Sample records for bacterial domain evidence

  1. The perturbation of tryptophan fluorescence by phenylalanine to alanine mutations identifies the hydrophobic core in a subset of bacterial Ig-like domains.

    PubMed

    Raman, Rajeev; Ptak, Christopher P; Hsieh, Ching-Lin; Oswald, Robert E; Chang, Yung-Fu; Sharma, Yogendra

    2013-07-09

    Many host-parasite interactions are mediated via surface-exposed proteins containing bacterial immunoglobulin-like (Big) domains. Here, we utilize the spectral properties of a conserved Trp to provide evidence that, along with a Phe, these residues are positioned within the hydrophobic core of a subset of Big_2 domains. The mutation of the Phe to Ala decreases Big_2 domain stability and impairs the ability of LigBCen2 to bind to the host protein, fibronectin.

  2. Observational evidence and strength of evidence domains: case examples

    PubMed Central

    2014-01-01

    Background Systematic reviews of healthcare interventions most often focus on randomized controlled trials (RCTs). However, certain circumstances warrant consideration of observational evidence, and such studies are increasingly being included as evidence in systematic reviews. Methods To illustrate the use of observational evidence, we present case examples of systematic reviews in which observational evidence was considered as well as case examples of individual observational studies, and how they demonstrate various strength of evidence domains in accordance with current Agency for Healthcare Research and Quality (AHRQ) Evidence-based Practice Center (EPC) methods guidance. Results In the presented examples, observational evidence is used when RCTs are infeasible or raise ethical concerns, lack generalizability, or provide insufficient data. Individual study case examples highlight how observational evidence may fulfill required strength of evidence domains, such as study limitations (reduced risk of selection, detection, performance, and attrition); directness; consistency; precision; and reporting bias (publication, selective outcome reporting, and selective analysis reporting), as well as additional domains of dose-response association, plausible confounding that would decrease the observed effect, and strength of association (magnitude of effect). Conclusions The cases highlighted in this paper demonstrate how observational studies may provide moderate to (rarely) high strength evidence in systematic reviews. PMID:24758494

  3. The crystal structures of EAP domains from Staphylococcus aureus reveal an unexpected homology to bacterial superantigens.

    PubMed

    Geisbrecht, Brian V; Hamaoka, Brent Y; Perman, Benjamin; Zemla, Adam; Leahy, Daniel J

    2005-04-29

    The Eap (extracellular adherence protein) of Staphylococcus aureus functions as a secreted virulence factor by mediating interactions between the bacterial cell surface and several extracellular host proteins. Eap proteins from different Staphylococcal strains consist of four to six tandem repeats of a structurally uncharacterized domain (EAP domain). We have determined the three-dimensional structures of three different EAP domains to 1.8, 2.2, and 1.35 A resolution, respectively. These structures reveal a core fold that is comprised of an alpha-helix lying diagonally across a five-stranded, mixed beta-sheet. Comparison of EAP domains with known structures reveals an unexpected homology with the C-terminal domain of bacterial superantigens. Examination of the structure of the superantigen SEC2 bound to the beta-chain of a T-cell receptor suggests a possible ligand-binding site within the EAP domain (Fields, B. A., Malchiodi, E. L., Li, H., Ysern, X., Stauffacher, C. V., Schlievert, P. M., Karjalainen, K., and Mariuzza, R. (1996) Nature 384, 188-192). These results provide the first structural characterization of EAP domains, relate EAP domains to a large class of bacterial toxins, and will guide the design of future experiments to analyze EAP domain structure/function relationships.

  4. Big domains are novel Ca²+-binding modules: evidences from big domains of Leptospira immunoglobulin-like (Lig) proteins.

    PubMed

    Raman, Rajeev; Rajanikanth, V; Palaniappan, Raghavan U M; Lin, Yi-Pin; He, Hongxuan; McDonough, Sean P; Sharma, Yogendra; Chang, Yung-Fu

    2010-12-29

    Many bacterial surface exposed proteins mediate the host-pathogen interaction more effectively in the presence of Ca²+. Leptospiral immunoglobulin-like (Lig) proteins, LigA and LigB, are surface exposed proteins containing Bacterial immunoglobulin like (Big) domains. The function of proteins which contain Big fold is not known. Based on the possible similarities of immunoglobulin and βγ-crystallin folds, we here explore the important question whether Ca²+ binds to a Big domains, which would provide a novel functional role of the proteins containing Big fold. We selected six individual Big domains for this study (three from the conserved part of LigA and LigB, denoted as Lig A3, Lig A4, and LigBCon5; two from the variable region of LigA, i.e., 9(th) (Lig A9) and 10(th) repeats (Lig A10); and one from the variable region of LigB, i.e., LigBCen2. We have also studied the conserved region covering the three and six repeats (LigBCon1-3 and LigCon). All these proteins bind the calcium-mimic dye Stains-all. All the selected four domains bind Ca²+ with dissociation constants of 2-4 µM. Lig A9 and Lig A10 domains fold well with moderate thermal stability, have β-sheet conformation and form homodimers. Fluorescence spectra of Big domains show a specific doublet (at 317 and 330 nm), probably due to Trp interaction with a Phe residue. Equilibrium unfolding of selected Big domains is similar and follows a two-state model, suggesting the similarity in their fold. We demonstrate that the Lig are Ca²+-binding proteins, with Big domains harbouring the binding motif. We conclude that despite differences in sequence, a Big motif binds Ca²+. This work thus sets up a strong possibility for classifying the proteins containing Big domains as a novel family of Ca²+-binding proteins. Since Big domain is a part of many proteins in bacterial kingdom, we suggest a possible function these proteins via Ca²+ binding.

  5. Role of the σ 54 Activator Interacting Domain in Bacterial Transcription Initiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Siegel, Alexander R.; Wemmer, David E.

    Bacterial sigma factors are subunits of RNA polymerase that direct the holoenzyme to specific sets of promoters in the genome and are a central element of regulating transcription. Most polymerase holoenzymes open the promoter and initiate transcription rapidly after binding. However, polymerase containing the members of the σ 54 family must be acted on by a transcriptional activator before DNA opening and initiation occur. A key domain in these transcriptional activators forms a hexameric AAA + ATPase that acts through conformational changes brought on by ATP hydrolysis. Contacts between the transcriptional activator and σ 54 are primarily made through anmore » N-terminal σ 54 activator interacting domain (AID). To better understand this mechanism of bacterial transcription initiation, we characterized the σ 54 AID by NMR spectroscopy and other biophysical methods and show that it is an intrinsically disordered domain in σ 54 alone. In this paper, we identified a minimal construct of the Aquifex aeolicus σ 54 AID that consists of two predicted helices and retains native-like binding affinity for the transcriptional activator NtrC1. Using the NtrC1 ATPase domain, bound with the non-hydrolyzable ATP analog ADP-beryllium fluoride, we studied the NtrC1–σ 54 AID complex using NMR spectroscopy. We show that the σ 54 AID becomes structured after associating with the core loops of the transcriptional activators in their ATP state and that the primary site of the interaction is the first predicted helix. Finally, understanding this complex, formed as the first step toward initiation, will help unravel the mechanism of σ 54 bacterial transcription initiation.« less

  6. Big Domains Are Novel Ca2+-Binding Modules: Evidences from Big Domains of Leptospira Immunoglobulin-Like (Lig) Proteins

    PubMed Central

    Palaniappan, Raghavan U. M.; Lin, Yi-Pin; He, Hongxuan; McDonough, Sean P.; Sharma, Yogendra; Chang, Yung-Fu

    2010-01-01

    Background Many bacterial surface exposed proteins mediate the host-pathogen interaction more effectively in the presence of Ca2+. Leptospiral immunoglobulin-like (Lig) proteins, LigA and LigB, are surface exposed proteins containing Bacterial immunoglobulin like (Big) domains. The function of proteins which contain Big fold is not known. Based on the possible similarities of immunoglobulin and βγ-crystallin folds, we here explore the important question whether Ca2+ binds to a Big domains, which would provide a novel functional role of the proteins containing Big fold. Principal Findings We selected six individual Big domains for this study (three from the conserved part of LigA and LigB, denoted as Lig A3, Lig A4, and LigBCon5; two from the variable region of LigA, i.e., 9th (Lig A9) and 10th repeats (Lig A10); and one from the variable region of LigB, i.e., LigBCen2. We have also studied the conserved region covering the three and six repeats (LigBCon1-3 and LigCon). All these proteins bind the calcium-mimic dye Stains-all. All the selected four domains bind Ca2+ with dissociation constants of 2–4 µM. Lig A9 and Lig A10 domains fold well with moderate thermal stability, have β-sheet conformation and form homodimers. Fluorescence spectra of Big domains show a specific doublet (at 317 and 330 nm), probably due to Trp interaction with a Phe residue. Equilibrium unfolding of selected Big domains is similar and follows a two-state model, suggesting the similarity in their fold. Conclusions We demonstrate that the Lig are Ca2+-binding proteins, with Big domains harbouring the binding motif. We conclude that despite differences in sequence, a Big motif binds Ca2+. This work thus sets up a strong possibility for classifying the proteins containing Big domains as a novel family of Ca2+-binding proteins. Since Big domain is a part of many proteins in bacterial kingdom, we suggest a possible function these proteins via Ca2+ binding. PMID:21206924

  7. Grasping the nettle: A bacterial invasin that targets immunoglobulin variable domains.

    PubMed

    Barlow, Paul

    2018-06-01

    In a new paper, the protein InvD from Yersinia pseudotuberculosis , a zoonotic pathogen, is shown to assist late-stage invasion of intestinal epithelia. Remarkably, InvD acts by binding the Fab region of IgG or IgA. It straddles adjacent light-chain and heavy-chain variable domains, but its binding is different from that of antigens in that complementarity-determining regions do not participate. Structure determination revealed that its Fab-interacting domain adopts an immunoglobulin-like fold, fused to the preceding immunoglobulin-like domain and carried on a long stalk anchored to the bacterial outer membrane. Possible roles of this unusual host-pathogen interaction include avoidance of clearance from the intestine by secretory IgA. © 2018 Barlow.

  8. Barriers and facilitators of evidence-based management of patients with bacterial infections among general dental practitioners: a theory-informed interview study.

    PubMed

    Newlands, Rumana; Duncan, Eilidh M; Prior, Maria; Elouafkaoui, Paula; Elders, Andrew; Young, Linda; Clarkson, Jan E; Ramsay, Craig R

    2016-01-29

    General dental practitioners (GDPs) regularly prescribe antibiotics to manage dental infections although most infections can be treated successfully by local measures. Published guidance to support GDPs to make appropriate prescribing decisions exists but there continues to be wide variation in dental antibiotic prescribing. An interview study was conducted as part of the Reducing Antibiotic Prescribing in Dentistry (RAPiD) trial to understand the barriers and facilitators of using local measures instead of prescribing antibiotics to manage bacterial infections. Thirty semi-structured one-to-one telephone interviews were conducted using the Theoretical Domains Framework (TDF). Responses were coded into domains of the TDF and sub-themes. Priority domains (high frequency: ≥50 % interviewees discussed) relevant to behaviour change were identified as targets for future intervention efforts and mapped onto 'intervention functions' of the Behaviour Change Wheel system. Five domains (behavioural regulation, social influences, reinforcement, environmental context and resources, and beliefs about consequences) with seven sub-themes were identified as targets for future intervention. All participants had knowledge about the evidence-based management of bacterial infections, but they reported difficulties in following this due to patient factors and time management. Lack of time was found to significantly influence their decision processes with regard to performing local measures. Beliefs about their capabilities to overcome patient influence, beliefs that performing local measures would impact on subsequent appointment times as well as there being no incentives for performing local measures were also featured. Though no knowledge or basic skills issues were identified, the participants suggested some continuous professional development programmes (e.g. time management, an overview of published guidance) to address some of the barriers. The domain results suggest a number

  9. Coexistence of domains with distinct order and polarity in fluid bacterial membranes.

    PubMed

    Vanounou, Sharon; Pines, Dina; Pines, Ehud; Parola, Abraham H; Fishov, Itzhak

    2002-07-01

    In this study we sought the detection and characterization of bacterial membrane domains. Fluorescence generalized polarization (GP) spectra of laurdan-labeled Escherichia coli and temperature dependencies of both laurdan's GP and fluorescence anisotropy of 1,3-diphenyl-1,3,5-hexatriene (DPH) (rDPH) affirmed that at physiological temperatures, the E. coli membrane is in a liquid-crystalline phase. However, the strong excitation wavelength dependence of rlaurdan at 37 degrees C reflects membrane heterogeneity. Time-resolved fluorescence emission spectra, which display distinct biphasic redshift kinetics, verified the coexistence of two subpopulations of laurdan. In the initial phase, <50 ps, the redshift in the spectral mass center is much faster for laurdan excited at the blue edge (350 nm), whereas at longer time intervals, similar kinetics is observed upon excitation at either blue or red edge (400 nm). Excitation in the blue region selects laurdan molecules presumably located in a lipid domain in which fast intramolecular relaxation and low anisotropy characterize laurdan's emission. In the proteo-lipid domain, laurdan motion and conformation are restricted as exhibited by a slower relaxation rate, higher anisotropy and a lower GP value. Triple-Gaussian decomposition of laurdan emission spectra showed a sharp phase transition in the temperature dependence of individual components when excited in the blue but not in the red region. At least two kinds of domains of distinct polarity and order are suggested to coexist in the liquid-crystalline bacterial membrane: a lipid-enriched and a proteolipid domain. In bacteria with chloramphenicol (Cam)-inhibited protein synthesis, laurdan showed reduced polarity and restoration of an isoemissive point in the temperature-dependent spectra. These results suggest a decrease in membrane heterogeneity caused by Cam-induced domain dissipation.

  10. Comparison of structure, function and regulation of plant cold shock domain proteins to bacterial and animal cold shock domain proteins.

    PubMed

    Chaikam, Vijay; Karlson, Dale T

    2010-01-01

    The cold shock domain (CSD) is among the most ancient and well conserved nucleic acid binding domains from bacteria to higher animals and plants. The CSD facilitates binding to RNA, ssDNA and dsDNA and most functions attributed to cold shock domain proteins are mediated by this nucleic acid binding activity. In prokaryotes, cold shock domain proteins only contain a single CSD and are termed cold shock proteins (Csps). In animal model systems, various auxiliary domains are present in addition to the CSD and are commonly named Y-box proteins. Similar to animal CSPs, plant CSPs contain auxiliary C-terminal domains in addition to their N-terminal CSD. Cold shock domain proteins have been shown to play important roles in development and stress adaptation in wide variety of organisms. In this review, the structure, function and regulation of plant CSPs are compared and contrasted to the characteristics of bacterial and animal CSPs. [BMB reports 2010; 43(1): 1-8].

  11. The crystal structure of a bacterial Sufu-like protein defines a novel group of bacterial proteins that are similar to the N-terminal domain of human Sufu

    PubMed Central

    Das, Debanu; Finn, Robert D; Abdubek, Polat; Astakhova, Tamara; Axelrod, Herbert L; Bakolitsa, Constantina; Cai, Xiaohui; Carlton, Dennis; Chen, Connie; Chiu, Hsiu-Ju; Chiu, Michelle; Clayton, Thomas; Deller, Marc C; Duan, Lian; Ellrott, Kyle; Farr, Carol L; Feuerhelm, Julie; Grant, Joanna C; Grzechnik, Anna; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K; Klock, Heath E; Knuth, Mark W; Kozbial, Piotr; Sri Krishna, S; Kumar, Abhinav; Lam, Winnie W; Marciano, David; Miller, Mitchell D; Morse, Andrew T; Nigoghossian, Edward; Nopakun, Amanda; Okach, Linda; Puckett, Christina; Reyes, Ron; Tien, Henry J; Trame, Christine B; van den Bedem, Henry; Weekes, Dana; Wooten, Tiffany; Xu, Qingping; Yeh, Andrew; Zhou, Jiadong; Hodgson, Keith O; Wooley, John; Elsliger, Marc-André; Deacon, Ashley M; Godzik, Adam; Lesley, Scott A; Wilson, Ian A

    2010-01-01

    Sufu (Suppressor of Fused), a two-domain protein, plays a critical role in regulating Hedgehog signaling and is conserved from flies to humans. A few bacterial Sufu-like proteins have previously been identified based on sequence similarity to the N-terminal domain of eukaryotic Sufu proteins, but none have been structurally or biochemically characterized and their function in bacteria is unknown. We have determined the crystal structure of a more distantly related Sufu-like homolog, NGO1391 from Neisseria gonorrhoeae, at 1.4 Å resolution, which provides the first biophysical characterization of a bacterial Sufu-like protein. The structure revealed a striking similarity to the N-terminal domain of human Sufu (r.m.s.d. of 2.6 Å over 93% of the NGO1391 protein), despite an extremely low sequence identity of ∼15%. Subsequent sequence analysis revealed that NGO1391 defines a new subset of smaller, Sufu-like proteins that are present in ∼200 bacterial species and has resulted in expansion of the SUFU (PF05076) family in Pfam. PMID:20836087

  12. Inference evaluation in a finite evidence domain

    NASA Astrophysics Data System (ADS)

    Ratway, Michael J.; Bellomo, Carryn

    2000-08-01

    Modeling of a target starts with a subject matter expert (SME) analysis of the available sensor(s) data. The SME then forms relationships between the data and known target attributes, called evidence, to support modeling of different types of targets or target activity. Speeds in the interval 10 to 30 knots and ranges less than 30 nautical miles are two samples of target evidence derived from sensor data. Evidence is then organized into sets to define the activities of a target and/or to distinguish different types of targets. For example, near an airport, target activities of takeoff, landing, and holding need to be evaluated in addition to target classification of civilian or commercial aircraft. This paper discusses a method for evaluation of the inferred activities over the finite evidence domain formed from the collection of models under consideration. The methodology accounts for repeated use of evidence in different models. For example, 'near an airport' is a required piece of evidence used repeatedly in the takeoff, landing, and holding models of a wide area sensor. Properties of the activity model evaluator methodology are discussed in terms of model construction and informal results are presented in a Boolean evidence type of problem domain.

  13. Human lysozyme possesses novel antimicrobial peptides within its N-terminal domain that target bacterial respiration.

    PubMed

    Ibrahim, Hisham R; Imazato, Kenta; Ono, Hajime

    2011-09-28

    Human milk lysozyme is thought to be a key defense factor in protecting the gastrointestinal tract of newborns against bacterial infection. Recently, evidence was found that pepsin, under conditions relevant to the newborn stomach, cleaves chicken lysozyme (cLZ) at specific loops to generate five antimicrobial peptide motifs. This study explores the antimicrobial role of the corresponding peptides of human lysozyme (hLZ), the actual protein in breast milk. Five peptide motifs of hLZ, one helix-loop-helix (HLH), its two helices (H1 and H2), and two helix-sheet motifs, H2-β-strands 1-2 (H2-S12) or H2-β-strands 1-3 (H2-S13), were synthesized and examined for antimicrobial action. The five peptides of hLZ exhibit microbicidal activity to various degrees against several bacterial strains. The HLH peptide and its N-terminal helix (H1) were significantly the most potent bactericidal to Gram-positive and Gram-negative bacteria and the fungus Candida albicans . Outer and inner membrane permeabilization studies, as well as measurements of transmembrane electrochemical potentials, provided evidence that HLH peptide and its N-terminal helix (H1) kill bacteria by crossing the outer membrane of Gram-negative bacteria via self-promoted uptake and are able to dissipate the membrane potential-dependent respiration of Gram-positive bacteria. This finding is the first to describe that hLZ possesses multiple antimicrobial peptide motifs within its N-terminal domain, providing insight into new classes of antibiotic peptides with potential use in the treatment of infectious diseases.

  14. Minimal domain of bacterial phytochrome required for chromophore binding and fluorescence

    NASA Astrophysics Data System (ADS)

    Rumyantsev, Konstantin A.; Shcherbakova, Daria M.; Zakharova, Natalia I.; Emelyanov, Alexander V.; Turoverov, Konstantin K.; Verkhusha, Vladislav V.

    2015-12-01

    Fluorescent proteins (FP) are used to study various biological processes. Recently, a series of near-infrared (NIR) FPs based on bacterial phytochromes was developed. Finding ways to improve NIR FPs is becoming progressively important. By applying rational design and molecular evolution we have engineered R. palustris bacterial phytochrome into a single-domain NIR FP of 19.6 kDa, termed GAF-FP, which is 2-fold and 1.4-fold smaller than bacterial phytochrome-based NIR FPs and GFP-like proteins, respectively. Engineering of GAF-FP involved a substitution of 15% of its amino acids and a deletion of the knot structure. GAF-FP covalently binds two tetrapyrrole chromophores, biliverdin (BV) and phycocyanobilin (PCB). With the BV chromophore GAF-FP absorbs at 635 nm and fluoresces at 670 nm. With the PCB chromophore GAF-FP becomes blue-shifted and absorbs at 625 nm and fluoresces at 657 nm. The GAF-FP structure has a high tolerance to small peptide insertions. The small size of GAF-FP and its additional absorbance band in the violet range has allowed for designing a chimeric protein with Renilla luciferase. The chimera exhibits efficient non-radiative energy transfer from luciferase to GAF-FP, resulting in NIR bioluminescence. This study opens the way for engineering of small NIR FPs and NIR luciferases from bacterial phytochromes.

  15. The Binary Toxin CDT of Clostridium difficile as a Tool for Intracellular Delivery of Bacterial Glucosyltransferase Domains.

    PubMed

    Beer, Lara-Antonia; Tatge, Helma; Schneider, Carmen; Ruschig, Maximilian; Hust, Michael; Barton, Jessica; Thiemann, Stefan; Fühner, Viola; Russo, Giulio; Gerhard, Ralf

    2018-06-01

    Binary toxins are produced by several pathogenic bacteria. Examples are the C2 toxin from Clostridium botulinum , the iota toxin from Clostridium perfringens, and the CDT from Clostridium difficile . All these binary toxins have ADP-ribosyltransferases (ADPRT) as their enzymatically active component that modify monomeric actin in their target cells. The binary C2 toxin was intensively described as a tool for intracellular delivery of allogenic ADPRTs. Here, we firstly describe the binary toxin CDT from C. difficile as an effective tool for heterologous intracellular delivery. Even 60 kDa glucosyltransferase domains of large clostridial glucosyltransferases can be delivered into cells. The glucosyltransferase domains of five tested large clostridial glucosyltransferases were successfully introduced into cells as chimeric fusions to the CDTa adapter domain (CDTaN). Cell uptake was demonstrated by the analysis of cell morphology, cytoskeleton staining, and intracellular substrate glucosylation. The fusion toxins were functional only when the adapter domain of CDTa was N -terminally located, according to its native orientation. Thus, like other binary toxins, the CDTaN/b system can be used for standardized delivery systems not only for bacterial ADPRTs but also for a variety of bacterial glucosyltransferase domains.

  16. The HD-GYP domain, cyclic di-GMP signaling, and bacterial virulence to plants.

    PubMed

    Dow, J Maxwell; Fouhy, Yvonne; Lucey, Jean F; Ryan, Robert P

    2006-12-01

    Cyclic di-GMP is an almost ubiquitous second messenger in bacteria that was first described as an allosteric activator of cellulose synthase but is now known to regulate a range of functions, including virulence in human and animal pathogens. Two protein domains, GGDEF and EAL, are implicated in the synthesis and degradation, respectively, of cyclic di-GMP. These domains are widely distributed in bacteria, including plant pathogens. The majority of proteins with GGDEF and EAL domains contain additional signal input domains, suggesting that their activities are responsive to environmental cues. Recent studies have demonstrated that a third domain, HD-GYP, is also active in cyclic di-GMP degradation. In the plant pathogen Xanthomonas campestris pv. campestris, a two-component signal transduction system comprising the HD-GYP domain regulatory protein RpfG and cognate sensor RpfC positively controls virulence. The signals recognized by RpfC may include the cell-cell signal DSF, which also acts to regulate virulence in X. campestris pv. campestris. Here, we review these recent advances in our understanding of cyclic di-GMP signaling with particular reference to one or more roles in the bacterial pathogenesis of plants.

  17. Bacterial natural product biosynthetic domain composition in soil correlates with changes in latitude on a continent-wide scale.

    PubMed

    Lemetre, Christophe; Maniko, Jeffrey; Charlop-Powers, Zachary; Sparrow, Ben; Lowe, Andrew J; Brady, Sean F

    2017-10-31

    Although bacterial bioactive metabolites have been one of the most prolific sources of lead structures for the development of small-molecule therapeutics, very little is known about the environmental factors associated with changes in secondary metabolism across natural environments. Large-scale sequencing of environmental microbiomes has the potential to shed light on the richness of bacterial biosynthetic diversity hidden in the environment, how it varies from one environment to the next, and what environmental factors correlate with changes in biosynthetic diversity. In this study, the sequencing of PCR amplicons generated using primers targeting either ketosynthase domains from polyketide biosynthesis or adenylation domains from nonribosomal peptide biosynthesis was used to assess biosynthetic domain composition and richness in soils collected across the Australian continent. Using environmental variables collected at each soil site, we looked for environmental factors that correlated with either high overall domain richness or changes in the domain composition. Among the environmental variables we measured, changes in biosynthetic domain composition correlate most closely with changes in latitude and to a lesser extent changes in pH. Although it is unclear at this time the exact mix of factors that may drive the relationship between biosynthetic domain composition and latitude, from a practical perspective the identification of a latitudinal basis for differences in soil metagenome biosynthetic domain compositions should help guide future natural product discovery efforts. Published under the PNAS license.

  18. Carbon fixation in sediments of Sino-Pacific seas-differential contributions of bacterial and archaeal domains

    NASA Astrophysics Data System (ADS)

    Das, Anindita; Cao, Wenrui; Zhang, Hongjie; Saren, Gaowa; Jiang, Mingyu; Yu, Xinke

    2017-11-01

    Oceanic stretches experiencing perpetual darkness and extreme limitation of utilizable organic matter often rely on chemosynthetic carbon (C)-fixation. However, C-fixation is not limited to carbon-deplete environments alone but might also occur in varying degrees in carbon-replete locales depending on the nature and concentration of utilizable carbon, electron donors and acceptors. Quantification of microbial C-fixation and relative contribution of domains bacteria and archaea are therefore crucial. The present experiment estimates the differential rates of C-fixation by archaea and bacteria along with the effects of different electron donors. Four Sino-Pacific marine sediments from Bashi strait (Western Pacific Warm Pool), East China Sea, South China Sea and Okinawa Trough were examined. Total microbial C-uptake was estimated by doping of aqueous NaH14CO3. Total bacterial C-uptake was measured by blocking archaeal metabolism using inhibitor GC7. Archaeal contribution was estimated by subtracting total bacterial from total microbial C-uptake. Effect of electron donor addition was analyzed by spiking with ammonium, sulfide, and reduced metals. Results suggested that C-fixation in marine sediments was not the function of archaea alone, which was in contrast to results from several recent publications. C-fixing bacteria are also equally active. Often in spite of great effort of one domain to fix carbon, the system does not become net C-fixing due to equal and opposite C-releasing activity of the other domain. Thus a C-releasing bacterial or archaeal community can become C-fixing with the change of nature and concentration of electron donors.

  19. Bacterial SPOR domains are recruited to septal peptidoglycan by binding to glycan strands that lack stem peptides

    PubMed Central

    Yahashiri, Atsushi; Jorgenson, Matthew A.; Weiss, David S.

    2015-01-01

    Bacterial SPOR domains bind peptidoglycan (PG) and are thought to target proteins to the cell division site by binding to “denuded” glycan strands that lack stem peptides, but uncertainties remain, in part because septal-specific binding has yet to be studied in a purified system. Here we show that fusions of GFP to SPOR domains from the Escherichia coli cell-division proteins DamX, DedD, FtsN, and RlpA all localize to septal regions of purified PG sacculi obtained from E. coli and Bacillus subtilis. Treatment of sacculi with an amidase that removes stem peptides enhanced SPOR domain binding, whereas treatment with a lytic transglycosylase that removes denuded glycans reduced SPOR domain binding. These findings demonstrate unequivocally that SPOR domains localize by binding to septal PG, that the physiologically relevant binding site is indeed a denuded glycan, and that denuded glycans are enriched in septal PG rather than distributed uniformly around the sacculus. Accumulation of denuded glycans in the septal PG of both E. coli and B. subtilis, organisms separated by 1 billion years of evolution, suggests that sequential removal of stem peptides followed by degradation of the glycan backbone is an ancient feature of PG turnover during bacterial cell division. Linking SPOR domain localization to the abundance of a structure (denuded glycans) present only transiently during biogenesis of septal PG provides a mechanism for coordinating the function of SPOR domain proteins with the progress of cell division. PMID:26305949

  20. L-arginine mediated renaturation enhances yield of human, α6 type IV collagen non-collagenous domain from bacterial inclusion bodies

    PubMed Central

    Gunda, Venugopal; Boosani, Chandra Shekhar; Verma, Raj Kumar; Guda, Chittibabu; Akul Sudhakar, Yakkanti

    2012-01-01

    The anti-angiogenic, carboxy terminal non-collagenous domain (NC1) derived from human Collagen type IV alpha 6 chain, [α6(IV)NC1] or hexastatin, was earlier obtained using different recombinant methods of expression in bacterial systems. However, the effect of L-arginine mediated renaturation in enhancing the relative yields of this protein from bacterial inclusion bodies has not been evaluated. In the present study, direct stirring and on-column renaturation methods using L-arginine and different size exclusion chromatography matrices were applied for enhancing the solubility in purifying the recombinant α6(IV)NC1 from bacterial inclusion bodies. This methodology enabled purification of higher quantities of soluble protein from inclusion bodies, which inhibited endothelial cell proliferation, migration and tube formation. Thus, the scope for L-arginine mediated renaturation in obtaining higher yields of soluble, biologically active NC1 domain from bacterial inclusion bodies was evaluated. PMID:22512648

  1. L-arginine mediated renaturation enhances yield of human, α6 Type IV collagen non-collagenous domain from bacterial inclusion bodies.

    PubMed

    Gunda, Venugopal; Boosani, Chandra Shekhar; Verma, Raj Kumar; Guda, Chittibabu; Sudhakar, Yakkanti Akul

    2012-10-01

    The anti-angiogenic, carboxy terminal non-collagenous domain (NC1) derived from human Collagen type IV alpha 6 chain, [α6(IV)NC1] or hexastatin, was earlier obtained using different recombinant methods of expression in bacterial systems. However, the effect of L-arginine mediated renaturation in enhancing the relative yields of this protein from bacterial inclusion bodies has not been evaluated. In the present study, direct stirring and on-column renaturation methods using L-arginine and different size exclusion chromatography matrices were applied for enhancing the solubility in purifying the recombinant α6(IV)NC1 from bacterial inclusion bodies. This methodology enabled purification of higher quantities of soluble protein from inclusion bodies, which inhibited endothelial cell proliferation, migration and tube formation. Thus, the scope for L-arginine mediated renaturation in obtaining higher yields of soluble, biologically active NC1 domain from bacterial inclusion bodies was evaluated.

  2. Bacterially produced human B7-1 protein encompassing its complete extracellular domain maintains its costimulatory activity in vitro.

    PubMed

    Shen, W; Wang, Y; Geng, Y; Si, L

    2000-08-01

    To investigate which of the two immunoglobulin (Ig)-like domains, immunoglobulin variable region homologous domain IgV (hB7-1 IgV), or immunoglobulin constant region homologous domain IgC (hB7-1 IgC) on human B7-1 molecule contain the receptor binding sites, and to evaluate if the B7-1 molecule expressed in bacteria has biological activity. PCR was used to amplify three fragments of hB7-1 IgV, hB7-1 IgC and complete extracellular region of human B7-1 containing both the IgV and IgC domains (hB7-1 IgV + IgC). Three recombinants, pQE9-hB7-1 IgV, pQE9-hB7-1 IgC and pQE9-Hb7-1 (IgV + IgC) were generated by cloning the PCR products into a prokaryote expression plasmid (pQE-9) and were introduced into the host stain M15. The relevant target hexahistidine-tagged proteins were identified by SDS-PAGE and Western blotting. With the presence of the first signal imitated by anti-CD3 antibody, T cell activation was observed by exposing purified T lymphocytes to each soluble form of the three bacterially-produced human B7-1 proteins and [3H]-TdR incorporation. Three recombinant proteins of human B7-1, hB7-1 IgV, hB7-1 IgC and hB7-1 (IgV + IgC) were produced and detected in both soluble and inclusive body forms from engineered bacterial cells. With the presence of anti-CD3 antibody, T lymphocytes proliferated when co-stimulated by bacterially produced hB7-1 (IgV + IgC), but not by either hB7-1 IgV or hB7-1 IgC. Functional glycoprotein human B7-1 could be produced in bacterial cells. Both extracellular immunoglobulin-like domains are necessary for B7-1 to react with its counter receptors.

  3. Identification of a novel calcium binding motif based on the detection of sequence insertions in the animal peroxidase domain of bacterial proteins.

    PubMed

    Santamaría-Hernando, Saray; Krell, Tino; Ramos-González, María-Isabel

    2012-01-01

    Proteins of the animal heme peroxidase (ANP) superfamily differ greatly in size since they have either one or two catalytic domains that match profile PS50292. The orf PP_2561 of Pseudomonas putida KT2440 that we have called PepA encodes a two-domain ANP. The alignment of these domains with those of PepA homologues revealed a variable number of insertions with the consensus G-x-D-G-x-x-[GN]-[TN]-x-D-D. This motif has also been detected in the structure of pseudopilin (pdb 3G20), where it was found to be involved in Ca(2+) coordination although a sequence analysis did not reveal the presence of any known calcium binding motifs in this protein. Isothermal titration calorimetry revealed that a peptide containing this consensus motif bound specifically calcium ions with affinities ranging between 33-79 µM depending on the pH. Microcalorimetric titrations of the purified N-terminal ANP-like domain of PepA revealed Ca(2+) binding with a K(D) of 12 µM and stoichiometry of 1.25 calcium ions per protein monomer. This domain exhibited peroxidase activity after its reconstitution with heme. These data led to the definition of a novel calcium binding motif that we have termed PERCAL and which was abundantly present in animal peroxidase-like domains of bacterial proteins. Bacterial heme peroxidases thus possess two different types of calcium binding motifs, namely PERCAL and the related hemolysin type calcium binding motif, with the latter being located outside the catalytic domains and in their C-terminal end. A phylogenetic tree of ANP-like catalytic domains of bacterial proteins with PERCAL motifs, including single domain peroxidases, was divided into two major clusters, representing domains with and without PERCAL motif containing insertions. We have verified that the recently reported classification of bacterial heme peroxidases in two families (cd09819 and cd09821) is unrelated to these insertions. Sequences matching PERCAL were detected in all kingdoms of life.

  4. Functional Analysis of a Bacterial Antifreeze Protein Indicates a Cooperative Effect between Its Two Ice-Binding Domains.

    PubMed

    Wang, Chen; Oliver, Erin E; Christner, Brent C; Luo, Bing-Hao

    2016-07-19

    Antifreeze proteins make up a class of ice-binding proteins (IBPs) that are possessed and expressed by certain cold-adapted organisms to enhance their freezing tolerance. Here we report the biophysical and functional characterization of an IBP discovered in a bacterium recovered from a deep glacial ice core drilled at Vostok Station, Antarctica (IBPv). Our study showed that the recombinant protein rIBPv exhibited a thermal hysteresis of 2 °C at concentrations of >50 μM, effectively inhibited ice recrystallization, and enhanced bacterial viability during freeze-thaw cycling. Circular dichroism scans indicated that rIBPv mainly consists of β strands, and its denaturing temperature was 53.5 °C. Multiple-sequence alignment of homologous IBPs predicted that IBPv contains two ice-binding domains, a feature unique among known IBPs. To examine functional differences between the IBPv domains, each domain was cloned, expressed, and purified. The second domain (domain B) expressed greater ice binding activity. Data from thermal hysteresis and gel filtration assays supported the idea that the two domains cooperate to achieve a higher ice binding effect by forming heterodimers. However, physical linkage of the domains was not required for this effect.

  5. Synthesis of eukaryotic lipid biomarkers in the bacterial domain

    NASA Astrophysics Data System (ADS)

    Welander, P. V.; Banta, A. B.; Lee, A. K.; Wei, J. H.

    2017-12-01

    Lipid biomarkers are organic molecules preserved in sediments and sedimentary rocks that can function as geological proxies for certain microbial taxa or for specific environmental conditions. These molecular fossils provide a link between organisms and their environments in both modern and ancient settings and have afforded significant insight into ancient climatic events, mass extinctions, and various evolutionary transitions throughout Earth's history. However, the proper interpretation of lipid biomarkers is dependent on a broad understanding of their diagenetic precursors in modern systems. This includes understanding the taphonomic transformations that these molecules undergo, their biosynthetic pathways, and the ecological conditions that affect their cellular production. In this study, we focus on one group of lipid biomarkers - the sterols. These are polycyclic isoprenoidal lipids that have a high preservation potential and play a critical role in the physiology of most eukaryotes. However, the synthesis and function of these lipids in the bacterial domain has not been fully explored. Here we utilize a combination of bioinformatics, microbial genetics, and biochemistry to demonstrate that bacterial sterol producers are more prevalent in environmental metagenomic samples than in the genomic databases of cultured organisms and to identify novel proteins required to synthesize and modify sterols in bacteria. These proteins represent a distinct pathway for sterol synthesis exclusive to bacteria and indicate that sterol synthesis in bacteria may have evolved independently of eukaryotic sterol biosynthesis. Taken together, these results demonstrate how studies in extant bacteria can provide insight into the biological sources and the biosynthetic pathways of specific lipid biomarkers and in turn may allow for more robust interpretation of biomarker signatures.

  6. Expanding the domains of attitudes towards evidence-based practice: the evidence based practice attitude scale-50.

    PubMed

    Aarons, Gregory A; Cafri, Guy; Lugo, Lindsay; Sawitzky, Angelina

    2012-09-01

    Mental health and social service provider attitudes toward evidence-based practice have been measured through the development and validation of the Evidence-Based Practice Attitude Scale (EBPAS; Aarons, Ment Health Serv Res 6(2):61-74, 2004). Scores on the EBPAS scales are related to provider demographic characteristics, organizational characteristics, and leadership. However, the EBPAS assesses only four domains of attitudes toward EBP. The current study expands and further identifies additional domains of attitudes towards evidence-based practice. A qualitative and quantitative mixed-methods approach was used to: (1) generate items from multiples sources (researcher, mental health program manager, clinician/therapist), (2) identify potential content domains, and (3) examine the preliminary domains and factor structure through exploratory factor analysis. Participants for item generation included the investigative team, a group of mental health program managers (n = 6), and a group of clinicians/therapists (n = 8). For quantitative analyses a sample of 422 mental health service providers from 65 outpatient programs in San Diego County completed a survey that included the new items. Eight new EBPAS factors comprised of 35 items were identified. Factor loadings were moderate to large and internal consistency reliabilities were fair to excellent. We found that the convergence of these factors with the four previously identified evidence-based practice attitude factors (15 items) was small to moderate suggesting that the newly identified factors represent distinct dimensions of mental health and social service provider attitudes toward adopting EBP. Combining the original 15 items with the 35 new items comprises the EBPAS 50-item version (EBPAS-50) that adds to our understanding of provider attitudes toward adopting EBPs. Directions for future research are discussed.

  7. Insights into substrate specificity of NlpC/P60 cell wall hydrolases containing bacterial SH3 domains

    DOE PAGES

    Xu, Qingping; Mengin-Lecreulx, Dominique; Liu, Xueqian W.; ...

    2015-09-15

    Bacterial SH3 (SH3b) domains are commonly fused with papain-like Nlp/P60 cell wall hydrolase domains. To understand how the modular architecture of SH3b and NlpC/P60 affects the activity of the catalytic domain, three putative NlpC/P60 cell wall hydrolases were biochemically and structurally characterized. In addition, these enzymes all have γ-d-Glu-A 2pm (A 2pm is diaminopimelic acid) cysteine amidase (ordl-endopeptidase) activities but with different substrate specificities. One enzyme is a cell wall lysin that cleaves peptidoglycan (PG), while the other two are cell wall recycling enzymes that only cleave stem peptides with an N-terminall-Ala. Their crystal structures revealed a highly conserved structuremore » consisting of two SH3b domains and a C-terminal NlpC/P60 catalytic domain, despite very low sequence identity. Interestingly, loops from the first SH3b domain dock into the ends of the active site groove of the catalytic domain, remodel the substrate binding site, and modulate substrate specificity. Two amino acid differences at the domain interface alter the substrate binding specificity in favor of stem peptides in recycling enzymes, whereas the SH3b domain may extend the peptidoglycan binding surface in the cell wall lysins. Remarkably, the cell wall lysin can be converted into a recycling enzyme with a single mutation.Peptidoglycan is a meshlike polymer that envelops the bacterial plasma membrane and bestows structural integrity. Cell wall lysins and recycling enzymes are part of a set of lytic enzymes that target covalent bonds connecting the amino acid and amino sugar building blocks of the PG network. These hydrolases are involved in processes such as cell growth and division, autolysis, invasion, and PG turnover and recycling. To avoid cleavage of unintended substrates, these enzymes have very selective substrate specificities. Our biochemical and structural analysis of three modular NlpC/P60 hydrolases, one lysin, and two recycling enzymes

  8. Insights into substrate specificity of NlpC/P60 cell wall hydrolases containing bacterial SH3 domains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Qingping; Mengin-Lecreulx, Dominique; Liu, Xueqian W.

    Bacterial SH3 (SH3b) domains are commonly fused with papain-like Nlp/P60 cell wall hydrolase domains. To understand how the modular architecture of SH3b and NlpC/P60 affects the activity of the catalytic domain, three putative NlpC/P60 cell wall hydrolases were biochemically and structurally characterized. In addition, these enzymes all have γ-d-Glu-A 2pm (A 2pm is diaminopimelic acid) cysteine amidase (ordl-endopeptidase) activities but with different substrate specificities. One enzyme is a cell wall lysin that cleaves peptidoglycan (PG), while the other two are cell wall recycling enzymes that only cleave stem peptides with an N-terminall-Ala. Their crystal structures revealed a highly conserved structuremore » consisting of two SH3b domains and a C-terminal NlpC/P60 catalytic domain, despite very low sequence identity. Interestingly, loops from the first SH3b domain dock into the ends of the active site groove of the catalytic domain, remodel the substrate binding site, and modulate substrate specificity. Two amino acid differences at the domain interface alter the substrate binding specificity in favor of stem peptides in recycling enzymes, whereas the SH3b domain may extend the peptidoglycan binding surface in the cell wall lysins. Remarkably, the cell wall lysin can be converted into a recycling enzyme with a single mutation.Peptidoglycan is a meshlike polymer that envelops the bacterial plasma membrane and bestows structural integrity. Cell wall lysins and recycling enzymes are part of a set of lytic enzymes that target covalent bonds connecting the amino acid and amino sugar building blocks of the PG network. These hydrolases are involved in processes such as cell growth and division, autolysis, invasion, and PG turnover and recycling. To avoid cleavage of unintended substrates, these enzymes have very selective substrate specificities. Our biochemical and structural analysis of three modular NlpC/P60 hydrolases, one lysin, and two recycling enzymes

  9. Insights into Substrate Specificity of NlpC/P60 Cell Wall Hydrolases Containing Bacterial SH3 Domains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Qingping; Mengin-Lecreulx, Dominique; Liu, Xueqian W.

    ABSTRACT Bacterial SH3 (SH3b) domains are commonly fused with papain-like Nlp/P60 cell wall hydrolase domains. To understand how the modular architecture of SH3b and NlpC/P60 affects the activity of the catalytic domain, three putative NlpC/P60 cell wall hydrolases were biochemically and structurally characterized. These enzymes all have γ-d-Glu-A 2pm (A 2pm is diaminopimelic acid) cysteine amidase (ordl-endopeptidase) activities but with different substrate specificities. One enzyme is a cell wall lysin that cleaves peptidoglycan (PG), while the other two are cell wall recycling enzymes that only cleave stem peptides with an N-terminall-Ala. Their crystal structures revealed a highly conserved structure consistingmore » of two SH3b domains and a C-terminal NlpC/P60 catalytic domain, despite very low sequence identity. Interestingly, loops from the first SH3b domain dock into the ends of the active site groove of the catalytic domain, remodel the substrate binding site, and modulate substrate specificity. Two amino acid differences at the domain interface alter the substrate binding specificity in favor of stem peptides in recycling enzymes, whereas the SH3b domain may extend the peptidoglycan binding surface in the cell wall lysins. Remarkably, the cell wall lysin can be converted into a recycling enzyme with a single mutation. IMPORTANCEPeptidoglycan is a meshlike polymer that envelops the bacterial plasma membrane and bestows structural integrity. Cell wall lysins and recycling enzymes are part of a set of lytic enzymes that target covalent bonds connecting the amino acid and amino sugar building blocks of the PG network. These hydrolases are involved in processes such as cell growth and division, autolysis, invasion, and PG turnover and recycling. To avoid cleavage of unintended substrates, these enzymes have very selective substrate specificities. Our biochemical and structural analysis of three modular NlpC/P60 hydrolases, one lysin, and two recycling

  10. Phylogenetic mapping of bacterial morphology

    NASA Technical Reports Server (NTRS)

    Siefert, J. L.; Fox, G. E.

    1998-01-01

    The availability of a meaningful molecular phylogeny for bacteria provides a context for examining the historical significance of various developments in bacterial evolution. Herein, the classical morphological descriptions of selected members of the domain Bacteria are mapped upon the genealogical ancestry deduced from comparison of small-subunit rRNA sequences. For the species examined in this study, a distinct pattern emerges which indicates that the coccus shape has arisen and accumulated independently multiple times in separate lineages and typically survived as a persistent end-state morphology. At least two other morphologies persist but have evolved only once. This study demonstrates that although bacterial morphology is not useful in defining bacterial phylogeny, it is remarkably consistent with that phylogeny once it is known. An examination of the experimental evidence available for morphogenesis as well as microbial fossil evidence corroborates these findings. It is proposed that the accumulation of persistent morphologies is a result of the biophysical properties of peptidoglycan and their genetic control, and that an evolved body-plan strategy based on peptidoglycan may have been a fate-sealing step in the evolution of Bacteria. More generally, this study illustrates that significant evolutionary insights can be obtained by examining biological and biochemical data in the context of a reliable phylogenetic structure.

  11. Soil bacterial communities are shaped by temporal and environmental filtering: evidence from a long-term chronosequence.

    PubMed

    Freedman, Zachary; Zak, Donald R

    2015-09-01

    Soil microbial communities are abundant, hyper-diverse and mediate global biogeochemical cycles, but we do not yet understand the processes mediating their assembly. Current hypothetical frameworks suggest temporal (e.g. dispersal limitation) and environmental (e.g. soil pH) filters shape microbial community composition; however, there is limited empirical evidence supporting this framework in the hyper-diverse soil environment, particularly at large spatial (i.e. regional to continental) and temporal (i.e. 100 to 1000 years) scales. Here, we present evidence from a long-term chronosequence (4000 years) that temporal and environmental filters do indeed shape soil bacterial community composition. Furthermore, nearly 20 years of environmental monitoring allowed us to control for potentially confounding environmental variation. Soil bacterial communities were phylogenetically distinct across the chronosequence. We determined that temporal and environmental factors accounted for significant portions of bacterial phylogenetic structure using distance-based linear models. Environmental factors together accounted for the majority of phylogenetic structure, namely, soil temperature (19%), pH (17%) and litter carbon:nitrogen (C:N; 17%). However, of all individual factors, time since deglaciation accounted for the greatest proportion of bacterial phylogenetic structure (20%). Taken together, our results provide empirical evidence that temporal and environmental filters act together to structure soil bacterial communities across large spatial and long-term temporal scales. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

  12. Domain-Swapped Dimers of Intracellular Lipid-Binding Proteins: Evidence for Ordered Folding Intermediates.

    PubMed

    Assar, Zahra; Nossoni, Zahra; Wang, Wenjing; Santos, Elizabeth M; Kramer, Kevin; McCornack, Colin; Vasileiou, Chrysoula; Borhan, Babak; Geiger, James H

    2016-09-06

    Human Cellular Retinol Binding Protein II (hCRBPII), a member of the intracellular lipid-binding protein family, is a monomeric protein responsible for the intracellular transport of retinol and retinal. Herein we report that hCRBPII forms an extensive domain-swapped dimer during bacterial expression. The domain-swapped region encompasses almost half of the protein. The dimer represents a novel structural architecture with the mouths of the two binding cavities facing each other, producing a new binding cavity that spans the length of the protein complex. Although wild-type hCRBPII forms the dimer, the propensity for dimerization can be substantially increased via mutation at Tyr60. The monomeric form of the wild-type protein represents the thermodynamically more stable species, making the domain-swapped dimer a kinetically trapped entity. Hypothetically, the wild-type protein has evolved to minimize dimerization of the folding intermediate through a critical hydrogen bond (Tyr60-Glu72) that disfavors the dimeric form. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. CNF1-like deamidase domains: common Lego bricks among cancer-promoting immunomodulatory bacterial virulence factors.

    PubMed

    Ho, Mengfei; Mettouchi, Amel; Wilson, Brenda A; Lemichez, Emmanuel

    2018-05-03

    Alterations of the cellular proteome over time due to spontaneous or toxin-mediated enzymatic deamidation of glutamine (Gln) and asparagine (Asn) residues contribute to bacterial infection and might represent a source of aging-related diseases. Here, we put into perspective what is known about the mode of action of the CNF1 toxin from pathogenic E. coli, a paradigm of bacterial deamidases that activate Rho GTPases, to illustrate the importance of determining whether exposure to these factors are risk factors in the etiology age-related diseases, such as cancer. In particular, through in silico analysis of the distribution of the CNF1-like deamidase active site Gly-Cys-(Xaa)n-His sequence motif in bacterial genomes, we unveil the wide distribution of the super-family of CNF-like toxins and CNF-like deamidase domains among members of the enterobacteriacae and in association with a large variety of toxin delivery systems. We extent our discussion with recent findings concerning cellular systems that control activated Rac1 GTPase stability and provide protection against cancer. These findings point to the urgency for developing holistic approaches toward personalized medicine that include monitoring for asymptomatic carriage of pathogenic toxin-producing bacteria and that ultimately might lead to improved public health and increased lifespans.

  14. The domain organization of the bacterial intermediate filament-like protein crescentin is important for assembly and function

    PubMed Central

    Cabeen, Matthew T; Herrmann, Harald; Jacobs-Wagner, Christine

    2011-01-01

    Crescentin is a bacterial filament-forming protein that exhibits domain organization features found in metazoan intermediate filament (IF) proteins. Structure-function studies of eukaryotic IFs have been hindered by a lack of simple genetic systems and easily quantifiable phenotypes. Here we exploit the characteristic localization of the crescentin structure along the inner curvature of Caulobacter crescentus cells and the loss of cell curvature associated with impaired crescentin function to analyze the importance of the domain organization of crescentin. By combining biochemistry and ultrastructural analysis in vitro with cellular localization and functional studies, we show that crescentin requires its distinctive domain organization, and furthermore that different structural elements have distinct structural and functional contributions. The head domain can be functionally subdivided into two subdomains; the first (amino-terminal) is required for function but not assembly, while the second is necessary for structure assembly. The rod domain is similarly required for structure assembly, and the linker L1 appears important to prevent runaway assembly into nonfunctional aggregates. The data also suggest that the stutter and the tail domain have critical functional roles in stabilizing crescentin structures against disassembly by monovalent cations in the cytoplasm. This study suggests that the IF-like behavior of crescentin is a consequence of its domain organization, implying that the IF protein layout is an adaptable cytoskeletal motif, much like the actin and tubulin folds, that is broadly exploited for various functions throughout life from bacteria to humans. © 2011 Wiley-Liss, Inc. PMID:21360832

  15. Collaboration Expertise in Medicine - No Evidence for Cross-Domain Application from a Memory Retrieval Study.

    PubMed

    Kiesewetter, Jan; Fischer, Frank; Fischer, Martin R

    2016-01-01

    Is there evidence for expertise on collaboration and, if so, is there evidence for cross-domain application? Recall of stimuli was used to measure so-called internal collaboration scripts of novices and experts in two studies. Internal collaboration scripts refer to an individual's knowledge about how to interact with others in a social situation. METHOD— Ten collaboration experts and ten novices of the content domain social science were presented with four pictures of people involved in collaborative activities. The recall texts were coded, distinguishing between superficial and collaboration script information. RESULTS— Experts recalled significantly more collaboration script information (M = 25.20; SD = 5.88) than did novices (M = 13.80; SD = 4.47). Differences in superficial information were not found. Study 2 tested whether the differences found in Study 1 could be replicated. Furthermore, the cross-domain application of internal collaboration scripts was explored. METHOD— Twenty collaboration experts and 20 novices of the content domain medicine were presented with four pictures and four videos of their content domain and a video and picture of another content domain. All stimuli showed collaborative activities typical for the respective content domains. RESULTS— As in Study 1, experts recalled significantly more collaboration script information of their content domain (M = 71.65; SD = 33.23) than did novices (M = 54.25; SD = 15.01). For the novices, no differences were found for the superficial information nor for the retrieval of collaboration script information recalled after the other content domain stimuli. There is evidence for expertise on collaboration in memory tasks. The results show that experts hold substantially more collaboration script information than did novices. Furthermore, the differences between collaboration novices and collaboration experts occurred only in their own content domain, indicating that internal collaboration scripts

  16. Evidence-based Sensor Tasking for Space Domain Awareness

    NASA Astrophysics Data System (ADS)

    Jaunzemis, A.; Holzinger, M.; Jah, M.

    2016-09-01

    Space Domain Awareness (SDA) is the actionable knowledge required to predict, avoid, deter, operate through, recover from, and/or attribute cause to the loss and/or degradation of space capabilities and services. A main purpose for SDA is to provide decision-making processes with a quantifiable and timely body of evidence of behavior(s) attributable to specific space threats and/or hazards. To fulfill the promise of SDA, it is necessary for decision makers and analysts to pose specific hypotheses that may be supported or refuted by evidence, some of which may only be collected using sensor networks. While Bayesian inference may support some of these decision making needs, it does not adequately capture ambiguity in supporting evidence; i.e., it struggles to rigorously quantify 'known unknowns' for decision makers. Over the past 40 years, evidential reasoning approaches such as Dempster Shafer theory have been developed to address problems with ambiguous bodies of evidence. This paper applies mathematical theories of evidence using Dempster Shafer expert systems to address the following critical issues: 1) How decision makers can pose critical decision criteria as rigorous, testable hypotheses, 2) How to interrogate these hypotheses to reduce ambiguity, and 3) How to task a network of sensors to gather evidence for multiple competing hypotheses. This theory is tested using a simulated sensor tasking scenario balancing search versus track responsibilities.

  17. Theory and experimental evidence of phonon domains and their roles in pre-martensitic phenomena

    NASA Astrophysics Data System (ADS)

    Jin, Yongmei M.; Wang, Yu U.; Ren, Yang

    2015-12-01

    Pre-martensitic phenomena, also called martensite precursor effects, have been known for decades while yet remain outstanding issues. This paper addresses pre-martensitic phenomena from new theoretical and experimental perspectives. A statistical mechanics-based Grüneisen-type phonon theory is developed. On the basis of deformation-dependent incompletely softened low-energy phonons, the theory predicts a lattice instability and pre-martensitic transition into elastic-phonon domains via 'phonon spinodal decomposition.' The phase transition lifts phonon degeneracy in cubic crystal and has a nature of phonon pseudo-Jahn-Teller lattice instability. The theory and notion of phonon domains consistently explain the ubiquitous pre-martensitic anomalies as natural consequences of incomplete phonon softening. The phonon domains are characterised by broken dynamic symmetry of lattice vibrations and deform through internal phonon relaxation in response to stress (a particular case of Le Chatelier's principle), leading to previously unexplored new domain phenomenon. Experimental evidence of phonon domains is obtained by in situ three-dimensional phonon diffuse scattering and Bragg reflection using high-energy synchrotron X-ray single-crystal diffraction, which observes exotic domain phenomenon fundamentally different from usual ferroelastic domain switching phenomenon. In light of the theory and experimental evidence of phonon domains and their roles in pre-martensitic phenomena, currently existing alternative opinions on martensitic precursor phenomena are revisited.

  18. Rab11-family of interacting protein 2 associates with chlamydial inclusions through its Rab-binding domain and promotes bacterial multiplication.

    PubMed

    Leiva, Natalia; Capmany, Anahí; Damiani, María Teresa

    2013-01-01

    Chlamydia trachomatis, an obligate intracellular pathogen, survives within host cells in a special compartment named 'inclusion' and takes advantage of host vesicular transport pathways for its growth and replication. Rab GTPases are key regulatory proteins of intracellular trafficking. Several Rabs, among them Rab11 and Rab14, are implicated in chlamydial development. FIP2, a member of the Rab11-Family of Interacting Proteins, presents at the C-terminus a Rab-binding domain that interacts with both Rab11 and Rab14. In this study, we determined and characterized the recruitment of endogenous and GFP-tagged FIP2 to the chlamydial inclusions. The recruitment of FIP2 is specific since other members of the Rab11-Family of Interacting Proteins do not associate with the chlamydial inclusions. The Rab-binding domain of FIP2 is essential for its association. Our results indicate that FIP2 binds to Rab11 at the chlamydial inclusion membrane through its Rab-binding domain. The presence of FIP2 at the chlamydial inclusion favours the recruitment of Rab14. Furthermore, our results show that FIP2 promotes inclusion development and bacterial replication. In agreement, the silencing of FIP2 decreases the bacterial progeny. C. trachomatis likely recruits FIP2 to hijack host intracellular trafficking to redirect vesicles full of nutrients towards the inclusion. © 2012 Blackwell Publishing Ltd.

  19. Evidence for the presence of a bacterial endosymbiont in the pecan scab pathogen Venturia effusa (basyonym: Fusicladium effusum).

    PubMed

    Medrano, E G; Grauke, L J; Stanford, R L; Thompson, T E

    2017-08-01

    To determine whether Venturia effusa, the causative fungal agent of pecan scab, harbours a bacterial symbiont. Venturia effusa isolates were maintained on potato dextrose agar amended with antibiotics (chloramphenicol (100 μg ml -1 ) and tetracycline 100 (μg ml -1 )). Genomic DNA extracted from mycelia was used to target eubacterial 16S rDNA. A 1·4-kbp PCR amplified product using 16S rDNA degenerate primers was cloned, sequenced and found to have 99% identities with Actinobacteria representatives. Attempts to culture the detected bacteria apart from the fungus following agitation and fungal cell lysis were unsuccessful using standard bacteriological media under either aerobic or anaerobic conditions. Fungal structures were visualized using scanning electron microscopy and putative bacterial formations associated with the fungal mycelia were observed. Fluorescence in situ hybridization using 16S rDNA oligonucleotides illuminated spores and portions of the hyphae. This is the first report to provide both molecular microbiological and microscopic evidence in support of the hypothesis that V. effusa harbours endosymbiotic bacteria. Findings from this research contribute fundamental information regarding the biology of the fungus that may ultimately lead to identifying a target of the pathogen for use in management and/or avoidance strategies. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

  20. How does processing affect storage in working memory tasks? Evidence for both domain-general and domain-specific effects.

    PubMed

    Jarrold, Christopher; Tam, Helen; Baddeley, Alan D; Harvey, Caroline E

    2011-05-01

    Two studies that examine whether the forgetting caused by the processing demands of working memory tasks is domain-general or domain-specific are presented. In each, separate groups of adult participants were asked to carry out either verbal or nonverbal operations on exactly the same processing materials while maintaining verbal storage items. The imposition of verbal processing tended to produce greater forgetting even though verbal processing operations took no longer to complete than did nonverbal processing operations. However, nonverbal processing did cause forgetting relative to baseline control conditions, and evidence from the timing of individuals' processing responses suggests that individuals in both processing groups slowed their responses in order to "refresh" the memoranda. Taken together the data suggest that processing has a domain-general effect on working memory performance by impeding refreshment of memoranda but can also cause effects that appear domain-specific and that result from either blocking of rehearsal or interference.

  1. Collaboration Expertise in Medicine - No Evidence for Cross-Domain Application from a Memory Retrieval Study

    PubMed Central

    Kiesewetter, Jan; Fischer, Frank; Fischer, Martin R.

    2016-01-01

    Background Is there evidence for expertise on collaboration and, if so, is there evidence for cross-domain application? Recall of stimuli was used to measure so-called internal collaboration scripts of novices and experts in two studies. Internal collaboration scripts refer to an individual’s knowledge about how to interact with others in a social situation. Method—Study 1 Ten collaboration experts and ten novices of the content domain social science were presented with four pictures of people involved in collaborative activities. The recall texts were coded, distinguishing between superficial and collaboration script information. Results—Study 1 Experts recalled significantly more collaboration script information (M = 25.20; SD = 5.88) than did novices (M = 13.80; SD = 4.47). Differences in superficial information were not found. Study 2 Study 2 tested whether the differences found in Study 1 could be replicated. Furthermore, the cross-domain application of internal collaboration scripts was explored. Method—Study 2 Twenty collaboration experts and 20 novices of the content domain medicine were presented with four pictures and four videos of their content domain and a video and picture of another content domain. All stimuli showed collaborative activities typical for the respective content domains. Results—Study 2 As in Study 1, experts recalled significantly more collaboration script information of their content domain (M = 71.65; SD = 33.23) than did novices (M = 54.25; SD = 15.01). For the novices, no differences were found for the superficial information nor for the retrieval of collaboration script information recalled after the other content domain stimuli. Discussion There is evidence for expertise on collaboration in memory tasks. The results show that experts hold substantially more collaboration script information than did novices. Furthermore, the differences between collaboration novices and collaboration experts occurred only in their own

  2. Comparative Genomic Analyses of the Bacterial Phosphotransferase System

    PubMed Central

    Barabote, Ravi D.; Saier, Milton H.

    2005-01-01

    We report analyses of 202 fully sequenced genomes for homologues of known protein constituents of the bacterial phosphoenolpyruvate-dependent phosphotransferase system (PTS). These included 174 bacterial, 19 archaeal, and 9 eukaryotic genomes. Homologues of PTS proteins were not identified in archaea or eukaryotes, showing that the horizontal transfer of genes encoding PTS proteins has not occurred between the three domains of life. Of the 174 bacterial genomes (136 bacterial species) analyzed, 30 diverse species have no PTS homologues, and 29 species have cytoplasmic PTS phosphoryl transfer protein homologues but lack recognizable PTS permeases. These soluble homologues presumably function in regulation. The remaining 77 species possess all PTS proteins required for the transport and phosphorylation of at least one sugar via the PTS. Up to 3.2% of the genes in a bacterium encode PTS proteins. These homologues were analyzed for family association, range of protein types, domain organization, and organismal distribution. Different strains of a single bacterial species often possess strikingly different complements of PTS proteins. Types of PTS protein domain fusions were analyzed, showing that certain types of domain fusions are common, while others are rare or prohibited. Select PTS proteins were analyzed from different phylogenetic standpoints, showing that PTS protein phylogeny often differs from organismal phylogeny. The results document the frequent gain and loss of PTS protein-encoding genes and suggest that the lateral transfer of these genes within the bacterial domain has played an important role in bacterial evolution. Our studies provide insight into the development of complex multicomponent enzyme systems and lead to predictions regarding the types of protein-protein interactions that promote efficient PTS-mediated phosphoryl transfer. PMID:16339738

  3. Strong and oriented immobilization of single domain antibodies from crude bacterial lysates for high-throughput compatible cost-effective antibody array generation

    PubMed Central

    Even-Desrumeaux, Klervi; Baty, Daniel; Chames, Patrick

    2010-01-01

    Antibodies microarrays are among the novel class of rapidly emerging proteomic technologies that will allow us to efficiently perform specific diagnosis and proteome analysis. Recombinant antibody fragments are especially suited for this approach but their stability is often a limiting factor. Camelids produce functional antibodies devoid of light chains (HCAbs) of which the single N-terminal domain is fully capable of antigen binding. When produced as an independent domain, these so-called single domain antibody fragments (sdAbs) have several advantages for biotechnological applications thanks to their unique properties of size (15 kDa), stability, solubility, and expression yield. These features should allow sdAbs to outperform other antibody formats in a number of applications, notably as capture molecule for antibody arrays. In this study, we have produced antibody microarrays using direct and oriented immobilization of sdAbs produced in crude bacterial lysates to generate proof-of-principle of a high-throughput compatible array design. Several sdAb immobilization strategies have been explored. Immobilization of in vivo biotinylated sdAbs by direct spotting of bacterial lysate on streptavidin and sandwich detection was developed to achieve high sensitivity and specificity, whereas immobilization of “multi-tagged” sdAbs via anti-tag antibodies and direct labeled sample detection strategy was optimized for the design of high-density antibody arrays for high-throughput proteomics and identification of potential biomarkers. PMID:20859568

  4. Role of the Dc domain of the bacterial hook protein FlgE in hook assembly and function

    PubMed Central

    Moriya, Nao; Minamino, Tohru; Ferris, Hedda U.; Morimoto, Yusuke V.; Ashihara, Masamichi; Kato, Takayuki; Namba, Keiichi

    2013-01-01

    The bacterial flagellar hook acts as a universal joint to smoothly transmit torque produced by the motor to the filament. The hook protein FlgE assembles into a 55 nm tubular structure with the help of the hook cap (FlgD). FlgE consists of four domains, D0, Dc, D1 and D2, arranged from the inner to the outer part of the tubular structure of the hook. The Dc domain contributes to the structural stability of the hook, but it is unclear how this Dc domain is responsible for the universal joint mechanism. Here, we carried out a deletion analysis of the FlgE Dc domain. FlgEΔ4/5 with deletion of residues 30 to 49 was not secreted into the culture media. FlgEΔ5 and FlgEΔ6 with deletions of residues 40 to 49 and 50 to 59, respectively, still formed hooks, allowing the export apparatus to export the hook-filament junction proteins FlgK and FlgL and flagellin FliC. However, these deletions inhibited the replacement of the FlgD hook cap by FlgK at the hook tip, thereby abolishing filament formation. Deletion of residues 50 to 59 significantly affected hook morphology. These results suggest that the Dc domain is responsible not only for hook assembly but also for FlgE export, the interaction with FlgK, and the polymorphic supercoiling mechanism of the hook. PMID:27493542

  5. Disarming Bacterial Virulence through Chemical Inhibition of the DNA Binding Domain of an AraC-like Transcriptional Activator Protein*

    PubMed Central

    Yang, Ji; Hocking, Dianna M.; Cheng, Catherine; Dogovski, Con; Perugini, Matthew A.; Holien, Jessica K.; Parker, Michael W.; Hartland, Elizabeth L.; Tauschek, Marija; Robins-Browne, Roy M.

    2013-01-01

    The misuse of antibiotics during past decades has led to pervasive antibiotic resistance in bacteria. Hence, there is an urgent need for the development of new and alternative approaches to combat bacterial infections. In most bacterial pathogens the expression of virulence is tightly regulated at the transcriptional level. Therefore, targeting pathogens with drugs that interfere with virulence gene expression offers an effective alternative to conventional antimicrobial chemotherapy. Many Gram-negative intestinal pathogens produce AraC-like proteins that control the expression of genes required for infection. In this study we investigated the prototypical AraC-like virulence regulator, RegA, from the mouse attaching and effacing pathogen, Citrobacter rodentium, as a potential drug target. By screening a small molecule chemical library and chemical optimization, we identified two compounds that specifically inhibited the ability of RegA to activate its target promoters and thus reduced expression of a number of proteins required for virulence. Biophysical, biochemical, genetic, and computational analyses indicated that the more potent of these two compounds, which we named regacin, disrupts the DNA binding capacity of RegA by interacting with amino acid residues within a conserved region of the DNA binding domain. Oral administration of regacin to mice, commencing 15 min before or 12 h after oral inoculation with C. rodentium, caused highly significant attenuation of intestinal colonization by the mouse pathogen comparable to that of an isogenic regA-deletion mutant. These findings demonstrate that chemical inhibition of the DNA binding domains of transcriptional regulators is a viable strategy for the development of antimicrobial agents that target bacterial pathogens. PMID:24019519

  6. New evidence for Cu-decorated binary-oxides mediating bacterial inactivation/mineralization in aerobic media.

    PubMed

    Rtimi, S; Pulgarin, C; Bensimon, M; Kiwi, J

    2016-08-01

    Binary oxide semiconductors TiO2-ZrO2 and Cu-decorated TiO2-ZrO2 (TiO2-ZrO2-Cu) uniform films were sputtered on polyester (PES). These films were irradiated under low intensity solar simulated light and led to bacterial inactivation in aerobic and anaerobic media as evaluated by CFU-plate counting. But bacterial mineralization was only induced by TiO2-ZrO2-Cu in aerobic media. The highly oxidative radicals generated on the films surface under light were identified by the use of appropriate scavengers. The hole generated on the TiO2-ZrO2 films is shown to be the main specie leading to bacterial inactivation. TiO2-ZrO2 and Cu-decorated TiO2-ZrO2 films release Zr and Ti <1ppb and Cu 4.6ppb/cm(2) as determined by inductively coupled plasma mass spectrometry (ICP-MS) This level is far below the citotoxicity permitted level allowed for mammalian cells suggesting that bacterial disinfection proceeds through an oligodynamic effect. By Fourier transform attenuated infrared spectroscopy (ATR-FTIR) the systematic shift of the predominating νs(CH2) vibrational-rotational peak making up most of the bacterial cell-wall content in C was monitored. Based on this evidence a mechanism suggested leading to CH bond stretching followed by cell lysis and cell death. Bacterial inactivation cycling was observed on TiO2-ZrO2-Cu showing the stability of these films leading to bacterial inactivation. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Bacterial Actins? An Evolutionary Perspective

    NASA Technical Reports Server (NTRS)

    Doolittle, Russell F.; York, Amanda L.

    2003-01-01

    According to the conventional wisdom, the existence of a cytoskeleton in eukaryotes and its absence in prokaryotes constitute a fundamental divide between the two domains of life. An integral part of the dogma is that a cytoskeleton enabled an early eukaryote to feed upon prokaryotes, a consequence of which was the occasional endosymbiosis and the eventual evolution of organelles. Two recent papers present compelling evidence that actin, one of the principal components of a cytoskeleton, has a homolog in Bacteria that behaves in many ways like eukaryotic actin. Sequence comparisons reveml that eukaryotic actin and the bacterial homolog (mreB protein), unlike many other proteins common to eukaryotes and Bacteria, have very different and more highly extended evolutionary histories.

  8. Solution structure of leptospiral LigA4 Big domain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mei, Song; Zhang, Jiahai; Zhang, Xuecheng

    Pathogenic Leptospiraspecies express immunoglobulin-like proteins which serve as adhesins to bind to the extracellular matrices of host cells. Leptospiral immunoglobulin-like protein A (LigA), a surface exposed protein containing tandem repeats of bacterial immunoglobulin-like (Big) domains, has been proved to be involved in the interaction of pathogenic Leptospira with mammalian host. In this study, the solution structure of the fourth Big domain of LigA (LigA4 Big domain) from Leptospira interrogans was solved by nuclear magnetic resonance (NMR). The structure of LigA4 Big domain displays a similar bacterial immunoglobulin-like fold compared with other Big domains, implying some common structural aspects of Bigmore » domain family. On the other hand, it displays some structural characteristics significantly different from classic Ig-like domain. Furthermore, Stains-all assay and NMR chemical shift perturbation revealed the Ca{sup 2+} binding property of LigA4 Big domain. - Highlights: • Determining the solution structure of a bacterial immunoglobulin-like domain from a surface protein of Leptospira. • The solution structure shows some structural characteristics significantly different from the classic Ig-like domains. • A potential Ca{sup 2+}-binding site was identified by strains-all and NMR chemical shift perturbation.« less

  9. A novel firmicute protein family related to the actinobacterial resuscitation-promoting factors by non-orthologous domain displacement.

    PubMed

    Ravagnani, Adriana; Finan, Christopher L; Young, Michael

    2005-03-17

    In Micrococcus luteus growth and resuscitation from starvation-induced dormancy is controlled by the production of a secreted growth factor. This autocrine resuscitation-promoting factor (Rpf) is the founder member of a family of proteins found throughout and confined to the actinobacteria (high G + C Gram-positive bacteria). The aim of this work was to search for and characterise a cognate gene family in the firmicutes (low G + C Gram-positive bacteria) and obtain information about how they may control bacterial growth and resuscitation. In silico analysis of the accessory domains of the Rpf proteins permitted their classification into several subfamilies. The RpfB subfamily is related to a group of firmicute proteins of unknown function, represented by YabE of Bacillus subtilis. The actinobacterial RpfB and firmicute YabE proteins have very similar domain structures and genomic contexts, except that in YabE, the actinobacterial Rpf domain is replaced by another domain, which we have called Sps. Although totally unrelated in both sequence and secondary structure, the Rpf and Sps domains fulfil the same function. We propose that these proteins have undergone "non-orthologous domain displacement", a phenomenon akin to "non-orthologous gene displacement" that has been described previously. Proteins containing the Sps domain are widely distributed throughout the firmicutes and they too fall into a number of distinct subfamilies. Comparative analysis of the accessory domains in the Rpf and Sps proteins, together with their weak similarity to lytic transglycosylases, provide clear evidence that they are muralytic enzymes. The results indicate that the firmicute Sps proteins and the actinobacterial Rpf proteins are cognate and that they control bacterial culturability via enzymatic modification of the bacterial cell envelope.

  10. Spatializing Emotion: No Evidence for a Domain-General Magnitude System.

    PubMed

    Pitt, Benjamin; Casasanto, Daniel

    2017-11-22

    People implicitly associate different emotions with different locations in left-right space. Which aspects of emotion do they spatialize, and why? Across many studies people spatialize emotional valence, mapping positive emotions onto their dominant side of space and negative emotions onto their non-dominant side, consistent with theories of metaphorical mental representation. Yet other results suggest a conflicting mapping of emotional intensity (a.k.a., emotional magnitude), according to which people associate more intense emotions with the right and less intense emotions with the left - regardless of their valence; this pattern has been interpreted as support for a domain-general system for representing magnitudes. To resolve the apparent contradiction between these mappings, we first tested whether people implicitly map either valence or intensity onto left-right space, depending on which dimension of emotion they attend to (Experiments 1a, b). When asked to judge emotional valence, participants showed the predicted valence mapping. However, when asked to judge emotional intensity, participants showed no systematic intensity mapping. We then tested an alternative explanation of findings previously interpreted as evidence for an intensity mapping (Experiments 2a, b). These results suggest that previous findings may reflect a left-right mapping of spatial magnitude (i.e., the size of a salient feature of the stimuli) rather than emotion. People implicitly spatialize emotional valence, but, at present, there is no clear evidence for an implicit lateral mapping of emotional intensity. These findings support metaphor theory and challenge the proposal that mental magnitudes are represented by a domain-general metric that extends to the domain of emotion. Copyright © 2017 Cognitive Science Society, Inc.

  11. Fluid therapy for acute bacterial meningitis.

    PubMed

    Maconochie, Ian K; Bhaumik, Soumyadeep

    2016-11-04

    Acute bacterial meningitis remains a disease with high mortality and morbidity rates. However, with prompt and adequate antimicrobial and supportive treatment, the chances for survival have improved, especially among infants and children. Careful management of fluid and electrolyte balance is an important supportive therapy. Both over- and under-hydration are associated with adverse outcomes. This is the latest update of a review first published in 2005 and updated in 2008 and 2014. To evaluate treatment of acute bacterial meningitis with differing volumes of initial fluid administration (up to 72 hours after first presentation) and the effects on death and neurological sequelae. For this 2016 update we searched the following databases up to March 2016: the Cochrane Acute Respiratory Infections Group's Specialised Register, CENTRAL, MEDLINE, CINAHL, Global Health, and Web of Science. Randomised controlled trials (RCTs) of differing volumes of fluid given in the initial management of bacterial meningitis were eligible for inclusion. All four of the original review authors extracted data and assessed trials for quality in the first publication of this review (one author, ROW, has passed away since the original review; see Acknowledgements). The current authors combined data for meta-analysis using risk ratios (RRs) for dichotomous data or mean difference (MD) for continuous data. We used a fixed-effect statistical model. We assessed the overall quality of evidence using the GRADE approach. We included three trials with a total of 420 children; there were no trials in adult populations. The largest of the three trials was conducted in settings with high mortality rates and was judged to have low risk of bias for all domains, except performance bias which was high risk. The other two smaller trials were not of high quality.The meta-analysis found no significant difference between the maintenance-fluid and restricted-fluid groups in number of deaths (RR 0.82, 95

  12. The C-Terminal Domain of the Virulence Factor MgtC Is a Divergent ACT Domain

    PubMed Central

    Yang, Yinshan; Labesse, Gilles; Carrère-Kremer, Séverine; Esteves, Kevin; Kremer, Laurent

    2012-01-01

    MgtC is a virulence factor of unknown function important for survival inside macrophages in several intracellular bacterial pathogens, including Mycobacterium tuberculosis. It is also involved in adaptation to Mg2+ deprivation, but previous work suggested that MgtC is not a Mg2+ transporter. In this study, we demonstrated that the amount of the M. tuberculosis MgtC protein is not significantly increased by Mg2+ deprivation. Members of the MgtC protein family share a conserved membrane N-terminal domain and a more divergent cytoplasmic C-terminal domain. To get insights into MgtC functional and structural organization, we have determined the nuclear magnetic resonance (NMR) structure of the C-terminal domain of M. tuberculosis MgtC. This structure is not affected by the Mg2+ concentration, indicating that it does not bind Mg2+. The structure of the C-terminal domain forms a βαββαβ fold found in small molecule binding domains called ACT domains. However, the M. tuberculosis MgtC ACT domain differs from canonical ACT domains because it appears to lack the ability to dimerize and to bind small molecules. We have shown, using a bacterial two-hybrid system, that the M. tuberculosis MgtC protein can dimerize and that the C-terminal domain somehow facilitates this dimerization. Taken together, these results indicate that M. tuberculosis MgtC does not have an intrinsic function related to Mg2+ uptake or binding but could act as a regulatory factor based on protein-protein interaction that could be facilitated by its ACT domain. PMID:22984256

  13. Protein domains of unknown function are essential in bacteria.

    PubMed

    Goodacre, Norman F; Gerloff, Dietlind L; Uetz, Peter

    2013-12-31

    More than 20% of all protein domains are currently annotated as "domains of unknown function" (DUFs). About 2,700 DUFs are found in bacteria compared with just over 1,500 in eukaryotes. Over 800 DUFs are shared between bacteria and eukaryotes, and about 300 of these are also present in archaea. A total of 2,786 bacterial Pfam domains even occur in animals, including 320 DUFs. Evolutionary conservation suggests that many of these DUFs are important. Here we show that 355 essential proteins in 16 model bacterial species contain 238 DUFs, most of which represent single-domain proteins, clearly establishing the biological essentiality of DUFs. We suggest that experimental research should focus on conserved and essential DUFs (eDUFs) for functional analysis given their important function and wide taxonomic distribution, including bacterial pathogens. The functional units of proteins are domains. Typically, each domain has a distinct structure and function. Genomes encode thousands of domains, and many of the domains have no known function (domains of unknown function [DUFs]). They are often ignored as of little relevance, given that many of them are found in only a few genomes. Here we show that many DUFs are essential DUFs (eDUFs) based on their presence in essential proteins. We also show that eDUFs are often essential even if they are found in relatively few genomes. However, in general, more common DUFs are more often essential than rare DUFs.

  14. Clinical nurse specialist practice domains and evidence-based practice competencies: a matrix of influence.

    PubMed

    Kring, Daria L

    2008-01-01

    The purpose of this article is to describe master's-level evidence-based practice (EBP) competencies as determined by a national consensus panel and present an EBP matrix that illustrates the influence that the clinical nurse specialist (CNS) practice can have on driving EBP change. Evidence-based practice is a growing and necessary paradigm for nursing care. The ACE Star Model conceptualizes the knowledge transformation that must occur in an EBP environment as 5 distinct points: discovery, summary, translation, integration, and evaluation. Master's-level EBP competencies based on these 5 steps were established by a national consensus panel. The CNS's practice can be organized around 5 domains: expert practitioner, researcher, consultant, educator, and leader. The master's-level EBP competencies can be transposed on a crosswalk of the ACE Star Model and the 5 CNS practice domains to form a matrix representing the influence that CNSs can have over the EBP process. Each competency falls well within the practice domains of the CNS, making the CNS an ideal person to lead the EBP movement forward, providing tangible outcomes to further demonstrate the need for the CNS role.

  15. Characterization of Bacterial, Archaeal and Eukaryote Symbionts from Antarctic Sponges Reveals a High Diversity at a Three-Domain Level and a Particular Signature for This Ecosystem.

    PubMed

    Rodríguez-Marconi, Susana; De la Iglesia, Rodrigo; Díez, Beatriz; Fonseca, Cássio A; Hajdu, Eduardo; Trefault, Nicole

    2015-01-01

    Sponge-associated microbial communities include members from the three domains of life. In the case of bacteria, they are diverse, host specific and different from the surrounding seawater. However, little is known about the diversity and specificity of Eukarya and Archaea living in association with marine sponges. This knowledge gap is even greater regarding sponges from regions other than temperate and tropical environments. In Antarctica, marine sponges are abundant and important members of the benthos, structuring the Antarctic marine ecosystem. In this study, we used high throughput ribosomal gene sequencing to investigate the three-domain diversity and community composition from eight different Antarctic sponges. Taxonomic identification reveals that they belong to families Acarnidae, Chalinidae, Hymedesmiidae, Hymeniacidonidae, Leucettidae, Microcionidae, and Myxillidae. Our study indicates that there are different diversity and similarity patterns between bacterial/archaeal and eukaryote microbial symbionts from these Antarctic marine sponges, indicating inherent differences in how organisms from different domains establish symbiotic relationships. In general, when considering diversity indices and number of phyla detected, sponge-associated communities are more diverse than the planktonic communities. We conclude that three-domain microbial communities from Antarctic sponges are different from surrounding planktonic communities, expanding previous observations for Bacteria and including the Antarctic environment. Furthermore, we reveal differences in the composition of the sponge associated bacterial assemblages between Antarctic and tropical-temperate environments and the presence of a highly complex microbial eukaryote community, suggesting a particular signature for Antarctic sponges, different to that reported from other ecosystems.

  16. A conceptual framework for the domain of evidence-based design.

    PubMed

    Ulrich, Roger S; Berry, Leonard L; Quan, Xiaobo; Parish, Janet Turner

    2010-01-01

    The physical facilities in which healthcare services are performed play an important role in the healing process. Evidence-based design in healthcare is a developing field of study that holds great promise for benefiting key stakeholders: patients, families, physicians, and nurses, as well as other healthcare staff and organizations. In this paper, the authors present and discuss a conceptual framework intended to capture the current domain of evidence-based design in healthcare. In this framework, the built environment is represented by nine design variable categories: audio environment, visual environment, safety enhancement, wayfinding system, sustainability, patient room, family support spaces, staff support spaces, and physician support spaces. Furthermore, a series of matrices is presented that indicates knowledge gaps concerning the relationship between specific healthcare facility design variable categories and participant and organizational outcomes. From this analysis, the authors identify fertile research opportunities from the perspectives of key stakeholders.

  17. Cytoplasmic Domain of MscS Interacts with Cell Division Protein FtsZ: A Possible Non-Channel Function of the Mechanosensitive Channel in Escherichia Coli.

    PubMed

    Koprowski, Piotr; Grajkowski, Wojciech; Balcerzak, Marcin; Filipiuk, Iwona; Fabczak, Hanna; Kubalski, Andrzej

    2015-01-01

    Bacterial mechano-sensitive (MS) channels reside in the inner membrane and are considered to act as emergency valves whose role is to lower cell turgor when bacteria enter hypo-osmotic environments. However, there is emerging evidence that members of the Mechano-sensitive channel Small (MscS) family play additional roles in bacterial and plant cell physiology. MscS has a large cytoplasmic C-terminal region that changes its shape upon activation and inactivation of the channel. Our pull-down and co-sedimentation assays show that this domain interacts with FtsZ, a bacterial tubulin-like protein. We identify point mutations in the MscS C-terminal domain that reduce binding to FtsZ and show that bacteria expressing these mutants are compromised in growth on sublethal concentrations of β-lactam antibiotics. Our results suggest that interaction between MscS and FtsZ could occur upon inactivation and/or opening of the channel and could be important for the bacterial cell response against sustained stress upon stationary phase and in the presence of β-lactam antibiotics.

  18. Cytoplasmic Domain of MscS Interacts with Cell Division Protein FtsZ: A Possible Non-Channel Function of the Mechanosensitive Channel in Escherichia Coli

    PubMed Central

    Koprowski, Piotr; Grajkowski, Wojciech; Balcerzak, Marcin; Filipiuk, Iwona; Fabczak, Hanna; Kubalski, Andrzej

    2015-01-01

    Bacterial mechano-sensitive (MS) channels reside in the inner membrane and are considered to act as emergency valves whose role is to lower cell turgor when bacteria enter hypo-osmotic environments. However, there is emerging evidence that members of the Mechano-sensitive channel Small (MscS) family play additional roles in bacterial and plant cell physiology. MscS has a large cytoplasmic C-terminal region that changes its shape upon activation and inactivation of the channel. Our pull-down and co-sedimentation assays show that this domain interacts with FtsZ, a bacterial tubulin-like protein. We identify point mutations in the MscS C-terminal domain that reduce binding to FtsZ and show that bacteria expressing these mutants are compromised in growth on sublethal concentrations of β-lactam antibiotics. Our results suggest that interaction between MscS and FtsZ could occur upon inactivation and/or opening of the channel and could be important for the bacterial cell response against sustained stress upon stationary phase and in the presence of β-lactam antibiotics. PMID:25996836

  19. Phylogenetic and Protein Sequence Analysis of Bacterial Chemoreceptors.

    PubMed

    Ortega, Davi R; Zhulin, Igor B

    2018-01-01

    Identifying chemoreceptors in sequenced bacterial genomes, revealing their domain architecture, inferring their evolutionary relationships, and comparing them to chemoreceptors of known function become important steps in genome annotation and chemotaxis research. Here, we describe bioinformatics procedures that enable such analyses, using two closely related bacterial genomes as examples.

