://www.ncbi.nlm.nih/BLAST ). During the study period, 41 samples were processed. Bacterial DNA of the following bacteria was detected in 21 samples: Cutibacterium acnes (formerly Propionibacterium acnes) (n = 11; 52.38% of patients with positive bacterial DNA detection), Staphylococcus sp. (n = 9; 42.86%), Streptococcus sp. (n = 1; 4.76%), Streptococcus sanguinis (n = 4; 19.05%), Streptococcus oralis (n = 1; 4.76%), Carnobacterium sp. (n = 1; 4.76%), Bacillus sp. (n = 2; 9.52%), and Bergeyella sp. (n = 1; 4.76%). In nine samples, multiple bacteria were found. Our results showed significant appearance of bacteria on pathologically changed heart valves in patients with no symptoms of infective endocarditis.

Synthesis of orthogonally protected bacterial, rare-sugar and D-glycosamine building blocks.

PubMed

Emmadi, Madhu; Kulkarni, Suvarn S

2013-10-01

Bacterial glycoconjugates comprise atypical deoxy amino sugars that are not present on the human cell surface, making them good targets for drug discovery and carbohydrate-based vaccine development. Unfortunately, they cannot be isolated with sufficient purity in acceptable amounts, and therefore chemical synthesis is a crucial step toward the development of these products. Here we describe a detailed protocol for the synthesis of orthogonally protected bacterial deoxy amino hexopyranoside (2,4-diacetamido-2,4,6-trideoxyhexose (DATDH), D-bacillosamine, D-fucosamine, and 2-acetamido-4-amino-2,4,6-trideoxy-D-galactose (AAT)), D-glucosamine and D-galactosamine building blocks starting from β-D-thiophenylmannoside. Readily available β-D-thiophenylmannoside was first converted into the corresponding 2,4-diols via deoxygenation or silylation at C6, followed by O3 acylation. The 2,4-diols were converted into 2,4-bis-trifluoromethanesulfonates, which underwent highly regioselective, one-pot, double-serial and double-parallel displacements by azide, phthalimide, acetate and nitrite ions as nucleophiles. Thus, D-rhamnosyl- and D-mannosyl 2,4-diols can be efficiently transformed into various rare sugars and D-galactosamine, respectively, as orthogonally protected thioglycoside building blocks on a gram scale in 1-2 d, in 54-85% overall yields, after a single chromatographic purification. This would otherwise take 1-2 weeks. D-Glucosamine building blocks can be prepared from β-D-thiophenylmannoside in four steps via C2 displacement of triflates by azide in 2 d and in 66-70% overall yields. These procedures have been applied to the synthesis of L-serine-linked trisaccharide of Neisseria meningitidis and a rare disaccharide fragment of the zwitterionic polysaccharide (ZPS) A1 (ZPS A1) of Bacteroides fragilis.

Synthesis of DNA

DOEpatents

Mariella, Jr., Raymond P.

2008-11-18

A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

Loss of the DNA Damage Repair Kinase ATM Impairs Inflammasome-Dependent Anti-Bacterial Innate Immunity.

PubMed

Erttmann, Saskia F; Härtlova, Anetta; Sloniecka, Marta; Raffi, Faizal A M; Hosseinzadeh, Ava; Edgren, Tomas; Rofougaran, Reza; Resch, Ulrike; Fällman, Maria; Ek, Torben; Gekara, Nelson O

2016-07-19

The ATM kinase is a central component of the DNA damage repair machinery and redox balance. ATM dysfunction results in the multisystem disease ataxia-telangiectasia (AT). A major cause of mortality in AT is respiratory bacterial infections. Whether ATM deficiency causes innate immune defects that might contribute to bacterial infections is not known. Here we have shown that loss of ATM impairs inflammasome-dependent anti-bacterial innate immunity. Cells from AT patients or Atm(-/-) mice exhibited diminished interleukin-1β (IL-1β) production in response to bacteria. In vivo, Atm(-/-) mice were more susceptible to pulmonary S. pneumoniae infection in a manner consistent with inflammasome defects. Our data indicate that such defects were due to oxidative inhibition of inflammasome complex assembly. This study reveals an unanticipated function of reactive oxygen species (ROS) in negative regulation of inflammasomes and proposes a theory for the notable susceptibility of AT patients to pulmonary bacterial infection. Copyright © 2016 Elsevier Inc. All rights reserved.

Assessment of potential damage to DNA in urine of coke oven workers: an assay of unscheduled DNA synthesis.

PubMed Central

Roos, F; Renier, A; Ettlinger, J; Iwatsubo, Y; Letourneux, M; Haguenoer, J M; Jaurand, M C; Pairon, J C

1997-01-01

OBJECTIVES: A study was conducted in coke oven workers to evaluate the biological consequences of the exposure of these workers, particularly production of potential genotoxic factors. METHODS: 60 coke oven workers and 40 controls were recruited in the same iron and steel works. Exposure to polycyclic aromatic hydrocarbons (PAHs) was assessed by job and measurement of 1-hydroxypyrene (1OHP) in urine samples. An unscheduled DNA synthesis assay was performed on rat pleural mesothelial cells used as a test system to evaluate the effect of the workers' filtered urine on the DNA repair capacity of rat cells to determine whether DNA damaging agents are present in the urine of these workers. RESULTS: Urinary concentrations of 1OHP ranged from 0.06 to 24.2 (mean (SD) 2.1 (3.6)) mumol/mol creatinine in exposed coke oven workers, and from 0.01 to 0.9 in controls (0.12 (0.15)). These high concentrations in coke oven workers reflected recent exposure to PAHs and were in agreement with the assessment of exposure by job. No significant difference was found between coke oven workers and controls in the DNA repair level of rat cells treated with urine samples. However, the rat cell repair capacity decreased with increasing 1OHP concentrations in the exposed population (r = -0.28, P < 0.05). CONCLUSIONS: As high concentrations of 1OHP were found in the urine of some workers, a more stringent control of exposures to PAHs in the workplace is required. Exposure to PAHs was not associated with a clear cut modification of the urinary excretion of DNA damaging factors in this test, as shown by the absence of increased unscheduled DNA synthesis in rat cells. However, impairment of some repair mechanisms by urinary constituents is suspected. PMID:9470892

BcsA and BcsB form the catalytically active core of bacterial cellulose synthase sufficient for in vitro cellulose synthesis.

PubMed

Omadjela, Okako; Narahari, Adishesh; Strumillo, Joanna; Mélida, Hugo; Mazur, Olga; Bulone, Vincent; Zimmer, Jochen

2013-10-29

Cellulose is a linear extracellular polysaccharide. It is synthesized by membrane-embedded glycosyltransferases that processively polymerize UDP-activated glucose. Polymer synthesis is coupled to membrane translocation through a channel formed by the cellulose synthase. Although eukaryotic cellulose synthases function in macromolecular complexes containing several different enzyme isoforms, prokaryotic synthases associate with additional subunits to bridge the periplasm and the outer membrane. In bacteria, cellulose synthesis and translocation is catalyzed by the inner membrane-associated bacterial cellulose synthase (Bcs)A and BcsB subunits. Similar to alginate and poly-β-1,6 N-acetylglucosamine, bacterial cellulose is implicated in the formation of sessile bacterial communities, termed biofilms, and its synthesis is likewise stimulated by cyclic-di-GMP. Biochemical studies of exopolysaccharide synthesis are hampered by difficulties in purifying and reconstituting functional enzymes. We demonstrate robust in vitro cellulose synthesis reconstituted from purified BcsA and BcsB proteins from Rhodobacter sphaeroides. Although BcsA is the catalytically active subunit, the membrane-anchored BcsB subunit is essential for catalysis. The purified BcsA-B complex produces cellulose chains of a degree of polymerization in the range 200-300. Catalytic activity critically depends on the presence of the allosteric activator cyclic-di-GMP, but is independent of lipid-linked reactants. Our data reveal feedback inhibition of cellulose synthase by UDP but not by the accumulating cellulose polymer and highlight the strict substrate specificity of cellulose synthase for UDP-glucose. A truncation analysis of BcsB localizes the region required for activity of BcsA within its C-terminal membrane-associated domain. The reconstituted reaction provides a foundation for the synthesis of biofilm exopolysaccharides, as well as its activation by cyclic-di-GMP.

BcsA and BcsB form the catalytically active core of bacterial cellulose synthase sufficient for in vitro cellulose synthesis

PubMed Central

Omadjela, Okako; Narahari, Adishesh; Strumillo, Joanna; Mélida, Hugo; Mazur, Olga; Bulone, Vincent; Zimmer, Jochen

2013-01-01

Cellulose is a linear extracellular polysaccharide. It is synthesized by membrane-embedded glycosyltransferases that processively polymerize UDP-activated glucose. Polymer synthesis is coupled to membrane translocation through a channel formed by the cellulose synthase. Although eukaryotic cellulose synthases function in macromolecular complexes containing several different enzyme isoforms, prokaryotic synthases associate with additional subunits to bridge the periplasm and the outer membrane. In bacteria, cellulose synthesis and translocation is catalyzed by the inner membrane-associated bacterial cellulose synthase (Bcs)A and BcsB subunits. Similar to alginate and poly-β-1,6 N-acetylglucosamine, bacterial cellulose is implicated in the formation of sessile bacterial communities, termed biofilms, and its synthesis is likewise stimulated by cyclic-di-GMP. Biochemical studies of exopolysaccharide synthesis are hampered by difficulties in purifying and reconstituting functional enzymes. We demonstrate robust in vitro cellulose synthesis reconstituted from purified BcsA and BcsB proteins from Rhodobacter sphaeroides. Although BcsA is the catalytically active subunit, the membrane-anchored BcsB subunit is essential for catalysis. The purified BcsA-B complex produces cellulose chains of a degree of polymerization in the range 200–300. Catalytic activity critically depends on the presence of the allosteric activator cyclic-di-GMP, but is independent of lipid-linked reactants. Our data reveal feedback inhibition of cellulose synthase by UDP but not by the accumulating cellulose polymer and highlight the strict substrate specificity of cellulose synthase for UDP-glucose. A truncation analysis of BcsB localizes the region required for activity of BcsA within its C-terminal membrane-associated domain. The reconstituted reaction provides a foundation for the synthesis of biofilm exopolysaccharides, as well as its activation by cyclic-di-GMP. PMID:24127606

5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

NASA Technical Reports Server (NTRS)

Frank, Natia L.; Meade, Thomas J.

2003-01-01

Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.

Newer systems for bacterial resistances to toxic heavy metals.

PubMed Central

Silver, S; Ji, G

1994-01-01

Bacterial plasmids contain specific genes for resistances to toxic heavy metal ions including Ag+, AsO2-, AsO4(3-), Cd2+, Co2+, CrO4(2-), Cu2+, Hg2+, Ni2+, Pb2+, Sb3+, and Zn2+. Recent progress with plasmid copper-resistance systems in Escherichia coli and Pseudomonas syringae show a system of four gene products, an inner membrane protein (PcoD), an outer membrane protein (PcoB), and two periplasmic Cu(2+)-binding proteins (PcoA and PcoC). Synthesis of this system is governed by two regulatory proteins (the membrane sensor PcoS and the soluble responder PcoR, probably a DNA-binding protein), homologous to other bacterial two-component regulatory systems. Chromosomally encoded Cu2+ P-type ATPases have recently been recognized in Enterococcus hirae and these are closely homologous to the bacterial cadmium efflux ATPase and the human copper-deficiency disease Menkes gene product. The Cd(2+)-efflux ATPase of gram-positive bacteria is a large P-type ATPase, homologous to the muscle Ca2+ ATPase and the Na+/K+ ATPases of animals. The arsenic-resistance system of gram-negative bacteria functions as an oxyanion efflux ATPase for arsenite and presumably antimonite. However, the structure of the arsenic ATPase is fundamentally different from that of P-type ATPases. The absence of the arsA gene (for the ATPase subunit) in gram-positive bacteria raises questions of energy-coupling for arsenite efflux. The ArsC protein product of the arsenic-resistance operons of both gram-positive and gram-negative bacteria is an intracellular enzyme that reduces arsenate [As(V)] to arsenite [As(III)], the substrate for the transport pump. Newly studied cation efflux systems for Cd2+, Zn2+, and Co2+ (Czc) or Co2+ and Ni2+ resistance (Cnr) lack ATPase motifs in their predicted polypeptide sequences. Therefore, not all plasmid-resistance systems that function through toxic ion efflux are ATPases. The first well-defined bacterial metallothionein was found in the cyanobacterium Synechococcus

Replicating DNA by cell factories: roles of central carbon metabolism and transcription in the control of DNA replication in microbes, and implications for understanding this process in human cells

PubMed Central

2013-01-01

Precise regulation of DNA replication is necessary to ensure the inheritance of genetic features by daughter cells after each cell division. Therefore, determining how the regulatory processes operate to control DNA replication is crucial to our understanding and application to biotechnological processes. Contrary to early concepts of DNA replication, it appears that this process is operated by large, stationary nucleoprotein complexes, called replication factories, rather than by single enzymes trafficking along template molecules. Recent discoveries indicated that in bacterial cells two processes, central carbon metabolism (CCM) and transcription, significantly and specifically influence the control of DNA replication of various replicons. The impact of these discoveries on our understanding of the regulation of DNA synthesis is discussed in this review. It appears that CCM may influence DNA replication by either action of specific metabolites or moonlighting activities of some enzymes involved in this metabolic pathway. The role of transcription in the control of DNA replication may arise from either topological changes in nucleic acids which accompany RNA synthesis or direct interactions between replication and transcription machineries. Due to intriguing similarities between some prokaryotic and eukaryotic regulatory systems, possible implications of studies on regulation of microbial DNA replication on understanding such a process occurring in human cells are discussed. PMID:23714207

Bacterial cellulose synthesis mechanism of facultative anaerobe Enterobacter sp. FY-07.

PubMed

Ji, Kaihua; Wang, Wei; Zeng, Bing; Chen, Sibin; Zhao, Qianqian; Chen, Yueqing; Li, Guoqiang; Ma, Ting

2016-02-25

Enterobacter sp. FY-07 can produce bacterial cellulose (BC) under aerobic and anaerobic conditions. Three potential BC synthesis gene clusters (bcsI, bcsII and bcsIII) of Enterobacter sp. FY-07 have been predicted using genome sequencing and comparative genome analysis, in which bcsIII was confirmed as the main contributor to BC synthesis by gene knockout and functional reconstitution methods. Protein homology, gene arrangement and gene constitution analysis indicated that bcsIII had high identity to the bcsI operon of Enterobacter sp. 638; however, its arrangement and composition were same as those of BC synthesizing operon of G. xylinum ATCC53582 except for the flanking sequences. According to the BC biosynthesizing process, oxygen is not directly involved in the reactions of BC synthesis, however, energy is required to activate intermediate metabolites and synthesize the activator, c-di-GMP. Comparative transcriptome and metabolite quantitative analysis demonstrated that under anaerobic conditions genes involved in the TCA cycle were downregulated, however, genes in the nitrate reduction and gluconeogenesis pathways were upregulated, especially, genes in three pyruvate metabolism pathways. These results suggested that Enterobacter sp. FY-07 could produce energy efficiently under anaerobic conditions to meet the requirement of BC biosynthesis.

Bacterial cellulose synthesis mechanism of facultative anaerobe Enterobacter sp. FY-07

PubMed Central

Ji, Kaihua; Wang, Wei; Zeng, Bing; Chen, Sibin; Zhao, Qianqian; Chen, Yueqing; Li, Guoqiang; Ma, Ting

2016-01-01

Enterobacter sp. FY-07 can produce bacterial cellulose (BC) under aerobic and anaerobic conditions. Three potential BC synthesis gene clusters (bcsI, bcsII and bcsIII) of Enterobacter sp. FY-07 have been predicted using genome sequencing and comparative genome analysis, in which bcsIII was confirmed as the main contributor to BC synthesis by gene knockout and functional reconstitution methods. Protein homology, gene arrangement and gene constitution analysis indicated that bcsIII had high identity to the bcsI operon of Enterobacter sp. 638; however, its arrangement and composition were same as those of BC synthesizing operon of G. xylinum ATCC53582 except for the flanking sequences. According to the BC biosynthesizing process, oxygen is not directly involved in the reactions of BC synthesis, however, energy is required to activate intermediate metabolites and synthesize the activator, c-di-GMP. Comparative transcriptome and metabolite quantitative analysis demonstrated that under anaerobic conditions genes involved in the TCA cycle were downregulated, however, genes in the nitrate reduction and gluconeogenesis pathways were upregulated, especially, genes in three pyruvate metabolism pathways. These results suggested that Enterobacter sp. FY-07 could produce energy efficiently under anaerobic conditions to meet the requirement of BC biosynthesis. PMID:26911736

Possible roles of HIV-1 nucleocapsid protein in the specificity of proviral DNA synthesis and in its variability.

PubMed

Lapadat-Tapolsky, M; Gabus, C; Rau, M; Darlix, J L

1997-05-02

Retroviral nucleocapsid (NC) protein is an integral part of the virion nucleocapsid where it coats the dimeric RNA genome. Due to its nucleic acid binding and annealing activities, NC protein directs the annealing of the tRNA primer to the primer binding site and greatly facilitates minus strand DNA elongation and transfer while protecting the nucleic acids against nuclease degradation. To understand the role of NCp7 in viral DNA synthesis, we examined the influence of NCp7 on self-primed versus primer-specific reverse transcription. The results show that HIV-1 NCp7 can extensively inhibit self-primed reverse transcription of viral and cellular RNAs while promoting primer-specific synthesis of proviral DNA. The role of NCp7 vis-a-vis the presence of mutations in the viral DNA during minus strand elongation was examined. NCp7 maximized the annealing between a cDNA(-) primer containing one to five consecutive errors and an RNA representing the 3' end of the genome. The ability of reverse transcriptase (RT) in the presence of NCp7 to subsequently extend the mutated primers depended upon the position of the mismatch within the primer:template complex. When the mutations were at the polymerisation site, primer extension by RT in the presence of NCp7 was very high, about 40% for one mismatch and 3% for five consecutive mismatches. Mutations within the DNA primer or at its 5' end had little effect on the extension of viral DNA by RT. Taken together these results indicate that NCp7 plays major roles in proviral DNA synthesis within the virion core due to its ability to promote prime-specific proviral DNA synthesis while concurrently inhibiting non-specific reverse transcription of viral and cellular RNAs. Moreover, the observation that NCp7 enhances the incorporation of mutations during minus strand DNA elongation favours the notion that NCp7 is a factor contributing to the high mutation rate of HIV-1.

Increased cellular levels of spermidine or spermine are required for optimal DNA synthesis in lymphocytes activated by concanavalin A.

PubMed Central

Fillingame, R H; Jorstad, C M; Morris, D R

1975-01-01

There are large increases in cellular levels of the polyamines spermidine and spermine in lymphocytes induced to transform by concanavalin A. The anti-leukemic agent methylglyoxal bis(guanylhydrazone) (MGBG) blocks synthesis of these polyamines by inhibiting S-adenosylmethionine decarboxylase. Previous results showed that when cells are activated in the presence of MGBG the synthesis and processing of RNA, as well as protein synthesis, proceed as in the absence of the drug. In contrast, the incorporation of [methyl-3H]thymidine into DNA and the rate of entry of the cells into mitosis are inhibited by 60% in the presence of MGBG. Several experiments suggest that MGBG inhibits cell proliferation by directly blocking polyamine synthesis and not by an unrelated pharmacological effect: (1) the inhibitory action of MGBG is reversed by exogenously added spermidine or spermine; (2) inhibition of DNA synthesis by MGBG shows the same dose-response curve as does inhibition of spermidine and spermine synthesis; and (3) if MGBG is added to cells which have been allowed to accumulate their maximum complement of polyamines, there is no inhibition of thymidine incorporation. MGBG-treated and control cultures initiate DNA synthesis at the same time and show the same percentage of labeled cells by autoradiography. Therefore, it appears that in the absence of increased cellular levels of polyamines, lymphocytes progress normally from G0 through G1 and into S-phase. Furthermore, these experiments suggest that the increased levels of spermidine and spermine generally seen in rapidly proliferating eukaryotic systems are necessary for enhanced rates of DNA replication. PMID:1060087

Enhanced GSH synthesis by Bisphenol A exposure promoted DNA methylation process in the testes of adult rare minnow Gobiocypris rarus.

PubMed

Yuan, Cong; Zhang, Yingying; Liu, Yan; Zhang, Ting; Wang, Zaizhao

2016-09-01

DNA methylation is a commonly studied epigenetic modification. The mechanism of BPA on DNA methylation is poorly understood. The present study aims to explore whether GSH synthesis affects DNA methylation in the testes of adult male rare minnow Gobiocypris rarus in response to Bisphenol A (BPA). Male G. rarus was exposed to 1, 15 and 225μgL(-1) BPA for 7 days. The levels of global DNA methylation, hydrogen peroxide (H2O2) and glutathione (GSH) in the testes were analyzed. Meanwhile, the levels of enzymes involved in DNA methylation and de novo GSH synthesis, and the substrate contents for GSH production were measured. Furthermore, gene expression profiles of the corresponding genes of all studied enzymes were analyzed. Results indicated that BPA at 15 and 225μgL(-1) caused hypermethylation of global DNA in the testes. The 15μgL(-1) BPA resulted in significant decrease of ten-eleven translocation proteins (TETs) while 225μgL(-1) BPA caused significant increase of DNA methyltransferase proteins (DNMTs). Moreover, 225μgL(-1) BPA caused significant increase of H2O2 and GSH levels, and the de novo GSH synthesis was enhanced. These results indicated that the significant decrease of the level of TETs may be sufficient to cause the DNA hypermethylation by 15μgL(-1) BPA. However, the significantly increased of DNMTs contributed to the significant increase of DNA methylation levels by 225μgL(-1) BPA. Moreover, the elevated de novo GSH synthesis may promote the DNA methylation process. Copyright © 2016 Elsevier B.V. All rights reserved.

DNA synthesis by Pol η promotes fragile site stability by preventing under-replicated DNA in mitosis

PubMed Central

Bergoglio, Valérie; Boyer, Anne-Sophie; Walsh, Erin; Naim, Valeria; Legube, Gaëlle; Lee, Marietta Y.W.T.; Rey, Laurie; Rosselli, Filippo; Cazaux, Christophe; Eckert, Kristin A.

