Sample records for bacterial insertion sequences

  1. The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure.

    PubMed

    Valle-García, David; Griffiths, Lyra M; Dyer, Michael A; Bernstein, Emily; Recillas-Targa, Félix

    2014-01-01

    The SWI/SNF-like chromatin-remodeling protein ATRX has emerged as a key factor in the regulation of α-globin gene expression, incorporation of histone variants into the chromatin template and, more recently, as a frequently mutated gene across a wide spectrum of cancers. Therefore, the availability of a functional ATRX cDNA for expression studies is a valuable tool for the scientific community. We have identified two independent transposon insertions of a bacterial IS10 element into exon 8 of ATRX isoform 2 coding sequence in two different plasmids derived from a single source. We demonstrate that these insertion events are common and there is an insertion hotspot within the ATRX cDNA. Such IS10 insertions produce a truncated form of ATRX, which significantly compromises its nuclear localization. In turn, we describe ways to prevent IS10 insertion during propagation and cloning of ATRX-containing vectors, including optimal growth conditions, bacterial strains, and suggested sequencing strategies. Finally, we have generated an insertion-free plasmid that is available to the community for expression studies of ATRX.

  2. Using PATIMDB to Create Bacterial Transposon Insertion Mutant Libraries

    PubMed Central

    Urbach, Jonathan M.; Wei, Tao; Liberati, Nicole; Grenfell-Lee, Daniel; Villanueva, Jacinto; Wu, Gang; Ausubel, Frederick M.

    2015-01-01

    PATIMDB is a software package for facilitating the generation of transposon mutant insertion libraries. The software has two main functions: process tracking and automated sequence analysis. The process tracking function specifically includes recording the status and fates of multiwell plates and samples in various stages of library construction. Automated sequence analysis refers specifically to the pipeline of sequence analysis starting with ABI files from a sequencing facility and ending with insertion location identifications. The protocols in this unit describe installation and use of PATIMDB software. PMID:19343706

  3. Stable zymomonas mobilis xylose and arabinose fermenting strains

    DOEpatents

    Zhang, Min [Lakewood, CO; Chou, Yat-Chen [Taipei, TW

    2008-04-08

    The present invention briefly includes a transposon for stable insertion of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, and at least one promoter for expression of the structural genes in the bacterium, a pair of inverted insertion sequences, the operons contained inside the insertion sequences, and a transposase gene located outside of the insertion sequences. A plasmid shuttle vector for transformation of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, at least one promoter for expression of the structural genes in the bacterium, and at least two DNA fragments having homology with a gene in the bacterial genome to be transformed, is also provided.The transposon and shuttle vectors are useful in constructing significantly different Zymomonas mobilis strains, according to the present invention, which are useful in the conversion of the cellulose derived pentose sugars into fuels and chemicals, using traditional fermentation technology, because they are stable for expression in a non-selection medium.

  4. A Metagenome-Wide Association Study and Arrayed Mutant Library Confirm Acetobacter Lipopolysaccharide Genes Are Necessary for Association with Drosophila melanogaster.

    PubMed

    White, K Makay; Matthews, Melinda K; Hughes, Rachel C; Sommer, Andrew J; Griffitts, Joel S; Newell, Peter D; Chaston, John M

    2018-03-28

    A metagenome wide association (MGWA) study of bacterial host association determinants in Drosophila predicted that LPS biosynthesis genes are significantly associated with host colonization. We were unable to create site-directed mutants for each of the predicted genes in Acetobacter , so we created an arrayed transposon insertion library using Acetobacter fabarum DsW_054 isolated from Drosophila Creation of the A. fabarum DsW_054 gene knock-out library was performed by combinatorial mapping and Illumina sequencing of random transposon insertion mutants. Transposon insertion locations for 6,418 mutants were successfully mapped, including hits within 63% of annotated genes in the A. fabarum DsW_054 genome. For 45/45 members of the library, insertion sites were verified by arbitrary PCR and Sanger sequencing. Mutants with insertions in four different LPS biosynthesis genes were selected from the library to validate the MGWA predictions. Insertion mutations in two genes biosynthetically upstream of Lipid-A formation, lpxC and lpxB , show significant differences in host association, whereas mutations in two genes encoding LPS biosynthesis functions downstream of Lipid-A biosynthesis had no effect. These results suggest an impact of bacterial cell surface molecules on the bacterial capacity for host association. Also, the transposon insertion mutant library will be a useful resource for ongoing research on the genetic basis for Acetobacter traits. Copyright © 2018 White et al.

  5. High-resolution definition of the Vibrio cholerae essential gene set with hidden Markov model–based analyses of transposon-insertion sequencing data

    PubMed Central

    Chao, Michael C.; Pritchard, Justin R.; Zhang, Yanjia J.; Rubin, Eric J.; Livny, Jonathan; Davis, Brigid M.; Waldor, Matthew K.

    2013-01-01

    The coupling of high-density transposon mutagenesis to high-throughput DNA sequencing (transposon-insertion sequencing) enables simultaneous and genome-wide assessment of the contributions of individual loci to bacterial growth and survival. We have refined analysis of transposon-insertion sequencing data by normalizing for the effect of DNA replication on sequencing output and using a hidden Markov model (HMM)-based filter to exploit heretofore unappreciated information inherent in all transposon-insertion sequencing data sets. The HMM can smooth variations in read abundance and thereby reduce the effects of read noise, as well as permit fine scale mapping that is independent of genomic annotation and enable classification of loci into several functional categories (e.g. essential, domain essential or ‘sick’). We generated a high-resolution map of genomic loci (encompassing both intra- and intergenic sequences) that are required or beneficial for in vitro growth of the cholera pathogen, Vibrio cholerae. This work uncovered new metabolic and physiologic requirements for V. cholerae survival, and by combining transposon-insertion sequencing and transcriptomic data sets, we also identified several novel noncoding RNA species that contribute to V. cholerae growth. Our findings suggest that HMM-based approaches will enhance extraction of biological meaning from transposon-insertion sequencing genomic data. PMID:23901011

  6. Identification and Characterization of Domesticated Bacterial Transposases

    PubMed Central

    Gallie, Jenna; Rainey, Paul B.

    2017-01-01

    Abstract Selfish genetic elements, such as insertion sequences and transposons are found in most genomes. Transposons are usually identifiable by their high copy number within genomes. In contrast, REP-associated tyrosine transposases (RAYTs), a recently described class of bacterial transposase, are typically present at just one copy per genome. This suggests that RAYTs no longer copy themselves and thus they no longer function as a typical transposase. Motivated by this possibility we interrogated thousands of fully sequenced bacterial genomes in order to determine patterns of RAYT diversity, their distribution across chromosomes and accessory elements, and rate of duplication. RAYTs encompass exceptional diversity and are divisible into at least five distinct groups. They possess features more similar to housekeeping genes than insertion sequences, are predominantly vertically transmitted and have persisted through evolutionary time to the point where they are now found in 24% of all species for which at least one fully sequenced genome is available. Overall, the genomic distribution of RAYTs suggests that they have been coopted by host genomes to perform a function that benefits the host cell. PMID:28910967

  7. Bacterial Artificial Chromosome Libraries for Mouse Sequencing and Functional Analysis

    PubMed Central

    Osoegawa, Kazutoyo; Tateno, Minako; Woon, Peng Yeong; Frengen, Eirik; Mammoser, Aaron G.; Catanese, Joseph J.; Hayashizaki, Yoshihide; de Jong, Pieter J.

    2000-01-01

    Bacterial artificial chromosome (BAC) and P1-derived artificial chromosome (PAC) libraries providing a combined 33-fold representation of the murine genome have been constructed using two different restriction enzymes for genomic digestion. A large-insert PAC library was prepared from the 129S6/SvEvTac strain in a bacterial/mammalian shuttle vector to facilitate functional gene studies. For genome mapping and sequencing, we prepared BAC libraries from the 129S6/SvEvTac and the C57BL/6J strains. The average insert sizes for the three libraries range between 130 kb and 200 kb. Based on the numbers of clones and the observed average insert sizes, we estimate each library to have slightly in excess of 10-fold genome representation. The average number of clones found after hybridization screening with 28 probes was in the range of 9–14 clones per marker. To explore the fidelity of the genomic representation in the three libraries, we analyzed three contigs, each established after screening with a single unique marker. New markers were established from the end sequences and screened against all the contig members to determine if any of the BACs and PACs are chimeric or rearranged. Only one chimeric clone and six potential deletions have been observed after extensive analysis of 113 PAC and BAC clones. Seventy-one of the 113 clones were conclusively nonchimeric because both end markers or sequences were mapped to the other confirmed contig members. We could not exclude chimerism for the remaining 41 clones because one or both of the insert termini did not contain unique sequence to design markers. The low rate of chimerism, ∼1%, and the low level of detected rearrangements support the anticipated usefulness of the BAC libraries for genome research. [The sequence data described in this paper have been submitted to the GenBank data library under accession numbers AQ797173–AQ797398.] PMID:10645956

  8. Identification of a novel calcium binding motif based on the detection of sequence insertions in the animal peroxidase domain of bacterial proteins.

    PubMed

    Santamaría-Hernando, Saray; Krell, Tino; Ramos-González, María-Isabel

    2012-01-01

    Proteins of the animal heme peroxidase (ANP) superfamily differ greatly in size since they have either one or two catalytic domains that match profile PS50292. The orf PP_2561 of Pseudomonas putida KT2440 that we have called PepA encodes a two-domain ANP. The alignment of these domains with those of PepA homologues revealed a variable number of insertions with the consensus G-x-D-G-x-x-[GN]-[TN]-x-D-D. This motif has also been detected in the structure of pseudopilin (pdb 3G20), where it was found to be involved in Ca(2+) coordination although a sequence analysis did not reveal the presence of any known calcium binding motifs in this protein. Isothermal titration calorimetry revealed that a peptide containing this consensus motif bound specifically calcium ions with affinities ranging between 33-79 µM depending on the pH. Microcalorimetric titrations of the purified N-terminal ANP-like domain of PepA revealed Ca(2+) binding with a K(D) of 12 µM and stoichiometry of 1.25 calcium ions per protein monomer. This domain exhibited peroxidase activity after its reconstitution with heme. These data led to the definition of a novel calcium binding motif that we have termed PERCAL and which was abundantly present in animal peroxidase-like domains of bacterial proteins. Bacterial heme peroxidases thus possess two different types of calcium binding motifs, namely PERCAL and the related hemolysin type calcium binding motif, with the latter being located outside the catalytic domains and in their C-terminal end. A phylogenetic tree of ANP-like catalytic domains of bacterial proteins with PERCAL motifs, including single domain peroxidases, was divided into two major clusters, representing domains with and without PERCAL motif containing insertions. We have verified that the recently reported classification of bacterial heme peroxidases in two families (cd09819 and cd09821) is unrelated to these insertions. Sequences matching PERCAL were detected in all kingdoms of life.

  9. Insertion Sequences

    PubMed Central

    Mahillon, Jacques; Chandler, Michael

    1998-01-01

    Insertion sequences (ISs) constitute an important component of most bacterial genomes. Over 500 individual ISs have been described in the literature to date, and many more are being discovered in the ongoing prokaryotic and eukaryotic genome-sequencing projects. The last 10 years have also seen some striking advances in our understanding of the transposition process itself. Not least of these has been the development of various in vitro transposition systems for both prokaryotic and eukaryotic elements and, for several of these, a detailed understanding of the transposition process at the chemical level. This review presents a general overview of the organization and function of insertion sequences of eubacterial, archaebacterial, and eukaryotic origins with particular emphasis on bacterial elements and on different aspects of the transposition mechanism. It also attempts to provide a framework for classification of these elements by assigning them to various families or groups. A total of 443 members of the collection have been grouped in 17 families based on combinations of the following criteria: (i) similarities in genetic organization (arrangement of open reading frames); (ii) marked identities or similarities in the enzymes which mediate the transposition reactions, the recombinases/transposases (Tpases); (iii) similar features of their ends (terminal IRs); and (iv) fate of the nucleotide sequence of their target sites (generation of a direct target duplication of determined length). A brief description of the mechanism(s) involved in the mobility of individual ISs in each family and of the structure-function relationships of the individual Tpases is included where available. PMID:9729608

  10. Evidence from the structure and function of cytochromes c(2) that nonsulfur purple bacterial photosynthesis followed the evolution of oxygen respiration.

    PubMed

    Meyer, Terry; Van Driessche, Gonzalez; Ambler, Richard; Kyndt, John; Devreese, Bart; Van Beeumen, Jozef; Cusanovich, Michael

    2010-10-01

    Cytochromes c(2) are the nearest bacterial homologs of mitochondrial cytochrome c. The sequences of the known cytochromes c(2) can be placed in two subfamilies based upon insertions and deletions, one subfamily is most like mitochondrial cytochrome c (the small C2s, without significant insertions and deletions), and the other, designated large C2, shares 3- and 8-residue insertions as well as a single-residue deletion. C2s generally function between cytochrome bc(1) and cytochrome oxidase in respiration (ca 80 examples known to date) and between cytochrome bc(1) and the reaction center in nonsulfur purple bacterial photosynthesis (ca 21 examples). However, members of the large C2 subfamily are almost always involved in photosynthesis (12 of 14 examples). In addition, the gene for the large C2 (cycA) is associated with those for the photosynthetic reaction center (pufBALM). We hypothesize that the insertions in the large C2s, which were already functioning in photosynthesis, allowed them to replace the membrane-bound tetraheme cytochrome, PufC, that otherwise mediates between the small C2 or other redox proteins and photosynthetic reaction centers. Based upon our analysis, we propose that the involvement of C2 in nonsulfur purple bacterial photosynthesis was a metabolic feature subsequent to the evolution of oxygen respiration.

  11. Bacteria of an anaerobic 1,2-dichloropropane-dechlorinating mixed culture are phylogenetically related to those of other anaerobic dechlorinating consortia.

    PubMed

    Schlötelburg, C; von Wintzingerode, F; Hauck, R; Hegemann, W; Göbel, U B

    2000-07-01

    A 16S-rDNA-based molecular study was performed to determine the bacterial diversity of an anaerobic, 1,2-dichloropropane-dechlorinating bioreactor consortium derived from sediment of the River Saale, Germany. Total community DNA was extracted and bacterial 16S rRNA genes were subsequently amplified using conserved primers. A clone library was constructed and analysed by sequencing the 16S rDNA inserts of randomly chosen clones followed by dot blot hybridization with labelled polynucleotide probes. The phylogenetic analysis revealed significant sequence similarities of several as yet uncultured bacterial species in the bioreactor to those found in other reductively dechlorinating freshwater consortia. In contrast, no close relationship was obtained with as yet uncultured bacteria found in reductively dechlorinating consortia derived from marine habitats. One rDNA clone showed >97% sequence similarity to Dehalobacter species, known for reductive dechlorination of tri- and tetrachloroethene. These results suggest that reductive dechlorination in microbial freshwater habitats depends upon a specific bacterial community structure.

  12. Contamination of sequence databases with adaptor sequences

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yoshikawa, Takeo; Sanders, A.R.; Detera-Wadleigh, S.D.

    Because of the exponential increase in the amount of DNA sequences being added to the public databases on a daily basis, it has become imperative to identify sources of contamination rapidly. Previously, contaminations of sequence databases have been reported to alert the scientific community to the problem. These contaminations can be divided into two categories. The first category comprises host sequences that have been difficult for submitters to manage or control. Examples include anomalous sequences derived from Escherichia coli, which are inserted into the chromosomes (and plasmids) of the bacterial hosts. Insertion sequences are highly mobile and are capable ofmore » transposing themselves into plasmids during cloning manipulation. Another example of the first category is the infection with yeast genomic DNA or with bacterial DNA of some commercially available cDNA libraries from Clontech. The second category of database contamination is due to the inadvertent inclusion of nonhost sequences. This category includes incorporation of cloning-vector sequences and multicloning sites in the database submission. M13-derived artifacts have been common, since M13-based vectors have been widely used for subcloning DNA fragments. Recognizing this problem, the National Center for Biotechnology Information (NCBI) started to screen, in April 1994, all sequences directly submitted to GenBank, against a set of vector data retrieved from GenBank by use of key-word searches, such as {open_quotes}vector.{close_quotes} In this report, we present evidence for another sequence artifact that is widespread but that, to our knowledge, has not yet been reported. 11 refs., 1 tab.« less

  13. Short- and Long-term Evolutionary Dynamics of Bacterial Insertion Sequences: Insights from Wolbachia Endosymbionts

    PubMed Central

    Cerveau, Nicolas; Leclercq, Sébastien; Leroy, Elodie; Bouchon, Didier; Cordaux, Richard

    2011-01-01

    Transposable elements (TE) are one of the major driving forces of genome evolution, raising the question of the long-term dynamics underlying their evolutionary success. Long-term TE evolution can readily be reconstructed in eukaryotes, thanks to many degraded copies constituting genomic fossil records of past TE proliferations. By contrast, bacterial genomes usually experience high sequence turnover and short TE retention times, thereby obscuring ancient TE evolutionary patterns. We found that Wolbachia bacterial genomes contain 52–171 insertion sequence (IS) TEs. IS account for 11% of Wolbachia wRi, which is one of the highest IS genomic coverage reported in prokaryotes to date. We show that many IS groups are currently expanding in various Wolbachia genomes and that IS horizontal transfers are frequent among strains, which can explain the apparent synchronicity of these IS proliferations. Remarkably, >70% of Wolbachia IS are nonfunctional. They constitute an unusual bacterial IS genomic fossil record providing direct empirical evidence for a long-term IS evolutionary dynamics following successive periods of intense transpositional activity. Our results show that comprehensive IS annotations have the potential to provide new insights into prokaryote TE evolution and, more generally, prokaryote genome evolution. Indeed, the identification of an important IS genomic fossil record in Wolbachia demonstrates that IS elements are not always of recent origin, contrary to the conventional view of TE evolution in prokaryote genomes. Our results also raise the question whether the abundance of IS fossils is specific to Wolbachia or it may be a general, albeit overlooked, feature of prokaryote genomes. PMID:21940637

  14. Short- and long-term evolutionary dynamics of bacterial insertion sequences: insights from Wolbachia endosymbionts.

    PubMed

    Cerveau, Nicolas; Leclercq, Sébastien; Leroy, Elodie; Bouchon, Didier; Cordaux, Richard

    2011-01-01

    Transposable elements (TE) are one of the major driving forces of genome evolution, raising the question of the long-term dynamics underlying their evolutionary success. Long-term TE evolution can readily be reconstructed in eukaryotes, thanks to many degraded copies constituting genomic fossil records of past TE proliferations. By contrast, bacterial genomes usually experience high sequence turnover and short TE retention times, thereby obscuring ancient TE evolutionary patterns. We found that Wolbachia bacterial genomes contain 52-171 insertion sequence (IS) TEs. IS account for 11% of Wolbachia wRi, which is one of the highest IS genomic coverage reported in prokaryotes to date. We show that many IS groups are currently expanding in various Wolbachia genomes and that IS horizontal transfers are frequent among strains, which can explain the apparent synchronicity of these IS proliferations. Remarkably, >70% of Wolbachia IS are nonfunctional. They constitute an unusual bacterial IS genomic fossil record providing direct empirical evidence for a long-term IS evolutionary dynamics following successive periods of intense transpositional activity. Our results show that comprehensive IS annotations have the potential to provide new insights into prokaryote TE evolution and, more generally, prokaryote genome evolution. Indeed, the identification of an important IS genomic fossil record in Wolbachia demonstrates that IS elements are not always of recent origin, contrary to the conventional view of TE evolution in prokaryote genomes. Our results also raise the question whether the abundance of IS fossils is specific to Wolbachia or it may be a general, albeit overlooked, feature of prokaryote genomes.

  15. Instability of plasmid DNA sequences: macro and micro evolution of the antibiotic resistance plasmid R6-5.

    PubMed

    Timmis, K N; Cabello, F; Andrés, I; Nordheim, A; Burkhardt, H J; Cohen, S N

    1978-11-16

    Detailed examination of the structure of cloned DNA fragments of the R6-5 antibiotic resistance plasmid has revealed a substantial degree of polynucleotide sequence heterogeneity and indicates that sequence rearrangements in plasmids and possible other replicons occur more frequently than has hitherto been appreciated. The sequences changes in cloned R6-5 fragments were shown in some instances to have occurred prior to cloning, i.e. existing in the original population of R6-5 molecules that was obtained from a single bacterial clone and by several different criteria judged to be homogeneous, and in others to have occurred either during the cloning procedure or during subsequent propagation of hybrid molecules. The molecular changes that are described involved insertion/deletion of the previously characterized IS2 insertion element, formation of a new inverted repeat structure probably by duplication of a preexisting R6-5 DNA sequence, sequence inversion, and loss and gain of restriction endonuclease cleavage sites.

  16. Premature terminator analysis sheds light on a hidden world of bacterial transcriptional attenuation.

    PubMed

    Naville, Magali; Gautheret, Daniel

    2010-01-01

    Bacterial transcription attenuation occurs through a variety of cis-regulatory elements that control gene expression in response to a wide range of signals. The signal-sensing structures in attenuators are so diverse and rapidly evolving that only a small fraction have been properly annotated and characterized to date. Here we apply a broad-spectrum detection tool in order to achieve a more complete view of the transcriptional attenuation complement of key bacterial species. Our protocol seeks gene families with an unusual frequency of 5' terminators found across multiple species. Many of the detected attenuators are part of annotated elements, such as riboswitches or T-boxes, which often operate through transcriptional attenuation. However, a significant fraction of candidates were not previously characterized in spite of their unmistakable footprint. We further characterized some of these new elements using sequence and secondary structure analysis. We also present elements that may control the expression of several non-homologous genes, suggesting co-transcription and response to common signals. An important class of such elements, which we called mobile attenuators, is provided by 3' terminators of insertion sequences or prophages that may be exapted as 5' regulators when inserted directly upstream of a cellular gene. We show here that attenuators involve a complex landscape of signal-detection structures spanning the entire bacterial domain. We discuss possible scenarios through which these diverse 5' regulatory structures may arise or evolve.

  17. Insertion sequence diversity in archaea.

    PubMed

    Filée, J; Siguier, P; Chandler, M

    2007-03-01

    Insertion sequences (ISs) can constitute an important component of prokaryotic (bacterial and archaeal) genomes. Over 1,500 individual ISs are included at present in the ISfinder database (www-is.biotoul.fr), and these represent only a small portion of those in the available prokaryotic genome sequences and those that are being discovered in ongoing sequencing projects. In spite of this diversity, the transposition mechanisms of only a few of these ubiquitous mobile genetic elements are known, and these are all restricted to those present in bacteria. This review presents an overview of ISs within the archaeal kingdom. We first provide a general historical summary of the known properties and behaviors of archaeal ISs. We then consider how transposition might be regulated in some cases by small antisense RNAs and by termination codon readthrough. This is followed by an extensive analysis of the IS content in the sequenced archaeal genomes present in the public databases as of June 2006, which provides an overview of their distribution among the major archaeal classes and species. We show that the diversity of archaeal ISs is very great and comparable to that of bacteria. We compare archaeal ISs to known bacterial ISs and find that most are clearly members of families first described for bacteria. Several cases of lateral gene transfer between bacteria and archaea are clearly documented, notably for methanogenic archaea. However, several archaeal ISs do not have bacterial equivalents but can be grouped into Archaea-specific groups or families. In addition to ISs, we identify and list nonautonomous IS-derived elements, such as miniature inverted-repeat transposable elements. Finally, we present a possible scenario for the evolutionary history of ISs in the Archaea.

  18. Genome-Wide Identification by Transposon Insertion Sequencing of Escherichia coli K1 Genes Essential for In Vitro Growth, Gastrointestinal Colonizing Capacity, and Survival in Serum.

    PubMed

    McCarthy, Alex J; Stabler, Richard A; Taylor, Peter W

    2018-04-01

    Escherichia coli K1 strains are major causative agents of invasive disease of newborn infants. The age dependency of infection can be reproduced in neonatal rats. Colonization of the small intestine following oral administration of K1 bacteria leads rapidly to invasion of the blood circulation; bacteria that avoid capture by the mesenteric lymphatic system and evade antibacterial mechanisms in the blood may disseminate to cause organ-specific infections such as meningitis. Some E. coli K1 surface constituents, in particular the polysialic acid capsule, are known to contribute to invasive potential, but a comprehensive picture of the factors that determine the fully virulent phenotype has not emerged so far. We constructed a library and constituent sublibraries of ∼775,000 Tn 5 transposon mutants of E. coli K1 strain A192PP and employed transposon-directed insertion site sequencing (TraDIS) to identify genes required for fitness for infection of 2-day-old rats. Transposon insertions were lacking in 357 genes following recovery on selective agar; these genes were considered essential for growth in nutrient-replete medium. Colonization of the midsection of the small intestine was facilitated by 167 E. coli K1 gene products. Restricted bacterial translocation across epithelial barriers precluded TraDIS analysis of gut-to-blood and blood-to-brain transits; 97 genes were required for survival in human serum. This study revealed that a large number of bacterial genes, many of which were not previously associated with systemic E. coli K1 infection, are required to realize full invasive potential. IMPORTANCE Escherichia coli K1 strains cause life-threatening infections in newborn infants. They are acquired from the mother at birth and colonize the small intestine, from where they invade the blood and central nervous system. It is difficult to obtain information from acutely ill patients that sheds light on physiological and bacterial factors determining invasive disease. Key aspects of naturally occurring age-dependent human infection can be reproduced in neonatal rats. Here, we employ transposon-directed insertion site sequencing to identify genes essential for the in vitro growth of E. coli K1 and genes that contribute to the colonization of susceptible rats. The presence of bottlenecks to invasion of the blood and cerebrospinal compartments precluded insertion site sequencing analysis, but we identified genes for survival in serum. Copyright © 2018 McCarthy et al.

  19. Genome-Wide Identification by Transposon Insertion Sequencing of Escherichia coli K1 Genes Essential for In Vitro Growth, Gastrointestinal Colonizing Capacity, and Survival in Serum

    PubMed Central

    McCarthy, Alex J.

    2018-01-01

    ABSTRACT Escherichia coli K1 strains are major causative agents of invasive disease of newborn infants. The age dependency of infection can be reproduced in neonatal rats. Colonization of the small intestine following oral administration of K1 bacteria leads rapidly to invasion of the blood circulation; bacteria that avoid capture by the mesenteric lymphatic system and evade antibacterial mechanisms in the blood may disseminate to cause organ-specific infections such as meningitis. Some E. coli K1 surface constituents, in particular the polysialic acid capsule, are known to contribute to invasive potential, but a comprehensive picture of the factors that determine the fully virulent phenotype has not emerged so far. We constructed a library and constituent sublibraries of ∼775,000 Tn5 transposon mutants of E. coli K1 strain A192PP and employed transposon-directed insertion site sequencing (TraDIS) to identify genes required for fitness for infection of 2-day-old rats. Transposon insertions were lacking in 357 genes following recovery on selective agar; these genes were considered essential for growth in nutrient-replete medium. Colonization of the midsection of the small intestine was facilitated by 167 E. coli K1 gene products. Restricted bacterial translocation across epithelial barriers precluded TraDIS analysis of gut-to-blood and blood-to-brain transits; 97 genes were required for survival in human serum. This study revealed that a large number of bacterial genes, many of which were not previously associated with systemic E. coli K1 infection, are required to realize full invasive potential. IMPORTANCE Escherichia coli K1 strains cause life-threatening infections in newborn infants. They are acquired from the mother at birth and colonize the small intestine, from where they invade the blood and central nervous system. It is difficult to obtain information from acutely ill patients that sheds light on physiological and bacterial factors determining invasive disease. Key aspects of naturally occurring age-dependent human infection can be reproduced in neonatal rats. Here, we employ transposon-directed insertion site sequencing to identify genes essential for the in vitro growth of E. coli K1 and genes that contribute to the colonization of susceptible rats. The presence of bottlenecks to invasion of the blood and cerebrospinal compartments precluded insertion site sequencing analysis, but we identified genes for survival in serum. PMID:29339415

  20. Structural features of the rice chromosome 4 centromere.

    PubMed

    Zhang, Yu; Huang, Yuchen; Zhang, Lei; Li, Ying; Lu, Tingting; Lu, Yiqi; Feng, Qi; Zhao, Qiang; Cheng, Zhukuan; Xue, Yongbiao; Wing, Rod A; Han, Bin

    2004-01-01

    A complete sequence of a chromosome centromere is necessary for fully understanding centromere function. We reported the sequence structures of the first complete rice chromosome centromere through sequencing a large insert bacterial artificial chromosome clone-based contig, which covered the rice chromosome 4 centromere. Complete sequencing of the 124-kb rice chromosome 4 centromere revealed that it consisted of 18 tracts of 379 tandemly arrayed repeats known as CentO and a total of 19 centromeric retroelements (CRs) but no unique sequences were detected. Four tracts, composed of 65 CentO repeats, were located in the opposite orientation, and 18 CentO tracts were flanked by 19 retroelements. The CRs were classified into four types, and the type I retroelements appeared to be more specific to rice centromeres. The preferential insert of the CRs among CentO repeats indicated that the centromere-specific retroelements may contribute to centromere expansion during evolution. The presence of three intact retrotransposons in the centromere suggests that they may be responsible for functional centromere initiation through a transcription-mediated mechanism.

  1. Cloning vector

    DOEpatents

    Guilfoyle, Richard A.; Smith, Lloyd M.

    1994-01-01

    A vector comprising a filamentous phage sequence containing a first copy of filamentous phage gene X and other sequences necessary for the phage to propagate is disclosed. The vector also contains a second copy of filamentous phage gene X downstream from a promoter capable of promoting transcription in a bacterial host. In a preferred form of the present invention, the filamentous phage is M13 and the vector additionally includes a restriction endonuclease site located in such a manner as to substantially inactivate the second gene X when a DNA sequence is inserted into the restriction site.

  2. Cloning vector

    DOEpatents

    Guilfoyle, R.A.; Smith, L.M.

    1994-12-27

    A vector comprising a filamentous phage sequence containing a first copy of filamentous phage gene X and other sequences necessary for the phage to propagate is disclosed. The vector also contains a second copy of filamentous phage gene X downstream from a promoter capable of promoting transcription in a bacterial host. In a preferred form of the present invention, the filamentous phage is M13 and the vector additionally includes a restriction endonuclease site located in such a manner as to substantially inactivate the second gene X when a DNA sequence is inserted into the restriction site. 2 figures.

  3. Recombinant Collagen Engineered to Bind to Discoidin Domain Receptor Functions as a Receptor Inhibitor*

    PubMed Central

    An, Bo; Abbonante, Vittorio; Xu, Huifang; Gavriilidou, Despoina; Yoshizumi, Ayumi; Bihan, Dominique; Farndale, Richard W.; Kaplan, David L.; Balduini, Alessandra; Leitinger, Birgit; Brodsky, Barbara

    2016-01-01

    A bacterial collagen-like protein Scl2 has been developed as a recombinant collagen model system to host human collagen ligand-binding sequences, with the goal of generating biomaterials with selective collagen bioactivities. Defined binding sites in human collagen for integrins, fibronectin, heparin, and MMP-1 have been introduced into the triple-helical domain of the bacterial collagen and led to the expected biological activities. The modular insertion of activities is extended here to the discoidin domain receptors (DDRs), which are collagen-activated receptor tyrosine kinases. Insertion of the DDR-binding sequence from human collagen III into bacterial collagen led to specific receptor binding. However, even at the highest testable concentrations, the construct was unable to stimulate DDR autophosphorylation. The recombinant collagen expressed in Escherichia coli does not contain hydroxyproline (Hyp), and complementary synthetic peptide studies showed that replacement of Hyp by Pro at the critical Gly-Val-Met-Gly-Phe-Hyp position decreased the DDR-binding affinity and consequently required a higher concentration for the induction of receptor activation. The ability of the recombinant bacterial collagen to bind the DDRs without inducing kinase activation suggested it could interfere with the interactions between animal collagen and the DDRs, and such an inhibitory role was confirmed in vitro and with a cell migration assay. This study illustrates that recombinant collagen can complement synthetic peptides in investigating structure-activity relationships, and this system has the potential for the introduction or inhibition of specific biological activities. PMID:26702058

  4. (New hosts and vectors for genome cloning)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    The main goal of our project remains the development of new bacterial hosts and vectors for the stable propagation of human DNA clones in E. coli. During the past six months of our current budget period, we have (1) continued to develop new hosts that permit the stable maintenance of unstable features of human DNA, and (2) developed a series of vectors for (a) cloning large DNA inserts, (b) assessing the frequency of human sequences that are lethal to the growth of E. coli, and (c) assessing the stability of human sequences cloned in M13 for large-scale sequencing projects.

  5. [New hosts and vectors for genome cloning]. Progress report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    The main goal of our project remains the development of new bacterial hosts and vectors for the stable propagation of human DNA clones in E. coli. During the past six months of our current budget period, we have (1) continued to develop new hosts that permit the stable maintenance of unstable features of human DNA, and (2) developed a series of vectors for (a) cloning large DNA inserts, (b) assessing the frequency of human sequences that are lethal to the growth of E. coli, and (c) assessing the stability of human sequences cloned in M13 for large-scale sequencing projects.

  6. Evolutionary genomics of miniature inverted-repeat transposable elements (MITEs) in Brassica.

    PubMed

    Nouroz, Faisal; Noreen, Shumaila; Heslop-Harrison, J S

    2015-12-01

    Miniature inverted-repeat transposable elements (MITEs) are truncated derivatives of autonomous DNA transposons, and are dispersed abundantly in most eukaryotic genomes. We aimed to characterize various MITEs families in Brassica in terms of their presence, sequence characteristics and evolutionary activity. Dot plot analyses involving comparison of homoeologous bacterial artificial chromosome (BAC) sequences allowed identification of 15 novel families of mobile MITEs. Of which, 5 were Stowaway-like with TA Target Site Duplications (TSDs), 4 Tourist-like with TAA/TTA TSDs, 5 Mutator-like with 9-10 bp TSDs and 1 novel MITE (BoXMITE1) flanked by 3 bp TSDs. Our data suggested that there are about 30,000 MITE-related sequences in Brassica rapa and B. oleracea genomes. In situ hybridization showed one abundant family was dispersed in the A-genome, while another was located near 45S rDNA sites. PCR analysis using primers flanking sequences of MITE elements detected MITE insertion polymorphisms between and within the three Brassica (AA, BB, CC) genomes, with many insertions being specific to single genomes and others showing evidence of more recent evolutionary insertions. Our BAC sequence comparison strategy enables identification of evolutionarily active MITEs with no prior knowledge of MITE sequences. The details of MITE families reported in Brassica enable their identification, characterization and annotation. Insertion polymorphisms of MITEs and their transposition activity indicated important mechanism of genome evolution and diversification. MITE families derived from known Mariner, Harbinger and Mutator DNA transposons were discovered, as well as some novel structures. The identification of Brassica MITEs will have broad applications in Brassica genomics, breeding, hybridization and phylogeny through their use as DNA markers.

  7. Characterisation of IS153, an IS3-family insertion sequence isolated from Lactobacillus sanfranciscensis and its use for strain differentiation.

    PubMed

    Ehrmann, M A; Vogel, R E

    2001-11-01

    An insertion sequence has been identified in the genome of Lactobacillus sanfranciscensis DSM 20451T as segment of 1351 nucleotides containing 37-bp imperfect terminal inverted repeats. The sequence of this element encodes two out of phase, overlapping open reading frames, orfA and orfB, from which three putative proteins are produced. OrfAB is a transframe protein produced by -1 translational frame shifting between orf A and orf B that is presumed to be the transposase. The large orfAB of this element encodes a 342 amino acid protein that displays similarities with transposases encoded by bacterial insertion sequences belonging to the IS3 family. In L. sanfranciscensis type strain DSM 20451T multiple truncated IS elements were identified. Inverse PCR was used to analyze target sites of four of these elements, but except of their highly AT rich character not any sequence specificity was identified so far. Moreover, no flanking direct repeats were identified. Multiple copies of IS153 were detected by hybridization in other strains of L. sanfranciscensis. Resulting hybridization patterns were shown to differentiate between organisms at strain level rather than a probe targeted against the 16S rDNA. With a PCR based approach IS153 or highly similar sequences were detected in L. acidophilus, L. casei, L. malefermentans, L. plantarum, L. hilgardii, L. collinoides L. farciminis L. sakei and L. salivarius, L. reuteri as well as in Enterococcus faecium, Pediococcus acidilactici and P. pentosaceus.

  8. Safe genetically engineered plants

    NASA Astrophysics Data System (ADS)

    Rosellini, D.; Veronesi, F.

    2007-10-01

    The application of genetic engineering to plants has provided genetically modified plants (GMPs, or transgenic plants) that are cultivated worldwide on increasing areas. The most widespread GMPs are herbicide-resistant soybean and canola and insect-resistant corn and cotton. New GMPs that produce vaccines, pharmaceutical or industrial proteins, and fortified food are approaching the market. The techniques employed to introduce foreign genes into plants allow a quite good degree of predictability of the results, and their genome is minimally modified. However, some aspects of GMPs have raised concern: (a) control of the insertion site of the introduced DNA sequences into the plant genome and of its mutagenic effect; (b) presence of selectable marker genes conferring resistance to an antibiotic or an herbicide, linked to the useful gene; (c) insertion of undesired bacterial plasmid sequences; and (d) gene flow from transgenic plants to non-transgenic crops or wild plants. In response to public concerns, genetic engineering techniques are continuously being improved. Techniques to direct foreign gene integration into chosen genomic sites, to avoid the use of selectable genes or to remove them from the cultivated plants, to reduce the transfer of undesired bacterial sequences, and make use of alternative, safer selectable genes, are all fields of active research. In our laboratory, some of these new techniques are applied to alfalfa, an important forage plant. These emerging methods for plant genetic engineering are briefly reviewed in this work.

  9. Bacterial and archaeal diversity in two hot spring microbial mats from the geothermal region of Tengchong, China.

    PubMed

    Pagaling, Eulyn; Grant, William D; Cowan, Don A; Jones, Brian E; Ma, Yanhe; Ventosa, Antonio; Heaphy, Shaun

    2012-07-01

    We investigated the bacterial and archaeal diversity in two hot spring microbial mats from the geothermal region of Tengchong in the Yunnan Province, China, using direct molecular analyses. The Langpu (LP) laminated mat was found by the side of a boiling pool with temperature of 60-65 °C and a pH of 8.5, while the Tengchong (TC) streamer mat consisted of white streamers in a slightly acidic (pH 6.5) hot pool outflow with a temperature of 72 °C. Four 16S rRNA gene clone libraries were constructed and restriction enzyme analysis of the inserts was used to identify unique sequences and clone frequencies. From almost 200 clones screened, 55 unique sequences were retrieved. Phylogenetic analysis showed that the LP mat consisted of a diverse bacterial population [Cyanobacteria, Chloroflexi, Chlorobia, Nitrospirae, 'Deinococcus-Thermus', Proteobacteria (alpha, beta and delta subdivisions), Firmicutes, Bacteroidetes and Actinobacteria], while the archaeal population was dominated by methanogenic Euryarchaeota and Crenarchaeota. In contrast, the TC streamer mat consisted of a bacterial population dominated by Aquificae, while the archaeal population also contained Korarchaeota as well as Crenarchaeota and methanogenic Euryarchaeota. These mats harboured clone sequences affiliated to unidentified lineages, suggesting that they are a potential source for discovering novel bacteria and archaea.

  10. [New hosts and vectors for genome cloning]. Progress report, 1990--1991

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    The main goal of our project remains the development of new bacterial hosts and vectors for the stable propagation of human DNA clones in E. coli. During the past six months of our current budget period, we have (1) continued to develop new hosts that permit the stable maintenance of unstable features of human DNA, and (2) developed a series of vectors for (a) cloning large DNA inserts, (b) assessing the frequency of human sequences that are lethal to the growth of E. coli, and (c) assessing the stability of human sequences cloned in M13 for large-scale sequencing projects.

  11. CRISPR regulation of intraspecies diversification by limiting IS transposition and intercellular recombination.

    PubMed

    Watanabe, Takayasu; Nozawa, Takashi; Aikawa, Chihiro; Amano, Atsuo; Maruyama, Fumito; Nakagawa, Ichiro

    2013-01-01

    Mobile genetic elements (MGEs) and genetic rearrangement are considered as major driving forces of bacterial diversification. Previous comparative genome analysis of Porphyromonas gingivalis, a pathogen related to periodontitis, implied such an important relationship. As a counterpart system to MGEs, clustered regularly interspaced short palindromic repeats (CRISPRs) in bacteria may be useful for genetic typing. We found that CRISPR typing could be a reasonable alternative to conventional methods for characterizing phylogenetic relationships among 60 highly diverse P. gingivalis isolates. Examination of genetic recombination along with multilocus sequence typing suggests the importance of such events between different isolates. MGEs appear to be strategically located at the breakpoint gaps of complicated genome rearrangements. Of these MGEs, insertion sequences (ISs) were found most frequently. CRISPR analysis identified 2,150 spacers that were clustered into 1,187 unique ones. Most of these spacers exhibited no significant nucleotide similarity to known sequences (97.6%: 1,158/1,187). Surprisingly, CRISPR spacers exhibiting high nucleotide similarity to regions of P. gingivalis genomes including ISs were predominant. The proportion of such spacers to all the unique spacers (1.6%: 19/1,187) was the highest among previous studies, suggesting novel functions for these CRISPRs. These results indicate that P. gingivalis is a bacterium with high intraspecies diversity caused by frequent insertion sequence (IS) transposition, whereas both the introduction of foreign DNA, primarily from other P. gingivalis cells, and IS transposition are limited by CRISPR interference. It is suggested that P. gingivalis CRISPRs could be an important source for understanding the role of CRISPRs in the development of bacterial diversity.

  12. Increasing genomic diversity and evidence of constrained lifestyle evolution due to insertion sequences in Aeromonas salmonicida.

    PubMed

    Vincent, Antony T; Trudel, Mélanie V; Freschi, Luca; Nagar, Vandan; Gagné-Thivierge, Cynthia; Levesque, Roger C; Charette, Steve J

    2016-01-12

    Aeromonads make up a group of Gram-negative bacteria that includes human and fish pathogens. The Aeromonas salmonicida species has the peculiarity of including five known subspecies. However, few studies of the genomes of A. salmonicida subspecies have been reported to date. We sequenced the genomes of additional A. salmonicida isolates, including three from India, using next-generation sequencing in order to gain a better understanding of the genomic and phylogenetic links between A. salmonicida subspecies. Their relative phylogenetic positions were confirmed by a core genome phylogeny based on 1645 gene sequences. The Indian isolates, which formed a sub-group together with A. salmonicida subsp. pectinolytica, were able to grow at either at 18 °C and 37 °C, unlike the A. salmonicida psychrophilic isolates that did not grow at 37 °C. Amino acid frequencies, GC content, tRNA composition, loss and gain of genes during evolution, pseudogenes as well as genes under positive selection and the mobilome were studied to explain this intraspecies dichotomy. Insertion sequences appeared to be an important driving force that locked the psychrophilic strains into their particular lifestyle in order to conserve their genomic integrity. This observation, based on comparative genomics, is in agreement with previous results showing that insertion sequence mobility induced by heat in A. salmonicida subspecies causes genomic plasticity, resulting in a deleterious effect on the virulence of the bacterium. We provide a proof-of-concept that selfish DNAs play a major role in the evolution of bacterial species by modeling genomes.

  13. Sequence diversity of NanA manifests in distinct enzyme kinetics and inhibitor susceptibility

    NASA Astrophysics Data System (ADS)

    Xu, Zhongli; von Grafenstein, Susanne; Walther, Elisabeth; Fuchs, Julian E.; Liedl, Klaus R.; Sauerbrei, Andreas; Schmidtke, Michaela

    2016-04-01

    Streptococcus pneumoniae is the leading pathogen causing bacterial pneumonia and meningitis. Its surface-associated virulence factor neuraminidase A (NanA) promotes the bacterial colonization by removing the terminal sialyl residues from glycoconjugates on eukaryotic cell surface. The predominant role of NanA in the pathogenesis of pneumococci renders it an attractive target for therapeutic intervention. Despite the highly conserved activity of NanA, our alignment of the 11 NanAs revealed the evolutionary diversity of this enzyme. The amino acid substitutions we identified, particularly those in the lectin domain and in the insertion domain next to the catalytic centre triggered our special interest. We synthesised the representative NanAs and the mutagenized derivatives from E. coli for enzyme kinetics study and neuraminidase inhibitor susceptibility test. Via molecular docking we got a deeper insight into the differences between the two major variants of NanA and their influence on the ligand-target interactions. In addition, our molecular dynamics simulations revealed a prominent intrinsic flexibility of the linker between the active site and the insertion domain, which influences the inhibitor binding. Our findings for the first time associated the primary sequence diversity of NanA with the biochemical properties of the enzyme and with the inhibitory efficiency of neuraminidase inhibitors.

  14. New Insights into the Classification and Integration Specificity of Streptococcus Integrative Conjugative Elements through Extensive Genome Exploration

    PubMed Central

    Ambroset, Chloé; Coluzzi, Charles; Guédon, Gérard; Devignes, Marie-Dominique; Loux, Valentin; Lacroix, Thomas; Payot, Sophie; Leblond-Bourget, Nathalie

    2016-01-01

    Recent genome analyses suggest that integrative and conjugative elements (ICEs) are widespread in bacterial genomes and therefore play an essential role in horizontal transfer. However, only a few of these elements are precisely characterized and correctly delineated within sequenced bacterial genomes. Even though previous analysis showed the presence of ICEs in some species of Streptococci, the global prevalence and diversity of ICEs was not analyzed in this genus. In this study, we searched for ICEs in the completely sequenced genomes of 124 strains belonging to 27 streptococcal species. These exhaustive analyses revealed 105 putative ICEs and 26 slightly decayed elements whose limits were assessed and whose insertion site was identified. These ICEs were grouped in seven distinct unrelated or distantly related families, according to their conjugation modules. Integration of these streptococcal ICEs is catalyzed either by a site-specific tyrosine integrase, a low-specificity tyrosine integrase, a site-specific single serine integrase, a triplet of site-specific serine integrases or a DDE transposase. Analysis of their integration site led to the detection of 18 target-genes for streptococcal ICE insertion including eight that had not been identified previously (ftsK, guaA, lysS, mutT, rpmG, rpsI, traG, and ebfC). It also suggests that all specificities have evolved to minimize the impact of the insertion on the host. This overall analysis of streptococcal ICEs emphasizes their prevalence and diversity and demonstrates that exchanges or acquisitions of conjugation and recombination modules are frequent. PMID:26779141

  15. New Insights into the Classification and Integration Specificity of Streptococcus Integrative Conjugative Elements through Extensive Genome Exploration.

    PubMed

    Ambroset, Chloé; Coluzzi, Charles; Guédon, Gérard; Devignes, Marie-Dominique; Loux, Valentin; Lacroix, Thomas; Payot, Sophie; Leblond-Bourget, Nathalie

    2015-01-01

    Recent genome analyses suggest that integrative and conjugative elements (ICEs) are widespread in bacterial genomes and therefore play an essential role in horizontal transfer. However, only a few of these elements are precisely characterized and correctly delineated within sequenced bacterial genomes. Even though previous analysis showed the presence of ICEs in some species of Streptococci, the global prevalence and diversity of ICEs was not analyzed in this genus. In this study, we searched for ICEs in the completely sequenced genomes of 124 strains belonging to 27 streptococcal species. These exhaustive analyses revealed 105 putative ICEs and 26 slightly decayed elements whose limits were assessed and whose insertion site was identified. These ICEs were grouped in seven distinct unrelated or distantly related families, according to their conjugation modules. Integration of these streptococcal ICEs is catalyzed either by a site-specific tyrosine integrase, a low-specificity tyrosine integrase, a site-specific single serine integrase, a triplet of site-specific serine integrases or a DDE transposase. Analysis of their integration site led to the detection of 18 target-genes for streptococcal ICE insertion including eight that had not been identified previously (ftsK, guaA, lysS, mutT, rpmG, rpsI, traG, and ebfC). It also suggests that all specificities have evolved to minimize the impact of the insertion on the host. This overall analysis of streptococcal ICEs emphasizes their prevalence and diversity and demonstrates that exchanges or acquisitions of conjugation and recombination modules are frequent.

  16. Identification and characterization of a selenoprotein family containing a diselenide bond in a redox motif

    PubMed Central

    Shchedrina, Valentina A.; Novoselov, Sergey V.; Malinouski, Mikalai Yu.; Gladyshev, Vadim N.

    2007-01-01

    Selenocysteine (Sec, U) insertion into proteins is directed by translational recoding of specific UGA codons located upstream of a stem-loop structure known as Sec insertion sequence (SECIS) element. Selenoproteins with known functions are oxidoreductases containing a single redox-active Sec in their active sites. In this work, we identified a family of selenoproteins, designated SelL, containing two Sec separated by two other residues to form a UxxU motif. SelL proteins show an unusual occurrence, being present in diverse aquatic organisms, including fish, invertebrates, and marine bacteria. Both eukaryotic and bacterial SelL genes use single SECIS elements for insertion of two Sec. In eukaryotes, the SECIS is located in the 3′ UTR, whereas the bacterial SelL SECIS is within a coding region and positioned at a distance that supports the insertion of either of the two Sec or both of these residues. SelL proteins possess a thioredoxin-like fold wherein the UxxU motif corresponds to the catalytic CxxC motif in thioredoxins, suggesting a redox function of SelL proteins. Distantly related SelL-like proteins were also identified in a variety of organisms that had either one or both Sec replaced with Cys. Danio rerio SelL, transiently expressed in mammalian cells, incorporated two Sec and localized to the cytosol. In these cells, it occurred in an oxidized form and was not reducible by DTT. In a bacterial expression system, we directly demonstrated the formation of a diselenide bond between the two Sec, establishing it as the first diselenide bond found in a natural protein. PMID:17715293

  17. Genetic Control of Plant Root Colonization by the Biocontrol agent, Pseudomonas fluorescens

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cole, Benjamin J.; Fletcher, Meghan; Waters, Jordan

    Plant growth promoting rhizobacteria (PGPR) are a critical component of plant root ecosystems. PGPR promote plant growth by solubilizing inaccessible minerals, suppressing pathogenic microorganisms in the soil, and directly stimulating growth through hormone synthesis. Pseudomonas fluorescens is a well-established PGPR isolated from wheat roots that can also colonize the root system of the model plant, Arabidopsis thaliana. We have created barcoded transposon insertion mutant libraries suitable for genome-wide transposon-mediated mutagenesis followed by sequencing (TnSeq). These libraries consist of over 105 independent insertions, collectively providing loss-of-function mutants for nearly all genes in the P.fluorescens genome. Each insertion mutant can be unambiguouslymore » identified by a randomized 20 nucleotide sequence (barcode) engineered into the transposon sequence. We used these libraries in a gnotobiotic assay to examine the colonization ability of P.fluorescens on A.thaliana roots. Taking advantage of the ability to distinguish individual colonization events using barcode sequences, we assessed the timing and microbial concentration dependence of colonization of the rhizoplane niche. These data provide direct insight into the dynamics of plant root colonization in an in vivo system and define baseline parameters for the systematic identification of the bacterial genes and molecular pathways using TnSeq assays. Having determined parameters that facilitate potential colonization of roots by thousands of independent insertion mutants in a single assay, we are currently establishing a genome-wide functional map of genes required for root colonization in P.fluorescens. Importantly, the approach developed and optimized here for P.fluorescens>A.thaliana colonization will be applicable to a wide range of plant-microbe interactions, including biofuel feedstock plants and microbes known or hypothesized to impact on biofuel-relevant traits including biomass productivity and pathogen resistance.« less

  18. Random insertion and gene disruption via transposon mutagenesis of Ureaplasma parvum using a mini-transposon plasmid

    PubMed Central

    Aboklaish, Ali F.; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I.; Spiller, O. Brad

    2015-01-01

    While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. PMID:25444567

  19. Random insertion and gene disruption via transposon mutagenesis of Ureaplasma parvum using a mini-transposon plasmid.

    PubMed

    Aboklaish, Ali F; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I; Spiller, O Brad

    2014-11-01

    While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. Copyright © 2014 Elsevier GmbH. All rights reserved.

  20. Sequence determination and analysis of S-adenosyl-L-homocysteine hydrolase from yellow lupine (Lupinus luteus).

    PubMed

    Brzeziński, K; Janowski, R; Podkowiński, J; Jaskólski, M

    2001-01-01

    The coding sequences of two S-adenosyl-L-homocysteine hydrolases (SAHases) were identified in yellow lupine by screenig of a cDNA library. One of them, corresponding to the complete protein, was sequenced and compared with 52 other SAHase sequences. Phylogenetic analysis of these proteins identified three groups of the enzymes. Group A comprises only bacterial sequences. Group B is subdivided into two subgroups, one of which (B1) is formed by animal sequences. Subgroup B2 consist of two distinct clusters, B2a and B2b. Cluster B2b comprises all known plant sequences, including the yellow lupine enzyme, which are distinguished by a 50-residue insert. Group C is heterogeneous and contains SAHases from Archaea as well as a new class of animal enzymes, distinctly different from those in group B1.

  1. Application of signature-tagged mutagenesis to the study of virulence of Erwinia amylovora.

    PubMed

    Wang, Limei; Beer, Steven V

    2006-12-01

    To identify genes that contribute to the virulence of Erwinia amylovora in plants, 1892 mutants were created and screened in pools of < or =96 mutants using signature-tagged mutagenesis. Nineteen mutants were not recovered from apple shoots following inoculation, which suggested that the insertions in these mutants affected genes important for bacterial survival in planta. DNA flanking the Tn5 insertions in the 19 mutants was sequenced and analysed by blast. One mutant had a Tn5 insertion in amsE, a gene involved in the biosynthesis of exopolysaccaride (EPS). Fourteen mutants had insertions in loci that were implicated in biosynthesis or transport of particular amino acids or nucleotides, a site-specific recombinase active during cell division and several putative proteins of unknown function; the flanking DNA of the remaining four mutants lacked significant homology with any DNA in the database. When inoculated individually to hosts, 10 of the 19 mutants caused significantly less disease and multiplied less, as compared with the wild-type strain.

  2. Molecular complexity of successive bacterial epidemics deconvoluted by comparative pathogenomics.

    PubMed

    Beres, Stephen B; Carroll, Ronan K; Shea, Patrick R; Sitkiewicz, Izabela; Martinez-Gutierrez, Juan Carlos; Low, Donald E; McGeer, Allison; Willey, Barbara M; Green, Karen; Tyrrell, Gregory J; Goldman, Thomas D; Feldgarden, Michael; Birren, Bruce W; Fofanov, Yuriy; Boos, John; Wheaton, William D; Honisch, Christiane; Musser, James M

    2010-03-02

    Understanding the fine-structure molecular architecture of bacterial epidemics has been a long-sought goal of infectious disease research. We used short-read-length DNA sequencing coupled with mass spectroscopy analysis of SNPs to study the molecular pathogenomics of three successive epidemics of invasive infections involving 344 serotype M3 group A Streptococcus in Ontario, Canada. Sequencing the genome of 95 strains from the three epidemics, coupled with analysis of 280 biallelic SNPs in all 344 strains, revealed an unexpectedly complex population structure composed of a dynamic mixture of distinct clonally related complexes. We discovered that each epidemic is dominated by micro- and macrobursts of multiple emergent clones, some with distinct strain genotype-patient phenotype relationships. On average, strains were differentiated from one another by only 49 SNPs and 11 insertion-deletion events (indels) in the core genome. Ten percent of SNPs are strain specific; that is, each strain has a unique genome sequence. We identified nonrandom temporal-spatial patterns of strain distribution within and between the epidemic peaks. The extensive full-genome data permitted us to identify genes with significantly increased rates of nonsynonymous (amino acid-altering) nucleotide polymorphisms, thereby providing clues about selective forces operative in the host. Comparative expression microarray analysis revealed that closely related strains differentiated by seemingly modest genetic changes can have significantly divergent transcriptomes. We conclude that enhanced understanding of bacterial epidemics requires a deep-sequencing, geographically centric, comparative pathogenomics strategy.

  3. pLS010 plasmid vector

    DOEpatents

    Lacks, Sanford A.; Balganesh, Tanjore S.

    1988-01-01

    Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb malM gene fragment ligated to a 4.4 Kb T.sub.c r DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems.

  4. The construction of recombinant industrial yeasts free of bacterial sequences by directed gene replacement into a nonessential region of the genome.

    PubMed

    Xiao, W; Rank, G H

    1989-03-15

    The yeast SMR1 gene was used as a dominant resistance-selectable marker for industrial yeast transformation and for targeting integration of an economically important gene at the homologous ILV2 locus. A MEL1 gene, which codes for alpha-galactosidase, was inserted into a dispensable upstream region of SMR1 in vitro; different treatments of the plasmid (pWX813) prior to transformation resulted in 3' end, 5' end and replacement integrations that exhibited distinct integrant structures. One-step replacement within a nonessential region of the host genome generated a stable integration of MEL1 devoid of bacterial plasmid DNA. Using this method, we have constructed several alpha-galactosidase positive industrial Saccharomyces strains. Our study provides a general method for stable gene transfer in most industrial Saccharomyces yeasts, including those used in the baking, brewing (ale and lager), distilling, wine and sake industries, with solely nucleotide sequences of interest. The absence of bacterial DNA in the integrant structure facilitates the commercial application of recombinant DNA technology in the food and beverage industry.

  5. ISC, a Novel Group of Bacterial and Archaeal DNA Transposons That Encode Cas9 Homologs

    PubMed Central

    Kapitonov, Vladimir V.; Makarova, Kira S.

    2015-01-01

    ABSTRACT Bacterial genomes encode numerous homologs of Cas9, the effector protein of the type II CRISPR-Cas systems. The homology region includes the arginine-rich helix and the HNH nuclease domain that is inserted into the RuvC-like nuclease domain. These genes, however, are not linked to cas genes or CRISPR. Here, we show that Cas9 homologs represent a distinct group of nonautonomous transposons, which we denote ISC (insertion sequences Cas9-like). We identify many diverse families of full-length ISC transposons and demonstrate that their terminal sequences (particularly 3′ termini) are similar to those of IS605 superfamily transposons that are mobilized by the Y1 tyrosine transposase encoded by the TnpA gene and often also encode the TnpB protein containing the RuvC-like endonuclease domain. The terminal regions of the ISC and IS605 transposons contain palindromic structures that are likely recognized by the Y1 transposase. The transposons from these two groups are inserted either exactly in the middle or upstream of specific 4-bp target sites, without target site duplication. We also identify autonomous ISC transposons that encode TnpA-like Y1 transposases. Thus, the nonautonomous ISC transposons could be mobilized in trans either by Y1 transposases of other, autonomous ISC transposons or by Y1 transposases of the more abundant IS605 transposons. These findings imply an evolutionary scenario in which the ISC transposons evolved from IS605 family transposons, possibly via insertion of a mobile group II intron encoding the HNH domain, and Cas9 subsequently evolved via immobilization of an ISC transposon. IMPORTANCE Cas9 endonucleases, the effectors of type II CRISPR-Cas systems, represent the new generation of genome-engineering tools. Here, we describe in detail a novel family of transposable elements that encode the likely ancestors of Cas9 and outline the evolutionary scenario connecting different varieties of these transposons and Cas9. PMID:26712934

  6. Genome-Wide Spectra of Transcription Insertions and Deletions Reveal That Slippage Depends on RNA:DNA Hybrid Complementarity.

    PubMed

    Traverse, Charles C; Ochman, Howard

    2017-08-29

    Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola , which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. IMPORTANCE The high level of mistakes generated during transcription can result in the accumulation of malfunctioning and misfolded proteins which can alter global gene regulation and in the expenditure of energy to degrade these nonfunctional proteins. The transcriptome-wide occurrence of base substitutions has been elucidated in bacteria, but information on transcription insertions and deletions-errors that potentially have more dire effects on protein function-is limited to reporter gene constructs. Here, we capture the transcriptome-wide spectrum of insertions and deletions in Escherichia coli and Buchnera aphidicola and show that they occur at rates approaching those of base substitutions. Knowledge of the full extent of sequences subject to transcription indels supports a new model of bacterial transcription slippage, one that relies on the number of complementary bases between the transcript and the DNA template to which it slipped. Copyright © 2017 Traverse and Ochman.

  7. Tandem Fusion of Hepatitis B Core Antigen Allows Assembly of Virus-Like Particles in Bacteria and Plants with Enhanced Capacity to Accommodate Foreign Proteins

    PubMed Central

    Peyret, Hadrien; Gehin, Annick; Thuenemann, Eva C.; Blond, Donatienne; El Turabi, Aadil; Beales, Lucy; Clarke, Dean; Gilbert, Robert J. C.; Fry, Elizabeth E.; Stuart, David I.; Holmes, Kris; Stonehouse, Nicola J.; Whelan, Mike; Rosenberg, William; Lomonossoff, George P.; Rowlands, David J.

    2015-01-01

    The core protein of the hepatitis B virus, HBcAg, assembles into highly immunogenic virus-like particles (HBc VLPs) when expressed in a variety of heterologous systems. Specifically, the major insertion region (MIR) on the HBcAg protein allows the insertion of foreign sequences, which are then exposed on the tips of surface spike structures on the outside of the assembled particle. Here, we present a novel strategy which aids the display of whole proteins on the surface of HBc particles. This strategy, named tandem core, is based on the production of the HBcAg dimer as a single polypeptide chain by tandem fusion of two HBcAg open reading frames. This allows the insertion of large heterologous sequences in only one of the two MIRs in each spike, without compromising VLP formation. We present the use of tandem core technology in both plant and bacterial expression systems. The results show that tandem core particles can be produced with unmodified MIRs, or with one MIR in each tandem dimer modified to contain the entire sequence of GFP or of a camelid nanobody. Both inserted proteins are correctly folded and the nanobody fused to the surface of the tandem core particle (which we name tandibody) retains the ability to bind to its cognate antigen. This technology paves the way for the display of natively folded proteins on the surface of HBc particles either through direct fusion or through non-covalent attachment via a nanobody. PMID:25830365

  8. Miniature Transposable Sequences Are Frequently Mobilized in the Bacterial Plant Pathogen Pseudomonas syringae pv. phaseolicola

    PubMed Central

    Bardaji, Leire; Añorga, Maite; Jackson, Robert W.; Martínez-Bilbao, Alejandro; Yanguas-Casás, Natalia; Murillo, Jesús

    2011-01-01

    Mobile genetic elements are widespread in Pseudomonas syringae, and often associate with virulence genes. Genome reannotation of the model bean pathogen P. syringae pv. phaseolicola 1448A identified seventeen types of insertion sequences and two miniature inverted-repeat transposable elements (MITEs) with a biased distribution, representing 2.8% of the chromosome, 25.8% of the 132-kb virulence plasmid and 2.7% of the 52-kb plasmid. Employing an entrapment vector containing sacB, we estimated that transposition frequency oscillated between 2.6×10−5 and 1.1×10−6, depending on the clone, although it was stable for each clone after consecutive transfers in culture media. Transposition frequency was similar for bacteria grown in rich or minimal media, and from cells recovered from compatible and incompatible plant hosts, indicating that growth conditions do not influence transposition in strain 1448A. Most of the entrapped insertions contained a full-length IS801 element, with the remaining insertions corresponding to sequences smaller than any transposable element identified in strain 1448A, and collectively identified as miniature sequences. From these, fragments of 229, 360 and 679-nt of the right end of IS801 ended in a consensus tetranucleotide and likely resulted from one-ended transposition of IS801. An average 0.7% of the insertions analyzed consisted of IS801 carrying a fragment of variable size from gene PSPPH_0008/PSPPH_0017, showing that IS801 can mobilize DNA in vivo. Retrospective analysis of complete plasmids and genomes of P. syringae suggests, however, that most fragments of IS801 are likely the result of reorganizations rather than one-ended transpositions, and that this element might preferentially contribute to genome flexibility by generating homologous regions of recombination. A further miniature sequence previously found to affect host range specificity and virulence, designated MITEPsy1 (100-nt), represented an average 2.4% of the total number of insertions entrapped in sacB, demonstrating for the first time the mobilization of a MITE in bacteria. PMID:22016774

  9. Miniature transposable sequences are frequently mobilized in the bacterial plant pathogen Pseudomonas syringae pv. phaseolicola.

    PubMed

    Bardaji, Leire; Añorga, Maite; Jackson, Robert W; Martínez-Bilbao, Alejandro; Yanguas-Casás, Natalia; Murillo, Jesús

    2011-01-01

    Mobile genetic elements are widespread in Pseudomonas syringae, and often associate with virulence genes. Genome reannotation of the model bean pathogen P. syringae pv. phaseolicola 1448A identified seventeen types of insertion sequences and two miniature inverted-repeat transposable elements (MITEs) with a biased distribution, representing 2.8% of the chromosome, 25.8% of the 132-kb virulence plasmid and 2.7% of the 52-kb plasmid. Employing an entrapment vector containing sacB, we estimated that transposition frequency oscillated between 2.6×10(-5) and 1.1×10(-6), depending on the clone, although it was stable for each clone after consecutive transfers in culture media. Transposition frequency was similar for bacteria grown in rich or minimal media, and from cells recovered from compatible and incompatible plant hosts, indicating that growth conditions do not influence transposition in strain 1448A. Most of the entrapped insertions contained a full-length IS801 element, with the remaining insertions corresponding to sequences smaller than any transposable element identified in strain 1448A, and collectively identified as miniature sequences. From these, fragments of 229, 360 and 679-nt of the right end of IS801 ended in a consensus tetranucleotide and likely resulted from one-ended transposition of IS801. An average 0.7% of the insertions analyzed consisted of IS801 carrying a fragment of variable size from gene PSPPH_0008/PSPPH_0017, showing that IS801 can mobilize DNA in vivo. Retrospective analysis of complete plasmids and genomes of P. syringae suggests, however, that most fragments of IS801 are likely the result of reorganizations rather than one-ended transpositions, and that this element might preferentially contribute to genome flexibility by generating homologous regions of recombination. A further miniature sequence previously found to affect host range specificity and virulence, designated MITEPsy1 (100-nt), represented an average 2.4% of the total number of insertions entrapped in sacB, demonstrating for the first time the mobilization of a MITE in bacteria.

  10. Evolution of Sphingomonad Gene Clusters Related to Pesticide Catabolism Revealed by Genome Sequence and Mobilomics of Sphingobium herbicidovorans MH

    PubMed Central

    Nielsen, Tue Kjærgaard; Rasmussen, Morten; Demanèche, Sandrine; Cecillon, Sébastien; Vogel, Timothy M.

    2017-01-01

    Abstract Bacterial degraders of chlorophenoxy herbicides have been isolated from various ecosystems, including pristine environments. Among these degraders, the sphingomonads constitute a prominent group that displays versatile xenobiotic-degradation capabilities. Four separate sequencing strategies were required to provide the complete sequence of the complex and plastic genome of the canonical chlorophenoxy herbicide-degrading Sphingobium herbicidovorans MH. The genome has an intricate organization of the chlorophenoxy-herbicide catabolic genes sdpA, rdpA, and cadABCD that encode the (R)- and (S)-enantiomer-specific 2,4-dichlorophenoxypropionate dioxygenases and four subunits of a Rieske non-heme iron oxygenase involved in 2-methyl-chlorophenoxyacetic acid degradation, respectively. Several major genomic rearrangements are proposed to help understand the evolution and mobility of these important genes and their genetic context. Single-strain mobilomic sequence analysis uncovered plasmids and insertion sequence-associated circular intermediates in this environmentally important bacterium and enabled the description of evolutionary models for pesticide degradation in strain MH and related organisms. The mobilome presented a complex mosaic of mobile genetic elements including four plasmids and several circular intermediate DNA molecules of insertion-sequence elements and transposons that are central to the evolution of xenobiotics degradation. Furthermore, two individual chromosomally integrated prophages were shown to excise and form free circular DNA molecules. This approach holds great potential for improving the understanding of genome plasticity, evolution, and microbial ecology. PMID:28961970

  11. Optical mapping reveals a large genetic inversion between two methicillin-resistant Staphylococcus aureus strains.

    PubMed

    Shukla, Sanjay K; Kislow, Jennifer; Briska, Adam; Henkhaus, John; Dykes, Colin

    2009-09-01

    Staphylococcus aureus is a highly versatile and evolving bacterium of great clinical importance. S. aureus can evolve by acquiring single nucleotide polymorphisms and mobile genetic elements and by recombination events. Identification and location of novel genomic elements in a bacterial genome are not straightforward, unless the whole genome is sequenced. Optical mapping is a new tool that creates a high-resolution, in situ ordered restriction map of a bacterial genome. These maps can be used to determine genomic organization and perform comparative genomics to identify genomic rearrangements, such as insertions, deletions, duplications, and inversions, compared to an in silico (virtual) restriction map of a known genome sequence. Using this technology, we report here the identification, approximate location, and characterization of a genetic inversion of approximately 500 kb of a DNA element between the NRS387 (USA800) and FPR3757 (USA300) strains. The presence of the inversion and location of its junction sites were confirmed by site-specific PCR and sequencing. At both the left and right junction sites in NRS387, an IS1181 element and a 73-bp sequence were identified as inverted repeats, which could explain the possible mechanism of the inversion event.

  12. Targeting vector construction through recombineering.

    PubMed

    Malureanu, Liviu A

    2011-01-01

    Gene targeting in mouse embryonic stem cells is an essential, yet still very expensive and highly time-consuming, tool and method to study gene function at the organismal level or to create mouse models of human diseases. Conventional cloning-based methods have been largely used for generating targeting vectors, but are hampered by a number of limiting factors, including the variety and location of restriction enzymes in the gene locus of interest, the specific PCR amplification of repetitive DNA sequences, and cloning of large DNA fragments. Recombineering is a technique that exploits the highly efficient homologous recombination function encoded by λ phage in Escherichia coli. Bacteriophage-based recombination can recombine homologous sequences as short as 30-50 bases, allowing manipulations such as insertion, deletion, or mutation of virtually any genomic region. The large availability of mouse genomic bacterial artificial chromosome (BAC) libraries covering most of the genome facilitates the retrieval of genomic DNA sequences from the bacterial chromosomes through recombineering. This chapter describes a successfully applied protocol and aims to be a detailed guide through the steps of generation of targeting vectors through recombineering.

  13. pLS101 plasmid vector

    DOEpatents

    Lacks, S.A.; Balganesh, T.S.

    1985-02-19

    Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb ma1M gene fragment ligated to a 4.4 Kb Tcr DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems. 5 figs., 2 tabs.

  14. Small molecules enhance CRISPR genome editing in pluripotent stem cells.

    PubMed

    Yu, Chen; Liu, Yanxia; Ma, Tianhua; Liu, Kai; Xu, Shaohua; Zhang, Yu; Liu, Honglei; La Russa, Marie; Xie, Min; Ding, Sheng; Qi, Lei S

    2015-02-05

    The bacterial CRISPR-Cas9 system has emerged as an effective tool for sequence-specific gene knockout through non-homologous end joining (NHEJ), but it remains inefficient for precise editing of genome sequences. Here we develop a reporter-based screening approach for high-throughput identification of chemical compounds that can modulate precise genome editing through homology-directed repair (HDR). Using our screening method, we have identified small molecules that can enhance CRISPR-mediated HDR efficiency, 3-fold for large fragment insertions and 9-fold for point mutations. Interestingly, we have also observed that a small molecule that inhibits HDR can enhance frame shift insertion and deletion (indel) mutations mediated by NHEJ. The identified small molecules function robustly in diverse cell types with minimal toxicity. The use of small molecules provides a simple and effective strategy to enhance precise genome engineering applications and facilitates the study of DNA repair mechanisms in mammalian cells. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Effects of intrauterine contraception on the vaginal microbiota.

    PubMed

    Bassis, Christine M; Allsworth, Jenifer E; Wahl, Heather N; Sack, Daniel E; Young, Vincent B; Bell, Jason D

    2017-09-01

    There have been conflicting reports of altered vaginal microbiota and infection susceptibility associated with contraception use. The objectives of this study were to determine if intrauterine contraception altered the vaginal microbiota and to compare the effects of a copper intrauterine device (Cu-IUD) and a levonorgestrel intrauterine system (LNG-IUS) on the vaginal microbiota. DNA was isolated from the vaginal swab samples of 76 women using Cu-IUD (n=36) or LNG-IUS (n=40) collected prior to insertion of intrauterine contraception (baseline) and at 6 months. A third swab from approximately 12 months following insertion was available for 69 (Cu-IUD, n=33; LNG-IUS, n=36) of these women. The V4 region of the bacterial 16S rRNA-encoding gene was amplified from the vaginal swab DNA and sequenced. The 16S rRNA gene sequences were processed and analyzed using the software package mothur to compare the structure and dynamics of the vaginal bacterial communities. The vaginal microbiota from individuals in this study clustered into 3 major vaginal bacterial community types: one dominated by Lactobacillus iners, one dominated by Lactobacillus crispatus and one community type that was not dominated by a single Lactobacillus species. Changes in the vaginal bacterial community composition were not associated with the use of Cu-IUD or LNG-IUS. Additionally, we did not observe a clear difference in vaginal microbiota stability with Cu-IUD versus LNG-IUS use. Although the vaginal microbiota can be highly dynamic, alterations in the community associated with the use of intrauterine contraception (Cu-IUD or LNG-IUS) were not detected over 12 months. We found no evidence that intrauterine contraception (Cu-IUD or LNG-IUS) altered the vaginal microbiota composition. Therefore, the use of intrauterine contraception is unlikely to shift the composition of the vaginal microbiota such that infection susceptibility is altered. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Mitochondrial genes in the colourless alga Prototheca wickerhamii resemble plant genes in their exons but fungal genes in their introns.

    PubMed Central

    Wolff, G; Burger, G; Lang, B F; Kück, U

    1993-01-01

    The mitochondrial DNA from the colourless alga Prototheca wickerhamii contains two mosaic genes as was revealed from complete sequencing of the circular extranuclear genome. The genes for the large subunit of the ribosomal RNA (LSUrRNA) as well as for subunit I of the cytochrome oxidase (coxI) carry two and three intronic sequences respectively. On the basis of their canonical nucleotide sequences they can be classified as group I introns. Phylogenetic comparisons of the coxI protein sequences allow us to conclude that the P.wickerhamii mtDNA is much closer related to higher plant mtDNAs than to those of the chlorophyte alga C.reinhardtii. The comparison of the intron sequences revealed several unusual features: (1) The P.wickerhamii introns are structurally related to mitochondrial introns from various ascomycetous fungi. (2) Phylogenetic analyses indicate a close relationship between fungal and algal intronic sequences. (3) The P. wickerhamii introns are located at positions within the structural genes which can be considered as preferred intron insertion sites in homologous mitochondrial genes from fungi or liverwort. In all cases, the sequences adjacent to the insertion sites are very well conserved over large evolutionary distances. Our finding of highly similar introns in fungi and algae is consistent with the idea that introns have already been present in the bacterial ancestors of present day mitochondria and evolved concomitantly with the organelles. PMID:7680126

  17. Construction of Biologically Functional Bacterial Plasmids In Vitro

    PubMed Central

    Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Helling, Robert B.

    1973-01-01

    The construction of new plasmid DNA species by in vitro joining of restriction endonuclease-generated fragments of separate plasmids is described. Newly constructed plasmids that are inserted into Escherichia coli by transformation are shown to be biologically functional replicons that possess genetic properties and nucleotide base sequences from both of the parent DNA molecules. Functional plasmids can be obtained by reassociation of endonuclease-generated fragments of larger replicons, as well as by joining of plasmid DNA molecules of entirely different origins. Images PMID:4594039

  18. The Major Cold Shock Gene, cspA, Is Involved in the Susceptibility of Staphylococcus aureus to an Antimicrobial Peptide of Human Cathepsin G

    PubMed Central

    Katzif, Samuel; Danavall, Damien; Bowers, Samera; Balthazar, Jacqueline T.; Shafer, William M.

    2003-01-01

    A Tn551 insertional library of Staphylococcus aureus strain ISP479 was challenged with an antimicrobial peptide (CG 117-136) derived from human neutrophil cathepsin G (CG). After repeated selection and screening of surviving colonies, a mutant was identified that expressed increased resistance to CG 117-136. Southern hybridization analysis revealed that the Tn551 insert in this mutant (SK1) was carried on a 10.6-kb EcoRI chromosomal DNA fragment. Subsequent physical mapping of this Tn551 insert revealed that it was positioned between a putative promoter sequence and the translational start codon of the cspA gene, which encodes a protein (CspA) highly similar to the major cold shock proteins CspA and CspB of Escherichia coli and Bacillus subtilis, respectively. This Tn551 insertion as well as a separate deletion-insertion mutation in cspA decreased the capacity of S. aureus to respond to the stress of cold shock and increased resistance to CG 117-136. The results indicate for the first time that a physiologic link exists between bacterial susceptibility to an antimicrobial peptide and a stress response system. PMID:12874306

  19. The major cold shock gene, cspA, is involved in the susceptibility of Staphylococcus aureus to an antimicrobial peptide of human cathepsin G.

    PubMed

    Katzif, Samuel; Danavall, Damien; Bowers, Samera; Balthazar, Jacqueline T; Shafer, William M

    2003-08-01

    A Tn551 insertional library of Staphylococcus aureus strain ISP479 was challenged with an antimicrobial peptide (CG 117-136) derived from human neutrophil cathepsin G (CG). After repeated selection and screening of surviving colonies, a mutant was identified that expressed increased resistance to CG 117-136. Southern hybridization analysis revealed that the Tn551 insert in this mutant (SK1) was carried on a 10.6-kb EcoRI chromosomal DNA fragment. Subsequent physical mapping of this Tn551 insert revealed that it was positioned between a putative promoter sequence and the translational start codon of the cspA gene, which encodes a protein (CspA) highly similar to the major cold shock proteins CspA and CspB of Escherichia coli and Bacillus subtilis, respectively. This Tn551 insertion as well as a separate deletion-insertion mutation in cspA decreased the capacity of S. aureus to respond to the stress of cold shock and increased resistance to CG 117-136. The results indicate for the first time that a physiologic link exists between bacterial susceptibility to an antimicrobial peptide and a stress response system.

  20. Structure and Evolution of Chlorate Reduction Composite Transposons

    PubMed Central

    Clark, Iain C.; Melnyk, Ryan A.; Engelbrektson, Anna; Coates, John D.

    2013-01-01

    ABSTRACT The genes for chlorate reduction in six bacterial strains were analyzed in order to gain insight into the metabolism. A newly isolated chlorate-reducing bacterium (Shewanella algae ACDC) and three previously isolated strains (Ideonella dechloratans, Pseudomonas sp. strain PK, and Dechloromarinus chlorophilus NSS) were genome sequenced and compared to published sequences (Alicycliphilus denitrificans BC plasmid pALIDE01 and Pseudomonas chloritidismutans AW-1). De novo assembly of genomes failed to join regions adjacent to genes involved in chlorate reduction, suggesting the presence of repeat regions. Using a bioinformatics approach and finishing PCRs to connect fragmented contigs, we discovered that chlorate reduction genes are flanked by insertion sequences, forming composite transposons in all four newly sequenced strains. These insertion sequences delineate regions with the potential to move horizontally and define a set of genes that may be important for chlorate reduction. In addition to core metabolic components, we have highlighted several such genes through comparative analysis and visualization. Phylogenetic analysis places chlorate reductase within a functionally diverse clade of type II dimethyl sulfoxide (DMSO) reductases, part of a larger family of enzymes with reactivity toward chlorate. Nucleotide-level forensics of regions surrounding chlorite dismutase (cld), as well as its phylogenetic clustering in a betaproteobacterial Cld clade, indicate that cld has been mobilized at least once from a perchlorate reducer to build chlorate respiration. PMID:23919996

  1. The Essential Genome of Escherichia coli K-12

    PubMed Central

    2018-01-01

    ABSTRACT Transposon-directed insertion site sequencing (TraDIS) is a high-throughput method coupling transposon mutagenesis with short-fragment DNA sequencing. It is commonly used to identify essential genes. Single gene deletion libraries are considered the gold standard for identifying essential genes. Currently, the TraDIS method has not been benchmarked against such libraries, and therefore, it remains unclear whether the two methodologies are comparable. To address this, a high-density transposon library was constructed in Escherichia coli K-12. Essential genes predicted from sequencing of this library were compared to existing essential gene databases. To decrease false-positive identification of essential genes, statistical data analysis included corrections for both gene length and genome length. Through this analysis, new essential genes and genes previously incorrectly designated essential were identified. We show that manual analysis of TraDIS data reveals novel features that would not have been detected by statistical analysis alone. Examples include short essential regions within genes, orientation-dependent effects, and fine-resolution identification of genome and protein features. Recognition of these insertion profiles in transposon mutagenesis data sets will assist genome annotation of less well characterized genomes and provides new insights into bacterial physiology and biochemistry. PMID:29463657

  2. CRISPR-based screening of genomic island excision events in bacteria.

    PubMed

    Selle, Kurt; Klaenhammer, Todd R; Barrangou, Rodolphe

    2015-06-30

    Genomic analysis of Streptococcus thermophilus revealed that mobile genetic elements (MGEs) likely contributed to gene acquisition and loss during evolutionary adaptation to milk. Clustered regularly interspaced short palindromic repeats-CRISPR-associated genes (CRISPR-Cas), the adaptive immune system in bacteria, limits genetic diversity by targeting MGEs including bacteriophages, transposons, and plasmids. CRISPR-Cas systems are widespread in streptococci, suggesting that the interplay between CRISPR-Cas systems and MGEs is one of the driving forces governing genome homeostasis in this genus. To investigate the genetic outcomes resulting from CRISPR-Cas targeting of integrated MGEs, in silico prediction revealed four genomic islands without essential genes in lengths from 8 to 102 kbp, totaling 7% of the genome. In this study, the endogenous CRISPR3 type II system was programmed to target the four islands independently through plasmid-based expression of engineered CRISPR arrays. Targeting lacZ within the largest 102-kbp genomic island was lethal to wild-type cells and resulted in a reduction of up to 2.5-log in the surviving population. Genotyping of Lac(-) survivors revealed variable deletion events between the flanking insertion-sequence elements, all resulting in elimination of the Lac-encoding island. Chimeric insertion sequence footprints were observed at the deletion junctions after targeting all of the four genomic islands, suggesting a common mechanism of deletion via recombination between flanking insertion sequences. These results established that self-targeting CRISPR-Cas systems may direct significant evolution of bacterial genomes on a population level, influencing genome homeostasis and remodeling.

  3. Gene cloning and overexpression of a geranylgeranyl diphosphate synthase of an extremely thermophilic bacterium, Thermus thermophilus.

    PubMed

    Ohto, C; Ishida, C; Koike-Takeshita, A; Yokoyama, K; Muramatsu, M; Nishino, T; Obata, S

    1999-02-01

    A geranylgeranyl diphosphate (GGPP) synthase gene of an extremely thermophilic bacterium, Thermus thermophilus, was cloned and sequenced. T. thermophilus GGPP synthase, overexpressed in Escherichia coli cells as a glutathione S-transferase fusion protein, was purified and characterized. The fusion protein, retaining thermostability, formed a homodimer, and showed higher specific activity than did a partially purified thermostable enzyme previously reported. Optimal reaction conditions and kinetic parameters were also examined. The deduced amino acid sequence indicated that T. thermophilus GGPP synthase was excluded from the group of bacterial type GGPP synthases and lacked the insertion amino acid residues in the first aspartate-rich motif as do archaeal and eukaryotic short-chain prenyltransferases.

  4. Evolution of Sphingomonad Gene Clusters Related to Pesticide Catabolism Revealed by Genome Sequence and Mobilomics of Sphingobium herbicidovorans MH.

    PubMed

    Nielsen, Tue Kjærgaard; Rasmussen, Morten; Demanèche, Sandrine; Cecillon, Sébastien; Vogel, Timothy M; Hansen, Lars Hestbjerg

    2017-09-01

    Bacterial degraders of chlorophenoxy herbicides have been isolated from various ecosystems, including pristine environments. Among these degraders, the sphingomonads constitute a prominent group that displays versatile xenobiotic-degradation capabilities. Four separate sequencing strategies were required to provide the complete sequence of the complex and plastic genome of the canonical chlorophenoxy herbicide-degrading Sphingobium herbicidovorans MH. The genome has an intricate organization of the chlorophenoxy-herbicide catabolic genes sdpA, rdpA, and cadABCD that encode the (R)- and (S)-enantiomer-specific 2,4-dichlorophenoxypropionate dioxygenases and four subunits of a Rieske non-heme iron oxygenase involved in 2-methyl-chlorophenoxyacetic acid degradation, respectively. Several major genomic rearrangements are proposed to help understand the evolution and mobility of these important genes and their genetic context. Single-strain mobilomic sequence analysis uncovered plasmids and insertion sequence-associated circular intermediates in this environmentally important bacterium and enabled the description of evolutionary models for pesticide degradation in strain MH and related organisms. The mobilome presented a complex mosaic of mobile genetic elements including four plasmids and several circular intermediate DNA molecules of insertion-sequence elements and transposons that are central to the evolution of xenobiotics degradation. Furthermore, two individual chromosomally integrated prophages were shown to excise and form free circular DNA molecules. This approach holds great potential for improving the understanding of genome plasticity, evolution, and microbial ecology. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. Modeling of 3D Structure of Chimeric Constructs Based on Hemagglutinin of Influenza Virus and Immunogenic Epitopes of Streptococcus Agalactiae.

    PubMed

    Fedorova, E A; Smolonogina, T A; Isakova-Sivak, I N; Koren'kov, D A; Kotomina, T S; Leont'eva, G F; Suvorov, A N; Rudenko, L G

    2018-04-01

    A project of an experimental recombinant vector vaccine for prevention of diseases caused by pathogenic streptococci based on ScaAB lipoprotein of Streptococcus agalactiae and a coldadapted strain of live influenza vaccine as a vector was developed. The sequence of ScaAB lipoprotein was analyzed and fragments forming immunodominant epitopes were determined. Chimeric molecules of influenza virus hemagglutinin H7 carrying insertions of bacterial origin were constructed. Based on the results of simulation, the most promising variants were selected; they represented fragments of lipoprotein ScaAB lacking N-terminal domain bound to hemagglutinin via a flexible linker. These insertions should minimally modulate the properties of the influenza strain, while retaining potential immunogenicity to a wide group of pathogenic streptococci.

