Enhanced delignification of steam-pretreated poplar by a bacterial laccase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Rahul; Hu, Jinguang; Regner, Matthew R.

The recalcitrance of woody biomass, particularly its lignin component, hinders its sustainable transformation to fuels and biomaterials. Although the recent discovery of several bacterial ligninases promises the development of novel biocatalysts, these enzymes have largely been characterized using model substrates: direct evidence for their action on biomass is lacking. Herein, we report the delignification of woody biomass by a small laccase (sLac) from Amycolatopsis sp. 75iv3. Incubation of steam-pretreated poplar (SPP) with sLac enhanced the release of acid-precipitable polymeric lignin (APPL) by ~6-fold, and reduced the amount of acid-soluble lignin by ~15%. NMR spectrometry revealed that the APPL was significantlymore » syringyl-enriched relative to the original material (~16:1 vs. ~3:1), and that sLac preferentially oxidized syringyl units and altered interunit linkage distributions. sLac’s substrate preference among monoaryls was also consistent with this observation. In addition, sLac treatment reduced the molar mass of the APPL by over 50%, as determined by gel-permeation chromatography coupled with multi-angle light scattering. Finally, sLac acted synergistically with a commercial cellulase cocktail to increase glucose production from SPP ~8%. Altogether, this study establishes the lignolytic activity of sLac on woody biomass and highlights the biocatalytic potential of bacterial enzymes.« less

Lysines 72, 80 and 213 and aspartic acid 210 of the Lactococcus lactis LacR repressor are involved in the response to the inducer tagatose-6-phosphate leading to induction of lac operon expression.

PubMed

van Rooijen, R J; Dechering, K J; Niek, C; Wilmink, J; de Vos, W M

1993-02-01

Site-directed mutagenesis of the Lactococcus lactis lacR gene was performed to identify residues in the LacR repressor that are involved in the induction of lacABCDFEGX operon expression by tagatose-6-phosphate. A putative inducer binding domain located near the C-terminus was previously postulated based on homology studies with the Escherichia coli DeoR family of repressors, which all have a phosphorylated sugar as inducer. Residues within this domain and lysine residues that are charge conserved in the DeoR family were changed into alanine or arginine. The production of the LacR mutants K72A, K80A, K80R, D210A, K213A and K213R in the LacR-deficient L.lactis strain NZ3015 resulted in repressed phospho-beta-galactosidase (LacG) activities and decreased growth rates on lactose. Gel mobility shift assays showed that the complex between a DNA fragment carrying the lac operators and LacR mutants K72A, K80A, K213A and D210A did not dissociate in the presence of tagatose-6-phosphate, in contrast to wild type LacR. Other mutations (K62A/K63A, K72R, K73A, K73R, T212A, F214R, R216R and R216K) exhibited no gross effects on inducer response. The results strongly suggest that the lysines at positions 72, 80 and 213 and aspartic acid at position 210 are involved in the induction of lac operon expression by tagatose-6-phosphate.

Indian Americans at Mille Lacs.

ERIC Educational Resources Information Center

Holbert, Victoria L.; And Others

The Training Center for Community Programs prepared a report on the Mille Lacs (Chippewa) Reservation in Minnesota. Data for the report were from 2 separate sources: a survey conducted by the Training Center with the assistance of the Mille Lacs community action program (1967) and an attitudinal survey conducted by Victoria Holbert during 1969.…

Arabidopsis CER8 encodes LONG-CHAIN ACYL-COA SYNTHETASE 1 (LACS1) that has overlapping functions with LACS2 in plant wax and cutin synthesis.

PubMed

Lü, Shiyou; Song, Tao; Kosma, Dylan K; Parsons, Eugene P; Rowland, Owen; Jenks, Matthew A