  20. A Bioinformatic Strategy for the Detection, Classification and Analysis of Bacterial Autotransporters

    PubMed Central

    Celik, Nermin; Webb, Chaille T.; Leyton, Denisse L.; Holt, Kathryn E.; Heinz, Eva; Gorrell, Rebecca; Kwok, Terry; Naderer, Thomas; Strugnell, Richard A.; Speed, Terence P.; Teasdale, Rohan D.; Likić, Vladimir A.; Lithgow, Trevor

    2012-01-01

    Autotransporters are secreted proteins that are assembled into the outer membrane of bacterial cells. The passenger domains of autotransporters are crucial for bacterial pathogenesis, with some remaining attached to the bacterial surface while others are released by proteolysis. An enigma remains as to whether autotransporters should be considered a class of secretion system, or simply a class of substrate with peculiar requirements for their secretion. We sought to establish a sensitive search protocol that could identify and characterize diverse autotransporters from bacterial genome sequence data. The new sequence analysis pipeline identified more than 1500 autotransporter sequences from diverse bacteria, including numerous species of Chlamydiales and Fusobacteria as well as all classes of Proteobacteria. Interrogation of the proteins revealed that there are numerous classes of passenger domains beyond the known proteases, adhesins and esterases. In addition the barrel-domain-a characteristic feature of autotransporters-was found to be composed from seven conserved sequence segments that can be arranged in multiple ways in the tertiary structure of the assembled autotransporter. One of these conserved motifs overlays the targeting information required for autotransporters to reach the outer membrane. Another conserved and diagnostic motif maps to the linker region between the passenger domain and barrel-domain, indicating it as an important feature in the assembly of autotransporters. PMID:22905239

  1. Is there a domain-general cognitive structuring system? Evidence from structural priming across music, math, action descriptions, and language.

    PubMed

    Van de Cavey, Joris; Hartsuiker, Robert J

    2016-01-01

    Cognitive processing in many domains (e.g., sentence comprehension, music listening, and math solving) requires sequential information to be organized into an integrational structure. There appears to be some overlap in integrational processing across domains, as shown by cross-domain interference effects when for example linguistic and musical stimuli are jointly presented (Koelsch, Gunter, Wittfoth, & Sammler, 2005; Slevc, Rosenberg, & Patel, 2009). These findings support theories of overlapping resources for integrational processing across domains (cfr. SSIRH Patel, 2003; SWM, Kljajevic, 2010). However, there are some limitations to the studies mentioned above, such as the frequent use of unnaturalistic integrational difficulties. In recent years, the idea has risen that evidence for domain-generality in structural processing might also be yielded though priming paradigms (cfr. Scheepers, 2003). The rationale behind this is that integrational processing across domains regularly requires the processing of dependencies across short or long distances in the sequence, involving respectively less or more syntactic working memory resources (cfr. SWM, Kljajevic, 2010), and such processing decisions might persist over time. However, whereas recent studies have shown suggestive priming of integrational structure between language and arithmetics (though often dependent on arithmetic performance, cfr. Scheepers et al., 2011; Scheepers & Sturt, 2014), it remains to be investigated to what extent we can also find evidence for priming in other domains, such as music and action (cfr. SWM, Kljajevic, 2010). Experiment 1a showed structural priming from the processing of musical sequences onto the position in the sentence structure (early or late) to which a relative clause was attached in subsequent sentence completion. Importantly, Experiment 1b showed that a similar structural manipulation based on non-hierarchically ordered color sequences did not yield any priming effect

  2. Overview of systematic reviews assessing the evidence for shorter versus longer duration antibiotic treatment for bacterial infections in secondary care.

    PubMed

    Onakpoya, Igho J; Walker, A Sarah; Tan, Pui S; Spencer, Elizabeth A; Gbinigie, Oghenekome A; Cook, Johanna; Llewelyn, Martin J; Butler, Christopher C

    2018-01-01

    Our objective was to assess the clinical effectiveness of shorter versus longer duration antibiotics for treatment of bacterial infections in adults and children in secondary care settings, using the evidence from published systematic reviews. We conducted electronic searches in MEDLINE, Embase, Cochrane, and Cinahl. Our primary outcome was clinical resolution. The quality of included reviews was assessed using the AMSTAR criteria, and the quality of the evidence was rated using the GRADE criteria. We included 6 systematic reviews (n = 3,162). Four reviews were rated high quality, and two of moderate quality. In adults, there was no difference between shorter versus longer duration in clinical resolution rates for peritonitis (RR 1.03, 95% CI 0.98 to 1.09, I2 = 0%), ventilator-associated pneumonia (RR 0.93; 95% CI 0.81 to 1.08, I2 = 24%), or acute pyelonephritis and septic UTI (clinical failure: RR 1.00, 95% CI 0.46 to 2.18). The quality of the evidence was very low to moderate. In children, there was no difference in clinical resolution rates for pneumonia (RR 0.98, 95% CI 0.91 to 1.04, I2 = 48%), pyelonephritis (RR 0.95, 95% CI 0.88 to 1.04) and confirmed bacterial meningitis (RR 1.02, 95% CI 0.93 to 1.11, I2 = 0%). The quality of the evidence was low to moderate. In conclusion, there is currently a limited body of evidence to clearly assess the clinical benefits of shorter versus longer duration antibiotics in secondary care. High quality trials assessing strategies to shorten antibiotic treatment duration for bacterial infections in secondary care settings should now be a priority.

  3. Overview of systematic reviews assessing the evidence for shorter versus longer duration antibiotic treatment for bacterial infections in secondary care

    PubMed Central

    Walker, A. Sarah; Tan, Pui S.; Spencer, Elizabeth A.; Gbinigie, Oghenekome A.; Cook, Johanna; Llewelyn, Martin J.; Butler, Christopher C.

    2018-01-01

    Our objective was to assess the clinical effectiveness of shorter versus longer duration antibiotics for treatment of bacterial infections in adults and children in secondary care settings, using the evidence from published systematic reviews. We conducted electronic searches in MEDLINE, Embase, Cochrane, and Cinahl. Our primary outcome was clinical resolution. The quality of included reviews was assessed using the AMSTAR criteria, and the quality of the evidence was rated using the GRADE criteria. We included 6 systematic reviews (n = 3,162). Four reviews were rated high quality, and two of moderate quality. In adults, there was no difference between shorter versus longer duration in clinical resolution rates for peritonitis (RR 1.03, 95% CI 0.98 to 1.09, I2 = 0%), ventilator-associated pneumonia (RR 0.93; 95% CI 0.81 to 1.08, I2 = 24%), or acute pyelonephritis and septic UTI (clinical failure: RR 1.00, 95% CI 0.46 to 2.18). The quality of the evidence was very low to moderate. In children, there was no difference in clinical resolution rates for pneumonia (RR 0.98, 95% CI 0.91 to 1.04, I2 = 48%), pyelonephritis (RR 0.95, 95% CI 0.88 to 1.04) and confirmed bacterial meningitis (RR 1.02, 95% CI 0.93 to 1.11, I2 = 0%). The quality of the evidence was low to moderate. In conclusion, there is currently a limited body of evidence to clearly assess the clinical benefits of shorter versus longer duration antibiotics in secondary care. High quality trials assessing strategies to shorten antibiotic treatment duration for bacterial infections in secondary care settings should now be a priority. PMID:29590188

  4. Bacterial zoonoses of fishes: a review and appraisal of evidence for linkages between fish and human infections.

    PubMed

    Gauthier, David T

    2015-01-01

    Human contact with and consumption of fishes presents hazards from a range of bacterial zoonotic infections. Whereas many bacterial pathogens have been presented as fish-borne zoonoses on the basis of epidemiological and phenotypic evidence, genetic identity between fish and human isolates is not frequently examined or does not provide support for transmission between these hosts. In order to accurately assess the zoonotic risk from exposure to fishes in the context of aquaculture, wild fisheries and ornamental aquaria, it is important to critically examine evidence of linkages between bacteria infecting fishes and humans. This article reviews bacteria typically presented as fish-borne zoonoses, and examines the current strength of evidence for this classification. Of bacteria generally described as fish-borne zoonoses, only Mycobacterium spp., Streptococcus iniae, Clostridium botulinum, and Vibrio vulnificus appear to be well-supported as zoonoses in the strict sense. Erysipelothrix rhusiopathiae, while transmissible from fishes to humans, does not cause disease in fishes and is therefore excluded from the list. Some epidemiological and/or molecular linkages have been made between other bacteria infecting both fishes and humans, but more work is needed to elucidate routes of transmission and the identity of these pathogens in their respective hosts at the genomic level. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Chemotaxis cluster 1 proteins form cytoplasmic arrays in Vibrio cholerae and are stabilized by a double signaling domain receptor DosM.

    PubMed

    Briegel, Ariane; Ortega, Davi R; Mann, Petra; Kjær, Andreas; Ringgaard, Simon; Jensen, Grant J

    2016-09-13

    Nearly all motile bacterial cells use a highly sensitive and adaptable sensory system to detect changes in nutrient concentrations in the environment and guide their movements toward attractants and away from repellents. The best-studied bacterial chemoreceptor arrays are membrane-bound. Many motile bacteria contain one or more additional, sometimes purely cytoplasmic, chemoreceptor systems. Vibrio cholerae contains three chemotaxis clusters (I, II, and III). Here, using electron cryotomography, we explore V. cholerae's cytoplasmic chemoreceptor array and establish that it is formed by proteins from cluster I. We further identify a chemoreceptor with an unusual domain architecture, DosM, which is essential for formation of the cytoplasmic arrays. DosM contains two signaling domains and spans the two-layered cytoplasmic arrays. Finally, we present evidence suggesting that this type of receptor is important for the structural stability of the cytoplasmic array.

  6. Structure of Thermotoga maritima TM0439: implications for the mechanism of bacterial GntR transcription regulators with Zn2+-binding FCD domains

    PubMed Central

    Zheng, Meiying; Cooper, David R.; Grossoehme, Nickolas E.; Yu, Minmin; Hung, Li-Wei; Cieslik, Marcin; Derewenda, Urszula; Lesley, Scott A.; Wilson, Ian A.; Giedroc, David P.; Derewenda, Zygmunt S.

    2009-01-01

    The GntR superfamily of dimeric transcription factors, with more than 6200 members encoded in bacterial genomes, are characterized by N-terminal winged-helix DNA-binding domains and diverse C-terminal regulatory domains which provide a basis for the classification of the constituent families. The largest of these families, FadR, contains nearly 3000 proteins with all-α-helical regulatory domains classified into two related Pfam families: FadR_C and FCD. Only two crystal structures of FadR-family members, those of Escherichia coli FadR protein and LldR from Corynebacterium glutamicum, have been described to date in the literature. Here, the crystal structure of TM0439, a GntR regulator with an FCD domain found in the Thermotoga maritima genome, is described. The FCD domain is similar to that of the LldR regulator and contains a buried metal-binding site. Using atomic absorption spectroscopy and Trp fluorescence, it is shown that the recombinant protein contains bound Ni2+ ions but that it is able to bind Zn2+ with K d < 70 nM. It is concluded that Zn2+ is the likely physiological metal and that it may perform either structural or regulatory roles or both. Finally, the TM0439 structure is compared with two other FadR-family structures recently deposited by structural genomics consortia. The results call for a revision in the classification of the FadR family of transcription factors. PMID:19307717

  7. Evidence of polyethylene biodegradation by bacterial strains from the guts of plastic-eating waxworms.

    PubMed

    Yang, Jun; Yang, Yu; Wu, Wei-Min; Zhao, Jiao; Jiang, Lei

    2014-12-02

    Polyethylene (PE) has been considered nonbiodegradable for decades. Although the biodegradation of PE by bacterial cultures has been occasionally described, valid evidence of PE biodegradation has remained limited in the literature. We found that waxworms, or Indian mealmoths (the larvae of Plodia interpunctella), were capable of chewing and eating PE films. Two bacterial strains capable of degrading PE were isolated from this worm's gut, Enterobacter asburiae YT1 and Bacillus sp. YP1. Over a 28-day incubation period of the two strains on PE films, viable biofilms formed, and the PE films' hydrophobicity decreased. Obvious damage, including pits and cavities (0.3-0.4 μm in depth), was observed on the surfaces of the PE films using scanning electron microscopy (SEM) and atomic force microscopy (AFM). The formation of carbonyl groups was verified using X-ray photoelectron spectroscopy (XPS) and microattenuated total reflectance/Fourier transform infrared (micro-ATR/FTIR) imaging microscope. Suspension cultures of YT1 and YP1 (10(8) cells/mL) were able to degrade approximately 6.1 ± 0.3% and 10.7 ± 0.2% of the PE films (100 mg), respectively, over a 60-day incubation period. The molecular weights of the residual PE films were lower, and the release of 12 water-soluble daughter products was also detected. The results demonstrated the presence of PE-degrading bacteria in the guts of waxworms and provided promising evidence for the biodegradation of PE in the environment.

  8. Specific arrangement of alpha-helical coiled coils in the core domain of the bacterial flagellar hook for the universal joint function.

    PubMed

    Fujii, Takashi; Kato, Takayuki; Namba, Keiichi

    2009-11-11

    The bacterial flagellar hook is a short, highly curved tubular structure connecting the rotary motor to the filament acting as a helical propeller. The bending flexibility of the hook allows it to work as a universal joint. A partial atomic model of the hook revealed a sliding intersubunit domain interaction along the protofilament to produce bending flexibility. However, it remained unclear how the tightly packed inner core domains can still permit axial extension and compression. We report advances in cryoEM image analysis for high-resolution, high-throughput structural analysis and a density map of the hook that reveals most of the secondary structures, including the terminal alpha helices forming a coiled coil. The orientations and axial packing interactions of these two alpha helices are distinctly different from those of the filament, allowing them to have a room for axial compression and extension for bending flexibility without impairing the mechanical stability of the hook.

  9. Global biogeographic sampling of bacterial secondary metabolism

    PubMed Central

    Charlop-Powers, Zachary; Owen, Jeremy G; Reddy, Boojala Vijay B; Ternei, Melinda A; Guimarães, Denise O; de Frias, Ulysses A; Pupo, Monica T; Seepe, Prudy; Feng, Zhiyang; Brady, Sean F

    2015-01-01

    Recent bacterial (meta)genome sequencing efforts suggest the existence of an enormous untapped reservoir of natural-product-encoding biosynthetic gene clusters in the environment. Here we use the pyro-sequencing of PCR amplicons derived from both nonribosomal peptide adenylation domains and polyketide ketosynthase domains to compare biosynthetic diversity in soil microbiomes from around the globe. We see large differences in domain populations from all except the most proximal and biome-similar samples, suggesting that most microbiomes will encode largely distinct collections of bacterial secondary metabolites. Our data indicate a correlation between two factors, geographic distance and biome-type, and the biosynthetic diversity found in soil environments. By assigning reads to known gene clusters we identify hotspots of biomedically relevant biosynthetic diversity. These observations not only provide new insights into the natural world, they also provide a road map for guiding future natural products discovery efforts. DOI: http://dx.doi.org/10.7554/eLife.05048.001 PMID:25599565

  10. D-amino acids inhibit initial bacterial adhesion: thermodynamic evidence.

    PubMed

    Xing, Su-Fang; Sun, Xue-Fei; Taylor, Alicia A; Walker, Sharon L; Wang, Yi-Fu; Wang, Shu-Guang

    2015-04-01

    Bacterial biofilms are structured communities of cells enclosed in a self-produced hydrated polymeric matrix that can adhere to inert or living surfaces. D-Amino acids were previously identified as self-produced compounds that mediate biofilm disassembly by causing the release of the protein component of the polymeric matrix. However, whether exogenous D-amino acids could inhibit initial bacterial adhesion is still unknown. Here, the effect of the exogenous amino acid D-tyrosine on initial bacterial adhesion was determined by combined use of chemical analysis, force spectroscopic measurement, and theoretical predictions. The surface thermodynamic theory demonstrated that the total interaction energy increased with more D-tyrosine, and the contribution of Lewis acid-base interactions relative to the change in the total interaction energy was much greater than the overall nonspecific interactions. Finally, atomic force microscopy analysis implied that the hydrogen bond numbers and adhesion forces decreased with the increase in D-tyrosine concentrations. D-Tyrosine contributed to the repulsive nature of the cell and ultimately led to the inhibition of bacterial adhesion. This study provides a new way to regulate biofilm formation by manipulating the contents of D-amino acids in natural or engineered systems. © 2014 Wiley Periodicals, Inc.

  11. A localized interaction surface for voltage-sensing domains on the pore domain of a K+ channel.

    PubMed

    Li-Smerin, Y; Hackos, D H; Swartz, K J

    2000-02-01

    Voltage-gated K+ channels contain a central pore domain and four surrounding voltage-sensing domains. How and where changes in the structure of the voltage-sensing domains couple to the pore domain so as to gate ion conduction is not understood. The crystal structure of KcsA, a bacterial K+ channel homologous to the pore domain of voltage-gated K+ channels, provides a starting point for addressing this question. Guided by this structure, we used tryptophan-scanning mutagenesis on the transmembrane shell of the pore domain in the Shaker voltage-gated K+ channel to localize potential protein-protein and protein-lipid interfaces. Some mutants cause only minor changes in gating and when mapped onto the KcsA structure cluster away from the interface between pore domain subunits. In contrast, mutants producing large changes in gating tend to cluster near this interface. These results imply that voltage-sensing domains interact with localized regions near the interface between adjacent pore domain subunits.

  12. Domain Specific vs Domain General: Implications for Dynamic Assessment

    ERIC Educational Resources Information Center

    Kaniel, Shlomo

    2010-01-01

    The article responds to the need for evidence-based dynamic assessment. The article is divided into two sections: In Part 1 we examine the scientific answer to the question of how far human mental activities and capabilities are domain general (DG) / domain specific (DS). A highly complex answer emerges from the literature review of domains such…

  13. C-terminal domains of bacterial proteases: structure, function and the biotechnological applications.

    PubMed

    Huang, J; Wu, C; Liu, D; Yang, X; Wu, R; Zhang, J; Ma, C; He, H

    2017-01-01

    C-terminal domains widely exist in the C-terminal region of multidomain proteases. As a β-sandwich domain in multidomain protease, the C-terminal domain plays an important role in proteolysis including regulation of the secretory process, anchoring and swelling the substrate molecule, presenting as an inhibitor for the preprotease and adapting the protein structural flexibility and stability. In this review, the diversity, structural characteristics and biological function of C-terminal protease domains are described. Furthermore, the application prospects of C-terminal domains, including polycystic kidney disease, prepeptidase C-terminal and collagen-binding domain, in the area of medicine and biological artificial materials are also discussed. © 2016 The Society for Applied Microbiology.

  14. Evidence for a role for the phosphotyrosine-binding domain of Shc in interleukin 2 signaling.

    PubMed Central

    Ravichandran, K S; Igras, V; Shoelson, S E; Fesik, S W; Burakoff, S J

    1996-01-01

    Stimulation via the T-cell growth factor interleukin 2 (IL-2) leads to tyrosine phosphorylation of Shc, the interaction of Shc with Grb2, and the Ras GTP/GDP exchange factor, mSOS. Shc also coprecipitates with the IL-2 receptor (IL-2R), and therefore, may link IL-2R to Ras activation. We have further characterized the Shc-IL-2R interaction and have made the following observations. (i) Among the two phosphotyrosine-interaction domains present in Shc, the phosphotyrosine-binding (PTB) domain, rather than its SH2 domain, interacts with the tyrosine-phosphorylated IL-2R beta chain. Moreover, the Shc-PTB domain binds a phosphopeptide derived from the IL-2R beta chain (corresponding to residues surrounding Y338, SCFTNQGpYFF) with high affinity. (ii) In vivo, mutant IL-2R beta chains lacking the acidic region of IL-2Rbeta (which contains Y338) fail to phosphorylate Shc. Furthermore, when wild type or mutant Shc proteins that lack the PTB domain were expressed in the IL-2-dependent CTLL-20 cell line, an intact Shc-PTB domain was required for Shc phosphorylation by the IL-2R, which provides further support for a Shc-PTB-IL-2R interaction in vivo. (iii) PTB and SH2 domains of Shc associate with different proteins in IL-2- and T-cell-receptor-stimulated lysates, suggesting that Shc, through the concurrent use of its two different phosphotyrosine-binding domains, could assemble multiple protein complexes. Taken together, our in vivo and in vitro observations suggest that the PTB domain of Shc interacts with Y338 of the IL-2R and provide evidence for a functional role for the Shc-PTB domain in IL-2 signaling. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8643566

  15. Unusual Sleep Experiences, Dissociation, and Schizotypy: Evidence for a Common Domain

    PubMed Central

    Koffel, Erin; Watson, David

    2009-01-01

    This paper reviews studies that have examined associations between unusual sleep experiences (including nightmares, vivid dreaming, narcolepsy symptoms, and complex nighttime behaviors) and dissociation and schizotypy. Using correlational studies and structural analyses, evidence is provided that unusual sleep experiences, dissociation, and schizotypy belong to a common domain. It is demonstrated that unusual sleep experiences show specificity to dissociation and schizotypy compared to other daytime symptoms (e.g., anxiety, depression, substance use) and other sleep disturbances (e.g., insomnia, lassitude/fatigue). The paper also outlines the methodological limitations of the existing evidence and makes suggestions for future research. Finally, three models for the overlap of daytime and nighttime symptoms are reviewed, including biological abnormalities, trauma, and personality traits. Although further research is needed, it is suggested that daytime and nighttime symptoms result from problems with sleep-wake state boundaries, which may be precipitated by stress or trauma. In addition, association between daytime and nighttime symptoms can be attributed to the higher order personality trait of Oddity. PMID:19581031

  16. Emotion and working memory: evidence for domain-specific processes for affective maintenance.

    PubMed

    Mikels, Joseph A; Reuter-Lorenz, Patricia A; Beyer, Jonathan A; Fredrickson, Barbara L

    2008-04-01

    Working memory is comprised of separable subsystems for visual and verbal information, but what if the information is affective? Does the maintenance of affective information rely on the same processes that maintain nonaffective information? The authors address this question using a novel delayed-response task developed to investigate the short-term maintenance of affective memoranda. Using selective interference methods the authors find that a secondary emotion-regulation task impaired affect intensity maintenance, whereas secondary cognitive tasks disrupted brightness intensity maintenance, but facilitated affect maintenance. Additionally, performance on the affect maintenance task depends on the valence of the maintained feeling, further supporting the domain-specific nature of the task. The importance of affect maintenance per se is further supported by demonstrating that the observed valence effects depend on a memory delay and are not evident with simultaneous presentation of stimuli. These findings suggest that the working memory system may include domain-specific components that are specialized for the maintenance of affective memoranda. (Copyright) 2008 APA.

  17. Beryllofluoride mimics phosphorylation of NtrC and other bacterial response regulators

    PubMed Central

    Yan, Dalai; Cho, Ho S.; Hastings, Curtis A.; Igo, Michele M.; Lee, Seok-Yong; Pelton, Jeffrey G.; Stewart, Valley; Wemmer, David E.; Kustu, Sydney

    1999-01-01

    Two-component systems, sensor kinase-response regulator pairs, dominate bacterial signal transduction. Regulation is exerted by phosphorylation of an Asp in receiver domains of response regulators. Lability of the acyl phosphate linkage has limited structure determination for the active, phosphorylated forms of receiver domains. As assessed by both functional and structural criteria, beryllofluoride yields an excellent analogue of aspartyl phosphate in response regulator NtrC, a bacterial enhancer-binding protein. Beryllofluoride also appears to activate the chemotaxis, sporulation, osmosensing, and nitrate/nitrite response regulators CheY, Spo0F, OmpR, and NarL, respectively. NMR spectroscopic studies indicate that beryllofluoride will facilitate both biochemical and structural characterization of the active forms of receiver domains. PMID:10611291

  18. Domain Evolution and Functional Diversification of Sulfite Reductases

    NASA Astrophysics Data System (ADS)

    Dhillon, Ashita; Goswami, Sulip; Riley, Monica; Teske, Andreas; Sogin, Mitchell

    2005-02-01

    Sulfite reductases are key enzymes of assimilatory and dissimilatory sulfur metabolism, which occur in diverse bacterial and archaeal lineages. They share a highly conserved domain "C-X5-C-n-C-X3-C" for binding siroheme and iron-sulfur clusters that facilitate electron transfer to the substrate. For each sulfite reductase cluster, the siroheme-binding domain is positioned slightly differently at the N-terminus of dsrA and dsrB, while in the assimilatory proteins the siroheme domain is located at the C-terminus. Our sequence and phylogenetic analysis of the siroheme-binding domain shows that sulfite reductase sequences diverged from a common ancestor into four separate clusters (aSir, alSir, dsr, and asrC) that are biochemically distinct; each serves a different assimilatory or dissimilatory role in sulfur metabolism. The phylogenetic distribution and functional grouping in sulfite reductase clusters (dsrA and dsrB vs. aSiR, asrC, and alSir) suggest that their functional diversification during evolution may have preceded the bacterial/archaeal divergence.

  19. A Common Fold Mediates Vertebrate Defense and Bacterial Attack

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosado, Carlos J.; Buckle, Ashley M.; Law, Ruby H.P.

    2008-10-02

    Proteins containing membrane attack complex/perforin (MACPF) domains play important roles in vertebrate immunity, embryonic development, and neural-cell migration. In vertebrates, the ninth component of complement and perforin form oligomeric pores that lyse bacteria and kill virus-infected cells, respectively. However, the mechanism of MACPF function is unknown. We determined the crystal structure of a bacterial MACPF protein, Plu-MACPF from Photorhabdus luminescens, to 2.0 angstrom resolution. The MACPF domain reveals structural similarity with poreforming cholesterol-dependent cytolysins (CDCs) from Gram-positive bacteria. This suggests that lytic MACPF proteins may use a CDC-like mechanism to form pores and disrupt cell membranes. Sequence similarity between bacterialmore » and vertebrate MACPF domains suggests that the fold of the CDCs, a family of proteins important for bacterial pathogenesis, is probably used by vertebrates for defense against infection.« less

  20. Spectral-domain optical coherence tomography of roth spots.

    PubMed

    Giovinazzo, Jerome; Mrejen, Sarah; Freund, K Bailey

    2013-01-01

    To describe the retinal findings of subacute bacterial endocarditis, their evolution after treatment, and analysis with spectral-domain optical coherence tomography. Retrospective chart review. A 21-year-old man presented with the sudden onset of a central scotoma in his left eye because of a sub-internal limiting membrane hemorrhage overlying the left fovea. When examined 2 weeks later, Roth spots were noted in his right eye. The patient was immediately referred to his internist and diagnosed with subacute bacterial endocarditis with cultures positive for Streptococcus viridans. He subsequently underwent aortic valve replacement surgery after 4 weeks of intravenous antibiotic therapy. When examined 4 weeks after valve replacement surgery, there was regression of the Roth spots. The present case demonstrates the importance of a funduscopic examination in the early diagnosis and management of subacute bacterial endocarditis. The analysis of Roth spots with spectral-domain optical coherence tomography suggested that they were septic emboli.

  1. Evolution of aminoacyl-tRNA synthetases--analysis of unique domain architectures and phylogenetic trees reveals a complex history of horizontal gene transfer events.

    PubMed

    Wolf, Y I; Aravind, L; Grishin, N V; Koonin, E V

    1999-08-01

    Phylogenetic analysis of aminoacyl-tRNA synthetases (aaRSs) of all 20 specificities from completely sequenced bacterial, archaeal, and eukaryotic genomes reveals a complex evolutionary picture. Detailed examination of the domain architecture of aaRSs using sequence profile searches delineated a network of partially conserved domains that is even more elaborate than previously suspected. Several unexpected evolutionary connections were identified, including the apparent origin of the beta-subunit of bacterial GlyRS from the HD superfamily of hydrolases, a domain shared by bacterial AspRS and the B subunit of archaeal glutamyl-tRNA amidotransferases, and another previously undetected domain that is conserved in a subset of ThrRS, guanosine polyphosphate hydrolases and synthetases, and a family of GTPases. Comparison of domain architectures and multiple alignments resulted in the delineation of synapomorphies-shared derived characters, such as extra domains or inserts-for most of the aaRSs specificities. These synapomorphies partition sets of aaRSs with the same specificity into two or more distinct and apparently monophyletic groups. In conjunction with cluster analysis and a modification of the midpoint-rooting procedure, this partitioning was used to infer the likely root position in phylogenetic trees. The topologies of the resulting rooted trees for most of the aaRSs specificities are compatible with the evolutionary "standard model" whereby the earliest radiation event separated bacteria from the common ancestor of archaea and eukaryotes as opposed to the two other possible evolutionary scenarios for the three major divisions of life. For almost all aaRSs specificities, however, this simple scheme is confounded by displacement of some of the bacterial aaRSs by their eukaryotic or, less frequently, archaeal counterparts. Displacement of ancestral eukaryotic aaRS genes by bacterial ones, presumably of mitochondrial origin, was observed for three aaRSs. In contrast

  2. A structural role for the PHP domain in E. coli DNA polymerase III

    PubMed Central

    2013-01-01

    Background In addition to the core catalytic machinery, bacterial replicative DNA polymerases contain a Polymerase and Histidinol Phosphatase (PHP) domain whose function is not entirely understood. The PHP domains of some bacterial replicases are active metal-dependent nucleases that may play a role in proofreading. In E. coli DNA polymerase III, however, the PHP domain has lost several metal-coordinating residues and is likely to be catalytically inactive. Results Genomic searches show that the loss of metal-coordinating residues in polymerase PHP domains is likely to have coevolved with the presence of a separate proofreading exonuclease that works with the polymerase. Although the E. coli Pol III PHP domain has lost metal-coordinating residues, the structure of the domain has been conserved to a remarkable degree when compared to that of metal-binding PHP domains. This is demonstrated by our ability to restore metal binding with only three point mutations, as confirmed by the metal-bound crystal structure of this mutant determined at 2.9 Å resolution. We also show that Pol III, a large multi-domain protein, unfolds cooperatively and that mutations in the degenerate metal-binding site of the PHP domain decrease the overall stability of Pol III and reduce its activity. Conclusions While the presence of a PHP domain in replicative bacterial polymerases is strictly conserved, its ability to coordinate metals and to perform proofreading exonuclease activity is not, suggesting additional non-enzymatic roles for the domain. Our results show that the PHP domain is a major structural element in Pol III and its integrity modulates both the stability and activity of the polymerase. PMID:23672456

  3. A structural role for the PHP domain in E. coli DNA polymerase III.

    PubMed

    Barros, Tiago; Guenther, Joel; Kelch, Brian; Anaya, Jordan; Prabhakar, Arjun; O'Donnell, Mike; Kuriyan, John; Lamers, Meindert H

    2013-05-14

    In addition to the core catalytic machinery, bacterial replicative DNA polymerases contain a Polymerase and Histidinol Phosphatase (PHP) domain whose function is not entirely understood. The PHP domains of some bacterial replicases are active metal-dependent nucleases that may play a role in proofreading. In E. coli DNA polymerase III, however, the PHP domain has lost several metal-coordinating residues and is likely to be catalytically inactive. Genomic searches show that the loss of metal-coordinating residues in polymerase PHP domains is likely to have coevolved with the presence of a separate proofreading exonuclease that works with the polymerase. Although the E. coli Pol III PHP domain has lost metal-coordinating residues, the structure of the domain has been conserved to a remarkable degree when compared to that of metal-binding PHP domains. This is demonstrated by our ability to restore metal binding with only three point mutations, as confirmed by the metal-bound crystal structure of this mutant determined at 2.9 Å resolution. We also show that Pol III, a large multi-domain protein, unfolds cooperatively and that mutations in the degenerate metal-binding site of the PHP domain decrease the overall stability of Pol III and reduce its activity. While the presence of a PHP domain in replicative bacterial polymerases is strictly conserved, its ability to coordinate metals and to perform proofreading exonuclease activity is not, suggesting additional non-enzymatic roles for the domain. Our results show that the PHP domain is a major structural element in Pol III and its integrity modulates both the stability and activity of the polymerase.

  4. Binding of a C-type lectin’s coiled-coil domain to the Domeless receptor directly activates the JAK/STAT pathway in the shrimp immune response to bacterial infection

    PubMed Central

    Zhao, Xiao-Fan; Vasta, Gerardo R.

    2017-01-01

    C-type lectins (CTLs) are characterized by the presence of a C-type carbohydrate recognition domain (CTLD) that by recognizing microbial glycans, is responsible for their roles as pattern recognition receptors in the immune response to bacterial infection. In addition to the CTLD, however, some CTLs display additional domains that can carry out effector functions, such as the collagenous domain of the mannose-binding lectin. While in vertebrates, the mechanisms involved in these effector functions have been characterized in considerable detail, in invertebrates they remain poorly understood. In this study, we identified in the kuruma shrimp (Marsupenaeus japonicus) a structurally novel CTL (MjCC-CL) that in addition to the canonical CTLD, contains a coiled-coil domain (CCD) responsible for the effector functions that are key to the shrimp’s antibacterial response mediated by antimicrobial peptides (AMPs). By the use of in vitro and in vivo experimental approaches we elucidated the mechanism by which the recognition of bacterial glycans by the CTLD of MjCC-CL leads to activation of the JAK/STAT pathway via interaction of the CCD with the surface receptor Domeless, and upregulation of AMP expression. Thus, our study of the shrimp MjCC-CL revealed a striking functional difference with vertebrates, in which the JAK/STAT pathway is indirectly activated by cell death and stress signals through cytokines or growth factors. Instead, by cross-linking microbial pathogens with the cell surface receptor Domeless, a lectin directly activates the JAK/STAT pathway, which plays a central role in the shrimp antibacterial immune responses by upregulating expression of selected AMPs. PMID:28931061

  5. Large scale genomic analysis shows no evidence for pathogen adaptation between the blood and cerebrospinal fluid niches during bacterial meningitis

    PubMed Central

    Lees, John A.; Kremer, Philip H. C.; Manso, Ana S.; Croucher, Nicholas J.; Ferwerda, Bart; Serón, Mercedes Valls; Oggioni, Marco R.; Parkhill, Julian; Brouwer, Matthijs C.; van der Ende, Arie; van de Beek, Diederik

    2017-01-01

    Recent studies have provided evidence for rapid pathogen genome diversification, some of which could potentially affect the course of disease. We have previously described such variation seen between isolates infecting the blood and cerebrospinal fluid (CSF) of a single patient during a case of bacterial meningitis. Here, we performed whole-genome sequencing of paired isolates from the blood and CSF of 869 meningitis patients to determine whether such variation frequently occurs between these two niches in cases of bacterial meningitis. Using a combination of reference-free variant calling approaches, we show that no genetic adaptation occurs in either invaded niche during bacterial meningitis for two major pathogen species, Streptococcus pneumoniae and Neisseria meningitidis. This study therefore shows that the bacteria capable of causing meningitis are already able to do this upon entering the blood, and no further sequence change is necessary to cross the blood–brain barrier. Our findings place the focus back on bacterial evolution between nasopharyngeal carriage and invasion, or diversity of the host, as likely mechanisms for determining invasiveness. PMID:28348877

  6. Structure of Thermotoga maritima TM0439: implications for the mechanism of bacterial GntR transcription regulators with Zn{sup 2+}-binding FCD domains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zheng, Meiying; Cooper, David R.; Grossoehme, Nickolas E.

    2009-04-01

    Here, the crystal structure of TM0439, a GntR regulator with an FCD domain found in the Thermotoga maritima genome, is described. The GntR superfamily of dimeric transcription factors, with more than 6200 members encoded in bacterial genomes, are characterized by N-terminal winged-helix DNA-binding domains and diverse C-terminal regulatory domains which provide a basis for the classification of the constituent families. The largest of these families, FadR, contains nearly 3000 proteins with all-α-helical regulatory domains classified into two related Pfam families: FadR-C and FCD. Only two crystal structures of FadR-family members, those of Escherichia coli FadR protein and LldR from Corynebacteriummore » glutamicum, have been described to date in the literature. Here, the crystal structure of TM0439, a GntR regulator with an FCD domain found in the Thermotoga maritima genome, is described. The FCD domain is similar to that of the LldR regulator and contains a buried metal-binding site. Using atomic absorption spectroscopy and Trp fluorescence, it is shown that the recombinant protein contains bound Ni{sup 2+} ions but that it is able to bind Zn{sup 2+} with K{sub d} < 70 nM. It is concluded that Zn{sup 2+} is the likely physiological metal and that it may perform either structural or regulatory roles or both. Finally, the TM0439 structure is compared with two other FadR-family structures recently deposited by structural genomics consortia. The results call for a revision in the classification of the FadR family of transcription factors.« less

  7. Role of quorum sensing in bacterial infections

    PubMed Central

    Castillo-Juárez, Israel; Maeda, Toshinari; Mandujano-Tinoco, Edna Ayerim; Tomás, María; Pérez-Eretza, Berenice; García-Contreras, Silvia Julieta; Wood, Thomas K; García-Contreras, Rodolfo

    2015-01-01

    Quorum sensing (QS) is cell communication that is widely used by bacterial pathogens to coordinate the expression of several collective traits, including the production of multiple virulence factors, biofilm formation, and swarming motility once a population threshold is reached. Several lines of evidence indicate that QS enhances virulence of bacterial pathogens in animal models as well as in human infections; however, its relative importance for bacterial pathogenesis is still incomplete. In this review, we discuss the present evidence from in vitro and in vivo experiments in animal models, as well as from clinical studies, that link QS systems with human infections. We focus on two major QS bacterial models, the opportunistic Gram negative bacteria Pseudomonas aeruginosa and the Gram positive Staphylococcus aureus, which are also two of the main agents responsible of nosocomial and wound infections. In addition, QS communication systems in other bacterial, eukaryotic pathogens, and even immune and cancer cells are also reviewed, and finally, the new approaches proposed to combat bacterial infections by the attenuation of their QS communication systems and virulence are also discussed. PMID:26244150

  8. GW domains of the Listeria monocytogenes invasion protein InlB are SH3-like and mediate binding to host ligands

    PubMed Central

    Marino, Michael; Banerjee, Manidipa; Jonquières, Renaud; Cossart, Pascale; Ghosh, Partho

    2002-01-01

    InlB, a surface-localized protein of Listeria monocytogenes, induces phagocytosis in non-phagocytic mammalian cells by activating Met, a receptor tyrosine kinase. InlB also binds glycosaminoglycans and the protein gC1q-R, two additional host ligands implicated in invasion. We present the structure of InlB, revealing a highly elongated molecule with leucine-rich repeats that bind Met at one end, and GW domains that dissociably bind the bacterial surface at the other. Surprisingly, the GW domains are seen to resemble SH3 domains. Despite this, GW domains are unlikely to act as functional mimics of SH3 domains since their potential proline-binding sites are blocked or destroyed. However, we do show that the GW domains, in addition to binding glycosaminoglycans, bind gC1q-R specifically, and that this binding requires release of InlB from the bacterial surface. Dissociable attachment to the bacterial surface via the GW domains may be responsible for restricting Met activation to a small, localized area of the host cell and for coupling InlB-induced host membrane dynamics with bacterial proximity during invasion. PMID:12411480

  9. The SPOR Domain, a Widely Conserved Peptidoglycan Binding Domain That Targets Proteins to the Site of Cell Division.

    PubMed

    Yahashiri, Atsushi; Jorgenson, Matthew A; Weiss, David S

    2017-07-15

    Sporulation-related repeat (SPOR) domains are small peptidoglycan (PG) binding domains found in thousands of bacterial proteins. The name "SPOR domain" stems from the fact that several early examples came from proteins involved in sporulation, but SPOR domain proteins are quite diverse and contribute to a variety of processes that involve remodeling of the PG sacculus, especially with respect to cell division. SPOR domains target proteins to the division site by binding to regions of PG devoid of stem peptides ("denuded" glycans), which in turn are enriched in septal PG by the intense, localized activity of cell wall amidases involved in daughter cell separation. This targeting mechanism sets SPOR domain proteins apart from most other septal ring proteins, which localize via protein-protein interactions. In addition to SPOR domains, bacteria contain several other PG-binding domains that can exploit features of the cell wall to target proteins to specific subcellular sites. Copyright © 2017 American Society for Microbiology.

  10. Bacterial nucleotide-based second messengers.

    PubMed

    Pesavento, Christina; Hengge, Regine

    2009-04-01

    In all domains of life nucleotide-based second messengers transduce signals originating from changes in the environment or in intracellular conditions into appropriate cellular responses. In prokaryotes cyclic di-GMP has emerged as an important and ubiquitous second messenger regulating bacterial life-style transitions relevant for biofilm formation, virulence, and many other bacterial functions. This review describes similarities and differences in the architecture of the cAMP, (p)ppGpp, and c-di-GMP signaling systems and their underlying signaling principles. Moreover, recent advances in c-di-GMP-mediated signaling will be presented and the integration of c-di-GMP signaling with other nucleotide-based signaling systems will be discussed.

  11. Bacterial and primary production in the Greenland Sea

    NASA Astrophysics Data System (ADS)

    Børsheim, Knut Yngve

    2017-12-01

    Bacterial production rates were measured in water profiles collected in the Greenland Sea and adjacent areas. Hydrography and nutrients throughout the water column were measured along 75°N from 12°W to 10°E at 20 km distance intervals. Net primary production rates from satellite sensed data were compared with literature values from 14C incubations and used for regional and seasonal comparisons. Maximum bacterial production rates were associated with the region close to the edge of the East Greenland current, and the rates decreased gradually towards the center of the Greenland Sea central gyre. Integrated over the upper 20 m the maximum bacterial production rate was 17.9 mmol C m- 2 day- 1, and east of the center of the gyre the average integrated rate was 4.6 mmol C m- 2 day- 1. It is hypothesized that high bacterial production rates in the western Greenland Sea were sustained by organic material carried from the Arctic Ocean by the East Greenland Current. The depth profiles of nitrate and phosphate were very similar both sides of the Arctic front, with 2% higher values between 500 m and 2000 m in the Arctic domain, and a N/P ratio of 13.6. The N/Si ratio varied by depth and region, with increasing silicate depletion from 1500 m depth to the surface. The rate of depletion from 1500 m depth to surface in the Atlantic domain was twice as high as in the Arctic domain. Net primary production rates in the area between the edge of the East Greenland current and the center of the Greenland Sea gyre was 96 mmol C m- 2 day- 1 at the time of the expedition in 2006, and 78 mmol C m- 2 day- 1 east of the center including the Atlantic domain. Annual net primary production estimated from satellite data in the Greenland Sea increased substantially in the period between 2003 and 2016, and the rate of increase was lowest close to the East Greenland Current.

  12. The actin homologue MreB organizes the bacterial cell membrane

    PubMed Central

    Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W.

    2014-01-01

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lipid staining techniques and spectroscopic methods, revealed that MreB filaments create specific membrane regions with increased fluidity (RIFs). Interference with these fluid lipid domains (RIFs) perturbs overall lipid homeostasis and affects membrane protein localization. The influence of MreB on membrane organization and fluidity may explain why the active movement of MreB stimulates membrane protein diffusion. These novel MreB activities add additional complexity to bacterial cell membrane organization and have implications for many membrane-associated processes. PMID:24603761

  13. The actin homologue MreB organizes the bacterial cell membrane.

    PubMed

    Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W

    2014-03-07

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lipid staining techniques and spectroscopic methods, revealed that MreB filaments create specific membrane regions with increased fluidity (RIFs). Interference with these fluid lipid domains (RIFs) perturbs overall lipid homeostasis and affects membrane protein localization. The influence of MreB on membrane organization and fluidity may explain why the active movement of MreB stimulates membrane protein diffusion. These novel MreB activities add additional complexity to bacterial cell membrane organization and have implications for many membrane-associated processes.

  14. Bacterial avirulence genes.

    PubMed

    Leach, J E; White, F F

    1996-01-01

    Although more than 30 bacterial avirulence genes have been cloned and characterized, the function of the gene products in the elictitation of resistance is unknown in all cases but one. The product of avrD from Pseudomonas syringae pv. glycinea likely functions indirectly to elicit resistance in soybean, that is, evidence suggests the gene product is an enzyme involved in elicitor production. In most if not all cases, bacterial avirulence gene function is dependent on interactions with the hypersensitive response and pathogenicity (hrp) genes. Many hrp genes are similar to genes involved in delivery of pathogenicity factors in mammalian bacterial pathogens. Thus, analogies between mammalian and plant pathogens may provide needed clues to elucidate how virulence gene products control induction of resistance.

  15. Phyletic Distribution and Lineage-Specific Domain Architectures of Archaeal Two-Component Signal Transduction Systems

    PubMed Central

    Makarova, Kira S.; Wolf, Yuri I.

    2017-01-01

    ABSTRACT The two-component signal transduction (TCS) machinery is a key mechanism of sensing environmental changes in the prokaryotic world. TCS systems have been characterized thoroughly in bacteria but to a much lesser extent in archaea. Here, we provide an updated census of more than 2,000 histidine kinases and response regulators encoded in 218 complete archaeal genomes, as well as unfinished genomes available from metagenomic data. We describe the domain architectures of the archaeal TCS components, including several novel output domains, and discuss the evolution of the archaeal TCS machinery. The distribution of TCS systems in archaea is strongly biased, with high levels of abundance in haloarchaea and thaumarchaea but none detected in the sequenced genomes from the phyla Crenarchaeota, Nanoarchaeota, and Korarchaeota. The archaeal sensor histidine kinases are generally similar to their well-studied bacterial counterparts but are often located in the cytoplasm and carry multiple PAS and/or GAF domains. In contrast, archaeal response regulators differ dramatically from the bacterial ones. Most archaeal genomes do not encode any of the major classes of bacterial response regulators, such as the DNA-binding transcriptional regulators of the OmpR/PhoB, NarL/FixJ, NtrC, AgrA/LytR, and ActR/PrrA families and the response regulators with GGDEF and/or EAL output domains. Instead, archaea encode multiple copies of response regulators containing either the stand-alone receiver (REC) domain or combinations of REC with PAS and/or GAF domains. Therefore, the prevailing mechanism of archaeal TCS signaling appears to be via a variety of protein-protein interactions, rather than direct transcriptional regulation. IMPORTANCE Although the Archaea represent a separate domain of life, their signaling systems have been assumed to be closely similar to the bacterial ones. A study of the domain architectures of the archaeal two-component signal transduction (TCS) machinery

  16. Evidence of benzenoid domains in nanographenes.

    PubMed

    Baldoni, Matteo; Mercuri, Francesco

    2015-01-21

    Calculations based on density functional theory demonstrate the occurrence of local deformations of the perfect honeycomb lattice in nanographenes to form arrangements, with triangular symmetry, composed of six-membered ring patterns. The formation of these locally regular superstructures, which can be considered as benzenoid-like domains on the 2D graphene lattice, is ascribed to the gain in resonance energy deriving from aromaticity. The relationship between the atomic morphology of nanographenes and details of the relaxed structure is rationalized in terms of Clar's theory of the aromatic sextet and by extending concepts borrowed from valence bond theory to 2D carbon nanostructures. Namely, two regular arrangements can be evidenced, defined as Clar (fully benzenoid) and Kekulé domains, which correspond to two different regular bond patterns in sets of adjacent six-membered rings. Our findings are compatible with recent experiments and have potentially relevant consequences in the development of novel electronic devices based on graphene materials.

  17. Genomic features of bacterial adaptation to plants

    PubMed Central

    Levy, Asaf; Gonzalez, Isai Salas; Mittelviefhaus, Maximilian; Clingenpeel, Scott; Paredes, Sur Herrera; Miao, Jiamin; Wang, Kunru; Devescovi, Giulia; Stillman, Kyra; Monteiro, Freddy; Alvarez, Bryan Rangel; Lundberg, Derek S.; Lu, Tse-Yuan; Lebeis, Sarah; Jin, Zhao; McDonald, Meredith; Klein, Andrew P.; Feltcher, Meghan E.; del Rio, Tijana Glavina; Grant, Sarah R.; Doty, Sharon L.; Ley, Ruth E.; Zhao, Bingyu; Venturi, Vittorio; Pelletier, Dale A.; Vorholt, Julia A.; Tringe, Susannah G.; Woyke, Tanja; Dangl, Jeffery L.

    2017-01-01

    Plants intimately associate with diverse bacteria. Plant-associated (PA) bacteria have ostensibly evolved genes enabling adaptation to the plant environment. However, the identities of such genes are mostly unknown and their functions are poorly characterized. We sequenced 484 genomes of bacterial isolates from roots of Brassicaceae, poplar, and maize. We then compared 3837 bacterial genomes to identify thousands of PA gene clusters. Genomes of PA bacteria encode more carbohydrate metabolism functions and fewer mobile elements than related non-plant associated genomes. We experimentally validated candidates from two sets of PA genes, one involved in plant colonization, the other serving in microbe-microbe competition between PA bacteria. We also identified 64 PA protein domains that potentially mimic plant domains; some are shared with PA fungi and oomycetes. This work expands the genome-based understanding of plant-microbe interactions and provides leads for efficient and sustainable agriculture through microbiome engineering. PMID:29255260

  18. Evidence and Role for Bacterial Mucin Degradation in Cystic Fibrosis Airway Disease

    PubMed Central

    Flynn, Jeffrey M.; Niccum, David; Dunitz, Jordan M.

    2016-01-01

    Chronic lung infections in cystic fibrosis (CF) patients are composed of complex microbial communities that incite persistent inflammation and airway damage. Despite the high density of bacteria that colonize the lower airways, nutrient sources that sustain bacterial growth in vivo, and how those nutrients are derived, are not well characterized. In this study, we examined the possibility that mucins serve as an important carbon reservoir for the CF lung microbiota. While Pseudomonas aeruginosa was unable to efficiently utilize mucins in isolation, we found that anaerobic, mucin-fermenting bacteria could stimulate the robust growth of CF pathogens when provided intact mucins as a sole carbon source. 16S rRNA sequencing and enrichment culturing of sputum also identified that mucin-degrading anaerobes are ubiquitous in the airways of CF patients. The collective fermentative metabolism of these mucin-degrading communities in vitro generated amino acids and short chain fatty acids (propionate and acetate) during growth on mucin, and the same metabolites were also found in abundance within expectorated sputum. The significance of these findings was supported by in vivo P. aeruginosa gene expression, which revealed a heightened expression of genes required for the catabolism of propionate. Given that propionate is exclusively derived from bacterial fermentation, these data provide evidence for an important role of mucin fermenting bacteria in the carbon flux of the lower airways. More specifically, microorganisms typically defined as commensals may contribute to airway disease by degrading mucins, in turn providing nutrients for pathogens otherwise unable to efficiently obtain carbon in the lung. PMID:27548479

  19. Evidence for the Biosynthesis of Bryostatins by the Bacterial Symbiont “Candidatus Endobugula sertula” of the Bryozoan Bugula neritina

    PubMed Central

    Davidson, S. K.; Allen, S. W.; Lim, G. E.; Anderson, C. M.; Haygood, M. G.

    2001-01-01

    The marine bryozoan, Bugula neritina, is the source of the bryostatins, a family of macrocyclic lactones with anticancer activity. Bryostatins have long been suspected to be bacterial products. B. neritina harbors the uncultivated gamma proteobacterial symbiont “Candidatus Endobugula sertula.” In this work several lines of evidence are presented that show that the symbiont is the most likely source of bryostatins. Bryostatins are complex polyketides similar to bacterial secondary metabolites synthesized by modular type I polyketide synthases (PKS-I). PKS-I gene fragments were cloned from DNA extracted from the B. neritina-“E. sertula” association, and then primers specific to one of these clones, KSa, were shown to amplify the KSa gene specifically and universally from total B. neritina DNA. In addition, a KSa RNA probe was shown to bind specifically to the symbiotic bacteria located in the pallial sinus of the larvae of B. neritina and not to B. neritina cells or to other bacteria. Finally, B. neritina colonies grown in the laboratory were treated with antibiotics to reduce the numbers of bacterial symbionts. Decreased symbiont levels resulted in the reduction of the KSa signal as well as the bryostatin content. These data provide evidence that the symbiont E. sertula has the genetic potential to make bryostatins and is necessary in full complement for the host bryozoan to produce normal levels of bryostatins. This study demonstrates that it may be possible to clone bryostatin genes from B. neritina directly and use these to produce bryostatins in heterologous host bacteria. PMID:11571152

  20. Tandem-repeat protein domains across the tree of life.

    PubMed

    Jernigan, Kristin K; Bordenstein, Seth R

    2015-01-01

    Tandem-repeat protein domains, composed of repeated units of conserved stretches of 20-40 amino acids, are required for a wide array of biological functions. Despite their diverse and fundamental functions, there has been no comprehensive assessment of their taxonomic distribution, incidence, and associations with organismal lifestyle and phylogeny. In this study, we assess for the first time the abundance of armadillo (ARM) and tetratricopeptide (TPR) repeat domains across all three domains in the tree of life and compare the results to our previous analysis on ankyrin (ANK) repeat domains in this journal. All eukaryotes and a majority of the bacterial and archaeal genomes analyzed have a minimum of one TPR and ARM repeat. In eukaryotes, the fraction of ARM-containing proteins is approximately double that of TPR and ANK-containing proteins, whereas bacteria and archaea are enriched in TPR-containing proteins relative to ARM- and ANK-containing proteins. We show in bacteria that phylogenetic history, rather than lifestyle or pathogenicity, is a predictor of TPR repeat domain abundance, while neither phylogenetic history nor lifestyle predicts ARM repeat domain abundance. Surprisingly, pathogenic bacteria were not enriched in TPR-containing proteins, which have been associated within virulence factors in certain species. Taken together, this comparative analysis provides a newly appreciated view of the prevalence and diversity of multiple types of tandem-repeat protein domains across the tree of life. A central finding of this analysis is that tandem repeat domain-containing proteins are prevalent not just in eukaryotes, but also in bacterial and archaeal species.

  1. Tandem-repeat protein domains across the tree of life

    PubMed Central

    Jernigan, Kristin K.

    2015-01-01

    Tandem-repeat protein domains, composed of repeated units of conserved stretches of 20–40 amino acids, are required for a wide array of biological functions. Despite their diverse and fundamental functions, there has been no comprehensive assessment of their taxonomic distribution, incidence, and associations with organismal lifestyle and phylogeny. In this study, we assess for the first time the abundance of armadillo (ARM) and tetratricopeptide (TPR) repeat domains across all three domains in the tree of life and compare the results to our previous analysis on ankyrin (ANK) repeat domains in this journal. All eukaryotes and a majority of the bacterial and archaeal genomes analyzed have a minimum of one TPR and ARM repeat. In eukaryotes, the fraction of ARM-containing proteins is approximately double that of TPR and ANK-containing proteins, whereas bacteria and archaea are enriched in TPR-containing proteins relative to ARM- and ANK-containing proteins. We show in bacteria that phylogenetic history, rather than lifestyle or pathogenicity, is a predictor of TPR repeat domain abundance, while neither phylogenetic history nor lifestyle predicts ARM repeat domain abundance. Surprisingly, pathogenic bacteria were not enriched in TPR-containing proteins, which have been associated within virulence factors in certain species. Taken together, this comparative analysis provides a newly appreciated view of the prevalence and diversity of multiple types of tandem-repeat protein domains across the tree of life. A central finding of this analysis is that tandem repeat domain-containing proteins are prevalent not just in eukaryotes, but also in bacterial and archaeal species. PMID:25653910

  2. Role and mechanism of the Hsp70 molecular chaperone machines in bacterial pathogens.

    PubMed

    Ghazaei, Ciamak

    2017-03-01

    Heat shock proteins are highly conserved, stress-inducible, ubiquitous proteins that maintain homeostasis in both eukaryotes and prokaryotes. Hsp70 proteins belong to the heat shock protein family and enhance bacterial survival in hostile environments. Hsp70, known as DnaK in prokaryotes, supports numerous processes such as the assembly and disassembly of protein complexes, the refolding of misfolded and clustered proteins, membrane translocation and the regulation of regulatory proteins. The chaperone-based activity of Hsp70 depends on dynamic interactions between its two domains, known as the ATPase domain and the substrate-binding domain. It also depends on interactions between these domains and other co-chaperone molecules such as the Hsp40 protein family member DnaJ and nucleotide exchange factors. DnaJ is the primary chaperone that interacts with nascent polypeptide chains and functions to prevent their premature release from the ribosome and misfolding before it is targeted by DnaK. Adhesion of bacteria to host cells is mediated by both host and bacterial Hsp70. Following infection of the host, bacterial Hsp70 (DnaK) is in a position to initiate bacterial survival processes and trigger an immune response by the host. Any mutations in the dnaK gene have been shown to decrease the viability of bacteria inside the host. This review will give insights into the structure and mechanism of Hsp70 and its role in regulating the protein activity that contributes to pathogenesis.

  3. Scientific reasoning in early and middle childhood: the development of domain-general evidence evaluation, experimentation, and hypothesis generation skills.

    PubMed

    Piekny, Jeanette; Maehler, Claudia

    2013-06-01

    According to Klahr's (2000, 2005; Klahr & Dunbar, 1988) Scientific Discovery as Dual Search model, inquiry processes require three cognitive components: hypothesis generation, experimentation, and evidence evaluation. The aim of the present study was to investigate (a) when the ability to evaluate perfect covariation, imperfect covariation, and non-covariation evidence emerges, (b) when experimentation emerges, (c) when hypothesis generation skills emerge, and (d), whether these abilities develop synchronously during childhood. We administered three scientific reasoning tasks referring to the three components to 223 children of five age groups (from age 4.0 to 13.5 years). Our results show that the three cognitive components of domain-general scientific reasoning emerge asynchronously. The development of domain-general scientific reasoning begins with the ability to handle unambiguous data, progresses to the interpretation of ambiguous data, and leads to a flexible adaptation of hypotheses according to the sufficiency of evidence. When children understand the relation between the level of ambiguity of evidence and the level of confidence in hypotheses, the ability to differentiate conclusive from inconclusive experiments accompanies this development. Implications of these results for designing science education concepts for young children are briefly discussed. © 2012 The British Psychological Society.

  4. Prevalence of the F-type lectin domain.

    PubMed

    Bishnoi, Ritika; Khatri, Indu; Subramanian, Srikrishna; Ramya, T N C

    2015-08-01

    F-type lectins are fucolectins with characteristic fucose and calcium-binding sequence motifs and a unique lectin fold (the "F-type" fold). F-type lectins are phylogenetically widespread with selective distribution. Several eukaryotic F-type lectins have been biochemically and structurally characterized, and the F-type lectin domain (FLD) has also been studied in the bacterial proteins, Streptococcus mitis lectinolysin and Streptococcus pneumoniae SP2159. However, there is little knowledge about the extent of occurrence of FLDs and their domain organization, especially, in bacteria. We have now mined the extensive genomic sequence information available in the public databases with sensitive sequence search techniques in order to exhaustively survey prokaryotic and eukaryotic FLDs. We report 437 FLD sequence clusters (clustered at 80% sequence identity) from eukaryotic, eubacterial and viral proteins. Domain architectures are diverse but mostly conserved in closely related organisms, and domain organizations of bacterial FLD-containing proteins are very different from their eukaryotic counterparts, suggesting unique specialization of FLDs to suit different requirements. Several atypical phylogenetic associations hint at lateral transfer. Among eukaryotes, we observe an expansion of FLDs in terms of occurrence and domain organization diversity in the taxa Mollusca, Hemichordata and Branchiostomi, perhaps coinciding with greater emphasis on innate immune strategies in these organisms. The naturally occurring FLDs with diverse domain organizations that we have identified here will be useful for future studies aimed at creating designer molecular platforms for directing desired biological activities to fucosylated glycoconjugates in target niches. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Next-Generation Sequencing Reveals Significant Bacterial Diversity of Botrytized Wine

    PubMed Central

    Bokulich, Nicholas A.; Joseph, C. M. Lucy; Allen, Greg; Benson, Andrew K.; Mills, David A.

    2012-01-01

    While wine fermentation has long been known to involve complex microbial communities, the composition and role of bacteria other than a select set of lactic acid bacteria (LAB) has often been assumed either negligible or detrimental. This study served as a pilot study for using barcoded amplicon next-generation sequencing to profile bacterial community structure in wines and grape musts, comparing the taxonomic depth achieved by sequencing two different domains of prokaryotic 16S rDNA (V4 and V5). This study was designed to serve two goals: 1) to empirically determine the most taxonomically informative 16S rDNA target region for barcoded amplicon sequencing of wine, comparing V4 and V5 domains of bacterial 16S rDNA to terminal restriction fragment length polymorphism (TRFLP) of LAB communities; and 2) to explore the bacterial communities of wine fermentation to better understand the biodiversity of wine at a depth previously unattainable using other techniques. Analysis of amplicons from the V4 and V5 provided similar views of the bacterial communities of botrytized wine fermentations, revealing a broad diversity of low-abundance taxa not traditionally associated with wine, as well as atypical LAB communities initially detected by TRFLP. The V4 domain was determined as the more suitable read for wine ecology studies, as it provided greater taxonomic depth for profiling LAB communities. In addition, targeted enrichment was used to isolate two species of Alphaproteobacteria from a finished fermentation. Significant differences in diversity between inoculated and uninoculated samples suggest that Saccharomyces inoculation exerts selective pressure on bacterial diversity in these fermentations, most notably suppressing abundance of acetic acid bacteria. These results determine the bacterial diversity of botrytized wines to be far higher than previously realized, providing further insight into the fermentation dynamics of these wines, and demonstrate the utility of next

  6. Diversity of Two-Domain Laccase-Like Multicopper Oxidase Genes in Streptomyces spp.: Identification of Genes Potentially Involved in Extracellular Activities and Lignocellulose Degradation during Composting of Agricultural Waste

    PubMed Central

    Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin

    2014-01-01

    Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870

  7. Where do bright ideas occur in our brain? Meta-analytic evidence from neuroimaging studies of domain-specific creativity

    PubMed Central

    Boccia, Maddalena; Piccardi, Laura; Palermo, Liana; Nori, Raffaella; Palmiero, Massimiliano

    2015-01-01

    Many studies have assessed the neural underpinnings of creativity, failing to find a clear anatomical localization. We aimed to provide evidence for a multi-componential neural system for creativity. We applied a general activation likelihood estimation (ALE) meta-analysis to 45 fMRI studies. Three individual ALE analyses were performed to assess creativity in different cognitive domains (Musical, Verbal, and Visuo-spatial). The general ALE revealed that creativity relies on clusters of activations in the bilateral occipital, parietal, frontal, and temporal lobes. The individual ALE revealed different maximal activation in different domains. Musical creativity yields activations in the bilateral medial frontal gyrus, in the left cingulate gyrus, middle frontal gyrus, and inferior parietal lobule and in the right postcentral and fusiform gyri. Verbal creativity yields activations mainly located in the left hemisphere, in the prefrontal cortex, middle and superior temporal gyri, inferior parietal lobule, postcentral and supramarginal gyri, middle occipital gyrus, and insula. The right inferior frontal gyrus and the lingual gyrus were also activated. Visuo-spatial creativity activates the right middle and inferior frontal gyri, the bilateral thalamus and the left precentral gyrus. This evidence suggests that creativity relies on multi-componential neural networks and that different creativity domains depend on different brain regions. PMID:26322002

  8. Phyletic Distribution and Lineage-Specific Domain Architectures of Archaeal Two-Component Signal Transduction Systems.

    PubMed

    Galperin, Michael Y; Makarova, Kira S; Wolf, Yuri I; Koonin, Eugene V

    2018-04-01

    The two-component signal transduction (TCS) machinery is a key mechanism of sensing environmental changes in the prokaryotic world. TCS systems have been characterized thoroughly in bacteria but to a much lesser extent in archaea. Here, we provide an updated census of more than 2,000 histidine kinases and response regulators encoded in 218 complete archaeal genomes, as well as unfinished genomes available from metagenomic data. We describe the domain architectures of the archaeal TCS components, including several novel output domains, and discuss the evolution of the archaeal TCS machinery. The distribution of TCS systems in archaea is strongly biased, with high levels of abundance in haloarchaea and thaumarchaea but none detected in the sequenced genomes from the phyla Crenarchaeota , Nanoarchaeota , and Korarchaeota The archaeal sensor histidine kinases are generally similar to their well-studied bacterial counterparts but are often located in the cytoplasm and carry multiple PAS and/or GAF domains. In contrast, archaeal response regulators differ dramatically from the bacterial ones. Most archaeal genomes do not encode any of the major classes of bacterial response regulators, such as the DNA-binding transcriptional regulators of the OmpR/PhoB, NarL/FixJ, NtrC, AgrA/LytR, and ActR/PrrA families and the response regulators with GGDEF and/or EAL output domains. Instead, archaea encode multiple copies of response regulators containing either the stand-alone receiver (REC) domain or combinations of REC with PAS and/or GAF domains. Therefore, the prevailing mechanism of archaeal TCS signaling appears to be via a variety of protein-protein interactions, rather than direct transcriptional regulation. IMPORTANCE Although the Archaea represent a separate domain of life, their signaling systems have been assumed to be closely similar to the bacterial ones. A study of the domain architectures of the archaeal two-component signal transduction (TCS) machinery revealed an

  9. Bacterial Cell Mechanics.

    PubMed

    Auer, George K; Weibel, Douglas B

    2017-07-25

    Cellular mechanical properties play an integral role in bacterial survival and adaptation. Historically, the bacterial cell wall and, in particular, the layer of polymeric material called the peptidoglycan were the elements to which cell mechanics could be primarily attributed. Disrupting the biochemical machinery that assembles the peptidoglycan (e.g., using the β-lactam family of antibiotics) alters the structure of this material, leads to mechanical defects, and results in cell lysis. Decades after the discovery of peptidoglycan-synthesizing enzymes, the mechanisms that underlie their positioning and regulation are still not entirely understood. In addition, recent evidence suggests a diverse group of other biochemical elements influence bacterial cell mechanics, may be regulated by new cellular mechanisms, and may be triggered in different environmental contexts to enable cell adaptation and survival. This review summarizes the contributions that different biomolecular components of the cell wall (e.g., lipopolysaccharides, wall and lipoteichoic acids, lipid bilayers, peptidoglycan, and proteins) make to Gram-negative and Gram-positive bacterial cell mechanics. We discuss the contribution of individual proteins and macromolecular complexes in cell mechanics and the tools that make it possible to quantitatively decipher the biochemical machinery that contributes to bacterial cell mechanics. Advances in this area may provide insight into new biology and influence the development of antibacterial chemotherapies.

  10. Steroids in bacterial meningitis: yes.

    PubMed

    Benninger, Felix; Steiner, Israel

    2013-02-01

    Bacterial meningitis is an infectious condition associated with severe morbidity and mortality, even with rapid diagnosis and appropriate antibiotic therapy. Despite decrease in the rate of bacterial meningitis brought about by vaccination programs against Haemophilus influenzae type-B and Streptococcus pneumonia, the incidence of meningitis is still unacceptably high and acute treatment remains the mainstay of therapy. The infection is accompanied by intense inflammatory response, which may carry deleterious effects upon the tissue. This led to the possibility of adjuvant corticosteroid therapy, as an anti-inflammatory agent, in bacterial meningitis. The debate focuses on the rational and evidence supporting and refuting such an approach.

  11. Deficits in Domains of Social Cognition in Schizophrenia: A Meta-Analysis of the Empirical Evidence

    PubMed Central

    Savla, Gauri N.

    2013-01-01

    Objective: Social cognition is strongly associated with functional outcome in schizophrenia, making it an important target for treatment. Our goal was to examine the average magnitude of differences between schizophrenia patients (SCs) and normal comparison (NCs) patients across multiple domains of social cognition recognized by the recent NIMH consensus statement: theory of mind (ToM), social perception, social knowledge, attributional bias, emotion perception, and emotion processing. Method: We conducted a meta-analysis of peer-reviewed studies of social cognition in schizophrenia, published between 1980 and November, 2011. Results: 112 studies reporting results from 3908 SCs and 3570 NCs met our inclusion criteria. SCs performed worse than NCs across all domains, with large effects for social perception (g = 1.04), ToM (g = 0.96), emotion perception (g = 0.89), and emotion processing (g = 0.88). Regression analyses showed that statistically significant heterogeneity in effects within domains was not explained by age, education, or gender. Greater deficits in social and emotion perception were associated with inpatient status, and greater deficits in emotion processing were associated with longer illness duration. Conclusions: Despite the limitations of existing studies, including lack of standardization or psychometric validation of measures, the evidence for deficits across multiple social cognitive domains in schizophrenia is clear. Future research should examine the role of neurobiological and psychosocial factors in models linking various aspects of deficit in schizophrenia, including social cognition, in order to identify targets for intervention. PMID:22949733

  12. Evidence for a bacterial lipopolysaccharide-recognizing G-protein-coupled receptor in the bacterial engulfment by Entamoeba histolytica.

    PubMed

    Brewer, Matthew T; Agbedanu, Prince N; Zamanian, Mostafa; Day, Tim A; Carlson, Steve A

    2013-11-01

    Entamoeba histolytica is the causative agent of amoebic dysentery, a worldwide protozoal disease that results in approximately 100,000 deaths annually. The virulence of E. histolytica may be due to interactions with the host bacterial flora, whereby trophozoites engulf colonic bacteria as a nutrient source. The engulfment process depends on trophozoite recognition of bacterial epitopes that activate phagocytosis pathways. E. histolytica GPCR-1 (EhGPCR-1) was previously recognized as a putative G-protein-coupled receptor (GPCR) used by Entamoeba histolytica during phagocytosis. In the present study, we attempted to characterize EhGPCR-1 by using heterologous GPCR expression in Saccharomyces cerevisiae. We discovered that bacterial lipopolysaccharide (LPS) is an activator of EhGPCR-1 and that LPS stimulates EhGPCR-1 in a concentration-dependent manner. Additionally, we demonstrated that Entamoeba histolytica prefers to engulf bacteria with intact LPS and that this engulfment process is sensitive to suramin, which prevents the interactions of GPCRs and G-proteins. Thus, EhGPCR-1 is an LPS-recognizing GPCR that is a potential drug target for treatment of amoebiasis, especially considering the well-established drug targeting to GPCRs.

  13. Evolution of GHF5 endoglucanase gene structure in plant-parasitic nematodes: no evidence for an early domain shuffling event.

    PubMed

    Kyndt, Tina; Haegeman, Annelies; Gheysen, Godelieve

    2008-11-03

    Endo-1,4-beta-glucanases or cellulases from the glycosyl hydrolase family 5 (GHF5) have been found in numerous bacteria and fungi, and recently also in higher eukaryotes, particularly in plant-parasitic nematodes (PPN). The origin of these genes has been attributed to horizontal gene transfer from bacteria, although there still is a lot of uncertainty about the origin and structure of the ancestral GHF5 PPN endoglucanase. It is not clear whether this ancestral endoglucanase consisted of the whole gene cassette, containing a catalytic domain and a carbohydrate-binding module (CBM, type 2 in PPN and bacteria) or only of the catalytic domain while the CBM2 was retrieved by domain shuffling later in evolution. Previous studies on the evolution of these genes have focused primarily on data of sedentary nematodes, while in this study, extra data from migratory nematodes were included. Two new endoglucanases from the migratory nematodes Pratylenchus coffeae and Ditylenchus africanus were included in this study. The latter one is the first gene isolated from a PPN of a different superfamily (Sphaerularioidea); all previously known nematode endoglucanases belong to the superfamily Tylenchoidea (order Rhabditida). Phylogenetic analyses were conducted with the PPN GHF5 endoglucanases and homologous endoglucanases from bacterial and other eukaryotic lineages such as beetles, fungi and plants. No statistical incongruence between the phylogenetic trees deduced from the catalytic domain and the CBM2 was found, which could suggest that both domains have evolved together. Furthermore, based on gene structure data, we inferred a model for the evolution of the GHF5 endoglucanase gene structure in plant-parasitic nematodes. Our data confirm a close relationship between Pratylenchus spp. and the root knot nematodes, while some Radopholus similis endoglucanases are more similar to cyst nematode genes. We conclude that the ancestral PPN GHF5 endoglucanase gene most probably consisted of

  14. Crystal structure of the Haemophilus influenzae Hap adhesin reveals an intercellular oligomerization mechanism for bacterial aggregation

    PubMed Central

    Meng, Guoyu; Spahich, Nicole; Kenjale, Roma; Waksman, Gabriel; St Geme, Joseph W

    2011-01-01

    Bacterial biofilms are complex microbial communities that are common in nature and are being recognized increasingly as an important determinant of bacterial virulence. However, the structural determinants of bacterial aggregation and eventual biofilm formation have been poorly defined. In Gram-negative bacteria, a major subgroup of extracellular proteins called self-associating autotransporters (SAATs) can mediate cell–cell adhesion and facilitate biofilm formation. In this study, we used the Haemophilus influenzae Hap autotransporter as a prototype SAAT to understand how bacteria associate with each other. The crystal structure of the H. influenzae HapS passenger domain (harbouring the SAAT domain) was determined to 2.2 Å by X-ray crystallography, revealing an unprecedented intercellular oligomerization mechanism for cell–cell interaction. The C-terminal SAAT domain folds into a triangular-prism-like structure that can mediate Hap–Hap dimerization and higher degrees of multimerization through its F1–F2 edge and F2 face. The intercellular multimerization can give rise to massive buried surfaces that are required for overcoming the repulsive force between cells, leading to bacterial cell–cell interaction and formation of complex microcolonies. PMID:21841773

  15. Bacterial flagellar capping proteins adopt diverse oligomeric states

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Postel, Sandra; Deredge, Daniel; Bonsor, Daniel A.

    2016-09-24

    Flagella are crucial for bacterial motility and pathogenesis. The flagellar capping protein (FliD) regulates filament assembly by chaperoning and sorting flagellin (FliC) proteins after they traverse the hollow filament and exit the growing flagellum tip. In the absence of FliD, flagella are not formed, resulting in impaired motility and infectivity. Here, we report the 2.2 Å resolution X-ray crystal structure of FliD fromPseudomonas aeruginosa, the first high-resolution structure of any FliD protein from any bacterium. Using this evidence in combination with a multitude of biophysical and functional analyses, we find thatPseudomonasFliD exhibits unexpected structural similarity to other flagellar proteins atmore » the domain level, adopts a unique hexameric oligomeric state, and depends on flexible determinants for oligomerization. Considering that the flagellin filaments on which FliD oligomers are affixed vary in protofilament number between bacteria, our results suggest that FliD oligomer stoichiometries vary across bacteria to complement their filament assemblies.« less

  16. Evidence for the requirement of ITAM domains but not SLP-76/Gads interaction for integrin signaling in hematopoietic cells.

    PubMed

    Abtahian, Farhad; Bezman, Natalie; Clemens, Regina; Sebzda, Eric; Cheng, Lan; Shattil, Sanford J; Kahn, Mark L; Koretzky, Gary A

    2006-09-01

    Syk tyrosine kinase and Src homology 2 (SH2) domain-containing leukocyte-specific phosphoprotein of 76 kDa (SLP-76) are signaling mediators activated downstream of immunoreceptor tyrosine-based activation motif (ITAM)-containing immunoreceptors and integrins. While the signaling cascades descending from integrins are similar to immunoreceptors, the mechanism of Syk activation and SLP-76 recruitment remains unclear. We used an in vivo structure-function approach to study the requirements for the domains of Syk and SLP-76 in immunoreceptor and integrin signaling. We found that both SH2 domains and the kinase domain of Syk are required for immunoreceptor-dependent signaling and cellular response via integrins. While the Gads-binding domain of SLP-76 is needed for immunoreceptor signaling, it appears dispensable for integrin signaling. Syk and SLP-76 also are required for initiating and/or maintaining separation between the blood and lymphatic vasculature. Therefore, we correlated the signaling requirement of the various domains of Syk and SLP-76 to their requirement in regulating vascular separation. Our data suggest ITAMs are required in Syk-dependent integrin signaling, demonstrate the separation of the structural features of SLP-76 to selectively support immunoreceptor versus integrin signaling, and provide evidence that the essential domains of SLP-76 for ITAM signals are those which most efficiently support separation between lymphatic and blood vessels.

  17. Genomic features of bacterial adaptation to plants

    DOE PAGES

    Levy, Asaf; Salas Gonzalez, Isai; Mittelviefhaus, Maximilian; ...

    2017-12-18

    Plants intimately associate with diverse bacteria. Plant-associated bacteria have ostensibly evolved genes that enable them to adapt to plant environments. However, the identities of such genes are mostly unknown, and their functions are poorly characterized. In this study, we sequenced 484 genomes of bacterial isolates from roots of Brassicaceae, poplar, and maize. We then compared 3,837 bacterial genomes to identify thousands of plant-associated gene clusters. Genomes of plant-associated bacteria encode more carbohydrate metabolism functions and fewer mobile elements than related non-plant-associated genomes do. We experimentally validated candidates from two sets of plant-associated genes: one involved in plant colonization, and themore » other serving in microbe–microbe competition between plant-associated bacteria. We also identified 64 plant-associated protein domains that potentially mimic plant domains; some are shared with plant-associated fungi and oomycetes. In conclusion, this work expands the genome-based understanding of plant–microbe interactions and provides potential leads for efficient and sustainable agriculture through microbiome engineering.« less

  18. Genomic features of bacterial adaptation to plants

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Levy, Asaf; Salas Gonzalez, Isai; Mittelviefhaus, Maximilian

    Plants intimately associate with diverse bacteria. Plant-associated bacteria have ostensibly evolved genes that enable them to adapt to plant environments. However, the identities of such genes are mostly unknown, and their functions are poorly characterized. In this study, we sequenced 484 genomes of bacterial isolates from roots of Brassicaceae, poplar, and maize. We then compared 3,837 bacterial genomes to identify thousands of plant-associated gene clusters. Genomes of plant-associated bacteria encode more carbohydrate metabolism functions and fewer mobile elements than related non-plant-associated genomes do. We experimentally validated candidates from two sets of plant-associated genes: one involved in plant colonization, and themore » other serving in microbe–microbe competition between plant-associated bacteria. We also identified 64 plant-associated protein domains that potentially mimic plant domains; some are shared with plant-associated fungi and oomycetes. In conclusion, this work expands the genome-based understanding of plant–microbe interactions and provides potential leads for efficient and sustainable agriculture through microbiome engineering.« less

  19. Behavioral and fMRI evidence of the differing cognitive load of domain-specific assessments.

    PubMed

    Howard, S J; Burianová, H; Ehrich, J; Kervin, L; Calleia, A; Barkus, E; Carmody, J; Humphry, S

    2015-06-25

    Standards-referenced educational reform has increased the prevalence of standardized testing; however, whether these tests accurately measure students' competencies has been questioned. This may be due to domain-specific assessments placing a differing domain-general cognitive load on test-takers. To investigate this possibility, functional magnetic resonance imaging (fMRI) was used to identify and quantify the neural correlates of performance on current, international standardized methods of spelling assessment. Out-of-scanner testing was used to further examine differences in assessment results. Results provide converging evidence that: (a) the spelling assessments differed in the cognitive load placed on test-takers; (b) performance decreased with increasing cognitive load of the assessment; and (c) brain regions associated with working memory were more highly activated during performance of assessments that were higher in cognitive load. These findings suggest that assessment design should optimize the cognitive load placed on test-takers, to ensure students' results are an accurate reflection of their true levels of competency. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. The dimerization domain in DapE enzymes is required for catalysis.

    PubMed

    Nocek, Boguslaw; Starus, Anna; Makowska-Grzyska, Magdalena; Gutierrez, Blanca; Sanchez, Stephen; Jedrzejczak, Robert; Mack, Jamey C; Olsen, Kenneth W; Joachimiak, Andrzej; Holz, Richard C

    2014-01-01

    The emergence of antibiotic-resistant bacterial strains underscores the importance of identifying new drug targets and developing new antimicrobial compounds. Lysine and meso-diaminopimelic acid are essential for protein production and bacterial peptidoglycan cell wall remodeling and are synthesized in bacteria by enzymes encoded within dap operon. Therefore dap enzymes may serve as excellent targets for developing a new class of antimicrobial agents. The dapE-encoded N-succinyl-L,L-diaminopimelic acid desuccinylase (DapE) converts N-succinyl-L,L-diaminopimelic acid to L,L-diaminopimelic acid and succinate. The enzyme is composed of catalytic and dimerization domains, and belongs to the M20 peptidase family. To understand the specific role of each domain of the enzyme we engineered dimerization domain deletion mutants of DapEs from Haemophilus influenzae and Vibrio cholerae, and characterized these proteins structurally and biochemically. No activity was observed for all deletion mutants. Structural comparisons of wild-type, inactive monomeric DapE enzymes with other M20 peptidases suggest that the dimerization domain is essential for DapE enzymatic activity. Structural analysis and molecular dynamics simulations indicate that removal of the dimerization domain increased the flexibility of a conserved active site loop that may provide critical interactions with the substrate.

  1. The Role of Bacterial Enhancer Binding Proteins as Specialized Activators of σ54-Dependent Transcription

    PubMed Central

    2012-01-01

    Summary: Bacterial enhancer binding proteins (bEBPs) are transcriptional activators that assemble as hexameric rings in their active forms and utilize ATP hydrolysis to remodel the conformation of RNA polymerase containing the alternative sigma factor σ54. We present a comprehensive and detailed summary of recent advances in our understanding of how these specialized molecular machines function. The review is structured by introducing each of the three domains in turn: the central catalytic domain, the N-terminal regulatory domain, and the C-terminal DNA binding domain. The role of the central catalytic domain is presented with particular reference to (i) oligomerization, (ii) ATP hydrolysis, and (iii) the key GAFTGA motif that contacts σ54 for remodeling. Each of these functions forms a potential target of the signal-sensing N-terminal regulatory domain, which can act either positively or negatively to control the activation of σ54-dependent transcription. Finally, we focus on the DNA binding function of the C-terminal domain and the enhancer sites to which it binds. Particular attention is paid to the importance of σ54 to the bacterial cell and its unique role in regulating transcription. PMID:22933558

  2. Domain-General and Domain-Specific Strategies for the Assessment of Distress Intolerance

    PubMed Central

    McHugh, R. Kathryn; Otto, Michael W.

    2011-01-01

    Recent research has provided evidence that distress intolerance—the perceived inability to tolerate distressing states—varies based on the domain of distress (e.g., pain, anxiety). Although domain-specific assessment strategies may provide information targeted to specific disorders or maladaptive behaviors, domain-general measures have the potential to facilitate comparisons across studies, disorders, and populations. The current study evaluated the utilization of self-report measures of distress intolerance as domain-general measures by examining their association with indices of behavioral avoidance and substance craving. Two groups of participants (N = 55) were recruited including a substance-dependent group and a comparison group equated based on the presence of an affective disorder. Results provided support for the validity of domain-general measures for assessing distress intolerance across varied domains. The importance of both domain-general and domain-specific measurement of distress intolerance is discussed. PMID:21823763

  3. Structural Analysis of the GGDEF-EAL Domain-Containing c-di-GMP Receptor FimX

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Navarro, M.; De, N; Bae, N

    2009-01-01

    Bacterial pathogenesis involves social behavior including biofilm formation and swarming, processes that are regulated by the bacterially unique second messenger cyclic di-GMP (c-di-GMP). Diguanylate cyclases containing GGDEF and phosphodiesterases containing EAL domains have been identified as the enzymes controlling cellular c-di-GMP levels, yet less is known regarding signal transmission and the targets of c-di-GMP. FimX, a protein from Pseudomonas aeruginosa that governs twitching motility, belongs to a large subfamily containing both GGDEF and EAL domains. Biochemical and structural analyses reveals its function as a high-affinity receptor for c-di-GMP. A model for full-length FimX was generated combining solution scattering data andmore » crystal structures of the degenerate GGDEF and EAL domains. Although FimX forms a dimer in solution via the N-terminal domains, a crystallographic EAL domain dimer suggests modes for the regulation of FimX by c-di-GMP binding. The results provide the structural basis for c-di-GMP sensing via degenerate phosphodiesterases.« less

  4. A Time-Space Domain Information Fusion Method for Specific Emitter Identification Based on Dempster-Shafer Evidence Theory.

    PubMed

    Jiang, Wen; Cao, Ying; Yang, Lin; He, Zichang

    2017-08-28

    Specific emitter identification plays an important role in contemporary military affairs. However, most of the existing specific emitter identification methods haven't taken into account the processing of uncertain information. Therefore, this paper proposes a time-space domain information fusion method based on Dempster-Shafer evidence theory, which has the ability to deal with uncertain information in the process of specific emitter identification. In this paper, radars will generate a group of evidence respectively based on the information they obtained, and our main task is to fuse the multiple groups of evidence to get a reasonable result. Within the framework of recursive centralized fusion model, the proposed method incorporates a correlation coefficient, which measures the relevance between evidence and a quantum mechanical approach, which is based on the parameters of radar itself. The simulation results of an illustrative example demonstrate that the proposed method can effectively deal with uncertain information and get a reasonable recognition result.

  5. Bright blue-shifted fluorescent proteins with Cys in the GAF domain engineered from bacterial phytochromes: fluorescence mechanisms and excited-state dynamics.

    PubMed

    Hontani, Yusaku; Shcherbakova, Daria M; Baloban, Mikhail; Zhu, Jingyi; Verkhusha, Vladislav V; Kennis, John T M

    2016-11-18

    Near-infrared fluorescent proteins (NIR FPs) engineered from bacterial phytochromes (BphPs) are of great interest for in vivo imaging. They utilize biliverdin (BV) as a chromophore, which is a heme degradation product, and therefore they are straightforward to use in mammalian tissues. Here, we report on fluorescence properties of NIR FPs with key alterations in their BV binding sites. BphP1-FP, iRFP670 and iRFP682 have Cys residues in both PAS and GAF domains, rather than in the PAS domain alone as in wild-type BphPs. We found that NIR FP variants with Cys in the GAF or with Cys in both PAS and GAF show blue-shifted emission with long fluorescence lifetimes. In contrast, mutants with Cys in the PAS only or no Cys residues at all exhibit red-shifted emission with shorter lifetimes. Combining these results with previous biochemical and BphP1-FP structural data, we conclude that BV adducts bound to Cys in the GAF are the origin of bright blue-shifted fluorescence. We propose that the long fluorescence lifetime follows from (i) a sterically more constrained thioether linkage, leaving less mobility for ring A than in canonical BphPs, and (ii) that π-electron conjugation does not extend on ring A, making excited-state deactivation less sensitive to ring A mobility.

  6. MIPS bacterial genomes functional annotation benchmark dataset.

    PubMed

    Tetko, Igor V; Brauner, Barbara; Dunger-Kaltenbach, Irmtraud; Frishman, Goar; Montrone, Corinna; Fobo, Gisela; Ruepp, Andreas; Antonov, Alexey V; Surmeli, Dimitrij; Mewes, Hans-Wernen

    2005-05-15

    Any development of new methods for automatic functional annotation of proteins according to their sequences requires high-quality data (as benchmark) as well as tedious preparatory work to generate sequence parameters required as input data for the machine learning methods. Different program settings and incompatible protocols make a comparison of the analyzed methods difficult. The MIPS Bacterial Functional Annotation Benchmark dataset (MIPS-BFAB) is a new, high-quality resource comprising four bacterial genomes manually annotated according to the MIPS functional catalogue (FunCat). These resources include precalculated sequence parameters, such as sequence similarity scores, InterPro domain composition and other parameters that could be used to develop and benchmark methods for functional annotation of bacterial protein sequences. These data are provided in XML format and can be used by scientists who are not necessarily experts in genome annotation. BFAB is available at http://mips.gsf.de/proj/bfab

  7. Riboregulation of bacterial and archaeal transposition.

    PubMed

    Ellis, Michael J; Haniford, David B

    2016-05-01

    The coexistence of transposons with their hosts depends largely on transposition levels being tightly regulated to limit the mutagenic burden associated with frequent transposition. For 'DNA-based' (class II) bacterial transposons there is growing evidence that regulation through small noncoding RNAs and/or the RNA-binding protein Hfq are prominent mechanisms of defense against transposition. Recent transcriptomics analyses have identified many new cases of antisense RNAs (asRNA) that potentially could regulate the expression of transposon-encoded genes giving the impression that asRNA regulation of DNA-based transposons is much more frequent than previously thought. Hfq is a highly conserved bacterial protein that plays a central role in posttranscriptional gene regulation and stress response pathways in many bacteria. Three different mechanisms for Hfq-directed control of bacterial transposons have been identified to date highlighting the versatility of this protein as a regulator of bacterial transposons. There is also evidence emerging that some DNA-based transposons encode RNAs that could regulate expression of host genes. In the case of IS200, which appears to have lost its ability to transpose, contributing a regulatory RNA to its host could account for the persistence of this mobile element in a wide range of bacterial species. It remains to be seen how prevalent these transposon-encoded RNA regulators are, but given the relatively large amount of intragenic transcription in bacterial genomes, it would not be surprising if new examples are forthcoming. WIREs RNA 2016, 7:382-398. doi: 10.1002/wrna.1341 For further resources related to this article, please visit the WIREs website. © 2016 Wiley Periodicals, Inc.