  6. Identification and cloning of a type III polyketide synthase required for diffusible pigment biosynthesis in Saccharopolyspora erythraea.

    PubMed

    Cortés, Jesús; Velasco, Javier; Foster, Graham; Blackaby, Andrew P; Rudd, Brian A M; Wilkinson, Barrie

    2002-06-01

    The soluble, diffusible red-brown pigment produced by a Saccharopolyspora erythraea "red variant" has been shown to contain glycosylated and polymerized derivatives of 2,5,7-trihydroxy-1,4-naphthoquinone (flaviolin). Flaviolin is a spontaneous oxidation product of 1,3,6,8-tetrahydroxynaphthalene (THN), which is biosynthesized in bacteria by a chalcone synthase-like (CS-like) type III polyketide synthase (PKS). A fragment of the gene responsible for THN biosynthesis in S. erythraea E_8-7 was amplified by polymerase chain reaction (PCR) using degenerate primers based on conserved regions of known plant CS and bacterial CS-like genes. From the isolated fragment, a suicide vector was prepared, which was subsequently used to disrupt the red-brown pigment-producing (rpp) locus in S. erythraea, generating a mutant that displayed an albino phenotype. Chromosomal DNA from the albino mutant was subsequently used in a vector-recapture protocol to isolate a plasmid that contained an insert spanning the entire rpp locus. Sequencing of the insert revealed that the disrupted open reading frame (ORF) encodes a CS-like protein displaying 69% sequence identity to the rppA gene of Streptomyces griseus. The S. griseus rppA gene encodes RppA, the first characterized bacterial CS-like protein, which is sufficient in vitro for the synthesis of THN from malonyl-CoA. The rppA disruption mutant and rppA sequence provided a means by which to address the mechanism of diffusible pigment biosynthesis, as well as to investigate any link between this and the modulation of erythromycin A titre, which has been observed for S. erythraea variants.

  7. Whole-genome sequencing of staphylococcus haemolyticus uncovers the extreme plasticity of its genome and the evolution of human-colonizing staphylococcal species.

    PubMed

    Takeuchi, Fumihiko; Watanabe, Shinya; Baba, Tadashi; Yuzawa, Harumi; Ito, Teruyo; Morimoto, Yuh; Kuroda, Makoto; Cui, Longzhu; Takahashi, Mikio; Ankai, Akiho; Baba, Shin-ichi; Fukui, Shigehiro; Lee, Jean C; Hiramatsu, Keiichi

    2005-11-01

    Staphylococcus haemolyticus is an opportunistic bacterial pathogen that colonizes human skin and is remarkable for its highly antibiotic-resistant phenotype. We determined the complete genome sequence of S.haemolyticus to better understand its pathogenicity and evolutionary relatedness to the other staphylococcal species. A large proportion of the open reading frames in the genomes of S.haemolyticus, Staphylococcus aureus, and Staphylococcus epidermidis were conserved in their sequence and order on the chromosome. We identified a region of the bacterial chromosome just downstream of the origin of replication that showed little homology among the species but was conserved among strains within a species. This novel region, designated the "oriC environ," likely contributes to the evolution and differentiation of the staphylococcal species, since it was enriched for species-specific nonessential genes that contribute to the biological features of each staphylococcal species. A comparative analysis of the genomes of S.haemolyticus, S.aureus, and S.epidermidis elucidated differences in their biological and genetic characteristics and pathogenic potentials. We identified as many as 82 insertion sequences in the S.haemolyticus chromosome that probably mediated frequent genomic rearrangements, resulting in phenotypic diversification of the strain. Such rearrangements could have brought genomic plasticity to this species and contributed to its acquisition of antibiotic resistance.

  8. Pyrosequencing for Microbial Identification and Characterization

    PubMed Central

    Cummings, Patrick J.; Ahmed, Ray; Durocher, Jeffrey A.; Jessen, Adam; Vardi, Tamar; Obom, Kristina M.

    2013-01-01

    Pyrosequencing is a versatile technique that facilitates microbial genome sequencing that can be used to identify bacterial species, discriminate bacterial strains and detect genetic mutations that confer resistance to anti-microbial agents. The advantages of pyrosequencing for microbiology applications include rapid and reliable high-throughput screening and accurate identification of microbes and microbial genome mutations. Pyrosequencing involves sequencing of DNA by synthesizing the complementary strand a single base at a time, while determining the specific nucleotide being incorporated during the synthesis reaction. The reaction occurs on immobilized single stranded template DNA where the four deoxyribonucleotides (dNTP) are added sequentially and the unincorporated dNTPs are enzymatically degraded before addition of the next dNTP to the synthesis reaction. Detection of the specific base incorporated into the template is monitored by generation of chemiluminescent signals. The order of dNTPs that produce the chemiluminescent signals determines the DNA sequence of the template. The real-time sequencing capability of pyrosequencing technology enables rapid microbial identification in a single assay. In addition, the pyrosequencing instrument, can analyze the full genetic diversity of anti-microbial drug resistance, including typing of SNPs, point mutations, insertions, and deletions, as well as quantification of multiple gene copies that may occur in some anti-microbial resistance patterns. PMID:23995536

  9. Pyrosequencing for microbial identification and characterization.

    PubMed

    Cummings, Patrick J; Ahmed, Ray; Durocher, Jeffrey A; Jessen, Adam; Vardi, Tamar; Obom, Kristina M

    2013-08-22

    Pyrosequencing is a versatile technique that facilitates microbial genome sequencing that can be used to identify bacterial species, discriminate bacterial strains and detect genetic mutations that confer resistance to anti-microbial agents. The advantages of pyrosequencing for microbiology applications include rapid and reliable high-throughput screening and accurate identification of microbes and microbial genome mutations. Pyrosequencing involves sequencing of DNA by synthesizing the complementary strand a single base at a time, while determining the specific nucleotide being incorporated during the synthesis reaction. The reaction occurs on immobilized single stranded template DNA where the four deoxyribonucleotides (dNTP) are added sequentially and the unincorporated dNTPs are enzymatically degraded before addition of the next dNTP to the synthesis reaction. Detection of the specific base incorporated into the template is monitored by generation of chemiluminescent signals. The order of dNTPs that produce the chemiluminescent signals determines the DNA sequence of the template. The real-time sequencing capability of pyrosequencing technology enables rapid microbial identification in a single assay. In addition, the pyrosequencing instrument, can analyze the full genetic diversity of anti-microbial drug resistance, including typing of SNPs, point mutations, insertions, and deletions, as well as quantification of multiple gene copies that may occur in some anti-microbial resistance patterns.

  10. Diversity of Shiga Toxin-Producing Escherichia coli (STEC) O26:H11 Strains Examined via stx Subtypes and Insertion Sites of Stx and EspK Bacteriophages

    PubMed Central

    Bonanno, Ludivine; Loukiadis, Estelle; Mariani-Kurkdjian, Patricia; Oswald, Eric; Garnier, Lucille; Michel, Valérie

    2015-01-01

    Shiga toxin-producing Escherichia coli (STEC) is a food-borne pathogen that may be responsible for severe human infections. Only a limited number of serotypes, including O26:H11, are involved in the majority of serious cases and outbreaks. The main virulence factors, Shiga toxins (Stx), are encoded by bacteriophages. Seventy-four STEC O26:H11 strains of various origins (including human, dairy, and cattle) were characterized for their stx subtypes and Stx phage chromosomal insertion sites. The majority of food and cattle strains possessed the stx1a subtype, while human strains carried mainly stx1a or stx2a. The wrbA and yehV genes were the main Stx phage insertion sites in STEC O26:H11, followed distantly by yecE and sbcB. Interestingly, the occurrence of Stx phages inserted in the yecE gene was low in dairy strains. In most of the 29 stx-negative E. coli O26:H11 strains also studied here, these bacterial insertion sites were vacant. Multilocus sequence typing of 20 stx-positive or stx-negative E. coli O26:H11 strains showed that they were distributed into two phylogenetic groups defined by sequence type 21 (ST21) and ST29. Finally, an EspK-carrying phage was found inserted in the ssrA gene in the majority of the STEC O26:H11 strains but in only a minority of the stx-negative E. coli O26:H11 strains. The differences in the stx subtypes and Stx phage insertion sites observed in STEC O26:H11 according to their origin might reflect that strains circulating in cattle and foods are clonally distinct from those isolated from human patients. PMID:25819955

  11. The accommodation index measures the perturbation associated with insertions and deletions in coiled‐coils: Application to understand signaling in histidine kinases

    PubMed Central

    Schmidt, Nathan W.; Grigoryan, Gevorg

    2017-01-01

    Abstract Coiled‐coils are essential components of many protein complexes. First discovered in structural proteins such as keratins, they have since been found to figure largely in the assembly and dynamics required for diverse functions, including membrane fusion, signal transduction and motors. Coiled‐coils have a characteristic repeating seven‐residue geometric and sequence motif, which is sometimes interrupted by the insertion of one or more residues. Such insertions are often highly conserved and critical to interdomain communication in signaling proteins such as bacterial histidine kinases. Here we develop the “accommodation index” as a parameter that allows automatic detection and classification of insertions based on the three dimensional structure of a protein. This method allows precise identification of the type of insertion and the “accommodation length” over which the insertion is structurally accommodated. A simple theory is presented that predicts the structural perturbations of 1, 3, 4 residue insertions as a function of the length over which the insertion is accommodated. Analysis of experimental structures is in good agreement with theory, and shows that short accommodation lengths give rise to greater perturbation of helix packing angles, changes in local helical phase, and increased structural asymmetry relative to long accommodation lengths. Cytoplasmic domains of histidine kinases in different signaling states display large changes in their accommodation lengths, which can now be seen to underlie diverse structural transitions including symmetry/asymmetry and local variations in helical phase that accompany signal transduction. PMID:27977891

  12. Identification by Subtractive Hybridization of a Novel Insertion Sequence Specific for Virulent Strains of Porphyromonas gingivalis

    PubMed Central

    Sawada, Koichi; Kokeguchi, Susumu; Hongyo, Hiroshi; Sawada, Satoko; Miyamoto, Manabu; Maeda, Hiroshi; Nishimura, Fusanori; Takashiba, Shogo; Murayama, Yoji

    1999-01-01

    Subtractive hybridization was employed to isolate specific genes from virulent Porphyromonas gingivalis strains that are possibly related to abscess formation. The genomic DNA from the virulent strain P. gingivalis W83 was subtracted with DNA from the avirulent strain ATCC 33277. Three clones unique to strain W83 were isolated and sequenced. The cloned DNA fragments were 885, 369, and 132 bp and had slight homology with only Bacillus stearothermophilus IS5377, which is a putative transposase. The regions flanking the cloned DNA fragments were isolated and sequenced, and the gene structure around the clones was revealed. These three clones were located side-by-side in a gene reported as an outer membrane protein. The three clones interrupt the open reading frame of the outer membrane protein gene. This inserted DNA, consisting of three isolated clones, was designated IS1598, which was 1,396 bp (i.e., a 1,158-bp open reading frame) in length and was flanked by 16-bp terminal inverted repeats and a 9-bp duplicated target sequence. IS1598 was detected in P. gingivalis W83, W50, and FDC 381 by Southern hybridization. All three P. gingivalis strains have been shown to possess abscess-forming ability in animal models. However, IS1598 was not detected in avirulent strains of P. gingivalis, including ATCC 33277. The IS1598 may interrupt the synthesis of the outer membrane protein, resulting in changes in the structure of the bacterial outer membrane. The IS1598 isolated in this study is a novel insertion element which might be a specific marker for virulent P. gingivalis strains. PMID:10531208

  13. An Efficient Method for High-Fidelity BAC/PAC Retrofitting with a Selectable Marker for Mammalian Cell Transfection

    PubMed Central

    Wang, Zunde; Engler, Peter; Longacre, Angelika; Storb, Ursula

    2001-01-01

    Large-scale genomic sequencing projects have provided DNA sequence information for many genes, but the biological functions for most of them will only be known through functional studies. Bacterial artificial chromosomes (BACs) and P1-derived artificial chromosomes (PACs) are large genomic clones stably maintained in bacteria and are very important in functional studies through transfection because of their large size and stability. Because most BAC or PAC vectors do not have a mammalian selection marker, transfecting mammalian cells with genes cloned in BACs or PACs requires the insertion into the BAC/PAC of a mammalian selectable marker. However, currently available procedures are not satisfactory in efficiency and fidelity. We describe a very simple and efficient procedure that allows one to retrofit dozens of BACs in a day with no detectable deletions or unwanted recombination. We use a BAC/PAC retrofitting vector that, on transformation into competent BAC or PAC strains, will catalyze the specific insertion of itself into BAC/PAC vectors through in vivo cre/loxP site-specific recombination. PMID:11156622

  14. Phylogenetic screening of a bacterial, metagenomic library using homing endonuclease restriction and marker insertion

    PubMed Central

    Yung, Pui Yi; Burke, Catherine; Lewis, Matt; Egan, Suhelen; Kjelleberg, Staffan; Thomas, Torsten

    2009-01-01

    Metagenomics provides access to the uncultured majority of the microbial world. The approaches employed in this field have, however, had limited success in linking functional genes to the taxonomic or phylogenetic origin of the organism they belong to. Here we present an efficient strategy to recover environmental DNA fragments that contain phylogenetic marker genes from metagenomic libraries. Our method involves the cleavage of 23S ribsosmal RNA (rRNA) genes within pooled library clones by the homing endonuclease I-CeuI followed by the insertion and selection of an antibiotic resistance cassette. This approach was applied to screen a library of 6500 fosmid clones derived from the microbial community associated with the sponge Cymbastela concentrica. Several fosmid clones were recovered after the screen and detailed phylogenetic and taxonomic assignment based on the rRNA gene showed that they belong to previously unknown organisms. In addition, compositional features of these fosmid clones were used to classify and taxonomically assign a dataset of environmental shotgun sequences. Our approach represents a valuable tool for the analysis of rapidly increasing, environmental DNA sequencing information. PMID:19767618

  15. Structural and phylogenetic analysis of Rhodobacter capsulatus NifF: uncovering general features of nitrogen-fixation (nif)-flavodoxins.

    PubMed

    Pérez-Dorado, Inmaculada; Bortolotti, Ana; Cortez, Néstor; Hermoso, Juan A

    2013-01-09

    Analysis of the crystal structure of NifF from Rhodobacter capsulatus and its homologues reported so far reflects the existence of unique structural features in nif flavodoxins: a leucine at the re face of the isoalloxazine, an eight-residue insertion at the C-terminus of the 50's loop and a remarkable difference in the electrostatic potential surface with respect to non-nif flavodoxins. A phylogenetic study on 64 sequences from 52 bacterial species revealed four clusters, including different functional prototypes, correlating the previously defined as "short-chain" with the firmicutes flavodoxins and the "long-chain" with gram-negative species. The comparison of Rhodobacter NifF structure with other bacterial flavodoxin prototypes discloses the concurrence of specific features of these functional electron donors to nitrogenase.

  16. Genome of the Actinomycete Plant Pathogen Clavibacter michiganensis subsp. sepedonicus Suggests Recent Niche Adaptation▿ †

    PubMed Central

    Bentley, Stephen D.; Corton, Craig; Brown, Susan E.; Barron, Andrew; Clark, Louise; Doggett, Jon; Harris, Barbara; Ormond, Doug; Quail, Michael A.; May, Georgiana; Francis, David; Knudson, Dennis; Parkhill, Julian; Ishimaru, Carol A.

    2008-01-01

    Clavibacter michiganensis subsp. sepedonicus is a plant-pathogenic bacterium and the causative agent of bacterial ring rot, a devastating agricultural disease under strict quarantine control and zero tolerance in the seed potato industry. This organism appears to be largely restricted to an endophytic lifestyle, proliferating within plant tissues and unable to persist in the absence of plant material. Analysis of the genome sequence of C. michiganensis subsp. sepedonicus and comparison with the genome sequences of related plant pathogens revealed a dramatic recent evolutionary history. The genome contains 106 insertion sequence elements, which appear to have been active in extensive rearrangement of the chromosome compared to that of Clavibacter michiganensis subsp. michiganensis. There are 110 pseudogenes with overrepresentation in functions associated with carbohydrate metabolism, transcriptional regulation, and pathogenicity. Genome comparisons also indicated that there is substantial gene content diversity within the species, probably due to differential gene acquisition and loss. These genomic features and evolutionary dating suggest that there was recent adaptation for life in a restricted niche where nutrient diversity and perhaps competition are low, correlated with a reduced ability to exploit previously occupied complex niches outside the plant. Toleration of factors such as multiplication and integration of insertion sequence elements, genome rearrangements, and functional disruption of many genes and operons seems to indicate that there has been general relaxation of selective pressure on a large proportion of the genome. PMID:18192393

  17. Phylogenetic analysis of anaerobic psychrophilic enrichment cultures obtained from a greenland glacier ice core

    NASA Technical Reports Server (NTRS)

    Sheridan, Peter P.; Miteva, Vanya I.; Brenchley, Jean E.

    2003-01-01

    The examination of microorganisms in glacial ice cores allows the phylogenetic relationships of organisms frozen for thousands of years to be compared with those of current isolates. We developed a method for aseptically sampling a sediment-containing portion of a Greenland ice core that had remained at -9 degrees C for over 100,000 years. Epifluorescence microscopy and flow cytometry results showed that the ice sample contained over 6 x 10(7) cells/ml. Anaerobic enrichment cultures inoculated with melted ice were grown and maintained at -2 degrees C. Genomic DNA extracted from these enrichments was used for the PCR amplification of 16S rRNA genes with bacterial and archaeal primers and the preparation of clone libraries. Approximately 60 bacterial inserts were screened by restriction endonuclease analysis and grouped into 27 unique restriction fragment length polymorphism types, and 24 representative sequences were compared phylogenetically. Diverse sequences representing major phylogenetic groups including alpha, beta, and gamma Proteobacteria as well as relatives of the Thermus, Bacteroides, Eubacterium, and Clostridium groups were found. Sixteen clone sequences were closely related to those from known organisms, with four possibly representing new species. Seven sequences may reflect new genera and were most closely related to sequences obtained only by PCR amplification. One sequence was over 12% distant from its closest relative and may represent a novel order or family. These results show that phylogenetically diverse microorganisms have remained viable within the Greenland ice core for at least 100,000 years.

  18. Phylogenetic Analysis of Anaerobic Psychrophilic Enrichment Cultures Obtained from a Greenland Glacier Ice Core

    PubMed Central

    Sheridan, Peter P.; Miteva, Vanya I.; Brenchley, Jean E.

    2003-01-01

    The examination of microorganisms in glacial ice cores allows the phylogenetic relationships of organisms frozen for thousands of years to be compared with those of current isolates. We developed a method for aseptically sampling a sediment-containing portion of a Greenland ice core that had remained at −9°C for over 100,000 years. Epifluorescence microscopy and flow cytometry results showed that the ice sample contained over 6 × 107 cells/ml. Anaerobic enrichment cultures inoculated with melted ice were grown and maintained at −2°C. Genomic DNA extracted from these enrichments was used for the PCR amplification of 16S rRNA genes with bacterial and archaeal primers and the preparation of clone libraries. Approximately 60 bacterial inserts were screened by restriction endonuclease analysis and grouped into 27 unique restriction fragment length polymorphism types, and 24 representative sequences were compared phylogenetically. Diverse sequences representing major phylogenetic groups including alpha, beta, and gamma Proteobacteria as well as relatives of the Thermus, Bacteroides, Eubacterium, and Clostridium groups were found. Sixteen clone sequences were closely related to those from known organisms, with four possibly representing new species. Seven sequences may reflect new genera and were most closely related to sequences obtained only by PCR amplification. One sequence was over 12% distant from its closest relative and may represent a novel order or family. These results show that phylogenetically diverse microorganisms have remained viable within the Greenland ice core for at least 100,000 years. PMID:12676695

  19. Biotechnological applications of mobile group II introns and their reverse transcriptases: gene targeting, RNA-seq, and non-coding RNA analysis.

    PubMed

    Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M

    2014-01-13

    Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The high processivity and fidelity of group II intron reverse transcriptases along with their novel template-switching activity, which can directly link RNA-seq adaptor sequences to cDNAs during reverse transcription, open new approaches for RNA-seq and the identification and profiling of non-coding RNAs, with potentially wide applications in research and biotechnology.

  20. Construction, Characterization, and Preliminary BAC-End Sequence Analysis of a Bacterial Artificial Chromosome Library of the Tea Plant (Camellia sinensis)

    PubMed Central

    Lin, Jinke; Kudrna, Dave; Wing, Rod A.

    2011-01-01

    We describe the construction and characterization of a publicly available BAC library for the tea plant, Camellia sinensis. Using modified methods, the library was constructed with the aim of developing public molecular resources to advance tea plant genomics research. The library consists of a total of 401,280 clones with an average insert size of 135 kb, providing an approximate coverage of 13.5 haploid genome equivalents. No empty vector clones were observed in a random sampling of 576 BAC clones. Further analysis of 182 BAC-end sequences from randomly selected clones revealed a GC content of 40.35% and low chloroplast and mitochondrial contamination. Repetitive sequence analyses indicated that LTR retrotransposons were the most predominant sequence class (86.93%–87.24%), followed by DNA retrotransposons (11.16%–11.69%). Additionally, we found 25 simple sequence repeats (SSRs) that could potentially be used as genetic markers. PMID:21234344

  1. Impact of Lateral Transfers on the Genomes of Lepidoptera

    PubMed Central

    Drezen, Jean-Michel; Josse, Thibaut; Bézier, Annie; Gauthier, Jérémy; Huguet, Elisabeth

    2017-01-01

    Transfer of DNA sequences between species regardless of their evolutionary distance is very common in bacteria, but evidence that horizontal gene transfer (HGT) also occurs in multicellular organisms has been accumulating in the past few years. The actual extent of this phenomenon is underestimated due to frequent sequence filtering of “alien” DNA before genome assembly. However, recent studies based on genome sequencing have revealed, and experimentally verified, the presence of foreign DNA sequences in the genetic material of several species of Lepidoptera. Large DNA viruses, such as baculoviruses and the symbiotic viruses of parasitic wasps (bracoviruses), have the potential to mediate these transfers in Lepidoptera. In particular, using ultra-deep sequencing, newly integrated transposons have been identified within baculovirus genomes. Bacterial genes have also been acquired by genomes of Lepidoptera, as in other insects and nematodes. In addition, insertions of bracovirus sequences were present in the genomes of certain moth and butterfly lineages, that were likely corresponding to rearrangements of ancient integrations. The viral genes present in these sequences, sometimes of hymenopteran origin, have been co-opted by lepidopteran species to confer some protection against pathogens. PMID:29120392

  2. Prevalent bacterial species and novel phylotypes in advanced noma lesions.

    PubMed

    Paster, B J; Falkler Jr, W A; Enwonwu, C O; Idigbe, E O; Savage, K O; Levanos, V A; Tamer, M A; Ericson, R L; Lau, C N; Dewhirst, F E

    2002-06-01

    The purpose of this study was to determine the bacterial diversity in advanced noma lesions using culture-independent molecular methods. 16S ribosomal DNA bacterial genes from DNA isolated from advanced noma lesions of four Nigerian children were PCR amplified with universally conserved primers and spirochetal selective primers and cloned into Escherichia coli. Partial 16S rRNA sequences of approximately 500 bases from 212 cloned inserts were used initially to determine species identity or closest relatives by comparison with sequences of known species or phylotypes. Nearly complete sequences of approximately 1,500 bases were obtained for most of the potentially novel species. A total of 67 bacterial species or phylotypes were detected, 25 of which have not yet been grown in vitro. Nineteen of the species or phylotypes, including Propionibacterium acnes, Staphylococcus spp., and the opportunistic pathogens Stenotrophomonas maltophilia and Ochrobactrum anthropi were detected in more than one subject. Other known species that were detected included Achromobacter spp., Afipia spp., Brevundimonas diminuta, Capnocytophaga spp., Cardiobacterium sp., Eikenella corrodens, Fusobacterium spp., Gemella haemoylsans, and Neisseria spp. Phylotypes that were unique to noma infections included those in the genera Eubacterium, Flavobacterium, Kocuria, Microbacterium, and Porphyromonas and the related Streptococcus salivarius and genera Sphingomonas and TREPONEMA: Since advanced noma lesions are infections open to the environment, it was not surprising to detect species not commonly associated with the oral cavity, e.g., from soil. Several species previously implicated as putative pathogens of noma, such as spirochetes and Fusobacterium spp., were detected in at least one subject. However, due to the limited number of available noma subjects, it was not possible at this time to associate specific species with the disease.

  3. Impact of targeted counseling on reported vaginal hygiene practices and bacterial vaginosis: the HIV Prevention Trials Network 035 study.

    PubMed

    Kasaro, Margaret P; Husnik, Marla J; Chi, Benjamin H; Reid, Cheri; Magure, Tsitsi; Makanani, Bonus; Tembo, Tchangani; Ramjee, Gita; Maslankowski, Lisa; Rabe, Lorna; Brad Guffey, M

    2017-04-01

    The objective of this study was to describe the impact of intense counseling to reduce vaginal hygiene practices and its effect on bacterial vaginosis. A secondary data analysis of the HIV Prevention Trials Network 035 study was undertaken, focusing on HIV-negative, nonpregnant women who were at least 18 years old, in seven African sites and one US site. At enrollment and during follow-up quarterly visits, vaginal hygiene practices were determined by face-to-face administration of a behavioral assessment questionnaire. Vaginal hygiene practices were categorized as insertion into the vagina of (1) nothing, (2) water only, and (3) other substances with or without water. Each practice was quantified by frequency and type/combination of inserted substances. At quarterly visits, diagnosis of bacterial vaginosis was made using the Nugent score. Trends for vaginal hygiene practices and bacterial vaginosis were evaluated using generalized estimating equation models. A total of 3087 participants from the HIV Prevention Trials Network 035 study were eligible for this analysis. At enrollment, 1859 (60%) reported recent vaginal hygiene practices. By one year, this figure had decreased to 1019 (33%) with counseling. However, bacterial vaginosis prevalence remained consistent across the study observation period, with 36%-38% of women testing positive for the condition ( p for trend = 0.27). Overall, those who reported douching with water only (AOR = 1.03, 95%CI: 0.94-1.13) and those who reported inserting other substances (AOR= 0.98, 95%CI: 0.88-1.09) in the past quarter were not more likely to have bacterial vaginosis compared to those who reported no insertions. However, in South Africa, an increase in bacterial vaginosis was seen among those who reported inserting other substances (AOR: 1.48, 95%CI: 1.17, 1.88). In conclusion, targeted counseling against vaginal hygiene practices resulted in change in self-reported behavior but did not have an impact on bacterial vaginosis diagnosis in all but one site.

  4. Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

    PubMed

    Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

    2014-11-01

    Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Products of three accessory genes, pilB, pilC, and pilD, are required for biogenesis of Pseudomonas aeruginosa pili.

    PubMed Central

    Nunn, D; Bergman, S; Lory, S

    1990-01-01

    The polar pili of Pseudomonas aeruginosa are composed of monomers of the pilin structural subunits. The biogenesis of pili involves the synthesis of pilin precursor, cleavage of a six-amino-acid leader peptide, membrane translocation, and assembly of monomers into a filamentous structure extending from the bacterial surface. This report describes three novel genes necessary for the formation of pili. DNA sequences adjacent to pilA, the pilin structural gene, were cloned and mutagenized with transposon Tn5. Each of the insertions were introduced into the chromosome of P. aeruginosa PAK by gene replacement. The effect of the Tn5 insertions in the bacterial chromosome on pilus assembly was assessed by electron microscopy and sensitivity of mutants to a pilus-specific bacteriophage. The resultant mutants were also tested for synthesis and membrane localization of the pilin antigen in order to define the genes required for maturation, export, and assembly of pilin. A 4.0-kilobase-pair region of DNA adjacent to the pilin structural gene was found to be essential for formation of pili. This region was sequenced and found to contain three open reading frames coding for 62-, 38- to 45-, and 28- to 32-kilodalton proteins (pilB, pilC, and pilD, respectively). Three proteins of similar molecular weight were expressed in Escherichia coli from the 4.0-kilobase-pair fragment flanking pilA with use of a T7 promoter-polymerase expression system. The results of the analyses of the three genes and the implications for pilin assembly and maturation are discussed. Images PMID:1971619

  6. Whole-Genome Sequencing of Staphylococcus haemolyticus Uncovers the Extreme Plasticity of Its Genome and the Evolution of Human-Colonizing Staphylococcal Species

    PubMed Central

    Takeuchi, Fumihiko; Watanabe, Shinya; Baba, Tadashi; Yuzawa, Harumi; Ito, Teruyo; Morimoto, Yuh; Kuroda, Makoto; Cui, Longzhu; Takahashi, Mikio; Ankai, Akiho; Baba, Shin-ichi; Fukui, Shigehiro; Lee, Jean C.; Hiramatsu, Keiichi

    2005-01-01

    Staphylococcus haemolyticus is an opportunistic bacterial pathogen that colonizes human skin and is remarkable for its highly antibiotic-resistant phenotype. We determined the complete genome sequence of S.haemolyticus to better understand its pathogenicity and evolutionary relatedness to the other staphylococcal species. A large proportion of the open reading frames in the genomes of S.haemolyticus, Staphylococcus aureus, and Staphylococcus epidermidis were conserved in their sequence and order on the chromosome. We identified a region of the bacterial chromosome just downstream of the origin of replication that showed little homology among the species but was conserved among strains within a species. This novel region, designated the “oriC environ,” likely contributes to the evolution and differentiation of the staphylococcal species, since it was enriched for species-specific nonessential genes that contribute to the biological features of each staphylococcal species. A comparative analysis of the genomes of S.haemolyticus, S.aureus, and S.epidermidis elucidated differences in their biological and genetic characteristics and pathogenic potentials. We identified as many as 82 insertion sequences in the S.haemolyticus chromosome that probably mediated frequent genomic rearrangements, resulting in phenotypic diversification of the strain. Such rearrangements could have brought genomic plasticity to this species and contributed to its acquisition of antibiotic resistance. PMID:16237012

  7. A Blumeria graminisf.sp. hordei BAC library--contig building and microsynteny studies.

    PubMed

    Pedersen, Carsten; Wu, Boqian; Giese, Henriette

    2002-11-01

    A bacterial artificial chromosome (BAC) library of Blumeria graminis f.sp. hordei, containing 12,000 clones with an average insert size of 41 kb, was constructed. The library represents about three genome equivalents and BAC-end sequencing showed a high content of repetitive sequences, making contig-building difficult. To identify overlapping clones, several strategies were used: colony hybridisation, PCR screening, fingerprinting techniques and the use of single-copy expressed sequence tags. The latter proved to be the most efficient method for identification of overlapping clones. Two contigs, at or close to avirulence loci, were constructed. Single nucleotide polymorphism (SNP) markers were developed from BAC-end sequences to link the contigs to the genetic maps. Two other BAC contigs were used to study microsynteny between B. graminis and two other ascomycetes, Neurospora crassa and Aspergillus fumigatus. The library provides an invaluable tool for the isolation of avirulence genes from B. graminis and for the study of gene synteny between this fungus and other fungi.

  8. Identification of Genomic Insertion and Flanking Sequence of G2-EPSPS and GAT Transgenes in Soybean Using Whole Genome Sequencing Method.

    PubMed

    Guo, Bingfu; Guo, Yong; Hong, Huilong; Qiu, Li-Juan

    2016-01-01

    Molecular characterization of sequence flanking exogenous fragment insertion is essential for safety assessment and labeling of genetically modified organism (GMO). In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS) method. More than 22.4 Gb sequence data (∼21 × coverage) for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundaries of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of genomic insertion sites of G2-EPSPS and GAT transgenes will facilitate the utilization of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS was a cost-effective and rapid method for identifying sites of T-DNA insertions and flanking sequences in soybean.

  9. Bacterial Diversity in Human Subgingival Plaque

    PubMed Central

    Paster, Bruce J.; Boches, Susan K.; Galvin, Jamie L.; Ericson, Rebecca E.; Lau, Carol N.; Levanos, Valerie A.; Sahasrabudhe, Ashish; Dewhirst, Floyd E.

    2001-01-01

    The purpose of this study was to determine the bacterial diversity in the human subgingival plaque by using culture-independent molecular methods as part of an ongoing effort to obtain full 16S rRNA sequences for all cultivable and not-yet-cultivated species of human oral bacteria. Subgingival plaque was analyzed from healthy subjects and subjects with refractory periodontitis, adult periodontitis, human immunodeficiency virus periodontitis, and acute necrotizing ulcerative gingivitis. 16S ribosomal DNA (rDNA) bacterial genes from DNA isolated from subgingival plaque samples were PCR amplified with all-bacterial or selective primers and cloned into Escherichia coli. The sequences of cloned 16S rDNA inserts were used to determine species identity or closest relatives by comparison with sequences of known species. A total of 2,522 clones were analyzed. Nearly complete sequences of approximately 1,500 bases were obtained for putative new species. About 60% of the clones fell into 132 known species, 70 of which were identified from multiple subjects. About 40% of the clones were novel phylotypes. Of the 215 novel phylotypes, 75 were identified from multiple subjects. Known putative periodontal pathogens such as Porphyromonas gingivalis, Bacteroides forsythus, and Treponema denticola were identified from multiple subjects, but typically as a minor component of the plaque as seen in cultivable studies. Several phylotypes fell into two recently described phyla previously associated with extreme natural environments, for which there are no cultivable species. A number of species or phylotypes were found only in subjects with disease, and a few were found only in healthy subjects. The organisms identified only from diseased sites deserve further study as potential pathogens. Based on the sequence data in this study, the predominant subgingival microbial community consisted of 347 species or phylotypes that fall into 9 bacterial phyla. Based on the 347 species seen in our sample of 2,522 clones, we estimate that there are 68 additional unseen species, for a total estimate of 415 species in the subgingival plaque. When organisms found on other oral surfaces such as the cheek, tongue, and teeth are added to this number, the best estimate of the total species diversity in the oral cavity is approximately 500 species, as previously proposed. PMID:11371542

  10. Construction of the BAC Library of Small Abalone (Haliotis diversicolor) for Gene Screening and Genome Characterization.

    PubMed

    Jiang, Likun; You, Weiwei; Zhang, Xiaojun; Xu, Jian; Jiang, Yanliang; Wang, Kai; Zhao, Zixia; Chen, Baohua; Zhao, Yunfeng; Mahboob, Shahid; Al-Ghanim, Khalid A; Ke, Caihuan; Xu, Peng

    2016-02-01

    The small abalone (Haliotis diversicolor) is one of the most important aquaculture species in East Asia. To facilitate gene cloning and characterization, genome analysis, and genetic breeding of it, we constructed a large-insert bacterial artificial chromosome (BAC) library, which is an important genetic tool for advanced genetics and genomics research. The small abalone BAC library includes 92,610 clones with an average insert size of 120 Kb, equivalent to approximately 7.6× of the small abalone genome. We set up three-dimensional pools and super pools of 18,432 BAC clones for target gene screening using PCR method. To assess the approach, we screened 12 target genes in these 18,432 BAC clones and identified 16 positive BAC clones. Eight positive BAC clones were then sequenced and assembled with the next generation sequencing platform. The assembled contigs representing these 8 BAC clones spanned 928 Kb of the small abalone genome, providing the first batch of genome sequences for genome evaluation and characterization. The average GC content of small abalone genome was estimated as 40.33%. A total of 21 protein-coding genes, including 7 target genes, were annotated into the 8 BACs, which proved the feasibility of PCR screening approach with three-dimensional pools in small abalone BAC library. One hundred fifty microsatellite loci were also identified from the sequences for marker development in the future. The BAC library and clone pools provided valuable resources and tools for genetic breeding and conservation of H. diversicolor.

  11. Experimental single-strain mobilomics reveals events that shape pathogen emergence

    DOE PAGES

    Schoeniger, Joseph S.; Hudson, Corey M.; Bent, Zachary W.; ...

    2016-07-04

    Virulence and resistance genes carried on mobile DNAs such as genomic islands (GIs) and plasmids promote bacterial pathogen emergence. An early step in the mobilization of GIs is their excision, which produces both a circular form of the GI and a deletion site in the chromosome; circular forms have also been described for some bacterial insertion sequences (ISs). We demonstrate that the recombinant sequence produced at the junction of such circles, and their corresponding deletion sites, can be detected sensitively in high throughput sequencing data, using new computational methods that enable empirical discovery of new mobile DNAs. Applied to themore » rich mobilome of a single strain (Kpn2146) of the emerging multidrug-resistant pathogen Klebsiella pneumoniae, our approach detected circular junctions for six GIs and seven IS types (several of the latter not previously known to circularize). Our methods further revealed differential biology of multiple mobile DNAs, imprecision of integrases and transposases, and differential activity among identical IS copies for IS26, ISKpn18 and ISKpn21. Exonuclease was used to enrich for circular dsDNA molecules, and internal calibration with the native Kpn2146 plasmids showed that not all molecules bearing GI and IS circular junctions were circular dsDNAs. Transposition events were also detected, revealing replicon preference (ISKpn18 preferring a conjugative IncA/C2 plasmid), local action (IS26), regional preferences, selection (against capsule synthesis), and left-right IS end swapping. Efficient discovery and global characterization of numerous mobile elements per experiment will allow detailed accounting of bacterial evolution, explaining the new gene combinations that arise in emerging pathogens.« less

  12. A bacterial genome in transition - an exceptional enrichment of IS elements but lack of evidence for recent transposition in the symbiont Amoebophilus asiaticus

    PubMed Central

    2011-01-01

    Background Insertion sequence (IS) elements are important mediators of genome plasticity and are widespread among bacterial and archaeal genomes. The 1.88 Mbp genome of the obligate intracellular amoeba symbiont Amoebophilus asiaticus contains an unusually large number of transposase genes (n = 354; 23% of all genes). Results The transposase genes in the A. asiaticus genome can be assigned to 16 different IS elements termed ISCaa1 to ISCaa16, which are represented by 2 to 24 full-length copies, respectively. Despite this high IS element load, the A. asiaticus genome displays a GC skew pattern typical for most bacterial genomes, indicating that no major rearrangements have occurred recently. Additionally, the high sequence divergence of some IS elements, the high number of truncated IS element copies (n = 143), as well as the absence of direct repeats in most IS elements suggest that the IS elements of A. asiaticus are transpositionally inactive. Although we could show transcription of 13 IS elements, we did not find experimental evidence for transpositional activity, corroborating our results from sequence analyses. However, we detected contiguous transcripts between IS elements and their downstream genes at nine loci in the A. asiaticus genome, indicating that some IS elements influence the transcription of downstream genes, some of which might be important for host cell interaction. Conclusions Taken together, the IS elements in the A. asiaticus genome are currently in the process of degradation and largely represent reflections of the evolutionary past of A. asiaticus in which its genome was shaped by their activity. PMID:21943072

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schoeniger, Joseph S.; Hudson, Corey M.; Bent, Zachary W.

    Virulence and resistance genes carried on mobile DNAs such as genomic islands (GIs) and plasmids promote bacterial pathogen emergence. An early step in the mobilization of GIs is their excision, which produces both a circular form of the GI and a deletion site in the chromosome; circular forms have also been described for some bacterial insertion sequences (ISs). We demonstrate that the recombinant sequence produced at the junction of such circles, and their corresponding deletion sites, can be detected sensitively in high throughput sequencing data, using new computational methods that enable empirical discovery of new mobile DNAs. Applied to themore » rich mobilome of a single strain (Kpn2146) of the emerging multidrug-resistant pathogen Klebsiella pneumoniae, our approach detected circular junctions for six GIs and seven IS types (several of the latter not previously known to circularize). Our methods further revealed differential biology of multiple mobile DNAs, imprecision of integrases and transposases, and differential activity among identical IS copies for IS26, ISKpn18 and ISKpn21. Exonuclease was used to enrich for circular dsDNA molecules, and internal calibration with the native Kpn2146 plasmids showed that not all molecules bearing GI and IS circular junctions were circular dsDNAs. Transposition events were also detected, revealing replicon preference (ISKpn18 preferring a conjugative IncA/C2 plasmid), local action (IS26), regional preferences, selection (against capsule synthesis), and left-right IS end swapping. Efficient discovery and global characterization of numerous mobile elements per experiment will allow detailed accounting of bacterial evolution, explaining the new gene combinations that arise in emerging pathogens.« less

  14. Activity of fosfomycin against nosocomial multiresistant bacterial pathogens from Croatia: a multicentric study

    PubMed Central

    Bielen, Luka; Likić, Robert; Erdeljić, Viktorija; Mareković, Ivana; Firis, Nataša; Grgić-Medić, Marijana; Godan, Ana; Tomić, Ivan; Hunjak, Blaženka; Markotić, Alemka; Bejuk, Danijela; Tičić, Vladimira; Balzar, Silvana; Bedenić, Branka

    2018-01-01

    Aim To determine in vitro susceptibility of multiresistant bacterial isolates to fosfomycin. Methods In this prospective in vitro study (local non-random sample, level of evidence 3), 288 consecutively collected multiresistant bacterial isolates from seven medical centers in Croatia were tested from February 2014 until October 2016 for susceptibility to fosfomycin and other antibiotics according to Clinical and Laboratory Standards Institute methodology. Susceptibility to fosfomycin was determined by agar dilution method, while disc diffusion were performed for in vitro testing of other antibiotics. Polymerase chain reaction and sequencing was performed for the majority of extended spectrum β-lactamase (ESBL)-producing Klebsiella pneumoniae (K. pneumoniae) and carbapenem-resistant isolates. Results The majority of 288 multiresistant bacterial isolates (82.6%) were susceptible to fosfomycin. The 236 multiresistant Gram-negative isolates showed excellent susceptibility to fosfomycin. Susceptibility rates were as follows: Escherichia coli ESBL 97%, K. pneumoniae ESBL 80%, Enterobacter species 85.7%, Citrobacter freundii 100%, Proteus mirabilis 93%, and Pseudomonas aeruginosa 60%. Of the 52 multiresistant Gram-positive isolates, methicillin-resistant Staphylococcus aureus showed excellent susceptibility to fosfomycin (94.4%) and vancomycin-resistant enterococcus showed low susceptibility to fosfomycin (31%). Polymerase chain reaction analysis of 36/50 ESBL-producing K. pneumoniae isolates showed that majority of isolates had CTX-M-15 beta lactamase (27/36) preceded by ISEcp insertion sequence. All carbapenem-resistant Enterobacter and Citrobacter isolates had blaVIM-1 metallo-beta-lactamase gene. Conclusion With the best in vitro activity among the tested antibiotics, fosfomycin could be an effective treatment option for infections caused by multiresistant Gram-negative and Gram-positive bacterial strains in the hospital setting. PMID:29740989

  15. The Essential Genome of Escherichia coli K-12.

    PubMed

    Goodall, Emily C A; Robinson, Ashley; Johnston, Iain G; Jabbari, Sara; Turner, Keith A; Cunningham, Adam F; Lund, Peter A; Cole, Jeffrey A; Henderson, Ian R

    2018-02-20

    Transposon-directed insertion site sequencing (TraDIS) is a high-throughput method coupling transposon mutagenesis with short-fragment DNA sequencing. It is commonly used to identify essential genes. Single gene deletion libraries are considered the gold standard for identifying essential genes. Currently, the TraDIS method has not been benchmarked against such libraries, and therefore, it remains unclear whether the two methodologies are comparable. To address this, a high-density transposon library was constructed in Escherichia coli K-12. Essential genes predicted from sequencing of this library were compared to existing essential gene databases. To decrease false-positive identification of essential genes, statistical data analysis included corrections for both gene length and genome length. Through this analysis, new essential genes and genes previously incorrectly designated essential were identified. We show that manual analysis of TraDIS data reveals novel features that would not have been detected by statistical analysis alone. Examples include short essential regions within genes, orientation-dependent effects, and fine-resolution identification of genome and protein features. Recognition of these insertion profiles in transposon mutagenesis data sets will assist genome annotation of less well characterized genomes and provides new insights into bacterial physiology and biochemistry. IMPORTANCE Incentives to define lists of genes that are essential for bacterial survival include the identification of potential targets for antibacterial drug development, genes required for rapid growth for exploitation in biotechnology, and discovery of new biochemical pathways. To identify essential genes in Escherichia coli , we constructed a transposon mutant library of unprecedented density. Initial automated analysis of the resulting data revealed many discrepancies compared to the literature. We now report more extensive statistical analysis supported by both literature searches and detailed inspection of high-density TraDIS sequencing data for each putative essential gene for the E. coli model laboratory organism. This paper is important because it provides a better understanding of the essential genes of E. coli , reveals the limitations of relying on automated analysis alone, and provides a new standard for the analysis of TraDIS data. Copyright © 2018 Goodall et al.

  16. Construction of random sheared fosmid library from Chinese cabbage and its use for Brassica rapa genome sequencing project.

    PubMed

    Park, Tae-Ho; Park, Beom-Seok; Kim, Jin-A; Hong, Joon Ki; Jin, Mina; Seol, Young-Joo; Mun, Jeong-Hwan

    2011-01-01

    As a part of the Multinational Genome Sequencing Project of Brassica rapa, linkage group R9 and R3 were sequenced using a bacterial artificial chromosome (BAC) by BAC strategy. The current physical contigs are expected to cover approximately 90% euchromatins of both chromosomes. As the project progresses, BAC selection for sequence extension becomes more limited because BAC libraries are restriction enzyme-specific. To support the project, a random sheared fosmid library was constructed. The library consists of 97536 clones with average insert size of approximately 40 kb corresponding to seven genome equivalents, assuming a Chinese cabbage genome size of 550 Mb. The library was screened with primers designed at the end of sequences of nine points of scaffold gaps where BAC clones cannot be selected to extend the physical contigs. The selected positive clones were end-sequenced to check the overlap between the fosmid clones and the adjacent BAC clones. Nine fosmid clones were selected and fully sequenced. The sequences revealed two completed gap filling and seven sequence extensions, which can be used for further selection of BAC clones confirming that the fosmid library will facilitate the sequence completion of B. rapa. Copyright © 2011. Published by Elsevier Ltd.

  17. Brucella abortus Strain 2308 Wisconsin Genome: Importance of the Definition of Reference Strains

    PubMed Central

    Suárez-Esquivel, Marcela; Ruiz-Villalobos, Nazareth; Castillo-Zeledón, Amanda; Jiménez-Rojas, César; Roop II, R. Martin; Comerci, Diego J.; Barquero-Calvo, Elías; Chacón-Díaz, Carlos; Caswell, Clayton C.; Baker, Kate S.; Chaves-Olarte, Esteban; Thomson, Nicholas R.; Moreno, Edgardo; Letesson, Jean J.; De Bolle, Xavier; Guzmán-Verri, Caterina

    2016-01-01

    Brucellosis is a bacterial infectious disease affecting a wide range of mammals and a neglected zoonosis caused by species of the genetically homogenous genus Brucella. As in most studies on bacterial diseases, research in brucellosis is carried out by using reference strains as canonical models to understand the mechanisms underlying host pathogen interactions. We performed whole genome sequencing analysis of the reference strain B. abortus 2308 routinely used in our laboratory, including manual curated annotation accessible as an editable version through a link at https://en.wikipedia.org/wiki/Brucella#Genomics. Comparison of this genome with two publically available 2308 genomes showed significant differences, particularly indels related to insertional elements, suggesting variability related to the transposition of these elements within the same strain. Considering the outcome of high resolution genomic techniques in the bacteriology field, the conventional concept of strain definition needs to be revised. PMID:27746773

  18. Construction of a nurse shark (Ginglymostoma cirratum) bacterial artificial chromosome (BAC) library and a preliminary genome survey.

    PubMed

    Luo, Meizhong; Kim, Hyeran; Kudrna, Dave; Sisneros, Nicholas B; Lee, So-Jeong; Mueller, Christopher; Collura, Kristi; Zuccolo, Andrea; Buckingham, E Bryan; Grim, Suzanne M; Yanagiya, Kazuyo; Inoko, Hidetoshi; Shiina, Takashi; Flajnik, Martin F; Wing, Rod A; Ohta, Yuko

    2006-05-03

    Sharks are members of the taxonomic class Chondrichthyes, the oldest living jawed vertebrates. Genomic studies of this group, in comparison to representative species in other vertebrate taxa, will allow us to theorize about the fundamental genetic, developmental, and functional characteristics in the common ancestor of all jawed vertebrates. In order to obtain mapping and sequencing data for comparative genomics, we constructed a bacterial artificial chromosome (BAC) library for the nurse shark, Ginglymostoma cirratum. The BAC library consists of 313,344 clones with an average insert size of 144 kb, covering ~4.5 x 1010 bp and thus providing an 11-fold coverage of the haploid genome. BAC end sequence analyses revealed, in addition to LINEs and SINEs commonly found in other animal and plant genomes, two new groups of nurse shark-specific repetitive elements, NSRE1 and NSRE2 that seem to be major components of the nurse shark genome. Screening the library with single-copy or multi-copy gene probes showed 6-28 primary positive clones per probe of which 50-90% were true positives, demonstrating that the BAC library is representative of the different regions of the nurse shark genome. Furthermore, some BAC clones contained multiple genes, making physical mapping feasible. We have constructed a deep-coverage, high-quality, large insert, and publicly available BAC library for a cartilaginous fish. It will be very useful to the scientific community interested in shark genomic structure, comparative genomics, and functional studies. We found two new groups of repetitive elements specific to the nurse shark genome, which may contribute to the architecture and evolution of the nurse shark genome.

  19. Cloning of the koi herpesvirus genome as an infectious bacterial artificial chromosome demonstrates that disruption of the thymidine kinase locus induces partial attenuation in Cyprinus carpio koi.

    PubMed

    Costes, B; Fournier, G; Michel, B; Delforge, C; Raj, V Stalin; Dewals, B; Gillet, L; Drion, P; Body, A; Schynts, F; Lieffrig, F; Vanderplasschen, A

    2008-05-01

    Koi herpesvirus (KHV) is the causative agent of a lethal disease in koi and common carp. In the present study, we describe the cloning of the KHV genome as a stable and infectious bacterial artificial chromosome (BAC) clone that can be used to produce KHV recombinant strains. This goal was achieved by the insertion of a loxP-flanked BAC cassette into the thymidine kinase (TK) locus. This insertion led to a BAC plasmid that was stably maintained in bacteria and was able to regenerate virions when permissive cells were transfected with the plasmid. Reconstituted virions free of the BAC cassette but carrying a disrupted TK locus (the FL BAC-excised strain) were produced by the transfection of Cre recombinase-expressing cells with the BAC. Similarly, virions with a wild-type revertant TK sequence (the FL BAC revertant strain) were produced by the cotransfection of cells with the BAC and a DNA fragment encoding the wild-type TK sequence. Reconstituted recombinant viruses were compared to the wild-type parental virus in vitro and in vivo. The FL BAC revertant strain and the FL BAC-excised strain replicated comparably to the parental FL strain. The FL BAC revertant strain induced KHV infection in koi carp that was indistinguishable from that induced by the parental strain, while the FL BAC-excised strain exhibited a partially attenuated phenotype. Finally, the usefulness of the KHV BAC for recombination studies was demonstrated by the production of an ORF16-deleted strain by using prokaryotic recombination technology. The availability of the KHV BAC is an important advance that will allow the study of viral genes involved in KHV pathogenesis, as well as the production of attenuated recombinant candidate vaccines.

  20. Expression of the recombinant bacterial outer surface protein A in tobacco chloroplasts leads to thylakoid localization and loss of photosynthesis.

    PubMed

    Hennig, Anna; Bonfig, Katharina; Roitsch, Thomas; Warzecha, Heribert

    2007-11-01

    Bacterial lipoproteins play crucial roles in host-pathogen interactions and pathogenesis and are important targets for the immune system. A prominent example is the outer surface protein A (OspA) of Borrelia burgdorferi, which has been efficiently used as a vaccine for the prevention of Lyme disease. In a previous study, OspA could be produced in tobacco chloroplasts in a lipidated and immunogenic form. To further explore the potential of chloroplasts for the production of bacterial lipoproteins, the role of the N-terminal leader sequence was investigated. The amount of recombinant OspA could be increased up to ten-fold by the variation of the insertion site in the chloroplast genome. Analysis of OspA mutants revealed that replacement of the invariant cysteine residue as well as deletion of the leader sequence abolishes palmitolyation of OspA. Also, decoration of OspA with an N-terminal eukaryotic lipidation motif does not lead to palmitoylation in chloroplasts. Strikingly, the bacterial signal peptide of OspA efficiently targets the protein to thylakoids, and causes a mutant phenotype. Plants accumulating OspA at 10% total soluble protein could not grow without exogenously supplied sugars and rapidly died after transfer to soil under greenhouse conditions. The plants were found to be strongly affected in photosystem II, as revealed by the analyses of temporal and spatial dynamics of photosynthetic activity by chlorophyll fluorescence imaging. Thus, overexpression of OspA in chloroplasts is limited by its concentration-dependent interference with essential functions of chloroplastic membranes required for primary metabolism.

  1. Chemical and UV Mutagenesis.

    PubMed

    Bose, Jeffrey L

    2016-01-01

    The ability to create mutations is an important step towards understanding bacterial physiology and virulence. While targeted approaches are invaluable, the ability to produce genome-wide random mutations can lead to crucial discoveries. Transposon mutagenesis is a useful approach, but many interesting mutations can be missed by these insertions that interrupt coding and noncoding sequences due to the integration of an entire transposon. Chemical mutagenesis and UV-based random mutagenesis are alternate approaches to isolate mutations of interest with the potential of only single nucleotide changes. Once a standard method, difficulty in identifying mutation sites had decreased the popularity of this technique. However, thanks to the recent emergence of economical whole-genome sequencing, this approach to making mutations can once again become a viable option. Therefore, this chapter provides an overview protocol for random mutagenesis using UV light or DNA-damaging chemicals.

  2. Cloning of human prourokinase cDNA without the signal peptide and expression in Escherichia coli.

    PubMed

    Hu, B; Li, J; Yu, W; Fang, J

    1993-01-01

    Human prourokinase (pro-UK) cDNA without the signal peptide was obtained using synthetic oligonucleotide and DNA recombination techniques and was successfully expressed in E. coli. The plasmid pMMUK which contained pro-UK cDNA (including both the entire coding sequence and the sequence for signal peptide) was digested with Hind III and PstI, so that the N-terminal 371-bp fragment could be recovered. A 304-bp fragment was collected from the 371-bp fragment after partial digestion with Fnu4HI in order to remove the signal peptide sequence. An intermediate plasmid was formed after this 304-bp fragment and the synthetic oligonucleotide was ligated with pUC18. Correctness of the ligation was confirmed by enzyme digestion and sequencing. By joining the PstI-PstI fragment of pro-UK to the plasmid we obtained the final plasmid which contained the entire coding sequence of pro-UK without the signal peptide. The coding sequence with correct orientation was inserted into pBV220 under the control of the temperature-induced promoter PRPL, and mature pro-UK was expressed in E. coli at 42 degrees C. Both sonicated supernatant and inclusion bodies of the bacterial host JM101 showed positive results by ELISA and FAPA assays. After renaturation, the biological activity of the expressed product was increased from 500-1000IU/L to about 60,000IU/L. The bacterial pro-UK showed a molecular weight of about 47,000 daltons by Western blot analysis. It can be completely inhibited by UK antiserum but not by t-PA antiserum nor by normal rabbit serum.

  3. Templated sequence insertion polymorphisms in the human genome

    NASA Astrophysics Data System (ADS)

    Onozawa, Masahiro; Aplan, Peter

    2016-11-01

    Templated Sequence Insertion Polymorphism (TSIP) is a recently described form of polymorphism recognized in the human genome, in which a sequence that is templated from a distant genomic region is inserted into the genome, seemingly at random. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; Class 1 TSIPs show features of insertions that are mediated via the LINE-1 ORF2 protein, including 1) target-site duplication (TSD), 2) polyadenylation 10-30 nucleotides downstream of a “cryptic” polyadenylation signal, and 3) preference for insertion at a 5’-TTTT/A-3’ sequence. In contrast, class 2 TSIPs show features consistent with repair of a DNA double-strand break via insertion of a DNA “patch” that is derived from a distant genomic region. Survey of a large number of normal human volunteers demonstrates that most individuals have 25-30 TSIPs, and that these TSIPs track with specific geographic regions. Similar to other forms of human polymorphism, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases.

  4. Landscape of Insertion Polymorphisms in the Human Genome

    PubMed Central

    Onozawa, Masahiro; Goldberg, Liat; Aplan, Peter D.

    2015-01-01

    Nucleotide substitutions, small (<50 bp) insertions or deletions (indels), and large (>50 bp) deletions are well-known causes of genetic variation within the human genome. We recently reported a previously unrecognized form of polymorphic insertions, termed templated sequence insertion polymorphism (TSIP), in which the inserted sequence was templated from a distant genomic region, and was inserted in the genome through reverse transcription of an RNA intermediate. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; class 1 TSIPs show target site duplication, polyadenylation, and preference for insertion at a 5′-TTTT/A-3′ sequence, suggesting a LINE-1 based insertion mechanism, whereas class 2 TSIPs show features consistent with repair of a DNA double strand break by nonhomologous end joining. To gain a more complete picture of TSIPs throughout the human population, we evaluated whole-genome sequence from 52 individuals, and identified 171 TSIPs. Most individuals had 25–30 TSIPs, and common (present in >20% of individuals) TSIPs were found in individuals throughout the world, whereas rare TSIPs tended to cluster in specific geographic regions. The number of rare TSIPs was greater than the number of common TSIPs, suggesting that TSIP generation is an ongoing process. Intriguingly, mitochondrial sequences were a frequent template for class 2 insertions, used more commonly than any nuclear chromosome. Similar to single nucleotide polymorphisms and indels, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases, and can be useful in tracking historical migration of populations. PMID:25745018

  5. Gift from statistical learning: Visual statistical learning enhances memory for sequence elements and impairs memory for items that disrupt regularities.

    PubMed

    Otsuka, Sachio; Saiki, Jun

    2016-02-01

    Prior studies have shown that visual statistical learning (VSL) enhances familiarity (a type of memory) of sequences. How do statistical regularities influence the processing of each triplet element and inserted distractors that disrupt the regularity? Given that increased attention to triplets induced by VSL and inhibition of unattended triplets, we predicted that VSL would promote memory for each triplet constituent, and degrade memory for inserted stimuli. Across the first two experiments, we found that objects from structured sequences were more likely to be remembered than objects from random sequences, and that letters (Experiment 1) or objects (Experiment 2) inserted into structured sequences were less likely to be remembered than those inserted into random sequences. In the subsequent two experiments, we examined an alternative account for our results, whereby the difference in memory for inserted items between structured and random conditions is due to individuation of items within random sequences. Our findings replicated even when control letters (Experiment 3A) or objects (Experiment 3B) were presented before or after, rather than inserted into, random sequences. Our findings suggest that statistical learning enhances memory for each item in a regular set and impairs memory for items that disrupt the regularity. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Characterization of GM events by insert knowledge adapted re-sequencing approaches

    PubMed Central

    Yang, Litao; Wang, Congmao; Holst-Jensen, Arne; Morisset, Dany; Lin, Yongjun; Zhang, Dabing

    2013-01-01

    Detection methods and data from molecular characterization of genetically modified (GM) events are needed by stakeholders of public risk assessors and regulators. Generally, the molecular characteristics of GM events are incomprehensively revealed by current approaches and biased towards detecting transformation vector derived sequences. GM events are classified based on available knowledge of the sequences of vectors and inserts (insert knowledge). Herein we present three insert knowledge-adapted approaches for characterization GM events (TT51-1 and T1c-19 rice as examples) based on paired-end re-sequencing with the advantages of comprehensiveness, accuracy, and automation. The comprehensive molecular characteristics of two rice events were revealed with additional unintended insertions comparing with the results from PCR and Southern blotting. Comprehensive transgene characterization of TT51-1 and T1c-19 is shown to be independent of a priori knowledge of the insert and vector sequences employing the developed approaches. This provides an opportunity to identify and characterize also unknown GM events. PMID:24088728

  7. Characterization of GM events by insert knowledge adapted re-sequencing approaches.

    PubMed

    Yang, Litao; Wang, Congmao; Holst-Jensen, Arne; Morisset, Dany; Lin, Yongjun; Zhang, Dabing

    2013-10-03

    Detection methods and data from molecular characterization of genetically modified (GM) events are needed by stakeholders of public risk assessors and regulators. Generally, the molecular characteristics of GM events are incomprehensively revealed by current approaches and biased towards detecting transformation vector derived sequences. GM events are classified based on available knowledge of the sequences of vectors and inserts (insert knowledge). Herein we present three insert knowledge-adapted approaches for characterization GM events (TT51-1 and T1c-19 rice as examples) based on paired-end re-sequencing with the advantages of comprehensiveness, accuracy, and automation. The comprehensive molecular characteristics of two rice events were revealed with additional unintended insertions comparing with the results from PCR and Southern blotting. Comprehensive transgene characterization of TT51-1 and T1c-19 is shown to be independent of a priori knowledge of the insert and vector sequences employing the developed approaches. This provides an opportunity to identify and characterize also unknown GM events.

  8. Experimental single-strain mobilomics reveals events that shape pathogen emergence.

    PubMed

    Schoeniger, Joseph S; Hudson, Corey M; Bent, Zachary W; Sinha, Anupama; Williams, Kelly P

    2016-08-19

    Virulence genes on mobile DNAs such as genomic islands (GIs) and plasmids promote bacterial pathogen emergence. Excision is an early step in GI mobilization, producing a circular GI and a deletion site in the chromosome; circular forms are also known for some bacterial insertion sequences (ISs). The recombinant sequence at the junctions of such circles and deletions can be detected sensitively in high-throughput sequencing data, using new computational methods that enable empirical discovery of mobile DNAs. For the rich mobilome of a hospital Klebsiella pneumoniae strain, circularization junctions (CJs) were detected for six GIs and seven IS types. Our methods revealed differential biology of multiple mobile DNAs, imprecision of integrases and transposases, and differential activity among identical IS copies for IS26, ISKpn18 and ISKpn21 Using the resistance of circular dsDNA molecules to exonuclease, internally calibrated with the native plasmids, showed that not all molecules bearing GI CJs were circular. Transpositions were also detected, revealing replicon preference (ISKpn18 prefers a conjugative IncA/C2 plasmid), local action (IS26), regional preferences, selection (against capsule synthesis) and IS polarity inversion. Efficient discovery and global characterization of numerous mobile elements per experiment improves accounting for the new gene combinations that arise in emerging pathogens. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Temperature-responsive genetic loci in the plant pathogen Pseudomonas syringae pv. glycinea.

    PubMed

    Ullrich, M S; Schergaut, M; Boch, J; Ullrich, B

    2000-10-01

    Plant-pathogenic bacteria may sense variations in environmental factors, such as temperature, to adapt to plant-associated habitats during pathogenesis or epiphytic growth. The bacterial blight pathogen of soybean, Pseudomonas syringae pv. glycinea PG4180, preferentially produces the phytotoxin coronatine at 18 degrees C and infects the host plant under conditions of low temperature and high humidity. A miniTn5-based promoterless glucuronidase (uidA) reporter gene was used to identify genetic loci of PG4180 preferentially expressed at 18 or 28 degrees C. Out of 7500 transposon mutants, 61 showed thermoregulated uidA expression as determined by a three-step screening procedure. Two-thirds of these mutants showed an increased reporter gene expression at 18 degrees C whilst the remainder exhibited higher uidA expression at 28 degrees C. MiniTn5-uidA insertion loci from these mutants were subcloned and their nucleotide sequences were determined. Several of the mutants induced at 18 degrees C contained the miniTn5-uidA insertion within the 32.8 kb coronatine biosynthetic gene cluster. Among the other mutants with increased uidA expression at 18 degrees C, insertions were found in genes encoding formaldehyde dehydrogenase, short-chain dehydrogenase and mannuronan C-5-epimerase, in a plasmid-borne replication protein, and in the hrpT locus, involved in pathogenicity of P. syringae. Among the mutants induced at 28 degrees C, insertions disrupted loci with similarities to a repressor of conjugal plasmid transfer, UV resistance determinants, an isoflavanoid-degrading enzyme, a HU-like DNA-binding protein, two additional regulatory proteins, a homologue of bacterial adhesins, transport proteins, LPS synthesis enzymes and two proteases. Genetic loci from 13 mutants did not show significant similarities to any database entries. Results of plant inoculations showed that three of the mutants tested were inhibited in symptom development and in planta multiplication rates. Temperature-shift experiments suggested that all of the identified loci showed a rather slow induction of expression upon change of temperature.

  10. Repair of DNA double-strand breaks by templated nucleotide sequence insertions derived from distant regions of the genome.

    PubMed

    Onozawa, Masahiro; Zhang, Zhenhua; Kim, Yoo Jung; Goldberg, Liat; Varga, Tamas; Bergsagel, P Leif; Kuehl, W Michael; Aplan, Peter D

    2014-05-27

    We used the I-SceI endonuclease to produce DNA double-strand breaks (DSBs) and observed that a fraction of these DSBs were repaired by insertion of sequences, which we termed "templated sequence insertions" (TSIs), derived from distant regions of the genome. These TSIs were derived from genic, retrotransposon, or telomere sequences and were not deleted from the donor site in the genome, leading to the hypothesis that they were derived from reverse-transcribed RNA. Cotransfection of RNA and an I-SceI expression vector demonstrated insertion of RNA-derived sequences at the DNA-DSB site, and TSIs were suppressed by reverse-transcriptase inhibitors. Both observations support the hypothesis that TSIs were derived from RNA templates. In addition, similar insertions were detected at sites of DNA DSBs induced by transcription activator-like effector nuclease proteins. Whole-genome sequencing of myeloma cell lines revealed additional TSIs, demonstrating that repair of DNA DSBs via insertion was not restricted to experimentally produced DNA DSBs. Analysis of publicly available databases revealed that many of these TSIs are polymorphic in the human genome. Taken together, these results indicate that insertional events should be considered as alternatives to gross chromosomal rearrangements in the interpretation of whole-genome sequence data and that this mutagenic form of DNA repair may play a role in genetic disease, exon shuffling, and mammalian evolution.

  11. CRISPR-Cas and Contact-Dependent Secretion Systems Present on Excisable Pathogenicity Islands with Conserved Recombination Modules.

    PubMed

    Carpenter, Megan R; Kalburge, Sai S; Borowski, Joseph D; Peters, Molly C; Colwell, Rita R; Boyd, E Fidelma

    2017-05-15

    Pathogenicity islands (PAIs) are mobile integrated genetic elements that contain a diverse range of virulence factors. PAIs integrate into the host chromosome at a tRNA locus that contains their specific bacterial attachment site, attB , via integrase-mediated site-specific recombination generating attL and attR sites. We identified conserved recombination modules (integrases and att sites) previously described in choleragenic Vibrio cholerae PAIs but with novel cargo genes. Clustered regularly interspaced short palindromic repeat (CRISPR)-associated proteins (Cas proteins) and a type VI secretion system (T6SS) gene cluster were identified at the Vibrio pathogenicity island 1 (VPI-1) insertion site in 19 V. cholerae strains and contained the same recombination module. Two divergent type I-F CRISPR-Cas systems were identified, which differed in Cas protein homology and content. The CRISPR repeat sequence was identical among all V. cholerae strains, but the CRISPR spacer sequences and the number of spacers varied. In silico analysis suggests that the CRISPR-Cas systems were active against phages and plasmids. A type III secretion system (T3SS) was present in 12 V. cholerae strains on a 68-kb island inserted at the same tRNA-serine insertion site as VPI-2 and contained the same recombination module. Bioinformatics analysis showed that two divergent T3SSs exist among the strains examined. Both the CRISPR and T3SS islands excised site specifically from the bacterial chromosome as complete units, and the cognate integrases were essential for this excision. These data demonstrated that identical recombination modules that catalyze integration and excision from the chromosome can acquire diverse cargo genes, signifying a novel method of acquisition for both CRISPR-Cas systems and T3SSs. IMPORTANCE This work demonstrated the presence of CRISPR-Cas systems and T3SSs on PAIs. Our work showed that similar recombination modules can associate with different cargo genes and catalyze their incorporation into bacterial chromosomes, which could convert a strain into a pathogen with very different disease pathologies. Each island had the ability to excise from the chromosome as distinct, complete units for possible transfer. Evolutionary analysis of these regions indicates that they were acquired by horizontal transfer and that PAIs are the units of transfer. Similar to the case for phage evolution, PAIs have a modular structure where different functional regions are acquired by identical recombination modules. Copyright © 2017 American Society for Microbiology.

  12. Prediction of the translocon-mediated membrane insertion free energies of protein sequences.

    PubMed

    Park, Yungki; Helms, Volkhard

    2008-05-15

    Helical membrane proteins (HMPs) play crucial roles in a variety of cellular processes. Unlike water-soluble proteins, HMPs need not only to fold but also get inserted into the membrane to be fully functional. This process of membrane insertion is mediated by the translocon complex. Thus, it is of great interest to develop computational methods for predicting the translocon-mediated membrane insertion free energies of protein sequences. We have developed Membrane Insertion (MINS), a novel sequence-based computational method for predicting the membrane insertion free energies of protein sequences. A benchmark test gives a correlation coefficient of 0.74 between predicted and observed free energies for 357 known cases, which corresponds to a mean unsigned error of 0.41 kcal/mol. These results are significantly better than those obtained by traditional hydropathy analysis. Moreover, the ability of MINS to reasonably predict membrane insertion free energies of protein sequences allows for effective identification of transmembrane (TM) segments. Subsequently, MINS was applied to predict the membrane insertion free energies of 316 TM segments found in known structures. An in-depth analysis of the predicted free energies reveals a number of interesting findings about the biogenesis and structural stability of HMPs. A web server for MINS is available at http://service.bioinformatik.uni-saarland.de/mins

  13. Conservative site-specific and single-copy transgenesis in human LINE-1 elements

    PubMed Central

    Vijaya Chandra, Shree Harsha; Makhija, Harshyaa; Peter, Sabrina; Myint Wai, Cho Mar; Li, Jinming; Zhu, Jindong; Ren, Zhonglu; D'Alcontres, Martina Stagno; Siau, Jia Wei; Chee, Sharon; Ghadessy, Farid John; Dröge, Peter

    2016-01-01

    Genome engineering of human cells plays an important role in biotechnology and molecular medicine. In particular, insertions of functional multi-transgene cassettes into suitable endogenous sequences will lead to novel applications. Although several tools have been exploited in this context, safety issues such as cytotoxicity, insertional mutagenesis and off-target cleavage together with limitations in cargo size/expression often compromise utility. Phage λ integrase (Int) is a transgenesis tool that mediates conservative site-specific integration of 48 kb DNA into a safe harbor site of the bacterial genome. Here, we show that an Int variant precisely recombines large episomes into a sequence, termed attH4X, found in 1000 human Long INterspersed Elements-1 (LINE-1). We demonstrate single-copy transgenesis through attH4X-targeting in various cell lines including hESCs, with the flexibility of selecting clones according to transgene performance and downstream applications. This is exemplified with pluripotency reporter cassettes and constitutively expressed payloads that remain functional in LINE1-targeted hESCs and differentiated progenies. Furthermore, LINE-1 targeting does not induce DNA damage-response or chromosomal aberrations, and neither global nor localized endogenous gene expression is substantially affected. Hence, this simple transgene addition tool should become particularly useful for applications that require engineering of the human genome with multi-transgenes. PMID:26673710

  14. Phylogenetic Evidence for Lateral Gene Transfer in the Intestine of Marine Iguanas

    PubMed Central

    Nelson, David M.; Cann, Isaac K. O.; Altermann, Eric; Mackie, Roderick I.

    2010-01-01

    Background Lateral gene transfer (LGT) appears to promote genotypic and phenotypic variation in microbial communities in a range of environments, including the mammalian intestine. However, the extent and mechanisms of LGT in intestinal microbial communities of non-mammalian hosts remains poorly understood. Methodology/Principal Findings We sequenced two fosmid inserts obtained from a genomic DNA library derived from an agar-degrading enrichment culture of marine iguana fecal material. The inserts harbored 16S rRNA genes that place the organism from which they originated within Clostridium cluster IV, a well documented group that habitats the mammalian intestinal tract. However, sequence analysis indicates that 52% of the protein-coding genes on the fosmids have top BLASTX hits to bacterial species that are not members of Clostridium cluster IV, and phylogenetic analysis suggests that at least 10 of 44 coding genes on the fosmids may have been transferred from Clostridium cluster XIVa to cluster IV. The fosmids encoded four transposase-encoding genes and an integrase-encoding gene, suggesting their involvement in LGT. In addition, several coding genes likely involved in sugar transport were probably acquired through LGT. Conclusion Our phylogenetic evidence suggests that LGT may be common among phylogenetically distinct members of the phylum Firmicutes inhabiting the intestinal tract of marine iguanas. PMID:20520734

  15. Impact of ionic liquids in aqueous solution on bacterial plasma membranes studied with molecular dynamics simulations.

    PubMed

    Lim, Geraldine S; Zidar, Jernej; Cheong, Daniel W; Jaenicke, Stephan; Klähn, Marco

    2014-09-04

    The impact of five different imidazolium-based ionic liquids (ILs) diluted in water on the properties of a bacterial plasma membrane is investigated using molecular dynamics (MD) simulations. Cations considered are 1-octyl-3-methylimidazolium (OMIM), 1-octyloxymethyl-3-methylimidazolium (OXMIM), and 1-tetradecyl-3-methylimidazolium (TDMIM), as well as the anions chloride and lactate. The atomistic model of the membrane bilayer is designed to reproduce the lipid composition of the plasma membrane of Gram-negative Escherichia coli. Spontaneous insertion of cations into the membrane is observed in all ILs. Substantially more insertions of OMIM than of OXMIM occur and the presence of chloride reduces cation insertions compared to lactate. In contrast, anions do not adsorb onto the membrane surface nor diffuse into the bilayer. Once inserted, cations are oriented in parallel to membrane lipids with cation alkyl tails embedded into the hydrophobic membrane core, while the imidazolium-ring remains mostly exposed to the solvent. Such inserted cations are strongly associated with one to two phospholipids in the membrane. The overall order of lipids decreased after OMIM and OXMIM insertions, while on the contrary the order of lipids in the vicinity of TDMIM increased. The short alkyl tails of OMIM and OXMIM generate voids in the bilayer that are filled by curling lipids. This cation induced lipid disorder also reduces the average membrane thickness. This effect is not observed after TDMIM insertions due to the similar length of cation alkyl chain and the fatty acids of the lipids. This lipid-mimicking behavior of inserted TDMIM indicates a high membrane affinity of this cation that could lead to an enhanced accumulation of cations in the membrane over time. Overall, the simulations reveal how cations are inserted into the bacterial membrane and how such insertions change its properties. Moreover, the different roles of cations and anions are highlighted and the fundamental importance of cation alkyl chain length and its functionalization is demonstrated.

  16. Identification of genetic loci that contribute to Campylobacter resistance to fowlicidin-1, a chicken host defense peptide

    PubMed Central

    Hoang, Ky Van; Wang, Ying; Lin, Jun

    2012-01-01

    Antimicrobial peptides (AMPs) are critical components of host defense limiting bacterial infections at the gastrointestinal mucosal surface. Bacterial pathogens have co-evolved with host innate immunity and developed means to counteract the effect of endogenous AMPs. However, molecular mechanisms of AMP resistance in Campylobacter, an important human food-borne pathogen with poultry as a major reservoir, are still largely unknown. In this study, random transposon mutagenesis and targeted site-directed mutagenesis approaches were used to identify genetic loci contributing Campylobacter resistance to fowlicidin-1, a chicken AMP belonging to cathelicidin family. An efficient transposon mutagenesis approach (EZ::TN™ Transposome) in conjunction with a microtiter plate screening identified three mutants whose susceptibilities to fowlicidin-1 were significantly increased. Backcrossing of the transposon mutations into parent strain confirmed that the AMP-sensitive phenotype in each mutant was linked to the specific transposon insertion. Direct sequencing showed that these mutants have transposon inserted in the genes encoding two-component regulator CbrR, transporter CjaB, and putative trigger factor Tig. Genomic analysis also revealed an operon (Cj1580c-1584c) that is homologous to sapABCDF, an operon conferring resistance to AMP in other pathogens. Insertional inactivation of Cj1583c (sapB) significantly increased susceptibility of Campylobacter to fowlicidin-1. The sapB as well as tig and cjaB mutants were significantly impaired in their ability to compete with their wild-type strain 81–176 to colonize the chicken cecum. Together, this study identified four genetic loci in Campylobacter that will be useful for characterizing molecular basis of Campylobacter resistance to AMPs, a significant knowledge gap in Campylobacter pathogenesis. PMID:22919624

  17. Global mapping of transposon location.

    PubMed

    Gabriel, Abram; Dapprich, Johannes; Kunkel, Mark; Gresham, David; Pratt, Stephen C; Dunham, Maitreya J

    2006-12-15

    Transposable genetic elements are ubiquitous, yet their presence or absence at any given position within a genome can vary between individual cells, tissues, or strains. Transposable elements have profound impacts on host genomes by altering gene expression, assisting in genomic rearrangements, causing insertional mutations, and serving as sources of phenotypic variation. Characterizing a genome's full complement of transposons requires whole genome sequencing, precluding simple studies of the impact of transposition on interindividual variation. Here, we describe a global mapping approach for identifying transposon locations in any genome, using a combination of transposon-specific DNA extraction and microarray-based comparative hybridization analysis. We use this approach to map the repertoire of endogenous transposons in different laboratory strains of Saccharomyces cerevisiae and demonstrate that transposons are a source of extensive genomic variation. We also apply this method to mapping bacterial transposon insertion sites in a yeast genomic library. This unique whole genome view of transposon location will facilitate our exploration of transposon dynamics, as well as defining bases for individual differences and adaptive potential.

  18. Comprehensive Identification of Meningococcal Genes and Small Noncoding RNAs Required for Host Cell Colonization

    PubMed Central

    Capel, Elena; Zomer, Aldert L.; Nussbaumer, Thomas; Bole, Christine; Izac, Brigitte; Frapy, Eric; Meyer, Julie; Bouzinba-Ségard, Haniaa; Bille, Emmanuelle; Jamet, Anne; Cavau, Anne; Letourneur, Franck; Bourdoulous, Sandrine; Rattei, Thomas; Coureuil, Mathieu

    2016-01-01

    ABSTRACT Neisseria meningitidis is a leading cause of bacterial meningitis and septicemia, affecting infants and adults worldwide. N. meningitidis is also a common inhabitant of the human nasopharynx and, as such, is highly adapted to its niche. During bacteremia, N. meningitidis gains access to the blood compartment, where it adheres to endothelial cells of blood vessels and causes dramatic vascular damage. Colonization of the nasopharyngeal niche and communication with the different human cell types is a major issue of the N. meningitidis life cycle that is poorly understood. Here, highly saturated random transposon insertion libraries of N. meningitidis were engineered, and the fitness of mutations during routine growth and that of colonization of endothelial and epithelial cells in a flow device were assessed in a transposon insertion site sequencing (Tn-seq) analysis. This allowed the identification of genes essential for bacterial growth and genes specifically required for host cell colonization. In addition, after having identified the small noncoding RNAs (sRNAs) located in intergenic regions, the phenotypes associated with mutations in those sRNAs were defined. A total of 383 genes and 8 intergenic regions containing sRNA candidates were identified to be essential for growth, while 288 genes and 33 intergenic regions containing sRNA candidates were found to be specifically required for host cell colonization. PMID:27486197

  19. Changes of resistome, mobilome and potential hosts of antibiotic resistance genes during the transformation of anaerobic digestion from mesophilic to thermophilic.

    PubMed

    Tian, Zhe; Zhang, Yu; Yu, Bo; Yang, Min

    2016-07-01

    This study aimed to reveal how antibiotic resistance genes (ARGs) and their horizontal and vertical transfer-related items (mobilome and bacterial hosts) respond to the transformation of anaerobic digestion (AD) from mesophilic to thermophilic using one-step temperature increase. The resistomes and mobilomes of mesophilic and thermophilic sludge were investigated using metagenome sequencing, and the changes in 24 representative ARGs belonging to three categories, class 1 integron and bacterial genera during the transition period were further followed using quantitative PCR and 454-pyrosequencing. After the temperature increase, resistome abundance in the digested sludge decreased from 125.97 ppm (day 0, mesophilic) to 50.65 ppm (day 57, thermophilic) with the reduction of most ARG types except for the aminoglycoside resistance genes. Thermophilic sludge also had a smaller mobilome, including plasmids, insertion sequences and integrons, than that of mesophilic sludge, suggesting the lower horizontal transfer potential of ARGs under thermophilic conditions. On the other hand, the total abundance of 18 bacterial genera, which were suggested as the possible hosts for 13 ARGs through network analysis, decreased from 23.27% in mesophilic sludge to 11.92% in thermophilic sludge, indicating fewer hosts for the vertical expansion of ARGs after the increase in temperature. These results indicate that the better reduction of resistome abundance by thermophilic AD might be associated with the decrease of both the horizontal and vertical transferability of ARGs. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. BAC end sequencing of Pacific white shrimp Litopenaeus vannamei: a glimpse into the genome of Penaeid shrimp

    NASA Astrophysics Data System (ADS)

    Zhao, Cui; Zhang, Xiaojun; Liu, Chengzhang; Huan, Pin; Li, Fuhua; Xiang, Jianhai; Huang, Chao

    2012-05-01

    Little is known about the genome of Pacific white shrimp ( Litopenaeus vannamei). To address this, we conducted BAC (bacterial artificial chromosome) end sequencing of L. vannamei. We selected and sequenced 7 812 BAC clones from the BAC library LvHE from the two ends of the inserts by Sanger sequencing. After trimming and quality filtering, 11 279 BAC end sequences (BESs) including 4 609 pairedends BESs were obtained. The total length of the BESs was 4 340 753 bp, representing 0.18% of the L. vannamei haploid genome. The lengths of the BESs ranged from 100 bp to 660 bp with an average length of 385 bp. Analysis of the BESs indicated that the L. vannamei genome is AT-rich and that the primary repeats patterns were simple sequence repeats (SSRs) and low complexity sequences. Dinucleotide and hexanucleotide repeats were the most common SSR types in the BESs. The most abundant transposable element was gypsy, which may contribute to the generation of the large genome size of L. vannamei. We successfully annotated 4 519 BESs by BLAST searching, including genes involved in immunity and sex determination. Our results provide an important resource for functional gene studies, map construction and integration, and complete genome assembly for this species.

  1. Drivers of bacterial genomes plasticity and roles they play in pathogen virulence, persistence and drug resistance.

    PubMed

    Patel, Seema

    2016-11-01

    Despite the advent of next-generation sequencing (NGS) technologies, sophisticated data analysis and drug development efforts, bacterial drug resistance persists and is escalating in magnitude. To better control the pathogens, a thorough understanding of their genomic architecture and dynamics is vital. Bacterial genome is extremely complex, a mosaic of numerous co-operating and antagonizing components, altruistic and self-interested entities, behavior of which are predictable and conserved to some extent, yet largely dictated by an array of variables. In this regard, mobile genetic elements (MGE), DNA repair systems, post-segregation killing systems, toxin-antitoxin (TA) systems, restriction-modification (RM) systems etc. are dominant agents and horizontal gene transfer (HGT), gene redundancy, epigenetics, phase and antigenic variation etc. processes shape the genome. By illegitimate recombinations, deletions, insertions, duplications, amplifications, inversions, conversions, translocations, modification of intergenic regions and other alterations, bacterial genome is modified to tackle stressors like drugs, and host immune effectors. Over the years, thousands of studies have investigated this aspect and mammoth amount of insights have been accumulated. This review strives to distillate the existing information, formulate hypotheses and to suggest directions, that might contribute towards improved mitigation of the vicious pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Diverse Bacterial Groups Contribute to the Alkane Degradation Potential of Chronically Polluted Subantarctic Coastal Sediments

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guibert, Lilian M.; Loviso, Claudia L.; Borglin, Sharon

    We aimed to gain insight into the alkane degradation potential of microbial communities from chronically polluted sediments of a subantarctic coastal environment using a combination of metagenomic approaches. A total of 6178 sequences annotated as alkane-1-monooxygenases (EC 1.14.15.3) were retrieved from a shotgun metagenomic dataset that included two sites analyzed in triplicate. The majority of the sequences binned with AlkB described in Bacteroidetes (32 ± 13 %) or Proteobacteria (29 ± 7 %), although a large proportion remained unclassified at the phylum level. Operational taxonomic unit (OTU)-based analyses showed small differences in AlkB distribution among samples that could be correlatedmore » with alkane concentrations, as well as with site-specific variations in pH and salinity. A number of low-abundance OTUs, mostly affiliated with Actinobacterial sequences, were found to be only present in the most contaminated samples. On the other hand, the molecular screening of a large-insert metagenomic library of intertidal sediments from one of the sampling sites identified two genomic fragments containing novel alkB gene sequences, as well as various contiguous genes related to lipid metabolism. Both genomic fragments were affiliated with the phylum Planctomycetes, and one could be further assigned to the genus Rhodopirellula due to the presence of a partial sequence of the 23S ribosomal RNA (rRNA) gene. This work highlights the diversity of bacterial groups contributing to the alkane degradation potential and reveals patterns of functional diversity in relation with environmental stressors in a chronically polluted, high-latitude coastal environment. In addition, alkane biodegradation genes are described for the first time in members of Planctomycetes.« less

  3. Retrotransposon Capture Sequencing (RC-Seq): A Targeted, High-Throughput Approach to Resolve Somatic L1 Retrotransposition in Humans.