2009-08-01

Plant cuticle is an extracellular lipid-based matrix of cutin and waxes, which covers aerial organs and protects them from many forms of environmental stress. We report here the characterization of CER8/LACS1, one of nine Arabidopsis long-chain acyl-CoA synthetases thought to activate acyl chains. Mutations in LACS1 reduced the amount of wax in all chemical classes on the stem and leaf, except in the very long-chain fatty acid (VLCFA) class wherein acids longer than 24 carbons (C(24)) were elevated more than 155%. The C(16) cutin monomers on lacs1 were reduced by 37% and 22%, whereas the C(18) monomers were increased by 28% and 20% on stem and leaf, respectively. Amounts of wax and cutin on a lacs1-1 lacs2-3 double mutant were much lower than on either parent, and lacs1-1 lacs2-3 had much higher cuticular permeability than either parent. These additive effects indicate that LACS1 and LACS2 have overlapping functions in both wax and cutin synthesis. We demonstrated that LACS1 has synthetase activity for VLCFAs C(20)-C(30), with highest activity for C(30) acids. LACS1 thus appears to function as a very long-chain acyl-CoA synthetase in wax metabolism. Since C(16) but not C(18) cutin monomers are reduced in lacs1, and C(16) acids are the next most preferred acid (behind C(30)) by LACS1 in our assays, LACS1 also appears to be important for the incorporation of C(16) monomers into cutin polyester. As such, LACS1 defines a functionally novel acyl-CoA synthetase that preferentially modifies both VLCFAs for wax synthesis and long-chain (C(16)) fatty acids for cutin synthesis.

Modified nucleotides reveal the indirect role of the central base pairs in stabilizing the lac repressor-operator complex.

PubMed Central

Zhang, X; Gottlieb, P A

1995-01-01

Guanine residues in the lac operator were replaced by 2-aminopurine or purine analogues, pairing the modified nucleotides with C. The observed equilibrium dissociation constants for lac repressor binding to substituted operators were measured in 10 mM Tris, 150 mM KCl, 0.1 mM EDTA, 0.1 mM DTE, pH 7.6 at 25 degrees C. These measurements revealed five positions that destabilized the complex when substituted with either analogue. Two positions, which are related by a 2-fold symmetry, are in the major groove of the operator thought to directly interact with the protein. Three sites were in the central region of the operator. A purine analogue at a sixth site perturbed the local DNA structure and destabilized the complex. Alkylation interference experiments of the 2-aminopurine substituted operators demonstrated that, of the five affected, two substitutions displayed altered phosphate interference patterns at the phosphate adjacent to the substituted base. For these operators, complex formation was measured in different concentrations of KCl to assess the contribution of counterion release to the bimolecular process. The results indicated that both complexes were similar to wild-type, although minor changes were observed. The Kobs of the complex was then measured when 2-aminopurine or purine analogues were paired with uracil nucleotide, a base pair that serves to stabilize the DNA. The introduction of the new base pairs revealed two effects on the bimolecular interaction. For those operator sites that are thought to perturb the interaction directly, the affinity of the complex was weakened to levels observed for the singly-substituted operators. In contrast, the nucleotides of 2-aminopurine paired with uracil positioned in the central region of the operator served to enhance the stability of the complex. The purine-uracil base pair substitution on the other hand had a significant destabilizing effect on the interaction. We propose that the central base pairs modulate

Late Holocene dinosterol hydrogen isotope variability in Lac Lalolalo and Lac Lanutavake on Wallis Island

NASA Astrophysics Data System (ADS)

Maloney, A. E.; Hing, S. N.; Richey, J. N.; Nelson, D. B.; Sachs, J. P.

2017-12-01

The South Pacific Convergence Zone (SPCZ) is the Southern Hemisphere's largest precipitation feature, yet little is known about the region's rainfall prior to the instrumental record. In the tropics, hydrogen isotopes of precipitation are controlled by the "amount effect" where higher mean annual rainfall rates result in 2H-depleted rain. In turn, hydrogen isotopes in tropical lakes are influenced by both rain water isotopes and evaporative enrichment. Molecular fossils preserved in lake sediments offer a promising tool for improving our understanding of the past SPCZ by tracking changes in lake water isotopes. Hydrogen isotope compositions (δ2H) of the algal lipid biomarker dinosterol were measured in duplicate sediment cores from lakes 2.75km apart on Wallis Island. The modern lakes differ in physical and chemical conditions but are both freshwater in the photic zone and experience identical climate conditions. They are an ideal setting to investigate the fidelity to which δ2Hdinosterol records climate. Duplicate records from Lac Lanutavake are in excellent agreement and reveal little change in during the past 1700 years with minor δ2Hdinosterol fluctuations between -280‰ and -290‰. Duplicate records from Lac Lalolalo also agree extremely well during the past 2,000 years. However, contrary to its neighbor, Lac Lalolalo has a highly variable δ2Hdinosterol history with 2H-depleted values of -300‰ during the youngest part of the record climbing to 2H-enriched values of -230‰ around 1000-2000 years ago. The large shift in Lac Lalolalo δ2Hdinosterol may be due to changes in lake biogeochemistry that impact growth conditions or shifts in dinoflagellate species composition. Alternatively, if the Lac Lalolalo record actually reflects changes in hydrology, large limnological changes must have occurred in Lac Lanutavke to mute the climate signal. This work emphasizes the importance of redundancy and duplication when investigating changes in past climate using