  8. Thermal Unfolding Simulations of Bacterial Flagellin: Insight into its Refolding Before Assembly

    PubMed Central

    Chng, Choon-Peng; Kitao, Akio

    2008-01-01

    Flagellin is the subunit of the bacterial filament, the micrometer-long propeller of a bacterial flagellum. The protein is believed to undergo unfolding for transport through the channel of the filament and to refold in a chamber at the end of the channel before being assembled into the growing filament. We report a thermal unfolding simulation study of S. typhimurium flagellin in aqueous solution as an attempt to gain atomic-level insight into the refolding process. Each molecule comprises two filament-core domains {D0, D1} and two hypervariable-region domains {D2, D3}. D2 can be separated into subdomains D2a and D2b. We observed a similar unfolding order of the domains as reported in experimental thermal denaturation. D2a and D3 exhibited high thermal stability and contained persistent three-stranded β-sheets in the denatured state which could serve as folding cores to guide refolding. A recent mutagenesis study on flagellin stability seems to suggest the importance of the folding cores. Using crude size estimates, our data suggests that the chamber might be large enough for either denatured hypervariable-region domains or filament-core domains, but not whole flagellin; this implicates a two-staged refolding process. PMID:18263660

  9. Conservation of the Human Integrin-Type Beta-Propeller Domain in Bacteria

    PubMed Central

    Chouhan, Bhanupratap; Denesyuk, Alexander; Heino, Jyrki; Johnson, Mark S.; Denessiouk, Konstantin

    2011-01-01

    Integrins are heterodimeric cell-surface receptors with key functions in cell-cell and cell-matrix adhesion. Integrin α and β subunits are present throughout the metazoans, but it is unclear whether the subunits predate the origin of multicellular organisms. Several component domains have been detected in bacteria, one of which, a specific 7-bladed β-propeller domain, is a unique feature of the integrin α subunits. Here, we describe a structure-derived motif, which incorporates key features of each blade from the X-ray structures of human αIIbβ3 and αVβ3, includes elements of the FG-GAP/Cage and Ca2+-binding motifs, and is specific only for the metazoan integrin domains. Separately, we searched for the metazoan integrin type β-propeller domains among all available sequences from bacteria and unicellular eukaryotic organisms, which must incorporate seven repeats, corresponding to the seven blades of the β-propeller domain, and so that the newly found structure-derived motif would exist in every repeat. As the result, among 47 available genomes of unicellular eukaryotes we could not find a single instance of seven repeats with the motif. Several sequences contained three repeats, a predicted transmembrane segment, and a short cytoplasmic motif associated with some integrins, but otherwise differ from the metazoan integrin α subunits. Among the available bacterial sequences, we found five examples containing seven sequential metazoan integrin-specific motifs within the seven repeats. The motifs differ in having one Ca2+-binding site per repeat, whereas metazoan integrins have three or four sites. The bacterial sequences are more conserved in terms of motif conservation and loop length, suggesting that the structure is more regular and compact than those example structures from human integrins. Although the bacterial examples are not full-length integrins, the full-length metazoan-type 7-bladed β-propeller domains are present, and sometimes two tandem

  10. Enhancement of DNaseI Salt Tolerance by Mimicking the Domain Structure of DNase from an Extremely Halotolerant Bacterium Thioalkalivibrio sp. K90mix

    PubMed Central

    Alzbutas, Gediminas; Kaniusaite, Milda; Lagunavicius, Arunas

    2016-01-01

    In our previous work we showed that DNaseI-like protein from an extremely halotolerant bacterium Thioalkalivibrio sp. K90mix retained its activity at salt concentrations as high as 4 M NaCl and the key factor allowing this was the C-terminal DNA-binding domain, which comprised two HhH (helix-hairpin-helix) motifs. The further investigations revealed that this domain originated from proteins related to bacterial competence ComEA/ComE proteins. It is likely that in the course of evolution the DNA-binding domain from these proteins was fused to a metallo-β-lactamase superfamily domain. Very likely such domain organization having proteins subsequently “donated” the DNA-binding domain to bacterial DNases. In this study we have mimicked this evolutionary step by fusing bovine DNaseI and DNA-binding domains. We have created two fusions: one harboring the DNA-binding domain of DNaseI-like protein from Thioalkalivibrio sp. K90mix and the second one harboring the DNA-binding domain of bacterial competence protein ComEA from Bacillus subtilis. Both domains enhanced salt tolerance of DNaseI, albeit to different extent. Molecular modeling revealed the essential differences between their interaction with DNA shedding some light on the differences in salt tolerance. In this study we have enhanced salt tolerance of bovine DNaseI; thus, we successfully mimicked the Nature’s evolutionary engineering that created the extremely halotolerant bacterial DNase. We have demonstrated that the newly engineered DNaseI variants can be successfully used in applications where activity of the wild type bovine DNaseI is impeded by buffers used. PMID:26939122

  11. Biochemical and functional characterization of the periplasmic domain of the outer membrane protein A from enterohemorrhagic Escherichia coli.

    PubMed

    Wang, Haiguang; Li, Qian; Fang, Yao; Yu, Shu; Tang, Bin; Na, Li; Yu, Bo; Zou, Quanming; Mao, Xuhu; Gu, Jiang

    2016-01-01

    Outer membrane protein A (OmpA) plays multiple roles in the physiology and pathogenesis of the zoonotic pathogen enterohemorrhagic Escherichia coli (EHEC). The N-terminus of OmpA forms a transmembrane domain (OmpA™), and the roles of this domain in bacterial pathogenesis have been well studied. However, how its C-terminal domain (OmpAper), which is located at the periplasmic space in the bacterial membrane, contributes to virulence remains unclear. Herein, we report that OmpAper forms a dimer and binds to peptidoglycan in vitro. Furthermore, OmpAper is responsible for bacterial resistance to acidic conditions, high osmotic pressure and high SDS environments. In addition, OmpAper contributes to the adhesion of bacteria to HeLa cells in vitro and ex vivo. These results provide an additional understanding of the role of OmpA in EHEC physiology and pathogenesis. Copyright © 2015 Elsevier GmbH. All rights reserved.

  12. Screening and management of bacterial vaginosis in pregnancy.

    PubMed

    Yudin, Mark H; Money, Deborah M

    2008-08-01

    To review the evidence and provide recommendations on screening for and management of bacterial vaginosis in pregnancy. The clinical practice options considered in formulating the guideline. Outcomes evaluated include antibiotic treatment efficacy and cure rates, and the influence of the treatment of bacterial vaginosis on the rates of adverse pregnancy outcomes such as preterm labour and delivery and preterm premature rupture of membranes. Medline, EMBASE, CINAHL, and Cochrane databases were searched for articles, published in English before the end of June 2007 on the topic of bacterial vaginosis in pregnancy. The evidence obtained was rated using the criteria developed by the Canadian Task Force on Preventive Health Care. Guideline implementation will assist the practitioner in developing an approach to the diagnosis and treatment of bacterial vaginosis in pregnant women. Patients will benefit from appropriate management of this condition. These guidelines have been prepared by the Infectious Diseases Committee of the SOGC, and approved by the Executive and Council of the SOGC. The Society of Obstetricians and Gynaecologists of Canada.

  13. Shrimp alpha-2-macroglobulin prevents the bacterial escape by inhibiting fibrinolysis of blood clots.

    PubMed

    Chaikeeratisak, Vorrapon; Somboonwiwat, Kunlaya; Tassanakajon, Anchalee

    2012-01-01

    Proteomic analysis of the hemocytic proteins of Penaeus monodon (Pm) has previously shown that alpha-2-macroglobulin (A2M) was among the proteins that showed substantially altered expression levels upon Vibrio harveyi infection. Therefore, in this study its potentially important role in the response of shrimp to bacterial infection was further characterized. The yeast two-hybrid system revealed that the receptor binding domain of PmA2M interacted with the carboxyl-terminus of one or both of the transglutaminase type II isoforms, which are key enzymes involved in the shrimp clotting system. In accord with this, PmA2M was found to be localized on the extracellular blood clots and to colocalize with clottable proteins. RNA interference (RNAi)-mediated knockdown of A2M transcript levels reduced the PmA2M transcript levels (∼94%) and significantly reduced the bacterial seizing ability of the clotting system, resulting in an up to 3.3-fold higher number of V. harveyi that systemically disseminated into the circulatory system at 5 min post-infection before subsequent clearance by the immune system. Furthermore, an appearance of PmA2M depleted clots in the presence of V. harveyi strikingly demonstrated fibrinolysis zones surrounding the bacteria. This study provides the first evidence of the vital role of PmA2M in enhancing bacterial sequestration by protecting blood clots against fibrinolysis.

  14. Characterization of DNA polymerase X from Thermus thermophilus HB8 reveals the POLXc and PHP domains are both required for 3'-5' exonuclease activity.

    PubMed

    Nakane, Shuhei; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji

    2009-04-01

    The X-family DNA polymerases (PolXs) comprise a highly conserved DNA polymerase family found in all kingdoms. Mammalian PolXs are known to be involved in several DNA-processing pathways including repair, but the cellular functions of bacterial PolXs are less known. Many bacterial PolXs have a polymerase and histidinol phosphatase (PHP) domain at their C-termini in addition to a PolX core (POLXc) domain, and possess 3'-5' exonuclease activity. Although both domains are highly conserved in bacteria, their molecular functions, especially for a PHP domain, are unknown. We found Thermus thermophilus HB8 PolX (ttPolX) has Mg(2+)/Mn(2+)-dependent DNA/RNA polymerase, Mn(2+)-dependent 3'-5' exonuclease and DNA-binding activities. We identified the domains of ttPolX by limited proteolysis and characterized their biochemical activities. The POLXc domain was responsible for the polymerase and DNA-binding activities but exonuclease activity was not detected for either domain. However, the POLXc and PHP domains interacted with each other and a mixture of the two domains had Mn(2+)-dependent 3'-5' exonuclease activity. Moreover, site-directed mutagenesis revealed catalytically important residues in the PHP domain for the 3'-5' exonuclease activity. Our findings provide a molecular insight into the functional domain organization of bacterial PolXs, especially the requirement of the PHP domain for 3'-5' exonuclease activity.

  15. Bacterial hybrid histidine kinases in plant-bacteria interactions.

    PubMed

    Borland, Stéphanie; Prigent-Combaret, Claire; Wisniewski-Dyé, Florence

    2016-10-01

    Two-component signal transduction systems are essential for many bacteria to maintain homeostasis and adapt to environmental changes. Two-component signal transduction systems typically involve a membrane-bound histidine kinase that senses stimuli, autophosphorylates in the transmitter region and then transfers the phosphoryl group to the receiver domain of a cytoplasmic response regulator that mediates appropriate changes in bacterial physiology. Although usually found on distinct proteins, the transmitter and receiver modules are sometimes fused into a so-called hybrid histidine kinase (HyHK). Such structure results in multiple phosphate transfers that are believed to provide extra-fine-tuning mechanisms and more regulatory checkpoints than classical phosphotransfers. HyHK-based regulation may be crucial for finely tuning gene expression in a heterogeneous environment such as the rhizosphere, where intricate plant-bacteria interactions occur. In this review, we focus on roles fulfilled by bacterial HyHKs in plant-associated bacteria, providing recent findings on the mechanistic of their signalling properties. Recent insights into understanding additive regulatory properties fulfilled by the tethered receiver domain of HyHKs are also addressed.

  16. Electrophysiological Evidence for Domain-General Processes in Task-Switching

    PubMed Central

    Capizzi, Mariagrazia; Ambrosini, Ettore; Arbula, Sandra; Mazzonetto, Ilaria; Vallesi, Antonino

    2016-01-01

    The ability to flexibly switch between tasks is a hallmark of cognitive control. Despite previous studies that have investigated whether different task-switching types would be mediated by distinct or overlapping neural mechanisms, no definitive consensus has been reached on this question yet. Here, we aimed at directly addressing this issue by recording the event-related potentials (ERPs) elicited by two types of task-switching occurring in the context of spatial and verbal cognitive domains. Source analysis was also applied to the ERP data in order to track the spatial dynamics of brain activity underlying task-switching abilities. In separate blocks of trials, participants had to perform either spatial or verbal switching tasks both of which employed the same type of stimuli. The ERP analysis, which was carried out through a channel- and time-uninformed mass univariate approach, showed no significant differences between the spatial and verbal domains in the modulation of switch and repeat trials. Specifically, relative to repeat trials, switch trials in both domains were associated with a first larger positivity developing over left parieto-occipital electrodes and with a subsequent larger negativity distributed over mid-left fronto-central sites. The source analysis reconstruction for the two ERP components complemented these findings by highlighting the involvement of left-lateralized prefrontal areas in task-switching. Overall, our results join and extend recent research confirming the existence of left-lateralized domain-general task-switching processes. PMID:27047366

  17. Solution Structure of Homology Region (HR) Domain of Type II Secretion System*

    PubMed Central

    Gu, Shuang; Kelly, Geoff; Wang, Xiaohui; Frenkiel, Tom; Shevchik, Vladimir E.; Pickersgill, Richard W.

    2012-01-01

    The type II secretion system of Gram-negative bacteria is important for bacterial pathogenesis and survival; it is composed of 12 mostly multimeric core proteins, which build a sophisticated secretion machine spanning both bacterial membranes. OutC is the core component of the inner membrane subcomplex thought to be involved in both recognition of substrate and interaction with the outer membrane secretin OutD. Here, we report the solution structure of the HR domain of OutC and explore its interaction with the secretin. The HR domain adopts a β-sandwich-like fold consisting of two β-sheets each composed of three anti-parallel β-strands. This structure is strikingly similar to the periplasmic region of PilP, an inner membrane lipoprotein from the type IV pilus system highlighting the common evolutionary origin of these two systems and showing that all the core components of the type II secretion system have a structural or sequence ortholog within the type IV pili system. The HR domain is shown to interact with the N0 domain of the secretin. The importance of this interaction is explored in the context of the functional secretion system. PMID:22253442

  18. Comprehensive phylogenetic analysis of bacterial reverse transcriptases.

    PubMed

    Toro, Nicolás; Nisa-Martínez, Rafael

    2014-01-01

    Much less is known about reverse transcriptases (RTs) in prokaryotes than in eukaryotes, with most prokaryotic enzymes still uncharacterized. Two surveys involving BLAST searches for RT genes in prokaryotic genomes revealed the presence of large numbers of diverse, uncharacterized RTs and RT-like sequences. Here, using consistent annotation across all sequenced bacterial species from GenBank and other sources via RAST, available from the PATRIC (Pathogenic Resource Integration Center) platform, we have compiled the data for currently annotated reverse transcriptases from completely sequenced bacterial genomes. RT sequences are broadly distributed across bacterial phyla, but green sulfur bacteria and cyanobacteria have the highest levels of RT sequence diversity (≤85% identity) per genome. By contrast, phylum Actinobacteria, for which a large number of genomes have been sequenced, was found to have a low RT sequence diversity. Phylogenetic analyses revealed that bacterial RTs could be classified into 17 main groups: group II introns, retrons/retron-like RTs, diversity-generating retroelements (DGRs), Abi-like RTs, CRISPR-Cas-associated RTs, group II-like RTs (G2L), and 11 other groups of RTs of unknown function. Proteobacteria had the highest potential functional diversity, as they possessed most of the RT groups. Group II introns and DGRs were the most widely distributed RTs in bacterial phyla. Our results provide insights into bacterial RT phylogeny and the basis for an update of annotation systems based on sequence/domain homology.

  19. Comprehensive Phylogenetic Analysis of Bacterial Reverse Transcriptases

    PubMed Central

    Toro, Nicolás; Nisa-Martínez, Rafael

    2014-01-01

    Much less is known about reverse transcriptases (RTs) in prokaryotes than in eukaryotes, with most prokaryotic enzymes still uncharacterized. Two surveys involving BLAST searches for RT genes in prokaryotic genomes revealed the presence of large numbers of diverse, uncharacterized RTs and RT-like sequences. Here, using consistent annotation across all sequenced bacterial species from GenBank and other sources via RAST, available from the PATRIC (Pathogenic Resource Integration Center) platform, we have compiled the data for currently annotated reverse transcriptases from completely sequenced bacterial genomes. RT sequences are broadly distributed across bacterial phyla, but green sulfur bacteria and cyanobacteria have the highest levels of RT sequence diversity (≤85% identity) per genome. By contrast, phylum Actinobacteria, for which a large number of genomes have been sequenced, was found to have a low RT sequence diversity. Phylogenetic analyses revealed that bacterial RTs could be classified into 17 main groups: group II introns, retrons/retron-like RTs, diversity-generating retroelements (DGRs), Abi-like RTs, CRISPR-Cas-associated RTs, group II-like RTs (G2L), and 11 other groups of RTs of unknown function. Proteobacteria had the highest potential functional diversity, as they possessed most of the RT groups. Group II introns and DGRs were the most widely distributed RTs in bacterial phyla. Our results provide insights into bacterial RT phylogeny and the basis for an update of annotation systems based on sequence/domain homology. PMID:25423096

  20. Structure of the Legionella Virulence Factor, SidC Reveals a Unique PI(4)P-Specific Binding Domain Essential for Its Targeting to the Bacterial Phagosome.

    PubMed

    Luo, Xi; Wasilko, David J; Liu, Yao; Sun, Jiayi; Wu, Xiaochun; Luo, Zhao-Qing; Mao, Yuxin

    2015-06-01

    The opportunistic intracellular pathogen Legionella pneumophila is the causative agent of Legionnaires' disease. L. pneumophila delivers nearly 300 effector proteins into host cells for the establishment of a replication-permissive compartment known as the Legionella-containing vacuole (LCV). SidC and its paralog SdcA are two effectors that have been shown to anchor on the LCV via binding to phosphatidylinositol-4-phosphate [PI(4)P] to facilitate the recruitment of ER proteins to the LCV. We recently reported that the N-terminal SNL (SidC N-terminal E3 Ligase) domain of SidC is a ubiquitin E3 ligase, and its activity is required for the recruitment of ER proteins to the LCV. Here we report the crystal structure of SidC (1-871). The structure reveals that SidC contains four domains that are packed into an arch-like shape. The P4C domain (PI(4)P binding of SidC) comprises a four α-helix bundle and covers the ubiquitin ligase catalytic site of the SNL domain. Strikingly, a pocket with characteristic positive electrostatic potentials is formed at one end of this bundle. Liposome binding assays of the P4C domain further identified the determinants of phosphoinositide recognition and membrane interaction. Interestingly, we also found that binding with PI(4)P stimulates the E3 ligase activity, presumably due to a conformational switch induced by PI(4)P from a closed form to an open active form. Mutations of key residues involved in PI(4)P binding significantly reduced the association of SidC with the LCV and abolished its activity in the recruitment of ER proteins and ubiquitin signals, highlighting that PI(4)P-mediated targeting of SidC is critical to its function in the remodeling of the bacterial phagosome membrane. Finally, a GFP-fusion with the P4C domain was demonstrated to be specifically localized to PI(4)P-enriched compartments in mammalian cells. This domain shows the potential to be developed into a sensitive and accurate PI(4)P probe in living cells.

  1. Pyrite discs in coal: evidence for fossilized bacterial colonies

    USGS Publications Warehouse

    Southam, G.; Donald, R.; Rostad, A.; Brock, C.

    2001-01-01

    Discs of pyrite from 1 to 3 mm in diameter and ∼100 μm thick were observed within fracture planes in coal from the Black Mesa coal deposit in northeastern Arizona. The pyrite discs were composed of aggregates of crystals, which suggested that sulfide mineral diagenesis had initiated at multiple nucleation sites and occurred prior to the compaction forces occurring during coal formation. Stable sulfur isotope analysis of the discs (δ34S = −31.7‰) supports a bacterial origin resulting from dissimilatory sulfate reduction. Fossilized bacteria on the disc surfaces (average = 27/100 μm2) appeared as halos when viewed using reflected light microscopy, but were lenticular by scanning electron microscopy, each microfossil being 2–3 μm in length. A fossilized bacterial colony (pyrite disc), 1 mm in diameter, would contain ∼2.1 × 107 microfossils. These microfossils were not observed on hydrothermal pyrite. Coating and in-filling of sulfate-reducing bacteria with iron disulfide during in vitro sulfide mineral diagenesis provide mechanisms to explain the preservation of the three-dimensional lenticular microfossils observed on the pyrite discs.

  2. Engineering the Bacterial Microcompartment Domain for Molecular Scaffolding Applications

    PubMed Central

    Young, Eric J.; Burton, Rodney; Mahalik, Jyoti P.; Sumpter, Bobby G.; Fuentes-Cabrera, Miguel; Kerfeld, Cheryl A.; Ducat, Daniel C.

    2017-01-01

    As synthetic biology advances the intricacy of engineered biological systems, the importance of spatial organization within the cellular environment must not be marginalized. Increasingly, biological engineers are investigating means to control spatial organization within the cell, mimicking strategies used by natural pathways to increase flux and reduce cross-talk. A modular platform for constructing a diverse set of defined, programmable architectures would greatly assist in improving yields from introduced metabolic pathways and increasing insulation of other heterologous systems. Here, we review recent research on the shell proteins of bacterial microcompartments and discuss their potential application as “building blocks” for a range of customized intracellular scaffolds. We summarize the state of knowledge on the self-assembly of BMC shell proteins and discuss future avenues of research that will be important to realize the potential of BMC shell proteins as predictively assembling and programmable biological materials for bioengineering. PMID:28824573

  3. Pathogenic Leptospira species express surface-exposed proteins belonging to the bacterial immunoglobulin superfamily

    PubMed Central

    Matsunaga, James; Barocchi, Michele A.; Croda, Julio; Young, Tracy A.; Sanchez, Yolanda; Siqueira, Isadora; Bolin, Carole A.; Reis, Mitermayer G.; Riley, Lee W.; Haake, David A.; Ko, Albert I.

    2005-01-01

    Summary Proteins with bacterial immunoglobulin-like (Big) domains, such as the Yersinia pseudotuberculosis invasin and Escherichia coli intimin, are surface-expressed proteins that mediate host mammalian cell invasion or attachment. Here, we report the identification and characterization of a new family of Big domain proteins, referred to as Lig (leptospiral Ig-like) proteins, in pathogenic Leptospira. Screening of L. interrogans and L. kirschneri expression libraries with sera from leptospirosis patients identified 13 lambda phage clones that encode tandem repeats of the 90 amino acid Big domain. Two lig genes, designated ligA and ligB, and one pseudo-gene, ligC, were identified. The ligA and ligB genes encode amino-terminal lipoprotein signal peptides followed by 10 or 11 Big domain repeats and, in the case of ligB, a unique carboxy-terminal non-repeat domain. The organization of ligC is similar to that of ligB but contains mutations that disrupt the reading frame. The lig sequences are present in pathogenic but not saprophytic Leptospira species. LigA and LigB are expressed by a variety of virulent leptospiral strains. Loss of Lig protein and RNA transcript expression is correlated with the observed loss of virulence during culture attenuation of pathogenic strains. High-pressure freeze substitution followed by immunocytochemical electron microscopy confirmed that the Lig proteins were localized to the bacterial surface. Immunoblot studies with patient sera found that the Lig proteins are a major antigen recognized during the acute host infection. These observations demonstrate that the Lig proteins are a newly identified surface protein of pathogenic Leptospira, which by analogy to other bacterial immunoglobulin superfamily virulence factors, may play a role in host cell attachment and invasion during leptospiral pathogenesis. PMID:12890019

  4. Pathogenic Leptospira species express surface-exposed proteins belonging to the bacterial immunoglobulin superfamily.

    PubMed

    Matsunaga, James; Barocchi, Michele A; Croda, Julio; Young, Tracy A; Sanchez, Yolanda; Siqueira, Isadora; Bolin, Carole A; Reis, Mitermayer G; Riley, Lee W; Haake, David A; Ko, Albert I

    2003-08-01

    Proteins with bacterial immunoglobulin-like (Big) domains, such as the Yersinia pseudotuberculosis invasin and Escherichia coli intimin, are surface-expressed proteins that mediate host mammalian cell invasion or attachment. Here, we report the identification and characterization of a new family of Big domain proteins, referred to as Lig (leptospiral Ig-like) proteins, in pathogenic Leptospira. Screening of L. interrogans and L. kirschneri expression libraries with sera from leptospirosis patients identified 13 lambda phage clones that encode tandem repeats of the 90 amino acid Big domain. Two lig genes, designated ligA and ligB, and one pseudogene, ligC, were identified. The ligA and ligB genes encode amino-terminal lipoprotein signal peptides followed by 10 or 11 Big domain repeats and, in the case of ligB, a unique carboxy-terminal non-repeat domain. The organization of ligC is similar to that of ligB but contains mutations that disrupt the reading frame. The lig sequences are present in pathogenic but not saprophytic Leptospira species. LigA and LigB are expressed by a variety of virulent leptospiral strains. Loss of Lig protein and RNA transcript expression is correlated with the observed loss of virulence during culture attenuation of pathogenic strains. High-pressure freeze substitution followed by immunocytochemical electron microscopy confirmed that the Lig proteins were localized to the bacterial surface. Immunoblot studies with patient sera found that the Lig proteins are a major antigen recognized during the acute host infection. These observations demonstrate that the Lig proteins are a newly identified surface protein of pathogenic Leptospira, which by analogy to other bacterial immunoglobulin superfamily virulence factors, may play a role in host cell attachment and invasion during leptospiral pathogenesis.

  5. Engineering the Bacterial Microcompartment Domain for Molecular Scaffolding Applications

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Young, Eric J.; Burton, Rodney; Mahalik, Jyoti P.

    As synthetic biology advances the intricacy of engineered biological systems, the importance of spatial organization within the cellular environment must not be marginalized. Increasingly, biological engineers are investigating means to control spatial organization within the cell, mimicking strategies used by natural pathways to increase flux and reduce cross-talk. A modular platform for constructing a diverse set of defined, programmable architectures would greatly assist in improving yields from introduced metabolic pathways and increasing insulation of other heterologous systems. Here, we review recent research on the shell proteins of bacterial microcompartments and discuss their potential application as “building blocks” for a rangemore » of customized intracellular scaffolds. As a result, we summarize the state of knowledge on the self-assembly of BMC shell proteins and discuss future avenues of research that will be important to realize the potential of BMC shell proteins as predictively assembling and programmable biological materials for bioengineering.« less

  6. Engineering the Bacterial Microcompartment Domain for Molecular Scaffolding Applications

    DOE PAGES

    Young, Eric J.; Burton, Rodney; Mahalik, Jyoti P.; ...

    2017-07-31

    As synthetic biology advances the intricacy of engineered biological systems, the importance of spatial organization within the cellular environment must not be marginalized. Increasingly, biological engineers are investigating means to control spatial organization within the cell, mimicking strategies used by natural pathways to increase flux and reduce cross-talk. A modular platform for constructing a diverse set of defined, programmable architectures would greatly assist in improving yields from introduced metabolic pathways and increasing insulation of other heterologous systems. Here, we review recent research on the shell proteins of bacterial microcompartments and discuss their potential application as “building blocks” for a rangemore » of customized intracellular scaffolds. As a result, we summarize the state of knowledge on the self-assembly of BMC shell proteins and discuss future avenues of research that will be important to realize the potential of BMC shell proteins as predictively assembling and programmable biological materials for bioengineering.« less

  7. Statistical analysis of the Bacterial Carbohydrate Structure Data Base (BCSDB): Characteristics and diversity of bacterial carbohydrates in comparison with mammalian glycans

    PubMed Central

    Herget, Stephan; Toukach, Philip V; Ranzinger, René; Hull, William E; Knirel, Yuriy A; von der Lieth, Claus-Wilhelm

    2008-01-01

    Background There are considerable differences between bacterial and mammalian glycans. In contrast to most eukaryotic carbohydrates, bacterial glycans are often composed of repeating units with diverse functions ranging from structural reinforcement to adhesion, colonization and camouflage. Since bacterial glycans are typically displayed at the cell surface, they can interact with the environment and, therefore, have significant biomedical importance. Results The sequence characteristics of glycans (monosaccharide composition, modifications, and linkage patterns) for the higher bacterial taxonomic classes have been examined and compared with the data for mammals, with both similarities and unique features becoming evident. Compared to mammalian glycans, the bacterial glycans deposited in the current databases have a more than ten-fold greater diversity at the monosaccharide level, and the disaccharide pattern space is approximately nine times larger. Specific bacterial subclasses exhibit characteristic glycans which can be distinguished on the basis of distinctive structural features or sequence properties. Conclusion For the first time a systematic database analysis of the bacterial glycome has been performed. This study summarizes the current knowledge of bacterial glycan architecture and diversity and reveals putative targets for the rational design and development of therapeutic intervention strategies by comparing bacterial and mammalian glycans. PMID:18694500

  8. Osteomyelitis in a Paleozoic reptile: ancient evidence for bacterial infection and its evolutionary significance

    NASA Astrophysics Data System (ADS)

    Reisz, Robert R.; Scott, Diane M.; Pynn, Bruce R.; Modesto, Sean P.

    2011-06-01

    We report on dental and mandibular pathology in Labidosaurus hamatus, a 275 million-year-old terrestrial reptile from North America and associate it with bacterial infection in an organism that is characterized by reduced tooth replacement. Analysis of the surface and internal mandibular structure using mechanical and CT-scanning techniques permits the reconstruction of events that led to the pathology and the possible death of the individual. The infection probably occurred as a result of prolonged exposure of the dental pulp cavity to oral bacteria, and this exposure was caused by injury to the tooth in an animal that is characterized by reduced tooth replacement cycles. In these early reptiles, the reduction in tooth replacement is an evolutionary innovation associated with strong implantation and increased oral processing. The dental abscess observed in L. hamatus, the oldest known infection in a terrestrial vertebrate, provides clear evidence of the ancient association between terrestrial vertebrates and their oral bacteria.

  9. Generic domain models in software engineering

    NASA Technical Reports Server (NTRS)

    Maiden, Neil

    1992-01-01

    This paper outlines three research directions related to domain-specific software development: (1) reuse of generic models for domain-specific software development; (2) empirical evidence to determine these generic models, namely elicitation of mental knowledge schema possessed by expert software developers; and (3) exploitation of generic domain models to assist modelling of specific applications. It focuses on knowledge acquisition for domain-specific software development, with emphasis on tool support for the most important phases of software development.

  10. Structural mapping of the coiled-coil domain of a bacterial condensin and comparative analyses across all domains of life suggest conserved features of SMC proteins.

    PubMed

    Waldman, Vincent M; Stanage, Tyler H; Mims, Alexandra; Norden, Ian S; Oakley, Martha G

    2015-06-01

    The structural maintenance of chromosomes (SMC) proteins form the cores of multisubunit complexes that are required for the segregation and global organization of chromosomes in all domains of life. These proteins share a common domain structure in which N- and C- terminal regions pack against one another to form a globular ATPase domain. This "head" domain is connected to a central, globular, "hinge" or dimerization domain by a long, antiparallel coiled coil. To date, most efforts for structural characterization of SMC proteins have focused on the globular domains. Recently, however, we developed a method to map interstrand interactions in the 50-nm coiled-coil domain of MukB, the divergent SMC protein found in γ-proteobacteria. Here, we apply that technique to map the structure of the Bacillus subtilis SMC (BsSMC) coiled-coil domain. We find that, in contrast to the relatively complicated coiled-coil domain of MukB, the BsSMC domain is nearly continuous, with only two detectable coiled-coil interruptions. Near the middle of the domain is a break in coiled-coil structure in which there are three more residues on the C-terminal strand than on the N-terminal strand. Close to the head domain, there is a second break with a significantly longer insertion on the same strand. These results provide an experience base that allows an informed interpretation of the output of coiled-coil prediction algorithms for this family of proteins. A comparison of such predictions suggests that these coiled-coil deviations are highly conserved across SMC types in a wide variety of organisms, including humans. © 2015 Wiley Periodicals, Inc.

  11. Evidence of variable bacterial colonization on coloured elastomeric ligatures during orthodontic treatment: An intermodular comparative study.

    PubMed

    Sharma, Ravish; Sharma, Kavita; Sawhney, Rajesh

    2018-03-01

    Besides, other factors, the choice of materials used as orthodontic ligatures could be one of the many tools to counter the effects of microbial adhesion, that culminates into dental ailments. Therefore, we assessed bacterial adhesion on elastomeric ligatures with special reference to coloured elastomeric rings during orthodontic treatment. A split mouth study, involving 240 samples of different elastomeric ligatures from forty orthodontic patients possessing good oral hygiene was carried out. The archwire was ligated to the brackets on both arches with elastomeric rings (superslick, clear transparent , blue and pink) at predetermined quadrants. After six weeks, ligatures from second premolars were removed and processed for bacterial enumeration using standard techniques. Bacterial counts were also determined for stimulated saliva samples taken at 0 and 6 weeks. A statistically significant difference in bacterial counts was obtained amongst different elastomeric modules used. Maximum bacterial counts were found on conventional pigmented elastomeric modules, followed by Superslick module and clear module. More number of bacteria associated with the conventional pink as compared to the conventional blue pigmented modules, however it was not statistically significant. The three bacterial genera Streptococcus Staphylococcus and Aerobic Lactobacilli adhered to elastomeric modules in following predominant pattern i.e. Conventional pink>Conventional Blue>Superslick>Clear. The studies evidenced colour and material dependent bacterial colonization on orthodontic modules and could be an indicator of bacterial biofilm forming potential based on surface chemistries and a clinically efficacious tool to redesign conventional and modified elastomeric rings as orthodontic ligation accessories. Key words: Bacterial colonization, biofilm, coloured elastomers, orthodontic ligatures.

  12. Molecular Evolution of the Oxygen-Binding Hemerythrin Domain

    PubMed Central

    Alvarez-Carreño, Claudia; Becerra, Arturo; Lazcano, Antonio

    2016-01-01

    Background The evolution of oxygenic photosynthesis during Precambrian times entailed the diversification of strategies minimizing reactive oxygen species-associated damage. Four families of oxygen-carrier proteins (hemoglobin, hemerythrin and the two non-homologous families of arthropodan and molluscan hemocyanins) are known to have evolved independently the capacity to bind oxygen reversibly, providing cells with strategies to cope with the evolutionary pressure of oxygen accumulation. Oxygen-binding hemerythrin was first studied in marine invertebrates but further research has made it clear that it is present in the three domains of life, strongly suggesting that its origin predated the emergence of eukaryotes. Results Oxygen-binding hemerythrins are a monophyletic sub-group of the hemerythrin/HHE (histidine, histidine, glutamic acid) cation-binding domain. Oxygen-binding hemerythrin homologs were unambiguously identified in 367/2236 bacterial, 21/150 archaeal and 4/135 eukaryotic genomes. Overall, oxygen-binding hemerythrin homologues were found in the same proportion as single-domain and as long protein sequences. The associated functions of protein domains in long hemerythrin sequences can be classified in three major groups: signal transduction, phosphorelay response regulation, and protein binding. This suggests that in many organisms the reversible oxygen-binding capacity was incorporated in signaling pathways. A maximum-likelihood tree of oxygen-binding hemerythrin homologues revealed a complex evolutionary history in which lateral gene transfer, duplications and gene losses appear to have played an important role. Conclusions Hemerythrin is an ancient protein domain with a complex evolutionary history. The distinctive iron-binding coordination site of oxygen-binding hemerythrins evolved first in prokaryotes, very likely prior to the divergence of Firmicutes and Proteobacteria, and spread into many bacterial, archaeal and eukaryotic species. The later

  13. Tone Language Speakers and Musicians Share Enhanced Perceptual and Cognitive Abilities for Musical Pitch: Evidence for Bidirectionality between the Domains of Language and Music

    PubMed Central

    Bidelman, Gavin M.; Hutka, Stefanie; Moreno, Sylvain

    2013-01-01

    Psychophysiological evidence suggests that music and language are intimately coupled such that experience/training in one domain can influence processing required in the other domain. While the influence of music on language processing is now well-documented, evidence of language-to-music effects have yet to be firmly established. Here, using a cross-sectional design, we compared the performance of musicians to that of tone-language (Cantonese) speakers on tasks of auditory pitch acuity, music perception, and general cognitive ability (e.g., fluid intelligence, working memory). While musicians demonstrated superior performance on all auditory measures, comparable perceptual enhancements were observed for Cantonese participants, relative to English-speaking nonmusicians. These results provide evidence that tone-language background is associated with higher auditory perceptual performance for music listening. Musicians and Cantonese speakers also showed superior working memory capacity relative to nonmusician controls, suggesting that in addition to basic perceptual enhancements, tone-language background and music training might also be associated with enhanced general cognitive abilities. Our findings support the notion that tone language speakers and musically trained individuals have higher performance than English-speaking listeners for the perceptual-cognitive processing necessary for basic auditory as well as complex music perception. These results illustrate bidirectional influences between the domains of music and language. PMID:23565267

  14. Functional Implications of Domain Organization Within Prokaryotic Rhomboid Proteases.

    PubMed

    Panigrahi, Rashmi; Lemieux, M Joanne

    2015-01-01

    Intramembrane proteases are membrane embedded enzymes that cleave transmembrane substrates. This interesting class of enzyme and its water mediated substrate cleavage mechanism occurring within the hydrophobic lipid bilayer has drawn the attention of researchers. Rhomboids are a family of ubiquitous serine intramembrane proteases. Bacterial forms of rhomboid proteases are mainly composed of six transmembrane helices that are preceded by a soluble N-terminal domain. Several crystal structures of the membrane domain of the E. coli rhomboid protease ecGlpG have been solved. Independently, the ecGlpG N-terminal cytoplasmic domain structure was solved using both NMR and protein crystallography. Despite these structures, we still do not know the structure of the full-length protein, nor do we know the functional role of these domains in the cell. This chapter will review the structural and functional roles of the different domains associated with prokaryotic rhomboid proteases. Lastly, we will address questions remaining in the field.

  15. Structure of the adenylation domain of NAD[superscript +]-dependent DNA ligase from Staphylococcus aureus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Han, Seungil; Chang, Jeanne S.; Griffor, Matt

    DNA ligase catalyzes phosphodiester-bond formation between immediately adjacent 5'-phosphate and 3''-hydroxyl groups in double-stranded DNA and plays a central role in many cellular and biochemical processes, including DNA replication, repair and recombination. Bacterial NAD{sup +}-dependent DNA ligases have been extensively characterized as potential antibacterial targets because of their essentiality and their structural distinction from human ATP-dependent DNA ligases. The high-resolution structure of the adenylation domain of Staphylococcus aureus NAD{sup +}-dependent DNA ligase establishes the conserved domain architecture with other bacterial adenylation domains. Two apo crystal structures revealed that the active site possesses the preformed NAD{sup +}-binding pocket and the 'C2more » tunnel' lined with hydrophobic residues: Leu80, Phe224, Leu287, Phe295 and Trp302. The C2 tunnel is unique to bacterial DNA ligases and the Leu80 side chain at the mouth of the tunnel points inside the tunnel and forms a narrow funnel in the S. aureus DNA ligase structure. Taken together with other DNA ligase structures, the S. aureus DNA ligase structure provides a basis for a more integrated understanding of substrate recognition and catalysis and will be also be of help in the development of small-molecule inhibitors.« less

  16. Determinants of eukaryal cell killing by the bacterial ribotoxin PrrC

    PubMed Central

    Meineke, Birthe; Schwer, Beate; Schaffrath, Raffael; Shuman, Stewart

    2011-01-01

    tRNA damage inflicted by the Escherichia coli anticodon nuclease PrrC (EcoPrrC) underlies an antiviral response to phage T4 infection. PrrC homologs are present in many bacterial proteomes, though their biological activities are uncharted. PrrCs consist of two domains: an N-terminal NTPase module related to the ABC family and a distinctive C-terminal ribonuclease module. In this article, we report that the expression of EcoPrrC in budding yeast is fungicidal, signifying that PrrC is toxic in a eukaryon in the absence of other bacterial or viral proteins. Whereas Streptococcus PrrC is also toxic in yeast, Neisseria and Xanthomonas PrrCs are not. Via analysis of the effects of 118 mutations on EcoPrrC toxicity in yeast, we identified 22 essential residues in the NTPase domain and 11 in the nuclease domain. Overexpressing PrrCs with mutations in the NTPase active site ameliorated the toxicity of wild-type EcoPrrC. Our findings support a model in which EcoPrrC toxicity is contingent on head-to-tail dimerization of the NTPase domains to form two composite NTP phosphohydrolase sites. Comparisons of EcoPrrC activity in a variety of yeast genetic backgrounds, and the rescuing effects of tRNA overexpression, implicate tRNALys(UUU) as a target of EcoPrrC toxicity in yeast. PMID:20855293

  17. Determinants of eukaryal cell killing by the bacterial ribotoxin PrrC.

    PubMed

    Meineke, Birthe; Schwer, Beate; Schaffrath, Raffael; Shuman, Stewart

    2011-01-01

    tRNA damage inflicted by the Escherichia coli anticodon nuclease PrrC (EcoPrrC) underlies an antiviral response to phage T4 infection. PrrC homologs are present in many bacterial proteomes, though their biological activities are uncharted. PrrCs consist of two domains: an N-terminal NTPase module related to the ABC family and a distinctive C-terminal ribonuclease module. In this article, we report that the expression of EcoPrrC in budding yeast is fungicidal, signifying that PrrC is toxic in a eukaryon in the absence of other bacterial or viral proteins. Whereas Streptococcus PrrC is also toxic in yeast, Neisseria and Xanthomonas PrrCs are not. Via analysis of the effects of 118 mutations on EcoPrrC toxicity in yeast, we identified 22 essential residues in the NTPase domain and 11 in the nuclease domain. Overexpressing PrrCs with mutations in the NTPase active site ameliorated the toxicity of wild-type EcoPrrC. Our findings support a model in which EcoPrrC toxicity is contingent on head-to-tail dimerization of the NTPase domains to form two composite NTP phosphohydrolase sites. Comparisons of EcoPrrC activity in a variety of yeast genetic backgrounds, and the rescuing effects of tRNA overexpression, implicate tRNA(Lys(UUU)) as a target of EcoPrrC toxicity in yeast.

  18. Evolution of the deaminase fold and multiple origins of eukaryotic editing and mutagenic nucleic acid deaminases from bacterial toxin systems

    PubMed Central

    Iyer, Lakshminarayan M.; Zhang, Dapeng; Rogozin, Igor B.; Aravind, L.

    2011-01-01

    The deaminase-like fold includes, in addition to nucleic acid/nucleotide deaminases, several catalytic domains such as the JAB domain, and others involved in nucleotide and ADP-ribose metabolism. Using sensitive sequence and structural comparison methods, we develop a comprehensive natural classification of the deaminase-like fold and show that its ancestral version was likely to operate on nucleotides or nucleic acids. Consequently, we present evidence that a specific group of JAB domains are likely to possess a DNA repair function, distinct from the previously known deubiquitinating peptidase activity. We also identified numerous previously unknown clades of nucleic acid deaminases. Using inference based on contextual information, we suggest that most of these clades are toxin domains of two distinct classes of bacterial toxin systems, namely polymorphic toxins implicated in bacterial interstrain competition and those that target distantly related cells. Genome context information suggests that these toxins might be delivered via diverse secretory systems, such as Type V, Type VI, PVC and a novel PrsW-like intramembrane peptidase-dependent mechanism. We propose that certain deaminase toxins might be deployed by diverse extracellular and intracellular pathogens as also endosymbionts as effectors targeting nucleic acids of host cells. Our analysis suggests that these toxin deaminases have been acquired by eukaryotes on several independent occasions and recruited as organellar or nucleo-cytoplasmic RNA modifiers, operating on tRNAs, mRNAs and short non-coding RNAs, and also as mutators of hyper-variable genes, viruses and selfish elements. This scenario potentially explains the origin of mutagenic AID/APOBEC-like deaminases, including novel versions from Caenorhabditis, Nematostella and diverse algae and a large class of fast-evolving fungal deaminases. These observations greatly expand the distribution of possible unidentified mutagenic processes catalyzed by

  19. Geometry and mechanics of growing bacterial colonies

    NASA Astrophysics Data System (ADS)

    You, Zhihong; Pearce, Daniel; Sengupta, Anupam; Giomi, Luca

    Bacterial colonies are abundant on living and non-living surfaces, and are known to mediate a broad range of processes in ecology, medicine and industry. Although extensively researched - from single cells up to the population levels - a comprehensive biophysical picture, highlighting the cell-to-colony dynamics, is still lacking. Here, using numerical and analytical models, we study the mechanics of self-organization leading to the colony morphology of cells growing on a substrate with free boundary. We consider hard rods to mimic the growth of rod-shaped non-motile cells, and show that the colony, as a whole, does not form an ordered nematic phase, nor does it result in a purely disordered (isotropic) phase. Instead, different sizes of domains, in which cells are highly aligned at specific orientations, are found. The distribution of the domain sizes follows an exponential relation - indicating the existence of a characteristic length scale that determines the domain size relative to that of the colony. A continuum theory, based on the hydrodynamics of liquid crystals, is built to account for these phenomena, and is applied to describe the buckling transition from a planar to three-dimensional (3D) colony. The theory supports preliminary experiments conducted with different strains of rod shaped bacterial cells, and reveals that the buckling transition can be regulated by varying the cell stiffness and aspect ratio. This work proposes that, in addition to biochemical pathways, the spatio-temporal organization in microbial colonies is significantly tuned by the biomechanical and geometric properties of the microbes in consideration.

  20. An active bacterial community linked to high chl-a concentrations in Antarctic winter-pack ice and evidence for the development of an anaerobic sea-ice bacterial community.

    PubMed

    Eronen-Rasimus, Eeva; Luhtanen, Anne-Mari; Rintala, Janne-Markus; Delille, Bruno; Dieckmann, Gerhard; Karkman, Antti; Tison, Jean-Louis

    2017-10-01

    Antarctic sea-ice bacterial community composition and dynamics in various developmental stages were investigated during the austral winter in 2013. Thick snow cover likely insulated the ice, leading to high (<4 μg l -1 ) chlorophyll-a (chl-a) concentrations and consequent bacterial production. Typical sea-ice bacterial genera, for example, Octadecabacter, Polaribacter and Glaciecola, often abundant in spring and summer during the sea-ice algal bloom, predominated in the communities. The variability in bacterial community composition in the different ice types was mainly explained by the chl-a concentrations, suggesting that as in spring and summer sea ice, the sea-ice bacteria and algae may also be coupled during the Antarctic winter. Coupling between the bacterial community and sea-ice algae was further supported by significant correlations between bacterial abundance and production with chl-a. In addition, sulphate-reducing bacteria (for example, Desulforhopalus) together with odour of H 2 S were observed in thick, apparently anoxic ice, suggesting that the development of the anaerobic bacterial community may occur in sea ice under suitable conditions. In all, the results show that bacterial community in Antarctic sea ice can stay active throughout the winter period and thus possible future warming of sea ice and consequent increase in bacterial production may lead to changes in bacteria-mediated processes in the Antarctic sea-ice zone.

  1. A bacterial toxin-antitoxin module is the origin of inter-bacterial and inter-kingdom effectors of Bartonella.

    PubMed

    Harms, Alexander; Liesch, Marius; Körner, Jonas; Québatte, Maxime; Engel, Philipp; Dehio, Christoph

    2017-10-01

    Host-targeting type IV secretion systems (T4SS) evolved from conjugative T4SS machineries that mediate interbacterial plasmid transfer. However, the origins of effectors secreted by these virulence devices have remained largely elusive. Previous work showed that some effectors exhibit homology to toxins of bacterial toxin-antitoxin modules, but the evolutionary trajectories underlying these ties had not been resolved. We previously reported that FicT toxins of FicTA toxin-antitoxin modules disrupt cellular DNA topology via their enzymatic FIC (filamentation induced by cAMP) domain. Intriguingly, the FIC domain of the FicT toxin VbhT of Bartonella schoenbuchensis is fused to a type IV secretion signal-the BID (Bep intracellular delivery) domain-similar to the Bartonella effector proteins (Beps) that are secreted into eukaryotic host cells via the host-targeting VirB T4SS. In this study, we show that the VbhT toxin is an interbacterial effector protein secreted via the conjugative Vbh T4SS that is closely related to the VirB T4SS and encoded by plasmid pVbh of B. schoenbuchensis. We therefore propose that the Vbh T4SS together with its effector VbhT represent an evolutionary missing link on a path that leads from a regular conjugation system and FicTA toxin-antitoxin modules to the VirB T4SS and the Beps. Intriguingly, phylogenetic analyses revealed that the fusion of FIC and BID domains has probably occurred independently in VbhT and the common ancestor of the Beps, suggesting parallel evolutionary paths. Moreover, several other examples of TA module toxins that are bona fide substrates of conjugative T4SS indicate that their recruitment as interbacterial effectors is prevalent and serves yet unknown biological functions in the context of bacterial conjugation. We propose that the adaptation for interbacterial transfer favors the exaptation of FicT and other TA module toxins as inter-kingdom effectors and may thus constitute an important stepping stone in the

  2. Disentangling the Role of Domain-Specific Knowledge in Student Modeling

    NASA Astrophysics Data System (ADS)

    Ruppert, John; Duncan, Ravit Golan; Chinn, Clark A.

    2017-08-01

    This study explores the role of domain-specific knowledge in students' modeling practice and how this knowledge interacts with two domain-general modeling strategies: use of evidence and developing a causal mechanism. We analyzed models made by middle school students who had a year of intensive model-based instruction. These models were made to explain a familiar but unstudied biological phenomenon: late onset muscle pain. Students were provided with three pieces of evidence related to this phenomenon and asked to construct a model to account for this evidence. Findings indicate that domain-specific resources play a significant role in the extent to which the models accounted for provided evidence. On the other hand, familiarity with the situation appeared to contribute to the mechanistic character of models. Our results indicate that modeling strategies alone are insufficient for the development of a mechanistic model that accounts for provided evidence and that, while learners can develop a tentative model with a basic familiarity of the situation, scaffolding certain domain-specific knowledge is necessary to assist students with incorporating evidence in modeling tasks.

  3. Brief Report: Cross-Cultural Evidence for the Heterogeneity of the Restricted, Repetitive Behaviours and Interests Domain of Autism--A Greek Study

    ERIC Educational Resources Information Center

    Papageorgiou, Vaya; Georgiades, Stelios; Mavreas, Venos

    2008-01-01

    Recent studies provide evidence that the Restricted, Repetitive Behaviours, and Interests (RRBI) domain of autism is heterogeneous, consisting of at least two factors: Insistence on Sameness (IS) and Repetitive Sensory and Motor Behaviours and Interests (RSMB) [Cuccaro et al. ("Child Psychiatry and Human Development," 34, 3-7, 2003;…

  4. Effectors of animal and plant pathogens use a common domain to bind host phosphoinositides.

    PubMed

    Salomon, Dor; Guo, Yirui; Kinch, Lisa N; Grishin, Nick V; Gardner, Kevin H; Orth, Kim

    2013-01-01

    Bacterial Type III Secretion Systems deliver effectors into host cells to manipulate cellular processes to the advantage of the pathogen. Many host targets of these effectors are found on membranes. Therefore, to identify their targets, effectors often use specialized membrane-localization domains to localize to appropriate host membranes. However, the molecular mechanisms used by many domains are unknown. Here we identify a conserved bacterial phosphoinositide-binding domain (BPD) that is found in functionally diverse Type III effectors of both plant and animal pathogens. We show that members of the BPD family functionally bind phosphoinositides and mediate localization to host membranes. Moreover, NMR studies reveal that the BPD of the newly identified Vibrio parahaemolyticus Type III effector VopR is unfolded in solution, but folds into a specific structure upon binding its ligand phosphatidylinositol-(4,5)-bisphosphate. Thus, our findings suggest a possible mechanism for promoting refolding of Type III effectors after delivery into host cells.

  5. Shrimp Alpha-2-Macroglobulin Prevents the Bacterial Escape by Inhibiting Fibrinolysis of Blood Clots

    PubMed Central

    Chaikeeratisak, Vorrapon; Somboonwiwat, Kunlaya; Tassanakajon, Anchalee

    2012-01-01

    Proteomic analysis of the hemocytic proteins of Penaeus monodon (Pm) has previously shown that alpha-2-macroglobulin (A2M) was among the proteins that showed substantially altered expression levels upon Vibrio harveyi infection. Therefore, in this study its potentially important role in the response of shrimp to bacterial infection was further characterized. The yeast two-hybrid system revealed that the receptor binding domain of PmA2M interacted with the carboxyl-terminus of one or both of the transglutaminase type II isoforms, which are key enzymes involved in the shrimp clotting system. In accord with this, PmA2M was found to be localized on the extracellular blood clots and to colocalize with clottable proteins. RNA interference (RNAi)-mediated knockdown of A2M transcript levels reduced the PmA2M transcript levels (∼94%) and significantly reduced the bacterial seizing ability of the clotting system, resulting in an up to 3.3-fold higher number of V. harveyi that systemically disseminated into the circulatory system at 5 min post-infection before subsequent clearance by the immune system. Furthermore, an appearance of PmA2M depleted clots in the presence of V. harveyi strikingly demonstrated fibrinolysis zones surrounding the bacteria. This study provides the first evidence of the vital role of PmA2M in enhancing bacterial sequestration by protecting blood clots against fibrinolysis. PMID:23082160

  6. Beta oscillations define discrete perceptual cycles in the somatosensory domain.

    PubMed

    Baumgarten, Thomas J; Schnitzler, Alfons; Lange, Joachim

    2015-09-29

    Whether seeing a movie, listening to a song, or feeling a breeze on the skin, we coherently experience these stimuli as continuous, seamless percepts. However, there are rare perceptual phenomena that argue against continuous perception but, instead, suggest discrete processing of sensory input. Empirical evidence supporting such a discrete mechanism, however, remains scarce and comes entirely from the visual domain. Here, we demonstrate compelling evidence for discrete perceptual sampling in the somatosensory domain. Using magnetoencephalography (MEG) and a tactile temporal discrimination task in humans, we find that oscillatory alpha- and low beta-band (8-20 Hz) cycles in primary somatosensory cortex represent neurophysiological correlates of discrete perceptual cycles. Our results agree with several theoretical concepts of discrete perceptual sampling and empirical evidence of perceptual cycles in the visual domain. Critically, these results show that discrete perceptual cycles are not domain-specific, and thus restricted to the visual domain, but extend to the somatosensory domain.

  7. How Does Processing Affect Storage in Working Memory Tasks? Evidence for Both Domain-General and Domain-Specific Effects

    ERIC Educational Resources Information Center

    Jarrold, Christopher; Tam, Helen; Baddeley, Alan D.; Harvey, Caroline E.

    2011-01-01

    Two studies that examine whether the forgetting caused by the processing demands of working memory tasks is domain-general or domain-specific are presented. In each, separate groups of adult participants were asked to carry out either verbal or nonverbal operations on exactly the same processing materials while maintaining verbal storage items.…

  8. Insights into the strategies used by related group II introns to adapt successfully for the colonisation of a bacterial genome

    PubMed Central

    Martínez-Rodríguez, Laura; García-Rodríguez, Fernando M; Molina-Sánchez, María Dolores; Toro, Nicolás; Martínez-Abarca, Francisco

    2014-01-01

    Group II introns are self-splicing RNAs and site-specific mobile retroelements found in bacterial and organellar genomes. The group II intron RmInt1 is present at high copy number in Sinorhizobium meliloti species, and has a multifunctional intron-encoded protein (IEP) with reverse transcriptase/maturase activities, but lacking the DNA-binding and endonuclease domains. We characterized two RmInt1-related group II introns RmInt2 from S. meliloti strain GR4 and Sr.md.I1 from S. medicae strain WSM419 in terms of splicing and mobility activities. We used both wild-type and engineered intron-donor constructs based on ribozyme ΔORF-coding sequence derivatives, and we determined the DNA target requirements for RmInt2, the element most distantly related to RmInt1. The excision and mobility patterns of intron-donor constructs expressing different combinations of IEP and intron RNA provided experimental evidence for the co-operation of IEPs and intron RNAs from related elements in intron splicing and, in some cases, in intron homing. We were also able to identify the DNA target regions recognized by these IEPs lacking the DNA endonuclease domain. Our results provide new insight into the versatility of related group II introns and the possible co-operation between these elements to facilitate the colonization of bacterial genomes. PMID:25482895

  9. Insights into the strategies used by related group II introns to adapt successfully for the colonisation of a bacterial genome.

    PubMed

    Martínez-Rodríguez, Laura; García-Rodríguez, Fernando M; Molina-Sánchez, María Dolores; Toro, Nicolás; Martínez-Abarca, Francisco

    2014-01-01

    Group II introns are self-splicing RNAs and site-specific mobile retroelements found in bacterial and organellar genomes. The group II intron RmInt1 is present at high copy number in Sinorhizobium meliloti species, and has a multifunctional intron-encoded protein (IEP) with reverse transcriptase/maturase activities, but lacking the DNA-binding and endonuclease domains. We characterized two RmInt1-related group II introns RmInt2 from S. meliloti strain GR4 and Sr.md.I1 from S. medicae strain WSM419 in terms of splicing and mobility activities. We used both wild-type and engineered intron-donor constructs based on ribozyme ΔORF-coding sequence derivatives, and we determined the DNA target requirements for RmInt2, the element most distantly related to RmInt1. The excision and mobility patterns of intron-donor constructs expressing different combinations of IEP and intron RNA provided experimental evidence for the co-operation of IEPs and intron RNAs from related elements in intron splicing and, in some cases, in intron homing. We were also able to identify the DNA target regions recognized by these IEPs lacking the DNA endonuclease domain. Our results provide new insight into the versatility of related group II introns and the possible co-operation between these elements to facilitate the colonization of bacterial genomes.

  10. Impact of an evidence-based guideline on the management of community-acquired bacterial meningitis: a prospective cohort study.

    PubMed

    Costerus, J M; Brouwer, M C; Bijlsma, M W; Tanck, M W; van der Ende, A; van de Beek, D

    2016-11-01

    To study the impact of an evidence-based guideline on the management of community-acquired bacterial meningitis. We performed an interrupted time series analysis in a prospective nationwide cohort study from 2006 to 2015. The guideline stresses the importance of cranial imaging before lumbar puncture (LP) in selected patients based on clinical criteria, and early treatment with amoxicillin and a third-generation cephalosporin for adults with suspected community-acquired bacterial meningitis. The guideline was published in April 2013. We included 1326 episodes before and 210 episodes after guideline introduction. Cranial imaging was performed before LP in 497 (84%) of 591 episodes with clinical criteria warranting computed tomography (CT). The guideline did not improve this (increase of 2%; 95% confidence interval (CI), -15 to 19). Without these criteria, imaging before LP occurred in 606 (67%) of 900 episodes, also without effect of the guideline (increase of 1%; 95% CI, -25 to 28). The estimate of effect of the guideline for treatment with the recommended antibiotic regimen was an increase of 19.5% (95% CI, 13.5 to 25.5), and there was a trend towards more frequent initiation of treatment before CT. There was no association between delay in antibiotic treatment due to imaging before LP and unfavourable outcome (odds ratio, 1.14; 95% CI 0.86 to 1.52). Cranial imaging is performed before LP in the majority of patients with bacterial meningitis, irrespective of guideline indications. The guideline introduction was associated with a trend towards early initiation of treatment before imaging and with increased adherence to antibiotic policy. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  11. Evidence of extensive diversity in bacterial adherence mechanisms that exploit unanticipated stainless steel surface structural complexity for biofilm formation.

    PubMed

    Davis, Elisabeth M; Li, Dongyang; Shahrooei, Mohammad; Yu, Bin; Muruve, Daniel; Irvin, Randall T

    2013-04-01

    Three protease-resistant bioorganic 304 stainless steel surfaces were created through the reaction of synthetic peptides consisting of the D-enantiomeric isomer (D-K122-4), the retro-inverso D-enantiomeric isomer (RI-K122-4), and a combination of the two peptides (D+RI) of the Pseudomonas aeruginosa PilA receptor binding domain with steel surfaces. The peptides used to produce the new materials differ only in handedness of their three-dimensional structure, but they reacted with the steel to yield materials that differed in their surface electron work function (EWF) while displaying an identical chemical composition and equivalent surface adhesive force properties. These surfaces allowed for an assessment of the relative role of surface EWF in initial biofilm formation. We examined the ability of various bacteria (selected strains of Listeria monocytogenes, L. innocua, Staphylococcus aureus and S. epidermidis) to initiate biofilm formation. The D-K1224 generated surface displayed the lowest EWF (classically associated with greater molecular interactions and more extensive biofilm formation) but was observed to be least effectively colonized by bacteria (>50% decrease in bacterial adherence of all strains). The highest surface EWF with the lowest surface free energy (RI-K122-4 generated) was more extensively colonized by bacteria, with the binding of some strains being equivalent to unmodified steel. The D+RI generated surface was least effective in minimizing biofilm formation, where some strains displayed enhanced bacterial colonization. Fluorescent microscopy revealed that the D and RI peptides displayed similar but clearly different binding patterns, suggesting that the peptides recognized different sites on the steel, and that differential binding of the peptides to the steel surfaces influences the binding of different bacterial strains and species. We have demonstrated that stainless steel surfaces can be easily modified by peptides to generate surfaces with

  12. Evidence for symmetry in the elementary process of bidirectional torque generation by the bacterial flagellar motor

    PubMed Central

    Nakamura, Shuichi; Kami-ike, Nobunori; Yokota, Jun-ichi P.; Minamino, Tohru; Namba, Keiichi

    2010-01-01

    The bacterial flagellar motor can rotate in both counterclockwise (CCW) and clockwise (CW) directions. It has been shown that the sodium ion-driven chimeric flagellar motor rotates with 26 steps per revolution, which corresponds to the number of FliG subunits that form part of the rotor ring, but the size of the backward step is smaller than the forward one. Here we report that the proton-driven flagellar motor of Salmonella also rotates with 26 steps per revolution but symmetrical in both CCW and CW directions with occasional smaller backward steps in both directions. Occasional shift in the stepping positions is also observed, suggesting the frequent exchange of stators in one of the 11–12 possible anchoring positions around the rotor. These observations indicate that the elementary process of torque generation by the cyclic association/dissociation of the stator with every FliG subunit along the circumference of the rotor is symmetric in CCW and CW rotation even though the structure of FliG is highly asymmetric and suggests a 180° rotation of a FliG domain for the rotor-stator interaction to reverse the direction of rotation. PMID:20876126

  13. The pepper GNA-related lectin and PAN domain protein gene, CaGLP1, is required for plant cell death and defense signaling during bacterial infection.

    PubMed

    Kim, Nak Hyun; Lee, Dong Hyuk; Choi, Du Seok; Hwang, Byung Kook

    2015-12-01

    Carbohydrate-binding proteins, commonly referred to as lectins or agglutinins, function in defense responses to microbial pathogens. Pepper (Capsicum annuum) GNA-related lectin and PAN-domain protein gene CaGLP1 was isolated and functionally characterized from pepper leaves infected with Xanthomonas campestris pv. vesicatoria (Xcv). CaGLP1 contained an amine-terminus prokaryotic membrane lipoprotein lipid attachment site, a Galanthus nivalis agglutinin (GNA)-related lectin domain responsible for the recognition of high-mannose N-glycans, and a carboxyl-terminus PAN/apple domain. RNA gel blot and immunoblot analyses determined that CaGLP1 was strongly induced in pepper by compatible and incompatible Xcv infection. CaGLP1 protein localized primarily to the plasma membrane and exhibited mannose-binding specificity. CaGLP1-silenced pepper plants were more susceptible to compatible or incompatible Xcv infection compared with that of non-silenced control plants. CaGLP1 silencing in pepper leaves did not accumulate H2O2 and induce cell death during incompatible Xcv infection. Defense-related CaDEF1 (defensin) gene expression was significantly reduced in CaGLP1-silenced pepper plants. CaGLP1-overexpression in Arabidopsis thaliana enhanced resistance to Pseudomonas syringae pv. tomato. Defense-related AtPDF1.2 expression was elevated in CaGLP1-overexpression lines. Together, these results suggest that CaGLP1 is required for plant cell death and defense responses through the reactive oxygen species burst and downstream defense-related gene expression in response to bacterial pathogen challenge. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  14. Molecular mechanics of Staphylococcus aureus adhesin, CNA, and the inhibition of bacterial adhesion by stretching collagen

    PubMed Central

    Madani, Ali; Garakani, Kiavash

    2017-01-01

    Bacterial adhesion to collagen, the most abundant protein in humans, is a critical step in the initiation and persistence of numerous bacterial infections. In this study, we explore the collagen binding mechanism of the multi-modular cell wall anchored collagen adhesin (CNA) in Staphylococcus aureus and examine how applied mechanical forces can modulate adhesion ability. The common structural-functional elements and domain organization of CNA are present across over 50 genera of bacteria. Through the use of molecular dynamics models and normal mode analysis, we shed light on the CNA’s structural and conformational dynamics and its interactions with collagen that lead to collagen binding. Our results suggest that the linker region, CNA165-173, acts as a hinge exhibiting bending, extensional, and torsional modes of structural flexibility and its residues are key in the interaction of the CNA-collagen complex. Steered molecular dynamics simulations were conducted with umbrella sampling. During the course of these simulations, the ‘locking’ latch from the CNA N2 domain was dissociated from its groove in the CNA N1 domain, implying the importance of the latch for effective ligand binding. Finally, we observed that the binding efficiency of the CNA N1-N2 domains to collagen decreases greatly with increasing tensile force application to the collagen peptides. Thus, CNA and similar adhesins might preferentially bind to sites in which collagen fibers are cleaved, such as in wounded, injured, or inflamed tissues, or in which the collagenous tissue is less mature. As alternative techniques for control of bacterial infection are in-demand due to the rise of bacterial antibiotic resistance, results from our computational studies with respect to the mechanoregulation of the collagen binding site may inspire new therapeutics and engineering solutions by mechanically preventing colonization and/or further pathogenesis. PMID:28665944

  15. Crystal structure of a chimaeric bacterial glutamate dehydrogenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oliveira, Tânia; Sharkey, Michael A.; Engel, Paul C.

    2016-05-23

    Glutamate dehydrogenases (EC 1.4.1.2–4) catalyse the oxidative deamination of L-glutamate to α-ketoglutarate using NAD(P) +as a cofactor. The bacterial enzymes are hexameric, arranged with 32 symmetry, and each polypeptide consists of an N-terminal substrate-binding segment (domain I) followed by a C-terminal cofactor-binding segment (domain II). The catalytic reaction takes place in the cleft formed at the junction of the two domains. Distinct signature sequences in the nucleotide-binding domain have been linked to the binding of NAD +versusNADP +, but they are not unambiguous predictors of cofactor preference. In the absence of substrate, the two domains move apart as rigid bodies,more » as shown by the apo structure of glutamate dehydrogenase fromClostridium symbiosum. Here, the crystal structure of a chimaeric clostridial/Escherichia colienzyme has been determined in the apo state. The enzyme is fully functional and reveals possible determinants of interdomain flexibility at a hinge region following the pivot helix. The enzyme retains the preference for NADP +cofactor from the parentE. colidomain II, although there are subtle differences in catalytic activity.« less

  16. BACTERIAL MORTALITY DUE TO SOLAR RADIATION, COMPARING EXPERIMENTAL AND STATISTICAL EVIDENCE

    EPA Science Inventory

    Many researchers report that sunlight is a primary stressor of beach indicator bacteria. Some water quality models include code that quantifies the effect of radiation on bacterial decay. For example, the EPA Visual Plumes model includes two coliform and one enterococcus submodel...

  17. Laying date, incubation and egg breakage as determinants of bacterial load on bird eggshells: experimental evidence.

    PubMed

    Soler, Juan José; Ruiz-Rodríguez, Magdalena; Martín-Vivaldi, Manuel; Peralta-Sánchez, Juan Manuel; Ruiz-Castellano, Cristina; Tomás, Gustavo

    2015-09-01

    Exploring factors guiding interactions of bacterial communities with animals has become of primary importance for ecologists and evolutionary biologists during the last years because of their likely central role in the evolution of animal life history traits. We explored the association between laying date and eggshell bacterial load (mesophilic bacteria, Enterobacteriaceae, Staphylococci, and Enterococci) in natural and artificial magpie (Pica pica) nests containing fresh commercial quail (Coturnix coturnix) eggs. We manipulated hygiene conditions by spilling egg contents on magpie and artificial nests and explored experimental effects during the breeding season. Egg breakage is a common outcome of brood parasitism by great spotted cuckoos (Clamator glandarius) on the nests of magpie, one of its main hosts. We found that the treatment increased eggshell bacterial load in artificial nests, but not in magpie nests with incubating females, which suggests that parental activity prevents the proliferation of bacteria on the eggshells in relation to egg breakage. Moreover, laying date was positively related to eggshell bacterial load in active magpie nests, but negatively in artificial nests. The results suggest that variation in parental characteristics of magpies rather than climatic variation during the breeding season explained the detected positive association. Because the eggshell bacterial load is a proxy of hatching success, the detected positive association between eggshell bacterial loads and laying date in natural, but not in artificial nests, suggests that the generalized negative association between laying date and avian breeding success can be, at least partially, explained by differential bacterial effects.

  18. Unfolding of a temperature-sensitive domain controls voltage-gated channel activation

    PubMed Central

    Arrigoni, Cristina; Rohaim, Ahmed; Shaya, David; Findeisen, Felix; Stein, Richard A.; Nurva, Shailika Reddy; Mishra, Smriti; Mchaourab, Hassane S.; Minor, Daniel L.

    2016-01-01

    Voltage-gated ion channels (VGICs) are outfitted with diverse cytoplasmic domains that impact function. To examine how such elements may affect VGIC behavior, we addressed how the bacterial voltage-gated sodium channel (BacNaV) C-terminal cytoplasmic domain (CTD) affects function. Our studies show that the BacNaV CTD exerts a profound influence on gating through a temperature-dependent unfolding transition in a discrete cytoplasmic domain, the neck domain, proximal to the pore. Structural and functional studies establish that the BacNaV CTD comprises a bi-partite four-helix bundle that bears an unusual hydrophilic core whose integrity is central to the unfolding mechanism and that couples directly to the channel activation gate. Together, our findings define a general principle for how the widespread four-helix bundle cytoplasmic domain architecture can control VGIC responses, uncover a mechanism underlying the diverse BacNaV voltage dependencies, and demonstrate that a discrete domain can encode the temperature dependent response of a channel. PMID:26919429

  19. No. 211-Screening and Management of Bacterial Vaginosis in Pregnancy.

    PubMed

    Yudin, Mark H; Money, Deborah M

    2017-08-01

    To review the evidence and provide recommendations on screening for and management of bacterial vaginosis in pregnancy. The clinical practice options considered in formulating the guideline. Outcomes evaluated include antibiotic treatment efficacy and cure rates, and the influence of the treatment of bacterial vaginosis on the rates of adverse pregnancy outcomes such as preterm labour and delivery and preterm premature rupture of membranes. Medline, EMBASE, CINAHL, and Cochrane databases were searched for articles, published in English before the end of June 2007 on the topic of bacterial vaginosis in pregnancy. The evidence obtained was rated using the criteria developed by the Canadian Task Force on Preventive Health Care. Guideline implementation will assist the practitioner in developing an approach to the diagnosis and treatment of bacterial vaginosis in pregnant women. Patients will benefit from appropriate management of this condition. These guidelines have been prepared by the Infectious Diseases Committee of the SOGC, and approved by the Executive and Council of the SOGC. The Society of Obstetricians and Gynaecologists of Canada. There is currently no consensus as to whether to screen for or treat bacterial vaginosis in the general pregnant population in order to prevent adverse outcomes, such as preterm birth. Copyright © 2017. Published by Elsevier Inc.

  20. Cellulase Linkers Are Optimized Based on Domain Type and Function: Insights from Sequence Analysis, Biophysical Measurements, and Molecular Simulation

    PubMed Central

    Sammond, Deanne W.; Payne, Christina M.; Brunecky, Roman; Himmel, Michael E.; Crowley, Michael F.; Beckham, Gregg T.

    2012-01-01

    Cellulase enzymes deconstruct cellulose to glucose, and are often comprised of glycosylated linkers connecting glycoside hydrolases (GHs) to carbohydrate-binding modules (CBMs). Although linker modifications can alter cellulase activity, the functional role of linkers beyond domain connectivity remains unknown. Here we investigate cellulase linkers connecting GH Family 6 or 7 catalytic domains to Family 1 or 2 CBMs, from both bacterial and eukaryotic cellulases to identify conserved characteristics potentially related to function. Sequence analysis suggests that the linker lengths between structured domains are optimized based on the GH domain and CBM type, such that linker length may be important for activity. Longer linkers are observed in eukaryotic GH Family 6 cellulases compared to GH Family 7 cellulases. Bacterial GH Family 6 cellulases are found with structured domains in either N to C terminal order, and similar linker lengths suggest there is no effect of domain order on length. O-glycosylation is uniformly distributed across linkers, suggesting that glycans are required along entire linker lengths for proteolysis protection and, as suggested by simulation, for extension. Sequence comparisons show that proline content for bacterial linkers is more than double that observed in eukaryotic linkers, but with fewer putative O-glycan sites, suggesting alternative methods for extension. Conversely, near linker termini where linkers connect to structured domains, O-glycosylation sites are observed less frequently, whereas glycines are more prevalent, suggesting the need for flexibility to achieve proper domain orientations. Putative N-glycosylation sites are quite rare in cellulase linkers, while an N-P motif, which strongly disfavors the attachment of N-glycans, is commonly observed. These results suggest that linkers exhibit features that are likely tailored for optimal function, despite possessing low sequence identity. This study suggests that cellulase

  1. The BID Domain of Type IV Secretion Substrates Forms a Conserved Four-Helix Bundle Topped with a Hook.

    PubMed

    Stanger, Frédéric V; de Beer, Tjaart A P; Dranow, David M; Schirmer, Tilman; Phan, Isabelle; Dehio, Christoph

    2017-01-03

    The BID (Bep intracellular delivery) domain functions as secretion signal in a subfamily of protein substrates of bacterial type IV secretion (T4S) systems. It mediates transfer of (1) relaxases and the attached DNA during bacterial conjugation, and (2) numerous Bartonella effector proteins (Beps) during protein transfer into host cells infected by pathogenic Bartonella species. Furthermore, BID domains of Beps have often evolved secondary effector functions within host cells. Here, we provide crystal structures for three representative BID domains and describe a novel conserved fold characterized by a compact, antiparallel four-helix bundle topped with a hook. The conserved hydrophobic core provides a rigid scaffold to a surface that, despite a few conserved exposed residues and similarities in charge distribution, displays significant variability. We propose that the genuine function of BID domains as T4S signal may primarily depend on their rigid structure, while the plasticity of their surface may facilitate adaptation to secondary effector functions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Structure-based receptor MIMICS targeted against bacterial superantigen toxins

    DOEpatents

    Gupta, Goutam [Santa Fe, NM; Hong-Geller, Elizabeth [Los Alamos, NM; Shiflett, Patrick R [Los Alamos, NM; Lehnert, Nancy M [Albuquerque, NM

    2009-08-18

    The invention provides therapeutic compositions useful in the treatment of bacterial superantigen mediated conditions, such as Toxic Shock Syndrome. The compositions comprise genetically engineered bifunctional polypeptides containing a specific T-cell receptor binding domain and a specific MHC class II receptor binding domain, each targeting non-overlapping epitopes on a superantigen molecule against which they are designed. The anti-superantigen "receptor mimetics" or "chimeras" are rationally designed to recreate the modality of superantigen binding directly to both the TCR and the MHC-II receptor, and are capable of acting as decoys for superantigen binding, effectively out-competing the host T-cell and MHC-II receptors, the natural host receptors.

  3. Evidence of reduced recombination rate in human regulatory domains.

    PubMed

    Liu, Yaping; Sarkar, Abhishek; Kheradpour, Pouya; Ernst, Jason; Kellis, Manolis

    2017-10-20

    Recombination rate is non-uniformly distributed across the human genome. The variation of recombination rate at both fine and large scales cannot be fully explained by DNA sequences alone. Epigenetic factors, particularly DNA methylation, have recently been proposed to influence the variation in recombination rate. We study the relationship between recombination rate and gene regulatory domains, defined by a gene and its linked control elements. We define these links using expression quantitative trait loci (eQTLs), methylation quantitative trait loci (meQTLs), chromatin conformation from publicly available datasets (Hi-C and ChIA-PET), and correlated activity links that we infer across cell types. Each link type shows a "recombination rate valley" of significantly reduced recombination rate compared to matched control regions. This recombination rate valley is most pronounced for gene regulatory domains of early embryonic development genes, housekeeping genes, and constitutive regulatory elements, which are known to show increased evolutionary constraint across species. Recombination rate valleys show increased DNA methylation, reduced doublestranded break initiation, and increased repair efficiency, specifically in the lineage leading to the germ line. Moreover, by using only the overlap of functional links and DNA methylation in germ cells, we are able to predict the recombination rate with high accuracy. Our results suggest the existence of a recombination rate valley at regulatory domains and provide a potential molecular mechanism to interpret the interplay between genetic and epigenetic variations.

  4. Osmotic therapies added to antibiotics for acute bacterial meningitis

    PubMed Central

    Wall, Emma Cb; Ajdukiewicz, Katherine Mb; Bergman, Hanna; Heyderman, Robert S; Garner, Paul

    2018-01-01

    Background Every day children and adults die from acute community-acquired bacterial meningitis, particularly in low-income countries, and survivors risk deafness, epilepsy and neurological disabilities. Osmotic therapies may attract extra-vascular fluid and reduce cerebral oedema, and thus reduce death and improve neurological outcomes. This is an update of a Cochrane Review first published in 2013. Objectives To evaluate the effects of osmotic therapies added to antibiotics for acute bacterial meningitis in children and adults on mortality, deafness and neurological disability. Search methods We searched CENTRAL (2017, Issue 1), MEDLINE (1950 to 17 February 2017), Embase (1974 to 17 February 2017), CINAHL (1981 to 17 February 2017), LILACS (1982 to 17 February 2017) and registers of ongoing clinical trials (ClinicalTrials.com, WHO ICTRP) (21 February 2017). We also searched conference abstracts and contacted researchers in the field (up to 12 December 2015). Selection criteria Randomised controlled trials testing any osmotic therapy in adults or children with acute bacterial meningitis. Data collection and analysis Two review authors independently screened the search results and selected trials for inclusion. Results are presented using risk ratios (RR) and 95% confidence intervals (CI) and grouped according to whether the participants received steroids or not. We used the GRADE approach to assess the certainty of the evidence. Main results We included five trials with 1451 participants. Four trials evaluated glycerol against placebo, and one evaluated glycerol against 50% dextrose; in addition three trials evaluated dexamethasone and one trial evaluated acetaminophen (paracetamol) in a factorial design. Stratified analysis shows no effect modification with steroids; we present aggregate effect estimates. Compared to placebo, glycerol probably has little or no effect on death in people with bacterial meningitis (RR 1.08, 95% CI 0.90 to 1.30; 5 studies, 1272

  5. Bacterial Polysaccharide Co-Polymerases Share a Common Framework for Control of Polymer Length

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tocilj,A.; Munger, C.; Proteau, A.

    2008-01-01

    The chain length distribution of complex polysaccharides present on the bacterial surface is determined by polysaccharide co-polymerases (PCPs) anchored in the inner membrane. We report crystal structures of the periplasmic domains of three PCPs that impart substantially different chain length distributions to surface polysaccharides. Despite very low sequence similarities, they have a common protomer structure with a long central alpha-helix extending 100 Angstroms into the periplasm. The protomers self-assemble into bell-shaped oligomers of variable sizes, with a large internal cavity. Electron microscopy shows that one of the full-length PCPs has a similar organization as that observed in the crystal formore » its periplasmic domain alone. Functional studies suggest that the top of the PCP oligomers is an important region for determining polysaccharide modal length. These structures provide a detailed view of components of the bacterial polysaccharide assembly machinery.« less

  6. Mechanism of the CO-sensing heme protein CooA: new insights from the truncated heme domain and UVRR spectroscopy

    PubMed Central

    Ibrahim, Mohammed; Kuchinskas, Michael; Youn, Hwan; Kerby, Robert L.; Roberts, Gary P.; Poulos, Thomas L.; Spiro, Thomas G.

    2007-01-01

    The bacterial CO-sensing heme protein CooA activates expression of genes whose products perform CO-metabolism by binding its target DNA in response to CO binding. The required conformational change has been proposed to result from CO-induced displacement of the heme and of the adjacent C-helix, which connects the sensory and DNA-binding domains. Support for this proposal comes from UV Resonance Raman (UVRR) spectroscopy, which reveals a more hydrophobic environment for the C-helix residue Trp110 when CO binds. In addition, we find a tyrosine UVRR response, which is attributable to weakening of a Tyr55-Glu83 H-bond that anchors the proximal side of the heme. Both Trp and Tyr responses are augmented in the heme domain when the DNA-binding domain has been removed, apparently reflecting loss of the inter-domain restraint. This augmentation is abolished by a Glu83Gln substitution, which weakens the anchoring H-bond. The CO recombination rate following photolysis of the CO adduct is similar for truncated and full-length protein, though truncation does increase the rate of CO association in the absence of photolysis; together these data indicate that truncation causes a faster dissociation of the endogenous Pro2 ligand. These findings are discussed in the light of structural evidence that the N-terminal tail, once released from the heme, selects the proper orientation of the DNA-binding domain, via docking interactions. PMID:17720248

  7. BACTERIAL GROWTH AND MULTIPLICATION AS DISCLOSED BY MICRO MOTION PICTURES

    PubMed Central

    Wyckoff, Ralph W. G.

    1934-01-01

    Using a micro motion picture technique for making records, studies covering several thousand hours of observation have been made of the growth of a number of bacteria. On the basis of these experiments a discussion is offered of bacterial division and its influence on gross colony appearance, of different kinds of pleomorphism that have been observed, and of the nature of the internal structure that is seen in some bacteria. Several of the microorganisms chosen for examination are ones that have been thought to give evidence of life cycle phenomena. The present pictures, however, contain no evidence of a bacterial cycle in the commonly accepted meaning of the term. PMID:19870252

  8. Characterization of Runella slithyformis HD-Pnk, a bifunctional DNA/RNA end-healing enzyme composed of an N-terminal 2',3' -phosphoesterase HD domain and a C-terminal 5' -OH polynucleotide kinase domain.

    PubMed

    Munir, Annum; Shuman, Stewart

    2016-11-28

    5' and 3' end healing are key steps in nucleic acid break repair in which 5' -OH ends are phosphorylated by a polynucleotide kinase and 3' -PO 4 or 2',3' -cyclic-PO 4 ends are hydrolyzed by a phosphoesterase to generate the 5' -PO 4 and 3' -OH termini required for sealing by classic polynucleotide ligases. End healing and sealing enzymes are present in diverse bacterial taxa, often organized as modular units within a single multifunctional polypeptide or as subunits of a repair complex. Here we identify and characterize Runella slithyformis HD-Pnk as a novel bifunctional end-healing enzyme composed of an N-terminal 2',3' -phosphoesterase HD domain and a C-terminal 5' -OH polynucleotide kinase P-loop domain. HD-Pnk phosphorylates 5' -OH polynucleotides (9-mers or longer) in the presence of magnesium and any NTP donor. HD-Pnk dephosphorylates RNA 2',3' -cyclic phosphate, RNA 3' -phosphate, RNA 2' -phosphate, and DNA 3' -phosphate ends in the presence of a transition metal cofactor, which can be nickel, copper or cobalt. HD-Pnkp homologs are present in genera from eleven bacterial phyla and are often encoded in an operon with a putative ATP-dependent polynucleotide ligase. The present study provides insights to the diversity of nucleic acid repair strategies via the characterization of Runella slithyformis HD-Pnkp as the exemplar of a novel clade of dual 5' and 3' end-healing enzymes that phosphorylate 5' -OH termini and dephosphorylate 2',3' -cyclic-PO 4 , 3' -PO 4 , and 2' -PO 4 ends. The distinctive feature of HD-Pnk is its domain composition: a fusion of an N-terminal HD phosphohydrolase module to a C-terminal P-loop polynucleotide kinase module. Homologs of Runella HD-Pnk with the same domain composition, domain order, and similar polypeptide size are distributed widely among genera from eleven bacterial phyla. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  9. Monomer/Dimer Transition of the Caspase-Recruitment Domain of Human Nod1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Srimathi,T.; Robbins, S.; Dubas, R.

    2008-01-01

    Nod1 is an essential cytoplasmic sensor for bacterial peptidoglycans in the innate immune system. The caspase-recruitment domain of Nod1 (Nod1{_}CARD) is indispensable for recruiting a downstream kinase, receptor-interacting protein 2 (RIP2), that activates nuclear factor-?B (NF-?B). The crystal structure of human Nod1{_}CARD at 1.9 Angstroms resolution reveals a novel homodimeric conformation. Our structural and biochemical analysis shows that the homodimerization of Nod1{_}CARD is achieved by swapping the H6 helices at the carboxy termini and stabilized by forming an interchain disulfide bond between the Cys39 residues of the two monomers in solution and in the crystal. In addition, we present experimentalmore » evidence for a pH-sensitive conformational change of Nod1{_}CARD. Our results suggest that the pH-sensitive monomer/dimer transition is a unique molecular property of Nod1{_}CARD.« less

  10. Structure, functional characterization, and evolution of the dihydroorotase domain of human CAD.

    PubMed

    Grande-García, Araceli; Lallous, Nada; Díaz-Tejada, Celsa; Ramón-Maiques, Santiago

    2014-02-04

    Upregulation of CAD, the multifunctional protein that initiates and controls the de novo biosynthesis of pyrimidines in animals, is essential for cell proliferation. Deciphering the architecture and functioning of CAD is of interest for its potential usage as an antitumoral target. However, there is no detailed structural information about CAD other than that it self-assembles into hexamers of ∼1.5 MDa. Here we report the crystal structure and functional characterization of the dihydroorotase domain of human CAD. Contradicting all assumptions, the structure reveals an active site enclosed by a flexible loop with two Zn²⁺ ions bridged by a carboxylated lysine and a third Zn coordinating a rare histidinate ion. Site-directed mutagenesis and functional assays prove the involvement of the Zn and flexible loop in catalysis. Comparison with homologous bacterial enzymes supports a reclassification of the DHOase family and provides strong evidence against current models of the architecture of CAD. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Bacterial expression of human kynurenine 3-monooxygenase: Solubility, activity, purification☆

    PubMed Central

    Wilson, K.; Mole, D.J.; Binnie, M.; Homer, N.Z.M.; Zheng, X.; Yard, B.A.; Iredale, J.P.; Auer, M.; Webster, S.P.