    PubMed

    Sanchez-Luque, Francisco J; Richardson, Sandra R; Faulkner, Geoffrey J

    2016-01-01

    Mobile genetic elements (MGEs) are of critical importance in genomics and developmental biology. Polymorphic and somatic MGE insertions have the potential to impact the phenotype of an individual, depending on their genomic locations and functional consequences. However, the identification of polymorphic and somatic insertions among the plethora of copies residing in the genome presents a formidable technical challenge. Whole genome sequencing has the potential to address this problem; however, its efficacy depends on the abundance of cells carrying the new insertion. Robust detection of somatic insertions present in only a subset of cells within a given sample can also be prohibitively expensive due to a requirement for high sequencing depth. Here, we describe retrotransposon capture sequencing (RC-seq), a sequence capture approach in which Illumina libraries are enriched for fragments containing the 5' and 3' termini of specific MGEs. RC-seq allows the detection of known polymorphic insertions present in an individual, as well as the identification of rare or private germline insertions not previously described. Furthermore, RC-seq can be used to detect and characterize somatic insertions, providing a valuable tool to elucidate the extent and characteristics of MGE activity in healthy tissues and in various disease states.

  4. Interkinase domain of kit contains the binding site for phosphatidylinositol 3' kinase.

    PubMed Central

    Lev, S; Givol, D; Yarden, Y

    1992-01-01

    Our previous analysis of the signal transduction pathway used by the c-kit-encoded receptor for the stem cell factor (SCF) indicated efficient coupling to the type I phosphatidylinositol 3' kinase (PI3K). In an attempt to localize the receptor's site of interaction with PI3K, we separately deleted either the noncatalytic 68-amino-acid-long interkinase domain or the carboxyl-terminal portion distal to the catalytic sequences. Loss of ligand-induced association of PI3K with the former deletion mutant and retention of the PI3K association by the carboxyl-terminally deleted receptor implied interactions of PI3K with the kinase insert. This was further supported by partial inhibition of the association by an anti-peptide antibody directed against the kinase insert and lack of effect of an antibody directed to the carboxyl tail of the SCF receptor. A bacterially expressed kinase insert domain was used as a fusion protein to directly test its presumed function as a PI3K association site. This protein bound PI3K from cell lysate as demonstrated by PI3K activity and by an associated phosphoprotein of 85 kDa. The association was dependent on phosphorylation of the tyrosine residues on the expressed kinase insert. On the basis of these observations, we conclude that the kinase insert domain of the SCF receptor selectively interacts with the p85 regulatory subunit of PI3K and that this association requires phosphorylation of tyrosine residues in the kinase insert region, with apparently no involvement of the bulk cytoplasmic structure or tyrosine kinase function of the receptor. Images PMID:1370584

  5. Re-sequencing transgenic plants revealed rearrangements at T-DNA inserts, and integration of a short T-DNA fragment, but no increase of small mutations elsewhere.

    PubMed

    Schouten, Henk J; Vande Geest, Henri; Papadimitriou, Sofia; Bemer, Marian; Schaart, Jan G; Smulders, Marinus J M; Perez, Gabino Sanchez; Schijlen, Elio

    2017-03-01

    Transformation resulted in deletions and translocations at T-DNA inserts, but not in genome-wide small mutations. A tiny T-DNA splinter was detected that probably would remain undetected by conventional techniques. We investigated to which extent Agrobacterium tumefaciens-mediated transformation is mutagenic, on top of inserting T-DNA. To prevent mutations due to in vitro propagation, we applied floral dip transformation of Arabidopsis thaliana. We re-sequenced the genomes of five primary transformants, and compared these to genomic sequences derived from a pool of four wild-type plants. By genome-wide comparisons, we identified ten small mutations in the genomes of the five transgenic plants, not correlated to the positions or number of T-DNA inserts. This mutation frequency is within the range of spontaneous mutations occurring during seed propagation in A. thaliana, as determined earlier. In addition, we detected small as well as large deletions specifically at the T-DNA insert sites. Furthermore, we detected partial T-DNA inserts, one of these a tiny 50-bp fragment originating from a central part of the T-DNA construct used, inserted into the plant genome without flanking other T-DNA. Because of its small size, we named this fragment a T-DNA splinter. As far as we know this is the first report of such a small T-DNA fragment insert in absence of any T-DNA border sequence. Finally, we found evidence for translocations from other chromosomes, flanking T-DNA inserts. In this study, we showed that next-generation sequencing (NGS) is a highly sensitive approach to detect T-DNA inserts in transgenic plants.

  6. Using synthetic bacterial enhancers to reveal a looping-based mechanism for quenching-like repression

    PubMed Central

    Brunwasser-Meirom, Michal; Pollak, Yaroslav; Goldberg, Sarah; Levy, Lior; Atar, Orna; Amit, Roee

    2016-01-01

    We explore a model for ‘quenching-like' repression by studying synthetic bacterial enhancers, each characterized by a different binding site architecture. To do so, we take a three-pronged approach: first, we compute the probability that a protein-bound dsDNA molecule will loop. Second, we use hundreds of synthetic enhancers to test the model's predictions in bacteria. Finally, we verify the mechanism bioinformatically in native genomes. Here we show that excluded volume effects generated by DNA-bound proteins can generate substantial quenching. Moreover, the type and extent of the regulatory effect depend strongly on the relative arrangement of the binding sites. The implications of these results are that enhancers should be insensitive to 10–11 bp insertions or deletions (INDELs) and sensitive to 5–6 bp INDELs. We test this prediction on 61 σ54-regulated qrr genes from the Vibrio genus and confirm the tolerance of these enhancers' sequences to the DNA's helical repeat. PMID:26832446

  7. Using synthetic bacterial enhancers to reveal a looping-based mechanism for quenching-like repression.

    PubMed

    Brunwasser-Meirom, Michal; Pollak, Yaroslav; Goldberg, Sarah; Levy, Lior; Atar, Orna; Amit, Roee

    2016-02-02

    We explore a model for 'quenching-like' repression by studying synthetic bacterial enhancers, each characterized by a different binding site architecture. To do so, we take a three-pronged approach: first, we compute the probability that a protein-bound dsDNA molecule will loop. Second, we use hundreds of synthetic enhancers to test the model's predictions in bacteria. Finally, we verify the mechanism bioinformatically in native genomes. Here we show that excluded volume effects generated by DNA-bound proteins can generate substantial quenching. Moreover, the type and extent of the regulatory effect depend strongly on the relative arrangement of the binding sites. The implications of these results are that enhancers should be insensitive to 10-11 bp insertions or deletions (INDELs) and sensitive to 5-6 bp INDELs. We test this prediction on 61 σ(54)-regulated qrr genes from the Vibrio genus and confirm the tolerance of these enhancers' sequences to the DNA's helical repeat.

  8. Characterization of a cfr-Carrying Plasmid from Porcine Escherichia coli That Closely Resembles Plasmid pEA3 from the Plant Pathogen Erwinia amylovora.

    PubMed

    Zhang, Rongmin; Sun, Bin; Wang, Yang; Lei, Lei; Schwarz, Stefan; Wu, Congming

    2016-01-01

    The multiresistance gene cfr was found in two porcine Escherichia coli isolates, one harboring it on the conjugative 33,885-bp plasmid pFSEC-01, the other harboring it in the chromosomal DNA. Sequence analysis of pFSEC-01 revealed that a 6,769-bp fragment containing the cfr gene bracketed by two IS26 elements was inserted into a plasmid closely related to pEA3 from the plant pathogen Erwinia amylovora, suggesting that pFSEC-01 may be transferred between different bacterial genera of both animal and plant origin. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  9. Construction and Analysis of Siberian Tiger Bacterial Artificial Chromosome Library with Approximately 6.5-Fold Genome Equivalent Coverage

    PubMed Central

    Liu, Changqing; Bai, Chunyu; Guo, Yu; Liu, Dan; Lu, Taofeng; Li, Xiangchen; Ma, Jianzhang; Ma, Yuehui; Guan, Weijun

    2014-01-01

    Bacterial artificial chromosome (BAC) libraries are extremely valuable for the genome-wide genetic dissection of complex organisms. The Siberian tiger, one of the most well-known wild primitive carnivores in China, is an endangered animal. In order to promote research on its genome, a high-redundancy BAC library of the Siberian tiger was constructed and characterized. The library is divided into two sub-libraries prepared from blood cells and two sub-libraries prepared from fibroblasts. This BAC library contains 153,600 individually archived clones; for PCR-based screening of the library, BACs were placed into 40 superpools of 10 × 384-deep well microplates. The average insert size of BAC clones was estimated to be 116.5 kb, representing approximately 6.46 genome equivalents of the haploid genome and affording a 98.86% statistical probability of obtaining at least one clone containing a unique DNA sequence. Screening the library with 19 microsatellite markers and a SRY sequence revealed that each of these markers were present in the library; the average number of positive clones per marker was 6.74 (range 2 to 12), consistent with 6.46 coverage of the tiger genome. Additionally, we identified 72 microsatellite markers that could potentially be used as genetic markers. This BAC library will serve as a valuable resource for physical mapping, comparative genomic study and large-scale genome sequencing in the tiger. PMID:24608928

  10. Recombinant Expression of Tandem-HBc Virus-Like Particles (VLPs).

    PubMed

    Stephen, Sam L; Beales, Lucy; Peyret, Hadrien; Roe, Amy; Stonehouse, Nicola J; Rowlands, David J

    2018-01-01

    The hepatitis B virus (HBV) core protein (HBc) has formed the building block for virus-like particle (VLP) production for more than 30 years. The ease of production of the protein, the robust ability of the core monomers to dimerize and assemble into intact core particles, and the strong immune responses they elicit when presenting antigenic epitopes all demonstrate its promise for vaccine development (reviewed in Pumpens and Grens (Intervirology 44: 98-114, 2001)). HBc has been modified in a number of ways in attempts to expand its potential as a novel vaccine platform. The HBc protein is predominantly α-helical in structure and folds to form an L-shaped molecule. The structural subunit of the HBc particle is a dimer of monomeric HBc proteins which together form an inverted T-shaped structure. In the assembled HBc particle the four-helix bundle formed at each dimer interface appears at the surface as a prominent "spike." The tips of the "spikes" are the preferred sites for the insertion of foreign sequences for vaccine purposes as they are the most highly exposed regions of the assembled particles. In the tandem-core modification two copies of the HBc protein are covalently linked by a flexible amino acid sequence which allows the fused dimer to fold correctly and assemble into HBc particles. The advantage of the modified structure is that the assembly of the dimeric subunits is defined and not formed by random association. This facilitates the introduction of single, larger sequences at the tip of each surface "spike," thus overcoming the conformational clashes contingent on insertion of large structures into monomeric HBc proteins.Differences in inserted sequences influence the assembly characteristics of the modified proteins, and it is important to optimize the design of each novel construct to maximize efficiency of assembly into regular VLPs. In addition to optimization of the construct, the expression system used can also influence the ability of recombinant structures to assemble into regular isometric particles. Here, we describe the production of recombinant tandem-core particles in bacterial, yeast and plant expression systems.

  11. Stepwise visualization of membrane pore formation by suilysin, a bacterial cholesterol-dependent cytolysin.

    PubMed

    Leung, Carl; Dudkina, Natalya V; Lukoyanova, Natalya; Hodel, Adrian W; Farabella, Irene; Pandurangan, Arun P; Jahan, Nasrin; Pires Damaso, Mafalda; Osmanović, Dino; Reboul, Cyril F; Dunstone, Michelle A; Andrew, Peter W; Lonnen, Rana; Topf, Maya; Saibil, Helen R; Hoogenboom, Bart W

    2014-12-02

    Membrane attack complex/perforin/cholesterol-dependent cytolysin (MACPF/CDC) proteins constitute a major superfamily of pore-forming proteins that act as bacterial virulence factors and effectors in immune defence. Upon binding to the membrane, they convert from the soluble monomeric form to oligomeric, membrane-inserted pores. Using real-time atomic force microscopy (AFM), electron microscopy (EM), and atomic structure fitting, we have mapped the structure and assembly pathways of a bacterial CDC in unprecedented detail and accuracy, focussing on suilysin from Streptococcus suis. We show that suilysin assembly is a noncooperative process that is terminated before the protein inserts into the membrane. The resulting ring-shaped pores and kinetically trapped arc-shaped assemblies are all seen to perforate the membrane, as also visible by the ejection of its lipids. Membrane insertion requires a concerted conformational change of the monomeric subunits, with a marked expansion in pore diameter due to large changes in subunit structure and packing.

  12. Stepwise visualization of membrane pore formation by suilysin, a bacterial cholesterol-dependent cytolysin

    PubMed Central

    Lukoyanova, Natalya; Hodel, Adrian W; Farabella, Irene; Pandurangan, Arun P; Jahan, Nasrin; Pires Damaso, Mafalda; Osmanović, Dino; Reboul, Cyril F; Dunstone, Michelle A; Andrew, Peter W; Lonnen, Rana; Topf, Maya

    2014-01-01

    Membrane attack complex/perforin/cholesterol-dependent cytolysin (MACPF/CDC) proteins constitute a major superfamily of pore-forming proteins that act as bacterial virulence factors and effectors in immune defence. Upon binding to the membrane, they convert from the soluble monomeric form to oligomeric, membrane-inserted pores. Using real-time atomic force microscopy (AFM), electron microscopy (EM), and atomic structure fitting, we have mapped the structure and assembly pathways of a bacterial CDC in unprecedented detail and accuracy, focussing on suilysin from Streptococcus suis. We show that suilysin assembly is a noncooperative process that is terminated before the protein inserts into the membrane. The resulting ring-shaped pores and kinetically trapped arc-shaped assemblies are all seen to perforate the membrane, as also visible by the ejection of its lipids. Membrane insertion requires a concerted conformational change of the monomeric subunits, with a marked expansion in pore diameter due to large changes in subunit structure and packing. DOI: http://dx.doi.org/10.7554/eLife.04247.001 PMID:25457051

  13. Enhancing the GABI-Kat Arabidopsis thaliana T-DNA Insertion Mutant Database by Incorporating Araport11 Annotation.

    PubMed

    Kleinboelting, Nils; Huep, Gunnar; Weisshaar, Bernd

    2017-01-01

    SimpleSearch provides access to a database containing information about T-DNA insertion lines of the GABI-Kat collection of Arabidopsis thaliana mutants. These mutants are an important tool for reverse genetics, and GABI-Kat is the second largest collection of such T-DNA insertion mutants. Insertion sites were deduced from flanking sequence tags (FSTs), and the database contains information about mutant plant lines as well as insertion alleles. Here, we describe improvements within the interface (available at http://www.gabi-kat.de/db/genehits.php) and with regard to the database content that have been realized in the last five years. These improvements include the integration of the Araport11 genome sequence annotation data containing the recently updated A. thaliana structural gene descriptions, an updated visualization component that displays groups of insertions with very similar insertion positions, mapped confirmation sequences, and primers. The visualization component provides a quick way to identify insertions of interest, and access to improved data about the exact structure of confirmed insertion alleles. In addition, the database content has been extended by incorporating additional insertion alleles that were detected during the confirmation process, as well as by adding new FSTs that have been produced during continued efforts to complement gaps in FST availability. Finally, the current database content regarding predicted and confirmed insertion alleles as well as primer sequences has been made available as downloadable flat files. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.

  14. “Agrolistic” transformation of plant cells: Integration of T-strands generated in planta

    PubMed Central

    Hansen, Geneviève; Chilton, Mary-Dell

    1996-01-01

    We describe a novel plant transformation technique, termed “agrolistic,” that combines the advantages of the Agrobacterium transformation system with the high efficiency of biolistic DNA delivery. Agrolistic transformation allows integration of the gene of interest without undesired vector sequence. The virulence genes virD1 and virD2 from Agrobacterium tumefaciens that are required in bacteria for excision of T-strands from the tumor-inducing plasmid were placed under the control of the CaMV35S promoter and codelivered with a target plasmid containing border sequences flanking the gene of interest. Transient expression assays in tobacco and in maize cells indicated that vir gene products caused strand-specific nicking in planta at the right border sequence, similar to VirD1/VirD2-catalyzed T-strand excision observed in Agrobacterium. Agrolistically transformed tobacco calli were obtained after codelivery of virD1 and virD2 genes together with a selectable marker flanked by border sequences. Some inserts exhibited right junctions with plant DNA that corresponded precisely to the sequence expected for T-DNA (portion of the tumor-inducing plasmid that is transferred to plant cells) insertion events. We designate these as “agrolistic” inserts, as distinguished from “biolistic” inserts. Both types of inserts were found in some transformed lines. The frequency of agrolistic inserts was 20% that of biolistic inserts. PMID:8962167

  15. Evolutionary genomics: transdomain gene transfers.

    PubMed

    Bordenstein, Seth R

    2007-11-06

    Biologists have until now conceded that bacterial gene transfer to multicellular animals is relatively uncommon in Nature. A new study showing promiscuous insertions of bacterial endosymbiont genes into invertebrate genomes ushers in a shift in this paradigm.

  16. Identification of novel MITEs (miniature inverted-repeat transposable elements) in Coxiella burnetii: implications for protein and small RNA evolution.

    PubMed

    Wachter, Shaun; Raghavan, Rahul; Wachter, Jenny; Minnick, Michael F

    2018-04-11

    Coxiella burnetii is a Gram-negative gammaproteobacterium and zoonotic agent of Q fever. C. burnetii's genome contains an abundance of pseudogenes and numerous selfish genetic elements. MITEs (miniature inverted-repeat transposable elements) are non-autonomous transposons that occur in all domains of life and are thought to be insertion sequences (ISs) that have lost their transposase function. Like most transposable elements (TEs), MITEs are thought to play an active role in evolution by altering gene function and expression through insertion and deletion activities. However, information regarding bacterial MITEs is limited. We describe two MITE families discovered during research on small non-coding RNAs (sRNAs) of C. burnetii. Two sRNAs, Cbsr3 and Cbsr13, were found to originate from a novel MITE family, termed QMITE1. Another sRNA, CbsR16, was found to originate from a separate and novel MITE family, termed QMITE2. Members of each family occur ~ 50 times within the strains evaluated. QMITE1 is a typical MITE of 300-400 bp with short (2-3 nt) direct repeats (DRs) of variable sequence and is often found overlapping annotated open reading frames (ORFs). Additionally, QMITE1 elements possess sigma-70 promoters and are transcriptionally active at several loci, potentially influencing expression of nearby genes. QMITE2 is smaller (150-190 bps), but has longer (7-11 nt) DRs of variable sequences and is mainly found in the 3' untranslated region of annotated ORFs and intergenic regions. QMITE2 contains a GTAG repetitive extragenic palindrome (REP) that serves as a target for IS1111 TE insertion. Both QMITE1 and QMITE2 display inter-strain linkage and sequence conservation, suggesting that they are adaptive and existed before divergence of C. burnetii strains. We have discovered two novel MITE families of C. burnetii. Our finding that MITEs serve as a source for sRNAs is novel. QMITE2 has a unique structure and occurs in large or small versions with unique DRs that display linkage and sequence conservation between strains, allowing for tracking of genomic rearrangements. QMITE1 and QMITE2 copies are hypothesized to influence expression of neighboring genes involved in DNA repair and virulence through transcriptional interference and ribonuclease processing.

  17. A novel adaptive needle insertion sequencing for robotic, single needle MR-guided high-dose-rate prostate brachytherapy

    NASA Astrophysics Data System (ADS)

    Borot de Battisti, M.; de Senneville, B. Denis; Hautvast, G.; Binnekamp, D.; Lagendijk, J. J. W.; Maenhout, M.; Moerland, M. A.

    2017-05-01

    MR-guided high-dose-rate (HDR) brachytherapy has gained increasing interest as a treatment for patients with localized prostate cancer because of the superior value of MRI for tumor and surrounding tissues localization. To enable needle insertion into the prostate with the patient in the MR bore, a single needle MR-compatible robotic system involving needle-by-needle dose delivery has been developed at our institution. Throughout the intervention, dose delivery may be impaired by: (1) sub-optimal needle positioning caused by e.g. needle bending, (2) intra-operative internal organ motion such as prostate rotations or swelling, or intra-procedural rectum or bladder filling. This may result in failure to reach clinical constraints. To assess the first aforementioned challenge, a recent study from our research group demonstrated that the deposited dose may be greatly improved by real-time adaptive planning with feedback on the actual needle positioning. However, the needle insertion sequence is left to the doctor and therefore, this may result in sub-optimal dose delivery. In this manuscript, a new method is proposed to determine and update automatically the needle insertion sequence. This strategy is based on the determination of the most sensitive needle track. The sensitivity of a needle track is defined as its impact on the dose distribution in case of sub-optimal positioning. A stochastic criterion is thus presented to determine each needle track sensitivity based on needle insertion simulations. To assess the proposed sequencing strategy, HDR prostate brachytherapy was simulated on 11 patients with varying number of needle insertions. Sub-optimal needle positioning was simulated at each insertion (modeled by typical random angulation errors). In 91% of the scenarios, the dose distribution improved when the needle was inserted into the most compared to the least sensitive needle track. The computation time for sequencing was less than 6 s per needle track. The proposed needle insertion sequencing can therefore assist in delivering an optimal dose in HDR prostate brachytherapy.

  18. A Comprehensive Analysis of In Vitro and In Vivo Genetic Fitness of Pseudomonas aeruginosa Using High-Throughput Sequencing of Transposon Libraries

    PubMed Central

    Aschard, Hugues; Cattoir, Vincent; Yoder-Himes, Deborah; Lory, Stephen; Pier, Gerald B.

    2013-01-01

    High-throughput sequencing of transposon (Tn) libraries created within entire genomes identifies and quantifies the contribution of individual genes and operons to the fitness of organisms in different environments. We used insertion-sequencing (INSeq) to analyze the contribution to fitness of all non-essential genes in the chromosome of Pseudomonas aeruginosa strain PA14 based on a library of ∼300,000 individual Tn insertions. In vitro growth in LB provided a baseline for comparison with the survival of the Tn insertion strains following 6 days of colonization of the murine gastrointestinal tract as well as a comparison with Tn-inserts subsequently able to systemically disseminate to the spleen following induction of neutropenia. Sequencing was performed following DNA extraction from the recovered bacteria, digestion with the MmeI restriction enzyme that hydrolyzes DNA 16 bp away from the end of the Tn insert, and fractionation into oligonucleotides of 1,200–1,500 bp that were prepared for high-throughput sequencing. Changes in frequency of Tn inserts into the P. aeruginosa genome were used to quantify in vivo fitness resulting from loss of a gene. 636 genes had <10 sequencing reads in LB, thus defined as unable to grow in this medium. During in vivo infection there were major losses of strains with Tn inserts in almost all known virulence factors, as well as respiration, energy utilization, ion pumps, nutritional genes and prophages. Many new candidates for virulence factors were also identified. There were consistent changes in the recovery of Tn inserts in genes within most operons and Tn insertions into some genes enhanced in vivo fitness. Strikingly, 90% of the non-essential genes were required for in vivo survival following systemic dissemination during neutropenia. These experiments resulted in the identification of the P. aeruginosa strain PA14 genes necessary for optimal survival in the mucosal and systemic environments of a mammalian host. PMID:24039572

  19. Reduced Mutation Rate and Increased Transformability of Transposon-Free Acinetobacter baylyi ADP1-ISx

    PubMed Central

    Suárez, Gabriel A.; Renda, Brian A.; Dasgupta, Aurko

    2017-01-01

    ABSTRACT The genomes of most bacteria contain mobile DNA elements that can contribute to undesirable genetic instability in engineered cells. In particular, transposable insertion sequence (IS) elements can rapidly inactivate genes that are important for a designed function. We deleted all six copies of IS1236 from the genome of the naturally transformable bacterium Acinetobacter baylyi ADP1. The natural competence of ADP1 made it possible to rapidly repair deleterious point mutations that arose during strain construction. In the resulting ADP1-ISx strain, the rates of mutations inactivating a reporter gene were reduced by 7- to 21-fold. This reduction was higher than expected from the incidence of new IS1236 insertions found during a 300-day mutation accumulation experiment with wild-type ADP1 that was used to estimate spontaneous mutation rates in the strain. The extra improvement appears to be due in part to eliminating large deletions caused by IS1236 activity, as the point mutation rate was unchanged in ADP1-ISx. Deletion of an error-prone polymerase (dinP) and a DNA damage response regulator (umuDAb [the umuD gene of A. baylyi]) from the ADP1-ISx genome did not further reduce mutation rates. Surprisingly, ADP1-ISx exhibited increased transformability. This improvement may be due to less autolysis and aggregation of the engineered cells than of the wild type. Thus, deleting IS elements from the ADP1 genome led to a greater than expected increase in evolutionary reliability and unexpectedly enhanced other key strain properties, as has been observed for other clean-genome bacterial strains. ADP1-ISx is an improved chassis for metabolic engineering and other applications. IMPORTANCE Acinetobacter baylyi ADP1 has been proposed as a next-generation bacterial host for synthetic biology and genome engineering due to its ability to efficiently take up DNA from its environment during normal growth. We deleted transposable elements that are capable of copying themselves, inserting into other genes, and thereby inactivating them from the ADP1 genome. The resulting “clean-genome” ADP1-ISx strain exhibited larger reductions in the rates of inactivating mutations than expected from spontaneous mutation rates measured via whole-genome sequencing of lineages evolved under relaxed selection. Surprisingly, we also found that IS element activity reduces transformability and is a major cause of cell aggregation and death in wild-type ADP1 grown under normal laboratory conditions. More generally, our results demonstrate that domesticating a bacterial genome by removing mobile DNA elements that have accumulated during evolution in the wild can have unanticipated benefits. PMID:28667117

  20. Reduced Mutation Rate and Increased Transformability of Transposon-Free Acinetobacter baylyi ADP1-ISx.

    PubMed

    Suárez, Gabriel A; Renda, Brian A; Dasgupta, Aurko; Barrick, Jeffrey E

    2017-09-01

    The genomes of most bacteria contain mobile DNA elements that can contribute to undesirable genetic instability in engineered cells. In particular, transposable insertion sequence (IS) elements can rapidly inactivate genes that are important for a designed function. We deleted all six copies of IS 1236 from the genome of the naturally transformable bacterium Acinetobacter baylyi ADP1. The natural competence of ADP1 made it possible to rapidly repair deleterious point mutations that arose during strain construction. In the resulting ADP1-ISx strain, the rates of mutations inactivating a reporter gene were reduced by 7- to 21-fold. This reduction was higher than expected from the incidence of new IS 1236 insertions found during a 300-day mutation accumulation experiment with wild-type ADP1 that was used to estimate spontaneous mutation rates in the strain. The extra improvement appears to be due in part to eliminating large deletions caused by IS 1236 activity, as the point mutation rate was unchanged in ADP1-ISx. Deletion of an error-prone polymerase ( dinP ) and a DNA damage response regulator ( umuD Ab [the umuD gene of A. baylyi ]) from the ADP1-ISx genome did not further reduce mutation rates. Surprisingly, ADP1-ISx exhibited increased transformability. This improvement may be due to less autolysis and aggregation of the engineered cells than of the wild type. Thus, deleting IS elements from the ADP1 genome led to a greater than expected increase in evolutionary reliability and unexpectedly enhanced other key strain properties, as has been observed for other clean-genome bacterial strains. ADP1-ISx is an improved chassis for metabolic engineering and other applications. IMPORTANCE Acinetobacter baylyi ADP1 has been proposed as a next-generation bacterial host for synthetic biology and genome engineering due to its ability to efficiently take up DNA from its environment during normal growth. We deleted transposable elements that are capable of copying themselves, inserting into other genes, and thereby inactivating them from the ADP1 genome. The resulting "clean-genome" ADP1-ISx strain exhibited larger reductions in the rates of inactivating mutations than expected from spontaneous mutation rates measured via whole-genome sequencing of lineages evolved under relaxed selection. Surprisingly, we also found that IS element activity reduces transformability and is a major cause of cell aggregation and death in wild-type ADP1 grown under normal laboratory conditions. More generally, our results demonstrate that domesticating a bacterial genome by removing mobile DNA elements that have accumulated during evolution in the wild can have unanticipated benefits. Copyright © 2017 American Society for Microbiology.

  1. Cloning of the Koi Herpesvirus Genome as an Infectious Bacterial Artificial Chromosome Demonstrates That Disruption of the Thymidine Kinase Locus Induces Partial Attenuation in Cyprinus carpio koi▿

    PubMed Central

    Costes, B.; Fournier, G.; Michel, B.; Delforge, C.; Raj, V. Stalin; Dewals, B.; Gillet, L.; Drion, P.; Body, A.; Schynts, F.; Lieffrig, F.; Vanderplasschen, A.

    2008-01-01

    Koi herpesvirus (KHV) is the causative agent of a lethal disease in koi and common carp. In the present study, we describe the cloning of the KHV genome as a stable and infectious bacterial artificial chromosome (BAC) clone that can be used to produce KHV recombinant strains. This goal was achieved by the insertion of a loxP-flanked BAC cassette into the thymidine kinase (TK) locus. This insertion led to a BAC plasmid that was stably maintained in bacteria and was able to regenerate virions when permissive cells were transfected with the plasmid. Reconstituted virions free of the BAC cassette but carrying a disrupted TK locus (the FL BAC-excised strain) were produced by the transfection of Cre recombinase-expressing cells with the BAC. Similarly, virions with a wild-type revertant TK sequence (the FL BAC revertant strain) were produced by the cotransfection of cells with the BAC and a DNA fragment encoding the wild-type TK sequence. Reconstituted recombinant viruses were compared to the wild-type parental virus in vitro and in vivo. The FL BAC revertant strain and the FL BAC-excised strain replicated comparably to the parental FL strain. The FL BAC revertant strain induced KHV infection in koi carp that was indistinguishable from that induced by the parental strain, while the FL BAC-excised strain exhibited a partially attenuated phenotype. Finally, the usefulness of the KHV BAC for recombination studies was demonstrated by the production of an ORF16-deleted strain by using prokaryotic recombination technology. The availability of the KHV BAC is an important advance that will allow the study of viral genes involved in KHV pathogenesis, as well as the production of attenuated recombinant candidate vaccines. PMID:18337580

  2. Evidence for a lineage of virulent bacteriophages that target Campylobacter.

    PubMed

    Timms, Andrew R; Cambray-Young, Joanna; Scott, Andrew E; Petty, Nicola K; Connerton, Phillippa L; Clarke, Louise; Seeger, Kathy; Quail, Mike; Cummings, Nicola; Maskell, Duncan J; Thomson, Nicholas R; Connerton, Ian F

    2010-03-30

    Our understanding of the dynamics of genome stability versus gene flux within bacteriophage lineages is limited. Recently, there has been a renewed interest in the use of bacteriophages as 'therapeutic' agents; a prerequisite for their use in such therapies is a thorough understanding of their genetic complement, genome stability and their ecology to avoid the dissemination or mobilisation of phage or bacterial virulence and toxin genes. Campylobacter, a food-borne pathogen, is one of the organisms for which the use of bacteriophage is being considered to reduce human exposure to this organism. Sequencing and genome analysis was performed for two Campylobacter bacteriophages. The genomes were extremely similar at the nucleotide level (> or = 96%) with most differences accounted for by novel insertion sequences, DNA methylases and an approximately 10 kb contiguous region of metabolic genes that were dissimilar at the sequence level but similar in gene function between the two phages. Both bacteriophages contained a large number of radical S-adenosylmethionine (SAM) genes, presumably involved in boosting host metabolism during infection, as well as evidence that many genes had been acquired from a wide range of bacterial species. Further bacteriophages, from the UK Campylobacter typing set, were screened for the presence of bacteriophage structural genes, DNA methylases, mobile genetic elements and regulatory genes identified from the genome sequences. The results indicate that many of these bacteriophages are related, with 10 out of 15 showing some relationship to the sequenced genomes. Two large virulent Campylobacter bacteriophages were found to show very high levels of sequence conservation despite separation in time and place of isolation. The bacteriophages show adaptations to their host and possess genes that may enhance Campylobacter metabolism, potentially advantaging both the bacteriophage and its host. Genetic conservation has been shown to extend to other Campylobacter bacteriophages, forming a highly conserved lineage of bacteriophages that predate upon campylobacters and indicating that highly adapted bacteriophage genomes can be stable over prolonged periods of time.

  3. Exponential Megapriming PCR (EMP) Cloning—Seamless DNA Insertion into Any Target Plasmid without Sequence Constraints

    PubMed Central

    Ulrich, Alexander; Andersen, Kasper R.; Schwartz, Thomas U.

    2012-01-01

    We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts. PMID:23300917

  4. Exponential megapriming PCR (EMP) cloning--seamless DNA insertion into any target plasmid without sequence constraints.

    PubMed

    Ulrich, Alexander; Andersen, Kasper R; Schwartz, Thomas U

    2012-01-01

    We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.

  5. Effects of a Transposable Element Insertion on Alcohol Dehydrogenase Expression in Drosophila Melanogaster

    PubMed Central

    Dunn, R. C.; Laurie, C. C.

    1995-01-01

    Variation in the DNA sequence and level of alcohol dehydrogenase (Adh) gene expression in Drosophila melanogaster have been studied to determine what types of DNA polymorphisms contribute to phenotypic variation in natural populations. The Adh gene, like many others, shows a high level of variability in both DNA sequence and quantitative level of expression. A number of transposable element insertions occur in the Adh region and one of these, a copia insertion in the 5' flanking region, is associated with unusually low Adh expression. To determine whether this insertion (called RI42) causes the low expression level, the insertion was excised from the cloned RI42 Adh gene and the effect was assessed by P-element transformation. Removal of this insertion causes a threefold increase in the level of ADH, clearly showing that it contributes to the naturally occurring variation in expression at this locus. Removal of all but one LTR also causes a threefold increase, indicating that the mechanism is not a simple sequence disruption. Furthermore, this copia insertion, which is located between the two Adh promoters and their upstream enhancer sequences, has differential effects on the levels of proximal and distal transcripts. Finally, a test for the possible modifying effects of two suppressor loci, su(w(a)) and su(f), on this insertional mutation was negative, in contrast to a previous report in the literature. PMID:7498745

  6. Whole-genome sequencing in bacteriology: state of the art

    PubMed Central

    Dark, Michael J

    2013-01-01

    Over the last ten years, genome sequencing capabilities have expanded exponentially. There have been tremendous advances in sequencing technology, DNA sample preparation, genome assembly, and data analysis. This has led to advances in a number of facets of bacterial genomics, including metagenomics, clinical medicine, bacterial archaeology, and bacterial evolution. This review examines the strengths and weaknesses of techniques in bacterial genome sequencing, upcoming technologies, and assembly techniques, as well as highlighting recent studies that highlight new applications for bacterial genomics. PMID:24143115

  7. Bacterial versus human thymidylate synthase: Kinetics and functionality

    PubMed Central

    Strutzenberg, Timothy S.; Ghosh, Ananda K.; Iqbal, Tasnia; Kohen, Amnon

    2018-01-01

    Thymidylate Synthase (TSase) is a highly conserved enzyme that catalyzes the production of the DNA building block thymidylate. Structurally, functionally and mechanistically, bacterial and mammalian TSases share remarkable similarities. Because of this closeness, bacterial enzymes have long been used as model systems for human TSase. Furthermore, while TSase inhibitors have long served as chemotherapeutic drugs, no TSase inhibitor serves as an antibiotic. Despite their high resemblance, the mammalian TSases are distinct in a few known aspects, such as having a N-terminal tail and two insertions in the primary sequence and active/inactive conformations. Here, we aim to comprehensively characterize human (hs) TSase and delineate its contrasts and the similarities to the well-studied Escherichia coli (ec) TSase. We found that, in contrast to ecTSase, Mg2+ does not enhance reaction rates for hsTSase. The temperature dependence of intrinsic kinetic isotope effects (KIEs), on the other hand, suggests that Mg2+ has little or no impact on the transition state of hydride transfer in either enzyme, and that the transition state for the hydride transfer in hsTSase is looser than in ecTSase. Additionally, the substrates’ binding order is strictly ordered for ecTSase but slightly less ordered for hsTSase. The observed kinetic and functional differences between bacterial and human enzymes may aid in the development of antibiotic drugs with reduced toxicity. PMID:29715278

  8. Structure of a bacterial toxin-activating acyltransferase.

    PubMed

    Greene, Nicholas P; Crow, Allister; Hughes, Colin; Koronakis, Vassilis

    2015-06-09

    Secreted pore-forming toxins of pathogenic Gram-negative bacteria such as Escherichia coli hemolysin (HlyA) insert into host-cell membranes to subvert signal transduction and induce apoptosis and cell lysis. Unusually, these toxins are synthesized in an inactive form that requires posttranslational activation in the bacterial cytosol. We have previously shown that the activation mechanism is an acylation event directed by a specialized acyl-transferase that uses acyl carrier protein (ACP) to covalently link fatty acids, via an amide bond, to specific internal lysine residues of the protoxin. We now reveal the 2.15-Å resolution X-ray structure of the 172-aa ApxC, a toxin-activating acyl-transferase (TAAT) from pathogenic Actinobacillus pleuropneumoniae. This determination shows that bacterial TAATs are a structurally homologous family that, despite indiscernible sequence similarity, form a distinct branch of the Gcn5-like N-acetyl transferase (GNAT) superfamily of enzymes that typically use acyl-CoA to modify diverse bacterial, archaeal, and eukaryotic substrates. A combination of structural analysis, small angle X-ray scattering, mutagenesis, and cross-linking defined the solution state of TAATs, with intermonomer interactions mediated by an N-terminal α-helix. Superposition of ApxC with substrate-bound GNATs, and assay of toxin activation and binding of acyl-ACP and protoxin peptide substrates by mutated ApxC variants, indicates the enzyme active site to be a deep surface groove.

  9. Identifying transposon insertions and their effects from RNA-sequencing data.

    PubMed

    de Ruiter, Julian R; Kas, Sjors M; Schut, Eva; Adams, David J; Koudijs, Marco J; Wessels, Lodewyk F A; Jonkers, Jos

    2017-07-07

    Insertional mutagenesis using engineered transposons is a potent forward genetic screening technique used to identify cancer genes in mouse model systems. In the analysis of these screens, transposon insertion sites are typically identified by targeted DNA-sequencing and subsequently assigned to predicted target genes using heuristics. As such, these approaches provide no direct evidence that insertions actually affect their predicted targets or how transcripts of these genes are affected. To address this, we developed IM-Fusion, an approach that identifies insertion sites from gene-transposon fusions in standard single- and paired-end RNA-sequencing data. We demonstrate IM-Fusion on two separate transposon screens of 123 mammary tumors and 20 B-cell acute lymphoblastic leukemias, respectively. We show that IM-Fusion accurately identifies transposon insertions and their true target genes. Furthermore, by combining the identified insertion sites with expression quantification, we show that we can determine the effect of a transposon insertion on its target gene(s) and prioritize insertions that have a significant effect on expression. We expect that IM-Fusion will significantly enhance the accuracy of cancer gene discovery in forward genetic screens and provide initial insight into the biological effects of insertions on candidate cancer genes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Evolutionary force of AT-rich repeats to trap genomic and episomal DNAs into the rice genome: lessons from endogenous pararetrovirus.

    PubMed

    Liu, Ruifang; Koyanagi, Kanako O; Chen, Sunlu; Kishima, Yuji

    2012-12-01

    In plant genomes, the incorporation of DNA segments is not a common method of artificial gene transfer. Nevertheless, various segments of pararetroviruses have been found in plant genomes in recent decades. The rice genome contains a number of segments of endogenous rice tungro bacilliform virus-like sequences (ERTBVs), many of which are present between AT dinucleotide repeats (ATrs). Comparison of genomic sequences between two closely related rice subspecies, japonica and indica, allowed us to verify the preferential insertion of ERTBVs into ATrs. In addition to ERTBVs, the comparative analyses showed that ATrs occasionally incorporate repeat sequences including transposable elements, and a wide range of other sequences. Besides the known genomic sequences, the insertion sequences also represented DNAs of unclear origins together with ERTBVs, suggesting that ATrs have integrated episomal DNAs that would have been suspended in the nucleus. Such insertion DNAs might be trapped by ATrs in the genome in a host-dependent manner. Conversely, other simple mono- and dinucleotide sequence repeats (SSR) were less frequently involved in insertion events relative to ATrs. Therefore, ATrs could be regarded as hot spots of double-strand breaks that induce non-homologous end joining. The insertions within ATrs occasionally generated new gene-related sequences or involved structural modifications of existing genes. Likewise, in a comparison between Arabidopsis thaliana and Arabidopsis lyrata, the insertions preferred ATrs to other SSRs. Therefore ATrs in plant genomes could be considered as genomic dumping sites that have trapped various DNA molecules and may have exerted a powerful evolutionary force. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  11. The Genome Sequence of Avibacterium paragallinarum Strain CL Has a Large Repertoire of Insertion Sequence Elements.

    PubMed

    Horta-Valerdi, Guillermo; Sanchez-Alonso, Maria Patricia; Perez-Marquez, Victor M; Negrete-Abascal, Erasmo; Vaca-Pacheco, Sergio; Hernandez-Gonzalez, Ismael; Gomez-Lunar, Zulema; Olmedo-Álvarez, Gabriela; Vázquez-Cruz, Candelario

    2017-04-13

    The draft genome sequence of Avibacterium paragallinarum strain CL serovar C is reported here. The genome comprises 154 contigs corresponding to 2.4 Mb with 41% G+C content and many insertion sequence (IS) elements, a characteristic not previously reported in A. paragallinarum . Copyright © 2017 Horta-Valerdi et al.

  12. A rapid and cost-effective method for sequencing pooled cDNA clones by using a combination of transposon insertion and Gateway technology.

    PubMed

    Morozumi, Takeya; Toki, Daisuke; Eguchi-Ogawa, Tomoko; Uenishi, Hirohide

    2011-09-01

    Large-scale cDNA-sequencing projects require an efficient strategy for mass sequencing. Here we describe a method for sequencing pooled cDNA clones using a combination of transposon insertion and Gateway technology. Our method reduces the number of shotgun clones that are unsuitable for reconstruction of cDNA sequences, and has the advantage of reducing the total costs of the sequencing project.

  13. High-Throughput Analysis of T-DNA Location and Structure Using Sequence Capture.

    PubMed

    Inagaki, Soichi; Henry, Isabelle M; Lieberman, Meric C; Comai, Luca

    2015-01-01

    Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA-genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously, using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. Our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.

  14. Genome-Wide Mutagenesis in Borrelia burgdorferi.

    PubMed

    Lin, Tao; Gao, Lihui

    2018-01-01

    Signature-tagged mutagenesis (STM) is a functional genomics approach to identify bacterial virulence determinants and virulence factors by simultaneously screening multiple mutants in a single host animal, and has been utilized extensively for the study of bacterial pathogenesis, host-pathogen interactions, and spirochete and tick biology. The signature-tagged transposon mutagenesis has been developed to investigate virulence determinants and pathogenesis of Borrelia burgdorferi. Mutants in genes important in virulence are identified by negative selection in which the mutants fail to colonize or disseminate in the animal host and tick vector. STM procedure combined with Luminex Flex ® Map™ technology and next-generation sequencing (e.g., Tn-seq) are the powerful high-throughput tools for the determination of Borrelia burgdorferi virulence determinants. The assessment of multiple tissue sites and two DNA resources at two different time points using Luminex Flex ® Map™ technology provides a robust data set. B. burgdorferi transposon mutant screening indicates that a high proportion of genes are the novel virulence determinants that are required for mouse and tick infection. In this protocol, an effective signature-tagged Himar1-based transposon suicide vector was developed and used to generate a sequence-defined library of nearly 4800 mutants in the infectious B. burgdorferi B31 clone. In STM, signature-tagged suicide vectors are constructed by inserting unique DNA sequences (tags) into the transposable elements. The signature-tagged transposon mutants are generated when transposon suicide vectors are transformed into an infectious B. burgdorferi clone, and the transposable element is transposed into the 5'-TA-3' sequence in the B. burgdorferi genome with the signature tag. The transposon library is created and consists of many sub-libraries, each sub-library has several hundreds of mutants with same tags. A group of mice or ticks are infected with a mixed population of mutants with different tags, after recovered from different tissues of infected mice and ticks, mutants from output pool and input pool are detected using high-throughput, semi-quantitative Luminex ® FLEXMAP™ or next-generation sequencing (Tn-seq) technologies. Thus far, we have created a high-density, sequence-defined transposon library of over 6600 STM mutants for the efficient genome-wide investigation of genes and gene products required for wild-type pathogenesis, host-pathogen interactions, in vitro growth, in vivo survival, physiology, morphology, chemotaxis, motility, structure, metabolism, gene regulation, plasmid maintenance and replication, etc. The insertion sites of 4480 transposon mutants have been determined. About 800 predicted protein-encoding genes in the genome were disrupted in the STM transposon library. The infectivity and some functions of 800 mutants in 500 genes have been determined. Analysis of these transposon mutants has yielded valuable information regarding the genes and gene products important in the pathogenesis and biology of B. burgdorferi and its tick vectors.

  15. Tn-Seq Analysis of Vibrio cholerae Intestinal Colonization Reveals a Role for T6SS-Mediated Antibacterial Activity in the Host

    PubMed Central

    Fu, Yang; Waldor, Matthew K.; Mekalanos, John J.

    2014-01-01

    SUMMARY Analysis of genes required for host infection will provide clues to the drivers of evolutionary fitness of pathogens like Vibrio cholerae, a mounting threat to global heath. We used transposon insertion site sequencing (Tn-seq) to comprehensively assess the contribution of nearly all V. cholerae genes toward growth in the infant rabbit intestine. Four hundred genes were identified as critical to V. cholerae in vivo fitness. These included most known colonization factors and several new genes affecting the bacterium's metabolic properties, resistance to bile, and ability to synthesize cyclic AMP-GMP. Notably, a mutant carrying an insertion in tsiV3, encoding immunity to a bacteriocidal type VI secretion system (T6SS) effector VgrG3, exhibited a colonization defect. The reduced in vivo fitness of tsiV3 mutants depends on their cocolonization with bacterial cells carrying an intact T6SS locus and VgrG3 gene, suggesting that the V. cholerae T6SS is functional and mediates antagonistic interbacterial interactions during infection. PMID:24331463

  16. A new molecular evolution model for limited insertion independent of substitution.

    PubMed

    Lèbre, Sophie; Michel, Christian J

    2013-10-01

    We recently introduced a new molecular evolution model called the IDIS model for Insertion Deletion Independent of Substitution [13,14]. In the IDIS model, the three independent processes of substitution, insertion and deletion of residues have constant rates. In order to control the genome expansion during evolution, we generalize here the IDIS model by introducing an insertion rate which decreases when the sequence grows and tends to 0 for a maximum sequence length nmax. This new model, called LIIS for Limited Insertion Independent of Substitution, defines a matrix differential equation satisfied by a vector P(t) describing the sequence content in each residue at evolution time t. An analytical solution is obtained for any diagonalizable substitution matrix M. Thus, the LIIS model gives an expression of the sequence content vector P(t) in each residue under evolution time t as a function of the eigenvalues and the eigenvectors of matrix M, the residue insertion rate vector R, the total insertion rate r, the initial and maximum sequence lengths n0 and nmax, respectively, and the sequence content vector P(t0) at initial time t0. The derivation of the analytical solution is much more technical, compared to the IDIS model, as it involves Gauss hypergeometric functions. Several propositions of the LIIS model are derived: proof that the IDIS model is a particular case of the LIIS model when the maximum sequence length nmax tends to infinity, fixed point, time scale, time step and time inversion. Using a relation between the sequence length l and the evolution time t, an expression of the LIIS model as a function of the sequence length l=n(t) is obtained. Formulas for 'insertion only', i.e. when the substitution rates are all equal to 0, are derived at evolution time t and sequence length l. Analytical solutions of the LIIS model are explicitly derived, as a function of either evolution time t or sequence length l, for two classical substitution matrices: the 3-parameter symmetric substitution matrix [12] (LIIS-SYM3) and the HKY asymmetric substitution matrix[9] (LIIS-HKY). An evaluation of the LIIS model (precisely, LIIS-HKY) based on four statistical analyses of the GC content in complete genomes of four prokaryotic taxonomic groups, namely Chlamydiae, Crenarchaeota, Spirochaetes and Thermotogae, shows the expected improvement from the theory of the LIIS model compared to the IDIS model. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Does implant coating with antibacterial-loaded hydrogel reduce bacterial colonization and biofilm formation in vitro?

    PubMed

    Drago, Lorenzo; Boot, Willemijn; Dimas, Kostantinos; Malizos, Kostantinos; Hänsch, Gertrud M; Stuyck, Jos; Gawlitta, Debby; Romanò, Carlo L

    2014-11-01

    Implant-related infections represent one of the most severe complications in orthopaedics. A fast-resorbable, antibacterial-loaded hydrogel may reduce or prevent bacterial colonization and biofilm formation of implanted biomaterials. We asked: (1) Is a fast-resorbable hydrogel able to deliver antibacterial compounds in vitro? (2) Can a hydrogel (alone or antibacterial-loaded) coating on implants reduce bacterial colonization? And (3) is intraoperative coating feasible and resistant to press-fit implant insertion? We tested the ability of Disposable Antibacterial Coating (DAC) hydrogel (Novagenit Srl, Mezzolombardo, Italy) to deliver antibacterial agents using spectrophotometry and a microbiologic assay. Antibacterial and antibiofilm activity were determined by broth microdilution and a crystal violet assay, respectively. Coating resistance to press-fit insertion was tested in rabbit tibias and human femurs. Complete release of all tested antibacterial compounds was observed in less than 96 hours. Bactericidal and antibiofilm effect of DAC hydrogel in combination with various antibacterials was shown in vitro. Approximately 80% of the hydrogel coating was retrieved on the implant after press-fit insertion. Implant coating with an antibacterial-loaded hydrogel reduces bacterial colonization and biofilm formation in vitro. A fast-resorbable, antibacterial-loaded hydrogel coating may help prevent implant-related infections in orthopaedics. However, further validation in animal models and properly controlled human studies is required.

  18. Development of a Single Locus Sequence Typing (SLST) Scheme for Typing Bacterial Species Directly from Complex Communities.

    PubMed

    Scholz, Christian F P; Jensen, Anders

    2017-01-01

    The protocol describes a computational method to develop a Single Locus Sequence Typing (SLST) scheme for typing bacterial species. The resulting scheme can be used to type bacterial isolates as well as bacterial species directly from complex communities using next-generation sequencing technologies.

  19. Construction of BAC Libraries from Flow-Sorted Chromosomes.

    PubMed

    Šafář, Jan; Šimková, Hana; Doležel, Jaroslav

    2016-01-01

    Cloned DNA libraries in bacterial artificial chromosome (BAC) are the most widely used form of large-insert DNA libraries. BAC libraries are typically represented by ordered clones derived from genomic DNA of a particular organism. In the case of large eukaryotic genomes, whole-genome libraries consist of a hundred thousand to a million clones, which make their handling and screening a daunting task. The labor and cost of working with whole-genome libraries can be greatly reduced by constructing a library derived from a smaller part of the genome. Here we describe construction of BAC libraries from mitotic chromosomes purified by flow cytometric sorting. Chromosome-specific BAC libraries facilitate positional gene cloning, physical mapping, and sequencing in complex plant genomes.

  20. Prospective comparison of two management strategies of central venous catheters in burn patients.

    PubMed

    Kealey, G P; Chang, P; Heinle, J; Rosenquist, M D; Lewis, R W

    1995-03-01

    Central venous catheters (CVCs) are associated with sepsis in burn patients. This study was undertaken to compare two strategies of CVC management in patients with major burn injuries. Forty-two burn patients with major burn injuries were randomly assigned to undergo site change every 48 hours of the CVC or to undergo wire guide exchange of the CVC every 48 hours at the same site. Catheter insertion site, distance from the burn wound, cultures of catheter tips, and blood cultures were obtained from all patients in a prospective manner. There was no difference in the incidence of CVC sepsis between the two groups studied. CVCs inserted less than 5 cm from the burn wound developed bacterial contamination at an earlier time than CVCs inserted more than 5 cm from the burn wound. There was no advantage to changing the CVC insertion site every 48 hours. Changing the CVC using the wire guide technique did not prevent, nor predict, CVC bacterial contamination.

  1. Bacterial diversity in permanently cold and alkaline ikaite columns from Greenland.

    PubMed

    Schmidt, Mariane; Priemé, Anders; Stougaard, Peter

    2006-12-01

    Bacterial diversity in alkaline (pH 10.4) and permanently cold (4 degrees C) ikaite tufa columns from the Ikka Fjord, SW Greenland, was investigated using growth characterization of cultured bacterial isolates with Terminal-restriction fragment length polymorphism (T-RFLP) and sequence analysis of bacterial 16S rRNA gene fragments. More than 200 bacterial isolates were characterized with respect to pH and temperature tolerance, and it was shown that the majority were cold-active alkaliphiles. T-RFLP analysis revealed distinct bacterial communities in different fractions of three ikaite columns, and, along with sequence analysis, it showed the presence of rich and diverse bacterial communities. Rarefaction analysis showed that the 109 sequenced clones in the 16S rRNA gene library represented between 25 and 65% of the predicted species richness in the three ikaite columns investigated. Phylogenetic analysis of the 16S rRNA gene sequences revealed many sequences with similarity to alkaliphilic or psychrophilic bacteria, and showed that 33% of the cloned sequences and 33% of the cultured bacteria showed less than 97% sequence identity to known sequences in databases, and may therefore represent yet unknown species.

  2. Visual attention distracter insertion for improved EEG rapid serial visual presentation (RSVP) target stimuli detection

    NASA Astrophysics Data System (ADS)

    Khosla, Deepak; Huber, David J.; Martin, Kevin

    2017-05-01

    This paper† describes a technique in which we improve upon the prior performance of the Rapid Serial Visual Presentation (RSVP) EEG paradigm for image classification though the insertion of visual attention distracters and overall sequence reordering based upon the expected ratio of rare to common "events" in the environment and operational context. Inserting distracter images maintains the ratio of common events to rare events at an ideal level, maximizing the rare event detection via P300 EEG response to the RSVP stimuli. The method has two steps: first, we compute the optimal number of distracters needed for an RSVP stimuli based on the desired sequence length and expected number of targets and insert the distracters into the RSVP sequence, and then we reorder the RSVP sequence to maximize P300 detection. We show that by reducing the ratio of target events to nontarget events using this method, we can allow RSVP sequences with more targets without sacrificing area under the ROC curve (azimuth).

  3. Designing deep sequencing experiments: detecting structural variation and estimating transcript abundance.

    PubMed

    Bashir, Ali; Bansal, Vikas; Bafna, Vineet

    2010-06-18

    Massively parallel DNA sequencing technologies have enabled the sequencing of several individual human genomes. These technologies are also being used in novel ways for mRNA expression profiling, genome-wide discovery of transcription-factor binding sites, small RNA discovery, etc. The multitude of sequencing platforms, each with their unique characteristics, pose a number of design challenges, regarding the technology to be used and the depth of sequencing required for a particular sequencing application. Here we describe a number of analytical and empirical results to address design questions for two applications: detection of structural variations from paired-end sequencing and estimating mRNA transcript abundance. For structural variation, our results provide explicit trade-offs between the detection and resolution of rearrangement breakpoints, and the optimal mix of paired-read insert lengths. Specifically, we prove that optimal detection and resolution of breakpoints is achieved using a mix of exactly two insert library lengths. Furthermore, we derive explicit formulae to determine these insert length combinations, enabling a 15% improvement in breakpoint detection at the same experimental cost. On empirical short read data, these predictions show good concordance with Illumina 200 bp and 2 Kbp insert length libraries. For transcriptome sequencing, we determine the sequencing depth needed to detect rare transcripts from a small pilot study. With only 1 Million reads, we derive corrections that enable almost perfect prediction of the underlying expression probability distribution, and use this to predict the sequencing depth required to detect low expressed genes with greater than 95% probability. Together, our results form a generic framework for many design considerations related to high-throughput sequencing. We provide software tools http://bix.ucsd.edu/projects/NGS-DesignTools to derive platform independent guidelines for designing sequencing experiments (amount of sequencing, choice of insert length, mix of libraries) for novel applications of next generation sequencing.

  4. Gene calling and bacterial genome annotation with BG7.

    PubMed

    Tobes, Raquel; Pareja-Tobes, Pablo; Manrique, Marina; Pareja-Tobes, Eduardo; Kovach, Evdokim; Alekhin, Alexey; Pareja, Eduardo

    2015-01-01

    New massive sequencing technologies are providing many bacterial genome sequences from diverse taxa but a refined annotation of these genomes is crucial for obtaining scientific findings and new knowledge. Thus, bacterial genome annotation has emerged as a key point to investigate in bacteria. Any efficient tool designed specifically to annotate bacterial genomes sequenced with massively parallel technologies has to consider the specific features of bacterial genomes (absence of introns and scarcity of nonprotein-coding sequence) and of next-generation sequencing (NGS) technologies (presence of errors and not perfectly assembled genomes). These features make it convenient to focus on coding regions and, hence, on protein sequences that are the elements directly related with biological functions. In this chapter we describe how to annotate bacterial genomes with BG7, an open-source tool based on a protein-centered gene calling/annotation paradigm. BG7 is specifically designed for the annotation of bacterial genomes sequenced with NGS. This tool is sequence error tolerant maintaining their capabilities for the annotation of highly fragmented genomes or for annotating mixed sequences coming from several genomes (as those obtained through metagenomics samples). BG7 has been designed with scalability as a requirement, with a computing infrastructure completely based on cloud computing (Amazon Web Services).

  5. Comparative Genome Analyses of Streptococcus suis Isolates from Endocarditis Demonstrate Persistence of Dual Phenotypic Clones

    PubMed Central

    Tohya, Mari; Watanabe, Takayasu; Maruyama, Fumito; Arai, Sakura; Ota, Atsushi; Athey, Taryn B. T.; Fittipaldi, Nahuel; Nakagawa, Ichiro; Sekizaki, Tsutomu

    2016-01-01

    Many bacterial species coexist in the same niche as heterogeneous clones with different phenotypes; however, understanding of infectious diseases by polyphenotypic bacteria is still limited. In the present study, encapsulation in isolates of the porcine pathogen Streptococcus suis from persistent endocarditis lesions was examined. Coexistence of both encapsulated and unencapsulated S. suis isolates was found in 26 out of 59 endocarditis samples. The isolates were serotype 2, and belonged to two different sequence types (STs), ST1 and ST28. The genomes of each of the 26 pairs of encapsulated and unencapsulated isolates from the 26 samples were sequenced. The data showed that each pair of isolates had one or more unique nonsynonymous mutations in the cps gene, and the encapsulated and unencapsulated isolates from the same samples were closest to each other. Pairwise comparisons of the sequences of cps genes in 7 pairs of encapsulated and unencapsulated isolates identified insertion/deletions (indels) ranging from one to 104 bp in different cps genes of unencapsulated isolates. Capsule expression was restored in a subset of unencapsulated isolates by complementation in trans with cps expression vectors. Examination of gene content common to isolates indicated that mutation frequency was higher in ST28 pairs than in ST1 pairs. Genes within mobile genetic elements were mutation hot spots among ST28 isolates. Taken all together, our results demonstrate the coexistence of dual phenotype (encapsulated and unencapsulated) bacterial clones and suggest that the dual phenotypes arose independently in each farm by means of spontaneous mutations in cps genes. PMID:27433935

  6. Germ line insertion of mtDNA at the breakpoint junction of a reciprocal constitutional translocation.

    PubMed

    Willett-Brozick, J E; Savul, S A; Richey, L E; Baysal, B E

    2001-08-01

    Constitutional chromosomal translocations are relatively common causes of human morbidity, yet the DNA double-strand break (DSB) repair mechanisms that generate them are incompletely understood. We cloned, sequenced and analyzed the breakpoint junctions of a familial constitutional reciprocal translocation t(9;11)(p24;q23). Within the 10-kb region flanking the breakpoints, chromosome 11 had 25% repeat elements, whereas chromosome 9 had 98% repeats, 95% of which were L1-type LINE elements. The breakpoints occurred within an L1-type repeat element at 9p24 and at the 3'-end of an Alu sequence at 11q23. At the breakpoint junction of derivative chromosome 9, we discovered an unusually large 41-bp insertion, which showed 100% identity to 12S mitochondrial DNA (mtDNA) between nucleotides 896 and 936 of the mtDNA sequence. Analysis of the human genome failed to show the preexistence of the inserted sequence at normal chromosomes 9 and 11 breakpoint junctions or elsewhere in the genome, strongly suggesting that the insertion was derived from human mtDNA and captured into the junction during the DSB repair process. To our knowledge, these findings represent the first observation of spontaneous germ line insertion of modern human mtDNA sequences and suggest that DSB repair may play a role in inter-organellar gene transfer in vivo. Our findings also provide evidence for a previously unrecognized insertional mechanism in human, by which non-mobile extra-chromosomal fragments can be inserted into the genome at DSB repair junctions.

  7. High-throughput analysis of T-DNA location and structure using sequence capture

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.

    Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less

  8. High-throughput analysis of T-DNA location and structure using sequence capture

    DOE PAGES

    Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.; ...

    2015-10-07

    Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less

  9. A bioinformatics approach for identifying transgene insertion sites using whole genome sequencing data.

    PubMed

    Park, Doori; Park, Su-Hyun; Ban, Yong Wook; Kim, Youn Shic; Park, Kyoung-Cheul; Kim, Nam-Soo; Kim, Ju-Kon; Choi, Ik-Young

    2017-08-15

    Genetically modified crops (GM crops) have been developed to improve the agricultural traits of modern crop cultivars. Safety assessments of GM crops are of paramount importance in research at developmental stages and before releasing transgenic plants into the marketplace. Sequencing technology is developing rapidly, with higher output and labor efficiencies, and will eventually replace existing methods for the molecular characterization of genetically modified organisms. To detect the transgenic insertion locations in the three GM rice gnomes, Illumina sequencing reads are mapped and classified to the rice genome and plasmid sequence. The both mapped reads are classified to characterize the junction site between plant and transgene sequence by sequence alignment. Herein, we present a next generation sequencing (NGS)-based molecular characterization method, using transgenic rice plants SNU-Bt9-5, SNU-Bt9-30, and SNU-Bt9-109. Specifically, using bioinformatics tools, we detected the precise insertion locations and copy numbers of transfer DNA, genetic rearrangements, and the absence of backbone sequences, which were equivalent to results obtained from Southern blot analyses. NGS methods have been suggested as an effective means of characterizing and detecting transgenic insertion locations in genomes. Our results demonstrate the use of a combination of NGS technology and bioinformatics approaches that offers cost- and time-effective methods for assessing the safety of transgenic plants.

  10. A Novel High-Resolving Method for Genomic PCR-Fingerprinting of Enterobacteria

    PubMed Central

    Isaeva, A.S.; Kulikov, E.E.; Tarasyan, K.K.

    2010-01-01

    We developed a novel PCR–fingerprinting system for differentiation of enterobacterial strains using a single oligonucleotide primer IS1tr that matches the inverted terminal repeats of the IS1 insertion element. Compared to widely used BOX–PCR and ribotyping methods, our system features higher resolution allowing differentiation of closely related isolates that appear identical in BOX–PCR and ribotyping but differ in their phage sensitivity. The IS1–profiling system is less sensitive to the quality of the material and equipment used. At the same time, BOX–PCR is more universal and suitable for bacterial strain grouping and reconstruction of the low–distance phylogeny. Thus, our system represents an important supplement to the existing set of tools for bacterial strain differentiation; it is particularly valuable for a detailed investigation of highly divergent and rapidly evolving natural bacterial populations and for studies on coliphage ecology. However, some isolates could not be reliably differentiated by IS1–PCR, because of the low number of bands in their patterns. For improvement of IS1–fingerprinting characteristics, we offer to modify the system by introducing the second primer TR8834 hybridizing to the sequence of a transposase gene that is widely spread in enterobacterial genomes. PMID:22649631

  11. Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promoter.

    PubMed

    Amirhaeri, S; Wohlrab, F; Wells, R D

    1995-02-17

    The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.

  12. Insights from 20 years of bacterial genome sequencing

    DOE PAGES

    Land, Miriam L.; Hauser, Loren; Jun, Se-Ran; ...

    2015-02-27

    Since the first two complete bacterial genome sequences were published in 1995, the science of bacteria has dramatically changed. Using third-generation DNA sequencing, it is possible to completely sequence a bacterial genome in a few hours and identify some types of methylation sites along the genome as well. Sequencing of bacterial genome sequences is now a standard procedure, and the information from tens of thousands of bacterial genomes has had a major impact on our views of the bacterial world. In this review, we explore a series of questions to highlight some insights that comparative genomics has produced. To date,more » there are genome sequences available from 50 different bacterial phyla and 11 different archaeal phyla. However, the distribution is quite skewed towards a few phyla that contain model organisms. But the breadth is continuing to improve, with projects dedicated to filling in less characterized taxonomic groups. The clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system provides bacteria with immunity against viruses, which outnumber bacteria by tenfold. How fast can we go? Second-generation sequencing has produced a large number of draft genomes (close to 90 % of bacterial genomes in GenBank are currently not complete); third-generation sequencing can potentially produce a finished genome in a few hours, and at the same time provide methlylation sites along the entire chromosome. The diversity of bacterial communities is extensive as is evident from the genome sequences available from 50 different bacterial phyla and 11 different archaeal phyla. Genome sequencing can help in classifying an organism, and in the case where multiple genomes of the same species are available, it is possible to calculate the pan- and core genomes; comparison of more than 2000 Escherichia coli genomes finds an E. coli core genome of about 3100 gene families and a total of about 89,000 different gene families. Why do we care about bacterial genome sequencing? There are many practical applications, such as genome-scale metabolic modeling, biosurveillance, bioforensics, and infectious disease epidemiology. In the near future, high-throughput sequencing of patient metagenomic samples could revolutionize medicine in terms of speed and accuracy of finding pathogens and knowing how to treat them.« less

  13. Insights from 20 years of bacterial genome sequencing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Land, Miriam L.; Hauser, Loren; Jun, Se-Ran

    Since the first two complete bacterial genome sequences were published in 1995, the science of bacteria has dramatically changed. Using third-generation DNA sequencing, it is possible to completely sequence a bacterial genome in a few hours and identify some types of methylation sites along the genome as well. Sequencing of bacterial genome sequences is now a standard procedure, and the information from tens of thousands of bacterial genomes has had a major impact on our views of the bacterial world. In this review, we explore a series of questions to highlight some insights that comparative genomics has produced. To date,more » there are genome sequences available from 50 different bacterial phyla and 11 different archaeal phyla. However, the distribution is quite skewed towards a few phyla that contain model organisms. But the breadth is continuing to improve, with projects dedicated to filling in less characterized taxonomic groups. The clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system provides bacteria with immunity against viruses, which outnumber bacteria by tenfold. How fast can we go? Second-generation sequencing has produced a large number of draft genomes (close to 90 % of bacterial genomes in GenBank are currently not complete); third-generation sequencing can potentially produce a finished genome in a few hours, and at the same time provide methlylation sites along the entire chromosome. The diversity of bacterial communities is extensive as is evident from the genome sequences available from 50 different bacterial phyla and 11 different archaeal phyla. Genome sequencing can help in classifying an organism, and in the case where multiple genomes of the same species are available, it is possible to calculate the pan- and core genomes; comparison of more than 2000 Escherichia coli genomes finds an E. coli core genome of about 3100 gene families and a total of about 89,000 different gene families. Why do we care about bacterial genome sequencing? There are many practical applications, such as genome-scale metabolic modeling, biosurveillance, bioforensics, and infectious disease epidemiology. In the near future, high-throughput sequencing of patient metagenomic samples could revolutionize medicine in terms of speed and accuracy of finding pathogens and knowing how to treat them.« less

  14. Bacterial molybdoenzymes: old enzymes for new purposes.

    PubMed

    Leimkühler, Silke; Iobbi-Nivol, Chantal

    2016-01-01

    Molybdoenzymes are widespread in eukaryotic and prokaryotic organisms where they play crucial functions in detoxification reactions in the metabolism of humans and bacteria, in nitrate assimilation in plants and in anaerobic respiration in bacteria. To be fully active, these enzymes require complex molybdenum-containing cofactors, which are inserted into the apoenzymes after folding. For almost all the bacterial molybdoenzymes, molybdenum cofactor insertion requires the involvement of specific chaperones. In this review, an overview on the molybdenum cofactor biosynthetic pathway is given together with the role of specific chaperones dedicated for molybdenum cofactor insertion and maturation. Many bacteria are involved in geochemical cycles on earth and therefore have an environmental impact. The roles of molybdoenzymes in bioremediation and for environmental applications are presented. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Influence of flanking sequences on presentation efficiency of a CD8+ cytotoxic T-cell epitope delivered by parvovirus-like particles.

    PubMed

    Rueda, P; Morón, G; Sarraseca, J; Leclerc, C; Casal, J I

    2004-03-01

    We have previously developed an antigen-delivery system based on hybrid recombinant porcine parvovirus-like particles (PPV-VLPs) formed by the self-assembly of the VP2 protein of PPV carrying a foreign epitope at its N terminus. In this study, different constructs were made containing a CD8(+) T-cell epitope of chicken ovalbumin (OVA) to analyse the influence of the sequence inserted into VP2 on the correct processing of VLPs by antigen-presenting cells. We analysed the presentation of the OVA epitope inserted without flanking sequences or with either different natural flanking sequences or with the natural flanking sequences of a CD8(+) T-cell epitope from the lymphocytic choriomeningitis virus nucleoprotein, and as a dimer with or without linker sequences. All constructs were studied in terms of level of expression, assembly of VLPs and ability to deliver the inserted epitope into the MHC I pathway. The presentation of the OVA epitope was considerably improved by insertion of short natural flanking sequences, which indicated the relevance of the flanking sequences on the processing of PPV-VLPs. Only PPV-VLPs carrying two copies of the OVA epitope linked by two glycines were able to be properly processed, suggesting that the introduction of flexible residues between the two consecutive OVA epitopes may be necessary for the correct presentation of these dimers by PPV-VLPs. These results provide information to improve the insertion of epitopes into PPV-VLPs to facilitate their processing and presentation by MHC class I molecules.

  16. Sequence variability of Campylobacter temperate bacteriophages

    PubMed Central

    Clark, Clifford G; Ng, Lai-King

    2008-01-01

    Background Prophages integrated within the chromosomes of Campylobacter jejuni isolates have been demonstrated very recently. Prior work with Campylobacter temperate bacteriophages, as well as evidence from prophages in other enteric bacteria, suggests these prophages might have a role in the biology and virulence of the organism. However, very little is known about the genetic variability of Campylobacter prophages which, if present, could lead to differential phenotypes in isolates carrying the phages versus those that do not. As a first step in the characterization of C. jejuni prophages, we investigated the distribution of prophage DNA within a C. jejuni population assessed the DNA and protein sequence variability within a subset of the putative prophages found. Results Southern blotting of C. jejuni DNA using probes from genes within the three putative prophages of the C. jejuni sequenced strain RM 1221 demonstrated the presence of at least one prophage gene in a large proportion (27/35) of isolates tested. Of these, 15 were positive for 5 or more of the 7 Campylobacter Mu-like phage 1 (CMLP 1, also designated Campylobacter jejuni integrated element 1, or CJIE 1) genes tested. Twelve of these putative prophages were chosen for further analysis. DNA sequencing of a 9,000 to 11,000 nucleotide region of each prophage demonstrated a close homology with CMLP 1 in both gene order and nucleotide sequence. Structural and sequence variability, including short insertions, deletions, and allele replacements, were found within the prophage genomes, some of which would alter the protein products of the ORFs involved. No insertions of novel genes were detected within the sequenced regions. The 12 prophages and RM 1221 had a % G+C very similar to C. jejuni sequenced strains, as well as promoter regions characteristic of C. jejuni. None of the putative prophages were successfully induced and propagated, so it is not known if they were functional or if they represented remnant prophage DNA in the bacterial chromosomes. Conclusion These putative prophages form a family of phages with conserved sequences, and appear to be adapted to Campylobacter. There was evidence for recombination among groups of prophages, suggesting that the prophages had a mosaic structure. In many of these properties, the Mu-like CMLP 1 homologs characterized in this study resemble temperate bacteriophages of enteric bacteria that are responsible for contributions to virulence and host adaptation. PMID:18366706

  17. A genomic landscape of mitochondrial DNA insertions in the pig nuclear genome provides evolutionary signatures of interspecies admixture.

    PubMed

    Schiavo, Giuseppina; Hoffmann, Orsolya Ivett; Ribani, Anisa; Utzeri, Valerio Joe; Ghionda, Marco Ciro; Bertolini, Francesca; Geraci, Claudia; Bovo, Samuele; Fontanesi, Luca

    2017-10-01

    Nuclear DNA sequences of mitochondrial origin (numts) are derived by insertion of mitochondrial DNA (mtDNA), into the nuclear genome. In this study, we provide, for the first time, a genome picture of numts inserted in the pig nuclear genome. The Sus scrofa reference nuclear genome (Sscrofa10.2) was aligned with circularized and consensus mtDNA sequences using LAST software. A total of 430 numt sequences that may represent 246 different numt integration events (57 numt regions determined by at least two numt sequences and 189 singletons) were identified, covering about 0.0078% of the nuclear genome. Numt integration events were correlated (0.99) to the chromosome length. The longest numt sequence (about 11 kbp) was located on SSC2. Six numts were sequenced and PCR amplified in pigs of European commercial and local pig breeds, of the Chinese Meishan breed and in European wild boars. Three of them were polymorphic for the presence or absence of the insertion. Surprisingly, the estimated age of insertion of two of the three polymorphic numts was more ancient than that of the speciation time of the Sus scrofa, supporting that these polymorphic sites were originated from interspecies admixture that contributed to shape the pig genome. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  18. Serendipitous discovery of Wolbachia genomes in multiple Drosophila species.

    PubMed

    Salzberg, Steven L; Dunning Hotopp, Julie C; Delcher, Arthur L; Pop, Mihai; Smith, Douglas R; Eisen, Michael B; Nelson, William C

    2005-01-01

    The Trace Archive is a repository for the raw, unanalyzed data generated by large-scale genome sequencing projects. The existence of this data offers scientists the possibility of discovering additional genomic sequences beyond those originally sequenced. In particular, if the source DNA for a sequencing project came from a species that was colonized by another organism, then the project may yield substantial amounts of genomic DNA, including near-complete genomes, from the symbiotic or parasitic organism. By searching the publicly available repository of DNA sequencing trace data, we discovered three new species of the bacterial endosymbiont Wolbachia pipientis in three different species of fruit fly: Drosophila ananassae, D. simulans, and D. mojavensis. We extracted all sequences with partial matches to a previously sequenced Wolbachia strain and assembled those sequences using customized software. For one of the three new species, the data recovered were sufficient to produce an assembly that covers more than 95% of the genome; for a second species the data produce the equivalent of a 'light shotgun' sampling of the genome, covering an estimated 75-80% of the genome; and for the third species the data cover approximately 6-7% of the genome. The results of this study reveal an unexpected benefit of depositing raw data in a central genome sequence repository: new species can be discovered within this data. The differences between these three new Wolbachia genomes and the previously sequenced strain revealed numerous rearrangements and insertions within each lineage and hundreds of novel genes. The three new genomes, with annotation, have been deposited in GenBank.

  19. Isolation of an insertion sequence (IS1051) from Xanthomonas campestris pv. dieffenbachiae with potential use for strain identification and characterization.

    PubMed Central

    Berthier, Y; Thierry, D; Lemattre, M; Guesdon, J L

    1994-01-01

    A new insertion sequence was isolated from Xanthomonas campestris pv. dieffenbachiae. Sequence analysis showed that this element is 1,158 bp long and has 15-bp inverted repeat ends containing two mismatches. Comparison of this sequence with sequences in data bases revealed significant homology with Escherichia coli IS5. IS1051, which detected multiple restriction fragment length polymorphisms, was used as a probe to characterize strains from the pathovar dieffenbachiae. Images PMID:7906933

  20. [Plasticity of bacterial genomes: pathogenicity islands and the locus of enterocyte effacement (LEE)].

    PubMed

    Kirsch, Petra; Jores, Jörg; Wieler, Lothar H

    2004-01-01

    Many bacterial virulence attributes, like toxins, adhesins, invasins, iron uptake systems, are encoded within specific regions of the bacterial genome. These in size varying regions are termed pathogenicity islands (PAIs) since they confer pathogenic properties to the respective micro-organism. Per definition PAIs are exclusively found in pathogenic strains and are often inserted near transfer-RNA genes. Nevertheless, non-pathogenic bacteria also possess foreign DNA elements that confer advantageous features, leading to improved fitness. These additional DNA elements as well as PAIs are termed genomic islands and were acquired during bacterial evolution. Significant G+C content deviation in pathogenicity islands with respect to the rest of the genome, the presence of direct repeat sequences at the flanking regions, the presence of integrase gene determinants as other mobility features,the particular insertion site (tRNA gene) as well as the observed genetic instability suggests that pathogenicity islands were acquired by horizontal gene transfer. PAIs are the fascinating proof of the plasticity of bacterial genomes. PAIs were originally described in human pathogenic Escherichia (E.) coli strains. In the meantime PAIs have been found in various pathogenic bacteria of humans, animals and even plants. The Locus of Enterocyte Effacement (LEE) is one particular widely distributed PAI of E coli. In addition, it also confers pathogenicity to the related species Citrobacter (C.) rodentium and Escherichia (E.) alvei. The LEE is an important virulence feature of several animal pathogens. It is an obligate PAI of all animal and human enteropathogenic E. coli (EPEC), and most enterohaemorrhegic E. coli (EHEC) also harbor the LEE. The LEE encodes a type III secretion system, an adhesion (intimin) that mediates the intimate contact between the bacterium and the epithelial cell, as well as various proteins which are secreted via the type III secretion system. The LEE encoded virulence features are responsible for the formation of so called attaching and effacing (AE) lesions in the intestinal epithelium. Due to its wide distribution in animal pathogens, LEE encoded antigens are suitable vaccine antigens. Acquisition and structure of the LEE pathogenicity island is the crucial point of numerous investigations. However, the evolution of the LEE, its origin and further spread in E. coli, are far from being resolved.

  1. Characterization of the UGA-recoding and SECIS-binding activities of SECIS-binding protein 2.

    PubMed

    Bubenik, Jodi L; Miniard, Angela C; Driscoll, Donna M

    2014-01-01

    Selenium, a micronutrient, is primarily incorporated into human physiology as selenocysteine (Sec). The 25 Sec-containing proteins in humans are known as selenoproteins. Their synthesis depends on the translational recoding of the UGA stop codon to allow Sec insertion. This requires a stem-loop structure in the 3' untranslated region of eukaryotic mRNAs known as the Selenocysteine Insertion Sequence (SECIS). The SECIS is recognized by SECIS-binding protein 2 (SBP2) and this RNA:protein interaction is essential for UGA recoding to occur. Genetic mutations cause SBP2 deficiency in humans, resulting in a broad set of symptoms due to differential effects on individual selenoproteins. Progress on understanding the different phenotypes requires developing robust tools to investigate SBP2 structure and function. In this study we demonstrate that SBP2 protein produced by in vitro translation discriminates among SECIS elements in a competitive UGA recoding assay and has a much higher specific activity than bacterially expressed protein. We also show that a purified recombinant protein encompassing amino acids 517-777 of SBP2 binds to SECIS elements with high affinity and selectivity. The affinity of the SBP2:SECIS interaction correlated with the ability of a SECIS to compete for UGA recoding activity in vitro. The identification of a 250 amino acid sequence that mediates specific, selective SECIS-binding will facilitate future structural studies of the SBP2:SECIS complex. Finally, we identify an evolutionarily conserved core cysteine signature in SBP2 sequences from the vertebrate lineage. Mutation of multiple, but not single, cysteines impaired SECIS-binding but did not affect protein localization in cells.

  2. Identification, variation and transcription of pneumococcal repeat sequences

    PubMed Central

    2011-01-01

    Background Small interspersed repeats are commonly found in many bacterial chromosomes. Two families of repeats (BOX and RUP) have previously been identified in the genome of Streptococcus pneumoniae, a nasopharyngeal commensal and respiratory pathogen of humans. However, little is known about the role they play in pneumococcal genetics. Results Analysis of the genome of S. pneumoniae ATCC 700669 revealed the presence of a third repeat family, which we have named SPRITE. All three repeats are present at a reduced density in the genome of the closely related species S. mitis. However, they are almost entirely absent from all other streptococci, although a set of elements related to the pneumococcal BOX repeat was identified in the zoonotic pathogen S. suis. In conjunction with information regarding their distribution within the pneumococcal chromosome, this suggests that it is unlikely that these repeats are specialised sequences performing a particular role for the host, but rather that they constitute parasitic elements. However, comparing insertion sites between pneumococcal sequences indicates that they appear to transpose at a much lower rate than IS elements. Some large BOX elements in S. pneumoniae were found to encode open reading frames on both strands of the genome, whilst another was found to form a composite RNA structure with two T box riboswitches. In multiple cases, such BOX elements were demonstrated as being expressed using directional RNA-seq and RT-PCR. Conclusions BOX, RUP and SPRITE repeats appear to have proliferated extensively throughout the pneumococcal chromosome during the species' past, but novel insertions are currently occurring at a relatively slow rate. Through their extensive secondary structures, they seem likely to affect the expression of genes with which they are co-transcribed. Software for annotation of these repeats is freely available from ftp://ftp.sanger.ac.uk/pub/pathogens/strep_repeats/. PMID:21333003

  3. The 3'-end region of the human PDGFR-β core promoter nuclease hypersensitive element forms a mixture of two unique end-insertion G-quadruplexes.

    PubMed

    Onel, Buket; Carver, Megan; Agrawal, Prashansa; Hurley, Laurence H; Yang, Danzhou

    2018-04-01

    While the most stable G-quadruplex formed in the human PDGFR-β promoter nuclease hypersensitive element (NHE) is the 5'-mid G-quadruplex, the 3'-end sequence that contains a 3'-GGA run forms a less stable G-quadruplex. Recently, the 3'-end G-quadruplex was found to be a transcriptional repressor and can be selectively targeted by a small molecule for PDGFR-β downregulation. We use 1D and 2D high-field NMR, in combination with Dimethylsulfate Footprinting, Circular Dichroism Spectroscopy, and Electrophoretic Mobility Shift Assay. We determine that the PDGFR-β extended 3'-end NHE sequence forms two novel end-insertion intramolecular G-quadruplexes that co-exist in equilibrium under physiological salt conditions. One G-quadruplex has a 3'-non-adjacent flanking guanine inserted into the 3'-external tetrad (3'-insertion-G4), and another has a 5'-non-adjacent flanking guanine inserted into the 5'-external tetrad (5'-insertion-G4). The two guanines in the GGA-run move up or down within the G-quadruplex to accommodate the inserted guanine. Each end-insertion G-quadruplex has a low thermal stability as compared to the 5'-mid G-quadruplex, but the selective stabilization of GSA1129 shifts the equilibrium toward the 3'-end G-quadruplex in the PDGFR-β NHE. An equilibrium mixture of two unique end-insertion intramolecular G-quadruplexes forms in the PDGFR-β NHE 3'-end sequence that contains a GGA-run and non-adjacent guanines in both the 3'- and 5'- flanking segments; the novel end-insertion structures of the 3'-end G-quadruplex are selectively stabilized by GSA1129. We show for the first time that an equilibrium mixture of two unusual end-insertion G-quadruplexes forms in a native promoter sequence and appears to be the molecular recognition for PDGFR-β downregulation. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Is ultraviolet radiation on haemodialysis RO water beneficial?

    PubMed

    Stragier, A

    2005-01-01

    The quality of dialysis fluids has become increasingly important in the treatment of HD patients. Purified water represents over 95% of its volume. Bacterial and endotoxin content of Reverse Osmosis (RO) water is usually kept under control by bacterial filters, inserted in the distribution departure loop, and by monthly disinfection of the distribution circuit; the simpler the circuit, the better. This paper reports 12 years experience during which Ultraviolet Irradiation (UV) has replaced bacterial filters. To keep the bacterial growth under control in a complex RO water circuit (including a tank and multiple loops) a simple UV lamp was inserted in the departure line. It proved sufficient to keep bacterial count within AAMI norms. Failure of the UV lamp was associated with a rise of up to 500 cfu/ml in the last (fourth week) before routine disinfection. Normal levels were again obtained after replacement of the UV lamp. Six years later, a second UV lamp was added on the return loop. Bacterial counts and endotoxin levels in RO water promptly fell to <1 cfu/ml and <0.125 EU, till today. It is concluded that UV lamps should be favoured over bacterial filters in systems that are not disinfected daily, such as the RO water circuit. The principle of UV irradiation is explained and its advantage over bacterial filters is discussed. Future possible applications of UV are presented.

  5. High-Resolution Functional Mapping of the Venezuelan Equine Encephalitis Virus Genome by Insertional Mutagenesis and Massively Parallel Sequencing

    DTIC Science & Technology

    2010-10-14

    High-Resolution Functional Mapping of the Venezuelan Equine Encephalitis Virus Genome by Insertional Mutagenesis and Massively Parallel Sequencing...Venezuelan equine encephalitis virus (VEEV) genome. We initially used a capillary electrophoresis method to gain insight into the role of the VEEV...Smith JM, Schmaljohn CS (2010) High-Resolution Functional Mapping of the Venezuelan Equine Encephalitis Virus Genome by Insertional Mutagenesis and

  6. Characterization of a collection of plasmid-containing bacteria isolated from an on-farm biopurification system used for pesticide removal.