2013-01-01

Human DNA polymerase η (Pol η) is best known for its role in responding to UV irradiation–induced genome damage. We have recently observed that Pol η is also required for the stability of common fragile sites (CFSs), whose rearrangements are considered a driving force of oncogenesis. Here, we explored the molecular mechanisms underlying this newly identified role. We demonstrated that Pol η accumulated at CFSs upon partial replication stress and could efficiently replicate non-B DNA sequences within CFSs. Pol η deficiency led to persistence of checkpoint-blind under-replicated CFS regions in mitosis, detectable as FANCD2-associated chromosomal sites that were transmitted to daughter cells in 53BP1-shielded nuclear bodies. Expression of a catalytically inactive mutant of Pol η increased replication fork stalling and activated the replication checkpoint. These data are consistent with the requirement of Pol η–dependent DNA synthesis during S phase at replication forks stalled in CFS regions to suppress CFS instability by preventing checkpoint-blind under-replicated DNA in mitosis. PMID:23609533

Characterization of bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, as determined by 16S rDNA analysis.

PubMed

Escalante, Adelfo; Rodríguez, María Elena; Martínez, Alfredo; López-Munguía, Agustín; Bolívar, Francisco; Gosset, Guillermo

2004-06-15

The bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, was studied in 16S rDNA clone libraries from three pulque samples. Sequenced clones identified as Lactobacillus acidophilus, Lactobacillus strain ASF360, L. kefir, L. acetotolerans, L. hilgardii, L. plantarum, Leuconostoc pseudomesenteroides, Microbacterium arborescens, Flavobacterium johnsoniae, Acetobacter pomorium, Gluconobacter oxydans, and Hafnia alvei, were detected for the first time in pulque. Identity of 16S rDNA sequenced clones showed that bacterial diversity present among pulque samples is dominated by Lactobacillus species (80.97%). Seventy-eight clones exhibited less than 95% of relatedness to NCBI database sequences, which may indicate the presence of new species in pulque samples.

mTOR signaling regulates myotube hypertrophy by modulating protein synthesis, rDNA transcription, and chromatin remodeling.

PubMed

von Walden, Ferdinand; Liu, Chang; Aurigemma, Nicole; Nader, Gustavo A

2016-10-01

Ribosome production is an early event during skeletal muscle hypertrophy and precedes muscle protein accretion. Signaling via mTOR is crucial for ribosome production and hypertrophy; however, the mechanisms by which it regulates these processes remain to be identified. Herein, we investigated the activation of mTOR signaling in hypertrophying myotubes and determined that mTOR coordinates various aspects of gene expression important for ribosome production. First, inhibition of translation with cycloheximide had a more potent effect on protein synthesis than rapamycin indicating that mTOR function during hypertrophy is not on general, but rather on specific protein synthesis. Second, blocking Pol II transcription had a similar effect as Rapamycin and, unexpectedly, revealed the necessity of Pol II transcription for Pol I transcription, suggesting that mTOR may regulate ribosome production also by controlling Class II genes at the transcriptional level. Third, Pol I activity is essential for rDNA transcription and, surprisingly, for protein synthesis as selective Pol I inhibition blunted rDNA transcription, protein synthesis, and the hypertrophic response of myotubes. Finally, mTOR has nuclear localization in muscle, which is not sensitive to rapamycin. Inhibition of mTOR signaling by rapamycin disrupted mTOR-rDNA promoter interaction and resulted in altered histone marks indicative of repressed transcription and formation of higher-order chromatin structure. Thus mTOR signaling appears to regulate muscle hypertrophy by affecting protein synthesis, Class I and II gene expression, and chromatin remodeling. Copyright © 2016 the American Physiological Society.

Correlation of the lipophilicity of xenobiotics with their synergistic effects on DNA synthesis in human fibroblasts.

PubMed

Jacobi, H; Leier, G; Witte, I

1996-04-01

The binary combination effects of DNA synthesis of human fibroblasts were investigated using 2,4-D with 15 xenobiotics of different chemical substance classes. Results were compared with previous investigations on cell growth. Each of the 15 chemicals tested at their no effect concentrations (NOEC's) increased the effects of 2,4-D on DNA synthesis. Thereby, the EC20 value of 2,4-D was reduced by approximately 40% in the combinations. The NOEC's of the xenobiotics used in the combinations varied by a factor of 1,600 and depended strongly on the lipophilicity of the agents combined with 2,4-D. A significant statistical correlation of r = 0.90 was found between the NOEC's of the 15 combined xenobiotics and their lipophilicity. The combination effects on DNA synthesis were similar to those on cell growth. The regression lines of the relationship between the NOEC's and lipophilicity in both assays showed only slight differences in the slopes. This is an additional confirmation of our hypothesis on a facilitated uptake of 2,4-D in the binary combinations.

DNA-binding by Haemophilus influenzae and Escherichia coli YbaB, members of a widely-distributed bacterial protein family.

PubMed

Cooley, Anne E; Riley, Sean P; Kral, Keith; Miller, M Clarke; DeMoll, Edward; Fried, Michael G; Stevenson, Brian

2009-07-13

Genes orthologous to the ybaB loci of Escherichia coli and Haemophilus influenzae are widely distributed among eubacteria. Several years ago, the three-dimensional structures of the YbaB orthologs of both E. coli and H. influenzae were determined, revealing a novel "tweezer"-like structure. However, a function for YbaB had remained elusive, with an early study of the H. influenzae ortholog failing to detect DNA-binding activity. Our group recently determined that the Borrelia burgdorferi YbaB ortholog, EbfC, is a DNA-binding protein. To reconcile those results, we assessed the abilities of both the H. influenzae and E. coli YbaB proteins to bind DNA to which B. burgdorferi EbfC can bind. Both the H. influenzae and the E. coli YbaB proteins bound to tested DNAs. DNA-binding was not well competed with poly-dI-dC, indicating some sequence preferences for those two proteins. Analyses of binding characteristics determined that both YbaB orthologs bind as homodimers. Different DNA sequence preferences were observed between H. influenzae YbaB, E. coli YbaB and B. burgdorferi EbfC, consistent with amino acid differences in the putative DNA-binding domains of these proteins. Three distinct members of the YbaB/EbfC bacterial protein family have now been demonstrated to bind DNA. Members of this protein family are encoded by a broad range of bacteria, including many pathogenic species, and results of our studies suggest that all such proteins have DNA-binding activities. The functions of YbaB/EbfC family members in each bacterial species are as-yet unknown, but given the ubiquity of these DNA-binding proteins among Eubacteria, further investigations are warranted.

Oxabicyclooctane-Linked Novel Bacterial Topoisomerase Inhibitors as Broad Spectrum Antibacterial Agents

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Sheo B.; Kaelin, David E.; Wu, Jin

Bacterial resistance is eroding the clinical utility of existing antibiotics necessitating the discovery of new agents. Bacterial type II topoisomerase is a clinically validated, highly effective, and proven drug target. This target is amenable to inhibition by diverse classes of inhibitors with alternative and distinct binding sites to quinolone antibiotics, thus enabling the development of agents that lack cross-resistance to quinolones. Described here are novel bacterial topoisomerase inhibitors (NBTIs), which are a new class of gyrase and topo IV inhibitors and consist of three distinct structural moieties. The substitution of the linker moiety led to discovery of potent broad-spectrum NBTIsmore » with reduced off-target activity (hERG IC50 > 18 μM) and improved physical properties. AM8191 is bactericidal and selectively inhibits DNA synthesis and Staphylococcus aureus gyrase (IC50 = 1.02 μM) and topo IV (IC50 = 10.4 μM). AM8191 showed parenteral and oral efficacy (ED50) at less than 2.5 mg/kg doses in a S. aureus murine infection model. A cocrystal structure of AM8191 bound to S. aureus DNA-gyrase showed binding interactions similar to that reported for GSK299423, displaying a key contact of Asp83 with the basic amine at position-7 of the linker.« less

Bacterial DNA of Ocean and Land on the Surface of the International Space Station.

NASA Astrophysics Data System (ADS)

Grebennikova, Tatiana

A.V. Syroeshkin2, T.V. Grebennikova1, E.V. Shubralova3, V.A. Shuvalov3, O.S. Tsygankov4, V.B. Lapshin2 1D. I. Ivanovsky Virology Institute, Moscow, Russia 2 Academician E. K. Fedorov Institute of Applied Geophysics, Moscow, Russia 3S.P. Korolev Rocket and Space Corporation «Energia» Korolev, Russia 4Central Research Institute of Machine Building, Korolev, Russia Existence of biological molecules as markers of microorganisms in the space environment has always attracted attention of researchers. There is great attention to the search for extraterrestrial life forms [Nicholson W.L. 2009, Kawaguchi Y. et al 2013], and as well as the coping mechanisms of living organisms in the interplanetary space [Hotchin J. et al 1965, Baranov V.M. 2009, Horneck G. et al 2010]. Experiments on American and Japanese segments of the International Space Station (ISS) over the different nature of resistance during prolonged stay in space were conducted [Scalzi G et al 2012, Wassmann M. et al 2012]. As a result of these experiments confirmed the possibility of preserving the viability of organisms in an open space for a long time. Consequence, became interested in the transfer of living matter from the stratosphere to near-Earth space [Smith D.J. 2013]. We hypothesized that viable forms, or at least, intact DNA can be transferred to the orbit of the ISS with the ascending branch of the global electric circuit. Samples of cosmic dust collected from the surface of the window of the ISS during the exit of an astronaut in space. Samples (washes with material of tampons and tampons) which were in vacuo, were analyzed for the presence of bacterial DNA by nested PCR using primers specific DNA genus Mycobacterium, the DNA of the strain of the genus Bacillus anthracis and DNA encoding the bacterial 16S ribosomal RNA after transportation of the samples to Earth. The results of amplification, followed by sequencing and phylogenetic analysis showed the presence in samples of cosmic dust DNA

Phase-assisted synthesis and DNA unpacking evaluation of biologically inspired metallo nanocomplexes using peptide as unique building block.

PubMed

Raman, N; Sudharsan, S

2011-12-01

The goal of nanomaterials' surface modification using a biomaterial is to preserve the materials' bulk properties while modifying only their surface to possess desired recognition and specificity. Here, we have developed a phase-assisted, modified Brust-Schiffrin methodological synthesis of metallo nanocomplexes anchored by a peptide, N,N'-(1,3-propylene)-bis-hippuricamide. The spectral, thermal and morphological characterizations assure the formation of nanocomplexes. Therapeutic behavior of all the nanocomplexes has been well sighted by evaluating their DNA unpacking skills. In addition, we demonstrate their biological inspiration by targeting few bacterial and fungal strains. The in vitro antimicrobial investigation reports that all the nanocomplexes disrupt microbial cell walls/membranes efficiently and inhibit the growth of microbes. These sorts of nanocomplexes synthesized in large quantities and at low cost, deliver versatile biomedical applications, and can be used to treat various diseases which may often cause high mortality. Copyright © 2011 Elsevier Inc. All rights reserved.

Bacterial Hsp70 (DnaK) and mammalian Hsp70 interact differently with lipid membranes.

PubMed

Lopez, Victor; Cauvi, David M; Arispe, Nelson; De Maio, Antonio

2016-07-01

The cellular response to stress is orchestrated by the expression of a family of proteins termed heat shock proteins (hsp) that are involved in the stabilization of basic cellular processes to preserve cell viability and homeostasis. The bulk of hsp function occurs within the cytosol and subcellular compartments. However, some hsp have also been found outside cells released by an active mechanism independent of cell death. Extracellular hsp act as signaling molecules directed at activating a systemic response to stress. The export of hsp requires the translocation from the cytosol into the extracellular milieu across the plasma membrane. We have proposed that membrane insertion is the initial step in this export process. We investigated the interaction of the major inducible hsp from mammalian (Hsp70) and bacterial (DnaK) species with liposomes. We found that mammalian Hsp70 displayed a high specificity for negatively charged phospholipids, such as phosphatidyl serine, whereas DnaK interacted with all lipids tested regardless of the charge. Both proteins were inserted into the lipid bilayer as demonstrated by resistance to acid or basic washes that was confirmed by partial protection from proteolytic cleavage. Several regions of mammalian Hsp70 were inserted into the membrane with a small portion of the N-terminus end exposed to the outer phase of the liposome. In contrast, the N-terminus end of DnaK was inserted into the membrane, exposing the C-terminus end outside the liposome. Mammalian Hsp70 was found to make high oligomeric complexes upon insertion into the membranes whereas DnaK only formed dimers within the lipid bilayer. These observations suggest that both Hsp70s interact with lipids, but mammalian Hsp70 displays a high degree of specificity and structure as compared with the bacterial form.

Targeting bacterial central metabolism for drug development.

PubMed

Murima, Paul; McKinney, John D; Pethe, Kevin

2014-11-20

Current antibiotics, derived mainly from natural sources, inhibit a narrow spectrum of cellular processes, namely DNA replication, protein synthesis, and cell wall biosynthesis. With the worldwide explosion of drug resistance, there is renewed interest in the investigation of alternate essential cellular processes, including bacterial central metabolic pathways, as a drug target space for the next generation of antibiotics. However, the validation of targets in central metabolism is more complex, as essentiality of such targets can be conditional and/or contextual. Bearing in mind our enhanced understanding of prokaryotic central metabolism, a key question arises: can central metabolism be bacteria's Achilles' heel and a therapeutic target for the development of new classes of antibiotics? In this review, we draw lessons from oncology and attempt to address some of the open questions related to feasibility of targeting bacterial central metabolism as a strategy for developing new antibacterial drugs. Copyright © 2014 Elsevier Ltd. All rights reserved.

Bacterial expression of self-assembling peptide hydrogelators

NASA Astrophysics Data System (ADS)

Sonmez, Cem

For tissue regeneration and drug delivery applications, various architectures are explored to serve as biomaterial tools. Via de novo design, functional peptide hydrogel materials have been developed as scaffolds for biomedical applications. The objective of this study is to investigate bacterial expression as an alternative method to chemical synthesis for the recombinant production of self-assembling peptides that can form rigid hydrogels under physiological conditions. The Schneider and Pochan Labs have designed and characterized a 20 amino acid beta-hairpin forming amphiphilic peptide containing a D-residue in its turn region (MAX1). As a result, this peptide must be prepared chemically. Peptide engineering, using the sequence of MAX1 as a template, afforded a small family of peptides for expression (EX peptides) that have different turn sequences consisting of natural amino acids and amenable to bacterial expression. Each sequence was initially chemically synthesized to quickly assess the material properties of its corresponding gel. One model peptide EX1, was chosen to start the bacterial expression studies. DNA constructs facilitating the expression of EX1 were designed in such that the peptide could be expressed with different fusion partners and subsequently cleaved by enzymatic or chemical means to afford the free peptide. Optimization studies were performed to increase the yield of pure peptide that ultimately allowed 50 mg of pure peptide to be harvested from one liter of culture, providing an alternate means to produce this hydrogel-forming peptide. Recombinant production of other self-assembling hairpins with different turn sequences was also successful using this optimized protocol. The studies demonstrate that new beta-hairpin self-assembling peptides that are amenable to bacterial production and form rigid hydrogels at physiological conditions can be designed and produced by fermentation in good yield at significantly reduced cost when compared to

Optimal vitamin D plasma levels are associated with lower bacterial DNA translocation in HIV/hepatitis c virus coinfected patients.

PubMed

García-Álvarez, Mónica; Berenguer, Juan; Jiménez-Sousa, Maria Ángeles; Vázquez-Morón, Sonia; Carrero, Ana; Gutiérrez-Rivas, Mónica; Aldámiz-Echevarría, Teresa; López, Juan Carlos; García-Broncano, Pilar; Resino, Salvador

2016-04-24

Vitamin D has been linked to the immune response modulation and the integrity of the intestinal mucosal barrier. Therefore, vitamin D might be involved in bacterial translocation related to HIV infection. Our major aim was to analyze the association between plasma levels of 25-hydroxy-vitamin D [25(OH)D] and bacterial 16S ribosomal DNA (bactDNA) in 120 HIV/hepatitis c virus (HCV) coinfected patients. Cross-sectional study. Plasma 25(OH)D levels were quantified by enzyme immunoassay. The vitamin D status was defined as deficient (<25 nmol/l), insufficient (25-74 nmol/l), and optimal (≥75 nmol/l) plasma levels. Plasma bactDNA levels were measured by quantitative real-time PCR. For bactDNA levels the cutoffs used were as follows: low [p75th). Eighteen (15%) patients had 25(OH)D deficiency, 93 (77.5%) had insufficiency and nine (7.5%) had 25(OH)D optimal values. The bactDNA levels were lower in patients with 25(OH)D at least 75 nmol/l [37 copies/μl] than in patients with 25(OH)D insufficiency [84.2 copies/μl; P = 0.042]. Conversely, low bactDNA levels (DNA levels above p25th were found only in 11.1% of them (P = 0.029). The plasma 25(OH)D not less than 75 nmol/l was associated with low bactDNA levels (bacterial translocation and inflammation in HIV/HCV coinfected patients.

AUTORADIOGRAPHIC STUDY OF DNA SYNTHESIS AND THE CELL CYCLE IN SPERMATOGONIA AND SPERMATOCYTES OF MOUSE TESTIS USING TRITIATED THYMIDINE

PubMed Central

Monesi, Valerio

1962-01-01

Mice were injected intraperitoneally with 15 µc of H3-thymidine. The time course of the labeling in spermatogonia and spermatocytes was studied by using autoradiography on 5 µ sections stained by the periodic acid-Schiff method and hematoxylin over a period of 57 hours after injection. Four generations of type A (called AI, AII, AIII, and AIV), one of intermediate, and one of type B spermatogonia occur in one cycle of the seminiferous epithelium. The average life span is about the same in all spermatogonia, i.e., about 27 to 30.5 hours. The average pre-DNA synthetic time, including the mitotic stages from metaphase through telophase and the portion of interphase preceding DNA synthesis, is also not very different, ranging between 7.5 and 10.5 hours. A remarkable difference exists, however, in the duration of DNA synthesis and of the post-DNA synthetic period. The average DNA synthetic time is very long and is highly variable in type B (14.5 hours), a little shorter and less variable in intermediate (12.5 hours) and AIV (13 hours) spermatogonia, and much shorter and very constant in AIII (8 hours), AII and AI (7 to 7.5 hours) spermatogonia. Conversely, the average post-DNA synthetic time, corresponding essentially to the duration of the prophase, is short and very constant in type B (4.5 hours), longer and variable in intermediate (6 hours) and AIV (8 hours) spermatogonia, and much longer and much more variable in AIII (11 hours), AII and AI (14 hours) spermatogonia. The premeiotic synthesis of DNA takes place in primary spermatocytes during the resting phase and terminates just before the visible onset of the meiotic prophase. Its average duration is 14 hours. No further synthesis of DNA takes place in later stages of spermatogenesis. PMID:14475361

Increased yield of PCR products by addition of T4 gene 32 protein to the SMART PCR cDNA synthesis system.

PubMed

Villalva, C; Touriol, C; Seurat, P; Trempat, P; Delsol, G; Brousset, P

2001-07-01

Under certain conditions, T4 gene 32 protein is known to increase the efficiency of different enzymes, such as Taq DNA polymerase, reverse transcriptase, and telomerase. In this study, we compared the efficiency of the SMART PCR cDNA synthesis kit with and without the T4 gene 32 protein. The use of this cDNA synthesis procedure, in combination with T4 gene 32 protein, increases the yield of RT-PCR products from approximately 90% to 150%. This effect is even observed for long mRNA templates and low concentrations of total RNA (25 ng). Therefore, we suggest the addition of T4 gene 32 protein in the RT-PCR mixture to increase the efficiency of cDNA synthesis, particularly in cases when low amounts of tissue are used.

No difference in portal and hepatic venous bacterial DNA in patients with cirrhosis undergoing transjugular intrahepatic portosystemic shunt insertion.

PubMed

Mortensen, Christian; Karlsen, Stine; Grønbæk, Henning; Nielsen, Dennis T; Frevert, Susanne; Clemmesen, Jens O; Møller, Søren; Jensen, Jørgen S; Bendtsen, Flemming

2013-10-01

Bacterial translocation (BT) with immune activation may lead to hemodynamical alterations and poor outcomes in patients with cirrhosis. We investigated bacterial DNA (bDNA), a marker of BT, and its relation to portal pressure and markers of inflammation in the portal and hepatic veins in patients with cirrhosis undergoing TIPS insertion. We analysed plasma for bDNA and markers of inflammation in 28 patients [median portal pressure gradient 15 (11-19) mmHg] during TIPS treatment for refractory ascites (n = 19) or acute variceal bleeding (n = 9). Advanced cirrhosis was present in the majority [Child-Pugh class (A/B/C): 1/14/13], and most often caused by alcohol (n = 21). bDNA was detectable in one or both samples in 16 of 28 patients (57%). bDNA was present in 39% of the samples from the portal vein vs 43% of the samples in the hepatic vein (P = 0.126). Antibiotics had no effect on bDNA or markers of inflammation. Markers of inflammation did not differ between the hepatic and portal veins with the exceptions of soluble urokinase plasminogen activating receptor (suPAR) and vascular endothelial growth factor (VEGF), both higher in the hepatic vein (P = 0.031 and 0.003 respectively). No transhepatic gradient of bDNA was evident, suggesting that no major hepatic elimination of bDNA occurs in advanced liver disease. bDNA, in contrast to previous reports was largely unrelated to a panel of markers of inflammation and without relation to portal pressure. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Synthesis of G-N2-(CH2)3-N2-G Trimethylene DNA interstrand cross-links

PubMed Central

Gruppi, Francesca; Salyard, Tracy L. Johnson; Rizzo, Carmelo J.

2014-01-01

The synthesis of G-N2-(CH2)3-N2-G trimethylene DNA interstrand cross-links (ICLs) in a 5′-CG-3′ and 5′-GC-3′ sequence from oligodeoxynucleotides containing N2-(3-aminopropyl)-2′-deoxyguanosine and 2-fluoro-O6-(trimethylsilylethyl)inosine is presented. Automated solid-phase DNA synthesis was used for unmodified bases and modified nucleotides were incorporated via their corresponding phosphoramidite reagent by a manual coupling protocol. The preparation of the phosphoramidite reagents for incorporation of N2-(3-aminopropyl)-2′-deoxyguanosine is reported. The high-purity trimethylene DNA interstrand cross-link product is obtained through a nucleophilic aromatic substitution reaction between the N2-(3-aminopropyl)-2′-deoxyguanosine and 2-fluoro-O6-(trimethylsilylethyl)inosine containing oligodeoxynucleotides. PMID:25431636

A method for detecting genetic toxicity using the RNA synthesis response to DNA damage.