A bacterial laccase from marine microbial metagenome exhibiting chloride tolerance and dye decolorization ability.

PubMed

Fang, Zemin; Li, Tongliang; Wang, Quan; Zhang, Xuecheng; Peng, Hui; Fang, Wei; Hong, Yuzhi; Ge, Honghua; Xiao, Yazhong

2011-02-01

Laccases are blue multicopper oxidases with potential applications in environmental and industrial biotechnology. In this study, a new bacterial laccase gene of 1.32 kb was obtained from a marine microbial metagenome of the South China Sea by using a sequence screening strategy. The protein (named as Lac15) of 439 amino acids encoded by the gene contains three conserved Cu(2+)-binding domains, but shares less than 40% of sequence identities with all of the bacterial multicopper oxidases characterized. Lac15, recombinantly expressed in Escherichia coli, showed high activity towards syringaldazine at pH 6.5-9.0 with an optimum pH of 7.5 and with the highest activity occurring at 45 °C. Lac15 was stable at pH ranging from 5.5 to 9.0 and at temperatures from 15 to 45 °C. Distinguished from fungal laccases, the activity of Lac15 was enhanced twofold by chloride at concentrations lower than 700 mM, and kept the original level even at 1,000 mM chloride. Furthermore, Lac15 showed an ability to decolorize several industrial dyes of reactive azo class under alkalescent conditions. The properties of alkalescence-dependent activity, high chloride tolerance, and dye decolorization ability make the new laccase Lac15 an alternative for specific industrial applications.

Louisiana SIP: LAC 33:III Ch. 14 Subchap A, 1401 to 1415--Determining Conformity of General Federal Actions to State or Federal Implementation Plans; SIP effective 1996-11-12 (LAc67) and 1998-05-08 (LAc75)

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch. 14 Subchap A, 1401 to 1415--Determining Conformity of General Federal Actions to State or Federal Implementation Plans; SIP effective 1996-11-12 (LAc67) and 1998-05-08 (LAc75)

Selected topics from classical bacterial genetics.

PubMed

Raleigh, Elisabeth A; Elbing, Karen; Brent, Roger

2002-08-01

Current cloning technology exploits many facts learned from classical bacterial genetics. This unit covers those that are critical to understanding the techniques described in this book. Topics include antibiotics, the LAC operon, the F factor, nonsense suppressors, genetic markers, genotype and phenotype, DNA restriction, modification and methylation and recombination.

Detoxification of diphenyl ether herbicide lactofen by Bacillus sp. Za and enantioselective characteristics of an esterase gene lacE.

PubMed

Zhang, Jing; Lu, Luyao; Chen, Feng; Chen, Lingling; Yin, Jingang; Huang, Xing

2018-01-05

A bacterial strain Za capable of degrading diphenyl ether herbicide lactofen was isolated and identified as Bacillus sp. This strain could degrade 94.8% of 50mgL -1 lactofen after 4days of inoculation in flasks. It was revealed that lactofen was initially hydrolyzed to desethyl lactofen, which was further transformed to acifluorfen, followed by the reduction of the nitro group to yield aminoacifluorfen. The phytotoxicity of the transformed product aminoacifluorfen to maize was decreased significantly compared with the lactofen. A gene lacE, encoding an esterase responsible for lactofen hydrolysis to desethyl lactofen and acifluorfen continuously, was cloned from Bacillus sp. Za. The deduced amino acid belonging to the esterase family VII contained a typical Ser-His-Asp/Glu catalytic triad and the conserved motifs GXSXG. The purified recombinant protein LacE displayed maximal esterase activity at 40°C and pH 7.0. Additionally, LacE had broad substrate specificity and was capable of hydrolyzing p-nitrophenyl esters. The enantioselectivity of LacE during lactofen degradation was further studied, and the results indicated that the (S)-(+)-lactofen was degraded faster than the (R)-(-)-lactofen, which could illustrate the reported phenomenon that (S)-(+)-lactofen was preferentially degraded in soil and sediment. Copyright © 2017 Elsevier B.V. All rights reserved.