    PubMed

    Martini, María Carla; Albicoro, Francisco Javier; Nour, Eman; Schlüter, Andreas; van Elsas, Jan Dirk; Springael, Dirk; Smalla, Kornelia; Pistorio, Mariano; Lagares, Antonio; Del Papa, María Florencia

    2015-07-01

    Biopurification systems (BPS) are complex soil-related and artificially-generated environments usually designed for the removal of toxic compounds from contaminated wastewaters. The present study has been conducted to isolate and characterize a collection of cultivable plasmid-carrying bacterial isolates recovered from a BPS established for the decontamination of wastewater generated in a farmyard. Out of 1400 isolates, a collection of 75 plasmid-containing bacteria was obtained, of which 35 representative isolates comprising in total at least 50 plasmids were chosen for further characterization. Bacterial hosts were taxonomically assigned by 16S ribosomal RNA gene sequencing and phenotypically characterized according to their ability to grow in presence of different antibiotics and heavy metals. The study demonstrated that a high proportion of the isolates was tolerant to antibiotics and/or heavy metals, highlighting the on-farm BPS enrichment in such genetic traits. Several plasmids conferring such resistances in the bacterial collection were detected to be either mobilizable or selftransmissible. Occurrence of broad host range plasmids of the incompatibility groups IncP, IncQ, IncN and IncW was examined with positive results only for the first group. Presence of the IS1071 insertion sequence, frequently associated with xenobiotics degradation genes, was detected in DNA obtained from 24 of these isolates, strongly suggesting the presence of yet-hidden catabolic activities in the collection of isolates. The results showed a remarkable diversity in the plasmid mobilome of cultivable bacteria in the BPS with the presence of abundant resistance markers of different types, thus providing a suitable environment to investigate the genetic structure of the mobile genetic pool in a model on-farm biofilter for wastewater decontamination in intensive agricultural production. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Spatial organization shapes the turnover of a bacterial transcriptome

    PubMed Central

    Moffitt, Jeffrey R; Pandey, Shristi; Boettiger, Alistair N; Wang, Siyuan; Zhuang, Xiaowei

    2016-01-01

    Spatial organization of the transcriptome has emerged as a powerful means for regulating the post-transcriptional fate of RNA in eukaryotes; however, whether prokaryotes use RNA spatial organization as a mechanism for post-transcriptional regulation remains unclear. Here we used super-resolution microscopy to image the E. coli transcriptome and observed a genome-wide spatial organization of RNA: mRNAs encoding inner-membrane proteins are enriched at the membrane, whereas mRNAs encoding outer-membrane, cytoplasmic and periplasmic proteins are distributed throughout the cytoplasm. Membrane enrichment is caused by co-translational insertion of signal peptides recognized by the signal-recognition particle. Time-resolved RNA-sequencing revealed that degradation rates of inner-membrane-protein mRNAs are on average greater that those of the other mRNAs and that this selective destabilization of inner-membrane-protein mRNAs is abolished by dissociating the RNA degradosome from the membrane. Together, these results demonstrate that the bacterial transcriptome is spatially organized and suggest that this organization shapes the post-transcriptional dynamics of mRNAs. DOI: http://dx.doi.org/10.7554/eLife.13065.001 PMID:27198188

  8. GABI-Kat SimpleSearch: new features of the Arabidopsis thaliana T-DNA mutant database.

    PubMed

    Kleinboelting, Nils; Huep, Gunnar; Kloetgen, Andreas; Viehoever, Prisca; Weisshaar, Bernd

    2012-01-01

    T-DNA insertion mutants are very valuable for reverse genetics in Arabidopsis thaliana. Several projects have generated large sequence-indexed collections of T-DNA insertion lines, of which GABI-Kat is the second largest resource worldwide. User access to the collection and its Flanking Sequence Tags (FSTs) is provided by the front end SimpleSearch (http://www.GABI-Kat.de). Several significant improvements have been implemented recently. The database now relies on the TAIRv10 genome sequence and annotation dataset. All FSTs have been newly mapped using an optimized procedure that leads to improved accuracy of insertion site predictions. A fraction of the collection with weak FST yield was re-analysed by generating new FSTs. Along with newly found predictions for older sequences about 20,000 new FSTs were included in the database. Information about groups of FSTs pointing to the same insertion site that is found in several lines but is real only in a single line are included, and many problematic FST-to-line links have been corrected using new wet-lab data. SimpleSearch currently contains data from ~71,000 lines with predicted insertions covering 62.5% of the 27,206 nuclear protein coding genes, and offers insertion allele-specific data from 9545 confirmed lines that are available from the Nottingham Arabidopsis Stock Centre.

  9. Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie.

    PubMed

    Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong

    2010-12-01

    P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance.

  10. Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie

    PubMed Central

    Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol

    2010-01-01

    P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance. PMID:21113104

  11. Identification of the bacterial etiology of culture-negative endocarditis by amplification and sequencing of a small ribosomal RNA gene.

    PubMed

    Khulordava, Irakli; Miller, Geraldine; Haas, David; Li, Haijing; McKinsey, Joel; Vanderende, Daniel; Tang, Yi-Wei

    2003-05-01

    We report two cases of culture-negative bacterial endocarditis in which the organisms were identified by amplification and sequencing of the bacterial 16S rRNA gene. These results support an important role for polymerase chain reaction followed by direct sequencing to determine the etiology of culture-negative bacterial endocarditis and to guide appropriate antimicrobial therapy.

  12. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    PubMed

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  13. The NH2-terminal php domain of the alpha subunit of the Escherichia coli replicase binds the epsilon proofreading subunit.

    PubMed

    Wieczorek, Anna; McHenry, Charles S

    2006-05-05

    The alpha subunit of the replicase of all bacteria contains a php domain, initially identified by its similarity to histidinol phosphatase but of otherwise unknown function (Aravind, L., and Koonin, E. V. (1998) Nucleic Acids Res. 26, 3746-3752). Deletion of 60 residues from the NH2 terminus of the alpha php domain destroys epsilon binding. The minimal 255-residue php domain, estimated by sequence alignment with homolog YcdX, is insufficient for epsilon binding. However, a 320-residue segment including sequences that immediately precede the polymerase domain binds epsilon with the same affinity as the 1160-residue full-length alpha subunit. A subset of mutations of a conserved acidic residue (Asp43 in Escherichia coli alpha) present in the php domain of all bacterial replicases resulted in defects in epsilon binding. Using sequence alignments, we show that the prototypical gram+ Pol C, which contains the polymerase and proofreading activities within the same polypeptide chain, has an epsilon-like sequence inserted in a surface loop near the center of the homologous YcdX protein. These findings suggest that the php domain serves as a platform to enable coordination of proofreading and polymerase activities during chromosomal replication.

  14. Intracellular screen to identify metagenomic clones that induce or inhibit a quorum-sensing biosensor.

    PubMed

    Williamson, Lynn L; Borlee, Bradley R; Schloss, Patrick D; Guan, Changhui; Allen, Heather K; Handelsman, Jo

    2005-10-01

    The goal of this study was to design and evaluate a rapid screen to identify metagenomic clones that produce biologically active small molecules. We built metagenomic libraries with DNA from soil on the floodplain of the Tanana River in Alaska. We extracted DNA directly from the soil and cloned it into fosmid and bacterial artificial chromosome vectors, constructing eight metagenomic libraries that contain 53,000 clones with inserts ranging from 1 to 190 kb. To identify clones of interest, we designed a high throughput "intracellular" screen, designated METREX, in which metagenomic DNA is in a host cell containing a biosensor for compounds that induce bacterial quorum sensing. If the metagenomic clone produces a quorum-sensing inducer, the cell produces green fluorescent protein (GFP) and can be identified by fluorescence microscopy or captured by fluorescence-activated cell sorting. Our initial screen identified 11 clones that induce and two that inhibit expression of GFP. The intracellular screen detected quorum-sensing inducers among metagenomic clones that a traditional overlay screen would not. One inducing clone carries a LuxI homologue that directs the synthesis of an N-acyl homoserine lactone quorum-sensing signal molecule. The LuxI homologue has 62% amino acid sequence identity to its closest match in GenBank, AmfI from Pseudomonas fluorescens, and is on a 78-kb insert that contains 67 open reading frames. Another inducing clone carries a gene with homology to homocitrate synthase. Our results demonstrate the power of an intracellular screen to identify functionally active clones and biologically active small molecules in metagenomic libraries.

  15. The acoustic sensor for rapid analysis of bacterial cells in the conductive suspensions.

    PubMed

    Borodina, I A; Zaitsev, B D; Guliy, O; Teplykh, A A; Shikhabudinov, A M

    2017-11-01

    The possibility of using the acoustic sensor on the basis of a two-channel delay line for rapid analysis of bacterial cells in the conductive suspensions was investigated. The dependencies of change in phase and insertion loss of output signal of the sensor on conductivity of buffer solution with various concentrations of cells due to a specific interaction "bacterial cells - mini-antibodies" for electrically open and electrically shorted channels of delay line were measured. It has been found that these changes have the most values for the electrically open channel. It has been also shown that the sensor rapidly responds to the specific interaction and the time stabilization of the phase and insertion loss of output signal is less than 10min. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Cutaneous antimicrobial preparation prior to intravenous catheterization in healthy dogs: clinical, microbiological, and histopathological evaluation.

    PubMed

    Coolman, B R; Marretta, S M; Kakoma, I; Wallig, M A; Coolman, S L; Paul, A J

    1998-12-01

    The purpose of this study was to determine the effects of a one-minute chlorhexidine gluconate skin preparation protocol prior to cephalic vein catheterization. Twenty-three healthy beagle dogs had one leg aseptically prepared and the opposite leg served as a control. Twenty-six- and 77-hour time groups were studied. Chlorhexidine-treated legs had significantly lower cutaneous bacterial counts than the control legs prior to catheter insertion and prior to catheter withdrawal for both time groups. Control legs developed significantly more dermatitis than the treated legs after 77 h. A one-minute preparation with 4% chlorhexidine gluconate was an effective method for sustained reduction of cutaneous bacterial counts at peripheral intravenous catheter insertion points in dogs. Increased cutaneous bacterial counts were associated with significantly more microscopic dermatitis in untreated legs after 77 h of catheterization.

  17. Three new insertion sequence elements ISLdl2, ISLdl3, and ISLdl4 in Lactobacillus delbrueckii: isolation, molecular characterization, and potential use for strain identification.

    PubMed

    Ravin, Victor; Alatossava, Tapani

    2003-05-01

    A group of new insertion sequence (IS) elements, ISLdl2, ISLdl3, and ISLdl4, from Lactobacillus delbrueckii subsp. lactis ATCC 15808 was isolated, characterized, and used for strain identification together with ISLdl1, recently characterized as an L. delbrueckii IS element belonging to the ISL3 family. ISLdl2 was 1367 bp in size and had a 24 bp IR and an 8 bp DR. The single ORF of ISLdl2 encoded a protein of 392 aa similar to transposases of the IS256 family. ISLdl3 had a single ORF encoding a protein of 343 aa similar to transposases of the IS30 family. Finally, ISLdl4 had a single ORF encoding a protein of 406 aa and displayed homology to the transposases of the IS110 family. ISLdl4 was only slight different from ISL4 (Accession No. AY040213). ISLdl1, ISLdl2, and ISLdl4 were present in all of the 10 L. delbrueckii subsp. lactis and subsp. delbrueckii strains tested, as well as in three of the 11 L. delbrueckii subsp. bulgaricus strains tested. ISLdl3 was present only in four closely related strains of L. delbrueckii subsp. lactis. These IS elements were not observed in Lactobacillus rhamnosus, Lactobacillus acidophilus, Lactobacillus helveticus, or Lactobacillus plantarum. A cluster of IS elements, ISLdl1, ISLdl2, ISLdl3, ISLdl4, and ISL6, was observed in L. delbrueckii subsp. lactis strain ATCC 15808. Within this cluster, ISLdl4 was inserted into ISLdl1 between the left IR and the start codon of ORF455, encoding a putative transposase. Most of the integration sites of the IS elements were strain-specific. We have observed that IS elements can migrate from one strain to another as integral parts of bacterial DNA by using phage LL-H as a vehicle. We demonstrate for the first time that inverse PCR and vectorette PCR methods with primers based on sequences of the IS elements could be used for identification of L. delbrueckii strains.

  18. Genomic resources for gene discovery, functional genome annotation, and evolutionary studies of maize and its close relatives.

    PubMed

    Wang, Chao; Shi, Xue; Liu, Lin; Li, Haiyan; Ammiraju, Jetty S S; Kudrna, David A; Xiong, Wentao; Wang, Hao; Dai, Zhaozhao; Zheng, Yonglian; Lai, Jinsheng; Jin, Weiwei; Messing, Joachim; Bennetzen, Jeffrey L; Wing, Rod A; Luo, Meizhong

    2013-11-01

    Maize is one of the most important food crops and a key model for genetics and developmental biology. A genetically anchored and high-quality draft genome sequence of maize inbred B73 has been obtained to serve as a reference sequence. To facilitate evolutionary studies in maize and its close relatives, much like the Oryza Map Alignment Project (OMAP) (www.OMAP.org) bacterial artificial chromosome (BAC) resource did for the rice community, we constructed BAC libraries for maize inbred lines Zheng58, Chang7-2, and Mo17 and maize wild relatives Zea mays ssp. parviglumis and Tripsacum dactyloides. Furthermore, to extend functional genomic studies to maize and sorghum, we also constructed binary BAC (BIBAC) libraries for the maize inbred B73 and the sorghum landrace Nengsi-1. The BAC/BIBAC vectors facilitate transfer of large intact DNA inserts from BAC clones to the BIBAC vector and functional complementation of large DNA fragments. These seven Zea Map Alignment Project (ZMAP) BAC/BIBAC libraries have average insert sizes ranging from 92 to 148 kb, organellar DNA from 0.17 to 2.3%, empty vector rates between 0.35 and 5.56%, and genome equivalents of 4.7- to 8.4-fold. The usefulness of the Parviglumis and Tripsacum BAC libraries was demonstrated by mapping clones to the reference genome. Novel genes and alleles present in these ZMAP libraries can now be used for functional complementation studies and positional or homology-based cloning of genes for translational genomics.

  19. Whole Genome Sequencing Identifies a 78 kb Insertion from Chromosome 8 as the Cause of Charcot-Marie-Tooth Neuropathy CMTX3

    PubMed Central

    Brewer, Megan H.; Chaudhry, Rabia; Qi, Jessica; Kidambi, Aditi; Drew, Alexander P.; Ryan, Monique M.; Subramanian, Gopinath M.; Young, Helen K.; Zuchner, Stephan; Reddel, Stephen W.; Nicholson, Garth A.; Kennerson, Marina L.

    2016-01-01

    With the advent of whole exome sequencing, cases where no pathogenic coding mutations can be found are increasingly being observed in many diseases. In two large, distantly-related families that mapped to the Charcot-Marie-Tooth neuropathy CMTX3 locus at chromosome Xq26.3-q27.3, all coding mutations were excluded. Using whole genome sequencing we found a large DNA interchromosomal insertion within the CMTX3 locus. The 78 kb insertion originates from chromosome 8q24.3, segregates fully with the disease in the two families, and is absent from the general population as well as 627 neurologically normal chromosomes from in-house controls. Large insertions into chromosome Xq27.1 are known to cause a range of diseases and this is the first neuropathy phenotype caused by an interchromosomal insertion at this locus. The CMTX3 insertion represents an understudied pathogenic structural variation mechanism for inherited peripheral neuropathies. Our finding highlights the importance of considering all structural variation types when studying unsolved inherited peripheral neuropathy cases with no pathogenic coding mutations. PMID:27438001

  20. Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health

    PubMed Central

    Martin, William F.

    2017-01-01

    Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. PMID:28444372

  1. The Complete Genome Sequence of the Plant Growth-Promoting Bacterium Pseudomonas sp. UW4

    PubMed Central

    Duan, Jin; Jiang, Wei; Cheng, Zhenyu; Heikkila, John J.; Glick, Bernard R.

    2013-01-01

    The plant growth-promoting bacterium (PGPB) Pseudomonas sp. UW4, previously isolated from the rhizosphere of common reeds growing on the campus of the University of Waterloo, promotes plant growth in the presence of different environmental stresses, such as flooding, high concentrations of salt, cold, heavy metals, drought and phytopathogens. In this work, the genome sequence of UW4 was obtained by pyrosequencing and the gaps between the contigs were closed by directed PCR. The P. sp. UW4 genome contains a single circular chromosome that is 6,183,388 bp with a 60.05% G+C content. The bacterial genome contains 5,423 predicted protein-coding sequences that occupy 87.2% of the genome. Nineteen genomic islands (GIs) were predicted and thirty one complete putative insertion sequences were identified. Genes potentially involved in plant growth promotion such as indole-3-acetic acid (IAA) biosynthesis, trehalose production, siderophore production, acetoin synthesis, and phosphate solubilization were determined. Moreover, genes that contribute to the environmental fitness of UW4 were also observed including genes responsible for heavy metal resistance such as nickel, copper, cadmium, zinc, molybdate, cobalt, arsenate, and chromate. Whole-genome comparison with other completely sequenced Pseudomonas strains and phylogeny of four concatenated “housekeeping” genes (16S rRNA, gyrB, rpoB and rpoD) of 128 Pseudomonas strains revealed that UW4 belongs to the fluorescens group, jessenii subgroup. PMID:23516524

  2. Chloroplast chlB gene is required for light-independent chlorophyll accumulation in Chlamydomonas reinhardtii.

    PubMed

    Liu, X Q; Xu, H; Huang, C

    1993-10-01

    Light-independent chlorophyll synthesis occurs in some algae, lower plants, and gymnosperms, but not in angiosperms. We have identified a new chloroplast gene, chlB, that is required for the light-independent accumulation of chlorophyll in the green alga Chlamydomonas reinhardtii. The chlB gene was cloned, sequenced, and then disrupted by performing particle gun-mediated chloroplast transformation. The resulting homoplasmic mutant was unable to accumulate chlorophyll in the dark and thus exhibited a 'yellow-in-the-dark' phenotype. The chlB gene encodes a polypeptide of 688 amino acid residues, and is distinct from two previously characterized chloroplast genes (chlN and chlL) also required for light-independent chlorophyll accumulation in C. reinhardtii. Three unidentified open reading frames in chloroplast genomes of liverwort, black pine, and Chlamydomonas moewusii were also identified as chlB genes, based on their striking sequence similarities to the C. reinhardtii chlB gene. A chlB-like gene is absent in chloroplast genomes of tobacco and rice, consistent with the lack of light-independent chlorophyll synthesis in these plants. Polypeptides encoded by the chloroplast chlB genes also show significant sequence similarities with the bchB gene product of Rhodobacter capsulatus. Comparisons among the chloroplast chlB and the bacterial bchB gene products revealed five highly conserved sequence areas that are interspersed by four stretches of highly variable and probably insertional sequences.

  3. Isolation and Whole-genome Sequence Analysis of the Imipenem Heteroresistant Acinetobacter baumannii Clinical Isolate HRAB-85.

    PubMed

    Li, Puyuan; Huang, Yong; Yu, Lan; Liu, Yannan; Niu, Wenkai; Zou, Dayang; Liu, Huiying; Zheng, Jing; Yin, Xiuyun; Yuan, Jing; Yuan, Xin; Bai, Changqing

    2017-09-01

    Heteroresistance is a phenomenon in which there are various responses to antibiotics from bacterial cells within the same population. Here, we isolated and characterised an imipenem heteroresistant Acinetobacter baumannii strain (HRAB-85). The genome of strain HRAB-85 was completely sequenced and analysed to understand its antibiotic resistance mechanisms. Population analysis and multilocus sequence typing were performed. Subpopulations grew in the presence of imipenem at concentrations of up to 64μg/mL, and the strain was found to belong to ST208. The total length of strain HRAB-85 was 4,098,585bp with a GC content of 39.98%. The genome harboured at least four insertion sequences: the common ISAba1, ISAba22, ISAba24, and newly reported ISAba26. Additionally, 19 antibiotic-resistance genes against eight classes of antimicrobial agents were found, and 11 genomic islands (GIs) were identified. Among them, GI3, GI10, and GI11 contained many ISs and antibiotic-resistance determinants. The existence of imipenem heteroresistant phenotypes in A. baumannii was substantiated in this hospital, and imipenem pressure, which could induce imipenem-heteroresistant subpopulations, may select for highly resistant strains. The complete genome sequencing and bioinformatics analysis of HRAB-85 could improve our understanding of the epidemiology and resistance mechanisms of carbapenem-heteroresistant A. baumannii. Copyright © 2017. Published by Elsevier Ltd.

  4. Comprehensive phylogenetic analysis of bacterial reverse transcriptases.

    PubMed

    Toro, Nicolás; Nisa-Martínez, Rafael

    2014-01-01

    Much less is known about reverse transcriptases (RTs) in prokaryotes than in eukaryotes, with most prokaryotic enzymes still uncharacterized. Two surveys involving BLAST searches for RT genes in prokaryotic genomes revealed the presence of large numbers of diverse, uncharacterized RTs and RT-like sequences. Here, using consistent annotation across all sequenced bacterial species from GenBank and other sources via RAST, available from the PATRIC (Pathogenic Resource Integration Center) platform, we have compiled the data for currently annotated reverse transcriptases from completely sequenced bacterial genomes. RT sequences are broadly distributed across bacterial phyla, but green sulfur bacteria and cyanobacteria have the highest levels of RT sequence diversity (≤85% identity) per genome. By contrast, phylum Actinobacteria, for which a large number of genomes have been sequenced, was found to have a low RT sequence diversity. Phylogenetic analyses revealed that bacterial RTs could be classified into 17 main groups: group II introns, retrons/retron-like RTs, diversity-generating retroelements (DGRs), Abi-like RTs, CRISPR-Cas-associated RTs, group II-like RTs (G2L), and 11 other groups of RTs of unknown function. Proteobacteria had the highest potential functional diversity, as they possessed most of the RT groups. Group II introns and DGRs were the most widely distributed RTs in bacterial phyla. Our results provide insights into bacterial RT phylogeny and the basis for an update of annotation systems based on sequence/domain homology.

  5. Comprehensive Phylogenetic Analysis of Bacterial Reverse Transcriptases

    PubMed Central

    Toro, Nicolás; Nisa-Martínez, Rafael

    2014-01-01

    Much less is known about reverse transcriptases (RTs) in prokaryotes than in eukaryotes, with most prokaryotic enzymes still uncharacterized. Two surveys involving BLAST searches for RT genes in prokaryotic genomes revealed the presence of large numbers of diverse, uncharacterized RTs and RT-like sequences. Here, using consistent annotation across all sequenced bacterial species from GenBank and other sources via RAST, available from the PATRIC (Pathogenic Resource Integration Center) platform, we have compiled the data for currently annotated reverse transcriptases from completely sequenced bacterial genomes. RT sequences are broadly distributed across bacterial phyla, but green sulfur bacteria and cyanobacteria have the highest levels of RT sequence diversity (≤85% identity) per genome. By contrast, phylum Actinobacteria, for which a large number of genomes have been sequenced, was found to have a low RT sequence diversity. Phylogenetic analyses revealed that bacterial RTs could be classified into 17 main groups: group II introns, retrons/retron-like RTs, diversity-generating retroelements (DGRs), Abi-like RTs, CRISPR-Cas-associated RTs, group II-like RTs (G2L), and 11 other groups of RTs of unknown function. Proteobacteria had the highest potential functional diversity, as they possessed most of the RT groups. Group II introns and DGRs were the most widely distributed RTs in bacterial phyla. Our results provide insights into bacterial RT phylogeny and the basis for an update of annotation systems based on sequence/domain homology. PMID:25423096

  6. First report of bacterial community from a Bat Guano using Illumina next-generation sequencing.

    PubMed

    De Mandal, Surajit; Zothansanga; Panda, Amritha Kumari; Bisht, Satpal Singh; Senthil Kumar, Nachimuthu

    2015-06-01

    V4 hypervariable region of 16S rDNA was analyzed for identifying the bacterial communities present in Bat Guano from the unexplored cave - Pnahkyndeng, Meghalaya, Northeast India. Metagenome comprised of 585,434 raw Illumina sequences with a 59.59% G+C content. A total of 416,490 preprocessed reads were clustered into 1282 OTUs (operational taxonomical units) comprising of 18 bacterial phyla. The taxonomic profile showed that the guano bacterial community is dominated by Chloroflexi, Actinobacteria and Crenarchaeota which account for 70.73% of all sequence reads and 43.83% of all OTUs. Metagenome sequence data are available at NCBI under the accession no. SRP051094. This study is the first to characterize Bat Guano bacterial community using next-generation sequencing approach.

  7. First report of bacterial community from a Bat Guano using Illumina next-generation sequencing

    PubMed Central

    De Mandal, Surajit; Zothansanga; Panda, Amritha Kumari; Bisht, Satpal Singh; Senthil Kumar, Nachimuthu

    2015-01-01

    V4 hypervariable region of 16S rDNA was analyzed for identifying the bacterial communities present in Bat Guano from the unexplored cave — Pnahkyndeng, Meghalaya, Northeast India. Metagenome comprised of 585,434 raw Illumina sequences with a 59.59% G+C content. A total of 416,490 preprocessed reads were clustered into 1282 OTUs (operational taxonomical units) comprising of 18 bacterial phyla. The taxonomic profile showed that the guano bacterial community is dominated by Chloroflexi, Actinobacteria and Crenarchaeota which account for 70.73% of all sequence reads and 43.83% of all OTUs. Metagenome sequence data are available at NCBI under the accession no. SRP051094. This study is the first to characterize Bat Guano bacterial community using next-generation sequencing approach. PMID:26484190

  8. TU-H-CAMPUS-JeP3-05: Adaptive Determination of Needle Sequence HDR Prostate Brachytherapy with Divergent Needle-By-Needle Delivery

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Borot de Battisti, M; Maenhout, M; Lagendijk, J J W

    Purpose: To develop a new method which adaptively determines the optimal needle insertion sequence for HDR prostate brachytherapy involving divergent needle-by-needle dose delivery by e.g. a robotic device. A needle insertion sequence is calculated at the beginning of the intervention and updated after each needle insertion with feedback on needle positioning errors. Methods: Needle positioning errors and anatomy changes may occur during HDR brachytherapy which can lead to errors in the delivered dose. A novel strategy was developed to calculate and update the needle sequence and the dose plan after each needle insertion with feedback on needle positioning errors. Themore » dose plan optimization was performed by numerical simulations. The proposed needle sequence determination optimizes the final dose distribution based on the dose coverage impact of each needle. This impact is predicted stochastically by needle insertion simulations. HDR procedures were simulated with varying number of needle insertions (4 to 12) using 11 patient MR data-sets with PTV, prostate, urethra, bladder and rectum delineated. Needle positioning errors were modeled by random normally distributed angulation errors (standard deviation of 3 mm at the needle’s tip). The final dose parameters were compared in the situations where the needle with the largest vs. the smallest dose coverage impact was selected at each insertion. Results: Over all scenarios, the percentage of clinically acceptable final dose distribution improved when the needle selected had the largest dose coverage impact (91%) compared to the smallest (88%). The differences were larger for few (4 to 6) needle insertions (maximum difference scenario: 79% vs. 60%). The computation time of the needle sequence optimization was below 60s. Conclusion: A new adaptive needle sequence determination for HDR prostate brachytherapy was developed. Coupled to adaptive planning, the selection of the needle with the largest dose coverage impact increases chances of reaching the clinical constraints. M. Borot de Battisti is funded by Philips Medical Systems Nederland B.V.; M. Moerland is principal investigator on a contract funded by Philips Medical Systems Nederland B.V.; G. Hautvast and D. Binnekamp are fulltime employees of Philips Medical Systems Nederland B.V.« less

  9. In vivo insertion pool sequencing identifies virulence factors in a complex fungal–host interaction

    PubMed Central

    Uhse, Simon; Pflug, Florian G.; Stirnberg, Alexandra; Ehrlinger, Klaus; von Haeseler, Arndt

    2018-01-01

    Large-scale insertional mutagenesis screens can be powerful genome-wide tools if they are streamlined with efficient downstream analysis, which is a serious bottleneck in complex biological systems. A major impediment to the success of next-generation sequencing (NGS)-based screens for virulence factors is that the genetic material of pathogens is often underrepresented within the eukaryotic host, making detection extremely challenging. We therefore established insertion Pool-Sequencing (iPool-Seq) on maize infected with the biotrophic fungus U. maydis. iPool-Seq features tagmentation, unique molecular barcodes, and affinity purification of pathogen insertion mutant DNA from in vivo-infected tissues. In a proof of concept using iPool-Seq, we identified 28 virulence factors, including 23 that were previously uncharacterized, from an initial pool of 195 candidate effector mutants. Because of its sensitivity and quantitative nature, iPool-Seq can be applied to any insertional mutagenesis library and is especially suitable for genetically complex setups like pooled infections of eukaryotic hosts. PMID:29684023

  10. Bacterial Hsp70 (DnaK) and mammalian Hsp70 interact differently with lipid membranes.

    PubMed

    Lopez, Victor; Cauvi, David M; Arispe, Nelson; De Maio, Antonio

    2016-07-01

    The cellular response to stress is orchestrated by the expression of a family of proteins termed heat shock proteins (hsp) that are involved in the stabilization of basic cellular processes to preserve cell viability and homeostasis. The bulk of hsp function occurs within the cytosol and subcellular compartments. However, some hsp have also been found outside cells released by an active mechanism independent of cell death. Extracellular hsp act as signaling molecules directed at activating a systemic response to stress. The export of hsp requires the translocation from the cytosol into the extracellular milieu across the plasma membrane. We have proposed that membrane insertion is the initial step in this export process. We investigated the interaction of the major inducible hsp from mammalian (Hsp70) and bacterial (DnaK) species with liposomes. We found that mammalian Hsp70 displayed a high specificity for negatively charged phospholipids, such as phosphatidyl serine, whereas DnaK interacted with all lipids tested regardless of the charge. Both proteins were inserted into the lipid bilayer as demonstrated by resistance to acid or basic washes that was confirmed by partial protection from proteolytic cleavage. Several regions of mammalian Hsp70 were inserted into the membrane with a small portion of the N-terminus end exposed to the outer phase of the liposome. In contrast, the N-terminus end of DnaK was inserted into the membrane, exposing the C-terminus end outside the liposome. Mammalian Hsp70 was found to make high oligomeric complexes upon insertion into the membranes whereas DnaK only formed dimers within the lipid bilayer. These observations suggest that both Hsp70s interact with lipids, but mammalian Hsp70 displays a high degree of specificity and structure as compared with the bacterial form.

  11. Electroporation of Functional Bacterial Effectors into Mammalian Cells

    DOE PAGES

    Sontag, Ryan L.; Mihai, Cosmin; Orr, Galya; ...

    2015-01-19

    Electroporation was used to insert purified bacterial virulence effector proteins directly into living eukaryotic cells. Protein localization was monitored by confocal immunofluorescence microscopy. This method allows for studies on trafficking, function, and protein-protein interactions using active exogenous proteins, avoiding the need for heterologous expression in eukaryotic cells.

  12. Time- and Cost-Efficient Identification of T-DNA Insertion Sites through Targeted Genomic Sequencing

    PubMed Central

    Lepage, Étienne; Zampini, Éric; Boyle, Brian; Brisson, Normand

    2013-01-01

    Forward genetic screens enable the unbiased identification of genes involved in biological processes. In Arabidopsis, several mutant collections are publicly available, which greatly facilitates such practice. Most of these collections were generated by agrotransformation of a T-DNA at random sites in the plant genome. However, precise mapping of T-DNA insertion sites in mutants isolated from such screens is a laborious and time-consuming task. Here we report a simple, low-cost and time efficient approach to precisely map T-DNA insertions simultaneously in many different mutants. By combining sequence capture, next-generation sequencing and 2D-PCR pooling, we developed a new method that allowed the rapid localization of T-DNA insertion sites in 55 out of 64 mutant plants isolated in a screen for gyrase inhibition hypersensitivity. PMID:23951038

  13. Molecular Characterization of Epiphytic Bacterial Communities on Charophycean Green Algae

    PubMed Central

    Fisher, Madeline M.; Wilcox, Lee W.; Graham, Linda E.

    1998-01-01

    Epiphytic bacterial communities within the sheath material of three filamentous green algae, Desmidium grevillii, Hyalotheca dissiliens, and Spondylosium pulchrum (class Charophyceae, order Zygnematales), collected from a Sphagnum bog were characterized by PCR amplification, cloning, and sequencing of 16S ribosomal DNA. A total of 20 partial sequences and nine different sequence types were obtained, and one sequence type was recovered from the bacterial communities on all three algae. By phylogenetic analysis, the cloned sequences were placed into several major lineages of the Bacteria domain: the Flexibacter/Cytophaga/Bacteroides phylum and the α, β, and γ subdivisions of the phylum Proteobacteria. Analysis at the subphylum level revealed that the majority of our sequences were not closely affiliated with those of known, cultured taxa, although the estimated evolutionary distances between our sequences and their nearest neighbors were always less than 0.1 (i.e., greater than 90% similar). This result suggests that the majority of sequences obtained in this study represent as yet phenotypically undescribed bacterial species and that the range of bacterial-algal interactions that occur in nature has not yet been fully described. PMID:9797295

  14. Sorting genomes by reciprocal translocations, insertions, and deletions.

    PubMed

    Qi, Xingqin; Li, Guojun; Li, Shuguang; Xu, Ying

    2010-01-01

    The problem of sorting by reciprocal translocations (abbreviated as SBT) arises from the field of comparative genomics, which is to find a shortest sequence of reciprocal translocations that transforms one genome Pi into another genome Gamma, with the restriction that Pi and Gamma contain the same genes. SBT has been proved to be polynomial-time solvable, and several polynomial algorithms have been developed. In this paper, we show how to extend Bergeron's SBT algorithm to include insertions and deletions, allowing to compare genomes containing different genes. In particular, if the gene set of Pi is a subset (or superset, respectively) of the gene set of Gamma, we present an approximation algorithm for transforming Pi into Gamma by reciprocal translocations and deletions (insertions, respectively), providing a sorting sequence with length at most OPT + 2, where OPT is the minimum number of translocations and deletions (insertions, respectively) needed to transform Pi into Gamma; if Pi and Gamma have different genes but not containing each other, we give a heuristic to transform Pi into Gamma by a shortest sequence of reciprocal translocations, insertions, and deletions, with bounds for the length of the sorting sequence it outputs. At a conceptual level, there is some similarity between our algorithm and the algorithm developed by El Mabrouk which is used to sort two chromosomes with different gene contents by reversals, insertions, and deletions.

  15. Development of genomic resources for the narrow-leafed lupin (Lupinus angustifolius): construction of a bacterial artificial chromosome (BAC) library and BAC-end sequencing

    PubMed Central

    2011-01-01

    Background Lupinus angustifolius L, also known as narrow-leafed lupin (NLL), is becoming an important grain legume crop that is valuable for sustainable farming and is becoming recognised as a potential human health food. Recent interest is being directed at NLL to improve grain production, disease and pest management and health benefits of the grain. However, studies have been hindered by a lack of extensive genomic resources for the species. Results A NLL BAC library was constructed consisting of 111,360 clones with an average insert size of 99.7 Kbp from cv Tanjil. The library has approximately 12 × genome coverage. Both ends of 9600 randomly selected BAC clones were sequenced to generate 13985 BAC end-sequences (BESs), covering approximately 1% of the NLL genome. These BESs permitted a preliminary characterisation of the NLL genome such as organisation and composition, with the BESs having approximately 39% G:C content, 16.6% repetitive DNA and 5.4% putative gene-encoding regions. From the BESs 9966 simple sequence repeat (SSR) motifs were identified and some of these are shown to be potential markers. Conclusions The NLL BAC library and BAC-end sequences are powerful resources for genetic and genomic research on lupin. These resources will provide a robust platform for future high-resolution mapping, map-based cloning, comparative genomics and assembly of whole-genome sequencing data for the species. PMID:22014081

  16. Bacterial identification and subtyping using DNA microarray and DNA sequencing.

    PubMed

    Al-Khaldi, Sufian F; Mossoba, Magdi M; Allard, Marc M; Lienau, E Kurt; Brown, Eric D

    2012-01-01

    The era of fast and accurate discovery of biological sequence motifs in prokaryotic and eukaryotic cells is here. The co-evolution of direct genome sequencing and DNA microarray strategies not only will identify, isotype, and serotype pathogenic bacteria, but also it will aid in the discovery of new gene functions by detecting gene expressions in different diseases and environmental conditions. Microarray bacterial identification has made great advances in working with pure and mixed bacterial samples. The technological advances have moved beyond bacterial gene expression to include bacterial identification and isotyping. Application of new tools such as mid-infrared chemical imaging improves detection of hybridization in DNA microarrays. The research in this field is promising and future work will reveal the potential of infrared technology in bacterial identification. On the other hand, DNA sequencing by using 454 pyrosequencing is so cost effective that the promise of $1,000 per bacterial genome sequence is becoming a reality. Pyrosequencing technology is a simple to use technique that can produce accurate and quantitative analysis of DNA sequences with a great speed. The deposition of massive amounts of bacterial genomic information in databanks is creating fingerprint phylogenetic analysis that will ultimately replace several technologies such as Pulsed Field Gel Electrophoresis. In this chapter, we will review (1) the use of DNA microarray using fluorescence and infrared imaging detection for identification of pathogenic bacteria, and (2) use of pyrosequencing in DNA cluster analysis to fingerprint bacterial phylogenetic trees.

  17. Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health.

    PubMed

    Hazkani-Covo, Einat; Martin, William F

    2017-05-01

    Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  18. Analysis of plastid and mitochondrial DNA insertions in the nucleus (NUPTs and NUMTs) of six plant species: size, relative age and chromosomal localization.

    PubMed

    Michalovova, M; Vyskot, B; Kejnovsky, E

    2013-10-01

    We analysed the size, relative age and chromosomal localization of nuclear sequences of plastid and mitochondrial origin (NUPTs-nuclear plastid DNA and NUMTs-nuclear mitochondrial DNA) in six completely sequenced plant species. We found that the largest insertions showed lower divergence from organelle DNA than shorter insertions in all species, indicating their recent origin. The largest NUPT and NUMT insertions were localized in the vicinity of the centromeres in the small genomes of Arabidopsis and rice. They were also present in other chromosomal regions in the large genomes of soybean and maize. Localization of NUPTs and NUMTs correlated positively with distribution of transposable elements (TEs) in Arabidopsis and sorghum, negatively in grapevine and soybean, and did not correlate in rice or maize. We propose a model where new plastid and mitochondrial DNA sequences are inserted close to centromeres and are later fragmented by TE insertions and reshuffled away from the centromere or removed by ectopic recombination. The mode and tempo of TE dynamism determines the turnover of NUPTs and NUMTs resulting in their species-specific chromosomal distributions.

  19. Microscopic, chemical, and molecular-biological investigation of the decayed medieval stained window glasses of two Catalonian churches

    PubMed Central

    Piñar, Guadalupe; Garcia-Valles, Maite; Gimeno-Torrente, Domingo; Fernandez-Turiel, Jose Luis; Ettenauer, Jörg; Sterflinger, Katja

    2013-01-01

    We investigated the decayed historical church window glasses of two Catalonian churches, both under Mediterranean climate. Glass surfaces were studied by scanning electron microscopy (SEM), energy dispersive spectrometry (EDS), and X-ray diffraction (XRD). Their chemical composition was determined by wavelength-dispersive spectrometry (WDS) microprobe analysis. The biodiversity was investigated by molecular methods: DNA extraction from glass, amplification by PCR targeting the16S rRNA and ITS regions, and fingerprint analyses by denaturing gradient gel electrophoresis (DGGE). Clone libraries containing either PCR fragments of the bacterial 16S rDNA or the fungal ITS regions were screened by DGGE. Clone inserts were sequenced and compared with the EMBL database. Similarity values ranged from 89 to 100% to known bacteria and fungi. Biological activity in both sites was evidenced in the form of orange patinas, bio-pitting, and mineral precipitation. Analyses revealed complex bacterial communities consisting of members of the phyla Proteobacteria, Bacteroidetes, Firmicutes, and Actinobacteria. Fungi showed less diversity than bacteria, and species of the genera Cladosporium and Phoma were dominant. The detected Actinobacteria and fungi may be responsible for the observed bio-pitting phenomenon. Moreover, some of the detected bacteria are known for their mineral precipitation capabilities. Sequence results also showed similarities with bacteria commonly found on deteriorated stone monuments, supporting the idea that medieval stained glass biodeterioration in the Mediterranean area shows a pattern comparable to that on stone. PMID:24092957

  20. A virus vector based on Canine Herpesvirus for vaccine applications in canids.

    PubMed

    Strive, T; Hardy, C M; Wright, J; Reubel, G H

    2007-01-31

    Canine Herpesvirus (CHV) is being developed as a virus vector for the vaccination of European red foxes. However, initial studies using recombinant CHV vaccines in foxes revealed viral attenuation and lack of antibody response to inserted foreign antigens. These findings were attributed both to inactivation of the thymidine kinase (TK) gene and excess foreign genetic material in the recombinant viral genome. In this study, we report an improved CHV-bacterial artificial chromosome (BAC) vector system designed to overcome attenuation in foxes. A non-essential region was identified in the CHV genome as an alternative insertion site for foreign genes. Replacement of a guanine/cytosine (GC)-rich intergenic region between UL21 and UL22 of CHV with a marker gene did not change growth behaviour in vitro, showing that this region is not essential for virus growth in cell culture. We subsequently produced a CHV-BAC vector with an intact TK gene in which the bacterial genes and the antigen expression cassette were inserted into this GC-rich locus. Unlike earlier constructs, the new CHV-BAC allowed self-excision of the bacterial genes via homologous recombination after transfection of BACs into cell culture. The BAC-CHV system was used to produce a recombinant virus that constitutively expressed porcine zona pellucida subunit C protein between the UL21 and UL22 genes of CHV. Complete self-excision of the bacterial genes from CHV was achieved within one round of replication whilst retaining antigen gene expression.

  1. Bacterial population dynamics during the ensiling of Medicago sativa (alfalfa) and subsequent exposure to air.

    PubMed

    McGarvey, J A; Franco, R B; Palumbo, J D; Hnasko, R; Stanker, L; Mitloehner, F M

    2013-06-01

    To describe, at high resolution, the bacterial population dynamics and chemical transformations during the ensiling of alfalfa and subsequent exposure to air. Samples of alfalfa, ensiled alfalfa and silage exposed to air were collected and their bacterial population structures compared using 16S rRNA gene libraries containing approximately 1900 sequences each. Cultural and chemical analyses were also performed to complement the 16S gene sequence data. Sequence analysis revealed significant differences (P < 0·05) in the bacterial populations at each time point. The alfalfa-derived library contained mostly sequences associated with the Gammaproteobacteria (including the genera: Enterobacter, Erwinia and Pantoea); the ensiled material contained mostly sequences associated with the lactic acid bacteria (LAB) (including the genera: Lactobacillus, Pediococcus and Lactococcus). Exposure to air resulted in even greater percentages of LAB, especially among the genus Lactobacillus, and a significant drop in bacterial diversity. In-depth 16S rRNA gene sequence analysis revealed significant bacterial population structure changes during ensiling and again during exposure to air. This in-depth description of the bacterial population dynamics that occurred during ensiling and simulated feed out expands our knowledge of these processes. © 2013 The Society for Applied Microbiology No claim to US Government works.

  2. A physical map of a BAC clone contig covering the entire autosome insertion between ovine MHC Class IIa and IIb

    PubMed Central

    2012-01-01

    Background The ovine Major Histocompatibility Complex (MHC) harbors genes involved in overall resistance/susceptibility of the host to infectious diseases. Compared to human and mouse, the ovine MHC is interrupted by a large piece of autosome insertion via a hypothetical chromosome inversion that constitutes ~25% of ovine chromosome 20. The evolutionary consequence of such an inversion and an insertion (inversion/insertion) in relation to MHC function remains unknown. We previously constructed a BAC clone physical map for the ovine MHC exclusive of the insertion region. Here we report the construction of a high-density physical map covering the autosome insertion in order to address the question of what the inversion/insertion had to do with ruminants during the MHC evolution. Results A total of 119 pairs of comparative bovine oligo primers were utilized to screen an ovine BAC library for positive clones and the orders and overlapping relationships of the identified clones were determined by DNA fingerprinting, BAC-end sequencing, and sequence-specific PCR. A total of 368 positive BAC clones were identified and 108 of the effective clones were ordered into an overlapping BAC contig to cover the consensus region between ovine MHC class IIa and IIb. Therefore, a continuous physical map covering the entire ovine autosome inversion/insertion region was successfully constructed. The map confirmed the bovine sequence assembly for the same homologous region. The DNA sequences of 185 BAC-ends have been deposited into NCBI database with the access numbers HR309252 through HR309068, corresponding to dbGSS ID 30164010 through 30163826. Conclusions We have constructed a high-density BAC clone physical map for the ovine autosome inversion/insertion between the MHC class IIa and IIb. The entire ovine MHC region is now fully covered by a continuous BAC clone contig. The physical map we generated will facilitate MHC functional studies in the ovine, as well as the comparative MHC evolution in ruminants. PMID:22897909

  3. Alu repeat discovery and characterization within human genomes

    PubMed Central

    Hormozdiari, Fereydoun; Alkan, Can; Ventura, Mario; Hajirasouliha, Iman; Malig, Maika; Hach, Faraz; Yorukoglu, Deniz; Dao, Phuong; Bakhshi, Marzieh; Sahinalp, S. Cenk; Eichler, Evan E.

    2011-01-01

    Human genomes are now being rapidly sequenced, but not all forms of genetic variation are routinely characterized. In this study, we focus on Alu retrotransposition events and seek to characterize differences in the pattern of mobile insertion between individuals based on the analysis of eight human genomes sequenced using next-generation sequencing. Applying a rapid read-pair analysis algorithm, we discover 4342 Alu insertions not found in the human reference genome and show that 98% of a selected subset (63/64) experimentally validate. Of these new insertions, 89% correspond to AluY elements, suggesting that they arose by retrotransposition. Eighty percent of the Alu insertions have not been previously reported and more novel events were detected in Africans when compared with non-African samples (76% vs. 69%). Using these data, we develop an experimental and computational screen to identify ancestry informative Alu retrotransposition events among different human populations. PMID:21131385

  4. Cloning of a CACTA transposon-like insertion in intron I of tomato invertase Lin5 gene and identification of transposase-like sequences of Solanaceae species.

    PubMed

    Proels, Reinhard K; Roitsch, Thomas

    2006-03-01

    Very few CACTA transposon-like sequences have been described in Solanaceae species. Sequence information has been restricted to partial transposase (TPase)-like fragments, and no target gene of CACTA-like transposon insertion has been described in tomato to date. In this manuscript, we report on a CACTA transposon-like insertion in intron I of tomato (Lycopersicon esculentum) invertase gene Lin5 and TPase-like sequences of several Solanaceae species. Consensus primers deduced from the TPase region of the tomato CACTA transposon-like element allowed the amplification of similar sequences from various Solanaceae species of different subfamilies including Solaneae (Solanum tuberosum), Cestreae (Nicotiana tabacum) and Datureae (Datura stramonium). This demonstrates the ubiquitous presence of CACTA-like elements in Solanaceae genomes. The obtained partial sequences are highly conserved, and allow further detection and detailed analysis of CACTA-like transposons throughout Solanaceae species. CACTA-like transposon sequences make possible the evaluation of their use for genome analysis, functional studies of genes and the evolutionary relationships between plant species.

  5. Method for introducing unidirectional nested deletions

    DOEpatents

    Dunn, John J.; Quesada, Mark A.; Randesi, Matthew

    2001-01-01

    Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment in the context of a cloning vector which contains an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment. Also disclosed is a method for producing single-stranded DNA probes utilizing the same cloning vector. An optimal vector, PZIP is described. Methods for introducing unidirectional deletions into a terminal location of a cloned DNA sequence which is inserted into the vector of the present invention are also disclosed. These methods are useful for introducing deletions into either or both ends of a cloned DNA insert, for high throughput sequencing of any DNA of interest.

  6. Triple helix purification and sequencing

    DOEpatents

    Wang, Renfeng; Smith, Lloyd M.; Tong, Xinchun E.

    1995-01-01

    Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis.

  7. Triple helix purification and sequencing

    DOEpatents

    Wang, R.; Smith, L.M.; Tong, X.E.

    1995-03-28

    Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis. 4 figures.

  8. An Inserted α/β Subdomain Shapes the Catalytic Pocket of Lactobacillus johnsonii Cinnamoyl Esterase

    PubMed Central

    Vu, Clara; Xu, Xiaohui; Cui, Hong; Molloy, Sara; Savchenko, Alexei; Yakunin, Alexander; Gonzalez, Claudio F.

    2011-01-01

    Background Microbial enzymes produced in the gastrointestinal tract are primarily responsible for the release and biochemical transformation of absorbable bioactive monophenols. In the present work we described the crystal structure of LJ0536, a serine cinnamoyl esterase produced by the probiotic bacterium Lactobacillus johnsonii N6.2. Methodology/Principal Findings We crystallized LJ0536 in the apo form and in three substrate-bound complexes. The structure showed a canonical α/β fold characteristic of esterases, and the enzyme is dimeric. Two classical serine esterase motifs (GlyXSerXGly) can be recognized from the amino acid sequence, and the structure revealed that the catalytic triad of the enzyme is formed by Ser106, His225, and Asp197, while the other motif is non-functional. In all substrate-bound complexes, the aromatic acyl group of the ester compound was bound in the deepest part of the catalytic pocket. The binding pocket also contained an unoccupied area that could accommodate larger ligands. The structure revealed a prominent inserted α/β subdomain of 54 amino acids, from which multiple contacts to the aromatic acyl groups of the substrates are made. Inserts of this size are seen in other esterases, but the secondary structure topology of this subdomain of LJ0536 is unique to this enzyme and its closest homolog (Est1E) in the Protein Databank. Conclusions The binding mechanism characterized (involving the inserted α/β subdomain) clearly differentiates LJ0536 from enzymes with similar activity of a fungal origin. The structural features herein described together with the activity profile of LJ0536 suggest that this enzyme should be clustered in a new group of bacterial cinnamoyl esterases. PMID:21876742

  9. An inserted α/β subdomain shapes the catalytic pocket of Lactobacillus johnsonii cinnamoyl esterase.

    PubMed

    Lai, Kin-Kwan; Stogios, Peter J; Vu, Clara; Xu, Xiaohui; Cui, Hong; Molloy, Sara; Savchenko, Alexei; Yakunin, Alexander; Gonzalez, Claudio F

    2011-01-01

    Microbial enzymes produced in the gastrointestinal tract are primarily responsible for the release and biochemical transformation of absorbable bioactive monophenols. In the present work we described the crystal structure of LJ0536, a serine cinnamoyl esterase produced by the probiotic bacterium Lactobacillus johnsonii N6.2. We crystallized LJ0536 in the apo form and in three substrate-bound complexes. The structure showed a canonical α/β fold characteristic of esterases, and the enzyme is dimeric. Two classical serine esterase motifs (GlyXSerXGly) can be recognized from the amino acid sequence, and the structure revealed that the catalytic triad of the enzyme is formed by Ser(106), His(225), and Asp(197), while the other motif is non-functional. In all substrate-bound complexes, the aromatic acyl group of the ester compound was bound in the deepest part of the catalytic pocket. The binding pocket also contained an unoccupied area that could accommodate larger ligands. The structure revealed a prominent inserted α/β subdomain of 54 amino acids, from which multiple contacts to the aromatic acyl groups of the substrates are made. Inserts of this size are seen in other esterases, but the secondary structure topology of this subdomain of LJ0536 is unique to this enzyme and its closest homolog (Est1E) in the Protein Databank. The binding mechanism characterized (involving the inserted α/β subdomain) clearly differentiates LJ0536 from enzymes with similar activity of a fungal origin. The structural features herein described together with the activity profile of LJ0536 suggest that this enzyme should be clustered in a new group of bacterial cinnamoyl esterases.

  10. Construction of a plant-transformation-competent BIBAC library and genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.)

    PubMed Central

    2013-01-01

    Background Cotton, one of the world’s leading crops, is important to the world’s textile and energy industries, and is a model species for studies of plant polyploidization, cellulose biosynthesis and cell wall biogenesis. Here, we report the construction of a plant-transformation-competent binary bacterial artificial chromosome (BIBAC) library and comparative genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.) with one of its diploid putative progenitor species, G. raimondii Ulbr. Results We constructed the cotton BIBAC library in a vector competent for high-molecular-weight DNA transformation in different plant species through either Agrobacterium or particle bombardment. The library contains 76,800 clones with an average insert size of 135 kb, providing an approximate 99% probability of obtaining at least one positive clone from the library using a single-copy probe. The quality and utility of the library were verified by identifying BIBACs containing genes important for fiber development, fiber cellulose biosynthesis, seed fatty acid metabolism, cotton-nematode interaction, and bacterial blight resistance. In order to gain an insight into the Upland cotton genome and its relationship with G. raimondii, we sequenced nearly 10,000 BIBAC ends (BESs) randomly selected from the library, generating approximately one BES for every 250 kb along the Upland cotton genome. The retroelement Gypsy/DIRS1 family predominates in the Upland cotton genome, accounting for over 77% of all transposable elements. From the BESs, we identified 1,269 simple sequence repeats (SSRs), of which 1,006 were new, thus providing additional markers for cotton genome research. Surprisingly, comparative sequence analysis showed that Upland cotton is much more diverged from G. raimondii at the genomic sequence level than expected. There seems to be no significant difference between the relationships of the Upland cotton D- and A-subgenomes with the G. raimondii genome, even though G. raimondii contains a D genome (D5). Conclusions The library represents the first BIBAC library in cotton and related species, thus providing tools useful for integrative physical mapping, large-scale genome sequencing and large-scale functional analysis of the Upland cotton genome. Comparative sequence analysis provides insights into the Upland cotton genome, and a possible mechanism underlying the divergence and evolution of polyploid Upland cotton from its diploid putative progenitor species, G. raimondii. PMID:23537070

  11. Directed Differentiation of Embryonic Stem Cells Into Cardiomyocytes by Bacterial Injection of Defined Transcription Factors.

    PubMed

    Bai, Fang; Ho Lim, Chae; Jia, Jingyue; Santostefano, Katherine; Simmons, Chelsey; Kasahara, Hideko; Wu, Weihui; Terada, Naohiro; Jin, Shouguang

    2015-10-09

    Forced expression of defined transcriptional factors has been well documented as an effective method for cellular reprogramming or directed differentiation. However, transgene expression is not amenable for therapeutic application due to potential insertional mutagenesis. Here, we have developed a bacterial type III secretion system (T3SS)-based protein delivery tool and shown its application in directing pluripotent stem cell differentiation by a controlled delivery of transcription factors relevant to early heart development. By fusing to an N-terminal secretion sequence for T3SS-dependent injection, three transcriptional factors, namely Gata4, Mef2c, and Tbx5 (abbreviated as GMT), were translocated into murine embryonic stem cells (ESCs), where the proteins are effectively targeted to the nucleus with an average intracellular half-life of 5.5 hours. Exogenous GMT protein injection activated the cardiac program, and multiple rounds of GMT protein delivery significantly improved the efficiency of ESC differentiation into cardiomyocytes. Combination of T3SS-mediated GMT delivery and Activin A treatment showed an additive effect, resulting in on average 60% of the ESCs differentiated into cardiomyocytes. ESC derived cardiomyocytes displayed spontaneous rhythmic contractile movement as well as normal hormonal responses. This work serves as a foundation for the bacterial delivery of multiple transcription factors to direct cell fate without jeopardizing genomic integrity.

  12. Directed Differentiation of Embryonic Stem Cells Into Cardiomyocytes by Bacterial Injection of Defined Transcription Factors

    PubMed Central

    Bai, Fang; Ho Lim, Chae; Jia, Jingyue; Santostefano, Katherine; Simmons, Chelsey; Kasahara, Hideko; Wu, Weihui; Terada, Naohiro; Jin, Shouguang

    2015-01-01

    Forced expression of defined transcriptional factors has been well documented as an effective method for cellular reprogramming or directed differentiation. However, transgene expression is not amenable for therapeutic application due to potential insertional mutagenesis. Here, we have developed a bacterial type III secretion system (T3SS)-based protein delivery tool and shown its application in directing pluripotent stem cell differentiation by a controlled delivery of transcription factors relevant to early heart development. By fusing to an N-terminal secretion sequence for T3SS-dependent injection, three transcriptional factors, namely Gata4, Mef2c, and Tbx5 (abbreviated as GMT), were translocated into murine embryonic stem cells (ESCs), where the proteins are effectively targeted to the nucleus with an average intracellular half-life of 5.5 hours. Exogenous GMT protein injection activated the cardiac program, and multiple rounds of GMT protein delivery significantly improved the efficiency of ESC differentiation into cardiomyocytes. Combination of T3SS-mediated GMT delivery and Activin A treatment showed an additive effect, resulting in on average 60% of the ESCs differentiated into cardiomyocytes. ESC derived cardiomyocytes displayed spontaneous rhythmic contractile movement as well as normal hormonal responses. This work serves as a foundation for the bacterial delivery of multiple transcription factors to direct cell fate without jeopardizing genomic integrity. PMID:26449528

  13. Draft genome of the mountain pine beetle, Dendroctonus ponderosae Hopkins, a major forest pest

    PubMed Central

    2013-01-01

    Background The mountain pine beetle, Dendroctonus ponderosae Hopkins, is the most serious insect pest of western North American pine forests. A recent outbreak destroyed more than 15 million hectares of pine forests, with major environmental effects on forest health, and economic effects on the forest industry. The outbreak has in part been driven by climate change, and will contribute to increased carbon emissions through decaying forests. Results We developed a genome sequence resource for the mountain pine beetle to better understand the unique aspects of this insect's biology. A draft de novo genome sequence was assembled from paired-end, short-read sequences from an individual field-collected male pupa, and scaffolded using mate-paired, short-read genomic sequences from pooled field-collected pupae, paired-end short-insert whole-transcriptome shotgun sequencing reads of mRNA from adult beetle tissues, and paired-end Sanger EST sequences from various life stages. We describe the cytochrome P450, glutathione S-transferase, and plant cell wall-degrading enzyme gene families important to the survival of the mountain pine beetle in its harsh and nutrient-poor host environment, and examine genome-wide single-nucleotide polymorphism variation. A horizontally transferred bacterial sucrose-6-phosphate hydrolase was evident in the genome, and its tissue-specific transcription suggests a functional role for this beetle. Conclusions Despite Coleoptera being the largest insect order with over 400,000 described species, including many agricultural and forest pest species, this is only the second genome sequence reported in Coleoptera, and will provide an important resource for the Curculionoidea and other insects. PMID:23537049

  14. [Isolation and function of genes regulating aphB expression in Vibrio cholerae].

    PubMed

    Chen, Haili; Zhu, Zhaoqin; Zhong, Zengtao; Zhu, Jun; Kan, Biao

    2012-02-04

    We identified genes that regulate the expression of aphB, the gene encoding a key virulence regulator in Vibrio cholerae O1 E1 Tor C6706(-). We constructed a transposon library in V. cholerae C6706 strain containing a P(aphB)-luxCDABE and P(aphB)-lacZ transcriptional reporter plasmids. Using a chemiluminescence imager system, we rapidly detected aphB promoter expression level at a large scale. We then sequenced the transposon insertion sites by arbitrary PCR and sequencing analysis. We obtained two candidate mutants T1 and T2 which displayed reduced aphB expression from approximately 40,000 transposon insertion mutants. Sequencing analysis shows that Tn inserted in vc1585 reading frame in the T1 mutant and Tn inserted in the end of coding sequence of vc1602 in the T2 mutant. By using a genetic screen, we identified two potential genes that may involve in regulation of the expression of the key virulence regulator AphB. This study sheds light on our further investigation to fully understand V. cholerae virulence gene regulatory cascades.

  15. Familial retinoblastoma due to intronic LINE-1 insertion causes aberrant and noncanonical mRNA splicing of the RB1 gene.

    PubMed

    Rodríguez-Martín, Carlos; Cidre, Florencia; Fernández-Teijeiro, Ana; Gómez-Mariano, Gema; de la Vega, Leticia; Ramos, Patricia; Zaballos, Ángel; Monzón, Sara; Alonso, Javier

    2016-05-01

    Retinoblastoma (RB, MIM 180200) is the paradigm of hereditary cancer. Individuals harboring a constitutional mutation in one allele of the RB1 gene have a high predisposition to develop RB. Here, we present the first case of familial RB caused by a de novo insertion of a full-length long interspersed element-1 (LINE-1) into intron 14 of the RB1 gene that caused a highly heterogeneous splicing pattern of RB1 mRNA. LINE-1 insertion was inferred by mRNA studies and full-length sequenced by massive parallel sequencing. Some of the aberrant mRNAs were produced by noncanonical acceptor splice sites, a new finding that up to date has not been described to occur upon LINE-1 retrotransposition. Our results clearly show that RNA-based strategies have the potential to detect disease-causing transposon insertions. It also confirms that the incorporation of new genetic approaches, such as massive parallel sequencing, contributes to characterize at the sequence level these unique and exceptional genetic alterations.

  16. Spatial variations of bacterial community and its relationship with water chemistry in Sanya Bay, South China Sea as determined by DGGE fingerprinting and multivariate analysis.

    PubMed

    Ling, Juan; Zhang, Yan-Ying; Dong, Jun-De; Wang, You-Shao; Feng, Jing-Bing; Zhou, Wei-Hua

    2015-10-01

    Bacteria play important roles in the structure and function of marine food webs by utilizing nutrients and degrading the pollutants, and their distribution are determined by surrounding water chemistry to a certain extent. It is vital to investigate the bacterial community's structure and identifying the significant factors by controlling the bacterial distribution in the paper. Flow cytometry showed that the total bacterial abundance ranged from 5.27 × 10(5) to 3.77 × 10(6) cells/mL. Molecular fingerprinting technique, denaturing gradient gel electrophoresis (DGGE) followed by DNA sequencing has been employed to investigate the bacterial community composition. The results were then interpreted through multivariate statistical analysis and tended to explain its relationship to the environmental factors. A total of 270 bands at 83 different positions were detected in DGGE profiles and 29 distinct DGGE bands were sequenced. The predominant bacteria were related to Phyla Protebacteria species (31 %, nine sequences), Cyanobacteria (37.9 %, eleven sequences) and Actinobacteria (17.2 %, five sequences). Other phylogenetic groups identified including Firmicutes (6.9 %, two sequences), Bacteroidetes (3.5 %, one sequences) and Verrucomicrobia (3.5 %, one sequences). Conical correspondence analysis was used to elucidate the relationships between the bacterial community compositions and environmental factors. The results showed that the spatial variations in the bacterial community composition was significantly related to phosphate (P = 0.002, P < 0.01), dissolved organic carbon (P = 0.004, P < 0.01), chemical oxygen demand (P = 0.010, P < 0.05) and nitrite (P = 0.016, P < 0.05). This study revealed the spatial variations of bacterial community and significant environmental factors driving the bacterial composition shift. These results may be valuable for further investigation on the functional microbial structure and expression quantitatively under the polluted environments in the world.

  17. CRISPR/Cas9 cleavages in budding yeast reveal templated insertions and strand-specific insertion/deletion profiles.

    PubMed

    Lemos, Brenda R; Kaplan, Adam C; Bae, Ji Eun; Ferrazzoli, Alexander E; Kuo, James; Anand, Ranjith P; Waterman, David P; Haber, James E

    2018-02-27

    Harnessing CRISPR-Cas9 technology provides an unprecedented ability to modify genomic loci via DNA double-strand break (DSB) induction and repair. We analyzed nonhomologous end-joining (NHEJ) repair induced by Cas9 in budding yeast and found that the orientation of binding of Cas9 and its guide RNA (gRNA) profoundly influences the pattern of insertion/deletions (indels) at the site of cleavage. A common indel created by Cas9 is a 1-bp (+1) insertion that appears to result from Cas9 creating a 1-nt 5' overhang that is filled in by a DNA polymerase and ligated. The origin of +1 insertions was investigated by using two gRNAs with PAM sequences located on opposite DNA strands but designed to cleave the same sequence. These templated +1 insertions are dependent on the X-family DNA polymerase, Pol4. Deleting Pol4 also eliminated +2 and +3 insertions, which are biased toward homonucleotide insertions. Using inverted PAM sequences, we also found significant differences in overall NHEJ efficiency and repair profiles, suggesting that the binding of the Cas9:gRNA complex influences subsequent NHEJ processing. As with events induced by the site-specific HO endonuclease, CRISPR-Cas9-mediated NHEJ repair depends on the Ku heterodimer and DNA ligase 4. Cas9 events are highly dependent on the Mre11-Rad50-Xrs2 complex, independent of Mre11's nuclease activity. Inspection of the outcomes of a large number of Cas9 cleavage events in mammalian cells reveals a similar templated origin of +1 insertions in human cells, but also a significant frequency of similarly templated +2 insertions.

  18. Ebbie: automated analysis and storage of small RNA cloning data using a dynamic web server

    PubMed Central

    Ebhardt, H Alexander; Wiese, Kay C; Unrau, Peter J

    2006-01-01

    Background DNA sequencing is used ubiquitously: from deciphering genomes[1] to determining the primary sequence of small RNAs (smRNAs) [2-5]. The cloning of smRNAs is currently the most conventional method to determine the actual sequence of these important regulators of gene expression. Typical smRNA cloning projects involve the sequencing of hundreds to thousands of smRNA clones that are delimited at their 5' and 3' ends by fixed sequence regions. These primers result from the biochemical protocol used to isolate and convert the smRNA into clonable PCR products. Recently we completed a smRNA cloning project involving tobacco plants, where analysis was required for ~700 smRNA sequences[6]. Finding no easily accessible research tool to enter and analyze smRNA sequences we developed Ebbie to assist us with our study. Results Ebbie is a semi-automated smRNA cloning data processing algorithm, which initially searches for any substring within a DNA sequencing text file, which is flanked by two constant strings. The substring, also termed smRNA or insert, is stored in a MySQL and BlastN database. These inserts are then compared using BlastN to locally installed databases allowing the rapid comparison of the insert to both the growing smRNA database and to other static sequence databases. Our laboratory used Ebbie to analyze scores of DNA sequencing data originating from an smRNA cloning project[6]. Through its built-in instant analysis of all inserts using BlastN, we were able to quickly identify 33 groups of smRNAs from ~700 database entries. This clustering allowed the easy identification of novel and highly expressed clusters of smRNAs. Ebbie is available under GNU GPL and currently implemented on Conclusion Ebbie was designed for medium sized smRNA cloning projects with about 1,000 database entries [6-8].Ebbie can be used for any type of sequence analysis where two constant primer regions flank a sequence of interest. The reliable storage of inserts, and their annotation in a MySQL database, BlastN[9] comparison of new inserts to dynamic and static databases make it a powerful new tool in any laboratory using DNA sequencing. Ebbie also prevents manual mistakes during the excision process and speeds up annotation and data-entry. Once the server is installed locally, its access can be restricted to protect sensitive new DNA sequencing data. Ebbie was primarily designed for smRNA cloning projects, but can be applied to a variety of RNA and DNA cloning projects[2,3,10,11]. PMID:16584563

  19. Efforts to deregulate Rainbow papaya in Japan: Molecular Characterization of Transgene and Vector Inserts

    USDA-ARS?s Scientific Manuscript database

    Transformation plasmid-derived insert number and insert site sequence in 55-1 line papaya derivatives Rainbow and SunUp was determined as part of a larger petition to allow its import into Japan (Suzuki, et al., 2007, 2008). Three insertions were detected by Southern analysis and their correspondin...

  20. Identification of an opd (organophosphate degradation) gene in an Agrobacterium isolate.

    PubMed

    Horne, Irene; Sutherland, Tara D; Harcourt, Rebecca L; Russell, Robyn J; Oakeshott, John G

    2002-07-01

    We isolated a bacterial strain, Agrobacterium radiobacter P230, which can hydrolyze a wide range of organophosphate (OP) insecticides. A gene encoding a protein involved in OP hydrolysis was cloned from A. radiobacter P230 and sequenced. This gene (called opdA) had sequence similarity to opd, a gene previously shown to encode an OP-hydrolyzing enzyme in Flavobacterium sp. strain ATCC 27551 and Brevundimonas diminuta MG. Insertional mutation of the opdA gene produced a strain lacking the ability to hydrolyze OPs, suggesting that this is the only gene encoding an OP-hydrolyzing enzyme in A. radiobacter P230. The OPH and OpdA proteins, encoded by opd and opdA, respectively, were overexpressed and purified as maltose-binding proteins, and the maltose-binding protein moiety was cleaved and removed. Neither protein was able to hydrolyze the aliphatic OP malathion. The kinetics of the two proteins for diethyl OPs were comparable. For dimethyl OPs, OpdA had a higher k(cat) than OPH. It was also capable of hydrolyzing the dimethyl OPs phosmet and fenthion, which were not hydrolyzed at detectable levels by OPH.

  1. Chimeric TALE recombinases with programmable DNA sequence specificity.

    PubMed

    Mercer, Andrew C; Gaj, Thomas; Fuller, Roberta P; Barbas, Carlos F

    2012-11-01

    Site-specific recombinases are powerful tools for genome engineering. Hyperactivated variants of the resolvase/invertase family of serine recombinases function without accessory factors, and thus can be re-targeted to sequences of interest by replacing native DNA-binding domains (DBDs) with engineered zinc-finger proteins (ZFPs). However, imperfect modularity with particular domains, lack of high-affinity binding to all DNA triplets, and difficulty in construction has hindered the widespread adoption of ZFPs in unspecialized laboratories. The discovery of a novel type of DBD in transcription activator-like effector (TALE) proteins from Xanthomonas provides an alternative to ZFPs. Here we describe chimeric TALE recombinases (TALERs): engineered fusions between a hyperactivated catalytic domain from the DNA invertase Gin and an optimized TALE architecture. We use a library of incrementally truncated TALE variants to identify TALER fusions that modify DNA with efficiency and specificity comparable to zinc-finger recombinases in bacterial cells. We also show that TALERs recombine DNA in mammalian cells. The TALER architecture described herein provides a platform for insertion of customized TALE domains, thus significantly expanding the targeting capacity of engineered recombinases and their potential applications in biotechnology and medicine.

  2. Molecular cloning and physical mapping of the genome of fish lymphocystis disease virus.

    PubMed

    Darai, G; Delius, H; Clarke, J; Apfel, H; Schnitzler, P; Flügel, R M

    1985-10-30

    A defined and complete gene library of the fish lymphocystis disease virus (FLDV) genome was established. FLDV DNA was cleaved with EcoRI, BamHI, EcoRI/BamHI and EcoRI/HindIII and the resulting fragments were inserted into the corresponding sites of the pACYC184 or pAT153 plasmid vectors using T4 DNA ligase. Since FLDV DNA is highly methylated at CpG sequences (Darai et al., 1983; Wagner et al., 1985), an Escherichia coli GC-3 strain was required to amplify the recombinant plasmids harboring the FLDV DNA fragments. Bacterial colonies harboring recombinant plasmids were selected. All cloned fragments were individually identified by digestion of the recombinant plasmid DNA with different restriction enzymes and screened by hybridization of recombinant plasmid DNA to viral DNA. This analysis revealed that sequences representing 100% of the viral genome were cloned. Using these recombinant plasmids, the physical maps of the genome were constructed for BamHI, EcoRI, BestEII, and PstI restriction endonucleases. Although the FLDV genome is linear, due to circular permutation the restriction maps are circular.

  3. The Paramecium germline genome provides a niche for intragenic parasitic DNA: evolutionary dynamics of internal eliminated sequences.

    PubMed

    Arnaiz, Olivier; Mathy, Nathalie; Baudry, Céline; Malinsky, Sophie; Aury, Jean-Marc; Denby Wilkes, Cyril; Garnier, Olivier; Labadie, Karine; Lauderdale, Benjamin E; Le Mouël, Anne; Marmignon, Antoine; Nowacki, Mariusz; Poulain, Julie; Prajer, Malgorzata; Wincker, Patrick; Meyer, Eric; Duharcourt, Sandra; Duret, Laurent; Bétermier, Mireille; Sperling, Linda

    2012-01-01

    Insertions of parasitic DNA within coding sequences are usually deleterious and are generally counter-selected during evolution. Thanks to nuclear dimorphism, ciliates provide unique models to study the fate of such insertions. Their germline genome undergoes extensive rearrangements during development of a new somatic macronucleus from the germline micronucleus following sexual events. In Paramecium, these rearrangements include precise excision of unique-copy Internal Eliminated Sequences (IES) from the somatic DNA, requiring the activity of a domesticated piggyBac transposase, PiggyMac. We have sequenced Paramecium tetraurelia germline DNA, establishing a genome-wide catalogue of -45,000 IESs, in order to gain insight into their evolutionary origin and excision mechanism. We obtained direct evidence that PiggyMac is required for excision of all IESs. Homology with known P. tetraurelia Tc1/mariner transposons, described here, indicates that at least a fraction of IESs derive from these elements. Most IES insertions occurred before a recent whole-genome duplication that preceded diversification of the P. aurelia species complex, but IES invasion of the Paramecium genome appears to be an ongoing process. Once inserted, IESs decay rapidly by accumulation of deletions and point substitutions. Over 90% of the IESs are shorter than 150 bp and present a remarkable size distribution with a -10 bp periodicity, corresponding to the helical repeat of double-stranded DNA and suggesting DNA loop formation during assembly of a transpososome-like excision complex. IESs are equally frequent within and between coding sequences; however, excision is not 100% efficient and there is selective pressure against IES insertions, in particular within highly expressed genes. We discuss the possibility that ancient domestication of a piggyBac transposase favored subsequent propagation of transposons throughout the germline by allowing insertions in coding sequences, a fraction of the genome in which parasitic DNA is not usually tolerated.

  4. The Paramecium Germline Genome Provides a Niche for Intragenic Parasitic DNA: Evolutionary Dynamics of Internal Eliminated Sequences

    PubMed Central

    Arnaiz, Olivier; Mathy, Nathalie; Baudry, Céline; Malinsky, Sophie; Aury, Jean-Marc; Denby Wilkes, Cyril; Garnier, Olivier; Labadie, Karine; Lauderdale, Benjamin E.; Le Mouël, Anne; Marmignon, Antoine; Nowacki, Mariusz; Poulain, Julie; Prajer, Malgorzata; Wincker, Patrick; Meyer, Eric; Duharcourt, Sandra; Duret, Laurent; Bétermier, Mireille; Sperling, Linda

    2012-01-01

    Insertions of parasitic DNA within coding sequences are usually deleterious and are generally counter-selected during evolution. Thanks to nuclear dimorphism, ciliates provide unique models to study the fate of such insertions. Their germline genome undergoes extensive rearrangements during development of a new somatic macronucleus from the germline micronucleus following sexual events. In Paramecium, these rearrangements include precise excision of unique-copy Internal Eliminated Sequences (IES) from the somatic DNA, requiring the activity of a domesticated piggyBac transposase, PiggyMac. We have sequenced Paramecium tetraurelia germline DNA, establishing a genome-wide catalogue of ∼45,000 IESs, in order to gain insight into their evolutionary origin and excision mechanism. We obtained direct evidence that PiggyMac is required for excision of all IESs. Homology with known P. tetraurelia Tc1/mariner transposons, described here, indicates that at least a fraction of IESs derive from these elements. Most IES insertions occurred before a recent whole-genome duplication that preceded diversification of the P. aurelia species complex, but IES invasion of the Paramecium genome appears to be an ongoing process. Once inserted, IESs decay rapidly by accumulation of deletions and point substitutions. Over 90% of the IESs are shorter than 150 bp and present a remarkable size distribution with a ∼10 bp periodicity, corresponding to the helical repeat of double-stranded DNA and suggesting DNA loop formation during assembly of a transpososome-like excision complex. IESs are equally frequent within and between coding sequences; however, excision is not 100% efficient and there is selective pressure against IES insertions, in particular within highly expressed genes. We discuss the possibility that ancient domestication of a piggyBac transposase favored subsequent propagation of transposons throughout the germline by allowing insertions in coding sequences, a fraction of the genome in which parasitic DNA is not usually tolerated. PMID:23071448

  5. Indel PDB: a database of structural insertions and deletions derived from sequence alignments of closely related proteins.

    PubMed

    Hsing, Michael; Cherkasov, Artem

    2008-06-25

    Insertions and deletions (indels) represent a common type of sequence variations, which are less studied and pose many important biological questions. Recent research has shown that the presence of sizable indels in protein sequences may be indicative of protein essentiality and their role in protein interaction networks. Examples of utilization of indels for structure-based drug design have also been recently demonstrated. Nonetheless many structural and functional characteristics of indels remain less researched or unknown. We have created a web-based resource, Indel PDB, representing a structural database of insertions/deletions identified from the sequence alignments of highly similar proteins found in the Protein Data Bank (PDB). Indel PDB utilized large amounts of available structural information to characterize 1-, 2- and 3-dimensional features of indel sites. Indel PDB contains 117,266 non-redundant indel sites extracted from 11,294 indel-containing proteins. Unlike loop databases, Indel PDB features more indel sequences with secondary structures including alpha-helices and beta-sheets in addition to loops. The insertion fragments have been characterized by their sequences, lengths, locations, secondary structure composition, solvent accessibility, protein domain association and three dimensional structures. By utilizing the data available in Indel PDB, we have studied and presented here several sequence and structural features of indels. We anticipate that Indel PDB will not only enable future functional studies of indels, but will also assist protein modeling efforts and identification of indel-directed drug binding sites.

  6. Characterization of a chromosomally encoded 2,4-dichlorophenoxyacetic acid/alpha-ketoglutarate dioxygenase from Burkholderia sp. strain RASC.

    PubMed Central

    Suwa, Y; Wright, A D; Fukimori, F; Nummy, K A; Hausinger, R P; Holben, W E; Forney, L J

    1996-01-01

    The findings of previous studies indicate that the genes required for metabolism of the pesticide 2,4-dichlorophenoxyacetic acid (2,4-D) are typically encoded on broad-host-range plasmids. However, characterization of plasmid-cured strains of Burkholderia sp. strain RASC, as well as mutants obtained by transposon mutagenesis, suggested that the 2,4-D catabolic genes were located on the chromosome of this strain. Mutants of Burkholderia strain RASC unable to degrade 2,4-D (2,4-D- strains) were obtained by insertional inactivation with Tn5. One such mutant (d1) was shown to have Tn5 inserted in tfdARASC, which encodes 2,4-D/alpha-ketoglutarate dioxygenase. This is the first reported example of a chromosomally encoded tfdA. The tfdARASC gene was cloned from a library of wild-type Burkholderia strain RASC DNA and shown to express 2,4-D/alpha-ketoglutarate dioxygenase activity in Escherichia coli. The DNA sequence of the gene was determined and shown to be similar, although not identical, to those of isofunctional genes from other bacteria. Moreover, the gene product (TfdARASC) was purified and shown to be similar in molecular weight, amino-terminal sequence, and reaction mechanism to the canonical TfdA of Alcaligenes eutrophus JMP134. The data presented here indicate that tfdA genes can be found on the chromosome of some bacterial species and suggest that these catabolic genes are rather mobile and may be transferred by means other than conjugation. PMID:8779585

  7. Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA

    DTIC Science & Technology

    2005-09-01

    tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such

  8. Molecular cloning of MSSP-2, a c-myc gene single-strand binding protein: characterization of binding specificity and DNA replication activity.

    PubMed Central

    Takai, T; Nishita, Y; Iguchi-Ariga, S M; Ariga, H

    1994-01-01

    We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Acid Res., 22, 2687-2693]. We have cloned the cDNA for MSSP-2, another member of the MSSP family of proteins. The MSSP-2 cDNA shares highly homologous sequences with MSSP-1 cDNA, except for the insertion of 48 bp coding 16 amino acids near the C-terminus. Like MSSP-1, MSSP-2 has RNP-1 consensus sequences. The results of the experiments using bacterially expressed MSSP-2, and its deletion mutants, as histidine fusion proteins suggested that the binding specificity of MSSP-2 to double- and single-stranded DNA is the same as that of MSSP-1, and that the RNP consensus sequences are required for the DNA binding of the protein. MSSP-2 stimulated the DNA replication of an SV40-derived plasmid containing the binding sequence for MSSP-1 or -2. MSSP-2 is hence suggested to play an important role in regulation of DNA replication. Images PMID:7838710

  9. Insertion sequence 1515 in the ply gene of a type 1 clinical isolate of Streptococcus pneumoniae abolishes pneumolysin expression.

    PubMed

    Garnier, Fabien; Janapatla, Rajendra Prasad; Charpentier, Emmanuelle; Masson, Geoffrey; Grélaud, Carole; Stach, Jean François; Denis, François; Ploy, Marie-Cécile

    2007-07-01

    A serotype 1 Streptococcus pneumoniae strain isolated by blood culture from a woman with pneumonia was found to harbor insertion sequence (IS) 1515 in the pneumolysin gene, abolishing pneumolysin expression. To our knowledge, this is the first report of an IS in the pneumolysin gene of S. pneumoniae.

  10. Methods and compositions for controlling gene expression by RNA processing

    DOEpatents

    Doudna, Jennifer A.; Qi, Lei S.; Haurwitz, Rachel E.; Arkin, Adam P.

    2017-08-29

    The present disclosure provides nucleic acids encoding an RNA recognition sequence positioned proximal to an insertion site for the insertion of a sequence of interest; and host cells genetically modified with the nucleic acids. The present disclosure also provides methods of modifying the activity of a target RNA, and kits and compositions for carrying out the methods.

  11. Semen Bacterial Concentrations and HIV-1 RNA Shedding Among HIV-1-Seropositive Kenyan Men.

    PubMed

    Korhonen, Christine J; Srinivasan, Sujatha; Huang, Dandi; Ko, Daisy L; Sanders, Eduard J; Peshu, Norbert M; Krieger, John N; Muller, Charles H; Coombs, Robert W; Fredricks, David N; Graham, Susan M

    2017-03-01

    HIV-1 is transmitted through semen from men to their sexual partners. Genital infections can increase HIV-1 RNA shedding in semen, but shedding also occurs in the absence of typical pathogens. We hypothesized that higher bacterial concentrations in semen would be associated with higher HIV-1 RNA levels. We analyzed semen samples from 42 HIV-1-seropositive Kenyan men using quantitative polymerase chain reaction (PCR) to assess bacterial concentrations and real-time PCR to measure HIV-1 RNA levels. Generalized estimation equations were used to evaluate associations between these 2 measures. Broad-range 16S rRNA gene PCR with pyrosequencing was performed on a subset of 13 samples to assess bacterial community composition. Bacteria were detected in 96.6% of 88 samples by quantitative PCR. Semen bacterial concentration and HIV-1 RNA levels were correlated 0.30 (P = 0.01). The association between bacterial concentration and HIV-1 RNA detection was not significant after adjustment for antiretroviral therapy (ART) (adjusted odds ratio: 1.27, 95% CI: 0.84 to 1.91). Factors associated with semen bacterial concentration included insertive anal sex (adjusted beta 0.92, 95% CI: 0.12 to 1.73) and ART use (adjusted beta: -0.77, 95% CI: -1.50 to 0.04). Among 13 samples with pyrosequencing data, Corynebacterium spp., Staphylococcus spp., and Streptococcus spp. were most frequently detected. Most of these HIV-1-infected men had bacteria in their semen. ART use was associated with undetectable semen HIV-1 RNA and lower semen bacterial concentrations, whereas insertive anal sex was associated with higher bacterial concentrations. Additional studies evaluating the relationship between semen bacteria, inflammation, mucosal immunity, and HIV-1 shedding are needed to understand implications for HIV-1 transmission.

  12. Semen Bacterial Concentrations and HIV-1 RNA Shedding Among HIV-1–Seropositive Kenyan Men

    PubMed Central

    Srinivasan, Sujatha; Huang, Dandi; Ko, Daisy L.; Sanders, Eduard J.; Peshu, Norbert M.; Krieger, John N.; Muller, Charles H.; Coombs, Robert W.; Fredricks, David N.; Graham, Susan M.

    2017-01-01

    Introduction: HIV-1 is transmitted through semen from men to their sexual partners. Genital infections can increase HIV-1 RNA shedding in semen, but shedding also occurs in the absence of typical pathogens. We hypothesized that higher bacterial concentrations in semen would be associated with higher HIV-1 RNA levels. Methods: We analyzed semen samples from 42 HIV-1–seropositive Kenyan men using quantitative polymerase chain reaction (PCR) to assess bacterial concentrations and real-time PCR to measure HIV-1 RNA levels. Generalized estimation equations were used to evaluate associations between these 2 measures. Broad-range 16S rRNA gene PCR with pyrosequencing was performed on a subset of 13 samples to assess bacterial community composition. Results: Bacteria were detected in 96.6% of 88 samples by quantitative PCR. Semen bacterial concentration and HIV-1 RNA levels were correlated 0.30 (P = 0.01). The association between bacterial concentration and HIV-1 RNA detection was not significant after adjustment for antiretroviral therapy (ART) (adjusted odds ratio: 1.27, 95% CI: 0.84 to 1.91). Factors associated with semen bacterial concentration included insertive anal sex (adjusted beta 0.92, 95% CI: 0.12 to 1.73) and ART use (adjusted beta: −0.77, 95% CI: −1.50 to 0.04). Among 13 samples with pyrosequencing data, Corynebacterium spp., Staphylococcus spp., and Streptococcus spp. were most frequently detected. Conclusion: Most of these HIV-1–infected men had bacteria in their semen. ART use was associated with undetectable semen HIV-1 RNA and lower semen bacterial concentrations, whereas insertive anal sex was associated with higher bacterial concentrations. Additional studies evaluating the relationship between semen bacteria, inflammation, mucosal immunity, and HIV-1 shedding are needed to understand implications for HIV-1 transmission. PMID:27861240

  13. Linear and exponential TAIL-PCR: a method for efficient and quick amplification of flanking sequences adjacent to Tn5 transposon insertion sites.

    PubMed

    Jia, Xianbo; Lin, Xinjian; Chen, Jichen

    2017-11-02

    Current genome walking methods are very time consuming, and many produce non-specific amplification products. To amplify the flanking sequences that are adjacent to Tn5 transposon insertion sites in Serratia marcescens FZSF02, we developed a genome walking method based on TAIL-PCR. This PCR method added a 20-cycle linear amplification step before the exponential amplification step to increase the concentration of the target sequences. Products of the linear amplification and the exponential amplification were diluted 100-fold to decrease the concentration of the templates that cause non-specific amplification. Fast DNA polymerase with a high extension speed was used in this method, and an amplification program was used to rapidly amplify long specific sequences. With this linear and exponential TAIL-PCR (LETAIL-PCR), we successfully obtained products larger than 2 kb from Tn5 transposon insertion mutant strains within 3 h. This method can be widely used in genome walking studies to amplify unknown sequences that are adjacent to known sequences.