PubMed

Morita, Yoko; Iwai, Shigenori; Kuraoka, Isao

2011-10-01

To date, biological risk assessment studies of chemicals that induce DNA lesions have been primarily based on the action of DNA polymerases during replication. However, DNA lesions interfere not only with replication but also with transcription. Therefore, detecting the damaging effects of DNA lesions during transcription might be important for estimating the safety of chemical mutagens and carcinogens. However, methods to address these effects have not been developed. Here, we report a simple, non-isotopic method for determining the toxicity of chemical agents by visualizing transcription in a mammalian cell system. The method is based on the measurement of the incorporation of bromouridine (as the uridine analogue) into the nascent RNA during RNA synthesis inhibition (RSI) induced by the stalling of RNA polymerases at DNA lesions on the transcribed DNA strand, which triggers transcription-coupled nucleotide excision repair (TC-NER). When we tested chemical agents (camptothecin, etoposide, 4-nitroquinoline-1-oxide, mitomycin C, methyl methanesulfonate, and cisplatin) in HeLa cells by the method, RSI indicative of genomic toxicity was observed in the nucleoli of the tested cells. This procedure provides the following advantages: 1) it uses common, affordable mammalian cells (HeLa cells, WI38VA13 cells, human dermal fibroblasts, or Chinese hamster ovary cells) rather than genetically modified microorganisms; 2) it can be completed within approximately 8 hr after the cells are prepared because RNA polymerase responses during TC-NER are faster than other DNA damage responses (replication, recombination, and apoptosis); and 3) it is safe because it uses non-radioactive bromouridine and antibodies to detect RNA synthesis on undamaged transcribed DNA strands.

Then and now: use of 16S rDNA gene sequencing for bacterial identification and discovery of novel bacteria in clinical microbiology laboratories.

PubMed

Woo, P C Y; Lau, S K P; Teng, J L L; Tse, H; Yuen, K-Y

2008-10-01

In the last decade, as a result of the widespread use of PCR and DNA sequencing, 16S rDNA sequencing has played a pivotal role in the accurate identification of bacterial isolates and the discovery of novel bacteria in clinical microbiology laboratories. For bacterial identification, 16S rDNA sequencing is particularly important in the case of bacteria with unusual phenotypic profiles, rare bacteria, slow-growing bacteria, uncultivable bacteria and culture-negative infections. Not only has it provided insights into aetiologies of infectious disease, but it also helps clinicians in choosing antibiotics and in determining the duration of treatment and infection control procedures. With the use of 16S rDNA sequencing, 215 novel bacterial species, 29 of which belong to novel genera, have been discovered from human specimens in the past 7 years of the 21st century (2001-2007). One hundred of the 215 novel species, 15 belonging to novel genera, have been found in four or more subjects. The largest number of novel species discovered were of the genera Mycobacterium (n = 12) and Nocardia (n = 6). The oral cavity/dental-related specimens (n = 19) and the gastrointestinal tract (n = 26) were the most important sites for discovery and/or reservoirs of novel species. Among the 100 novel species, Streptococcus sinensis, Laribacter hongkongensis, Clostridium hathewayi and Borrelia spielmanii have been most thoroughly characterized, with the reservoirs and routes of transmission documented, and S. sinensis, L. hongkongensis and C. hathewayi have been found globally. One of the greatest hurdles in putting 16S rDNA sequencing into routine use in clinical microbiology laboratories is automation of the technology. The only step that can be automated at the moment is input of the 16S rDNA sequence of the bacterial isolate for identification into one of the software packages that will generate the result of the identity of the isolate on the basis of its sequence database. However

Design and characterization of a nanopore-coupled polymerase for single-molecule DNA sequencing by synthesis on an electrode array

PubMed Central

Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.

2016-01-01

Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524

[Investigation of bacterial diversity in the biological desulfurization reactor for treating high salinity wastewater by the 16S rDNA cloning method].

PubMed

Liu, Wei-Guo; Liang, Cun-Zhen; Yang, Jin-Sheng; Wang, Gui-Ping; Liu, Miao-Miao

2013-02-01

The bacterial diversity in the biological desulfurization reactor operated continuously for 1 year was studied by the 16S rDNA cloning and sequencing method. Forty clones were randomly selected and their partial 16S rDNA genes (ca. 1,400 bp) were sequenced and blasted. The results indicated that there were dominant bacterias in the biological desulfurization reactor, where 33 clones belonged to 3 different published phyla, while 1 clone belonged to unknown phylum. The dominant bacterial community in the system was Proteobacteria, which accounted for 85.3%. The bacterial community succession was as follows: the gamma-Proteobacteria(55.9%), beta-Proteobacteria(17.6%), Actinobacteridae (8.8%), delta-Proteobacteria (5.9%) , alpha-Proteobacteria(5.9%), and Sphingobacteria (2.9%). Halothiobacillus sp. ST15 and Thiobacillus sp. UAM-I were the major desulfurization strains.

Amplification of unscheduled DNA synthesis signal enables fluorescence-based single cell quantification of transcription-coupled nucleotide excision repair

PubMed Central

Wienholz, Franziska; Vermeulen, Wim

2017-01-01

Abstract Nucleotide excision repair (NER) comprises two damage recognition pathways: global genome NER (GG-NER) and transcription-coupled NER (TC-NER), which remove a wide variety of helix-distorting lesions including UV-induced damage. During NER, a short stretch of single-stranded DNA containing damage is excised and the resulting gap is filled by DNA synthesis in a process called unscheduled DNA synthesis (UDS). UDS is measured by quantifying the incorporation of nucleotide analogues into repair patches to provide a measure of NER activity. However, this assay is unable to quantitatively determine TC-NER activity due to the low contribution of TC-NER to the overall NER activity. Therefore, we developed a user-friendly, fluorescence-based single-cell assay to measure TC-NER activity. We combined the UDS assay with tyramide-based signal amplification to greatly increase the UDS signal, thereby allowing UDS to be quantified at low UV doses, as well as DNA-repair synthesis of other excision-based repair mechanisms such as base excision repair and mismatch repair. Importantly, we demonstrated that the amplified UDS is sufficiently sensitive to quantify TC-NER-derived repair synthesis in GG-NER-deficient cells. This assay is important as a diagnostic tool for NER-related disorders and as a research tool for obtaining new insights into the mechanism and regulation of excision repair. PMID:28088761

Synthesis and DNA interaction of a mixed proflavine-phenanthroline Tröger base.

PubMed

Baldeyrou, Brigitte; Tardy, Christelle; Bailly, Christian; Colson, Pierre; Houssier, Claude; Charmantray, Franck; Demeunynck, Martine

2002-04-01

We report the synthesis of an asymmetric Tröger base containing the two well characterised DNA binding chromophores, proflavine and phenanthroline. The mode of interaction of the hybrid molecule was investigated by circular and linear dichroism experiments and a biochemical assay using DNA topoisomerase I. The data are compatible with a model in which the proflavine moiety intercalates between DNA base pairs and the phenanthroline ring occupies the DNA groove. DNase I cleavage experiments were carried out to investigate the sequence preference of the hybrid ligand and a well resolved footprint was detected at a site encompassing two adjacent 5'-GTC.5-GAC triplets. The sequence preference of the asymmetric molecule is compared to that of the symmetric analogues.

Parkin regulates translesion DNA synthesis in response to UV radiation.

PubMed

Zhu, Xuefei; Ma, Xiaolu; Tu, Yingfeng; Huang, Min; Liu, Hongmei; Wang, Fengli; Gong, Juanjuan; Wang, Jiuqiang; Li, Xiaoling; Chen, Qian; Shen, Hongyan; Zhu, Shu; Wang, Yun; Liu, Yang; Guo, Caixia; Tang, Tie-Shan

2017-05-30

Deficiency of Parkin is a major cause of early-onset Parkinson's disease (PD). Notably, PD patients also exhibit a significantly higher risk in melanoma and other skin tumors, while the mechanism remains largely unknown. In this study, we show that depletion of Parkin causes compromised cell viability and genome stability after ultraviolet (UV) radiation. We demonstrate that Parkin promotes efficient Rad18-dependent proliferating cell nuclear antigen (PCNA) monoubiquitination by facilitating the formation of Replication protein A (RPA)-coated ssDNA upon UV radiation. Furthermore, Parkin is found to physically interact with NBS1 (Nijmegen breakage syndrome 1), and to be required for optimal recruitment of NBS1 and DNA polymerase eta (Polη) to UV-induced damage sites. Consequently, depletion of Parkin leads to increased UV-induced mutagenesis. These findings unveil an important role of Parkin in protecting genome stability through positively regulating translesion DNA synthesis (TLS) upon UV damage, providing a novel mechanistic link between Parkin deficiency and predisposition to skin cancers in PD patients.

Ribonucleic Acid Synthesis by Cucumber Chromatin

PubMed Central

Johnson, Kenneth D.; Purves, William K.

1970-01-01

When intact etiolated 2-day cucumber (Cucumis sativus) embryos were treated with indoleacetic acid (IAA), gibberellin A7 (GA7), or kinetin, chromatin derived from the embryonic axes exhibited an increased capacity to support RNA synthesis in either the presence or the absence of bacterial RNA polymerase. An IAA effect on cucumber RNA polymerase activity was evident after 4 hours of hormone treatment; the IAA effect on DNA template activity (bacterial RNA polymerase added) occurred after longer treatments (12 hours). GA7 also promoted template activity, but again only after a prior stimulation of endogenous chromatin activity. After 12 hours of kinetin treatment, both endogenous chromatin and DNA template activities were substantially above control values, but longer kinetin treatments caused these activities to decline in magnitude. When chromatin was prepared from hypocotyl segments that were floated on a GA7 solution, a GA-induced increase in endogenous chromatin activity occurred, but only if cotyledon tissue was left attached to the segments during the period of hormone treatment. Age of the seedling tissue had a profound influence on the chromatin characteristics. With progression of development from the 2-day to the 4-day stage, the endogenous chromatin activity declined while the DNA template activity increased. PMID:16657509

Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence

PubMed Central

2011-01-01

Background Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. Results An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). Conclusions The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at

Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence.

PubMed

Sobolewski, Ireneusz; Polska, Katarzyna; Zylicz-Stachula, Agnieszka; Jeżewska-Frąckowiak, Joanna; Rak, Janusz; Skowron, Piotr

2011-08-24

Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at specific position is an

Bacterial DNA-induced NK cell IFN-gamma production is dependent on macrophage secretion of IL-12.

PubMed

Chace, J H; Hooker, N A; Mildenstein, K L; Krieg, A M; Cowdery, J S

1997-08-01

Bacterial DNA (bDNA) activates B cells and macrophages and can augment inflammatory responses by inducing release of proinflammatory cytokines. We found that bDNA stimulation of mouse spleen cells induced NK cell IFN-gamma production that was dependent upon the presence of unmethylated CpG motifs, and oligonucleotides with internal CpG motifs could also induce splenocytes to secrete IFN-gamma. The bDNA-induced IFN-gamma response was strictly macrophages dependent. While splenocytes from SCID mice secreted IFN-gamma in response to bDNA, depletion of macrophages eliminated this response. Additionally, purified NK cells did not respond to bDNA; however, addition of macrophages restored the NK cell IFN-gamma response. Coculture of NK cells with preactivated macrophages further increased bDNA-induced NK cell IFN-gamma production. Anti-IL-12 or IL-10 inhibited bDNA-induced IFN-gamma response. Treatment of purified macrophages with bDNA resulted in IL-12 secretion accompanied by an increase in IL-12 p40 mRNA level. Although isolated NK cells did not make IFN-gamma in response to bDNA, NK cells costimulated with IL-12 gained the ability to respond to bDNA. These experiments show that bDNA induces macrophage IL-12 production which, in turn, stimulates NK cell IFN-gamma production. Macrophage-derived IL-12 renders NK cells responsive to bDNA permitting an even greater IFN-gamma response to bDNA.

Genetic networks controlled by the bacterial replication initiator and transcription factor DnaA in Bacillus subtilis.

PubMed

Washington, Tracy A; Smith, Janet L; Grossman, Alan D

2017-10-01

DnaA is the widely conserved bacterial AAA+ ATPase that functions as both the replication initiator and a transcription factor. In many organisms, DnaA controls expression of its own gene and likely several others during growth and in response to replication stress. To evaluate the effects of DnaA on gene expression, separate from its role in replication initiation, we analyzed changes in mRNA levels in Bacillus subtilis cells with and without dnaA, using engineered strains in which dnaA is not essential. We found that dnaA was required for many of the changes in gene expression in response to replication stress. We also found that dnaA indirectly affected expression of several regulons during growth, including those controlled by the transcription factors Spo0A, AbrB, PhoP, SinR, RemA, Rok and YvrH. These effects were largely mediated by the effects of DnaA on expression of sda. DnaA activates transcription of sda, and Sda inhibits histidine protein kinases required for activation of the transcription factor Spo0A. We also found that loss of dnaA caused a decrease in the development of genetic competence. Together, our results indicate that DnaA plays an important role in modulating cell physiology, separate from its role in replication initiation. © 2017 John Wiley & Sons Ltd.

Incorporation of DNA and Protein Precursors into Macromolecules by Bacteria at −15oC

PubMed Central

Christner, Brent C.

2002-01-01

DNA and protein precursors were incorporated into trichloroacetic acid-precipitated material by bacterial cell suspensions during incubation for 50 to 100 days at −15oC. Incorporation did not occur at −70oC and was inhibited by antibiotics. The results demonstrate that bacteria can perform macromolecular synthesis under conditions that mimic entrapment in glacial ice. PMID:12450874

Design, Synthesis, and Evaluation of Novel Tyrosine-Based DNA Gyrase B Inhibitors.

PubMed

Cotman, Andrej E; Trampuž, Marko; Brvar, Matjaž; Kikelj, Danijel; Ilaš, Janez; Peterlin-Mašič, Lucija; Montalvão, Sofia; Tammela, Päivi; Frlan, Rok

2017-08-01

The discovery and synthesis of new tyrosine-based inhibitors of DNA gyrase B (GyrB), which target its ATPase subunit, is reported. Twenty-four compounds were synthesized and evaluated for activity against DNA gyrase and DNA topoisomerase IV. The antibacterial properties of selected GyrB inhibitors were demonstrated by their activity against Staphylococcus aureus and Enterococcus faecalis in the low micromolar range. The most promising compounds, 8a and 13e, inhibited Escherichia coli and S. aureus GyrB with IC 50 values of 40 and 30 µM. The same compound also inhibited the growth of S. aureus and E. faecalis with minimal inhibitory concentrations (MIC 90 ) of 14 and 28 µg/mL, respectively. © 2017 Deutsche Pharmazeutische Gesellschaft.

The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure.

PubMed

Valle-García, David; Griffiths, Lyra M; Dyer, Michael A; Bernstein, Emily; Recillas-Targa, Félix

2014-01-01

The SWI/SNF-like chromatin-remodeling protein ATRX has emerged as a key factor in the regulation of α-globin gene expression, incorporation of histone variants into the chromatin template and, more recently, as a frequently mutated gene across a wide spectrum of cancers. Therefore, the availability of a functional ATRX cDNA for expression studies is a valuable tool for the scientific community. We have identified two independent transposon insertions of a bacterial IS10 element into exon 8 of ATRX isoform 2 coding sequence in two different plasmids derived from a single source. We demonstrate that these insertion events are common and there is an insertion hotspot within the ATRX cDNA. Such IS10 insertions produce a truncated form of ATRX, which significantly compromises its nuclear localization. In turn, we describe ways to prevent IS10 insertion during propagation and cloning of ATRX-containing vectors, including optimal growth conditions, bacterial strains, and suggested sequencing strategies. Finally, we have generated an insertion-free plasmid that is available to the community for expression studies of ATRX.

Analysis of Duck Hepatitis B Virus Reverse Transcription Indicates a Common Mechanism for the Two Template Switches during Plus-Strand DNA Synthesis

PubMed Central

Havert, Michael B.; Ji, Lin; Loeb, Daniel D.

2002-01-01

The synthesis of the hepadnavirus relaxed circular DNA genome requires two template switches, primer translocation and circularization, during plus-strand DNA synthesis. Repeated sequences serve as donor and acceptor templates for these template switches, with direct repeat 1 (DR1) and DR2 for primer translocation and 5′r and 3′r for circularization. These donor and acceptor sequences are at, or near, the ends of the minus-strand DNA. Analysis of plus-strand DNA synthesis of duck hepatitis B virus (DHBV) has indicated that there are at least three other cis-acting sequences that make contributions during the synthesis of relaxed circular DNA. These sequences, 5E, M, and 3E, are located near the 5′ end, the middle, and the 3′ end of minus-strand DNA, respectively. The mechanism by which these sequences contribute to the synthesis of plus-strand DNA was unclear. Our aim was to better understand the mechanism by which 5E and M act. We localized the DHBV 5E element to a short sequence of approximately 30 nucleotides that is 100 nucleotides 3′ of DR2 on minus-strand DNA. We found that the new 5E mutants were partially defective for primer translocation/utilization at DR2. They were also invariably defective for circularization. In addition, examination of several new DHBV M variants indicated that they too were defective for primer translocation/utilization and circularization. Thus, this analysis indicated that 5E and M play roles in both primer translocation/utilization and circularization. In conjunction with earlier findings that 3E functions in both template switches, our findings indicate that the processes of primer translocation and circularization share a common underlying mechanism. PMID:11861843

Efficiency, error and yield in light-directed maskless synthesis of DNA microarrays

PubMed Central

2011-01-01

Background Light-directed in situ synthesis of DNA microarrays using computer-controlled projection from a digital micromirror device--maskless array synthesis (MAS)--has proved to be successful at both commercial and laboratory scales. The chemical synthetic cycle in MAS is quite similar to that of conventional solid-phase synthesis of oligonucleotides, but the complexity of microarrays and unique synthesis kinetics on the glass substrate require a careful tuning of parameters and unique modifications to the synthesis cycle to obtain optimal deprotection and phosphoramidite coupling. In addition, unintended deprotection due to scattering and diffraction introduce insertion errors that contribute significantly to the overall error rate. Results Stepwise phosphoramidite coupling yields have been greatly improved and are now comparable to those obtained in solid phase synthesis of oligonucleotides. Extended chemical exposure in the synthesis of complex, long oligonucleotide arrays result in lower--but still high--final average yields which approach 99%. The new synthesis chemistry includes elimination of the standard oxidation until the final step, and improved coupling and light deprotection. Coupling Insertions due to stray light are the limiting factor in sequence quality for oligonucleotide synthesis for gene assembly. Diffraction and local flare are by far the largest contributors to loss of optical contrast. Conclusions Maskless array synthesis is an efficient and versatile method for synthesizing high density arrays of long oligonucleotides for hybridization- and other molecular binding-based experiments. For applications requiring high sequence purity, such as gene assembly, diffraction and flare remain significant obstacles, but can be significantly reduced with straightforward experimental strategies. PMID:22152062

Synthesis of Mitochondrial DNA Precursors during Myogenesis, an Analysis in Purified C2C12 Myotubes*

PubMed Central

Frangini, Miriam; Franzolin, Elisa; Chemello, Francesco; Laveder, Paolo; Romualdi, Chiara; Bianchi, Vera; Rampazzo, Chiara

2013-01-01

During myogenesis, myoblasts fuse into multinucleated myotubes that acquire the contractile fibrils and accessory structures typical of striated skeletal muscle fibers. To support the high energy requirements of muscle contraction, myogenesis entails an increase in mitochondrial (mt) mass with stimulation of mtDNA synthesis and consumption of DNA precursors (dNTPs). Myotubes are quiescent cells and as such down-regulate dNTP production despite a high demand for dNTPs. Although myogenesis has been studied extensively, changes in dNTP metabolism have not been examined specifically. In differentiating cultures of C2C12 myoblasts and purified myotubes, we analyzed expression and activities of enzymes of dNTP biosynthesis, dNTP pools, and the expansion of mtDNA. Myotubes exibited pronounced post-mitotic modifications of dNTP synthesis with a particularly marked down-regulation of de novo thymidylate synthesis. Expression profiling revealed the same pattern of enzyme down-regulation in adult murine muscles. The mtDNA increased steadily after myoblast fusion, turning over rapidly, as revealed after treatment with ethidium bromide. We individually down-regulated p53R2 ribonucleotide reductase, thymidine kinase 2, and deoxyguanosine kinase by siRNA transfection to examine how a further reduction of these synthetic enzymes impacted myotube development. Silencing of p53R2 had little effect, but silencing of either mt kinase caused 50% mtDNA depletion and an unexpected decrease of all four dNTP pools independently of the kinase specificity. We suggest that during development of myotubes the shortage of even a single dNTP may affect all four pools through dysregulation of ribonucleotide reduction and/or dissipation of the non-limiting dNTPs during unproductive elongation of new DNA chains. PMID:23297407

Acute inactivation of the replicative helicase in human cells triggers MCM8–9-dependent DNA synthesis

PubMed Central

Natsume, Toyoaki; Nishimura, Kohei; Minocherhomji, Sheroy; Bhowmick, Rahul; Hickson, Ian D.; Kanemaki, Masato T.

2017-01-01

DNA replication fork progression can be disrupted at difficult to replicate loci in the human genome, which has the potential to challenge chromosome integrity. This replication fork disruption can lead to the dissociation of the replisome and the formation of DNA damage. To model the events stemming from replisome dissociation during DNA replication perturbation, we used a degron-based system for inducible proteolysis of a subunit of the replicative helicase. We show that MCM2-depleted cells activate a DNA damage response pathway and generate replication-associated DNA double-strand breaks (DSBs). Remarkably, these cells maintain some DNA synthesis in the absence of MCM2, and this requires the MCM8–9 complex, a paralog of the MCM2–7 replicative helicase. We show that MCM8–9 functions in a homologous recombination-based pathway downstream from RAD51, which is promoted by DSB induction. This RAD51/MCM8–9 axis is distinct from the recently described RAD52-dependent DNA synthesis pathway that operates in early mitosis at common fragile sites. We propose that stalled replication forks can be restarted in S phase via homologous recombination using MCM8–9 as an alternative replicative helicase. PMID:28487407

Bacterial rep- mutations that block development of small DNA bacteriophages late in infection.