The business of refractive laser assisted cataract surgery (ReLACS).

PubMed

Berdahl, John P; Jensen, Matthew P

2014-01-01

Refractive Laser Assisted Cataract Surgery (ReLACS) combines the femtosecond laser with other noncovered tests and services in an attempt to reduce spectacle dependence in combination with cataract surgery. Significant interest is present among ophthalmologists who are considering adopting this technology, however significant capital outlays and continuing expenses can make the decision to adopt ReLACS foreboding. We review the financial considerations of ReLACS and review the trends seen in early adopters of this technology. Recent findings have shown that ReLACS is a growing segment of cataract surgery. Most practices who have implemented the technology have broken even and have a positive outlook on the financial return of implementing the ReLACS program. The average break-even analysis point for practices is around 230 cases a year. ReLACS is growing and appears to be a financial viable approach for many practices.

Systematic Analysis of the Pleurotus ostreatus Laccase Gene (PoLac) Family and Functional Characterization of PoLac2 Involved in the Degradation of Cotton-Straw Lignin.

PubMed

Jiao, Xiaoyu; Li, Guoqing; Wang, Yan; Nie, Fan; Cheng, Xi; Abdullah, Muhammad; Lin, Yi; Cai, Yongping

2018-04-11

Fungal laccases play important roles in the degradation of lignocellulose. Although some PoLac s have been reported in several studies, still no comprehensive bioinformatics study of the LAC family in Pleurotus ostreatus has been reported. In this study, we identified 12 laccase genes in the whole genome sequence of P. ostreatus and their physical characteristics, gene distribution, phylogenic relationships, gene structure, conserved motifs, and cis-elements were also analyzed. The expression patterns of 12 PoLac genes at different developmental stages and under different culture substrates were also analyzed. The results revealed that PoLac2 and PoLac12 may be involved in the degradation of lignin and the formation of the fruiting body, respectively. Subsequently, we overexpressed PoLac2 in P. ostreatus by the Agrobacterium tumefaciens -mediated transformation (ATMT) method. The transformants' laccase activity increased in varying degrees, and the gene expression level of PoLac2 in transformants was 2-8 times higher than that of the wild-type strain. Furthermore, the lignin degradation rate by transgenic fungus over 30 days was 2.36-6.3% higher than that of wild-type. Our data show that overexpression of PoLac2 significantly enhanced the lignin degradation of cotton-straw. To our knowledge, this study is the first report to demonstrate the functions of PoLac2 in P. ostreatus .

Adaptive Evolution of the Streptococcus pyogenes Regulatory Aldolase LacD.1

PubMed Central

Cusumano, Zachary

2013-01-01

In the human-pathogenic bacterium Streptococcus pyogenes, the tagatose bisphosphate aldolase LacD.1 likely originated through a gene duplication event and was adapted to a role as a metabolic sensor for regulation of virulence gene transcription. Although LacD.1 retains enzymatic activity, its ancestral metabolic function resides in the LacD.2 aldolase, which is required for the catabolism of galactose. In this study, we compared these paralogous proteins to identify characteristics correlated with divergence and novel function. Surprisingly, despite the fact that these proteins have identical active sites and 82% similarity in amino acid sequence, LacD.1 was less efficient at cleaving both fructose and tagatose bisphosphates. Analysis of kinetic properties revealed that LacD.1's adaptation was associated with a decrease in kcat and an increase in Km. Construction and analysis of enzyme chimeras indicated that non-active-site residues previously associated with the variable activities of human aldolase isoenzymes modulated LacD.1's affinity for substrate. Mutant LacD.1 proteins engineered to have LacD.2-like levels of enzymatic efficiency lost the ability to function as regulators, suggesting that an alteration in efficiency was required for adaptation. In competition under growth conditions that mimic a deep-tissue environment, LacD.1 conferred a significant gain in fitness that was associated with its regulatory activity. Taken together, these data suggest that LacD.1's adaptation represents a form of neofunctionalization in which duplication facilitated the gain of regulatory function important for growth in tissue and pathogenesis. PMID:23316044

Structural Explanation for Allolactose (lac Operon Inducer) Synthesis by lacZ β-Galactosidase and the Evolutionary Relationship between Allolactose Synthesis and the lac Repressor

PubMed Central

Wheatley, Robert W.; Lo, Summie; Jancewicz, Larisa J.; Dugdale, Megan L.; Huber, Reuben E.