    2014-01-01

    Kynurenine 3-monooxygenase (KMO) is an enzyme central to the kynurenine pathway of tryptophan metabolism. KMO has been implicated as a therapeutic target in several disease states, including Huntington’s disease. Recombinant human KMO protein production is challenging due to the presence of transmembrane domains, which localise KMO to the outer mitochondrial membrane and render KMO insoluble in many in vitro expression systems. Efficient bacterial expression of human KMO would accelerate drug development of KMO inhibitors but until now this has not been achieved. Here we report the first successful bacterial (Escherichia coli) expression of active FLAG™-tagged human KMO enzyme expressed in the soluble fraction and progress towards its purification. PMID:24316190

  12. Bacterial recombination promotes the evolution of multi-drug-resistance in functionally diverse populations

    PubMed Central

    Perron, Gabriel G.; Lee, Alexander E. G.; Wang, Yun; Huang, Wei E.; Barraclough, Timothy G.

    2012-01-01

    Bacterial recombination is believed to be a major factor explaining the prevalence of multi-drug-resistance (MDR) among pathogenic bacteria. Despite extensive evidence for exchange of resistance genes from retrospective sequence analyses, experimental evidence for the evolutionary benefits of bacterial recombination is scarce. We compared the evolution of MDR between populations of Acinetobacter baylyi in which we manipulated both the recombination rate and the initial diversity of strains with resistance to single drugs. In populations lacking recombination, the initial presence of multiple strains resistant to different antibiotics inhibits the evolution of MDR. However, in populations with recombination, the inhibitory effect of standing diversity is alleviated and MDR evolves rapidly. Moreover, only the presence of DNA harbouring resistance genes promotes the evolution of resistance, ruling out other proposed benefits for recombination. Together, these results provide direct evidence for the fitness benefits of bacterial recombination and show that this occurs by mitigation of functional interference between genotypes resistant to single antibiotics. Although analogous to previously described mechanisms of clonal interference among alternative beneficial mutations, our results actually highlight a different mechanism by which interactions among co-occurring strains determine the benefits of recombination for bacterial evolution. PMID:22048956

  13. Pathogen espionage: multiple bacterial adrenergic sensors eavesdrop on host communication systems.

    PubMed

    Karavolos, Michail H; Winzer, Klaus; Williams, Paul; Khan, C M Anjam

    2013-02-01

    The interactions between bacterial pathogens and their eukaryotic hosts are vital in determining the outcome of infections. Bacterial pathogens employ molecular sensors to detect and facilitate adaptation to changes in their niche. The sensing of these extracellular signals enables the pathogen to navigate within mammalian hosts. Intercellular bacterial communication is facilitated by the production and sensing of autoinducer (AI) molecules via quorum sensing. More recently, AI-3 and the host neuroendocrine (NE) hormones adrenaline and noradrenaline were reported to display cross-talk for the activation of the same signalling pathways. Remarkably, there is increasing evidence to suggest that enteric bacteria sense and respond to the host NE stress hormones adrenaline and noradrenaline to modulate virulence. These responses can be inhibited by α and β-adrenergic receptor antagonists implying a bacterial receptor-based sensing and signalling cascade. In Escherichia coli O157:H7 and Salmonella, QseC has been proposed as the adrenergic receptor. Strikingly, there is an increasing body of evidence that not all the bacterial adrenergic responses require signalling through QseC. Here we provide additional hypotheses to reconcile these observations implicating the existence of alternative adrenergic receptors including BasS, QseE and CpxA and their associated signalling cascades with major roles in interkingdom communication. © 2012 Blackwell Publishing Ltd.

  14. Neglected Bacterial Zoonoses

    PubMed Central

    Chikeka, Ijeuru; Dumler, J. Stephen

    2015-01-01

    Bacterial zoonoses comprise a group of diseases in humans or animals acquired by direct contact with or by oral consumption of contaminated animal materials, or via arthropod vectors. Among neglected infections, bacterial zoonoses are among the most neglected given emerging data on incidence and prevalence as causes of acute febrile illness, even in areas where recognized neglected tropical diseases occur frequently. While many other bacterial infections could also be considered in this neglected category, five distinct infections stand out because they are globally distributed, are acute febrile diseases, have high rates of morbidity and case fatality, and are reported as commonly as malaria, typhoid or dengue virus infections in carefully designed studies in which a broad spectrum diagnoses are actively sought. Thus, this review will focus attention on leptospirosis, relapsing fever borreliosis, and rickettsioses, including scrub typhus, murine typhus and spotted fever group rickettsiosis. Of greatest interest is the lack of distinguishing clinical features among these infections when in humans, which confounds diagnosis where laboratory confirmation is lacking, and in regions where clinical diagnosis is often attributed to one of several perceived more common threats. As diseases such as malaria come under improved control, the real impact of these common and under-recognized infections will become evident, as will the requirement for the strategies and allocation of resources for their control. PMID:25964152

  15. Bacterial sex in dental plaque.

    PubMed

    Olsen, Ingar; Tribble, Gena D; Fiehn, Nils-Erik; Wang, Bing-Yan

    2013-01-01

    Genes are transferred between bacteria in dental plaque by transduction, conjugation, and transformation. Membrane vesicles can also provide a mechanism for horizontal gene transfer. DNA transfer is considered bacterial sex, but the transfer is not parallel to processes that we associate with sex in higher organisms. Several examples of bacterial gene transfer in the oral cavity are given in this review. How frequently this occurs in dental plaque is not clear, but evidence suggests that it affects a number of the major genera present. It has been estimated that new sequences in genomes established through horizontal gene transfer can constitute up to 30% of bacterial genomes. Gene transfer can be both inter- and intrageneric, and it can also affect transient organisms. The transferred DNA can be integrated or recombined in the recipient's chromosome or remain as an extrachromosomal inheritable element. This can make dental plaque a reservoir for antimicrobial resistance genes. The ability to transfer DNA is important for bacteria, making them better adapted to the harsh environment of the human mouth, and promoting their survival, virulence, and pathogenicity.

  16. Unfolding of a Temperature-Sensitive Domain Controls Voltage-Gated Channel Activation.

    PubMed

    Arrigoni, Cristina; Rohaim, Ahmed; Shaya, David; Findeisen, Felix; Stein, Richard A; Nurva, Shailika Reddy; Mishra, Smriti; Mchaourab, Hassane S; Minor, Daniel L

    2016-02-25

    Voltage-gated ion channels (VGICs) are outfitted with diverse cytoplasmic domains that impact function. To examine how such elements may affect VGIC behavior, we addressed how the bacterial voltage-gated sodium channel (BacNa(V)) C-terminal cytoplasmic domain (CTD) affects function. Our studies show that the BacNa(V) CTD exerts a profound influence on gating through a temperature-dependent unfolding transition in a discrete cytoplasmic domain, the neck domain, proximal to the pore. Structural and functional studies establish that the BacNa(V) CTD comprises a bi-partite four-helix bundle that bears an unusual hydrophilic core whose integrity is central to the unfolding mechanism and that couples directly to the channel activation gate. Together, our findings define a general principle for how the widespread four-helix bundle cytoplasmic domain architecture can control VGIC responses, uncover a mechanism underlying the diverse BacNa(V) voltage dependencies, and demonstrate that a discrete domain can encode the temperature-dependent response of a channel. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Bacterial Biofilms in Jones Tubes.

    PubMed

    Ahn, Eric S; Hauck, Matthew J; Kirk Harris, Jonathan; Robertson, Charles E; Dailey, Roger A

    To investigate the presence and microbiology of bacterial biofilms on Jones tubes (JTs) by direct visualization with scanning electron microscopy and polymerase chain reaction (PCR) of representative JTs, and to correlate these findings with inflammation and/or infection related to the JT. In this study, prospective case series were performed. JTs were recovered from consecutive patients presenting to clinic for routine cleaning or recurrent irritation/infection. Four tubes were processed for scanning electron microscopy alone to visualize evidence of biofilms. Two tubes underwent PCR alone for bacterial quantification. One tube was divided in half and sent for scanning electron microscopy and PCR. Symptoms related to the JTs were recorded at the time of recovery. Seven tubes were obtained. Five underwent SEM, and 3 out of 5 showed evidence of biofilms (60%). Two of the 3 biofilms demonstrated cocci and the third revealed rods. Three tubes underwent PCR. The predominant bacteria identified were Pseudomonadales (39%), Pseudomonas (16%), and Staphylococcus (14%). Three of the 7 patients (43%) reported irritation and discharge at presentation. Two symptomatic patients, whose tubes were imaged only, revealed biofilms. The third symptomatic patient's tube underwent PCR only, showing predominantly Staphylococcus (56%) and Haemophilus (36%) species. Two of the 4 asymptomatic patients also showed biofilms. All symptomatic patients improved rapidly after tube exchange and steroid antibiotic drops. Bacterial biofilms were variably present on JTs, and did not always correlate with patients' symptoms. Nevertheless, routine JT cleaning is recommended to treat and possibly prevent inflammation caused by biofilms.

  18. Chronic bacterial prostatitis and chronic pelvic pain syndrome.

    PubMed

    Bowen, Diana K; Dielubanza, Elodi; Schaeffer, Anthony J

    2015-08-27

    Chronic prostatitis can cause pain and urinary symptoms, and can occur either with an active infection (chronic bacterial prostatitis [CBP]) or with only pain and no evidence of bacterial causation (chronic pelvic pain syndrome [CPPS]). Bacterial prostatitis is characterised by recurrent urinary tract infections or infection in the prostate with the same bacterial strain, which often results from urinary tract instrumentation. However, the cause and natural history of CPPS are unknown and not associated with active infection. We conducted a systematic overview and aimed to answer the following clinical questions: What are the effects of treatments for chronic bacterial prostatitis? What are the effects of treatments for chronic pelvic pain syndrome? We searched: Medline, Embase, The Cochrane Library, and other important databases up to February 2014 (Clinical Evidence overviews are updated periodically; please check our website for the most up-to-date version of this overview). At this update, searching of electronic databases retrieved 131 studies. After deduplication and removal of conference abstracts, 67 records were screened for inclusion in the overview. Appraisal of titles and abstracts led to the exclusion of 51 studies and the further review of 16 full publications. Of the 16 full articles evaluated, three systematic reviews and one RCT were included at this update. We performed a GRADE evaluation for 14 PICO combinations. In this systematic overview, we categorised the efficacy for 12 interventions based on information relating to the effectiveness and safety of 5 alpha-reductase inhibitors, allopurinol, alpha-blockers, local injections of antimicrobial drugs, mepartricin, non-steroidal anti-inflammatory drugs (NSAIDs), oral antimicrobial drugs, pentosan polysulfate, quercetin, sitz baths, transurethral microwave thermotherapy (TUMT), and transurethral resection of the prostate (TURP).

  19. Cholesterol segregates into submicrometric domains at the living erythrocyte membrane: evidence and regulation.

    PubMed

    Carquin, Mélanie; Conrard, Louise; Pollet, Hélène; Van Der Smissen, Patrick; Cominelli, Antoine; Veiga-da-Cunha, Maria; Courtoy, Pierre J; Tyteca, Donatienne

    2015-12-01

    Although cholesterol is essential for membrane fluidity and deformability, the level of its lateral heterogeneity at the plasma membrane of living cells is poorly understood due to lack of appropriate probe. We here report on the usefulness of the D4 fragment of Clostridium perfringens toxin fused to mCherry (theta*), as specific, non-toxic, sensitive and quantitative cholesterol-labeling tool, using erythrocyte flat membrane. By confocal microscopy, theta* labels cholesterol-enriched submicrometric domains in coverslip-spread but also gel-suspended (non-stretched) fresh erythrocytes, suggesting in vivo relevance. Cholesterol domains on spread erythrocytes are stable in time and space, restricted by membrane:spectrin anchorage via 4.1R complexes, and depend on temperature and sphingomyelin, indicating combined regulation by extrinsic membrane:cytoskeleton interaction and by intrinsic lipid packing. Cholesterol domains partially co-localize with BODIPY-sphingomyelin-enriched domains. In conclusion, we show that theta* is a useful vital probe to study cholesterol organization and demonstrate that cholesterol forms submicrometric domains in living cells.

  20. Colourful parrot feathers resist bacterial degradation

    PubMed Central

    Burtt, Edward H.; Schroeder, Max R.; Smith, Lauren A.; Sroka, Jenna E.; McGraw, Kevin J.

    2011-01-01

    The brilliant red, orange and yellow colours of parrot feathers are the product of psittacofulvins, which are synthetic pigments known only from parrots. Recent evidence suggests that some pigments in bird feathers function not just as colour generators, but also preserve plumage integrity by increasing the resistance of feather keratin to bacterial degradation. We exposed a variety of colourful parrot feathers to feather-degrading Bacillus licheniformis and found that feathers with red psittacofulvins degraded at about the same rate as those with melanin and more slowly than white feathers, which lack pigments. Blue feathers, in which colour is based on the microstructural arrangement of keratin, air and melanin granules, and green feathers, which combine structural blue with yellow psittacofulvins, degraded at a rate similar to that of red and black feathers. These differences in resistance to bacterial degradation of differently coloured feathers suggest that colour patterns within the Psittaciformes may have evolved to resist bacterial degradation, in addition to their role in communication and camouflage. PMID:20926430

  1. Lubricin: A novel means to decrease bacterial adhesion and proliferation

    PubMed Central

    Aninwene, George E.; Abadian, Pegah N.; Ravi, Vishnu; Taylor, Erik N.; Hall, Douglas M.; Mei, Amy; Jay, Gregory D.; Goluch, Edgar D.; Webster, Thomas J.

    2015-01-01

    This study investigated the ability of lubricin (LUB) to prevent bacterial attachment and proliferation on model tissue culture polystyrene surfaces. The findings from this study indicated that LUB was able to reduce the attachment and growth of Staphylococcus aureus on tissue culture polystyrene over the course of 24 h by approximately 13.9% compared to a phosphate buffered saline (PBS)-soaked control. LUB also increased S. aureus lag time (the period of time between the introduction of bacteria to a new environment and their exponential growth) by approximately 27% compared to a PBS-soaked control. This study also indicated that vitronectin (VTN), a protein homologous to LUB, reduced bacterial S. aureus adhesion and growth on tissue culture polystyrene by approximately 11% compared to a PBS-soaked control. VTN also increased the lag time of S. aureus by approximately 43%, compared to a PBS-soaked control. Bovine submaxillary mucin was studied because there are similarities between it and the center mucin-like domain of LUB. Results showed that the reduction of S. aureus and Staphylococcus epidermidis proliferation on mucin coated surfaces was not as substantial as that seen with LUB. In summary, this study provided the first evidence that LUB reduced the initial adhesion and growth of both S. aureus and S. epidermidis on a model surface to suppress biofilm formation. These reductions in initial bacteria adhesion and proliferation can be beneficial for medical implants and, although requiring more study, can lead to drastically improved patient outcomes. PMID:24737699

  2. Molecular Characterization of Epiphytic Bacterial Communities on Charophycean Green Algae

    PubMed Central

    Fisher, Madeline M.; Wilcox, Lee W.; Graham, Linda E.

    1998-01-01

    Epiphytic bacterial communities within the sheath material of three filamentous green algae, Desmidium grevillii, Hyalotheca dissiliens, and Spondylosium pulchrum (class Charophyceae, order Zygnematales), collected from a Sphagnum bog were characterized by PCR amplification, cloning, and sequencing of 16S ribosomal DNA. A total of 20 partial sequences and nine different sequence types were obtained, and one sequence type was recovered from the bacterial communities on all three algae. By phylogenetic analysis, the cloned sequences were placed into several major lineages of the Bacteria domain: the Flexibacter/Cytophaga/Bacteroides phylum and the α, β, and γ subdivisions of the phylum Proteobacteria. Analysis at the subphylum level revealed that the majority of our sequences were not closely affiliated with those of known, cultured taxa, although the estimated evolutionary distances between our sequences and their nearest neighbors were always less than 0.1 (i.e., greater than 90% similar). This result suggests that the majority of sequences obtained in this study represent as yet phenotypically undescribed bacterial species and that the range of bacterial-algal interactions that occur in nature has not yet been fully described. PMID:9797295

  3. Reductive evolution and the loss of PDC/PAS domains from the genus Staphylococcus

    PubMed Central

    2013-01-01

    Background The Per-Arnt-Sim (PAS) domain represents a ubiquitous structural fold that is involved in bacterial sensing and adaptation systems, including several virulence related functions. Although PAS domains and the subclass of PhoQ-DcuS-CitA (PDC) domains have a common structure, there is limited amino acid sequence similarity. To gain greater insight into the evolution of PDC/PAS domains present in the bacterial kingdom and staphylococci in specific, the PDC/PAS domains from the genomic sequences of 48 bacteria, representing 5 phyla, were identified using the sensitive search method based on HMM-to-HMM comparisons (HHblits). Results A total of 1,007 PAS domains and 686 PDC domains distributed over 1,174 proteins were identified. For 28 Gram-positive bacteria, the distribution, organization, and molecular evolution of PDC/PAS domains were analyzed in greater detail, with a special emphasis on the genus Staphylococcus. Compared to other bacteria the staphylococci have relatively fewer proteins (6–9) containing PDC/PAS domains. As a general rule, the staphylococcal genomes examined in this study contain a core group of seven PDC/PAS domain-containing proteins consisting of WalK, SrrB, PhoR, ArlS, HssS, NreB, and GdpP. The exceptions to this rule are: 1) S. saprophyticus lacks the core NreB protein; 2) S. carnosus has two additional PAS domain containing proteins; 3) S. epidermidis, S. aureus, and S. pseudintermedius have an additional protein with two PDC domains that is predicted to code for a sensor histidine kinase; 4) S. lugdunensis has an additional PDC containing protein predicted to be a sensor histidine kinase. Conclusions This comprehensive analysis demonstrates that variation in PDC/PAS domains among bacteria has limited correlations to the genome size or pathogenicity; however, our analysis established that bacteria having a motile phase in their life cycle have significantly more PDC/PAS-containing proteins. In addition, our analysis revealed a

  4. Reductive evolution and the loss of PDC/PAS domains from the genus Staphylococcus.

    PubMed

    Shah, Neethu; Gaupp, Rosmarie; Moriyama, Hideaki; Eskridge, Kent M; Moriyama, Etsuko N; Somerville, Greg A

    2013-07-31

    The Per-Arnt-Sim (PAS) domain represents a ubiquitous structural fold that is involved in bacterial sensing and adaptation systems, including several virulence related functions. Although PAS domains and the subclass of PhoQ-DcuS-CitA (PDC) domains have a common structure, there is limited amino acid sequence similarity. To gain greater insight into the evolution of PDC/PAS domains present in the bacterial kingdom and staphylococci in specific, the PDC/PAS domains from the genomic sequences of 48 bacteria, representing 5 phyla, were identified using the sensitive search method based on HMM-to-HMM comparisons (HHblits). A total of 1,007 PAS domains and 686 PDC domains distributed over 1,174 proteins were identified. For 28 Gram-positive bacteria, the distribution, organization, and molecular evolution of PDC/PAS domains were analyzed in greater detail, with a special emphasis on the genus Staphylococcus. Compared to other bacteria the staphylococci have relatively fewer proteins (6-9) containing PDC/PAS domains. As a general rule, the staphylococcal genomes examined in this study contain a core group of seven PDC/PAS domain-containing proteins consisting of WalK, SrrB, PhoR, ArlS, HssS, NreB, and GdpP. The exceptions to this rule are: 1) S. saprophyticus lacks the core NreB protein; 2) S. carnosus has two additional PAS domain containing proteins; 3) S. epidermidis, S. aureus, and S. pseudintermedius have an additional protein with two PDC domains that is predicted to code for a sensor histidine kinase; 4) S. lugdunensis has an additional PDC containing protein predicted to be a sensor histidine kinase. This comprehensive analysis demonstrates that variation in PDC/PAS domains among bacteria has limited correlations to the genome size or pathogenicity; however, our analysis established that bacteria having a motile phase in their life cycle have significantly more PDC/PAS-containing proteins. In addition, our analysis revealed a tremendous amount of variation in the

  5. Evidence that the tandem-pleckstrin-homology-domain-containing protein TAPP1 interacts with Ptd(3,4)P2 and the multi-PDZ-domain-containing protein MUPP1 in vivo.

    PubMed Central

    Kimber, Wendy A; Trinkle-Mulcahy, Laura; Cheung, Peter C F; Deak, Maria; Marsden, Louisa J; Kieloch, Agnieszka; Watt, Stephen; Javier, Ronald T; Gray, Alex; Downes, C Peter; Lucocq, John M; Alessi, Dario R

    2002-01-01

    PtdIns(3,4,5)P3 is an established second messenger of growth-factor and insulin-induced signalling pathways. There is increasing evidence that one of the immediate breakdown products of PtdIns(3,4,5)P3, namely PtdIns(3,4)P2, whose levels are elevated by numerous extracellular agonists, might also function as a signalling molecule. Recently, we identified two related pleckstrin-homology (PH)-domain-containing proteins, termed 'tandem-PH-domain-containing protein-1' (TAPP1) and TAPP2, which interacted in vitro with high affinity with PtdIns(3,4)P2, but did not bind PtdIns(3,4,5)P3 or other phosphoinositides. In the present study we demonstrate that stimulation of Swiss 3T3 or 293 cells with agonists that stimulate PtdIns(3,4)P2 production results in the marked translocation of TAPP1 to the plasma membrane. This recruitment is dependent on a functional PtdIns(3,4)P2-binding PH domain and is inhibited by wortmannin, a phosphoinositide 3-kinase inhibitor that prevents PtdIns(3,4)P2 generation. A search for proteins that interact with TAPP1 identified the multi-PDZ-containing protein termed 'MUPP1', a protein possessing 13 PDZ domains and no other known modular or catalytic domains [PDZ is postsynaptic density protein (PSD-95)/Drosophila disc large tumour suppressor (dlg)/tight junction protein (ZO1)]. We demonstrate that immunoprecipitation of endogenously expressed TAPP1 from 293-cell lysates results in the co-immunoprecipitation of endogenous MUPP1, indicating that these proteins are likely to interact with each other physiologically. We show that TAPP1 and TAPP2 interact with the 10th and 13th PDZ domain of MUPP1 through their C-terminal amino acids. The results of the present study suggest that TAPP1 and TAPP2 could function in cells as adapter proteins to recruit MUPP1, or other proteins that they may interact with, to the plasma membrane in response to signals that elevate PtdIns(3,4)P2. PMID:11802782

  6. Crystal Structure of the Passenger Domain of the Escherichia coli Autotransporter EspP

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khan, Shekeb; Mian, Hira S.; Sandercock, Linda E.

    2013-03-07

    Autotransporters represent a large superfamily of known and putative virulence factors produced by Gram-negative bacteria. They consist of an N-terminal 'passenger domain' responsible for the specific effector functions of the molecule and a C-terminal '{beta}-domain' responsible for translocation of the passenger across the bacterial outer membrane. Here, we present the 2.5-{angstrom} crystal structure of the passenger domain of the extracellular serine protease EspP, produced by the pathogen Escherichia coli O157:H7 and a member of the serine protease autotransporters of Enterobacteriaceae (SPATEs). Like the previously structurally characterized SPATE passenger domains, the EspP passenger domain contains an extended right-handed parallel {beta}-helix precededmore » by an N-terminal globular domain housing the catalytic function of the protease. Of note, however, is the absence of a second globular domain protruding from this {beta}-helix. We describe the structure of the EspP passenger domain in the context of previous results and provide an alternative hypothesis for the function of the {beta}-helix within SPATEs.« less

  7. Study of the bacterial diversity of foods: PCR-DGGE versus LH-PCR.

    PubMed

    Garofalo, Cristiana; Bancalari, Elena; Milanović, Vesna; Cardinali, Federica; Osimani, Andrea; Sardaro, Maria Luisa Savo; Bottari, Benedetta; Bernini, Valentina; Aquilanti, Lucia; Clementi, Francesca; Neviani, Erasmo; Gatti, Monica

    2017-02-02

    The present study compared two culture-independent methods, polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) and length-heterogeneity polymerase chain reaction (LH-PCR), for their ability to reveal food bacterial microbiota. Total microbial DNA and RNA were extracted directly from fourteen fermented and unfermented foods, and domain A of the variable regions V1 and V2 of the 16S rRNA gene was analyzed through LH-PCR and PCR-DGGE. Finally, the outline of these analyses was compared with bacterial viable counts obtained after bacterial growth on suitable selective media. For the majority of the samples, RNA-based PCR-DGGE revealed species that the DNA-based PCR-DGGE was not able to highlight. When analyzing either DNA or RNA, LH-PCR identified several lactic acid bacteria (LAB) and coagulase negative cocci (CCN) species that were not identified by PCR-DGGE. This phenomenon was particularly evident in food samples with viable loads<5.0 Logcfug -1 . Furthermore, LH-PCR was able to detect a higher number of peaks in the analyzed food matrices relative to species identified by PCR-DGGE. In light of these findings, it may be suggested that LH-PCR shows greater sensitivity than PCR-DGGE. However, PCR-DGGE detected some other species (LAB included) that were not detected by LH-PCR. Therefore, certain LH-PCR peaks not attributed to known species within the LH-PCR database could be solved by comparing them with species identified by PCR-DGGE. Overall, this study also showed that LH-PCR is a promising method for use in the food microbiology field, indicating the necessity to expand the LH-PCR database, which is based, up to now, mainly on LAB isolates from dairy products. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. A bacterial toxin-antitoxin module is the origin of inter-bacterial and inter-kingdom effectors of Bartonella

    PubMed Central

    Liesch, Marius

    2017-01-01

    Host-targeting type IV secretion systems (T4SS) evolved from conjugative T4SS machineries that mediate interbacterial plasmid transfer. However, the origins of effectors secreted by these virulence devices have remained largely elusive. Previous work showed that some effectors exhibit homology to toxins of bacterial toxin-antitoxin modules, but the evolutionary trajectories underlying these ties had not been resolved. We previously reported that FicT toxins of FicTA toxin-antitoxin modules disrupt cellular DNA topology via their enzymatic FIC (filamentation induced by cAMP) domain. Intriguingly, the FIC domain of the FicT toxin VbhT of Bartonella schoenbuchensis is fused to a type IV secretion signal–the BID (Bep intracellular delivery) domain—similar to the Bartonella effector proteins (Beps) that are secreted into eukaryotic host cells via the host-targeting VirB T4SS. In this study, we show that the VbhT toxin is an interbacterial effector protein secreted via the conjugative Vbh T4SS that is closely related to the VirB T4SS and encoded by plasmid pVbh of B. schoenbuchensis. We therefore propose that the Vbh T4SS together with its effector VbhT represent an evolutionary missing link on a path that leads from a regular conjugation system and FicTA toxin-antitoxin modules to the VirB T4SS and the Beps. Intriguingly, phylogenetic analyses revealed that the fusion of FIC and BID domains has probably occurred independently in VbhT and the common ancestor of the Beps, suggesting parallel evolutionary paths. Moreover, several other examples of TA module toxins that are bona fide substrates of conjugative T4SS indicate that their recruitment as interbacterial effectors is prevalent and serves yet unknown biological functions in the context of bacterial conjugation. We propose that the adaptation for interbacterial transfer favors the exaptation of FicT and other TA module toxins as inter-kingdom effectors and may thus constitute an important stepping stone in the

  9. The role of domain-general cognitive control in language comprehension

    PubMed Central

    Fedorenko, Evelina

    2014-01-01

    What role does domain-general cognitive control play in understanding linguistic input? Although much evidence has suggested that domain-general cognitive control and working memory resources are sometimes recruited during language comprehension, many aspects of this relationship remain elusive. For example, how frequently do cognitive control mechanisms get engaged when we understand language? And is this engagement necessary for successful comprehension? I here (a) review recent brain imaging evidence for the neural separability of the brain regions that support high-level linguistic processing vs. those that support domain-general cognitive control abilities; (b) define the space of possibilities for the relationship between these sets of brain regions; and (c) review the available evidence that constrains these possibilities to some extent. I argue that we should stop asking whether domain-general cognitive control mechanisms play a role in language comprehension, and instead focus on characterizing the division of labor between the cognitive control brain regions and the more functionally specialized language regions. PMID:24803909

  10. Effect of neohesperidin dihydrochalcone on the activity and stability of alpha-amylase: a comparative study on bacterial, fungal, and mammalian enzymes.

    PubMed

    Kashani-Amin, Elaheh; Ebrahim-Habibi, Azadeh; Larijani, Bagher; Moosavi-Movahedi, Ali Akbar

    2015-10-01

    Neohesperidin dihydrochalcone (NHDC) was recently introduced as an activator of mammalian alpha-amylase. In the current study, the effect of NHDC has been investigated on bacterial and fungal alpha-amylases. Enzyme assays and kinetic analysis demonstrated the capability of NHDC to significantly activate both tested alpha-amylases. The ligand activation pattern was found to be more similar between the fungal and mammalian enzyme in comparison with the bacterial one. Further, thermostability experiments indicated a stability increase in the presence of NHDC for the bacterial enzyme. In silico (docking) test locates a putative binding site for NHDC on alpha-amylase surface in domain B. This domain shows differences in various alpha-amylase types, and the different behavior of the ligand toward the studied enzymes may be attributed to this fact. Copyright © 2015 John Wiley & Sons, Ltd.

  11. Proteome analysis of Arabidopsis seedlings exposed to bacterial volatiles.

    PubMed

    Kwon, Young Sang; Ryu, Choong-Min; Lee, Soohyun; Park, Hyo Bee; Han, Ki Soo; Lee, Jung Han; Lee, Kyunghee; Chung, Woo Sik; Jeong, Mi-Jeong; Kim, Hee Kyu; Bae, Dong-Won

    2010-11-01

    Plant root-associated bacteria (rhizobacteria) elicit plant basal immunity referred to as induced systemic resistance (ISR) against multiple pathogens. Among multi-bacterial determinants involving such ISR, the induction of ISR and promotion of growth by bacterial volatile compounds was previously reported. To exploit global de novo expression of plant proteins by bacterial volatiles, proteomic analysis was performed after exposure of Arabidopsis plants to the rhizobacterium Bacillus subtilis GB03. Ethylene biosynthesis enzymes were significantly up-regulated. Analysis by quantitative reverse transcriptase polymerase chain reaction confirmed that ethylene biosynthesis-related genes SAM-2, ACS4, ACS12, and ACO2 as well as ethylene response genes, ERF1, GST2, and CHIB were up-regulated by the exposure to bacterial volatiles. More interestingly, the emission of bacterial volatiles significantly up-regulated both key defense mechanisms mediated by jasmonic acid and salicylic acid signaling pathways. In addition, high accumulation of antioxidant proteins also provided evidence of decreased sensitivity to reactive oxygen species during the elicitation of ISR by bacterial volatiles. The present results suggest that the proteomic analysis of plant defense responses in bacterial volatile-mediated ISR can reveal the mechanisms of plant basal defenses orchestrated by endogenous ethylene production pathways and the generation of reactive oxygen species.

  12. Long-term memory-based control of attention in multi-step tasks requires working memory: evidence from domain-specific interference

    PubMed Central

    Foerster, Rebecca M.; Carbone, Elena; Schneider, Werner X.

    2014-01-01

    Evidence for long-term memory (LTM)-based control of attention has been found during the execution of highly practiced multi-step tasks. However, does LTM directly control for attention or are working memory (WM) processes involved? In the present study, this question was investigated with a dual-task paradigm. Participants executed either a highly practiced visuospatial sensorimotor task (speed stacking) or a verbal task (high-speed poem reciting), while maintaining visuospatial or verbal information in WM. Results revealed unidirectional and domain-specific interference. Neither speed stacking nor high-speed poem reciting was influenced by WM retention. Stacking disrupted the retention of visuospatial locations, but did not modify memory performance of verbal material (letters). Reciting reduced the retention of verbal material substantially whereas it affected the memory performance of visuospatial locations to a smaller degree. We suggest that the selection of task-relevant information from LTM for the execution of overlearned multi-step tasks recruits domain-specific WM. PMID:24847304

  13. Evidence for the generation of myristylated FMN by bacterial luciferase.

    PubMed

    Tabib, Chaitanya R; Brodl, Eveline; Macheroux, Peter

    2017-06-01

    The genes responsible for the light production in bioluminescent bacteria are present as an operon, luxCDABEG. Many strains of Photobacteria carry an additional gene, termed luxF. X-ray crystallographic analysis of LuxF revealed the presence of four molecules of a flavin derivative, i.e. 6-(3'-(R)-myristyl) flavin adenine mononucleotide (myrFMN) non-covalently bound to the homodimer. In the present study, we exploited the binding of myrFMN to recombinant apo-LuxF to explore the occurrence of myrFMN in various bioluminescent bacteria. MyrFMN was detected in all bacterial strains tested including Vibrio and Aliivibrio indicating that it is more widely occurring in bioluminescent bacteria than previously assumed. We also show that apo-LuxF captures myrFMN and thereby relieves the inhibitory effect on luciferase activity. Thus our results provide support for the hypothesis that LuxF acts as a scavenger of myrFMN in bioluminescent bacteria. However, the source of myrFMN remained obscure. To address this issue, we established a cofactor regeneration enzyme-catalyzed cascade reaction that supports luciferase activity in vitro for up to 3 days. This approach enabled us to unambiguously demonstrate that myrFMN is generated in the bacterial bioluminescent reaction. Based on this finding we postulate a reaction mechanism for myrFMN generation that is based on the luciferase reaction. © 2017 The Authors Molecular Microbiology Published by John Wiley & Sons Ltd.

  14. Bacterial respiration of arsenic and selenium

    USGS Publications Warehouse

    Stolz, J.F.; Oremland, R.S.

    1999-01-01

    Oxyanions of arsenic and selenium can be used in microbial anaerobic respiration as terminal electron acceptors. The detection of arsenate and selenate respiring bacteria in numerous pristine and contaminated environments and their rapid appearance in enrichment culture suggest that they are widespread and metabolically active in nature. Although the bacterial species that have been isolated and characterized are still few in number, they are scattered throughout the bacterial domain and include Gram- positive bacteria, beta, gamma and epsilon Proteobacteria and the sole member of a deeply branching lineage of the bacteria, Chrysiogenes arsenatus. The oxidation of a number of organic substrates (i.e. acetate, lactate, pyruvate, glycerol, ethanol) or hydrogen can be coupled to the reduction of arsenate and selenate, but the actual donor used varies from species to species. Both periplasmic and membrane-associated arsenate and selenate reductases have been characterized. Although the number of subunits and molecular masses differs, they all contain molybdenum. The extent of the environmental impact on the transformation and mobilization of arsenic and selenium by microbial dissimilatory processes is only now being fully appreciated.

  15. Modeling physiological resistance in bacterial biofilms.

    PubMed

    Cogan, N G; Cortez, Ricardo; Fauci, Lisa

    2005-07-01

    A mathematical model of the action of antimicrobial agents on bacterial biofilms is presented. The model includes the fluid dynamics in and around the biofilm, advective and diffusive transport of two chemical constituents and the mechanism of physiological resistance. Although the mathematical model applies in three dimensions, we present two-dimensional simulations for arbitrary biofilm domains and various dosing strategies. The model allows the prediction of the spatial evolution of bacterial population and chemical constituents as well as different dosing strategies based on the fluid motion. We find that the interaction between the nutrient and the antimicrobial agent can reproduce survival curves which are comparable to other model predictions as well as experimental results. The model predicts that exposing the biofilm to low concentration doses of antimicrobial agent for longer time is more effective than short time dosing with high antimicrobial agent concentration. The effects of flow reversal and the roughness of the fluid/biofilm are also investigated. We find that reversing the flow increases the effectiveness of dosing. In addition, we show that overall survival decreases with increasing surface roughness.

  16. Bacterial expression of human kynurenine 3-monooxygenase: solubility, activity, purification.

    PubMed

    Wilson, K; Mole, D J; Binnie, M; Homer, N Z M; Zheng, X; Yard, B A; Iredale, J P; Auer, M; Webster, S P

    2014-03-01

    Kynurenine 3-monooxygenase (KMO) is an enzyme central to the kynurenine pathway of tryptophan metabolism. KMO has been implicated as a therapeutic target in several disease states, including Huntington's disease. Recombinant human KMO protein production is challenging due to the presence of transmembrane domains, which localise KMO to the outer mitochondrial membrane and render KMO insoluble in many in vitro expression systems. Efficient bacterial expression of human KMO would accelerate drug development of KMO inhibitors but until now this has not been achieved. Here we report the first successful bacterial (Escherichia coli) expression of active FLAG™-tagged human KMO enzyme expressed in the soluble fraction and progress towards its purification. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  17. Archaeal and bacterial community analysis of several Yellowstone National Park hot springs

    NASA Astrophysics Data System (ADS)

    Colman, D. R.; Takacs-Vesbach, C. D.

    2012-12-01

    The hot springs of Yellowstone National Park (YNP) are home to a diverse assemblage of microorganisms. Culture-independent studies have significantly expanded our understanding of the diversity of both Bacteria and Archaea present in YNP springs as well as the geochemical and ecological controls on communities. While the ecological analysis of Bacteria among the physicochemically heterogenous springs of YNP has been previously conducted, less is known about the extent of diversity of Archaeal communities and the chemical and ecological controls on their populations. Here we report a culture-independent analysis of 31 hot spring archaeal and bacterial communities of YNP springs using next generation sequencing. We found the phylogenetic diversity of Archaea to be generally comparable to that of co-occurring bacterial communities although overall, in the springs we investigated, diversity was higher for Bacteria than Archaea. Chemical and physical controls were similar for both domains with pH correlating most strongly with community composition. Community differences reflected the partitioning of taxonomic groups in low or high pH springs for both domains. Results will be discussed in a geochemical and ecological context.

  18. Evidence-based practice implementation in community mental health settings: the relative importance of key domains of implementation activity.

    PubMed

    Torrey, William C; Bond, Gary R; McHugo, Gregory J; Swain, Karin

    2012-09-01

    Implementation research has examined practice prioritization, implementation leadership, workforce development, workflow re-engineering, and practice reinforcement, but not addressed their relative importance as implementation drivers. This study investigated domains of implementation activities and correlated them to implementation success during a large national evidence-based practice implementation project. Implementation success was correlated with active leadership strategically devoted to redesigning the flow of work and reinforcing implementation through measurement and feedback. Relative attention to workforce development was negatively correlated with implementation. Active leaders should focus on redesigning the flow of work to support the implementation and on reinforcing program improvements.

  19. Recombinant Collagen Engineered to Bind to Discoidin Domain Receptor Functions as a Receptor Inhibitor*

    PubMed Central

    An, Bo; Abbonante, Vittorio; Xu, Huifang; Gavriilidou, Despoina; Yoshizumi, Ayumi; Bihan, Dominique; Farndale, Richard W.; Kaplan, David L.; Balduini, Alessandra; Leitinger, Birgit; Brodsky, Barbara

    2016-01-01

    A bacterial collagen-like protein Scl2 has been developed as a recombinant collagen model system to host human collagen ligand-binding sequences, with the goal of generating biomaterials with selective collagen bioactivities. Defined binding sites in human collagen for integrins, fibronectin, heparin, and MMP-1 have been introduced into the triple-helical domain of the bacterial collagen and led to the expected biological activities. The modular insertion of activities is extended here to the discoidin domain receptors (DDRs), which are collagen-activated receptor tyrosine kinases. Insertion of the DDR-binding sequence from human collagen III into bacterial collagen led to specific receptor binding. However, even at the highest testable concentrations, the construct was unable to stimulate DDR autophosphorylation. The recombinant collagen expressed in Escherichia coli does not contain hydroxyproline (Hyp), and complementary synthetic peptide studies showed that replacement of Hyp by Pro at the critical Gly-Val-Met-Gly-Phe-Hyp position decreased the DDR-binding affinity and consequently required a higher concentration for the induction of receptor activation. The ability of the recombinant bacterial collagen to bind the DDRs without inducing kinase activation suggested it could interfere with the interactions between animal collagen and the DDRs, and such an inhibitory role was confirmed in vitro and with a cell migration assay. This study illustrates that recombinant collagen can complement synthetic peptides in investigating structure-activity relationships, and this system has the potential for the introduction or inhibition of specific biological activities. PMID:26702058

  20. SH2 domains of the p85 alpha subunit of phosphatidylinositol 3-kinase regulate binding to growth factor receptors.

    PubMed Central

    McGlade, C J; Ellis, C; Reedijk, M; Anderson, D; Mbamalu, G; Reith, A D; Panayotou, G; End, P; Bernstein, A; Kazlauskas, A

    1992-01-01

    The binding of cytoplasmic signaling proteins such as phospholipase C-gamma 1 and Ras GTPase-activating protein to autophosphorylated growth factor receptors is directed by their noncatalytic Src homology region 2 (SH2) domains. The p85 alpha regulatory subunit of phosphatidylinositol (PI) 3-kinase, which associates with several receptor protein-tyrosine kinases, also contains two SH2 domains. Both p85 alpha SH2 domains, when expressed individually as fusion proteins in bacteria, bound stably to the activated beta receptor for platelet-derived growth factor (PDGF). Complex formation required PDGF stimulation and was dependent on receptor tyrosine kinase activity. The bacterial p85 alpha SH2 domains recognized activated beta PDGF receptor which had been immobilized on a filter, indicating that SH2 domains contact autophosphorylated receptors directly. Several receptor tyrosine kinases within the PDGF receptor subfamily, including the colony-stimulating factor 1 receptor and the Steel factor receptor (Kit), also associate with PI 3-kinase in vivo. Bacterially expressed SH2 domains derived from the p85 alpha subunit of PI 3-kinase bound in vitro to the activated colony-stimulating factor 1 receptor and to Kit. We infer that the SH2 domains of p85 alpha bind to high-affinity sites on these receptors, whose creation is dependent on receptor autophosphorylation. The SH2 domains of p85 are therefore primarily responsible for the binding of PI 3-kinase to activated growth factor receptors. Images PMID:1372092

  1. Domain-General and Domain-Specific Patterns of Activity Supporting Metacognition in Human Prefrontal Cortex

    PubMed Central

    2018-01-01

    Metacognition is the capacity to evaluate the success of one's own cognitive processes in various domains; for example, memory and perception. It remains controversial whether metacognition relies on a domain-general resource that is applied to different tasks or if self-evaluative processes are domain specific. Here, we investigated this issue directly by examining the neural substrates engaged when metacognitive judgments were made by human participants of both sexes during perceptual and memory tasks matched for stimulus and performance characteristics. By comparing patterns of fMRI activity while subjects evaluated their performance, we revealed both domain-specific and domain-general metacognitive representations. Multivoxel activity patterns in anterior prefrontal cortex predicted levels of confidence in a domain-specific fashion, whereas domain-general signals predicting confidence and accuracy were found in a widespread network in the frontal and posterior midline. The demonstration of domain-specific metacognitive representations suggests the presence of a content-rich mechanism available to introspection and cognitive control. SIGNIFICANCE STATEMENT We used human neuroimaging to investigate processes supporting memory and perceptual metacognition. It remains controversial whether metacognition relies on a global resource that is applied to different tasks or if self-evaluative processes are specific to particular tasks. Using multivariate decoding methods, we provide evidence that perceptual- and memory-specific metacognitive representations coexist with generic confidence signals. Our findings reconcile previously conflicting results on the domain specificity/generality of metacognition and lay the groundwork for a mechanistic understanding of metacognitive judgments. PMID:29519851

  2. Neglected bacterial zoonoses.

    PubMed

    Chikeka, I; Dumler, J S

    2015-05-01

    Bacterial zoonoses comprise a group of diseases in humans or animals acquired by direct contact with or by oral consumption of contaminated animal materials, or via arthropod vectors. Among neglected infections, bacterial zoonoses are among the most neglected given emerging data on incidence and prevalence as causes of acute febrile illness, even in areas where recognized neglected tropical diseases occur frequently. Although many other bacterial infections could also be considered in this neglected category, five distinct infections stand out because they are globally distributed, are acute febrile diseases, have high rates of morbidity and case fatality, and are reported as commonly as malaria, typhoid or dengue virus infections in carefully designed studies in which broad-spectrum diagnoses are actively sought. This review will focus attention on leptospirosis, relapsing fever borreliosis and rickettsioses, including scrub typhus, murine typhus and spotted fever group rickettsiosis. Of greatest interest is the lack of distinguishing clinical features among these infections when in humans, which confounds diagnosis where laboratory confirmation is lacking, and in regions where clinical diagnosis is often attributed to one of several perceived more common threats. As diseases such as malaria come under improved control, the real impact of these common and under-recognized infections will become evident, as will the requirement for the strategies and allocation of resources for their control. Copyright © 2015 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  3. Social cognitive conflict resolution: Contributions of domain general and domain specific neural systems

    PubMed Central

    Zaki, Jamil; Hennigan, Kelly; Weber, Jochen; Ochsner, Kevin N.

    2010-01-01

    Cognitive control mechanisms allow individuals to behave adaptively in the face of complex and sometimes conflicting information. While the neural bases of these control mechanisms have been examined in many contexts, almost no attention has been paid to their role in resolving conflicts between competing social cues, which is surprising, given that cognitive conflicts are part of many social interactions. Evidence about the neural processing of social information suggests that two systems—the mirror neuron system (MNS) and mental state attribution system (MSAS)—are specialized for processing nonverbal and contextual social cues, respectively. This could support a model of social cognitive conflict resolution in which competition between social cues would recruit domain-general cognitive control mechanisms, which in turn would bias processing towards the MNS or MSAS. Such biasing could also alter social behaviors, such as inferences made about the internal states of others. We tested this model by scanning participants using fMRI while they drew inferences about social targets' emotional states based on congruent or incongruent nonverbal and contextual social cues. Conflicts between social cues recruited the anterior cingulate and lateral prefrontal cortex, brain areas associated with domain-general control processes. This activation was accompanied by biasing of neural activity towards areas in the MNS or MSAS, which tracked, respectively, with perceivers' behavioral reliance on nonverbal or contextual cues when drawing inferences about targets' emotions. Together, these data provide evidence about both domain general and domain specific mechanisms involved in resolving social cognitive conflicts. PMID:20573895

  4. Biological effects of individually synthesized TNF-binding domain of variola virus CrmB protein.

    PubMed

    Tsyrendorzhiev, D D; Orlovskaya, I A; Sennikov, S V; Tregubchak, T V; Gileva, I P; Tsyrendorzhieva, M D; Shchelkunov, S N

    2014-06-01

    The biological characteristics of a 17-kDa protein synthesized in bacterial cells, a TNF-binding domain (VARV-TNF-BP) of a 47-kDa variola virus CrmB protein (VARV-CrmB) consisting of TNF-binding and chemokine-binding domains, were studied. Removal of the C-terminal chemokine-binding domain from VARV-CrmB protein was inessential for the efficiency of its inhibition of TNF cytotoxicity towards L929 mouse fibroblast culture and for TNF-induced oxidative metabolic activity of mouse blood leukocytes. The results of this study could form the basis for further studies of VARV-TNF-BP mechanisms of activity for prospective use in practical medicine.

  5. Precambrian domains in Lithuania: evidence of terrane tectonics

    NASA Astrophysics Data System (ADS)

    Skridlaite, Grazina; Motuza, Gediminas

    2001-09-01

    The West Lithuanian Granulite (WLG) and East Lithuanian domains (ELD) form the Proterozoic basement of Lithuania and can be distinguished on the basis of differing structural patterns, lithologies, and evolutionary histories. They are juxtaposed along the Mid-Lithuanian Suture Zone (MLSZ). In the WLG, the main lithotectonic complexes comprise felsic and intermediate, mostly metasedimentary granulites in the south-west and mafic metaigneous granulites in the north-east. The former are interpreted as marine metapelites, while most of the mafic ones have been derived from island-arc tholeiites. These rock complexes trend NW-SE and are marked by contrasting gravity and magnetic anomalies. NE- and E-W-striking faults and shear zones complicate the potential-field patterns. Sets of NW-trending anomalies also extend from Lithuania across the Baltic Sea to south-central Sweden and indicate that the WLG complexes continue into the Baltic/Fennoscandian Shield. Voluminous anatectic granites alternate with the metapelites, whereas the mafic granulites occur together with enderbites and charnockites. In the ELD, the main structures produce strong, NNE-SSW-oriented gravity and magnetic anomalies which trend parallel to the Belarus-Baltic Granulite Belt (BBG) and other terranes situated still farther east. The ELD is composed of metasedimentary rocks interpreted as one-time graywackes, shales and dolomites accumulated in continental-margin arc and shallow-water basinal environments. Amphibolites and gabbros with MORB and IAT characteristics, and voluminous granitoids are also present. The coexistence of juvenile mafic rocks with continental-margin and shelf sediments suggests an oceanic back-arc setting. The two Lithuanian basement domains display contrasting metamorphic histories that suggest separate developments before the eventual amalgamation. In the WLG, the metapelites indicate peak metamorphism at high temperatures (up to 850-900°C) and moderate pressures (8-10 kbar

  6. Characterization of Runella slithyformis HD-Pnk, a Bifunctional DNA/RNA End-Healing Enzyme Composed of an N-Terminal 2′,3′-Phosphoesterase HD Domain and a C-Terminal 5′-OH Polynucleotide Kinase Domain

    PubMed Central

    Munir, Annum

    2016-01-01

    ABSTRACT 5′- and 3′-end-healing reactions are key steps in nucleic acid break repair in which 5′-OH ends are phosphorylated by a polynucleotide kinase (Pnk) and 3′-PO4 or 2′,3′-cyclic-PO4 ends are hydrolyzed by a phosphoesterase to generate the 5′-PO4 and 3′-OH termini required for sealing by classic polynucleotide ligases. End-healing and sealing enzymes are present in diverse bacterial taxa, often organized as modular units within a single multifunctional polypeptide or as subunits of a repair complex. Here we identify and characterize Runella slithyformis HD-Pnk as a novel bifunctional end-healing enzyme composed of an N-terminal 2′,3′-phosphoesterase HD domain and a C-terminal 5′-OH polynucleotide kinase P-loop domain. HD-Pnk phosphorylates 5′-OH polynucleotides (9-mers or longer) in the presence of magnesium and any nucleoside triphosphate donor. HD-Pnk dephosphorylates RNA 2′,3′-cyclic phosphate, RNA 3′-phosphate, RNA 2′-phosphate, and DNA 3′-phosphate ends in the presence of a transition metal cofactor, which can be nickel, copper, or cobalt. HD-Pnk homologs are present in genera from 11 bacterial phyla and are often encoded in an operon with a putative ATP-dependent polynucleotide ligase. IMPORTANCE The present study provides insights regarding the diversity of nucleic acid repair strategies via the characterization of Runella slithyformis HD-Pnk as the exemplar of a novel clade of dual 5′- and 3′-end-healing enzymes that phosphorylate 5′-OH termini and dephosphorylate 2′,3′-cyclic-PO4, 3′-PO4, and 2′-PO4 ends. The distinctive feature of HD-Pnk is its domain composition, i.e., a fusion of an N-terminal HD phosphohydrolase module and a C-terminal P-loop polynucleotide kinase module. Homologs of Runella HD-Pnk with the same domain composition, same domain order, and similar polypeptide sizes are distributed widely among genera from 11 bacterial phyla. PMID:27895092

  7. Domain Specificity and the Limits of Creativity Theory

    ERIC Educational Resources Information Center

    Baer, John

    2012-01-01

    A growing body of research evidence suggests that creativity is very domain-specific and that domain-general skills or traits contribute little to creative performance. The term "creativity" is a convenient term for collecting many interesting artifacts, processes, and people into a single category, and the term "creative thinking…

  8. Query-oriented evidence extraction to support evidence-based medicine practice.

    PubMed

    Sarker, Abeed; Mollá, Diego; Paris, Cecile

    2016-02-01

    Evidence-based medicine practice requires medical practitioners to rely on the best available evidence, in addition to their expertise, when making clinical decisions. The medical domain boasts a large amount of published medical research data, indexed in various medical databases such as MEDLINE. As the size of this data grows, practitioners increasingly face the problem of information overload, and past research has established the time-associated obstacles faced by evidence-based medicine practitioners. In this paper, we focus on the problem of automatic text summarisation to help practitioners quickly find query-focused information from relevant documents. We utilise an annotated corpus that is specialised for the task of evidence-based summarisation of text. In contrast to past summarisation approaches, which mostly rely on surface level features to identify salient pieces of texts that form the summaries, our approach focuses on the use of corpus-based statistics, and domain-specific lexical knowledge for the identification of summary contents. We also apply a target-sentence-specific summarisation technique that reduces the problem of underfitting that persists in generic summarisation models. In automatic evaluations run over a large number of annotated summaries, our extractive summarisation technique statistically outperforms various baseline and benchmark summarisation models with a percentile rank of 96.8%. A manual evaluation shows that our extractive summarisation approach is capable of selecting content with high recall and precision, and may thus be used to generate bottom-line answers to practitioners' queries. Our research shows that the incorporation of specialised data and domain-specific knowledge can significantly improve text summarisation performance in the medical domain. Due to the vast amounts of medical text available, and the high growth of this form of data, we suspect that such summarisation techniques will address the time

  9. Haem Recognition By a Staphylococcus Aureus NEAT Domain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Grigg, J.C.; Vermeiren, C.; Heinrichs, D.E.

    2009-06-01

    Successful pathogenic organisms have developed mechanisms to thrive under extreme levels of iron restriction. Haem-iron represents the largest iron reservoir in the human body and is a significant source of iron for some bacterial pathogens. NEAT (NEAr Transporter) domains are found exclusively in a family of cell surface proteins in Gram-positive bacteria. Many NEAT domain-containing proteins, including IsdA in Staphylococcus aureus, are implicated in haem binding. Here, we show that overexpression of IsdA in S. aureus enhances growth and an inactivation mutant of IsdA has a growth defect, compared with wild type, when grown in media containing haem as themore » sole iron source. Furthermore, the haem-binding property of IsdA is contained within the NEAT domain. Crystal structures of the apo-IsdA NEAT domain and in complex with haem were solved and reveal a clathrin adapter-like beta-sandwich fold with a large hydrophobic haem-binding pocket. Haem is bound with the propionate groups directed at the molecular surface and the iron is co-ordinated solely by Tyr(166). The phenol groups of Tyr(166) and Tyr(170) form an H-bond that may function in regulating haem binding and release. An analysis of IsdA structure-sequence alignments indicate that conservation of Tyr(166) is a predictor of haem binding by NEAT domains.« less

  10. Spatial pattern in Antarctica: what can we learn from Antarctic bacterial isolates?

    PubMed

    Chong, Chun Wie; Goh, Yuh Shan; Convey, Peter; Pearce, David; Tan, Irene Kit Ping

    2013-09-01

    A range of small- to moderate-scale studies of patterns in bacterial biodiversity have been conducted in Antarctica over the last two decades, most suggesting strong correlations between the described bacterial communities and elements of local environmental heterogeneity. However, very few of these studies have advanced interpretations in terms of spatially associated patterns, despite increasing evidence of patterns in bacterial biogeography globally. This is likely to be a consequence of restricted sampling coverage, with most studies to date focusing only on a few localities within a specific Antarctic region. Clearly, there is now a need for synthesis over a much larger spatial to consolidate the available data. In this study, we collated Antarctic bacterial culture identities based on the 16S rRNA gene information available in the literature and the GenBank database (n > 2,000 sequences). In contrast to some recent evidence for a distinct Antarctic microbiome, our phylogenetic comparisons show that a majority (~75 %) of Antarctic bacterial isolates were highly similar (≥99 % sequence similarity) to those retrieved from tropical and temperate regions, suggesting widespread distribution of eurythermal mesophiles in Antarctic environments. However, across different Antarctic regions, the dominant bacterial genera exhibit some spatially distinct diversity patterns analogous to those recently proposed for Antarctic terrestrial macroorganisms. Taken together, our results highlight the threat of cross-regional homogenisation in Antarctic biodiversity, and the imperative to include microbiota within the framework of biosecurity measures for Antarctica.

  11. Bacterial meningitis post-PCV7: declining incidence and treatment.

    PubMed

    Kowalsky, Rachel H; Jaffe, David M

    2013-06-01

    The epidemiology of bacterial meningitis in the United States has changed tremendously in the past 20 years. Since the introduction of the Haemophilus influenzae type b vaccine in 1988, the incidence of H. influenzae type b meningitis has declined by at least 97%, and Streptococcus pneumoniae has emerged as the most common etiologic agent. The PCV7 (7-valent pneumococcal conjugate vaccine [Prevnar]; Wyeth Pharmaceuticals) vaccine, which targets 7 pneumococcal serotypes, was introduced in 2000 and has had an enormous impact on both the incidence and epidemiology of bacterial meningitis. This article reviews the impact of the PCV7 vaccine and the most up-to-date evidence on diagnosis and empiric therapy of suspected bacterial meningitis in the current day.

  12. The C-terminal periplasmic domain of MotB is responsible for load-dependent control of the number of stators of the bacterial flagellar motor.

    PubMed

    Castillo, David J; Nakamura, Shuichi; Morimoto, Yusuke V; Che, Yong-Suk; Kami-Ike, Nobunori; Kudo, Seishi; Minamino, Tohru; Namba, Keiichi

    2013-01-01

    The bacterial flagellar motor is made of a rotor and stators. In Salmonella it is thought that about a dozen MotA/B complexes are anchored to the peptidoglycan layer around the motor through the C-terminal peptidoglycan-binding domain of MotB to become active stators as well as proton channels. MotB consists of 309 residues, forming a single transmembrane helix (30-50), a stalk (51-100) and a C-terminal peptidoglycan-binding domain (101-309). Although the stalk is dispensable for torque generation by the motor, it is required for efficient motor performance. Residues 51 to 72 prevent premature proton leakage through the proton channel prior to stator assembly into the motor. However, the role of residues 72-100 remains unknown. Here, we analyzed the torque-speed relationship of the MotB(Δ72-100) motor. At a low speed near stall, this mutant motor produced torque at the wild-type level. Unlike the wild-type motor, however, torque dropped off drastically by slight decrease in external load and then showed a slow exponential decay over a wide range of load by its further reduction. Since it is known that the stator is a mechano-sensor and that the number of active stators changes in a load-dependent manner, we interpreted this unusual torque-speed relationship as anomaly in load-dependent control of the number of active stators. The results suggest that residues 72-100 of MotB is required for proper load-dependent control of the number of active stators around the rotor.

  13. Modulation of post-antibiotic bacterial community reassembly and host response by Candida albicans.

    PubMed

    Erb Downward, John R; Falkowski, Nicole R; Mason, Katie L; Muraglia, Ryan; Huffnagle, Gary B

    2013-01-01

    The introduction of Candida albicans into cefoperazone-treated mice results in changes in bacterial community reassembly. Our objective was to use high-throughput sequencing to characterize at much greater depth the specific changes in the bacterial microbiome. The colonization of C. albicans significantly altered bacterial community reassembly that was evident at multiple taxonomic levels of resolution. There were marked changes in the levels of Bacteriodetes and Lactobacillaceae. Lachnospiraceae and Ruminococcaceae, the two most abundant bacterial families, did not change in relative proportions after antibiotics, but there were marked genera-level shifts within these two bacterial families. The microbiome shifts occurred in the absence of overt intestinal inflammation. Overall, these experiments demonstrate that the introduction of a single new microbe in numerically inferior numbers into the bacterial microbiome during a broad community disturbance has the potential to significantly alter the subsequent reassembly of the bacterial community as it recovers from that disturbance.

  14. Domain Organization in Candida glabrata THI6, a Bifunctional Enzyme Required for Thiamin Biosynthesis in Eukaryotes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paul, Debamita; Chatterjee, Abhishek; Begley, Tadhg P.

    2010-11-15

    THI6 is a bifunctional enzyme found in the thiamin biosynthetic pathway in eukaryotes. The N-terminal domain of THI6 catalyzes the ligation of the thiamin thiazole and pyrimidine moieties to form thiamin phosphate, and the C-terminal domain catalyzes the phosphorylation of 4-methyl-5-hydroxyethylthiazole in a salvage pathway. In prokaryotes, thiamin phosphate synthase and 4-methyl-5-hydroxyethylthiazole kinase are separate gene products. Here we report the first crystal structure of a eukaryotic THI6 along with several complexes that characterize the active sites responsible for the two chemical reactions. THI6 from Candida glabrata is a homohexamer in which the six protomers form a cage-like structure. Eachmore » protomer is composed of two domains, which are structurally homologous to their monofunctional bacterial counterparts. Two loop regions not found in the bacterial enzymes provide interactions between the two domains. The structures of different protein-ligand complexes define the thiazole and ATP binding sites of the 4-methyl-5-hydroxyethylthiazole kinase domain and the thiazole phosphate and 4-amino-5-hydroxymethyl-2-methylpyrimidine pyrophosphate binding sites of the thiamin phosphate synthase domain. Our structural studies reveal that the active sites of the two domains are 40 {angstrom} apart and are not connected by an obvious channel. Biochemical studies show 4-methyl-5-hydroxyethylthiazole phosphate is a substrate for THI6; however, adenosine diphospho-5{beta}-ethyl-4-methylthiazole-2-carboxylic acid, the product of THI4, is not a substrate for THI6. This suggests that an unidentified enzyme is necessary to produce the substrate for THI6 from the THI4 product.« less

  15. Bacterial expression and purification of a heterodimeric adrenomedullin receptor extracellular domain complex using DsbC-assisted disulfide shuffling.

    PubMed

    Hill, Heather E; Pioszak, Augen A

    2013-03-01

    Adrenomedullin (AM) is a peptide hormone that is a potent vasodilator and is essential for vascular development. The AM receptor is a heterodimeric cell surface receptor composed of the calcitonin receptor-like receptor (CLR), a class B G protein-coupled receptor, in association with either of two receptor activity modifying protein (RAMP) coreceptors, RAMP2 or -3. The extracellular domains (ECDs) of CLR and the RAMPs form the primary AM binding site. Here, we present novel methodology for expression and purification of a heterodimeric AM receptor ECD complex as an MBP-CLR ECD fusion protein in association with the RAMP2 ECD. Co-expression of the RAMP2 ECD with the disulfide bond isomerase DsbC in the oxidizing cytoplasm of E. coli trxB gor enabled proper disulfide formation in vivo. The isolated RAMP2 ECD was purified to homogeneity. Co-expression of a soluble MBP-CLR ECD fusion protein with DsbC in E. coli trxB gor yielded a heterogeneous mixture of species with misfolded ECD. Incubation of affinity-purified MBP-CLR ECD in vitro with purified RAMP2 ECD, DsbC, and glutathione redox buffer promoted proper folding of the CLR ECD and formation of a stable MBP-CLR ECD:RAMP2 ECD complex that was purified by size-exclusion chromatography and which exhibited specific AM binding. Approximately 40mg of highly purified complex was obtained starting with 6L bacterial cultures for each protein. The methodology reported here will facilitate structure/function studies of the AM receptor. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Evidence for The Domains Supporting The Construct of Intrinsic Capacity.

    PubMed

    Cesari, Matteo; Araujo de Carvalho, Islene; Amuthavalli Thiyagarajan, Jotheeswaran; Cooper, Cyrus; Martin, Finbarr C; Reginster, Jean-Yves; Vellas, Bruno; Beard, John R

    2018-02-02

    Healthy ageing can be defined as "the process of developing and maintaining the functional ability that enables wellbeing in older age". Functional ability (i.e., the health-related attributes that enable people to be and to do what they have reason to value) is determined by intrinsic capacity (i.e., the composite of all the physical and mental capacities of an individual), the environment (i.e., all the factors in the extrinsic world that form the context of an individual's life), and the interactions between the two. This innovative model recently proposed by the World Health Organization has the potential to substantially modify the way in which clinical practice is currently conducted, shifting from disease-centered towards function-centered paradigms. By overcoming the multiple limitations affecting the construct of disease, this novel framework may allow the worldwide dissemination of a more proactive and function-based approach towards achieving optimal health status.In order to facilitate the translation of the current theoretical model into practice, it is important to identify the inner nature of its constituting constructs. In this paper, we consider intrinsic capacity. Using the International Classification of Functioning, Disability and Health (ICF) framework as background and taking into account available evidence, five domains (i.e., locomotion, vitality, cognition, psychological, sensory) are identified as pivotal for capturing the individual's intrinsic capacity (and therefore also reserves) and, through this, pave the way for its objective measurement. © The Author(s) 2018. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. Osmotic therapies added to antibiotics for acute bacterial meningitis.

    PubMed

    Wall, Emma Cb; Ajdukiewicz, Katherine Mb; Bergman, Hanna; Heyderman, Robert S; Garner, Paul

    2018-02-06

    Every day children and adults die from acute community-acquired bacterial meningitis, particularly in low-income countries, and survivors risk deafness, epilepsy and neurological disabilities. Osmotic therapies may attract extra-vascular fluid and reduce cerebral oedema, and thus reduce death and improve neurological outcomes.This is an update of a Cochrane Review first published in 2013. To evaluate the effects of osmotic therapies added to antibiotics for acute bacterial meningitis in children and adults on mortality, deafness and neurological disability. We searched CENTRAL (2017, Issue 1), MEDLINE (1950 to 17 February 2017), Embase (1974 to 17 February 2017), CINAHL (1981 to 17 February 2017), LILACS (1982 to 17 February 2017) and registers of ongoing clinical trials (ClinicalTrials.com, WHO ICTRP) (21 February 2017). We also searched conference abstracts and contacted researchers in the field (up to 12 December 2015). Randomised controlled trials testing any osmotic therapy in adults or children with acute bacterial meningitis. Two review authors independently screened the search results and selected trials for inclusion. Results are presented using risk ratios (RR) and 95% confidence intervals (CI) and grouped according to whether the participants received steroids or not. We used the GRADE approach to assess the certainty of the evidence. We included five trials with 1451 participants. Four trials evaluated glycerol against placebo, and one evaluated glycerol against 50% dextrose; in addition three trials evaluated dexamethasone and one trial evaluated acetaminophen (paracetamol) in a factorial design. Stratified analysis shows no effect modification with steroids; we present aggregate effect estimates.Compared to placebo, glycerol probably has little or no effect on death in people with bacterial meningitis (RR 1.08, 95% CI 0.90 to 1.30; 5 studies, 1272 participants; moderate-certainty evidence), but may reduce neurological disability (RR 0.73, 95% CI 0

  18. Decoding rule search domain in the left inferior frontal gyrus

    PubMed Central

    Babcock, Laura; Vallesi, Antonino

    2018-01-01

    Traditionally, the left hemisphere has been thought to extract mainly verbal patterns of information, but recent evidence has shown that the left Inferior Frontal Gyrus (IFG) is active during inductive reasoning in both the verbal and spatial domains. We aimed to understand whether the left IFG supports inductive reasoning in a domain-specific or domain-general fashion. To do this we used Multi-Voxel Pattern Analysis to decode the representation of domain during a rule search task. Thirteen participants were asked to extract the rule underlying streams of letters presented in different spatial locations. Each rule was either verbal (letters forming words) or spatial (positions forming geometric figures). Our results show that domain was decodable in the left prefrontal cortex, suggesting that this region represents domain-specific information, rather than processes common to the two domains. A replication study with the same participants tested two years later confirmed these findings, though the individual representations changed, providing evidence for the flexible nature of representations. This study extends our knowledge on the neural basis of goal-directed behaviors and on how information relevant for rule extraction is flexibly mapped in the prefrontal cortex. PMID:29547623

  19. Cognitive regulation alters social and dietary choice by changing attribute representations in domain-general and domain-specific brain circuits

    PubMed Central

    Hutcherson, Cendri A

    2018-01-01

    Are some people generally more successful using cognitive regulation or does it depend on the choice domain? Why? We combined behavioral computational modeling and multivariate decoding of fMRI responses to identify neural loci of regulation-related shifts in value representations across goals and domains (dietary or altruistic choice). Surprisingly, regulatory goals did not alter integrative value representations in the ventromedial prefrontal cortex, which represented all choice-relevant attributes across goals and domains. Instead, the dorsolateral prefrontal cortex (DLPFC) flexibly encoded goal-consistent values and predicted regulatory success for the majority of choice-relevant attributes, using attribute-specific neural codes. We also identified domain-specific exceptions: goal-dependent encoding of prosocial attributes localized to precuneus and temporo-parietal junction (not DLPFC). Our results suggest that cognitive regulation operated by changing specific attribute representations (not integrated values). Evidence of domain-general and domain-specific neural loci reveals important divisions of labor, explaining when and why regulatory success generalizes (or doesn’t) across contexts and domains. PMID:29813018

  20. Does negative-pressure wound therapy influence subjacent bacterial growth? A systematic review.

    PubMed

    Glass, Graeme E; Murphy, George R F; Nanchahal, Jagdeep

    2017-08-01

    Negative-pressure wound therapy is a ubiquitous wound management resource. The influence of NPWT on the bacterial bioburden of the subjacent wound remains unclear. We sought to examine the evidence. MEDLINE, Embase, PubMed, the Cochrane Database of Systematic Reviews and the Cochrane Controlled Trials Register were searched for articles quantitatively evaluating bacterial load under NPWT. Twenty-four studies met the inclusion criteria including 4 randomised controlled trials, 8 clinical series and 12 experimental studies. Twenty studies evaluated conventional NPWT, while 4 evaluated infiltration-based NPWT. While 8 studies using conventional NPWT failed to demonstrate an observable effect on bacterial load, 7 studies reported that NPWT was inherently bacteriostatic and 5 others reported species selectivity with suppression of non-fermentative gram-negative bacilli (NFGNB), including Pseudomonas spp. Simultaneously, there was some evidence of enhanced proliferation of gram-positive cocci where the niche was cleared of NFGNB. Two of the 4 studies using infiltration-based NPWT also reported selectively impaired proliferation of Pseudomonas spp. The assumption that NPWT suppresses bacterial proliferation is oversimplified. There is evidence that NPWT exhibits species selectivity, suppressing the proliferation of NFGNB. However, this may depopulate the niche for exploitation by gram-positive cocci. This, in turn, has implications for the use of NPWT where highly virulent strains of gram-positive cocci have been isolated and the duration of NPWT therapy and frequency of dressing changes. Copyright © 2017 British Association of Plastic, Reconstructive and Aesthetic Surgeons. Published by Elsevier Ltd. All rights reserved.

  1. Cross-β Polymerization of Low Complexity Sequence Domains.

    PubMed

    Kato, Masato; McKnight, Steven L

    2017-03-01

    Most transcription factors and RNA regulatory proteins encoded by eukaryotic genomes ranging from yeast to humans contain polypeptide domains variously described as intrinsically disordered, prion-like, or of low complexity (LC). These LC domains exist in an unfolded state when DNA and RNA regulatory proteins are studied in biochemical isolation from cells. Upon incubation in the purified state, many of these LC domains polymerize into homogeneous, labile amyloid-like fibers. Here, we consider several lines of evidence that may favor biologic utility for LC domain polymers. Copyright © 2017 Cold Spring Harbor Laboratory Press; all rights reserved.

  2. Dynamics of bacterial community succession in a salt marsh chronosequence: evidences for temporal niche partitioning.

    PubMed

    Dini-Andreote, Francisco; de Cássia Pereira e Silva, Michele; Triadó-Margarit, Xavier; Casamayor, Emilio O; van Elsas, Jan Dirk; Salles, Joana Falcão

    2014-10-01

    The mechanisms underlying community assembly and promoting temporal succession are often overlooked in microbial ecology. Here, we studied an undisturbed salt marsh chronosequence, spanning over a century of ecosystem development, to understand bacterial succession in soil. We used 16S rRNA gene-based quantitative PCR to determine bacterial abundance and multitag 454 pyrosequencing for community composition and diversity analyses. Despite 10-fold lower 16S rRNA gene abundances, the initial stages of soil development held higher phylogenetic diversities than the soil at late succession. Temporal variations in phylogenetic β-diversity were greater at initial stages of soil development, possibly as a result of the great dynamism imposed by the daily influence of the tide, promoting high immigration rates. Allogenic succession of bacterial communities was mostly driven by shifts in the soil physical structure, as well as variations in pH and salinity, which collectively explained 84.5% of the variation concerning community assemblage. The community assembly data for each successional stage were integrated into a network co-occurrence analysis, revealing higher complexity at initial stages, coinciding with great dynamism in turnover and environmental variability. Contrary to a spatial niche-based perspective of bacterial community assembly, we suggest temporal niche partitioning as the dominant mechanism of assembly (promoting more phylotype co-occurrence) in the initial stages of succession, where continuous environmental change results in the existence of multiple niches over short periods of time.

  3. Dynamics of bacterial community succession in a salt marsh chronosequence: evidences for temporal niche partitioning

    PubMed Central

    Dini-Andreote, Francisco; de Cássia Pereira e Silva, Michele; Triadó-Margarit, Xavier; Casamayor, Emilio O; van Elsas, Jan Dirk; Salles, Joana Falcão

    2014-01-01

    The mechanisms underlying community assembly and promoting temporal succession are often overlooked in microbial ecology. Here, we studied an undisturbed salt marsh chronosequence, spanning over a century of ecosystem development, to understand bacterial succession in soil. We used 16S rRNA gene-based quantitative PCR to determine bacterial abundance and multitag 454 pyrosequencing for community composition and diversity analyses. Despite 10-fold lower 16S rRNA gene abundances, the initial stages of soil development held higher phylogenetic diversities than the soil at late succession. Temporal variations in phylogenetic β-diversity were greater at initial stages of soil development, possibly as a result of the great dynamism imposed by the daily influence of the tide, promoting high immigration rates. Allogenic succession of bacterial communities was mostly driven by shifts in the soil physical structure, as well as variations in pH and salinity, which collectively explained 84.5% of the variation concerning community assemblage. The community assembly data for each successional stage were integrated into a network co-occurrence analysis, revealing higher complexity at initial stages, coinciding with great dynamism in turnover and environmental variability. Contrary to a spatial niche-based perspective of bacterial community assembly, we suggest temporal niche partitioning as the dominant mechanism of assembly (promoting more phylotype co-occurrence) in the initial stages of succession, where continuous environmental change results in the existence of multiple niches over short periods of time. PMID:24739625

  4. Nest Material Shapes Eggs Bacterial Environment.

    PubMed

    Ruiz-Castellano, Cristina; Tomás, Gustavo; Ruiz-Rodríguez, Magdalena; Martín-Gálvez, David; Soler, Juan José

    2016-01-01

    Selective pressures imposed by pathogenic microorganisms to embryos have selected in hosts for a battery of antimicrobial lines of defenses that includes physical and chemical barriers. Due to the antimicrobial properties of volatile compounds of green plants and of chemicals of feather degrading bacteria, the use of aromatic plants and feathers for nest building has been suggested as one of these barriers. However, experimental evidence suggesting such effects is scarce in the literature. During two consecutive years, we explored experimentally the effects of these nest materials on loads of different groups of bacteria (mesophilic bacteria, Enterobacteriaceae, Staphylococcus and Enterococcus) of eggshells in nests of spotless starlings (Sturnus unicolor) at the beginning and at the end of the incubation period. This was also explored in artificial nests without incubation activity. We also experimentally increased bacterial density of eggs in natural and artificial nests and explored the effects of nest lining treatments on eggshell bacterial load. Support for the hypothetical antimicrobial function of nest materials was mainly detected for the year and location with larger average values of eggshell bacterial density. The beneficial effects of feathers and plants were more easily detected in artificial nests with no incubation activity, suggesting an active role of incubation against bacterial colonization of eggshells. Pigmented and unpigmented feathers reduced eggshell bacterial load in starling nests and artificial nest boxes. Results from artificial nests allowed us to discuss and discard alternative scenarios explaining the detected association, particularly those related to the possible sexual role of feathers and aromatic plants in starling nests. All these results considered together confirm the antimicrobial functionality mainly of feathers but also of plants used as nest materials, and highlight the importance of temporally and geographically

  5. Nest Material Shapes Eggs Bacterial Environment

    PubMed Central

    Ruiz-Castellano, Cristina; Tomás, Gustavo; Ruiz-Rodríguez, Magdalena; Martín-Gálvez, David; Soler, Juan José

    2016-01-01

    Selective pressures imposed by pathogenic microorganisms to embryos have selected in hosts for a battery of antimicrobial lines of defenses that includes physical and chemical barriers. Due to the antimicrobial properties of volatile compounds of green plants and of chemicals of feather degrading bacteria, the use of aromatic plants and feathers for nest building has been suggested as one of these barriers. However, experimental evidence suggesting such effects is scarce in the literature. During two consecutive years, we explored experimentally the effects of these nest materials on loads of different groups of bacteria (mesophilic bacteria, Enterobacteriaceae, Staphylococcus and Enterococcus) of eggshells in nests of spotless starlings (Sturnus unicolor) at the beginning and at the end of the incubation period. This was also explored in artificial nests without incubation activity. We also experimentally increased bacterial density of eggs in natural and artificial nests and explored the effects of nest lining treatments on eggshell bacterial load. Support for the hypothetical antimicrobial function of nest materials was mainly detected for the year and location with larger average values of eggshell bacterial density. The beneficial effects of feathers and plants were more easily detected in artificial nests with no incubation activity, suggesting an active role of incubation against bacterial colonization of eggshells. Pigmented and unpigmented feathers reduced eggshell bacterial load in starling nests and artificial nest boxes. Results from artificial nests allowed us to discuss and discard alternative scenarios explaining the detected association, particularly those related to the possible sexual role of feathers and aromatic plants in starling nests. All these results considered together confirm the antimicrobial functionality mainly of feathers but also of plants used as nest materials, and highlight the importance of temporally and geographically

  6. Atomic model of a cell-wall cross-linking enzyme in complex with an intact bacterial peptidoglycan.

    PubMed

    Schanda, Paul; Triboulet, Sébastien; Laguri, Cédric; Bougault, Catherine M; Ayala, Isabel; Callon, Morgane; Arthur, Michel; Simorre, Jean-Pierre

    2014-12-24

    The maintenance of bacterial cell shape and integrity is largely attributed to peptidoglycan, a highly cross-linked biopolymer. The transpeptidases that perform this cross-linking are important targets for antibiotics. Despite this biomedical importance, to date no structure of a protein in complex with an intact bacterial peptidoglycan has been resolved, primarily due to the large size and flexibility of peptidoglycan sacculi. Here we use solid-state NMR spectroscopy to derive for the first time an atomic model of an l,d-transpeptidase from Bacillus subtilis bound to its natural substrate, the intact B. subtilis peptidoglycan. Importantly, the model obtained from protein chemical shift perturbation data shows that both domains-the catalytic domain as well as the proposed peptidoglycan recognition domain-are important for the interaction and reveals a novel binding motif that involves residues outside of the classical enzymatic pocket. Experiments on mutants and truncated protein constructs independently confirm the binding site and the implication of both domains. Through measurements of dipolar-coupling derived order parameters of bond motion we show that protein binding reduces the flexibility of peptidoglycan. This first report of an atomic model of a protein-peptidoglycan complex paves the way for the design of new antibiotic drugs targeting l,d-transpeptidases. The strategy developed here can be extended to the study of a large variety of enzymes involved in peptidoglycan morphogenesis.

  7. Probing Prokaryotic Social Behaviors with Bacterial “Lobster Traps”

    PubMed Central

    Connell, Jodi L.; Wessel, Aimee K.; Parsek, Matthew R.; Ellington, Andrew D.; Whiteley, Marvin; Shear, Jason B.

    2010-01-01

    Bacteria are social organisms that display distinct behaviors/phenotypes when present in groups. These behaviors include the abilities to construct antibiotic-resistant sessile biofilm communities and to communicate with small signaling molecules (quorum sensing [QS]). Our understanding of biofilms and QS arises primarily from in vitro studies of bacterial communities containing large numbers of cells, often greater than 108 bacteria; however, in nature, bacteria often reside in dense clusters (aggregates) consisting of significantly fewer cells. Indeed, bacterial clusters containing 101 to 105 cells are important for transmission of many bacterial pathogens. Here, we describe a versatile strategy for conducting mechanistic studies to interrogate the molecular processes controlling antibiotic resistance and QS-mediated virulence factor production in high-density bacterial clusters. This strategy involves enclosing a single bacterium within three-dimensional picoliter-scale microcavities (referred to as bacterial “lobster traps”) defined by walls that are permeable to nutrients, waste products, and other bioactive small molecules. Within these traps, bacteria divide normally into extremely dense (1012 cells/ml) clonal populations with final population sizes similar to that observed in naturally occurring bacterial clusters. Using these traps, we provide strong evidence that within low-cell-number/high-density bacterial clusters, QS is modulated not only by bacterial density but also by population size and flow rate of the surrounding medium. We also demonstrate that antibiotic resistance develops as cell density increases, with as few as ~150 confined bacteria exhibiting an antibiotic-resistant phenotype similar to biofilm bacteria. Together, these findings provide key insights into clinically relevant phenotypes in low-cell-number/high-density bacterial populations. PMID:21060734

  8. [Calcified aortic stenosis due to healed experimental bacterial endocarditis].

    PubMed

    Contreras Rodríguez, R; Rodríguez Velasco, A; Flores Miranda, J R; Ramos Amaro, J

    1993-01-01

    We studied the role of bacterial endocarditis in the development of aortic valve stenosis. A femoral arterio venous shunt was performed in nine dogs with the method previously proposed by Lillehei. We induced bacteremic infection with the administration of streptococcus mitis (1 x 10(10)) 10 ml once a day for 15 days these bacterium were sensible to penicillin. All dogs were treated with 1,000,000 U of benzatinic penicillin and sacrificed between 28-102 days after the bacterial inoculation ended. In one dog we observed bacterial endocarditis in the mitral and aortic valves and in other three dogs there was an aortic valve stenosis with calcium deposits in the body and in the free edges of the aortic valve with evident irregular stenosis as seen in man.

  9. The role of internal duplication in the evolution of multi-domain proteins.

    PubMed

    Nacher, J C; Hayashida, M; Akutsu, T

    2010-08-01

    Many proteins consist of several structural domains. These multi-domain proteins have likely been generated by selective genome growth dynamics during evolution to perform new functions as well as to create structures that fold on a biologically feasible time scale. Domain units frequently evolved through a variety of genetic shuffling mechanisms. Here we examine the protein domain statistics of more than 1000 organisms including eukaryotic, archaeal and bacterial species. The analysis extends earlier findings on asymmetric statistical laws for proteome to a wider variety of species. While proteins are composed of a wide range of domains, displaying a power-law decay, the computation of domain families for each protein reveals an exponential distribution, characterizing a protein universe composed of a thin number of unique families. Structural studies in proteomics have shown that domain repeats, or internal duplicated domains, represent a small but significant fraction of genome. In spite of its importance, this observation has been largely overlooked until recently. We model the evolutionary dynamics of proteome and demonstrate that these distinct distributions are in fact rooted in an internal duplication mechanism. This process generates the contemporary protein structural domain universe, determines its reduced thickness, and tames its growth. These findings have important implications, ranging from protein interaction network modeling to evolutionary studies based on fundamental mechanisms governing genome expansion.

  10. Proteins with an Euonymus lectin-like domain are ubiquitous in Embryophyta

    PubMed Central

    2009-01-01

    Background Cloning of the Euonymus lectin led to the discovery of a novel domain that also occurs in some stress-induced plant proteins. The distribution and the diversity of proteins with an Euonymus lectin (EUL) domain were investigated using detailed analysis of sequences in publicly accessible genome and transcriptome databases. Results Comprehensive in silico analyses indicate that the recently identified Euonymus europaeus lectin domain represents a conserved structural unit of a novel family of putative carbohydrate-binding proteins, which will further be referred to as the Euonymus lectin (EUL) family. The EUL domain is widespread among plants. Analysis of retrieved sequences revealed that some sequences consist of a single EUL domain linked to an unrelated N-terminal domain whereas others comprise two in tandem arrayed EUL domains. A new classification system for these lectins is proposed based on the overall domain architecture. Evolutionary relationships among the sequences with EUL domains are discussed. Conclusion The identification of the EUL family provides the first evidence for the occurrence in terrestrial plants of a highly conserved plant specific domain. The widespread distribution of the EUL domain strikingly contrasts the more limited or even narrow distribution of most other lectin domains found in plants. The apparent omnipresence of the EUL domain is indicative for a universal role of this lectin domain in plants. Although there is unambiguous evidence that several EUL domains possess carbohydrate-binding activity further research is required to corroborate the carbohydrate-binding properties of different members of the EUL family. PMID:19930663

  11. Domain structure, GTP-hydrolyzing activity and 7S RNA binding of Acidianus ambivalens ffh-homologous protein suggest an SRP-like complex in archaea.

    PubMed

    Moll, R; Schmidtke, S; Schäfer, G

    1999-01-01

    In this study we provide, for the first time, experimental evidence that a protein homologous to bacterial Ffh is part of an SRP-like ribonucleoprotein complex in hyperthermophilic archaea. The gene encoding the Ffh homologue in the hyperthermophilic archaeote Acidianus ambivalens has been cloned and sequenced. Recombinant Ffh protein was expressed in E. coli and subjected to biochemical and functional studies. A. ambivalens Ffh encodes a 50.4-kDa protein that is structured by three distinct regions: the N-terminal hydrophilic N-region (N), the GTP/GDP-binding domain (G) and a C-terminal located C-domain (C). The A. ambivalens Ffh sequence shares 44-46% sequence similarity with Ffh of methanogenic archaea, 34-36% similarity with eukaryal SRP54 and 30-34% similarity with bacterial Ffh. A polyclonal antiserum raised against the first two domains of A. ambivalens Ffh reacts specifically with a single protein (apparent molecular mass: 46 kDa, termed p46) present in cytosolic and in plasmamembrane cell fractions of A. ambivalens. Recombinant Ffh has a melting point of tm = 89 degreesC. Its intrinsic GTPase activity obviously depends on neutral pH and low ionic strength with a preference for chloride and acetate salts. Highest rates of GTP hydrolysis have been achieved at 81 degreesC in presence of 0.1-1 mm Mg2+. GTP hydrolysis is significantly inhibited by high glycerol concentrations, and the GTP hydrolysis rate also markedly decreases by addition of detergents. The Km for GTP is 13.7 microm at 70 degreesC and GTP hydrolysis is strongly inhibited by GDP (Ki = 8 microm). A. ambivalens Ffh, which includes an RNA-binding motif in the C-terminal domain, is shown to bind specifically to 7S RNA of the related crenarchaeote Sulfolobus solfataricus. Comparative sequence analysis reveals the presence of typical signal sequences in plasma membrane as well as extracellular proteins of hyperthermophilic crenarchaea which strongly supposes recognition events by an Ffh containing

  12. Evidence-based selection of theories for designing behaviour change interventions: using methods based on theoretical construct domains to understand clinicians' blood transfusion behaviour.