PubMed Central

Tessman, E S; Peterson, P K

1976-01-01

Several related mutants of Escherichia coli C have been isolated that block the growth of the small icosahedral DNA phages phiX174 and S13 late in infection. Phage G6 is also blocked, at a stage not yet known. Growth of the filamentous phage M13, though not blocked, is affected in these strains. These host mutations co-transduce with ilv at high frequency, as do rep- mutations. However, the new mutants, designated groL-, differ from previously studied rep- mutants in that they permit synthesis of progeny replicative-form DNA. The groL- mutants are blocked in synthesis of stable single-stranded DNA of phiX174 and related phages. They are gro+ for P2. Evidence that groL- mutations and rep- mutations are in the same gene is presented. Spontaneous mutants (ogr) of phiX174, S13, and the G phages can grow on groL- strains. The ogr mutations are located in the phage's major capsid gene, F, as determined by complementation tests. There are numerous sites for mutation to ogr. Some mutations in genes A and F interfere with the ogr property when combined with an ogr mutation on the same genome. The ogr mutations are cis acting in a groL- cell; i.e., an ogr mutant gives very poor rescue of a non-ogr mutant. The wild-type form of each G phage appears to be naturally in the ogr mutant state for one or more groL- strains. It is suggested that a complex between F and rep proteins is involved in phage maturation. The A protein appears to interact with this complex. PMID:789914

[Intensity of DNA synthesis in animal organs after a flight on the Kosmos-782 biosatellite].

PubMed

Guseĭnov, F T; Egorov, I A; Komolova, G S; Tigranian, R A

1979-01-01

With respect to H3-thymidine incorporation the rate of DNA synthesis in the liver, spleen and thymus of rats was determined in flight and synchronous rats. Six hours post-flight the rate of H3-thymidine incorporation into the liver of flight rats did not differ from the normal (vivarium controls) and was 50% higher than in the synchronous rats. In the spleen and thymus of flight animals this parameter was 60 and 33% below the norm. Similar but less pronounced changes in the spleen were found in the synchronous rats. Twenty-five days postflight the rate of DNA synthesis in lymph organs recovered completely and tended to increase, whereas in the liver it remained significantly below the norm.

Therapeutic touch affects DNA synthesis and mineralization of human osteoblasts in culture.

PubMed

Jhaveri, Ankur; Walsh, Stephen J; Wang, Yatzen; McCarthy, MaryBeth; Gronowicz, Gloria

2008-11-01

Complementary and alternative medicine (CAM) techniques are commonly used in hospitals and private medical facilities; however, the effectiveness of many of these practices has not been thoroughly studied in a scientific manner. Developed by Dr. Dolores Krieger and Dora Kunz, Therapeutic Touch is one of these CAM practices and is a highly disciplined five-step process by which a practitioner can generate energy through their hands to promote healing. There are numerous clinical studies on the effects of TT but few in vitro studies. Our purpose was to determine if Therapeutic Touch had any effect on osteoblast proliferation, differentiation, and mineralization in vitro. TT was performed twice a week for 10 min each on human osteoblasts (HOBs) and on an osteosarcoma-derived cell line, SaOs-2. No significant differences were found in DNA synthesis, assayed by [(3)H]-thymidine incorporation at 1 or 2 weeks for SaOs-2 or 1 week for HOBs. However, after four TT treatments in 2 weeks, TT significantly (p = 0.03) increased HOB DNA synthesis compared to controls. Immunocytochemistry for Proliferating Cell Nuclear Antigen (PCNA) confirmed these data. At 2 weeks in differentiation medium, TT significantly increased mineralization in HOBs (p = 0.016) and decreased mineralization in SaOs-2 (p = 0.0007), compared to controls. Additionally, Northern blot analysis indicated a TT-induced increase in mRNA expression for Type I collagen, bone sialoprotein, and alkaline phosphatase in HOBs and a decrease of these bone markers in SaOs-2 cells. In conclusion, Therapeutic Touch appears to increase human osteoblast DNA synthesis, differentiation and mineralization, and decrease differentiation and mineralization in a human osteosarcoma-derived cell line. (c) 2008 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

Superstatistical model of bacterial DNA architecture

NASA Astrophysics Data System (ADS)

Bogachev, Mikhail I.; Markelov, Oleg A.; Kayumov, Airat R.; Bunde, Armin

2017-02-01

Understanding the physical principles that govern the complex DNA structural organization as well as its mechanical and thermodynamical properties is essential for the advancement in both life sciences and genetic engineering. Recently we have discovered that the complex DNA organization is explicitly reflected in the arrangement of nucleotides depicted by the universal power law tailed internucleotide interval distribution that is valid for complete genomes of various prokaryotic and eukaryotic organisms. Here we suggest a superstatistical model that represents a long DNA molecule by a series of consecutive ~150 bp DNA segments with the alternation of the local nucleotide composition between segments exhibiting long-range correlations. We show that the superstatistical model and the corresponding DNA generation algorithm explicitly reproduce the laws governing the empirical nucleotide arrangement properties of the DNA sequences for various global GC contents and optimal living temperatures. Finally, we discuss the relevance of our model in terms of the DNA mechanical properties. As an outlook, we focus on finding the DNA sequences that encode a given protein while simultaneously reproducing the nucleotide arrangement laws observed from empirical genomes, that may be of interest in the optimization of genetic engineering of long DNA molecules.

Mechanisms by which herpes simplex virus DNA polymerase limits translesion synthesis through abasic sites.

PubMed

Zhu, Yali; Song, Liping; Stroud, Jason; Parris, Deborah S

2008-01-01

Results suggest a high probability that abasic (AP) sites occur at least once per herpes simplex virus type 1 (HSV-1) genome. The parameters that control the ability of HSV-1 DNA polymerase (pol) to engage in AP translesion synthesis (TLS) were examined because AP lesions could influence the completion and fidelity of viral DNA synthesis. Pre-steady-state kinetic experiments demonstrated that wildtype (WT) and exonuclease-deficient (exo-) pol could incorporate opposite an AP lesion, but full TLS required absence of exo function. Virtually all of the WT pol was bound at the exo site to AP-containing primer-templates (P/Ts) at equilibrium, and the pre-steady-state rate of excision by WT pol was higher on AP-containing than on matched DNA. However, several factors influencing polymerization work synergistically with exo activity to prevent HSV-1 pol from engaging in TLS. Although the pre-steady-state catalytic rate constant for insertion of dATP opposite a T or AP site was similar, ground-state-binding affinity of dATP for insertion opposite an AP site was reduced 3-9-fold. Single-turnover running-start experiments demonstrated a reduced proportion of P/Ts extended to the AP site compared to the preceding site during processive synthesis by WT or exo- pol. Only the exo- pol engaged in TLS, though inefficiently and without burst kinetics, suggesting a much slower rate-limiting step for extension beyond the AP site.

Heterologous Synthesis and Recovery of Advanced Biofuels from Bacterial Cell Factories.

PubMed

Malik, Sana; Afzal, Ifrah; Mehmood, Muhammad Aamer; Al Doghaither, Huda; Rahimuddin, Sawsan Abdulaziz; Gull, Munazza; Nahid, Nazia

2018-01-01

Microbial engineering to produce advanced biofuels is currently the most encouraging approach in renewable energy. Heterologous synthesis of biofuels and other useful industrial chemicals using bacterial cell factories has radically diverted the attentions from the native synthesis of these compounds. However, recovery of biofuels from the media and cellular toxicity are the main hindrances to successful commercialization of advanced biofuels. Therefore, membrane transporter engineering is gaining increasing attentions from all over the world. The main objective of this review is to explore the ways to increase the microbial production of biofuels by counteracting the cellular toxicity and facilitating their easier recovery from media. Microbial synthesis of industrially viable compounds such as biofuels has been increased due to genomic revolution. Moreover, advancements in protein engineering, gene regulation, pathway portability, metabolic engineering and synthetic biology led the focus towards the development of robust and cost-effective systems for biofuel production. The most convenient way to combat cellular toxicity and to secrete biofuels is the use of membrane transport system. The use of membrane transporters is currently a serious oversight as do not involve chemical changes and contribute greatly to efflux biofuels in extracellular milieu. However, overexpression of transport systems can also be detrimental to cell, so, in future, structure-based engineering of transporters can be employed to evaluate optimum expression range, to increase biofuel specificity and transport rate through structural studies of biofuel molecules. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Cyclic AMP Regulates Bacterial Persistence through Repression of the Oxidative Stress Response and SOS-Dependent DNA Repair in Uropathogenic Escherichia coli.

PubMed

Molina-Quiroz, Roberto C; Silva-Valenzuela, Cecilia; Brewster, Jennifer; Castro-Nallar, Eduardo; Levy, Stuart B; Camilli, Andrew

2018-01-09

Bacterial persistence is a transient, nonheritable physiological state that provides tolerance to bactericidal antibiotics. The stringent response, toxin-antitoxin modules, and stochastic processes, among other mechanisms, play roles in this phenomenon. How persistence is regulated is relatively ill defined. Here we show that cyclic AMP, a global regulator of carbon catabolism and other core processes, is a negative regulator of bacterial persistence in uropathogenic Escherichia coli , as measured by survival after exposure to a β-lactam antibiotic. This phenotype is regulated by a set of genes leading to an oxidative stress response and SOS-dependent DNA repair. Thus, persister cells tolerant to cell wall-acting antibiotics must cope with oxidative stress and DNA damage and these processes are regulated by cyclic AMP in uropathogenic E. coli IMPORTANCE Bacterial persister cells are important in relapsing infections in patients treated with antibiotics and also in the emergence of antibiotic resistance. Our results show that in uropathogenic E. coli , the second messenger cyclic AMP negatively regulates persister cell formation, since in its absence much more persister cells form that are tolerant to β-lactams antibiotics. We reveal the mechanism to be decreased levels of reactive oxygen species, specifically hydroxyl radicals, and SOS-dependent DNA repair. Our findings suggest that the oxidative stress response and DNA repair are relevant pathways to target in the design of persister-specific antibiotic compounds. Copyright © 2018 Molina-Quiroz et al.

Roles of exonucleases and translesion synthesis DNA polymerases during mitotic gap repair in yeast

PubMed Central

Guo, Xiaoge; Jinks-Robertson, Sue

2013-01-01

Transformation-based gap-repair assays have long been used to model the repair of mitotic double-strand breaks (DSBs) by homologous recombination in yeast. In the current study, we examine genetic requirements of two key processes involved in DSB repair: (1) the processive 5′-end resection that is required to efficiently engage a repair template and (2) the filling of resected ends by DNA polymerases. The specific gap-repair assay used allows repair events resolved as crossover versus noncrossover products to be distinguished, as well as the extent of heteroduplex DNA formed during recombination to be measured. To examine end resection, the efficiency and outcome of gap repair were monitored in the absence of the Exo1 exonuclease and the Sgs1 helicase. We found that either Exo1 or Sgs1 presence is sufficient to inhibit gap-repair efficiency over 10-fold, consistent with resection-mediated destruction of the introduced plasmid. In terms of DNA polymerase requirements for gap repair, we focused specifically on potential roles of the Pol ζ and Pol η translesion synthesis DNA polymerases. We found that both Pol ζ and Pol η are necessary for efficient gap repair and that each functions independently of the other. These polymerases may be either in the initiation of DNA synthesis from the an invading end, or in a gap-filling process that is required to complete recombination. PMID:24210827

Recovery of infectious virus from full-length cowpox virus (CPXV) DNA cloned as a bacterial artificial chromosome (BAC)

PubMed Central

2011-01-01

Transmission from pet rats and cats to humans as well as severe infection in felids and other animal species have recently drawn increasing attention to cowpox virus (CPXV). We report the cloning of the entire genome of cowpox virus strain Brighton Red (BR) as a bacterial artificial chromosome (BAC) in Escherichia coli and the recovery of infectious virus from cloned DNA. Generation of a full-length CPXV DNA clone was achieved by first introducing a mini-F vector, which allows maintenance of large circular DNA in E. coli, into the thymidine kinase locus of CPXV by homologous recombination. Circular replication intermediates were then electroporated into E. coli DH10B cells. Upon successful establishment of the infectious BR clone, we modified the full-length clone such that recombination-mediated excision of bacterial sequences can occur upon transfection in eukaryotic cells. This self-excision of the bacterial replicon is made possible by a sequence duplication within mini-F sequences and allows recovery of recombinant virus progeny without remaining marker or vector sequences. The in vitro growth properties of viruses derived from both BAC clones were determined and found to be virtually indistinguishable from those of parental, wild-type BR. Finally, the complete genomic sequence of the infectious clone was determined and the cloned viral genome was shown to be identical to that of the parental virus. In summary, the generated infectious clone will greatly facilitate studies on individual genes and pathogenesis of CPXV. Moreover, the vector potential of CPXV can now be more systematically explored using this newly generated tool. PMID:21314965

Zinc as a second messenger of mitogenic induction. Effects on diadenosine tetraphosphate (Ap4A) and DNA synthesis.

PubMed

Grummt, F; Weinmann-Dorsch, C; Schneider-Schaulies, J; Lux, A

1986-03-01

DNA synthesis and adenosine(5')tetraphosphate(5')adenosine (Ap4A) levels decrease in cells treated with EDTA. The inhibitory effect of EDTA can be reversed with micromolar amounts of ZnCl2. ZnCl2 in micromolar concentrations also inhibits Ap4A hydrolase and stimulates amino acid-dependent Ap4A synthesis, suggesting that Zn2+ is modulating intracellular Ap4A pools. Serum addition to G1-arrested cells enhances uptake of Zn, whereas serum depletion leads to a fivefold decrease of the rates of zinc uptake. These results are discussed by regarding Zn2+ as a putative 'second messenger' of mitogenic induction and Ap4A as a possible 'third messenger' and trigger of DNA synthesis.

Selective inhibition of influenza virus protein synthesis by inhibitors of DNA function. [UV radiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Minor, P.D.; Dimmock, N.J.

1977-05-15

Various known inhibitors of cellular DNA function were shown to inhibit cellular RNA synthesis and influenza (fowl plague) virus multiplication. The drugs were investigated for their effect upon the synthesis of influenza virus proteins. According to this effect they could be classified with previously studied compounds as follows: Group I (ethidium bromide, proflavine, and N-nitroquinoline-N-oxide) inhibited both viral and cellular protein synthesis; Group II (nogalomycin, daunomycin and ..cap alpha..-amanitin) inhibited viral but not cellular protein synthesis, and all viral proteins were inhibited coordinately; Group III (mithramycin, echinomycin, and actinomycin D) inhibited all viral but not cellular protein synthesis at highmore » concentrations, but at a lower critical concentration inhibited the synthesis of viral haemagglutinin, neuraminidase, and M protein preferentially; Group IV(uv irradiation and camptothecin) inhibited the synthesis of viral haemagglutinin, neuraminidase, and M protein, but not other viral proteins, even at high doses. The mode of action of these inhibitors is discussed in relation to the mechanism of the nuclear events upon which influenza virus multiplication is dependent.« less

Synthesis and studies of polypeptide materials: Self-assembled block copolypeptide amphiphiles, DNA-condensing block copolypeptides and membrane-interactive random copolypeptides

NASA Astrophysics Data System (ADS)

Wyrsta, Michael Dmytro

A new class of transition metal initiators for the controlled polymerization of alpha-aminoacid-N-carboxyanhydrides (alpha-NCAs), has been developed by Deming et al. This discovery has allowed for the synthesis of well-defined "protein-like" polymers. Using this chemistry we have made distinct block/random copolypeptides for biomedical applications. Drug delivery, gene delivery, and antimicrobial polymers were the focus of our research efforts. The motivation for the synthesis and study of synthetic polypeptide based materials comes from proteins. Natural proteins are able to adopt a staggeringly large amount of uniquely well-defined folded structures. These structures account for the diversity in properties of proteins. As catalysts (enzymes) natural proteins perform some of the most difficult chemistry with ease and precision at ambient pressures and temperatures. They also exhibit incredible structural properties that directly result from formation of complex hierarchical assemblies. Self-assembling block copolymers were synthesized with various compositions and architectures. In general, di- and tri-block amphiphiles were studied for their self-assembling properties. Both spherical and tubular vesicles were found to assemble from di- and tri-block amphiphiles, respectively. In addition to self-assembly, pH responsiveness was engineered into these amphiphiles by the incorporation of basic residues (lysine) into the hydrophobic block. Another form of self-assembly studied was the condensation of DNA using cationic block copolymers. It was found that cationic block copolymers could condense DNA into compact, ordered, water-soluble aggregates on the nanoscale. These aggregates sufficiently protected DNA from nucleases and yet were susceptible to proteases. These studies form the basis of a gene delivery platform. The ease with which NCAs are polymerized renders them completely amenable to parallel synthetic methods. We have employed this technique to discover new

Microinjection of the SH2 domain of the 85-kilodalton subunit of phosphatidylinositol 3-kinase inhibits insulin-induced DNA synthesis and c-fos expression.

PubMed Central

Jhun, B H; Rose, D W; Seely, B L; Rameh, L; Cantley, L; Saltiel, A R; Olefsky, J M

1994-01-01

We have investigated the functional role of the SH2 domain of the 85-kDa subunit (p85) of the phosphatidylinositol 3-kinase in the insulin signal transduction pathway. Microinjection of a bacterial fusion protein containing the N-terminal SH2 domain of p85 inhibited insulin- and other growth factor-induced DNA synthesis by 90% and c-fos protein expression by 80% in insulin-responsive rat fibroblasts. The specificity of the fusion protein was examined by in vitro precipitation experiments, which showed that the SH2 domain of p85 can independently associate with both insulin receptor substrate 1 and the insulin receptor itself in the absence of detectable binding to other phosphoproteins. The microinjection results were confirmed through the use of an affinity-purified antibody directed against p85, which gave the same phenotype. Additional studies were carried out in another cell line expressing mutant insulin receptors which lack the cytoplasmic tyrosine residues with which p85 interacts. Microinjection of the SH2 domain fusion protein also inhibited insulin signaling in these cells, suggesting that association of p85 with insulin receptor substrate 1 is a key element in insulin-mediated cell cycle progression. In addition, coinjection of purified p21ras protein with the p85 fusion protein or the antibody restored DNA synthesis, suggesting that ras function is either downstream or independent of p85 SH2 domain interaction. Images PMID:7935461

Terminations of DNA synthesis on 'proflavine and light'-treated phi X174 single-stranded DNA.

PubMed

Piette, J; Calberg-Bacq, C M; Lopez, M; van de Vorst, A

1984-04-05

Bacteriophage phi X174 single-stranded DNA molecules were primed with five different restriction fragments and irradiated with visible light in the presence of proflavine. This photodamaged DNA was used as template for the in vitro complementary chain synthesis by E. coli DNA polymerase I (Klenow fragment). Chain terminations were observed by polyacrylamide gel electrophoresis of the synthesized products and localized by comparison with standard sequencing performed simultaneously on the untreated template. 90% of the chain terminations occurred one nucleotide before a guanine residue in the template strand. More than 80% of the sequenced guanine residues were blocking lesions demonstrating the absence of 'hot-spots' for the photodamaging effect of proflavine. At a defined position, the chain termination frequency increased linearly with the irradiation time and was directly influenced by the proflavine concentration present. An important part of lesions resulted from the action of singlet oxygen produced by excited proflavine as shown by the effect that both NaN3 and 2H2O exerted on the reaction. The induced blocking lesions must be important in vivo since no complete replicative forms could be extracted from cell infected with bacteriophages inactivated by 'proflavine and light' treatment.

Neurotoxicity of cytarabine (Ara-C) in dorsal root ganglion neurons originates from impediment of mtDNA synthesis and compromise of mitochondrial function.

PubMed

Zhuo, Ming; Gorgun, Murat F; Englander, Ella W

2018-06-01

Peripheral Nervous System (PNS) neurotoxicity caused by cancer drugs hinders attainment of chemotherapy goals. Due to leakiness of the blood nerve barrier, circulating chemotherapeutic drugs reach PNS neurons and adversely affect their function. Chemotherapeutic drugs are designed to target dividing cancer cells and mechanisms underlying their toxicity in postmitotic neurons remain to be fully clarified. The objective of this work was to elucidate progression of events triggered by antimitotic drugs in postmitotic neurons. For proof of mechanism study, we chose cytarabine (ara-C), an antimetabolite used in treatment of hematological cancers. Ara-C is a cytosine analog that terminates DNA synthesis. To investigate how ara-C affects postmitotic neurons, which replicate mitochondrial but not genomic DNA, we adapted a model of Dorsal Root Ganglion (DRG) neurons. We showed that DNA polymerase γ, which is responsible for mtDNA synthesis, is inhibited by ara-C and that sublethal ara-C exposure of DRG neurons leads to reduction in mtDNA content, ROS generation, oxidative mtDNA damage formation, compromised mitochondrial respiration and diminution of NADPH and GSH stores, as well as, activation of the DNA damage response. Hence, it is plausible that in ara-C exposed DRG neurons, ROS amplified by the high mitochondrial content shifts from physiologic to pathologic levels signaling stress to the nucleus. Combined, the findings suggest that ara-C neurotoxicity in DRG neurons originates in mitochondria and that continuous mtDNA synthesis and reliance on oxidative phosphorylation for energy needs sensitize the highly metabolic neurons to injury by mtDNA synthesis terminating cancer drugs. Copyright © 2018 Elsevier Inc. All rights reserved.

Importance of the efficiency of double-stranded DNA formation in cDNA synthesis for the imprecision of microarray expression analysis.