2013-01-01

β-Galactosidase (lacZ) has bifunctional activity. It hydrolyzes lactose to galactose and glucose and catalyzes the intramolecular isomerization of lactose to allolactose, the lac operon inducer. β-Galactosidase promotes the isomerization by means of an acceptor site that binds glucose after its cleavage from lactose and thus delays its exit from the site. However, because of its relatively low affinity for glucose, details of this site have remained elusive. We present structural data mapping the glucose site based on a substituted enzyme (G794A-β-galactosidase) that traps allolactose. Various lines of evidence indicate that the glucose of the trapped allolactose is in the acceptor position. The evidence includes structures with Bis-Tris (2,2-bis(hydroxymethyl)-2,2′,2″-nitrilotriethanol) and l-ribose in the site and kinetic binding studies with substituted β-galactosidases. The site is composed of Asn-102, His-418, Lys-517, Ser-796, Glu-797, and Trp-999. Ser-796 and Glu-797 are part of a loop (residues 795–803) that closes over the active site. This loop appears essential for the bifunctional nature of the enzyme because it helps form the glucose binding site. In addition, because the loop is mobile, glucose binding is transient, allowing the release of some glucose. Bioinformatics studies showed that the residues important for interacting with glucose are only conserved in a subset of related enzymes. Thus, intramolecular isomerization is not a universal feature of β-galactosidases. Genomic analyses indicated that lac repressors were co-selected only within the conserved subset. This shows that the glucose binding site of β-galactosidase played an important role in lac operon evolution. PMID:23486479

A method for constructing single-copy lac fusions in Salmonella typhimurium and its application to the hemA-prfA operon.

PubMed

Elliott, T

1992-01-01

This report describes a set of Escherichia coli and Salmonella typhimurium strains that permits the reversible transfer of lac fusions between a plasmid and either bacterial chromosome. The system relies on homologous recombination in an E. coli recD host for transfer from plasmid to chromosome. This E. coli strain carries the S. typhimurium put operon inserted into trp, and the resulting fusions are of the form trp::put::[Kanr-X-lac], where X is the promoter or gene fragment under study. The put homology flanks the lac fusion segment, so that fusions can be transduced into S. typhimurium, replacing the resident put operon. Subsequent transduction into an S. typhimurium strain with a large chromosomal deletion covering put allows selection for recombinants that inherit the fusion on a plasmid. A transposable version of the put operon was constructed and used to direct lac fusions to novel locations, including the F plasmid and the ara locus. Transductional crosses between strains with fusions bearing different segments of the hemA-prfA operon were used to determine the contribution of the hemA promoter region to expression of the prfA gene and other genes downstream of hemA in S. typhimurium.

Are some BL Lacs artefacts of gravitational lensing?

PubMed

Ostriker, J P; Vietri, M

1990-03-01

WE suggested in 1985 that a significant fraction of BL Lacertae objects, a kind of lineless quasar, seen in nearby galaxies are in fact images, gravitationally lensed and substantially amplified by stars in the nearby galaxy, of background objects, optically violent variable (OVV) quasars at redshifts z > 1 (ref. 1). This hypothesis was made on the basis of certain general similarities between BL Lacs and O Ws, but for two recently observed BL Lacs(2,3) a strong case can be made that the accompanying elliptical galaxy is a foreground object. In addition, we argue that the distribution of BL Lac redshifts is hard to understand without gravitational lensing, unless we happen to be at a very local maximum of the spatial cosmic distribution of BL Lacs. Our analysis also indicates that the galaxies whose stars are likely to act as microlenses will be found in two peaks, one nearby, with redshift 0.05-0.10, and the other near the distant quasar.

A source of artifact in the lacZ reversion assay in Escherichia coli.