    PubMed

    Francis, Jill J; Stockton, Charlotte; Eccles, Martin P; Johnston, Marie; Cuthbertson, Brian H; Grimshaw, Jeremy M; Hyde, Chris; Tinmouth, Alan; Stanworth, Simon J

    2009-11-01

    Many theories of behaviour are potentially relevant to predictive and intervention studies but most studies investigate a narrow range of theories. Michie et al. (2005) agreed 12 'theoretical domains' from 33 theories that explain behaviour change. They developed a 'Theoretical Domains Interview' (TDI) for identifying relevant domains for specific clinical behaviours, but the framework has not been used for selecting theories for predictive studies. It was used here to investigate clinicians' transfusion behaviour in intensive care units (ICU). Evidence suggests that red blood cells transfusion could be reduced for some patients without reducing quality of care. (1) To identify the domains relevant to transfusion practice in ICUs and neonatal intensive care units (NICUs), using the TDI. (2) To use the identified domains to select appropriate theories for a study predicting transfusion behaviour. An adapted TDI about managing a patient with borderline haemoglobin by watching and waiting instead of transfusing red blood cells was used to conduct semi-structured, one-to-one interviews with 18 intensive care consultants and neonatologists across the UK. Relevant theoretical domains were: knowledge, beliefs about capabilities, beliefs about consequences, social influences, behavioural regulation. Further analysis at the construct level resulted in selection of seven theoretical approaches relevant to this context: Knowledge-Attitude-Behaviour Model, Theory of Planned Behaviour, Social Cognitive Theory, Operant Learning Theory, Control Theory, Normative Model of Work Team Effectiveness and Action Planning Approaches. This study illustrated, the use of the TDI to identify relevant domains in a complex area of inpatient care. This approach is potentially valuable for selecting theories relevant to predictive studies and resulted in greater breadth of potential explanations than would be achieved if a single theoretical model had been adopted.

  13. Critical domain interactions for type A RNase P RNA catalysis with and without the specificity domain

    PubMed Central

    Mao, Guanzhong; Srivastava, Abhishek S.; Wu, Shiying; Kosek, David; Lindell, Magnus

    2018-01-01

    The natural trans-acting ribozyme RNase P RNA (RPR) is composed of two domains in which the catalytic (C-) domain mediates cleavage of various substrates. The C-domain alone, after removal of the second specificity (S-) domain, catalyzes this reaction as well, albeit with reduced efficiency. Here we provide experimental evidence indicating that efficient cleavage mediated by the Escherichia coli C-domain (Eco CP RPR) with and without the C5 protein likely depends on an interaction referred to as the "P6-mimic". Moreover, the P18 helix connects the C- and S-domains between its loop and the P8 helix in the S-domain (the P8/ P18-interaction). In contrast to the "P6-mimic", the presence of P18 does not contribute to the catalytic performance by the C-domain lacking the S-domain in cleavage of an all ribo model hairpin loop substrate while deletion or disruption of the P8/ P18-interaction in full-size RPR lowers the catalytic efficiency in cleavage of the same model hairpin loop substrate in keeping with previously reported data using precursor tRNAs. Consistent with that P18 is not required for cleavage mediated by the C-domain we show that the archaeal Pyrococcus furiosus RPR C-domain, which lacks the P18 helix, is catalytically active in trans without the S-domain and any protein. Our data also suggest that the S-domain has a larger impact on catalysis for E. coli RPR compared to P. furiosus RPR. Finally, we provide data indicating that the absence of the S-domain and P18, or the P8/ P18-interaction in full-length RPR influences the charge distribution near the cleavage site in the RPR-substrate complex to a small but reproducible extent. PMID:29509761

  14. Taxonomic distribution, repeats, and functions of the S1 domain-containing proteins as members of the OB-fold family.

    PubMed

    Deryusheva, Evgeniia I; Machulin, Andrey V; Selivanova, Olga M; Galzitskaya, Oxana V

    2017-04-01

    Proteins of the nucleic acid-binding proteins superfamily perform such functions as processing, transport, storage, stretching, translation, and degradation of RNA. It is one of the 16 superfamilies containing the OB-fold in protein structures. Here, we have analyzed the superfamily of nucleic acid-binding proteins (the number of sequences exceeds 200,000) and obtained that this superfamily prevalently consists of proteins containing the cold shock DNA-binding domain (ca. 131,000 protein sequences). Proteins containing the S1 domain compose 57% from the cold shock DNA-binding domain family. Furthermore, we have found that the S1 domain was identified mainly in the bacterial proteins (ca. 83%) compared to the eukaryotic and archaeal proteins, which are available in the UniProt database. We have found that the number of multiple repeats of S1 domain in the S1 domain-containing proteins depends on the taxonomic affiliation. All archaeal proteins contain one copy of the S1 domain, while the number of repeats in the eukaryotic proteins varies between 1 and 15 and correlates with the protein size. In the bacterial proteins, the number of repeats is no more than 6, regardless of the protein size. The large variation of the repeat number of S1 domain as one of the structural variants of the OB-fold is a distinctive feature of S1 domain-containing proteins. Proteins from the other families and superfamilies have either one OB-fold or change slightly the repeat numbers. On the whole, it can be supposed that the repeat number is a vital for multifunctional activity of the S1 domain-containing proteins. Proteins 2017; 85:602-613. © 2016 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  15. Marine Bacterial and Archaeal Ion-Pumping Rhodopsins: Genetic Diversity, Physiology, and Ecology

    PubMed Central

    DeLong, Edward F.; Béjà, Oded; González, José M.; Pedrós-Alió, Carlos

    2016-01-01

    SUMMARY The recognition of a new family of rhodopsins in marine planktonic bacteria, proton-pumping proteorhodopsin, expanded the known phylogenetic range, environmental distribution, and sequence diversity of retinylidene photoproteins. At the time of this discovery, microbial ion-pumping rhodopsins were known solely in haloarchaea inhabiting extreme hypersaline environments. Shortly thereafter, proteorhodopsins and other light-activated energy-generating rhodopsins were recognized to be widespread among marine bacteria. The ubiquity of marine rhodopsin photosystems now challenges prior understanding of the nature and contributions of “heterotrophic” bacteria to biogeochemical carbon cycling and energy fluxes. Subsequent investigations have focused on the biophysics and biochemistry of these novel microbial rhodopsins, their distribution across the tree of life, evolutionary trajectories, and functional expression in nature. Later discoveries included the identification of proteorhodopsin genes in all three domains of life, the spectral tuning of rhodopsin variants to wavelengths prevailing in the sea, variable light-activated ion-pumping specificities among bacterial rhodopsin variants, and the widespread lateral gene transfer of biosynthetic genes for bacterial rhodopsins and their associated photopigments. Heterologous expression experiments with marine rhodopsin genes (and associated retinal chromophore genes) provided early evidence that light energy harvested by rhodopsins could be harnessed to provide biochemical energy. Importantly, some studies with native marine bacteria show that rhodopsin-containing bacteria use light to enhance growth or promote survival during starvation. We infer from the distribution of rhodopsin genes in diverse genomic contexts that different marine bacteria probably use rhodopsins to support light-dependent fitness strategies somewhere between these two extremes. PMID:27630250

  16. Bacterial Transcription as a Target for Antibacterial Drug Development

    PubMed Central

    Ma, Cong; Yang, Xiao

    2016-01-01

    SUMMARY Transcription, the first step of gene expression, is carried out by the enzyme RNA polymerase (RNAP) and is regulated through interaction with a series of protein transcription factors. RNAP and its associated transcription factors are highly conserved across the bacterial domain and represent excellent targets for broad-spectrum antibacterial agent discovery. Despite the numerous antibiotics on the market, there are only two series currently approved that target transcription. The determination of the three-dimensional structures of RNAP and transcription complexes at high resolution over the last 15 years has led to renewed interest in targeting this essential process for antibiotic development by utilizing rational structure-based approaches. In this review, we describe the inhibition of the bacterial transcription process with respect to structural studies of RNAP, highlight recent progress toward the discovery of novel transcription inhibitors, and suggest additional potential antibacterial targets for rational drug design. PMID:26764017

  17. The antigen 43 structure reveals a molecular Velcro-like mechanism of autotransporter-mediated bacterial clumping

    PubMed Central

    Heras, Begoña; Totsika, Makrina; Peters, Kate M.; Paxman, Jason J.; Gee, Christine L.; Jarrott, Russell J.; Perugini, Matthew A.; Whitten, Andrew E.; Schembri, Mark A.

    2014-01-01

    Aggregation and biofilm formation are critical mechanisms for bacterial resistance to host immune factors and antibiotics. Autotransporter (AT) proteins, which represent the largest group of outer-membrane and secreted proteins in Gram-negative bacteria, contribute significantly to these phenotypes. Despite their abundance and role in bacterial pathogenesis, most AT proteins have not been structurally characterized, and there is a paucity of detailed information with regard to their mode of action. Here we report the structure–function relationships of Antigen 43 (Ag43a), a prototypic self-associating AT protein from uropathogenic Escherichia coli. The functional domain of Ag43a displays a twisted L-shaped β-helical structure firmly stabilized by a 3D hydrogen-bonded scaffold. Notably, the distinctive Ag43a L shape facilitates self-association and cell aggregation. Combining all our data, we define a molecular “Velcro-like” mechanism of AT-mediated bacterial clumping, which can be tailored to fit different bacterial lifestyles such as the formation of biofilms. PMID:24335802

  18. Solution structure of the Big domain from Streptococcus pneumoniae reveals a novel Ca2+-binding module

    PubMed Central

    Wang, Tao; Zhang, Jiahai; Zhang, Xuecheng; Xu, Chao; Tu, Xiaoming

    2013-01-01

    Streptococcus pneumoniae is a pathogen causing acute respiratory infection, otitis media and some other severe diseases in human. In this study, the solution structure of a bacterial immunoglobulin-like (Big) domain from a putative S. pneumoniae surface protein SP0498 was determined by NMR spectroscopy. SP0498 Big domain adopts an eight-β-strand barrel-like fold, which is different in some aspects from the two-sheet sandwich-like fold of the canonical Ig-like domains. Intriguingly, we identified that the SP0498 Big domain was a Ca2+ binding domain. The structure of the Big domain is different from those of the well known Ca2+ binding domains, therefore revealing a novel Ca2+-binding module. Furthermore, we identified the critical residues responsible for the binding to Ca2+. We are the first to report the interactions between the Big domain and Ca2+ in terms of structure, suggesting an important role of the Big domain in many essential calcium-dependent cellular processes such as pathogenesis. PMID:23326635

  19. Structural and biochemical analysis of Escherichia coli ObgE, a central regulator of bacterial persistence.

    PubMed

    Gkekas, Sotirios; Singh, Ranjan Kumar; Shkumatov, Alexander V; Messens, Joris; Fauvart, Maarten; Verstraeten, Natalie; Michiels, Jan; Versées, Wim

    2017-04-07

    The Obg protein family belongs to the TRAFAC (translation factor) class of P-loop GTPases and is conserved from bacteria to eukaryotes. Essential roles in many different cellular processes have been suggested for the Obg protein from Escherichia coli (ObgE), and we recently showed that it is a central regulator of bacterial persistence. Here, we report the first crystal structure of ObgE at 1.85-Å resolution in the GDP-bound state, showing the characteristic N-terminal domain and a central G domain that are common to all Obg proteins. ObgE also contains an intrinsically disordered C-terminal domain, and we show here that this domain specifically contributed to GTP binding, whereas it did not influence GDP binding or GTP hydrolysis. Biophysical analysis, using small angle X-ray scattering and multi-angle light scattering experiments, revealed that ObgE is a monomer in solution, regardless of the bound nucleotide. In contrast to recent suggestions, our biochemical analyses further indicate that ObgE is neither activated by K + ions nor by homodimerization. However, the ObgE GTPase activity was stimulated upon binding to the ribosome, confirming the ribosome-dependent GTPase activity of the Obg family. Combined, our data represent an important step toward further unraveling the detailed molecular mechanism of ObgE, which might pave the way to further studies into how this GTPase regulates bacterial physiology, including persistence. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Domain 4 (D4) of Perfringolysin O to Visualize Cholesterol in Cellular Membranes-The Update.

    PubMed

    Maekawa, Masashi

    2017-03-03

    The cellular membrane of eukaryotes consists of phospholipids, sphingolipids, cholesterol and membrane proteins. Among them, cholesterol is crucial for various cellular events (e.g., signaling, viral/bacterial infection, and membrane trafficking) in addition to its essential role as an ingredient of steroid hormones, vitamin D, and bile acids. From a micro-perspective, at the plasma membrane, recent emerging evidence strongly suggests the existence of lipid nanodomains formed with cholesterol and phospholipids (e.g., sphingomyelin, phosphatidylserine). Thus, it is important to elucidate how cholesterol behaves in membranes and how the behavior of cholesterol is regulated at the molecular level. To elucidate the complexed characteristics of cholesterol in cellular membranes, a couple of useful biosensors that enable us to visualize cholesterol in cellular membranes have been recently developed by utilizing domain 4 (D4) of Perfringolysin O (PFO, theta toxin), a cholesterol-binding toxin. This review highlights the current progress on development of novel cholesterol biosensors that uncover new insights of cholesterol in cellular membranes.

  1. Bacterial prostatitis.

    PubMed

    Gill, Bradley C; Shoskes, Daniel A

    2016-02-01

    The review provides the infectious disease community with a urologic perspective on bacterial prostatitis. Specifically, the article briefly reviews the categorization of prostatitis by type and provides a distillation of new findings published on bacterial prostatitis over the past year. It also highlights key points from the established literature. Cross-sectional prostate imaging is becoming more common and may lead to more incidental diagnoses of acute bacterial prostatitis. As drug resistance remains problematic in this condition, the reemergence of older antibiotics such as fosfomycin, has proven beneficial. With regard to chronic bacterial prostatitis, no clear clinical risk factors emerged in a large epidemiological study. However, bacterial biofilm formation has been associated with more severe cases. Surgery has a limited role in bacterial prostatitis and should be reserved for draining of a prostatic abscess or the removal of infected prostatic stones. Prostatitis remains a common and bothersome clinical condition. Antibiotic therapy remains the basis of treatment for both acute and chronic bacterial prostatitis. Further research into improving prostatitis treatment is indicated.

  2. Detection of Intracellular Bacterial Communities in Human Urinary Tract Infection

    PubMed Central

    Rosen, David A; Hooton, Thomas M; Stamm, Walter E; Humphrey, Peter A; Hultgren, Scott J

    2007-01-01

    Background Urinary tract infections (UTIs) are one of the most common bacterial infections and are predominantly caused by uropathogenic Escherichia coli (UPEC). While UTIs are typically considered extracellular infections, it has been recently demonstrated that UPEC bind to, invade, and replicate within the murine bladder urothelium to form intracellular bacterial communities (IBCs). These IBCs dissociate and bacteria flux out of bladder facet cells, some with filamentous morphology, and ultimately establish quiescent intracellular reservoirs that can seed recurrent infection. This IBC pathogenic cycle has not yet been investigated in humans. In this study we sought to determine whether evidence of an IBC pathway could be found in urine specimens from women with acute UTI. Methods and Findings We collected midstream, clean-catch urine specimens from 80 young healthy women with acute uncomplicated cystitis and 20 asymptomatic women with a history of UTI. Investigators were blinded to culture results and clinical history. Samples were analyzed by light microscopy, immunofluorescence, and electron microscopy for evidence of exfoliated IBCs and filamentous bacteria. Evidence of IBCs was found in 14 of 80 (18%) urines from women with UTI. Filamentous bacteria were found in 33 of 80 (41%) urines from women with UTI. None of the 20 urines from the asymptomatic comparative group showed evidence of IBCs or filaments. Filamentous bacteria were present in all 14 of the urines with IBCs compared to 19 (29%) of 66 samples with no evidence of IBCs (p < 0.001). Of 65 urines from patients with E. coli infections, 14 (22%) had evidence of IBCs and 29 (45%) had filamentous bacteria, while none of the gram-positive infections had IBCs or filamentous bacteria. Conclusions The presence of exfoliated IBCs and filamentous bacteria in the urines of women with acute cystitis suggests that the IBC pathogenic pathway characterized in the murine model may occur in humans. The findings

  3. Bacterial Sialidase

    NASA Technical Reports Server (NTRS)

    2004-01-01

    Data shows that elevated sialidase in bacterial vaginosis patients correlates to premature births in women. Bacterial sialidase also plays a significant role in the unusual colonization of Pseudomonas aeruginosa in cystic fibrosis patients. Crystals of Salmonella sialidase have been reproduced and are used for studying the inhibitor-enzyme complexes. These inhibitors may also be used to inhibit a trans-sialidase of Trypanosome cruzi, a very similar enzyme to bacterial sialidase, therefore preventing T. cruzi infection, the causitive agent of Chagas' disease. The Center for Macromolecular Crystallography suggests that inhibitors of bacterial sialidases can be used as prophylactic drugs to prevent bacterial infections in these critical cases.

  4. Surgical treatment of neurologic complications of bacterial meningitis in children in Kosovo.

    PubMed

    Namani, Sadie A; Koci, Remzie A; Kuchar, Ernest; Dedushi, Kreshnike H

    2012-04-01

    Neurologic complications of bacterial meningitis can occur any time during the course of the disease and some of them need neurosurgical aproach. to determine the incidence of neurologic complications of bacterial meningitis in children requring neurosurgical treatment. a total of 277 children were followed and treated for bacterial meningitis at the Clinic of Infectious Diseases in Prishtina. The authors have analyzed cases who developed acute neurologic complications and treatment procedures. of the 277 children treated for bacterial meningitis, due to the suspicion for neurologic complications, 109 children underwent a head computerized tomography scan. About 47 cases (43%) had evident structural abnormalities while only 15/277 cases (5%) required neurosurgical treatment; 9/38 cases with subdural collections, 5 cases with hydrocephalus and 1 case of spinal abscess. Neurosurgical intervention were not common in pediatric bacterial meningitis cases (5%) but were highly significant in cases complicated with acute neurologic complications (32%).

  5. Contribution of trimeric autotransporter C-terminal domains of oligomeric coiled-coil adhesin (Oca) family members YadA, UspA1, EibA, and Hia to translocation of the YadA passenger domain and virulence of Yersinia enterocolitica.

    PubMed

    Ackermann, Nikolaus; Tiller, Maximilian; Anding, Gisela; Roggenkamp, Andreas; Heesemann, Jürgen

    2008-07-01

    The Oca family is a novel class of autotransporter-adhesins with highest structural similarity in their C-terminal transmembrane region, which supposedly builds a beta-barrel pore in the outer membrane (OM). The prototype of the Oca family is YadA, an adhesin of Yersinia enterocolitica and Yersinia pseudotuberculosis. YadA forms a homotrimeric lollipop-like structure on the bacterial surface. The C-terminal regions of three YadA monomers form a barrel in the OM and translocate the trimeric N-terminal passenger domain, consisting of stalk, neck, and head region to the exterior. To elucidate the structural and functional role of the C-terminal translocator domain (TLD) and to assess its promiscuous capability with respect to transport of related passenger domains, we constructed chimeric YadA proteins, which consist of the N-terminal YadA passenger domain and C-terminal TLDs of Oca family members UspA1 (Moraxella catarrhalis), EibA (Escherichia coli), and Hia (Haemophilus influenzae). These constructs were expressed in Y. enterocolitica and compared for OM localization, surface exposure, oligomerization, adhesion properties, serum resistance, and mouse virulence. We demonstrate that all chimeric YadA proteins translocated the YadA passenger domain across the OM. Y. enterocolitica strains producing YadA chimeras or wild-type YadA showed comparable binding to collagen and epithelial cells. However, strains producing YadA chimeras were attenuated in serum resistance and mouse virulence. These results demonstrate for the first time that TLDs of Oca proteins of different origin are efficient translocators of the YadA passenger domain and that the cognate TLD of YadA is essential for bacterial survival in human serum and mouse virulence.

  6. Structural Basis for Translocation of a Biofilm-supporting Exopolysaccharide across the Bacterial Outer Membrane.

    PubMed

    Wang, Yan; Andole Pannuri, Archana; Ni, Dongchun; Zhou, Haizhen; Cao, Xiou; Lu, Xiaomei; Romeo, Tony; Huang, Yihua

    2016-05-06

    The partially de-N-acetylated poly-β-1,6-N-acetyl-d-glucosamine (dPNAG) polymer serves as an intercellular biofilm adhesin that plays an essential role for the development and maintenance of integrity of biofilms of diverse bacterial species. Translocation of dPNAG across the bacterial outer membrane is mediated by a tetratricopeptide repeat-containing outer membrane protein, PgaA. To understand the molecular basis of dPNAG translocation, we determined the crystal structure of the C-terminal transmembrane domain of PgaA (residues 513-807). The structure reveals that PgaA forms a 16-strand transmembrane β-barrel, closed by four loops on the extracellular surface. Half of the interior surface of the barrel that lies parallel to the translocation pathway is electronegative, suggesting that the corresponding negatively charged residues may assist the secretion of the positively charged dPNAG polymer. In vivo complementation assays in a pgaA deletion bacterial strain showed that a cluster of negatively charged residues proximal to the periplasm is necessary for biofilm formation. Biochemical analyses further revealed that the tetratricopeptide repeat domain of PgaA binds directly to the N-deacetylase PgaB and is critical for biofilm formation. Our studies support a model in which the positively charged PgaB-bound dPNAG polymer is delivered to PgaA through the PgaA-PgaB interaction and is further targeted to the β-barrel lumen of PgaA potentially via a charge complementarity mechanism, thus priming the translocation of dPNAG across the bacterial outer membrane. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. An exceptional horizontal gene transfer in plastids: gene replacement by a distant bacterial paralog and evidence that haptophyte and cryptophyte plastids are sisters

    PubMed Central

    Rice, Danny W; Palmer, Jeffrey D

    2006-01-01

    Background Horizontal gene transfer (HGT) to the plant mitochondrial genome has recently been shown to occur at a surprisingly high rate; however, little evidence has been found for HGT to the plastid genome, despite extensive sequencing. In this study, we analyzed all genes from sequenced plastid genomes to unearth any neglected cases of HGT and to obtain a measure of the overall extent of HGT to the plastid. Results Although several genes gave strongly supported conflicting trees under certain conditions, we are confident of HGT in only a single case beyond the rubisco HGT already reported. Most of the conflicts involved near neighbors connected by long branches (e.g. red algae and their secondary hosts), where phylogenetic methods are prone to mislead. However, three genes – clpP, ycf2, and rpl36 – provided strong support for taxa moving far from their organismal position. Further taxon sampling of clpP and ycf2 resulted in rejection of HGT due to long-branch attraction and a serious error in the published plastid genome sequence of Oenothera elata, respectively. A single new case, a bacterial rpl36 gene transferred into the ancestor of the cryptophyte and haptophyte plastids, appears to be a true HGT event. Interestingly, this rpl36 gene is a distantly related paralog of the rpl36 type found in other plastids and most eubacteria. Moreover, the transferred gene has physically replaced the native rpl36 gene, yet flanking genes and intergenic regions show no sign of HGT. This suggests that gene replacement somehow occurred by recombination at the very ends of rpl36, without the level and length of similarity normally expected to support recombination. Conclusion The rpl36 HGT discovered in this study is of considerable interest in terms of both molecular mechanism and phylogeny. The plastid acquisition of a bacterial rpl36 gene via HGT provides the first strong evidence for a sister-group relationship between haptophyte and cryptophyte plastids to the

  8. Si(111) strained layers on Ge(111): Evidence for c (2 ×4 ) domains

    NASA Astrophysics Data System (ADS)

    Zhachuk, R.; Coutinho, J.; Dolbak, A.; Cherepanov, V.; Voigtländer, B.

    2017-08-01

    The tensile-strained Si (111 ) layers grown on top of Ge (111 ) substrates are studied by combining scanning tunneling microscopy, low-energy electron diffraction, and first-principles calculations. It is shown that the layers exhibit c (2 ×4 ) domains, which are separated by domain walls along <1 ¯10 > directions. A model structure for the c (2 ×4 ) domains is proposed, which shows low formation energy and good agreement with the experimental data. The results of our calculations suggest that Ge atoms are likely to replace Si atoms with dangling bonds on the surface (rest-atoms and adatoms), thus significantly lowering the surface energy and inducing the formation of domain walls. The experiments and calculations demonstrate that when surface strain changes from compressive to tensile, the (111) reconstruction converts from dimer-adatom-stacking fault-based to adatom-based structures.

  9. Crystal structure of a complex between the phosphorelay protein YPD1 and the response regulator domain of SLN1 bound to a phosphoryl analog

    PubMed Central

    Zhao, Xiaodong; Copeland, Daniel M.; Soares, Alexei S.; West, Ann H.

    2008-01-01

    Summary The crystal structure of the yeast SLN1 response regulator domain bound to both a phosphoryl analog (BeF3−) and Mg2+ ion in complex with its downstream phosphorelay signaling partner YPD1 has been determined at a resolution of 1.70 Å. Comparisons between the beryllium fluoride-activated complex and the unliganded (or apo) complex determined previously reveal modest but important differences. The SLN1-R1•Mg2+•BeF3− structure from the complex provides evidence for the first time that the mechanism of phosphorylation-induced activation is highly conserved between bacterial response regulator domains and this example from a eukaryotic organism. Residues in and around the active site undergo slight rearrangements in order to form bonds to the essential divalent cation and fluorine atoms of BeF3−. Two conserved switch-like residues (Thr 1173 and Phe 1192) occupy distinctly different positions in the apo- versus BeF3−-bound structures consistent with the “Y-T” coupling mechanism proposed for activation of CheY and other bacterial response regulators. Several loop regions and the α4-β5-α5 surface of the SLN1-R1 domain undergo subtle conformational changes (∼1-3 Å displacements relative to the apo-structure) that lead to significant changes in terms of contacts that are formed with YPD1. Detailed structural comparisons of protein-protein interactions in the apo- and BeF3−-bound complexes suggest at least a two-state equilibrium model for formation of a transient encounter complex, in which phosphorylation of the response regulator promotes the formation of a phosphotransfer-competent complex. In the BeF3−-activated complex, the position of His 64 from YPD1 is within ideal distance and near linear geometry with Asp 1144 from the SLN1-R1 domain for phosphotransfer to occur. The ground state structure presented here suggests that phosphoryl transfer will likely proceed through an associative mechanism involving formation of a

  10. Bacterial Actins.

    PubMed

    Izoré, Thierry; van den Ent, Fusinita

    2017-01-01

    A diverse set of protein polymers, structurally related to actin filaments contributes to the organization of bacterial cells as cytomotive or cytoskeletal filaments. This chapter describes actin homologs encoded by bacterial chromosomes. MamK filaments, unique to magnetotactic bacteria, help establishing magnetic biological compasses by interacting with magnetosomes. Magnetosomes are intracellular membrane invaginations containing biomineralized crystals of iron oxide that are positioned by MamK along the long-axis of the cell. FtsA is widespread across bacteria and it is one of the earliest components of the divisome to arrive at midcell, where it anchors the cell division machinery to the membrane. FtsA binds directly to FtsZ filaments and to the membrane through its C-terminus. FtsA shows altered domain architecture when compared to the canonical actin fold. FtsA's subdomain 1C replaces subdomain 1B of other members of the actin family and is located on the opposite side of the molecule. Nevertheless, when FtsA assembles into protofilaments, the protofilament structure is preserved, as subdomain 1C replaces subdomain IB of the following subunit in a canonical actin filament. MreB has an essential role in shape-maintenance of most rod-shaped bacteria. Unusually, MreB filaments assemble from two protofilaments in a flat and antiparallel arrangement. This non-polar architecture implies that both MreB filament ends are structurally identical. MreB filaments bind directly to membranes where they interact with both cytosolic and membrane proteins, thereby forming a key component of the elongasome. MreB filaments in cells are short and dynamic, moving around the long axis of rod-shaped cells, sensing curvature of the membrane and being implicated in peptidoglycan synthesis.

  11. Bacterial streamers in curved microchannels

    NASA Astrophysics Data System (ADS)

    Rusconi, Roberto; Lecuyer, Sigolene; Guglielmini, Laura; Stone, Howard

    2009-11-01

    Biofilms, generally identified as microbial communities embedded in a self-produced matrix of extracellular polymeric substances, are involved in a wide variety of health-related problems ranging from implant-associated infections to disease transmissions and dental plaque. The usual picture of these bacterial films is that they grow and develop on surfaces. However, suspended biofilm structures, or streamers, have been found in natural environments (e.g., rivers, acid mines, hydrothermal hot springs) and are always suggested to stem from a turbulent flow. We report the formation of bacterial streamers in curved microfluidic channels. By using confocal laser microscopy we are able to directly image and characterize the spatial and temporal evolution of these filamentous structures. Such streamers, which always connect the inner corners of opposite sides of the channel, are always located in the middle plane. Numerical simulations of the flow provide evidences for an underlying hydrodynamic mechanism behind the formation of the streamers.

  12. Bacterial flagella grow through an injection-diffusion mechanism

    PubMed Central

    Renault, Thibaud T; Abraham, Anthony O; Bergmiller, Tobias; Paradis, Guillaume; Rainville, Simon; Charpentier, Emmanuelle; Guet, Călin C; Tu, Yuhai; Namba, Keiichi; Keener, James P; Minamino, Tohru; Erhardt, Marc

    2017-01-01

    The bacterial flagellum is a self-assembling nanomachine. The external flagellar filament, several times longer than a bacterial cell body, is made of a few tens of thousands subunits of a single protein: flagellin. A fundamental problem concerns the molecular mechanism of how the flagellum grows outside the cell, where no discernible energy source is available. Here, we monitored the dynamic assembly of individual flagella using in situ labelling and real-time immunostaining of elongating flagellar filaments. We report that the rate of flagellum growth, initially ∼1,700 amino acids per second, decreases with length and that the previously proposed chain mechanism does not contribute to the filament elongation dynamics. Inhibition of the proton motive force-dependent export apparatus revealed a major contribution of substrate injection in driving filament elongation. The combination of experimental and mathematical evidence demonstrates that a simple, injection-diffusion mechanism controls bacterial flagella growth outside the cell. DOI: http://dx.doi.org/10.7554/eLife.23136.001 PMID:28262091

  13. Bacterial flagella grow through an injection-diffusion mechanism.

    PubMed

    Renault, Thibaud T; Abraham, Anthony O; Bergmiller, Tobias; Paradis, Guillaume; Rainville, Simon; Charpentier, Emmanuelle; Guet, Călin C; Tu, Yuhai; Namba, Keiichi; Keener, James P; Minamino, Tohru; Erhardt, Marc

    2017-03-06

    The bacterial flagellum is a self-assembling nanomachine. The external flagellar filament, several times longer than a bacterial cell body, is made of a few tens of thousands subunits of a single protein: flagellin. A fundamental problem concerns the molecular mechanism of how the flagellum grows outside the cell, where no discernible energy source is available. Here, we monitored the dynamic assembly of individual flagella using in situ labelling and real-time immunostaining of elongating flagellar filaments. We report that the rate of flagellum growth, initially ∼1,700 amino acids per second, decreases with length and that the previously proposed chain mechanism does not contribute to the filament elongation dynamics. Inhibition of the proton motive force-dependent export apparatus revealed a major contribution of substrate injection in driving filament elongation. The combination of experimental and mathematical evidence demonstrates that a simple, injection-diffusion mechanism controls bacterial flagella growth outside the cell.

  14. Structural basis for methylesterase CheB regulation by a phosphorylation-activated domain

    PubMed Central

    Djordjevic, Snezana; Goudreau, Paul N.; Xu, Qingping; Stock, Ann M.; West, Ann H.

    1998-01-01

    We report the x-ray crystal structure of the methylesterase CheB, a phosphorylation-activated response regulator involved in reversible modification of bacterial chemotaxis receptors. Methylesterase CheB and methyltransferase CheR modulate signaling output of the chemotaxis receptors by controlling the level of receptor methylation. The structure of CheB, which consists of an N-terminal regulatory domain and a C-terminal catalytic domain joined by a linker, was solved by molecular replacement methods using independent search models for the two domains. In unphosphorylated CheB, the N-terminal domain packs against the active site of the C-terminal domain and thus inhibits methylesterase activity by directly restricting access to the active site. We propose that phosphorylation of CheB induces a conformational change in the regulatory domain that disrupts the domain interface, resulting in a repositioning of the domains and allowing access to the active site. Structural similarity between the two companion receptor modification enzymes, CheB and CheR, suggests an evolutionary and/or functional relationship. Specifically, the phosphorylated N-terminal domain of CheB may facilitate interaction with the receptors, similar to the postulated role of the N-terminal domain of CheR. Examination of surfaces in the N-terminal regulatory domain of CheB suggests that despite a common fold throughout the response regulator family, surfaces used for protein–protein interactions differ significantly. Comparison between CheB and other response regulators indicates that analogous surfaces are used for different functions and conversely, similar functions are mediated by different molecular surfaces. PMID:9465023

  15. Functional analysis of conserved aromatic amino acids in the discoidin domain of Paenibacillus β-1,3-glucanase

    PubMed Central

    2009-01-01

    The 190-kDa Paenibacillus β-1,3-glucanase (LamA) contains a catalytic module of the glycoside hydrolase family 16 (GH16) and several auxiliary domains. Of these, a discoidin domain (DS domain), present in both eukaryotic and prokaryotic proteins with a wide variety of functions, exists at the carboxyl-terminus. To better understand the bacterial DS domain in terms of its structure and function, this domain alone was expressed in Escherichia coli and characterized. The results indicate that the DS domain binds various polysaccharides and enhances the biological activity of the GH16 module on composite substrates. We also investigated the importance of several conserved aromatic residues in the domain's stability and substrate-binding affinity. Both were affected by mutations of these residues; however, the effect on protein stability was more notable. In particular, the forces contributed by a sandwiched triad (W1688, R1756, and W1729) were critical for the presumable β-sandwich fold. PMID:19930717

  16. Composition and development of oral bacterial communities.

    PubMed

    Palmer, Robert J

    2014-02-01

    The oral bacterial microbiome encompasses approximately 700 commonly occurring phylotypes, approximately half of which can be present at any time in any individual. These bacteria are largely indigenous to the oral cavity; this limited habitat range suggests that interactions between the various phylotypes, and between the phylotypes and their environment, are crucial for their existence. Molecular cataloging has confirmed many basic observations on the composition of the oral microbiome that were formulated well before ribosomal RNA-based systematics, but the power and the scope of molecular taxonomy have resulted in the discovery of new phylotypes and, more importantly, have made possible a level of bacterial community analysis that was unachievable with classical methods. Bacterial community structure varies with location within the mouth, and changes in community structure are related to disease initiation and disease progression. Factors that influence the formation and the evolution of communities include selective adherence to epithelial or tooth surfaces, specific cell-to-cell binding as a driver of early community composition, and interorganismal interaction leading to alteration of the local environment, which represents the first step on the road to oral disease. A comprehensive understanding of how these factors interact to drive changes in the composition of the oral microbial community can lead to new strategies for the inhibition of periodontal diseases and dental caries. Published 2013. This article is a US Government work and is in the public domain in the USA.

  17. Root bacterial endophytes alter plant phenotype, but not physiology

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Henning, Jeremiah A.; Weston, David J.; Pelletier, Dale A.

    Plant traits, such as root and leaf area, influence how plants interact with their environment and the diverse microbiota living within plants can influence plant morphology and physiology. Here, we explored how three bacterial strains isolated from the Populus root microbiome, influenced plant phenotype. Here, we chose three bacterial strains that differed in predicted metabolic capabilities, plant hormone production and metabolism, and secondary metabolite synthesis. We inoculated each bacterial strain on a single genotype of Populus trichocarpa and measured the response of plant growth related traits (root:shoot, biomass production, root and leaf growth rates) and physiological traits (chlorophyll content, netmore » photosynthesis, net photosynthesis at saturating light–A sat, and saturating CO 2–A max). Overall, we found that bacterial root endophyte infection increased root growth rate up to 184% and leaf growth rate up to 137% relative to non-inoculated control plants, evidence that plants respond to bacteria by modifying morphology. However, endophyte inoculation had no influence on total plant biomass and photosynthetic traits (net photosynthesis, chlorophyll content). In sum, bacterial inoculation did not significantly increase plant carbon fixation and biomass, but their presence altered where and how carbon was being allocated in the plant host.« less

  18. Root bacterial endophytes alter plant phenotype, but not physiology

    DOE PAGES

    Henning, Jeremiah A.; Weston, David J.; Pelletier, Dale A.; ...

    2016-11-01

    Plant traits, such as root and leaf area, influence how plants interact with their environment and the diverse microbiota living within plants can influence plant morphology and physiology. Here, we explored how three bacterial strains isolated from the Populus root microbiome, influenced plant phenotype. Here, we chose three bacterial strains that differed in predicted metabolic capabilities, plant hormone production and metabolism, and secondary metabolite synthesis. We inoculated each bacterial strain on a single genotype of Populus trichocarpa and measured the response of plant growth related traits (root:shoot, biomass production, root and leaf growth rates) and physiological traits (chlorophyll content, netmore » photosynthesis, net photosynthesis at saturating light–A sat, and saturating CO 2–A max). Overall, we found that bacterial root endophyte infection increased root growth rate up to 184% and leaf growth rate up to 137% relative to non-inoculated control plants, evidence that plants respond to bacteria by modifying morphology. However, endophyte inoculation had no influence on total plant biomass and photosynthetic traits (net photosynthesis, chlorophyll content). In sum, bacterial inoculation did not significantly increase plant carbon fixation and biomass, but their presence altered where and how carbon was being allocated in the plant host.« less

  19. Archaeal and bacterial H-GDGTs are abundant in peat and their relative abundance is positively correlated with temperature

    NASA Astrophysics Data System (ADS)

    Naafs, B. D. A.; McCormick, D.; Inglis, G. N.; Pancost, R. D.; T-GRES Peat Database Collaborators

    2018-04-01

    Glycerol monoalkyl glycerol tetraether lipids (GMGTs; also called 'H-GDGTs') differ from the more commonly studied glycerol dialkyl glycerol tetraether (GDGTs) in that they have an additional covalent bond that links the two alkyl chains. Six different archaeal isoprenoidal H-GDGTs (H-isoGDGTs) and one branched H-GDGT (H-brGDGT), presumably produced by bacteria, have previously been found. However, the function of H-GDGTs in both domains of life is unknown. It is thought that the formation of this additional covalent bond results in enhanced membrane stability, accounting for the high abundance of H-GDGTs in extreme environments such as geothermal settings, but so far there has been little evidence to support this hypothesis. Here we report the distribution of H-GDGTs in a global peat database (n = 471) with a broad range in mean annual air temperature (MAAT) and pH. This is the first finding of H-GDGTs in soils (specifically, peat), highlighting that H-GDGTs are widespread in mesophilic settings. In addition, we report the presence of two new H-brGDGTs with one (H-1034) and two (H-1048) additional methyl groups, respectively. Our results suggest that the relative abundance of both bacterial and archaeal H-GDGTs compared to regular GDGTs is related to temperature with the highest relative abundance of H-GDGTs in tropical peats. Although other factors besides temperature likely also play a role, these results do support the hypothesis that H-GDGTs are an adaptation to temperature to maintain membrane stability. The observation that both bacterial and archaeal membrane lipids respond to temperature indicates the same adaption across the lipid divide between these two domains of life, suggesting parallel or convergent evolution (potentially facilitated by lateral gene transfer).

  20. Bacterial incorporation of leucine into protein down to -20 degrees C with evidence for potential activity in sub-eutectic saline ice formations.

    PubMed

    Junge, Karen; Eicken, Hajo; Swanson, Brian D; Deming, Jody W

    2006-06-01

    Direct evidence for metabolism in a variety of frozen environments has pushed temperature limits for bacterial activity to increasingly lower temperatures, so far to -20 degrees C. To date, the metabolic activities of marine psychrophilic bacteria, important components of sea-ice communities, have not been studied in laboratory culture, not in ice and not below -12 degrees C. We measured [3H]-leucine incorporation into macromolecules (further fractionated biochemically) by the marine psychrophilic bacterium Colwellia psychrerythraea strain 34H over a range of anticipated activity-permissive temperatures, from +13 to -20 degrees C, including expected negative controls at -80 and -196 degrees C. For incubation temperatures below -1 degrees C, the cell suspensions [all in artificial seawater (ASW)] were first quick-frozen in liquid nitrogen. We also examined the effect of added extracellular polymeric substances (EPS) on [3H]-leucine incorporation. Results showed that live cells of strain 34H incorporated substantial amounts of [3H]-leucine into TCA-precipitable material (primarily protein) down to -20 degrees C. At temperatures from -1 to -20 degrees C, rates were enhanced by EPS. No activity was detected in the killed controls for strain 34H (or in Escherichia coli controls), which included TCA-killed, heat-killed, and sodium azide- and chloramphenicol-treated samples. Surprisingly, evidence for low but significant rates of intracellular incorporation of [3H]-leucine into protein was observed for both ASW-only and EPS-amended (and live only) samples incubated at -80 and -196 degrees C. Mechanisms that could explain the latter results require further study, but the process of vitrification promoted by rapid freezing and the presence of salts and organic polymers may be relevant. Overall, distinguishing between intracellular and extracellular aspects of bacterial activity appears important to understanding behavior at sub-freezing temperatures.

  1. New evidence for hybrid acrylic/TiO2 films inducing bacterial inactivation under low intensity simulated sunlight.

    PubMed

    Bonnefond, Audrey; González, Edurne; Asua, Jose María; Leiza, Jose Ramon; Kiwi, John; Pulgarin, Cesar; Rtimi, Sami

    2015-11-01

    This study addresses the preparation and characterization of hybrid films prepared from Titanium dioxide (TiO2) Pickering stabilized acrylic polymeric dispersion as well as their bacterial inactivation efficiency under sunlight irradiation. Complete bacterial inactivation under low intensity simulated solar light irradiation (55 mW/cm(2)) was observed within 240 min for the films containing 10 weight based on monomers (wbm) % of TiO2, whereas 360 min were needed for the films containing 20 wbm% of TiO2. The hybrid films showed repetitive Escherichia coli (E. coli) inactivation under light irradiation. TiO2 released from the films surfaces was measured by inductively coupled plasma mass spectrometry (IPC-MS), obtaining values of ∼ 0.5 and 1 ppb/cm(2) for the films containing 10 wbm% and 20 wbm% of TiO2, respectively, far below the allowed cytotoxicity level for TiO2 (200 ppb). Transmission electron microscopy (TEM) of the hybrid films showed that TiO2 nanoparticles (NPs) were located at the polymer particle's surface forming a continuous inorganic network inside the film matrix. Atomic force microscopy (AFM) images showed differences in the TiO2 dispersion between the air-film and film-substrate interfaces. Films containing 10 wbm% of TiO2 had higher roughness (Rg) at both interfaces than the one containing 20 wbm% of TiO2 inducing an increase in the bacterial adhesion as well as the bacterial inactivation kinetics. The highly oxidative OH-radicals participating in the bacterial inactivation were determined by fluorescence. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Limiting Speed of the Bacterial Flagellar Motor

    NASA Astrophysics Data System (ADS)

    Nirody, Jasmine; Berry, Richard; Oster, George

    The bacterial flagellar motor (BFM) drives swimming in a wide variety of bacterial species, making it crucial for several fundamental biological processes including chemotaxis and community formation. Recent experiments have shown that the structure of this nanomachine is more dynamic than previously believed. Specifically, the number of active torque-generating units (stators) was shown to vary across applied loads. This finding invalidates the experimental evidence reporting that limiting (zero-torque) speed is independent of the number of active stators. Here, we put forward a model for the torque generation mechanism of this motor and propose that the maximum speed of the motor increases as additional torque-generators are recruited. This is contrary to the current widely-held belief that there is a universal upper limit to the speed of the BFM. Our result arises from the assumption that stators disengage from the motor for a significant portion of their mechanochemical cycles at low loads. We show that this assumption is consistent with current experimental evidence and consolidate our predictions with arguments that a processive motor must have a high duty ratio at high loads.

  3. Pharmacological Interventions for the MATRICS Cognitive Domains in Schizophrenia: What’s the Evidence?

    PubMed Central

    Vingerhoets, Wilhelmina A. M.; Bloemen, Oswald J. N.; Bakker, Geor; van Amelsvoort, Therese A. M. J.

    2013-01-01

    Schizophrenia is a disabling, chronic psychiatric disorder with a prevalence rate of 0.5–1% in the general population. Symptoms include positive (e.g., delusions, hallucinations), negative (e.g., blunted affect, social withdrawal), as well as cognitive symptoms (e.g., memory and attention problems). Although 75–85% of patients with schizophrenia report cognitive impairments, the underlying neuropharmacological mechanisms are not well understood and currently no effective treatment is available for these impairments. This has led to the Measurement and Treatment Research to Improve Cognition in Schizophrenia (MATRICS) initiative, which established seven cognitive domains that are fundamentally impaired in schizophrenia. These domains include verbal learning and memory, visual learning and memory, working memory, attention and vigilance, processing speed, reasoning and problem solving, and social cognition. Recently, a growing number of studies have been conducted trying to identify the underlying neuropharmacological mechanisms of cognitive impairments in schizophrenia patients. Specific cognitive impairments seem to arise from different underlying neuropharmacological mechanisms. However, most review articles describe cognition in general and an overview of the mechanisms involved in these seven separate cognitive domains is currently lacking. Therefore, we reviewed the underlying neuropharmacological mechanisms focusing on the domains as established by the MATRICS initiative which are considered most crucial in schizophrenia. PMID:24363646

  4. Non-bacterial etiologies of diarrheal diseases in Afghanistan.

    PubMed

    Elyan, Diaa; Wasfy, Momtaz; El Mohammady, Hanan; Hassan, Khaled; Monestersky, Jesse; Noormal, Bashir; Oyofo, Buhari

    2014-08-01

    Microbial diarrheal diseases are one of the leading causes of child morbidity and mortality in developing countries. This study aimed to identify the main causes of non-bacterial diarrhea in Afghanistan. A total of 699 stools were collected from children aged under 5 years who presented with diarrhea at Indira Gandhi and Kandahar hospitals. Frozen aliquots were preserved for screening against rotavirus, astrovirus, adenovirus, norovirus, Cryptosporidium and Giardia, when bacterial cultures tested negative. Tests were performed at the hospitals after laboratory staff were trained and provided with enzyme-immunoassays and equipment. Results were confirmed at the U.S. Naval Medical Research Unit No. 3, Cairo, Egypt. Of the samples tested, 71.9% (503/699) were infected with one or more pathogens. However, the majority (85.8%; 432/503) showed single infections: rotavirus (72.2%; 329/432), Cryptosporidium (14.1%; 61/432), Giardia (5.1%; 22/432), astrovirus (2.3%; 10/432), adenovirus (1.6%; 7/432) and norovirus (0.7%; 3/432). The remaining 14% (71/503) showed mixed infections of the tested pathogens. Non-bacterial pathogens were identified that could enable health officials to adopt more effective treatment and control measures for diarrhea in Afghanistan. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene 2014. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  5. Mechanism of Mediator recruitment by tandem Gcn4 activation domains and three Gal11 activator-binding domains.

    PubMed

    Herbig, Eric; Warfield, Linda; Fish, Lisa; Fishburn, James; Knutson, Bruce A; Moorefield, Beth; Pacheco, Derek; Hahn, Steven

    2010-05-01

    Targets of the tandem Gcn4 acidic activation domains in transcription preinitiation complexes were identified by site-specific cross-linking. The individual Gcn4 activation domains cross-link to three common targets, Gal11/Med15, Taf12, and Tra1, which are subunits of four conserved coactivator complexes, Mediator, SAGA, TFIID, and NuA4. The Gcn4 N-terminal activation domain also cross-links to the Mediator subunit Sin4/Med16. The contribution of the two Gcn4 activation domains to transcription was gene specific and varied from synergistic to less than additive. Gcn4-dependent genes had a requirement for Gal11 ranging from 10-fold dependence to complete Gal11 independence, while the Gcn4-Taf12 interaction did not significantly contribute to the expression of any gene studied. Complementary methods identified three conserved Gal11 activator-binding domains that bind each Gcn4 activation domain with micromolar affinity. These Gal11 activator-binding domains contribute additively to transcription activation and Mediator recruitment at Gcn4- and Gal11-dependent genes. Although we found that the conserved Gal11 KIX domain contributes to Gal11 function, we found no evidence of specific Gcn4-KIX interaction and conclude that the Gal11 KIX domain does not function by specific interaction with Gcn4. Our combined results show gene-specific coactivator requirements, a surprising redundancy in activator-target interactions, and an activator-coactivator interaction mediated by multiple low-affinity protein-protein interactions.

  6. Domain Shuffling in a Sensor Protein Contributed to the Evolution of Insect Pathogenicity in Plant-Beneficial Pseudomonas protegens

    PubMed Central

    Kupferschmied, Peter; Péchy-Tarr, Maria; Imperiali, Nicola; Maurhofer, Monika; Keel, Christoph

    2014-01-01

    Pseudomonas protegens is a biocontrol rhizobacterium with a plant-beneficial and an insect pathogenic lifestyle, but it is not understood how the organism switches between the two states. Here, we focus on understanding the function and possible evolution of a molecular sensor that enables P. protegens to detect the insect environment and produce a potent insecticidal toxin specifically during insect infection but not on roots. By using quantitative single cell microscopy and mutant analysis, we provide evidence that the sensor histidine kinase FitF is a key regulator of insecticidal toxin production. Our experimental data and bioinformatic analyses indicate that FitF shares a sensing domain with DctB, a histidine kinase regulating carbon uptake in Proteobacteria. This suggested that FitF has acquired its specificity through domain shuffling from a common ancestor. We constructed a chimeric DctB-FitF protein and showed that it is indeed functional in regulating toxin expression in P. protegens. The shuffling event and subsequent adaptive modifications of the recruited sensor domain were critical for the microorganism to express its potent insect toxin in the observed host-specific manner. Inhibition of the FitF sensor during root colonization could explain the mechanism by which P. protegens differentiates between the plant and insect host. Our study establishes FitF of P. protegens as a prime model for molecular evolution of sensor proteins and bacterial pathogenicity. PMID:24586167

  7. Interventions for treating bacterial vaginosis in pregnancy.

    PubMed

    Brocklehurst, P; Hannah, M; McDonald, H

    2000-01-01

    Bacterial vaginosis has been associated with poor perinatal outcome. Since the infections are amenable to treatment, identification during pregnancy and treatment may reduce the risk of preterm birth and its consequences. The objective of this review was to assess the effects of antibiotic treatment of bacterial vaginosis in pregnancy. We searched the Cochrane Pregnancy and Childbirth Group trials register and the Cochrane Controlled Trials Register. Randomised trials comparing one antibiotic regimen with placebo or no treatment, or which compare two or more alternative antibiotic regimens in pregnant women with bacterial vaginosis. Trial quality assessments and data extraction were done independently by three reviewers. Study authors were contacted for additional information. Five trials involving 1504 women were included. These trials were of good quality. Antibiotic therapy was highly effective at eradicating infection during pregnancy as judged by 'test-of-cure' following therapy (odds ratio 0.22, 95% confidence interval 0.17 to 0.27). The effect of treating bacterial vaginosis during pregnancy showed a trend to less births before 37 weeks gestation (odds ratio 0.78, 95% confidence interval 0.60 to 1.02). The prevention of preterm birth less than 37 weeks gestation was most marked in the subgroup of women with a previous preterm birth (odds ratio 0.37, 95% confidence interval 0.23 to 0. 60). The current evidence does not support screening and treating all pregnant women for bacterial vaginosis to prevent preterm birth and its consequences. For women with a history of a previous preterm birth there is some suggestion that detection and treatment of bacterial vaginosis early in pregnancy may prevent a proportion of these women having a further preterm birth. It is not known whether this is associated with an improvement in neonatal well-being.

  8. The crystal structure of the streptococcal collagen-like protein 2 globular domain from invasive M3-type group A Streptococcus shows significant similarity to immunomodulatory HIV protein gp41.

    PubMed

    Squeglia, Flavia; Bachert, Beth; De Simone, Alfonso; Lukomski, Slawomir; Berisio, Rita

    2014-02-21

    The arsenal of virulence factors deployed by streptococci includes streptococcal collagen-like (Scl) proteins. These proteins, which are characterized by a globular domain and a collagen-like domain, play key roles in host adhesion, host immune defense evasion, and biofilm formation. In this work, we demonstrate that the Scl2.3 protein is expressed on the surface of invasive M3-type strain MGAS315 of Streptococcus pyogenes. We report the crystal structure of Scl2.3 globular domain, the first of any Scl. This structure shows a novel fold among collagen trimerization domains of either bacterial or human origin. Despite there being low sequence identity, we observed that Scl2.3 globular domain structurally resembles the gp41 subunit of the envelope glycoprotein from human immunodeficiency virus type 1, an essential subunit for viral fusion to human T cells. We combined crystallographic data with modeling and molecular dynamics techniques to gather information on the entire lollipop-like Scl2.3 structure. Molecular dynamics data evidence a high flexibility of Scl2.3 with remarkable interdomain motions that are likely instrumental to the protein biological function in mediating adhesive or immune-modulatory functions in host-pathogen interactions. Altogether, our results provide molecular tools for the understanding of Scl-mediated streptococcal pathogenesis and important structural insights for the future design of small molecular inhibitors of streptococcal invasion.

  9. Mutations in the FMN domain modulate MCD spectra of the heme site in the oxygenase domain of inducible nitric oxide synthase.

    PubMed

    Sempombe, Joseph; Elmore, Bradley O; Sun, Xi; Dupont, Andrea; Ghosh, Dipak K; Guillemette, J Guy; Kirk, Martin L; Feng, Changjian

    2009-05-27

    The nitric oxide synthase (NOS) output state for NO production is a complex of the flavin mononucleotide (FMN)-binding domain and the heme domain, and thereby it facilitates the interdomain electron transfer from the FMN to the catalytic heme site. Emerging evidence suggests that interdomain FMN-heme interactions are important in the formation of the output state because they guide the docking of the FMN domain to the heme domain. In this study, notable effects of mutations in the adjacent FMN domain on the heme structure in a human iNOS bidomain oxygenase/FMN construct have been observed by using low-temperature magnetic circular dichroism (MCD) spectroscopy. The comparative MCD study of wild-type and mutant proteins clearly indicates that a properly docked FMN domain contributes to the observed L-Arg perturbation of the heme MCD spectrum in the wild-type protein and that the conserved surface residues in the FMN domain (E546 and E603) play key roles in facilitating a productive alignment of the FMN and heme domains in iNOS.

  10. Novel division level bacterial diversity in a Yellowstone hot spring.

    PubMed

    Hugenholtz, P; Pitulle, C; Hershberger, K L; Pace, N R

    1998-01-01

    A culture-independent molecular phylogenetic survey was carried out for the bacterial community in Obsidian Pool (OP), a Yellowstone National Park hot spring previously shown to contain remarkable archaeal diversity (S. M. Barns, R. E. Fundyga, M. W. Jeffries, and N. R. Page, Proc. Natl. Acad. Sci. USA 91:1609-1613, 1994). Small-subunit rRNA genes (rDNA) were amplified directly from OP sediment DNA by PCR with universally conserved or Bacteria-specific rDNA primers and cloned. Unique rDNA types among > 300 clones were identified by restriction fragment length polymorphism, and 122 representative rDNA sequences were determined. These were found to represent 54 distinct bacterial sequence types or clusters (> or = 98% identity) of sequences. A majority (70%) of the sequence types were affiliated with 14 previously recognized bacterial divisions (main phyla; kingdoms); 30% were unaffiliated with recognized bacterial divisions. The unaffiliated sequence types (represented by 38 sequences) nominally comprise 12 novel, division level lineages termed candidate divisions. Several OP sequences were nearly identical to those of cultivated chemolithotrophic thermophiles, including the hydrogen-oxidizing Calderobacterium and the sulfate reducers Thermodesulfovibrio and Thermodesulfobacterium, or belonged to monophyletic assemblages recognized for a particular type of metabolism, such as the hydrogen-oxidizing Aquificales and the sulfate-reducing delta-Proteobacteria. The occurrence of such organisms is consistent with the chemical composition of OP (high in reduced iron and sulfur) and suggests a lithotrophic base for primary productivity in this hot spring, through hydrogen oxidation and sulfate reduction. Unexpectedly, no archaeal sequences were encountered in OP clone libraries made with universal primers. Hybridization analysis of amplified OP DNA with domain-specific probes confirmed that the analyzed community rDNA from OP sediment was predominantly bacterial. These

  11. Evaluation of Selected Binding Domains for the Analysis of Ubiquitinated Proteomes

    NASA Astrophysics Data System (ADS)

    Nakayasu, Ernesto S.; Ansong, Charles; Brown, Joseph N.; Yang, Feng; Lopez-Ferrer, Daniel; Qian, Wei-Jun; Smith, Richard D.; Adkins, Joshua N.

    2013-08-01

    Ubiquitination is an abundant post-translational modification that consists of covalent attachment of ubiquitin to lysine residues or the N-terminus of proteins. Mono- and polyubiquitination have been shown to be involved in many critical eukaryotic cellular functions and are often disrupted by intracellular bacterial pathogens. Affinity enrichment of ubiquitinated proteins enables global analysis of this key modification. In this context, the use of ubiquitin-binding domains is a promising but relatively unexplored alternative to more broadly used immunoaffinity or tagged affinity enrichment methods. In this study, we evaluated the application of eight ubiquitin-binding domains that have differing affinities for ubiquitination states. Small-scale proteomics analysis identified ~200 ubiquitinated protein candidates per ubiquitin-binding domain pull-down experiment. Results from subsequent Western blot analyses that employed anti-ubiquitin or monoclonal antibodies against polyubiquitination at lysine 48 and 63 suggest that ubiquitin-binding domains from Dsk2 and ubiquilin-1 have the broadest specificity in that they captured most types of ubiquitination, whereas the binding domain from NBR1 was more selective to polyubiquitination. These data demonstrate that with optimized purification conditions, ubiquitin-binding domains can be an alternative tool for proteomic applications. This approach is especially promising for the analysis of tissues or cells resistant to transfection, of which the overexpression of tagged ubiquitin is a major hurdle.

  12. Evaluation of selected binding domains for the analysis of ubiquitinated proteomes

    PubMed Central

    Nakayasu, Ernesto S.; Ansong, Charles; Brown, Joseph N.; Yang, Feng; Lopez-Ferrer, Daniel; Qian, Wei-Jun; Smith, Richard D.; Adkins, Joshua N.

    2013-01-01

    Ubiquitination is an abundant post-translational modification that consists of covalent attachment of ubiquitin to lysine residues or the N-terminus of proteins. Mono and polyubiquitination have been shown to be involved in many critical eukaryotic cellular functions and are often disrupted by intracellular bacterial pathogens. Affinity enrichment of ubiquitinated proteins enables global analysis of this key modification. In this context, the use of ubiquitin-binding domains is a promising, but relatively unexplored alternative to more broadly used immunoaffinity or tagged affinity enrichment methods. In this study, we evaluated the application of eight ubiquitin-binding domains that have differing affinities for ubiquitination states. Small-scale proteomics analysis identified ∼200 ubiquitinated protein candidates per ubiquitin-binding domain pull-down experiment. Results from subsequent Western blot analyses that employed anti-ubiquitin or monoclonal antibodies against polyubiquitination at lysine 48 and 63 suggest that ubiquitin-binding domains from Dsk2 and ubiquilin-1 have the broadest specificity in that they captured most types of ubiquitination, whereas the binding domain from NBR1 was more selective to polyubiquitination. These data demonstrate that with optimized purification conditions, ubiquitin-binding domains can be an alternative tool for proteomic applications. This approach is especially promising for the analysis of tissues or cells resistant to transfection, of which the overexpression of tagged ubiquitin is a major hurdle. PMID:23649778

  13. Discovery and Characterization of Cadherin Domains in Saccharophagus degradans 2-40▿ †

    PubMed Central

    Fraiberg, Milana; Borovok, Ilya; Weiner, Ronald M.; Lamed, Raphael

    2010-01-01

    Saccharophagus degradans strain 2-40 is a prominent member of newly discovered group of marine and estuarine bacteria that recycle complex polysaccharides. The S. degradans 2-40 genome codes for 15 extraordinary long polypeptides, ranging from 274 to 1,600 kDa. Five of these contain at least 52 cadherin (CA) and cadherin-like (CADG) domains, the types of which were reported to bind calcium ions and mediate protein/protein interactions in metazoan systems. In order to evaluate adhesive features of these domains, recombinant CA doublet domains (two neighboring domains) from CabC (Sde_3323) and recombinant CADG doublet domains from CabD (Sde_0798) were examined qualitatively and quantitatively for homophilic and heterophilic interactions. In addition, CA and CADG doublet domains were tested for adhesion to the surface of S. degradans 2-40. Results showed obvious homophilic and heterophilic, calcium ion-dependent interactions between CA and CADG doublet domains. Likewise, CA and CADG doublet domains adhered to the S. degradans 2-40 surface of cells that were grown on xylan from birch wood or pectin, respectively, as a sole carbon source. This research shows for the first time that bacterial cadherin homophilic and heterophilic interactions may be similar in their nature to cadherin domains from metazoan lineages. We hypothesize that S. degradans 2-40 cadherin and cadherin-like multiple domains contribute to protein-protein interactions that may mediate cell-cell contact in the marine environment. PMID:20023015

  14. The orientation and molecular movement of a k(+) channel voltage-sensing domain.

    PubMed

    Gandhi, Chris S; Clark, Eliana; Loots, Eli; Pralle, Arnd; Isacoff, Ehud Y

    2003-10-30

    Voltage-gated channels operate through the action of a voltage-sensing domain (membrane segments S1-S4) that controls the conformation of gates located in the pore domain (membrane segments S5-S6). Recent structural studies on the bacterial K(v)AP potassium channel have led to a new model of voltage sensing in which S4 lies in the lipid at the channel periphery and moves through the membrane as a unit with a portion of S3. Here we describe accessibility probing and disulfide scanning experiments aimed at determining how well the K(v)AP model describes the Drosophila Shaker potassium channel. We find that the S1-S3 helices have one end that is externally exposed, S3 does not undergo a transmembrane motion, and S4 lies in close apposition to the pore domain in the resting and activated state.

  15. [Bacterial meningitis].

    PubMed

    Brouwer, M C; van de Beek, D

    2012-05-01

    Bacterial meningitis is a severe disease which affects 35.000 Europeans each year and has a mortality rate of about 20%. During the past 25 years the epidemiology of bacterial meningitis has changed significantly due to the implementation of vaccination against Haemophilus influenzae, Neisseria meningtidis group C and Streptococcus pneumoniae. Due to these vaccines, meningitis is now predominantly a disease occurring in adults, caused especially by Streptococcus pneumoniae, while it was formerly a child disease which was largely caused by Haemophilus influenzae. Bacterial meningitis is often difficult to recognize since the classical presentation with neck stiffness, reduced awareness and fever occurs in less than half of the patients. The only way to diagnose or exclude bacterial meningitis is by performing low-threshold cerebrospinal fluid examination with a suspicion of bacterial meningitis. The treatment consists of the prescription of antibiotics and dexamethasone.

  16. Immunoregulatory and immunostimulatory responses of bacterial lysates in respiratory infections and asthma.

    PubMed

    Kearney, Sean Christopher; Dziekiewicz, Marcin; Feleszko, Wojciech

    2015-05-01

    This review focuses on the current understanding of the molecular mechanisms of bacterial lysates, evidence of an induction of innate immunity, and the interaction with immunoregulators, dendritic cells, and regulatory T cells. Clinical relevance is summarized based on the observed mechanisms of action of bacterial lysates. Academic Search Complete, CENTRAL, Health Source: Nursing/Academic Edition, MEDLINE, and Cochrane databases. Three independent researchers focused on primary and secondary end points in systematic reviews, meta-analyses, and randomized controlled trials using bacterial lysates as a verum group or within a subpopulation of larger studies. Interventional and observational studies on novel applications also were included. Preclinical studies included murine models focusing on toll-like receptors (TLRs) and regulatory T cells and on the relation with asthma and respiratory immunity. Bacterial lysates have been observed to induce synergistic TLR-2/6- and TLR-9-dependent innate immunity. It has positive outcomes in decreasing recurrent respiratory tract infections in childhood and adult chronic obstructive pulmonary disease. This class of immunostimulants shows some evidence of mitigating infection morbidity in children and decreasing the frequency of inflammatory episodes (ie, wheezing exacerbations) in children with asthma. Preclinical studies suggest that regulatory T cells can be induced by bacterial lysates and might attenuate T-helper cell type 2 allergic responses. Although successful prevention against all common respiratory pathogens is not possible, bacterial lysates seem capable of targeting specific immunocompetent cells through pathogen recognition receptor activation. Current challenges include clarifying the duality of immunoregulatory and immunostimulatory responses in children at risk for allergy. Larger clinical trials are required to elicit efficacy in allergy prevention. Copyright © 2015 American College of Allergy, Asthma

  17. Bacterial virulence effectors and their activities.

    PubMed

    Hann, Dagmar R; Gimenez-Ibanez, Selena; Rathjen, John P

    2010-08-01

    The major virulence strategy for plant pathogenic bacteria is deployment of effector molecules within the host cytoplasm. Each bacterial strain possesses a set of 20-30 effectors which have overlapping activities, are functionally interchangeable, and diverge in composition between strains. Effectors target host molecules to suppress immunity. Two main strategies are apparent. Effectors that target host proteins seem to attack conserved structural domains but otherwise lack specificity. On the other hand, those that influence host gene transcription directly do so with extreme specificity. In both cases, examples are known where the host has exploited effector-target affinities to establish immune recognition of effectors. The molecular activity of each effector links virulence and immune outcomes. Copyright 2010 Elsevier Ltd. All rights reserved.

  18. The Translocation Domain of Botulinum Neurotoxin A Moderates the Propensity of the Catalytic Domain to Interact with Membranes at Acidic pH

    PubMed Central

    Araye, Anne; Goudet, Amélie; Barbier, Julien; Pichard, Sylvain; Baron, Bruno; England, Patrick; Pérez, Javier; Zinn-Justin, Sophie; Chenal, Alexandre; Gillet, Daniel

    2016-01-01

    Botulinum neurotoxin A (BoNT/A) is composed of three domains: a catalytic domain (LC), a translocation domain (HN) and a receptor-binding domain (HC). Like most bacterial toxins BoNT/A is an amphitropic protein, produced in a soluble form that is able to interact, penetrate and/or cross a membrane to achieve its toxic function. During intoxication BoNT/A is internalized by the cell by receptor-mediated endocytosis. Then, LC crosses the membrane of the endocytic compartment and reaches the cytosol. This translocation is initiated by the low pH found in this compartment. It has been suggested that LC passes in an unfolded state through a transmembrane passage formed by HN. We report here that acidification induces no major conformational change in either secondary or tertiary structures of LC and HN of BoNT/A in solution. GdnHCl-induced denaturation experiments showed that the stability of LC and HN increases as pH drops, and that HN further stabilizes LC. Unexpectedly we found that LC has a high propensity to interact with and permeabilize anionic lipid bilayers upon acidification without the help of HN. This property is downplayed when LC is linked to HN. HN thus acts as a chaperone for LC by enhancing its stability but also as a moderator of the membrane interaction of LC. PMID:27070312

  19. Impact of wall shear stress on initial bacterial adhesion in rotating annular reactor

    PubMed Central

    Saur, Thibaut; Morin, Emilie; Habouzit, Frédéric; Bernet, Nicolas

    2017-01-01

    The objective of this study was to investigate the bacterial adhesion under different wall shear stresses in turbulent flow and using a diverse bacterial consortium. A better understanding of the mechanisms governing microbial adhesion can be useful in diverse domains such as industrial processes, medical fields or environmental biotechnologies. The impact of wall shear stress—four values ranging from 0.09 to 7.3 Pa on polypropylene (PP) and polyvinyl chloride (PVC)—was carried out in rotating annular reactors to evaluate the adhesion in terms of morphological and microbiological structures. A diverse inoculum consisting of activated sludge was used. Epifluorescence microscopy was used to quantitatively and qualitatively characterize the adhesion. Attached bacterial communities were assessed by molecular fingerprinting profiles (CE-SSCP). It has been demonstrated that wall shear stress had a strong impact on both quantitative and qualitative aspects of the bacterial adhesion. ANOVA tests also demonstrated the significant impact of wall shear stress on all three tested morphological parameters (surface coverage, number of objects and size of objects) (p-values < 2.10−16). High wall shear stresses increased the quantity of attached bacteria but also altered their spatial distribution on the substratum surface. As the shear increased, aggregates or clusters appeared and their size grew when increasing the shears. Concerning the microbiological composition, the adhered bacterial communities changed gradually with the applied shear. PMID:28207869

  20. Young Children Bet On Their Numerical Skills: Metacognition in the Numerical Domain

    PubMed Central

    Vo, Vy A.; Li, Rosa; Kornell, Nate; Pouget, Alexandre; Cantlon, Jessica F.

    2014-01-01

    Metacognition, the ability to assess one’s own knowledge, has been targeted as a critical learning mechanism in mathematics education. Yet, the early childhood origins of metacognition have proven difficult to study. Using a novel nonverbal task and a comprehensive set of metacognitive measures, we provide the strongest evidence to date that young children are metacognitive. We show that children as young as 5 years make metacognitive “bets” on their numerical discriminations in a wagering task. However, contrary to previous reports from adults, children’s metacognition proved to be domain-specific: children’s metacognition in the numerical domain was unrelated to their metacognition in another domain (emotion discrimination). Moreover, children’s metacognitive ability in only the numerical domain predicted their school-based mathematics knowledge. The data provide novel evidence that metacognition is a fundamental, domain-dependent cognitive ability in children. The findings have implications for theories of uncertainty and reveal new avenues for training metacognition in children. PMID:24973137

  1. A population based twin study of DSM-5 maladaptive personality domains.

    PubMed

    South, Susan C; Krueger, Robert F; Knudsen, Gun Peggy; Ystrom, Eivind; Czajkowski, Nikolai; Aggen, Steven H; Neale, Michael C; Gillespie, Nathan A; Kendler, Kenneth S; Reichborn-Kjennerud, Ted

    2017-10-01

    Personality disorders (PDs) can be partly captured by dimensional traits, a viewpoint reflected in the most recent Diagnostic and Statistical Manual of Mental Disorders-Fifth Edition (DSM-5) Alternative (Section III) Model for PD classification. The current study adds to the literature on the Alternative Model by examining the magnitude of genetic and environmental influences on 6 domains of maladaptive personality: negative emotionality, detachment, antagonism, disinhibition, compulsivity, and psychoticism. In a large, population-based sample (N = 2,293) of Norwegian male and female twin pairs, we investigated (a) if the domains demonstrated measurement invariance across gender at the phenotypic level, meaning that the relationships between the items and the latent factor were equivalent in men and women; and (b) if genetic and environmental influences on variation in these domains were equivalent across gender. Multiple group confirmatory factor modeling provided evidence that all 6 domain scale measurement models were gender-invariant. The best fitting biometric model for 4 of the 6 domains (negative emotionality, detachment, disinhibition, and compulsivity) was one in which genetic and environmental influences could be set invariant across gender. Evidence for sex differences in psychoticism was mixed, but the only clear evidence for quantitative sex differences was for the antagonism scale, with greater genetic influences found for men than women. Genetic influences across domains were moderate overall (19-37%), in line with previous research using symptom-based measures of PDs. This study adds to the very limited knowledge currently existing on the etiology of maladaptive personality traits. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  2. Interaction of Prevotella intermedia Strain 17 Leucine-Rich Repeat Domain Protein AdpF with Eukaryotic Cells Promotes Bacterial Internalization

    PubMed Central

    Sengupta, Dipanwita; Kang, Dae-Joong; Anaya-Bergman, Cecilia; Wyant, Tiana; Ghosh, Arnab K.; Miyazaki, Hiroshi

    2014-01-01

    Prevotella intermedia is an oral bacterium implicated in a variety of oral diseases. Although internalization of this bacterium by nonphagocytic host cells is well established, the molecular players mediating the process are not well known. Here, the properties of a leucine-rich repeat (LRR) domain protein, designated AdpF, are described. This protein contains a leucine-rich region composed of 663 amino acid residues, and molecular modeling shows that it folds into a classical curved solenoid structure. The cell surface localization of recombinant AdpF (rAdpF) was confirmed by electron and confocal microscopy analyses. The recombinant form of this protein bound fibronectin in a dose-dependent manner. Furthermore, the protein was internalized by host cells, with the majority of the process accomplished within 30 min. The internalization of rAdpF was inhibited by nystatin, cytochalasin, latrunculin, nocodazole, and wortmannin, indicating that microtubules, microfilaments, and signal transduction are required for the invasion. It is noteworthy that preincubation of eukaryotic cells with AdpF increased P. intermedia 17 internalization by 5- and 10-fold for HeLa and NIH 3T3 fibroblast cell lines, respectively. The addition of the rAdpF protein was also very effective in inducing bacterial internalization into the oral epithelial cell line HN4, as well as into primary cells, including human oral keratinocytes (HOKs) and human umbilical vein endothelial cells (HUVECs). Finally, cells exposed to P. intermedia 17 internalized the bacteria more readily upon reinfection. Taken together, our data demonstrate that rAdpF plays a role in the internalization of P. intermedia 17 by a variety of host cells. PMID:24711565

  3. Interaction of Prevotella intermedia strain 17 leucine-rich repeat domain protein AdpF with eukaryotic cells promotes bacterial internalization.

    PubMed

    Sengupta, Dipanwita; Kang, Dae-Joong; Anaya-Bergman, Cecilia; Wyant, Tiana; Ghosh, Arnab K; Miyazaki, Hiroshi; Lewis, Janina P

    2014-06-01

    Prevotella intermedia is an oral bacterium implicated in a variety of oral diseases. Although internalization of this bacterium by nonphagocytic host cells is well established, the molecular players mediating the process are not well known. Here, the properties of a leucine-rich repeat (LRR) domain protein, designated AdpF, are described. This protein contains a leucine-rich region composed of 663 amino acid residues, and molecular modeling shows that it folds into a classical curved solenoid structure. The cell surface localization of recombinant AdpF (rAdpF) was confirmed by electron and confocal microscopy analyses. The recombinant form of this protein bound fibronectin in a dose-dependent manner. Furthermore, the protein was internalized by host cells, with the majority of the process accomplished within 30 min. The internalization of rAdpF was inhibited by nystatin, cytochalasin, latrunculin, nocodazole, and wortmannin, indicating that microtubules, microfilaments, and signal transduction are required for the invasion. It is noteworthy that preincubation of eukaryotic cells with AdpF increased P. intermedia 17 internalization by 5- and 10-fold for HeLa and NIH 3T3 fibroblast cell lines, respectively. The addition of the rAdpF protein was also very effective in inducing bacterial internalization into the oral epithelial cell line HN4, as well as into primary cells, including human oral keratinocytes (HOKs) and human umbilical vein endothelial cells (HUVECs). Finally, cells exposed to P. intermedia 17 internalized the bacteria more readily upon reinfection. Taken together, our data demonstrate that rAdpF plays a role in the internalization of P. intermedia 17 by a variety of host cells.

  4. Modeling the integration of bacterial rRNA fragments into the human cancer genome.

    PubMed

    Sieber, Karsten B; Gajer, Pawel; Dunning Hotopp, Julie C

    2016-03-21

    Cancer is a disease driven by the accumulation of genomic alterations, including the integration of exogenous DNA into the human somatic genome. We previously identified in silico evidence of DNA fragments from a Pseudomonas-like bacteria integrating into the 5'-UTR of four proto-oncogenes in stomach cancer sequencing data. The functional and biological consequences of these bacterial DNA integrations remain unknown. Modeling of these integrations suggests that the previously identified sequences cover most of the sequence flanking the junction between the bacterial and human DNA. Further examination of these reads reveals that these integrations are rich in guanine nucleotides and the integrated bacterial DNA may have complex transcript secondary structures. The models presented here lay the foundation for future experiments to test if bacterial DNA integrations alter the transcription of the human genes.

  5. Intestinal bacterial signatures of white feces syndrome in shrimp.

    PubMed

    Hou, Dongwei; Huang, Zhijian; Zeng, Shenzheng; Liu, Jian; Wei, Dongdong; Deng, Xisha; Weng, Shaoping; Yan, Qingyun; He, Jianguo

    2018-04-01

    Increasing evidence suggests that the intestinal microbiota is closely correlated with the host's health status. Thus, a serious disturbance that disrupts the stability of the intestinal microecosystem could cause host disease. Shrimps are one of the most important products among fishery trading commodities. However, digestive system diseases, such as white feces syndrome (WFS), frequently occur in shrimp culture and have led to enormous economic losses across the world. The WFS occurrences are unclear. Here, we compared intestinal bacterial communities of WFS shrimp and healthy shrimp. Intestinal bacterial communities of WFS shrimp exhibited less diversity but were more heterogeneous than those of healthy shrimp. The intestinal bacterial communities were significantly different between WFS shrimp and healthy shrimp; compared with healthy shrimp, in WFS shrimp, Candidatus Bacilloplasma and Phascolarctobacterium were overrepresented, whereas Paracoccus and Lactococcus were underrepresented. PICRUSt functional predictions indicated that the relative abundances of genes involved in energy metabolism and genetic information processing were significantly greater in WFS shrimp. Collectively, we found that the composition and predicted functions of the intestinal bacterial community were markedly shifted by WFS. Significant increases in Candidatus Bacilloplasma and Phascolarctobacterium and decreases in Paracoccus and Lactococcus may contribute to WFS in shrimp.

  6. The CRM domain: an RNA binding module derived from an ancient ribosome-associated protein.

    PubMed

    Barkan, Alice; Klipcan, Larik; Ostersetzer, Oren; Kawamura, Tetsuya; Asakura, Yukari; Watkins, Kenneth P

    2007-01-01

    The CRS1-YhbY domain (also called the CRM domain) is represented as a stand-alone protein in Archaea and Bacteria, and in a family of single- and multidomain proteins in plants. The function of this domain is unknown, but structural data and the presence of the domain in several proteins known to interact with RNA have led to the proposal that it binds RNA. Here we describe a phylogenetic analysis of the domain, its incorporation into diverse proteins in plants, and biochemical properties of a prokaryotic and eukaryotic representative of the domain family. We show that a bacterial member of the family, Escherichia coli YhbY, is associated with pre-50S ribosomal subunits, suggesting that YhbY functions in ribosome assembly. GFP fused to a single-domain CRM protein from maize localizes to the nucleolus, suggesting that an analogous activity may have been retained in plants. We show further that an isolated maize CRM domain has RNA binding activity in vitro, and that a small motif shared with KH RNA binding domains, a conserved "GxxG" loop, contributes to its RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes.

  7. DC-SIGN neck domain is a pH-sensor controlling oligomerization: SAXS and hydrodynamic studies of extracellular domain.

    PubMed

    Tabarani, Georges; Thépaut, Michel; Stroebel, David; Ebel, Christine; Vivès, Corinne; Vachette, Patrice; Durand, Dominique; Fieschi, Franck

    2009-08-07

    DC-SIGN is a C-type lectin receptor of dendritic cells and is involved in the early stages of numerous infectious diseases. DC-SIGN is organized into a tetramer enabling multivalent interaction with pathogens. Once formed, the DC-SIGN-pathogen complex can be internalized into compartments of increasing acidity. We have studied the pH dependence of the oligomerization state and conformation of the entire extracellular domain and neck region. We present evidence for equilibrium between the monomeric and tetrameric states of the extracellular domain, which exhibits a marked dependence with respect to both pH and ionic strength. Using solution x-ray scattering we have obtained a molecular envelope of the extracellular domain in which a model has been built. Our results highlight the central role of the neck domain in the pH-sensitive control of the oligomerization state, in the extended conformation of the protein, and in carbohydrate recognition domain organization and presentation. This work opens new insight into the molecular mechanism of ligand release and points to new avenues to block the first step of this important infection pathway.

  8. Using the Theoretical Domains Framework (TDF) to understand adherence to multiple evidence-based indicators in primary care: a qualitative study.

    PubMed

    Lawton, Rebecca; Heyhoe, Jane; Louch, Gemma; Ingleson, Emma; Glidewell, Liz; Willis, Thomas A; McEachan, Rosemary R C; Foy, Robbie

    2016-08-08

    There are recognised gaps between evidence and practice in general practice, a setting posing particular implementation challenges. We earlier screened clinical guideline recommendations to derive a set of 'high-impact' indicators based upon criteria including potential for significant patient benefit, scope for improved practice and amenability to measurement using routinely collected data. Here, we explore health professionals' perceived determinants of adherence to these indicators, examining the degree to which determinants were indicator-specific or potentially generalisable across indicators. We interviewed 60 general practitioners, practice nurses and practice managers in West Yorkshire, the UK, about adherence to four indicators: avoidance of risky prescribing; treatment targets in type 2 diabetes; blood pressure targets in treated hypertension; and anticoagulation in atrial fibrillation. Interview questions drew upon the Theoretical Domains Framework (TDF). Data were analysed using framework analysis. Professional role and identity and environmental context and resources featured prominently across all indicators whilst the importance of other domains, for example, beliefs about consequences, social influences and knowledge varied across indicators. We identified five meta-themes representing more general organisational and contextual factors common to all indicators. The TDF helped elicit a wide range of reported determinants of adherence to 'high-impact' indicators in primary care. It was more difficult to pinpoint which determinants, if targeted by an implementation strategy, would maximise change. The meta-themes broadly underline the need to align the design of interventions targeting general practices with higher level supports and broader contextual considerations. However, our findings suggest that it is feasible to develop interventions to promote the uptake of different evidence-based indicators which share common features whilst also including

  9. Multiple conversion between the genes encoding bacterial class-I release factors

    PubMed Central

    Ishikawa, Sohta A.; Kamikawa, Ryoma; Inagaki, Yuji

    2015-01-01

    Bacteria require two class-I release factors, RF1 and RF2, that recognize stop codons and promote peptide release from the ribosome. RF1 and RF2 were most likely established through gene duplication followed by altering their stop codon specificities in the common ancestor of extant bacteria. This scenario expects that the two RF gene families have taken independent evolutionary trajectories after the ancestral gene duplication event. However, we here report two independent cases of conversion between RF1 and RF2 genes (RF1-RF2 gene conversion), which were severely examined by procedures incorporating the maximum-likelihood phylogenetic method. In both cases, RF1-RF2 gene conversion was predicted to occur in the region encoding nearly entire domain 3, of which functions are common between RF paralogues. Nevertheless, the ‘direction’ of gene conversion appeared to be opposite from one another—from RF2 gene to RF1 gene in one case, while from RF1 gene to RF2 gene in the other. The two cases of RF1-RF2 gene conversion prompt us to propose two novel aspects in the evolution of bacterial class-I release factors: (i) domain 3 is interchangeable between RF paralogues, and (ii) RF1-RF2 gene conversion have occurred frequently in bacterial genome evolution. PMID:26257102

  10. Bacterial adherence to graft tissues in static and flow conditions.

    PubMed

    Veloso, Tiago Rafael; Claes, Jorien; Van Kerckhoven, Soetkin; Ditkowski, Bartosz; Hurtado-Aguilar, Luis G; Jockenhoevel, Stefan; Mela, Petra; Jashari, Ramadan; Gewillig, Marc; Hoylaerts, Marc F; Meyns, Bart; Heying, Ruth

    2018-01-01

    Various conduits and stent-mounted valves are used as pulmonary valve graft tissues for right ventricular outflow tract reconstruction with good hemodynamic results. Valve replacement carries an increased risk of infective endocarditis (IE). Recent observations have increased awareness of the risk of IE after transcatheter implantation of a stent-mounted bovine jugular vein valve. This study focused on the susceptibility of graft tissue surfaces to bacterial adherence as a potential risk factor for subsequent IE. Adhesion of Staphylococcus aureus, Staphylococcus epidermidis, and Streptococcus sanguinis to bovine pericardium (BP) patch, bovine jugular vein (BJV), and cryopreserved homograft (CH) tissues was quantified under static and shear stress conditions. Microscopic analysis and histology were performed to evaluate bacterial adhesion to matrix components. In general, similar bacteria numbers were recovered from CH and BJV tissue surfaces for all strains, especially in flow conditions. Static bacterial adhesion to the CH wall was lower for S sanguinis adhesion (P < .05 vs BP patch). Adhesion to the BJV wall, CH wall, and leaflet was decreased for S epidermidis in static conditions (P < .05 vs BP patch). Bacterial adhesion under shear stress indicated similar bacterial adhesion to all tissues, except for lower adhesion to the BJV wall after S sanguinis incubation. Microscopic analysis showed the importance of matrix component exposure for bacterial adherence to CH. Our data provide evidence that the surface composition of BJV and CH tissues themselves, bacterial surface proteins, and shear forces per se are not the prime determinants of bacterial adherence. Copyright © 2017 The American Association for Thoracic Surgery. Published by Elsevier Inc. All rights reserved.

  11. The effect of bacterial cellulose on the shape memory behavior of polyvinyl alcohol nanocomposite hydrogel

    NASA Astrophysics Data System (ADS)

    Pirahmadi, Pegah; Kokabi, Mehrdad

    2018-01-01

    Most research on shape memory polymers has been confined to neat polymers in their dry state, while, some hydrogel networks are known for their shape memory properties. Hydrogels have low glass transition temperatures which are below 100°C depend on the content of water. But they are usually weak and brittle, and not suitable for structural applications due to their low mechanical strengths because of these materials have large amount of water (>50%), so they could not remember original shape perfectly. Bacterial cellulose nanofibers with perfect properties such as high water holding capacity, high crystallinity, high tensile strength and good biocompatibility can dismiss all the drawbacks. In the present study, polyvinyl alcohol/bacterial cellulose nanocomposite hydrogel prepared by repetitive freezing-thawing method. The bacterial cellulose was used as reinforcement to improve the mechanical properties and stimuli response. Differential scanning calorimetry was employed to obtain the glass transition temperature. Nanocomposite morphology was characterized by field-emission scanning electron microscopy and mechanical properties were investigated by standard tensile test. Finally, the effect of bacterial cellulose nanofiber on shape memory behavior of polyvinyl alcohol/bacterial cellulose nanocomposite hydrogel was investigated. It is found that switching temperature of this system is the glass transition temperature of the nano domains formed within the system. The results also show increase of shape recovery, and shape recovery speed due to presence of bacterial cellulose.

  12. Exploiting Quorum Sensing To Confuse Bacterial Pathogens

    PubMed Central

    LaSarre, Breah

    2013-01-01

    SUMMARY Cell-cell communication, or quorum sensing, is a widespread phenomenon in bacteria that is used to coordinate gene expression among local populations. Its use by bacterial pathogens to regulate genes that promote invasion, defense, and spread has been particularly well documented. With the ongoing emergence of antibiotic-resistant pathogens, there is a current need for development of alternative therapeutic strategies. An antivirulence approach by which quorum sensing is impeded has caught on as a viable means to manipulate bacterial processes, especially pathogenic traits that are harmful to human and animal health and agricultural productivity. The identification and development of chemical compounds and enzymes that facilitate quorum-sensing inhibition (QSI) by targeting signaling molecules, signal biogenesis, or signal detection are reviewed here. Overall, the evidence suggests that QSI therapy may be efficacious against some, but not necessarily all, bacterial pathogens, and several failures and ongoing concerns that may steer future studies in productive directions are discussed. Nevertheless, various QSI successes have rightfully perpetuated excitement surrounding new potential therapies, and this review highlights promising QSI leads in disrupting pathogenesis in both plants and animals. PMID:23471618

  13. Bacterial diversity differences along an epigenic cave stream reveal evidence of community dynamics, succession, and stability.