PubMed

Thormar, Hans G; Gudmundsson, Bjarki; Eiriksdottir, Freyja; Kil, Siyoen; Gunnarsson, Gudmundur H; Magnusson, Magnus Karl; Hsu, Jason C; Jonsson, Jon J

2013-04-01

The causes of imprecision in microarray expression analysis are poorly understood, limiting the use of this technology in molecular diagnostics. Two-dimensional strandness-dependent electrophoresis (2D-SDE) separates nucleic acid molecules on the basis of length and strandness, i.e., double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), and RNA·DNA hybrids. We used 2D-SDE to measure the efficiency of cDNA synthesis and its importance for the imprecision of an in vitro transcription-based microarray expression analysis. The relative amount of double-stranded cDNA formed in replicate experiments that used the same RNA sample template was highly variable, ranging between 0% and 72% of the total DNA. Microarray experiments showed an inverse relationship between the difference between sample pairs in probe variance and the relative amount of dsDNA. Approximately 15% of probes showed between-sample variation (P < 0.05) when the dsDNA percentage was between 12% and 35%. In contrast, only 3% of probes showed between-sample variation when the dsDNA percentage was 69% and 72%. Replication experiments of the 35% dsDNA and 72% dsDNA samples were used to separate sample variation from probe replication variation. The estimated SD of the sample-to-sample variation and of the probe replicates was lower in 72% dsDNA samples than in 35% dsDNA samples. Variation in the relative amount of double-stranded cDNA synthesized can be an important component of the imprecision in T7 RNA polymerase-based microarray expression analysis. © 2013 American Association for Clinical Chemistry

Mechanisms of bacterial DNA replication restart

PubMed Central

Windgassen, Tricia A; Wessel, Sarah R; Bhattacharyya, Basudeb

2018-01-01

Abstract Multi-protein DNA replication complexes called replisomes perform the essential process of copying cellular genetic information prior to cell division. Under ideal conditions, replisomes dissociate only after the entire genome has been duplicated. However, DNA replication rarely occurs without interruptions that can dislodge replisomes from DNA. Such events produce incompletely replicated chromosomes that, if left unrepaired, prevent the segregation of full genomes to daughter cells. To mitigate this threat, cells have evolved ‘DNA replication restart’ pathways that have been best defined in bacteria. Replication restart requires recognition and remodeling of abandoned replication forks by DNA replication restart proteins followed by reloading of the replicative DNA helicase, which subsequently directs assembly of the remaining replisome subunits. This review summarizes our current understanding of the mechanisms underlying replication restart and the proteins that drive the process in Escherichia coli (PriA, PriB, PriC and DnaT). PMID:29202195

Novel Antimicrobial Peptides That Inhibit Gram Positive Bacterial Exotoxin Synthesis

PubMed Central

Merriman, Joseph A.; Nemeth, Kimberly A.; Schlievert, Patrick M.

2014-01-01

Gram-positive bacteria, such as Staphylococcus aureus, cause serious human illnesses through combinations of surface virulence factors and secretion of exotoxins. Our prior studies using the protein synthesis inhibitor clindamycin and signal transduction inhibitors glycerol monolaurate and α-globin and β-globin chains of hemoglobin indicate that their abilities to inhibit exotoxin production by S. aureus are separable from abilities to inhibit growth of the organism. Additionally, our previous studies suggest that inhibition of exotoxin production, in absence of ability to kill S. aureus and normal flora lactobacilli, will prevent colonization by pathogenic S. aureus, while not interfering with lactobacilli colonization. These disparate activities may be important in development of novel anti-infective agents that do not alter normal flora. We initiated studies to explore the exotoxin-synthesis-inhibition activity of hemoglobin peptides further to develop potential agents to prevent S. aureus infections. We tested synthesized α-globin chain peptides, synthetic variants of α-globin chain peptides, and two human defensins for ability to inhibit exotoxin production without significantly inhibiting S. aureus growth. All of these peptides were weakly or not inhibitory to bacterial growth. However, the peptides were inhibitory to exotoxin production with increasing activity dependent on increasing numbers of positively-charged amino acids. Additionally, the peptides could be immobilized on agarose beads or have amino acid sequences scrambled and still retain exotoxin-synthesis-inhibition. The peptides are not toxic to human vaginal epithelial cells and do not inhibit growth of normal flora L. crispatus. These peptides may interfere with plasma membrane signal transduction in S. aureus due to their positive charges. PMID:24748386

Looping and clustering model for the organization of protein-DNA complexes on the bacterial genome

NASA Astrophysics Data System (ADS)

Walter, Jean-Charles; Walliser, Nils-Ole; David, Gabriel; Dorignac, Jérôme; Geniet, Frédéric; Palmeri, John; Parmeggiani, Andrea; Wingreen, Ned S.; Broedersz, Chase P.

2018-03-01

The bacterial genome is organized by a variety of associated proteins inside a structure called the nucleoid. These proteins can form complexes on DNA that play a central role in various biological processes, including chromosome segregation. A prominent example is the large ParB-DNA complex, which forms an essential component of the segregation machinery in many bacteria. ChIP-Seq experiments show that ParB proteins localize around centromere-like parS sites on the DNA to which ParB binds specifically, and spreads from there over large sections of the chromosome. Recent theoretical and experimental studies suggest that DNA-bound ParB proteins can interact with each other to condense into a coherent 3D complex on the DNA. However, the structural organization of this protein-DNA complex remains unclear, and a predictive quantitative theory for the distribution of ParB proteins on DNA is lacking. Here, we propose the looping and clustering model, which employs a statistical physics approach to describe protein-DNA complexes. The looping and clustering model accounts for the extrusion of DNA loops from a cluster of interacting DNA-bound proteins that is organized around a single high-affinity binding site. Conceptually, the structure of the protein-DNA complex is determined by a competition between attractive protein interactions and loop closure entropy of this protein-DNA cluster on the one hand, and the positional entropy for placing loops within the cluster on the other. Indeed, we show that the protein interaction strength determines the ‘tightness’ of the loopy protein-DNA complex. Thus, our model provides a theoretical framework for quantitatively computing the binding profiles of ParB-like proteins around a cognate (parS) binding site.

Experimental iron-inactivated Pasteurella multocida A: 1 vaccine adjuvanted with bacterial DNA is safe and protects chickens from fowl cholera.

PubMed

Herath, Chitra; Kumar, Pankaj; Singh, Mithilesh; Kumar, Devender; Ramakrishnan, Saravanan; Goswami, Tapas Kumar; Singh, Ajit; Ram, G C

2010-03-08

Fowl cholera is a serious problem in large and small scale poultry production. The present study describes the development and testing of an inactivated whole-cell, low-cost, safe, and effective vaccine for fowl cholera based on a previous work (Vaccine 23:5590-5598). Pasteurella multocida A: 1 grown in the presence of low FeCl(3) concentrations, inactivated with higher concentrations of FeCl(3), and adjuvanted with bacterial DNA from P. multocida B: 2 containing immunostimulatory CpG motifs protect chickens with a lethal P. multocida A: 1 challenge. Chickens were immunized with two whole-cell inactivated vaccine doses at 4 weeks apart and challenged 4 weeks after booster immunization. Experimental vaccines were pure, easy injectable, and caused very little distress in chickens due to their aqueous consistency. Vaccines and bacterial DNA (bDNA) posed no safety problems when chickens were injected subcutaneously (s.c.) with a single, double, and overdose of these preparations. Immunized chickens produced systemic IgY antibodies (Ab) responses and vaccine adjuvanted with bDNA protected 100% chickens from lethal intrapertoneal (i.p.) P. multocida A: 1 challenge. This work suggests that use of bDNA as an adjuvant can improve the cost-effectiveness of inactivated veterinary vaccines for their use in developing countries. Our future studies will focus on safety and potency evaluation of experimental and current vaccines using bDNA as an adjuvant. Copyright 2010 Elsevier Ltd. All rights reserved.

DNA and RNA Synthesis in Animal Cells in Culture--Methods for Use in Schools

ERIC Educational Resources Information Center

Godsell, P. M.; Balls, M.

1973-01-01

Describes the experimental procedures used for detecting DNA and RNA synthesis in xenopus cells by autoradiography. The method described is suitable for senior high school laboratory classes or biology projects, if supervised by a teacher qualified to handle radioisotopes. (JR)

Parkin regulates translesion DNA synthesis in response to UV radiation

PubMed Central

Huang, Min; Liu, Hongmei; Wang, Fengli; Gong, Juanjuan; Wang, Jiuqiang; Li, Xiaoling; Chen, Qian; Shen, Hongyan; Zhu, Shu; Wang, Yun; Liu, Yang; Guo, Caixia; Tang, Tie-Shan

2017-01-01

Deficiency of Parkin is a major cause of early-onset Parkinson's disease (PD). Notably, PD patients also exhibit a significantly higher risk in melanoma and other skin tumors, while the mechanism remains largely unknown. In this study, we show that depletion of Parkin causes compromised cell viability and genome stability after ultraviolet (UV) radiation. We demonstrate that Parkin promotes efficient Rad18-dependent proliferating cell nuclear antigen (PCNA) monoubiquitination by facilitating the formation of Replication protein A (RPA)-coated ssDNA upon UV radiation. Furthermore, Parkin is found to physically interact with NBS1 (Nijmegen breakage syndrome 1), and to be required for optimal recruitment of NBS1 and DNA polymerase eta (Polη) to UV-induced damage sites. Consequently, depletion of Parkin leads to increased UV-induced mutagenesis. These findings unveil an important role of Parkin in protecting genome stability through positively regulating translesion DNA synthesis (TLS) upon UV damage, providing a novel mechanistic link between Parkin deficiency and predisposition to skin cancers in PD patients. PMID:28430587

The crystal structure of Neisseria gonorrhoeae PriB reveals mechanistic differences among bacterial DNA replication restart pathways

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dong, Jinlan; George, Nicholas P.; Duckett, Katrina L.

2010-05-25

Reactivation of repaired DNA replication forks is essential for complete duplication of bacterial genomes. However, not all bacteria encode homologs of the well-studied Escherichia coli DNA replication restart primosome proteins, suggesting that there might be distinct mechanistic differences among DNA replication restart pathways in diverse bacteria. Since reactivation of repaired DNA replication forks requires coordinated DNA and protein binding by DNA replication restart primosome proteins, we determined the crystal structure of Neisseria gonorrhoeae PriB at 2.7 {angstrom} resolution and investigated its ability to physically interact with DNA and PriA helicase. Comparison of the crystal structures of PriB from N. gonorrhoeaemore » and E. coli reveals a well-conserved homodimeric structure consisting of two oligosaccharide/oligonucleotide-binding (OB) folds. In spite of their overall structural similarity, there is significant species variation in the type and distribution of surface amino acid residues. This correlates with striking differences in the affinity with which each PriB homolog binds single-stranded DNA and PriA helicase. These results provide evidence that mechanisms of DNA replication restart are not identical across diverse species and that these pathways have likely become specialized to meet the needs of individual organisms.« less

The T4 Phage DNA Mimic Protein Arn Inhibits the DNA Binding Activity of the Bacterial Histone-like Protein H-NS*

PubMed Central

Ho, Chun-Han; Wang, Hao-Ching; Ko, Tzu-Ping; Chang, Yuan-Chih; Wang, Andrew H.-J.

2014-01-01

The T4 phage protein Arn (Anti restriction nuclease) was identified as an inhibitor of the restriction enzyme McrBC. However, until now its molecular mechanism remained unclear. In the present study we used structural approaches to investigate biological properties of Arn. A structural analysis of Arn revealed that its shape and negative charge distribution are similar to dsDNA, suggesting that this protein could act as a DNA mimic. In a subsequent proteomic analysis, we found that the bacterial histone-like protein H-NS interacts with Arn, implying a new function. An electrophoretic mobility shift assay showed that Arn prevents H-NS from binding to the Escherichia coli hns and T4 p8.1 promoters. In vitro gene expression and electron microscopy analyses also indicated that Arn counteracts the gene-silencing effect of H-NS on a reporter gene. Because McrBC and H-NS both participate in the host defense system, our findings suggest that T4 Arn might knock down these mechanisms using its DNA mimicking properties. PMID:25118281

Inflating bacterial cells by increased protein synthesis

PubMed Central

Basan, Markus; Zhu, Manlu; Dai, Xiongfeng; Warren, Mya; Sévin, Daniel; Wang, Yi-Ping; Hwa, Terence

2015-01-01

Understanding how the homeostasis of cellular size and composition is accomplished by different organisms is an outstanding challenge in biology. For exponentially growing Escherichia coli cells, it is long known that the size of cells exhibits a strong positive relation with their growth rates in different nutrient conditions. Here, we characterized cell sizes in a set of orthogonal growth limitations. We report that cell size and mass exhibit positive or negative dependences with growth rate depending on the growth limitation applied. In particular, synthesizing large amounts of “useless” proteins led to an inversion of the canonical, positive relation, with slow growing cells enlarged 7- to 8-fold compared to cells growing at similar rates under nutrient limitation. Strikingly, this increase in cell size was accompanied by a 3- to 4-fold increase in cellular DNA content at slow growth, reaching up to an amount equivalent to ∼8 chromosomes per cell. Despite drastic changes in cell mass and macromolecular composition, cellular dry mass density remained constant. Our findings reveal an important role of protein synthesis in cell division control. PMID:26519362

Bacterial cell-free expression technology to in vitro systems engineering and optimization.

PubMed

Caschera, Filippo

2017-06-01

Cell-free expression system is a technology for the synthesis of proteins in vitro . The system is a platform for several bioengineering projects, e.g. cell-free metabolic engineering, evolutionary design of experiments, and synthetic minimal cell construction. Bacterial cell-free protein synthesis system (CFPS) is a robust tool for synthetic biology. The bacteria lysate, the DNA, and the energy module, which are the three optimized sub-systems for in vitro protein synthesis, compose the integrated system. Currently, an optimized E. coli cell-free expression system can produce up to ∼2.3 mg/mL of a fluorescent reporter protein. Herein, I will describe the features of ATP-regeneration systems for in vitro protein synthesis, and I will present a machine-learning experiment for optimizing the protein yield of E. coli cell-free protein synthesis systems. Moreover, I will introduce experiments on the synthesis of a minimal cell using liposomes as dynamic containers, and E. coli cell-free expression system as biochemical platform for metabolism and gene expression. CFPS can be further integrated with other technologies for novel applications in environmental, medical and material science.

Plackett-Burman experimental design for bacterial cellulose-silica composites synthesis.

PubMed

Guzun, Anicuta Stoica; Stroescu, Marta; Jinga, Sorin Ion; Voicu, Georgeta; Grumezescu, Alexandru Mihai; Holban, Alina Maria

2014-09-01

Bacterial cellulose-silica hybrid composites were prepared starting from wet bacterial cellulose (BC) membranes using Stöber reaction. The structure and surface morphology of hybrid composites were examined by FTIR and SEM. The SEM pictures revealed that the silica particles are attached to BC fibrils and are well dispersed in the BC matrix. The influence of silica particles upon BC crystallinity was studied using XRD analysis. Thermogravimetric (TG) analysis showed that the composites are stable up to 300°C. A Plackett-Burman design was applied in order to investigate the influence of process parameters upon silica particle sizes and silica content of BC-silica composites. The statistical model predicted that it is possible for silica particles size to vary the synthesis parameters in order to obtain silica particles deposed on BC membranes in the range from 34.5 to 500 nm, the significant parameters being ammonia concentration, reaction time and temperature. The silica content also varies depending on process parameters, the statistical model predicting that the most influential parameters are water-tetraethoxysilane (TEOS) ratio and reaction temperature. The antimicrobial behavior on Staphylococcus aureus of BC-silica composites functionalized with usnic acid (UA) was also studied, in order to create improved surfaces with antiadherence and anti-biofilm properties. Copyright © 2014 Elsevier B.V. All rights reserved.

Interleukin-10 functions in vitro and in vivo to inhibit bacterial DNA-induced secretion of interleukin-12.

PubMed

Anitescu, M; Chace, J H; Tuetken, R; Yi, A K; Berg, D J; Krieg, A M; Cowdery, J S

1997-12-01

Bacterial DNA (bDNA) has a number of biologic properties, including the ability to induce interleukin-12 (IL-12) production by macrophages. We studied the role of the regulatory cytokine IL-10 as a potential inhibitor of bDNA-induced IL-12 production. IL-10 concentrations as low as 0.3 ng/ml profoundly inhibited bDNA-induced macrophage IL-12 production as measured by Elispot analysis of IL-12 p40-secreting cells. Additionally, we found that IL-10 inhibited bDNA-induced IL-12 secretion by the macrophage cell lines J774 and RAW 264. Preincubation of splenic adherent cells with IL-10 markedly reduced bDNA-induced transcription of IL-12 p40 mRNA. Interestingly, after 2 h of exposure, bDNA also induces transcription of IL-10 mRNA by splenic adherent cells. The importance of IL-10 in the in vivo regulation of bDNA-induced cytokine secretion was illustrated by the response of mice with disrupted IL-10 genes (IL-10 ko mice) to i.v. bDNA challenge. Compared to +/+ mice, IL-10 knockout (ko) mice exhibited increased numbers of IL-12 and interferon-gamma (IFN-gamma)-secreting cells following either single or repeated challenge with bDNA. These findings indicate that IL-10 plays a key role in regulating bDNA-induced production of inflammatory cytokines.

Repurposing Toremifene for Treatment of Oral Bacterial Infections.

PubMed

Gerits, Evelien; Defraine, Valerie; Vandamme, Katleen; De Cremer, Kaat; De Brucker, Katrijn; Thevissen, Karin; Cammue, Bruno P A; Beullens, Serge; Fauvart, Maarten; Verstraeten, Natalie; Michiels, Jan

2017-03-01

The spread of antibiotic resistance and the challenges associated with antiseptics such as chlorhexidine have necessitated a search for new antibacterial agents against oral bacterial pathogens. As a result of failing traditional approaches, drug repurposing has emerged as a novel paradigm to find new antibacterial agents. In this study, we examined the effects of the FDA-approved anticancer agent toremifene against the oral bacteria Porphyromonas gingivalis and Streptococcus mutans We found that the drug was able to inhibit the growth of both pathogens, as well as prevent biofilm formation, at concentrations ranging from 12.5 to 25 μM. Moreover, toremifene was shown to eradicate preformed biofilms at concentrations ranging from 25 to 50 μM. In addition, we found that toremifene prevents P. gingivalis and S. mutans biofilm formation on titanium surfaces. A time-kill study indicated that toremifene is bactericidal against S. mutans Macromolecular synthesis assays revealed that treatment with toremifene does not cause preferential inhibition of DNA, RNA, or protein synthesis pathways, indicating membrane-damaging activity. Biophysical studies using fluorescent probes and fluorescence microscopy further confirmed the membrane-damaging mode of action. Taken together, our results suggest that the anticancer agent toremifene is a suitable candidate for further investigation for the development of new treatment strategies for oral bacterial infections. Copyright © 2017 American Society for Microbiology.

Comparison of specific binding sites for Escherichia coli RNA polymerase with naturally occurring hairpin regions in single-stranded DNA of coliphage M13. [Aspergillus oryzae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Niyogi, S.K.; Mitra, S.

Escherichia coli RNA polymerase binds specifically to the single-stranded circular DNA of coliphage M13 in the presence of a saturating concentration of the bacterial DNA binding protein presumably as an essential step in the synthesis of the RNA primer required for synthesizing the complementary DNA strand in parental replicative-form DNA. The RNA polymerase-protected DNA regions were isolated after extensive digestion with pancreatic DNase, S1 endonuclease of Aspergillus oryzae, and exonuclease I of E. coli. The physicochemical properties of the RNA polymerase-protected segments (called PI and PII) were compared with those of the naturally occurring hairpin regions.

Synthesis, properties, and NMR studies of a C8-phenylguanine modified oligonucleotide that preferentially adopts the Z DNA conformation.

PubMed

Gannett, Peter M; Heavner, Sue; Daft, Jonathan R; Shaughnessy, Kevin H; Epperson, Jon D; Greenbaum, Nancy L

2003-10-01

Carcinogenic aryl hydrazines produce C8-arylated purine adducts. The effect of these adducts on DNA conformation and their role in hydrazine carcinogenesis are unknown. Here, we describe a new synthetic route to produce these adducts that is also compatible with the synthesis of the corresponding phosphoramidites needed for oligonucleotide synthesis. Two oligonucleotides were prepared, an unmodified oligonucleotide, d((5)(')CGCGCGCGCG(3)(')), and a C8-phenylguanine modified oligonucleotide, d((5)(')CGCGCGCGCG(3)(')) (G = 8-phenylguanine). These oligonucleotides were compared using thermal denaturation, circular dichroism, NMR, and molecular modeling. The phenyl modification destabilizes the B DNA form and stabilizes the Z DNA form such that the B:Z ratio is near one under physiological conditions. In light of recent studies that show a role for Z DNA in gene expression and cell transformation, Z DNA stabilization by C8-arylguanine formation from aryl hydrazines may be relevant to their role in carcinogenesis.

Stochastic Endogenous Replication Stress Causes ATR-Triggered Fluctuations in CDK2 Activity that Dynamically Adjust Global DNA Synthesis Rates.

PubMed

Daigh, Leighton H; Liu, Chad; Chung, Mingyu; Cimprich, Karlene A; Meyer, Tobias

2018-06-04

Faithful DNA replication is challenged by stalling of replication forks during S phase. Replication stress is further increased in cancer cells or in response to genotoxic insults. Using live single-cell image analysis, we found that CDK2 activity fluctuates throughout an unperturbed S phase. We show that CDK2 fluctuations result from transient ATR signals triggered by stochastic replication stress events. In turn, fluctuating endogenous CDK2 activity causes corresponding decreases and increases in DNA synthesis rates, linking changes in stochastic replication stress to fluctuating global DNA replication rates throughout S phase. Moreover, cells that re-enter the cell cycle after mitogen stimulation have increased CDK2 fluctuations and prolonged S phase resulting from increased replication stress-induced CDK2 suppression. Thus, our study reveals a dynamic control principle for DNA replication whereby CDK2 activity is suppressed and fluctuates throughout S phase to continually adjust global DNA synthesis rates in response to recurring stochastic replication stress events. Copyright © 2018. Published by Elsevier Inc.

Extraordinary Structured Noncoding RNAs Revealed by Bacterial Metagenome Analysis

PubMed Central

Weinberg, Zasha; Perreault, Jonathan; Meyer, Michelle M.; Breaker, Ronald R.