PubMed

Hoffmann, George R; Gray, Carol L; Lange, Paulina B; Marando, Christie I

2015-06-01

The lacZ reversion assay in Escherichia coli measures point mutations that occur by specific base substitutions and frameshift mutations. The tester strains cannot use lactose as a carbon source (Lac(-)), and revertants are easily detected by growth on lactose medium (Lac(+)). Six strains identify the six possible base substitutions, and five strains measure +G, -G, -CG, +A and -A frameshifts. Strong mutagens give dose-dependent increases in numbers of revertants per plate and revertant frequencies. Testing compounds that are arguably nonmutagens or weakly mutagenic, we often noted statistically significant dose-dependent increases in revertant frequency that were not accompanied by an absolute increase in numbers of revertants. The increase in frequency was wholly ascribable to a declining number of viable cells owing to toxicity. Analysis of the conditions revealed that the frequency of spontaneous revertants is higher when there are fewer viable cells per plate. The phenomenon resembles "adaptive" or "stress" mutagenesis, whereby lactose revertants accumulate in Lac(-) bacteria under starvation conditions in the absence of catabolite repression. Adaptive mutation is observed after long incubation and might be expected to be irrelevant in a standard assay using 48-h incubation. However, we found that elevated revertant frequencies occur under typical assay conditions when the bacterial lawn is thin, and this can cause increases in revertant frequency that mimic chemical mutagenesis when treatments are toxic but not mutagenic. Responses that resemble chemical mutagenesis were observed in the absence of mutagenic treatment in strains that revert by different frameshift mutations. The magnitude of the artifact is affected by cell density, dilution, culture age, incubation time, catabolite repression and the age and composition of media. Although the specific reversion assay is effective for quickly distinguishing classes of mutations induced by potent mutagens, its

Evaluation of coloring efficacy of lac dye in comminuted meat product.

PubMed

Divya; Singh, R P; Baboo, B; Prasad, K M

2011-06-01

Effect of incorporation of graded levels (4, 6, 8, 10, 25 ppm) of lac dye on coloring efficacy and possible use of this natural color in processed meat products was studied. Inclusion of lac dye at different concentrations did not affect the pH significantly whereas a linear increase in the Lovibond red color unit of chicken nuggets was noted with raising the level of lac dye from 4 to 10 ppm. The sensory rating for color was highest at addition level of 25 ppm of lac dye and it was comparable to color score of the product containing 200 ppm sodium nitrite. Lac dye inclusion in nuggets at all concentrations studied had better antimicrobial properties as compared to 200 ppm sodium nitrite. It was concluded that lac dye from 10 to 25 ppm could be incorporated in comminuted meat products as a natural colorant with antimicrobial action.

Clustering environments of BL Lac objects

NASA Technical Reports Server (NTRS)

Wurtz, Ronald; Ellingson, Erica; Stocke, John T.; Yee, H. K. C.

1993-01-01

We report measurements of the amplitude of the BL Lac galaxy spatial covariance function, B(gb), for the fields of five BL Lacertae objects. We present evidence for rich clusters around MS 1207+39 and MS 1407+59, and confirm high richness for the cluster containing H0414+009. We discuss the ease of 3C 66 A and find evidence for a poor cluster based on an uncertain redshift of z = 0.444. These data suggest that at least some BL Lac objects are consistent with being FR 1 radio galaxies in rich clusters.

X-Ray Variability of BL Lac Objects

NASA Astrophysics Data System (ADS)

McHardy, Ian

I present an overview of the X-ray temporal and spectral variability of BL Lacs on both short and long timescales. The previously observed behaviour of short (~days) flares superimposed on a relatively steady `quiescent' level is still broadly correct. However, for the brighter BL Lacs, the well sampled lightcurves from the RXTE ASM show that the `quiescent' level also varies considerably on timescales of ~100 days in a manner similar to that seen in Optically Violently Variable Quasars (OVVs) such as 3C279 and 3C273. Possible reasons for this behaviour are discussed. For the large majority of BL Lacs the soft and medium energy X-ray bands are dominated by synchrotron emission and, unlike the case of OVVs, the emission mechanism is not in doubt. Most interest then centres on the structure of the emitting region, and the electron acceleration processes, particularly during outbursts. That structure, and the acceleration processes, can be investigated by consideration of the spectral variability during flares, which is not simple. I review the observations of spectral variability and consider the evidence for and against homogeneous models. I also briefly compare the X-ray spectral variability of BL Lacs with that of OVVs such as 3C273.