  14. The wheat cytochrome oxidase subunit II gene has an intron insert and three radical amino acid changes relative to maize

    PubMed Central

    Bonen, Linda; Boer, Poppo H.; Gray, Michael W.

    1984-01-01

    We have determined the sequence of the wheat mitochondrial gene for cytochrome oxidase subunit II (COII) and find that its derived protein sequence differs from that of maize at only three amino acid positions. Unexpectedly, all three replacements are non-conservative ones. The wheat COII gene has a highly-conserved intron at the same position as in maize, but the wheat intron is 1.5 times longer because of an insert relative to its maize counterpart. Hybridization analysis of mitochondrial DNA from rye, pea, broad bean and cucumber indicates strong sequence conservation of COII coding sequences among all these higher plants. However, only rye and maize mitochondrial DNA show homology with wheat COII intron sequences and rye alone with intron-insert sequences. We find that a sequence identical to the region of the 5' exon corresponding to the transmembrane domain of the COII protein is present at a second genomic location in wheat mitochondria. These variations in COII gene structure and size, as well as the presence of repeated COII sequences, illustrate at the DNA sequence level, factors which contribute to higher plant mitochondrial DNA diversity and complexity. ImagesFig. 3.Fig. 4.Fig. 5. PMID:16453565

  15. MR-compatibility assessment of MADPET4: a study of interferences between an SiPM-based PET insert and a 7 T MRI system.

    PubMed

    Omidvari, Negar; Topping, Geoffrey; Cabello, Jorge; Paul, Stephan; Schwaiger, Markus; Ziegler, Sibylle I

    2018-05-01

    Compromises in the design of a positron emission tomography (PET) insert for a magnetic resonance imaging (MRI) system should minimize the deterioration of image quality in both modalities, particularly when simultaneous demanding acquisitions are performed. In this work, the advantages of using individually read-out crystals with high-gain silicon photomultipliers (SiPMs) were studied with a small animal PET insert for a 7 T MRI system, in which the SiPM charge was transferred to outside the MRI scanner using coaxial cables. The interferences between the two systems were studied with three radio-frequency (RF) coil configurations. The effects of PET on the static magnetic field, flip angle distribution, RF noise, and image quality of various MRI sequences (gradient echo, spin echo, and echo planar imaging (EPI) at 1 H frequency, and chemical shift imaging at 13 C frequency) were investigated. The effects of fast-switching gradient fields and RF pulses on PET count rate were studied, while the PET insert and the readout electronics were not shielded. Operating the insert inside a 1 H volume coil, used for RF transmission and reception, limited the MRI to T1-weighted imaging, due to coil detuning and RF attenuation, and resulted in significant PET count loss. Using a surface receive coil allowed all tested MR sequences to be used with the insert, with 45-59% signal-to-noise ratio (SNR) degradation, compared to without PET. With a 1 H/ 13 C volume coil inside the insert and shielded by a copper tube, the SNR degradation was limited to 23-30% with all tested sequences. The insert did not introduce any discernible distortions into images of two tested EPI sequences. Use of truncated sinc shaped RF excitation pulses and gradient field switching had negligible effects on PET count rate. However, PET count rate was substantially affected by high-power RF block pulses and temperature variations due to high gradient duty cycles.

  16. Automated Identification of Medically Important Bacteria by 16S rRNA Gene Sequencing Using a Novel Comprehensive Database, 16SpathDB▿

    PubMed Central

    Woo, Patrick C. Y.; Teng, Jade L. L.; Yeung, Juilian M. Y.; Tse, Herman; Lau, Susanna K. P.; Yuen, Kwok-Yung

    2011-01-01

    Despite the increasing use of 16S rRNA gene sequencing, interpretation of 16S rRNA gene sequence results is one of the most difficult problems faced by clinical microbiologists and technicians. To overcome the problems we encountered in the existing databases during 16S rRNA gene sequence interpretation, we built a comprehensive database, 16SpathDB (http://147.8.74.24/16SpathDB) based on the 16S rRNA gene sequences of all medically important bacteria listed in the Manual of Clinical Microbiology and evaluated its use for automated identification of these bacteria. Among 91 nonduplicated bacterial isolates collected in our clinical microbiology laboratory, 71 (78%) were reported by 16SpathDB as a single bacterial species having >98.0% nucleotide identity with the query sequence, 19 (20.9%) were reported as more than one bacterial species having >98.0% nucleotide identity with the query sequence, and 1 (1.1%) was reported as no match. For the 71 bacterial isolates reported as a single bacterial species, all results were identical to their true identities as determined by a polyphasic approach. For the 19 bacterial isolates reported as more than one bacterial species, all results contained their true identities as determined by a polyphasic approach and all of them had their true identities as the “best match in 16SpathDB.” For the isolate (Gordonibacter pamelaeae) reported as no match, the bacterium has never been reported to be associated with human disease and was not included in the Manual of Clinical Microbiology. 16SpathDB is an automated, user-friendly, efficient, accurate, and regularly updated database for 16S rRNA gene sequence interpretation in clinical microbiology laboratories. PMID:21389154

  17. Evolution of aminoacyl-tRNA synthetases--analysis of unique domain architectures and phylogenetic trees reveals a complex history of horizontal gene transfer events.

    PubMed

    Wolf, Y I; Aravind, L; Grishin, N V; Koonin, E V

    1999-08-01

    Phylogenetic analysis of aminoacyl-tRNA synthetases (aaRSs) of all 20 specificities from completely sequenced bacterial, archaeal, and eukaryotic genomes reveals a complex evolutionary picture. Detailed examination of the domain architecture of aaRSs using sequence profile searches delineated a network of partially conserved domains that is even more elaborate than previously suspected. Several unexpected evolutionary connections were identified, including the apparent origin of the beta-subunit of bacterial GlyRS from the HD superfamily of hydrolases, a domain shared by bacterial AspRS and the B subunit of archaeal glutamyl-tRNA amidotransferases, and another previously undetected domain that is conserved in a subset of ThrRS, guanosine polyphosphate hydrolases and synthetases, and a family of GTPases. Comparison of domain architectures and multiple alignments resulted in the delineation of synapomorphies-shared derived characters, such as extra domains or inserts-for most of the aaRSs specificities. These synapomorphies partition sets of aaRSs with the same specificity into two or more distinct and apparently monophyletic groups. In conjunction with cluster analysis and a modification of the midpoint-rooting procedure, this partitioning was used to infer the likely root position in phylogenetic trees. The topologies of the resulting rooted trees for most of the aaRSs specificities are compatible with the evolutionary "standard model" whereby the earliest radiation event separated bacteria from the common ancestor of archaea and eukaryotes as opposed to the two other possible evolutionary scenarios for the three major divisions of life. For almost all aaRSs specificities, however, this simple scheme is confounded by displacement of some of the bacterial aaRSs by their eukaryotic or, less frequently, archaeal counterparts. Displacement of ancestral eukaryotic aaRS genes by bacterial ones, presumably of mitochondrial origin, was observed for three aaRSs. In contrast, there was no convincing evidence of displacement of archaeal aaRSs by bacterial ones. Displacement of aaRS genes by eukaryotic counterparts is most common among parasitic and symbiotic bacteria, particularly the spirochaetes, in which 10 of the 19 aaRSs seem to have been displaced by the respective eukaryotic genes and two by the archaeal counterpart. Unlike the primary radiation events between the three main divisions of life, that were readily traceable through the phylogenetic analysis of aaRSs, no consistent large-scale bacterial phylogeny could be established. In part, this may be due to additional gene displacement events among bacterial lineages. Argument is presented that, although lineage-specific gene loss might have contributed to the evolution of some of the aaRSs, this is not a viable alternative to horizontal gene transfer as the principal evolutionary phenomenon in this gene class.

  18. Low X/Y divergence in four pairs of papaya sex-linked genes.

    PubMed

    Yu, Qingyi; Hou, Shaobin; Feltus, F Alex; Jones, Meghan R; Murray, Jan E; Veatch, Olivia; Lemke, Cornelia; Saw, Jimmy H; Moore, Richard C; Thimmapuram, Jyothi; Liu, Lei; Moore, Paul H; Alam, Maqsudul; Jiang, Jiming; Paterson, Andrew H; Ming, Ray

    2008-01-01

    Sex chromosomes in flowering plants, in contrast to those in animals, evolved relatively recently and only a few are heteromorphic. The homomorphic sex chromosomes of papaya show features of incipient sex chromosome evolution. We investigated the features of paired X- and Y-specific bacterial artificial chromosomes (BACs), and estimated the time of divergence in four pairs of sex-linked genes. We report the results of a comparative analysis of long contiguous genomic DNA sequences between the X and hermaphrodite Y (Y(h)) chromosomes. Numerous chromosomal rearrangements were detected in the male-specific region of the Y chromosome (MSY), including inversions, deletions, insertions, duplications and translocations, showing the dynamic evolutionary process on the MSY after recombination ceased. DNA sequence expansion was documented in the two regions of the MSY, demonstrating that the cytologically homomorphic sex chromosomes are heteromorphic at the molecular level. Analysis of sequence divergence between four X and Y(h) gene pairs resulted in a estimated age of divergence of between 0.5 and 2.2 million years, supporting a recent origin of the papaya sex chromosomes. Our findings indicate that sex chromosomes did not evolve at the family level in Caricaceae, and reinforce the theory that sex chromosomes evolve at the species level in some lineages.

  19. Comparative Genomic Analyses of Clavibacter michiganensis subsp. insidiosus and Pathogenicity on Medicago truncatula.

    PubMed

    Lu, You; Ishimaru, Carol A; Glazebrook, Jane; Samac, Deborah A

    2018-02-01

    Clavibacter michiganensis is the most economically important gram-positive bacterial plant pathogen, with subspecies that cause serious diseases of maize, wheat, tomato, potato, and alfalfa. Much less is known about pathogenesis involving gram-positive plant pathogens than is known for gram-negative bacteria. Comparative genome analyses of C. michiganensis subspecies affecting tomato, potato, and maize have provided insights on pathogenicity. In this study, we identified strains of C. michiganensis subsp. insidiosus with contrasting pathogenicity on three accessions of the model legume Medicago truncatula. We generated complete genome sequences for two strains and compared these to a previously sequenced strain and genome sequences of four other subspecies. The three C. michiganensis subsp. insidiosus strains varied in gene content due to genome rearrangements, most likely facilitated by insertion elements, and plasmid number, which varied from one to three depending on strain. The core C. michiganensis genome consisted of 1,917 genes, with 379 genes unique to C. michiganensis subsp. insidiosus. An operon for synthesis of the extracellular blue pigment indigoidine, enzymes for pectin degradation, and an operon for inositol metabolism are among the unique features. Secreted serine proteases belonging to both the pat-1 and ppa families were present but highly diverged from those in other subspecies.

  20. Localization of Action of the Is50-Encoded Transposase Protein

    PubMed Central

    Phadnis, Suhas H.; Sasakawa, Chihiro; Berg, Douglas E.

    1986-01-01

    The movement of the bacterial insertion sequence IS50 and of composite elements containing direct terminal repeats of IS50 involves the two ends of IS50, designated O (outside) and I (inside), which are weakly matched in DNA sequence, and an IS50 encoded protein, transposase, which recognizes the O and I ends and acts preferentially in cis. Previous data had suggested that, initially, transposase interacts preferentially with the O end sequence and then, in a second step, with either an O or an I end. To better understand the cis action of transposase and how IS50 ends are selected, we generated a series of composite transposons which contain direct repeats of IS50 elements. In each transposon, one IS50 element encoded transposase (tnp +), and the other contained a null (tnp-) allele. In each of the five sets of composite transposons studied, the transposon for which the tnp+ IS50 element contained its O end was more active than a complementary transposon for which the tnp - IS50 element contained its O end. This pattern of O end use suggests models in which the cis action of transposase and its choice of ends is determined by protein tracking along DNA molecules. PMID:3007274

  1. Genetic Diversity among 3-Chloroaniline- and Aniline-Degrading Strains of the Comamonadaceae

    PubMed Central

    Boon, Nico; Goris, Johan; De Vos, Paul; Verstraete, Willy; Top, Eva M.

    2001-01-01

    We examined the diversity of the plasmids and of the gene tdnQ, involved in the oxidative deamination of aniline, in five bacterial strains that are able to metabolize both aniline and 3-chloroaniline (3-CA). Three strains have been described and identified previously, i.e., Comamonas testosteroni I2 and Delftia acidovorans CA28 and BN3.1. Strains LME1 and B8c were isolated in this study from linuron-treated soil and from a wastewater treatment plant, respectively, and were both identified as D. acidovorans. Both Delftia and Comamonas belong to the family Comamonadaceae. All five strains possess a large plasmid of ca. 100 kb, but the plasmids from only four strains could be transferred to a recipient strain by selection on aniline or 3-CA as a sole source of carbon and/or nitrogen. Plasmid transfer experiments and Southern hybridization revealed that the plasmid of strain I2 was responsible for total aniline but not 3-CA degradation, while the plasmids of strains LME1 and B8c were responsible only for the oxidative deamination of aniline. Several transconjugant clones that had received the plasmid from strain CA28 showed different degradative capacities: all transconjugants could use aniline as a nitrogen source, while only some of the transconjugants could deaminate 3-CA. For all four plasmids, the IS1071 insertion sequence of Tn5271 was found to be located on a 1.4-kb restriction fragment, which also hybridized with the tdnQ probe. This result suggests the involvement of this insertion sequence element in the dissemination of aniline degradation genes in the environment. By use of specific primers for the tdnQ gene from Pseudomonas putida UCC22, the diversity of the PCR-amplified fragments in the five strains was examined by denaturing gradient gel electrophoresis (DGGE). With DGGE, three different clusters of the tdnQ fragment could be distinguished. Sequencing data showed that the tdnQ sequences of I2, LME1, B8c, and CA28 were very closely related, while the tdnQ sequences of BN3.1 and P. putida UCC22 were only about 83% identical to the other sequences. Northern hybridization revealed that the tdnQ gene is transcribed only in the presence of aniline and not when only 3-CA is present. PMID:11229899

  2. Endophytic bacterial diversity in grapevine (Vitis vinifera L.) leaves described by 16S rRNA gene sequence analysis and length heterogeneity-PCR.

    PubMed

    Bulgari, Daniela; Casati, Paola; Brusetti, Lorenzo; Quaglino, Fabio; Brasca, Milena; Daffonchio, Daniele; Bianco, Piero Attilio

    2009-08-01

    Diversity of bacterial endophytes associated with grapevine leaf tissues was analyzed by cultivation and cultivation-independent methods. In order to identify bacterial endophytes directly from metagenome, a protocol for bacteria enrichment and DNA extraction was optimized. Sequence analysis of 16S rRNA gene libraries underscored five diverse Operational Taxonomic Units (OTUs), showing best sequence matches with gamma-Proteobacteria, family Enterobacteriaceae, with a dominance of the genus Pantoea. Bacteria isolation through cultivation revealed the presence of six OTUs, showing best sequence matches with Actinobacteria, genus Curtobacterium, and with Firmicutes genera Bacillus and Enterococcus. Length Heterogeneity-PCR (LH-PCR) electrophoretic peaks from single bacterial clones were used to setup a database representing the bacterial endophytes identified in association with grapevine tissues. Analysis of healthy and phytoplasma-infected grapevine plants showed that LH-PCR could be a useful complementary tool for examining the diversity of bacterial endophytes especially for diversity survey on a large number of samples.

  3. Compositions and methods for the expression of selenoproteins in eukaryotic cells

    DOEpatents

    Gladyshev, Vadim [Lincoln, NE; Novoselov, Sergey [Puschino, RU

    2012-09-25

    Recombinant nucleic acid constructs for the efficient expression of eukaryotic selenoproteins and related methods for production of recombinant selenoproteins are provided. The nucleic acid constructs comprise novel selenocysteine insertion sequence (SECIS) elements. Certain novel SECIS elements of the invention contain non-canonical quartet sequences. Other novel SECIS elements provided by the invention are chimeric SECIS elements comprising a canonical SECIS element that contains a non-canonical quartet sequence and chimeric SECIS elements comprising a non-canonical SECIS element that contains a canonical quartet sequence. The novel SECIS elements of the invention facilitate the insertion of selenocysteine residues into recombinant polypeptides.

  4. Targeted Mutagenesis of Guinea Pig Cytomegalovirus Using CRISPR/Cas9-Mediated Gene Editing.

    PubMed

    Bierle, Craig J; Anderholm, Kaitlyn M; Wang, Jian Ben; McVoy, Michael A; Schleiss, Mark R

    2016-08-01

    The cytomegaloviruses (CMVs) are among the most genetically complex mammalian viruses, with viral genomes that often exceed 230 kbp. Manipulation of cytomegalovirus genomes is largely performed using infectious bacterial artificial chromosomes (BACs), which necessitates the maintenance of the viral genome in Escherichia coli and successful reconstitution of virus from permissive cells after transfection of the BAC. Here we describe an alternative strategy for the mutagenesis of guinea pig cytomegalovirus that utilizes clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9)-mediated genome editing to introduce targeted mutations to the viral genome. Transient transfection and drug selection were used to restrict lytic replication of guinea pig cytomegalovirus to cells that express Cas9 and virus-specific guide RNA. The result was highly efficient editing of the viral genome that introduced targeted insertion or deletion mutations to nonessential viral genes. Cotransfection of multiple virus-specific guide RNAs or a homology repair template was used for targeted, markerless deletions of viral sequence or to introduce exogenous sequence by homology-driven repair. As CRISPR/Cas9 mutagenesis occurs directly in infected cells, this methodology avoids selective pressures that may occur during propagation of the viral genome in bacteria and may facilitate genetic manipulation of low-passage or clinical CMV isolates. The cytomegalovirus genome is complex, and viral adaptations to cell culture have complicated the study of infection in vivo Recombineering of viral bacterial artificial chromosomes enabled the study of recombinant cytomegaloviruses. Here we report the development of an alternative approach using CRISPR/Cas9-based mutagenesis in guinea pig cytomegalovirus, a small-animal model of congenital cytomegalovirus disease. CRISPR/Cas9 mutagenesis can introduce the same types of mutations to the viral genome as bacterial artificial chromosome recombineering but does so directly in virus-infected cells. CRISPR/Cas9 mutagenesis is not dependent on a bacterial intermediate, and defined viral mutants can be recovered after a limited number of viral genome replications, minimizing the risk of spontaneous mutation. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  5. Lesion bypass activity of DNA polymerase θ (POLQ) is an intrinsic property of the pol domain and depends on unique sequence inserts.

    PubMed

    Hogg, Matthew; Seki, Mineaki; Wood, Richard D; Doublié, Sylvie; Wallace, Susan S

    2011-01-21

    DNA polymerase θ (POLQ, polθ) is a large, multidomain DNA polymerase encoded in higher eukaryotic genomes. It is important for maintaining genetic stability in cells and helping protect cells from DNA damage caused by ionizing radiation. POLQ contains an N-terminal helicase-like domain, a large central domain of indeterminate function, and a C-terminal polymerase domain with sequence similarity to the A-family of DNA polymerases. The enzyme has several unique properties, including low fidelity and the ability to insert and extend past abasic sites and thymine glycol lesions. It is not known whether the abasic site bypass activity is an intrinsic property of the polymerase domain or whether helicase activity is also required. Three "insertion" sequence elements present in POLQ are not found in any other A-family DNA polymerase, and it has been proposed that they may lend some unique properties to POLQ. Here, we analyzed the activity of the DNA polymerase in the absence of each sequence insertion. We found that the pol domain is capable of highly efficient bypass of abasic sites in the absence of the helicase-like or central domains. Insertion 1 increases the processivity of the polymerase but has little, if any, bearing on the translesion synthesis properties of the enzyme. However, removal of insertions 2 and 3 reduces activity on undamaged DNA and completely abrogates the ability of the enzyme to bypass abasic sites or thymine glycol lesions. Copyright © 2010 Elsevier Ltd. All rights reserved.

  6. Novel division level bacterial diversity in a Yellowstone hot spring.

    PubMed

    Hugenholtz, P; Pitulle, C; Hershberger, K L; Pace, N R

    1998-01-01

    A culture-independent molecular phylogenetic survey was carried out for the bacterial community in Obsidian Pool (OP), a Yellowstone National Park hot spring previously shown to contain remarkable archaeal diversity (S. M. Barns, R. E. Fundyga, M. W. Jeffries, and N. R. Page, Proc. Natl. Acad. Sci. USA 91:1609-1613, 1994). Small-subunit rRNA genes (rDNA) were amplified directly from OP sediment DNA by PCR with universally conserved or Bacteria-specific rDNA primers and cloned. Unique rDNA types among > 300 clones were identified by restriction fragment length polymorphism, and 122 representative rDNA sequences were determined. These were found to represent 54 distinct bacterial sequence types or clusters (> or = 98% identity) of sequences. A majority (70%) of the sequence types were affiliated with 14 previously recognized bacterial divisions (main phyla; kingdoms); 30% were unaffiliated with recognized bacterial divisions. The unaffiliated sequence types (represented by 38 sequences) nominally comprise 12 novel, division level lineages termed candidate divisions. Several OP sequences were nearly identical to those of cultivated chemolithotrophic thermophiles, including the hydrogen-oxidizing Calderobacterium and the sulfate reducers Thermodesulfovibrio and Thermodesulfobacterium, or belonged to monophyletic assemblages recognized for a particular type of metabolism, such as the hydrogen-oxidizing Aquificales and the sulfate-reducing delta-Proteobacteria. The occurrence of such organisms is consistent with the chemical composition of OP (high in reduced iron and sulfur) and suggests a lithotrophic base for primary productivity in this hot spring, through hydrogen oxidation and sulfate reduction. Unexpectedly, no archaeal sequences were encountered in OP clone libraries made with universal primers. Hybridization analysis of amplified OP DNA with domain-specific probes confirmed that the analyzed community rDNA from OP sediment was predominantly bacterial. These results expand substantially our knowledge of the extent of bacterial diversity and call into question the commonly held notion that Archaea dominate hydrothermal environments. Finally, the currently known extent of division level bacterial phylogenetic diversity is collated and summarized.

  7. A High-Throughput Arabidopsis Reverse Genetics System

    PubMed Central

    Sessions, Allen; Burke, Ellen; Presting, Gernot; Aux, George; McElver, John; Patton, David; Dietrich, Bob; Ho, Patrick; Bacwaden, Johana; Ko, Cynthia; Clarke, Joseph D.; Cotton, David; Bullis, David; Snell, Jennifer; Miguel, Trini; Hutchison, Don; Kimmerly, Bill; Mitzel, Theresa; Katagiri, Fumiaki; Glazebrook, Jane; Law, Marc; Goff, Stephen A.

    2002-01-01

    A collection of Arabidopsis lines with T-DNA insertions in known sites was generated to increase the efficiency of functional genomics. A high-throughput modified thermal asymetric interlaced (TAIL)-PCR protocol was developed and used to amplify DNA fragments flanking the T-DNA left borders from ∼100,000 transformed lines. A total of 85,108 TAIL-PCR products from 52,964 T-DNA lines were sequenced and compared with the Arabidopsis genome to determine the positions of T-DNAs in each line. Predicted T-DNA insertion sites, when mapped, showed a bias against predicted coding sequences. Predicted insertion mutations in genes of interest can be identified using Arabidopsis Gene Index name searches or by BLAST (Basic Local Alignment Search Tool) search. Insertions can be confirmed by simple PCR assays on individual lines. Predicted insertions were confirmed in 257 of 340 lines tested (76%). This resource has been named SAIL (Syngenta Arabidopsis Insertion Library) and is available to the scientific community at www.tmri.org. PMID:12468722

  8. Transposon Insertion Finder (TIF): a novel program for detection of de novo transpositions of transposable elements.

    PubMed

    Nakagome, Mariko; Solovieva, Elena; Takahashi, Akira; Yasue, Hiroshi; Hirochika, Hirohiko; Miyao, Akio

    2014-03-14

    Transposition event detection of transposable element (TE) in the genome using short reads from the next-generation sequence (NGS) was difficult, because the nucleotide sequence of TE itself is repetitive, making it difficult to identify locations of its insertions by alignment programs for NGS. We have developed a program with a new algorithm to detect the transpositions from NGS data. In the process of tool development, we used next-generation sequence (NGS) data of derivative lines (ttm2 and ttm5) of japonica rice cv. Nipponbare, regenerated through cell culture. The new program, called a transposon insertion finder (TIF), was applied to detect the de novo transpositions of Tos17 in the regenerated lines. TIF searched 300 million reads of a line within 20 min, identifying 4 and 12 de novo transposition in ttm2 and ttm5 lines, respectively. All of the transpositions were confirmed by PCR/electrophoresis and sequencing. Using the program, we also detected new transposon insertions of P-element from NGS data of Drosophila melanogaster. TIF operates to find the transposition of any elements provided that target site duplications (TSDs) are generated by their transpositions.

  9. Mutational scanning reveals the determinants of protein insertion and association energetics in the plasma membrane.

    PubMed

    Elazar, Assaf; Weinstein, Jonathan; Biran, Ido; Fridman, Yearit; Bibi, Eitan; Fleishman, Sarel Jacob

    2016-01-29

    Insertion of helix-forming segments into the membrane and their association determines the structure, function, and expression levels of all plasma membrane proteins. However, systematic and reliable quantification of membrane-protein energetics has been challenging. We developed a deep mutational scanning method to monitor the effects of hundreds of point mutations on helix insertion and self-association within the bacterial inner membrane. The assay quantifies insertion energetics for all natural amino acids at 27 positions across the membrane, revealing that the hydrophobicity of biological membranes is significantly higher than appreciated. We further quantitate the contributions to membrane-protein insertion from positively charged residues at the cytoplasm-membrane interface and reveal large and unanticipated differences among these residues. Finally, we derive comprehensive mutational landscapes in the membrane domains of Glycophorin A and the ErbB2 oncogene, and find that insertion and self-association are strongly coupled in receptor homodimers.

  10. Time-Resolved Transposon Insertion Sequencing Reveals Genome-Wide Fitness Dynamics during Infection.

    PubMed

    Yang, Guanhua; Billings, Gabriel; Hubbard, Troy P; Park, Joseph S; Yin Leung, Ka; Liu, Qin; Davis, Brigid M; Zhang, Yuanxing; Wang, Qiyao; Waldor, Matthew K

    2017-10-03

    Transposon insertion sequencing (TIS) is a powerful high-throughput genetic technique that is transforming functional genomics in prokaryotes, because it enables genome-wide mapping of the determinants of fitness. However, current approaches for analyzing TIS data assume that selective pressures are constant over time and thus do not yield information regarding changes in the genetic requirements for growth in dynamic environments (e.g., during infection). Here, we describe structured analysis of TIS data collected as a time series, termed pattern analysis of conditional essentiality (PACE). From a temporal series of TIS data, PACE derives a quantitative assessment of each mutant's fitness over the course of an experiment and identifies mutants with related fitness profiles. In so doing, PACE circumvents major limitations of existing methodologies, specifically the need for artificial effect size thresholds and enumeration of bacterial population expansion. We used PACE to analyze TIS samples of Edwardsiella piscicida (a fish pathogen) collected over a 2-week infection period from a natural host (the flatfish turbot). PACE uncovered more genes that affect E. piscicida 's fitness in vivo than were detected using a cutoff at a terminal sampling point, and it identified subpopulations of mutants with distinct fitness profiles, one of which informed the design of new live vaccine candidates. Overall, PACE enables efficient mining of time series TIS data and enhances the power and sensitivity of TIS-based analyses. IMPORTANCE Transposon insertion sequencing (TIS) enables genome-wide mapping of the genetic determinants of fitness, typically based on observations at a single sampling point. Here, we move beyond analysis of endpoint TIS data to create a framework for analysis of time series TIS data, termed pattern analysis of conditional essentiality (PACE). We applied PACE to identify genes that contribute to colonization of a natural host by the fish pathogen Edwardsiella piscicida. PACE uncovered more genes that affect E. piscicida 's fitness in vivo than were detected using a terminal sampling point, and its clustering of mutants with related fitness profiles informed design of new live vaccine candidates. PACE yields insights into patterns of fitness dynamics and circumvents major limitations of existing methodologies. Finally, the PACE method should be applicable to additional "omic" time series data, including screens based on clustered regularly interspaced short palindromic repeats with Cas9 (CRISPR/Cas9). Copyright © 2017 Yang et al.

  11. Insertion sequence typing of Mycobacterium tuberculosis: characterization of a widespread subtype with a single copy of IS6110.

    PubMed

    Fomukong, N G; Tang, T H; al-Maamary, S; Ibrahim, W A; Ramayah, S; Yates, M; Zainuddin, Z F; Dale, J W

    1994-12-01

    DNA fingerprinting with the insertion sequence IS6110 (also known as IS986) has become established as a major tool for investigating the spread of tuberculosis. Most strains of Mycobacterium tuberculosis have multiple copies of IS6110, but a small minority carry a single copy only. We have examined selected strains from Malaysia, Tanzania and Oman, in comparison with M. bovis isolates and BCG strains carrying one or two copies of IS6110. The insertion sequence appears to be present in the same position in all these strains, which suggests that in these organisms the element is defective in transposition and that the loss of transposability may have occurred at an early stage in the evolution of the M. tuberculosis complex.

  12. Phylogenetic and Protein Sequence Analysis of Bacterial Chemoreceptors.

    PubMed

    Ortega, Davi R; Zhulin, Igor B

    2018-01-01

    Identifying chemoreceptors in sequenced bacterial genomes, revealing their domain architecture, inferring their evolutionary relationships, and comparing them to chemoreceptors of known function become important steps in genome annotation and chemotaxis research. Here, we describe bioinformatics procedures that enable such analyses, using two closely related bacterial genomes as examples.

  13. Bacterial and archaeal phylogenetic diversity of a cold sulfur-rich spring on the shoreline of Lake Erie, Michigan

    USGS Publications Warehouse

    Chaudhary, A.; Haack, S.K.; Duris, J.W.; Marsh, T.L.

    2009-01-01

    Studies of sulfidic springs have provided new insights into microbial metabolism, groundwater biogeochemistry, and geologic processes. We investigated Great Sulphur Spring on the western shore of Lake Erie and evaluated the phylogenetic affiliations of 189 bacterial and 77 archaeal 16S rRNA gene sequences from three habitats: the spring origin (11-m depth), bacterial-algal mats on the spring pond surface, and whitish filamentous materials from the spring drain. Water from the spring origin water was cold, pH 6.3, and anoxic (H2, 5.4 nM; CH4, 2.70 ??M) with concentrations of S2- (0.03 mM), SO42- (14.8 mM), Ca2+ (15.7 mM), and HCO3- (4.1 mM) similar to those in groundwater from the local aquifer. No archaeal and few bacterial sequences were >95% similar to sequences of cultivated organisms. Bacterial sequences were largely affiliated with sulfur-metabolizing or chemolithotrophic taxa in Beta-, Gamma-, Delta-, and Epsilonproteobacteria. Epsilonproteobacteria sequences similar to those obtained from other sulfidic environments and a new clade of Cyanobacteria sequences were particularly abundant (16% and 40%, respectively) in the spring origin clone library. Crenarchaeota sequences associated with archaeal-bacterial consortia in whitish filaments at a German sulfidic spring were detected only in a similar habitat at Great Sulphur Spring. This study expands the geographic distribution of many uncultured Archaea and Bacteria sequences to the Laurentian Great Lakes, indicates possible roles for epsilonproteobacteria in local aquifer chemistry and karst formation, documents new oscillatorioid Cyanobacteria lineages, and shows that uncultured, cold-adapted Crenarchaeota sequences may comprise a significant part of the microbial community of some sulfidic environments. Copyright ?? 2009, American Society for Microbiology. All Rights Reserved.

  14. Comparative mode of action of novel hybrid peptide CS-1a and its rearranged amphipathic analogue CS-2a.

    PubMed

    Joshi, Seema; Bisht, Gopal S; Rawat, Diwan S; Maiti, Souvik; Pasha, Santosh

    2012-10-01

    Cell selective, naturally occurring, host defence cationic peptides present a good template for the design of novel peptides with the aim of achieving a short length with improved antimicrobial potency and selectivity. A novel, short peptide CS-1a (14 residues) was derived using a sequence hybridization approach on sarcotoxin I (39 residues) and cecropin B (35 residues). The sequence of CS-1a was rearranged to enhance amphipathicity with the help of a Schiffer-Edmundson diagram to obtain CS-2a. Both peptides showed good antibacterial activity in the concentration range 4-16 μg·mL(-1) against susceptible as well as drug-resistant bacterial strains, including the clinically relevant pathogens Acenatobacter sp. and methicillin-resistant Staphylococcus aureus. The major thrust of these peptides is their nonhaemolytic activity against human red blood cells up to a high concentration of 512 μg·mL(-1). Compared to CS-1a, amphipathic peptide CS-2a showed a more pronounced α-helical conformation, along with a better membrane insertion depth in bacterial mimic 1,2-dipalmitoyl-sn-glycero-3-phosphocholine/1,2-dipalmitoyl-sn-glycero-3-phospho-(1'-rac-glycerol) small unilamellar vesicles. With equivalent lipid-binding affinity, the two peptides assumed different pathways of membrane disruption, as demonstrated by calcein leakage and the results of transmission electron microscopy on model bacterial mimic large unilamellar vesicles. Extending the work from model membranes to intact Escherichia coli cells, differences in membrane perturbation were visible in microscopic images of peptide-treated E. coli. The present study describes two novel short peptides with potent activity, cell selectivity and divergent modes of action that will aid in the future design of peptides with better therapeutic potential. © 2012 The Authors Journal compilation © 2012 FEBS.

  15. Toward a Molecular Cytogenetic Map for Cultivated Sunflower (Helianthus annuus L.) by Landed BAC/BIBAC Clones

    PubMed Central

    Feng, Jiuhuan; Liu, Zhao; Cai, Xiwen; Jan, Chao-Chien

    2013-01-01

    Conventional karyotypes and various genetic linkage maps have been established in sunflower (Helianthus annuus L., 2n = 34). However, the relationship between linkage groups and individual chromosomes of sunflower remains unknown and has considerable relevance for the sunflower research community. Recently, a set of linkage group-specific bacterial /binary bacterial artificial chromosome (BAC/BIBAC) clones was identified from two complementary BAC and BIBAC libraries constructed for cultivated sunflower cv. HA89. In the present study, we used these linkage group-specific clones (∼100 kb in size) as probes to in situ hybridize to HA89 mitotic chromosomes at metaphase using the BAC- fluorescence in situ hybridization (FISH) technique. Because a characteristic of the sunflower genome is the abundance of repetitive DNA sequences, a high ratio of blocking DNA to probe DNA was applied to hybridization reactions to minimize the background noise. As a result, all sunflower chromosomes were anchored by one or two BAC/BIBAC clones with specific FISH signals. FISH analysis based on tandem repetitive sequences, such as rRNA genes, has been previously reported; however, the BAC-FISH technique developed here using restriction fragment length polymorphism (RFLP)−derived BAC/BIBAC clones as probes to apply genome-wide analysis is new for sunflower. As chromosome-specific cytogenetic markers, the selected BAC/BIBAC clones that encompass the 17 linkage groups provide a valuable tool for identifying sunflower cytogenetic stocks (such as trisomics) and tracking alien chromosomes in interspecific crosses. This work also demonstrates the potential of using a large-insert DNA library for the development of molecular cytogenetic resources. PMID:23316437

  16. AFEAP cloning: a precise and efficient method for large DNA sequence assembly.

    PubMed

    Zeng, Fanli; Zang, Jinping; Zhang, Suhua; Hao, Zhimin; Dong, Jingao; Lin, Yibin

    2017-11-14

    Recent development of DNA assembly technologies has spurred myriad advances in synthetic biology, but new tools are always required for complicated scenarios. Here, we have developed an alternative DNA assembly method named AFEAP cloning (Assembly of Fragment Ends After PCR), which allows scarless, modular, and reliable construction of biological pathways and circuits from basic genetic parts. The AFEAP method requires two-round of PCRs followed by ligation of the sticky ends of DNA fragments. The first PCR yields linear DNA fragments and is followed by a second asymmetric (one primer) PCR and subsequent annealing that inserts overlapping overhangs at both sides of each DNA fragment. The overlapping overhangs of the neighboring DNA fragments annealed and the nick was sealed by T4 DNA ligase, followed by bacterial transformation to yield the desired plasmids. We characterized the capability and limitations of new developed AFEAP cloning and demonstrated its application to assemble DNA with varying scenarios. Under the optimized conditions, AFEAP cloning allows assembly of an 8 kb plasmid from 1-13 fragments with high accuracy (between 80 and 100%), and 8.0, 11.6, 19.6, 28, and 35.6 kb plasmids from five fragments at 91.67, 91.67, 88.33, 86.33, and 81.67% fidelity, respectively. AFEAP cloning also is capable to construct bacterial artificial chromosome (BAC, 200 kb) with a fidelity of 46.7%. AFEAP cloning provides a powerful, efficient, seamless, and sequence-independent DNA assembly tool for multiple fragments up to 13 and large DNA up to 200 kb that expands synthetic biologist's toolbox.

  17. MIPS bacterial genomes functional annotation benchmark dataset.

    PubMed

    Tetko, Igor V; Brauner, Barbara; Dunger-Kaltenbach, Irmtraud; Frishman, Goar; Montrone, Corinna; Fobo, Gisela; Ruepp, Andreas; Antonov, Alexey V; Surmeli, Dimitrij; Mewes, Hans-Wernen

    2005-05-15

    Any development of new methods for automatic functional annotation of proteins according to their sequences requires high-quality data (as benchmark) as well as tedious preparatory work to generate sequence parameters required as input data for the machine learning methods. Different program settings and incompatible protocols make a comparison of the analyzed methods difficult. The MIPS Bacterial Functional Annotation Benchmark dataset (MIPS-BFAB) is a new, high-quality resource comprising four bacterial genomes manually annotated according to the MIPS functional catalogue (FunCat). These resources include precalculated sequence parameters, such as sequence similarity scores, InterPro domain composition and other parameters that could be used to develop and benchmark methods for functional annotation of bacterial protein sequences. These data are provided in XML format and can be used by scientists who are not necessarily experts in genome annotation. BFAB is available at http://mips.gsf.de/proj/bfab

  18. Restructuring of the Aquatic Bacterial Community by Hydric Dynamics Associated with Superstorm Sandy

    PubMed Central

    Ulrich, Nikea; Rosenberger, Abigail; Brislawn, Colin; Wright, Justin; Kessler, Collin; Toole, David; Solomon, Caroline; Strutt, Steven; McClure, Erin

    2016-01-01

    ABSTRACT Bacterial community composition and longitudinal fluctuations were monitored in a riverine system during and after Superstorm Sandy to better characterize inter- and intracommunity responses associated with the disturbance associated with a 100-year storm event. High-throughput sequencing of the 16S rRNA gene was used to assess microbial community structure within water samples from Muddy Creek Run, a second-order stream in Huntingdon, PA, at 12 different time points during the storm event (29 October to 3 November 2012) and under seasonally matched baseline conditions. High-throughput sequencing of the 16S rRNA gene was used to track changes in bacterial community structure and divergence during and after Superstorm Sandy. Bacterial community dynamics were correlated to measured physicochemical parameters and fecal indicator bacteria (FIB) concentrations. Bioinformatics analyses of 2.1 million 16S rRNA gene sequences revealed a significant increase in bacterial diversity in samples taken during peak discharge of the storm. Beta-diversity analyses revealed longitudinal shifts in the bacterial community structure. Successional changes were observed, in which Betaproteobacteria and Gammaproteobacteria decreased in 16S rRNA gene relative abundance, while the relative abundance of members of the Firmicutes increased. Furthermore, 16S rRNA gene sequences matching pathogenic bacteria, including strains of Legionella, Campylobacter, Arcobacter, and Helicobacter, as well as bacteria of fecal origin (e.g., Bacteroides), exhibited an increase in abundance after peak discharge of the storm. This study revealed a significant restructuring of in-stream bacterial community structure associated with hydric dynamics of a storm event. IMPORTANCE In order to better understand the microbial risks associated with freshwater environments during a storm event, a more comprehensive understanding of the variations in aquatic bacterial diversity is warranted. This study investigated the bacterial communities during and after Superstorm Sandy to provide fine time point resolution of dynamic changes in bacterial composition. This study adds to the current literature by revealing the variation in bacterial community structure during the course of a storm. This study employed high-throughput DNA sequencing, which generated a deep analysis of inter- and intracommunity responses during a significant storm event. This study has highlighted the utility of applying high-throughput sequencing for water quality monitoring purposes, as this approach enabled a more comprehensive investigation of the bacterial community structure. Altogether, these data suggest a drastic restructuring of the stream bacterial community during a storm event and highlight the potential of high-throughput sequencing approaches for assessing the microbiological quality of our environment. PMID:27060115

  19. The impact of sampling, PCR, and sequencing replication on discerning changes in drinking water bacterial community over diurnal time-scales.

    PubMed

    Bautista-de Los Santos, Quyen Melina; Schroeder, Joanna L; Blakemore, Oliver; Moses, Jonathan; Haffey, Mark; Sloan, William; Pinto, Ameet J

    2016-03-01

    High-throughput and deep DNA sequencing, particularly amplicon sequencing, is being increasingly utilized to reveal spatial and temporal dynamics of bacterial communities in drinking water systems. Whilst the sampling and methodological biases associated with PCR and sequencing have been studied in other environments, they have not been quantified for drinking water. These biases are likely to have the greatest effect on the ability to characterize subtle spatio-temporal patterns influenced by process/environmental conditions. In such cases, intra-sample variability may swamp any underlying small, systematic variation. To evaluate this, we undertook a study with replication at multiple levels including sampling sites, sample collection, PCR amplification, and high throughput sequencing of 16S rRNA amplicons. The variability inherent to the PCR amplification and sequencing steps is significant enough to mask differences between bacterial communities from replicate samples. This was largely driven by greater variability in detection of rare bacteria (relative abundance <0.01%) across PCR/sequencing replicates as compared to replicate samples. Despite this, we captured significant changes in bacterial community over diurnal time-scales and find that the extent and pattern of diurnal changes is specific to each sampling location. Further, we find diurnal changes in bacterial community arise due to differences in the presence/absence of the low abundance bacteria and changes in the relative abundance of dominant bacteria. Finally, we show that bacterial community composition is significantly different across sampling sites for time-periods during which there are typically rapid changes in water use. This suggests hydraulic changes (driven by changes in water demand) contribute to shaping the bacterial community in bulk drinking water over diurnal time-scales. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. IS30-related transposon mediated insertional inactivation of bile salt hydrolase (bsh1) gene of Lactobacillus plantarum strain Lp20.

    PubMed

    Kumar, Rajesh; Grover, Sunita; Kaushik, Jai K; Batish, Virender Kumar

    2014-01-01

    Lactobacillus plantarum is a flexible and versatile microorganism that inhabits a variety of niches, and its genome may express up to four bsh genes to maximize its survival in the mammalian gut. However, the ecological significance of multiple bsh genes in L. plantarum is still not clearly understood. Hence, this study demonstrated the disruption of bile salt hydrolase (bsh1) gene due to the insertion of a transposable element in L. plantarum Lp20 - a wild strain of human fecal origin. Surprisingly, L. plantarum strain Lp20 produced a ∼2.0 kb bsh1 amplicon against the normal size (∼1.0 kb) bsh1 amplicon of Bsh(+)L. plantarum Lp21. Strain Lp20 exhibited minimal Bsh activity in spite of having intact bsh2, bsh3 and bsh4 genes in its genome and hence had a Bsh(-) phenotype. Cloning and sequence characterization of Lp20 bsh1 gene predicted four individual open reading frames (ORFs) within this region. BLAST analysis of ORF1 and ORF2 revealed significant sequence similarity to the L. plantarum bsh1 gene while ORF3 and ORF4 showed high sequence homology to IS30-family transposases. Since, IS30-related transposon element was inserted within Lp20 bsh1 gene in reverse orientation (3'-5'), it introduced several stop codons and disrupted the protein reading frames of both Bsh1 and transposase. Inverted terminal repeats (GGCAGATTG) of transposon, mediated its insertion at 255-263 nt and 1301-1309 nt positions of Lp20 bsh1 gene. In conclusion, insertion of IS30 related-transposon within the bsh1 gene sequence of L. plantarum strain Lp20 demolished the integrity and functionality of Bsh1 enzyme. Additionally, this transposon DNA sequence remains active among various Lactobacillus spp. and hence harbors the potential to be explored in the development of efficient insertion mutagenesis system. Copyright © 2013 Elsevier GmbH. All rights reserved.

  1. Utilization of next generation sequencing for analyzing transgenic insertions in plum

    USDA-ARS?s Scientific Manuscript database

    When utilizing transgenic plants, it is useful to know how many copies of the genes were inserted and the locations of these insertions in the genome. This information can provide important insights for the interpretation of transgene expression and the resulting phenotype. Traditionally, these qu...

  2. The vector homology problem in diagnostic nucleic acid hybridization of clinical specimens.

    PubMed Central

    Ambinder, R F; Charache, P; Staal, S; Wright, P; Forman, M; Hayward, S D; Hayward, G S

    1986-01-01

    Nucleic acid hybridization techniques using cloned probes are finding application in assays of clinical specimens in research and diagnostic laboratories. The probes that we and others have used are recombinant plasmids composed of viral inserts and bacterial plasmid vectors such as pBR322. We suspected that there was material homologous to pBR322 present in many clinical samples. because hybridization occurred in samples which lacked evidence of virus by other techniques. If the presence of this vector-homologous material was unrecognized, hybridization in the test sample might erroneously be interpreted as indicating the presence of viral sequences. In this paper we demonstrate specific hybridization of labeled pBR322 DNA with DNA from various clinical samples. Evidence is presented that nonspecific probe trapping could not account for this phenomenon. In mixing experiments, it is shown that contamination of clinical samples with bacteria would explain such a result. Approaches tested to circumvent this problem included the use of isolated insert probes, alternate cloning vectors, and cold competitor pBR322 DNA in prehybridization and hybridization mixes. None proved entirely satisfactory. We therefore emphasize that it is essential that all hybridization detection systems use a control probe of the vector alone in order to demonstrate the absence of material with vector homology in the specimen tested. Images PMID:3013928

  3. Identification of Microbial Profile of Koji Using Single Molecule, Real-Time Sequencing Technology.

    PubMed

    Hui, Wenyan; Hou, Qiangchuan; Cao, Chenxia; Xu, Haiyan; Zhen, Yi; Kwok, Lai-Yu; Sun, Tiansong; Zhang, Heping; Zhang, Wenyi

    2017-05-01

    Koji is a kind of Japanese traditional fermented starter that has been used for centuries. Many fermented foods are made from koji, such as sake, miso, and soy sauce. This study used the single molecule real-time sequencing technology (SMRT) to investigate the bacterial and fungal microbiota of 3 Japanese koji samples. After SMRT analysis, a total of 39121 high-quality sequences were generated, including 14354 bacterial and 24767 fungal sequence reads. The high-quality gene sequences were assigned to 5 bacterial and 2 fungal plyla, dominated by Proteobacteria and Ascomycota, respectively. At the genus level, Ochrobactrum and Wickerhamomyces were the most abundant bacterial and fungal genera, respectively. The predominant bacterial and fungal species were Ochrobactrum lupini and Wickerhamomyces anomalus, respectively. Our study profiled the microbiota composition of 3 Japanese koji samples to the species level precision. The results may be useful for further development of traditional fermented products, especially optimization of koji preparation. Meanwhile, this study has demonstrated that SMRT is a robust tool for analyzing the microbial composition in food samples. © 2017 Institute of Food Technologists®.

  4. Characterization of (CA)n microsatellite repeats from large-insert clones.

    PubMed

    Litt, M; Browne, D

    2001-05-01

    The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit determination of sequences flanking the microsatellites. When cosmids or large-insert phage clones are used as primary sources of (CA)n repeat markers, they have traditionally been subcloned into plasmid vectors such as pUC18 or M13 mp 18/19 cloning vectors to obtain fragments of suitable size for DNA sequencing. This unit presents an alternative approach whereby a set of degenerate sequencing primers that anneal directly to (CA)n microsatellites can be used to determine sequences that are inaccessible with vector-derived primers. Because the primers anneal to the repeat and not to the vector, they can be used with subclones containing inserts of several kilobases and should, in theory, always give sequence in the regions directly flanking the repeat. Degeneracy at the 3 end of each of these primers prevents elongation of primers that have annealed out-of-register. The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit.

  5. Allexiviruses may have acquired inserted sequences between the CP and CRP genes to change the translation reinitiation strategy of CRP.

    PubMed

    Yoshida, Naoto; Shimura, Hanako; Masuta, Chikara

    2018-06-01

    Allexiviruses are economically important garlic viruses that are involved in garlic mosaic diseases. In this study, we characterized the allexivirus cysteine-rich protein (CRP) gene located just downstream of the coat protein (CP) gene in the viral genome. We determined the nucleotide sequences of the CP and CRP genes from numerous allexivirus isolates and performed a phylogenetic analysis. According to the resulting phylogenetic tree, we found that allexiviruses were clearly divided into two major groups (group I and group II) based on the sequences of the CP and CRP genes. In addition, the allexiviruses in group II had distinct sequences just before the CRP gene, while group I isolates did not. The inserted sequence between the CP and CRP genes was partially complementary to garlic 18S rRNA. Using a potato virus X vector, we showed that the CRPs affected viral accumulation and symptom induction in Nicotiana benthamiana, suggesting that the allexivirus CRP is a pathogenicity determinant. We assume that the inserted sequences before the CRP gene may have been generated during viral evolution to alter the termination-reinitiation mechanism for coupled translation of CP and CRP.

  6. Suitability of partial 16S ribosomal RNA gene sequence analysis for the identification of dangerous bacterial pathogens.

    PubMed

    Ruppitsch, W; Stöger, A; Indra, A; Grif, K; Schabereiter-Gurtner, C; Hirschl, A; Allerberger, F

    2007-03-01

    In a bioterrorism event a rapid tool is needed to identify relevant dangerous bacteria. The aim of the study was to assess the usefulness of partial 16S rRNA gene sequence analysis and the suitability of diverse databases for identifying dangerous bacterial pathogens. For rapid identification purposes a 500-bp fragment of the 16S rRNA gene of 28 isolates comprising Bacillus anthracis, Brucella melitensis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, Yersinia pestis, and eight genus-related and unrelated control strains was amplified and sequenced. The obtained sequence data were submitted to three public and two commercial sequence databases for species identification. The most frequent reason for incorrect identification was the lack of the respective 16S rRNA gene sequences in the database. Sequence analysis of a 500-bp 16S rDNA fragment allows the rapid identification of dangerous bacterial species. However, for discrimination of closely related species sequencing of the entire 16S rRNA gene, additional sequencing of the 23S rRNA gene or sequencing of the 16S-23S rRNA intergenic spacer is essential. This work provides comprehensive information on the suitability of partial 16S rDNA analysis and diverse databases for rapid and accurate identification of dangerous bacterial pathogens.

  7. Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe.

    PubMed

    Chen, Bo-Ruei; Hale, Devin C; Ciolek, Peter J; Runge, Kurt W

    2012-05-03

    Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches.

  8. Retrotransposon insertion targeting: a mechanism for homogenization of centromere sequences on nonhomologous chromosomes.

    PubMed

    Birchler, James A; Presting, Gernot G

    2012-04-01

    The centromeres of most eukaryotic organisms consist of highly repetitive arrays that are similar across nonhomologous chromosomes. These sequences evolve rapidly, thus posing a mystery as to how such arrays can be homogenized. Recent work in species in which centromere-enriched retrotransposons occur indicates that these elements preferentially insert into the centromeric regions. In two different Arabidopsis species, a related element was recognized in which the specificity for such targeting was altered. These observations provide a partial explanation for how homogenization of centromere DNA sequences occurs.

  9. Crystallographic insight into the evolutionary origins of xyloglucan endo-transglycosylases and endo-hydrolases

    PubMed Central

    McGregor, Nicholas; Yin, Victor; Tung, Ching-Chieh; Van Petegem, Filip; Brumer, Harry

    2016-01-01

    SUMMARY The xyloglucan endo-transglycosylase/hydrolase (XTH) gene family encodes enzymes of central importance to plant cell wall remodelling. The evolutionary history of plant XTH gene products is incompletely understood vis-à-vis the larger body of bacterial endo-glycanases in Glycoside Hydrolase Family 16 (GH16). To provide molecular insight into this issue, high-resolution X-ray crystal structures and detailed enzyme kinetics of an extant transitional plant endo-glucanase (EG) were determined. Functionally intermediate between plant XTH gene products and bacterial licheninases of GH16, Vitis vinifera EG16 (VvEG16) effectively catalyzes the hydrolysis of the backbones of two dominant plant cell wall matrix glycans, xyloglucan (XyG) and β(1,3)/β(1,4)-mixed-linkage glucan (MLG). Crystallographic complexes with extended oligosaccharide substrates reveal the structural basis for the accommodation of both unbranched, mixed-linked (MLG) and highly decorated, linear (XyG) polysaccharide chains in a broad, extended active-site cleft. Structural comparison with representative bacterial licheninases, a xyloglucan endo-tranglycosylase (XET), and a xyloglucan endo-hydrolase (XEH) outline the functional ramifications of key sequence deletions and insertions across the phylogenetic landscape of GH16. Although the biological role(s) of EG16 orthologs remains to be fully resolved, the present biochemical and tertiary structural characterization provides key insight into plant cell wall enzyme evolution, which will continue to inform genomic analyses and functional studies across species. PMID:27859885

  10. Construction of an infectious clone of canine herpesvirus genome as a bacterial artificial chromosome.

    PubMed

    Arii, Jun; Hushur, Orkash; Kato, Kentaro; Kawaguchi, Yasushi; Tohya, Yukinobu; Akashi, Hiroomi

    2006-04-01

    Canine herpesvirus (CHV) is an attractive candidate not only for use as a recombinant vaccine to protect dogs from a variety of canine pathogens but also as a viral vector for gene therapy in domestic animals. However, developments in this area have been impeded by the complicated techniques used for eukaryotic homologous recombination. To overcome these problems, we used bacterial artificial chromosomes (BACs) to generate infectious BACs. Our findings may be summarized as follows: (i) the CHV genome (pCHV/BAC), in which a BAC flanked by loxP sites was inserted into the thymidine kinase gene, was maintained in Escherichia coli; (ii) transfection of pCHV/BAC into A-72 cells resulted in the production of infectious virus; (iii) the BAC vector sequence was almost perfectly excisable from the genome of the reconstituted virus CHV/BAC by co-infection with CHV/BAC and a recombinant adenovirus that expressed the Cre recombinase; and (iv) a recombinant virus in which the glycoprotein C gene was deleted was generated by lambda recombination followed by Flp recombination, which resulted in a reduction in viral titer compared with that of the wild-type virus. The infectious clone pCHV/BAC is useful for the modification of the CHV genome using bacterial genetics, and CHV/BAC should have multiple applications in the rapid generation of genetically engineered CHV recombinants and the development of CHV vectors for vaccination and gene therapy in domestic animals.

  11. Identification of Bacterial Species in Kuwaiti Waters Through DNA Sequencing

    NASA Astrophysics Data System (ADS)

    Chen, K.

    2017-01-01

    With an objective of identifying the bacterial diversity associated with ecosystem of various Kuwaiti Seas, bacteria were cultured and isolated from 3 water samples. Due to the difficulties for cultured and isolated fecal coliforms on the selective agar plates, bacterial isolates from marine agar plates were selected for molecular identification. 16S rRNA genes were successfully amplified from the genome of the selected isolates using Universal Eubacterial 16S rRNA primers. The resulted amplification products were subjected to automated DNA sequencing. Partial 16S rDNA sequences obtained were compared directly with sequences in the NCBI database using BLAST as well as with the sequences available with Ribosomal Database Project (RDP).

  12. Characterization of IS1515, a Functional Insertion Sequence in Streptococcus pneumoniae

    PubMed Central

    Muñoz, Rosario; López, Rubens; García, Ernesto

    1998-01-01

    We describe the characterization of a new insertion sequence, IS1515, identified in the genome of Streptococcus pneumoniae I41R, an unencapsulated mutant isolated many years ago (R. Austrian, H. P. Bernheimer, E. E. B. Smith, and G. T. Mills, J. Exp. Med. 110:585–602, 1959). A copy of this element located in the cap1EI41R gene was sequenced. The 871-bp-long IS1515 element possesses 12-bp perfect inverted repeats and generates a 3-bp target duplication upon insertion. The IS encodes a protein of 271 amino acid residues similar to the putative transposases of other insertion sequences, namely IS1381 from S. pneumoniae, ISL2 from Lactobacillus helveticus, IS702 from the cyanobacterium Calothrix sp. strain PCC 7601, and IS112 from Streptomyces albus G. IS1515 appears to be present in the genome of most type 1 pneumococci in a maximum of 13 copies, although it has also been found in the chromosome of pneumococcal isolates belonging to other serotypes. We have found that the unencapsulated phenotype of strain I41R is the result of both the presence of an IS1515 copy and a frameshift mutation in the cap1EI41R gene. Precise excision of the IS was observed in the type 1 encapsulated transformants isolated in experiments designed to repair the frameshift. These results reveal that IS1515 behaves quite differently from other previously described pneumococcal insertion sequences. Several copies of IS1515 were also able to excise and move to another locations in the chromosome of S. pneumoniae. To our knowledge, this is the first report of a functional IS in pneumococcus. PMID:9580131

  13. The Influence of Primary and Secondary DNA Structure in Deletion and Duplication between Direct Repeats in Escherichia Coli

    PubMed Central

    Trinh, T. Q.; Sinden, R. R.

    1993-01-01

    We describe a system to measure the frequency of both deletions and duplications between direct repeats. Short 17- and 18-bp palindromic and nonpalindromic DNA sequences were cloned into the EcoRI site within the chloramphenicol acetyltransferase gene of plasmids pBR325 and pJT7. This creates an insert between direct repeated EcoRI sites and results in a chloramphenicol-sensitive phenotype. Selection for chloramphenicol resistance was utilized to select chloramphenicol resistant revertants that included those with precise deletion of the insert from plasmid pBR325 and duplication of the insert in plasmid pJT7. The frequency of deletion or duplication varied more than 500-fold depending on the sequence of the short sequence inserted into the EcoRI site. For the nonpalindromic inserts, multiple internal direct repeats and the length of the direct repeats appear to influence the frequency of deletion. Certain palindromic DNA sequences with the potential to form DNA hairpin structures that might stabilize the misalignment of direct repeats had a high frequency of deletion. Other DNA sequences with the potential to form structures that might destabilize misalignment of direct repeats had a very low frequency of deletion. Duplication mutations occurred at the highest frequency when the DNA between the direct repeats contained no direct or inverted repeats. The presence of inverted repeats dramatically reduced the frequency of duplications. The results support the slippage-misalignment model, suggesting that misalignment occurring during DNA replication leads to deletion and duplication mutations. The results also support the idea that the formation of DNA secondary structures during DNA replication can facilitate and direct specific mutagenic events. PMID:8325478

  14. Nuclear Mitochondrial DNA Activates Replication in Saccharomyces cerevisiae

    PubMed Central

    Chatre, Laurent; Ricchetti, Miria

    2011-01-01

    The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS) consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in. PMID:21408151

  15. Nuclear mitochondrial DNA activates replication in Saccharomyces cerevisiae.

    PubMed

    Chatre, Laurent; Ricchetti, Miria

    2011-03-08

    The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS) consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in.

  16. Ex vivo rabbit cornea diffusion studies with a soluble insert of moxifloxacin.

    PubMed

    Sebastián-Morelló, María; Calatayud-Pascual, María Aracely; Rodilla, Vicent; Balaguer-Fernández, Cristina; López-Castellano, Alicia

    2018-02-01

    The objective of this research was to develop and evaluate an ocular insert for the controlled drug delivery of moxifloxacin which could perhaps be used in the treatment of corneal keratitis or even bacterial endophthalmitis. We have evaluated the ex vivo ocular diffusion of moxifloxacin through rabbit cornea, both fresh and preserved under different conditions. Histological studies were also carried out. Subsequently, drug matrix inserts were prepared using bioadhesive polymers. The inserts were evaluated for their physicochemical parameters. Ophthalmic ex vivo permeation of moxifloxacin was carried out with the most promising insert. The formulate insert was thin and provided higher ocular diffusion than commercial formulations. Ocular diffusion studies revealed significant differences between fresh and frozen corneas. Histological examinations also showed differences in the thickness of stroma between fresh and frozen corneas. The ophthalmic insert we have developed allows a larger quantity of moxifloxacin to permeate through the cornea than existing commercial formulations of the drug. Ocular delivery of moxifloxacin with this insert could be a new approach for the treatment of eye diseases.

  17. Electromagnetic signals are produced by aqueous nanostructures derived from bacterial DNA sequences.

    PubMed

    Montagnier, Luc; Aïssa, Jamal; Ferris, Stéphane; Montagnier, Jean-Luc; Lavallée, Claude

    2009-06-01

    A novel property of DNA is described: the capacity of some bacterial DNA sequences to induce electromagnetic waves at high aqueous dilutions. It appears to be a resonance phenomenon triggered by the ambient electromagnetic background of very low frequency waves. The genomic DNA of most pathogenic bacteria contains sequences which are able to generate such signals. This opens the way to the development of highly sensitive detection system for chronic bacterial infections in human and animal diseases.

  18. Disruption of the M949_RS01915 gene changed the bacterial lipopolysaccharide pattern, pathogenicity and gene expression of Riemerella anatipestifer.

    PubMed

    Dou, Yafeng; Wang, Xiaolan; Yu, Guijing; Wang, Shaohui; Tian, Mingxing; Qi, Jingjing; Li, Tao; Ding, Chan; Yu, Shengqing

    2017-02-06

    Riemerella anatipestifer is an important pathogen that causes septicemia anserum exsudativa in ducks. Lipopolysaccharide (LPS) is considered to be a major virulence factor of R. anatipestifer. To identify genes involved in LPS biosynthesis, we screened a library of random Tn4351 transposon mutants using a monoclonal antibody against R. anatipestifer serotype 1 LPS (anti-LPS MAb). A mutant strain RA1067 which lost the reactivity in an indirect ELISA was obtained. Southern blot and sequencing analyses indicated a single Tn4351 was inserted at 116 bp in the M949_RS01915 gene in the RA1067 chromosomal DNA. Silver staining and Western blot analyses indicated that the RA1067 LPS was defected compared to the wild-type strain CH3 LPS. The RA1067 displayed a significant decreased growth rate at the late stage of growth in TSB in comparison with CH3. In addition, RA1067 showed higher susceptibility to complement-dependent killing, more than 360-fold attenuated virulence based on the median lethal dose determination, increased bacterial adhesion and invasion capacities to Vero cells and significantly decreased blood bacterial loads in RA1067 infected ducks, when compared to the CH3. An animal experiment indicated that inactivated RA1067 cells was effective in cross-protecting of the ducks from challenging with R. anatipestifer strains WJ4 (serotype 1), Yb2 (serotype 2) and HXb2 (serotype 10), further confirming the alteration of the RA1067 antigenicity. Moreover, RNA-Seq analysis and real-time PCR verified two up-regulated and three down-regulated genes in RA1067. Our findings demonstrate that the M949_RS01915 gene is associated to bacterial antigenicity, pathogenicity and gene regulation of R. anatipestifer.

  19. Active bacterial community structure along vertical redox gradients in Baltic Sea sediment

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jansson, Janet; Edlund, Anna; Hardeman, Fredrik

    Community structures of active bacterial populations were investigated along a vertical redox profile in coastal Baltic Sea sediments by terminal-restriction fragment length polymorphism (T-RFLP) and clone library analysis. According to correspondence analysis of T-RFLP results and sequencing of cloned 16S rRNA genes, the microbial community structures at three redox depths (179 mV, -64 mV and -337 mV) differed significantly. The bacterial communities in the community DNA differed from those in bromodeoxyuridine (BrdU)-labeled DNA, indicating that the growing members of the community that incorporated BrdU were not necessarily the most dominant members. The structures of the actively growing bacterial communities weremore » most strongly correlated to organic carbon followed by total nitrogen and redox potentials. Bacterial identification by sequencing of 16S rRNA genes from clones of BrdU-labeled DNA and DNA from reverse transcription PCR (rt-PCR) showed that bacterial taxa involved in nitrogen and sulfur cycling were metabolically active along the redox profiles. Several sequences had low similarities to previously detected sequences indicating that novel lineages of bacteria are present in Baltic Sea sediments. Also, a high number of different 16S rRNA gene sequences representing different phyla were detected at all sampling depths.« less

  20. Identification of characteristic oligonucleotides in the bacterial 16S ribosomal RNA sequence dataset

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; Willson, Richard C.; Fox, George E.

    2002-01-01

    MOTIVATION: The phylogenetic structure of the bacterial world has been intensively studied by comparing sequences of 16S ribosomal RNA (16S rRNA). This database of sequences is now widely used to design probes for the detection of specific bacteria or groups of bacteria one at a time. The success of such methods reflects the fact that there are local sequence segments that are highly characteristic of particular organisms or groups of organisms. It is not clear, however, the extent to which such signature sequences exist in the 16S rRNA dataset. A better understanding of the numbers and distribution of highly informative oligonucleotide sequences may facilitate the design of hybridization arrays that can characterize the phylogenetic position of an unknown organism or serve as the basis for the development of novel approaches for use in bacterial identification. RESULTS: A computer-based algorithm that characterizes the extent to which any individual oligonucleotide sequence in 16S rRNA is characteristic of any particular bacterial grouping was developed. A measure of signature quality, Q(s), was formulated and subsequently calculated for every individual oligonucleotide sequence in the size range of 5-11 nucleotides and for 15mers with reference to each cluster and subcluster in a 929 organism representative phylogenetic tree. Subsequently, the perfect signature sequences were compared to the full set of 7322 sequences to see how common false positives were. The work completed here establishes beyond any doubt that highly characteristic oligonucleotides exist in the bacterial 16S rRNA sequence dataset in large numbers. Over 16,000 15mers were identified that might be useful as signatures. Signature oligonucleotides are available for over 80% of the nodes in the representative tree.

  1. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing

    PubMed Central

    Eastman, Alexander W.; Yuan, Ze-Chun

    2015-01-01

    Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing projects. PMID:25653642

  2. Molecular diversity of bacterial endosymbionts associated with dagger nematodes of the genus Xiphinema (Nematoda: Longidoridae) reveals a high degree of phylogenetic congruence with their host.

    PubMed

    Palomares-Rius, Juan E; Archidona-Yuste, Antonio; Cantalapiedra-Navarrete, Carolina; Prieto, Pilar; Castillo, Pablo

    2016-12-01

    Bacterial endosymbionts have been detected in some groups of plant-parasitic nematodes, but few cases have been reported compared to other groups in the phylum Nematoda, such as animal-parasitic or free-living nematodes. This study was performed on a wide variety of plant-parasitic nematode families and species from different host plants and nematode populations. A total of 124 nematode populations (previously identified morphologically and molecularly) were screened for the presence of potential bacterial endosymbionts using the partial 16S rRNA gene and fluorescence in situ hybridization (FISH) and confocal microscopy. Potential bacterial endosymbionts were only detected in nematode species belonging to the genus Xiphinema and specifically in the X. americanum group. Fifty-seven partial 16S rRNA sequences were obtained from bacterial endosymbionts in this study. One group of sequences was closely related to the genus 'Candidatus Xiphinematobacter' (19 bacterial endosymbiont sequences were associated with seven nematode host species, including two that have already been described and three unknown bacterial endosymbionts). The second bacterial endosymbiont group (38 bacterial endosymbiont sequences associated with six nematode species) was related to the family Burkholderiaceae, which includes fungal and soil-plant bacterial endosymbionts. These endosymbionts were reported for the first time in the phylum Nematoda. Our findings suggest that there is a highly specific symbiotic relationship between nematode host and bacterial endosymbionts. Overall, these results were corroborated by a phylogeny of nematode host and bacterial endosymbionts that suggested that there was a high degree of phylogenetic congruence and long-term evolutionary persistence between hosts and endosymbionts. © 2016 John Wiley & Sons Ltd.

  3. Sequence-Specific Affinity Chromatography of Bacterial Small Regulatory RNA-Binding Proteins from Bacterial Cells.

    PubMed

    Gans, Jonathan; Osborne, Jonathan; Cheng, Juliet; Djapgne, Louise; Oglesby-Sherrouse, Amanda G

    2018-01-01

    Bacterial small RNA molecules (sRNAs) are increasingly recognized as central regulators of bacterial stress responses and pathogenesis. In many cases, RNA-binding proteins are critical for the stability and function of sRNAs. Previous studies have adopted strategies to genetically tag an sRNA of interest, allowing isolation of RNA-protein complexes from cells. Here we present a sequence-specific affinity purification protocol that requires no prior genetic manipulation of bacterial cells, allowing isolation of RNA-binding proteins bound to native RNA molecules.

  4. Structure of genes and an insertion element in the methane producing archaebacterium Methanobrevibacter smithii.

    PubMed

    Hamilton, P T; Reeve, J N

    1985-01-01

    DNA fragments cloned from the methanogenic archaebacterium Methanobrevibacter smithii which complement mutations in the purE and proC genes of E. coli have been sequenced. Sequence analyses, transposon mutagenesis and expression in E. coli minicells indicate that purE and proC complementations result from the synthesis of M. smithii polypeptides with molecular weights of 36,697 and 27,836 respectively. The encoding genes appear to be located in operons. The M. smithii genome contains 69% A/T basepairs (bp) which is reflected in unusual codon usages and intergenic regions containing approximately 85% A/T bp. An insertion element, designated ISM1, was found within the cloned M. smithii DNA located adjacent to the proC complementing region. ISM1 is 1381 bp in length, has 29 bp terminal inverted repeat sequences and contains one major ORF encoded in 87% of the ISM1 sequence. ISM1 is mobile, present in approximately 10 copies per genome and integration duplicates 8 bp at the site of insertion. The duplicated sequences show homology with sequences within the 29 bp terminal repeat sequence of ISM1. Comparison of our data with sequences from halophilic archaebacteria suggests that 5'GAANTTTCA and 5'TTTTAATATAAA may be consensus promoter sequences for archaebacteria. These sequences closely resemble the consensus sequences which precede Drosophila heat-shock genes (Pelham 1982; Davidson et al. 1983). Methanogens appear to employ the eubacterial system of mRNA: 16SrRNA hybridization to ensure initiation of translation; the consensus ribosome binding sequence is 5'AGGTGA.

  5. MR-compatibility assessment of MADPET4: a study of interferences between an SiPM-based PET insert and a 7 T MRI system

    NASA Astrophysics Data System (ADS)

    Omidvari, Negar; Topping, Geoffrey; Cabello, Jorge; Paul, Stephan; Schwaiger, Markus; Ziegler, Sibylle I.

    2018-05-01

    Compromises in the design of a positron emission tomography (PET) insert for a magnetic resonance imaging (MRI) system should minimize the deterioration of image quality in both modalities, particularly when simultaneous demanding acquisitions are performed. In this work, the advantages of using individually read-out crystals with high-gain silicon photomultipliers (SiPMs) were studied with a small animal PET insert for a 7 T MRI system, in which the SiPM charge was transferred to outside the MRI scanner using coaxial cables. The interferences between the two systems were studied with three radio-frequency (RF) coil configurations. The effects of PET on the static magnetic field, flip angle distribution, RF noise, and image quality of various MRI sequences (gradient echo, spin echo, and echo planar imaging (EPI) at 1H frequency, and chemical shift imaging at 13C frequency) were investigated. The effects of fast-switching gradient fields and RF pulses on PET count rate were studied, while the PET insert and the readout electronics were not shielded. Operating the insert inside a 1H volume coil, used for RF transmission and reception, limited the MRI to T1-weighted imaging, due to coil detuning and RF attenuation, and resulted in significant PET count loss. Using a surface receive coil allowed all tested MR sequences to be used with the insert, with 45–59% signal-to-noise ratio (SNR) degradation, compared to without PET. With a 1H/13C volume coil inside the insert and shielded by a copper tube, the SNR degradation was limited to 23–30% with all tested sequences. The insert did not introduce any discernible distortions into images of two tested EPI sequences. Use of truncated sinc shaped RF excitation pulses and gradient field switching had negligible effects on PET count rate. However, PET count rate was substantially affected by high-power RF block pulses and temperature variations due to high gradient duty cycles.

  6. Rapid molecular sexing of three-spined sticklebacks, Gasterosteus aculeatus L., based on large Y-chromosomal insertions.

    PubMed

    Bakker, Theo C M; Giger, Thomas; Frommen, Joachim G; Largiadèr, Carlo R

    2017-08-01

    There is a need for rapid and reliable molecular sexing of three-spined sticklebacks, Gasterosteus aculeatus, the supermodel species for evolutionary biology. A DNA region at the 5' end of the sex-linked microsatellite Gac4202 was sequenced for the X chromosome of six females and the Y chromosome of five males from three populations. The Y chromosome contained two large insertions, which did not recombine with the phenotype of sex in a cross of 322 individuals. Genetic variation (SNPs and indels) within the insertions was smaller than on flanking DNA sequences. Three molecular PCR-based sex tests were developed, in which the first, the second or both insertions were covered. In five European populations (from DE, CH, NL, GB) of three-spined sticklebacks, tests with both insertions combined showed two clearly separated bands on agarose minigels in males and one band in females. The tests with the separate insertions gave similar results. Thus, the new molecular sexing method gave rapid and reliable results for sexing three-spined sticklebacks and is an improvement and/or alternative to existing methods.

  7. CHARACTERIZATION AND NUCLEOTIDE SEQUENCE DETERMINATION OF A REPEAT ELEMENT ISOLATED FROM A 2,4,5,-T DEGRADING STRAIN OF PSEUDOMONAS CEPACIA

    EPA Science Inventory

    Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...

  8. Identification of Genes and Pathways Related to Phenol Degradation in Metagenomic Libraries from Petroleum Refinery Wastewater

    PubMed Central

    Silva, Cynthia C.; Hayden, Helen; Sawbridge, Tim; Mele, Pauline; De Paula, Sérgio O.; Silva, Lívia C. F.; Vidigal, Pedro M. P.; Vicentini, Renato; Sousa, Maíra P.; Torres, Ana Paula R.; Santiago, Vânia M. J.; Oliveira, Valéria M.

    2013-01-01

    Two fosmid libraries, totaling 13,200 clones, were obtained from bioreactor sludge of petroleum refinery wastewater treatment system. The library screening based on PCR and biological activity assays revealed more than 400 positive clones for phenol degradation. From these, 100 clones were randomly selected for pyrosequencing in order to evaluate the genetic potential of the microorganisms present in wastewater treatment plant for biodegradation, focusing mainly on novel genes and pathways of phenol and aromatic compound degradation. The sequence analysis of selected clones yielded 129,635 reads at an estimated 17-fold coverage. The phylogenetic analysis showed Burkholderiales and Rhodocyclales as the most abundant orders among the selected fosmid clones. The MG-RAST analysis revealed a broad metabolic profile with important functions for wastewater treatment, including metabolism of aromatic compounds, nitrogen, sulphur and phosphorus. The predicted 2,276 proteins included phenol hydroxylases and cathecol 2,3- dioxygenases, involved in the catabolism of aromatic compounds, such as phenol, byphenol, benzoate and phenylpropanoid. The sequencing of one fosmid insert of 33 kb unraveled the gene that permitted the host, Escherichia coli EPI300, to grow in the presence of aromatic compounds. Additionally, the comparison of the whole fosmid sequence against bacterial genomes deposited in GenBank showed that about 90% of sequence showed no identity to known sequences of Proteobacteria deposited in the NCBI database. This study surveyed the functional potential of fosmid clones for aromatic compound degradation and contributed to our knowledge of the biodegradative capacity and pathways of microbial assemblages present in refinery wastewater treatment system. PMID:23637911

  9. Medical-grade honey does not reduce skin colonization at central venous catheter-insertion sites of critically ill patients: a randomized controlled trial

    PubMed Central

    2012-01-01

    Introduction Catheter-related bloodstream infections (CRBSIs) associated with short-term central venous catheters (CVCs) in intensive care unit (ICU) patients are a major clinical problem. Bacterial colonization of the skin at the CVC insertion site is an important etiologic factor for CRBSI. The aim of this study was to assess the efficacy of medical-grade honey in reducing bacterial skin colonization at insertion sites. Methods A prospective, single-center, open-label randomized controlled trial was performed at the ICU of a university hospital in The Netherlands to assess the efficacy of medical-grade honey to reduce skin colonization of insertion sites. Medical-grade honey was applied in addition to standard CVC-site dressing and disinfection with 0.5% chlorhexidine in 70% alcohol. Skin colonization was assessed on a daily basis before CVC-site disinfection. The primary end point was colonization of insertion sites with >100 colony-forming units at the last sampling before removal of the CVC or transfer of the patient from the ICU. Secondary end points were quantitative levels of colonization of the insertion sites and colonization of insertion sites stratified for CVC location. Results Colonization of insertion sites was not affected by the use of medical-grade honey, as 44 (34%) of 129 and 36 (34%) of 106 patients in the honey and standard care groups, respectively, had a positive skin culture (P = 0.98). Median levels of skin colonization at the last sampling were 1 (0 to 2.84) and 1 (0 to 2.70) log colony-forming units (CFUs)/swab for the honey and control groups, respectively (P = 0.94). Gender, days of CVC placement, CVC location, and CVC type were predictive for a positive skin culture. Correction for these variables did not change the effect of honey on skin-culture positivity. Conclusions Medical-grade honey does not affect colonization of the skin at CVC insertion sites in ICU patients when applied in addition to standard disinfection with 0.5% chlorhexidine in 70% alcohol. Trial registration Netherlands Trial Registry, NTR1652. PMID:23111148

  10. Medical-grade honey does not reduce skin colonization at central venous catheter-insertion sites of critically ill patients: a randomized controlled trial.

    PubMed

    Kwakman, Paulus H; Müller, Marcella C; Binnekade, Jan M; van den Akker, Johannes P; de Borgie, Corianne A; Schultz, Marcus J; Zaat, Sebastian A

    2012-10-30

    Catheter-related bloodstream infections (CRBSIs) associated with short-term central venous catheters (CVCs) in intensive care unit (ICU) patients are a major clinical problem. Bacterial colonization of the skin at the CVC insertion site is an important etiologic factor for CRBSI. The aim of this study was to assess the efficacy of medical-grade honey in reducing bacterial skin colonization at insertion sites. A prospective, single-center, open-label randomized controlled trial was performed at the ICU of a university hospital in The Netherlands to assess the efficacy of medical-grade honey to reduce skin colonization of insertion sites. Medical-grade honey was applied in addition to standard CVC-site dressing and disinfection with 0.5% chlorhexidine in 70% alcohol. Skin colonization was assessed on a daily basis before CVC-site disinfection. The primary end point was colonization of insertion sites with >100 colony-forming units at the last sampling before removal of the CVC or transfer of the patient from the ICU. Secondary end points were quantitative levels of colonization of the insertion sites and colonization of insertion sites stratified for CVC location. Colonization of insertion sites was not affected by the use of medical-grade honey, as 44 (34%) of 129 and 36 (34%) of 106 patients in the honey and standard care groups, respectively, had a positive skin culture (P = 0.98). Median levels of skin colonization at the last sampling were 1 (0 to 2.84) and 1 (0 to 2.70) log colony-forming units (CFUs)/swab for the honey and control groups, respectively (P = 0.94). Gender, days of CVC placement, CVC location, and CVC type were predictive for a positive skin culture. Correction for these variables did not change the effect of honey on skin-culture positivity. Medical-grade honey does not affect colonization of the skin at CVC insertion sites in ICU patients when applied in addition to standard disinfection with 0.5% chlorhexidine in 70% alcohol. Netherlands Trial Registry, NTR1652.

  11. Import of honeybee prepromelittin into the endoplasmic reticulum: structural basis for independence of SRP and docking protein.

    PubMed Central

    Müller, G; Zimmermann, R

    1987-01-01

    Honeybee prepromelittin is correctly processed and imported by dog pancreas microsomes. Insertion of prepromelittin into microsomal membranes, as assayed by signal sequence removal, does not depend on signal recognition particle (SRP) and docking protein. We addressed the question as to how prepromelittin bypasses the SRP/docking protein system. Hybrid proteins between prepromelittin, or carboxy-terminally truncated derivatives, and the cytoplasmic protein dihydrofolate reductase from mouse were constructed. These hybrid proteins were analysed for membrane insertion and sequestration into microsomes. The results suggest the following: (i) The signal sequence of prepromelittin is capable of interacting with the SRP/docking protein system, but this interaction is not mandatory for membrane insertion; this is related to the small size of prepromelittin. (ii) In prepromelittin a cluster of negatively charged amino acids must be balanced by a cluster of positively charged amino acids in order to allow membrane insertion. (iii) In general, a signal sequence can be sufficient to mediate membrane insertion independently of SRP and docking protein in the case of short precursor proteins; however, the presence and distribution of charged amino acids within the mature part of these precursors can play distinct roles. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. Fig. 8. Fig. 9. PMID:2820722

  12. The Diversity of Prokaryotic DDE Transposases of the Mutator Superfamily, Insertion Specificity, and Association with Conjugation Machineries

    PubMed Central

    Guérillot, Romain; Siguier, Patricia; Gourbeyre, Edith; Chandler, Michael; Glaser, Philippe

    2014-01-01

    Transposable elements (TEs) are major components of both prokaryotic and eukaryotic genomes and play a significant role in their evolution. In this study, we have identified new prokaryotic DDE transposase families related to the eukaryotic Mutator-like transposases. These genes were retrieved by cascade PSI-Blast using as initial query the transposase of the streptococcal integrative and conjugative element (ICE) TnGBS2. By combining secondary structure predictions and protein sequence alignments, we predicted the DDE catalytic triad and the DNA-binding domain recognizing the terminal inverted repeats. Furthermore, we systematically characterized the organization and the insertion specificity of the TEs relying on these prokaryotic Mutator-like transposases (p-MULT) for their mobility. Strikingly, two distant TE families target their integration upstream σA dependent promoters. This allowed us to identify a transposase sequence signature associated with this unique insertion specificity and to show that the dissymmetry between the two inverted repeats is responsible for the orientation of the insertion. Surprisingly, while DDE transposases are generally associated with small and simple transposons such as insertion sequences (ISs), p-MULT encoding TEs show an unprecedented diversity with several families of IS, transposons, and ICEs ranging in size from 1.1 to 52 kb. PMID:24418649

  13. Diagnosis of Meningococcal Meningitis by Broad-Range Bacterial PCR with Cerebrospinal Fluid

    PubMed Central

    Kotilainen, Pirkko; Jalava, Jari; Meurman, Olli; Lehtonen, Olli-Pekka; Rintala, Esa; Seppälä, Olli-Pekka; Eerola, Erkki; Nikkari, Simo

    1998-01-01

    We used broad-range bacterial PCR combined with DNA sequencing to examine prospectively cerebrospinal fluid (CSF) samples from patients with suspected meningitis. Fifty-six CSF samples from 46 patients were studied during the year 1995. Genes coding for bacterial 16S and/or 23S rRNA genes could be amplified from the CSF samples from five patients with a clinical picture consistent with acute bacterial meningitis. For these patients, the sequenced PCR product shared 98.3 to 100% homology with the Neisseria meningitidis sequence. For one patient, the diagnosis was initially made by PCR alone. Of the remaining 51 CSF samples, for 50 (98.0%) samples the negative PCR findings were in accordance with the negative findings by bacterial culture and Gram staining, as well as with the eventual clinical diagnosis for the patient. However, the PCR test failed to detect the bacterial rRNA gene in one CSF sample, the culture of which yielded Listeria monocytogenes. These results invite new research efforts to be focused on the application of PCR with broad-range bacterial primers to improve the etiologic diagnosis of bacterial meningitis. In a clinical setting, Gram staining and bacterial culture still remain the cornerstones of diagnosis. PMID:9665992

  14. RNA-Seq for Bacterial Gene Expression.

    PubMed

    Poulsen, Line Dahl; Vinther, Jeppe

    2018-06-01

    RNA sequencing (RNA-seq) has become the preferred method for global quantification of bacterial gene expression. With the continued improvements in sequencing technology and data analysis tools, the most labor-intensive and expensive part of an RNA-seq experiment is the preparation of sequencing libraries, which is also essential for the quality of the data obtained. Here, we present a straightforward and inexpensive basic protocol for preparation of strand-specific RNA-seq libraries from bacterial RNA as well as a computational pipeline for the data analysis of sequencing reads. The protocol is based on the Illumina platform and allows easy multiplexing of samples and the removal of sequencing reads that are PCR duplicates. © 2018 by John Wiley & Sons, Inc. © 2018 John Wiley & Sons, Inc.

  15. Brain Microbial Populations in HIV/AIDS: α-Proteobacteria Predominate Independent of Host Immune Status

    PubMed Central

    Branton, William G.; Ellestad, Kristofor K.; Maingat, Ferdinand; Wheatley, B. Matt; Rud, Erling; Warren, René L.; Holt, Robert A.; Surette, Michael G.; Power, Christopher

    2013-01-01

    The brain is assumed to be a sterile organ in the absence of disease although the impact of immune disruption is uncertain in terms of brain microbial diversity or quantity. To investigate microbial diversity and quantity in the brain, the profile of infectious agents was examined in pathologically normal and abnormal brains from persons with HIV/AIDS [HIV] (n = 12), other disease controls [ODC] (n = 14) and in cerebral surgical resections for epilepsy [SURG] (n = 6). Deep sequencing of cerebral white matter-derived RNA from the HIV (n = 4) and ODC (n = 4) patients and SURG (n = 2) groups revealed bacterially-encoded 16 s RNA sequences in all brain specimens with α-proteobacteria representing over 70% of bacterial sequences while the other 30% of bacterial classes varied widely. Bacterial rRNA was detected in white matter glial cells by in situ hybridization and peptidoglycan immunoreactivity was also localized principally in glia in human brains. Analyses of amplified bacterial 16 s rRNA sequences disclosed that Proteobacteria was the principal bacterial phylum in all human brain samples with similar bacterial rRNA quantities in HIV and ODC groups despite increased host neuroimmune responses in the HIV group. Exogenous viruses including bacteriophage and human herpes viruses-4, -5 and -6 were detected variably in autopsied brains from both clinical groups. Brains from SIV- and SHIV-infected macaques displayed a profile of bacterial phyla also dominated by Proteobacteria but bacterial sequences were not detected in experimentally FIV-infected cat or RAG1−/− mouse brains. Intracerebral implantation of human brain homogenates into RAG1−/− mice revealed a preponderance of α-proteobacteria 16 s RNA sequences in the brains of recipient mice at 7 weeks post-implantation, which was abrogated by prior heat-treatment of the brain homogenate. Thus, α-proteobacteria represented the major bacterial component of the primate brain’s microbiome regardless of underlying immune status, which could be transferred into naïve hosts leading to microbial persistence in the brain. PMID:23355888

  16. The Genetic Analysis of an Acinetobacter johnsonii Clinical Strain Evidenced the Presence of Horizontal Genetic Transfer.