    PubMed

    Brannen-Donnelly, Kathleen; Engel, Annette S

    2015-01-01

    Unchanging physicochemical conditions and nutrient sources over long periods of time in cave and karst subsurface habitats, particularly aquifers, can support stable ecosystems, termed autochthonous microbial endokarst communities (AMEC). AMEC existence is unknown for other karst settings, such as epigenic cave streams. Conceptually, AMEC should not form in streams due to faster turnover rates and seasonal disturbances that have the capacity to transport large quantities of water and sediment and to change allochthonous nutrient and organic matter sources. Our goal was to investigate whether AMEC could form and persist in hydrologically active, epigenic cave streams. We analyzed bacterial diversity from cave water, sediments, and artificial substrates (Bio-Traps®) placed in the cave at upstream and downstream locations. Distinct communities existed for the water, sediments, and Bio-Trap® samplers. Throughout the study period, a subset of community members persisted in the water, regardless of hydrological disturbances. Stable habitat conditions based on flow regimes resulted in more than one contemporaneous, stable community throughout the epigenic cave stream. However, evidence for AMEC was insufficient for the cave water or sediments. Community succession, specifically as predictable exogenous heterotrophic microbial community succession, was evident from decreases in community richness from the Bio-Traps®, a peak in Bio-Trap® community biomass, and from changes in the composition of Bio-Trap® communities. The planktonic community was compositionally similar to Bio-Trap® initial colonizers, but the downstream Bio-Trap® community became more similar to the sediment community at the same location. These results can help in understanding the diversity of planktonic and attached microbial communities from karst, as well as microbial community dynamics, stability, and succession during disturbance or contamination responses over time.

  14. The impact of natural transformation on adaptation in spatially structured bacterial populations.

    PubMed

    Moradigaravand, Danesh; Engelstädter, Jan

    2014-06-20

    Recent studies have demonstrated that natural transformation and the formation of highly structured populations in bacteria are interconnected. In spite of growing evidence about this connection, little is known about the dynamics of natural transformation in spatially structured bacterial populations. In this work, we model the interdependency between the dynamics of the bacterial gene pool and those of environmental DNA in space to dissect the effect of transformation on adaptation. Our model reveals that even with only a single locus under consideration, transformation with a free DNA fragment pool results in complex adaptation dynamics that do not emerge in previous models focusing only on the gene shuffling effect of transformation at multiple loci. We demonstrate how spatial restriction on population growth and DNA diffusion in the environment affect the impact of transformation on adaptation. We found that in structured bacterial populations intermediate DNA diffusion rates predominantly cause transformation to impede adaptation by spreading deleterious alleles in the population. Overall, our model highlights distinctive evolutionary consequences of bacterial transformation in spatially restricted compared to planktonic bacterial populations.

  15. Structure and Function of the Bi-Directional Bacterial Flagellar Motor

    PubMed Central

    Morimoto, Yusuke V.; Minamino, Tohru

    2014-01-01

    The bacterial flagellum is a locomotive organelle that propels the bacterial cell body in liquid environments. The flagellum is a supramolecular complex composed of about 30 different proteins and consists of at least three parts: a rotary motor, a universal joint, and a helical filament. The flagellar motor of Escherichia coli and Salmonella enterica is powered by an inward-directed electrochemical potential difference of protons across the cytoplasmic membrane. The flagellar motor consists of a rotor made of FliF, FliG, FliM and FliN and a dozen stators consisting of MotA and MotB. FliG, FliM and FliN also act as a molecular switch, enabling the motor to spin in both counterclockwise and clockwise directions. Each stator is anchored to the peptidoglycan layer through the C-terminal periplasmic domain of MotB and acts as a proton channel to couple the proton flow through the channel with torque generation. Highly conserved charged residues at the rotor–stator interface are required not only for torque generation but also for stator assembly around the rotor. In this review, we will summarize our current understanding of the structure and function of the proton-driven bacterial flagellar motor. PMID:24970213

  16. A bacterial genetic selection system for ubiquitylation cascade discovery.

    PubMed

    Levin-Kravets, Olga; Tanner, Neta; Shohat, Noa; Attali, Ilan; Keren-Kaplan, Tal; Shusterman, Anna; Artzi, Shay; Varvak, Alexander; Reshef, Yael; Shi, Xiaojing; Zucker, Ori; Baram, Tamir; Katina, Corine; Pilzer, Inbar; Ben-Aroya, Shay; Prag, Gali

    2016-11-01

    About one-third of the eukaryotic proteome undergoes ubiquitylation, but the enzymatic cascades leading to substrate modification are largely unknown. We present a genetic selection tool that utilizes Escherichia coli, which lack deubiquitylases, to identify interactions along ubiquitylation cascades. Coexpression of split antibiotic resistance protein tethered to ubiquitin and ubiquitylation target together with a functional ubiquitylation apparatus results in a covalent assembly of the resistance protein, giving rise to bacterial growth on selective media. We applied the selection system to uncover an E3 ligase from the pathogenic bacteria EHEC and to identify the epsin ENTH domain as an ultraweak ubiquitin-binding domain. The latter was complemented with a structure-function analysis of the ENTH-ubiquitin interface. We also constructed and screened a yeast fusion library, discovering Sem1 as a novel ubiquitylation substrate of Rsp5 E3 ligase. Collectively, our selection system provides a robust high-throughput approach for genetic studies of ubiquitylation cascades and for small-molecule modulator screening.

  17. N-METHYL GROUPS IN BACTERIAL LIPIDS

    PubMed Central

    Goldfine, Howard; Ellis, Martha E.

    1964-01-01

    Goldfine, Howard (Harvard Medical School, Boston, Mass.), and Martha E. Ellis. N-methyl groups in bacterial lipids. J. Bacteriol. 87:8–15. 1964.—The ability of bacteria to synthesize lecithin was examined by measuring the incorporation of the methyl group of methionine into the water-soluble moieties obtained on acid hydrolysis of bacterial lipids. Of 21 species examined, mostly of the order Eubacteriales, only 2, Agrobacterium radiobacter and A. rhizogenes, incorporated the methyl group of methionine into lipid-bound choline. Evidence was also obtained for the formation of lipid-bound N-methylethanolamine and N,N′-dimethylethanolamine in these two organisms. Two other species, Clostridium butyricum and Proteus vulgaris, incorporated the methyl group of methionine into lipid-bound N-methylethanolamine, but did not appear to be able to further methylate these lipids to form lecithin. The results of this study lend further strength to the generalization that bacteria, with the exception of the genus Agrobacterium, are unable to synthesize lecithin. PMID:14102879

  18. Evidence for alternative quaternary structure in a bacterial Type III secretion system chaperone

    PubMed Central

    2010-01-01

    Background Type III secretion systems are a common virulence mechanism in many Gram-negative bacterial pathogens. These systems use a nanomachine resembling a molecular needle and syringe to provide an energized conduit for the translocation of effector proteins from the bacterial cytoplasm to the host cell cytoplasm for the benefit of the pathogen. Prior to translocation specialized chaperones maintain proper effector protein conformation. The class II chaperone, Invasion plasmid gene (Ipg) C, stabilizes two pore forming translocator proteins. IpgC exists as a functional dimer to facilitate the mutually exclusive binding of both translocators. Results In this study, we present the 3.3 Å crystal structure of an amino-terminally truncated form (residues 10-155, denoted IpgC10-155) of the class II chaperone IpgC from Shigella flexneri. Our structure demonstrates an alternative quaternary arrangement to that previously described for a carboxy-terminally truncated variant of IpgC (IpgC1-151). Specifically, we observe a rotationally-symmetric "head-to- head" dimerization interface that is far more similar to that previously described for SycD from Yersinia enterocolitica than to IpgC1-151. The IpgC structure presented here displays major differences in the amino terminal region, where extended coil-like structures are seen, as opposed to the short, ordered alpha helices and asymmetric dimerization interface seen within IpgC1-151. Despite these differences, however, both modes of dimerization support chaperone activity, as judged by a copurification assay with a recombinant form of the translocator protein, IpaB. Conclusions From primary to quaternary structure, these results presented here suggest that a symmetric dimerization interface is conserved across bacterial class II chaperones. In light of previous data which have described the structure and function of asymmetric dimerization, our results raise the possibility that class II chaperones may transition between

  19. Tannerella forsythia and Pseudomonas aeruginosa in subgingival bacterial samples from parous women.

    PubMed

    Persson, G Rutger; Hitti, Jane; Paul, Katie; Hirschi, Regula; Weibel, Marianne; Rothen, Marilynn; Persson, Rigmor E

    2008-03-01

    Information on the subgingival microbiota in parous women is limited. The present study assessed 74 bacterial species at periodontal sites. Subgingival bacterial plaque was collected from women > or =6 months after delivery. Bacteria were assessed by the checkerboard DNA-DNA hybridization method. Gingivitis was defined as > or =20% of sites with bleeding on probing (BOP), and periodontitis was defined as radiographic evidence of bone loss and probing depths > or =5.0 mm. A total of 197 women (mean age: 29.4 +/- 6.8 years; range: 18 to 46 years) were included in the study. Gingivitis was identified in 82 of 138 subjects without evidence of periodontitis (59.4%). Periodontitis was found in 59 women (32%). Higher bacterial levels in subjects with gingivitis compared to those without evidence of gingivitis were observed for Actinomyces neuii, Bifidobacterium bifidum, Corynebacterium pseudogenitalis, Porphyromonas endodontalis, Prevotella bivia, and Pseudomonas aeruginosa (P <0.001 for each). Higher bacterial levels in subjects with periodontitis compared to those without periodontitis (BOP not accounted for) were found for 32 of 79 species (P <0.001) including Lactobacillus iners, Haemophilus influenzae, Porphyromonas gingivalis, Tannerella forsythia (previously T. forsythensis), Prevotella bivia, P. aeruginosa, and Staphylococcus aureus. Binary univariate logistic regression analysis identified that P. aeruginosa (P <0.001) and T. forsythia (P <0.05) were independently predictive of periodontal status. The odds ratio of having P. aeruginosa at levels > or =1 x 10(5) in the sample and periodontitis was 3.1 (95% confidence interval: 1.6 to 5.9; P <0.001). In addition to P. gingivalis and T. forsythia, a diverse microbiota, including P. aeruginosa, P. endodontalis, P. bivia, and S. aureus, can be found in subgingival plaque samples from women of child-bearing age with periodontitis.

  20. Enhanced mixing and spatial instability in concentrated bacterial suspensions

    NASA Astrophysics Data System (ADS)

    Sokolov, Andrey; Goldstein, Raymond E.; Feldchtein, Felix I.; Aranson, Igor S.

    2009-09-01

    High-resolution optical coherence tomography is used to study the onset of a large-scale convective motion in free-standing thin films of adjustable thickness containing suspensions of swimming aerobic bacteria. Clear evidence is found that beyond a threshold film thickness there exists a transition from quasi-two-dimensional collective swimming to three-dimensional turbulent behavior. The latter state, qualitatively different from bioconvection in dilute bacterial suspensions, is characterized by enhanced diffusivities of oxygen and bacteria. These results emphasize the impact of self-organized bacterial locomotion on the onset of three-dimensional dynamics, and suggest key ingredients necessary to extend standard models of bioconvection to incorporate effects of large-scale collective motion.

  1. Glycogen with short average chain length enhances bacterial durability

    NASA Astrophysics Data System (ADS)

    Wang, Liang; Wise, Michael J.

    2011-09-01

    Glycogen is conventionally viewed as an energy reserve that can be rapidly mobilized for ATP production in higher organisms. However, several studies have noted that glycogen with short average chain length in some bacteria is degraded very slowly. In addition, slow utilization of glycogen is correlated with bacterial viability, that is, the slower the glycogen breakdown rate, the longer the bacterial survival time in the external environment under starvation conditions. We call that a durable energy storage mechanism (DESM). In this review, evidence from microbiology, biochemistry, and molecular biology will be assembled to support the hypothesis of glycogen as a durable energy storage compound. One method for testing the DESM hypothesis is proposed.

  2. Insights from 20 years of bacterial genome sequencing

    DOE PAGES

    Land, Miriam L.; Hauser, Loren; Jun, Se-Ran; ...

    2015-02-27

    Since the first two complete bacterial genome sequences were published in 1995, the science of bacteria has dramatically changed. Using third-generation DNA sequencing, it is possible to completely sequence a bacterial genome in a few hours and identify some types of methylation sites along the genome as well. Sequencing of bacterial genome sequences is now a standard procedure, and the information from tens of thousands of bacterial genomes has had a major impact on our views of the bacterial world. In this review, we explore a series of questions to highlight some insights that comparative genomics has produced. To date,more » there are genome sequences available from 50 different bacterial phyla and 11 different archaeal phyla. However, the distribution is quite skewed towards a few phyla that contain model organisms. But the breadth is continuing to improve, with projects dedicated to filling in less characterized taxonomic groups. The clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system provides bacteria with immunity against viruses, which outnumber bacteria by tenfold. How fast can we go? Second-generation sequencing has produced a large number of draft genomes (close to 90 % of bacterial genomes in GenBank are currently not complete); third-generation sequencing can potentially produce a finished genome in a few hours, and at the same time provide methlylation sites along the entire chromosome. The diversity of bacterial communities is extensive as is evident from the genome sequences available from 50 different bacterial phyla and 11 different archaeal phyla. Genome sequencing can help in classifying an organism, and in the case where multiple genomes of the same species are available, it is possible to calculate the pan- and core genomes; comparison of more than 2000 Escherichia coli genomes finds an E. coli core genome of about 3100 gene families and a total of about 89,000 different gene families. Why do we care about

  3. Insights from 20 years of bacterial genome sequencing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Land, Miriam L.; Hauser, Loren; Jun, Se-Ran

    Since the first two complete bacterial genome sequences were published in 1995, the science of bacteria has dramatically changed. Using third-generation DNA sequencing, it is possible to completely sequence a bacterial genome in a few hours and identify some types of methylation sites along the genome as well. Sequencing of bacterial genome sequences is now a standard procedure, and the information from tens of thousands of bacterial genomes has had a major impact on our views of the bacterial world. In this review, we explore a series of questions to highlight some insights that comparative genomics has produced. To date,more » there are genome sequences available from 50 different bacterial phyla and 11 different archaeal phyla. However, the distribution is quite skewed towards a few phyla that contain model organisms. But the breadth is continuing to improve, with projects dedicated to filling in less characterized taxonomic groups. The clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system provides bacteria with immunity against viruses, which outnumber bacteria by tenfold. How fast can we go? Second-generation sequencing has produced a large number of draft genomes (close to 90 % of bacterial genomes in GenBank are currently not complete); third-generation sequencing can potentially produce a finished genome in a few hours, and at the same time provide methlylation sites along the entire chromosome. The diversity of bacterial communities is extensive as is evident from the genome sequences available from 50 different bacterial phyla and 11 different archaeal phyla. Genome sequencing can help in classifying an organism, and in the case where multiple genomes of the same species are available, it is possible to calculate the pan- and core genomes; comparison of more than 2000 Escherichia coli genomes finds an E. coli core genome of about 3100 gene families and a total of about 89,000 different gene families. Why do we care about

  4. Recognition of β-calcineurin by the domains of calmodulin: thermodynamic and structural evidence for distinct roles.

    PubMed

    O'Donnell, Susan E; Yu, Liping; Fowler, C Andrew; Shea, Madeline A

    2011-03-01

    Calcineurin (CaN, PP2B, PPP3), a heterodimeric Ca(2+)-calmodulin-dependent Ser/Thr phosphatase, regulates swimming in Paramecia, stress responses in yeast, and T-cell activation and cardiac hypertrophy in humans. Calcium binding to CaN(B) (the regulatory subunit) triggers conformational change in CaN(A) (the catalytic subunit). Two isoforms of CaN(A) (α, β) are both abundant in brain and heart and activated by calcium-saturated calmodulin (CaM). The individual contribution of each domain of CaM to regulation of calcineurin is not known. Hydrodynamic analyses of (Ca(2+))₄-CaM(1-148) bound to βCaNp, a peptide representing its CaM-binding domain, indicated a 1:1 stoichiometry. βCaNp binding to CaM increased the affinity of calcium for the N- and C-domains equally, thus preserving intrinsic domain differences, and the preference of calcium for sites III and IV. The equilibrium constants for individual calcium-saturated CaM domains dissociating from βCaNp were ∼1 μM. A limiting K(d) ≤ 1 nM was measured directly for full-length CaM, while thermodynamic linkage analysis indicated that it was approximately 1 pM. βCaNp binding to ¹⁵N-(Ca(2+))₄-CaM(1-148) monitored by ¹⁵N/¹HN HSQC NMR showed that association perturbed the N-domain of CaM more than its C-domain. NMR resonance assignments of CaM and βCaNp, and interpretation of intermolecular NOEs observed in the ¹³C-edited and ¹²C-¹⁴N-filtered 3D NOESY spectrum indicated anti-parallel binding. The sole aromatic residue (Phe) located near the βCaNp C-terminus was in close contact with several residues of the N-domain of CaM outside the hydrophobic cleft. These structural and thermodynamic properties would permit the domains of CaM to have distinct physiological roles in regulating activation of βCaN. Copyright © 2010 Wiley-Liss, Inc.

  5. Prediction and Experimental Evidence for Thermodynamically Stable Charged Orbital Domain Walls

    DOE PAGES

    Li, Qing’an; Gray, K. E.; Wilkins, S. B.; ...

    2014-08-18

    On theoretical grounds, we show that orbital domain walls (ODWs), which are known to exist in the charge and orbital ordered layered manganite LaSr 2Mn 2O 7, should be partially charged as a result of competition between orbital-induced strain and Coulomb repulsion. Furthermore, this unexpected result provides the necessary condition for the known thermodynamic stability of these ODWs, which are unlike the more typical domain walls that arise only from an external field. We offer experimental data consistent with this theoretical framework through a combined transport and x-ray-diffraction study. In particular, our transport data on this charge and orbital orderedmore » manganite exhibit abrupt transformations to higher conductance at a threshold electric field. As transport phenomena closely resemble effects found for sliding charge-density waves (SCDWs) in pseudo-one-dimensional (1D) materials, a SCDW along such pseudo-1D ODWs provides a natural explanation of our data. Importantly, x-ray-diffraction data eliminate heating and melting of charge order as tenable alternative explanations of our data.« less

  6. Modulating bacterial and gut mucosal interactions with engineered biofilm matrix proteins.

    PubMed

    Duraj-Thatte, Anna M; Praveschotinunt, Pichet; Nash, Trevor R; Ward, Frederick R; Joshi, Neel S

    2018-02-22

    Extracellular appendages play a significant role in mediating communication between bacteria and their host. Curli fibers are a class of bacterial fimbria that is highly amenable to engineering. We demonstrate the use of engineered curli fibers to rationally program interactions between bacteria and components of the mucosal epithelium. Commensal E. coli strains were engineered to produce recombinant curli fibers fused to the trefoil family of human cytokines. Biofilms formed from these strains bound more mucins than those producing wild-type curli fibers, and modulated mucin rheology as well. When treated with bacteria producing the curli-trefoil fusions mammalian cells behaved identically in terms of their migration behavior as when they were treated with the corresponding soluble trefoil factors. Overall, this demonstrates the potential utility of curli fibers as a scaffold for the display of bioactive domains and an untapped approach to rationally modulating host-microbe interactions using bacterial matrix proteins.

  7. Challenges of bacterial meningitis case management in low income settings: an experience from Ethiopia.

    PubMed

    Gudina, Esayas Kebede; Tesfaye, Markos; Adane, Aynishet; Lemma, Kinfe; Shibiru, Tamiru; Pfister, Hans-Walter; Klein, Matthias

    2016-07-01

    To investigate the current diagnostic and therapeutic strategies used in the care of patients with suspected bacterial meningitis at teaching hospitals in Ethiopia. This was a hospital-based retrospective study conducted at four teaching hospitals in different regions of Ethiopia. Participants were patients aged 14 years and older treated for suspected bacterial meningitis. Presenting complaints, diagnostic strategies used and treatments given were obtained from clinical records. A total of 425 patients were included in the study; 52.7% were men and 83.8% were younger than 50 years. Fever, headache, neck stiffness and impaired consciousness were the most common clinical presentations; 55.5% underwent lumbar puncture. Overall, only 96 (22.6%) patients had cerebrospinal fluid abnormalities compatible with bacterial meningitis. A causative bacterium was identified in only 14 cases. Ceftriaxone was used as the empiric treatment of choice, either alone or in combination with other antibiotics; 17.6% of patients were also given vancomycin. Adjunctive dexamethasone was given to 50.4%. Most patients treated as bacterial meningitis did not receive a proper diagnostic workup. The choice of antibiotic was not tailored to the specific clinical condition of the patient. Such an approach may result in poor treatment outcomes and lead to antibiotic resistance. Management of patients with suspected bacterial meningitis should be supported by analysis of cerebrospinal fluid, and treatment should be tailored to local evidence and current evidence-based recommendations. © 2016 John Wiley & Sons Ltd.

  8. Hybrid protection algorithms based on game theory in multi-domain optical networks

    NASA Astrophysics Data System (ADS)

    Guo, Lei; Wu, Jingjing; Hou, Weigang; Liu, Yejun; Zhang, Lincong; Li, Hongming

    2011-12-01

    With the network size increasing, the optical backbone is divided into multiple domains and each domain has its own network operator and management policy. At the same time, the failures in optical network may lead to a huge data loss since each wavelength carries a lot of traffic. Therefore, the survivability in multi-domain optical network is very important. However, existing survivable algorithms can achieve only the unilateral optimization for profit of either users or network operators. Then, they cannot well find the double-win optimal solution with considering economic factors for both users and network operators. Thus, in this paper we develop the multi-domain network model with involving multiple Quality of Service (QoS) parameters. After presenting the link evaluation approach based on fuzzy mathematics, we propose the game model to find the optimal solution to maximize the user's utility, the network operator's utility, and the joint utility of user and network operator. Since the problem of finding double-win optimal solution is NP-complete, we propose two new hybrid protection algorithms, Intra-domain Sub-path Protection (ISP) algorithm and Inter-domain End-to-end Protection (IEP) algorithm. In ISP and IEP, the hybrid protection means that the intelligent algorithm based on Bacterial Colony Optimization (BCO) and the heuristic algorithm are used to solve the survivability in intra-domain routing and inter-domain routing, respectively. Simulation results show that ISP and IEP have the similar comprehensive utility. In addition, ISP has better resource utilization efficiency, lower blocking probability, and higher network operator's utility, while IEP has better user's utility.

  9. Structure, function, and evolution of bacterial ATP-binding cassette systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Davidson, A.L.; Dassa, E.; Orelle, C.

    2010-07-27

    The ATP-binding cassette (ABC) systems constitute one of the largest superfamilies of paralogous sequences. All ABC systems share a highly conserved ATP-hydrolyzing domain or protein (the ABC; also referred to as a nucleotide-binding domain [NBD]) that is unequivocally characterized by three short sequence motifs (Fig. 1): these are the Walker A and Walker B motifs, indicative of the presence of a nucleotide-binding site, and the signature motif, unique to ABC proteins, located upstream of the Walker B motif (426). Other motifs diagnostic of ABC proteins are also indicated in Fig. 1. The biological significance of these motifs is discussed inmore » Structure, Function, and Dynamics of the ABC. ABC systems are widespread among living organisms and have been detected in all genera of the three kingdoms of life, with remarkable conservation in the primary sequence of the cassette and in the organization of the constitutive domains or subunits (203, 420). ABC systems couple the energy of ATP hydrolysis to an impressively large variety of essential biological phenomena, comprising not only transmembrane (TM) transport, for which they are best known, but also several non-transport-related processes, such as translation elongation (62) and DNA repair (174). Although ABC systems deserve much attention because they are involved in severe human inherited diseases (107), they were first discovered and characterized in detail in prokaryotes, as early as the 1970s (13, 148, 238, 468). The most extensively analyzed systems were the high-affinity histidine and maltose uptake systems of Salmonella enterica serovar Typhimurium and Escherichia coli. Over 2 decades ago, after the completion of the nucleotide sequences encoding these transporters in the respective laboratories of Giovanna Ames and Maurice Hofnung, Hiroshi Nikaido and colleagues noticed that the two systems displayed a global similarity in the nature of their components and, moreover, that the primary sequences of

  10. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  11. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

  12. Antibiotics for treating bacterial vaginosis in pregnancy.

    PubMed

    McDonald, H; Brocklehurst, P; Parsons, J; Vigneswaran, R

    2003-01-01

    Bacterial vaginosis is an imbalance of the normal vaginal flora with an overgrowth of anaerobic bacteria and a lack of the normal lactobacillary flora. Bacterial vaginosis during pregnancy has been associated with poor perinatal outcome and, in particular, preterm birth. Identification and treatment may reduce the risk of preterm birth and its consequences. To assess the effects of antibiotic treatment of bacterial vaginosis in pregnancy. We searched the Cochrane Pregnancy and Childbirth Group trials register (September 2002). Randomized trials comparing antibiotic treatment with placebo or no treatment, or comparing two or more antibiotic regimens in pregnant women with bacterial vaginosis. Two reviewers assessed trials and extracted data independently. Study authors were contacted for additional information. Ten trials involving 4249 women were included; all were of good quality. Antibiotic therapy was effective at eradicating bacterial vaginosis during pregnancy (odds ratio (OR) 0.21, 95% confidence interval (CI) 0.18 to 0.24, eight trials of 3825 women). Treatment did not significantly reduce the risk of preterm birth before 37 weeks (OR 0.95, 95% CI 0.82 to 1.10, eight trials of 4062 women), 34 weeks (OR 1.20, 95% CI 0.69 to 2.07, five trials of 851 women), or 32 weeks (OR 1.08, 95% CI 0.70 to 1.68, three trials of 3080 women). However, antibiotic treatment did significantly decrease the risk of preterm prelabour rupture of membranes (OR 0.32, 95% CI 0.15 to 0.67, three trials of 562 women). In women with a previous preterm birth, treatment did not affect the risk of subsequent preterm birth (OR 0.83, 95% CI 0.59 to 1.17, five trials of 622 women) but it did decrease the risk of preterm prelabour rupture of membranes (OR 0.14, 95% CI 0.05 to 0.38, two trials of 114 women) and low birthweight (OR 0.31, 95% CI 0.13 to 0.75, five trials of 622 women). Antibiotic treatment can eradicate bacterial vaginosis in pregnancy. However, the current evidence does not

  13. Steady at the wheel: conservative sex and the benefits of bacterial transformation

    PubMed Central

    Ambur, Ole Herman; Engelstädter, Jan; Johnsen, Pål J.

    2016-01-01

    Many bacteria are highly sexual, but the reasons for their promiscuity remain obscure. Did bacterial sex evolve to maximize diversity and facilitate adaptation in a changing world, or does it instead help to retain the bacterial functions that work right now? In other words, is bacterial sex innovative or conservative? Our aim in this review is to integrate experimental, bioinformatic and theoretical studies to critically evaluate these alternatives, with a main focus on natural genetic transformation, the bacterial equivalent of eukaryotic sexual reproduction. First, we provide a general overview of several hypotheses that have been put forward to explain the evolution of transformation. Next, we synthesize a large body of evidence highlighting the numerous passive and active barriers to transformation that have evolved to protect bacteria from foreign DNA, thereby increasing the likelihood that transformation takes place among clonemates. Our critical review of the existing literature provides support for the view that bacterial transformation is maintained as a means of genomic conservation that provides direct benefits to both individual bacterial cells and to transformable bacterial populations. We examine the generality of this view across bacteria and contrast this explanation with the different evolutionary roles proposed to maintain sex in eukaryotes.  This article is part of the themed issue ‘Weird sex: the underappreciated diversity of sexual reproduction’. PMID:27619692

  14. Steady at the wheel: conservative sex and the benefits of bacterial transformation.

    PubMed

    Ambur, Ole Herman; Engelstädter, Jan; Johnsen, Pål J; Miller, Eric L; Rozen, Daniel E

    2016-10-19

    Many bacteria are highly sexual, but the reasons for their promiscuity remain obscure. Did bacterial sex evolve to maximize diversity and facilitate adaptation in a changing world, or does it instead help to retain the bacterial functions that work right now? In other words, is bacterial sex innovative or conservative? Our aim in this review is to integrate experimental, bioinformatic and theoretical studies to critically evaluate these alternatives, with a main focus on natural genetic transformation, the bacterial equivalent of eukaryotic sexual reproduction. First, we provide a general overview of several hypotheses that have been put forward to explain the evolution of transformation. Next, we synthesize a large body of evidence highlighting the numerous passive and active barriers to transformation that have evolved to protect bacteria from foreign DNA, thereby increasing the likelihood that transformation takes place among clonemates. Our critical review of the existing literature provides support for the view that bacterial transformation is maintained as a means of genomic conservation that provides direct benefits to both individual bacterial cells and to transformable bacterial populations. We examine the generality of this view across bacteria and contrast this explanation with the different evolutionary roles proposed to maintain sex in eukaryotes. This article is part of the themed issue 'Weird sex: the underappreciated diversity of sexual reproduction'. © 2016 The Author(s).

  15. Significant expansion of exon-bordering protein domains during animal proteome evolution

    PubMed Central

    Liu, Mingyi; Walch, Heiko; Wu, Shaoping; Grigoriev, Andrei

    2005-01-01

    We present evidence of remarkable genome-wide mobility and evolutionary expansion for a class of protein domains whose borders locate close to the borders of their encoding exons. These exon-bordering domains are more numerous and widely distributed in the human genome than other domains. They also co-occur with more diverse domains to form a larger variety of domain architectures in human proteins. A systematic comparison of nine animal genomes from nematodes to mammals revealed that exon-bordering domains expanded faster than other protein domains in both abundance and distribution, as well as the diversity of co-occurring domains and the domain architectures of harboring proteins. Furthermore, exon-bordering domains exhibited a particularly strong preference for class 1-1 intron phase. Our findings suggest that exon-bordering domains were amplified and interchanged within a genome more often and/or more successfully than other domains during evolution, probably the result of extensive exon shuffling and gene duplication events. The diverse biological functions of these domains underscore the important role they play in the expansion and diversification of animal proteomes. PMID:15640447

  16. Functional and structural characterization of a novel putative cysteine protease cell wall-modifying multi-domain enzyme selected from a microbial metagenome.

    PubMed

    Faheem, Muhammad; Martins-de-Sa, Diogo; Vidal, Julia F D; Álvares, Alice C M; Brandão-Neto, José; Bird, Louise E; Tully, Mark D; von Delft, Frank; Souto, Betulia M; Quirino, Betania F; Freitas, Sonia M; Barbosa, João Alexandre R G

    2016-12-09

    A current metagenomics focus is to interpret and transform collected genomic data into biological information. By combining structural, functional and genomic data we have assessed a novel bacterial protein selected from a carbohydrate-related activity screen in a microbial metagenomic library from Capra hircus (domestic goat) gut. This uncharacterized protein was predicted as a bacterial cell wall-modifying enzyme (CWME) and shown to contain four domains: an N-terminal, a cysteine protease, a peptidoglycan-binding and an SH3 bacterial domain. We successfully cloned, expressed and purified this putative cysteine protease (PCP), which presented autoproteolytic activity and inhibition by protease inhibitors. We observed cell wall hydrolytic activity and ampicillin binding capacity, a characteristic of most bacterial CWME. Fluorimetric binding analysis yielded a K b of 1.8 × 10 5  M -1 for ampicillin. Small-angle X-ray scattering (SAXS) showed a maximum particle dimension of 95 Å with a real-space R g of 28.35 Å. The elongated molecular envelope corroborates the dynamic light scattering (DLS) estimated size. Furthermore, homology modeling and SAXS allowed the construction of a model that explains the stability and secondary structural changes observed by circular dichroism (CD). In short, we report a novel cell wall-modifying autoproteolytic PCP with insight into its biochemical, biophysical and structural features.

  17. Screening of bacterial strains isolated from uranium mill tailings porewaters for bioremediation purposes.

    PubMed

    Sánchez-Castro, Iván; Amador-García, Ahinara; Moreno-Romero, Cristina; López-Fernández, Margarita; Phrommavanh, Vannapha; Nos, Jeremy; Descostes, Michael; Merroun, Mohamed L

    2017-01-01

    The present work characterizes at different levels a number of bacterial strains isolated from porewaters sampled in the vicinity of two French uranium tailing repositories. The 16S rRNA gene from 33 bacterial isolates, corresponding to the different morphotypes recovered, was almost fully sequenced. The resulting sequences belonged to 13 bacterial genera comprised in the phyla Firmicutes, Actinobacteria and Proteobacteria. Further characterization at physiological level and metals/metalloid tolerance provided evidences for an appropriate selection of bacterial strains potentially useful for immobilization of uranium and other common contaminants. By using High Resolution Transmission Electron Microscope (HRTEM), this potential ability to immobilize uranium as U phosphate mineral phases was confirmed for the bacterial strains Br3 and Br5 corresponding to Arthrobacter sp. and Microbacterium oxydans, respectively. Scanning Transmission Electron Microscope- High-Angle Annular Dark-Field (STEM-HAADF) analysis showed U accumulates on the surface and within bacterial cytoplasm, in addition to the extracellular space. Energy Dispersive X-ray (EDX) element-distribution maps demonstrated the presence of U and P within these accumulates. These results indicate the potential of certain bacterial strains isolated from porewaters of U mill tailings for immobilizing uranium, likely as uranium phosphates. Some of these bacterial isolates might be considered as promising candidates in the design of uranium bioremediation strategies. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. [Bacterial prostatitis and prostatic fibrosis: modern view on the treatment and prophylaxis].

    PubMed

    Zaitsev, A V; Pushkar, D Yu; Khodyreva, L A; Dudareva, A A

    2016-08-01

    Treatments of chronic bacterial prostatitis (CP) remain difficult problem. Bacterial prostatitis is a disease entity diagnosed clinically and by evidence of inflammation and infection localized to the prostate. Risk factors for UTI in men include urological interventions, such as transrectal prostate biopsy. Ensuing infections after prostate biopsy, such as UTI and bacterial prostatitis, are increasing due to increasing rates of fluoroquinolone resistance. The increasing global antibiotic resistance also significantly affects management of UTI in men, and therefore calls for alternative strategies. Prostatic inflammation has been suggested to contribute to the etiology of lower urinary tract symptoms (LUTS) by inducing fibrosis. Several studies have shown that prostatic fibrosis is strongly associated with impaired urethral function and LUTS severity. Fibrosis resulting from excessive deposition of collagen is traditionally recognized as a progressive irreversible condition and an end stage of inflammatory diseases; however, there is compelling evidence in both animal and human studies to support that the development of fibrosis could potentially be a reversible process. Prostate inflammation may induce fibrotic changes in periurethral prostatic tissues, promote urethral stiffness and LUTS. Patients experiencing CP and prostate-related LUTS could benefit from anti-inflammatory therapies, especially used in combination with the currently prescribed enzyme treatment with Longidase. Treatment results showed that longidase is highly effective in bacterial and abacterial CP. Longidase addition to standard therapeutic methods significantly reduced the disease symptoms and regression of inflammatory-proliferative alterations in the prostate.

  19. Crystal Structure of the Human, FIC-Domain Containing Protein HYPE and Implications for Its Functions

    PubMed Central

    Bunney, Tom D.; Cole, Ambrose R.; Broncel, Malgorzata; Esposito, Diego; Tate, Edward W.; Katan, Matilda

    2014-01-01

    Summary Protein AMPylation, the transfer of AMP from ATP to protein targets, has been recognized as a new mechanism of host-cell disruption by some bacterial effectors that typically contain a FIC-domain. Eukaryotic genomes also encode one FIC-domain protein, HYPE, which has remained poorly characterized. Here we describe the structure of human HYPE, solved by X-ray crystallography, representing the first structure of a eukaryotic FIC-domain protein. We demonstrate that HYPE forms stable dimers with structurally and functionally integrated FIC-domains and with TPR-motifs exposed for protein-protein interactions. As HYPE also uniquely possesses a transmembrane helix, dimerization is likely to affect its positioning and function in the membrane vicinity. The low rate of autoAMPylation of the wild-type HYPE could be due to autoinhibition, consistent with the mechanism proposed for a number of putative FIC AMPylators. Our findings also provide a basis to further consider possible alternative cofactors of HYPE and distinct modes of target-recognition. PMID:25435325

  20. Crystal structure of the human, FIC-domain containing protein HYPE and implications for its functions.

    PubMed

    Bunney, Tom D; Cole, Ambrose R; Broncel, Malgorzata; Esposito, Diego; Tate, Edward W; Katan, Matilda

    2014-12-02

    Protein AMPylation, the transfer of AMP from ATP to protein targets, has been recognized as a new mechanism of host-cell disruption by some bacterial effectors that typically contain a FIC-domain. Eukaryotic genomes also encode one FIC-domain protein,HYPE, which has remained poorly characterized.Here we describe the structure of human HYPE, solved by X-ray crystallography, representing the first structure of a eukaryotic FIC-domain protein. We demonstrate that HYPE forms stable dimers with structurally and functionally integrated FIC-domains and with TPR-motifs exposed for protein-protein interactions. As HYPE also uniquely possesses a transmembrane helix, dimerization is likely to affect its positioning and function in the membrane vicinity. The low rate of auto AMPylation of the wild-type HYPE could be due to autoinhibition, consistent with the mechanism proposed for a number of putative FIC AMPylators. Our findings also provide a basis to further consider possible alternative cofactors of HYPE and distinct modes of target-recognition.

  1. Namib Desert edaphic bacterial, fungal and archaeal communities assemble through deterministic processes but are influenced by different abiotic parameters.

    PubMed

    Johnson, Riegardt M; Ramond, Jean-Baptiste; Gunnigle, Eoin; Seely, Mary; Cowan, Don A

    2017-03-01

    The central Namib Desert is hyperarid, where limited plant growth ensures that biogeochemical processes are largely driven by microbial populations. Recent research has shown that niche partitioning is critically involved in the assembly of Namib Desert edaphic communities. However, these studies have mainly focussed on the Domain Bacteria. Using microbial community fingerprinting, we compared the assembly of the bacterial, fungal and archaeal populations of microbial communities across nine soil niches from four Namib Desert soil habitats (riverbed, dune, gravel plain and salt pan). Permutational multivariate analysis of variance indicated that the nine soil niches presented significantly different physicochemistries (R 2  = 0.8306, P ≤ 0.0001) and that bacterial, fungal and archaeal populations were soil niche specific (R 2  ≥ 0.64, P ≤ 0.001). However, the abiotic drivers of community structure were Domain-specific (P < 0.05), with P, clay and sand fraction, and NH 4 influencing bacterial, fungal and archaeal communities, respectively. Soil physicochemistry and soil niche explained over 50% of the variation in community structure, and communities displayed strong non-random patterns of co-occurrence. Taken together, these results demonstrate that in central Namib Desert soil microbial communities, assembly is principally driven by deterministic processes.

  2. Family-specific scaling laws in bacterial genomes.

    PubMed

    De Lazzari, Eleonora; Grilli, Jacopo; Maslov, Sergei; Cosentino Lagomarsino, Marco

    2017-07-27

    Among several quantitative invariants found in evolutionary genomics, one of the most striking is the scaling of the overall abundance of proteins, or protein domains, sharing a specific functional annotation across genomes of given size. The size of these functional categories change, on average, as power-laws in the total number of protein-coding genes. Here, we show that such regularities are not restricted to the overall behavior of high-level functional categories, but also exist systematically at the level of single evolutionary families of protein domains. Specifically, the number of proteins within each family follows family-specific scaling laws with genome size. Functionally similar sets of families tend to follow similar scaling laws, but this is not always the case. To understand this systematically, we provide a comprehensive classification of families based on their scaling properties. Additionally, we develop a quantitative score for the heterogeneity of the scaling of families belonging to a given category or predefined group. Under the common reasonable assumption that selection is driven solely or mainly by biological function, these findings point to fine-tuned and interdependent functional roles of specific protein domains, beyond our current functional annotations. This analysis provides a deeper view on the links between evolutionary expansion of protein families and the functional constraints shaping the gene repertoire of bacterial genomes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Eukaryotic ribonucleases P/MRP: the crystal structure of the P3 domain.

    PubMed

    Perederina, Anna; Esakova, Olga; Quan, Chao; Khanova, Elena; Krasilnikov, Andrey S

    2010-02-17

    Ribonuclease (RNase) P is a site-specific endoribonuclease found in all kingdoms of life. Typical RNase P consists of a catalytic RNA component and a protein moiety. In the eukaryotes, the RNase P lineage has split into two, giving rise to a closely related enzyme, RNase MRP, which has similar components but has evolved to have different specificities. The eukaryotic RNases P/MRP have acquired an essential helix-loop-helix protein-binding RNA domain P3 that has an important function in eukaryotic enzymes and distinguishes them from bacterial and archaeal RNases P. Here, we present a crystal structure of the P3 RNA domain from Saccharomyces cerevisiae RNase MRP in a complex with RNase P/MRP proteins Pop6 and Pop7 solved to 2.7 A. The structure suggests similar structural organization of the P3 RNA domains in RNases P/MRP and possible functions of the P3 domains and proteins bound to them in the stabilization of the holoenzymes' structures as well as in interactions with substrates. It provides the first insight into the structural organization of the eukaryotic enzymes of the RNase P/MRP family.

  4. Bacterial meningitis.

    PubMed

    Heckenberg, Sebastiaan G B; Brouwer, Matthijs C; van de Beek, Diederik

    2014-01-01

    Bacterial meningitis is a neurologic emergency. Vaccination against common pathogens has decreased the burden of disease. Early diagnosis and rapid initiation of empiric antimicrobial and adjunctive therapy are vital. Therapy should be initiated as soon as blood cultures have been obtained, preceding any imaging studies. Clinical signs suggestive of bacterial meningitis include fever, headache, meningismus, and an altered level of consciousness but signs may be scarce in children, in the elderly, and in meningococcal disease. Host genetic factors are major determinants of susceptibility to meningococcal and pneumococcal disease. Dexamethasone therapy has been implemented as adjunctive treatment of adults with pneumococcal meningitis. Adequate and prompt treatment of bacterial meningitis is critical to outcome. In this chapter we review the epidemiology, pathophysiology, and management of bacterial meningitis. © 2014 Elsevier B.V. All rights reserved.

  5. Susceptibility of metallic magnesium implants to bacterial biofilm infections.

    PubMed

    Rahim, Muhammad Imran; Rohde, Manfred; Rais, Bushra; Seitz, Jan-Marten; Mueller, Peter P

    2016-06-01

    Magnesium alloys have promising mechanical and biological properties as biodegradable medical implant materials for temporary applications during bone healing or as vascular stents. Whereas conventional implants are prone to colonization by treatment resistant microbial biofilms in which bacteria are embedded in a protective matrix, magnesium alloys have been reported to act antibacterial in vitro. To permit a basic assessment of antibacterial properties of implant materials in vivo an economic but robust animal model was established. Subcutaneous magnesium implants were inoculated with bacteria in a mouse model. Contrary to the expectations, bacterial activity was enhanced and prolonged in the presence of magnesium implants. Systemic antibiotic treatments were remarkably ineffective, which is a typical property of bacterial biofilms. Biofilm formation was further supported by electron microscopic analyses that revealed highly dense bacterial populations and evidence for the presence of extracellular matrix material. Bacterial agglomerates could be detected not only on the implant surface but also at a limited distance in the peri-implant tissue. Therefore, precautions may be necessary to minimize risks of metallic magnesium-containing implants in prospective clinical applications. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 104A: 1489-1499, 2016. © 2016 Wiley Periodicals, Inc.

  6. Proteomic analysis of the bacterial cell cycle

    PubMed Central

    Grünenfelder, Björn; Rummel, Gabriele; Vohradsky, Jiri; Röder, Daniel; Langen, Hanno; Jenal, Urs

    2001-01-01

    A global approach was used to analyze protein synthesis and stability during the cell cycle of the bacterium Caulobacter crescentus. Approximately one-fourth (979) of the estimated C. crescentus gene products were detected by two-dimensional gel electrophoresis, 144 of which showed differential cell cycle expression patterns. Eighty-one of these proteins were identified by mass spectrometry and were assigned to a wide variety of functional groups. Pattern analysis revealed that coexpression groups were functionally clustered. A total of 48 proteins were rapidly degraded in the course of one cell cycle. More than half of these unstable proteins were also found to be synthesized in a cell cycle-dependent manner, establishing a strong correlation between rapid protein turnover and the periodicity of the bacterial cell cycle. This is, to our knowledge, the first evidence for a global role of proteolysis in bacterial cell cycle control. PMID:11287652

  7. Intracellular Protein Delivery System Using a Target-Specific Repebody and Translocation Domain of Bacterial Exotoxin.

    PubMed

    Kim, Hee-Yeon; Kang, Jung Ae; Ryou, Jeong-Hyun; Lee, Gyeong Hee; Choi, Dae Seong; Lee, Dong Eun; Kim, Hak-Sung

    2017-11-17

    With the high efficacy of protein-based therapeutics and plenty of intracellular drug targets, cytosolic protein delivery in a cell-specific manner has attracted considerable attention in the field of precision medicine. Herein, we present an intracellular protein delivery system based on a target-specific repebody and the translocation domain of Pseudomonas aeruginosa exotoxin A. The delivery platform was constructed by genetically fusing an EGFR-specific repebody as a targeting moiety to the translocation domain, while a protein cargo was fused to the C-terminal end of the delivery platform. The delivery platform was revealed to efficiently translocate a protein cargo to the cytosol in a target-specific manner. We demonstrate the utility and potential of the delivery platform by showing a remarkable tumor regression with negligible toxicity in a xenograft mice model when gelonin was used as the cytotoxic protein cargo. The present platform can find wide applications to the cell-selective cytosolic delivery of diverse proteins in many areas.

  8. Changes in bacterial composition of biofilm in a metropolitan drinking water distribution system.

    PubMed

    Revetta, R P; Gomez-Alvarez, V; Gerke, T L; Santo Domingo, J W; Ashbolt, N J

    2016-07-01

    This study examined the development of bacterial biofilms within a metropolitan distribution system. The distribution system is fed with different source water (i.e. groundwater, GW and surface water, SW) and undergoes different treatment processes in separate facilities. The biofilm community was characterized using 16S rRNA gene clone libraries and functional potential analysis, generated from total DNA extracted from coupons in biofilm annular reactors fed with onsite drinking water for up to 18 months. Differences in the bacterial community structure were observed between GW and SW. Representatives that explained the dissimilarity were associated with the classes Betaproteobacteria, Alphaproteobacteria, Actinobacteria, Gammaproteobacteria and Firmicutes. After 9 months the biofilm bacterial community from both GW and SW were dominated by Mycobacterium species. The distribution of the dominant operational taxonomic unit (OTU) (Mycobacterium) positively correlated with the drinking water distribution system (DWDS) temperature. In this study, the biofilm community structure observed between GW and SW were dissimilar, while communities from different locations receiving SW did not show significant differences. The results suggest that source water and/or the water quality shaped by their respective treatment processes may play an important role in shaping the bacterial communities in the distribution system. In addition, several bacterial groups were present in all samples, suggesting that they are an integral part of the core microbiota of this DWDS. These results provide an ecological insight into biofilm bacterial structure in chlorine-treated drinking water influenced by different water sources and their respective treatment processes. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

  9. Molecular and Ecological Evidence for Species Specificity and Coevolution in a Group of Marine Algal-Bacterial Symbioses

    PubMed Central

    Ashen, Jon B.; Goff, Lynda J.

    2000-01-01

    The phylogenetic relationships of bacterial symbionts from three gall-bearing species in the marine red algal genus Prionitis (Rhodophyta) were inferred from 16S rDNA sequence analysis and compared to host phylogeny also inferred from sequence comparisons (nuclear ribosomal internal-transcribed-spacer region). Gall formation has been described previously on two species of Prionitis, P. lanceolata (from central California) and P. decipiens (from Peru). This investigation reports gall formation on a third related host, Prionitis filiformis. Phylogenetic analyses based on sequence comparisons place the bacteria as a single lineage within the Roseobacter grouping of the α subclass of the division Proteobacteria (99.4 to 98.25% sequence identity among phylotypes). Comparison of symbiont and host molecular phylogenies confirms the presence of three gall-bearing algal lineages and is consistent with the hypothesis that these red seaweeds and their bacterial symbionts are coevolving. The species specificity of these associations was investigated in nature by whole-cell hybridization of gall bacteria and in the laboratory by using cross-inoculation trials. Whole-cell in situ hybridization confirmed that a single bacterial symbiont phylotype is present in galls on each host. In laboratory trials, bacterial symbionts were incapable of inducing galls on alternate hosts (including two non-gall-bearing species). Symbiont-host specificity in Prionitis gall formation indicates an effective ecological separation between these closely related symbiont phylotypes and provides an example of a biological context in which to consider the organismic significance of 16S rDNA sequence variation. PMID:10877801

  10. Archaeal MCM has separable processivity, substrate choice and helicase domains

    PubMed Central

    Barry, Elizabeth R.; McGeoch, Adam T.; Kelman, Zvi; Bell, Stephen D.

    2007-01-01

    The mini-chromosome maintenance (MCM) complex is the principal candidate for the replicative helicase of archaea and eukaryotes. Here, we describe a functional dissection of the roles of the three principal structural modules of the homomultimeric MCM of the hyperthermophilic archaeon Sulfolobus solfataricus. Our results include the first analysis of the central AAA+ domain in isolation. This domain possesses ATPase and helicase activity, defining this as the minimal helicase domain. Reconstitution experiments show that the helicase activity of the AAA+ domain can be stimulated by addition of the isolated N-terminal half in trans. Addition of the N-terminus influences both the processivity of the helicase and the choice of substrate that can be melted by the ATPase domain. The degenerate helix-turn-helix domain at the C-terminus of MCM exerts a negative effect on the helicase activity of the complex. These results provide the first evidence for extensive regulatory inter-domain communication within the MCM complex. PMID:17259218

  11. Response of soil bacterial community to repeated applications of carbendazim.

    PubMed

    Wang, Xiuguo; Song, Min; Wang, Yiqi; Gao, Chunming; Zhang, Qun; Chu, Xiaoqiang; Fang, Hua; Yu, Yunlong

    2012-01-01

    The effect of repeated carbendazim applications on functional diversity of culturable microorganisms and bacterial community composition was studied under field conditions. The functional diversity of soil culturable microbial community (Shannon index, H') reduced significantly (P<0.05) after the first introduction of carbendazim at levels of 0.94, 1.88 and 4.70 kg active ingredient (a.i.)ha(-1) and then recovered to that in the control with subsequent applications. An evident (P<0.01) difference in the bacterial community composition was observed after the second carbendazim application by Temperature Gradient Gel Electrophoresis (TGGE) analysis of 16S rRNA genes amplified from treated and control soils, which remained after the third and fourth treatments. Our results indicated that repeated carbendazim applications have a transient harmful effect on functional diversity of soil culturable microbial community and result in an alteration in bacterial community composition largely due to one species within the γ-proteobacterium. Copyright © 2011 Elsevier Inc. All rights reserved.

  12. Bacterial biomass and activity in the deep waters of the eastern Atlantic—evidence of a barophilic community

    NASA Astrophysics Data System (ADS)

    Patching, J. W.; Eardly, D.

    1997-09-01

    Bacterial biomass and activity were investigated in deep waters at two sites in the eastern Atlantic, of similar depth (4560-4800 m), but varying in their nutritional status. The Northern (N) site was eutrophic and subject to a strong seasonal input of surface derived organic matter (phytodetritus) to the sediment. The Southern (S) site was oligotrophic. Deep water at this site does not appear to receive any strong seasonal input. Bacterial numbers in the deep water column at the N site showed no significant seasonal variation but were greater than those at the S site. Deep water bacteria were typically small and free-living. From biovolume determinations, it was estimated that mean concentrations of bacterial organic carbon at depths greater than 500 m were 0.12 (0.03-0.29) μg C 1 -1 and 0.02 (0.01-0.04) μg C 1 -1 at the N and S sites, respectively. Rates of thymidine and leucine incorporation were used as indicators of bacterial activity. Bacterial communities in water in contact with the sediment (SCW; sediment contact water) at both sites (but especially at the S site) were strongly barophilic at in situ temperatures (2.5-4.1°C). The barophilic response of thymidine incorporation was enhanced when SCW samples from the N site were incubated at 11.5°C. It is proposed that this result indicated an elevating effect of pressure on cardinal temperatures and that the SCW community was obligately psychrophilic when unpressurised. Comparison of cell-specific incorporation rates determined under in situ conditions showed bacteria in the SCW to have levels of activity comparable with bacteria from a depth of 150 m. Thymidine incorporation rates were highest in SCW samples taken at the N site in May 1988 and September 1989. Thymidine incorporation by SCW samples taken immediately before (10 April 1994) the main spring-bloom-associated deposition of phytodetritus was significantly lower and comparable with that determined for the oligotrophic S site. The attributes

  13. The Measurement and Role of Ecological Resilience Systems Theory Across Domain-Specific Outcomes: The Domain-Specific Resilient Systems Scales.

    PubMed

    Maltby, John; Day, Liz; Hall, Sophie S; Chivers, Sally

    2017-10-01

    Research suggests that trait resilience may be best understood within an ecological resilient systems theory, comprising engineering, ecological, and adaptive capacity resilience. However, there is no evidence as to how this theory translates to specific life domains. Data from two samples (the United States, n = 1,278; the United Kingdom, n = 211) facilitated five studies that introduce the Domain-Specific Resilient Systems Scales for assessing ecological resilient systems theory within work, health, marriage, friendships, and education. The Domain-Specific Resilient Systems Scales are found to predict unique variance in job satisfaction, lower job burnout, quality-of-life following illness, marriage commitment, and educational engagement, while controlling for factors including sex, age, personality, cognitive ability, and trait resilience. The findings also suggest a distinction between the three resilience dimensions in terms of the types of systems to which they contribute. Engineering resilience may contribute most to life domains where an established system needs to be maintained, for example, one's health. Ecological resilience may contribute most to life domains where the system needs sustainability in terms of present and future goal orientation, for example, one's work. Adaptive Capacity may contribute most to life domains where the system needs to be retained, preventing it from reaching a crisis state, for example, work burnout.

  14. SLC15A2 and SLC15A4 Mediate the Transport of Bacterially Derived Di/Tripeptides To Enhance the Nucleotide-Binding Oligomerization Domain-Dependent Immune Response in Mouse Bone Marrow-Derived Macrophages.

    PubMed

    Hu, Yongjun; Song, Feifeng; Jiang, Huidi; Nuñez, Gabriel; Smith, David E

    2018-05-21

    There is increasing evidence that proton-coupled oligopeptide transporters (POTs) can transport bacterially derived chemotactic peptides and therefore reside at the critical interface of innate immune responses and regulation. However, there is substantial contention regarding how these bacterial peptides access the cytosol to exert their effects and which POTs are involved in facilitating this process. Thus, the current study proposed to determine the (sub)cellular expression and functional activity of POTs in macrophages derived from mouse bone marrow and to evaluate the effect of specific POT deletion on the production of inflammatory cytokines in wild-type, Pept2 knockout and Pht1 knockout mice. We found that PEPT2 and PHT1 were highly expressed and functionally active in mouse macrophages, but PEPT1 was absent. The fluorescent imaging of muramyl dipeptide-rhodamine clearly demonstrated that PEPT2 was expressed on the plasma membrane of macrophages, whereas PHT1 was expressed on endosomal membranes. Moreover, both transporters could significantly influence the effect of bacterially derived peptide ligands on cytokine stimulation, as shown by the reduced responses in Pept2 knockout and Pht1 knockout mice as compared with wild-type animals. Taken as a whole, our results point to PEPT2 (at plasma membranes) and PHT1 (at endosomal membranes) working in concert to optimize the uptake of bacterial ligands into the cytosol of macrophages, thereby enhancing the production of proinflammatory cytokines. This new paradigm offers significant insight into potential drug development strategies along with transporter-targeted therapies for endocrine, inflammatory, and autoimmune diseases. Copyright © 2018 by The American Association of Immunologists, Inc.

  15. Simultaneous amplicon sequencing to explore co-occurrence patterns of bacterial, archaeal and eukaryotic microorganisms in rumen microbial communities.

    PubMed

    Kittelmann, Sandra; Seedorf, Henning; Walters, William A; Clemente, Jose C; Knight, Rob; Gordon, Jeffrey I; Janssen, Peter H

    2013-01-01

    Ruminants rely on a complex rumen microbial community to convert dietary plant material to energy-yielding products. Here we developed a method to simultaneously analyze the community's bacterial and archaeal 16S rRNA genes, ciliate 18S rRNA genes and anaerobic fungal internal transcribed spacer 1 genes using 12 DNA samples derived from 11 different rumen samples from three host species (Ovis aries, Bos taurus, Cervus elephas) and multiplex 454 Titanium pyrosequencing. We show that the mixing ratio of the group-specific DNA templates before emulsion PCR is crucial to compensate for differences in amplicon length. This method, in contrast to using a non-specific universal primer pair, avoids sequencing non-targeted DNA, such as plant- or endophyte-derived rRNA genes, and allows increased or decreased levels of community structure resolution for each microbial group as needed. Communities analyzed with different primers always grouped by sample origin rather than by the primers used. However, primer choice had a greater impact on apparent archaeal community structure than on bacterial community structure, and biases for certain methanogen groups were detected. Co-occurrence analysis of microbial taxa from all three domains of life suggested strong within- and between-domain correlations between different groups of microorganisms within the rumen. The approach used to simultaneously characterize bacterial, archaeal and eukaryotic components of a microbiota should be applicable to other communities occupying diverse habitats.

  16. Structure and function of the bi-directional bacterial flagellar motor.

    PubMed

    Morimoto, Yusuke V; Minamino, Tohru

    2014-02-18

    The bacterial flagellum is a locomotive organelle that propels the bacterial cell body in liquid environments. The flagellum is a supramolecular complex composed of about 30 different proteins and consists of at least three parts: a rotary motor, a universal joint, and a helical filament. The flagellar motor of Escherichia coli and Salmonella enterica is powered by an inward-directed electrochemical potential difference of protons across the cytoplasmic membrane. The flagellar motor consists of a rotor made of FliF, FliG, FliM and FliN and a dozen stators consisting of MotA and MotB. FliG, FliM and FliN also act as a molecular switch, enabling the motor to spin in both counterclockwise and clockwise directions. Each stator is anchored to the peptidoglycan layer through the C-terminal periplasmic domain of MotB and acts as a proton channel to couple the proton flow through the channel with torque generation. Highly conserved charged residues at the rotor-stator interface are required not only for torque generation but also for stator assembly around the rotor. In this review, we will summarize our current understanding of the structure and function of the proton-driven bacterial flagellar motor.

  17. Plasma surface modification of rigid contact lenses decreases bacterial adhesion.

    PubMed

    Wang, Yingming; Qian, Xuefeng; Zhang, Xiaofeng; Xia, Wei; Zhong, Lei; Sun, Zhengtai; Xia, Jing

    2013-11-01

    Contact lens safety is an important topic in clinical studies. Corneal infections usually occur because of the use of bacteria-carrying contact lenses. The current study investigated the impact of plasma surface modification on bacterial adherence to rigid contact lenses made of fluorosilicone acrylate materials. Boston XO and XO2 contact lenses were modified using plasma technology (XO-P and XO2-P groups). Untreated lenses were used as controls. Plasma-treated and control lenses were incubated in solutions containing Staphylococcus aureus or Pseudomonas aeruginosa. MTT colorimetry, colony-forming unit counting method, and scanning electron microscopy were used to measure bacterial adhesion. MTT colorimetry measurements showed that the optical density (OD) values of XO-P and XO2-P were significantly lower than those of XO and XO2, respectively, after incubation with S. aureus (P < 0.01). The OD value of XO-P was also much lower than that of XO after incubation with P. aeruginosa (P < 0.01). Colony-forming unit counting revealed that a significantly lower number of bacterial colonies attached to the XO-P versus XO lenses and to the XO2-P versus XO2 lenses incubated with S. aureus (P < 0.01). Fewer bacterial colonies attached to the XO-P versus XO lenses incubated with P. aeruginosa (P < 0.01). Further, scanning electron microscopy suggested different bacterial adhesion morphology on plasma-treated versus control lenses. Plasma surface modification can significantly decrease bacterial adhesion to fluorosilicone acrylate contact lenses. This study provides important evidence of a unique benefit of plasma technology in contact lens surface modification.

  18. OST-HTH: a novel predicted RNA-binding domain

    PubMed Central

    2010-01-01

    Background The mechanism by which the arthropod Oskar and vertebrate TDRD5/TDRD7 proteins nucleate or organize structurally related ribonucleoprotein (RNP) complexes, the polar granule and nuage, is poorly understood. Using sequence profile searches we identify a novel domain in these proteins that is widely conserved across eukaryotes and bacteria. Results Using contextual information from domain architectures, sequence-structure superpositions and available functional information we predict that this domain is likely to adopt the winged helix-turn-helix fold and bind RNA with a potential specificity for dsRNA. We show that in eukaryotes this domain is often combined in the same polypeptide with protein-protein- or lipid- interaction domains that might play a role in anchoring these proteins to specific cytoskeletal structures. Conclusions Thus, proteins with this domain might have a key role in the recognition and localization of dsRNA, including miRNAs, rasiRNAs and piRNAs hybridized to their targets. In other cases, this domain is fused to ubiquitin-binding, E3 ligase and ubiquitin-like domains indicating a previously under-appreciated role for ubiquitination in regulating the assembly and stability of nuage-like RNP complexes. Both bacteria and eukaryotes encode a conserved family of proteins that combines this predicted RNA-binding domain with a previously uncharacterized domain (DUF88). We present evidence that it is an RNAse belonging to the superfamily that includes the 5'->3' nucleases, PIN and NYN domains and might be recruited to degrade certain RNAs. Reviewers This article was reviewed by Sandor Pongor and Arcady Mushegian. PMID:20302647

  19. Domain or not domain? That is the question: longitudinal semantic deterioration in Alzheimer's disease.

    PubMed

    Moreno-Martínez, F Javier; Goñi-Imízcoz, Miguel; Spitznagel, Mary Beth

    2011-10-01

    Category specific semantic impairment (e.g. living versus nonliving things) has been reported in association with various pathologies, including herpes simplex encephalitis and semantic dementia. However, evidence is inconsistent regarding whether this effect exists in diseases progressively impacting diverse cortical regions, such as Alzheimer's disease (AD). Ceiling effects producing non-Gaussian distributions and poor control for confounds such as nuisance variables (e.g. familiarity) may contribute to this discrepancy. Fourteen AD patients were longitudinally studied examining category effects on three semantic tasks (picture naming, naming to description and word to picture matching) matched across domain on all known nuisance variables (NV). To address non-Gaussian distributions, we run bootstrap analyses to determine whether NV, semantic domain or control performance best predicted AD patient performance. Multiple hierarchical regression analyses revealed that, whilst NV accounted for most of the explained variance in patients in the three tasks, the influence of semantic domain was substantially lower. Individual logistic regression demonstrated a significant category effect in only a few patients and healthy controls. No significant qualitative changes were observed in patients over time. Our results confirm the importance of NVs as predictors of AD patient performance, suggesting that the role of semantic domain is not a useful predictor of the progressive deterioration in AD. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. OmpA: A Flexible Clamp for Bacterial Cell Wall Attachment.

    PubMed

    Samsudin, Firdaus; Ortiz-Suarez, Maite L; Piggot, Thomas J; Bond, Peter J; Khalid, Syma

    2016-12-06

    The envelope of Gram-negative bacteria is highly complex, containing separate outer and inner membranes and an intervening periplasmic space encompassing a peptidoglycan (PGN) cell wall. The PGN scaffold is anchored non-covalently to the outer membrane via globular OmpA-like domains of various proteins. We report atomically detailed simulations of PGN bound to OmpA in three different states, including the isolated C-terminal domain (CTD), the full-length monomer, or the complete full-length dimeric form. Comparative analysis of dynamics of OmpA CTD from different bacteria helped to identify a conserved PGN-binding mode. The dynamics of full-length OmpA, embedded within a realistic representation of the outer membrane containing full-rough (Ra) lipopolysaccharide, phospholipids, and cardiolipin, suggested how the protein may provide flexible mechanical support to the cell wall. An accurate model of the heterogeneous bacterial cell envelope should facilitate future efforts to develop antibacterial agents. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Structure of a bacterial homologue of vitamin K epoxide reductase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Weikai; Schulman, Sol; Dutton, Rachel J.

    Vitamin K epoxide reductase (VKOR) generates vitamin K hydroquinone to sustain {gamma}-carboxylation of many blood coagulation factors. Here, we report the 3.6 {angstrom} crystal structure of a bacterial homologue of VKOR from Synechococcus sp. The structure shows VKOR in complex with its naturally fused redox partner, a thioredoxin-like domain, and corresponds to an arrested state of electron transfer. The catalytic core of VKOR is a four transmembrane helix bundle that surrounds a quinone, connected through an additional transmembrane segment with the periplasmic thioredoxin-like domain. We propose a pathway for how VKOR uses electrons from cysteines of newly synthesized proteins tomore » reduce a quinone, a mechanism confirmed by in vitro reconstitution of vitamin K-dependent disulphide bridge formation. Our results have implications for the mechanism of the mammalian VKOR and explain how mutations can cause resistance to the VKOR inhibitor warfarin, the most commonly used oral anticoagulant.« less

  2. Multi-functional roles for the polypeptide transport associated domains of Toc75 in chloroplast protein import

    PubMed Central

    Paila, Yamuna D; Richardson, Lynn GL; Inoue, Hitoshi; Parks, Elizabeth S; McMahon, James; Inoue, Kentaro; Schnell, Danny J

    2016-01-01

    Toc75 plays a central role in chloroplast biogenesis in plants as the membrane channel of the protein import translocon at the outer envelope of chloroplasts (TOC). Toc75 is a member of the Omp85 family of bacterial and organellar membrane insertases, characterized by N-terminal POTRA (polypeptide-transport associated) domains and C-terminal membrane-integrated β-barrels. We demonstrate that the Toc75 POTRA domains are essential for protein import and contribute to interactions with TOC receptors, thereby coupling preprotein recognition at the chloroplast surface with membrane translocation. The POTRA domains also interact with preproteins and mediate the recruitment of molecular chaperones in the intermembrane space to facilitate membrane transport. Our studies are consistent with the multi-functional roles of POTRA domains observed in other Omp85 family members and demonstrate that the domains of Toc75 have evolved unique properties specific to the acquisition of protein import during endosymbiotic evolution of the TOC system in plastids. DOI: http://dx.doi.org/10.7554/eLife.12631.001 PMID:26999824

  3. The pore-forming bacterial effector, VopQ, halts autophagic turnover.

    PubMed

    Sreelatha, Anju; Orth, Kim; Starai, Vincent J

    2013-12-01

    Vibrio parahemolyticus Type III effector VopQ is both necessary and sufficient to induce autophagy within one hour of infection. We demonstrated that VopQ interacts with the Vo domain of the conserved vacuolar H(+)-ATPase. Membrane-associated VopQ subsequently forms pores in the membranes of acidic compartments, resulting in immediate release of protons without concomitant release of lumenal protein contents. These studies show how a bacterial pathogen can compromise host ion potentials using a gated pore-forming effector to equilibrate levels of small molecules found in endolysosomal compartments and disrupt cellular processes such as autophagy.

  4. Ovarian Tumor (OTU)-domain Containing Viral Proteases Evade Ubiquitin- and ISG15-dependent Innate Immune Responses

    PubMed Central

    Frias-Staheli, Natalia; Giannakopoulos, Nadia V.; Kikkert, Marjolein; Taylor, Shannon L.; Bridgen, Anne; Paragas, Jason J.; Richt, Juergen A.; Rowland, Raymond R.; Schmaljohn, Connie S.; Lenschow, Deborah J.; Snijder, Eric J.; García-Sastre, Adolfo; Virgin, Herbert Whiting

    2007-01-01

    Summary Ubiquitin (Ub) and interferon stimulated gene product 15 (ISG15) reversibly conjugate to proteins via a conserved LRLRGG C-terminal motif, mediating important innate antiviral responses. The ovarian tumor (OTU) domain represents a superfamily of predicted proteases found in eukaryotic, bacterial and viral proteins, some of which have Ub-deconjugating activity. We show that the OTU domain-containing proteases of nairoviruses and arteriviruses hydrolyze Ub and ISG15 from cellular target proteins. This broad activity contrasts with the target specificity of known mammalian OTU domain-containing proteins. The biological significance of this activity of viral OTU domain-containing proteases was evidenced by their capacity to inhibit NF-κB dependent signaling and to antagonize the antiviral effects of ISG15 during Sindbis virus infection in vivo. The deconjugating activity of viral OTU proteases represents a novel viral immune evasion mechanism that inhibits Ub-and ISG15-dependent antiviral pathways. PMID:18078692

  5. A novel dimerization interface of cyclic nucleotide binding domain, which is disrupted in presence of cAMP: implications for CNG channels gating.

    PubMed

    Gushchin, Ivan Y; Gordeliy, Valentin I; Grudinin, Sergei

    2012-09-01

    Cyclic nucleotide binding domain (CNBD) is a ubiquitous domain of effector proteins involved in signalling cascades of prokaryota and eukaryota. CNBD activation by cyclic nucleotide monophosphate (cNMP) is studied well in the case of several proteins. However, this knowledge is hardly applicable to cNMP-modulated cation channels. Despite the availability of CNBD crystal structures of bacterial cyclic nucleotide-gated (CNG) and mammalian hyperpolarization-activated cyclic nucleotide-modulated (HCN) channels in presence and absence of the cNMP, the full understanding of CNBD conformational changes during activation is lacking. Here, we describe a novel CNBD dimerization interface found in crystal structures of bacterial CNG channel MlotiK1 and mammalian cAMP-activated guanine nucleotide-exchange factor Epac2. Molecular dynamics simulations show that the found interface is stable on the studied timescale of 100 ns, in contrast to the dimerization interface, reported previously. Comparisons with cN-bound structures of CNBD show that the dimerization is incompatible with cAMP binding. Thus, the cAMP-dependent monomerization of CNBD may be an alternative mechanism of the cAMP sensing. Based on these findings, we propose a model of the bacterial CNG channel modulation by cAMP.

  6. A Structural Study of CESA1 Catalytic Domain of Arabidopsis Cellulose Synthesis Complex: Evidence for CESA Trimers

    DOE PAGES

    Vandavasi, Venu Gopal; Putnam, Daniel K.; Zhang, Qiu; ...

    2015-11-10

    In a cellulose synthesis complex a "rosette" shape is responsible for the synthesis of cellulose chains and their assembly into microfibrils within the cell walls of land plants and their charophyte algal progenitors. The number of cellulose synthase proteins in this large multisubunit transmembrane protein complex and the number of cellulose chains in a microfibril have been debated for many years. Our work reports a low resolution structure of the catalytic domain of CESA1 from Arabidopsis (Arabidopsis thaliana; AtCESA1CatD) determined by small-angle scattering techniques and provides the first experimental evidence for the self-assembly of CESA into a stable trimer inmore » solution. The catalytic domain was overexpressed in Escherichia coli, and using a two-step procedure, it was possible to isolate monomeric and trimeric forms of AtCESA1CatD. Moreover, the conformation of monomeric and trimeric AtCESA1CatD proteins were studied using small-angle neutron scattering and small-angle x-ray scattering. A series of AtCESA1CatD trimer computational models were compared with the small-angle x-ray scattering trimer profile to explore the possible arrangement of the monomers in the trimers. Several candidate trimers were identified with monomers oriented such that the newly synthesized cellulose chains project toward the cell membrane. In these models, the class-specific region is found at the periphery of the complex, and the plant-conserved region forms the base of the trimer. Finally, this study strongly supports the "hexamer of trimers" model for the rosette cellulose synthesis complex that synthesizes an 18-chain cellulose microfibril as its fundamental product.« less

  7. A Structural Study of CESA1 Catalytic Domain of Arabidopsis Cellulose Synthesis Complex: Evidence for CESA Trimers.

    PubMed

    Vandavasi, Venu Gopal; Putnam, Daniel K; Zhang, Qiu; Petridis, Loukas; Heller, William T; Nixon, B Tracy; Haigler, Candace H; Kalluri, Udaya; Coates, Leighton; Langan, Paul; Smith, Jeremy C; Meiler, Jens; O'Neill, Hugh

    2016-01-01

    A cellulose synthesis complex with a "rosette" shape is responsible for synthesis of cellulose chains and their assembly into microfibrils within the cell walls of land plants and their charophyte algal progenitors. The number of cellulose synthase proteins in this large multisubunit transmembrane protein complex and the number of cellulose chains in a microfibril have been debated for many years. This work reports a low resolution structure of the catalytic domain of CESA1 from Arabidopsis (Arabidopsis thaliana; AtCESA1CatD) determined by small-angle scattering techniques and provides the first experimental evidence for the self-assembly of CESA into a stable trimer in solution. The catalytic domain was overexpressed in Escherichia coli, and using a two-step procedure, it was possible to isolate monomeric and trimeric forms of AtCESA1CatD. The conformation of monomeric and trimeric AtCESA1CatD proteins were studied using small-angle neutron scattering and small-angle x-ray scattering. A series of AtCESA1CatD trimer computational models were compared with the small-angle x-ray scattering trimer profile to explore the possible arrangement of the monomers in the trimers. Several candidate trimers were identified with monomers oriented such that the newly synthesized cellulose chains project toward the cell membrane. In these models, the class-specific region is found at the periphery of the complex, and the plant-conserved region forms the base of the trimer. This study strongly supports the "hexamer of trimers" model for the rosette cellulose synthesis complex that synthesizes an 18-chain cellulose microfibril as its fundamental product. © 2016 American Society of Plant Biologists. All Rights Reserved.

  8. ISYMOD: a knowledge warehouse for the identification, assembly and analysis of bacterial integrated systems.

    PubMed

    Chabalier, Julie; Capponi, Cécile; Quentin, Yves; Fichant, Gwennaele

    2005-04-01

    Complex biological functions emerge from interactions between proteins in stable supra-molecular assemblies and/or through transitory contacts. Most of the time protein partners of the assemblies are composed of one or several domains which exhibit different biochemical functions. Thus the study of cellular process requires the identification of different functional units and their integration in an interaction network; such complexes are referred to as integrated systems. In order to exploit with optimum efficiency the increased release of data, automated bioinformatics strategies are needed to identify, reconstruct and model such systems. For that purpose, we have developed a knowledge warehouse dedicated to the representation and acquisition of bacterial integrated systems involved in the exchange of the bacterial cell with its environment. ISYMOD is a knowledge warehouse that consistently integrates in the same environment the data and the methods used for their acquisition. This is achieved through the construction of (1) a domain knowledge base (DKB) devoted to the storage of the knowledge about the systems, their functional specificities, their partners and how they are related and (2) a methodological knowledge base (MKB) which depicts the task layout used to identify and reconstruct functional integrated systems. Instantiation of the DKB is obtained by solving the tasks of the MKB, whereas some tasks need instances of the DKB to be solved. AROM, an object-based knowledge representation system, has been used to design the DKB, and its task manager, AROMTasks, for developing the MKB. In this study two integrated systems, ABC transporters and two component systems, both involved in adaptation processes of a bacterial cell to its biotope, have been used to evaluate the feasibility of the approach.

  9. Multiple Functional Domains of Enterococcus faecalis Aggregation Substance Asc10 Contribute to Endocarditis Virulence ▿ †

    PubMed Central

    Chuang, Olivia N.; Schlievert, Patrick M.; Wells, Carol L.; Manias, Dawn A.; Tripp, Timothy J.; Dunny, Gary M.

    2009-01-01

    Aggregation substance proteins encoded by sex pheromone plasmids increase the virulence of Enterococcus faecalis in experimental pathogenesis models, including infectious endocarditis models. These large surface proteins may contain multiple functional domains involved in various interactions with other bacterial cells and with the mammalian host. Aggregation substance Asc10, encoded by plasmid pCF10, is induced during growth in the mammalian bloodstream, and pCF10 carriage gives E. faecalis a significant selective advantage in this environment. We employed a rabbit model to investigate the role of various functional domains of Asc10 in endocarditis. The data suggested that the bacterial load of the infected tissue was the best indicator of virulence. Isogenic strains carrying either no plasmid, wild-type pCF10, a pCF10 derivative with an in-frame deletion of the prgB gene encoding Asc10, or pCF10 derivatives expressing other alleles of prgB were examined in this model. Previously identified aggregation domains contributed to the virulence associated with the wild-type protein, and a strain expressing an Asc10 derivative in which glycine residues in two RGD motifs were changed to alanine residues showed the greatest reduction in virulence. Remarkably, this strain and the strain carrying the pCF10 derivative with the in-frame deletion of prgB were both significantly less virulent than an isogenic plasmid-free strain. The data demonstrate that multiple functional domains are important in Asc10-mediated interactions with the host during the course of experimental endocarditis and that in the absence of a functional prgB gene, pCF10 carriage is actually disadvantageous in vivo. PMID:18955479

  10. Bacterial effectors target the plant cell nucleus to subvert host transcription.

    PubMed

    Canonne, Joanne; Rivas, Susana

    2012-02-01

    In order to promote virulence, Gram-negative bacteria have evolved the ability to inject so-called type III effector proteins into host cells. The plant cell nucleus appears to be a subcellular compartment repeatedly targeted by bacterial effectors. In agreement with this observation, mounting evidence suggests that manipulation of host transcription is a major strategy developed by bacteria to counteract plant defense responses. It has been suggested that bacterial effectors may adopt at least three alternative, although not mutually exclusive, strategies to subvert host transcription. T3Es may (1) act as transcription factors that directly activate transcription in host cells, (2) affect histone packing and chromatin configuration, and/or (3) target host transcription factor activity. Here, we provide an overview on how all these strategies may lead to host transcriptional re-programming and, as a result, to improved bacterial multiplication inside plant cells.

  11. A versatile palindromic amphipathic repeat coding sequence horizontally distributed among diverse bacterial and eucaryotic microbes

    PubMed Central

    2010-01-01

    Background Intragenic tandem repeats occur throughout all domains of life and impart functional and structural variability to diverse translation products. Repeat proteins confer distinctive surface phenotypes to many unicellular organisms, including those with minimal genomes such as the wall-less bacterial monoderms, Mollicutes. One such repeat pattern in this clade is distributed in a manner suggesting its exchange by horizontal gene transfer (HGT). Expanding genome sequence databases reveal the pattern in a widening range of bacteria, and recently among eucaryotic microbes. We examined the genomic flux and consequences of the motif by determining its distribution, predicted structural features and association with membrane-targeted proteins. Results Using a refined hidden Markov model, we document a 25-residue protein sequence motif tandemly arrayed in variable-number repeats in ORFs lacking assigned functions. It appears sporadically in unicellular microbes from disparate bacterial and eucaryotic clades, representing diverse lifestyles and ecological niches that include host parasitic, marine and extreme environments. Tracts of the repeats predict a malleable configuration of recurring domains, with conserved hydrophobic residues forming an amphipathic secondary structure in which hydrophilic residues endow extensive sequence variation. Many ORFs with these domains also have membrane-targeting sequences that predict assorted topologies; others may comprise reservoirs of sequence variants. We demonstrate expressed variants among surface lipoproteins that distinguish closely related animal pathogens belonging to a subgroup of the Mollicutes. DNA sequences encoding the tandem domains display dyad symmetry. Moreover, in some taxa the domains occur in ORFs selectively associated with mobile elements. These features, a punctate phylogenetic distribution, and different patterns of dispersal in genomes of related taxa, suggest that the repeat may be disseminated by

  12. Antibiotics for treating bacterial vaginosis in pregnancy.

    PubMed

    McDonald, H M; Brocklehurst, P; Gordon, A

    2007-01-24

    ). Clindamycin did not reduce the risk of PTB before 37 weeks (Peto OR 0.80, 95% CI 0.60 to 1.05; six trials, 2406 women). Antibiotic treatment can eradicate bacterial vaginosis in pregnancy. This review provides little evidence that screening and treating all pregnant women with asymptomatic bacterial vaginosis will prevent PTB and its consequences. However, there is some suggestion that treatment before 20 weeks' gestation may reduce the risk of PTB. This needs to be further verified by future trials.

  13. Antibiotics for treating bacterial vaginosis in pregnancy.

    PubMed

    McDonald, H; Brocklehurst, P; Parsons, J

    2005-01-25

    0.75, two trials of 114 women). Antibiotic treatment can eradicate bacterial vaginosis in pregnancy. However, this review provides little evidence that screening and treating all pregnant women with asymptomatic bacterial vaginosis will prevent preterm birth and its consequences. For women with a previous preterm birth, there is some suggestion that treatment of bacterial vaginosis may reduce the risk of preterm prelabour rupture of membranes and low birthweight.

  14. Supra-domains: evolutionary units larger than single protein domains.

    PubMed

    Vogel, Christine; Berzuini, Carlo; Bashton, Matthew; Gough, Julian; Teichmann, Sarah A

    2004-02-20

    Domains are the evolutionary units that comprise proteins, and most proteins are built from more than one domain. Domains can be shuffled by recombination to create proteins with new arrangements of domains. Using structural domain assignments, we examined the combinations of domains in the proteins of 131 completely sequenced organisms. We found two-domain and three-domain combinations that recur in different protein contexts with different partner domains. The domains within these combinations have a particular functional and spatial relationship. These units are larger than individual domains and we term them "supra-domains". Amongst the supra-domains, we identified some 1400 (1203 two-domain and 166 three-domain) combinations that are statistically significantly over-represented relative to the occurrence and versatility of the individual component domains. Over one-third of all structurally assigned multi-domain proteins contain these over-represented supra-domains. This means that investigation of the structural and functional relationships of the domains forming these popular combinations would be particularly useful for an understanding of multi-domain protein function and evolution as well as for genome annotation. These and other supra-domains were analysed for their versatility, duplication, their distribution across the three kingdoms of life and their functional classes. By examining the three-dimensional structures of several examples of supra-domains in different biological processes, we identify two basic types of spatial relationships between the component domains: the combined function of the two domains is such that either the geometry of the two domains is crucial and there is a tight constraint on the interface, or the precise orientation of the domains is less important and they are spatially separate. Frequently, the role of the supra-domain becomes clear only once the three-dimensional structure is known. Since this is the case for only a

  15. The Influence of Host and Bacterial Genotype on the Development of Disseminated Disease with Mycobacterium tuberculosis

    PubMed Central

    Caws, Maxine; Thwaites, Guy; Dunstan, Sarah; Hawn, Thomas R.; Thi Ngoc Lan, Nguyen; Thuong, Nguyen Thuy Thuong; Stepniewska, Kasia; Huyen, Mai Nguyet Thu; Bang, Nguyen Duc; Huu Loc, Tran; Gagneux, Sebastien; van Soolingen, Dick; Kremer, Kristin; van der Sande, Marianne; Small, Peter; Thi Hoang Anh, Phan; Chinh, Nguyen Tran; Thi Quy, Hoang; Thi Hong Duyen, Nguyen; Quang Tho, Dau; Hieu, Nguyen T.; Torok, Estee; Hien, Tran Tinh; Dung, Nguyen Huy; Thi Quynh Nhu, Nguyen; Duy, Phan Minh; van Vinh Chau, Nguyen; Farrar, Jeremy

    2008-01-01

    The factors that govern the development of tuberculosis disease are incompletely understood. We hypothesized that some strains of Mycobacterium tuberculosis (M. tuberculosis) are more capable of causing disseminated disease than others and may be associated with polymorphisms in host genes responsible for the innate immune response to infection. We compared the host and bacterial genotype in 187 Vietnamese adults with tuberculous meningitis (TBM) and 237 Vietnamese adults with uncomplicated pulmonary tuberculosis. The host genotype of tuberculosis cases was also compared with the genotype of 392 cord blood controls from the same population. Isolates of M. tuberculosis were genotyped by large sequence polymorphisms. The hosts were defined by polymorphisms in genes encoding Toll-interleukin 1 receptor domain containing adaptor protein (TIRAP) and Toll-like receptor-2 (TLR-2). We found a significant protective association between the Euro-American lineage of M. tuberculosis and pulmonary rather than meningeal tuberculosis (Odds ratio (OR) for causing TBM 0.395, 95% confidence intervals (C.I.) 0.193–0.806, P = 0.009), suggesting these strains are less capable of extra-pulmonary dissemination than others in the study population. We also found that individuals with the C allele of TLR-2 T597C allele were more likely to have tuberculosis caused by the East-Asian/Beijing genotype (OR = 1.57 [95% C.I. 1.15–2.15]) than other individuals. The study provides evidence that M. tuberculosis genotype influences clinical disease phenotype and demonstrates, for the first time, a significant interaction between host and bacterial genotypes and the development of tuberculosis. PMID:18369480

  16. In Sickness but Not in Wealth: Field Evidence on Patients' Risk Preferences in Financial and Health Domains.

    PubMed

    Galizzi, Matteo M; Miraldo, Marisa; Stavropoulou, Charitini

    2016-05-01

    We present results from a hypothetical framed field experiment assessing whether risk preferences significantly differ across the health and financial domains when they are elicited through the same multiple price list paired-lottery method. We consider a sample of 300 patients attending outpatient clinics in a university hospital in Athens during the Greek financial crisis. Risk preferences in finance were elicited using paired-lottery questions with hypothetical payments. The questions were adapted to the health domain by framing the lotteries as risky treatments in hypothetical health care scenarios. Using maximum likelihood methods, we estimated the degree of risk aversion, allowing for the estimates to be dependent on domain and individual characteristics. The subjects in our sample, who were exposed to both health and financial distress, tended to be less risk averse in the financial domain than in the health domain. © The Author(s) 2016.

  17. Modulation of chaperone function and cochaperone interaction by novobiocin in the C-terminal domain of Hsp90: evidence that coumarin antibiotics disrupt Hsp90 dimerization.

    PubMed

    Allan, Rudi K; Mok, Danny; Ward, Bryan K; Ratajczak, Thomas

    2006-03-17

    The C-terminal domain of Hsp90 displays independent chaperone activity, mediates dimerization, and contains the MEEVD motif essential for interaction with tetratricopeptide repeat-containing immunophilin cochaperones assembled in mature steroid receptor complexes. An alpha-helical region, upstream of the MEEVD peptide, helps form the dimerization interface and includes a hydrophobic microdomain that contributes to the Hsp90 interaction with the immunophilin cochaperones and corresponds to the binding site for novobiocin, a coumarin-related Hsp90 inhibitor. Mutation of selected residues within the hydrophobic microdomain significantly impacted the chaperone function of a recombinant C-terminal Hsp90 fragment and novobiocin inhibited wild-type chaperone activity. Prior incubation of the Hsp90 fragment with novobiocin led to a direct blockade of immunophilin cochaperone binding. However, the drug had little influence on the pre-formed Hsp90-immunophilin complex, suggesting that bound cochaperones mask the novobiocin-binding site. We observed a differential effect of the drug on Hsp90-immunophilin interaction, suggesting that the immunophilins make distinct contacts within the C-terminal domain to specifically modulate Hsp90 function. Novobiocin also precluded the interaction of full-length Hsp90 with the p50(cdc37) cochaperone, which targets the N-terminal nucleotide-binding domain, and is prevalent in Hsp90 complexes with protein kinase substrates. Novobiocin therefore acts locally and allosterically to induce conformational changes within multiple regions of the Hsp90 protein. We provide evidence that coumermycin A1, a coumarin structurally related to novobiocin, interferes with dimerization of the Hsp90 C-terminal domain. Coumarin-based inhibitors then may antagonize Hsp90 function by inducing a conformation favoring separation of the C-terminal domains and release of substrate.