Louisiana SIP: LAC 33:III Ch. 7 - Table 2 - Ambient Air--Methods of Contaminant Measurements; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) to 2011-08-03 (LAd34 - Moved to Section 711 and revised [adds PM-2.5])

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch. 7 - Table 2 - Ambient Air--Methods of Contaminant Measurements; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) to 2011-08-03 (LAd34 - Moved to Section 711 and revised [adds PM-2.5])

Louisiana SIP: LAC 33:III Ch. 7 Section 709. Measurement of Concentrations PM10, SO2, Carbon Monoxide, Atmospheric Oxidants, Nitrogen Oxides, and Lead; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) to 2011-08-03 (LAd34 - Revised)

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch. 7 Section 709. Measurement of Concentrations PM10, SO2, Carbon Monoxide, Atmospheric Oxidants, Nitrogen Oxides, and Lead; SIP effective 1989-05-08 (LAc49) and 1989-08-14 (LAc50) to 2011-08-03 (LAd34 - Revised)

An acid-stable bacterial laccase identified from the endophyte Pantoea ananatis Sd-1 genome exhibiting lignin degradation and dye decolorization abilities.

PubMed

Shi, Xiaowei; Liu, Qian; Ma, Jiangshan; Liao, Hongdong; Xiong, Xianqiu; Zhang, Keke; Wang, Tengfei; Liu, Xuanmin; Xu, Ting; Yuan, Shanshan; Zhang, Xin; Zhu, Yonghua

2015-11-01

Isolation and identification of a novel laccase (namely Lac4) with various industrial applications potentials from an endophytical bacterium. Endophyte Sd-1 cultured in rice straw showed intra- and extra-cellular laccase activities. Genomic analysis of Sd-1 identified four putative laccases, Lac1 to Lac4. However, only Lac4 contains the complete signature sequence of laccase and shares at most 64 % sequence identity with other characterized bacterial multi-copper oxidases. Recombinant Lac4 can oxidize non-phenolic and phenolic compounds under acidic conditions and at 30-50 °C; Km values of Lac4 for ABTS at pH 2.5 and for guaiacol at pH 4.5 were 1 ± 0.15 and 6.1 ± 1.7 mM, respectively. The activity of Lac4 was stimulated by 0.8 mM Cu(2+) and 5 mM Fe(2+). In addition, Lac4 could decolorize various synthetic dyes and exhibit the degradation rate of 38 % for lignin. The data suggest that Lac4 possesses promising biotechnological potentials.

Shine-Dalgarno sequence enhances the efficiency of lacZ repression by artificial anti-lac antisense RNAs in Escherichia coli.

PubMed

Stefan, Alessandra; Schwarz, Flavio; Bressanin, Daniela; Hochkoeppler, Alejandro

2010-11-01

Silencing of the lacZ gene in Escherichia coli was attempted by means of the expression of antisense RNAs (asRNAs) in vivo. A short fragment of lacZ was cloned into the pBAD expression vector, in reverse orientation, using the EcoRI and PstI restriction sites. This construct (pBAD-Zcal1) was used to transform E. coli cells, and the antisense transcription was induced simply by adding arabinose to the culture medium. We demonstrated that the Zcal1 asRNA effectively silenced lacZ using β-galactosidase activity determinations, SDS-PAGE, and Western blotting. Because the concentration of the lac mRNA was always high in cells that expressed Zcal1, we hypothesize that this antisense acts by inhibiting messenger translation. Similar analyses, performed with a series of site-specific Zcal1 mutants, showed that the Shine-Dalgarno sequence, which is conferred by the pBAD vector, is an essential requisite for silencing competence. Indeed, the presence of the intact Shine-Dalgarno sequence positively affects asRNA stability and, hence, silencing effectiveness. Our observations will contribute to the understanding of the main determinants of silencing as exerted by asRNAs as well as provide useful support for the design of robust and efficient prokaryotic gene silencers. Copyright © 2010 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Regulation of lac Operon Expression: Reappraisal of the Theory of Catabolite Repression

PubMed Central

Wanner, Barry L.; Kodaira, Ryoji; Neidhardt, Frederick C.