2012-01-01

Estimates of the total number of bacterial species1-3 suggest that existing DNA sequence databases carry only a tiny fraction of the total amount of DNA sequence space represented by this division of life. Indeed, environmental DNA samples have been shown to encode many previously unknown classes of proteins4 and RNAs5. Bioinformatics searches6-10 of genomic DNA from bacteria commonly identify novel noncoding RNAs (ncRNAs)10-12 such as riboswitches13,14. In rare instances, RNAs that exhibit more extensive sequence and structural conservation across a wide range of bacteria are encountered15,16. Given that large structured RNAs are known to carry out complex biochemical functions such as protein synthesis and RNA processing reactions, identifying more RNAs of great size and intricate structure is likely to reveal additional biochemical functions that can be achieved by RNA. We applied an updated computational pipeline17 to discover ncRNAs that rival the known large ribozymes in size and structural complexity or that are among the most abundant RNAs in bacteria that encode them. These RNAs would have been difficult or impossible to detect without examining environmental DNA sequences, suggesting that numerous RNAs with extraordinary size, structural complexity, or other exceptional characteristics remain to be discovered in unexplored sequence space. PMID:19956260

Site-Specific Integration of Foreign DNA into Minimal Bacterial and Human Target Sequences Mediated by a Conjugative Relaxase

PubMed Central

Agúndez, Leticia; González-Prieto, Coral; Machón, Cristina; Llosa, Matxalen

2012-01-01

Background Bacterial conjugation is a mechanism for horizontal DNA transfer between bacteria which requires cell to cell contact, usually mediated by self-transmissible plasmids. A protein known as relaxase is responsible for the processing of DNA during bacterial conjugation. TrwC, the relaxase of conjugative plasmid R388, is also able to catalyze site-specific integration of the transferred DNA into a copy of its target, the origin of transfer (oriT), present in a recipient plasmid. This reaction confers TrwC a high biotechnological potential as a tool for genomic engineering. Methodology/Principal Findings We have characterized this reaction by conjugal mobilization of a suicide plasmid to a recipient cell with an oriT-containing plasmid, selecting for the cointegrates. Proteins TrwA and IHF enhanced integration frequency. TrwC could also catalyze integration when it is expressed from the recipient cell. Both Y18 and Y26 catalytic tyrosil residues were essential to perform the reaction, while TrwC DNA helicase activity was dispensable. The target DNA could be reduced to 17 bp encompassing TrwC nicking and binding sites. Two human genomic sequences resembling the 17 bp segment were accepted as targets for TrwC-mediated site-specific integration. TrwC could also integrate the incoming DNA molecule into an oriT copy present in the recipient chromosome. Conclusions/Significance The results support a model for TrwC-mediated site-specific integration. This reaction may allow R388 to integrate into the genome of non-permissive hosts upon conjugative transfer. Also, the ability to act on target sequences present in the human genome underscores the biotechnological potential of conjugative relaxase TrwC as a site-specific integrase for genomic modification of human cells. PMID:22292089

Sterol Synthesis in Diverse Bacteria.

PubMed

Wei, Jeremy H; Yin, Xinchi; Welander, Paula V

2016-01-01

Sterols are essential components of eukaryotic cells whose biosynthesis and function has been studied extensively. Sterols are also recognized as the diagenetic precursors of steranes preserved in sedimentary rocks where they can function as geological proxies for eukaryotic organisms and/or aerobic metabolisms and environments. However, production of these lipids is not restricted to the eukaryotic domain as a few bacterial species also synthesize sterols. Phylogenomic studies have identified genes encoding homologs of sterol biosynthesis proteins in the genomes of several additional species, indicating that sterol production may be more widespread in the bacterial domain than previously thought. Although the occurrence of sterol synthesis genes in a genome indicates the potential for sterol production, it provides neither conclusive evidence of sterol synthesis nor information about the composition and abundance of basic and modified sterols that are actually being produced. Here, we coupled bioinformatics with lipid analyses to investigate the scope of bacterial sterol production. We identified oxidosqualene cyclase (Osc), which catalyzes the initial cyclization of oxidosqualene to the basic sterol structure, in 34 bacterial genomes from five phyla (Bacteroidetes, Cyanobacteria, Planctomycetes, Proteobacteria, and Verrucomicrobia) and in 176 metagenomes. Our data indicate that bacterial sterol synthesis likely occurs in diverse organisms and environments and also provides evidence that there are as yet uncultured groups of bacterial sterol producers. Phylogenetic analysis of bacterial and eukaryotic Osc sequences confirmed a complex evolutionary history of sterol synthesis in this domain. Finally, we characterized the lipids produced by Osc-containing bacteria and found that we could generally predict the ability to synthesize sterols. However, predicting the final modified sterol based on our current knowledge of sterol synthesis was difficult. Some bacteria

Unraveling a mechanism of honey antibacterial action: polyphenol/H₂O₂-induced oxidative effect on bacterial cell growth and on DNA degradation.

PubMed

Brudzynski, Katrina; Abubaker, Kamal; Miotto, Danielle

2012-07-15

Several compounds with antibacterial activities were identified in honey however, a mechanism by which they lead to bacterial growth inhibition and bacterial death remains still unknown. We recently found that honeys possess DNA degrading activity mediated by honey hydrogen peroxide and an unknown honey component(s). Here we provide evidence that active honeys (MIC90 of 6.25-12.5% v/v) possessed significantly higher levels of phenolics (p<0.02) of higher radical scavenging activities (p<0.005) than honeys of average activity. Removal of H2O2 by catalase eliminated bacteriostatic activities caused by both phenolics and H2O2 suggesting that the growth inhibition resulted from the coupling chemistry between these compounds. Both phenolics and H2O2 were involved in DNA degradation by honeys. Treatment of plasmid DNA with H2O2 alone did not affect the DNA integrity but H2O2 removal from honey by catalase prevented DNA degradation. Polyphenols extracted from honeys degraded plasmid DNA in the presence of H2O2 and Cu(II) in the Fenton-type reaction. The extent of DNA degradation was inversely related to the polyphenol concentration in this system as well as in honeys. At low content, honey polyphenols exerted pro-oxidant activity damaging to DNA. In conclusion, honey phenolics with pro-oxidant activities were necessary intermediates that conferred oxidative action of H2O2. Phenolic/H2O2-induced oxidative stress constituted the mechanism of honey bacteriostatic and DNA damaging activities. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.

A high-throughput and quantitative method to assess the mutagenic potential of translesion DNA synthesis

PubMed Central

Taggart, David J.; Camerlengo, Terry L.; Harrison, Jason K.; Sherrer, Shanen M.; Kshetry, Ajay K.; Taylor, John-Stephen; Huang, Kun; Suo, Zucai

2013-01-01

Cellular genomes are constantly damaged by endogenous and exogenous agents that covalently and structurally modify DNA to produce DNA lesions. Although most lesions are mended by various DNA repair pathways in vivo, a significant number of damage sites persist during genomic replication. Our understanding of the mutagenic outcomes derived from these unrepaired DNA lesions has been hindered by the low throughput of existing sequencing methods. Therefore, we have developed a cost-effective high-throughput short oligonucleotide sequencing assay that uses next-generation DNA sequencing technology for the assessment of the mutagenic profiles of translesion DNA synthesis catalyzed by any error-prone DNA polymerase. The vast amount of sequencing data produced were aligned and quantified by using our novel software. As an example, the high-throughput short oligonucleotide sequencing assay was used to analyze the types and frequencies of mutations upstream, downstream and at a site-specifically placed cis–syn thymidine–thymidine dimer generated individually by three lesion-bypass human Y-family DNA polymerases. PMID:23470999

Synthesis and Crystal Structure of 2’-Se-modified guanosine Containing DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Salon, J.; Sheng, J; Gan, J

Selenium modification of nucleic acids is of great importance in X-ray crystal structure determination and functional study of nucleic acids. Herein, we describe a convenient synthesis of a new building block, the 2{prime}-SeMe-modified guanosine (G{sub Se}) phosphoramidite, and report the first incorporation of the 2{prime}-Se-G moiety into DNA. The X-ray crystal structure of the 2{prime}-Se-modified octamer DNA (5{prime}-GTG{sub Se}TACAC-3{prime}) was determined at a resolution of 1.20 {angstrom}. We also found that the 2{prime}-Se modification points to the minor groove and that the modified and native structures are virtually identical. Furthermore, we observed that the 2{prime}-Se-G modification can significantly facilitate themore » crystal growth with respect to the corresponding native DNA.« less

DNA polymerase ζ cooperates with polymerases κ and ι in translesion DNA synthesis across pyrimidine photodimers in cells from XPV patients

PubMed Central

Ziv, Omer; Geacintov, Nicholas; Nakajima, Satoshi; Yasui, Akira; Livneh, Zvi

2009-01-01

Human cells tolerate UV-induced cyclobutane pyrimidine dimers (CPD) by translesion DNA synthesis (TLS), carried out by DNA polymerase η, the POLH gene product. A deficiency in DNA polymerase η due to germ-line mutations in POLH causes the hereditary disease xeroderma pigmentosum variant (XPV), which is characterized by sunlight sensitivity and extreme predisposition to sunlight-induced skin cancer. XPV cells are UV hypermutable due to the activity of mutagenic TLS across CPD, which explains the cancer predisposition of the patients. However, the identity of the backup polymerase that carries out this mutagenic TLS was unclear. Here, we show that DNA polymerase ζ cooperates with DNA polymerases κ and ι to carry out error-prone TLS across a TT CPD. Moreover, DNA polymerases ζ and κ, but not ι, protect XPV cells against UV cytotoxicity, independently of nucleotide excision repair. This presents an extreme example of benefit-risk balance in the activity of TLS polymerases, which provide protection against UV cytotoxicity at the cost of increased mutagenic load. PMID:19564618

DNA polymerase zeta cooperates with polymerases kappa and iota in translesion DNA synthesis across pyrimidine photodimers in cells from XPV patients.

PubMed

Ziv, Omer; Geacintov, Nicholas; Nakajima, Satoshi; Yasui, Akira; Livneh, Zvi

2009-07-14

Human cells tolerate UV-induced cyclobutane pyrimidine dimers (CPD) by translesion DNA synthesis (TLS), carried out by DNA polymerase eta, the POLH gene product. A deficiency in DNA polymerase eta due to germ-line mutations in POLH causes the hereditary disease xeroderma pigmentosum variant (XPV), which is characterized by sunlight sensitivity and extreme predisposition to sunlight-induced skin cancer. XPV cells are UV hypermutable due to the activity of mutagenic TLS across CPD, which explains the cancer predisposition of the patients. However, the identity of the backup polymerase that carries out this mutagenic TLS was unclear. Here, we show that DNA polymerase zeta cooperates with DNA polymerases kappa and iota to carry out error-prone TLS across a TT CPD. Moreover, DNA polymerases zeta and kappa, but not iota, protect XPV cells against UV cytotoxicity, independently of nucleotide excision repair. This presents an extreme example of benefit-risk balance in the activity of TLS polymerases, which provide protection against UV cytotoxicity at the cost of increased mutagenic load.

Suppression of dexamethasone-stimulated DNA synthesis in an oncogene construct containing rat cell line by a DNA site-oriented ligand of poly-ADP-ribose polymerase: 6-amino-1,2-benzopyrone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kirsten, E.; Bauer, P.I.; Kun, E.

1991-03-01

The cellular inhibitory effects of 6-amino-1,2-benzopyrone (6-ABP), a DNA site-specific ligand of adenosine diphosphoribosyl transferase (ADPRT), were determined in a dexamethasone-sensitive EJ-ras gene construct containing cell line (14C cells). Dexamethansone in vitro transforms these cells to a tumorigenic phenotype and also stimulates cell replication. AT a nontoxic concentration 6-ABP treatment of intact cells for 4 days inhibits the dexamethasone-stimulated increment of cellular DNA content, depresses replicative DNA synthesis as assayed by thymidine incorporation to the level of cells that were not exposed to dexamethasone, and in permeabilized cells reduces the dexamethasone-stimulated increase of deoxyribonucleotide incorporation into DNA to the levelmore » of untreated cells. In situ pulse labeling of cells pretreated with 6-ABP indicated an inhibition of DNA synthesis at a stage prior to the formation of the 10-kb intermediate species. Neither dexamethasone nor the drug influenced the cellular quantity of ADPRT molecules, tested immunochemically.« less

SYNTHESIS, IN VITRO METABOLISM, MUTAGENICITY, AND DNA-ADDUCTION OF NAPHTHO[1,2-E]PYRENE

EPA Science Inventory

SYNTHESIS, IN V1TRO METABOLISM, MUTAGENICITY , AND DNA-ADDUCnON OF NAPHTHO[l ,2-e ]PYRENE

Literature data, although limited, underscore the contribution of C24HI4 polycyclic aromatic hydrocarbons to the biological activity of the extracts of complex environmental samples....

Synthesis and characterization of DNA nano-meso-microspheres as drug delivery carriers for intratumoral chemotherapy

NASA Astrophysics Data System (ADS)

Enriquez Schumacher, Iris Vanessa

Conventional cancer chemotherapy results in systemic toxicity which severely limits effectiveness and often adversely affects patient quality of life. There is a need to find new drugs and delivery methods for less toxic therapy. Previous studies concerning DNA complexing with chemotherapy drugs suggest unique opportunities for DNA as a mesosphere drug carrier. The overall objective of this research was devoted to the synthesis and evaluation of novel DNA-drug nano-mesospheres designed for localized chemotherapy via intratumoral injection. My research presents DNA nano-meso-microspheres (DNA-MS) that were prepared using a modified steric stabilization method originally developed in this lab for the preparation of albumin MS. DNA-MS were prepared with glutaraldehyde covalent crosslinking (genipin crosslinking was attempted) through the DNA base pairs. In addition, novel crosslinking of DNA-MS was demonstrated using chromium, gadolinium, or iron cations through the DNA phosphate groups. Covalent and ionic crosslinked DNA-MS syntheses yielded smooth and spherical particle morphologies with multimodal size distributions. Optimized DNA-MS syntheses produced particles with narrow and normal size distributions in the 50nm to 5mum diameter size range. In aqueous dispersions approximately 200% swelling was observed with dispersion stability for more than 48 hours. Typical process conditions included a 1550rpm initial mixing speed and particle filtration through 20mum filters to facilitate preparation. DNA-MS were in situ loaded during synthesis for the first time with mitoxantrone, 5-fluorouracil, and methotrexate. DNA-MS drug incorporation was 12%(w/w) for mitoxantrone, 9%(w/w) for methotrexate, and 5%(w/w) for 5-fluorouracil. In vitro drug release into phosphate buffered saline was observed for over 35 days by minimum sink release testing. The effect of gadolinium crosslink concentration on mitoxantrone release was evaluated at molar equivalences in the range of 20% to

In vivo evidence for translesion synthesis by the replicative DNA polymerase δ

PubMed Central

Hirota, Kouji; Tsuda, Masataka; Mohiuddin; Tsurimoto, Toshiki; Cohen, Isadora S.; Livneh, Zvi; Kobayashi, Kaori; Narita, Takeo; Nishihara, Kana; Murai, Junko; Iwai, Shigenori; Guilbaud, Guillaume; Sale, Julian E.; Takeda, Shunichi

2016-01-01

The intolerance of DNA polymerase δ (Polδ) to incorrect base pairing contributes to its extremely high accuracy during replication, but is believed to inhibit translesion synthesis (TLS). However, chicken DT40 cells lacking the POLD3 subunit of Polδ are deficient in TLS. Previous genetic and biochemical analysis showed that POLD3 may promote lesion bypass by Polδ itself independently of the translesion polymerase Polζ of which POLD3 is also a subunit. To test this hypothesis, we have inactivated Polδ proofreading in pold3 cells. This significantly restored TLS in pold3 mutants, enhancing dA incorporation opposite abasic sites. Purified proofreading-deficient human Polδ holoenzyme performs TLS of abasic sites in vitro much more efficiently than the wild type enzyme, with over 90% of TLS events resulting in dA incorporation. Furthermore, proofreading deficiency enhances the capability of Polδ to continue DNA synthesis over UV lesions both in vivo and in vitro. These data support Polδ contributing to TLS in vivo and suggest that the mutagenesis resulting from loss of Polδ proofreading activity may in part be explained by enhanced lesion bypass. PMID:27185888

Ketone-DNA: a versatile postsynthetic DNA decoration platform.

PubMed

Dey, S; Sheppard, T L

2001-12-13

[reaction: see text] A general strategy for the functional diversification of DNA oligonucleotides under physiological conditions was developed. We describe the synthesis of DNA molecules bearing ketone ports (ketone-DNA) and the efficient postsynthetic decoration of ketone-DNA with structurally diverse aminooxy compounds.

Finding of widespread viral and bacterial revolution dsDNA translocation motors distinct from rotation motors by channel chirality and size

PubMed Central

2014-01-01

Background Double-stranded DNA translocation is ubiquitous in living systems. Cell mitosis, bacterial binary fission, DNA replication or repair, homologous recombination, Holliday junction resolution, viral genome packaging and cell entry all involve biomotor-driven dsDNA translocation. Previously, biomotors have been primarily classified into linear and rotational motors. We recently discovered a third class of dsDNA translocation motors in Phi29 utilizing revolution mechanism without rotation. Analogically, the Earth rotates around its own axis every 24 hours, but revolves around the Sun every 365 days. Results Single-channel DNA translocation conductance assay combined with structure inspections of motor channels on bacteriophages P22, SPP1, HK97, T7, T4, Phi29, and other dsDNA translocation motors such as bacterial FtsK and eukaryotic mimiviruses or vaccinia viruses showed that revolution motor is widespread. The force generation mechanism for revolution motors is elucidated. Revolution motors can be differentiated from rotation motors by their channel size and chirality. Crystal structure inspection revealed that revolution motors commonly exhibit channel diameters larger than 3 nm, while rotation motors that rotate around one of the two separated DNA strands feature a diameter smaller than 2 nm. Phi29 revolution motor translocated double- and tetra-stranded DNA that occupied 32% and 64% of the narrowest channel cross-section, respectively, evidencing that revolution motors exhibit channel diameters significantly wider than the dsDNA. Left-handed oriented channels found in revolution motors drive the right-handed dsDNA via anti-chiral interaction, while right-handed channels observed in rotation motors drive the right-handed dsDNA via parallel threads. Tethering both the motor and the dsDNA distal-end of the revolution motor does not block DNA packaging, indicating that no rotation is required for motors of dsDNA phages, while a small-angle left

Active, motor-driven mechanics in a DNA gel.

PubMed

Bertrand, Olivier J N; Fygenson, Deborah Kuchnir; Saleh, Omar A

2012-10-23

Cells are capable of a variety of dramatic stimuli-responsive mechanical behaviors. These capabilities are enabled by the pervading cytoskeletal network, an active gel composed of structural filaments (e.g., actin) that are acted upon by motor proteins (e.g., myosin). Here, we describe the synthesis and characterization of an active gel using noncytoskeletal components. We use methods of base-pair-templated DNA self assembly to create a hybrid DNA gel containing stiff tubes and flexible linkers. We then activate the gel by adding the motor FtsK50C, a construct derived from the bacterial protein FtsK that, in vitro, has a strong and processive DNA contraction activity. The motors stiffen the gel and create stochastic contractile events that affect the positions of attached beads. We quantify the fluctuations of the beads and show that they are comparable both to measurements of cytoskeletal systems and to theoretical predictions for active gels. Thus, we present a DNA-based active gel whose behavior highlights the universal aspects of nonequilibrium, motor-driven networks.

A Novel Strategy to Predict Carcinogenicity of Antiparasitics Based on a Combination of DNA Lesions and Bacterial Mutagenicity Tests

PubMed Central

Liu, Qianying; Lei, Zhixin; Zhu, Feng; Ihsan, Awais; Wang, Xu; Yuan, Zonghui

2017-01-01

Genotoxicity and carcinogenicity testing of pharmaceuticals prior to commercialization is requested by regulatory agencies. The bacterial mutagenicity test was considered having the highest accuracy of carcinogenic prediction. However, some evidences suggest that it always results in false-positive responses when the bacterial mutagenicity test is used to predict carcinogenicity. Along with major changes made to the International Committee on Harmonization guidance on genotoxicity testing [S2 (R1)], the old data (especially the cytotgenetic data) may not meet current guidelines. This review provides a compendium of retrievable results of genotoxicity and animal carcinogenicity of 136 antiparasitics. Neither genotoxicity nor carcinogenicity data is available for 84 (61.8%), while 52 (38.2%) have been evaluated in at least one genotoxicity or carcinogenicity study, and only 20 (14.7%) in both genotoxicity and carcinogenicity studies. Among 33 antiparasitics with at least one old result in in vitro genotoxicity, 15 (45.5%) are in agreement with the current ICH S2 (R1) guidance for data acceptance. Compared with other genotoxicity assays, the DNA lesions can significantly increase the accuracy of prediction of carcinogenicity. Together, a combination of DNA lesion and bacterial tests is a more accurate way to predict carcinogenicity. PMID:29170735

Eukaryotic DNA Replication Fork.

PubMed

Burgers, Peter M J; Kunkel, Thomas A

2017-06-20

This review focuses on the biogenesis and composition of the eukaryotic DNA replication fork, with an emphasis on the enzymes that synthesize DNA and repair discontinuities on the lagging strand of the replication fork. Physical and genetic methodologies aimed at understanding these processes are discussed. The preponderance of evidence supports a model in which DNA polymerase ε (Pol ε) carries out the bulk of leading strand DNA synthesis at an undisturbed replication fork. DNA polymerases α and δ carry out the initiation of Okazaki fragment synthesis and its elongation and maturation, respectively. This review also discusses alternative proposals, including cellular processes during which alternative forks may be utilized, and new biochemical studies with purified proteins that are aimed at reconstituting leading and lagging strand DNA synthesis separately and as an integrated replication fork.

Coupling between d-3-phosphoglycerate dehydrogenase and d-2-hydroxyglutarate dehydrogenase drives bacterial l-serine synthesis

PubMed Central

Zhang, Wen; Zhang, Manman; Gao, Chao; Zhang, Yipeng; Ge, Yongsheng; Guo, Shiting; Guo, Xiaoting; Zhou, Zikang; Liu, Qiuyuan; Zhang, Yingxin; Ma, Cuiqing; Tao, Fei; Xu, Ping

2017-01-01

l-Serine biosynthesis, a crucial metabolic process in most domains of life, is initiated by d-3-phosphoglycerate (d-3-PG) dehydrogenation, a thermodynamically unfavorable reaction catalyzed by d-3-PG dehydrogenase (SerA). d-2-Hydroxyglutarate (d-2-HG) is traditionally viewed as an abnormal metabolite associated with cancer and neurometabolic disorders. Here, we reveal that bacterial anabolism and catabolism of d-2-HG are involved in l-serine biosynthesis in Pseudomonas stutzeri A1501 and Pseudomonas aeruginosa PAO1. SerA catalyzes the stereospecific reduction of 2-ketoglutarate (2-KG) to d-2-HG, responsible for the major production of d-2-HG in vivo. SerA combines the energetically favorable reaction of d-2-HG production to overcome the thermodynamic barrier of d-3-PG dehydrogenation. We identified a bacterial d-2-HG dehydrogenase (D2HGDH), a flavin adenine dinucleotide (FAD)-dependent enzyme, that converts d-2-HG back to 2-KG. Electron transfer flavoprotein (ETF) and ETF-ubiquinone oxidoreductase (ETFQO) are also essential in d-2-HG metabolism through their capacity to transfer electrons from D2HGDH. Furthermore, while the mutant with D2HGDH deletion displayed decreased growth, the defect was rescued by adding l-serine, suggesting that the D2HGDH is functionally tied to l-serine synthesis. Substantial flux flows through d-2-HG, being produced by SerA and removed by D2HGDH, ETF, and ETFQO, maintaining d-2-HG homeostasis. Overall, our results uncover that d-2-HG–mediated coupling between SerA and D2HGDH drives bacterial l-serine synthesis. PMID:28827360

Rolling Circle Amplification For Spatially Directed Synthesis Of A Solid Phase Anchored Single-Stranded DNA Molecule

NASA Astrophysics Data System (ADS)

Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.