    PubMed

    Montaña, Sabrina; Schramm, Sareda T J; Traglia, German Matías; Chiem, Kevin; Parmeciano Di Noto, Gisela; Almuzara, Marisa; Barberis, Claudia; Vay, Carlos; Quiroga, Cecilia; Tolmasky, Marcelo E; Iriarte, Andrés; Ramírez, María Soledad

    2016-01-01

    Acinetobacter johnsonii rarely causes human infections. While most A. johnsonii isolates are susceptible to virtually all antibiotics, strains harboring a variety of β-lactamases have recently been described. An A. johnsonii Aj2199 clinical strain recovered from a hospital in Buenos Aires produces PER-2 and OXA-58. We decided to delve into its genome by obtaining the whole genome sequence of the Aj2199 strain. Genome comparison studies on Aj2199 revealed 240 unique genes and a close relation to strain WJ10621, isolated from the urine of a patient in China. Genomic analysis showed evidence of horizontal genetic transfer (HGT) events. Forty-five insertion sequences and two intact prophages were found in addition to several resistance determinants such as blaPER-2, blaOXA-58, blaTEM-1, strA, strB, ereA, sul1, aacC2 and a new variant of blaOXA-211, called blaOXA-498. In particular, blaPER-2 and blaTEM-1 are present within the typical contexts previously described in the Enterobacteriaceae family. These results suggest that A. johnsonii actively acquires exogenous DNA from other bacterial species and concomitantly becomes a reservoir of resistance genes.

  17. Isolation of complementary DNA clones encoding pathogenesis-related proteins P and Q, two acidic chitinases from tobacco.

    PubMed Central

    Payne, G; Ahl, P; Moyer, M; Harper, A; Beck, J; Meins, F; Ryals, J

    1990-01-01

    Complementary DNA clones encoding two isoforms of the acidic endochitinase (chitinase, EC 3.2.1.14) from tobacco were isolated. Comparison of amino acid sequences deduced from the cDNA clones and the sequence of peptides derived from purified proteins show that these clones encode the pathogenesis-related proteins PR-P and PR-Q. The cDNA inserts were not homologous to either the bacterial form of chitinase or the form from cucumber but shared significant homology to the basic form of chitinase from tobacco and bean. The acidic isoforms of tobacco chitinase did not contain the amino-terminal, cysteine-rich "hevein" domain found in the basic isoforms, indicating that this domain, which binds chitin, is not essential for chitinolytic activity. The accumulation of mRNA for the pathogenesis-related proteins PR-1, PR-R, PR-P, and PR-Q in Xanthi.nc tobacco leaves following infection with tobacco mosaic virus was measured by primer extension. The results indicate that the induction of these proteins during the local necrotic lesion response to the virus is coordinated at the mRNA level. Images PMID:2296608

  18. Multiprimer PCR system for differential identification of mycobacteria in clinical samples.

    PubMed Central

    Del Portillo, P; Thomas, M C; Martínez, E; Marañón, C; Valladares, B; Patarroyo, M E; Carlos López, M

    1996-01-01

    A novel multiprimer PCR method with the potential to identify mycobacteria in clinical samples is presented. The assay relies on the simultaneous amplification of three bacterial DNA genomic fragments by using different sets of oligonucleotide primers. The first set of primers amplifies a 506-bp fragment from the gene for the 32-kDa antigen of Mycobacterium tuberculosis, which is present in most of the species belonging to the genus Mycobacterium. The second set of primers amplifies a 984-bp fragment from the IS6110 insertion sequence of the bacteria belonging to the M. tuberculosis complex. The third set of primers, derived from an M. tuberculosis species-specific sequence named MTP40, amplifies a 396-bp genomic fragment. Thus, while the multiprimer system would render three amplification fragments from the M. tuberculosis genome and two fragments from the Mycobacterium bovis genome, a unique amplification fragment would be obtained from nontuberculous mycobacteria. The results obtained, using reference mycobacterial strains and typed clinical isolates, show that the multiprimer PCR method may be a rapid, sensitive, and specific tool for the differential identification of various mycobacterial strains in a single-step assay. PMID:8789008

  19. Identification of a Pantoea Biosynthetic Cluster That Directs the Synthesis of an Antimicrobial Natural Product

    PubMed Central

    Walterson, Alyssa M.; Smith, Derek D. N.; Stavrinides, John

    2014-01-01

    Fire Blight is a destructive disease of apple and pear caused by the enteric bacterial pathogen, Erwinia amylovora. E. amylovora initiates infection by colonizing the stigmata of apple and pear trees, and entering the plants through natural openings. Epiphytic populations of the related enteric bacterium, Pantoea, reduce the incidence of disease through competition and antibiotic production. In this study, we identify an antibiotic from Pantoea ananatis BRT175, which is effective against E. amylovora and select species of Pantoea. We used transposon mutagenesis to create a mutant library, screened approximately 5,000 mutants for loss of antibiotic production, and recovered 29 mutants. Sequencing of the transposon insertion sites of these mutants revealed multiple independent disruptions of an 8.2 kb cluster consisting of seven genes, which appear to be coregulated. An analysis of the distribution of this cluster revealed that it was not present in any other of our 115 Pantoea isolates, or in any of the fully sequenced Pantoea genomes, and is most closely related to antibiotic biosynthetic clusters found in three different species of Pseudomonas. This identification of this biosynthetic cluster highlights the diversity of natural products produced by Pantoea. PMID:24796857

  20. MiMIC: a highly versatile transposon insertion resource for engineering Drosophila melanogaster genes

    PubMed Central

    Venken, Koen J. T.; Schulze, Karen L.; Haelterman, Nele A.; Pan, Hongling; He, Yuchun; Evans-Holm, Martha; Carlson, Joseph W.; Levis, Robert W.; Spradling, Allan C.; Hoskins, Roger A.; Bellen, Hugo J.

    2011-01-01

    We demonstrate the versatility of a collection of insertions of the transposon Minos mediated integration cassette (MiMIC), in Drosophila melanogaster. MiMIC contains a gene-trap cassette and the yellow+ marker flanked by two inverted bacteriophage ΦC31 attP sites. MiMIC integrates almost at random in the genome to create sites for DNA manipulation. The attP sites allow the replacement of the intervening sequence of the transposon with any other sequence through recombinase mediated cassette exchange (RMCE). We can revert insertions that function as gene traps and cause mutant phenotypes to wild type by RMCE and modify insertions to control GAL4 or QF overexpression systems or perform lineage analysis using the Flp system. Insertions within coding introns can be exchanged with protein-tag cassettes to create fusion proteins to follow protein expression and perform biochemical experiments. The applications of MiMIC vastly extend the Drosophila melanogaster toolkit. PMID:21985007

  1. Active role of a human genomic insert in replication of a yeast artificial chromosome.

    PubMed

    van Brabant, A J; Fangman, W L; Brewer, B J

    1999-06-01

    Yeast artificial chromosomes (YACs) are a common tool for cloning eukaryotic DNA. The manner by which large pieces of foreign DNA are assimilated by yeast cells into a functional chromosome is poorly understood, as is the reason why some of them are stably maintained and some are not. We examined the replication of a stable YAC containing a 240-kb insert of DNA from the human T-cell receptor beta locus. The human insert contains multiple sites that serve as origins of replication. The activity of these origins appears to require the yeast ARS consensus sequence and, as with yeast origins, additional flanking sequences. In addition, the origins in the human insert exhibit a spacing, a range of activation efficiencies, and a variation in times of activation during S phase similar to those found for normal yeast chromosomes. We propose that an appropriate combination of replication origin density, activation times, and initiation efficiencies is necessary for the successful maintenance of YAC inserts.

  2. Alu element insertion in PKLR gene as a novel cause of pyruvate kinase deficiency in Middle Eastern patients.

    PubMed

    Lesmana, Harry; Dyer, Lisa; Li, Xia; Denton, James; Griffiths, Jenna; Chonat, Satheesh; Seu, Katie G; Heeney, Matthew M; Zhang, Kejian; Hopkin, Robert J; Kalfa, Theodosia A

    2018-03-01

    Pyruvate kinase deficiency (PKD) is the most frequent red blood cell enzyme abnormality of the glycolytic pathway and the most common cause of hereditary nonspherocytic hemolytic anemia. Over 250 PKLR-gene mutations have been described, including missense/nonsense, splicing and regulatory mutations, small insertions, small and gross deletions, causing PKD and hemolytic anemia of variable severity. Alu retrotransposons are the most abundant mobile DNA sequences in the human genome, contributing to almost 11% of its mass. Alu insertions have been associated with a number of human diseases either by disrupting a coding region or a splice signal. Here, we report on two unrelated Middle Eastern patients, both born from consanguineous parents, with transfusion-dependent hemolytic anemia, where sequence analysis revealed a homozygous insertion of AluYb9 within exon 6 of the PKLR gene, causing precipitous decrease of PKLR RNA levels. This Alu element insertion consists a previously unrecognized mechanism underlying pathogenesis of PKD. © 2017 Wiley Periodicals, Inc.

  3. Endophyte Microbiome Diversity in Micropropagated Atriplex canescens and Atriplex torreyi var griffithsii

    PubMed Central

    Lucero, Mary E.; Unc, Adrian; Cooke, Peter; Dowd, Scot; Sun, Shulei

    2011-01-01

    Microbial diversity associated with micropropagated Atriplex species was assessed using microscopy, isolate culturing, and sequencing. Light, electron, and confocal microscopy revealed microbial cells in aseptically regenerated leaves and roots. Clone libraries and tag-encoded FLX amplicon pyrosequencing (TEFAP) analysis amplified sequences from callus homologous to diverse fungal and bacterial taxa. Culturing isolated some seed borne endophyte taxa which could be readily propagated apart from the host. Microbial cells were observed within biofilm-like residues associated with plant cell surfaces and intercellular spaces. Various universal primers amplified both plant and microbial sequences, with different primers revealing different patterns of fungal diversity. Bacterial and fungal TEFAP followed by alignment with sequences from curated databases revealed 7 bacterial and 17 ascomycete taxa in A. canescens, and 5 bacterial taxa in A. torreyi. Additional diversity was observed among isolates and clone libraries. Micropropagated Atriplex retains a complex, intimately associated microbiome which includes diverse strains well poised to interact in manners that influence host physiology. Microbiome analysis was facilitated by high throughput sequencing methods, but primer biases continue to limit recovery of diverse sequences from even moderately complex communities. PMID:21437280

  4. Isolation and sequence analysis of the Pseudomonas syringae pv. tomato gene encoding a 2,3-diphosphoglycerate-independent phosphoglyceromutase.

    PubMed

    Morris, V L; Jackson, D P; Grattan, M; Ainsworth, T; Cuppels, D A

    1995-04-01

    Pseudomonas syringae pv. tomato DC3481, a Tn5-induced mutant of the tomato pathogen DC3000, cannot grow and elicit disease symptoms on tomato seedlings. It also cannot grow on minimal medium containing malate, citrate, or succinate, three of the major organic acids found in tomatoes. We report here that this mutant also cannot use, as a sole carbon and/or energy source, a wide variety of hexoses and intermediates of hexose catabolism. Uptake studies have shown that DC3481 is not deficient in transport. A 3.8-kb EcoRI fragment of DC3000 DNA, which complements the Tn5 mutation, has been cloned and sequenced. The deduced amino acid sequences of two of the three open reading frames (ORFs) present on this fragment, ORF2 and ORF3, had no significant homology with sequences in the GenBank databases. However, the 510-amino-acid sequence of ORF1, the site of the Tn5 insertion, strongly resembled the deduced amino acid sequences of the Bacillus subtilis and Zea mays genes encoding 2,3-diphosphoglycerate (DPG)-independent phosphoglyceromutase (PGM) (52% identity and 72% similarity and 37% identity and 57% similarity, respectively). PGMs not requiring the cofactor DPG are usually found in plants and algae. Enzyme assays confirmed that P. syringae PGM activity required an intact ORF1. Not only is DC3481 the first PGM-deficient pseudomonad mutant to be described, but the P. syringae pgm gene is the first gram-negative bacterial gene identified that appears to code for a DPG-independent PGM. PGM activity appears essential for the growth and pathogenicity of P. syringae pv. tomato on its host plant.

  5. Isolation and sequence analysis of the Pseudomonas syringae pv. tomato gene encoding a 2,3-diphosphoglycerate-independent phosphoglyceromutase.

    PubMed Central

    Morris, V L; Jackson, D P; Grattan, M; Ainsworth, T; Cuppels, D A

    1995-01-01

    Pseudomonas syringae pv. tomato DC3481, a Tn5-induced mutant of the tomato pathogen DC3000, cannot grow and elicit disease symptoms on tomato seedlings. It also cannot grow on minimal medium containing malate, citrate, or succinate, three of the major organic acids found in tomatoes. We report here that this mutant also cannot use, as a sole carbon and/or energy source, a wide variety of hexoses and intermediates of hexose catabolism. Uptake studies have shown that DC3481 is not deficient in transport. A 3.8-kb EcoRI fragment of DC3000 DNA, which complements the Tn5 mutation, has been cloned and sequenced. The deduced amino acid sequences of two of the three open reading frames (ORFs) present on this fragment, ORF2 and ORF3, had no significant homology with sequences in the GenBank databases. However, the 510-amino-acid sequence of ORF1, the site of the Tn5 insertion, strongly resembled the deduced amino acid sequences of the Bacillus subtilis and Zea mays genes encoding 2,3-diphosphoglycerate (DPG)-independent phosphoglyceromutase (PGM) (52% identity and 72% similarity and 37% identity and 57% similarity, respectively). PGMs not requiring the cofactor DPG are usually found in plants and algae. Enzyme assays confirmed that P. syringae PGM activity required an intact ORF1. Not only is DC3481 the first PGM-deficient pseudomonad mutant to be described, but the P. syringae pgm gene is the first gram-negative bacterial gene identified that appears to code for a DPG-independent PGM. PGM activity appears essential for the growth and pathogenicity of P. syringae pv. tomato on its host plant. PMID:7896694

  6. Onset and establishment of diazotrophs and other bacterial associates in the early life history stages of the coral Acropora millepora.

    PubMed

    Lema, Kimberley A; Bourne, David G; Willis, Bette L

    2014-10-01

    Early establishment of coral-microbial symbioses is fundamental to the fitness of corals, but comparatively little is known about the onset and succession of bacterial communities in their early life history stages. In this study, bacterial associates of the coral Acropora millepora were characterized throughout the first year of life, from larvae and 1-week-old juveniles reared in laboratory conditions in the absence of the dinoflagellate endosymbiont Symbiodinium to field-outplanted juveniles with established Symbiodinium symbioses, and sampled at 2 weeks and at 3, 6 and 12 months. Using an amplicon pyrosequencing approach, the diversity of both nitrogen-fixing bacteria and of bacterial communities overall was assessed through analysis of nifH and 16S rRNA genes, respectively. The consistent presence of sequences affiliated with diazotrophs of the order Rhizobiales (23-58% of retrieved nifH sequences; 2-12% of 16S rRNA sequences), across all samples from larvae to 12-month-old coral juveniles, highlights the likely functional importance of this nitrogen-fixing order to the coral holobiont. Dominance of Roseobacter-affiliated sequences (>55% of retrieved 16S rRNA sequences) in larvae and 1-week-old juveniles, and the consistent presence of sequences related to Oceanospirillales and Altermonadales throughout all early life history stages, signifies their potential importance as coral associates. Increased diversity of bacterial communities once juveniles were transferred to the field, particularly of Cyanobacteria and Deltaproteobacteria, demonstrates horizontal (environmental) uptake of coral-associated bacterial communities. Although overall bacterial communities were dynamic, bacteria with likely important functional roles remain stable throughout early life stages of Acropora millepora. © 2014 John Wiley & Sons Ltd.

  7. Mechanism for DNA transposons to generate introns on genomic scales

    PubMed Central

    Huff, Jason T.; Zilberman, Daniel; Roy, Scott W.

    2017-01-01

    Discovered four decades ago, the existence of introns was one of the most unexpected findings in molecular biology1. Introns are sequences interrupting genes that must be removed as part of mRNA production. Genome sequencing projects have documented that most eukaryotic genes contain at least one and frequently many introns2,3. Comparison of these genomes reveals a history of long evolutionary periods with little intron gain punctuated by episodes of rapid, extensive gain2,3. However, no detailed mechanism for such episodic intron generation has been empirically supported on a sufficient scale, despite several proposals4–8. Here we show how short non-autonomous DNA transposons independently generated hundreds to thousands of introns in the prasinophyte Micromonas pusilla and the pelagophyte Aureococcus anophagefferens. Each transposon carries one splice site. The other splice site is co-opted from gene sequence duplicated upon transposon insertion, allowing perfect splicing out of RNA. The distributions of sequences that can be co-opted are biased with respect to codons, and phasing of transposon-generated introns is similarly biased. These transposons insert between preexisting nucleosomes, so that multiple nearby insertions generate nucleosome-sized intervening segments. Thus, transposon insertion and sequence co-option may explain the intron phase biases2 and prevalence of nucleosome-sized exons9 observed in eukaryotes. Overall, the two independent examples of proliferating elements illustrate a general DNA transposon mechanism plausibly accounting for episodes of rapid, extensive intron gain during eukaryotic evolution2,3. PMID:27760113

  8. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    PubMed

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  9. Metallization of bacterial cellulose for electrical and electronic device manufacture

    DOEpatents

    Evans, Barbara R [Oak Ridge, TN; O'Neill, Hugh M [Knoxville, TN; Jansen, Valerie Malyvanh [Memphis, TN; Woodward, Jonathan [Knoxville, TN

    2011-06-07

    A method for the deposition of metals in bacterial cellulose and for the employment of the metallized bacterial cellulose in the construction of fuel cells and other electronic devices is disclosed. The method for impregnating bacterial cellulose with a metal comprises placing a bacterial cellulose matrix in a solution of a metal salt such that the metal salt is reduced to metallic form and the metal precipitates in or on the matrix. The method for the construction of a fuel cell comprises placing a hydrated bacterial cellulose support structure in a solution of a metal salt such that the metal precipitates in or on the support structure, inserting contact wires into two pieces of the metal impregnated support structure, placing the two pieces of metal impregnated support structure on opposite sides of a layer of hydrated bacterial cellulose, and dehydrating the three layer structure to create a fuel cell.

  10. Metallization of bacterial cellulose for electrical and electronic device manufacture

    DOEpatents

    Evans, Barbara R [Oak Ridge, TN; O'Neill, Hugh M [Knoxville, TN; Jansen, Valerie Malyvanh [Memphis, TN; Woodward, Jonathan [Knoxville, TN

    2010-09-28

    A method for the deposition of metals in bacterial cellulose and for the employment of the metallized bacterial cellulose in the construction of fuel cells and other electronic devices is disclosed. The method for impregnating bacterial cellulose with a metal comprises placing a bacterial cellulose matrix in a solution of a metal salt such that the metal salt is reduced to metallic form and the metal precipitates in or on the matrix. The method for the construction of a fuel cell comprises placing a hydrated bacterial cellulose support structure in a solution of a metal salt such that the metal precipitates in or on the support structure, inserting contact wires into two pieces of the metal impregnated support structure, placing the two pieces of metal impregnated support structure on opposite sides of a layer of hydrated bacterial cellulose, and dehydrating the three layer structure to create a fuel cell.

  11. Detection of Bacterial Pathogens from Broncho-Alveolar Lavage by Next-Generation Sequencing.

    PubMed

    Leo, Stefano; Gaïa, Nadia; Ruppé, Etienne; Emonet, Stephane; Girard, Myriam; Lazarevic, Vladimir; Schrenzel, Jacques

    2017-09-20

    The applications of whole-metagenome shotgun sequencing (WMGS) in routine clinical analysis are still limited. A combination of a DNA extraction procedure, sequencing, and bioinformatics tools is essential for the removal of human DNA and for improving bacterial species identification in a timely manner. We tackled these issues with a broncho-alveolar lavage (BAL) sample from an immunocompromised patient who had developed severe chronic pneumonia. We extracted DNA from the BAL sample with protocols based either on sequential lysis of human and bacterial cells or on the mechanical disruption of all cells. Metagenomic libraries were sequenced on Illumina HiSeq platforms. Microbial community composition was determined by k-mer analysis or by mapping to taxonomic markers. Results were compared to those obtained by conventional clinical culture and molecular methods. Compared to mechanical cell disruption, a sequential lysis protocol resulted in a significantly increased proportion of bacterial DNA over human DNA and higher sequence coverage of Mycobacterium abscessus , Corynebacterium jeikeium and Rothia dentocariosa , the bacteria reported by clinical microbiology tests. In addition, we identified anaerobic bacteria not searched for by the clinical laboratory. Our results further support the implementation of WMGS in clinical routine diagnosis for bacterial identification.

  12. A Predictive Model of Intein Insertion Site for Use in the Engineering of Molecular Switches

    PubMed Central

    Apgar, James; Ross, Mary; Zuo, Xiao; Dohle, Sarah; Sturtevant, Derek; Shen, Binzhang; de la Vega, Humberto; Lessard, Philip; Lazar, Gabor; Raab, R. Michael

    2012-01-01

    Inteins are intervening protein domains with self-splicing ability that can be used as molecular switches to control activity of their host protein. Successfully engineering an intein into a host protein requires identifying an insertion site that permits intein insertion and splicing while allowing for proper folding of the mature protein post-splicing. By analyzing sequence and structure based properties of native intein insertion sites we have identified four features that showed significant correlation with the location of the intein insertion sites, and therefore may be useful in predicting insertion sites in other proteins that provide native-like intein function. Three of these properties, the distance to the active site and dimer interface site, the SVM score of the splice site cassette, and the sequence conservation of the site showed statistically significant correlation and strong predictive power, with area under the curve (AUC) values of 0.79, 0.76, and 0.73 respectively, while the distance to secondary structure/loop junction showed significance but with less predictive power (AUC of 0.54). In a case study of 20 insertion sites in the XynB xylanase, two features of native insertion sites showed correlation with the splice sites and demonstrated predictive value in selecting non-native splice sites. Structural modeling of intein insertions at two sites highlighted the role that the insertion site location could play on the ability of the intein to modulate activity of the host protein. These findings can be used to enrich the selection of insertion sites capable of supporting intein splicing and hosting an intein switch. PMID:22649521

  13. Ericoid Roots and Mycospheres Govern Plant-Specific Bacterial Communities in Boreal Forest Humus.

    PubMed

    Timonen, Sari; Sinkko, Hanna; Sun, Hui; Sietiö, Outi-Maaria; Rinta-Kanto, Johanna M; Kiheri, Heikki; Heinonsalo, Jussi

    2017-05-01

    In this study, the bacterial populations of roots and mycospheres of the boreal pine forest ericoid plants, heather (Calluna vulgaris), bilberry (Vaccinium myrtillus), and lingonberry (Vaccinium vitis-idaea), were studied by qPCR and next-generation sequencing (NGS). All bacterial communities of mycosphere soils differed from soils uncolonized by mycorrhizal mycelia. Colonization by mycorrhizal hyphae increased the total number of bacterial 16S ribosomal DNA (rDNA) gene copies in the humus but decreased the number of different bacterial operational taxonomic units (OTUs). Nevertheless, ericoid roots and mycospheres supported numerous OTUs not present in uncolonized humus. Bacterial communities in bilberry mycospheres were surprisingly similar to those in pine mycospheres but not to bacterial communities in heather and lingonberry mycospheres. In contrast, bacterial communities of ericoid roots were more similar to each other than to those of pine roots. In all sample types, the relative abundances of bacterial sequences belonging to Alphaproteobacteria and Acidobacteria were higher than the sequences belonging to other classes. Soil samples contained more Actinobacteria, Deltaproteobacteria, Opitutae, and Planctomycetia, whereas Armatimonadia, Betaproteobacteria, Gammaproteobacteria, and Sphingobacteriia were more common to roots. All mycosphere soils and roots harbored bacteria unique to that particular habitat. Our study suggests that the habitation by ericoid plants increases the overall bacterial diversity of boreal forest soils.

  14. Modeling the integration of bacterial rRNA fragments into the human cancer genome.

    PubMed

    Sieber, Karsten B; Gajer, Pawel; Dunning Hotopp, Julie C

    2016-03-21

    Cancer is a disease driven by the accumulation of genomic alterations, including the integration of exogenous DNA into the human somatic genome. We previously identified in silico evidence of DNA fragments from a Pseudomonas-like bacteria integrating into the 5'-UTR of four proto-oncogenes in stomach cancer sequencing data. The functional and biological consequences of these bacterial DNA integrations remain unknown. Modeling of these integrations suggests that the previously identified sequences cover most of the sequence flanking the junction between the bacterial and human DNA. Further examination of these reads reveals that these integrations are rich in guanine nucleotides and the integrated bacterial DNA may have complex transcript secondary structures. The models presented here lay the foundation for future experiments to test if bacterial DNA integrations alter the transcription of the human genes.

  15. Open and closed conformations of two SpoIIAA-like proteins (YP_749275.1 and YP_001095227.1) provide insights into membrane association and ligand binding

    PubMed Central

    Kumar, Abhinav; Lomize, Andrei; Jin, Kevin K.; Carlton, Dennis; Miller, Mitchell D.; Jaroszewski, Lukasz; Abdubek, Polat; Astakhova, Tamara; Axelrod, Herbert L.; Chiu, Hsiu-Ju; Clayton, Thomas; Das, Debanu; Deller, Marc C.; Duan, Lian; Feuerhelm, Julie; Grant, Joanna C.; Grzechnik, Anna; Han, Gye Won; Klock, Heath E.; Knuth, Mark W.; Kozbial, Piotr; Krishna, S. Sri; Marciano, David; McMullan, Daniel; Morse, Andrew T.; Nigoghossian, Edward; Okach, Linda; Reyes, Ron; Rife, Christopher L.; Sefcovic, Natasha; Tien, Henry J.; Trame, Christine B.; van den Bedem, Henry; Weekes, Dana; Xu, Qingping; Hodgson, Keith O.; Wooley, John; Elsliger, Marc-André; Deacon, Ashley M.; Godzik, Adam; Lesley, Scott A.; Wilson, Ian A.

    2010-01-01

    The crystal structures of the proteins encoded by the YP_749275.1 and YP_001095227.1 genes from Shewanella frigidimarina and S. loihica, respectively, have been determined at 1.8 and 2.25 Å resolution, respectively. These proteins are members of a novel family of bacterial proteins that adopt the α/β SpoIIAA-like fold found in STAS and CRAL-TRIO domains. Despite sharing 54% sequence identity, these two proteins adopt distinct conformations arising from different dispositions of their α2 and α3 helices. In the ‘open’ conformation (YP_001095227.1), these helices are 15 Å apart, leading to the creation of a deep nonpolar cavity. In the ‘closed’ structure (YP_749275.1), the helices partially unfold and rearrange, occluding the cavity and decreasing the solvent-exposed hydrophobic surface. These two complementary structures are reminiscent of the conformational switch in CRAL-TRIO carriers of hydrophobic compounds. It is suggested that both proteins may associate with the lipid bilayer in their ‘open’ monomeric state by inserting their amphiphilic helices, α2 and α3, into the lipid bilayer. These bacterial proteins may function as carriers of nonpolar substances or as interfacially activated enzymes. PMID:20944218

  16. Rapid and efficient introduction of a foreign gene into bacterial artificial chromosome-cloned varicella vaccine by Tn7-mediated site-specific transposition

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Somboonthum, Pranee; Koshizuka, Tetsuo; Okamoto, Shigefumi

    2010-06-20

    Using a rapid and reliable system based on Tn7-mediated site-specific transposition, we have successfully constructed a recombinant Oka varicella vaccine (vOka) expressing the mumps virus (MuV) fusion protein (F). The backbone of the vector was our previously reported vOka-BAC (bacterial artificial chromosome) genome. We inserted the transposon Tn7 attachment sequence, LacZ{alpha}-mini-attTn7, into the region between ORF12 and ORF13 to generate a vOka-BAC-Tn genome. The MuV-F expressing cassette was transposed into the vOka-BAC genome at the mini-attTn7 transposition site. MuV-F protein was expressed in recombinant virus, rvOka-F infected cells. In addition, the MuV-F protein was cleaved in the rvOka-F infected cellsmore » as in MuV-infected cells. The growth of rvOka-F was similar to that of the original recombinant vOka without the F gene. Thus, we show that Tn7-mediated transposition is an efficient method for introducing a foreign gene expression cassette into the vOka-BAC genome as a live virus vector.« less

  17. Insertion sequences enrichment in extreme Red sea brine pool vent.

    PubMed

    Elbehery, Ali H A; Aziz, Ramy K; Siam, Rania

    2017-03-01

    Mobile genetic elements are major agents of genome diversification and evolution. Limited studies addressed their characteristics, including abundance, and role in extreme habitats. One of the rare natural habitats exposed to multiple-extreme conditions, including high temperature, salinity and concentration of heavy metals, are the Red Sea brine pools. We assessed the abundance and distribution of different mobile genetic elements in four Red Sea brine pools including the world's largest known multiple-extreme deep-sea environment, the Red Sea Atlantis II Deep. We report a gradient in the abundance of mobile genetic elements, dramatically increasing in the harshest environment of the pool. Additionally, we identified a strong association between the abundance of insertion sequences and extreme conditions, being highest in the harshest and deepest layer of the Red Sea Atlantis II Deep. Our comparative analyses of mobile genetic elements in secluded, extreme and relatively non-extreme environments, suggest that insertion sequences predominantly contribute to polyextremophiles genome plasticity.

  18. Complete Genome Sequence of a Novel Newcastle Disease Virus Strain Isolated from a Chicken in West Africa

    PubMed Central

    Kim, Shin-Hee; Nayak, Subhashree; Paldurai, Anandan; Nayak, Baibaswata; Samuel, Arthur; Aplogan, Gilbert L.; Awoume, Kodzo A.; Webby, Richard J.; Ducatez, Mariette F.; Collins, Peter L.

    2012-01-01

    The complete genome sequence of an African Newcastle disease virus (NDV) strain isolated from a chicken in Togo in 2009 was determined. The genome is 15,198 nucleotides (nt) in length and is classified in genotype VII in the class II cluster. Compared to common vaccine strains, the African strain contains a previously described 6-nt insert in the downstream untranslated region of the N gene and a novel 6-nt insert in the HN-L intergenic region. Genome length differences are a marker of the natural history of NDV. This is the first description of a class II NDV strain with a genome of 15,198 nt and a 6-nt insert in the HN-L intergenic region. Sequence divergence relative to vaccine strains was substantial, likely contributes to outbreaks, and illustrates the continued evolution of new NDV strains in West Africa. PMID:22997417

  19. Phage display of the serpin alpha-1 proteinase inhibitor randomized at consecutive residues in the reactive centre loop and biopanned with or without thrombin.

    PubMed

    Scott, Benjamin M; Matochko, Wadim L; Gierczak, Richard F; Bhakta, Varsha; Derda, Ratmir; Sheffield, William P

    2014-01-01

    In spite of the power of phage display technology to identify variant proteins with novel properties in large libraries, it has only been previously applied to one member of the serpin superfamily. Here we describe phage display of human alpha-1 proteinase inhibitor (API) in a T7 bacteriophage system. API M358R fused to the C-terminus of T7 capsid protein 10B was directly shown to form denaturation-resistant complexes with thrombin by electrophoresis and immunoblotting following exposure of intact phages to thrombin. We therefore developed a biopanning protocol in which thrombin-reactive phages were selected using biotinylated anti-thrombin antibodies and streptavidin-coated magnetic beads. A library consisting of displayed API randomized at residues 357 and 358 (P2-P1) yielded predominantly Pro-Arg at these positions after five rounds of thrombin selection; in contrast the same degree of mock selection yielded only non-functional variants. A more diverse library of API M358R randomized at residues 352-356 (P7-P3) was also probed, yielding numerous variants fitting a loose consensus of DLTVS as judged by sequencing of the inserts of plaque-purified phages. The thrombin-selected sequences were transferred en masse into bacterial expression plasmids, and lysates from individual colonies were screening for API-thrombin complexing. The most active candidates from this sixth round of screening contained DITMA and AAFVS at P7-P3 and inhibited thrombin 2.1-fold more rapidly than API M358R with no change in reaction stoichiometry. Deep sequencing using the Ion Torrent platform confirmed that over 800 sequences were significantly enriched in the thrombin-panned versus naïve phage display library, including some detected using the combined phage display/bacterial lysate screening approach. Our results show that API joins Plasminogen Activator Inhibitor-1 (PAI-1) as a serpin amenable to phage display and suggest the utility of this approach for the selection of "designer serpins" with novel reactivity and/or specificity.

  20. Phage Display of the Serpin Alpha-1 Proteinase Inhibitor Randomized at Consecutive Residues in the Reactive Centre Loop and Biopanned with or without Thrombin

    PubMed Central

    Scott, Benjamin M.; Matochko, Wadim L.; Gierczak, Richard F.; Bhakta, Varsha; Derda, Ratmir; Sheffield, William P.

    2014-01-01

    In spite of the power of phage display technology to identify variant proteins with novel properties in large libraries, it has only been previously applied to one member of the serpin superfamily. Here we describe phage display of human alpha-1 proteinase inhibitor (API) in a T7 bacteriophage system. API M358R fused to the C-terminus of T7 capsid protein 10B was directly shown to form denaturation-resistant complexes with thrombin by electrophoresis and immunoblotting following exposure of intact phages to thrombin. We therefore developed a biopanning protocol in which thrombin-reactive phages were selected using biotinylated anti-thrombin antibodies and streptavidin-coated magnetic beads. A library consisting of displayed API randomized at residues 357 and 358 (P2–P1) yielded predominantly Pro-Arg at these positions after five rounds of thrombin selection; in contrast the same degree of mock selection yielded only non-functional variants. A more diverse library of API M358R randomized at residues 352–356 (P7–P3) was also probed, yielding numerous variants fitting a loose consensus of DLTVS as judged by sequencing of the inserts of plaque-purified phages. The thrombin-selected sequences were transferred en masse into bacterial expression plasmids, and lysates from individual colonies were screening for API-thrombin complexing. The most active candidates from this sixth round of screening contained DITMA and AAFVS at P7–P3 and inhibited thrombin 2.1-fold more rapidly than API M358R with no change in reaction stoichiometry. Deep sequencing using the Ion Torrent platform confirmed that over 800 sequences were significantly enriched in the thrombin-panned versus naïve phage display library, including some detected using the combined phage display/bacterial lysate screening approach. Our results show that API joins Plasminogen Activator Inhibitor-1 (PAI-1) as a serpin amenable to phage display and suggest the utility of this approach for the selection of “designer serpins” with novel reactivity and/or specificity. PMID:24427287

  1. Multilayer polyelectrolyte films functionalized by insertion of defensin: a new approach to protection of implants from bacterial colonization.

    PubMed

    Etienne, O; Picart, C; Taddei, C; Haikel, Y; Dimarcq, J L; Schaaf, P; Voegel, J C; Ogier, J A; Egles, C

    2004-10-01

    Infection of implanted materials by bacteria constitutes one of the most serious complications following prosthetic surgery. In the present study, we developed a new strategy based on the insertion of an antimicrobial peptide (defensin from Anopheles gambiae mosquitoes) into polyelectrolyte multilayer films built by the alternate deposition of polyanions and polycations. Quartz crystal microbalance and streaming potential measurements were used to follow step by step the construction of the multilayer films and embedding of the defensin within the films. Antimicrobial assays were performed with two strains: Micrococcus luteus (a gram-positive bacterium) and Escherichia coli D22 (a gram-negative bacterium). The inhibition of E. coli D22 growth at the surface of defensin-functionalized films was found to be 98% when 10 antimicrobial peptide layers were inserted in the film architecture. Noticeably, the biofunctionalization could be achieved only when positively charged poly(l-lysine) was the outermost layer of the film. On the basis of the results of bacterial adhesion experiments observed by confocal or electron microscopy, these observations could result from the close interaction of the bacteria with the positively charged ends of the films, which allows defensin to interact with the bacterial membrane structure. These results open new possibilities for the use of such easily built and functionalized architectures onto any type of implantable biomaterial. The modified surfaces are active against microbial infection and represent a novel means of local host protection.

  2. CRISPRDetect: A flexible algorithm to define CRISPR arrays.

    PubMed

    Biswas, Ambarish; Staals, Raymond H J; Morales, Sergio E; Fineran, Peter C; Brown, Chris M

    2016-05-17

    CRISPR (clustered regularly interspaced short palindromic repeats) RNAs provide the specificity for noncoding RNA-guided adaptive immune defence systems in prokaryotes. CRISPR arrays consist of repeat sequences separated by specific spacer sequences. CRISPR arrays have previously been identified in a large proportion of prokaryotic genomes. However, currently available detection algorithms do not utilise recently discovered features regarding CRISPR loci. We have developed a new approach to automatically detect, predict and interactively refine CRISPR arrays. It is available as a web program and command line from bioanalysis.otago.ac.nz/CRISPRDetect. CRISPRDetect discovers putative arrays, extends the array by detecting additional variant repeats, corrects the direction of arrays, refines the repeat/spacer boundaries, and annotates different types of sequence variations (e.g. insertion/deletion) in near identical repeats. Due to these features, CRISPRDetect has significant advantages when compared to existing identification tools. As well as further support for small medium and large repeats, CRISPRDetect identified a class of arrays with 'extra-large' repeats in bacteria (repeats 44-50 nt). The CRISPRDetect output is integrated with other analysis tools. Notably, the predicted spacers can be directly utilised by CRISPRTarget to predict targets. CRISPRDetect enables more accurate detection of arrays and spacers and its gff output is suitable for inclusion in genome annotation pipelines and visualisation. It has been used to analyse all complete bacterial and archaeal reference genomes.

  3. Clinical characteristics of severe congenital neutropenia caused by novel ELANE gene mutations.

    PubMed

    Shu, Zhou; Li, Xiao-Hui; Bai, Xiao-Ming; Zhang, Zhi-Yong; Jiang, Li-ping; Tang, Xue-Mei; Zhao, Xiao-dong

    2015-02-01

    Mutations within the ELANE gene, which encodes human neutrophil elastase, are the most common genetic causes of severe congenital neutropenia (SCN). No cases of SCN have been previously described from a Chinese population. Herein, we describe the clinical, hematologic and molecular characteristics of 7 Chinese SCN cases with novel ELANE mutations. Seven Chinese pediatric patients (4 males and 3 females) with suspected SCN were enrolled in this study. Clinical data, peripheral blood, bone marrow and immune function were evaluated for SCN. ELANE genomic DNA and cDNA sequences from patients and potential carriers were analyzed using polymerase chain reaction (PCR) and direct sequencing. All the7 patients experienced recurrent infection (soft tissue, lung, oral cavity) during a period of 120 days. Noninfectious conditions such as anemia and osteopenia were found in most patients, and absolute peripheral neutrophil counts varied. DNA and cDNA sequencing demonstrated that the patients harbored a range of heterozygous ELANE gene mutations, including substitution, deletion, insertion and frame shift alterations. All the mutations had not been reported previously; however, no mutation carriers were identified among the parents or siblings, even in a family with 2 affected offspring. SCN cases were identified for the first time in China, and all patients carried novel ELANE mutations. Granulocyte-colony stimulating factor (G-CSF) was an effective treatment for most of the SCN patients and prevented life-threatening bacterial infections.

  4. The map-based genome sequence of Spirodela polyrhiza aligned with its chromosomes, a reference for karyotype evolution.

    PubMed

    Cao, Hieu Xuan; Vu, Giang Thi Ha; Wang, Wenqin; Appenroth, Klaus J; Messing, Joachim; Schubert, Ingo

    2016-01-01

    Duckweeds are aquatic monocotyledonous plants of potential economic interest with fast vegetative propagation, comprising 37 species with variable genome sizes (0.158-1.88 Gbp). The genomic sequence of Spirodela polyrhiza, the smallest and the most ancient duckweed genome, needs to be aligned to its chromosomes as a reference and prerequisite to study the genome and karyotype evolution of other duckweed species. We selected physically mapped bacterial artificial chromosomes (BACs) containing Spirodela DNA inserts with little or no repetitive elements as probes for multicolor fluorescence in situ hybridization (mcFISH), using an optimized BAC pooling strategy, to validate its physical map and correlate it with its chromosome complement. By consecutive mcFISH analyses, we assigned the originally assembled 32 pseudomolecules (supercontigs) of the genomic sequences to the 20 chromosomes of S. polyrhiza. A Spirodela cytogenetic map containing 96 BAC markers with an average distance of 0.89 Mbp was constructed. Using a cocktail of 41 BACs in three colors, all chromosome pairs could be individualized simultaneously. Seven ancestral blocks emerged from duplicated chromosome segments of 19 Spirodela chromosomes. The chromosomally integrated genome of S. polyrhiza and the established prerequisites for comparative chromosome painting enable future studies on the chromosome homoeology and karyotype evolution of duckweed species. © 2015 IPK Gatersleben. New Phytologist © 2015 New Phytologist Trust.

  5. PIMMS (Pragmatic Insertional Mutation Mapping System) Laboratory Methodology a Readily Accessible Tool for Identification of Essential Genes in Streptococcus

    PubMed Central

    Blanchard, Adam M.; Egan, Sharon A.; Emes, Richard D.; Warry, Andrew; Leigh, James A.

    2016-01-01

    The Pragmatic Insertional Mutation Mapping (PIMMS) laboratory protocol was developed alongside various bioinformatics packages (Blanchard et al., 2015) to enable detection of essential and conditionally essential genes in Streptococcus and related bacteria. This extended the methodology commonly used to locate insertional mutations in individual mutants to the analysis of mutations in populations of bacteria. In Streptococcus uberis, a pyogenic Streptococcus associated with intramammary infection and mastitis in ruminants, the mutagen pGhost9:ISS1 was shown to integrate across the entire genome. Analysis of >80,000 mutations revealed 196 coding sequences, which were not be mutated and a further 67 where mutation only occurred beyond the 90th percentile of the coding sequence. These sequences showed good concordance with sequences within the database of essential genes and typically matched sequences known to be associated with basic cellular functions. Due to the broad utility of this mutagen and the simplicity of the methodology it is anticipated that PIMMS will be of value to a wide range of laboratories in functional genomic analysis of a wide range of Gram positive bacteria (Streptococcus, Enterococcus, and Lactococcus) of medical, veterinary, and industrial significance. PMID:27826289

  6. A Sequence of Sorting Strategies.

    ERIC Educational Resources Information Center

    Duncan, David R.; Litwiller, Bonnie H.

    1984-01-01

    Describes eight increasingly sophisticated and efficient sorting algorithms including linear insertion, binary insertion, shellsort, bubble exchange, shakersort, quick sort, straight selection, and tree selection. Provides challenges for the reader and the student to program these efficiently. (JM)

  7. Acid-triggered membrane insertion of Pseudomonas exotoxin A involves an original mechanism based on pH-regulated tryptophan exposure.

    PubMed

    Méré, Jocelyn; Morlon-Guyot, Juliette; Bonhoure, Anne; Chiche, Laurent; Beaumelle, Bruno

    2005-06-03

    Exposure to low endosomal pH during internalization of Pseudomonas exotoxin A (PE) triggers membrane insertion of its translocation domain. This process is a prerequisite for PE translocation to the cytosol where it inactivates protein synthesis. Although hydrophobic helices enable membrane insertion of related bacterial toxins such as diphtheria toxin, the PE translocation domain is devoid of hydrophobic stretches and the structural features triggering acid-induced membrane insertion of PE are not known. Here we have identified a molecular device that enables PE membrane insertion. This process is promoted by exposure of a key tryptophan residue. At neutral pH, this Trp is buried in a hydrophobic pocket closed by the smallest alpha-helix of the translocation domain. Upon acidification, protonation of the Asp that is the N-cap residue of the helix leads to its destabilization, enabling Trp side chain insertion into the endosome membrane. This tryptophan-based membrane insertion system is surprisingly similar to the membrane-anchoring mechanism of human annexin-V and could be used by other proteins as well.

  8. Whole-Genome Sequencing and Concordance Between Antimicrobial Susceptibility Genotypes and Phenotypes of Bacterial Isolates Associated with Bovine Respiratory Disease

    PubMed Central

    Owen, Joseph R.; Noyes, Noelle; Young, Amy E.; Prince, Daniel J.; Blanchard, Patricia C.; Lehenbauer, Terry W.; Aly, Sharif S.; Davis, Jessica H.; O’Rourke, Sean M.; Abdo, Zaid; Belk, Keith; Miller, Michael R.; Morley, Paul; Van Eenennaam, Alison L.

    2017-01-01

    Extended laboratory culture and antimicrobial susceptibility testing timelines hinder rapid species identification and susceptibility profiling of bacterial pathogens associated with bovine respiratory disease, the most prevalent cause of cattle mortality in the United States. Whole-genome sequencing offers a culture-independent alternative to current bacterial identification methods, but requires a library of bacterial reference genomes for comparison. To contribute new bacterial genome assemblies and evaluate genetic diversity and variation in antimicrobial resistance genotypes, whole-genome sequencing was performed on bovine respiratory disease–associated bacterial isolates (Histophilus somni, Mycoplasma bovis, Mannheimia haemolytica, and Pasteurella multocida) from dairy and beef cattle. One hundred genomically distinct assemblies were added to the NCBI database, doubling the available genomic sequences for these four species. Computer-based methods identified 11 predicted antimicrobial resistance genes in three species, with none being detected in M. bovis. While computer-based analysis can identify antibiotic resistance genes within whole-genome sequences (genotype), it may not predict the actual antimicrobial resistance observed in a living organism (phenotype). Antimicrobial susceptibility testing on 64 H. somni, M. haemolytica, and P. multocida isolates had an overall concordance rate between genotype and phenotypic resistance to the associated class of antimicrobials of 72.7% (P < 0.001), showing substantial discordance. Concordance rates varied greatly among different antimicrobial, antibiotic resistance gene, and bacterial species combinations. This suggests that antimicrobial susceptibility phenotypes are needed to complement genomically predicted antibiotic resistance gene genotypes to better understand how the presence of antibiotic resistance genes within a given bacterial species could potentially impact optimal bovine respiratory disease treatment and morbidity/mortality outcomes. PMID:28739600

  9. Whole-Genome Sequencing and Concordance Between Antimicrobial Susceptibility Genotypes and Phenotypes of Bacterial Isolates Associated with Bovine Respiratory Disease.

    PubMed

    Owen, Joseph R; Noyes, Noelle; Young, Amy E; Prince, Daniel J; Blanchard, Patricia C; Lehenbauer, Terry W; Aly, Sharif S; Davis, Jessica H; O'Rourke, Sean M; Abdo, Zaid; Belk, Keith; Miller, Michael R; Morley, Paul; Van Eenennaam, Alison L

    2017-09-07

    Extended laboratory culture and antimicrobial susceptibility testing timelines hinder rapid species identification and susceptibility profiling of bacterial pathogens associated with bovine respiratory disease, the most prevalent cause of cattle mortality in the United States. Whole-genome sequencing offers a culture-independent alternative to current bacterial identification methods, but requires a library of bacterial reference genomes for comparison. To contribute new bacterial genome assemblies and evaluate genetic diversity and variation in antimicrobial resistance genotypes, whole-genome sequencing was performed on bovine respiratory disease-associated bacterial isolates ( Histophilus somni , Mycoplasma bovis , Mannheimia haemolytica , and Pasteurella multocida ) from dairy and beef cattle. One hundred genomically distinct assemblies were added to the NCBI database, doubling the available genomic sequences for these four species. Computer-based methods identified 11 predicted antimicrobial resistance genes in three species, with none being detected in M. bovis While computer-based analysis can identify antibiotic resistance genes within whole-genome sequences (genotype), it may not predict the actual antimicrobial resistance observed in a living organism (phenotype). Antimicrobial susceptibility testing on 64 H. somni , M. haemolytica , and P. multocida isolates had an overall concordance rate between genotype and phenotypic resistance to the associated class of antimicrobials of 72.7% ( P < 0.001), showing substantial discordance. Concordance rates varied greatly among different antimicrobial, antibiotic resistance gene, and bacterial species combinations. This suggests that antimicrobial susceptibility phenotypes are needed to complement genomically predicted antibiotic resistance gene genotypes to better understand how the presence of antibiotic resistance genes within a given bacterial species could potentially impact optimal bovine respiratory disease treatment and morbidity/mortality outcomes. Copyright © 2017 Owen et al.

  10. Complete genome analysis of three Acinetobacter baumannii clinical isolates in China for insight into the diversification of drug resistance elements.

    PubMed

    Zhu, Lingxiang; Yan, Zhongqiang; Zhang, Zhaojun; Zhou, Qiming; Zhou, Jinchun; Wakeland, Edward K; Fang, Xiangdong; Xuan, Zhenyu; Shen, Dingxia; Li, Quan-Zhen

    2013-01-01

    The emergence and rapid spreading of multidrug-resistant Acinetobacter baumannii strains has become a major health threat worldwide. To better understand the genetic recombination related with the acquisition of drug-resistant elements during bacterial infection, we performed complete genome analysis on three newly isolated multidrug-resistant A. baumannii strains from Beijing using next-generation sequencing technology. Whole genome comparison revealed that all 3 strains share some common drug resistant elements including carbapenem-resistant bla OXA-23 and tetracycline (tet) resistance islands, but the genome structures are diversified among strains. Various genomic islands intersperse on the genome with transposons and insertions, reflecting the recombination flexibility during the acquisition of the resistant elements. The blood-isolated BJAB07104 and ascites-isolated BJAB0868 exhibit high similarity on their genome structure with most of the global clone II strains, suggesting these two strains belong to the dominant outbreak strains prevalent worldwide. A large resistance island (RI) of about 121-kb, carrying a cluster of resistance-related genes, was inserted into the ATPase gene on BJAB07104 and BJAB0868 genomes. A 78-kb insertion element carrying tra-locus and bla OXA-23 island, can be either inserted into one of the tniB gene in the 121-kb RI on the chromosome, or transformed to conjugative plasmid in the two BJAB strains. The third strains of this study, BJAB0715, which was isolated from spinal fluid, exhibit much more divergence compared with above two strains. It harbors multiple drug-resistance elements including a truncated AbaR-22-like RI on its genome. One of the unique features of this strain is that it carries both bla OXA-23 and bla OXA-58 genes on its genome. Besides, an Acinetobacter lwoffii adeABC efflux element was found inserted into the ATPase position in BJAB0715. Our comparative analysis on currently completed Acinetobacter baumannii genomes revealed extensive and dynamic genome organizations, which may facilitate the bacteria to acquire drug-resistance elements into their genomes.

  11. Retroviral insertions in the VISION database identify molecular pathways in mouse lymphoid leukemia and lymphoma

    PubMed Central

    Weiser, Keith C.; Liu, Bin; Hansen, Gwenn M.; Skapura, Darlene; Hentges, Kathryn E.; Yarlagadda, Sujatha; Morse III, Herbert C.

    2007-01-01

    AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFκB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision. PMID:17926094

  12. Retroviral insertions in the VISION database identify molecular pathways in mouse lymphoid leukemia and lymphoma.

    PubMed

    Weiser, Keith C; Liu, Bin; Hansen, Gwenn M; Skapura, Darlene; Hentges, Kathryn E; Yarlagadda, Sujatha; Morse Iii, Herbert C; Justice, Monica J

    2007-10-01

    AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFkappaB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision .

  13. Phylogenetic Placement of Exact Amplicon Sequences Improves Associations with Clinical Information

    PubMed Central

    McDonald, Daniel; Gonzalez, Antonio; Navas-Molina, Jose A.; Jiang, Lingjing; Xu, Zhenjiang Zech; Winker, Kevin; Kado, Deborah M.; Orwoll, Eric; Manary, Mark; Mirarab, Siavash

    2018-01-01

    ABSTRACT Recent algorithmic advances in amplicon-based microbiome studies enable the inference of exact amplicon sequence fragments. These new methods enable the investigation of sub-operational taxonomic units (sOTU) by removing erroneous sequences. However, short (e.g., 150-nucleotide [nt]) DNA sequence fragments do not contain sufficient phylogenetic signal to reproduce a reasonable tree, introducing a barrier in the utilization of critical phylogenetically aware metrics such as Faith’s PD or UniFrac. Although fragment insertion methods do exist, those methods have not been tested for sOTUs from high-throughput amplicon studies in insertions against a broad reference phylogeny. We benchmarked the SATé-enabled phylogenetic placement (SEPP) technique explicitly against 16S V4 sequence fragments and showed that it outperforms the conceptually problematic but often-used practice of reconstructing de novo phylogenies. In addition, we provide a BSD-licensed QIIME2 plugin (https://github.com/biocore/q2-fragment-insertion) for SEPP and integration into the microbial study management platform QIITA. IMPORTANCE The move from OTU-based to sOTU-based analysis, while providing additional resolution, also introduces computational challenges. We demonstrate that one popular method of dealing with sOTUs (building a de novo tree from the short sequences) can provide incorrect results in human gut metagenomic studies and show that phylogenetic placement of the new sequences with SEPP resolves this problem while also yielding other benefits over existing methods. PMID:29719869

  14. Comparative genomic survey, exon-intron annotation and phylogenetic analysis of NAT-homologous sequences in archaea, protists, fungi, viruses, and invertebrates

    USDA-ARS?s Scientific Manuscript database

    We have previously published extensive genomic surveys [1-3], reporting NAT-homologous sequences in hundreds of sequenced bacterial, fungal and vertebrate genomes. We present here the results of our latest search of 2445 genomes, representing 1532 (70 archaeal, 1210 bacterial, 43 protist, 97 fungal,...

  15. Genomic library screening for viruses from the human dental plaque revealed pathogen-specific lytic phage sequences.

    PubMed

    Al-Jarbou, Ahmed Nasser

    2012-01-01

    Bacterial pathogenesis presents an astounding arsenal of virulence factors that allow them to conquer many different niches throughout the course of infection. Principally fascinating is the fact that some bacterial species are able to induce different diseases by expression of different combinations of virulence factors. Nevertheless, studies aiming at screening for the presence of bacteriophages in humans have been limited. Such screening procedures would eventually lead to identification of phage-encoded properties that impart increased bacterial fitness and/or virulence in a particular niche, and hence, would potentially be used to reverse the course of bacterial infections. As the human oral cavity represents a rich and dynamic ecosystem for several upper respiratory tract pathogens. However, little is known about virus diversity in human dental plaque which is an important reservoir. We applied the culture-independent approach to characterize virus diversity in human dental plaque making a library from a virus DNA fraction amplified using a multiple displacement method and sequenced 80 clones. The resulting sequence showed 44% significant identities to GenBank databases by TBLASTX analysis. TBLAST homology comparisons showed that 66% was viral; 18% eukarya; 10% bacterial; 6% mobile elements. These sequences were sorted into 6 contigs and 45 single sequences in which 4 contigs and a single sequence showed significant identity to a small region of a putative prophage in the Corynebacterium diphtheria genome. These findings interestingly highlight the uniqueness of over half of the sequences, whilst the dominance of a pathogen-specific prophage sequences imply their role in virulence.

  16. Vertical Distribution of Bacterial Communities in the Indian Ocean as Revealed by Analyses of 16S rRNA and nasA Genes.

    PubMed

    Jiang, Xuexia; Jiao, Nianzhi

    2016-09-01

    Bacteria play an important role in the marine biogeochemical cycles. However, research on the bacterial community structure of the Indian Ocean is scarce, particularly within the vertical dimension. In this study, we investigated the bacterial diversity of the pelagic, mesopelagic and bathypelagic zones of the southwestern Indian Ocean (50.46°E, 37.71°S). The clone libraries constructed by 16S rRNA gene sequence revealed that most phylotypes retrieved from the Indian Ocean were highly divergent from those retrieved from other oceans. Vertical differences were observed based on the analysis of natural bacterial community populations derived from the 16S rRNA gene sequences. Based on the analysis of the nasA gene sequences from GenBank database, a pair of general primers was developed and used to amplify the bacterial nitrate-assimilating populations. Environmental factors play an important role in mediating the bacterial communities in the Indian Ocean revealed by canonical correlation analysis.

  17. Cytochrome P450 diversity in the tree of life.

    PubMed

    Nelson, David R

    2018-01-01

    Sequencing in all areas of the tree of life has produced >300,000 cytochrome P450 (CYP) sequences that have been mined and collected. Nomenclature has been assigned to >41,000 CYP sequences and the majority of the remainder has been sorted by BLAST searches into clans, families and subfamilies in preparation for naming. The P450 sequence space is being systematically explored and filled in. Well-studied groups like vertebrates are covered in greater depth while new insights are being added into uncharted territories like horseshoe crab (Limulus polyphemus), tardigrades (Hypsibius dujardini), velvet worm (Euperipatoides_rowelli), and basal land plants like hornworts, liverworts and mosses. CYPs from the fungi, one of the most diverse groups, are being explored and organized as nearly 800 fungal species are now sequenced. The CYP clan structure in fungi is emerging with 805 CYP families sorting into 32 CYP clans. >3000 bacterial sequences are named, mostly from terrestrial or freshwater sources. Of 18,379 bacterial sequences downloaded from the CYPED database, all are >43% identical to named CYPs. Therefore, they fit in the 602 named P450 prokaryotic families. Diversity in this group is becoming saturated, however 25% of 3305 seawater bacterial P450s did not match known P450 families, indicating marine bacterial CYPs are not as well sampled as land/freshwater based bacterial CYPs. Future sequencing plans of the Genome 10K project, i5k and GIGA (Global Invertebrate Genomics Alliance) are expected to produce more than one million cytochrome P450 sequences by 2020. This article is part of a Special Issue entitled: Cytochrome P450 biodiversity and biotechnology, edited by Erika Plettner, Gianfranco Gilardi, Luet Wong, Vlada Urlacher, Jared Goldstone. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Detecting macroecological patterns in bacterial communities across independent studies of global soils.

    PubMed

    Ramirez, Kelly S; Knight, Christopher G; de Hollander, Mattias; Brearley, Francis Q; Constantinides, Bede; Cotton, Anne; Creer, Si; Crowther, Thomas W; Davison, John; Delgado-Baquerizo, Manuel; Dorrepaal, Ellen; Elliott, David R; Fox, Graeme; Griffiths, Robert I; Hale, Chris; Hartman, Kyle; Houlden, Ashley; Jones, David L; Krab, Eveline J; Maestre, Fernando T; McGuire, Krista L; Monteux, Sylvain; Orr, Caroline H; van der Putten, Wim H; Roberts, Ian S; Robinson, David A; Rocca, Jennifer D; Rowntree, Jennifer; Schlaeppi, Klaus; Shepherd, Matthew; Singh, Brajesh K; Straathof, Angela L; Bhatnagar, Jennifer M; Thion, Cécile; van der Heijden, Marcel G A; de Vries, Franciska T

    2018-02-01

    The emergence of high-throughput DNA sequencing methods provides unprecedented opportunities to further unravel bacterial biodiversity and its worldwide role from human health to ecosystem functioning. However, despite the abundance of sequencing studies, combining data from multiple individual studies to address macroecological questions of bacterial diversity remains methodically challenging and plagued with biases. Here, using a machine-learning approach that accounts for differences among studies and complex interactions among taxa, we merge 30 independent bacterial data sets comprising 1,998 soil samples from 21 countries. Whereas previous meta-analysis efforts have focused on bacterial diversity measures or abundances of major taxa, we show that disparate amplicon sequence data can be combined at the taxonomy-based level to assess bacterial community structure. We find that rarer taxa are more important for structuring soil communities than abundant taxa, and that these rarer taxa are better predictors of community structure than environmental factors, which are often confounded across studies. We conclude that combining data from independent studies can be used to explore bacterial community dynamics, identify potential 'indicator' taxa with an important role in structuring communities, and propose hypotheses on the factors that shape bacterial biogeography that have been overlooked in the past.

  19. Differential signatures of bacterial and mammalian IMP dehydrogenase enzymes.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, R.; Evans, G.; Rotella, F.

    1999-06-01

    IMP dehydrogenase (IMPDH) is an essential enzyme of de novo guanine nucleotide synthesis. IMPDH inhibitors have clinical utility as antiviral, anticancer or immunosuppressive agents. The essential nature of this enzyme suggests its therapeutic applications may be extended to the development of antimicrobial agents. Bacterial IMPDH enzymes show bio- chemical and kinetic characteristics that are different than the mammalian IMPDH enzymes, suggesting IMPDH may be an attractive target for the development of antimicrobial agents. We suggest that the biochemical and kinetic differences between bacterial and mammalian enzymes are a consequence of the variance of specific, identifiable amino acid residues. Identification ofmore » these residues or combination of residues that impart this mammalian or bacterial enzyme signature is a prerequisite for the rational identification of agents that specifically target the bacterial enzyme. We used sequence alignments of IMPDH proteins to identify sequence signatures associated with bacterial or eukaryotic IMPDH enzymes. These selections were further refined to discern those likely to have a role in catalysis using information derived from the bacterial and mammalian IMPDH crystal structures and site-specific mutagenesis. Candidate bacterial sequence signatures identified by this process include regions involved in subunit interactions, the active site flap and the NAD binding region. Analysis of sequence alignments in these regions indicates a pattern of catalytic residues conserved in all enzymes and a secondary pattern of amino acid conservation associated with the major phylogenetic groups. Elucidation of the basis for this mammalian/bacterial IMPDH signature will provide insight into the catalytic mechanism of this enzyme and the foundation for the development of highly specific inhibitors.« less

  20. Soil Parameters Drive the Structure, Diversity and Metabolic Potentials of the Bacterial Communities Across Temperate Beech Forest Soil Sequences.

    PubMed

    Jeanbille, M; Buée, M; Bach, C; Cébron, A; Frey-Klett, P; Turpault, M P; Uroz, S

    2016-02-01

    Soil and climatic conditions as well as land cover and land management have been shown to strongly impact the structure and diversity of the soil bacterial communities. Here, we addressed under a same land cover the potential effect of the edaphic parameters on the soil bacterial communities, excluding potential confounding factors as climate. To do this, we characterized two natural soil sequences occurring in the Montiers experimental site. Spatially distant soil samples were collected below Fagus sylvatica tree stands to assess the effect of soil sequences on the edaphic parameters, as well as the structure and diversity of the bacterial communities. Soil analyses revealed that the two soil sequences were characterized by higher pH and calcium and magnesium contents in the lower plots. Metabolic assays based on Biolog Ecoplates highlighted higher intensity and richness in usable carbon substrates in the lower plots than in the middle and upper plots, although no significant differences occurred in the abundance of bacterial and fungal communities along the soil sequences as assessed using quantitative PCR. Pyrosequencing analysis of 16S ribosomal RNA (rRNA) gene amplicons revealed that Proteobacteria, Acidobacteria and Bacteroidetes were the most abundantly represented phyla. Acidobacteria, Proteobacteria and Chlamydiae were significantly enriched in the most acidic and nutrient-poor soils compared to the Bacteroidetes, which were significantly enriched in the soils presenting the higher pH and nutrient contents. Interestingly, aluminium, nitrogen, calcium, nutrient availability and pH appeared to be the best predictors of the bacterial community structures along the soil sequences.

  1. Transposon variation by order during allopolyploidisation between Brassica oleracea and Brassica rapa.

    PubMed

    An, Z; Tang, Z; Ma, B; Mason, A S; Guo, Y; Yin, J; Gao, C; Wei, L; Li, J; Fu, D

    2014-07-01

    Although many studies have shown that transposable element (TE) activation is induced by hybridisation and polyploidisation in plants, much less is known on how different types of TE respond to hybridisation, and the impact of TE-associated sequences on gene function. We investigated the frequency and regularity of putative transposon activation for different types of TE, and determined the impact of TE-associated sequence variation on the genome during allopolyploidisation. We designed different types of TE primers and adopted the Inter-Retrotransposon Amplified Polymorphism (IRAP) method to detect variation in TE-associated sequences during the process of allopolyploidisation between Brassica rapa (AA) and Brassica oleracea (CC), and in successive generations of self-pollinated progeny. In addition, fragments with TE insertions were used to perform Blast2GO analysis to characterise the putative functions of the fragments with TE insertions. Ninety-two primers amplifying 548 loci were used to detect variation in sequences associated with four different orders of TE sequences. TEs could be classed in ascending frequency into LTR-REs, TIRs, LINEs, SINEs and unknown TEs. The frequency of novel variation (putative activation) detected for the four orders of TEs was highest from the F1 to F2 generations, and lowest from the F2 to F3 generations. Functional annotation of sequences with TE insertions showed that genes with TE insertions were mainly involved in metabolic processes and binding, and preferentially functioned in organelles. TE variation in our study severely disturbed the genetic compositions of the different generations, resulting in inconsistencies in genetic clustering. Different types of TE showed different patterns of variation during the process of allopolyploidisation. © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.

  2. In vitro optimization of truncated stem-loop II variants of the hammerhead ribozyme for cleavage in low concentrations of magnesium under non-turnover conditions.

    PubMed Central

    Zillmann, M; Limauro, S E; Goodchild, J

    1997-01-01

    By truncating helix II to two base pairs in a hammerhead ribozyme having long flanking sequences (greater than 30 bases), the rate of cleavage in 1 mM magnesium can be increased roughly 100-fold. Replacing most of the nucleotides in a typical stem-loop II with 1-4 randomized nucleotides gave an RNA library that, even before selection, was more active in 1 mM magnesium than the parent ribozyme, but considerably less active than the truncated stem-loop II ribozyme. A novel, multiround selection for intermolecular cleavage was exploited to optimize this library for cleavage in low concentrations of magnesium. After three rounds of selection at sequentially lower concentrations of magnesium, the library cleaved substrate RNA 20-fold faster than the initial pool and was cloned. This pool was heavily enriched for one particular sequence (5'-CGUG-3') that represented 16 of 52 isolates (the next most common sequence was represented only six times). This sequence also represented the most active sequence, exceeding the activity of the short helix II variant under the conditions of the selection, thereby demonstrating the effectiveness of the selection technique. Analysis of the cleavage rates of RNAs made from eight isolates having different four-base insert sequences allowed assignment of highly preferred bases at each position in the insert. Analysis of pool clones having insert of differing lengths showed that, in general, activity decreased as the length of the insert decreased from 4 to 1. This supports the suggested role of stem-loop II in stabilizing the non-Watson-Crick interactions between the conserved bases of the catalytic core. PMID:9214657

  3. Entire plastid phylogeny of the carrot genus (Daucus, Apiaceae): Concordance with nuclear data and mitochondrial and nuclear DNA insertions to the plastid.

    PubMed

    Spooner, David M; Ruess, Holly; Iorizzo, Massimo; Senalik, Douglas; Simon, Philipp

    2017-02-01

    We explored the phylogenetic utility of entire plastid DNA sequences in Daucus and compared the results with prior phylogenetic results using plastid and nuclear DNA sequences. We used Illumina sequencing to obtain full plastid sequences of 37 accessions of 20 Daucus taxa and outgroups, analyzed the data with phylogenetic methods, and examined evidence for mitochondrial DNA transfer to the plastid ( Dc MP). Our phylogenetic trees of the entire data set were highly resolved, with 100% bootstrap support for most of the external and many of the internal clades, except for the clade of D. carota and its most closely related species D. syrticus . Subsets of the data, including regions traditionally used as phylogenetically informative regions, provide various degrees of soft congruence with the entire data set. There are areas of hard incongruence, however, with phylogenies using nuclear data. We extended knowledge of a mitochondrial to plastid DNA insertion sequence previously named Dc MP and identified the first instance in flowering plants of a sequence of potential nuclear genome origin inserted into the plastid genome. There is a relationship of inverted repeat junction classes and repeat DNA to phylogeny, but no such relationship with nonsynonymous mutations. Our data have allowed us to (1) produce a well-resolved plastid phylogeny of Daucus , (2) evaluate subsets of the entire plastid data for phylogeny, (3) examine evidence for plastid and nuclear DNA phylogenetic incongruence, and (4) examine mitochondrial and nuclear DNA insertion into the plastid. © 2017 Spooner et al. Published by the Botanical Society of America. This work is licensed under a Creative Commons public domain license (CC0 1.0).

  4. Few mitochondrial DNA sequences are inserted into the turkey (Meleagris gallopavo) nuclear genome: evolutionary analyses and informativity in the domestic lineage.

    PubMed

    Schiavo, G; Strillacci, M G; Ribani, A; Bovo, S; Roman-Ponce, S I; Cerolini, S; Bertolini, F; Bagnato, A; Fontanesi, L

    2018-06-01

    Mitochondrial DNA (mtDNA) insertions have been detected in the nuclear genome of many eukaryotes. These sequences are pseudogenes originated by horizontal transfer of mtDNA fragments into the nuclear genome, producing nuclear DNA sequences of mitochondrial origin (numt). In this study we determined the frequency and distribution of mtDNA-originated pseudogenes in the turkey (Meleagris gallopavo) nuclear genome. The turkey reference genome (Turkey_2.01) was aligned with the reference linearized mtDNA sequence using last. A total of 32 numt sequences (corresponding to 18 numt regions derived by unique insertional events) were identified in the turkey nuclear genome (size ranging from 66 to 1415 bp; identity against the modern turkey mtDNA corresponding region ranging from 62% to 100%). Numts were distributed in nine chromosomes and in one scaffold. They derived from parts of 10 mtDNA protein-coding genes, ribosomal genes, the control region and 10 tRNA genes. Seven numt regions reported in the turkey genome were identified in orthologues positions in the Gallus gallus genome and therefore were present in the ancestral genome that in the Cretaceous originated the lineages of the modern crown Galliformes. Five recently integrated turkey numts were validated by PCR in 168 turkeys of six different domestic populations. None of the analysed numts were polymorphic (i.e. absence of the inserted sequence, as reported in numts of recent integration in other species), suggesting that the reticulate speciation model is not useful for explaining the origin of the domesticated turkey lineage. © 2018 Stichting International Foundation for Animal Genetics.

  5. MRKAd5 HIV-1 Gag/Pol/Nef Vaccine-Induced T-Cell Responses Inadequately Predict Distance of Breakthrough HIV-1 Sequences to the Vaccine or Viral Load

    PubMed Central

    Janes, Holly; Frahm, Nicole; DeCamp, Allan; Rolland, Morgane; Gabriel, Erin; Wolfson, Julian; Hertz, Tomer; Kallas, Esper; Goepfert, Paul; Friedrich, David P.; Corey, Lawrence; Mullins, James I.; McElrath, M. Juliana; Gilbert, Peter

    2012-01-01

    Background The sieve analysis for the Step trial found evidence that breakthrough HIV-1 sequences for MRKAd5/HIV-1 Gag/Pol/Nef vaccine recipients were more divergent from the vaccine insert than placebo sequences in regions with predicted epitopes. We linked the viral sequence data with immune response and acute viral load data to explore mechanisms for and consequences of the observed sieve effect. Methods Ninety-one male participants (37 placebo and 54 vaccine recipients) were included; viral sequences were obtained at the time of HIV-1 diagnosis. T-cell responses were measured 4 weeks post-second vaccination and at the first or second week post-diagnosis. Acute viral load was obtained at RNA-positive and antibody-negative visits. Findings Vaccine recipients had a greater magnitude of post-infection CD8+ T cell response than placebo recipients (median 1.68% vs 1.18%; p = 0·04) and greater breadth of post-infection response (median 4.5 vs 2; p = 0·06). Viral sequences for vaccine recipients were marginally more divergent from the insert than placebo sequences in regions of Nef targeted by pre-infection immune responses (p = 0·04; Pol p = 0·13; Gag p = 0·89). Magnitude and breadth of pre-infection responses did not correlate with distance of the viral sequence to the insert (p>0·50). Acute log viral load trended lower in vaccine versus placebo recipients (estimated mean 4·7 vs 5·1) but the difference was not significant (p = 0·27). Neither was acute viral load associated with distance of the viral sequence to the insert (p>0·30). Interpretation Despite evidence of anamnestic responses, the sieve effect was not well explained by available measures of T-cell immunogenicity. Sequence divergence from the vaccine was not significantly associated with acute viral load. While point estimates suggested weak vaccine suppression of viral load, the result was not significant and more viral load data would be needed to detect suppression. PMID:22952672

  6. Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar)

    PubMed Central

    Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn

    2009-01-01

    Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining cDNA libraries generated by SGP represent a valuable cCDS FLIc source. The conservation of 7-mers in 3'UTRs indicates that these motifs are functionally important. Identity between some of these 7-mers and miRNA target sequences suggests that they are miRNA targets in Salmo salar transcripts as well. PMID:19878547

  7. Sequence variations of the partially dominant DELLA gene Rht-B1c in wheat and their functional impacts

    PubMed Central

    Ma, Zhengqiang

    2013-01-01

    Rht-B1c, allelic to the DELLA protein-encoding gene Rht-B1a, is a natural mutation documented in common wheat (Triticum aestivum). It confers variation to a number of traits related to cell and plant morphology, seed dormancy, and photosynthesis. The present study was conducted to examine the sequence variations of Rht-B1c and their functional impacts. The results showed that Rht-B1c was partially dominant or co-dominant for plant height, and exhibited an increased dwarfing effect. At the sequence level, Rht-B1c differed from Rht-B1a by one 2kb Veju retrotransposon insertion, three coding region single nucleotide polymorphisms (SNPs), one 197bp insertion, and four SNPs in the 1kb upstream sequence. Haplotype investigations, association analyses, transient expression assays, and expression profiling showed that the Veju insertion was primarily responsible for the extreme dwarfing effect. It was found that the Veju insertion changed processing of the Rht-B1c transcripts and resulted in DELLA motif primary structure disruption. Expression assays showed that Rht-B1c caused reduction of total Rht-1 transcript levels, and up-regulation of GATA-like transcription factors and genes positively regulated by these factors, suggesting that one way in which Rht-1 proteins affect plant growth and development is through GATA-like transcription factor regulation. PMID:23918966

  8. Construction of cDNA library from intestine, mesentery and coelomocyte of Apostichopus japonicus Selenka infected with Vibrio sp. and a preliminary analysis of immunity-related genes

    NASA Astrophysics Data System (ADS)

    Liu, Hongzhan; Zheng, Fengrong; Sun, Xiuqin; Cai, Yimei

    2012-06-01

    The aquaculture of sea cucumber Apostichopus japonicus (Echinodermata, Holothuroidea) has grown rapidly during recent years and has become an important sector of the marine industry in Northern China. However, with the rapid growth of the industry and the use of non-standard culture techniques, epidemic diseases of A. japonicus now pose increasing problems to the industry. To screen the genes with stress response to bacterial infection in sea cucumber at a genome wide level, we constructed a cDNA library from A. japonicus Selenka (Aspidochirotida: Stichopodidae) after infecting them with Vibrio sp. for 48 h. Total RNA was extracted from the intestine, mesentery and coelomocyte of infected sea cucumber using Trizol and mRNA was isolated by Oligotex mRNA Kits. The ligated cDNAs were transformed into DH5α, and a library of 3.24×105 clones (3.24×105 cfu mL-1) was obtained with the sizes of inserted fragments ranging from 0.8 to 2.5 kb. Sequencing the cDNA clones resulted in a total of 1106 ESTs that passed the quality control. BlastX and BlastN searches have identified 168 (31.5%) ESTs sharing significant homology with known sequences in NCBI protein or nucleotide databases. Among a panel of 25 putative immunity-related genes, serum lectin isoform, complement component 3, complement component 3-like genes were further studied by real-time PCR and they all increased more than 5 fold in response to Vibrio sp. challenge. Our library provides a valuable molecular tool for future study of invertebrate immunity against bacterial infection and our gene expression data indicates the importance of the immune system in the evolution and development of sea cucumber.

  9. Insertion and deletion mutagenesis of the human cytomegalovirus genome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Spaete, R.R.; Mocarski, E.S.

    1987-10-01

    Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less

  10. Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe

    PubMed Central

    2012-01-01

    Background Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. Results An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. Conclusions This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches. PMID:22554201

  11. Genome-Wide Spectra of Transcription Insertions and Deletions Reveal That Slippage Depends on RNA:DNA Hybrid Complementarity

    PubMed Central

    Traverse, Charles C.

    2017-01-01

    ABSTRACT Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola, which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. PMID:28851848

  12. [Construction of a general AAV vector regulated by minimal and artificial hypoxic-responsive element].

    PubMed

    Nie, Xiao-wei; Sun, Li-jun; Hao, Yue-wen; Yang, Guang-xiao; Wang, Quan-ying

    2011-03-01

    To synthesize the minimal and artificial HRE, and to insert it into the anterior extremity of CMV promoter of a AAV plasmid, and then to construct the AAV regulated by hypoxic-responsive element which was introduced into 293 cell by method of Ca3(PO4)2 using three plasmids. Thus obtaining the adenoassociated virus vector regulated by hypoxic-responsive element was possibly used for gene therapy in ischemia angiocardiopathy and cerebrovascular disease. Artificially synthesize the 36 bp nucleotide sequences of four connection in series HIF-binding sites A/GCGTG(4×HBS)and a 35 bp nucleotide sequences spacing inserted into anterior extremity of CMV promoter TATA Box, then amplified by PCR. The cDNA fragment was confirmed to be right by DNA sequencing. Molecular biology routine method was used to construct a AAV vector regulated by minimal hypoxic-responsive element after the normal CMV promoter in AAV vector was replaced by the CMV promoter included minimal hypoxic-responsive element. Then, NT4-6His-PR39 fusogenic peptide was inserted into MCS of the plasmid, the recombinant AAV vector was obtained by three plasmid co-transfection in 293 cells, in which we can also investigate the expression of 6×His using immunochemistry in hypoxia environment. Artificial HRE was inserted into anterior extremity of CMV promoter and there was a correct spacing between the HRE and the TATA-box. The DNA sequencing and restriction enzyme digestion results indicated that the AAV regulated by hypoxic-responsive element was successfully constructed. Compared to the control group, the expressions of 6×His was significantly increased in the experimental groups in hypoxia environment, which confirmed that the AAV effectually regulated by the minimal HRE was inserted into anterior extremity of CMV promoter. The HRE is inserted into anterior extremity of CMV promoter to lack incision enzyme recognition site by PCR. And eukaryotic expression vector regulated by hypoxic-responsive is constructed. The AAV effectually regulated by the minimal HRE inserted into anterior extremity of CMV promoter. The vector is successfully constructed and it has important theoretical and practical value in the synteresis and therapy of ischemia angiocardiopathy and cerebrovascular disease.

  13. Equivalent Indels – Ambiguous Functional Classes and Redundancy in Databases

    PubMed Central

    Assmus, Jens; Kleffe, Jürgen; Schmitt, Armin O.; Brockmann, Gudrun A.

    2013-01-01

    There is considerable interest in studying sequenced variations. However, while the positions of substitutions are uniquely identifiable by sequence alignment, the location of insertions and deletions still poses problems. Each insertion and deletion causes a change of sequence. Yet, due to low complexity or repetitive sequence structures, the same indel can sometimes be annotated in different ways. Two indels which differ in allele sequence and position can be one and the same, i.e. the alternative sequence of the whole chromosome is identical in both cases and, therefore, the two deletions are biologically equivalent. In such a case, it is impossible to identify the exact position of an indel merely based on sequence alignment. Thus, variation entries in a mutation database are not necessarily uniquely defined. We prove the existence of a contiguous region around an indel in which all deletions of the same length are biologically identical. Databases often show only one of several possible locations for a given variation. Furthermore, different data base entries can represent equivalent variation events. We identified 1,045,590 such problematic entries of insertions and deletions out of 5,860,408 indel entries in the current human database of Ensembl. Equivalent indels are found in sequence regions of different functions like exons, introns or 5' and 3' UTRs. One and the same variation can be assigned to several different functional classifications of which only one is correct. We implemented an algorithm that determines for each indel database entry its complete set of equivalent indels which is uniquely characterized by the indel itself and a given interval of the reference sequence. PMID:23658777

  14. Complete Genome Sequence of Lactobacillus rhamnosus Strain BPL5 (CECT 8800), a Probiotic for Treatment of Bacterial Vaginosis.

    PubMed

    Chenoll, Empar; Codoñer, Francisco M; Martinez-Blanch, Juan F; Ramón, Daniel; Genovés, Salvador; Menabrito, Marco

    2016-04-21

    ITALIC! Lactobacillus rhamnosusBPL5 (CECT 8800), is a probiotic strain suitable for the treatment of bacterial vaginosis. Here, we report its complete genome sequence deciphered by PacBio single-molecule real-time (SMRT) technology. Analysis of the sequence may provide insight into its functional activity. Copyright © 2016 Chenoll et al.

  15. Bacterial Genome Engineering and Synthetic Biology: Combating Pathogens

    DTIC Science & Technology

    2016-11-04

    engineering and SB methods such as recombineering, clustered regularly interspaced short palindromic repeats ( CRISPR ), and bacterial cell-cell...Cholera# Yersinia pseudotuberculosis# Staphylococcus aureus* Phage Engineering CRISPR /Cas9 Delivery of CRISPR genes and RNA guides for sequence...bear very close sequence alignment to the harmless strains via the use of the CRISPR /Cas9 system. The CRISPR system specifically targets a DNA sequence

  16. Bacterial diversity in three distinct sub-habitats within the pitchers of the northern pitcher plant, Sarracenia purpurea.

    PubMed

    Krieger, Joseph R; Kourtev, Peter S

    2012-03-01

    Pitcher plants have been widely used in ecological studies of food webs; however, their bacterial communities are poorly characterized. Pitchers of Sarracenia purpurea contain several distinct sub-habitats, namely the bottom sediment, the liquid, and the internal pitcher wall. We hypothesized that those three sub-habitats within pitcher plants are inhabited by distinct bacterial populations. We used denaturing gradient gel electrophoresis and 16S rRNA gene sequencing to characterize bacterial populations in pitchers from three bogs. DGGE and sequencing revealed that in any given pitcher, the three sub-habitats contain significantly different bacterial populations. However, there was significant variability between bacterial populations inhabiting the same type of habitat in different pitchers, even at the same site. Therefore, no consistent set of bacterial populations was enriched in any of the three sub-habitats. All sub-habitats appeared to be dominated by alpha- and betaproteobacteria in differing proportions. In addition, sequences from the Bacteroidetes and Firmicutes were obtained from all three sub-habitats. We conclude that container aquatic habitats such as the pitchers of S. purpurea possess a very high bacterial diversity, with many unique bacterial populations enriched in individual pitchers. Within an individual pitcher, populations of certain bacterial families may be enriched in one of the three studied sub-habitats. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  17. The Comprehensive Phytopathogen Genomics Resource: a web-based resource for data-mining plant pathogen genomes.

    PubMed

    Hamilton, John P; Neeno-Eckwall, Eric C; Adhikari, Bishwo N; Perna, Nicole T; Tisserat, Ned; Leach, Jan E; Lévesque, C André; Buell, C Robin

    2011-01-01

    The Comprehensive Phytopathogen Genomics Resource (CPGR) provides a web-based portal for plant pathologists and diagnosticians to view the genome and trancriptome sequence status of 806 bacterial, fungal, oomycete, nematode, viral and viroid plant pathogens. Tools are available to search and analyze annotated genome sequences of 74 bacterial, fungal and oomycete pathogens. Oomycete and fungal genomes are obtained directly from GenBank, whereas bacterial genome sequences are downloaded from the A Systematic Annotation Package (ASAP) database that provides curation of genomes using comparative approaches. Curated lists of bacterial genes relevant to pathogenicity and avirulence are also provided. The Plant Pathogen Transcript Assemblies Database provides annotated assemblies of the transcribed regions of 82 eukaryotic genomes from publicly available single pass Expressed Sequence Tags. Data-mining tools are provided along with tools to create candidate diagnostic markers, an emerging use for genomic sequence data in plant pathology. The Plant Pathogen Ribosomal DNA (rDNA) database is a resource for pathogens that lack genome or transcriptome data sets and contains 131 755 rDNA sequences from GenBank for 17 613 species identified as plant pathogens and related genera. Database URL: http://cpgr.plantbiology.msu.edu.

  18. Bacterial inosine 5'-monophosphate dehydrogenase ("IMPDH") DNA as a dominant selectable marker in mammals and other eukaryotes

    DOEpatents

    Huberman, Eliezer [Chicago, IL; Baccam, Mekhine J [Woodridge, IL

    2007-02-27

    The present invention relates to a nucleic acid sequence and its corresponding protein sequence useful as a dominant selectable marker in eukaryotes. More specifically the invention relates to a nucleic acid encoding a bacterial IMPDH gene that has been engineered into a eukaryotic expression vectors, thereby permitting bacterial IMPDH expression in mammalian cells. Bacterial IMPDH expression confers resistance to MPA which can be used as dominant selectable marker in eukaryotes including mammals. The invention also relates to expression vectors and cells that express the bacterial IMPDH gene as well as gene therapies and protein synthesis.