  18. Phages and the Evolution of Bacterial Pathogens: from Genomic Rearrangements to Lysogenic Conversion

    PubMed Central

    Brüssow, Harald; Canchaya, Carlos; Hardt, Wolf-Dietrich

    2004-01-01

    Comparative genomics demonstrated that the chromosomes from bacteria and their viruses (bacteriophages) are coevolving. This process is most evident for bacterial pathogens where the majority contain prophages or phage remnants integrated into the bacterial DNA. Many prophages from bacterial pathogens encode virulence factors. Two situations can be distinguished: Vibrio cholerae, Shiga toxin-producing Escherichia coli, Corynebacterium diphtheriae, and Clostridium botulinum depend on a specific prophage-encoded toxin for causing a specific disease, whereas Staphylococcus aureus, Streptococcus pyogenes, and Salmonella enterica serovar Typhimurium harbor a multitude of prophages and each phage-encoded virulence or fitness factor makes an incremental contribution to the fitness of the lysogen. These prophages behave like “swarms” of related prophages. Prophage diversification seems to be fueled by the frequent transfer of phage material by recombination with superinfecting phages, resident prophages, or occasional acquisition of other mobile DNA elements or bacterial chromosomal genes. Prophages also contribute to the diversification of the bacterial genome architecture. In many cases, they actually represent a large fraction of the strain-specific DNA sequences. In addition, they can serve as anchoring points for genome inversions. The current review presents the available genomics and biological data on prophages from bacterial pathogens in an evolutionary framework. PMID:15353570

  19. Comparison of the structural basis for thermal stability between archaeal and bacterial proteins.

    PubMed

    Ding, Yanrui; Cai, Yujie; Han, Yonggang; Zhao, Bingqiang

    2012-01-01

    In this study, the structural basis for thermal stability in archaeal and bacterial proteins was investigated. There were many common factors that confer resistance to high temperature in both archaeal and bacterial proteins. These factors include increases in the Lys content, the bends and blanks of secondary structure, the Glu content of salt bridge; decreases in the number of main-side chain hydrogen bond and exposed surface area, and changes in the bends and blanks of amino acids. Certainly, the utilization of charged amino acids to form salt bridges is a primary factor. In both heat-resistant archaeal and bacterial proteins, most Glu and Asp participate in the formation of salt bridges. Other factors may influence either archaeal or bacterial protein thermostability, which includes the more frequent occurrence of shorter 3(10)-helices and increased hydrophobicity in heat-resistant archaeal proteins. However, there were increases in average helix length, the Glu content in salt bridges, temperature factors and decreases in the number of main-side chain hydrogen bonds, uncharged-uncharged hydrogen bonds, hydrophobicity, and buried and exposed polar surface area in heat-resistant bacterial proteins. Evidently, there are few similarities and many disparities between the heat-resistant mechanisms of archaeal and bacterial proteins.

  20. Structure of the catalytic domain of the colistin resistance enzyme MCR-1

    DOE PAGES

    Stojanoski, Vlatko; Sankaran, Banumathi; Prasad, B. V. Venkataram; ...

    2016-09-21

    Due to the paucity of novel antibiotics, colistin has become a last resort antibiotic for treating multidrug resistant bacteria. Colistin acts by binding the lipid A component of lipopolysaccharides and subsequently disrupting the bacterial membrane. The recently identified plasmid-encoded MCR-1 enzyme is the first transmissible colistin resistance determinant and is a cause for concern for the spread of this resistance trait. MCR-1 is a phosphoethanolamine transferase that catalyzes the addition of phosphoethanolamine to lipid A to decrease colistin affinity. The structure of the catalytic domain of MCR-1 at 1.32 Å reveals the active site is similar to that of relatedmore » phosphoethanolamine transferases. The putative nucleophile for catalysis, threonine 285, is phosphorylated in cMCR-1 and a zinc is present at a conserved site in addition to three zincs more peripherally located in the active site. As noted for catalytic domains of other phosphoethanolamine transferases, binding sites for the lipid A and phosphatidylethanolamine substrates are not apparent in the cMCR-1 structure, suggesting that they are present in the membrane domain.« less

  1. Three-dimensional organization of three-domain copper oxidases: A review

    NASA Astrophysics Data System (ADS)

    Zhukhlistova, N. E.; Zhukova, Yu. N.; Lyashenko, A. V.; Zaĭtsev, V. N.; Mikhaĭlov, A. M.

    2008-01-01

    “Blue” copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrena maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.

  2. Magnetoresistance due to domain walls in an epitaxial microfabricated Fe wire

    NASA Astrophysics Data System (ADS)

    Rüdiger, U.; Yu, J.; Kent, A. D.; Parkin, S. S. P.

    1998-08-01

    The domain wall (DW) contribution to magnetoresistance has been investigated using an epitaxial microfabricated bcc (110) Fe wires of 2 μm linewidth. A strong in-plane uniaxial component to the magnetic anisotropy perpendicular to the wire axis causes a regular stripe domain pattern with closure domains. The stripe domain width in zero-applied magnetic field is strongly affected by the magnetic history and can be continuously varied from 0.45 to 1.8 μm. This enables a measurement of the resistivity as a function of DW density in a single wire. Clear evidence is presented that the resistivity is reduced in the presence of DWs at low temperatures.

  3. Virulence Regulation with Venus Flytrap Domains: Structure and Function of the Periplasmic Moiety of the Sensor-Kinase BvgS

    PubMed Central

    Lensink, Marc F.; Wintjens, René; Vagin, Alexey; Lebedev, Andrey; Crosson, Sean; Villeret, Vincent; Locht, Camille; Antoine, Rudy; Jacob-Dubuisson, Françoise

    2015-01-01

    Two-component systems (TCS) represent major signal-transduction pathways for adaptation to environmental conditions, and regulate many aspects of bacterial physiology. In the whooping cough agent Bordetella pertussis, the TCS BvgAS controls the virulence regulon, and is therefore critical for pathogenicity. BvgS is a prototypical TCS sensor-kinase with tandem periplasmic Venus flytrap (VFT) domains. VFT are bi-lobed domains that typically close around specific ligands using clamshell motions. We report the X-ray structure of the periplasmic moiety of BvgS, an intricate homodimer with a novel architecture. By combining site-directed mutagenesis, functional analyses and molecular modeling, we show that the conformation of the periplasmic moiety determines the state of BvgS activity. The intertwined structure of the periplasmic portion and the different conformation and dynamics of its mobile, membrane-distal VFT1 domains, and closed, membrane-proximal VFT2 domains, exert a conformational strain onto the transmembrane helices, which sets the cytoplasmic moiety in a kinase-on state by default corresponding to the virulent phase of the bacterium. Signaling the presence of negative signals perceived by the periplasmic domains implies a shift of BvgS to a distinct state of conformation and activity, corresponding to the avirulent phase. The response to negative modulation depends on the integrity of the periplasmic dimer, indicating that the shift to the kinase-off state implies a concerted conformational transition. This work lays the bases to understand virulence regulation in Bordetella. As homologous sensor-kinases control virulence features of diverse bacterial pathogens, the BvgS structure and mechanism may pave the way for new modes of targeted therapeutic interventions. PMID:25738876

  4. An intermolecular binding mechanism involving multiple LysM domains mediates carbohydrate recognition by an endopeptidase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wong, Jaslyn E. M. M.; Midtgaard, Søren Roi; Gysel, Kira

    The crystal and solution structures of the T. thermophilus NlpC/P60 d, l-endopeptidase as well as the co-crystal structure of its N-terminal LysM domains bound to chitohexaose allow a proposal to be made regarding how the enzyme recognizes peptidoglycan. LysM domains, which are frequently present as repetitive entities in both bacterial and plant proteins, are known to interact with carbohydrates containing N-acetylglucosamine (GlcNAc) moieties, such as chitin and peptidoglycan. In bacteria, the functional significance of the involvement of multiple LysM domains in substrate binding has so far lacked support from high-resolution structures of ligand-bound complexes. Here, a structural study of themore » Thermus thermophilus NlpC/P60 endopeptidase containing two LysM domains is presented. The crystal structure and small-angle X-ray scattering solution studies of this endopeptidase revealed the presence of a homodimer. The structure of the two LysM domains co-crystallized with N-acetyl-chitohexaose revealed a new intermolecular binding mode that may explain the differential interaction between LysM domains and short or long chitin oligomers. By combining the structural information with the three-dimensional model of peptidoglycan, a model suggesting how protein dimerization enhances the recognition of peptidoglycan is proposed.« less

  5. In silico analysis of Schmidtea mediterranea TIR domain-containing proteins.

    PubMed

    Tsoumtsa, Landry Laure; Sougoufora, Seynabou; Torre, Cedric; Lemichez, Emmanuel; Pontarotti, Pierre; Ghigo, Eric

    2018-09-01

    While genetic evidence points towards an absence of Toll-Like Receptors (TLRs) in Platyhelminthes, the Toll/IL-1 Receptor (TIR)-domains that drive the assembly of signalling complexes downstream TLR are present in these organisms. Here, we undertook the characterisation of the repertoire of TIR-domain containing proteins in Schmidtea mediterranea in order to gain valuable information on TLR evolution in metazoan. We report the presence of twenty proteins containing between one and two TIR domains. In addition, our phylogenetic-based reconstruction approach identified Smed-SARM and Smed-MyD88 as conserved TLR adaptors. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. Domains of awareness in schizophrenia.

    PubMed

    Gilleen, J; Greenwood, K; David, A S

    2011-01-01

    Patients with schizophrenia are often characterized as lacking insight or awareness into their illness and symptoms, yet despite considerable research, we still lack a full understanding of the factors involved in causing poor awareness. Within schizophrenia, there has been shown to be a fractionation across dimensions of awareness into mental illness: of being ill, of symptoms, and of treatment compliance. Recently, attention has turned to evidence of a fractionation between awareness of illness and of cognitive impairments and functioning. The current study investigated the degree of fractionation across a broad range of domains of function in schizophrenia and how each domain may be associated with neuropsychological functioning, clinical, mood, and demographic variables. Thirty-one mostly chronic stable patients with schizophrenia completed a battery of neuropsychological tests and measures of psychopathology, including mood. Cognitive insight and awareness of illness, symptoms, memory, and behavioral functioning were also measured. Insight and awareness were assessed using a combination of semistructured interview, observer-rated, self-rated, and objective measures, and included measures of the discrepancy between carer and self-ratings of impairment. Results revealed that awareness of functioning in each domain was largely independent and that awareness in each domain was predicted by different factors. Insight into symptoms was relatively poor while insight into cognitive deficits was preserved. Relative to neuropsychological variables, cognitive insight, comprising self-certainty and self-reflexivity, was a greater predictor of awareness. In conclusion, awareness is multiply fractionated and multiply determined. Therapeutic interventions could, therefore, produce beneficial changes within specific domains of awareness.

  7. Domains of Awareness in Schizophrenia

    PubMed Central

    Gilleen, J.; Greenwood, K.; David, A. S.

    2011-01-01

    Patients with schizophrenia are often characterized as lacking insight or awareness into their illness and symptoms, yet despite considerable research, we still lack a full understanding of the factors involved in causing poor awareness. Within schizophrenia, there has been shown to be a fractionation across dimensions of awareness into mental illness: of being ill, of symptoms, and of treatment compliance. Recently, attention has turned to evidence of a fractionation between awareness of illness and of cognitive impairments and functioning. The current study investigated the degree of fractionation across a broad range of domains of function in schizophrenia and how each domain may be associated with neuropsychological functioning, clinical, mood, and demographic variables. Thirty-one mostly chronic stable patients with schizophrenia completed a battery of neuropsychological tests and measures of psychopathology, including mood. Cognitive insight and awareness of illness, symptoms, memory, and behavioral functioning were also measured. Insight and awareness were assessed using a combination of semistructured interview, observer-rated, self-rated, and objective measures, and included measures of the discrepancy between carer and self-ratings of impairment. Results revealed that awareness of functioning in each domain was largely independent and that awareness in each domain was predicted by different factors. Insight into symptoms was relatively poor while insight into cognitive deficits was preserved. Relative to neuropsychological variables, cognitive insight, comprising self-certainty and self-reflexivity, was a greater predictor of awareness. In conclusion, awareness is multiply fractionated and multiply determined. Therapeutic interventions could, therefore, produce beneficial changes within specific domains of awareness. PMID:20851850

  8. An emerging link between LIM domain proteins and nuclear receptors.

    PubMed

    Sala, Stefano; Ampe, Christophe

    2018-06-01

    Nuclear receptors are ligand-activated transcription factors that partake in several biological processes including development, reproduction and metabolism. Over the last decade, evidence has accumulated that group 2, 3 and 4 LIM domain proteins, primarily known for their roles in actin cytoskeleton organization, also partake in gene transcription regulation. They shuttle between the cytoplasm and the nucleus, amongst other as a consequence of triggering cells with ligands of nuclear receptors. LIM domain proteins act as important coregulators of nuclear receptor-mediated gene transcription, in which they can either function as coactivators or corepressors. In establishing interactions with nuclear receptors, the LIM domains are important, yet pleiotropy of LIM domain proteins and nuclear receptors frequently occurs. LIM domain protein-nuclear receptor complexes function in diverse physiological processes. Their association is, however, often linked to diseases including cancer.

  9. Resonant tunneling across a ferroelectric domain wall

    NASA Astrophysics Data System (ADS)

    Li, M.; Tao, L. L.; Velev, J. P.; Tsymbal, E. Y.

    2018-04-01

    Motivated by recent experimental observations, we explore electron transport properties of a ferroelectric tunnel junction (FTJ) with an embedded head-to-head ferroelectric domain wall, using first-principles density-functional theory calculations. We consider a FTJ with L a0.5S r0.5Mn O3 electrodes separated by a BaTi O3 barrier layer and show that an in-plane charged domain wall in the ferroelectric BaTi O3 can be induced by polar interfaces. The resulting V -shaped electrostatic potential profile across the BaTi O3 layer creates a quantum well and leads to the formation of a two-dimensional electron gas, which stabilizes the domain wall. The confined electronic states in the barrier are responsible for resonant tunneling as is evident from our quantum-transport calculations. We find that the resonant tunneling is an orbital selective process, which leads to sharp spikes in the momentum- and energy-resolved transmission spectra. Our results indicate that domain walls embedded in FTJs can be used to control the electron transport.

  10. Youth Civic Development: Theorizing a Domain with Evidence from Different Cultural Contexts

    ERIC Educational Resources Information Center

    Flanagan, Constance A.; Martinez, M. Loreto; Cumsille, Patricio; Ngomane, Tsakani

    2011-01-01

    The authors use examples of youth civic engagement from Chile, South Africa, Central/Eastern Europe, and the United States--and also emphasize diversities among youth from different subgroups within countries--to illustrate common elements of the civic domain of youth development. These include the primacy of collective activity for forming…

  11. Molecular characterization of nucleotide binding and oligomerization domain (NOD)-2, analysis of its inductive expression and down-stream signaling following ligands exposure and bacterial infection in rohu (Labeo rohita).

    PubMed

    Swain, B; Basu, M; Sahoo, B R; Maiti, N K; Routray, P; Eknath, A E; Samanta, M

    2012-01-01

    Nucleotide-binding and oligomerization domain (NOD)-2 is a cytoplasmic pattern recognition receptor (PRR) and is a member of NOD like receptor (NLR) family. It senses a wide range of bacteria and viruses or their products and is involved in innate immune responses. In this report, NOD-2 gene was cloned and characterized from rohu (Labeo rohita) which is highly commercially important fish species in the Indian subcontinent. The full length rohu NOD-2 (rNOD-2) cDNA comprised of 3176 bp with a single open reading frame (ORF) of 2949 bp encoding a polypeptide of 982 amino acids (aa) with an estimated molecular mass of 109.65 kDa. The rNOD-2 comprised two N-terminal CARD domains (at 4-91 aa and 111-200 aa), one NACHT domain (at 271-441 aa) and seven C-terminal leucine rich repeat (LRR) regions. Phylogenetically, rNOD-2 was closely related to grass carp NOD-2 (gcNOD2) and exhibited significant similarity (94.2%) and identity (88.6%) in their amino acids. Ontogeny analysis of rNOD-2 showed its constitutive expression across the developmental stages, and highlighted the embryonic innate defense system in fish. Tissue specific analysis of rNOD-2 by quantitative real-time PCR (qRT-PCR) revealed its wide distribution; highest expression was in liver followed by blood. In response to PGN and LTA stimulation, Aeromonas hydrophila and Edwardsiella tarda infection, and poly I:C treatment, expression of rNOD-2 and its associated downstream molecules RICK and IFN-γ were significantly enhanced in the treated fish compared to control. These findings suggested the key role of NOD-2 in augmenting innate immunity in fish in response to bacterial and viral infection. This study may be helpful for the development of preventive measures against infectious diseases in fish. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. A Staphylococcus aureus TIR domain protein virulence factor blocks TLR2-mediated NF-κB signaling.

    PubMed

    Askarian, Fatemeh; van Sorge, Nina M; Sangvik, Maria; Beasley, Federico C; Henriksen, Jørn R; Sollid, Johanna U E; van Strijp, Jos A G; Nizet, Victor; Johannessen, Mona

    2014-01-01

    Signaling through Toll-like receptors (TLRs), crucial molecules in the induction of host defense responses, requires adaptor proteins that contain a Toll/interleukin-1 receptor (TIR) domain. The pathogen Staphylococcus aureus produces several innate immune-evasion molecules that interfere with the host's innate immune response. A database search analysis suggested the presence of a gene encoding a homologue of the human TIR domain in S. aureus MSSA476 which was named staphylococcal TIR domain protein (TirS). Ectopic expression of TirS in human embryonic kidney, macrophage and keratinocyte cell lines interfered with signaling through TLR2, including MyD88 and TIRAP, NF-κB and/or mitogen-activated protein kinase pathways. Moreover, the presence of TirS reduced the levels of cytokines MCP-1 and G-CSF secreted in response to S. aureus. The effects on NF-κB pathway were confirmed using S. aureus MSSA476 wild type, an isogenic mutant MSSA476ΔtirS, and complemented MSSA476ΔtirS +pTirS in a Transwell system where bacteria and host cells were physically separated. Finally, in a systematic mouse infection model, TirS promoted bacterial accumulation in several organs 4 days postinfection. The results of this study reveal a new S. aureus virulence factor that can interfere with PAMP-induced innate immune signaling in vitro and bacterial survival in vivo. © 2014 S. Karger AG, Basel.

  13. Implications of Domain-General "Psychological Support Skills" for Transfer of Skill and Acquisition of Expertise

    ERIC Educational Resources Information Center

    Eccles, David W.; Feltovich, Paul J.

    2008-01-01

    The article proposes that individuals who acquire certain psychological support skills may experience accelerated learning and enhanced performance in many domains. In support of this proposal, we present evidence that these skills enhance learning and performance, that they are domain-general in that they can be applied in a variety of domains,…

  14. Prioritisation of associations between protein domains and complex diseases using domain-domain interaction networks.

    PubMed

    Wang, W; Zhang, W; Jiang, R; Luan, Y

    2010-05-01

    It is of vital importance to find genetic variants that underlie human complex diseases and locate genes that are responsible for these diseases. Since proteins are typically composed of several structural domains, it is reasonable to assume that harmful genetic variants may alter structures of protein domains, affect functions of proteins and eventually cause disorders. With this understanding, the authors explore the possibility of recovering associations between protein domains and complex diseases. The authors define associations between protein domains and disease families on the basis of associations between non-synonymous single nucleotide polymorphisms (nsSNPs) and complex diseases, similarities between diseases, and relations between proteins and domains. Based on a domain-domain interaction network, the authors propose a 'guilt-by-proximity' principle to rank candidate domains according to their average distance to a set of seed domains in the domain-domain interaction network. The authors validate the method through large-scale cross-validation experiments on simulated linkage intervals, random controls and the whole genome. Results show that areas under receiver operating characteristic curves (AUC scores) can be as high as 77.90%, and the mean rank ratios can be as low as 21.82%. The authors further offer a freely accessible web interface for a genome-wide landscape of associations between domains and disease families.

  15. Structures of a bifunctional cell wall hydrolase CwlT containing a novel bacterial lysozyme and an NlpC/P60 DL-endopeptidase.

    PubMed

    Xu, Qingping; Chiu, Hsiu-Ju; Farr, Carol L; Jaroszewski, Lukasz; Knuth, Mark W; Miller, Mitchell D; Lesley, Scott A; Godzik, Adam; Elsliger, Marc-André; Deacon, Ashley M; Wilson, Ian A

    2014-01-09

    Tn916-like conjugative transposons carrying antibiotic resistance genes are found in a diverse range of bacteria. Orf14 within the conjugation module encodes a bifunctional cell wall hydrolase CwlT that consists of an N-terminal bacterial lysozyme domain (N-acetylmuramidase, bLysG) and a C-terminal NlpC/P60 domain (γ-d-glutamyl-l-diamino acid endopeptidase) and is expected to play an important role in the spread of the transposons. We determined the crystal structures of CwlT from two pathogens, Staphylococcus aureus Mu50 (SaCwlT) and Clostridium difficile 630 (CdCwlT). These structures reveal that NlpC/P60 and LysG domains are compact and conserved modules, connected by a short flexible linker. The LysG domain represents a novel family of widely distributed bacterial lysozymes. The overall structure and the active site of bLysG bear significant similarity to other members of the glycoside hydrolase family 23 (GH23), such as the g-type lysozyme (LysG) and Escherichia coli lytic transglycosylase MltE. The active site of bLysG contains a unique structural and sequence signature (DxxQSSES+S) that is important for coordinating a catalytic water. Molecular modeling suggests that the bLysG domain may recognize glycan in a similar manner to MltE. The C-terminal NlpC/P60 domain contains a conserved active site (Cys-His-His-Tyr) that appears to be specific to murein tetrapeptide. Access to the active site is likely regulated by isomerism of a side chain atop the catalytic cysteine, allowing substrate entry or product release (open state), or catalysis (closed state). © 2013.

  16. The structure of a conserved Piezo channel domain reveals a novel beta sandwich fold

    PubMed Central

    Kamajaya, Aron; Kaiser, Jens; Lee, Jonas; Reid, Michelle; Rees, Douglas C.

    2014-01-01

    Summary Piezo has recently been identified as a family of eukaryotic mechanosensitive channels composed of subunits containing over 2000 amino acids, without recognizable sequence similarity to other channels. Here, we present the crystal structure of a large, conserved extramembrane domain located just before the last predicted transmembrane helix of C. elegans PIEZO, which adopts a novel beta sandwich fold. The structure was also determined of a point mutation located on a conserved surface at the position equivalent to the human PIEZO1 mutation found in Dehydrated Hereditary Stomatocytosis (DHS) patients (M2225R). While the point mutation does not change the overall domain structure, it does alter the surface electrostatic potential that may perturb interactions with a yet-to-be identified ligand or protein. The lack of structural similarity between this domain and any previously characterized fold, including those of eukaryotic and bacterial channels, highlights the distinctive nature of the Piezo family of eukaryotic mechanosensitive channels. PMID:25242456

  17. The prophage-encoded hyaluronate lyase has broad substrate specificity and is regulated by the N-terminal domain.

    PubMed

    Singh, Sudhir Kumar; Bharati, Akhilendra Pratap; Singh, Neha; Pandey, Praveen; Joshi, Pankaj; Singh, Kavita; Mitra, Kalyan; Gayen, Jiaur R; Sarkar, Jayanta; Akhtar, Md Sohail

    2014-12-19

    Streptococcus equi is the causative agent of the highly contagious disease "strangles" in equines and zoonotic meningitis in human. Spreading of infection in host tissues is thought to be facilitated by the bacterial gene encoded extracellular hyaluronate lyase (HL), which degrades hyaluronan (HA), chondroitin 6-sulfate, and dermatan sulfate of the extracellular matrix). The clinical strain S. equi 4047 however, lacks a functional extracellular HL. The prophages of S. equi and other streptococci encode intracellular HLs which are reported to partially degrade HA and do not cleave any other glycosaminoglycans. The phage HLs are thus thought to play a role limited to the penetration of streptococcal HA capsules, facilitating bacterial lysogenization and not in the bacterial pathogenesis. Here we systematically looked into the structure-function relationship of S. equi 4047 phage HL. Although HA is the preferred substrate, this HL has weak activity toward chondroitin 6-sulfate and dermatan sulfate and can completely degrade all of them. Even though the catalytic triple-stranded β-helix domain of phage HL is functionally independent, its catalytic efficiency and specificity is influenced by the N-terminal domain. The phage HL also interacts with human transmembrane glycoprotein CD44. The above results suggest that the streptococci can use phage HLs to degrade glycosaminoglycans of the extracellular matrix for spreading virulence factors and toxins while utilizing the disaccharides as a nutrient source for proliferation at the site of infection. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. The Prophage-encoded Hyaluronate Lyase Has Broad Substrate Specificity and Is Regulated by the N-terminal Domain*

    PubMed Central

    Singh, Sudhir Kumar; Bharati, Akhilendra Pratap; Singh, Neha; Pandey, Praveen; Joshi, Pankaj; Singh, Kavita; Mitra, Kalyan; Gayen, Jiaur R.; Sarkar, Jayanta; Akhtar, Md. Sohail

    2014-01-01

    Streptococcus equi is the causative agent of the highly contagious disease “strangles” in equines and zoonotic meningitis in human. Spreading of infection in host tissues is thought to be facilitated by the bacterial gene encoded extracellular hyaluronate lyase (HL), which degrades hyaluronan (HA), chondroitin 6-sulfate, and dermatan sulfate of the extracellular matrix). The clinical strain S. equi 4047 however, lacks a functional extracellular HL. The prophages of S. equi and other streptococci encode intracellular HLs which are reported to partially degrade HA and do not cleave any other glycosaminoglycans. The phage HLs are thus thought to play a role limited to the penetration of streptococcal HA capsules, facilitating bacterial lysogenization and not in the bacterial pathogenesis. Here we systematically looked into the structure-function relationship of S. equi 4047 phage HL. Although HA is the preferred substrate, this HL has weak activity toward chondroitin 6-sulfate and dermatan sulfate and can completely degrade all of them. Even though the catalytic triple-stranded β-helix domain of phage HL is functionally independent, its catalytic efficiency and specificity is influenced by the N-terminal domain. The phage HL also interacts with human transmembrane glycoprotein CD44. The above results suggest that the streptococci can use phage HLs to degrade glycosaminoglycans of the extracellular matrix for spreading virulence factors and toxins while utilizing the disaccharides as a nutrient source for proliferation at the site of infection. PMID:25378402

  19. Diversity and composition of the bacterial community in Amphioxus feces.

    PubMed

    Pan, Minming; Yuan, Dongjuan; Chen, Shangwu; Xu, Anlong

    2015-11-01

    Amphioxus is a typical filter feeder animal and is confronted with a complex bacterial community in the seawater of its habitat. It has evolved a strong innate immune system to cope with the external bacterial stimulation, however, the ecological system of the bacterial community in Amphioxus remains unknown. Through massive parallel 16S rRNA gene tag pyrosequencing, the investigation indicated that the composition of wild and lab-cultured Amphioxus fecal bacteria was complex with more than 85,000 sequence tags being assigned to 12/13 phyla. The bacterial diversity between the two fecal samples was similar according to OTU richness of V4 tag, Chao1 index, Shannon index and Rarefaction curves, however, the most prominent bacteria in wild feces were genera Pseudoalteromonas (gamma Proteobacteria) and Arcobacter (epsilon Proteobacteria); the highly abundant bacteria in lab-cultured feces were other groups, including Leisingera, Phaeobacter (alpha Proteobacteria), and Vibrio (gamma Proteobacteria). Such difference indicates the complex fecal bacteria with the potential for multi-stability. The bacteria of habitat with 28 assigned phyla had the higher bacterial diversity and species richness than both fecal bacteria. Shared bacteria between wild feces and its habitat reached to approximately 90% (153/169 genera) and 28% (153/548 genera), respectively. As speculative, the less diversity of both fecal bacteria compared to its habitat partly because Amphioxus lives buried and the feces will ultimately end up in the sediment. Therefore, our study comprehensively investigates the complex bacterial community of Amphioxus and provides evidence for understanding the relationship of this basal chordate with the environment. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Structural differences in the bacterial flagellar motor among bacterial species.

    PubMed

    Terashima, Hiroyuki; Kawamoto, Akihiro; Morimoto, Yusuke V; Imada, Katsumi; Minamino, Tohru

    2017-01-01

    The bacterial flagellum is a supramolecular motility machine consisting of the basal body as a rotary motor, the hook as a universal joint, and the filament as a helical propeller. Intact structures of the bacterial flagella have been observed for different bacterial species by electron cryotomography and subtomogram averaging. The core structures of the basal body consisting of the C ring, the MS ring, the rod and the protein export apparatus, and their organization are well conserved, but novel and divergent structures have also been visualized to surround the conserved structure of the basal body. This suggests that the flagellar motors have adapted to function in various environments where bacteria live and survive. In this review, we will summarize our current findings on the divergent structures of the bacterial flagellar motor.

  1. Early symptomatic and late seizures in Kosovar children with bacterial meningitis.

    PubMed

    Namani, Sadie A; Kuchar, Ernest; Koci, Remzie; Mehmeti, Murat; Dedushi, Kreshnike

    2011-11-01

    Despite the dramatic decrease of mortality rate among children with bacterial meningitis in recent decades, some patients are left with neurologic sequelae. The purpose of this study was to analyze the occurrence of seizures as predictors for meningitis-related deaths or neurological sequelae including late seizures. This study uses a retrospective chart review of 277 children (aged 0-16 years, median 2 years, 162 boys) treated for bacterial meningitis in University Clinical Centre in Prishtina (Kosovo). Of the 277 children treated for bacterial meningitis, 60 children (22%) manifested seizures prior to admission, 57 children (21%) had seizures after admission, and late seizures were diagnosed in 24 children (9%). The risk for adverse outcome was significantly higher in patients who had seizures prior to admission (52/60) and in patients who manifested seizures later than 24 h (41/41; RR 8.17 and 6.78 respectively, p < 0.0001). All children who manifested late seizures were diagnosed with meningitis-related acute neurologic complications: subdural effusion (18), hydrocephalus (6), intracranial bleeding (1), and subdural empyema (2). Of the 60 children who presented seizures prior to admission, only 11 manifested late seizures. Seizures prior to admission were predictors of high risk of adverse outcome in bacterial meningitis in children. The risk of secondary epilepsy (9%) occurred only in children with evident structural neurologic complications during the acute phase of bacterial meningitis.

  2. Sibling rivalry: related bacterial small RNAs and their redundant and non-redundant roles

    PubMed Central

    Caswell, Clayton C.; Oglesby-Sherrouse, Amanda G.; Murphy, Erin R.

    2014-01-01

    Small RNA molecules (sRNAs) are now recognized as key regulators controlling bacterial gene expression, as sRNAs provide a quick and efficient means of positively or negatively altering the expression of specific genes. To date, numerous sRNAs have been identified and characterized in a myriad of bacterial species, but more recently, a theme in bacterial sRNAs has emerged: the presence of more than one highly related sRNAs produced by a given bacterium, here termed sibling sRNAs. Sibling sRNAs are those that are highly similar at the nucleotide level, and while it might be expected that sibling sRNAs exert identical regulatory functions on the expression of target genes based on their high degree of relatedness, emerging evidence is demonstrating that this is not always the case. Indeed, there are several examples of bacterial sibling sRNAs with non-redundant regulatory functions, but there are also instances of apparent regulatory redundancy between sibling sRNAs. This review provides a comprehensive overview of the current knowledge of bacterial sibling sRNAs, and also discusses important questions about the significance and evolutionary implications of this emerging class of regulators. PMID:25389522

  3. Sibling rivalry: related bacterial small RNAs and their redundant and non-redundant roles.

    PubMed

    Caswell, Clayton C; Oglesby-Sherrouse, Amanda G; Murphy, Erin R

    2014-01-01

    Small RNA molecules (sRNAs) are now recognized as key regulators controlling bacterial gene expression, as sRNAs provide a quick and efficient means of positively or negatively altering the expression of specific genes. To date, numerous sRNAs have been identified and characterized in a myriad of bacterial species, but more recently, a theme in bacterial sRNAs has emerged: the presence of more than one highly related sRNAs produced by a given bacterium, here termed sibling sRNAs. Sibling sRNAs are those that are highly similar at the nucleotide level, and while it might be expected that sibling sRNAs exert identical regulatory functions on the expression of target genes based on their high degree of relatedness, emerging evidence is demonstrating that this is not always the case. Indeed, there are several examples of bacterial sibling sRNAs with non-redundant regulatory functions, but there are also instances of apparent regulatory redundancy between sibling sRNAs. This review provides a comprehensive overview of the current knowledge of bacterial sibling sRNAs, and also discusses important questions about the significance and evolutionary implications of this emerging class of regulators.

  4. A Proteome-wide Domain-centric Perspective on Protein Phosphorylation *

    PubMed Central

    Palmeri, Antonio; Ausiello, Gabriele; Ferrè, Fabrizio; Helmer-Citterich, Manuela; Gherardini, Pier Federico

    2014-01-01

    Phosphorylation is a widespread post-translational modification that modulates the function of a large number of proteins. Here we show that a significant proportion of all the domains in the human proteome is significantly enriched or depleted in phosphorylation events. A substantial improvement in phosphosites prediction is achieved by leveraging this observation, which has not been tapped by existing methods. Phosphorylation sites are often not shared between multiple occurrences of the same domain in the proteome, even when the phosphoacceptor residue is conserved. This is partly because of different functional constraints acting on the same domain in different protein contexts. Moreover, by augmenting domain alignments with structural information, we were able to provide direct evidence that phosphosites in protein-protein interfaces need not be positionally conserved, likely because they can modulate interactions simply by sitting in the same general surface area. PMID:24830415

  5. Bacterial Flora Changes in Conjunctiva of Rats with Streptozotocin-Induced Type I Diabetes.

    PubMed

    Yang, Chao; Fei, Yuda; Qin, Yali; Luo, Dan; Yang, Shufei; Kou, Xinyun; Zi, Yingxin; Deng, Tingting; Jin, Ming

    2015-01-01

    The microbiota of both humans and animals plays an important role in their health and the development of disease. Therefore, the bacterial flora of the conjunctiva may also be associated with some diseases. However, there are no reports on the alteration of bacterial flora in conjunctiva of diabetic rats in the literature. Therefore, we investigated the changes in bacterial flora in bulbar conjunctiva of rats with streptozotocin (STZ)-induced type I diabetes. A high dose of STZ (60 mg/kg, i.p.) was injected into Sprague-Dawley (SD) rats to induce type I diabetes mellitus (T1DM). The diabetic rats were raised in the animal laboratory and at 8 months post-injection of STZ swab samples were taken from the bulbar conjunctiva for cultivation of aerobic bacteria. The bacterial isolates were identified by Gram staining and biochemical features. The identified bacteria from both diabetic and healthy rats were then compared. The diabetic and healthy rats had different bacterial flora present in their bulbar conjunctiva. In total, 10 and 8 bacterial species were found in the STZ and control groups, respectively, with only three species (Enterococcus faecium, Enterococcus gallinarum and Escherichia coli) shared between the two groups. Gram-positive bacteria were common in both groups and the most abundant was Enterococcus faecium. However, after the development of T1DM, the bacterial flora in the rat bulbar conjunctiva changed considerably, with a reduced complexity evident. STZ-induced diabetes caused alterations of bacterial flora in the bulbar conjunctiva in rats, with some bacterial species disappearing and others emerging. Our results indicate that the conjunctival bacterial flora in diabetic humans should be surveyed for potential diagnostic markers or countermeasures to prevent eye infections in T1DM patients.

  6. Bacterial Flora Changes in Conjunctiva of Rats with Streptozotocin-Induced Type I Diabetes

    PubMed Central

    Qin, Yali; Luo, Dan; Yang, Shufei; Kou, Xinyun; Zi, Yingxin; Deng, Tingting; Jin, Ming

    2015-01-01

    Background The microbiota of both humans and animals plays an important role in their health and the development of disease. Therefore, the bacterial flora of the conjunctiva may also be associated with some diseases. However, there are no reports on the alteration of bacterial flora in conjunctiva of diabetic rats in the literature. Therefore, we investigated the changes in bacterial flora in bulbar conjunctiva of rats with streptozotocin (STZ)-induced type I diabetes. Methods A high dose of STZ (60 mg/kg, i.p.) was injected into Sprague-Dawley (SD) rats to induce type I diabetes mellitus (T1DM). The diabetic rats were raised in the animal laboratory and at 8 months post-injection of STZ swab samples were taken from the bulbar conjunctiva for cultivation of aerobic bacteria. The bacterial isolates were identified by Gram staining and biochemical features. The identified bacteria from both diabetic and healthy rats were then compared. Results The diabetic and healthy rats had different bacterial flora present in their bulbar conjunctiva. In total, 10 and 8 bacterial species were found in the STZ and control groups, respectively, with only three species (Enterococcus faecium, Enterococcus gallinarum and Escherichia coli) shared between the two groups. Gram-positive bacteria were common in both groups and the most abundant was Enterococcus faecium. However, after the development of T1DM, the bacterial flora in the rat bulbar conjunctiva changed considerably, with a reduced complexity evident. Conclusions STZ-induced diabetes caused alterations of bacterial flora in the bulbar conjunctiva in rats, with some bacterial species disappearing and others emerging. Our results indicate that the conjunctival bacterial flora in diabetic humans should be surveyed for potential diagnostic markers or countermeasures to prevent eye infections in T1DM patients. PMID:26176548

  7. Nucleic acid sequences encoding D1 and D1/D2 domains of human coxsackievirus and adenovirus receptor (CAR)

    DOEpatents

    Freimuth, Paul I.

    2010-04-06

    The invention provides recombinant human CAR (coxsackievirus and adenovirus receptor) polypeptides which bind adenovirus. Specifically, polypeptides corresponding to adenovirus binding domain D1 and the entire extracellular domain of human CAR protein comprising D1 and D2 are provided. In another aspect, the invention provides nucleic acid sequences encoding these domains and expression vectors for producing the domains and bacterial cells containing such vectors. The invention also includes an isolated fusion protein comprised of the D1 polypeptide fused to a polypeptide which facilitates folding of D1 when expressed in bacteria. The functional D1 domain finds application in a therapeutic method for treating a patient infected with a CAR D1-binding virus, and also in a method for identifying an antiviral compound which interferes with viral attachment. The invention also provides a method for specifically targeting a cell for infection by a virus which binds to D1.

  8. STUDIES ON THE BACTERIOPHAGE OF D'HERELLE : IX. EVIDENCE OF HYDROLYSIS OF BACTERIAL PROTEIN DURING LYSIS.

    PubMed

    Hetler, D M; Bronfenbrenner, J

    1928-07-31

    1. During the process of lysis by bacteriophage, there is an appreciable increase in the amount of free amino acid present in the culture. 2. The increase of free amino acid is due to hydrolysis of bacterial protein.

  9. The Role of Chaperone-subunit Usher Domain Interactions in the Mechanism of Bacterial Pilus Biogenesis Revealed by ESI-MS*

    PubMed Central

    Morrissey, Bethny; Leney, Aneika C.; Toste Rêgo, Ana; Phan, Gilles; Allen, William J.; Verger, Denis; Waksman, Gabriel; Ashcroft, Alison E.; Radford, Sheena E.

    2012-01-01

    The PapC usher is a β-barrel outer membrane protein essential for assembly and secretion of P pili that are required for adhesion of pathogenic E. coli, which cause the development of pyelonephritis. Multiple protein subunits form the P pilus, the highly specific assembly of which is coordinated by the usher. Despite a wealth of structural knowledge, how the usher catalyzes subunit polymerization and orchestrates a correct and functional order of subunit assembly remain unclear. Here, the ability of the soluble N-terminal (UsherN), C-terminal (UsherC2), and Plug (UsherP) domains of the usher to bind different chaperone-subunit (PapDPapX) complexes is investigated using noncovalent electrospray ionization mass spectrometry. The results reveal that each usher domain is able to bind all six PapDPapX complexes, consistent with an active role of all three usher domains in pilus biogenesis. Using collision induced dissociation, combined with competition binding experiments and dissection of the adhesin subunit, PapG, into separate pilin and adhesin domains, the results reveal why PapG has a uniquely high affinity for the usher, which is consistent with this subunit always being displayed at the pilus tip. In addition, we show how the different soluble usher domains cooperate to coordinate and control efficient pilus assembly at the usher platform. As well as providing new information about the protein-protein interactions that determine pilus biogenesis, the results highlight the power of noncovalent MS to interrogate biological mechanisms, especially in complex mixtures of species. PMID:22371487

  10. The role of chaperone-subunit usher domain interactions in the mechanism of bacterial pilus biogenesis revealed by ESI-MS.

    PubMed

    Morrissey, Bethny; Leney, Aneika C; Toste Rêgo, Ana; Phan, Gilles; Allen, William J; Verger, Denis; Waksman, Gabriel; Ashcroft, Alison E; Radford, Sheena E

    2012-07-01

    The PapC usher is a β-barrel outer membrane protein essential for assembly and secretion of P pili that are required for adhesion of pathogenic E. coli, which cause the development of pyelonephritis. Multiple protein subunits form the P pilus, the highly specific assembly of which is coordinated by the usher. Despite a wealth of structural knowledge, how the usher catalyzes subunit polymerization and orchestrates a correct and functional order of subunit assembly remain unclear. Here, the ability of the soluble N-terminal (UsherN), C-terminal (UsherC2), and Plug (UsherP) domains of the usher to bind different chaperone-subunit (PapDPapX) complexes is investigated using noncovalent electrospray ionization mass spectrometry. The results reveal that each usher domain is able to bind all six PapDPapX complexes, consistent with an active role of all three usher domains in pilus biogenesis. Using collision induced dissociation, combined with competition binding experiments and dissection of the adhesin subunit, PapG, into separate pilin and adhesin domains, the results reveal why PapG has a uniquely high affinity for the usher, which is consistent with this subunit always being displayed at the pilus tip. In addition, we show how the different soluble usher domains cooperate to coordinate and control efficient pilus assembly at the usher platform. As well as providing new information about the protein-protein interactions that determine pilus biogenesis, the results highlight the power of noncovalent MS to interrogate biological mechanisms, especially in complex mixtures of species.

  11. Real-time measurement of UV-inactivated Escherichia coli bacterial particles by electrospray-assisted UVAPS spectrometry.

    PubMed

    Jung, Jae Hee; Lee, Jung Eun; Bae, Gwi Nam

    2011-08-01

    The ultraviolet aerodynamic particle sizer (UVAPS) is a novel commercially available aerosol spectrometer for real-time continuous monitoring of viable bioaerosols, based on fluorescence from living microorganisms. In a previous study, we developed an electrospray-assisted UVAPS using biological electrospray techniques, which have the advantage of generating non-agglomerated single particles by the repulsive electrical forces. With this electrospraying of suspensions containing microorganisms, the analytical system can supply more accurate and quantitative information about living microorganisms than with conventional aerosolization. Using electrospray-assisted UVAPS, we investigated the characteristics of bacterial particles with various viabilities in real-time. Escherichia coli was used as the test microorganism, and its initial viability was controlled by the degree of exposure to UV irradiation. In the stable cone-jet domain, the particle size distributions of test bacterial particles remained almost uniform regardless of the degree of UV inactivation. However, the fluorescence spectra of the bacterial particles changed with the degree of UV inactivation. The fluorescence characteristics of UV-inactivated bacterial particles tended to show a similar decline with viability, determined by the sampling and culture method, although the percentage showing fluorescence was higher than that showing viability. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. Impact assessment of silver nanoparticles on plant growth and soil bacterial diversity.

    PubMed

    Pallavi; Mehta, C M; Srivastava, Rashmi; Arora, Sandeep; Sharma, A K

    2016-12-01

    The present study was carried out to investigate the impact of silver nanoparticles (AgNPs) on the growth of three different crop species, wheat (Triticum aestivum, var. UP2338), cowpea (Vigna sinensis, var. Pusa Komal), and Brassica (Brassica juncea, var. Pusa Jai Kisan), along with their impact on the rhizospheric bacterial diversity. Three different concentrations (0, 50 and 75 ppm) of AgNPs were applied through foliar spray. After harvesting, shoot and root parameters were compared, and it was observed that wheat was relatively unaffected by all AgNP treatments. The optimum growth promotion and increased root nodulation were observed at 50 ppm treatment in cowpea, while improved shoot parameters were recorded at 75 ppm in Brassica. To observe the impact of AgNPs on soil bacterial community, sampling was carried out from the rhizosphere of these crops at 20 and 40 days after the spraying of AgNPS. The bacterial diversity of these samples was analyzed by both cultural and molecular techniques (denaturing gradient gel electrophoresis). It is clearly evident from the results that application of AgNPs changes the soil bacterial diversity and this is further influenced by the plant species grown in that soil. Also, the functional bacterial diversity differed with different concentrations of AgNPs.

  13. White piedra: further evidence of a synergistic infection.

    PubMed

    Youker, Summer R; Andreozzi, Robert J; Appelbaum, Peter C; Credito, Kim; Miller, Jeffrey J

    2003-10-01

    White piedra is a fungal infection of the hair shaft caused by Trichosporon beigelii. A synergistic coryneform bacterial infection is often present with T beigelii. White piedra, although not commonly reported to infect scalp hair in North America, is an important consideration in the differential diagnosis of scalp hair concretions. We report a case of white piedra of scalp hair with synergistic coryneform bacterial infection in two sisters, both US natives. Culture and light and electronmicroscopic evidence of the synergistic infection are presented.

  14. The role of the PHP domain associated with DNA polymerase X from Thermus thermophilus HB8 in base excision repair.

    PubMed

    Nakane, Shuhei; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji

    2012-11-01

    Base excision repair (BER) is one of the most commonly used DNA repair pathways involved in genome stability. X-family DNA polymerases (PolXs) play critical roles in BER, especially in filling single-nucleotide gaps. In addition to a polymerase core domain, bacterial PolXs have a polymerase and histidinol phosphatase (PHP) domain with phosphoesterase activity which is also required for BER. However, the role of the PHP domain of PolX in bacterial BER remains unresolved. We found that the PHP domain of Thermus thermophilus HB8 PolX (ttPolX) functions as two types of phosphoesterase in BER, including a 3'-phosphatase and an apurinic/apyrimidinic (AP) endonuclease. Experiments using T. thermophilus HB8 cell lysates revealed that the majority of the 3'-phosphatase and AP endonuclease activities are attributable to the another phosphoesterase in T. thermophilus HB8, endonuclease IV (ttEndoIV). However, ttPolX possesses significant 3'-phosphatase activity in ΔttendoIV cell lysate, indicating possible complementation. Our experiments also reveal that there are only two enzymes that display the 3'-phosphatase activity in the T. thermophilus HB8 cell, ttPolX and ttEndoIV. Furthermore, phenotypic analysis of ΔttpolX, ΔttendoIV, and ΔttpolX/ΔttendoIV using hydrogen peroxide and sodium nitrite supports the hypothesis that ttPolX functions as a backup for ttEndoIV in BER. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. A new model for the spectral induced polarization signature of bacterial growth in porous media

    NASA Astrophysics Data System (ADS)

    Zhang, C.; Revil, A.; Atekwana, E. A.; Jardani, A.; Smith, S.

    2012-12-01

    Recent biogeophysics studies demonstrated the sensitivity of complex conductivity to bacterial growth and microbial mediated mineral transformations in porous media. Frequency-domain induced polarization is a minimally invasive manner to measure the complex conductivity of a material over a broad range of frequencies. The real component of complex conductivity is associated with electromigration of the charge carriers, and the imaginary component represents reversible energy storage of charge carriers at polarization length scales. Quantitative relationship between frequency-domain induced polarization responses and bacterial growth and decay in porous media is analyzed in this study using a new developed model. We focus on the direct contribution of bacteria themselves to the complex conductivity in porous media in the absence of biomineralization. At low frequencies, the induced polarization of bacteria (α-polarization) is related to the properties of the electrical double layer surrounding the membrane surface of bacteria. Surface conductivity and α-polarization are due to the Stern layer of the counterions occurring in a brush of polymers coating the surface of the bacteria, and can be related to the cation exchange capacity of the bacteria. From the modeling results, at low frequencies (< 10 Hz), the mobility of the counterions (K+) in the Stern layer of bacteria is found to be extremely small (4.7×10-10 m2s-1 V-1 at 25°C), and is close to the mobility of the same counterions along the surface of clay minerals (Na+, 1.5×10-10 m2s-1 V-1 at 25°C). This result is in agreement with experimental observations and it indicates a very low relaxation frequency for the α-polarization of the bacteria cells (typically around 0.1 to 5 Hertz). By coupling this new model with reactive transport modeling in which the evolution of bacterial populations are usually described by Monod kinetics, we show that the changes in imaginary conductivity with time can be used to

  16. Urban greenness influences airborne bacterial community composition.

    PubMed

    Mhuireach, Gwynne; Johnson, Bart R; Altrichter, Adam E; Ladau, Joshua; Meadow, James F; Pollard, Katherine S; Green, Jessica L

    2016-11-15

    Urban green space provides health benefits for city dwellers, and new evidence suggests that microorganisms associated with soil and vegetation could play a role. While airborne microorganisms are ubiquitous in urban areas, the influence of nearby vegetation on airborne microbial communities remains poorly understood. We examined airborne microbial communities in parks and parking lots in Eugene, Oregon, using high-throughput sequencing of the bacterial 16S rRNA gene on the Illumina MiSeq platform to identify bacterial taxa, and GIS to measure vegetation cover in buffer zones of different diameters. Our goal was to explore variation among highly vegetated (parks) versus non-vegetated (parking lots) urban environments. A secondary objective was to evaluate passive versus active collection methods for outdoor airborne microbial sampling. Airborne bacterial communities from five parks were different from those of five parking lots (p=0.023), although alpha diversity was similar. Direct gradient analysis showed that the proportion of vegetated area within a 50m radius of the sampling station explained 15% of the variation in bacterial community composition. A number of key taxa, including several Acidobacteriaceae were substantially more abundant in parks, while parking lots had higher relative abundance of Acetobacteraceae. Parks had greater beta diversity than parking lots, i.e. individual parks were characterized by unique bacterial signatures, whereas parking lot communities tended to be similar to each other. Although parks and parking lots were selected to form pairs of nearby sites, spatial proximity did not appear to affect compositional similarity. Our results also showed that passive and active collection methods gave comparable results, indicating the "settling dish" method is effective for outdoor airborne sampling. This work sets a foundation for understanding how urban vegetation may impact microbial communities, with potential implications for designing

  17. Bacterial mycophagy: definition and diagnosis of a unique bacterial-fungal interaction.

    PubMed

    Leveau, Johan H J; Preston, Gail M

    2008-01-01

    This review analyses the phenomenon of bacterial mycophagy, which we define as a set of phenotypic behaviours that enable bacteria to obtain nutrients from living fungi and thus allow the conversion of fungal into bacterial biomass. We recognize three types of bacterial strategies to derive nutrition from fungi: necrotrophy, extracellular biotrophy and endocellular biotrophy. Each is characterized by a set of uniquely sequential and differently overlapping interactions with the fungal target. We offer a detailed analysis of the nature of these interactions, as well as a comprehensive overview of methodologies for assessing and quantifying their individual contributions to the mycophagy phenotype. Furthermore, we discuss future prospects for the study and exploitation of bacterial mycophagy, including the need for appropriate tools to detect bacterial mycophagy in situ in order to be able to understand, predict and possibly manipulate the way in which mycophagous bacteria affect fungal activity, turnover, and community structure in soils and other ecosystems.

  18. Electing a candidate: a speculative history of the bacterial phylum OP10.

    PubMed

    Dunfield, Peter F; Tamas, Ivica; Lee, Kevin C; Morgan, Xochitl C; McDonald, Ian R; Stott, Matthew B

    2012-12-01

    In 1998, a cultivation-independent survey of the microbial community in Obsidian Pool, Yellowstone National Park, detected 12 new phyla within the Domain Bacteria. These were dubbed 'candidate divisions' OP1 to OP12. Since that time the OP10 candidate division has been commonly detected in various environments, usually as part of the rare biosphere, but occasionally as a predominant community component. Based on 16S rRNA gene phylogeny, OP10 comprises at least 12 class-level subdivisions. However, despite this broad ecological and evolutionary diversity, all OP10 bacteria have eluded cultivation until recently. In 2011, two reference species of OP10 were taxonomically validated, removing the phylum from its 'candidate' status. Construction of a highly resolved phylogeny based on 29 universally conserved genes verifies its standing as a unique bacterial phylum. In the following paper we summarize what is known and what is suspected about the newest described bacterial phylum, the Armatimonadetes. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

  19. The cysteine-rich domain regulates ADAM protease function in vivo.

    PubMed

    Smith, Katherine M; Gaultier, Alban; Cousin, Helene; Alfandari, Dominique; White, Judith M; DeSimone, Douglas W

    2002-12-09

    ADAMs are membrane-anchored proteases that regulate cell behavior by proteolytically modifying the cell surface and ECM. Like other membrane-anchored proteases, ADAMs contain candidate "adhesive" domains downstream of their metalloprotease domains. The mechanism by which membrane-anchored cell surface proteases utilize these putative adhesive domains to regulate protease function in vivo is not well understood. We address this important question by analyzing the relative contributions of downstream extracellular domains (disintegrin, cysteine rich, and EGF-like repeat) of the ADAM13 metalloprotease during Xenopus laevis development. When expressed in embryos, ADAM13 induces hyperplasia of the cement gland, whereas ADAM10 does not. Using chimeric constructs, we find that the metalloprotease domain of ADAM10 can substitute for that of ADAM13, but that specificity for cement gland expansion requires a downstream extracellular domain of ADAM13. Analysis of finer resolution chimeras indicates an essential role for the cysteine-rich domain and a supporting role for the disintegrin domain. These and other results reveal that the cysteine-rich domain of ADAM13 cooperates intramolecularly with the ADAM13 metalloprotease domain to regulate its function in vivo. Our findings thus provide the first evidence that a downstream extracellular adhesive domain plays an active role in regulating ADAM protease function in vivo. These findings are likely relevant to other membrane-anchored cell surface proteases.

  20. Pathogen blocks host death receptor signalling by arginine GlcNAcylation of death domains.

    PubMed

    Li, Shan; Zhang, Li; Yao, Qing; Li, Lin; Dong, Na; Rong, Jie; Gao, Wenqing; Ding, Xiaojun; Sun, Liming; Chen, Xing; Chen, She; Shao, Feng

    2013-09-12

    The tumour necrosis factor (TNF) family is crucial for immune homeostasis, cell death and inflammation. These cytokines are recognized by members of the TNF receptor (TNFR) family of death receptors, including TNFR1 and TNFR2, and FAS and TNF-related apoptosis-inducing ligand (TRAIL) receptors. Death receptor signalling requires death-domain-mediated homotypic/heterotypic interactions between the receptor and its downstream adaptors, including TNFR1-associated death domain protein (TRADD) and FAS-associated death domain protein (FADD). Here we discover that death domains in several proteins, including TRADD, FADD, RIPK1 and TNFR1, were directly inactivated by NleB, an enteropathogenic Escherichia coli (EPEC) type III secretion system effector known to inhibit host nuclear factor-κB (NF-κB) signalling. NleB contained an unprecedented N-acetylglucosamine (GlcNAc) transferase activity that specifically modified a conserved arginine in these death domains (Arg 235 in the TRADD death domain). NleB GlcNAcylation (the addition of GlcNAc onto a protein side chain) of death domains blocked homotypic/heterotypic death domain interactions and assembly of the oligomeric TNFR1 complex, thereby disrupting TNF signalling in EPEC-infected cells, including NF-κB signalling, apoptosis and necroptosis. Type-III-delivered NleB also blocked FAS ligand and TRAIL-induced cell death by preventing formation of a FADD-mediated death-inducing signalling complex (DISC). The arginine GlcNAc transferase activity of NleB was required for bacterial colonization in the mouse model of EPEC infection. The mechanism of action of NleB represents a new model by which bacteria counteract host defences, and also a previously unappreciated post-translational modification.

  1. Sterol Synthesis in Diverse Bacteria.

    PubMed

    Wei, Jeremy H; Yin, Xinchi; Welander, Paula V

    2016-01-01

    Sterols are essential components of eukaryotic cells whose biosynthesis and function has been studied extensively. Sterols are also recognized as the diagenetic precursors of steranes preserved in sedimentary rocks where they can function as geological proxies for eukaryotic organisms and/or aerobic metabolisms and environments. However, production of these lipids is not restricted to the eukaryotic domain as a few bacterial species also synthesize sterols. Phylogenomic studies have identified genes encoding homologs of sterol biosynthesis proteins in the genomes of several additional species, indicating that sterol production may be more widespread in the bacterial domain than previously thought. Although the occurrence of sterol synthesis genes in a genome indicates the potential for sterol production, it provides neither conclusive evidence of sterol synthesis nor information about the composition and abundance of basic and modified sterols that are actually being produced. Here, we coupled bioinformatics with lipid analyses to investigate the scope of bacterial sterol production. We identified oxidosqualene cyclase (Osc), which catalyzes the initial cyclization of oxidosqualene to the basic sterol structure, in 34 bacterial genomes from five phyla (Bacteroidetes, Cyanobacteria, Planctomycetes, Proteobacteria, and Verrucomicrobia) and in 176 metagenomes. Our data indicate that bacterial sterol synthesis likely occurs in diverse organisms and environments and also provides evidence that there are as yet uncultured groups of bacterial sterol producers. Phylogenetic analysis of bacterial and eukaryotic Osc sequences confirmed a complex evolutionary history of sterol synthesis in this domain. Finally, we characterized the lipids produced by Osc-containing bacteria and found that we could generally predict the ability to synthesize sterols. However, predicting the final modified sterol based on our current knowledge of sterol synthesis was difficult. Some bacteria

  2. Cellular damage in bacterial meningitis: an interplay of bacterial and host driven toxicity.

    PubMed

    Weber, Joerg R; Tuomanen, Elaine I

    2007-03-01

    Bacterial meningitis is still an important infectious disease causing death and disability. Invasive bacterial infections of the CNS generate some of the most powerful inflammatory responses known in medicine. Although the components of bacterial cell surfaces are now chemically defined in exquisite detail and the interaction with several receptor pathways has been discovered, it is only very recently that studies combining these advanced biochemical and cell biological tools have been done. Additional to the immunological response direct bacterial toxicity has been identified as an important contributor to neuronal damage. A detailed understanding of the complex interaction of bacterial toxicity and host response may generate opportunities for innovative and specific neuroprotective therapies.

  3. Novel Prevention Strategies for Bacterial Infections in Cirrhosis

    PubMed Central

    Yan, Kathleen; Garcia-Tsao, Guadalupe

    2016-01-01

    Introduction Bacterial infections are a serious complication of cirrhosis, as they can lead to decompensation, multiple organ failure, and/or death. Preventing infections is therefore very relevant. Because gut bacterial translocation is their main pathogenic mechanism, prevention of infections is mostly based on the use of orally administered poorly absorbed antibiotics such as norfloxacin (selective intestinal decontamination). However, antibiotic prophylaxis leads to antibiotic resistance, limiting therapy and increasing morbidity and mortality. Prevention of bacterial infections in cirrhosis should therefore move away from antibiotics. Areas Covered This review focuses on various potentially novel methods to prevent infections in cirrhosis focusing on non-antibiotic strategies. The use of probiotics, nonselective intestinal decontamination with rifaximin, prokinetics and beta-blockers or fecal microbiota transplant as means of targeting altered gut microbiota, bile acids and FXR agonists are all potential alternatives to selective intestinal decontamination. Prokinetics and beta-blockers can improve intestinal motility, while bile acids and FXR agonists help by improving the intestinal barrier. Finally, granulocyte colony stimulating factor (G-CSF) and statins are emerging therapeutic strategies that may improve immune dysfunction in cirrhosis. Expert Opinion Evidence for these strategies has been restricted to animal studies and proof-of concept studies but we expect this to change in coming years. PMID:26799197

  4. RAV transcription factors are essential for disease resistance against cassava bacterial blight via activation of melatonin biosynthesis genes.

    PubMed

    Wei, Yunxie; Chang, Yanli; Zeng, Hongqiu; Liu, Guoyin; He, Chaozu; Shi, Haitao

    2018-01-01

    With 1 AP2 domain and 1 B3 domain, 7 MeRAVs in apetala2/ethylene response factor (AP2/ERF) gene family have been identified in cassava. However, the in vivo roles of these remain unknown. Gene expression assays showed that the transcripts of MeRAVs were commonly regulated after Xanthomonas axonopodis pv manihotis (Xam) and MeRAVs were specifically located in plant cell nuclei. Through virus-induced gene silencing (VIGS) in cassava, we found that MeRAV1 and MeRAV2 are essential for plant disease resistance against cassava bacterial blight, as shown by the bacterial propagation of Xam in plant leaves. Through VIGS in cassava leaves and overexpression in cassava leave protoplasts, we found that MeRAV1 and MeRAV2 positively regulated melatonin biosynthesis genes and the endogenous melatonin level. Further investigation showed that MeRAV1 and MeRAV2 are direct transcriptional activators of 3 melatonin biosynthesis genes in cassava, as evidenced by chromatin immunoprecipitation-PCR in cassava leaf protoplasts and electrophoretic mobility shift assay. Moreover, cassava melatonin biosynthesis genes also positively regulated plant disease resistance. Taken together, this study identified MeRAV1 and MeRAV2 as common and upstream transcription factors of melatonin synthesis genes in cassava and revealed a model of MeRAV1 and MeRAV2-melatonin biosynthesis genes-melatonin level in plant disease resistance against cassava bacterial blight. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Simultaneous Amplicon Sequencing to Explore Co-Occurrence Patterns of Bacterial, Archaeal and Eukaryotic Microorganisms in Rumen Microbial Communities

    PubMed Central

    Kittelmann, Sandra; Seedorf, Henning; Walters, William A.; Clemente, Jose C.; Knight, Rob; Gordon, Jeffrey I.; Janssen, Peter H.

    2013-01-01

    Ruminants rely on a complex rumen microbial community to convert dietary plant material to energy-yielding products. Here we developed a method to simultaneously analyze the community's bacterial and archaeal 16S rRNA genes, ciliate 18S rRNA genes and anaerobic fungal internal transcribed spacer 1 genes using 12 DNA samples derived from 11 different rumen samples from three host species (Ovis aries, Bos taurus, Cervus elephas) and multiplex 454 Titanium pyrosequencing. We show that the mixing ratio of the group-specific DNA templates before emulsion PCR is crucial to compensate for differences in amplicon length. This method, in contrast to using a non-specific universal primer pair, avoids sequencing non-targeted DNA, such as plant- or endophyte-derived rRNA genes, and allows increased or decreased levels of community structure resolution for each microbial group as needed. Communities analyzed with different primers always grouped by sample origin rather than by the primers used. However, primer choice had a greater impact on apparent archaeal community structure than on bacterial community structure, and biases for certain methanogen groups were detected. Co-occurrence analysis of microbial taxa from all three domains of life suggested strong within- and between-domain correlations between different groups of microorganisms within the rumen. The approach used to simultaneously characterize bacterial, archaeal and eukaryotic components of a microbiota should be applicable to other communities occupying diverse habitats. PMID:23408926

  6. Cultured bacterial diversity and human impact on alpine glacier cryoconite.

    PubMed

    Lee, Yung Mi; Kim, So-Yeon; Jung, Jia; Kim, Eun Hye; Cho, Kyeung Hee; Schinner, Franz; Margesin, Rosa; Hong, Soon Gyu; Lee, Hong Kum

    2011-06-01

    The anthropogenic effect on the microbial communities in alpine glacier cryoconites was investigated by cultivation and physiological characterization of bacteria from six cryoconite samples taken at sites with different amounts of human impact. Two hundred and forty seven bacterial isolates were included in Actinobacteria (9%, particularly Arthrobacter), Bacteroidetes (14%, particularly Olleya), Firmicutes (0.8%), Alphaproteobacteria (2%), Betaproteobacteria (16%, particularly Janthinobacterium), and Gammaproteobacteria (59%, particularly Pseudomonas). Among them, isolates of Arthrobacter were detected only in samples from sites with no human impact, while isolates affiliated with Enterobacteriaceae were detected only in samples from sites with strong human impact. Bacterial isolates included in Actinobacteria and Bacteroidetes were frequently isolated from pristine sites and showed low maximum growth temperature and enzyme secretion. Bacterial isolates included in Gammaproteobacteria were more frequently isolated from sites with stronger human impact and showed high maximum growth temperature and enzyme secretion. Ecotypic differences were not evident among isolates of Janthinobacterium lividum, Pseudomonas fluorescens, and Pseudomonas veronii, which were frequently isolated from sites with different degrees of anthropogenic effect.

  7. Bacterial surface adaptation

    NASA Astrophysics Data System (ADS)

    Utada, Andrew

    2014-03-01

    Biofilms are structured multi-cellular communities that are fundamental to the biology and ecology of bacteria. Parasitic bacterial biofilms can cause lethal infections and biofouling, but commensal bacterial biofilms, such as those found in the gut, can break down otherwise indigestible plant polysaccharides and allow us to enjoy vegetables. The first step in biofilm formation, adaptation to life on a surface, requires a working knowledge of low Reynolds number fluid physics, and the coordination of biochemical signaling, polysaccharide production, and molecular motility motors. These crucial early stages of biofilm formation are at present poorly understood. By adapting methods from soft matter physics, we dissect bacterial social behavior at the single cell level for several prototypical bacterial species, including Pseudomonas aeruginosa and Vibrio cholerae.

  8. A Bacterial Multidomain NAD-Independent d-Lactate Dehydrogenase Utilizes Flavin Adenine Dinucleotide and Fe-S Clusters as Cofactors and Quinone as an Electron Acceptor for d-Lactate Oxidization

    PubMed Central

    Jiang, Tianyi; Guo, Xiaoting; Yan, Jinxin; Zhang, Yingxin; Wang, Yujiao; Zhang, Manman; Sheng, Binbin; Ma, Cuiqing; Xu, Ping

    2017-01-01

    ABSTRACT Bacterial membrane-associated NAD-independent d-lactate dehydrogenase (Fe-S d-iLDH) oxidizes d-lactate into pyruvate. A sequence analysis of the enzyme reveals that it contains an Fe-S oxidoreductase domain in addition to a flavin adenine dinucleotide (FAD)-containing dehydrogenase domain, which differs from other typical d-iLDHs. Fe-S d-iLDH from Pseudomonas putida KT2440 was purified as a His-tagged protein and characterized in detail. This monomeric enzyme exhibited activities with l-lactate and several d-2-hydroxyacids. Quinone was shown to be the preferred electron acceptor of the enzyme. The two domains of the enzyme were then heterologously expressed and purified separately. The Fe-S cluster-binding motifs predicted by sequence alignment were preliminarily verified by site-directed mutagenesis of the Fe-S oxidoreductase domain. The FAD-containing dehydrogenase domain retained 2-hydroxyacid-oxidizing activity, although it decreased compared to the full Fe-S d-iLDH. Compared to the intact enzyme, the FAD-containing dehydrogenase domain showed increased catalytic efficiency with cytochrome c as the electron acceptor, but it completely lost the ability to use coenzyme Q10. Additionally, the FAD-containing dehydrogenase domain was no longer associated with the cell membrane, and it could not support the utilization of d-lactate as a carbon source. Based on the results obtained, we conclude that the Fe-S oxidoreductase domain functions as an electron transfer component to facilitate the utilization of quinone as an electron acceptor by Fe-S d-iLDH, and it helps the enzyme associate with the cell membrane. These functions make the Fe-S oxidoreductase domain crucial for the in vivo d-lactate utilization function of Fe-S d-iLDH. IMPORTANCE Lactate metabolism plays versatile roles in most domains of life. Lactate utilization processes depend on certain enzymes to oxidize lactate to pyruvate. In recent years, novel bacterial lactate-oxidizing enzymes have been

  9. Assessment of the bacterial contamination of hand air dryer in washrooms.

    PubMed

    Alharbi, Sulaiman Ali; Salmen, Saleh Hussein; Chinnathambi, Arunachalam; Alharbi, Naiyf S; Zayed, M E; Al-Johny, Bassam O; Wainwright, Milton

    2016-03-01

    The present study was carried out, using standard techniques, to identify and count the bacterial contamination of hand air dryers, used in washrooms. Bacteria were isolated from the air flow, outlet nozzle of warm air dryers in fifteen air dryers used in these washrooms. Bacteria were found to be relatively numerous in the air flows. Bacterially contaminated air was found to be emitted whenever a warm air dryer was running, even when not being used for hand drying. Our investigation shows that Staphylococcus haemolyticus, Micrococcus luteus, Pseudomonas alcaligenes, Bacillus cereus and Brevundimonad diminuta/vesicularis were emitted from all of the dryers sampled, with 95% showing evidence of the presence of the potential pathogen S. haemolyticus. It is concluded that hot air dryers can deposit pathogenic bacteria onto the hands and body of users. Bacteria are distributed into the general environment whenever dryers are running and could be inhaled by users and none-users alike. The results provide an evidence base for the development and enhancement of hygienic hand drying practices.

  10. Assessment of the bacterial contamination of hand air dryer in washrooms

    PubMed Central

    Alharbi, Sulaiman Ali; Salmen, Saleh Hussein; Chinnathambi, Arunachalam; Alharbi, Naiyf S.; Zayed, M.E.; Al-Johny, Bassam O.; Wainwright, Milton

    2015-01-01

    The present study was carried out, using standard techniques, to identify and count the bacterial contamination of hand air dryers, used in washrooms. Bacteria were isolated from the air flow, outlet nozzle of warm air dryers in fifteen air dryers used in these washrooms. Bacteria were found to be relatively numerous in the air flows. Bacterially contaminated air was found to be emitted whenever a warm air dryer was running, even when not being used for hand drying. Our investigation shows that Staphylococcus haemolyticus, Micrococcus luteus, Pseudomonas alcaligenes, Bacillus cereus and Brevundimonad diminuta/vesicularis were emitted from all of the dryers sampled, with 95% showing evidence of the presence of the potential pathogen S. haemolyticus. It is concluded that hot air dryers can deposit pathogenic bacteria onto the hands and body of users. Bacteria are distributed into the general environment whenever dryers are running and could be inhaled by users and none-users alike. The results provide an evidence base for the development and enhancement of hygienic hand drying practices. PMID:26981009

  11. System modeling with the DISC framework: evidence from safety-critical domains.

    PubMed

    Reiman, Teemu; Pietikäinen, Elina; Oedewald, Pia; Gotcheva, Nadezhda

    2012-01-01

    The objective of this paper is to illustrate the development and application of the Design for Integrated Safety Culture (DISC) framework for system modeling by evaluating organizational potential for safety in nuclear and healthcare domains. The DISC framework includes criteria for good safety culture and a description of functions that the organization needs to implement in order to orient the organization toward the criteria. Three case studies will be used to illustrate the utilization of the DISC framework in practice.

  12. Large interdomain rearrangement triggered by suppression of micro- to millisecond dynamics in bacterial Enzyme I

    NASA Astrophysics Data System (ADS)

    Venditti, Vincenzo; Tugarinov, Vitali; Schwieters, Charles D.; Grishaev, Alexander; Clore, G. Marius

    2015-01-01

    Enzyme I (EI), the first component of the bacterial phosphotransfer signal transduction system, undergoes one of the largest substrate-induced interdomain rearrangements documented to date. Here we characterize the perturbations generated by two small molecules, the natural substrate phosphoenolpyruvate and the inhibitor α-ketoglutarate, on the structure and dynamics of EI using NMR, small-angle X-ray scattering and biochemical techniques. The results indicate unambiguously that the open-to-closed conformational switch of EI is triggered by complete suppression of micro- to millisecond dynamics within the C-terminal domain of EI. Indeed, we show that a ligand-induced transition from a dynamic to a more rigid conformational state of the C-terminal domain stabilizes the interface between the N- and C-terminal domains observed in the structure of the closed state, thereby promoting the resulting conformational switch and autophosphorylation of EI. The mechanisms described here may be common to several other multidomain proteins and allosteric systems.

  13. Green synthesis of bacterial mediated anti-proliferative gold nanoparticles: inducing mitotic arrest (G2/M phase) and apoptosis (intrinsic pathway)

    NASA Astrophysics Data System (ADS)

    Ganesh Kumar, C.; Poornachandra, Y.; Chandrasekhar, Cheemalamarri

    2015-11-01

    The physiochemical and biological properties of microbial derived gold nanoparticles have potential applications in various biomedical domains as well as in cancer therapy. We have fabricated anti-proliferative bacterial mediated gold nanoparticles (b-Au NPs) using a culture supernatant of Streptomyces clavuligerus and later characterized them by UV-visible, TEM, DLS, XRD and FT-IR spectroscopic techniques. The capping agent responsible for the nanoparticle formation was characterized based on SDS-PAGE and MALDI-TOF-MS analyses. They were tested for anticancer activity in A549, HeLa and DU145 cell lines. The biocompatibility and non-toxic nature of the nanoparticles were tested on normal human lung cell line (MRC-5). The b-Au NPs induced the cell cycle arrest in G2/M phase and also inhibited the microtubule assembly in DU145 cells. Mechanistic studies, such as ROS, MMP, Cyt-c, GSH, caspases 9, 8 and 3 activation and the Annexin V-FITC staining, along with the above parameters tested provided sufficient evidence that the b-Au NPs induced apoptosis through the intrinsic pathway. The results supported the use of b-Au NPs for future therapeutic application in cancer therapy and other biomedical applications.The physiochemical and biological properties of microbial derived gold nanoparticles have potential applications in various biomedical domains as well as in cancer therapy. We have fabricated anti-proliferative bacterial mediated gold nanoparticles (b-Au NPs) using a culture supernatant of Streptomyces clavuligerus and later characterized them by UV-visible, TEM, DLS, XRD and FT-IR spectroscopic techniques. The capping agent responsible for the nanoparticle formation was characterized based on SDS-PAGE and MALDI-TOF-MS analyses. They were tested for anticancer activity in A549, HeLa and DU145 cell lines. The biocompatibility and non-toxic nature of the nanoparticles were tested on normal human lung cell line (MRC-5). The b-Au NPs induced the cell cycle arrest in G2

  14. Effects of an EPSPS-transgenic soybean line ZUTS31 on root-associated bacterial communities during field growth

    PubMed Central

    Cheng, Jing; Wang, Gu-Hao; Zhu, Yin-Ling; Zhang, Li-Ya; Shou, Hui-Xia; Qi, Jin-Liang

    2018-01-01

    The increased worldwide commercial cultivation of transgenic crops during the past 20 years is accompanied with potential effects on the soil microbial communities, because many rhizosphere and endosphere bacteria play important roles in promoting plant health and growth. Previous studies reported that transgenic plants exert differential effects on soil microbial communities, especially rhizobacteria. Thus, this study compared the soybean root-associated bacterial communities between a 5-enolpyruvylshikimate-3-phosphate synthase -transgenic soybean line (ZUTS31 or simply Z31) and its recipient cultivar (Huachun3 or simply HC3) at the vegetative, flowering, and seed-filling stages. High-throughput sequencing of 16S rRNA gene (16S rDNA) V4 hypervariable region amplicons via Illumina MiSeq and real-time quantitative PCR (qPCR) were performed. Our results revealed no significant differences in the overall alpha diversity of root-associated bacterial communities at the three developmental stages and in the beta diversity of root-associated bacterial communities at the flowering stage between Z31 and HC3 under field growth. However, significant differences in the beta diversity of rhizosphere bacterial communities were found at the vegetative and seed-filling stages between the two groups. Furthermore, the results of next generation sequencing and qPCR showed that the relative abundances of root-associated main nitrogen-fixing bacterial genera, especially Bradyrhizobium in the roots, evidently changed from the flowering stage to the seed-filling stage. In conclusion, Z31 exerts transitory effects on the taxonomic diversity of rhizosphere bacterial communities at the vegetative and seed-filling stages compared to the control under field conditions. In addition, soybean developmental change evidently influences the main symbiotic nitrogen-fixing bacterial genera in the roots from the flowering stage to the seed-filling stage. PMID:29408918

  15. Nest Bacterial Environment Affects Microbiome of Hoopoe Eggshells, but Not That of the Uropygial Secretion.

    PubMed

    Martínez-García, Ángela; Martín-Vivaldi, Manuel; Rodríguez-Ruano, Sonia M; Peralta-Sánchez, Juan Manuel; Valdivia, Eva; Soler, Juan J

    2016-01-01

    The study of associations between symbiotic bacterial communities of hosts and those of surrounding environments would help to understand how bacterial assemblages are acquired, and how they are transmitted from one to another location (i.e. symbiotic bacteria acquisition by hosts). Hoopoes (Upupa epops) smear their eggshells with uropygial secretion (oily secretion produced in their uropygial gland) that harbors antibiotic producing bacteria. Trying to elucidate a possible role of nest material and cloaca microbiota in determining the bacterial community of the uropygial gland and the eggshells of hoopoes, we characterized bacterial communities of nest material, cloaca, uropygial gland and eggshells by the ARISA fingerprinting. Further, by adding material with scarce bacteria and antimicrobial properties, we manipulated the bacterial community of nest material and thus tested experimentally its effects on the microbiomes of the uropygial secretion and of the eggshells. The experiment did not influence the microbiome of the uropygial secretion of females, but affected the community established on eggshells. This is the first experimental evidence indicating that nest material influences the bacterial community of the eggshells and, therefore, probability of embryo infection. Some of the bacterial strains detected in the secretion were also in the bacterial communities of the nest material and of cloaca, but their occurrence within nests was not associated, which suggests that bacterial environments of nest material and cloaca are not sources of symbiotic bacteria for the gland. These results do not support a role of nest environments of hoopoes as reservoirs of symbiotic bacteria. We discuss possible scenarios explaining bacterial acquisition by hoopoes that should be further explored.

  16. Visualization studies on evidence-based medicine domain knowledge (series 3): visualization for dissemination of evidence based medicine information.

    PubMed

    Shen, Jiantong; Yao, Leye; Li, Youping; Clarke, Mike; Gan, Qi; Li, Yifei; Fan, Yi; Gou, Yongchao; Wang, Li

    2011-05-01

    To identify patterns in information sharing between a series of Chinese evidence based medicine (EBM) journals and the Cochrane Database of Systematic Reviews, to determine key evidence dissemination areas for EBM and to provide a scientific basis for improving the dissemination of EBM research. Data were collected on citing and cited from the Chinese Journal of Evidence-Based Medicine (CJEBM), Journal of Evidence-Based Medicine (JEBMc), Chinese Journal of Evidence Based Pediatrics (CJEBP), and the Cochrane Database of Systematic Reviews (CDSR). Relationships between citations were visualized. High-frequency key words from these sources were identified, to build a word co-occurrence matrix and to map research subjects. CDSR contains a large collection of information of relevance to EBM and its contents are widely cited across many journals, suggesting a well-developed citation environment. The content and citation of the Chinese journals have been increasing in recent years. However, their citation environments are much less developed, and there is a wide variation in the breadth and strength of their knowledge communication, with the ranking from highest to lowest being CJEBM, JEBMc and CJEBP. The content of CDSR is almost exclusively Cochrane intervention reviews examining the effects of healthcare interventions, so it's contribution to EBM is mostly in disease control and treatment. On the other hand, the Chinese journals on evidence-based medicine and practice focused more on areas such as education and research, design and quality of clinical trials, evidence based policymaking, evidence based clinical practice, tumor treatment, and pediatrics. Knowledge and findings of EBM are widely communicated and disseminated. However, citation environments and range of knowledge communication differ greatly between the journals examined in this study. This finds that Chinese EBM has focused mainly on clinical medicine, Traditional Chinese Medicine, pediatrics, tumor

  17. C-reactive Protein Versus Neutrophil/lymphocyte Ratio in Differentiating Bacterial and Non-bacterial Pneumonia in Children.

    PubMed

    Gauchan, E; Adhikari, S

    2016-09-01

    Pneumonia is a leading cause of childhood mortality in a low resource country. Simple laboratory markers can help differentiate between bacterial and non-bacterial pneumonias for appropriate management. In children aged one to 60 months with features of lower respiratory infection, C-reactive protein (CRP) and neutrophil-lymphocyte ratio (NLR) were used to differentiate between bacterial and non-bacterial pneumonias. The cutoff values for detecting bacterial pneumonias were evaluated by statistical tools. Bacterial pneumonia was diagnosed in 285 (43.6%) children out of 654 studied. At a cut-off value of 36 mg/L CRP was predictive of bacterial pneumonias with sensitivity and specificity of 61.8% and 91.3% respectively while the sensitivity and specificity for predicting bacterial pneumonia using NLR was 45.6% and 64% respectively with 1.28 used as a cut-off. Our study shows that CRP is superior to NLR in differentiating bacterial from non-bacterial pneumonias in children.

  18. Structural complementarity of Toll/interleukin-1 receptor domains in Toll-like receptors and the adaptors Mal and MyD88.

    PubMed

    Dunne, Aisling; Ejdeback, Mikael; Ludidi, Phumzile L; O'Neill, Luke A J; Gay, Nicholas J

    2003-10-17

    The Toll/interleukin 1 receptor (TIR) domain is a region found in the cytoplasmic tails of members of the Toll-like receptor/interleukin-1 receptor superfamily. The domain is essential for signaling and is also found in the adaptor proteins Mal (MyD88 adaptor-like) and MyD88, which function to couple activation of the receptor to downstream signaling components. Experimental structures of two Toll/interleukin 1 receptor domains reveal a alpha-beta-fold similar to that of the bacterial chemotaxis protein CheY, and other evidence suggests that the adaptors can make heterotypic interactions with both the receptors and themselves. Here we show that the purified TIR domains of Mal and MyD88 can form stable heterodimers and also that Mal homodimers and oligomers are dissociated in the presence of ATP. To identify structural features that may contribute to the formation of signaling complexes, we produced models of the TIR domains from human Toll-like receptor 4 (TLR4), Mal, and MyD88. We found that although the overall fold is conserved the electrostatic surface potentials are quite distinct. Docking studies of the models suggest that Mal and MyD88 bind to different regions in TLRs 2 and 4, a finding consistent with a cooperative role of the two adaptors in signaling. Mal and MyD88 are predicted to interact at a third non-overlapping site, suggesting that the receptor and adaptors may form heterotetrameric complexes. The theoretical model of the interactions is supported by experimental data from glutathione S-transferase pull-downs and co-immunoprecipitations. Neither theoretical nor experimental data suggest a direct role for the conserved proline in the BB-loop in the association of TLR4, Mal, and MyD88. Finally we show a sequence relationship between the Drosophila protein Tube and Mal that may indicate a functional equivalence of these two adaptors in the Drosophila and vertebrate Toll pathways.

  19. Acidic pH sensing in the bacterial cytoplasm is required for Salmonella virulence.

    PubMed

    Choi, Jeongjoon; Groisman, Eduardo A

    2016-09-01

    pH regulates gene expression, biochemical activities and cellular behaviors. A mildly acidic pH activates the master virulence regulatory system PhoP/PhoQ in the facultative intracellular pathogen Salmonella enterica serovar Typhimurium. The sensor PhoQ harbors an extracytoplasmic domain implicated in signal sensing, and a cytoplasmic domain controlling activation of the regulator PhoP. We now report that, surprisingly, a decrease in Salmonella's own cytoplasmic pH induces transcription of PhoP-activated genes even when the extracytoplasmic pH remains neutral. Amino acid substitutions in PhoQ's cytoplasmic domain hindered activation by acidic pH and attenuated virulence in mice, but did not abolish activation by low Mg(2+) or the antimicrobial peptide C18G. Conversely, removal of PhoQ's extracytoplasmic domains prevented the response to the latter PhoQ-activating signals but not to acidic pH. PhoP-dependent genes were minimally induced by acidic pH in the non-pathogenic species Salmonella bongori but were activated by low Mg(2+) and C18G as in pathogenic S. enterica. Our findings indicate that the sensor PhoQ enables S. enterica to respond to both host- and bacterial-derived signals that alter its cytoplasmic pH. © 2016 John Wiley & Sons Ltd.

  20. A Protein Domain and Family Based Approach to Rare Variant Association Analysis.

    PubMed

    Richardson, Tom G; Shihab, Hashem A; Rivas, Manuel A; McCarthy, Mark I; Campbell, Colin; Timpson, Nicholas J; Gaunt, Tom R

    2016-01-01

    It has become common practice to analyse large scale sequencing data with statistical approaches based around the aggregation of rare variants within the same gene. We applied a novel approach to rare variant analysis by collapsing variants together using protein domain and family coordinates, regarded to be a more discrete definition of a biologically functional unit. Using Pfam definitions, we collapsed rare variants (Minor Allele Frequency ≤ 1%) together in three different ways 1) variants within single genomic regions which map to individual protein domains 2) variants within two individual protein domain regions which are predicted to be responsible for a protein-protein interaction 3) all variants within combined regions from multiple genes responsible for coding the same protein domain (i.e. protein families). A conventional collapsing analysis using gene coordinates was also undertaken for comparison. We used UK10K sequence data and investigated associations between regions of variants and lipid traits using the sequence kernel association test (SKAT). We observed no strong evidence of association between regions of variants based on Pfam domain definitions and lipid traits. Quantile-Quantile plots illustrated that the overall distributions of p-values from the protein domain analyses were comparable to that of a conventional gene-based approach. Deviations from this distribution suggested that collapsing by either protein domain or gene definitions may be favourable depending on the trait analysed. We have collapsed rare variants together using protein domain and family coordinates to present an alternative approach over collapsing across conventionally used gene-based regions. Although no strong evidence of association was detected in these analyses, future studies may still find value in adopting these approaches to detect previously unidentified association signals.

  1. Isolation of bacterial metabolites as natural inducers for larval settlement in the marine polychaete Hydroides elegans (Haswell).

    PubMed

    Harder, Tilmann; Lau, Stanley Chun Kwan; Dahms, Hans-Uwe; Qian, Pei-Yuan

    2002-10-01

    The bacterial component of marine biofilms plays an important role in the induction of larval settlement in the polychaete Hydroides elegans. In this study, we provide experimental evidence that bacterial metabolites comprise the chemical signal for larval settlement. Bacteria were isolated from biofilms, purified and cultured according to standard procedures. Bacterial metabolites were isolated from spent culture broth by chloroform extraction as well as by closed-loop stripping and adsorption of volatile components on surface-modified silica gel. A pronounced biological activity was exclusively observed when concentrated metabolites were adsorbed on activated charcoal. Larvae did not respond to waterbome metabolites when prevented from contacting the bacterial film surface. These results indicate that an association of the chemical signal with a sorbent-like substratum may be an essential cofactor for the expression of biological activity. The functional role of bacterial exopolymers as an adsorptive matrix for larval settlement signals is discussed.