2006-09-01

In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.

The bacterial segrosome: a dynamic nucleoprotein machine for DNA trafficking and segregation.

PubMed

Hayes, Finbarr; Barillà, Daniela

2006-02-01

The genomes of unicellular and multicellular organisms must be partitioned equitably in coordination with cytokinesis to ensure faithful transmission of duplicated genetic material to daughter cells. Bacteria use sophisticated molecular mechanisms to guarantee accurate segregation of both plasmids and chromosomes at cell division. Plasmid segregation is most commonly mediated by a Walker-type ATPase and one of many DNA-binding proteins that assemble on a cis-acting centromere to form a nucleoprotein complex (the segrosome) that mediates intracellular plasmid transport. Bacterial chromosome segregation involves a multipartite strategy in which several discrete protein complexes potentially participate. Shedding light on the basis of genome segregation in bacteria could indicate new strategies aimed at combating pathogenic and antibiotic-resistant bacteria.

Assessment of DNA synthesis in Islet-1{sup +} cells in the adult murine heart

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weinberger, Florian, E-mail: f.weinberger@uke.de; Mehrkens, Dennis, E-mail: dennis.mehrkens@uk-koeln.de; Starbatty, Jutta, E-mail: starbatty@uke.uni-hamburg.de

Highlights: • Islet-1 was expressed in the adult heart. • Islet-1-positive cells did not proliferate in the adult heart. • Sinoatrial node cells did not proliferate in the adult heart. - Abstract: Rationale: Islet-1 positive (Islet-1{sup +}) cardiac progenitor cells give rise to the right ventricle, atria and outflow tract during murine cardiac development. In the adult heart Islet-1 expression is limited to parasympathetic neurons, few cardiomyocytes, smooth muscle cells, within the proximal aorta and pulmonary artery and sinoatrial node cells. Its role in these cells is unknown. Here we tested the hypothesis that Islet-1{sup +} cells retain proliferative activitymore » and may therefore play a role in regenerating specialized regions in the heart. Methods and results: DNA synthesis was analyzed by the incorporation of tritiated thymidine ({sup 3}H-thymidine) in Isl-1-nLacZ mice, a transgenic model with an insertion of a nuclear beta-galactosidase in the Islet-1 locus. Mice received daily injections of {sup 3}H-thymidine for 5 days. DNA synthesis was visualized throughout the heart by dipping autoradiography of cryosections. Colocalization of an nLacZ-signal and silver grains would indicate DNA synthesis in Islet-1{sup +} cells. Whereas Islet{sup −} non-myocyte nuclei were regularly marked by accumulation of silver grains, colocalization with nLacZ-signals was not detected in >25,000 cells analyzed. Conclusions: Islet-1{sup +} cells are quiescent in the adult heart, suggesting that, under normal conditions, even pacemaking cells do not proliferate at higher rates than normal cardiac myocytes.« less

Rehosting of Bacterial Chaperones for High-Quality Protein Production▿

PubMed Central

Martínez-Alonso, Mónica; Toledo-Rubio, Verónica; Noad, Rob; Unzueta, Ugutz; Ferrer-Miralles, Neus; Roy, Polly; Villaverde, Antonio

2009-01-01

Coproduction of DnaK/DnaJ in Escherichia coli enhances solubility but promotes proteolytic degradation of their substrates, minimizing the yield of unstable polypeptides. Higher eukaryotes have orthologs of DnaK/DnaJ but lack the linked bacterial proteolytic system. By coexpression of DnaK and DnaJ in insect cells with inherently misfolding-prone recombinant proteins, we demonstrate simultaneous improvement of soluble protein yield and quality and proteolytic stability. Thus, undesired side effects of bacterial folding modulators can be avoided by appropriate rehosting in heterologous cell expression systems. PMID:19820142

Synthesis and characterization of DNA minor groove binding alkylating agents.

PubMed

Iyer, Prema; Srinivasan, Ajay; Singh, Sreelekha K; Mascara, Gerard P; Zayitova, Sevara; Sidone, Brian; Fouquerel, Elise; Svilar, David; Sobol, Robert W; Bobola, Michael S; Silber, John R; Gold, Barry

2013-01-18

Derivatives of methyl 3-(1-methyl-5-(1-methyl-5-(propylcarbamoyl)-1H-pyrrol-3-ylcarbamoyl)-1H-pyrrol-3-ylamino)-3-oxopropane-1-sulfonate (1), a peptide-based DNA minor groove binding methylating agent, were synthesized and characterized. In all cases, the N-terminus was appended with an O-methyl sulfonate ester, while the C-terminus group was varied with nonpolar and polar side chains. In addition, the number of pyrrole rings was varied from 2 (dipeptide) to 3 (tripeptide). The ability of the different analogues to efficiently generate N3-methyladenine was demonstrated as was their selectivity for minor groove (N3-methyladenine) versus major groove (N7-methylguanine) methylation. Induced circular dichroism studies were used to measure the DNA equilibrium binding properties of the stable sulfone analogues; the tripeptide binds with affinity that is >10-fold higher than that of the dipeptide. The toxicities of the compounds were evaluated in alkA/tag glycosylase mutant E. coli and in human WT glioma cells and in cells overexpressing and under-expressing N-methylpurine-DNA glycosylase, which excises N3-methyladenine from DNA. The results show that equilibrium binding correlates with the levels of N3-methyladenine produced and cellular toxicity. The toxicity of 1 was inversely related to the expression of MPG in both the bacterial and mammalian cell lines. The enhanced toxicity parallels the reduced activation of PARP and the diminished rate of formation of aldehyde reactive sites observed in the MPG knockdown cells. It is proposed that unrepaired N3-methyladenine is toxic due to its ability to directly block DNA polymerization.

Two distinct modes of RecA action are required for DNA polymerase V-catalyzed translesion synthesis.

PubMed

Pham, Phuong; Seitz, Erica M; Saveliev, Sergei; Shen, Xuan; Woodgate, Roger; Cox, Michael M; Goodman, Myron F

2002-08-20

SOS mutagenesis in Escherichia coli requires DNA polymerase V (pol V) and RecA protein to copy damaged DNA templates. Here we show that two distinct biochemical modes for RecA protein are necessary for pol V-catalyzed translesion synthesis. One RecA mode is characterized by a strong stimulation in nucleotide incorporation either directly opposite a lesion or at undamaged template sites, but by the absence of lesion bypass. A separate RecA mode is necessary for translesion synthesis. The RecA1730 mutant protein, which was identified on the basis of its inability to promote pol V (UmuD'(2)C)-dependent UV-mutagenesis, appears proficient for the first mode of RecA action but is deficient in the second mode. Data are presented suggesting that the two RecA modes are "nonfilamentous". That is, contrary to current models for SOS mutagenesis, formation of a RecA nucleoprotein filament may not be required for copying damaged DNA templates. Instead, SOS mutagenesis occurs when pol V interacts with two RecA molecules, first at a 3' primer end, upstream of a template lesion, where RecA mode 1 stimulates pol V activity, and subsequently at a site immediately downstream of the lesion, where RecA mode 2 cocatalyzes lesion bypass. We posit that in vivo assembly of a RecA nucleoprotein filament may be required principally to target pol V to a site of DNA damage and to stabilize the pol V-RecA interaction at the lesion. However, it is only a RecA molecule located at the 3' filament tip, proximal to a damaged template base, that is directly responsible for translesion synthesis.

C-terminal Phenylalanine of Bacteriophage T7 Single-stranded DNA-binding Protein Is Essential for Strand Displacement Synthesis by T7 DNA Polymerase at a Nick in DNA*

PubMed Central

Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C.

2009-01-01

Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5′-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations. PMID:19726688

C-terminal phenylalanine of bacteriophage T7 single-stranded DNA-binding protein is essential for strand displacement synthesis by T7 DNA polymerase at a nick in DNA.

PubMed

Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C

2009-10-30

Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5'-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations.

Influence of Nrf2 activators on subcellular skeletal muscle protein and DNA synthesis rates after 6 weeks of milk protein feeding in older adults.

PubMed

Konopka, Adam R; Laurin, Jaime L; Musci, Robert V; Wolff, Christopher A; Reid, Justin J; Biela, Laurie M; Zhang, Qian; Peelor, Fredrick F; Melby, Christopher L; Hamilton, Karyn L; Miller, Benjamin F

2017-04-01

In older adults, chronic oxidative and inflammatory stresses are associated with an impaired increase in skeletal muscle protein synthesis after acute anabolic stimuli. Conjugated linoleic acid (CLA) and Protandim have been shown to activate nuclear factor erythroid-derived 2-like 2 (Nrf2), a transcription factor for the antioxidant response element and anti-inflammatory pathways. This study tested the hypothesis that compared to a placebo control (CON), CLA and Protandim would increase skeletal muscle subcellular protein (myofibrillar, mitochondrial, cytoplasmic) and DNA synthesis in older adults after 6 weeks of milk protein feeding. CLA decreased oxidative stress and skeletal muscle oxidative damage with a trend to increase messenger RNA (mRNA) expression of a Nrf2 target, NAD(P)H dehydrogenase quinone 1 (NQO1). However, CLA did not influence other Nrf2 targets (heme oxygenase-1 (HO-1), glutathione peroxidase 1 (Gpx1)) or protein or DNA synthesis. Conversely, Protandim increased HO-1 protein content but not the mRNA expression of downstream Nrf2 targets, oxidative stress, or skeletal muscle oxidative damage. Rates of myofibrillar protein synthesis were maintained despite lower mitochondrial and cytoplasmic protein syntheses after Protandim versus CON. Similarly, DNA synthesis was non-significantly lower after Protandim compared to CON. After Protandim, the ratio of protein to DNA synthesis tended to be greater in the myofibrillar fraction and maintained in the mitochondrial and cytoplasmic fractions, emphasizing the importance of measuring both protein and DNA synthesis to gain insight into proteostasis. Overall, these data suggest that Protandim may enhance proteostatic mechanisms of skeletal muscle contractile proteins after 6 weeks of milk protein feeding in older adults.

Regulation of DNA synthesis and cell division by polyamines in Catharanthus roseus suspension cultures

Treesearch

R. Minocha; S.C. Minocha; A. Komamine; W.C. Shortle

1991-01-01

Various inhibitors of polyamine biosynthesis were used to study the role of polyamines in DNA synthesis and cell division in suspension cultures of Catharanthus roseus (L) G. Don. Arginine decarboxylase (ADC; EC 4.1.1.19) was the major enzyme responsible for putrescine production. DL α-difluoromethylarginine inhibited ADC activity, cellular...

Disarming Bacterial Virulence through Chemical Inhibition of the DNA Binding Domain of an AraC-like Transcriptional Activator Protein*

PubMed Central

Yang, Ji; Hocking, Dianna M.; Cheng, Catherine; Dogovski, Con; Perugini, Matthew A.; Holien, Jessica K.; Parker, Michael W.; Hartland, Elizabeth L.; Tauschek, Marija; Robins-Browne, Roy M.

2013-01-01

The misuse of antibiotics during past decades has led to pervasive antibiotic resistance in bacteria. Hence, there is an urgent need for the development of new and alternative approaches to combat bacterial infections. In most bacterial pathogens the expression of virulence is tightly regulated at the transcriptional level. Therefore, targeting pathogens with drugs that interfere with virulence gene expression offers an effective alternative to conventional antimicrobial chemotherapy. Many Gram-negative intestinal pathogens produce AraC-like proteins that control the expression of genes required for infection. In this study we investigated the prototypical AraC-like virulence regulator, RegA, from the mouse attaching and effacing pathogen, Citrobacter rodentium, as a potential drug target. By screening a small molecule chemical library and chemical optimization, we identified two compounds that specifically inhibited the ability of RegA to activate its target promoters and thus reduced expression of a number of proteins required for virulence. Biophysical, biochemical, genetic, and computational analyses indicated that the more potent of these two compounds, which we named regacin, disrupts the DNA binding capacity of RegA by interacting with amino acid residues within a conserved region of the DNA binding domain. Oral administration of regacin to mice, commencing 15 min before or 12 h after oral inoculation with C. rodentium, caused highly significant attenuation of intestinal colonization by the mouse pathogen comparable to that of an isogenic regA-deletion mutant. These findings demonstrate that chemical inhibition of the DNA binding domains of transcriptional regulators is a viable strategy for the development of antimicrobial agents that target bacterial pathogens. PMID:24019519

Cytoplasmic DNA synthesis in Amoeba proteus. I. On the particulate nature of the DNA-containing elements.

PubMed

RABINOVITCH, M; PLAUT, W

1962-12-01

The incorporation of tritiated thymidine in Amoeba proteus was reinvestigated in order to see if it could be associated with microscopically detectable structures. Staining experiments with basic dyes, including the fluorochrome acridine orange, revealed the presence of large numbers of 0.3 to 0.5 micro particles in the cytoplasm of all cells studied. The effect of nuclease digestion on the dye affinity of the particles suggests that they contain DNA as well as RNA. Centrifugation of living cells at 10,000 g leads to the sedimentation of the particles in the centrifugal third of the ameba near the nucleus. Analysis of centrifuged cells which had been incubated with H(3)-thymidine showed a very high degree of correlation between the location of the nucleic acid-containing granules and that of acid-insoluble, deoxyribonuclease-sensitive labeled molecules and leads to the conclusion that cytoplasmic DNA synthesis in Amoeba proteus occurs in association with these particles.

Hda, a novel DnaA-related protein, regulates the replication cycle in Escherichia coli.

PubMed

Kato , J; Katayama, T

2001-08-01

The bacterial DnaA protein binds to the chromosomal origin of replication to trigger a series of initiation reactions, which leads to the loading of DNA polymerase III. In Escherichia coli, once this polymerase initiates DNA synthesis, ATP bound to DnaA is efficiently hydrolyzed to yield the ADP-bound inactivated form. This negative regulation of DnaA, which occurs through interaction with the beta-subunit sliding clamp configuration of the polymerase, functions in the temporal blocking of re-initiation. Here we show that the novel DnaA-related protein, Hda, from E.coli is essential for this regulatory inactivation of DnaA in vitro and in vivo. Our results indicate that the hda gene is required to prevent over-initiation of chromosomal replication and for cell viability. Hda belongs to the chaperone-like ATPase family, AAA(+), as do DnaA and certain eukaryotic proteins essential for the initiation of DNA replication. We propose that the once-per-cell-cycle rule of replication depends on the timely interaction of AAA(+) proteins that comprise the apparatus regulating the activity of the initiator of replication.

DNA excision repair in cell extracts from human cell lines exhibiting hypersensitivity to DNA-damaging agents

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hansson, J.; Keyse, S.M.; Lindahl, T.

Whole cell extracts from human lymphoid cell lines can perform in vitro DNA repair synthesis in plasmids damaged by agents including UV or cis-diamminedichloroplatinum(II) (cis-DDP). Extracts from xeroderma pigmentosum (XP) cells are defective in repair synthesis. We have now studied in vitro DNA repair synthesis using extracts from lymphoblastoid cell lines representing four human hereditary syndromes with increased sensitivity to DNA-damaging agents. Extracts of cell lines from individuals with the sunlight-sensitive disorders dysplastic nevus syndrome or Cockayne's syndrome (complementation groups A and B) showed normal DNA repair synthesis in plasmids with UV photoproducts. This is consistent with in vivo measurementsmore » of the overall DNA repair capacity in such cell lines. A number of extracts were prepared from two cell lines representing the variant form of XP (XP-V). Half of the extracts prepared showed normal levels of in vitro DNA repair synthesis in plasmids containing UV lesions, but the remainder of the extracts from the same cell lines showed deficient repair synthesis, suggesting the possibility of an unusually labile excision repair protein in XP-V. Fanconi's anemia (FA) cells show cellular hypersensitivity to cross-linking agents including cis-DDP. Extracts from cell lines belonging to two different complementation groups of FA showed normal DNA repair synthesis in plasmids containing cis-DDP or UV adducts. Thus, there does not appear to be an overall excision repair defect in FA, but the data do not exclude a defect in the repair of interstrand DNA cross-links.« less

Role of special cross-links in structure formation of bacterial DNA polymer

NASA Astrophysics Data System (ADS)

Agarwal, Tejal; Manjunath, G. P.; Habib, Farhat; Lakshmi Vaddavalli, Pavana; Chatterji, Apratim

2018-01-01

Using data from contact maps of the DNA-polymer of Escherichia coli (E. Coli) (at kilobase pair resolution) as an input to our model, we introduce cross-links between monomers in a bead-spring model of a ring polymer at very specific points along the chain. Via suitable Monte Carlo simulations, we show that the presence of these cross-links leads to a particular organization of the chain at large (micron) length scales of the DNA. We also investigate the structure of a ring polymer with an equal number of cross-links at random positions along the chain. We find that though the polymer does get organized at the large length scales, the nature of the organization is quite different from the organization observed with cross-links at specific biologically determined positions. We used the contact map of E. Coli bacteria which has around 4.6 million base pairs in a single circular chromosome. In our coarse-grained flexible ring polymer model, we used 4642 monomer beads and observed that around 80 cross-links are enough to induce the large-scale organization of the molecule accounting for statistical fluctuations caused by thermal energy. The length of a DNA chain even of a simple bacterial cell such as E. Coli is much longer than typical proteins, hence we avoided methods used to tackle protein folding problems. We define new suitable quantities to identify the large scale structure of a polymer chain with a few cross-links.

3' rapid amplification of cDNA ends (RACE) walking for rapid structural analysis of large transcripts.

PubMed

Ozawa, Tatsuhiko; Kondo, Masato; Isobe, Masaharu

2004-01-01

The 3' rapid amplification of cDNA ends (3' RACE) is widely used to isolate the cDNA of unknown 3' flanking sequences. However, the conventional 3' RACE often fails to amplify cDNA from a large transcript if there is a long distance between the 5' gene-specific primer and poly(A) stretch, since the conventional 3' RACE utilizes 3' oligo-dT-containing primer complementary to the poly(A) tail of mRNA at the first strand cDNA synthesis. To overcome this problem, we have developed an improved 3' RACE method suitable for the isolation of cDNA derived from very large transcripts. By using the oligonucleotide-containing random 9mer together with the GC-rich sequence for the suppression PCR technology at the first strand of cDNA synthesis, we have been able to amplify the cDNA from a very large transcript, such as the microtubule-actin crosslinking factor 1 (MACF1) gene, which codes a transcript of 20 kb in size. When there is no splicing variant, our highly specific amplification allows us to perform the direct sequencing of 3' RACE products without requiring cloning in bacterial hosts. Thus, this stepwise 3' RACE walking will help rapid characterization of the 3' structure of a gene, even when it encodes a very large transcript.

Seasonal succession leads to habitat-dependent differentiation in ribosomal RNA:DNA ratios among freshwater lake bacteria

DOE PAGES

Denef, Vincent J.; Fujimoto, Masanori; Berry, Michelle A.; ...

2016-04-29

Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP). Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA genemore » sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate) water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. Furthermore, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors.« less

Seasonal succession leads to habitat-dependent differentiation in ribosomal RNA:DNA ratios among freshwater lake bacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Denef, Vincent J.; Fujimoto, Masanori; Berry, Michelle A.

Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP). Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA genemore » sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate) water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. Furthermore, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors.« less

Spatial organization of transcription machinery and its segregation from the replisome in fast-growing bacterial cells

PubMed Central

Cagliero, Cedric; Zhou, Yan Ning; Jin, Ding Jun

2014-01-01

In a fast-growing Escherichia coli cell, most RNA polymerase (RNAP) is allocated to rRNA synthesis forming transcription foci at clusters of rrn operons or bacterial nucleolus, and each of the several nascent nucleoids contains multiple pairs of replication forks. The composition of transcription foci has not been determined. In addition, how the transcription machinery is three-dimensionally organized to promote cell growth in concord with replication machinery in the nucleoid remains essentially unknown. Here, we determine the spatial and functional landscapes of transcription and replication machineries in fast-growing E. coli cells using super-resolution-structured illumination microscopy. Co-images of RNAP and DNA reveal spatial compartmentation and duplication of the transcription foci at the surface of the bacterial chromosome, encompassing multiple nascent nucleoids. Transcription foci cluster with NusA and NusB, which are the rrn anti-termination system and are associated with nascent rRNAs. However, transcription foci tend to separate from SeqA and SSB foci, which track DNA replication forks and/or the replisomes, demonstrating that transcription machinery and replisome are mostly located in different chromosomal territories to maintain harmony between the two major cellular functions in fast-growing cells. Our study suggests that bacterial chromosomes are spatially and functionally organized, analogous to eukaryotes. PMID:25416798

Thiophene antibacterials that allosterically stabilize DNA-cleavage complexes with DNA gyrase.

PubMed

Chan, Pan F; Germe, Thomas; Bax, Benjamin D; Huang, Jianzhong; Thalji, Reema K; Bacqué, Eric; Checchia, Anna; Chen, Dongzhao; Cui, Haifeng; Ding, Xiao; Ingraham, Karen; McCloskey, Lynn; Raha, Kaushik; Srikannathasan, Velupillai; Maxwell, Anthony; Stavenger, Robert A

2017-05-30

A paucity of novel acting antibacterials is in development to treat the rising threat of antimicrobial resistance, particularly in Gram-negative hospital pathogens, which has led to renewed efforts in antibiotic drug discovery. Fluoroquinolones are broad-spectrum antibacterials that target DNA gyrase by stabilizing DNA-cleavage complexes, but their clinical utility has been compromised by resistance. We have identified a class of antibacterial thiophenes that target DNA gyrase with a unique mechanism of action and have activity against a range of bacterial pathogens, including strains resistant to fluoroquinolones. Although fluoroquinolones stabilize double-stranded DNA breaks, the antibacterial thiophenes stabilize gyrase-mediated DNA-cleavage complexes in either one DNA strand or both DNA strands. X-ray crystallography of DNA gyrase-DNA complexes shows the compounds binding to a protein pocket between the winged helix domain and topoisomerase-primase domain, remote from the DNA. Mutations of conserved residues around this pocket affect activity of the thiophene inhibitors, consistent with allosteric inhibition of DNA gyrase. This druggable pocket provides potentially complementary opportunities for targeting bacterial topoisomerases for antibiotic development.