  19. Genetic Diversity of Bacterial Communities and Gene Transfer Agents in Northern South China Sea

    PubMed Central

    Sun, Fu-Lin; Wang, You-Shao; Wu, Mei-Lin; Jiang, Zhao-Yu; Sun, Cui-Ci; Cheng, Hao

    2014-01-01

    Pyrosequencing of the 16S ribosomal RNA gene (rDNA) amplicons was performed to investigate the unique distribution of bacterial communities in northern South China Sea (nSCS) and evaluate community structure and spatial differences of bacterial diversity. Cyanobacteria, Proteobacteria, Actinobacteria, and Bacteroidetes constitute the majority of bacteria. The taxonomic description of bacterial communities revealed that more Chroococcales, SAR11 clade, Acidimicrobiales, Rhodobacterales, and Flavobacteriales are present in the nSCS waters than other bacterial groups. Rhodobacterales were less abundant in tropical water (nSCS) than in temperate and cold waters. Furthermore, the diversity of Rhodobacterales based on the gene transfer agent (GTA) major capsid gene (g5) was investigated. Four g5 gene clone libraries were constructed from samples representing different regions and yielded diverse sequences. Fourteen g5 clusters could be identified among 197 nSCS clones. These clusters were also related to known g5 sequences derived from genome-sequenced Rhodobacterales. The composition of g5 sequences in surface water varied with the g5 sequences in the sampling sites; this result indicated that the Rhodobacterales population could be highly diverse in nSCS. Phylogenetic tree analysis result indicated distinguishable diversity patterns among tropical (nSCS), temperate, and cold waters, thereby supporting the niche adaptation of specific Rhodobacterales members in unique environments. PMID:25364820

  20. Genome Engineering in Bacillus anthracis Using Cre Recombinase

    PubMed Central

    Pomerantsev, Andrei P.; Sitaraman, Ramakrishnan; Galloway, Craig R.; Kivovich, Violetta; Leppla, Stephen H.

    2006-01-01

    Genome engineering is a powerful method for the study of bacterial virulence. With the availability of the complete genomic sequence of Bacillus anthracis, it is now possible to inactivate or delete selected genes of interest. However, many current methods for disrupting or deleting more than one gene require use of multiple antibiotic resistance determinants. In this report we used an approach that temporarily inserts an antibiotic resistance marker into a selected region of the genome and subsequently removes it, leaving the target region (a single gene or a larger genomic segment) permanently mutated. For this purpose, a spectinomycin resistance cassette flanked by bacteriophage P1 loxP sites oriented as direct repeats was inserted within a selected gene. After identification of strains having the spectinomycin cassette inserted by a double-crossover event, a thermo-sensitive plasmid expressing Cre recombinase was introduced at the permissive temperature. Cre recombinase action at the loxP sites excised the spectinomycin marker, leaving a single loxP site within the targeted gene or genomic segment. The Cre-expressing plasmid was then removed by growth at the restrictive temperature. The procedure could then be repeated to mutate additional genes. In this way, we sequentially mutated two pairs of genes: pepM and spo0A, and mcrB and mrr. Furthermore, loxP sites introduced at distant genes could be recombined by Cre recombinase to cause deletion of large intervening regions. In this way, we deleted the capBCAD region of the pXO2 plasmid and the entire 30 kb of chromosomal DNA between the mcrB and mrr genes, and in the latter case we found that the 32 intervening open reading frames were not essential to growth. PMID:16369025

  1. RNA from the 5' end of the R2 retrotransposon controls R2 protein binding to and cleavage of its DNA target site.

    PubMed

    Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H

    2006-11-21

    Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.

  2. Plastome Sequencing of Ten Nonmodel Crop Species Uncovers a Large Insertion of Mitochondrial DNA in Cashew.

    PubMed

    Rabah, Samar O; Lee, Chaehee; Hajrah, Nahid H; Makki, Rania M; Alharby, Hesham F; Alhebshi, Alawiah M; Sabir, Jamal S M; Jansen, Robert K; Ruhlman, Tracey A

    2017-11-01

    In plant evolution, intracellular gene transfer (IGT) is a prevalent, ongoing process. While nuclear and mitochondrial genomes are known to integrate foreign DNA via IGT and horizontal gene transfer (HGT), plastid genomes (plastomes) have resisted foreign DNA incorporation and only recently has IGT been uncovered in the plastomes of a few land plants. In this study, we completed plastome sequences for l0 crop species and describe a number of structural features including variation in gene and intron content, inversions, and expansion and contraction of the inverted repeat (IR). We identified a putative in cinnamon ( J. Presl) and other sequenced Lauraceae and an apparent functional transfer of to the nucleus of quinoa ( Willd.). In the orchard tree cashew ( L.), we report the insertion of an ∼6.7-kb fragment of mitochondrial DNA into the plastome IR. BLASTn analyses returned high identity hits to mitogenome sequences including an intact open reading frame. Using three plastome markers for five species of , we generated a phylogeny to investigate the distribution and timing of the insertion. Four species share the insertion, suggesting that this event occurred <20 million yr ago in a single clade in the genus. Our study extends the observation of mitochondrial to plastome IGT to include long-lived tree species. While previous studies have suggested possible mechanisms facilitating IGT to the plastome, more examples of this phenomenon, along with more complete mitogenome sequences, will be required before a common, or variable, mechanism can be elucidated. Copyright © 2017 Crop Science Society of America.

  3. Metagenomic analysis of bacterial and archaeal assemblages in the soil-mousse surrounding a geothermal spring.

    PubMed

    Bhatia, Sonu; Batra, Navneet; Pathak, Ashish; Joshi, Amit; Souza, Leila; Almeida, Paulo; Chauhan, Ashvini

    2015-09-01

    The soil-mousse surrounding a geothermal spring was analyzed for bacterial and archaeal diversity using 16S rRNA gene amplicon metagenomic sequencing which revealed the presence of 18 bacterial phyla distributed across 109 families and 219 genera. Firmicutes, Actinobacteria, and the Deinococcus-Thermus group were the predominant bacterial assemblages with Crenarchaeota and Thaumarchaeota as the main archaeal assemblages in this largely understudied geothermal habitat. Several metagenome sequences remained taxonomically unassigned suggesting the presence of a repertoire of hitherto undescribed microbes in this geothermal soil-mousse econiche.

  4. Development of bacterial biofilms in dairy processing lines.

    PubMed

    Austin, J W; Bergeron, G

    1995-08-01

    Adherence of bacteria to various milk contact sites was examined by scanning electron microscopy and transmission electron microscopy. New gaskets, endcaps, vacuum breaker plugs and pipeline inserts were installed in different areas in lines carrying either raw or pasteurized milk, and a routine schedule of cleaning-in-place and sanitizing was followed. Removed cleaned and sanitized gaskets were processed for scanning or transmission electron microscopy. Adherent bacteria were observed on the sides of gaskets removed from both pasteurized and raw milk lines. Some areas of Buna-n gaskets were colonized with a confluent layer of bacterial cells surrounded by an extensive amorphous matrix, while other areas of Buna-n gaskets showed a diffuse adherence over large areas of the surface. Most of the bacteria attached to polytetrafluoroethylene (PTFE or Teflon) gaskets were found in crevices created by insertion of the gasket into the pipeline. Examination of stainless steel endcaps, pipeline inserts, and PTFE vacuum breaker plugs did not reveal the presence of adherent bacteria. The results of this study indicate that biofilms developed on the sides of gaskets in spite of cleaning-in-place procedures. These biofilms may be a source of post-pasteurization contamination.

  5. Identification of a new steroid degrading bacterial strain H5 from the Baltic Sea and isolation of two estradiol inducible genes.

    PubMed

    Sang, Yingying; Xiong, Guangming; Maser, Edmund

    2012-03-01

    The presence of steroid hormones in the aquatic environment is potentially threatening the population dynamics of all kinds of sea animals and public health. Environmental estrogens in water have been reported to be associated with abnormal sexual development and abnormal feminizing responses in some animals. New approaches for the bioremediation of steroid hormones from the environment are therefore urgently sought. We have previously isolated a steroid degrading bacterial strain (H5) from the Baltic Sea, at Kiel, Germany. In the present investigation, 16S rRNA analysis showed that marine strain H5 belongs to the genus Vibrio, family Vibrionaceae and class Gamma-Proteobacteria. To enable identification of steroid inducible genes from bacterial strain H5, a library was constructed of H5 chromosomal DNA fragments cloned into a fluorescent reporter (pKEGFP-2). A reporter plasmid pK3α-4.6-EGFP3 containing the estrogen-inducible gene 3α-hydroxysteroid dehydrogenase/carbonyl reductase (3α-HSD/CR) from Comamonas testosteroni (C. testosteroni) was created as a positive control. Steroid induction could be detected by a microplate fluorescence reader, when the plasmids were transformed into Escherichia coli (E. coli) HB101 cells. With our meta-genomic pKEGFP-2 approach, we identified two estradiol-inducible genes from marine strain H5, which are obviously involved in steroid degradation. Sequencing of the pKEGFP-2 inserts and data base research at NCBI revealed that one gene corresponds to 3-ketosteroid-delta-1-dehydrogenase from several Mycobacterium strains, while the other showed high similarity to carboxylesterase in Sebadella termitidis and Brachyspira murdochii. Both 3-ketosteroid-delta-1-dehydrogenase and carboxylesterase are one of the first enzymes in steroid degradation. In addition, we identified a strain H5 specific DNA sequence of 480bp which allows sensitive PCR detection and quantification of strain H5 bacteria in "unknown" seawater samples. Currently, the exact characterization and systematic classification of the marine steroid degrading bacterial strain H5 is envisaged, which might be used for the bioremediation of steroid contaminations in seawater. Article from a special issue on steroids and microorganisms. Copyright © 2011 Elsevier Ltd. All rights reserved.

  6. Within-host evolution of Staphylococcus aureus during asymptomatic carriage.

    PubMed

    Golubchik, Tanya; Batty, Elizabeth M; Miller, Ruth R; Farr, Helen; Young, Bernadette C; Larner-Svensson, Hanna; Fung, Rowena; Godwin, Heather; Knox, Kyle; Votintseva, Antonina; Everitt, Richard G; Street, Teresa; Cule, Madeleine; Ip, Camilla L C; Didelot, Xavier; Peto, Timothy E A; Harding, Rosalind M; Wilson, Daniel J; Crook, Derrick W; Bowden, Rory

    2013-01-01

    Staphylococcus aureus is a major cause of healthcare associated mortality, but like many important bacterial pathogens, it is a common constituent of the normal human body flora. Around a third of healthy adults are carriers. Recent evidence suggests that evolution of S. aureus during nasal carriage may be associated with progression to invasive disease. However, a more detailed understanding of within-host evolution under natural conditions is required to appreciate the evolutionary and mechanistic reasons why commensal bacteria such as S. aureus cause disease. Therefore we examined in detail the evolutionary dynamics of normal, asymptomatic carriage. Sequencing a total of 131 genomes across 13 singly colonized hosts using the Illumina platform, we investigated diversity, selection, population dynamics and transmission during the short-term evolution of S. aureus. We characterized the processes by which the raw material for evolution is generated: micro-mutation (point mutation and small insertions/deletions), macro-mutation (large insertions/deletions) and the loss or acquisition of mobile elements (plasmids and bacteriophages). Through an analysis of synonymous, non-synonymous and intergenic mutations we discovered a fitness landscape dominated by purifying selection, with rare examples of adaptive change in genes encoding surface-anchored proteins and an enterotoxin. We found evidence for dramatic, hundred-fold fluctuations in the size of the within-host population over time, which we related to the cycle of colonization and clearance. Using a newly-developed population genetics approach to detect recent transmission among hosts, we revealed evidence for recent transmission between some of our subjects, including a husband and wife both carrying populations of methicillin-resistant S. aureus (MRSA). This investigation begins to paint a picture of the within-host evolution of an important bacterial pathogen during its prevailing natural state, asymptomatic carriage. These results also have wider significance as a benchmark for future systematic studies of evolution during invasive S. aureus disease.

  7. Regulation of Bioluminescence in Photobacterium leiognathi Strain KNH6

    PubMed Central

    Rader, Bethany A.; Stabb, Eric V.; Mandel, Mark J.

    2015-01-01

    ABSTRACT Bacterial bioluminescence is taxonomically restricted to certain proteobacteria, many of which belong to the Vibrionaceae. In the most well-studied cases, pheromone signaling plays a key role in regulation of light production. However, previous reports have indicated that certain Photobacterium strains do not use this regulatory method for controlling luminescence. In this study, we combined genome sequencing with genetic approaches to characterize the regulation of luminescence in Photobacterium leiognathi strain KNH6, an extremely bright isolate. Using transposon mutagenesis and screening for decreased luminescence, we identified insertions in genes encoding components necessary for the luciferase reaction (lux, lum, and rib operons) as well as in nine other loci. These additional loci encode gene products predicted to be involved in the tricarboxylic acid (TCA) cycle, DNA and RNA metabolism, transcriptional regulation, and the synthesis of cytochrome c, peptidoglycan, and fatty acids. The mutagenesis screen did not identify any mutants with disruptions of predicted pheromone-related loci. Using targeted gene insertional disruptions, we demonstrate that under the growth conditions tested, luminescence levels do not appear to be controlled through canonical pheromone signaling systems in this strain. IMPORTANCE Despite the long-standing interest in luminous bacteria, outside a few model organisms, little is known about the regulation and function of luminescence. Light-producing marine bacteria are widely distributed and have diverse lifestyles, suggesting that the control and significance of luminescence may be similarly diverse. In this study, we apply genetic tools to the study of regulation of light production in the extremely bright isolate Photobacterium leiognathi KNH6. Our results suggest an unusual lack of canonical pheromone-mediated control of luminescence and contribute to a better understanding of alternative strategies for regulation of a key bacterial behavior. These experiments lay the groundwork for further study of the regulation and role of bioluminescence in P. leiognathi. PMID:26350139

  8. Evidence for Horizontal Gene Transfer in Evolution of Elongation Factor Tu in Enterococci

    PubMed Central

    Ke, Danbing; Boissinot, Maurice; Huletsky, Ann; Picard, François J.; Frenette, Johanne; Ouellette, Marc; Roy, Paul H.; Bergeron, Michel G.

    2000-01-01

    The elongation factor Tu, encoded by tuf genes, is a GTP binding protein that plays a central role in protein synthesis. One to three tuf genes per genome are present, depending on the bacterial species. Most low-G+C-content gram-positive bacteria carry only one tuf gene. We have designed degenerate PCR primers derived from consensus sequences of the tuf gene to amplify partial tuf sequences from 17 enterococcal species and other phylogenetically related species. The amplified DNA fragments were sequenced either by direct sequencing or by sequencing cloned inserts containing putative amplicons. Two different tuf genes (tufA and tufB) were found in 11 enterococcal species, including Enterococcus avium, Enterococcus casseliflavus, Enterococcus dispar, Enterococcus durans, Enterococcus faecium, Enterococcus gallinarum, Enterococcus hirae, Enterococcus malodoratus, Enterococcus mundtii, Enterococcus pseudoavium, and Enterococcus raffinosus. For the other six enterococcal species (Enterococcus cecorum, Enterococcus columbae, Enterococcus faecalis, Enterococcus sulfureus, Enterococcus saccharolyticus, and Enterococcus solitarius), only the tufA gene was present. Based on 16S rRNA gene sequence analysis, the 11 species having two tuf genes all have a common ancestor, while the six species having only one copy diverged from the enterococcal lineage before that common ancestor. The presence of one or two copies of the tuf gene in enterococci was confirmed by Southern hybridization. Phylogenetic analysis of tuf sequences demonstrated that the enterococcal tufA gene branches with the Bacillus, Listeria, and Staphylococcus genera, while the enterococcal tufB gene clusters with the genera Streptococcus and Lactococcus. Primary structure analysis showed that four amino acid residues encoded within the sequenced regions are conserved and unique to the enterococcal tufB genes and the tuf genes of streptococci and Lactococcus lactis. The data suggest that an ancestral streptococcus or a streptococcus-related species may have horizontally transferred a tuf gene to the common ancestor of the 11 enterococcal species which now carry two tuf genes. PMID:11092850

  9. Neptune: a bioinformatics tool for rapid discovery of genomic variation in bacterial populations

    PubMed Central

    Marinier, Eric; Zaheer, Rahat; Berry, Chrystal; Weedmark, Kelly A.; Domaratzki, Michael; Mabon, Philip; Knox, Natalie C.; Reimer, Aleisha R.; Graham, Morag R.; Chui, Linda; Patterson-Fortin, Laura; Zhang, Jian; Pagotto, Franco; Farber, Jeff; Mahony, Jim; Seyer, Karine; Bekal, Sadjia; Tremblay, Cécile; Isaac-Renton, Judy; Prystajecky, Natalie; Chen, Jessica; Slade, Peter

    2017-01-01

    Abstract The ready availability of vast amounts of genomic sequence data has created the need to rethink comparative genomics algorithms using ‘big data’ approaches. Neptune is an efficient system for rapidly locating differentially abundant genomic content in bacterial populations using an exact k-mer matching strategy, while accommodating k-mer mismatches. Neptune’s loci discovery process identifies sequences that are sufficiently common to a group of target sequences and sufficiently absent from non-targets using probabilistic models. Neptune uses parallel computing to efficiently identify and extract these loci from draft genome assemblies without requiring multiple sequence alignments or other computationally expensive comparative sequence analyses. Tests on simulated and real datasets showed that Neptune rapidly identifies regions that are both sensitive and specific. We demonstrate that this system can identify trait-specific loci from different bacterial lineages. Neptune is broadly applicable for comparative bacterial analyses, yet will particularly benefit pathogenomic applications, owing to efficient and sensitive discovery of differentially abundant genomic loci. The software is available for download at: http://github.com/phac-nml/neptune. PMID:29048594

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sobottka, Marcelo, E-mail: sobottka@mtm.ufsc.br; Hart, Andrew G., E-mail: ahart@dim.uchile.cl

    Highlights: {yields} We propose a simple stochastic model to construct primitive DNA sequences. {yields} The model provide an explanation for Chargaff's second parity rule in primitive DNA sequences. {yields} The model is also used to predict a novel type of strand symmetry in primitive DNA sequences. {yields} We extend the results for bacterial DNA sequences and compare distributional properties intrinsic to the model to statistical estimates from 1049 bacterial genomes. {yields} We find out statistical evidences that the novel type of strand symmetry holds for bacterial DNA sequences. -- Abstract: Chargaff's second parity rule for short oligonucleotides states that themore » frequency of any short nucleotide sequence on a strand is approximately equal to the frequency of its reverse complement on the same strand. Recent studies have shown that, with the exception of organellar DNA, this parity rule generally holds for double-stranded DNA genomes and fails to hold for single-stranded genomes. While Chargaff's first parity rule is fully explained by the Watson-Crick pairing in the DNA double helix, a definitive explanation for the second parity rule has not yet been determined. In this work, we propose a model based on a hidden Markov process for approximating the distributional structure of primitive DNA sequences. Then, we use the model to provide another possible theoretical explanation for Chargaff's second parity rule, and to predict novel distributional aspects of bacterial DNA sequences.« less

  11. High-throughput nucleotide sequence analysis of diverse bacterial communities in leachates of decomposing pig carcasses

    PubMed Central

    Yang, Seung Hak; Lim, Joung Soo; Khan, Modabber Ahmed; Kim, Bong Soo; Choi, Dong Yoon; Lee, Eun Young; Ahn, Hee Kwon

    2015-01-01

    The leachate generated by the decomposition of animal carcass has been implicated as an environmental contaminant surrounding the burial site. High-throughput nucleotide sequencing was conducted to investigate the bacterial communities in leachates from the decomposition of pig carcasses. We acquired 51,230 reads from six different samples (1, 2, 3, 4, 6 and 14 week-old carcasses) and found that sequences representing the phylum Firmicutes predominated. The diversity of bacterial 16S rRNA gene sequences in the leachate was the highest at 6 weeks, in contrast to those at 2 and 14 weeks. The relative abundance of Firmicutes was reduced, while the proportion of Bacteroidetes and Proteobacteria increased from 3–6 weeks. The representation of phyla was restored after 14 weeks. However, the community structures between the samples taken at 1–2 and 14 weeks differed at the bacterial classification level. The trend in pH was similar to the changes seen in bacterial communities, indicating that the pH of the leachate could be related to the shift in the microbial community. The results indicate that the composition of bacterial communities in leachates of decomposing pig carcasses shifted continuously during the study period and might be influenced by the burial site. PMID:26500442

  12. Microbial community analysis of a coastal hot spring in Kagoshima, Japan, using molecular- and culture-based approaches.

    PubMed

    Nishiyama, Minako; Yamamoto, Shuichi; Kurosawa, Norio

    2013-08-01

    Ibusuki hot spring is located on the coastline of Kagoshima Bay, Japan. The hot spring water is characterized by high salinity, high temperature, and neutral pH. The hot spring is covered by the sea during high tide, which leads to severe fluctuations in several environmental variables. A combination of molecular- and culture-based techniques was used to determine the bacterial and archaeal diversity of the hot spring. A total of 48 thermophilic bacterial strains were isolated from two sites (Site 1: 55.6°C; Site 2: 83.1°C) and they were categorized into six groups based on their 16S rRNA gene sequence similarity. Two groups (including 32 isolates) demonstrated low sequence similarity with published species, suggesting that they might represent novel taxa. The 148 clones from the Site 1 bacterial library included 76 operational taxonomy units (OTUs; 97% threshold), while 132 clones from the Site 2 bacterial library included 31 OTUs. Proteobacteria, Bacteroidetes, and Firmicutes were frequently detected in both clone libraries. The clones were related to thermophilic, mesophilic and psychrophilic bacteria. Approximately half of the sequences in bacterial clone libraries shared <92% sequence similarity with their closest sequences in a public database, suggesting that the Ibusuki hot spring may harbor a unique and novel bacterial community. By contrast, 77 clones from the Site 2 archaeal library contained only three OTUs, most of which were affiliated with Thaumarchaeota.

  13. Construction of a BAC library and mapping BAC clones to the linkage map of Barramundi, Lates calcarifer.

    PubMed

    Wang, Chun Ming; Lo, Loong Chueng; Feng, Felicia; Gong, Ping; Li, Jian; Zhu, Ze Yuan; Lin, Grace; Yue, Gen Hua

    2008-03-25

    Barramundi (Lates calcarifer) is an important farmed marine food fish species. Its first generation linkage map has been applied to map QTL for growth traits. To identify genes located in QTL responsible for specific traits, genomic large insert libraries are of crucial importance. We reported herein a bacterial artificial chromosome (BAC) library and the mapping of BAC clones to the linkage map. This BAC library consisted of 49,152 clones with an average insert size of 98 kb, representing 6.9-fold haploid genome coverage. Screening the library with 24 microsatellites and 15 ESTs/genes demonstrated that the library had good genome coverage. In addition, 62 novel microsatellites each isolated from 62 BAC clones were mapped onto the first generation linkage map. A total of 86 BAC clones were anchored on the linkage map with at least one BAC clone on each linkage group. We have constructed the first BAC library for L. calcarifer and mapped 86 BAC clones to the first generation linkage map. This BAC library and the improved linkage map with 302 DNA markers not only supply an indispensable tool to the integration of physical and linkage maps, the fine mapping of QTL and map based cloning genes located in QTL of commercial importance, but also contribute to comparative genomic studies and eventually whole genome sequencing.

  14. Determination of Membrane-Insertion Free Energies by Molecular Dynamics Simulations

    PubMed Central

    Gumbart, James; Roux, Benoît

    2012-01-01

    The accurate prediction of membrane-insertion probability for arbitrary protein sequences is a critical challenge to identifying membrane proteins and determining their folded structures. Although algorithms based on sequence statistics have had moderate success, a complete understanding of the energetic factors that drive the insertion of membrane proteins is essential to thoroughly meeting this challenge. In the last few years, numerous attempts to define a free-energy scale for amino-acid insertion have been made, yet disagreement between most experimental and theoretical scales persists. However, for a recently resolved water-to-bilayer scale, it is found that molecular dynamics simulations that carefully mimic the conditions of the experiment can reproduce experimental free energies, even when using the same force field as previous computational studies that were cited as evidence of this disagreement. Therefore, it is suggested that experimental and simulation-based scales can both be accurate and that discrepancies stem from disparities in the microscopic processes being considered rather than methodological errors. Furthermore, these disparities make the development of a single universally applicable membrane-insertion free energy scale difficult. PMID:22385850

  15. The loss-of-allele assay for ES cell screening and mouse genotyping.

    PubMed

    Frendewey, David; Chernomorsky, Rostislav; Esau, Lakeisha; Om, Jinsop; Xue, Yingzi; Murphy, Andrew J; Yancopoulos, George D; Valenzuela, David M

    2010-01-01

    Targeting vectors used to create directed mutations in mouse embryonic stem (ES) cells consist, in their simplest form, of a gene for drug selection flanked by mouse genomic sequences, the so-called homology arms that promote site-directed homologous recombination between the vector and the target gene. The VelociGene method for the creation of targeted mutations in ES cells employs targeting vectors, called BACVecs, that are based on bacterial artificial chromosomes. Compared with conventional short targeting vectors, BacVecs provide two major advantages: (1) their much larger homology arms promote high targeting efficiencies without the need for isogenicity or negative selection strategies; and (2) they enable deletions and insertions of up to 100kb in a single targeting event, making possible gene-ablating definitive null alleles and other large-scale genomic modifications. Because of their large arm sizes, however, BACVecs do not permit screening by conventional assays, such as long-range PCR or Southern blotting, that link the inserted targeting vector to the targeted locus. To exploit the advantages of BACVecs for gene targeting, we inverted the conventional screening logic in developing the loss-of-allele (LOA) assay, which quantifies the number of copies of the native locus to which the mutation was directed. In a correctly targeted ES cell clone, the LOA assay detects one of the two native alleles (for genes not on the X or Y chromosome), the other allele being disrupted by the targeted modification. We apply the same principle in reverse as a gain-of-allele assay to quantify the copy number of the inserted targeting vector. The LOA assay reveals a correctly targeted clone as having lost one copy of the native target gene and gained one copy of the drug resistance gene or other inserted marker. The combination of these quantitative assays makes LOA genotyping unequivocal and amenable to automated scoring. We use the quantitative polymerase chain reaction (qPCR) as our method of allele quantification, but any method that can reliably distinguish the difference between one and two copies of the target gene can be used to develop an LOA assay. We have designed qPCR LOA assays for deletions, insertions, point mutations, domain swaps, conditional, and humanized alleles and have used the insert assays to quantify the copy number of random insertion BAC transgenics. Because of its quantitative precision, specificity, and compatibility with high throughput robotic operations, the LOA assay eliminates bottlenecks in ES cell screening and mouse genotyping and facilitates maximal speed and throughput for knockout mouse production. Copyright (c) 2010 Elsevier Inc. All rights reserved.

  16. Native and dry-heated lysozyme interactions with membrane lipid monolayers: Lipid packing modifications of a phospholipid mixture, model of the Escherichia coli cytoplasmic membrane.

    PubMed

    Derde, Melanie; Nau, Françoise; Guérin-Dubiard, Catherine; Lechevalier, Valérie; Paboeuf, Gilles; Jan, Sophie; Baron, Florence; Gautier, Michel; Vié, Véronique

    2015-04-01

    Antimicrobial resistance is currently an important public health issue. The need for innovative antimicrobials is therefore growing. The ideal antimicrobial compound should limit antimicrobial resistance. Antimicrobial peptides or proteins such as hen egg white lysozyme are promising molecules that act on bacterial membranes. Hen egg white lysozyme has recently been identified as active on Gram-negative bacteria due to disruption of the outer and cytoplasmic membrane integrity. Furthermore, dry-heating (7 days and 80 °C) improves the membrane activity of lysozyme, resulting in higher antimicrobial activity. These in vivo findings suggest interactions between lysozyme and membrane lipids. This is consistent with the findings of several other authors who have shown lysozyme interaction with bacterial phospholipids such as phosphatidylglycerol and cardiolipin. However, until now, the interaction between lysozyme and bacterial cytoplasmic phospholipids has been in need of clarification. This study proposes the use of monolayer models with a realistic bacterial phospholipid composition in physiological conditions. The lysozyme/phospholipid interactions have been studied by surface pressure measurements, ellipsometry and atomic force microscopy. Native lysozyme has proved able to absorb and insert into a bacterial phospholipid monolayer, resulting in lipid packing reorganization, which in turn has lead to lateral cohesion modifications between phospholipids. Dry-heating of lysozyme has increased insertion capacity and ability to induce lipid packing modifications. These in vitro findings are then consistent with the increased membrane disruption potential of dry heated lysozyme in vivo compared to native lysozyme. Moreover, an eggPC monolayer study suggested that lysozyme/phospholipid interactions are specific to bacterial cytoplasmic membranes. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. The Design and Analysis of Transposon-Insertion Sequencing Experiments

    PubMed Central

    Chao, Michael C.; Abel, Sören; Davis, Brigid M.; Waldor, Matthew K.

    2016-01-01

    Preface Transposon-insertion sequencing (TIS) is a powerful approach that can be widely applied to genome-wide definition of loci that are required for growth in diverse conditions. However, experimental design choices and stochastic biological processes can heavily influence the results of TIS experiments and affect downstream statistical analysis. Here, we discuss TIS experimental parameters and how these factors relate to the benefits and limitations of the various statistical frameworks that can be applied to computational analysis of TIS data. PMID:26775926

  18. Word and frame synchronization with verification for PPM optical communications

    NASA Technical Reports Server (NTRS)

    Marshall, William K.

    1986-01-01

    A method for obtaining word and frame synchronization in pulse position modulated optical communication systems is described. The method uses a short sync sequence inserted at the beginning of each data frame and a verification procedure to distinguish between inserted and randomly occurring sequences at the receiver. This results in an easy to implement sync system which provides reliable synchronization even at high symbol error rates. Results are given for the application of this approach to a highly energy efficient 256-ary PPM test system.

  19. Characterization of the Porphyromonas gingivalis conjugative transposon CTnPg1: determination of the integration site and the genes essential for conjugal transfer.

    PubMed

    Naito, Mariko; Sato, Keiko; Shoji, Mikio; Yukitake, Hideharu; Ogura, Yoshitoshi; Hayashi, Tetsuya; Nakayama, Koji

    2011-07-01

    In our previous study, extensive genomic rearrangements were found in two strains of the Gram-negative anaerobic bacterium Porphyromonas (Por.) gingivalis, and most of these rearrangements were associated with mobile genetic elements such as insertion sequences and conjugative transposons (CTns). CTnPg1, identified in Por. gingivalis strain ATCC 33277, was the first complete CTn reported for the genus Porphyromonas. In the present study, we found that CTnPg1 can be transferred from strain ATCC 33277 to another Por. gingivalis strain, W83, at a frequency of 10(-7) to 10(-6). The excision of CTnPg1 from the chromosome in a donor cell depends on an integrase (Int; PGN_0094) encoded in CTnPg1, whereas CTnPg1 excision is independent of PGN_0084 (a DNA topoisomerase I homologue; Exc) encoded within CTnPg1 and recA (PGN_1057) on the donor chromosome. Intriguingly, however, the transfer of CTnPg1 between Por. gingivalis strains requires RecA function in the recipient. Sequencing analysis of CTnPg1-integrated sites on the chromosomes of transconjugants revealed that the consensus attachment (att) sequence is a 13 bp sequence, TTTTCNNNNAAAA. We further report that CTnPg1 is able to transfer to two other bacterial species, Bacteroides thetaiotaomicron and Prevotella oralis. In addition, CTnPg1-like CTns are located in the genomes of other oral anaerobic bacteria, Porphyromonas endodontalis, Prevotella buccae and Prevotella intermedia, with the same consensus att sequence. These results suggest that CTns in the CTnPg1 family are widely distributed among oral anaerobic Gram-negative bacteria found in humans and play important roles in horizontal gene transfer among these bacteria.

  20. Global Genomic Diversity of Oryza sativa Varieties Revealed by Comparative Physical Mapping

    PubMed Central

    Wang, Xiaoming; Kudrna, David A.; Pan, Yonglong; Wang, Hao; Liu, Lin; Lin, Haiyan; Zhang, Jianwei; Song, Xiang; Goicoechea, Jose Luis; Wing, Rod A.; Zhang, Qifa; Luo, Meizhong

    2014-01-01

    Bacterial artificial chromosome (BAC) physical maps embedding a large number of BAC end sequences (BESs) were generated for Oryza sativa ssp. indica varieties Minghui 63 (MH63) and Zhenshan 97 (ZS97) and were compared with the genome sequences of O. sativa spp. japonica cv. Nipponbare and O. sativa ssp. indica cv. 93-11. The comparisons exhibited substantial diversities in terms of large structural variations and small substitutions and indels. Genome-wide BAC-sized and contig-sized structural variations were detected, and the shared variations were analyzed. In the expansion regions of the Nipponbare reference sequence, in comparison to the MH63 and ZS97 physical maps, as well as to the previously constructed 93-11 physical map, the amounts and types of the repeat contents, and the outputs of gene ontology analysis, were significantly different from those of the whole genome. Using the physical maps of four wild Oryza species from OMAP (http://www.omap.org) as a control, we detected many conserved and divergent regions related to the evolution process of O. sativa. Between the BESs of MH63 and ZS97 and the two reference sequences, a total of 1532 polymorphic simple sequence repeats (SSRs), 71,383 SNPs, 1767 multiple nucleotide polymorphisms, 6340 insertions, and 9137 deletions were identified. This study provides independent whole-genome resources for intra- and intersubspecies comparisons and functional genomics studies in O. sativa. Both the comparative physical maps and the GBrowse, which integrated the QTL and molecular markers from GRAMENE (http://www.gramene.org) with our physical maps and analysis results, are open to the public through our Web site (http://gresource.hzau.edu.cn/resource/resource.html). PMID:24424778

  1. Draft Genome Sequence of Xanthomonas arboricola pv. pruni Strain Xap33, Causal Agent of Bacterial Spot Disease on Almond

    PubMed Central

    Garita-Cambronero, J.; Sena-Vélez, M.; Palacio-Bielsa, A.

    2014-01-01

    We report the annotated genome sequence of Xanthomonas arboricola pv. pruni strain Xap33, isolated from almond leaves showing bacterial spot disease symptoms in Spain. The availability of this genome sequence will aid our understanding of the infection mechanism of this bacterium as well as its relationship to other species of the same genus. PMID:24903863

  2. Complete Genome Sequence of a Putative New Bacterial Strain, I507, Isolated from the Indian Ocean

    PubMed Central

    Wang, Shu-yan; Wei, Jia-qiang

    2018-01-01

    ABSTRACT Bacterial strain I507 was isolated from the central Indian Ocean and may be a potential novel species, according to the 16S rRNA gene sequence. Here, we present its complete genome sequence and expect that it will provide researchers with valuable information to further understand its classification and function in the future. PMID:29674539

  3. Histophagous ciliate Pseudocollinia brintoni and bacterial assemblage interaction with krill Nyctiphanes simplex. I. Transmission process.

    PubMed

    Gómez-Gutiérrez, Jaime; López-Cortés, Alejandro; Aguilar-Méndez, Mario J; Del Angel-Rodríguez, Jorge A; Tremblay, Nelly; Zenteno-Savín, Tania; Robinson, Carlos J

    2015-10-27

    Histophagous ciliates of the genus Pseudocollinia cause epizootic events that kill adult female krill (Euphausiacea), but their mode of transmission is unknown. We compared 16S rRNA sequences of bacterial strains isolated from stomachs of healthy krill Nyctiphanes simplex specimens with sequences of bacterial isolates and sequences of natural bacterial communities from the hemocoel of N. simplex specimens infected with P. brintoni to determine possible transmission pathways. All P. brintoni endoparasitic life stages and the transmission tomite stage (outside the host) were associated with bacterial assemblages. 16S rRNA sequences from isolated bacterial strains showed that Photobacterium spp. and Pseudoalteromonas spp. were dominant members of the bacterial assemblages during all life phases of P. brintoni and potential pathobionts. They were apparently unaffected by the krill's immune system or the histophagous activity of P. brintoni. However, other bacterial strains were found only in certain P. brintoni life phases, indicating that as the infection progressed, microhabitat conditions and microbial interactions may have become unfavorable for some strains of bacteria. Trophic infection is the most parsimonious explanation for how P. brintoni infects krill. We estimated N. simplex vulnerability to P. brintoni infection during more than three-fourths of their life span, infecting mostly adult females. The ciliates have relatively high prevalence levels (albeit at <10% of sampled stations) and a short life cycle (estimated <7 d). Histophagous ciliate-krill interactions may occur in other krill species, particularly those that form dense swarms and attain high population densities that potentially enhance trophic transmission and allow completion of the Pseudocollinia spp. life cycle.

  4. Bacterial DNA Detected in Japanese Rice Wines and the Fermentation Starters.

    PubMed

    Terasaki, Momoka; Fukuyama, Akari; Takahashi, Yurika; Yamada, Masato; Nishida, Hiromi

    2017-12-01

    As Japanese rice wine (sake) brewing is not done aseptically, bacterial contamination is conceivable during the process of sake production. There are two types of the fermentation starter, sokujo-moto and yamahai-moto (kimoto). We identified bacterial DNA found in various sakes, the sokujo-moto and the yamahai-moto making just after sake yeast addition. Each sake has a unique variety of bacterial DNA not observed in other sakes. Although most bacterial DNA sequences detected in the sokujo-moto were found in sakes of different sake breweries, most bacterial DNA sequences detected in the yamahai-moto at the early stage of the starter fermentation were not detected in any sakes. Our findings demonstrate that various bacteria grow and then die during the process of sake brewing, as indicated by the presence of trace levels of bacterial DNA.

  5. QuickMap: a public tool for large-scale gene therapy vector insertion site mapping and analysis.

    PubMed

    Appelt, J-U; Giordano, F A; Ecker, M; Roeder, I; Grund, N; Hotz-Wagenblatt, A; Opelz, G; Zeller, W J; Allgayer, H; Fruehauf, S; Laufs, S

    2009-07-01

    Several events of insertional mutagenesis in pre-clinical and clinical gene therapy studies have created intense interest in assessing the genomic insertion profiles of gene therapy vectors. For the construction of such profiles, vector-flanking sequences detected by inverse PCR, linear amplification-mediated-PCR or ligation-mediated-PCR need to be mapped to the host cell's genome and compared to a reference set. Although remarkable progress has been achieved in mapping gene therapy vector insertion sites, public reference sets are lacking, as are the possibilities to quickly detect non-random patterns in experimental data. We developed a tool termed QuickMap, which uniformly maps and analyzes human and murine vector-flanking sequences within seconds (available at www.gtsg.org). Besides information about hits in chromosomes and fragile sites, QuickMap automatically determines insertion frequencies in +/- 250 kb adjacency to genes, cancer genes, pseudogenes, transcription factor and (post-transcriptional) miRNA binding sites, CpG islands and repetitive elements (short interspersed nuclear elements (SINE), long interspersed nuclear elements (LINE), Type II elements and LTR elements). Additionally, all experimental frequencies are compared with the data obtained from a reference set, containing 1 000 000 random integrations ('random set'). Thus, for the first time a tool allowing high-throughput profiling of gene therapy vector insertion sites is available. It provides a basis for large-scale insertion site analyses, which is now urgently needed to discover novel gene therapy vectors with 'safe' insertion profiles.

  6. A Single Banana Streak Virus Integration Event in the Banana Genome as the Origin of Infectious Endogenous Pararetrovirus▿

    PubMed Central

    Gayral, Philippe; Noa-Carrazana, Juan-Carlos; Lescot, Magali; Lheureux, Fabrice; Lockhart, Benham E. L.; Matsumoto, Takashi; Piffanelli, Pietro; Iskra-Caruana, Marie-Line

    2008-01-01

    Sequencing of plant nuclear genomes reveals the widespread presence of integrated viral sequences known as endogenous pararetroviruses (EPRVs). Banana is one of the three plant species known to harbor infectious EPRVs. Musa balbisiana carries integrated copies of Banana streak virus (BSV), which are infectious by releasing virions in interspecific hybrids. Here, we analyze the organization of the EPRV of BSV Goldfinger (BSGfV) present in the wild diploid M. balbisiana cv. Pisang Klutuk Wulung (PKW) revealed by the study of Musa bacterial artificial chromosome resources and interspecific genetic cross. cv. PKW contains two similar EPRVs of BSGfV. Genotyping of these integrants and studies of their segregation pattern show an allelic insertion. Despite the fact that integrated BSGfV has undergone extensive rearrangement, both EPRVs contain the full-length viral genome. The high degree of sequence conservation between the integrated and episomal form of the virus indicates a recent integration event; however, only one allele is infectious. Analysis of BSGfV EPRV segregation among an F1 population from an interspecific genetic cross revealed that these EPRV sequences correspond to two alleles originating from a single integration event. We describe here for the first time the full genomic and genetic organization of the two EPRVs of BSGfV present in cv. PKW in response to the challenge facing both scientists and breeders to identify and generate genetic resources free from BSV. We discuss the consequences of this unique host-pathogen interaction in terms of genetic and genomic plant defenses versus strategies of infectious BSGfV EPRVs. PMID:18417582

  7. Identification of 16S Ribosomal DNA-Defined Bacterial Populations at a Shallow Submarine Hydrothermal Vent near Milos Island (Greece)

    PubMed Central

    Sievert, Stefan M.; Kuever, Jan; Muyzer, Gerard

    2000-01-01

    In a recent publication (S. M. Sievert, T. Brinkhoff, G. Muyzer, W. Ziebis, and J. Kuever, Appl. Environ. Microbiol. 65:3834–3842, 1999) we described spatiotemporal changes in the bacterial community structure at a shallow-water hydrothermal vent in the Aegean Sea near the isle of Milos (Greece). Here we describe identification and phylogenetic analysis of the predominant bacterial populations at the vent site and their distribution at the vent site as determined by sequencing of DNA molecules (bands) excised from denaturing gradient gels. A total of 36 bands could be sequenced, and there were representatives of eight major lineages of the domain Bacteria. Cytophaga-Flavobacterium and Acidobacterium were the most frequently retrieved bacterial groups. Less than 33% of the sequences exhibited 90% or more identity with cultivated organisms. The predominance of putative heterotrophic populations in the sequences retrieved is explained by the input of allochthonous organic matter at the vent site. PMID:10877814

  8. Construction and sequence sampling of deep-coverage, large-insert BAC libraries for three model lepidopteran species

    PubMed Central

    Wu, Chengcang; Proestou, Dina; Carter, Dorothy; Nicholson, Erica; Santos, Filippe; Zhao, Shaying; Zhang, Hong-Bin; Goldsmith, Marian R

    2009-01-01

    Background Manduca sexta, Heliothis virescens, and Heliconius erato represent three widely-used insect model species for genomic and fundamental studies in Lepidoptera. Large-insert BAC libraries of these insects are critical resources for many molecular studies, including physical mapping and genome sequencing, but not available to date. Results We report the construction and characterization of six large-insert BAC libraries for the three species and sampling sequence analysis of the genomes. The six BAC libraries were constructed with two restriction enzymes, two libraries for each species, and each has an average clone insert size ranging from 152–175 kb. We estimated that the genome coverage of each library ranged from 6–9 ×, with the two combined libraries of each species being equivalent to 13.0–16.3 × haploid genomes. The genome coverage, quality and utility of the libraries were further confirmed by library screening using 6~8 putative single-copy probes. To provide a first glimpse into these genomes, we sequenced and analyzed the BAC ends of ~200 clones randomly selected from the libraries of each species. The data revealed that the genomes are AT-rich, contain relatively small fractions of repeat elements with a majority belonging to the category of low complexity repeats, and are more abundant in retro-elements than DNA transposons. Among the species, the H. erato genome is somewhat more abundant in repeat elements and simple repeats than those of M. sexta and H. virescens. The BLAST analysis of the BAC end sequences suggested that the evolution of the three genomes is widely varied, with the genome of H. virescens being the most conserved as a typical lepidopteran, whereas both genomes of H. erato and M. sexta appear to have evolved significantly, resulting in a higher level of species- or evolutionary lineage-specific sequences. Conclusion The high-quality and large-insert BAC libraries of the insects, together with the identified BACs containing genes of interest, provide valuable information, resources and tools for comprehensive understanding and studies of the insect genomes and for addressing many fundamental questions in Lepidoptera. The sample of the genomic sequences provides the first insight into the constitution and evolution of the insect genomes. PMID:19558662

  9. Comparative Analysis of the Gut Microbial Communities in Forest and Alpine Musk Deer Using High-Throughput Sequencing

    PubMed Central

    Hu, Xiaolong; Liu, Gang; Shafer, Aaron B. A.; Wei, Yuting; Zhou, Juntong; Lin, Shaobi; Wu, Haibin; Zhou, Mi; Hu, Defu; Liu, Shuqiang

    2017-01-01

    The gut ecosystem is characterized by dynamic and reciprocal interactions between the host and bacteria. Although characterizing microbiota for herbivores has become recognized as important tool for gauging species health, no study to date has investigated the bacterial communities and evaluated the age-related bacterial dynamics of musk deer. Moreover, gastrointestinal diseases have been hypothesized to be a limiting factor of population growth in captive musk deer. Here, high-throughput sequencing of the bacterial 16S rRNA gene was used to profile the fecal bacterial communities in juvenile and adult alpine and forest musk deer. The two musk deer species harbored similar bacterial communities at the phylum level, whereas the key genera for the two species were distinct. The bacterial communities were dominated by Firmicutes and Bacteroidetes, with the bacterial diversity being higher in forest musk deer. The Firmicutes to Bacteroidetes ratio also increased from juvenile to adult, while the bacterial diversity, within-group and between-group similarity, all increased with age. This work serves as the first sequence-based analysis of variation in bacterial communities within and between musk deer species, and demonstrates how the gut microbial community dynamics vary among closely related species and shift with age. As gastrointestinal diseases have been observed in captive populations, this study provides valuable data that might benefit captive management and future reintroduction programs. PMID:28421061

  10. Orangutan Alu quiescence reveals possible source element: support for ancient backseat drivers

    PubMed Central

    2012-01-01

    Background Sequence analysis of the orangutan genome revealed that recent proliferative activity of Alu elements has been uncharacteristically quiescent in the Pongo (orangutan) lineage, compared with all previously studied primate genomes. With relatively few young polymorphic insertions, the genomic landscape of the orangutan seemed like the ideal place to search for a driver, or source element, of Alu retrotransposition. Results Here we report the identification of a nearly pristine insertion possessing all the known putative hallmarks of a retrotranspositionally competent Alu element. It is located in an intronic sequence of the DGKB gene on chromosome 7 and is highly conserved in Hominidae (the great apes), but absent from Hylobatidae (gibbon and siamang). We provide evidence for the evolution of a lineage-specific subfamily of this shared Alu insertion in orangutans and possibly the lineage leading to humans. In the orangutan genome, this insertion contains three orangutan-specific diagnostic mutations which are characteristic of the youngest polymorphic Alu subfamily, AluYe5b5_Pongo. In the Homininae lineage (human, chimpanzee and gorilla), this insertion has acquired three different mutations which are also found in a single human-specific Alu insertion. Conclusions This seemingly stealth-like amplification, ongoing at a very low rate over millions of years of evolution, suggests that this shared insertion may represent an ancient backseat driver of Alu element expansion. PMID:22541534

  11. Orangutan Alu quiescence reveals possible source element: support for ancient backseat drivers.

    PubMed

    Walker, Jerilyn A; Konkel, Miriam K; Ullmer, Brygg; Monceaux, Christopher P; Ryder, Oliver A; Hubley, Robert; Smit, Arian Fa; Batzer, Mark A

    2012-04-30

    Sequence analysis of the orangutan genome revealed that recent proliferative activity of Alu elements has been uncharacteristically quiescent in the Pongo (orangutan) lineage, compared with all previously studied primate genomes. With relatively few young polymorphic insertions, the genomic landscape of the orangutan seemed like the ideal place to search for a driver, or source element, of Alu retrotransposition. Here we report the identification of a nearly pristine insertion possessing all the known putative hallmarks of a retrotranspositionally competent Alu element. It is located in an intronic sequence of the DGKB gene on chromosome 7 and is highly conserved in Hominidae (the great apes), but absent from Hylobatidae (gibbon and siamang). We provide evidence for the evolution of a lineage-specific subfamily of this shared Alu insertion in orangutans and possibly the lineage leading to humans. In the orangutan genome, this insertion contains three orangutan-specific diagnostic mutations which are characteristic of the youngest polymorphic Alu subfamily, AluYe5b5_Pongo. In the Homininae lineage (human, chimpanzee and gorilla), this insertion has acquired three different mutations which are also found in a single human-specific Alu insertion. This seemingly stealth-like amplification, ongoing at a very low rate over millions of years of evolution, suggests that this shared insertion may represent an ancient backseat driver of Alu element expansion.

  12. Antigenic Diversity of the Plasmodium vivax Circumsporozoite Protein in Parasite Isolates of Western Colombia

    PubMed Central

    Hernández-Martínez, Miguel Ángel; Escalante, Ananías A.; Arévalo-Herrera, Myriam; Herrera, Sócrates

    2011-01-01

    Circumsporozoite (CS) protein is a malaria antigen involved in sporozoite invasion of hepatocytes, and thus considered to have good vaccine potential. We evaluated the polymorphism of the Plasmodium vivax CS gene in 24 parasite isolates collected from malaria-endemic areas of Colombia. We sequenced 27 alleles, most of which (25/27) corresponded to the VK247 genotype and the remainder to the VK210 type. All VK247 alleles presented a mutation (Gly → Asn) at position 28 in the N-terminal region, whereas the C-terminal presented three insertions: the ANKKAGDAG, which is common in all VK247 isolates; 12 alleles presented the insertion GAGGQAAGGNAANKKAGDAG; and 5 alleles presented the insertion GGNAGGNA. Both repeat regions were polymorphic in gene sequence and size. Sequences coding for B-, T-CD4+, and T-CD8+ cell epitopes were found to be conserved. This study confirms the high polymorphism of the repeat domain and the highly conserved nature of the flanking regions. PMID:21292878

  13. Determinism and randomness in the evolution of introns and sine inserts in mouse and human mitochondrial solute carrier and cytokine receptor genes.

    PubMed

    Cianciulli, Antonia; Calvello, Rosa; Panaro, Maria A

    2015-04-01

    In the homologous genes studied, the exons and introns alternated in the same order in mouse and human. We studied, in both species: corresponding short segments of introns, whole corresponding introns and complete homologous genes. We considered the total number of nucleotides and the number and orientation of the SINE inserts. Comparisons of mouse and human data series showed that at the level of individual relatively short segments of intronic sequences the stochastic variability prevails in the local structuring, but at higher levels of organization a deterministic component emerges, conserved in mouse and human during the divergent evolution, despite the ample re-editing of the intronic sequences and the fact that processes such as SINE spread had taken place in an independent way in the two species. Intron conservation is negatively correlated with the SINE occupancy, suggesting that virus inserts interfere with the conservation of the sequences inherited from the common ancestor. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. A snapshot of the microbiome of Amblyomma tuberculatum ticks infesting the gopher tortoise, an endangered species.

    PubMed

    Budachetri, Khemraj; Gaillard, Daniel; Williams, Jaclyn; Mukherjee, Nabanita; Karim, Shahid

    2016-10-01

    The gopher tortoise tick, Amblyomma tuberculatum, has a unique relationship with the gopher tortoise, Gopherus polyphemus, found in sandy habitats across the southeastern United States. We aimed to understand the overall bacterial community associated with A. tuberculatum while also focusing on spotted fever group Rickettsia. These tortoises in the Southern Mississippi region are a federally threatened species; therefore, we have carefully trapped the tortoises and removed the species-specific ticks attached to them. Genomic DNA was extracted from individual ticks and used to explore overall bacterial load using pyrosequencing of bacterial 16S rRNA on 454-sequencing platform. The spotted fever group of Rickettsia was explored by amplifying rickettsial outer membrane protein A (rompA) gene by nested PCR. Sequencing results revealed 330 bacterial operational taxonomic units (OTUs) after all the necessary curation of sequences. Four whole A. tuberculatum ticks showed Proteobacteria, Firmicutes, Actinobacteria and Bacteroidetes as the most dominant phyla with a total of 74 different bacterial genera detected. Together Rickettsiae and Francisella showed >85% abundance, thus dominating the bacterial community structure. Partial sequences obtained from ompA amplicons revealed the presence of an uncharacterized Rickettsia similar to the Rickettsial endosymbiont of A. tuberculatum. This is the first preliminary profile of a complete bacterial community from gopher tortoise ticks and warrants further investigation regarding the functional role of Rickettsial and Francisella-like endosymbionts in tick physiology. Copyright © 2016 Elsevier GmbH. All rights reserved.

  15. Megabase sequencing of human genome by ordered-shotgun-sequencing (OSS) strategy

    NASA Astrophysics Data System (ADS)

    Chen, Ellson Y.

    1997-05-01

    So far we have used OSS strategy to sequence over 2 megabases DNA in large-insert clones from regions of human X chromosomes with different characteristic levels of GC content. The method starts by randomly fragmenting a BAC, YAC or PAC to 8-12 kb pieces and subcloning those into lambda phage. Insert-ends of these clones are sequenced and overlapped to create a partial map. Complete sequencing is then done on a minimal tiling path of selected subclones, recursively focusing on those at the edges of contigs to facilitate mergers of clones across the entire target. To reduce manual labor, PCR processes have been adapted to prepare sequencing templates throughout the entire operation. The streamlined process can thus lend itself to further automation. The OSS approach is suitable for large- scale genomic sequencing, providing considerable flexibility in the choice of subclones or regions for more or less intensive sequencing. For example, subclones containing contaminating host cell DNA or cloning vector can be recognized and ignored with minimal sequencing effort; regions overlapping a neighboring clone already sequenced need not be redone; and segments containing tandem repeats or long repetitive sequences can be spotted early on and targeted for additional attention.

  16. Effectiveness of timely intraoperative iodine irrigation during cataract surgery.

    PubMed

    Matsuura, Kazuki; Miyazaki, Dai; Sasaki, Shin-Ichi; Yakura, Keiko; Inoue, Yoshitsugu; Sakamoto, Masako

    2016-11-01

    To determine the antiseptic efficacy of timely intraoperative iodine irrigation during cataract surgery. A total of 198 eyes of 99 cataract surgery patients were studied. The eyes were randomly assigned to treatment with or without timely intraoperative iodine irrigation of the surgical field with an iodine compound equivalent to 0.33 % povidone-iodine. In eyes in the timely intraoperative iodine irrigation group, the ocular surface was irrigated twice intraoperatively-before the initial incision and before insertion of the intraocular lens (IOL). The efficacy of the antiseptic treatment was evaluated by culture tests using scrapings of the surface of the sclerocornea and conjunctiva to the left of the incision and by broad-range real-time PCR for bacterial 16S ribosomal DNA using scrapings from the right side of the incision. Following intraoperative application of the iodine, bacteria were not detected in cultures of the samples. For the control eyes without timely iodine irrigation, cultures of samples from five and two eyes were positive before the initial incision and before IOL insertion, respectively. The bacterial DNA copy number before the initial incision was 1.7 ± 0.5 × 10 3 , which was significantly lower than that of the control eyes (1.7 ± 0.6 × 10 4 ). For both groups of eyes, the bacterial DNA copy number was significantly lower before the IOL insertion depending on the time course. When the antiseptic effect of the iodine irrigation and time course on bacterial DNA copy number was analyzed using generalized mixed linear regression, both were found to be significantly effective. No significant intraoperative epithelial defect was observed. The postoperative corneal endothelial cell count did not differ significantly between the two groups of eyes. Timely iodine irrigation can serve as a simple and useful adjunctive disinfection step in cataract surgery.

  17. Quick and clean cloning.

    PubMed

    Thieme, Frank; Marillonnet, Sylvestre

    2014-01-01

    Identification of unknown sequences that flank known sequences of interest requires PCR amplification of DNA fragments that contain the junction between the known and unknown flanking sequences. Since amplified products often contain a mixture of specific and nonspecific products, the quick and clean (QC) cloning procedure was developed to clone specific products only. QC cloning is a ligation-independent cloning procedure that relies on the exonuclease activity of T4 DNA polymerase to generate single-stranded extensions at the ends of the vector and insert. A specific feature of QC cloning is the use of vectors that contain a sequence called catching sequence that allows cloning specific products only. QC cloning is performed by a one-pot incubation of insert and vector in the presence of T4 DNA polymerase at room temperature for 10 min followed by direct transformation of the incubation mix in chemo-competent Escherichia coli cells.

  18. Insertion sequence ISRP10 inactivation of the oprD gene in imipenem-resistant Pseudomonas aeruginosa clinical isolates.

    PubMed

    Sun, Qinghui; Ba, Zhaofen; Wu, Guoying; Wang, Wei; Lin, Shuxiang; Yang, Hongjiang

    2016-05-01

    Carbapenem resistance mechanisms were investigated in 32 imipenem-resistant Pseudomonas aeruginosa clinical isolates recovered from hospitalised children. Sequence analysis revealed that 31 of the isolates had an insertion sequence element ISRP10 disrupting the porin gene oprD, demonstrating that ISRP10 inactivation of oprD conferred imipenem resistance in the majority of the isolates. Multilocus sequence typing (MLST) was used to discriminate the isolates. In total, 11 sequence types (STs) were identified including 3 novel STs, and 68.3% (28/41) of the tested strains were characterised as clone ST253. In combination with random amplified polymorphic DNA (RAPD) analysis, the imipenem-resistant isolates displayed a relatively high degree of genetic variability and were unlikely associated with nosocomial infections. Copyright © 2016 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  19. Occurrence of Can-SINEs and intron sequence evolution supports robust phylogeny of pinniped carnivores and their terrestrial relatives.

    PubMed

    Schröder, Christiane; Bleidorn, Christoph; Hartmann, Stefanie; Tiedemann, Ralph

    2009-12-15

    Investigating the dog genome we found 178965 introns with a moderate length of 200-1000 bp. A screening of these sequences against 23 different repeat libraries to find insertions of short interspersed elements (SINEs) detected 45276 SINEs. Virtually all of these SINEs (98%) belong to the tRNA-derived Can-SINE family. Can-SINEs arose about 55 million years ago before Carnivora split into two basal groups, the Caniformia (dog-like carnivores) and the Feliformia (cat-like carnivores). Genome comparisons of dog and cat recovered 506 putatively informative SINE loci for caniformian phylogeny. In this study we show how to use such genome information of model organisms to research the phylogeny of related non-model species of interest. Investigating a dataset including representatives of all major caniformian lineages, we analysed 24 randomly chosen loci for 22 taxa. All loci were amplifiable and revealed 17 parsimony-informative SINE insertions. The screening for informative SINE insertions yields a large amount of sequence information, in particular of introns, which contain reliable phylogenetic information as well. A phylogenetic analysis of intron- and SINE sequence data provided a statistically robust phylogeny which is congruent with the absence/presence pattern of our SINE markers. This phylogeny strongly supports a sistergroup relationship of Musteloidea and Pinnipedia. Within Pinnipedia, we see strong support from bootstrapping and the presence of a SINE insertion for a sistergroup relationship of the walrus with the Otariidae.

  20. Alterations in the 5 'untranslated region of the EPSPS gene influence EPSPS overexpression in glyphosate-resistant Eleusine indica.

    PubMed

    Zhang, Chun; Feng, Li; Tian, Xing-Shan

    2018-04-26

    The herbicide glyphosate inhibits the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Overexpression of the EPSPS gene is one of the molecular mechanisms conferring glyphosate resistance in weeds, but the transcriptional regulation of this gene is poorly understood. The EPSPS gene was found to be significantly up-regulated following glyphosate treatment in a glyphosate- resistant Eleusine indica population from South China. To further investigate the regulation of EPSPS overexpression, the promoter of the EPSPS gene from this E. indica population was cloned and analyzed. Two upstream regulatory sequences, Epro-S (862 bp) and Epro-R (877 bp) of EPSPS were obtained from glyphosate-susceptible (S) and -resistant (R) E. indica plants respectively by HiTAIL-PCR. The Epro-S and Epro-R sequences were 99% homologous, except for the two insertions (3 bp and12 bp) in the R sequence. The 12-base insertion of the Epro-R sequence was located in the 5'-UTR-Py-rich stretch element. The promoter activity tests showed that the 12-base insertion resulted in significant enhancement of the Epro-R promoter activity, whereas the 3-base insertion had little effect on Epro-R promoter activity. Alterations in the 5'-UTR-Py-rich stretch element of EPSPS are responsible for glyphosate induced EPSPS overexpression. Therefore, EPSPS transcriptional regulation confers glyphosate resistance in this E. indica population. This article is protected by copyright. All rights reserved.

  1. Metagenomic analysis of bacterial and archaeal assemblages in the soil-mousse surrounding a geothermal spring

    PubMed Central

    Bhatia, Sonu; Batra, Navneet; Pathak, Ashish; Joshi, Amit; Souza, Leila; Almeida, Paulo; Chauhan, Ashvini

    2015-01-01

    The soil-mousse surrounding a geothermal spring was analyzed for bacterial and archaeal diversity using 16S rRNA gene amplicon metagenomic sequencing which revealed the presence of 18 bacterial phyla distributed across 109 families and 219 genera. Firmicutes, Actinobacteria, and the Deinococcus-Thermus group were the predominant bacterial assemblages with Crenarchaeota and Thaumarchaeota as the main archaeal assemblages in this largely understudied geothermal habitat. Several metagenome sequences remained taxonomically unassigned suggesting the presence of a repertoire of hitherto undescribed microbes in this geothermal soil-mousse econiche. PMID:26484255

  2. New perspectives on bacterial ferredoxin evolution

    NASA Technical Reports Server (NTRS)

    George, D. G.; Hunt, L. T.; Yeh, L.-S. L.; Barker, W. C.

    1985-01-01

    Ferredoxins are low-molecular-weight, nonheme, iron proteins which function as electron carriers in a wide variety of electron transport chains. Howard et al. (1983) have suggested that the amino end of Azotobacter vinelandii ferredoxin shows a greater similarity to the carboxyl end of ferredoxin from Chromatium vinosum and that their half-chain sequences are homologous when the half-chains of either species are considered in inverse order. Examination of this proposition has made it necessary to reevaluate previous conclusions concerning the evolution of bacterial ferredoxin. Attention is given to the properties of the bacterial ferredoxin sequences, and the evolution of the bacterial ferredoxins.

  3. Transposon insertion libraries for the characterization of mutants from the kiwifruit pathogen Pseudomonas syringae pv. actinidiae

    PubMed Central

    Mesarich, Carl H.; Rees-George, Jonathan; Gardner, Paul P.; Ghomi, Fatemeh Ashari; Gerth, Monica L.; Andersen, Mark T.; Rikkerink, Erik H. A.; Fineran, Peter C.

    2017-01-01

    Pseudomonas syringae pv. actinidiae (Psa), the causal agent of kiwifruit canker, is one of the most devastating plant diseases of recent times. We have generated two mini-Tn5-based random insertion libraries of Psa ICMP 18884. The first, a ‘phenotype of interest’ (POI) library, consists of 10,368 independent mutants gridded into 96-well plates. By replica plating onto selective media, the POI library was successfully screened for auxotrophic and motility mutants. Lipopolysaccharide (LPS) biosynthesis mutants with ‘Fuzzy-Spreader’-like morphologies were also identified through a visual screen. The second, a ‘mutant of interest’ (MOI) library, comprises around 96,000 independent mutants, also stored in 96-well plates, with approximately 200 individuals per well. The MOI library was sequenced on the Illumina MiSeq platform using Transposon-Directed Insertion site Sequencing (TraDIS) to map insertion sites onto the Psa genome. A grid-based PCR method was developed to recover individual mutants, and using this strategy, the MOI library was successfully screened for a putative LPS mutant not identified in the visual screen. The Psa chromosome and plasmid had 24,031 and 1,236 independent insertion events respectively, giving insertion frequencies of 3.65 and 16.6 per kb respectively. These data suggest that the MOI library is near saturation, with the theoretical probability of finding an insert in any one chromosomal gene estimated to be 97.5%. However, only 47% of chromosomal genes had insertions. This surprisingly low rate cannot be solely explained by the lack of insertions in essential genes, which would be expected to be around 5%. Strikingly, many accessory genes, including most of those encoding type III effectors, lacked insertions. In contrast, 94% of genes on the Psa plasmid had insertions, including for example, the type III effector HopAU1. These results suggest that some chromosomal sites are rendered inaccessible to transposon insertion, either by DNA-binding proteins or by the architecture of the nucleoid. PMID:28249011

  4. The CRISPR Spacer Space Is Dominated by Sequences from Species-Specific Mobilomes.

    PubMed

    Shmakov, Sergey A; Sitnik, Vassilii; Makarova, Kira S; Wolf, Yuri I; Severinov, Konstantin V; Koonin, Eugene V

    2017-09-19

    Clustered regularly interspaced short palindromic repeats and CRISPR-associated protein (CRISPR-Cas) systems store the memory of past encounters with foreign DNA in unique spacers that are inserted between direct repeats in CRISPR arrays. For only a small fraction of the spacers, homologous sequences, called protospacers, are detectable in viral, plasmid, and microbial genomes. The rest of the spacers remain the CRISPR "dark matter." We performed a comprehensive analysis of the spacers from all CRISPR- cas loci identified in bacterial and archaeal genomes, and we found that, depending on the CRISPR-Cas subtype and the prokaryotic phylum, protospacers were detectable for 1% to about 19% of the spacers (~7% global average). Among the detected protospacers, the majority, typically 80 to 90%, originated from viral genomes, including proviruses, and among the rest, the most common source was genes that are integrated into microbial chromosomes but are involved in plasmid conjugation or replication. Thus, almost all spacers with identifiable protospacers target mobile genetic elements (MGE). The GC content, as well as dinucleotide and tetranucleotide compositions, of microbial genomes, their spacer complements, and the cognate viral genomes showed a nearly perfect correlation and were almost identical. Given the near absence of self-targeting spacers, these findings are most compatible with the possibility that the spacers, including the dark matter, are derived almost completely from the species-specific microbial mobilomes. IMPORTANCE The principal function of CRISPR-Cas systems is thought to be protection of bacteria and archaea against viruses and other parasitic genetic elements. The CRISPR defense function is mediated by sequences from parasitic elements, known as spacers, that are inserted into CRISPR arrays and then transcribed and employed as guides to identify and inactivate the cognate parasitic genomes. However, only a small fraction of the CRISPR spacers match any sequences in the current databases, and of these, only a minority correspond to known parasitic elements. We show that nearly all spacers with matches originate from viral or plasmid genomes that are either free or have been integrated into the host genome. We further demonstrate that spacers with no matches have the same properties as those of identifiable origins, strongly suggesting that all spacers originate from mobile elements.

  5. A ribosomal orphon sequence from Xenopus laevis flanked by novel low copy number repetitive elements.

    PubMed

    Guimond, A; Moss, T

    1999-02-01

    We have used a differential cloning approach to isolate ribosomal/non-ribosomal frontier sequences from Xenopus laevis. A ribosomal intergenic spacer sequence (IGS) was cloned and shown not to be physically linked with the ribosomal locus. This ribosomal orphon contained the IGS sequences found immediately downstream of the 28S gene and included an array of enhancer repetitions and a non-functional spacer promoter. The orphon sequence was flanked by a member of the novel 'Frt' low copy repetitive element family. Three individual Frt repeats were sequenced and all members of this family were shown to lie clustered at two chromosomal sites, one of which contained the ribosomal orphon. One of the Frt elements contained an insertion of 297 bp that showed extensive homology to sequences within at least three other Xenopus genes. Each homology region was flanked by members of the T2 family of short interspersed repetitive elements, (SINEs), and by its target insertion sequence, suggesting multiple translocation events. The data are discussed in terms of the evolution of the ribosomal gene locus.

  6. M13 procoat protein insertion into YidC and SecYEG proteoliposomes and liposomes.

    PubMed

    Stiegler, Natalie; Dalbey, Ross E; Kuhn, Andreas

    2011-02-25

    M13 procoat protein was one of the first model proteins used to study bacterial membrane protein insertion. It contains a signal peptide of 23 amino acid residues and is not membrane targeted by the signal recognition particle. The translocation of its periplasmic domain is independent of the preprotein translocase (SecAYEG) but requires electrochemical membrane potential and the membrane insertase YidC of Escherichia coli. We show here that YidC is sufficient for efficient membrane insertion of the purified M13 procoat protein into energized YidC proteoliposomes. When no membrane potential is applied, the insertion is substantially reduced. Only in the presence of YidC, membrane insertion occurs if bilayer integrity is preserved and membrane potential is stable for more than 20 min. A mutant of the M13 procoat protein, H5EE, with two additional negatively charged residues in the periplasmic domain inserted into YidC proteoliposomes and SecYEG proteoliposomes with equal efficiencies. We conclude that the protein can use both the YidC-only pathway and the Sec pathway. This poses the questions of how procoat H5EE is inserted in vivo and how insertion pathways are selected in the cell. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Spatial and vertical distribution of bacterial community in the northern South China Sea.

    PubMed

    Sun, Fu-Lin; Wang, You-Shao; Wu, Mei-Lin; Sun, Cui-Ci; Cheng, Hao

    2015-10-01

    Microbial communities are highly diverse in coastal oceans and response rapidly with changing environments. Learning about this will help us understand the ecology of microbial populations in marine ecosystems. This study aimed to assess the spatial and vertical distributions of the bacterial community in the northern South China Sea. Multi-dimensional scaling analyses revealed structural differences of the bacterial community among sampling sites and vertical depth. Result also indicated that bacterial community in most sites had higher diversity in 0-75 m depths than those in 100-200 m depths. Bacterial community of samples was positively correlation with salinity and depth, whereas was negatively correlation with temperature. Proteobacteria and Cyanobacteria were the dominant groups, which accounted for the majority of sequences. The α-Proteobacteria was highly diverse, and sequences belonged to Rhodobacterales bacteria were dominant in all characterized sequences. The current data indicate that the Rhodobacterales bacteria, especially Roseobacter clade are the diverse group in the tropical waters.

  8. Diagnostic use of computational retrotransposon detection: Successful definition of pathogenetic mechanism in a ciliopathy phenotype.

    PubMed

    Takenouchi, Toshiki; Kuchikata, Tomu; Yoshihashi, Hiroshi; Fujiwara, Mineko; Uehara, Tomoko; Miyama, Sahoko; Yamada, Shiro; Kosaki, Kenjiro

    2017-05-01

    Among more than 5,000 human monogenic disorders with known causative genes, transposable element insertion of a Long Interspersed Nuclear Element 1 (LINE1, L1) is known as the mechanistic basis in only 13 genetic conditions. Meckel-Gruber syndrome is a rare ciliopathy characterized by occipital encephalocele and cystic kidney disease. Here, we document a boy with occipital encephalocele, post-axial polydactyly, and multicystic renal disease. A medical exome analysis detected a heterozygous frameshift mutation, c.4582_4583delCG p.(Arg1528Serfs*17) in CC2D2A in the maternally derived allele. The further use of a dedicated bioinformatics algorithm for detecting retrotransposon insertions led to the detection of an L1 insertion affecting exon 7 in the paternally derived allele. The complete sequencing and sequence homology analysis of the inserted L1 element showed that the L1 element was classified as L1HS (L1 human specific) and that the element had intact open reading frames in the two L1-encoded proteins. This observation ranks Meckel-Gruber syndrome as only the 14th disorder to be caused by an L1 insertion among more than 5,000 known human genetic disorders. Although a transposable element detection algorithm is not included in the current best-practice next-generation sequencing analysis, the present observation illustrates the utility of such an algorithm, which would require modest computational time and resources. Whether the seemingly infrequent recognition of L1 insertion in the pathogenesis of human genetic diseases might simply reflect a lack of appropriate detection methods remains to be seen. © 2017 Wiley Periodicals, Inc.

  9. Cytochrome cd1-containing nitrite reductase encoding gene nirS as a new functional biomarker for detection of anaerobic ammonium oxidizing (Anammox) bacteria.

    PubMed

    Li, Meng; Ford, Tim; Li, Xiaoyan; Gu, Ji-Dong

    2011-04-15

    A newly designed primer set (AnnirS), together with a previously published primer set (ScnirS), was used to detect anammox bacterial nirS genes from sediments collected from three marine environments. Phylogenetic analysis demonstrated that all retrieved sequences were clearly different from typical denitrifiers' nirS, but do group together with the known anammox bacterial nirS. Sequences targeted by ScnirS are closely related to Scalindua nirS genes recovered from the Peruvian oxygen minimum zone (OMZ), whereas sequences targeted by AnnirS are more closely affiliated with the nirS of Candidatus 'Kuenenia stuttgartiensis' and even form a new phylogenetic nirS clade, which might be related to other genera of the anammox bacteria. Analysis demonstrated that retrieved sequences had higher sequence identities (>60%) with known anammox bacterial nirS genes than with denitrifiers' nirS, on both nucleotide and amino acid levels. Compared to the 16S rRNA and hydrazine oxidoreductase (hzo) genes, the anammox bacterial nirS not only showed consistent phylogenetic relationships but also demonstrated more reliable quantification of anammox bacteria because of the single copy of the nirS gene in the anammox bacterial genome and the specificity of PCR primers for different genera of anammox bacteria, thus providing a suitable functional biomarker for investigation of anammox bacteria.

  10. Alterations of microbiota in urine from women with interstitial cystitis

    PubMed Central

    2012-01-01

    Background Interstitial Cystitis (IC) is a chronic inflammatory condition of the bladder with unknown etiology. The aim of this study was to characterize the microbial community present in the urine from IC female patients by 454 high throughput sequencing of the 16S variable regions V1V2 and V6. The taxonomical composition, richness and diversity of the IC microbiota were determined and compared to the microbial profile of asymptomatic healthy female (HF) urine. Results The composition and distribution of bacterial sequences differed between the urine microbiota of IC patients and HFs. Reduced sequence richness and diversity were found in IC patient urine, and a significant difference in the community structure of IC urine in relation to HF urine was observed. More than 90% of the IC sequence reads were identified as belonging to the bacterial genus Lactobacillus, a marked increase compared to 60% in HF urine. Conclusion The 16S rDNA sequence data demonstrates a shift in the composition of the bacterial community in IC urine. The reduced microbial diversity and richness is accompanied by a higher abundance of the bacterial genus Lactobacillus, compared to HF urine. This study demonstrates that high throughput sequencing analysis of urine microbiota in IC patients is a powerful tool towards a better understanding of this enigmatic disease. PMID:22974186

  11. Genetic plasticity of the Shigella virulence plasmid is mediated by intra- and inter-molecular events between insertion sequences.

    PubMed

    Pilla, Giulia; McVicker, Gareth; Tang, Christoph M

    2017-09-01

    Acquisition of a single copy, large virulence plasmid, pINV, led to the emergence of Shigella spp. from Escherichia coli. The plasmid encodes a Type III secretion system (T3SS) on a 30 kb pathogenicity island (PAI), and is maintained in a bacterial population through a series of toxin:antitoxin (TA) systems which mediate post-segregational killing (PSK). The T3SS imposes a significant cost on the bacterium, and strains which have lost the plasmid and/or genes encoding the T3SS grow faster than wild-type strains in the laboratory, and fail to bind the indicator dye Congo Red (CR). Our aim was to define the molecular events in Shigella flexneri that cause loss of Type III secretion (T3S), and to examine whether TA systems exert positional effects on pINV. During growth at 37°C, we found that deletions of regions of the plasmid including the PAI lead to the emergence of CR-negative colonies; deletions occur through intra-molecular recombination events between insertion sequences (ISs) flanking the PAI. Furthermore, by repositioning MvpAT (which belongs to the VapBC family of TA systems) near the PAI, we demonstrate that the location of this TA system alters the rearrangements that lead to loss of T3S, indicating that MvpAT acts both globally (by reducing loss of pINV through PSK) as well as locally (by preventing loss of adjacent sequences). During growth at environmental temperatures, we show for the first time that pINV spontaneously integrates into different sites in the chromosome, and this is mediated by inter-molecular events involving IS1294. Integration leads to reduced PAI gene expression and impaired secretion through the T3SS, while excision of pINV from the chromosome restores T3SS function. Therefore, pINV integration provides a reversible mechanism for Shigella to circumvent the metabolic burden imposed by pINV. Intra- and inter-molecular events between ISs, which are abundant in Shigella spp., mediate plasticity of S. flexneri pINV.

  12. Gene replacements and insertions in rice by intron targeting using CRISPR-Cas9.

    PubMed

    Li, Jun; Meng, Xiangbing; Zong, Yuan; Chen, Kunling; Zhang, Huawei; Liu, Jinxing; Li, Jiayang; Gao, Caixia

    2016-09-12

    Sequence-specific nucleases have been exploited to create targeted gene knockouts in various plants(1), but replacing a fragment and even obtaining gene insertions at specific loci in plant genomes remain a serious challenge. Here, we report efficient intron-mediated site-specific gene replacement and insertion approaches that generate mutations using the non-homologous end joining (NHEJ) pathway using the clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) system. Using a pair of single guide RNAs (sgRNAs) targeting adjacent introns and a donor DNA template including the same pair of sgRNA sites, we achieved gene replacements in the rice endogenous gene 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) at a frequency of 2.0%. We also obtained targeted gene insertions at a frequency of 2.2% using a sgRNA targeting one intron and a donor DNA template including the same sgRNA site. Rice plants harbouring the OsEPSPS gene with the intended substitutions were glyphosate-resistant. Furthermore, the site-specific gene replacements and insertions were faithfully transmitted to the next generation. These newly developed approaches can be generally used to replace targeted gene fragments and to insert exogenous DNA sequences into specific genomic sites in rice and other plants.

  13. Simultaneous detection of human mitochondrial DNA and nuclear-inserted mitochondrial-origin sequences (NumtS) using forensic mtDNA amplification strategies and pyrosequencing technology.

    PubMed

    Bintz, Brittania J; Dixon, Groves B; Wilson, Mark R

    2014-07-01

    Next-generation sequencing technologies enable the identification of minor mitochondrial DNA variants with higher sensitivity than Sanger methods, allowing for enhanced identification of minor variants. In this study, mixtures of human mtDNA control region amplicons were subjected to pyrosequencing to determine the detection threshold of the Roche GS Junior(®) instrument (Roche Applied Science, Indianapolis, IN). In addition to expected variants, a set of reproducible variants was consistently found in reads from one particular amplicon. A BLASTn search of the variant sequence revealed identity to a segment of a 611-bp nuclear insertion of the mitochondrial control region (NumtS) spanning the primer-binding sites of this amplicon (Nature 1995;378:489). Primers (Hum Genet 2012;131:757; Hum Biol 1996;68:847) flanking the insertion were used to confirm the presence or absence of the NumtS in buccal DNA extracts from twenty donors. These results further our understanding of human mtDNA variation and are expected to have a positive impact on the interpretation of mtDNA profiles using deep-sequencing methods in casework. © 2014 American Academy of Forensic Sciences.

  14. The American cranberry mitochondrial genome reveals the presence of selenocysteine (tRNA-Sec and SECIS) insertion machinery in land plants.

    PubMed

    Fajardo, Diego; Schlautman, Brandon; Steffan, Shawn; Polashock, James; Vorsa, Nicholi; Zalapa, Juan

    2014-02-25

    This is the first de novo assembly and annotation of a complete mitochondrial genome in the Ericales order from the American cranberry (Vaccinium macrocarpon Ait.). Moreover, only four complete Asterid mitochondrial genomes have been made publicly available. The cranberry mitochondrial genome was assembled and reconstructed from whole genome 454 Roche GS-FLX and Illumina shotgun sequences. Compared with other Asterids, the reconstruction of the genome revealed an average size mitochondrion (459,678 nt) with relatively little repetitive sequences and DNA of plastid origin. The complete mitochondrial genome of cranberry was annotated obtaining a total of 34 genes classified based on their putative function, plus three ribosomal RNAs, and 17 transfer RNAs. Maternal organellar cranberry inheritance was inferred by analyzing gene variation in the cranberry mitochondria and plastid genomes. The annotation of cranberry mitochondrial genome revealed the presence of two copies of tRNA-Sec and a selenocysteine insertion sequence (SECIS) element which were lost in plants during evolution. This is the first report of a land plant possessing selenocysteine insertion machinery at the sequence level. Published by Elsevier B.V.

  15. Long interspersed element-1 (LINE-1): passenger or driver in human neoplasms?

    PubMed

    Rodić, Nemanja; Burns, Kathleen H

    2013-03-01

    LINE-1 (L1) retrotransposons make up a significant portion of human genomes, with an estimated 500,000 copies per genome. Like other retrotransposons, L1 retrotransposons propagate through RNA sequences that are reverse transcribed into DNA sequences, which are integrated into new genomic loci. L1 somatic insertions have the potential to disrupt the transcriptome by inserting into or nearby genes. By mutating genes and playing a role in epigenetic dysregulation, L1 transposons may contribute to tumorigenesis. Studies of the "mobilome" have lagged behind other tumor characterizations at the sequence, transcript, and epigenetic levels. Here, we consider evidence that L1 retrotransposons may sometimes drive human tumorigenesis.

  16. Bacterial Community Analysis of Drinking Water Biofilms in Southern Sweden

    PubMed Central

    Lührig, Katharina; Canbäck, Björn; Paul, Catherine J.; Johansson, Tomas; Persson, Kenneth M.; Rådström, Peter

    2015-01-01

    Next-generation sequencing of the V1–V2 and V3 variable regions of the 16S rRNA gene generated a total of 674,116 reads that described six distinct bacterial biofilm communities from both water meters and pipes. A high degree of reproducibility was demonstrated for the experimental and analytical work-flow by analyzing the communities present in parallel water meters, the rare occurrence of biological replicates within a working drinking water distribution system. The communities observed in water meters from households that did not complain about their drinking water were defined by sequences representing Proteobacteria (82–87%), with 22–40% of all sequences being classified as Sphingomonadaceae. However, a water meter biofilm community from a household with consumer reports of red water and flowing water containing elevated levels of iron and manganese had fewer sequences representing Proteobacteria (44%); only 0.6% of all sequences were classified as Sphingomonadaceae; and, in contrast to the other water meter communities, markedly more sequences represented Nitrospira and Pedomicrobium. The biofilm communities in pipes were distinct from those in water meters, and contained sequences that were identified as Mycobacterium, Nocardia, Desulfovibrio, and Sulfuricurvum. The approach employed in the present study resolved the bacterial diversity present in these biofilm communities as well as the differences that occurred in biofilms within a single distribution system, and suggests that next-generation sequencing of 16S rRNA amplicons can show changes in bacterial biofilm communities associated with different water qualities. PMID:25739379

  17. Bacterial community analysis of drinking water biofilms in southern Sweden.

    PubMed

    Lührig, Katharina; Canbäck, Björn; Paul, Catherine J; Johansson, Tomas; Persson, Kenneth M; Rådström, Peter

    2015-01-01

    Next-generation sequencing of the V1-V2 and V3 variable regions of the 16S rRNA gene generated a total of 674,116 reads that described six distinct bacterial biofilm communities from both water meters and pipes. A high degree of reproducibility was demonstrated for the experimental and analytical work-flow by analyzing the communities present in parallel water meters, the rare occurrence of biological replicates within a working drinking water distribution system. The communities observed in water meters from households that did not complain about their drinking water were defined by sequences representing Proteobacteria (82-87%), with 22-40% of all sequences being classified as Sphingomonadaceae. However, a water meter biofilm community from a household with consumer reports of red water and flowing water containing elevated levels of iron and manganese had fewer sequences representing Proteobacteria (44%); only 0.6% of all sequences were classified as Sphingomonadaceae; and, in contrast to the other water meter communities, markedly more sequences represented Nitrospira and Pedomicrobium. The biofilm communities in pipes were distinct from those in water meters, and contained sequences that were identified as Mycobacterium, Nocardia, Desulfovibrio, and Sulfuricurvum. The approach employed in the present study resolved the bacterial diversity present in these biofilm communities as well as the differences that occurred in biofilms within a single distribution system, and suggests that next-generation sequencing of 16S rRNA amplicons can show changes in bacterial biofilm communities associated with different water qualities.

  18. Bacterial taxa–area and distance–decay relationships in marine environments

    PubMed Central

    Zinger, L; Boetius, A; Ramette, A

    2014-01-01

    The taxa–area relationship (TAR) and the distance–decay relationship (DDR) both describe spatial turnover of taxa and are central patterns of biodiversity. Here, we compared TAR and DDR of bacterial communities across different marine realms and ecosystems at the global scale. To obtain reliable global estimates for both relationships, we quantified the poorly assessed effects of sequencing depth, rare taxa removal and number of sampling sites. Slope coefficients of bacterial TARs were within the range of those of plants and animals, whereas slope coefficients of bacterial DDR were much lower. Slope coefficients were mostly affected by removing rare taxa and by the number of sampling sites considered in the calculations. TAR and DDR slope coefficients were overestimated at sequencing depth <4000 sequences per sample. Noticeably, bacterial TAR and DDR patterns did not correlate with each other both within and across ecosystem types, suggesting that (i) TAR cannot be directly derived from DDR and (ii) TAR and DDR may be influenced by different ecological factors. Nevertheless, we found marine bacterial TAR and DDR to be steeper in ecosystems associated with high environmental heterogeneity or spatial isolation, namely marine sediments and coastal environments compared with pelagic ecosystems. Hence, our study provides information on macroecological patterns of marine bacteria, as well as methodological and conceptual insights, at a time when biodiversity surveys increasingly make use of high-throughput sequencing technologies. PMID:24460915

  19. Identification and Antimicrobial Resistance of Bacteria Isolated from Probiotic Products Used in Shrimp Culture.

    PubMed

    Noor Uddin, Gazi Md; Larsen, Marianne Halberg; Christensen, Henrik; Aarestrup, Frank M; Phu, Tran Minh; Dalsgaard, Anders

    2015-01-01

    Probiotics are increasingly used in aquaculture to control diseases and improve feed digestion and pond water quality; however, little is known about the antimicrobial resistance properties of such probiotic bacteria and to what extent they may contribute to the development of bacterial resistance in aquaculture ponds. Concerns have been raised that the declared information on probiotic product labels are incorrect and information on bacterial composition are often missing. We therefore evaluated seven probiotics commonly used in Vietnamese shrimp culture for their bacterial species content, phenotypic antimicrobial resistance and associated transferable resistance genes. The bacterial species was established by 16S rRNA sequence analysis of 125 representative bacterial isolates. MIC testing was done for a range of antimicrobials and whole genome sequencing of six multiple antimicrobial resistant Bacillus spp. used to identify resistance genes and genetic elements associated with horizontal gene transfer. Thirteen bacterial species declared on the probiotic products could not be identified and 11 non-declared Bacillus spp. were identified. Although our culture-based isolation and identification may have missed a few bacterial species present in the tested products this would represent minor bias, but future studies may apply culture independent identification methods like pyro sequencing. Only 6/60 isolates were resistant to more than four antimicrobials and whole genome sequencing showed that they contained macrolide (ermD), tetracycline (tetL), phenicol (fexA) and trimethoprim (dfrD, dfrG and dfrK) resistance genes, but not known structures associated with horizontal gene transfer. Probiotic bacterial strains used in Vietnamese shrimp culture seem to contribute with very limited types and numbers of resistance genes compared to the naturally occurring bacterial species in aquaculture environments. Approval procedures of probiotic products must be strengthened through scientific-based efficacy trials and product labels should allow identification of individual bacterial strains and inform the farmer on specific purpose, dosage and correct application measures.