  2. Structural Characterization of a Newly Identified Component of α-Carboxysomes: The AAA+ Domain Protein CsoCbbQ

    DOE PAGES

    Sutter, Markus; Roberts, Evan W.; Gonzalez, Raul C.; ...

    2015-11-05

    Carboxysomes are bacterial microcompartments that enhance carbon fixation by concentrating ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO) and its substrate CO 2 within a proteinaceous shell. They are found in all cyanobacteria, some purple photoautotrophs and many chemoautotrophic bacteria. Carboxysomes consist of a protein shell that encapsulates several hundred molecules of RuBisCO, and contain carbonic anhydrase and other accessory proteins. Genes coding for carboxysome shell components and the encapsulated proteins are typically found together in an operon. The α-carboxysome operon is embedded in a cluster of additional, conserved genes that are presumably related to its function. In many chemoautotrophs, products of the expanded carboxysomemore » locus include CbbO and CbbQ, a member of the AAA+ domain superfamily. We bioinformatically identified subtypes of CbbQ proteins and show that their genes frequently co-occur with both Form IA and Form II RuBisCO. The α-carboxysome-associated ortholog, CsoCbbQ, from Halothiobacillus neapolitanus forms a hexamer in solution and hydrolyzes ATP. The crystal structure shows that CsoCbbQ is a hexamer of the typical AAA+ domain; the additional C-terminal domain, diagnostic of the CbbQ subfamily, structurally fills the inter-monomer gaps, resulting in a distinctly hexagonal shape. Finally, we show that CsoCbbQ interacts with CsoCbbO and is a component of the carboxysome shell, the first example of ATPase activity associated with a bacterial microcompartment.« less

  3. Fungal mediator tail subunits contain classical transcriptional activation domains.

    PubMed

    Liu, Zhongle; Myers, Lawrence C

    2015-04-01

    Classical activation domains within DNA-bound eukaryotic transcription factors make weak interactions with coactivator complexes, such as Mediator, to stimulate transcription. How these interactions stimulate transcription, however, is unknown. The activation of reporter genes by artificial fusion of Mediator subunits to DNA binding domains that bind to their promoters has been cited as evidence that the primary role of activators is simply to recruit Mediator. We have identified potent classical transcriptional activation domains in the C termini of several tail module subunits of Saccharomyces cerevisiae, Candida albicans, and Candida dubliniensis Mediator, while their N-terminal domains are necessary and sufficient for their incorporation into Mediator but do not possess the ability to activate transcription when fused to a DNA binding domain. This suggests that Mediator fusion proteins actually are functioning in a manner similar to that of a classical DNA-bound activator rather than just recruiting Mediator. Our finding that deletion of the activation domains of S. cerevisiae Med2 and Med3, as well as C. dubliniensis Tlo1 (a Med2 ortholog), impairs the induction of certain genes shows these domains function at native promoters. Activation domains within coactivators are likely an important feature of these complexes and one that may have been uniquely leveraged by a common fungal pathogen. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  4. The bacterial alarmone (p)ppGpp activates the type III secretion system in Erwinia amylovora.

    PubMed

    Ancona, Veronica; Lee, Jae Hoon; Chatnaparat, Tiyakhon; Oh, Jinrok; Hong, Jong-In; Zhao, Youfu

    2015-04-01

    The hypersensitive response and pathogenicity (hrp) type III secretion system (T3SS) is a key pathogenicity factor in Erwinia amylovora. Previous studies have demonstrated that the T3SS in E. amylovora is transcriptionally regulated by a sigma factor cascade. In this study, the role of the bacterial alarmone ppGpp in activating the T3SS and virulence of E. amylovora was investigated using ppGpp mutants generated by Red recombinase cloning. The virulence of a ppGpp-deficient mutant (ppGpp(0)) as well as a dksA mutant of E. amylovora was completely impaired, and bacterial growth was significantly reduced, suggesting that ppGpp is required for full virulence of E. amylovora. Expression of T3SS genes was greatly downregulated in the ppGpp(0) and dksA mutants. Western blotting showed that accumulations of the HrpA protein in the ppGpp(0) and dksA mutants were about 10 and 4%, respectively, of that in the wild-type strain. Furthermore, higher levels of ppGpp resulted in a reduced cell size of E. amylovora. Moreover, serine hydroxamate and α-methylglucoside, which induce amino acid and carbon starvation, respectively, activated hrpA and hrpL promoter activities in hrp-inducing minimal medium. These results demonstrated that ppGpp and DksA play central roles in E. amylovora virulence and indicated that E. amylovora utilizes ppGpp as an internal messenger to sense environmental/nutritional stimuli for regulation of the T3SS and virulence. The type III secretion system (T3SS) is a key pathogenicity factor in Gram-negative bacteria. Fully elucidating how the T3SS is activated is crucial for comprehensively understanding the function of the T3SS, bacterial pathogenesis, and survival under stress conditions. In this study, we present the first evidence that the bacterial alarmone ppGpp-mediated stringent response activates the T3SS through a sigma factor cascade, indicating that ppGpp acts as an internal messenger to sense environmental/nutritional stimuli for the regulation

  5. The Bacterial Alarmone (p)ppGpp Activates the Type III Secretion System in Erwinia amylovora

    PubMed Central

    Ancona, Veronica; Lee, Jae Hoon; Chatnaparat, Tiyakhon; Oh, Jinrok; Hong, Jong-In

    2015-01-01

    ABSTRACT The hypersensitive response and pathogenicity (hrp) type III secretion system (T3SS) is a key pathogenicity factor in Erwinia amylovora. Previous studies have demonstrated that the T3SS in E. amylovora is transcriptionally regulated by a sigma factor cascade. In this study, the role of the bacterial alarmone ppGpp in activating the T3SS and virulence of E. amylovora was investigated using ppGpp mutants generated by Red recombinase cloning. The virulence of a ppGpp-deficient mutant (ppGpp0) as well as a dksA mutant of E. amylovora was completely impaired, and bacterial growth was significantly reduced, suggesting that ppGpp is required for full virulence of E. amylovora. Expression of T3SS genes was greatly downregulated in the ppGpp0 and dksA mutants. Western blotting showed that accumulations of the HrpA protein in the ppGpp0 and dksA mutants were about 10 and 4%, respectively, of that in the wild-type strain. Furthermore, higher levels of ppGpp resulted in a reduced cell size of E. amylovora. Moreover, serine hydroxamate and α-methylglucoside, which induce amino acid and carbon starvation, respectively, activated hrpA and hrpL promoter activities in hrp-inducing minimal medium. These results demonstrated that ppGpp and DksA play central roles in E. amylovora virulence and indicated that E. amylovora utilizes ppGpp as an internal messenger to sense environmental/nutritional stimuli for regulation of the T3SS and virulence. IMPORTANCE The type III secretion system (T3SS) is a key pathogenicity factor in Gram-negative bacteria. Fully elucidating how the T3SS is activated is crucial for comprehensively understanding the function of the T3SS, bacterial pathogenesis, and survival under stress conditions. In this study, we present the first evidence that the bacterial alarmone ppGpp-mediated stringent response activates the T3SS through a sigma factor cascade, indicating that ppGpp acts as an internal messenger to sense environmental/nutritional stimuli for

  6. Dietary Fiber and the Human Gut Microbiota: Application of Evidence Mapping Methodology.

    PubMed

    Sawicki, Caleigh M; Livingston, Kara A; Obin, Martin; Roberts, Susan B; Chung, Mei; McKeown, Nicola M

    2017-02-10

    Interest is rapidly growing around the role of the human gut microbiota in facilitating beneficial health effects associated with consumption of dietary fiber. An evidence map of current research activity in this area was created using a newly developed database of dietary fiber intervention studies in humans to identify studies with the following broad outcomes: (1) modulation of colonic microflora; and/or (2) colonic fermentation/short-chain fatty acid concentration. Study design characteristics, fiber exposures, and outcome categories were summarized. A sub-analysis described oligosaccharides and bacterial composition in greater detail. One hundred eighty-eight relevant studies were identified. The fiber categories represented by the most studies were oligosaccharides (20%), resistant starch (16%), and chemically synthesized fibers (15%). Short-chain fatty acid concentration (47%) and bacterial composition (88%) were the most frequently studied outcomes. Whole-diet interventions, measures of bacterial activity, and studies in metabolically at-risk subjects were identified as potential gaps in the evidence. This evidence map efficiently captured the variability in characteristics of expanding research on dietary fiber, gut microbiota, and physiological health benefits, and identified areas that may benefit from further research. We hope that this evidence map will provide a resource for researchers to direct new intervention studies and meta-analyses.

  7. Dietary Fiber and the Human Gut Microbiota: Application of Evidence Mapping Methodology

    PubMed Central

    Sawicki, Caleigh M.; Livingston, Kara A.; Obin, Martin; Roberts, Susan B.; Chung, Mei; McKeown, Nicola M.

    2017-01-01

    Interest is rapidly growing around the role of the human gut microbiota in facilitating beneficial health effects associated with consumption of dietary fiber. An evidence map of current research activity in this area was created using a newly developed database of dietary fiber intervention studies in humans to identify studies with the following broad outcomes: (1) modulation of colonic microflora; and/or (2) colonic fermentation/short-chain fatty acid concentration. Study design characteristics, fiber exposures, and outcome categories were summarized. A sub-analysis described oligosaccharides and bacterial composition in greater detail. One hundred eighty-eight relevant studies were identified. The fiber categories represented by the most studies were oligosaccharides (20%), resistant starch (16%), and chemically synthesized fibers (15%). Short-chain fatty acid concentration (47%) and bacterial composition (88%) were the most frequently studied outcomes. Whole-diet interventions, measures of bacterial activity, and studies in metabolically at-risk subjects were identified as potential gaps in the evidence. This evidence map efficiently captured the variability in characteristics of expanding research on dietary fiber, gut microbiota, and physiological health benefits, and identified areas that may benefit from further research. We hope that this evidence map will provide a resource for researchers to direct new intervention studies and meta-analyses. PMID:28208609

  8. A taxonomy of bacterial microcompartment loci constructed by a novel scoring method

    DOE PAGES

    Axen, Seth D.; Erbilgin, Onur; Kerfeld, Cheryl A.; ...

    2014-10-23

    Bacterial microcompartments (BMCs) are proteinaceous organelles involved in both autotrophic and heterotrophic metabolism. All BMCs share homologous shell proteins but differ in their complement of enzymes; these are typically encoded adjacent to shell protein genes in genetic loci, or operons. To enable the identification and prediction of functional (sub)types of BMCs, we developed LoClass, an algorithm that finds putative BMC loci and inventories, weights, and compares their constituent pfam domains to construct a locus similarity network and predict locus (sub)types. In addition to using LoClass to analyze sequences in the Non-redundant Protein Database, we compared predicted BMC loci found inmore » seven candidate bacterial phyla (six from single-cell genomic studies) to the LoClass taxonomy. Together, these analyses resulted in the identification of 23 different types of BMCs encoded in 30 distinct locus (sub)types found in 23 bacterial phyla. These include the two carboxysome types and a divergent set of metabolosomes, BMCs that share a common catalytic core and process distinct substrates via specific signature enzymes. Furthermore, many Candidate BMCs were found that lack one or more core metabolosome components, including one that is predicted to represent an entirely new paradigm for BMC-associated metabolism, joining the carboxysome and metabolosome. By placing these results in a phylogenetic context, we provide a framework for understanding the horizontal transfer of these loci, a starting point for studies aimed at understanding the evolution of BMCs. This comprehensive taxonomy of BMC loci, based on their constituent protein domains, foregrounds the functional diversity of BMCs and provides a reference for interpreting the role of BMC gene clusters encoded in isolate, single cell, and metagenomic data. Many loci encode ancillary functions such as transporters or genes for cofactor assembly; this expanded vocabulary of BMC-related functions should

  9. A Taxonomy of Bacterial Microcompartment Loci Constructed by a Novel Scoring Method

    PubMed Central

    Kerfeld, Cheryl A.

    2014-01-01

    Bacterial microcompartments (BMCs) are proteinaceous organelles involved in both autotrophic and heterotrophic metabolism. All BMCs share homologous shell proteins but differ in their complement of enzymes; these are typically encoded adjacent to shell protein genes in genetic loci, or operons. To enable the identification and prediction of functional (sub)types of BMCs, we developed LoClass, an algorithm that finds putative BMC loci and inventories, weights, and compares their constituent pfam domains to construct a locus similarity network and predict locus (sub)types. In addition to using LoClass to analyze sequences in the Non-redundant Protein Database, we compared predicted BMC loci found in seven candidate bacterial phyla (six from single-cell genomic studies) to the LoClass taxonomy. Together, these analyses resulted in the identification of 23 different types of BMCs encoded in 30 distinct locus (sub)types found in 23 bacterial phyla. These include the two carboxysome types and a divergent set of metabolosomes, BMCs that share a common catalytic core and process distinct substrates via specific signature enzymes. Furthermore, many Candidate BMCs were found that lack one or more core metabolosome components, including one that is predicted to represent an entirely new paradigm for BMC-associated metabolism, joining the carboxysome and metabolosome. By placing these results in a phylogenetic context, we provide a framework for understanding the horizontal transfer of these loci, a starting point for studies aimed at understanding the evolution of BMCs. This comprehensive taxonomy of BMC loci, based on their constituent protein domains, foregrounds the functional diversity of BMCs and provides a reference for interpreting the role of BMC gene clusters encoded in isolate, single cell, and metagenomic data. Many loci encode ancillary functions such as transporters or genes for cofactor assembly; this expanded vocabulary of BMC-related functions should be useful

  10. Evidence-Centered Design: Recommendations for Implementation and Practice

    ERIC Educational Resources Information Center

    Hendrickson, Amy; Ewing, Maureen; Kaliski, Pamela; Huff, Kristen

    2013-01-01

    Evidence-centered design (ECD) is an orientation towards assessment development. It differs from conventional practice in several ways and consists of multiple activities. Each of these activities results in a set of useful documentation: domain analysis, domain modeling, construction of the assessment framework, and assessment…

  11. IRS-1 activates phosphatidylinositol 3'-kinase by associating with src homology 2 domains of p85.

    PubMed Central

    Myers, M G; Backer, J M; Sun, X J; Shoelson, S; Hu, P; Schlessinger, J; Yoakim, M; Schaffhausen, B; White, M F

    1992-01-01

    IRS-1 is an insulin receptor substrate that undergoes tyrosine phosphorylation and associates with the phosphatidylinositol (PtdIns) 3'-kinase immediately after insulin stimulation. Recombinant IRS-1 protein was tyrosine phosphorylated by the insulin receptor in vitro and associated with the PtdIns 3'-kinase from lysates of quiescent 3T3 fibroblasts. Bacterial fusion proteins containing the src homology 2 domains (SH2 domains) of the 85-kDa subunit (p85) of the PtdIns 3'-kinase bound quantitatively to tyrosine phosphorylated, but not unphosphorylated, IRS-1, and this association was blocked by phosphotyrosine-containing synthetic peptides. Moreover, the phosphorylated peptides and the SH2 domains each inhibited binding of PtdIns 3'-kinase to IRS-1. Phosphorylated IRS-1 activated PtdIns 3'-kinase in anti-p85 immunoprecipitates in vitro, and this activation was blocked by SH2 domain fusion proteins. These data suggest that the interaction between PtdIns 3'-kinase and IRS-1 is mediated by tyrosine phosphorylated motifs on IRS-1 and the SH2 domains of p85, and IRS-1 activates PtdIns 3'-kinase by binding to the SH2 domains of p85. Thus, IRS-1 likely serves to transmit the insulin signal by binding and regulating intracellular enzymes containing SH2 domains. Images PMID:1332046

  12. A pilot study to assess the bacterial contaminants in hookah pipes in a community setting.

    PubMed

    Martinasek, M; Rivera, Z; Ferrer, A; Freundt, E

    2018-05-01

    Hookah smoking among young adults remains a public health threat. Increasing research has uncovered the deleterious effects of hookah smoking, including both acute and chronic health conditions. Due to the current lack of regulation, hookah bars/lounges lack protocols for equipment sanitation. To examine evidence of bacterial contamination in hookah pipes due to a lack of sanitation regulations. For this field/laboratory study, 10 hookah bars/lounges were studied. Isolated bacteria were characterized and identified by species using 16S ribosomal RNA gene sequencing. At the 10 hookah bars sampled, the mouthpiece had the highest bacterial prevalence and diversity. Some of the bacterial isolates were found to be antibiotic-resistant. Ten of the isolated bacteria were Gram-positive and two were identified as Gram-negative. Levels of bacterial contamination vary widely from one hookah bar to the next, and reflect a lack of industry standards for cleaning these devices. Bacterial contamination of hookah pipes may represent a fomite for transmission of infectious diseases. Our results warrant future surveillance of hookahs to monitor for potential human pathogens.

  13. New insights into valve-related intramural and intracellular bacterial diversity in infective endocarditis

    PubMed Central

    Feder, Stefan; Lehmann, Stefanie; Kullnick, Yvonne; Buschmann, Tilo; Blumert, Conny; Horn, Friedemann; Neuhaus, Jochen; Neujahr, Ralph; Bagaev, Erik; Hagl, Christian; Pichlmaier, Maximilian; Rodloff, Arne Christian; Gräber, Sandra; Kirsch, Katharina; Sandri, Marcus; Kumbhari, Vivek; Behzadi, Armirhossein; Behzadi, Amirali; Correia, Joao Carlos; Mohr, Friedrich Wilhelm

    2017-01-01

    Aims In infective endocarditis (IE), a severe inflammatory disease of the endocardium with an unchanged incidence and mortality rate over the past decades, only 1% of the cases have been described as polymicrobial infections based on microbiological approaches. The aim of this study was to identify potential biodiversity of bacterial species from infected native and prosthetic valves. Furthermore, we compared the ultrastructural micro-environments to detect the localization and distribution patterns of pathogens in IE. Material and methods Using next-generation sequencing (NGS) of 16S rDNA, which allows analysis of the entire bacterial community within a single sample, we investigated the biodiversity of infectious bacterial species from resected native and prosthetic valves in a clinical cohort of 8 IE patients. Furthermore, we investigated the ultrastructural infected valve micro-environment by focused ion beam scanning electron microscopy (FIB-SEM). Results Biodiversity was detected in 7 of 8 resected heart valves. This comprised 13 bacterial genera and 16 species. In addition to 11 pathogens already described as being IE related, 5 bacterial species were identified as having a novel association. In contrast, valve and blood culture-based diagnosis revealed only 4 species from 3 bacterial genera and did not show any relevant antibiotic resistance. The antibiotics chosen on this basis for treatment, however, did not cover the bacterial spectra identified by our amplicon sequencing analysis in 4 of 8 cases. In addition to intramural distribution patterns of infective bacteria, intracellular localization with evidence of bacterial immune escape mechanisms was identified. Conclusion The high frequency of polymicrobial infections, pathogen diversity, and intracellular persistence of common IE-causing bacteria may provide clues to help explain the persistent and devastating mortality rate observed for IE. Improved bacterial diagnosis by 16S rDNA NGS that increases the

  14. The Epidemiology, Management, and Outcomes of Bacterial Meningitis in Infants.

    PubMed

    Ouchenir, Lynda; Renaud, Christian; Khan, Sarah; Bitnun, Ari; Boisvert, Andree-Anne; McDonald, Jane; Bowes, Jennifer; Brophy, Jason; Barton, Michelle; Ting, Joseph; Roberts, Ashley; Hawkes, Michael; Robinson, Joan L

    2017-07-01

    The pathogens that cause bacterial meningitis in infants and their antimicrobial susceptibilities may have changed in this era of increasing antimicrobial resistance, use of conjugated vaccines, and maternal antibiotic prophylaxis for group B Streptococcus (GBS). The objective was to determine the optimal empirical antibiotics for bacterial meningitis in early infancy. This was a cohort study of infants <90 days of age with bacterial meningitis at 7 pediatric tertiary care hospitals across Canada in 2013 and 2014. There were 113 patients diagnosed with proven meningitis ( n = 63) or suspected meningitis ( n = 50) presented at median 19 days of age, with 63 patients (56%) presenting a diagnosis from home. Predominant pathogens were Escherichia coli ( n = 37; 33%) and GBS ( n = 35; 31%). Two of 15 patients presenting meningitis on day 0 to 6 had isolates resistant to both ampicillin and gentamicin ( E coli and Haemophilus influenzae type B). Six of 60 infants presenting a diagnosis of meningitis from home from day 7 to 90 had isolates, for which cefotaxime would be a poor choice ( Listeria monocytogenes [ n = 3], Enterobacter cloacae , Cronobacter sakazakii , and Pseudomonas stutzeri ). Sequelae were documented in 84 infants (74%), including 8 deaths (7%). E coli and GBS remain the most common causes of bacterial meningitis in the first 90 days of life. For empirical therapy of suspected bacterial meningitis, one should consider a third-generation cephalosporin (plus ampicillin for at least the first month), potentially substituting a carbapenem for the cephalosporin if there is evidence for Gram-negative meningitis. Copyright © 2017 by the American Academy of Pediatrics.

  15. The archaeo-eukaryotic primase of plasmid pRN1 requires a helix bundle domain for faithful primer synthesis

    PubMed Central

    Beck, Kirsten; Vannini, Alessandro; Cramer, Patrick; Lipps, Georg

    2010-01-01

    The plasmid pRN1 encodes for a multifunctional replication protein with primase, DNA polymerase and helicase activity. The minimal region required for primase activity encompasses amino-acid residues 40–370. While the N-terminal part of that minimal region (residues 47–247) folds into the prim/pol domain and bears the active site, the structure and function of the C-terminal part (residues 248–370) is unknown. Here we show that the C-terminal part of the minimal region folds into a compact domain with six helices and is stabilized by a disulfide bond. Three helices superimpose well with the C-terminal domain of the primase of the bacterial broad host range plasmid RSF1010. Structure-based site-directed mutagenesis shows that the C-terminal helix of the helix bundle domain is required for primase activity although it is distant to the active site in the crystallized conformation. Furthermore, we identified mutants of the C-terminal domain, which are defective in template binding, dinucleotide formation and conformation change prior to DNA extension. PMID:20511586

  16. Bacterial gene transfer by natural genetic transformation in the environment.

    PubMed Central

    Lorenz, M G; Wackernagel, W

    1994-01-01

    Natural genetic transformation is the active uptake of free DNA by bacterial cells and the heritable incorporation of its genetic information. Since the famous discovery of transformation in Streptococcus pneumoniae by Griffith in 1928 and the demonstration of DNA as the transforming principle by Avery and coworkers in 1944, cellular processes involved in transformation have been studied extensively by in vitro experimentation with a few transformable species. Only more recently has it been considered that transformation may be a powerful mechanism of horizontal gene transfer in natural bacterial populations. In this review the current understanding of the biology of transformation is summarized to provide the platform on which aspects of bacterial transformation in water, soil, and sediments and the habitat of pathogens are discussed. Direct and indirect evidence for gene transfer routes by transformation within species and between different species will be presented, along with data suggesting that plasmids as well as chromosomal DNA are subject to genetic exchange via transformation. Experiments exploring the prerequisites for transformation in the environment, including the production and persistence of free DNA and factors important for the uptake of DNA by cells, will be compiled, as well as possible natural barriers to transformation. The efficiency of gene transfer by transformation in bacterial habitats is possibly genetically adjusted to submaximal levels. The fact that natural transformation has been detected among bacteria from all trophic and taxonomic groups including archaebacteria suggests that transformability evolved early in phylogeny. Probable functions of DNA uptake other than gene acquisition will be discussed. The body of information presently available suggests that transformation has a great impact on bacterial population dynamics as well as on bacterial evolution and speciation. PMID:7968924

  17. A synthetic redox biofilm made from metalloprotein-prion domain chimera nanowires

    NASA Astrophysics Data System (ADS)

    Altamura, Lucie; Horvath, Christophe; Rengaraj, Saravanan; Rongier, Anaëlle; Elouarzaki, Kamal; Gondran, Chantal; Maçon, Anthony L. B.; Vendrely, Charlotte; Bouchiat, Vincent; Fontecave, Marc; Mariolle, Denis; Rannou, Patrice; Le Goff, Alan; Duraffourg, Nicolas; Holzinger, Michael; Forge, Vincent

    2017-02-01

    Engineering bioelectronic components and set-ups that mimic natural systems is extremely challenging. Here we report the design of a protein-only redox film inspired by the architecture of bacterial electroactive biofilms. The nanowire scaffold is formed using a chimeric protein that results from the attachment of a prion domain to a rubredoxin (Rd) that acts as an electron carrier. The prion domain self-assembles into stable fibres and provides a suitable arrangement of redox metal centres in Rd to permit electron transport. This results in highly organized films, able to transport electrons over several micrometres through a network of bionanowires. We demonstrate that our bionanowires can be used as electron-transfer mediators to build a bioelectrode for the electrocatalytic oxygen reduction by laccase. This approach opens opportunities for the engineering of protein-only electron mediators (with tunable redox potentials and optimized interactions with enzymes) and applications in the field of protein-only bioelectrodes.

  18. A Structural Study of CESA1 Catalytic Domain of Arabidopsis Cellulose Synthesis Complex: Evidence for CESA Trimers1

    PubMed Central

    Zhang, Qiu; Petridis, Loukas; Nixon, B. Tracy; Haigler, Candace H.; Kalluri, Udaya; Coates, Leighton; Smith, Jeremy C.; Meiler, Jens

    2016-01-01

    A cellulose synthesis complex with a “rosette” shape is responsible for synthesis of cellulose chains and their assembly into microfibrils within the cell walls of land plants and their charophyte algal progenitors. The number of cellulose synthase proteins in this large multisubunit transmembrane protein complex and the number of cellulose chains in a microfibril have been debated for many years. This work reports a low resolution structure of the catalytic domain of CESA1 from Arabidopsis (Arabidopsis thaliana; AtCESA1CatD) determined by small-angle scattering techniques and provides the first experimental evidence for the self-assembly of CESA into a stable trimer in solution. The catalytic domain was overexpressed in Escherichia coli, and using a two-step procedure, it was possible to isolate monomeric and trimeric forms of AtCESA1CatD. The conformation of monomeric and trimeric AtCESA1CatD proteins were studied using small-angle neutron scattering and small-angle x-ray scattering. A series of AtCESA1CatD trimer computational models were compared with the small-angle x-ray scattering trimer profile to explore the possible arrangement of the monomers in the trimers. Several candidate trimers were identified with monomers oriented such that the newly synthesized cellulose chains project toward the cell membrane. In these models, the class-specific region is found at the periphery of the complex, and the plant-conserved region forms the base of the trimer. This study strongly supports the “hexamer of trimers” model for the rosette cellulose synthesis complex that synthesizes an 18-chain cellulose microfibril as its fundamental product. PMID:26556795

  19. The structure of a conserved piezo channel domain reveals a topologically distinct β sandwich fold.

    PubMed

    Kamajaya, Aron; Kaiser, Jens T; Lee, Jonas; Reid, Michelle; Rees, Douglas C

    2014-10-07

    Piezo has recently been identified as a family of eukaryotic mechanosensitive channels composed of subunits containing over 2,000 amino acids, without recognizable sequence similarity to other channels. Here, we present the crystal structure of a large, conserved extramembrane domain located just before the last predicted transmembrane helix of C. elegans PIEZO, which adopts a topologically distinct β sandwich fold. The structure was also determined of a point mutation located on a conserved surface at the position equivalent to the human PIEZO1 mutation found in dehydrated hereditary stomatocytosis patients (M2225R). While the point mutation does not change the overall domain structure, it does alter the surface electrostatic potential that may perturb interactions with a yet-to-be-identified ligand or protein. The lack of structural similarity between this domain and any previously characterized fold, including those of eukaryotic and bacterial channels, highlights the distinctive nature of the Piezo family of eukaryotic mechanosensitive channels. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Bacterial Prostatitis: Bacterial Virulence, Clinical Outcomes, and New Directions.

    PubMed

    Krieger, John N; Thumbikat, Praveen

    2016-02-01

    Four prostatitis syndromes are recognized clinically: acute bacterial prostatitis, chronic bacterial prostatitis, chronic prostatitis/chronic pelvic pain syndrome, and asymptomatic prostatitis. Because Escherichia coli represents the most common cause of bacterial prostatitis, we investigated the importance of bacterial virulence factors and antimicrobial resistance in E. coli strains causing prostatitis and the potential association of these characteristics with clinical outcomes. A structured literature review revealed that we have limited understanding of the virulence-associated characteristics of E. coli causing acute prostatitis. Therefore, we completed a comprehensive microbiological and molecular investigation of a unique strain collection isolated from healthy young men. We also considered new data from an animal model system suggesting certain E. coli might prove important in the etiology of chronic prostatitis/chronic pelvic pain syndrome. Our human data suggest that E. coli needs multiple pathogenicity-associated traits to overcome anatomic and immune responses in healthy young men without urological risk factors. The phylogenetic background and accumulation of an exceptional repertoire of extraintestinal pathogenic virulence-associated genes indicate that these E. coli strains belong to a highly virulent subset of uropathogenic variants. In contrast, antibiotic resistance confers little added advantage to E. coli strains in these healthy outpatients. Our animal model data also suggest that certain pathogenic E. coli may be important in the etiology of chronic prostatitis/chronic pelvic pain syndrome through mechanisms that are dependent on the host genetic background and the virulence of the bacterial strain.

  1. Resonance assignments for the substrate binding domain of Hsp70 chaperone Ssa1 from Saccharomyces cerevisiae.

    PubMed

    Hu, Wanhui; Wu, Huiwen; Zhang, Hong; Gong, Weibin; Perrett, Sarah

    2015-10-01

    Hsp70 chaperone proteins play crucial roles in the cell. Extensive structural and functional studies have been performed for bacterial and mammalian Hsp70s. Ssa1 from Saccharomyces cerevisiae is a member of the Hsp70 family. In vivo and biochemical studies on Ssa1 have revealed that it regulates prion propagation and the cell cycle. However, no structural data has been obtained for Ssa1 up to now. Here we report the almost complete (96 %) (1)H, (13)C, (15)N backbone and side chain NMR assignment of the 18.8 kDa Ssa1 substrate binding domain. The construct includes residues 382-554, which corresponds to the entire substrate binding domain and two following α-helices in homologous structures. The secondary structure predicted from the assigned chemical shifts is consistent with that of homologous Hsp70 substrate binding domains.

  2. Benefits of Matching Domain Structure for Planning Software: The Right Stuff

    NASA Technical Reports Server (NTRS)

    Billman, Dorrit Owen; Arsintescu, Lucica; Feary, Michael S.; Lee, Jessica Chia-Rong; Smith, Asha Halima; Tiwary, Rachna

    2011-01-01

    We investigated the role of domain structure in software design. We compared 2 planning applications, for a Mission Control group (International Space Station), and measured users speed and accuracy. Based on our needs analysis, we identified domain structure and used this to develop new prototype software that matched domain structure better than the legacy system. We took a high-fidelity analog of the natural task into the laboratory and found (large) periformance differences, favoring the system that matched domain structure. Our task design enabled us to attribute better periormance to better match of domain structure. We ran through the whole development cycle, in miniature, from needs analysis through design, development, and evaluation. Doing so enabled inferences not just about the particular systems compared, but also provided evidence for the viability of the design process (particularly needs analysis) that we are exploring.

  3. Design and Evaluation of a Bacterial Clinical Infectious Diseases Ontology

    PubMed Central

    Gordon, Claire L.; Pouch, Stephanie; Cowell, Lindsay G.; Boland, Mary Regina; Platt, Heather L.; Goldfain, Albert; Weng, Chunhua

    2013-01-01

    With antimicrobial resistance increasing worldwide, there is a great need to use automated antimicrobial decision support systems (ADSSs) to lower antimicrobial resistance rates by promoting appropriate antimicrobial use. However, they are infrequently used mostly because of their poor interoperability with different health information technologies. Ontologies can augment portable ADSSs by providing an explicit knowledge representation for biomedical entities and their relationships, helping to standardize and integrate heterogeneous data resources. We developed a bacterial clinical infectious diseases ontology (BCIDO) using Protégé-OWL. BCIDO defines a controlled terminology for clinical infectious diseases along with domain knowledge commonly used in hospital settings for clinical infectious disease treatment decision-making. BCIDO has 599 classes and 2355 object properties. Terms were imported from or mapped to Systematized Nomenclature of Medicine, Unified Medical Language System, RxNorm and National Center for Bitechnology Information Organismal Classification where possible. Domain expert evaluation using the “laddering” technique, ontology visualization, and clinical notes and scenarios, confirmed the correctness and potential usefulness of BCIDO. PMID:24551353

  4. Influenza Virus Induces Bacterial and Nonbacterial Otitis Media

    PubMed Central

    Diavatopoulos, Dimitri A.; Thornton, Ruth; Pedersen, John; Strugnell, Richard A.; Wise, Andrew K.; Reading, Patrick C.; Wijburg, Odilia L.

    2011-01-01

    Otitis media (OM) is one of the most common childhood diseases. OM can arise when a viral infection enables bacteria to disseminate from the nasopharynx to the middle ear. Here, we provide the first infant murine model for disease. Mice coinfected with Streptococcus pneumoniae and influenza virus had high bacterial load in the middle ear, middle ear inflammation, and hearing loss. In contrast, mice colonized with S. pneumoniae alone had significantly less bacteria in the ear, minimal hearing loss, and no inflammation. Of interest, infection with influenza virus alone also caused some middle ear inflammation and hearing loss. Overall, this study provides a clinically relevant and easily accessible animal model to study the pathogenesis and prevention of OM. Moreover, we provide, to our knowledge, the first evidence that influenza virus alone causes middle ear inflammation in infant mice. This inflammation may then play an important role in the development of bacterial OM. PMID:21930608

  5. A novel type of peptidoglycan-binding domain highly specific for amidated D-Asp cross-bridge, identified in Lactobacillus casei bacteriophage endolysins.

    PubMed

    Regulski, Krzysztof; Courtin, Pascal; Kulakauskas, Saulius; Chapot-Chartier, Marie-Pierre

    2013-07-12

    Peptidoglycan hydrolases (PGHs) are responsible for bacterial cell lysis. Most PGHs have a modular structure comprising a catalytic domain and a cell wall-binding domain (CWBD). PGHs of bacteriophage origin, called endolysins, are involved in bacterial lysis at the end of the infection cycle. We have characterized two endolysins, Lc-Lys and Lc-Lys-2, identified in prophages present in the genome of Lactobacillus casei BL23. These two enzymes have different catalytic domains but similar putative C-terminal CWBDs. By analyzing purified peptidoglycan (PG) degradation products, we showed that Lc-Lys is an N-acetylmuramoyl-L-alanine amidase, whereas Lc-Lys-2 is a γ-D-glutamyl-L-lysyl endopeptidase. Remarkably, both lysins were able to lyse only Gram-positive bacterial strains that possess PG with D-Ala(4)→D-Asx-L-Lys(3) in their cross-bridge, such as Lactococcus casei, Lactococcus lactis, and Enterococcus faecium. By testing a panel of L. lactis cell wall mutants, we observed that Lc-Lys and Lc-Lys-2 were not able to lyse mutants with a modified PG cross-bridge, constituting D-Ala(4)→L-Ala-(L-Ala/L-Ser)-L-Lys(3); moreover, they do not lyse the L. lactis mutant containing only the nonamidated D-Asp cross-bridge, i.e. D-Ala(4)→D-Asp-L-Lys(3). In contrast, Lc-Lys could lyse the ampicillin-resistant E. faecium mutant with 3→3 L-Lys(3)-D-Asn-L-Lys(3) bridges replacing the wild-type 4→3 D-Ala(4)-D-Asn-L-Lys(3) bridges. We showed that the C-terminal CWBD of Lc-Lys binds PG containing mainly D-Asn but not PG with only the nonamidated D-Asp-containing cross-bridge, indicating that the CWBD confers to Lc-Lys its narrow specificity. In conclusion, the CWBD characterized in this study is a novel type of PG-binding domain targeting specifically the D-Asn interpeptide bridge of PG.

  6. Twice-daily cimetidine does not increase gastric bacterial flora.

    PubMed Central

    Bourne, J. T.; Mountford, R. A.; Barry, R. E.

    1984-01-01

    Thirty patients with peptic ulcer (20 duodenal, 10 gastric) underwent glucose-hydrogen (H2) breath tests before and after 6 weeks treatment with cimetidine, 400 mg twice daily. For the group as a whole, basal breath H2 and integrated H2 output over a 2.5 hr test period was unchanged by cimetidine treatment. We conclude that there was no evidence of significant gastric bacterial colonization following twice daily cimetidine treatment. PMID:6462995

  7. Mechanisms of Host-Pathogen Protein Complex Formation and Bacterial Immune Evasion of Streptococcus suis Protein Fhb.

    PubMed

    Li, Xueqin; Liu, Peng; Gan, Shuzhen; Zhang, Chunmao; Zheng, Yuling; Jiang, Yongqiang; Yuan, Yuan

    2016-08-12

    Streptococcus suis serotype 2 (S. suis 2)-induced sepsis and meningitis are often accompanied by bacteremia. The evasion of polymorphonuclear leukocyte-mediated phagocytic clearance is central to the establishment of bacteremia caused by S. suis 2 and is facilitated by the ability of factor H (FH)-binding protein (Fhb) to bind FH on the bacterial surface, thereby impeding alternative pathway complement activation and phagocytic clearance. Here, C3b/C3d was found to bind to Fhb, along with FH, forming a large immune complex. The formation of this immune complex was mediated by domain II of Fhb via electrostatic and hydrophobic interactions, which, to our knowledge, is a new type of interaction. Interestingly, Fhb was found to be associated with the cell envelope and also present in the culture supernatant, where secreted Fhb inhibited complement activation via interactions with domain II, thereby enhancing antiphagocytic clearance by polymorphonuclear leukocytes. Thus, Fhb is a multifunctional bacterial protein, which binds host complement component C3 as well as FH and interferes with innate immune recognition in a secret protein manner. S. suis 2 therefore appears to have developed a new strategy to combat host innate immunity and enhance survival in host blood. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Mechanisms of Host-Pathogen Protein Complex Formation and Bacterial Immune Evasion of Streptococcus suis Protein Fhb*

    PubMed Central

    Li, Xueqin; Liu, Peng; Gan, Shuzhen; Zhang, Chunmao; Zheng, Yuling; Jiang, Yongqiang; Yuan, Yuan

    2016-01-01

    Streptococcus suis serotype 2 (S. suis 2)-induced sepsis and meningitis are often accompanied by bacteremia. The evasion of polymorphonuclear leukocyte-mediated phagocytic clearance is central to the establishment of bacteremia caused by S. suis 2 and is facilitated by the ability of factor H (FH)-binding protein (Fhb) to bind FH on the bacterial surface, thereby impeding alternative pathway complement activation and phagocytic clearance. Here, C3b/C3d was found to bind to Fhb, along with FH, forming a large immune complex. The formation of this immune complex was mediated by domain II of Fhb via electrostatic and hydrophobic interactions, which, to our knowledge, is a new type of interaction. Interestingly, Fhb was found to be associated with the cell envelope and also present in the culture supernatant, where secreted Fhb inhibited complement activation via interactions with domain II, thereby enhancing antiphagocytic clearance by polymorphonuclear leukocytes. Thus, Fhb is a multifunctional bacterial protein, which binds host complement component C3 as well as FH and interferes with innate immune recognition in a secret protein manner. S. suis 2 therefore appears to have developed a new strategy to combat host innate immunity and enhance survival in host blood. PMID:27342778

  9. Modulating the Effects of the Bacterial Chaperonin GroEL on Fibrillogenic Polypeptides through Modification of Domain Hinge Architecture.

    PubMed

    Fukui, Naoya; Araki, Kiho; Hongo, Kunihiro; Mizobata, Tomohiro; Kawata, Yasushi

    2016-11-25

    The isolated apical domain of the Escherichia coli GroEL subunit displays the ability to suppress the irreversible fibrillation of numerous amyloid-forming polypeptides. In previous experiments, we have shown that mutating Gly-192 (located at hinge II that connects the apical domain and the intermediate domain) to a tryptophan results in an inactive chaperonin whose apical domain is disoriented. In this study, we have utilized this disruptive effect of Gly-192 mutation to our advantage, by substituting this residue with amino acid residues of varying van der Waals volumes with the intent to modulate the affinity of GroEL toward fibrillogenic peptides. The affinities of GroEL toward fibrillogenic polypeptides such as Aβ(1-40) (amyloid-β(1-40)) peptide and α-synuclein increased in accordance to the larger van der Waals volume of the substituent amino acid side chain in the G192X mutants. When we compared the effects of wild-type GroEL and selected GroEL G192X mutants on α-synuclein fibril formation, we found that the effects of the chaperonin on α-synuclein fibrillation were different; the wild-type chaperonin caused changes in both the initial lag phase and the rate of fibril extension, whereas the effects of the G192X mutants were more specific toward the nucleus-forming lag phase. The chaperonins also displayed differential effects on α-synuclein fibril morphology, suggesting that through mutation of Gly-192, we may induce changes to the intermolecular affinities between GroEL and α-synuclein, leading to more efficient fibril suppression, and in specific cases, modulation of fibril morphology. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Systematic approach to in-depth understanding of photoelectrocatalytic bacterial inactivation mechanisms by tracking the decomposed building blocks.

    PubMed

    Sun, Hongwei; Li, Guiying; Nie, Xin; Shi, Huixian; Wong, Po-Keung; Zhao, Huijun; An, Taicheng

    2014-08-19

    A systematic approach was developed to understand, in-depth, the mechanisms involved during the inactivation of bacterial cells using photoelectrocatalytic (PEC) processes with Escherichia coli K-12 as the model microorganism. The bacterial cells were found to be inactivated and decomposed primarily due to attack from photogenerated H2O2. Extracellular reactive oxygen species (ROSs), such as H2O2, may penetrate into the bacterial cell and cause dramatically elevated intracellular ROSs levels, which would overwhelm the antioxidative capacity of bacterial protective enzymes such as superoxide dismutase and catalase. The activities of these two enzymes were found to decrease due to the ROSs attacks during PEC inactivation. Bacterial cell wall damage was then observed, including loss of cell membrane integrity and increased permeability, followed by the decomposition of cell envelope (demonstrated by scanning electronic microscope images). One of the bacterial building blocks, protein, was found to be oxidatively damaged due to the ROSs attacks, as well. Leakage of cytoplasm and biomolecules (bacterial building blocks such as proteins and nucleic acids) were evident during prolonged PEC inactivation process. The leaked cytoplasmic substances and cell debris could be further degraded and, ultimately, mineralized with prolonged PEC treatment.

  11. Cholesterol Bilayer Domains in the Eye Lens Health: A Review.

    PubMed

    Widomska, Justyna; Subczynski, Witold K; Mainali, Laxman; Raguz, Marija

    2017-12-01

    The most unique biochemical characteristic of the eye lens fiber cell plasma membrane is its extremely high cholesterol content, the need for which is still unclear. It is evident, however, that the disturbance of Chol homeostasis may result in damages associated with cataracts. Electron paramagnetic resonance methods allow discrimination of two types of lipid domains in model membranes overloaded with Chol, namely, phospholipid-cholesterol domains and pure Chol bilayer domains. These domains are also detected in human lens lipid membranes prepared from the total lipids extracted from lens cortices and nuclei of donors from different age groups. Independent of the age-related changes in phospholipid composition, the physical properties of phospholipid-Chol domains remain the same for all age groups and are practically identical for cortical and nuclear membranes. The presence of Chol bilayer domains in these membranes provides a buffering capacity for cholesterol concentration in the surrounding phospholipid-Chol domains, keeping it at a constant saturating level and thus keeping the physical properties of the membrane consistent with and independent of changes in phospholipid composition. It seems that the presence of Chol bilayer domains plays an integral role in the regulation of cholesterol-dependent processes in fiber cell plasm membranes and in the maintenance of fiber cell membrane homeostasis.

  12. Bacterial Community Shift Drives Antibiotic Resistance Promotion during Drinking Water Chlorination.

    PubMed

    Jia, Shuyu; Shi, Peng; Hu, Qing; Li, Bing; Zhang, Tong; Zhang, Xu-Xiang

    2015-10-20

    For comprehensive insights into the effects of chlorination, a widely used disinfection technology, on bacterial community and antibiotic resistome in drinking water, this study applied high-throughput sequencing and metagenomic approaches to investigate the changing patterns of antibiotic resistance genes (ARGs) and bacterial community in a drinking water treatment and distribution system. At genus level, chlorination could effectively remove Methylophilus, Methylotenera, Limnobacter, and Polynucleobacter, while increase the relative abundance of Pseudomonas, Acidovorax, Sphingomonas, Pleomonas, and Undibacterium in the drinking water. A total of 151 ARGs within 15 types were detectable in the drinking water, and chlorination evidently increased their total relative abundance while reduced their diversity in the opportunistic bacteria (p < 0.05). Residual chlorine was identified as the key contributing factor driving the bacterial community shift and resistome alteration. As the dominant persistent ARGs in the treatment and distribution system, multidrug resistance genes (mainly encoding resistance-nodulation-cell division transportation system) and bacitracin resistance gene bacA were mainly carried by chlorine-resistant bacteria Pseudomonas and Acidovorax, which mainly contributed to the ARGs abundance increase. The strong correlation between bacterial community shift and antibiotic resistome alteration observed in this study may shed new light on the mechanism behind the chlorination effects on antibiotic resistance.

  13. Models accounting for intention-behavior discordance in the physical activity domain: a user's guide, content overview, and review of current evidence.

    PubMed

    Rhodes, Ryan E; Yao, Christopher A

    2015-02-07

    There is a growing concern among researchers with the limited effectiveness and yet subsequent stagnation of theories applied to physical activity (PA). One of the most highlighted areas of concern is the established gap between intention and PA, yet the considerable use of models that assume intention is the proximal antecedent of PA. The objective of this review was to: 1) provide a guide and thematic analysis of the available models that include constructs that address intention-behavior discordance and 2) highlight the evidence for these structures in the PA domain. A literature search was conducted among 13 major databases to locate relevant models and PA studies published before August 2014. Sixteen models were identified and nine overall themes for post-intentional constructs were created. Of the 16 models, eight were applied to 36 PA studies. Early evidence supported maintenance self-efficacy, behavioral regulation strategies, affective judgments, perceived control/opportunity, habit, and extraversion as reliable predictors of post-intention PA. Several intention-behavior discordance models exist within the literature, but are not used frequently. Further efforts are needed to test these models, preferably with experimental designs.

  14. Characterization of the Bacteroides fragilis bfr Gene Product Identifies a Bacterial DPS-Like Protein and Suggests Evolutionary Links in the Ferritin Superfamily

    PubMed Central

    Gauss, George H.; Reott, Michael A.; Rocha, Edson R.; Young, Mark J.; Douglas, Trevor

    2012-01-01

    A factor contributing to the pathogenicity of Bacteroides fragilis, the most common anaerobic species isolated from clinical infections, is the bacterium's extreme aerotolerance, which allows survival in oxygenated tissues prior to anaerobic abscess formation. We investigated the role of the bacterioferritin-related (bfr) gene in the B. fragilis oxidative stress response. The bfr mRNA levels are increased in stationary phase or in response to O2 or iron. In addition, bfr null mutants exhibit reduced aerotolerance, and the bfr gene product protects DNA from hydroxyl radical cleavage in vitro. Crystallographic studies revealed a protein with a dodecameric structure and greater similarity to an archaeal DNA protection in starved cells (DPS)-like protein than to the 24-subunit bacterioferritins. Similarity to the DPS-like (DPSL) protein extends to the subunit and includes a pair of conserved cysteine residues juxtaposed to a buried dimetal binding site within the four-helix bundle. Compared to archaeal DPSLs, however, this bacterial DPSL protein contains several unique features, including a significantly different conformation in the C-terminal tail that alters the number and location of pores leading to the central cavity and a conserved metal binding site on the interior surface of the dodecamer. Combined, these characteristics confirm this new class of miniferritin in the bacterial domain, delineate the similarities and differences between bacterial DPSL proteins and their archaeal homologs, allow corrected annotations for B. fragilis bfr and other dpsl genes within the bacterial domain, and suggest an evolutionary link within the ferritin superfamily that connects dodecameric DPS to the (bacterio)ferritin 24-mer. PMID:22020642

  15. Phytoplankton-Associated Bacterial Community Composition and Succession during Toxic Diatom Bloom and Non-Bloom Events

    PubMed Central

    Sison-Mangus, Marilou P.; Jiang, Sunny; Kudela, Raphael M.; Mehic, Sanjin

    2016-01-01

    Pseudo-nitzschia blooms often occur in coastal and open ocean environments, sometimes leading to the production of the neurotoxin domoic acid that can cause severe negative impacts to higher trophic levels. Increasing evidence suggests a close relationship between phytoplankton bloom and bacterial assemblages, however, the microbial composition and succession during a bloom process is unknown. Here, we investigate the bacterial assemblages before, during and after toxic and non-toxic Pseudo-nitzschia blooms to determine the patterns of bacterial succession in a natural bloom setting. Opportunistic sampling of bacterial community profiles were determined weekly at Santa Cruz Municipal Wharf by 454 pyrosequencing and analyzed together with domoic acid levels, phytoplankton community and biomass, nutrients and temperature. We asked if the bacterial communities are similar between bloom and non-bloom events and if domoic acid or the presence of toxic algal species acts as a driving force that can significantly structure phytoplankton-associated bacterial communities. We found that bacterial diversity generally increases when Pseudo-nitzschia numbers decline. Furthermore, bacterial diversity is higher when the low-DA producing P. fraudulenta dominates the algal bloom while bacterial diversity is lower when high-DA producing P. australis dominates the algal bloom, suggesting that the presence of algal toxin can structure bacterial community. We also found bloom-related succession patterns among associated bacterial groups; Gamma-proteobacteria, were dominant during low toxic P. fraudulenta blooms comprising mostly of Vibrio spp., which increased in relative abundance (6–65%) as the bloom progresses. On the other hand, Firmicutes bacteria comprising mostly of Planococcus spp. (12–86%) dominate during high toxic P. australis blooms, with the bacterial assemblage showing the same bloom-related successional patterns in three independent bloom events. Other environmental

  16. Multi-domain models of risk factors for depression and anxiety symptoms in preschoolers: evidence for common and specific factors.

    PubMed

    Hopkins, Joyce; Lavigne, John V; Gouze, Karen R; LeBailly, Susan A; Bryant, Fred B

    2013-07-01

    Relatively few studies have examined multiple pathways by which risk factors from different domains are related to symptoms of anxiety and depression in young children; even fewer have assessed risks for these symptoms specifically, rather than for internalizing symptoms in general. We examined a theoretically- and empirically-based model of variables associated with these symptom types in a diverse community sample of 796 4-year-olds (391 boys, 405 girls) that included factors from the following domains: contextual (SES, stress and family conflict); parent characteristics (parental depression); parenting (support/engagement, hostility and scaffolding); and child characteristics including negative affect (NA) effortful control (EC) sensory regulation (SR), inhibitory control (IC) and attachment. We also compared the models to determine which variables contribute to a common correlates of symptoms of anxiety or depression, and which correlates differentiate between those symptom types. In the best-fitting model for these symptom types (a) SES, stress and conflict had indirect effects on both symptom types via long-chain paths; (b) caregiver depression had direct effects and indirect ones (mediated through parenting and child effortful control) on both symptom types; (c) parenting had direct and indirect effects (via temperament and SR); and temperament had direct effects on both symptom types. These data provide evidence of common risk factors, as well as indicate some specific pathways/mediators for the different symptom types. EC was related to anxiety, but not depression symptoms, suggesting that strategies to improve child EC may be particularly effective for treatment of anxiety symptoms in young children.

  17. Linkage of the Nit1C gene cluster to bacterial cyanide assimilation as a nitrogen source.

    PubMed

    Jones, Lauren B; Ghosh, Pallab; Lee, Jung-Hyun; Chou, Chia-Ni; Kunz, Daniel A

    2018-05-21

    A genetic linkage between a conserved gene cluster (Nit1C) and the ability of bacteria to utilize cyanide as the sole nitrogen source was demonstrated for nine different bacterial species. These included three strains whose cyanide nutritional ability has formerly been documented (Pseudomonas fluorescens Pf11764, Pseudomonas putida BCN3 and Klebsiella pneumoniae BCN33), and six not previously known to have this ability [Burkholderia (Paraburkholderia) xenovorans LB400, Paraburkholderia phymatum STM815, Paraburkholderia phytofirmans PsJN, Cupriavidus (Ralstonia) eutropha H16, Gluconoacetobacter diazotrophicus PA1 5 and Methylobacterium extorquens AM1]. For all bacteria, growth on or exposure to cyanide led to the induction of the canonical nitrilase (NitC) linked to the gene cluster, and in the case of Pf11764 in particular, transcript levels of cluster genes (nitBCDEFGH) were raised, and a nitC knock-out mutant failed to grow. Further studies demonstrated that the highly conserved nitB gene product was also significantly elevated. Collectively, these findings provide strong evidence for a genetic linkage between Nit1C and bacterial growth on cyanide, supporting use of the term cyanotrophy in describing what may represent a new nutritional paradigm in microbiology. A broader search of Nit1C genes in presently available genomes revealed its presence in 270 different bacteria, all contained within the domain Bacteria, including Gram-positive Firmicutes and Actinobacteria, and Gram-negative Proteobacteria and Cyanobacteria. Absence of the cluster in the Archaea is congruent with events that may have led to the inception of Nit1C occurring coincidentally with the first appearance of cyanogenic species on Earth, dating back 400-500 million years.

  18. Nest Bacterial Environment Affects Microbiome of Hoopoe Eggshells, but Not That of the Uropygial Secretion

    PubMed Central

    Martínez-García, Ángela; Martín-Vivaldi, Manuel; Rodríguez-Ruano, Sonia M.; Peralta-Sánchez, Juan Manuel; Valdivia, Eva; Soler, Juan J.

    2016-01-01

    The study of associations between symbiotic bacterial communities of hosts and those of surrounding environments would help to understand how bacterial assemblages are acquired, and how they are transmitted from one to another location (i.e. symbiotic bacteria acquisition by hosts). Hoopoes (Upupa epops) smear their eggshells with uropygial secretion (oily secretion produced in their uropygial gland) that harbors antibiotic producing bacteria. Trying to elucidate a possible role of nest material and cloaca microbiota in determining the bacterial community of the uropygial gland and the eggshells of hoopoes, we characterized bacterial communities of nest material, cloaca, uropygial gland and eggshells by the ARISA fingerprinting. Further, by adding material with scarce bacteria and antimicrobial properties, we manipulated the bacterial community of nest material and thus tested experimentally its effects on the microbiomes of the uropygial secretion and of the eggshells. The experiment did not influence the microbiome of the uropygial secretion of females, but affected the community established on eggshells. This is the first experimental evidence indicating that nest material influences the bacterial community of the eggshells and, therefore, probability of embryo infection. Some of the bacterial strains detected in the secretion were also in the bacterial communities of the nest material and of cloaca, but their occurrence within nests was not associated, which suggests that bacterial environments of nest material and cloaca are not sources of symbiotic bacteria for the gland. These results do not support a role of nest environments of hoopoes as reservoirs of symbiotic bacteria. We discuss possible scenarios explaining bacterial acquisition by hoopoes that should be further explored. PMID:27409772

  19. The Effect of Vacuum-Assisted Closure on the Bacterial Load and Type of Bacteria: A Systematic Review

    PubMed Central

    Patmo, Aryan S.P.; Krijnen, Pieta; Tuinebreijer, Wim E.; Breederveld, Roelf S.

    2014-01-01

    Significance: A high bacterial load interferes with the healing process of a wound. Vacuum-assisted closure (VAC) is a wound healing therapy that utilizes a dressing system that continuously or intermittently applies a negative pressure to the wound surface. Recent Advances: VAC stimulates wound healing, but data on changes in the bacterial load and changes in the bacterial spectrum are scarce. Critical Issues: While VAC supposedly removes bacteria from the treated wounds and therefore reduces the risk of infection, this relationship has not yet been clinically proven. If VAC increases the bacterial load instead of decreasing it, then this may be a reason not to use VAC on certain types of wounds. Only seven small and heterogeneous studies reporting on the relationship between VAC usage and the bacterial load and type of bacteria in the treated wounds in clinical practice were found in the literature. Although there is some low quality evidence that VAC therapy does not change the bacterial load, no definite conclusions on changes in the bacterial load and type of bacteria during VAC can be drawn. Future Directions: Prospectively monitoring changes in the bacterial load and bacterial spectrum in patients that will receive VAC treatment on indication might be an effective way to find out whether it should indeed be used on specific wounds. PMID:24804158

  20. ATR-FTIR Spectroscopic Evidence for Biomolecular Phosphorus and Carboxyl Groups Facilitating Bacterial Adhesion to Iron Oxides

    PubMed Central

    Parikh, Sanjai J.; Mukome, Fungai N.D.; Zhang, Xiaoming

    2014-01-01

    Attenuated total reflectance (ATR) Fourier transform infrared (FTIR) spectroscopy has been used to probe the binding of bacteria to hematite (α-Fe2O3) and goethite (α-FeOOH). In situ ATR-FTIR experiments with bacteria (Pseudomonas putida, P. aeruginosa, Escherichia coli), mixed amino acids, polypeptide extracts, deoxyribonucleic acid (DNA), and a suite of model compounds were conducted. These compounds represent carboxyl, catecholate, amide, and phosphate groups present in siderophores, amino acids, polysaccharides, phospholipids, and DNA. Due in part to the ubiquitous presence of carboxyl groups in biomolecules, numerous IR peaks corresponding to outer-sphere or unbound (1400 cm−1) and inner-sphere (1310-1320 cm−1) coordinated carboxyl groups are noted following reaction of bacteria and biomolecules with α-Fe2O3 and α-FeOOH. However, the data also reveal that the presence of low-level amounts (i.e., 0.45-0.79%) of biomolecular phosphorous groups result in strong IR bands at ~1043 cm−1, corresponding to inner-sphere Fe-O-P bonds, underscoring the importance of bacteria associated P-containing groups in biomolecule and cell adhesion. Spectral comparisons also reveal slightly greater P-O-Fe contributions for bacteria (Pseudomonad, E. coli) deposited on α-FeOOH, as compared to α-Fe2O3. This data demonstrates that slight differences in bacterial adhesion to Fe oxides can be attributed to bacterial species and Fe-oxide minerals. However, more importantly, the strong binding affinity of phosphate in all bacteria samples to both Fe-oxides results in the formation of inner-sphere Fe-O-P bonds, signifying the critical role of biomolecular P in the initiation of bacterial adhesion. PMID:24859052

  1. A type III effector antagonizes death receptor signalling during bacterial gut infection.

    PubMed

    Pearson, Jaclyn S; Giogha, Cristina; Ong, Sze Ying; Kennedy, Catherine L; Kelly, Michelle; Robinson, Keith S; Lung, Tania Wong Fok; Mansell, Ashley; Riedmaier, Patrice; Oates, Clare V L; Zaid, Ali; Mühlen, Sabrina; Crepin, Valerie F; Marches, Olivier; Ang, Ching-Seng; Williamson, Nicholas A; O'Reilly, Lorraine A; Bankovacki, Aleksandra; Nachbur, Ueli; Infusini, Giuseppe; Webb, Andrew I; Silke, John; Strasser, Andreas; Frankel, Gad; Hartland, Elizabeth L

    2013-09-12

    Successful infection by enteric bacterial pathogens depends on the ability of the bacteria to colonize the gut, replicate in host tissues and disseminate to other hosts. Pathogens such as Salmonella, Shigella and enteropathogenic and enterohaemorrhagic (EPEC and EHEC, respectively) Escherichia coli use a type III secretion system (T3SS) to deliver virulence effector proteins into host cells during infection that promote colonization and interfere with antimicrobial host responses. Here we report that the T3SS effector NleB1 from EPEC binds to host cell death-domain-containing proteins and thereby inhibits death receptor signalling. Protein interaction studies identified FADD, TRADD and RIPK1 as binding partners of NleB1. NleB1 expressed ectopically or injected by the bacterial T3SS prevented Fas ligand or TNF-induced formation of the canonical death-inducing signalling complex (DISC) and proteolytic activation of caspase-8, an essential step in death-receptor-induced apoptosis. This inhibition depended on the N-acetylglucosamine transferase activity of NleB1, which specifically modified Arg 117 in the death domain of FADD. The importance of the death receptor apoptotic pathway to host defence was demonstrated using mice deficient in the FAS signalling pathway, which showed delayed clearance of the EPEC-like mouse pathogen Citrobacter rodentium and reversion to virulence of an nleB mutant. The activity of NleB suggests that EPEC and other attaching and effacing pathogens antagonize death-receptor-induced apoptosis of infected cells, thereby blocking a major antimicrobial host response.

  2. A type III effector antagonises death receptor signalling during bacterial gut infection

    PubMed Central

    Pearson, Jaclyn S; Giogha, Cristina; Ong, Sze Ying; Kennedy, Catherine L; Kelly, Michelle; Robinson, Keith S; Wong, Tania; Mansell, Ashley; Riedmaier, Patrice; Oates, Clare VL; Zaid, Ali; Mühlen, Sabrina; Crepin, Valerie F; Marches, Olivier; Ang, Ching-Seng; Williamson, Nicholas A; O’Reilly, Lorraine A; Bankovacki, Aleksandra; Nachbur, Ueli; Infusini, Giuseppe; Webb, Andrew I; Silke, John; Strasser, Andreas; Frankel, Gad; Hartland, Elizabeth L

    2013-01-01

    Successful infection by enteric bacterial pathogens depends on the ability of the bacteria to colonise the gut, replicate in host tissues and disseminate to other hosts. Pathogens such as Salmonella, Shigella and enteropathogenic and enterohaemorrhagic E. coli (EPEC and EHEC), utilise a type III secretion system (T3SS) to deliver virulence effector proteins into host cells during infection that promote colonisation and interfere with antimicrobial host responses 1-3. Here we report that the T3SS effector NleB1 from EPEC binds to host cell death domain containing proteins and thereby inhibits death receptor signalling. Protein interaction studies identified FADD, TRADD and RIPK1 as binding partners of NleB1. NleB1 expressed ectopically or injected by the bacterial T3SS prevented Fas ligand or TNF-induced formation of the canonical death inducing signalling complex (DISC) and proteolytic activation of caspase-8, an essential step in death receptor induced apoptosis. This inhibition depended on the N-GlcNAc transferase activity of NleB1, which specifically modified Arg117 in the death domain of FADD. The importance of the death receptor apoptotic pathway to host defence was demonstrated using mice deficient in the FAS signalling pathway, which showed delayed clearance of the EPEC-like mouse pathogen Citrobacter rodentium and reversion to virulence of an nleB mutant. The activity of NleB suggests that EPEC and other attaching and effacing (A/E) pathogens antagonise death receptor induced apoptosis of infected cells, thereby blocking a major antimicrobial host response. PMID:24025841

  3. The chitin-binding domain of a GH-18 chitinase from Vibrio harveyi is crucial for chitin-chitinase interactions.

    PubMed

    Suginta, Wipa; Sirimontree, Paknisa; Sritho, Natchanok; Ohnuma, Takayuki; Fukamizo, Tamo

    2016-12-01

    Vibrio harveyi chitinase A (VhChiA) is a GH-18 glycosyl hydrolase with a structure containing three distinct domains: i) the N-terminal chitin-binding domain; ii) the (α/β) 8 TIM barrel catalytic domain; and iii) the α+β insertion domain. In this study, we cloned the gene fragment encoding the chitin-binding domain of VhChiA, termed ChBD Vh ChiA . The recombinant ChBD Vh ChiA was heterologously expressed in E. coli BL21 strain Tuner(DE3)pLacI host cells, and purified to homogeneity. CD measurements suggested that ChBD Vh ChiA contained β-sheets as major structural components and fluorescence spectroscopy showed that the protein domain was folded correctly, and suitable for functional characterization. Chitin binding assays showed that ChBD Vh ChiA bound to both α- and β-chitins, with the greatest affinity for β-colloidal chitin, but barely bound to polymeric chitosan. These results identified the tandem N-acetamido functionality on chitin chains as the specific sites of enzyme-substrate interactions. The binding affinity of the isolated domain was significantly lower than that of intact VhChiA, suggesting that the catalytic domain works synergistically with the chitin-binding domain to guide the polymeric substrate into the substrate binding cleft. These data confirm the physiological role of the chitin-binding domain of the marine bacterial GH-18 chitinase A in chitin-chitinase interactions. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. PRECEPT: an evidence assessment framework for infectious disease epidemiology, prevention and control.

    PubMed

    Harder, Thomas; Takla, Anja; Eckmanns, Tim; Ellis, Simon; Forland, Frode; James, Roberta; Meerpohl, Joerg J; Morgan, Antony; Rehfuess, Eva; Schünemann, Holger; Zuiderent-Jerak, Teun; de Carvalho Gomes, Helena; Wichmann, Ole

    2017-10-01

    Decisions in public health should be based on the best available evidence, reviewed and appraised using a rigorous and transparent methodology. The Project on a Framework for Rating Evidence in Public Health (PRECEPT) defined a methodology for evaluating and grading evidence in infectious disease epidemiology, prevention and control that takes different domains and question types into consideration. The methodology rates evidence in four domains: disease burden, risk factors, diagnostics and intervention. The framework guiding it has four steps going from overarching questions to an evidence statement. In step 1, approaches for identifying relevant key areas and developing specific questions to guide systematic evidence searches are described. In step 2, methodological guidance for conducting systematic reviews is provided; 15 study quality appraisal tools are proposed and an algorithm is given for matching a given study design with a tool. In step 3, a standardised evidence-grading scheme using the Grading of Recommendations Assessment, Development and Evaluation Working Group (GRADE) methodology is provided, whereby findings are documented in evidence profiles. Step 4 consists of preparing a narrative evidence summary. Users of this framework should be able to evaluate and grade scientific evidence from the four domains in a transparent and reproducible way.

  5. PRECEPT: an evidence assessment framework for infectious disease epidemiology, prevention and control

    PubMed Central

    Harder, Thomas; Takla, Anja; Eckmanns, Tim; Ellis, Simon; Forland, Frode; James, Roberta; Meerpohl, Joerg J; Morgan, Antony; Rehfuess, Eva; Schünemann, Holger; Zuiderent-Jerak, Teun; de Carvalho Gomes, Helena; Wichmann, Ole

    2017-01-01

    Decisions in public health should be based on the best available evidence, reviewed and appraised using a rigorous and transparent methodology. The Project on a Framework for Rating Evidence in Public Health (PRECEPT) defined a methodology for evaluating and grading evidence in infectious disease epidemiology, prevention and control that takes different domains and question types into consideration. The methodology rates evidence in four domains: disease burden, risk factors, diagnostics and intervention. The framework guiding it has four steps going from overarching questions to an evidence statement. In step 1, approaches for identifying relevant key areas and developing specific questions to guide systematic evidence searches are described. In step 2, methodological guidance for conducting systematic reviews is provided; 15 study quality appraisal tools are proposed and an algorithm is given for matching a given study design with a tool. In step 3, a standardised evidence-grading scheme using the Grading of Recommendations Assessment, Development and Evaluation Working Group (GRADE) methodology is provided, whereby findings are documented in evidence profiles. Step 4 consists of preparing a narrative evidence summary. Users of this framework should be able to evaluate and grade scientific evidence from the four domains in a transparent and reproducible way. PMID:29019317

  6. Three-dimensional organization of three-domain copper oxidases: A review

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhukhlistova, N. E., E-mail: amm@ns.crys.ras.ru; Zhukova, Yu. N.; Lyashenko, A. V.

    2008-01-15

    'Blue' copper-containing proteins are multidomain proteins that utilize a unique redox property of copper ions. Among other blue multicopper oxidases, three-domain oxidases belong to the group of proteins that exhibit a wide variety of compositions in amino acid sequences, functions, and occurrences in organisms. This paper presents a review of the data obtained from X-ray diffraction investigations of the three-dimensional structures of three-domain multicopper oxidases, such as the ascorbate oxidase catalyzing oxidation of ascorbate to dehydroascorbate and its three derivatives; the multicopper oxidase CueO (the laccase homologue); the laccases isolated from the basidiomycetes Coprinus cinereus, Trametes versicolor, Coriolus zonatus, Cerrenamore » maxima, and Rigidoporus lignosus and the ascomycete Melanocarpus albomyces; and the bacterial laccases CotA from the endospore coats of Bacillus subtilis. A comparison of the molecular structures of the laccases of different origins demonstrates that, structurally, these objects are highly conservative. This obviously indicates that the catalytic activity of the enzymes under consideration is characterized by similar mechanisms.« less

  7. A bacterial genome in transition - an exceptional enrichment of IS elements but lack of evidence for recent transposition in the symbiont Amoebophilus asiaticus

    PubMed Central

    2011-01-01

    Background Insertion sequence (IS) elements are important mediators of genome plasticity and are widespread among bacterial and archaeal genomes. The 1.88 Mbp genome of the obligate intracellular amoeba symbiont Amoebophilus asiaticus contains an unusually large number of transposase genes (n = 354; 23% of all genes). Results The transposase genes in the A. asiaticus genome can be assigned to 16 different IS elements termed ISCaa1 to ISCaa16, which are represented by 2 to 24 full-length copies, respectively. Despite this high IS element load, the A. asiaticus genome displays a GC skew pattern typical for most bacterial genomes, indicating that no major rearrangements have occurred recently. Additionally, the high sequence divergence of some IS elements, the high number of truncated IS element copies (n = 143), as well as the absence of direct repeats in most IS elements suggest that the IS elements of A. asiaticus are transpositionally inactive. Although we could show transcription of 13 IS elements, we did not find experimental evidence for transpositional activity, corroborating our results from sequence analyses. However, we detected contiguous transcripts between IS elements and their downstream genes at nine loci in the A. asiaticus genome, indicating that some IS elements influence the transcription of downstream genes, some of which might be important for host cell interaction. Conclusions Taken together, the IS elements in the A. asiaticus genome are currently in the process of degradation and largely represent reflections of the evolutionary past of A. asiaticus in which its genome was shaped by their activity. PMID:21943072

  8. Bacterial Adhesion to Hexadecane (Model NAPL)-Water Interfaces

    NASA Astrophysics Data System (ADS)

    Ghoshal, S.; Zoueki, C. R.; Tufenkji, N.

    2009-05-01

    The rates of biodegradation of NAPLs have been shown to be influenced by the adhesion of hydrocarbon- degrading microorganisms as well as their proximity to the NAPL-water interface. Several studies provide evidence for bacterial adhesion or biofilm formation at alkane- or crude oil-water interfaces, but there is a significant knowledge gap in our understanding of the processes that influence initial adhesion of bacteria on to NAPL-water interfaces. In this study bacterial adhesion to hexadecane, and a series of NAPLs comprised of hexadecane amended with toluene, and/or with asphaltenes and resins, which are the surface active fractions of crude oils, were examined using a Microbial Adhesion to Hydrocarbons (MATH) assay. The microorganisms employed were Mycobacterium kubicae, Pseudomonas aeruginosa and Pseudomonas putida, which are hydrocarbon degraders or soil microorganisms. MATH assays as well as electrophoretic mobility measurements of the bacterial cells and the NAPL droplet surfaces in aqueous solutions were conducted at three solution pHs (4, 6 and 7). Asphaltenes and resins were shown to generally decrease microbial adhesion. Results of the MATH assay were not in qualitative agreement with theoretical predictions of bacteria- hydrocarbon interactions based on the extended Derjaguin-Landau-Verwey-Overbeek (XDLVO) model of free energy of interaction between the cell and NAPL droplets. In this model the free energy of interaction between two colloidal particles is predicted based on electrical double layer, van der Waals and hydrophobic forces. It is likely that the steric repulsion between bacteria and NAPL surfaces, caused by biopolymers on bacterial surfaces and aphaltenes and resins at the NAPL-water interface contributed to the decreased adhesion compared to that predicted by the XDLVO model.

  9. Common bacterial responses in six ecosystems exposed to 10 years of elevated atmospheric carbon dioxide.

    PubMed

    Dunbar, John; Eichorst, Stephanie A; Gallegos-Graves, La Verne; Silva, Shannon; Xie, Gary; Hengartner, N W; Evans, R David; Hungate, Bruce A; Jackson, Robert B; Megonigal, J Patrick; Schadt, Christopher W; Vilgalys, Rytas; Zak, Donald R; Kuske, Cheryl R

    2012-05-01

    Six terrestrial ecosystems in the USA were exposed to elevated atmospheric CO(2) in single or multifactorial experiments for more than a decade to assess potential impacts. We retrospectively assessed soil bacterial community responses in all six-field experiments and found ecosystem-specific and common patterns of soil bacterial community response to elevated CO(2) . Soil bacterial composition differed greatly across the six ecosystems. No common effect of elevated atmospheric CO(2) on bacterial biomass, richness and community composition across all of the ecosystems was identified, although significant responses were detected in individual ecosystems. The most striking common trend across the sites was a decrease of up to 3.5-fold in the relative abundance of Acidobacteria Group 1 bacteria in soils exposed to elevated CO(2) or other climate factors. The Acidobacteria Group 1 response observed in exploratory 16S rRNA gene clone library surveys was validated in one ecosystem by 100-fold deeper sequencing and semi-quantitative PCR assays. Collectively, the 16S rRNA gene sequencing approach revealed influences of elevated CO(2) on multiple ecosystems. Although few common trends across the ecosystems were detected in the small surveys, the trends may be harbingers of more substantive changes in less abundant, more sensitive taxa that can only be detected by deeper surveys. Representative bacterial 16S rRNA gene clone sequences were deposited in GenBank with Accession No. JQ366086–JQ387568. Published 2012. This article is a U.S. Government work and is in the public domain in the USA.

  10. Domain atrophy creates rare cases of functional partial protein domains.

    PubMed

    Prakash, Ananth; Bateman, Alex

    2015-04-30

    Protein domains display a range of structural diversity, with numerous additions and deletions of secondary structural elements between related domains. We have observed a small number of cases of surprising large-scale deletions of core elements of structural domains. We propose a new concept called domain atrophy, where protein domains lose a significant number of core structural elements. Here, we implement a new pipeline to systematically identify new cases of domain atrophy across all known protein sequences. The output of this pipeline was carefully checked by hand, which filtered out partial domain instances that were unlikely to represent true domain atrophy due to misannotations or un-annotated sequence fragments. We identify 75 cases of domain atrophy, of which eight cases are found in a three-dimensional protein structure and 67 cases have been inferred based on mapping to a known homologous structure. Domains with structural variations include ancient folds such as the TIM-barrel and Rossmann folds. Most of these domains are observed to show structural loss that does not affect their functional sites. Our analysis has significantly increased the known cases of domain atrophy. We discuss specific instances of domain atrophy and see that there has often been a compensatory mechanism that helps to maintain the stability of the partial domain. Our study indicates that although domain atrophy is an extremely rare phenomenon, protein domains under certain circumstances can tolerate extreme mutations giving rise to partial, but functional, domains.

  11. Integrating different perspectives on socialization theory and research: a domain-specific approach.

    PubMed

    Grusec, Joan E; Davidov, Maayan

    2010-01-01

    There are several different theoretical and research approaches to the study of socialization, characterized by frequently competing basic tenets and apparently contradictory evidence. As a way of integrating approaches and understanding discrepancies, it is proposed that socialization processes be viewed from a domain perspective, with each domain characterized by a particular form of social interaction between the object and agent of socialization and by specific socialization mechanisms and outcomes. It is argued that this approach requires researchers to identify the domain of social interaction they are investigating, to understand that phenotypically similar behaviors may belong to different domains, and to acknowledge that caregivers who are effective in one type of interaction may not be effective in another.

  12. dBBQs: dataBase of Bacterial Quality scores.

    PubMed

    Wanchai, Visanu; Patumcharoenpol, Preecha; Nookaew, Intawat; Ussery, David

    2017-12-28

    It is well-known that genome sequencing technologies are becoming significantly cheaper and faster. As a result of this, the exponential growth in sequencing data in public databases allows us to explore ever growing large collections of genome sequences. However, it is less known that the majority of available sequenced genome sequences in public databases are not complete, drafts of varying qualities. We have calculated quality scores for around 100,000 bacterial genomes from all major genome repositories and put them in a fast and easy-to-use database. Prokaryotic genomic data from all sources were collected and combined to make a non-redundant set of bacterial genomes. The genome quality score for each was calculated by four different measurements: assembly quality, number of rRNA and tRNA genes, and the occurrence of conserved functional domains. The dataBase of Bacterial Quality scores (dBBQs) was designed to store and retrieve quality scores. It offers fast searching and download features which the result can be used for further analysis. In addition, the search results are shown in interactive JavaScript chart framework using DC.js. The analysis of quality scores across major public genome databases find that around 68% of the genomes are of acceptable quality for many uses. dBBQs (available at http://arc-gem.uams.edu/dbbqs ) provides genome quality scores for all available prokaryotic genome sequences with a user-friendly Web-interface. These scores can be used as cut-offs to get a high-quality set of genomes for testing bioinformatics tools or improving the analysis. Moreover, all data of the four measurements that were combined to make the quality score for each genome, which can potentially be used for further analysis. dBBQs will be updated regularly and is freely use for non-commercial purpose.

  13. Crystallization and preliminary X-ray analysis of the isomerase domain of glucosamine-6-phosphate synthase from Candida albicans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Olchowy, Jaroslaw; Jedrzejczak, Robert; Milewski, Slawomir

    2005-11-01

    The isomerase domain of glucosamine-6-phosphate synthase from C. albicans has been crystallized and X-ray diffraction data have been collected. Preliminary analysis of the data reveals the oligomeric structure of the eukaryotic synthase to be a ‘dimer’ of prokaryotic-like dimers. Glucosamine-6-phosphate synthase (EC 2.6.1.16) catalyses the first and practically irreversible step in the hexosamine metabolism pathway, the end product of which, uridine 5′-diphospho-N-acetyl d-glucosamine, is an essential substrate for assembly of the cell wall. The isomerase domain, consisting of residues 346–712 (42 kDa), of glucosamine-6-phosphate synthase from Candida albicans has been crystallized. X-ray analysis revealed that the crystals belonged to spacemore » group I4, with unit-cell parameters a = b = 149, c = 103 Å. Diffraction data were collected to 3.8 Å. Preliminary results from molecular replacement using the homologous bacterial monomer reveal that the asymmetric unit contains two monomers that resemble a bacterial dimer. The crystal lattice consists of pairs of such symmetry-related dimers forming elongated tetramers.« less

  14. Recent progress on lipid lateral heterogeneity in plasma membranes: from rafts to submicrometric domains

    PubMed Central

    Carquin, Mélanie; D'Auria, Ludovic; Pollet, Hélène; Bongarzone, Ernesto R.; Tyteca, Donatienne

    2016-01-01

    The concept of transient nanometric domains known as lipid rafts has brought interest to reassess the validity of the Singer-Nicholson model of a fluid bilayer for cell membranes. However, this new view is still insufficient to explain the cellular control of surface lipid diversity or membrane deformability. During the past decade, the hypothesis that some lipids form large (submicrometric/mesoscale vs nanometric rafts) and stable (> min vs sec) membrane domains has emerged, largely based on indirect methods. Morphological evidence for stable submicrometric lipid domains, well-accepted for artificial and highly specialized biological membranes, was further reported for a variety of living cells from prokaryotes to yeast and mammalian cells. However, results remained questioned based on limitations of available fluorescent tools, use of poor lipid fixatives, and imaging artifacts due to non-resolved membrane projections. In this review, we will discuss recent evidence generated using powerful and innovative approaches such as lipid-specific toxin fragments that support the existence of submicrometric domains. We will integrate documented mechanisms involved in the formation and maintenance of these domains, and provide a perspective on their relevance on membrane deformability and regulation of membrane protein distribution. PMID:26738447

  15. [Current treatment of bacterial vaginosis].

    PubMed

    Borisov, I

    1999-01-01

    Therapeutic options for the treatment of accurately diagnosed bacterial vaginosis are reviewed on the basis of current concepts for treatment of bacterial vaginosis. The importance for screening for bacterial vaginosis is pointed out especially before intrauterine procedures and in pregnant women at risk for premature deliveries. Treatment regimens for pregnant women are discussed as well. Emphasis is given to treatment modalities for recurrent bacterial vaginosis.

  16. Evaluating bacterial pathogen DNA preservation in museum osteological collections

    PubMed Central

    Barnes, Ian; Thomas, Mark G

    2005-01-01

    Reports of bacterial pathogen DNA sequences obtained from archaeological bone specimens raise the possibility of greatly improving our understanding of the history of infectious diseases. However, the survival of pathogen DNA over long time periods is poorly characterized, and scepticism remains about the reliability of these data. In order to explore the survival of bacterial pathogen DNA in bone specimens, we analysed samples from 59 eighteenth and twentieth century individuals known to have been infected with either Mycobacterium tuberculosis or Treponema pallidum. No reproducible evidence of surviving pathogen DNA was obtained, despite the use of extraction and PCR-amplification methods determined to be highly sensitive. These data suggest that previous studies need to be interpreted with caution, and we propose that a much greater emphasis is placed on understanding how pathogen DNA survives in archaeological material, and how its presence can be properly verified and used. PMID:16608682

  17. Plant immunity: a lesson from pathogenic bacterial effector proteins.

    PubMed

    Cui, Haitao; Xiang, Tingting; Zhou, Jian-Min

    2009-10-01

    Phytopathogenic bacteria inject an array of effector proteins into host cells to alter host physiology and assist the infection process. Some of these effectors can also trigger disease resistance as a result of recognition in the plant cell by cytoplasmic immune receptors. In addition to effector-triggered immunity, plants immunity can be triggered upon the detection of Pathogen/Microbe-Associated Molecular Patterns by surface-localized immune receptors. Recent progress indicates that many bacterial effector proteins use a variety of biochemical properties to directly attack key components of PAMP-triggered immunity and effector-triggered immunity, providing new insights into the molecular basis of plant innate immunity. Emerging evidence indicate that the evolution of disease resistance in plants is intimately linked to the mechanism by which bacterial effectors promote parasitism. This review focuses on how these studies have conceptually advanced our understanding of plant-pathogen interactions.

  18. Mapping the Moral Domain

    PubMed Central

    Graham, Jesse; Nosek, Brian A.; Haidt, Jonathan; Iyer, Ravi; Koleva, Spassena; Ditto, Peter H.

    2010-01-01

    The moral domain is broader than the empathy and justice concerns assessed by existing measures of moral competence, and it is not just a subset of the values assessed by value inventories. To fill the need for reliable and theoretically-grounded measurement of the full range of moral concerns, we developed the Moral Foundations Questionnaire (MFQ) based on a theoretical model of five universally available (but variably developed) sets of moral intuitions: Harm/care, Fairness/reciprocity, Ingroup/loyalty, Authority/respect, and Purity/sanctity. We present evidence for the internal and external validity of the scale and the model, and in doing so present new findings about morality: 1. Comparative model fitting of confirmatory factor analyses provides empirical justification for a five-factor structure of moral concerns. 2. Convergent/discriminant validity evidence suggests that moral concerns predict personality features and social group attitudes not previously considered morally relevant. 3. We establish pragmatic validity of the measure in providing new knowledge and research opportunities concerning demographic and cultural differences in moral intuitions. These analyses provide evidence for the usefulness of Moral Foundations Theory in simultaneously increasing the scope and sharpening the resolution of psychological views of morality. PMID:21244182

  19. Beneficial effect of Cu on Ti-Nb-Ta-Zr sputtered uniform/adhesive gum films accelerating bacterial inactivation under indoor visible light.

    PubMed

    Alhussein, Akram; Achache, Sofiane; Deturche, Regis; Sanchette, Frederic; Pulgarin, Cesar; Kiwi, John; Rtimi, Sami

    2017-04-01

    This article presents the evidence for the significant effect of copper accelerating the bacterial inactivation on Ti-Nb-Ta-Zr (TNTZ) sputtered films on glass up to a Cu content of 8.3 at.%. These films were deposited by dc magnetron co-sputtering of an alloy target Ti-23Nb-0.7Ta-2Zr (at.%) and a Cu target. The fastest bacterial inactivation of E. coli on this later TNTZ-Cu surface proceeded within ∼75min. The films deposited by magnetron sputtering are chemically homogenous. The film roughness evaluated by atomic force spectroscopy (AFM) on the TNTZ-Cu 8.3 at.% Cu sample presented an RMS-value of 20.1nm being the highest RMS of any Cu-sputtered TNTZ sample. The implication of the RMS value found for this sample leading to the fastest interfacial bacterial inactivation kinetics is also discussed. Values for the Young's modulus and hardness are reported for the TNTZ films in the presence of various Cu-contents. Evaluation of the bacterial inactivation kinetics of E. coli under low intensity actinic hospital light and in the dark was carried out. The stable repetitive bacterial inactivation was consistent with the extremely low Cu-ion release from the samples of 0.4 ppb. Evidence is presented by the bacterial inactivation dependence on the applied light intensity for the intervention of Cu as semiconductor CuO during the bacterial inactivation at the TNTZ-Cu interface. The mechanism of CuO-intervention under light is suggested based on the pH/and potential changes registered during bacterial disinfection. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Hybridization improved bacteria resistance in abalone: Evidence from physiological and molecular responses.

    PubMed

    Liang, Shuang; Luo, Xuan; You, Weiwei; Ke, Caihuan

    2018-01-01

    Hybridization is an effective way of improving germplasm in abalone, as it often generates benign traits in the hybrids. The hybrids of Haliotis discus hannai and H. gigantea have shown heterosis in terms of disease resistance than one or both parental species. In the present study, to elucidate the physiological and molecular mechanism of this heterosis, we analyzed the dynamic changes of several immune indexes including survival rate, total circulating haemocyte count (THC), phagocytic activity, reactive oxygen species level (ROS) and phenoloxidase activity (PO) in two parental species, H. discus hannai (DD) and H. gigantea (GG), and their reciprocal hybrids H. discus hannai ♀ × H. gigantea ♂ (DG), H. gigantea ♀ × H. discus hannai ♂ (GD) challenged with a mixture of Vibrio harveyi, V. alginolyticus and V. parahaemolyticus (which have been demonstrated to be pathogenic to abalone). Besides, we cloned and analyzed three important immune genes: heat shock protein 70 (hsp70), ferritin and cold shock domain protein (csdp) in H. discus hannai and H. gigantea, then further investigated their mRNA level changes in the four abalone genotypes after bacterial challenge. Results showed that these physiological and molecular parameters were significantly induced by bacterial exposure, and their changing patterns were obviously different between the four genotypes: (1) Survival rates of the two hybrids were higher than both parental species after bacterial exposure; (2) DG had higher THC than the other three genotypes; (3) Phagocytosis responded slower in the hybrids than in the parental species; (4) DD's ROS level was lower than the other three genotypes at 48 h post infection; (5) Phenoloxidase activity was lower in DD during the infection compared to the other genotypes; (6) mRNA levels of hsp70 and csdp, were always lower in at least one parental species (DD) than in the hybrids after the bacterial exposure. Results from this study indicate that the hybrids