The POLD3 subunit of DNA polymerase δ can promote translesion synthesis independently of DNA polymerase ζ

PubMed Central

Hirota, Kouji; Yoshikiyo, Kazunori; Guilbaud, Guillaume; Tsurimoto, Toshiki; Murai, Junko; Tsuda, Masataka; Phillips, Lara G.; Narita, Takeo; Nishihara, Kana; Kobayashi, Kaori; Yamada, Kouich; Nakamura, Jun; Pommier, Yves; Lehmann, Alan; Sale, Julian E.; Takeda, Shunichi

2015-01-01

The replicative DNA polymerase Polδ consists of a catalytic subunit POLD1/p125 and three regulatory subunits POLD2/p50, POLD3/p66 and POLD4/p12. The ortholog of POLD3 in Saccharomyces cerevisiae, Pol32, is required for a significant proportion of spontaneous and UV-induced mutagenesis through its additional role in translesion synthesis (TLS) as a subunit of DNA polymerase ζ. Remarkably, chicken DT40 B lymphocytes deficient in POLD3 are viable and able to replicate undamaged genomic DNA with normal kinetics. Like its counterpart in yeast, POLD3 is required for fully effective TLS, its loss resulting in hypersensitivity to a variety of DNA damaging agents, a diminished ability to maintain replication fork progression after UV irradiation and a significant decrease in abasic site-induced mutagenesis in the immunoglobulin loci. However, these defects appear to be largely independent of Polζ, suggesting that POLD3 makes a significant contribution to TLS independently of Polζ in DT40 cells. Indeed, combining polη, polζ and pold3 mutations results in synthetic lethality. Additionally, we show in vitro that POLD3 promotes extension beyond an abasic by the Polδ holoenzyme suggesting that while POLD3 is not required for normal replication, it may help Polδ to complete abasic site bypass independently of canonical TLS polymerases. PMID:25628356

Mitochondrial transcription terminator family members mTTF and mTerf5 have opposing roles in coordination of mtDNA synthesis.

PubMed

Jõers, Priit; Lewis, Samantha C; Fukuoh, Atsushi; Parhiala, Mikael; Ellilä, Simo; Holt, Ian J; Jacobs, Howard T

2013-01-01

All genomes require a system for avoidance or handling of collisions between the machineries of DNA replication and transcription. We have investigated the roles in this process of the mTERF (mitochondrial transcription termination factor) family members mTTF and mTerf5 in Drosophila melanogaster. The two mTTF binding sites in Drosophila mtDNA, which also bind mTerf5, were found to coincide with major sites of replication pausing. RNAi-mediated knockdown of either factor resulted in mtDNA depletion and developmental arrest. mTTF knockdown decreased site-specific replication pausing, but led to an increase in replication stalling and fork regression in broad zones around each mTTF binding site. Lagging-strand DNA synthesis was impaired, with extended RNA/DNA hybrid segments seen in replication intermediates. This was accompanied by the accumulation of recombination intermediates and nicked/broken mtDNA species. Conversely, mTerf5 knockdown led to enhanced replication pausing at mTTF binding sites, a decrease in fragile replication intermediates containing single-stranded segments, and the disappearance of species containing segments of RNA/DNA hybrid. These findings indicate an essential and previously undescribed role for proteins of the mTERF family in the integration of transcription and DNA replication, preventing unregulated collisions and facilitating productive interactions between the two machineries that are inferred to be essential for completion of lagging-strand DNA synthesis.

Mitochondrial Transcription Terminator Family Members mTTF and mTerf5 Have Opposing Roles in Coordination of mtDNA Synthesis

PubMed Central

Jõers, Priit; Lewis, Samantha C.; Fukuoh, Atsushi; Parhiala, Mikael; Ellilä, Simo; Holt, Ian J.; Jacobs, Howard T.

2013-01-01

All genomes require a system for avoidance or handling of collisions between the machineries of DNA replication and transcription. We have investigated the roles in this process of the mTERF (mitochondrial transcription termination factor) family members mTTF and mTerf5 in Drosophila melanogaster. The two mTTF binding sites in Drosophila mtDNA, which also bind mTerf5, were found to coincide with major sites of replication pausing. RNAi-mediated knockdown of either factor resulted in mtDNA depletion and developmental arrest. mTTF knockdown decreased site-specific replication pausing, but led to an increase in replication stalling and fork regression in broad zones around each mTTF binding site. Lagging-strand DNA synthesis was impaired, with extended RNA/DNA hybrid segments seen in replication intermediates. This was accompanied by the accumulation of recombination intermediates and nicked/broken mtDNA species. Conversely, mTerf5 knockdown led to enhanced replication pausing at mTTF binding sites, a decrease in fragile replication intermediates containing single-stranded segments, and the disappearance of species containing segments of RNA/DNA hybrid. These findings indicate an essential and previously undescribed role for proteins of the mTERF family in the integration of transcription and DNA replication, preventing unregulated collisions and facilitating productive interactions between the two machineries that are inferred to be essential for completion of lagging-strand DNA synthesis. PMID:24068965

Serine Metabolism Supports the Methionine Cycle and DNA/RNA Methylation through De Novo ATP Synthesis in Cancer Cells

PubMed Central

Maddocks, Oliver D.K.; Labuschagne, Christiaan F.; Adams, Peter D.; Vousden, Karen H.

2016-01-01

Summary Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids. PMID:26774282

Serine Metabolism Supports the Methionine Cycle and DNA/RNA Methylation through De Novo ATP Synthesis in Cancer Cells.

PubMed

Maddocks, Oliver D K; Labuschagne, Christiaan F; Adams, Peter D; Vousden, Karen H

2016-01-21

Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Nicotine inhibits collagen synthesis and alkaline phosphatase activity, but stimulates DNA synthesis in osteoblast-like cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ramp, W.K.; Lenz, L.G.; Galvin, R.J.

1991-05-01

Use of smokeless tobacco is associated with various oral lesions including periodontal damage and alveolar bone loss. This study was performed to test the effects of nicotine on bone-forming cells at concentrations that occur in the saliva of smokeless tobacco users. Confluent cultures of osteoblast-like cells isolated from chick embryo calvariae were incubated for 2 days with nicotine added to the culture medium (25-600 micrograms/ml). Nicotine inhibited alkaline phosphatase in the cell layer and released to the medium, whereas glycolysis (as indexed by lactate production) was unaffected or slightly elevated. The effects on medium and cell layer alkaline phosphatase weremore » concentration dependent with maximal inhibition occurring at 600 micrograms nicotine/ml. Nicotine essentially did not affect the noncollagenous protein content of the cell layer, but did inhibit collagen synthesis (hydroxylation of ({sup 3}H)proline and collagenase-digestible protein) at 100, 300, and 600 micrograms/ml. Release of ({sup 3}H)hydroxyproline to the medium was also decreased in a dose-dependent manner, as was the collagenase-digestible protein for both the medium and cell layer. In contrast, DNA synthesis (incorporation of ({sup 3}H)thymidine) was more than doubled by the alkaloid, whereas total DNA content was slightly inhibited at 600 micrograms/ml, suggesting stimulated cell turnover. Morphologic changes occurred in nicotine-treated cells including rounding up, detachment, and the occurrence of numerous large vacuoles. These results suggest that steps to reduce the salivary concentration of nicotine in smokeless tobacco users might diminish damaging effects of this product on alveolar bone.« less

Efficient Sleeping Beauty DNA Transposition From DNA Minicircles

PubMed Central

Sharma, Nynne; Cai, Yujia; Bak, Rasmus O; Jakobsen, Martin R; Schrøder, Lisbeth Dahl; Mikkelsen, Jacob Giehm

2013-01-01

DNA transposon-based vectors have emerged as new potential delivery tools in therapeutic gene transfer. Such vectors are now showing promise in hematopoietic stem cells and primary human T cells, and clinical trials with transposon-engineered cells are on the way. However, the use of plasmid DNA as a carrier of the vector raises safety concerns due to the undesirable administration of bacterial sequences. To optimize vectors based on the Sleeping Beauty (SB) DNA transposon for clinical use, we examine here SB transposition from DNA minicircles (MCs) devoid of the bacterial plasmid backbone. Potent DNA transposition, directed by the hyperactive SB100X transposase, is demonstrated from MC donors, and the stable transfection rate is significantly enhanced by expressing the SB100X transposase from MCs. The stable transfection rate is inversely related to the size of circular donor, suggesting that a MC-based SB transposition system benefits primarily from an increased cellular uptake and/or enhanced expression which can be observed with DNA MCs. DNA transposon and transposase MCs are easily produced, are favorable in size, do not carry irrelevant DNA, and are robust substrates for DNA transposition. In accordance, DNA MCs should become a standard source of DNA transposons not only in therapeutic settings but also in the daily use of the SB system. PMID:23443502

Two distinct modes of RecA action are required for DNA polymerase V-catalyzed translesion synthesis

PubMed Central

Pham, Phuong; Seitz, Erica M.; Saveliev, Sergei; Shen, Xuan; Woodgate, Roger; Cox, Michael M.; Goodman, Myron F.

2002-01-01

SOS mutagenesis in Escherichia coli requires DNA polymerase V (pol V) and RecA protein to copy damaged DNA templates. Here we show that two distinct biochemical modes for RecA protein are necessary for pol V-catalyzed translesion synthesis. One RecA mode is characterized by a strong stimulation in nucleotide incorporation either directly opposite a lesion or at undamaged template sites, but by the absence of lesion bypass. A separate RecA mode is necessary for translesion synthesis. The RecA1730 mutant protein, which was identified on the basis of its inability to promote pol V (UmuD′2C)-dependent UV-mutagenesis, appears proficient for the first mode of RecA action but is deficient in the second mode. Data are presented suggesting that the two RecA modes are “nonfilamentous”. That is, contrary to current models for SOS mutagenesis, formation of a RecA nucleoprotein filament may not be required for copying damaged DNA templates. Instead, SOS mutagenesis occurs when pol V interacts with two RecA molecules, first at a 3′ primer end, upstream of a template lesion, where RecA mode 1 stimulates pol V activity, and subsequently at a site immediately downstream of the lesion, where RecA mode 2 cocatalyzes lesion bypass. We posit that in vivo assembly of a RecA nucleoprotein filament may be required principally to target pol V to a site of DNA damage and to stabilize the pol V-RecA interaction at the lesion. However, it is only a RecA molecule located at the 3′ filament tip, proximal to a damaged template base, that is directly responsible for translesion synthesis. PMID:12177433

Combined Use of 16S Ribosomal DNA and 16S rRNA To Study the Bacterial Community of Polychlorinated Biphenyl-Polluted Soil

PubMed Central

Nogales, Balbina; Moore, Edward R. B.; Llobet-Brossa, Enrique; Rossello-Mora, Ramon; Amann, Rudolf; Timmis, Kenneth N.

2001-01-01

The bacterial diversity assessed from clone libraries prepared from rRNA (two libraries) and ribosomal DNA (rDNA) (one library) from polychlorinated biphenyl (PCB)-polluted soil has been analyzed. A good correspondence of the community composition found in the two types of library was observed. Nearly 29% of the cloned sequences in the rDNA library were identical to sequences in the rRNA libraries. More than 60% of the total cloned sequence types analyzed were grouped in phylogenetic groups (a clone group with sequence similarity higher than 97% [98% for Burkholderia and Pseudomonas-type clones]) represented in both types of libraries. Some of those phylogenetic groups, mostly represented by a single (or pair) of cloned sequence type(s), were observed in only one of the types of library. An important difference between the libraries was the lack of clones representative of the Actinobacteria in the rDNA library. The PCB-polluted soil exhibited a high bacterial diversity which included representatives of two novel lineages. The apparent abundance of bacteria affiliated to the beta-subclass of the Proteobacteria, and to the genus Burkholderia in particular, was confirmed by fluorescence in situ hybridization analysis. The possible influence on apparent diversity of low template concentrations was assessed by dilution of the RNA template prior to amplification by reverse transcription-PCR. Although differences in the composition of the two rRNA libraries obtained from high and low RNA concentrations were observed, the main components of the bacterial community were represented in both libraries, and therefore their detection was not compromised by the lower concentrations of template used in this study. PMID:11282645

Synthesis of structurally diverse major groove DNA interstrand crosslinks using three different aldehyde precursors

PubMed Central

Mukherjee, Shivam; Guainazzi, Angelo; Schärer, Orlando D.

2014-01-01

DNA interstrand crosslinks (ICLs) are extremely cytotoxic lesions that block essential cellular processes, such as replication and transcription. Crosslinking agents are widely used in cancer chemotherapy and form an array of structurally diverse ICLs. Despite the clinical success of these agents, resistance of tumors to crosslinking agents, for example, through repair of these lesions by the cellular machinery remains a problem. We have previously reported the synthesis of site-specific ICLs mimicking those formed by nitrogen mustards to facilitate the studies of cellular responses to ICL formation. Here we extend these efforts and report the synthesis of structurally diverse major groove ICLs that induce severe, little or no distortion in the DNA. Our approach employs the incorporation of aldehyde precursors of different lengths into complementary strands and ICL formation using a double reductive amination with a variety of amines. Our studies provide insight into the structure and reactivity parameters of ICL formation by double reductive amination and yield a set of diverse ICLs that will be invaluable for exploring structure–activity relationships in ICL repair. PMID:24782532

DNA topoisomerase I and DNA gyrase as targets for TB therapy.

PubMed

Nagaraja, Valakunja; Godbole, Adwait A; Henderson, Sara R; Maxwell, Anthony

2017-03-01

Tuberculosis (TB) is the deadliest bacterial disease in the world. New therapeutic agents are urgently needed to replace existing drugs for which resistance is a significant problem. DNA topoisomerases are well-validated targets for antimicrobial and anticancer chemotherapies. Although bacterial topoisomerase I has yet to be exploited as a target for clinical antibiotics, DNA gyrase has been extensively targeted, including the highly clinically successful fluoroquinolones, which have been utilized in TB therapy. Here, we review the exploitation of topoisomerases as antibacterial targets and summarize progress in developing new agents to target DNA topoisomerase I and DNA gyrase from Mycobacterium tuberculosis. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.

DNA polymerase V activity is autoregulated by a novel intrinsic DNA-dependent ATPase

PubMed Central

Erdem, Aysen L; Jaszczur, Malgorzata; Bertram, Jeffrey G; Woodgate, Roger; Cox, Michael M; Goodman, Myron F

2014-01-01

Escherichia coli DNA polymerase V (pol V), a heterotrimeric complex composed of UmuD′2C, is marginally active. ATP and RecA play essential roles in the activation of pol V for DNA synthesis including translesion synthesis (TLS). We have established three features of the roles of ATP and RecA. (1) RecA-activated DNA polymerase V (pol V Mut), is a DNA-dependent ATPase; (2) bound ATP is required for DNA synthesis; (3) pol V Mut function is regulated by ATP, with ATP required to bind primer/template (p/t) DNA and ATP hydrolysis triggering dissociation from the DNA. Pol V Mut formed with an ATPase-deficient RecA E38K/K72R mutant hydrolyzes ATP rapidly, establishing the DNA-dependent ATPase as an intrinsic property of pol V Mut distinct from the ATP hydrolytic activity of RecA when bound to single-stranded (ss)DNA as a nucleoprotein filament (RecA*). No similar ATPase activity or autoregulatory mechanism has previously been found for a DNA polymerase. DOI: http://dx.doi.org/10.7554/eLife.02384.001 PMID:24843026

Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA

DTIC Science & Technology

2005-09-01

tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such

DNA Polymorphisms and Biocontrol of Bacillus Antagonistic to Citrus Bacterial Canker with Indication of the Interference of Phyllosphere Biofilms

PubMed Central

Huang, Tzu-Pi; Tzeng, Dean Der-Syh; Wong, Amy C. L.; Chen, Chun-Han; Lu, Kuan-Min; Lee, Ya-Huei; Huang, Wen-Di; Hwang, Bing-Fang; Tzeng, Kuo-Ching

2012-01-01

Citrus bacterial canker caused by Xanthomonas axonopodis pv. citri is a devastating disease resulting in significant crop losses in various citrus cultivars worldwide. A biocontrol agent has not been recommended for this disease. To explore the potential of bacilli native to Taiwan to control this disease, Bacillus species with a broad spectrum of antagonistic activity against various phytopathogens were isolated from plant potting mixes, organic compost and the rhizosphere soil. Seven strains TKS1-1, OF3-16, SP4-17, HSP1, WG6-14, TLB7-7, and WP8-12 showing superior antagonistic activity were chosen for biopesticide development. The genetic identity based on 16S rDNA sequences indicated that all seven native strains were close relatives of the B. subtilis group and appeared to be discrete from the B. cereus group. DNA polymorphisms in strains WG6-14, SP4-17, TKS1-1, and WP8-12, as revealed by repetitive sequence-based PCR with the BOXA1R primers were similar to each other, but different from those of the respective Bacillus type strains. However, molecular typing of the strains using either tDNA-intergenic spacer regions or 16S–23S intergenic transcribed spacer regions was unable to differentiate the strains at the species level. Strains TKS1-1 and WG6-14 attenuated symptom development of citrus bacterial canker, which was found to be correlated with a reduction in colonization and biofilm formation by X. axonopodis pv. citri on leaf surfaces. The application of a Bacillus strain TKS1-1 endospore formulation to the leaf surfaces of citrus reduced the incidence of citrus bacterial canker and could prevent development of the disease. PMID:22848728

Host DNA synthesis-suppressing factor in culture fluid of tissue cultures infected with measles virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Minagawa, T.; Nakaya, C.; Iida, H.

1974-05-01

Host DNA synthesis is suppressed by the culture fluid of cell cultures infected with measles virus. This activity in the culture fluid is initiated somewhat later than the growth of infectious virus. Ninety percent of host DNA synthesis in HeLa cells is inhibited by culture fluid of 3-day-old cell cultures of Vero or HeLa cells infected with measles virus. This suppressing activity is not a property of the virion, but is due to nonvirion-associated componentnent which shows none of the activities of measles virus such as hemagglutination, hemolysis, or cell fusion nor does it have the antigenicity of measles virusmore » as tested by complement-fixation or hemagglutination-inhibiting antibody blocking tests. Neutralization of the activity of this component is not attained with the pooled sera of convalescent measles patients. This component has molecular weights of about 45,000, 20,000, and 3,000 and appears to be a heat-stable protein. The production of host DNA suppressing factor (DSF) is blocked by cycloheximide. Neither uv-inactivated nor antiserum-neutralized measles virus produce DSF. Furthermore, such activity of nonvirion-associated component is not detected in the culture fluid of cultures infected with other RNA viruses such as poliovirus, vesicular stomatitis virus, or Sindbis virus. (auth)« less

Host DNA Synthesis-Suppressing Factor in Culture Fluid of Tissue Cultures Infected with Measles Virus

PubMed Central

Minagawa, Tomonori; Nakaya, Chikako; Iida, Hiroo

1974-01-01

Host DNA synthesis is suppressed by the culture fluid of cell cultures infected with measles virus. This activity in the culture fluid is initiated somewhat later than the growth of infectious virus. Ninety percent of host DNA synthesis in HeLa cells is inhibited by culture fluid of 3-day-old cell cultures of Vero or HeLa cells infected with measles virus. This suppressing activity is not a property of the virion, but is due to nonvirion-associated component which shows none of the activities of measles virus such as hemagglutination, hemolysis, or cell fusion nor does it have the antigenicity of measles virus as tested by complement-fixation or hemagglutination-inhibiting antibody blocking tests. Neutralization of the activity of this component is not attained with the pooled sera of convalescent measles patients. This component has molecular weights of about 45,000, 20,000, and 3,000 and appears to be a heat-stable protein. The production of host DNA suppressing factor (DSF) is blocked by cycloheximide. Neither UV-inactivated nor antiserum-neutralized measles virus produce DSF. Furthermore, such activity of nonvirion-associated component is not detected in the culture fluid of cultures infected with other RNA viruses such as poliovirus, vesicular stomatitis virus, or Sindbis virus. PMID:4207526

Modeling the integration of bacterial rRNA fragments into the human cancer genome.

PubMed

Sieber, Karsten B; Gajer, Pawel; Dunning Hotopp, Julie C

2016-03-21

Cancer is a disease driven by the accumulation of genomic alterations, including the integration of exogenous DNA into the human somatic genome. We previously identified in silico evidence of DNA fragments from a Pseudomonas-like bacteria integrating into the 5'-UTR of four proto-oncogenes in stomach cancer sequencing data. The functional and biological consequences of these bacterial DNA integrations remain unknown. Modeling of these integrations suggests that the previously identified sequences cover most of the sequence flanking the junction between the bacterial and human DNA. Further examination of these reads reveals that these integrations are rich in guanine nucleotides and the integrated bacterial DNA may have complex transcript secondary structures. The models presented here lay the foundation for future experiments to test if bacterial DNA integrations alter the transcription of the human genes.

Homologous Recombination and Translesion DNA Synthesis Play Critical Roles on Tolerating DNA Damage Caused by Trace Levels of Hexavalent Chromium

PubMed Central

Chen, Youjun; Zhou, Yi-Hui; Neo, Dayna; Clement, Jean; Takata, Minoru; Takeda, Shunichi; Sale, Julian; Wright, Fred A.; Swenberg, James A.; Nakamura, Jun

2016-01-01

Contamination of potentially carcinogenic hexavalent chromium (Cr(VI)) in the drinking water is a major public health concern worldwide. However, little information is available regarding the biological effects of a nanomoler amount of Cr(VI). Here, we investigated the genotoxic effects of Cr(VI) at nanomoler levels and their repair pathways. We found that DNA damage response analyzed based on differential toxicity of isogenic cells deficient in various DNA repair proteins is observed after a three-day incubation with K2CrO4 in REV1-deficient DT40 cells at 19.2 μg/L or higher as well as in TK6 cells deficient in polymerase delta subunit 3 (POLD3) at 9.8 μg/L or higher. The genotoxicity of Cr(VI) decreased ~3000 times when the incubation time was reduced from three days to ten minutes. TK mutation rate also significantly decreased from 6 day to 1 day exposure to Cr(VI). The DNA damage response analysis suggest that DNA repair pathways, including the homologous recombination and REV1- and POLD3-mediated error-prone translesion synthesis pathways, are critical for the cells to tolerate to DNA damage caused by trace amount of Cr(VI). PMID:27907204

Options for Synthetic DNA Order Screening, Revisited.

PubMed

DiEuliis, Diane; Carter, Sarah R; Gronvall, Gigi Kwik