  20. Serratia marcescens outbreak in a neonatal intensive care unit (NICU): new insights from next-generation sequencing applications.

    PubMed

    Martineau, Christine; Li, Xuejing; Lalancette, Cindy; Perreault, Thérèse; Fournier, Eric; Tremblay, Julien; Gonzales, Milagros; Yergeau, Étienne; Quach, Caroline

    2018-06-13

    Serratia marcescens is an environmental bacterium commonly associated with outbreaks in neonatal intensive care units (NICU). Investigation of S. marcescens outbreaks requires efficient recovery and typing of clinical and environmental isolates. In this study, we described how the use of next-generation sequencing applications, such as bacterial whole-genome sequencing (WGS) and bacterial community profiling, could improve S. marcescens outbreak investigation. Phylogenomic links and potential antibiotic resistance genes and plasmids in S. marcescens isolates were investigated using WGS, while bacterial communities and relative abundances of Serratia in environmental samples were assessed using sequencing of bacterial phylogenetic marker genes (16S rRNA and gyrB genes). Typing results obtained using WGS for the ten S. marcescens isolates recovered during a NICU outbreak investigation were highly consistent with those from pulse-field gel electrophoresis (PFGE), the current gold standard typing method for this bacterium. WGS also allowed for the identification of genes associated with antibiotic resistance in all isolates, while no plasmid was detected. Sequencing of the 16S rRNA and gyrB genes both showed higher relative abundances of Serratia in environmental sampling sites that were in close contact with infected babies. Much lower relative abundances of Serratia were observed following disinfection of a room, indicating that the protocol used was efficient. Variations in the bacterial community composition and structure following room disinfection and between sampling sites were also identified through 16S rRNA gene sequencing. Globally, results from this study highlight the potential for next-generation sequencing tools to improve and facilitate outbreak investigation. Copyright © 2018 American Society for Microbiology.

  1. Assembled sequence contigs by SOAPdenova and Volvet algorithms from metagenomic short reads of a new bacterial isolate of gut origin

    USDA-ARS?s Scientific Manuscript database

    Assembled sequence contigs by SOAPdenova and Volvet algorithms from metagenomic short reads of a new bacterial isolate of gut origin. This study included 2 submissions with a total of 9.8 million bp of assembled contigs....

  2. Joint analysis of bacterial DNA methylation, predicted promoter and regulation motifs for biological significance

    USDA-ARS?s Scientific Manuscript database

    Advances in long-read, single molecule real-time sequencing technology and analysis software over the last two years has enabled the efficient production of closed bacterial genome sequences. However, consistent annotation of these genomes has lagged behind the ability to create them, while the avai...

  3. Unique transposon landscapes are pervasive across Drosophila melanogaster genomes

    PubMed Central

    Rahman, Reazur; Chirn, Gung-wei; Kanodia, Abhay; Sytnikova, Yuliya A.; Brembs, Björn; Bergman, Casey M.; Lau, Nelson C.

    2015-01-01

    To understand how transposon landscapes (TLs) vary across animal genomes, we describe a new method called the Transposon Insertion and Depletion AnaLyzer (TIDAL) and a database of >300 TLs in Drosophila melanogaster (TIDAL-Fly). Our analysis reveals pervasive TL diversity across cell lines and fly strains, even for identically named sub-strains from different laboratories such as the ISO1 strain used for the reference genome sequence. On average, >500 novel insertions exist in every lab strain, inbred strains of the Drosophila Genetic Reference Panel (DGRP), and fly isolates in the Drosophila Genome Nexus (DGN). A minority (<25%) of transposon families comprise the majority (>70%) of TL diversity across fly strains. A sharp contrast between insertion and depletion patterns indicates that many transposons are unique to the ISO1 reference genome sequence. Although TL diversity from fly strains reaches asymptotic limits with increasing sequencing depth, rampant TL diversity causes unsaturated detection of TLs in pools of flies. Finally, we show novel transposon insertions negatively correlate with Piwi-interacting RNA (piRNA) levels for most transposon families, except for the highly-abundant roo retrotransposon. Our study provides a useful resource for Drosophila geneticists to understand how transposons create extensive genomic diversity in fly cell lines and strains. PMID:26578579

  4. Cloning and expression of 130-kd mosquito-larvicidal delta-endotoxin gene of Bacillus thuringiensis var. Israelensis in Escherichia coli.

    PubMed

    Angsuthanasombat, C; Chungjatupornchai, W; Kertbundit, S; Luxananil, P; Settasatian, C; Wilairat, P; Panyim, S

    1987-07-01

    Five recombinant E. coli clones exhibiting toxicity to Aedes aegypti larvae were obtained from a library of 800 clones containing XbaI DNA fragments of 110 kb plasmid from B. thuringiensis var. israelensis. All the five clones (pMU 14/258/303/388/679) had the same 3.8-kb insert and encoded a major protein of 130 kDa which was highly toxic to A. aegypti larvae. Three clones (pMU 258/303/388) transcribed the 130 kD a gene in the same direction as that of lac Z promoter of pUC12 vector whereas the transcription of the other two (pMU 14/679) was in the opposite direction. A 1.9-kb fragment of the 3.8 kb insert coded for a protein of 65 kDa. Partial DNA sequence of the 3.8 kb insert, corresponding to the 5'-terminal of the 130 kDa gene, revealed a continuous reading frame, a Shine-Dalgarno sequence and a tentative 5'-regulatory region. These results demonstrated that the 3.8 kb insert is a minimal DNA fragment containing a regulatory region plus the coding sequence of the 130 kDa protein that is highly toxic to mosquito larvae.

  5. MINS2: revisiting the molecular code for transmembrane-helix recognition by the Sec61 translocon.

    PubMed

    Park, Yungki; Helms, Volkhard

    2008-08-15

    To be fully functional, membrane proteins should not only fold, but also get inserted into the membrane, which is mediated by the Sec61 translocon. Recent experimental studies have attempted to elucidate how the Sec61 translocon accomplishes this delicate task by measuring the translocon-mediated membrane insertion free energies of 357 systematically designed peptides. On the basis of this data set, we have developed MINS2, a novel sequence-based computational method for predicting the membrane insertion free energies of protein sequences. A benchmark analysis of MINS2 shows that MINS2 signi.cantly outperforms previously proposed methods. Importantly, the application of MINS2 to known membrane protein structures shows that a better prediction of membrane insertion free energies does not lead to a better prediction of transmembrane segments of polytopic membrane proteins. A web server for MINS2 is publicly available at http://service.bioinformatik.uni-saarland.de/mins. Supplementary data are available at Bioinformatics online.

  6. Structure of yeast Argonaute with guide RNA

    PubMed Central

    Nakanishi, Kotaro; Weinberg, David E.; Bartel, David P.; Patel, Dinshaw J.

    2012-01-01

    The RNA-induced silencing complex, comprising Argonaute and guide RNA, mediates RNA interference. Here we report the 3.2 Å crystal structure of Kluyveromyces Argonaute (KpAGO) fortuitously complexed with guide RNA originating from small-RNA duplexes autonomously loaded and processed by recombinant KpAGO. Despite their diverse sequences, guide-RNA nucleotides 1–8 are positioned similarly, with sequence-independent contacts to bases, phosphates and 2′-hydroxyl groups pre-organizing the backbone of nucleotides 2–8 in a near–A-form conformation. Compared with prokaryotic Argonautes, KpAGO has numerous surface-exposed insertion segments, with a cluster of conserved insertions repositioning the N domain to enable full propagation of guide–target pairing. Compared with Argonautes in inactive conformations, KpAGO has a hydrogen-bond network that stabilizes an expanded and repositioned loop, which inserts an invariant glutamate into the catalytic pocket. Mutation analyses and analogies to Ribonuclease H indicate that insertion of this glutamate finger completes a universally conserved catalytic tetrad, thereby activating Argonaute for RNA cleavage. PMID:22722195

  7. Assembling short reads from jumping libraries with large insert sizes.

    PubMed

    Vasilinetc, Irina; Prjibelski, Andrey D; Gurevich, Alexey; Korobeynikov, Anton; Pevzner, Pavel A

    2015-10-15

    Advances in Next-Generation Sequencing technologies and sample preparation recently enabled generation of high-quality jumping libraries that have a potential to significantly improve short read assemblies. However, assembly algorithms have to catch up with experimental innovations to benefit from them and to produce high-quality assemblies. We present a new algorithm that extends recently described exSPAnder universal repeat resolution approach to enable its applications to several challenging data types, including jumping libraries generated by the recently developed Illumina Nextera Mate Pair protocol. We demonstrate that, with these improvements, bacterial genomes often can be assembled in a few contigs using only a single Nextera Mate Pair library of short reads. Described algorithms are implemented in C++ as a part of SPAdes genome assembler, which is freely available at bioinf.spbau.ru/en/spades. ap@bioinf.spbau.ru Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  8. Transposon-mediated random gene disruption with moderate halophilic bacteria and its application for halophilic bacterial siderophore analysis.

    PubMed

    Matsui, Toru; Nishino, Tomohiko

    2016-12-01

    Analytical conditions using chromo azurol S was validated for quantification of siderophore in aqueous samples, followed by the characterization of siderophore derived from newly isolated moderately halophilic bacteria. Conditions with good linearity between the absorbance and the siderophore concentration were obtained at a siderophore concentration less than 20 µM, in the wavelength range between 630 and 660 nm with developing time for at least 2 h. Of the halophilic bacteria isolated from Tunisian soil, Halomonas sp., namely strain 21a was selected as siderophore producing halophiles. The strain produced siderophore significantly in the absence of iron in minimal medium. Siderophore-deficient mutant, namely IIa10, of the strain 21a was obtained from gene disruptant library constructed using transposon complex by electroporation. Genomic sequence analysis of the mutant IIa10 revealed that the transposon-inserted gene was TonB-dependent receptor. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Complementation of a red-light-indifferent cyanobacterial mutant.

    PubMed Central

    Chiang, G G; Schaefer, M R; Grossman, A R

    1992-01-01

    Many cyanobacteria alter their phycobilisome composition in response to changes in light wavelength in a process termed complementary chromatic adaptation. Mutant strains FdR1 and FdR2 of the filamentous cyanobacterium Fremyella diplosiphon are characterized by aberrant chromatic adaptation. Instead of adjusting to different wavelengths of light, FdR1 and FdR2 behave as if they are always in green light; they do not respond to red light. We have previously reported complementation of FdR1 by conjugal transfer of a wild-type genomic library. The complementing DNA has now been localized by genetic analysis to a region on the rescued genomic subclone that contains a gene designated rcaC. This region of DNA is also able to complement FdR2. Southern blot analysis of genomic DNA from FdR1 and FdR2 indicates that these strains harbor DNA insertions within the rcaC sequence that may have resulted from the activity of transposable genetic elements. The predicted amino acid sequence of RcaC shares strong identity to response regulators of bacterial two-component regulatory systems. This relationship is discussed in the context of the signal-transduction pathway mediating regulation of genes encoding phycobilisome polypeptides during chromatic adaptation. Images PMID:1409650

  10. A cool tool for hot and sour Archaea: proteomics of Sulfolobus solfataricus.

    PubMed

    Kort, Julia Christin; Esser, Dominik; Pham, Trong Khoa; Noirel, Josselin; Wright, Phillip C; Siebers, Bettina

    2013-10-01

    In recent years, much progress has been made in proteomic studies to unravel metabolic pathways and basic cellular processes. This is especially interesting for members of the Archaea, the third domain of life. Archaea exhibit extraordinary features and many of their cultivable representatives are adaptable to extreme environments. Archaea harbor many unique traits besides bacterial attributes, such as size, shape, and DNA structure and eukaryal characteristics like information processing. Sulfolobus solfataricus P2, a thermoacidophilic archaeal representative, is a well-established model organism adapted to low-pH environments (pH 2-3) and high temperatures (80°C). The genome has a size of 3 Mbp and its sequence has been deciphered. Approximately 3033 predicted open reading frames have been identified and the genome is characterized by a great number of diverse insertion sequence elements. In unraveling the organisms' metabolism and lifestyle, proteomic analyses have played a major role. Much effort has been directed at this organism and is reviewed here. With the help of proteomics, unique metabolic pathways were resolved in S. solfataricus, targets for regulatory protein phosphorylation identified, and cellular responses upon virus infection as well as oxidative stress analyzed. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Attenuated Virulence and Genomic Reductive Evolution in the Entomopathogenic Bacterial Symbiont Species, Xenorhabdus poinarii

    PubMed Central

    Ogier, Jean-Claude; Pagès, Sylvie; Bisch, Gaëlle; Chiapello, Hélène; Médigue, Claudine; Rouy, Zoé; Teyssier, Corinne; Vincent, Stéphanie; Tailliez, Patrick; Givaudan, Alain; Gaudriault, Sophie

    2014-01-01

    Bacteria of the genus Xenorhabdus are symbionts of soil entomopathogenic nematodes of the genus Steinernema. This symbiotic association constitutes an insecticidal complex active against a wide range of insect pests. Unlike other Xenorhabdus species, Xenorhabdus poinarii is avirulent when injected into insects in the absence of its nematode host. We sequenced the genome of the X. poinarii strain G6 and the closely related but virulent X. doucetiae strain FRM16. G6 had a smaller genome (500–700 kb smaller) than virulent Xenorhabdus strains and lacked genes encoding potential virulence factors (hemolysins, type 5 secretion systems, enzymes involved in the synthesis of secondary metabolites, and toxin–antitoxin systems). The genomes of all the X. poinarii strains analyzed here had a similar small size. We did not observe the accumulation of pseudogenes, insertion sequences or decrease in coding density usually seen as a sign of genomic erosion driven by genetic drift in host-adapted bacteria. Instead, genome reduction of X. poinarii seems to have been mediated by the excision of genomic blocks from the flexible genome, as reported for the genomes of attenuated free pathogenic bacteria and some facultative mutualistic bacteria growing exclusively within hosts. This evolutionary pathway probably reflects the adaptation of X. poinarii to specific host. PMID:24904010

  12. Responses of Baltic Sea Ice and Open-Water Natural Bacterial Communities to Salinity Change

    PubMed Central

    Kaartokallio, Hermanni; Laamanen, Maria; Sivonen, Kaarina

    2005-01-01

    To investigate the responses of Baltic Sea wintertime bacterial communities to changing salinity (5 to 26 practical salinity units), an experimental study was conducted. Bacterial communities of Baltic seawater and sea ice from a coastal site in southwest Finland were used in two batch culture experiments run for 17 or 18 days at 0°C. Bacterial abundance, cell volume, and leucine and thymidine incorporation were measured during the experiments. The bacterial community structure was assessed using denaturing gradient gel electrophoresis (DGGE) of PCR-amplified partial 16S rRNA genes with sequencing of DGGE bands from initial communities and communities of day 10 or 13 of the experiment. The sea ice-derived bacterial community was metabolically more active than the open-water community at the start of the experiment. Ice-derived bacterial communities were able to adapt to salinity change with smaller effects on physiology and community structure, whereas in the open-water bacterial communities, the bacterial cell volume evolution, bacterial abundance, and community structure responses indicated the presence of salinity stress. The closest relatives for all eight partial 16S rRNA gene sequences obtained were either organisms found in polar sea ice and other cold habitats or those found in summertime Baltic seawater. All sequences except one were associated with the α- and γ-proteobacteria or the Cytophaga-Flavobacterium-Bacteroides group. The overall physiological and community structure responses were parallel in ice-derived and open-water bacterial assemblages, which points to a linkage between community structure and physiology. These results support previous assumptions of the role of salinity fluctuation as a major selective factor shaping the sea ice bacterial community structure. PMID:16085826

  13. Comparison of the complete genome sequences of four γ-hexachlorocyclohexane-degrading bacterial strains: insights into the evolution of bacteria able to degrade a recalcitrant man-made pesticide.

    PubMed

    Tabata, Michiro; Ohhata, Satoshi; Nikawadori, Yuki; Kishida, Kouhei; Sato, Takuya; Kawasumi, Toru; Kato, Hiromi; Ohtsubo, Yoshiyuki; Tsuda, Masataka; Nagata, Yuji

    2016-12-01

    γ-Hexachlorocyclohexane (γ-HCH) is a recalcitrant man-made chlorinated pesticide. Here, the complete genome sequences of four γ-HCH-degrading sphingomonad strains, which are most unlikely to have been derived from one ancestral γ-HCH degrader, were compared. Together with several experimental data, we showed that (i) all the four strains carry almost identical linA to linE genes for the conversion of γ-HCH to maleylacetate (designated "specific" lin genes), (ii) considerably different genes are used for the metabolism of maleylacetate in one of the four strains, and (iii) the linKLMN genes for the putative ABC transporter necessary for γ-HCH utilization exhibit structural divergence, which reflects the phylogenetic relationship of their hosts. Replicon organization and location of the lin genes in the four genomes are significantly different with one another, and that most of the specific lin genes are located on multiple sphingomonad-unique plasmids. Copies of IS6100, the most abundant insertion sequence in the four strains, are often located in close proximity to the specific lin genes. Analysis of the footprints of target duplication upon IS6100 transposition and the experimental detection of IS6100 transposition strongly suggested that the IS6100 transposition has caused dynamic genome rearrangements and the diversification of lin-flanking regions in the four strains. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  14. A Bacterial Analysis Platform: An Integrated System for Analysing Bacterial Whole Genome Sequencing Data for Clinical Diagnostics and Surveillance.

    PubMed

    Thomsen, Martin Christen Frølund; Ahrenfeldt, Johanne; Cisneros, Jose Luis Bellod; Jurtz, Vanessa; Larsen, Mette Voldby; Hasman, Henrik; Aarestrup, Frank Møller; Lund, Ole

    2016-01-01

    Recent advances in whole genome sequencing have made the technology available for routine use in microbiological laboratories. However, a major obstacle for using this technology is the availability of simple and automatic bioinformatics tools. Based on previously published and already available web-based tools we developed a single pipeline for batch uploading of whole genome sequencing data from multiple bacterial isolates. The pipeline will automatically identify the bacterial species and, if applicable, assemble the genome, identify the multilocus sequence type, plasmids, virulence genes and antimicrobial resistance genes. A short printable report for each sample will be provided and an Excel spreadsheet containing all the metadata and a summary of the results for all submitted samples can be downloaded. The pipeline was benchmarked using datasets previously used to test the individual services. The reported results enable a rapid overview of the major results, and comparing that to the previously found results showed that the platform is reliable and able to correctly predict the species and find most of the expected genes automatically. In conclusion, a combined bioinformatics platform was developed and made publicly available, providing easy-to-use automated analysis of bacterial whole genome sequencing data. The platform may be of immediate relevance as a guide for investigators using whole genome sequencing for clinical diagnostics and surveillance. The platform is freely available at: https://cge.cbs.dtu.dk/services/CGEpipeline-1.1 and it is the intention that it will continue to be expanded with new features as these become available.

  15. Testing the Role of Multicopy Plasmids in the Evolution of Antibiotic Resistance.

    PubMed

    Escudero, Jose Antonio; MacLean, R Craig; San Millan, Alvaro

    2018-05-02

    Multicopy plasmids are extremely abundant in prokaryotes but their role in bacterial evolution remains poorly understood. We recently showed that the increase in gene copy number per cell provided by multicopy plasmids could accelerate the evolution of plasmid-encoded genes. In this work, we present an experimental system to test the ability of multicopy plasmids to promote gene evolution. Using simple molecular biology methods, we constructed a model system where an antibiotic resistance gene can be inserted into Escherichia coli MG1655, either in the chromosome or on a multicopy plasmid. We use an experimental evolution approach to propagate the different strains under increasing concentrations of antibiotics and we measure survival of bacterial populations over time. The choice of the antibiotic molecule and the resistance gene is so that the gene can only confer resistance through the acquisition of mutations. This "evolutionary rescue" approach provides a simple method to test the potential of multicopy plasmids to promote the acquisition of antibiotic resistance. In the next step of the experimental system, the molecular bases of antibiotic resistance are characterized. To identify mutations responsible for the acquisition of antibiotic resistance we use deep DNA sequencing of samples obtained from whole populations and clones. Finally, to confirm the role of the mutations in the gene under study, we reconstruct them in the parental background and test the resistance phenotype of the resulting strains.

  16. The unique genomic landscape surrounding the EPSPS gene in glyphosate resistant Amaranthus palmeri: a repetitive path to resistance.

    PubMed

    Molin, William T; Wright, Alice A; Lawton-Rauh, Amy; Saski, Christopher A

    2017-01-17

    The expanding number and global distributions of herbicide resistant weedy species threaten food, fuel, fiber and bioproduct sustainability and agroecosystem longevity. Amongst the most competitive weeds, Amaranthus palmeri S. Wats has rapidly evolved resistance to glyphosate primarily through massive amplification and insertion of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene across the genome. Increased EPSPS gene copy numbers results in higher titers of the EPSPS enzyme, the target of glyphosate, and confers resistance to glyphosate treatment. To understand the genomic unit and mechanism of EPSPS gene copy number proliferation, we developed and used a bacterial artificial chromosome (BAC) library from a highly resistant biotype to sequence the local genomic landscape flanking the EPSPS gene. By sequencing overlapping BACs, a 297 kb sequence was generated, hereafter referred to as the "EPSPS cassette." This region included several putative genes, dense clusters of tandem and inverted repeats, putative helitron and autonomous replication sequences, and regulatory elements. Whole genome shotgun sequencing (WGS) of two biotypes exhibiting high and no resistance to glyphosate was performed to compare genomic representation across the EPSPS cassette. Mapping of sequences for both biotypes to the reference EPSPS cassette revealed significant differences in upstream and downstream sequences relative to EPSPS with regard to both repetitive units and coding content between these biotypes. The differences in sequence may have resulted from a compounded-building mechanism such as repetitive transpositional events. The association of putative helitron sequences with the cassette suggests a possible amplification and distribution mechanism. Flow cytometry revealed that the EPSPS cassette added measurable genomic content. The adoption of glyphosate resistant cropping systems in major crops such as corn, soybean, cotton and canola coupled with excessive use of glyphosate herbicide has led to evolved glyphosate resistance in several important weeds. In Amaranthus palmeri, the amplification of the EPSPS cassette, characterized by a complex array of repetitive elements and putative helitron sequences, suggests an adaptive structural genomic mechanism that drives amplification and distribution around the genome. The added genomic content not found in glyphosate sensitive plants may be driving evolution through genome expansion.

  17. Knock-in/Knock-out (KIKO) vectors for rapid integration of large DNA sequences, including whole metabolic pathways, onto the Escherichia coli chromosome at well-characterised loci.

    PubMed

    Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E

    2013-06-24

    Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable expression without the need for continuous antibiotic selection. Three non-essential loci have been characterised as insertion loci; combinatorial insertion at all three loci can be performed in one strain. The largest insertion at a single site described here was 5.4 kb; we have used this method in other studies to insert a total of 7.3 kb at one locus and 11.3 kb across two loci. These vectors are particularly useful for integration of multigene cassettes for metabolic engineering applications.

  18. Illumina sequencing-based analyses of bacterial communities during short-chain fatty-acid production from food waste and sewage sludge fermentation at different pH values.

    PubMed

    Cheng, Weixiao; Chen, Hong; Yan, ShuHai; Su, Jianqiang

    2014-09-01

    Short-chain fatty acids (SCFAs) can be produced by primary and waste activated sludge anaerobic fermentation. The yield and product spectrum distribution of SCFAs can be significantly affected by different initial pH values. However, most studies have focused on the physical and chemical aspects of SCFA production by waste activated sludge fermentation at different pH values. Information on the bacterial community structures during acidogenic fermentation is limited. In this study, comparisons of the bacterial communities during the co-substrate fermentation of food wastes and sewage sludge at different pH values were performed using the barcoded Illumina paired-end sequencing method. The results showed that different pH environments harbored a characteristic bacterial community, including sequences related to Lactobacillus, Prevotella, Mitsuokella, Treponema, Clostridium, and Ureibacillus. The most abundant bacterial operational taxonomic units in the different pH environments were those related to carbohydrate-degrading bacteria, which are associated with constituents of co-substrate fermentation. Further analyses showed that during organic matter fermentation, a core microbiota composed of Firmicutes, Proteobacteria, and Bacteroidetes existed. Comparison analyses revealed that the bacterial community during fermentation was significantly affected by the pH, and that the diverse product distribution was related to the shift in bacterial communities.

  19. Assessing the impact of fungicide enostroburin application on bacterial community in wheat phyllosphere.

    PubMed

    Gu, Likun; Bai, Zhihui; Jin, Bo; Hu, Qing; Wang, Huili; Zhuang, Guoqiang; Zhang, Hongxun

    2010-01-01

    Fungicides have been used extensively for controlling fungal pathogens of plants. However, little is known regarding the effects that fungicides upon the indigenous bacterial communities within the plant phyllosphere. The aims of this study were to assess the impact of fungicide enostroburin upon bacterial communities in wheat phyllosphere. Culture-independent methodologies of 16S rDNA clone library and 16S rDNA directed polymerase chain reaction with denaturing gradient gel electrophoresis (PCR-DGGE) were used for monitoring the change of bacterial community. The 16S rDNA clone library and PCR-DGGE analysis both confirmed the microbial community of wheat plant phyllosphere were predominantly of the gamma-Proteobacteria phyla. Results from PCR-DGGE analysis indicated a significant change in bacterial community structure within the phyllosphere following fungicide enostroburin application. Bands sequenced within control cultures were predominantly of Pseudomonas genus, but those bands sequenced in the treated samples were predominantly strains of Pantoea genus and Pseudomonas genus. Of interest was the appearance of two DGGE bands following fungicide treatment, one of which had sequence similarities (98%) to Pantoea sp. which might be a competitor of plant pathogens. This study revealed the wheat phyllosphere bacterial community composition and a shift in the bacterial community following fungicide enostroburin application.

  20. Identification of genomic indels and structural variations using split reads

    PubMed Central

    2011-01-01

    Background Recent studies have demonstrated the genetic significance of insertions, deletions, and other more complex structural variants (SVs) in the human population. With the development of the next-generation sequencing technologies, high-throughput surveys of SVs on the whole-genome level have become possible. Here we present split-read identification, calibrated (SRiC), a sequence-based method for SV detection. Results We start by mapping each read to the reference genome in standard fashion using gapped alignment. Then to identify SVs, we score each of the many initial mappings with an assessment strategy designed to take into account both sequencing and alignment errors (e.g. scoring more highly events gapped in the center of a read). All current SV calling methods have multilevel biases in their identifications due to both experimental and computational limitations (e.g. calling more deletions than insertions). A key aspect of our approach is that we calibrate all our calls against synthetic data sets generated from simulations of high-throughput sequencing (with realistic error models). This allows us to calculate sensitivity and the positive predictive value under different parameter-value scenarios and for different classes of events (e.g. long deletions vs. short insertions). We run our calculations on representative data from the 1000 Genomes Project. Coupling the observed numbers of events on chromosome 1 with the calibrations gleaned from the simulations (for different length events) allows us to construct a relatively unbiased estimate for the total number of SVs in the human genome across a wide range of length scales. We estimate in particular that an individual genome contains ~670,000 indels/SVs. Conclusions Compared with the existing read-depth and read-pair approaches for SV identification, our method can pinpoint the exact breakpoints of SV events, reveal the actual sequence content of insertions, and cover the whole size spectrum for deletions. Moreover, with the advent of the third-generation sequencing technologies that produce longer reads, we expect our method to be even more useful. PMID:21787423

  1. Fingerprints of Modified RNA Bases from Deep Sequencing Profiles.

    PubMed

    Kietrys, Anna M; Velema, Willem A; Kool, Eric T

    2017-11-29

    Posttranscriptional modifications of RNA bases are not only found in many noncoding RNAs but have also recently been identified in coding (messenger) RNAs as well. They require complex and laborious methods to locate, and many still lack methods for localized detection. Here we test the ability of next-generation sequencing (NGS) to detect and distinguish between ten modified bases in synthetic RNAs. We compare ultradeep sequencing patterns of modified bases, including miscoding, insertions and deletions (indels), and truncations, to unmodified bases in the same contexts. The data show widely varied responses to modification, ranging from no response, to high levels of mutations, insertions, deletions, and truncations. The patterns are distinct for several of the modifications, and suggest the future use of ultradeep sequencing as a fingerprinting strategy for locating and identifying modifications in cellular RNAs.

  2. Draft genome sequences of Actinomyces timonensis strain 7400942T and its prophage.

    PubMed

    Gorlas, Aurore; Gimenez, Grégory; Raoult, Didier; Roux, Véronique

    2012-12-01

    A draft genome sequence of Actinomyces timonensis, an anaerobic bacterium isolated from a human clinical osteoarticular sample, is described here. CRISPR-associated proteins, insertion sequence, and toxin-antitoxin loci were found on the genome. A new virus or provirus, AT-1, was characterized.

  3. The novel fusion transcript NR5A2-KLHL29FT is generated by an insertion at the KLHL29 locus.

    PubMed

    Sun, Zhenguo; Ke, Xiquan; Salzberg, Steven L; Kim, Daehwan; Antonescu, Valentin; Cheng, Yulan; Huang, Binbin; Song, Jee Hoon; Abraham, John M; Ibrahim, Sariat; Tian, Hui; Meltzer, Stephen J

    2017-05-01

    Novel fusion transcripts (FTs) caused by chromosomal rearrangement are common factors in the development of cancers. In the current study, the authors used massively parallel RNA sequencing to identify new FTs in colon cancers. RNA sequencing (RNA-Seq) and TopHat-Fusion were used to identify new FTs in colon cancers. The authors then investigated whether the novel FT nuclear receptor subfamily 5, group A, member 2 (NR5A2)-Kelch-like family member 29 FT (KLHL29FT) was transcribed from a genomic chromosomal rearrangement. Next, the expression of NR5A2-KLHL29FT was measured by quantitative real-time polymerase chain reaction in colon cancers and matched corresponding normal epithelia. The authors identified the FT NR5A2-KLHL29FT in normal and cancerous epithelia. While investigating this transcript, it was unexpectedly found that it was due to an uncharacterized polymorphic germline insertion of the NR5A2 sequence from chromosome 1 into the KLHL29 locus at chromosome 2, rather than a chromosomal rearrangement. This germline insertion, which occurred at a population frequency of 0.40, appeared to bear no relationship to cancer development. Moreover, expression of NR5A2-KLHL29FT was validated in RNA specimens from samples with insertions of NR5A2 at the KLHL29 gene locus, but not from samples without this insertion. It is interesting to note that NR5A2-KLH29FT expression levels were significantly lower in colon cancers than in matched normal colonic epithelia (P =.029), suggesting the potential participation of NR5A2-KLHL29FT in the origin or progression of this tumor type. NR5A2-KLHL29FT was generated from a polymorphism insertion of the NR5A2 sequence into the KLHL29 locus. NR5A2-KLHL29FT may influence the origin or progression of colon cancer. Moreover, researchers should be aware that similar FTs may occur due to transchromosomal insertions that are not correctly annotated in genome databases, especially with current assembly algorithms. Cancer 2017;123:1507-1515. © 2017 American Cancer Society. © 2016 American Cancer Society.

  4. Entire plastid phylogeny of the carrot genus (Daucus, Apiaceae):Concordance with nuclear data and mitochondrial and nuclear DNA insertions to the plastid

    USDA-ARS?s Scientific Manuscript database

    We explored the phylogenetic utility of entire plastid DNA sequences in Daucus and compared the results to prior phylogenetic results using plastid, nuclear, and mitochondrial DNA sequences. We obtained, using Illumina sequencing, full plastid sequences of 37 accessions of 20 Daucus taxa and outgrou...

  5. Formation of cis-diamminedichloroplatinum(II) 1,2-intrastrand cross-links on DNA is flanking-sequence independent.

    PubMed

    Burstyn, J N; Heiger-Bernays, W J; Cohen, S M; Lippard, S J

    2000-11-01

    Mapping of cis-diamminedichloroplatinum(II) (cis-DDP, cisplatin) DNA adducts over >3000 nucleotides was carried out using a replication blockage assay. The sites of inhibition of modified T4 DNA polymerase, also referred to as stop sites, were analyzed to determine the effects of local sequence context on the distribution of intrastrand cisplatin cross-links. In a 3120 base fragment from replicative form M13mp18 DNA containing 24.6% guanine, 25.5% thymine, 26.9% adenine and 23.0% cytosine, 166 individual stop sites were observed at a bound platinum/nucleotide ratio of 1-2 per thousand. The majority of stop sites (90%) occurred at G(n>2) sequences and the remainder were located at sites containing an AG dinucleotide. For all of the GG sites present in the mapped sequences, including those with Gn(>)2, 89% blocked replication, whereas for the AG sites only 17% blocked replication. These blockage sites were independent of flanking nucleotides in a sequence of N(1)G*G*N(2) where N(1), N(2) = A, C, G, T and G*G* indicates a 1,2-intrastrand platinum cross-link. The absence of long-range sequence dependence was confirmed by monitoring the reaction of cisplatin with a plasmid containing an 800 bp insert of the human telomere repeat sequence (TTAGGG)(n). Platination reactions monitored at several formal platinum/nucleotide ratios or as a function of time reveal that the telomere insert was not preferentially damaged by cisplatin. Both replication blockage and telomere-insert plasmid platination experiments indicate that cisplatin 1,2-intrastrand adducts do not form preferentially at G-rich sequences in vitro.

  6. Ribosomal Binding Site Switching: An Effective Strategy for High-Throughput Cloning Constructions

    PubMed Central

    Li, Yunlong; Zhang, Yong; Lu, Pei; Rayner, Simon; Chen, Shiyun

    2012-01-01

    Direct cloning of PCR fragments by TA cloning or blunt end ligation are two simple methods which would greatly benefit high-throughput (HTP) cloning constructions if the efficiency can be improved. In this study, we have developed a ribosomal binding site (RBS) switching strategy for direct cloning of PCR fragments. RBS is an A/G rich region upstream of the translational start codon and is essential for gene expression. Change from A/G to T/C in the RBS blocks its activity and thereby abolishes gene expression. Based on this property, we introduced an inactive RBS upstream of a selectable marker gene, and designed a fragment insertion site within this inactive RBS. Forward and reverse insertions of specifically tailed fragments will respectively form an active and inactive RBS, thus all background from vector self-ligation and fragment reverse insertions will be eliminated due to the non-expression of the marker gene. The effectiveness of our strategy for TA cloning and blunt end ligation are confirmed. Application of this strategy to gene over-expression, a bacterial two-hybrid system, a bacterial one-hybrid system, and promoter bank construction are also verified. The advantages of this simple procedure, together with its low cost and high efficiency, makes our strategy extremely useful in HTP cloning constructions. PMID:23185557

  7. Pregnant women's attitudes about topical microbicides for the prevention and treatment of bacterial vaginosis during pregnancy.

    PubMed

    Catallozzi, Marina; Fraiz, Lauren Dapena; Hargreaves, Katharine M; Zimet, Gregory D; Stanberry, Lawrence R; Ratner, Adam J; Gelber, Shari E; Rosenthal, Susan L

    2017-08-01

    We sought to understand pregnant women's product preference and likelihood of use of topical microbicides for bacterial vaginosis (BV) prevention and treatment. Pregnant women (N = 196) in a obstetrics clinic completed a survey between June 2014 and January 2015 about vaginal product use for BV. This cross-sectional study explored product preferences, likelihood of product use for BV management and father of the baby (FOB) involvement. Most participants were under 30 (68%) and underrepresented minorities (47% Hispanic, 21% African-American). Most women preferred the gel (69%). Only 30% were likely to use either product for prevention of BV; 76% if high risk for BV; 83% treatment of BV. Anticipated FOB involvement in decision-making included that 46% would ask his opinion, 38% would inform him of the decision and 7% would need approval. Most (87%) would ask the FOB for reminders and 66% for insertion help. Those under 30 were more likely to agree to ask the FOB for reminders (p < 0.01) and insertion help (p = 0.05). African-American women were less likely to have their FOB help with insertion (p < 0.01). Product preferences may be less critical than risk perception. Involvement of the FOB in decision-making may be vital.

  8. Bacterial collagen-like proteins that form triple-helical structures

    PubMed Central

    Yu, Zhuoxin; An, Bo; Ramshaw, John A.M.; Brodsky, Barbara

    2014-01-01

    A large number of collagen-like proteins have been identified in bacteria during the past ten years, principally from analysis of genome databases. These bacterial collagens share the distinctive Gly-Xaa-Yaa repeating amino acid sequence of animal collagens which underlies their unique triple-helical structure. A number of the bacterial collagens have been expressed in E. coli, and they all adopt a triple-helix conformation. Unlike animal collagens, these bacterial proteins do not contain the post-translationally modified amino acid, hydroxyproline, which is known to stabilize the triple-helix structure and may promote self-assembly. Despite the absence of collagen hydroxylation, the triple-helix structures of the bacterial collagens studied exhibit a high thermal stability of 35–39 °C, close to that seen for mammalian collagens. These bacterial collagens are readily produced in large quantities by recombinant methods, either in the original amino acid sequence or in genetically manipulated sequences. This new family of recombinant, easy to modify collagens could provide a novel system for investigating structural and functional motifs in animal collagens and could also form the basis of new biomedical materials with designed structural properties and functions. PMID:24434612

  9. Phylogenetic congruence of armored scale insects (Hemiptera: Diaspididae) and their primary endosymbionts from the phylum Bacteroidetes.

    PubMed

    Gruwell, Matthew E; Morse, Geoffrey E; Normark, Benjamin B

    2007-07-01

    Insects in the sap-sucking hemipteran suborder Sternorrhyncha typically harbor maternally transmitted bacteria housed in a specialized organ, the bacteriome. In three of the four superfamilies of Sternorrhyncha (Aphidoidea, Aleyrodoidea, Psylloidea), the bacteriome-associated (primary) bacterial lineage is from the class Gammaproteobacteria (phylum Proteobacteria). The fourth superfamily, Coccoidea (scale insects), has a diverse array of bacterial endosymbionts whose affinities are largely unexplored. We have amplified fragments of two bacterial ribosomal genes from each of 68 species of armored scale insects (Diaspididae). In spite of initially using primers designed for Gammaproteobacteria, we consistently amplified sequences from a different bacterial phylum: Bacteroidetes. We use these sequences (16S and 23S, 2105 total base pairs), along with previously published sequences from the armored scale hosts (elongation factor 1alpha and 28S rDNA) to investigate phylogenetic congruence between the two clades. The Bayesian tree for the bacteria is roughly congruent with that of the hosts, with 67% of nodes identical. Partition homogeneity tests found no significant difference between the host and bacterial data sets. Of thirteen Shimodaira-Hasegawa tests, comparing the original Bayesian bacterial tree to bacterial trees with incongruent clades forced to match the host tree, 12 found no significant difference. A significant difference in topology was found only when the entire host tree was compared with the entire bacterial tree. For the bacterial data set, the treelengths of the most parsimonious host trees are only 1.8-2.4% longer than that of the most parsimonious bacterial trees. The high level of congruence between the topologies indicates that these Bacteroidetes are the primary endosymbionts of armored scale insects. To investigate the phylogenetic affinities of these endosymbionts, we aligned some of their 16S rDNA sequences with other known Bacteroidetes endosymbionts and with other similar sequences identified by BLAST searches. Although the endosymbionts of armored scales are only distantly related to the endosymbionts of the other sternorrhynchan insects, they are closely related to bacteria associated with eriococcid and margarodid scale insects, to cockroach and auchenorrynchan endosymbionts (Blattabacterium and Sulcia), and to male-killing endosymbionts of ladybird beetles. We propose the name "Candidatus Uzinura diaspidicola" for the primary endosymbionts of armored scale insects.

  10. Inter-individual and intragenomic variations in the ITS region of Clonorchis sinensis (Trematoda: Opisthorchiidae) from Russia and Vietnam.

    PubMed

    Tatonova, Yulia V; Chelomina, Galina N; Nguyen, Hung Manh

    2017-11-01

    Here we examined the intraspecific genetic variability of Clonorchis sinensis from Russia and Vietnam using nuclear DNA sequences (the 5.8S gene and two internal transcribed spacers of the ribosomal cluster). Despite the low level of variability in the ITS1 region, this marker has revealed some features of C. sinensis across multiple geographic regions. The genetic diversity levels for the Russian and Vietnamese populations were similar (0.1 and 0.09%, respectively) but were significantly lower than the C. sinensis from China (0.31%). About half of the sequences of the Chinese (53%) and Korean (47%) populations and about a tenth of the Vietnamese (12%) and Russian (8%) sequences included a 5bp insertion. No sequences with nucleotide substitutions both upstream and downstream of the 5bp insertion were found within the whole data set. The population of northern China had both sequence variants (with substitutions either upstream or downstream of the insertion), while only one of these variants was presented at the other localities. The Vietnamese population had a higher frequency of intragenomic polymorphism than the Russian population (69% vs. 46% and 23% vs. 3% at the 114bp and 339bp positions, respectively). These data are discussed in connection with parasite origin and adaptation, and also its invasive capacity and drug-resistance. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Genetic and DNA sequence analysis of the kanamycin resistance transposon Tn903.

    PubMed Central

    Grindley, N D; Joyce, C M

    1980-01-01

    The kanamycin resistance transposon Tn903 consists of a unique region of about 1000 base pairs bounded by a pair of 1050-base-pair inverted repeat sequences. Each repeat contains two Pvu II endonuclease cleavage sites separated by 520 base pairs. We have constructed derivatives of Tn903 in which this 520-base-pair fragment is deleted from one or both repeats. Those derivatives that lack both 520-base-pair fragments cannot transpose, whereas those that lack just one remain transposition proficient. One such transposable derivative, Tn903 delta I, has been selected for further study. We have determined the sequence of the intact inverted repeat. The 18 base pairs at each end are identical and inverted relative to one another, a structure characteristic of insertion sequences. Additional experiments indicate that a single inverted repeat from Tn903 can, in fact, transpose; we propose that this element be called IS903. To correlate the DNA sequence with genetic activities, we have created mutations by inserting a 10-base-pair DNA fragment at several sites within the intact repeat of Tn903 delta 1, and we have examined the effect of such insertions on transposability. The results suggest that IS903 encodes a 307-amino-acid polypeptide (a "transposase") that is absolutely required for transposition of IS903 or Tn903. Images PMID:6261245

  12. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing.

    PubMed

    Naveed, Muhammad; Mubeen, Samavia; Khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad

    2014-01-01

    In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  13. Bacterial-like PPP protein phosphatases: novel sequence alterations in pathogenic eukaryotes and peculiar features of bacterial sequence similarity.

    PubMed

    Kerk, David; Uhrig, R Glen; Moorhead, Greg B

    2013-01-01

    Reversible phosphorylation is a widespread modification affecting the great majority of eukaryotic cellular proteins, and whose effects influence nearly every cellular function. Protein phosphatases are increasingly recognized as exquisitely regulated contributors to these changes. The PPP (phosphoprotein phosphatase) family comprises enzymes, which catalyze dephosphorylation at serine and threonine residues. Nearly a decade ago, "bacterial-like" enzymes were recognized with similarity to proteins from various bacterial sources: SLPs (Shewanella-like phosphatases), RLPHs (Rhizobiales-like phosphatases), and ALPHs (ApaH-like phosphatases). A recent article from our laboratory appearing in Plant Physiology characterizes their extensive organismal distribution, abundance in plant species, predicted subcellular localization, motif organization, and sequence evolution. One salient observation is the distinct evolutionary trajectory followed by SLP genes and proteins in photosynthetic eukaryotes vs. animal and plant pathogens derived from photosynthetic ancestors. We present here a closer look at sequence data that emphasizes the distinctiveness of pathogen SLP proteins and that suggests that they might represent novel drug targets. A second observation in our original report was the high degree of similarity between the bacterial-like PPPs of eukaryotes and closely related proteins of the "eukaryotic-like" phyla Myxococcales and Planctomycetes. We here reflect on the possible implications of these observations and their importance for future research.

  14. Bacterial taxa associated with the hematophagous mite Dermanyssus gallinae detected by 16S rRNA PCR amplification and TTGE fingerprinting.

    PubMed

    Valiente Moro, Claire; Thioulouse, Jean; Chauve, Claude; Normand, Philippe; Zenner, Lionel

    2009-01-01

    Dermanyssus gallinae (Arthropoda, Mesostigmata) is suspected to be involved in the transmission of a wide variety of pathogens, but nothing is known about its associated non-pathogenic bacterial community. To address this question, we examined the composition of bacterial communities in D. gallinae collected from standard poultry farms in Brittany, France. Genetic fingerprints of bacterial communities were generated by temporal temperature gradient gel electrophoresis (TTGE) separation of individual polymerase chain reaction (PCR)-amplified 16S rRNA gene fragments, followed by DNA sequence analysis. Most of the sequences belonged to the Proteobacteria and Firmicute phyla, with a majority of sequences corresponding to the Enterobacteriales order and the Staphylococcus genus. By using statistical analysis, we showed differences in biodiversity between poultry farms. We also determined the major phylotypes that compose the characteristic microbiota associated with D. gallinae. Saprophytes, opportunistic pathogens and pathogenic agents such as Pasteurella multocida, Erysipelothrix rhusiopathiae and sequences close to the genus Aerococcus were identified. Endosymbionts such as Schineria sp., Spiroplasma sp. Anistosticta, "Candidatus Cardinium hertigii" and Rickettsiella sp. were also present in the subdominant bacterial community. Identification of potential targets within the symbiont community may be considered in the future as a means of ectoparasite control.

  15. A Bioinformatic Strategy for the Detection, Classification and Analysis of Bacterial Autotransporters

    PubMed Central

    Celik, Nermin; Webb, Chaille T.; Leyton, Denisse L.; Holt, Kathryn E.; Heinz, Eva; Gorrell, Rebecca; Kwok, Terry; Naderer, Thomas; Strugnell, Richard A.; Speed, Terence P.; Teasdale, Rohan D.; Likić, Vladimir A.; Lithgow, Trevor

    2012-01-01

    Autotransporters are secreted proteins that are assembled into the outer membrane of bacterial cells. The passenger domains of autotransporters are crucial for bacterial pathogenesis, with some remaining attached to the bacterial surface while others are released by proteolysis. An enigma remains as to whether autotransporters should be considered a class of secretion system, or simply a class of substrate with peculiar requirements for their secretion. We sought to establish a sensitive search protocol that could identify and characterize diverse autotransporters from bacterial genome sequence data. The new sequence analysis pipeline identified more than 1500 autotransporter sequences from diverse bacteria, including numerous species of Chlamydiales and Fusobacteria as well as all classes of Proteobacteria. Interrogation of the proteins revealed that there are numerous classes of passenger domains beyond the known proteases, adhesins and esterases. In addition the barrel-domain-a characteristic feature of autotransporters-was found to be composed from seven conserved sequence segments that can be arranged in multiple ways in the tertiary structure of the assembled autotransporter. One of these conserved motifs overlays the targeting information required for autotransporters to reach the outer membrane. Another conserved and diagnostic motif maps to the linker region between the passenger domain and barrel-domain, indicating it as an important feature in the assembly of autotransporters. PMID:22905239

  16. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    PubMed Central

    Naveed, Muhammad; Mubeen, Samavia; khan, SamiUllah; Ahmed, Iftikhar; Khalid, Nauman; Suleria, Hafiz Ansar Rasul; Bano, Asghari; Mumtaz, Abdul Samad

    2014-01-01

    In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh) gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ). Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization. PMID:25477935

  17. Detection of Mixed Infection from Bacterial Whole Genome Sequence Data Allows Assessment of Its Role in Clostridium difficile Transmission

    PubMed Central

    Eyre, David W.; Cule, Madeleine L.; Griffiths, David; Crook, Derrick W.; Peto, Tim E. A.

    2013-01-01

    Bacterial whole genome sequencing offers the prospect of rapid and high precision investigation of infectious disease outbreaks. Close genetic relationships between microorganisms isolated from different infected cases suggest transmission is a strong possibility, whereas transmission between cases with genetically distinct bacterial isolates can be excluded. However, undetected mixed infections—infection with ≥2 unrelated strains of the same species where only one is sequenced—potentially impairs exclusion of transmission with certainty, and may therefore limit the utility of this technique. We investigated the problem by developing a computationally efficient method for detecting mixed infection without the need for resource-intensive independent sequencing of multiple bacterial colonies. Given the relatively low density of single nucleotide polymorphisms within bacterial sequence data, direct reconstruction of mixed infection haplotypes from current short-read sequence data is not consistently possible. We therefore use a two-step maximum likelihood-based approach, assuming each sample contains up to two infecting strains. We jointly estimate the proportion of the infection arising from the dominant and minor strains, and the sequence divergence between these strains. In cases where mixed infection is confirmed, the dominant and minor haplotypes are then matched to a database of previously sequenced local isolates. We demonstrate the performance of our algorithm with in silico and in vitro mixed infection experiments, and apply it to transmission of an important healthcare-associated pathogen, Clostridium difficile. Using hospital ward movement data in a previously described stochastic transmission model, 15 pairs of cases enriched for likely transmission events associated with mixed infection were selected. Our method identified four previously undetected mixed infections, and a previously undetected transmission event, but no direct transmission between the pairs of cases under investigation. These results demonstrate that mixed infections can be detected without additional sequencing effort, and this will be important in assessing the extent of cryptic transmission in our hospitals. PMID:23658511

  18. Control of artefactual variation in reported inter-sample relatedness during clinical use of a Mycobacterium tuberculosis sequencing pipeline.

    PubMed

    Wyllie, David H; Sanderson, Nicholas; Myers, Richard; Peto, Tim; Robinson, Esther; Crook, Derrick W; Smith, E Grace; Walker, A Sarah

    2018-06-06

    Contact tracing requires reliable identification of closely related bacterial isolates. When we noticed the reporting of artefactual variation between M. tuberculosis isolates during routine next generation sequencing of Mycobacterium spp, we investigated its basis in 2,018 consecutive M. tuberculosis isolates. In the routine process used, clinical samples were decontaminated and inoculated into broth cultures; from positive broth cultures DNA was extracted, sequenced, reads mapped, and consensus sequences determined. We investigated the process of consensus sequence determination, which selects the most common nucleotide at each position. Having determined the high-quality read depth and depth of minor variants across 8,006 M. tuberculosis genomic regions, we quantified the relationship between the minor variant depth and the amount of non-Mycobacterial bacterial DNA, which originates from commensal microbes killed during sample decontamination. In the presence of non-Mycobacterial bacterial DNA, we found significant increases in minor variant frequencies of more than 1.5 fold in 242 regions covering 5.1% of the M. tuberculosis genome. Included within these were four high variation regions strongly influenced by the amount of non-Mycobacterial bacterial DNA. Excluding these four regions from pairwise distance comparisons reduced biologically implausible variation from 5.2% to 0% in an independent validation set derived from 226 individuals. Thus, we have demonstrated an approach identifying critical genomic regions contributing to clinically relevant artefactual variation in bacterial similarity searches. The approach described monitors the outputs of the complex multi-step laboratory and bioinformatics process, allows periodic process adjustments, and will have application to quality control of routine bacterial genomics. Copyright © 2018 Wyllie et al.

  19. Transforming microbial genotyping: a robotic pipeline for genotyping bacterial strains.

    PubMed

    O'Farrell, Brian; Haase, Jana K; Velayudhan, Vimalkumar; Murphy, Ronan A; Achtman, Mark

    2012-01-01

    Microbial genotyping increasingly deals with large numbers of samples, and data are commonly evaluated by unstructured approaches, such as spread-sheets. The efficiency, reliability and throughput of genotyping would benefit from the automation of manual manipulations within the context of sophisticated data storage. We developed a medium- throughput genotyping pipeline for MultiLocus Sequence Typing (MLST) of bacterial pathogens. This pipeline was implemented through a combination of four automated liquid handling systems, a Laboratory Information Management System (LIMS) consisting of a variety of dedicated commercial operating systems and programs, including a Sample Management System, plus numerous Python scripts. All tubes and microwell racks were bar-coded and their locations and status were recorded in the LIMS. We also created a hierarchical set of items that could be used to represent bacterial species, their products and experiments. The LIMS allowed reliable, semi-automated, traceable bacterial genotyping from initial single colony isolation and sub-cultivation through DNA extraction and normalization to PCRs, sequencing and MLST sequence trace evaluation. We also describe robotic sequencing to facilitate cherrypicking of sequence dropouts. This pipeline is user-friendly, with a throughput of 96 strains within 10 working days at a total cost of < €25 per strain. Since developing this pipeline, >200,000 items were processed by two to three people. Our sophisticated automated pipeline can be implemented by a small microbiology group without extensive external support, and provides a general framework for semi-automated bacterial genotyping of large numbers of samples at low cost.

  20. Transforming Microbial Genotyping: A Robotic Pipeline for Genotyping Bacterial Strains

    PubMed Central

    Velayudhan, Vimalkumar; Murphy, Ronan A.; Achtman, Mark

    2012-01-01

    Microbial genotyping increasingly deals with large numbers of samples, and data are commonly evaluated by unstructured approaches, such as spread-sheets. The efficiency, reliability and throughput of genotyping would benefit from the automation of manual manipulations within the context of sophisticated data storage. We developed a medium- throughput genotyping pipeline for MultiLocus Sequence Typing (MLST) of bacterial pathogens. This pipeline was implemented through a combination of four automated liquid handling systems, a Laboratory Information Management System (LIMS) consisting of a variety of dedicated commercial operating systems and programs, including a Sample Management System, plus numerous Python scripts. All tubes and microwell racks were bar-coded and their locations and status were recorded in the LIMS. We also created a hierarchical set of items that could be used to represent bacterial species, their products and experiments. The LIMS allowed reliable, semi-automated, traceable bacterial genotyping from initial single colony isolation and sub-cultivation through DNA extraction and normalization to PCRs, sequencing and MLST sequence trace evaluation. We also describe robotic sequencing to facilitate cherrypicking of sequence dropouts. This pipeline is user-friendly, with a throughput of 96 strains within 10 working days at a total cost of < €25 per strain. Since developing this pipeline, >200,000 items were processed by two to three people. Our sophisticated automated pipeline can be implemented by a small microbiology group without extensive external support, and provides a general framework for semi-automated bacterial genotyping of large numbers of samples at low cost. PMID:23144721

  1. Archaeal and bacterial diversity in two hot springs from geothermal regions in Bulgaria as demostrated by 16S rRNA and GH-57 genes.

    PubMed

    Stefanova, Katerina; Tomova, Iva; Tomova, Anna; Radchenkova, Nadja; Atanassov, Ivan; Kambourova, Margarita

    2015-12-01

    Archaeal and bacterial diversity in two Bulgarian hot springs, geographically separated with different tectonic origin and different temperature of water was investigated exploring two genes, 16S rRNA and GH-57. Archaeal diversity was significantly higher in the hotter spring Levunovo (LV) (82°C); on the contrary, bacterial diversity was higher in the spring Vetren Dol (VD) (68°C). The analyzed clones from LV library were referred to twenty eight different sequence types belonging to five archaeal groups from Crenarchaeota and Euryarchaeota. A domination of two groups was observed, Candidate Thaumarchaeota and Methanosarcinales. The majority of the clones from VD were referred to HWCG (Hot Water Crenarchaeotic Group). The formation of a group of thermophiles in the order Methanosarcinales was suggested. Phylogenetic analysis revealed high numbers of novel sequences, more than one third of archaeal and half of the bacterial phylotypes displayed similarity lower than 97% with known ones. The retrieved GH-57 gene sequences showed a complex phylogenic distribution. The main part of the retrieved homologous GH-57 sequences affiliated with bacterial phyla Bacteroidetes, Deltaproteobacteria, Candidate Saccharibacteria and affiliation of almost half of the analyzed sequences is not fully resolved. GH-57 gene analysis allows an increased resolution of the biodiversity assessment and in depth analysis of specific taxonomic groups. [Int Microbiol 18(4):217-223 (2015)]. Copyright© by the Spanish Society for Microbiology and Institute for Catalan Studies.

  2. Efficient generation of complete sequences of MDR-encoding plasmids by rapid assembly of MinION barcoding sequencing data.

    PubMed

    Li, Ruichao; Xie, Miaomiao; Dong, Ning; Lin, Dachuan; Yang, Xuemei; Wong, Marcus Ho Yin; Chan, Edward Wai-Chi; Chen, Sheng

    2018-03-01

    Multidrug resistance (MDR)-encoding plasmids are considered major molecular vehicles responsible for transmission of antibiotic resistance genes among bacteria of the same or different species. Delineating the complete sequences of such plasmids could provide valuable insight into the evolution and transmission mechanisms underlying bacterial antibiotic resistance development. However, due to the presence of multiple repeats of mobile elements, complete sequencing of MDR plasmids remains technically complicated, expensive, and time-consuming. Here, we demonstrate a rapid and efficient approach to obtaining multiple MDR plasmid sequences through the use of the MinION nanopore sequencing platform, which is incorporated in a portable device. By assembling the long sequencing reads generated by a single MinION run according to a rapid barcoding sequencing protocol, we obtained the complete sequences of 20 plasmids harbored by multiple bacterial strains. Importantly, single long reads covering a plasmid end-to-end were recorded, indicating that de novo assembly may be unnecessary if the single reads exhibit high accuracy. This workflow represents a convenient and cost-effective approach for systematic assessment of MDR plasmids responsible for treatment failure of bacterial infections, offering the opportunity to perform detailed molecular epidemiological studies to probe the evolutionary and transmission mechanisms of MDR-encoding elements.

  3. TEs or not TEs? That is the evolutionary question.

    PubMed

    Vaknin, Keren; Goren, Amir; Ast, Gil

    2009-10-23

    Transposable elements (TEs) have contributed a wide range of functional sequences to their host genomes. A recent paper in BMC Molecular Biology discusses the creation of new transcripts by transposable element insertion upstream of retrocopies and the involvement of such insertions in tissue-specific post-transcriptional regulation.

  4. Metabolic pathways of Pseudomonas aeruginosa involved in competition with respiratory bacterial pathogens

    PubMed Central

    Beaume, Marie; Köhler, Thilo; Fontana, Thierry; Tognon, Mikael; Renzoni, Adriana; van Delden, Christian

    2015-01-01

    Background: Chronic airway infection by Pseudomonas aeruginosa considerably contributes to lung tissue destruction and impairment of pulmonary function in cystic-fibrosis (CF) patients. Complex interplays between P. aeruginosa and other co-colonizing pathogens including Staphylococcus aureus, Burkholderia sp., and Klebsiella pneumoniae may be crucial for pathogenesis and disease progression. Methods: We generated a library of PA14 transposon insertion mutants to identify P. aeruginosa genes required for exploitative and direct competitions with S. aureus, Burkholderia cenocepacia, and K. pneumoniae. Results: Whereas wild-type PA14 inhibited S. aureus growth, two transposon insertions located in pqsC and carB, resulted in reduced growth inhibition. PqsC is involved in the synthesis of 4-hydroxy-2-alkylquinolines (HAQs), a family of molecules having antibacterial properties, while carB is a key gene in pyrimidine biosynthesis. The carB mutant was also unable to grow in the presence of B. cepacia and K. pneumoniae but not Escherichia coli and S. epidermidis. We further identified a transposon insertion in purF, encoding a key enzyme of purine metabolism. This mutant displayed a severe growth deficiency in the presence of Gram-negative but not of Gram-positive bacteria. We identified a beneficial interaction in a bioA transposon mutant, unable to grow on rich medium. This growth defect could be restored either by addition of biotin or by co-culturing the mutant in the presence of K. pneumoniae or E. coli. Conclusion: Complex interactions take place between the various bacterial species colonizing CF-lungs. This work identified both detrimental and beneficial interactions occurring between P. aeruginosa and three other respiratory pathogens involving several major metabolic pathways. Manipulating these pathways could be used to interfere with bacterial interactions and influence the colonization by respiratory pathogens. PMID:25954256

  5. Expression of CXCL4 and aquaporin 3 and 10 mRNAs in patients with otitis media with effusion.

    PubMed

    Jin, Zhe; Cha, Sung Ho; Choi, Yong-Sung; Kim, Young Il; Choi, Sun A; Yeo, Seung Geun

    2016-02-01

    Bacterial infections in children with underdeveloped Eustachian tubes are a major cause of otitis media with effusion (OEM), and persistent effusion in the middle ear in these patients is a major cause of surgical intervention. CXCL4 is associated with bacterial infection, and aquaporins 3 and 10 are associated with water metabolism. This study assessed the expression of mRNAs encoding CXCL-4 and aquaporins 3 and 10 in the effusion of pediatric OME patients, and the association of this expression with clinical manifestations. Levels of CXCL4 and aquaporin 3 and 10 mRNA were assayed by real-time RT-PCR in the middle ear effusion of 38 pediatric patients with OME requiring ventilation tube insertion. The relationships of these mRNA levels with the presence of bacteria; concomitant diseases such as allergic rhinitis, sinusitis, and adenoid disease; recurrence of OME; and number of ventilation tube insertions were evaluated. CXCL4 and aquaporin 3 and 10 mRNAs were expressed in middle ear effusion of all OME patients. CXCL-4 mRNA levels were significantly lower when bacteria were present and in patients with concomitant diseases (p<0.05 each). Levels of all three mRNAs were unrelated to OME recurrence or number of ventilation tube insertions (p>0.05 each). The levels of CXCL4 and aquaporin 10 mRNAs were significantly correlated (p<0.05). Expression of CXCL4 and aquaporin 3 and 10 mRNAs in middle ear effusion is associated with the pathophysiology of OME. CXCL4 mRNA levels are significantly lower in patients with than without concomitant diseases or bacterial infections. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  6. Characterization of three Agrobacterium tumefaciens avirulent mutants with chromosomal mutations that affect induction of vir genes.

    PubMed

    Metts, J; West, J; Doares, S H; Matthysse, A G

    1991-02-01

    Three Agrobacterium tumefaciens mutants with chromosomal mutations that affect bacterial virulence were isolated by transposon mutagenesis. Two of the mutants were avirulent on all hosts tested. The third mutant, Ivr-211, was a host range mutant which was avirulent on Bryophyllum diagremontiana, Nicotiana tabacum, N. debneyi, N. glauca, and Daucus carota but was virulent on Zinnia elegans and Lycopersicon esculentum (tomato). That the mutant phenotype was due to the transposon insertion was determined by cloning the DNA containing the transposon insertion and using the cloned DNA to replace the wild-type DNA in the parent bacterial strain by marker exchange. The transposon insertions in the three mutants mapped at three widely separated locations on the bacterial chromosome. The effects of the mutations on various steps in tumor formation were examined. All three mutants showed no alteration in binding to carrot cells. However, none of the mutants showed any induction of vir genes by acetosyringone under conditions in which the parent strain showed vir gene induction. When the mutant bacteria were examined for changes in surface components, it was found that all three of the mutants showed a similar alteration in lipopolysaccharide (LPS). LPS from the mutants was larger in size and more heavily saccharide substituted than LPS from the parent strain. Two of the mutants showed no detectable alteration in outer membrane and periplasmic space proteins. The third mutant, Ivr-225, was missing a 79-kDa surface peptide. The reason(s) for the failure of vir gene induction in these mutants and its relationship, if any, to the observed alteration in LPS are unknown.

  7. Uncovering the transmembrane metal binding site of the novel bacterial major facilitator superfamily-type copper importer CcoA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khalfaoui-Hassani, Bahia; Verissimo, Andreia F.; Koch, Hans -Georg

    In this study, uptake and trafficking of metals and their delivery to their respective metalloproteins are important processes. Cells need precise control of each step to avoid exposure to excessive metal concentrations and their harmful consequences. Copper (Cu) is a required micronutrient used as a cofactor in proteins. However, in large amounts, it can induce oxidative damage; hence, Cu homeostasis is indispensable for cell survival. Biogenesis of respiratory heme-Cu oxygen (HCO) reductases includes insertion of Cu into their catalytic subunits to form heme-Cu binuclear centers. Previously, we had shown that CcoA is a major facilitator superfamily (MFS)-type bacterial Cu importermore » required for biogenesis of cbb 3-type cytochrome coxidase ( cbb 3-Cox). Here, using Rhodobacter capsulatus, we focused on the import and delivery of Cu to cbb 3-Cox. By comparing the CcoA amino acid sequence with its homologues from other bacterial species, we located several well-conserved Met, His, and Tyr residues that might be important for Cu transport. We determined the topology of the transmembrane helices that carry these residues to establish that they are membrane embedded, and substituted for them amino acids that do not ligand metal atoms. Characterization of these mutants for their uptake of radioactive 64Cu and cbb 3-Cox activities demonstrated that Met233 and His261 of CcoA are essential and Met237 and Met265 are important, whereas Tyr230 has no role for Cu uptake or cbb3-Cox biogenesis. These findings show for the first time that CcoA-mediated Cu import relies on conserved Met and His residues that could act as metal ligands at the membrane-embedded Cu binding domain of this transporter.« less

  8. Uncovering the transmembrane metal binding site of the novel bacterial major facilitator superfamily-type copper importer CcoA

    DOE PAGES

    Khalfaoui-Hassani, Bahia; Verissimo, Andreia F.; Koch, Hans -Georg; ...

    2016-01-19

    In this study, uptake and trafficking of metals and their delivery to their respective metalloproteins are important processes. Cells need precise control of each step to avoid exposure to excessive metal concentrations and their harmful consequences. Copper (Cu) is a required micronutrient used as a cofactor in proteins. However, in large amounts, it can induce oxidative damage; hence, Cu homeostasis is indispensable for cell survival. Biogenesis of respiratory heme-Cu oxygen (HCO) reductases includes insertion of Cu into their catalytic subunits to form heme-Cu binuclear centers. Previously, we had shown that CcoA is a major facilitator superfamily (MFS)-type bacterial Cu importermore » required for biogenesis of cbb 3-type cytochrome coxidase ( cbb 3-Cox). Here, using Rhodobacter capsulatus, we focused on the import and delivery of Cu to cbb 3-Cox. By comparing the CcoA amino acid sequence with its homologues from other bacterial species, we located several well-conserved Met, His, and Tyr residues that might be important for Cu transport. We determined the topology of the transmembrane helices that carry these residues to establish that they are membrane embedded, and substituted for them amino acids that do not ligand metal atoms. Characterization of these mutants for their uptake of radioactive 64Cu and cbb 3-Cox activities demonstrated that Met233 and His261 of CcoA are essential and Met237 and Met265 are important, whereas Tyr230 has no role for Cu uptake or cbb3-Cox biogenesis. These findings show for the first time that CcoA-mediated Cu import relies on conserved Met and His residues that could act as metal ligands at the membrane-embedded Cu binding domain of this transporter.« less

  9. Use of a bacterial expression vector to map the varicella-zoster virus major glycoprotein gene, gC.

    PubMed Central

    Ellis, R W; Keller, P M; Lowe, R S; Zivin, R A

    1985-01-01

    The genome of varicella-zoster virus (VZV) encodes at least three major glycoprotein genes. Among viral gene products, the gC gene products are the most abundant glycoproteins and induce a substantial humoral immune response (Keller et al., J. Virol. 52:293-297, 1984). We utilized two independent approaches to map the gC gene. Small fragments of randomly digested VZV DNA were inserted into a bacterial expression vector. Bacterial colonies transformed by this vector library were screened serologically for antigen expression with monoclonal antibodies to gC. Hybridization of the plasmid DNA from a gC antigen-positive clone revealed homology to the 3' end of the VZV Us segment. In addition, mRNA from VZV-infected cells was hybrid selected by a set of VZV DNA recombinant plasmids and translated in vitro, and polypeptide products were immunoprecipitated by convalescent zoster serum or by monoclonal antibodies to gC. This analysis revealed that the mRNA encoding a 70,000-dalton polypeptide precipitable by anti-gC antibodies mapped to the HindIII C fragment, which circumscribes the entire Us region. We conclude that the VZV gC glycoprotein gene maps to the 3' end of the Us region and is expressed as a 70,000-dalton primary translational product. These results are consistent with the recently reported DNA sequence of Us (A.J. Davison, EMBO J. 2:2203-2209, 1983). Furthermore, glycosylation appears not to be required for a predominant portion of the antigenicity of gC glycoproteins. We also report the tentative map assignments for eight other VZV primary translational products. Images PMID:2981365

  10. Bypassing bacterial infection in phage display by sequencing DNA released from phage particles.

    PubMed

    Villequey, Camille; Kong, Xu-Dong; Heinis, Christian

    2017-11-01

    Phage display relies on a bacterial infection step in which the phage particles are replicated to perform multiple affinity selection rounds and to enable the identification of isolated clones by DNA sequencing. While this process is efficient for wild-type phage, the bacterial infection rate of phage with mutant or chemically modified coat proteins can be low. For example, a phage mutant with a disulfide-free p3 coat protein, used for the selection of bicyclic peptides, has a more than 100-fold reduced infection rate compared to the wild-type. A potential strategy for bypassing the bacterial infection step is to directly sequence DNA extracted from phage particles after a single round of phage panning using high-throughput sequencing. In this work, we have quantified the fraction of phage clones that can be identified by directly sequencing DNA from phage particles. The results show that the DNA of essentially all of the phage particles can be 'decoded', and that the sequence coverage for mutants equals that of amplified DNA extracted from cells infected with wild-type phage. This procedure is particularly attractive for selections with phage that have a compromised infection capacity, and it may allow phage display to be performed with particles that are not infective at all. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  11. Vecuum: identification and filtration of false somatic variants caused by recombinant vector contamination.

    PubMed

    Kim, Junho; Maeng, Ju Heon; Lim, Jae Seok; Son, Hyeonju; Lee, Junehawk; Lee, Jeong Ho; Kim, Sangwoo

    2016-10-15

    Advances in sequencing technologies have remarkably lowered the detection limit of somatic variants to a low frequency. However, calling mutations at this range is still confounded by many factors including environmental contamination. Vector contamination is a continuously occurring issue and is especially problematic since vector inserts are hardly distinguishable from the sample sequences. Such inserts, which may harbor polymorphisms and engineered functional mutations, can result in calling false variants at corresponding sites. Numerous vector-screening methods have been developed, but none could handle contamination from inserts because they are focusing on vector backbone sequences alone. We developed a novel method-Vecuum-that identifies vector-originated reads and resultant false variants. Since vector inserts are generally constructed from intron-less cDNAs, Vecuum identifies vector-originated reads by inspecting the clipping patterns at exon junctions. False variant calls are further detected based on the biased distribution of mutant alleles to vector-originated reads. Tests on simulated and spike-in experimental data validated that Vecuum could detect 93% of vector contaminants and could remove up to 87% of variant-like false calls with 100% precision. Application to public sequence datasets demonstrated the utility of Vecuum in detecting false variants resulting from various types of external contamination. Java-based implementation of the method is available at http://vecuum.sourceforge.net/ CONTACT: swkim@yuhs.acSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  12. Characterization of intronic uridine-rich sequence elements acting as possible targets for nuclear proteins during pre-mRNA splicing in Nicotiana plumbaginifolia.

    PubMed

    Gniadkowski, M; Hemmings-Mieszczak, M; Klahre, U; Liu, H X; Filipowicz, W

    1996-02-15

    Introns of nuclear pre-mRNAs in dicotyledonous plants, unlike introns in vertebrates or yeast, are distinctly rich in A+U nucleotides and this feature is essential for their processing. In order to define more precisely sequence elements important for intron recognition in plants, we investigated the effects of short insertions, either U-rich or A-rich, on splicing of synthetic introns in transfected protoplast of Nicotiana plumbaginifolia. It was found that insertions of U-rich (sequence UUUUUAU) but not A-rich (AUAAAAA) segments can activate splicing of a GC-rich synthetic infron, and that U-rich segments, or multimers thereof, can function irrespective of the site of insertion within the intron. Insertions of multiple U-rich segments, either at the same or different locations, generally had an additive, stimulatory effect on splicing. Mutational analysis showed that replacement of one or two U residues in the UUUUUAU sequence with A or C residues had only a small effect on splicing, but replacement with G residues was strongly inhibitory. Proteins that interact with fragments of natural and synthetic pre-mRNAs in vitro were identified in nuclear extracts of N.plumbaginifolia by UV cross- linking. The profile of cross-linked plant proteins was considerably less complex than that obtained with a HeLa cell nuclear extract. Two major cross-linkable plant proteins had apparent molecular mass of 50 and 54 kDa and showed affinity for oligouridilates present in synGC introns or for poly(U).

  13. Characterization of intronic uridine-rich sequence elements acting as possible targets for nuclear proteins during pre-mRNA splicing in Nicotiana plumbaginifolia.

    PubMed Central

    Gniadkowski, M; Hemmings-Mieszczak, M; Klahre, U; Liu, H X; Filipowicz, W

    1996-01-01

    Introns of nuclear pre-mRNAs in dicotyledonous plants, unlike introns in vertebrates or yeast, are distinctly rich in A+U nucleotides and this feature is essential for their processing. In order to define more precisely sequence elements important for intron recognition in plants, we investigated the effects of short insertions, either U-rich or A-rich, on splicing of synthetic introns in transfected protoplast of Nicotiana plumbaginifolia. It was found that insertions of U-rich (sequence UUUUUAU) but not A-rich (AUAAAAA) segments can activate splicing of a GC-rich synthetic infron, and that U-rich segments, or multimers thereof, can function irrespective of the site of insertion within the intron. Insertions of multiple U-rich segments, either at the same or different locations, generally had an additive, stimulatory effect on splicing. Mutational analysis showed that replacement of one or two U residues in the UUUUUAU sequence with A or C residues had only a small effect on splicing, but replacement with G residues was strongly inhibitory. Proteins that interact with fragments of natural and synthetic pre-mRNAs in vitro were identified in nuclear extracts of N.plumbaginifolia by UV cross- linking. The profile of cross-linked plant proteins was considerably less complex than that obtained with a HeLa cell nuclear extract. Two major cross-linkable plant proteins had apparent molecular mass of 50 and 54 kDa and showed affinity for oligouridilates present in synGC introns or for poly(U). PMID:8604302

  14. The site-specific ribosomal DNA insertion element R1Bm belongs to a class of non-long-terminal-repeat retrotransposons.

    PubMed Central

    Xiong, Y; Eickbush, T H

    1988-01-01

    Two types of insertion elements, R1 and R2 (previously called type I and type II), are known to interrupt the 28S ribosomal genes of several insect species. In the silkmoth, Bombyx mori, each element occupies approximately 10% of the estimated 240 ribosomal DNA units, while at most only a few copies are located outside the ribosomal DNA units. We present here the complete nucleotide sequence of an R1 insertion from B. mori (R1Bm). This 5.1-kilobase element contains two overlapping open reading frames (ORFs) which together occupy 88% of its length. ORF1 is 461 amino acids in length and exhibits characteristics of retroviral gag genes. ORF2 is 1,051 amino acids in length and contains homology to reverse transcriptase-like enzymes. The analysis of 3' and 5' ends of independent isolates from the ribosomal locus supports the suggestion that R1 is still functioning as a transposable element. The precise location of the element within the genome implies that its transposition must occur with remarkable insertion sequence specificity. Comparison of the deduced amino acid sequences from six retrotransposons, R1 and R2 of B. mori, I factor and F element of Drosophila melanogaster, L1 of Mus domesticus, and Ingi of Trypanosoma brucei, reveals a relatively high level of sequence homology in the reverse transcriptase region. Like R1, these elements lack long terminal repeats. We have therefore named this class of related elements the non-long-terminal-repeat (non-LTR) retrotransposons. Images PMID:2447482

  15. Next-Generation Sequencing Reveals Significant Bacterial Diversity of Botrytized Wine

    PubMed Central

    Bokulich, Nicholas A.; Joseph, C. M. Lucy; Allen, Greg; Benson, Andrew K.; Mills, David A.

    2012-01-01

    While wine fermentation has long been known to involve complex microbial communities, the composition and role of bacteria other than a select set of lactic acid bacteria (LAB) has often been assumed either negligible or detrimental. This study served as a pilot study for using barcoded amplicon next-generation sequencing to profile bacterial community structure in wines and grape musts, comparing the taxonomic depth achieved by sequencing two different domains of prokaryotic 16S rDNA (V4 and V5). This study was designed to serve two goals: 1) to empirically determine the most taxonomically informative 16S rDNA target region for barcoded amplicon sequencing of wine, comparing V4 and V5 domains of bacterial 16S rDNA to terminal restriction fragment length polymorphism (TRFLP) of LAB communities; and 2) to explore the bacterial communities of wine fermentation to better understand the biodiversity of wine at a depth previously unattainable using other techniques. Analysis of amplicons from the V4 and V5 provided similar views of the bacterial communities of botrytized wine fermentations, revealing a broad diversity of low-abundance taxa not traditionally associated with wine, as well as atypical LAB communities initially detected by TRFLP. The V4 domain was determined as the more suitable read for wine ecology studies, as it provided greater taxonomic depth for profiling LAB communities. In addition, targeted enrichment was used to isolate two species of Alphaproteobacteria from a finished fermentation. Significant differences in diversity between inoculated and uninoculated samples suggest that Saccharomyces inoculation exerts selective pressure on bacterial diversity in these fermentations, most notably suppressing abundance of acetic acid bacteria. These results determine the bacterial diversity of botrytized wines to be far higher than previously realized, providing further insight into the fermentation dynamics of these wines, and demonstrate the utility of next-generation sequencing for wine ecology studies. PMID:22563494

  16. Bacterial diversity in the oral cavity of ten healthy individuals

    PubMed Central

    Bik, Elisabeth M.; Long, Clara Davis; Armitage, Gary C.; Loomer, Peter; Emerson, Joanne; Mongodin, Emmanuel F.; Nelson, Karen E.; Gill, Steven R.; Fraser-Liggett, Claire M.; Relman, David A.

    2010-01-01

    The composition of the oral microbiota from 10 individuals with healthy oral tissues was determined using culture-independent techniques. From each individual, 26 specimens, each from different oral sites at a single point in time, were collected and pooled. An eleventh pool was constructed using portions of the subgingival specimens from all 10 individuals. The 16S rRNA gene was amplified using broad-range bacterial primers, and clone libraries from the individual and subgingival pools were constructed. From a total of 11 368 high-quality, non-chimeric, near full-length sequences, 247 species-level phylotypes (using a 99% sequence identity threshold) and 9 bacteria phyla were identified. At least 15 bacterial genera were conserved among all 10 individuals, with significant interindividual differences at the species and strain level. Comparisons of these oral bacterial sequences to near full-length sequences found previously in the large intestines and feces of other healthy individuals suggest that the mouth and intestinal tract harbor distinct sets of bacteria. Co-occurrence analysis demonstrated significant segregation of taxa when community membership was examined at the level of genus, but not at the level of species, suggesting that ecologically-significant, competitive interactions are more apparent at a broader taxonomic level than species. This study is one of the more comprehensive, high-resolution analyses of bacterial diversity within the healthy human mouth to date, and highlights the value of tools from macroecology for enhancing our understanding of bacterial ecology in human health. PMID:20336157

  17. No lower bacterial adhesion for ceramics compared to other biomaterials: An in vitro analysis.

    PubMed

    Slullitel, P A; Buttaro, M A; Greco, G; Oñativia, J I; Sánchez, M L; Mc Loughlin, S; García-Ávila, C; Comba, F; Zanotti, G; Piccaluga, F

    2018-06-01

    Although there is some clinical evidence of ceramic bearings being associated with a lower infection rate after total hip arthroplasty (THA), available data remains controversial since this surface is usually reserved for young, healthy patients. Therefore, we investigated the influence of five commonly used biomaterials on the adhesion potential of four biofilm-producing bacteria usually detected in infected THAs. Ceramic biomaterials exhibit less bacterial adherence than other biomaterials. In this in vitro research, we evaluated the ability of Staphylococcus aureus, Staphylococcus epidermidis ATCC 35984, Escherichia coli ATCC 25922 and Pseudomonas aeruginosa to adhere to the surface of a cobalt-chromium metal head, a fourth-generation ceramic head, a fourth-generation ceramic insert, a highly-crossed linked polyethylene insert and a titanium porous-coated acetabular component. After an initial washing step, bacterial separation from the surface of each specimen was done with a vortex agitator. The colony-forming units were counted to determine the number of viable adherent bacteria. We found no differences on global bacterial adhesion between the different surfaces (p=0.5). E. coli presented the least adherence potential among the analysed pathogens (p<0.001). The combination of E. coli and S. epidermidis generated an antagonist effect over the adherence potential of S. epidermidis individually (58±4% vs. 48±5%; p=0.007). The combination of P. aeruginosa and S. aureus presented a trend to an increased adherence of P. aeruginosa independently, suggesting an agonist effect (71% vs. 62%; p=0.07). Ceramic bearings appeared not to be related to a lower bacterial adhesion than other biomaterials. However, different adhesive potentials among bacteria may play a major role on infection's inception. IV, in vitro study. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  18. Innate Immune Complexity in the Purple Sea Urchin: Diversity of the Sp185/333 System

    PubMed Central

    Smith, L. Courtney

    2012-01-01

    The California purple sea urchin, Strongylocentrotus purpuratus, is a long-lived echinoderm with a complex and sophisticated innate immune system. There are several large gene families that function in immunity in this species including the Sp185/333 gene family that has ∼50 (±10) members. The family shows intriguing sequence diversity and encodes a broad array of diverse yet similar proteins. The genes have two exons of which the second encodes the mature protein and has repeats and blocks of sequence called elements. Mosaics of element patterns plus single nucleotide polymorphisms-based variants of the elements result in significant sequence diversity among the genes yet maintains similar structure among the members of the family. Sequence of a bacterial artificial chromosome insert shows a cluster of six, tightly linked Sp185/333 genes that are flanked by GA microsatellites. The sequences between the GA microsatellites in which the Sp185/333 genes and flanking regions are located, are much more similar to each other than are the sequences outside the microsatellites suggesting processes such as gene conversion, recombination, or duplication. However, close linkage does not correspond with greater sequence similarity compared to randomly cloned and sequenced genes that are unlikely to be linked. There are three segmental duplications that are bounded by GAT microsatellites and include three almost identical genes plus flanking regions. RNA editing is detectible throughout the mRNAs based on comparisons to the genes, which, in combination with putative post-translational modifications to the proteins, results in broad arrays of Sp185/333 proteins that differ among individuals. The mature proteins have an N-terminal glycine-rich region, a central RGD motif, and a C-terminal histidine-rich region. The Sp185/333 proteins are localized to the cell surface and are found within vesicles in subsets of polygonal and small phagocytes. The coelomocyte proteome shows full-length and truncated proteins, including some with missense sequence. Current results suggest that both native Sp185/333 proteins and a recombinant protein bind bacteria and are likely important in sea urchin innate immunity. PMID:22566951

  19. Vector for IS element entrapment and functional characterization based on turning on expression of distal promoterless genes.

    PubMed

    Szeverényi, I; Hodel, A; Arber, W; Olasz, F

    1996-09-26

    We constructed and characterized a novel trap vector for rapid isolation of insertion sequences. The strategy used for the isolation of IS elements is based on the ability of many IS elements to turn on the expression of otherwise silent genes distal to some sites of insertion. The simple transposition of an IS element can sometimes cause the constitutive expression of promoterless antibiotic resistance genes resulting in selectable phenotypes. The trap vector pAW1326 is based on a pBR322 replicon, it carries ampicillin and streptomycin resistance genes, and also silenced genes that confer chloramphenicol and kanamycin resistance once activated. The trap vector pAW1326 proved to be efficient and 85 percent of all isolated mutations were insertions. The majority of IS elements resident in the studied Escherichia coli strains tested became trapped, namely IS2, IS3, IS5, IS150, IS186 and Tn1000. We also encountered an insertion sequence, called IS10L/R-2, which is a hybrid of the two IS variants IS10L and IS10R. IS10L/R-2 is absent from most E. coli strains, but it is detectable in some strains such as JM109 which had been submitted to Tn10 mutagenesis. The distribution of the insertion sequences within the trap region was not random. Rather, the integration of chromosomal mobile genetic elements into the offered target sequence occurred in element-specific clusters. This is explained both by the target specificity and by the specific requirements for the activation of gene transcription by the DNA rearrangement. The employed trap vector pAW1326 proved to be useful for the isolation of mobile genetic elements, for a demonstration of their transposition activity as well as for the further characterization of some of the functional parameters of transposition.

  20. Targeted gene insertion for molecular medicine.

    PubMed

    Voigt, Katrin; Izsvák, Zsuzsanna; Ivics, Zoltán

    2008-11-01

    Genomic insertion of a functional gene together with suitable transcriptional regulatory elements is often required for long-term therapeutical benefit in gene therapy for several genetic diseases. A variety of integrating vectors for gene delivery exist. Some of them exhibit random genomic integration, whereas others have integration preferences based on attributes of the targeted site, such as primary DNA sequence and physical structure of the DNA, or through tethering to certain DNA sequences by host-encoded cellular factors. Uncontrolled genomic insertion bears the risk of the transgene being silenced due to chromosomal position effects, and can lead to genotoxic effects due to mutagenesis of cellular genes. None of the vector systems currently used in either preclinical experiments or clinical trials displays sufficient preferences for target DNA sequences that would ensure appropriate and reliable expression of the transgene and simultaneously prevent hazardous side effects. We review in this paper the advantages and disadvantages of both viral and non-viral gene delivery technologies, discuss mechanisms of target site selection of integrating genetic elements (viruses and transposons), and suggest distinct molecular strategies for targeted gene delivery.

Top