1978-01-01

The physiological state of Escherichia coli with respect to (permanent) catabolite repression was assessed by measuring the steady-state level of β-galactosidase in induced or in constitutive cells under a variety of growth conditions. Four results were obtained. (i) Catabolite repression had a major effect on fully induced or constitutive expression of the lac gene, and the magnitude of this effect was found to be dependent on the promoter structure; cells with a wild-type lac promoter showed an 18-fold variation in lac expression, and cells with the lacP37 (formerly lac-L37) promoter exhibited several hundred-fold variation. (ii) Exogenous adenosine cyclic 3′,5′-monophosphoric acid (cAMP) could not abolish catabolite repression, even though several controls demonstrated that cAMP was entering the cells in significant amounts. (Rapid intracellular degradation of cAMP could not be ruled out.) (iii) Neither the growth rate nor the presence of biosynthetic products altered the degree of catabolite repression; all variation could be related to the catabolites present in the growth medium. (iv) Slowing by imposing an amino acid restriction decreased the differential rate of β-galactosidase synthesis from the wild-type lac promoter when bacteria were cultured in either the absence or presence of cAMP; this decreased lac expression also occurred when the bacteria harbored the catabolite-insensitive lacP5 (formerly lacUV5) promoter mutation. These findings support the idea that (permanent) catabolite repression is set by the catabolites in the growth medium and may not be related to an imbalance between catabolism and anabolism. PMID:214424

Modification of natural matrix lac-bagasse for matrix composite films

NASA Astrophysics Data System (ADS)

Nurhayati, Nanik Dwi; Widjaya, Karna; Triyono

2016-02-01

Material technology continues to be developed in order to a material that is more efficient with composite technology is a combination of two or more materials to obtain the desired material properties. The objective of this research was to modification and characterize the natural matrix lac-bagasse as composite films. The first step, natural matrix lac was changed from solid to liquid using an ethanol as a solvent so the matrix homogenly. Natural matrix lac was modified by adding citric acid with concentration variation. Secondly, the bagasse delignification using acid hydrolysis method. The composite films natural matrix lac-bagasse were prepared with optimum modified the addition citric acid 5% (v/v) and delignification bagasse optimum at 1,5% (v/v) in hot press at 80°C 6 Kg/cm-1. Thirdly, composite films without and with modification were characterized functional group analysis using FTIR spectrophotometer and mechanical properties using Universal Testing Machine. The result of research showed natural matrix lac can be modified by reaction with citric acid. FTIR spectra showed without and with modification had functional groups wide absorption 3448 cm-1 group -OH, C=O ester strong on 1712 cm-1 and the methylene group -CH2 on absorption 1465 cm-1. The mechanical properties showed tensile strength 0,55 MPa and elongation at break of 0,95 %. So that composite films natural matrix lac can be made with reinforcement bagasse for material application.

Evolutionary behaviour of AGN: Investigations on BL Lac objects and Seyfert II galaxies

NASA Astrophysics Data System (ADS)

Beckmann, V.

2000-12-01

The evolution and nature of AGN is still one of the enigmatic questions in astrophysics. While large and complete Quasar samples are available, special classes of AGN, like BL Lac objects and Seyfert II galaxies, are still rare objects. In this work I present two new AGN samples. The first one is the HRX-BL Lac survey, resulting in a sample of X-ray selected BL Lac objects. This sample results from 223 BL Lac candidates based on a correlation of X-ray sources with radio sources. The identification of this sample is 98% complete. 77 objects have been identified as BL Lac objects and form the HRX-BL Lac complete sample, the largest homogeneous sample of BL Lac objects existing today. For this sample, redshifts are now known for 62 objects (81 %). In total I present 101 BL Lac objects in the enlarged HRX-BL Lac survey, for which redshift information is available for 84 objects. During the HRX-BL Lac survey I found several objects of special interest. 1ES 1517+656 turned out to be the brightest known BL Lac object in the universe. 1ES 0927+500 could be the first BL Lac object with a line detected in the X-ray region. RX J1211+2242 is probably the the counterpart of the up to now unidentified gamma-ray source 3EG J1212+2304. Additionally I present seven candidates for ultra high frequency peaked BL Lac objects. RX J1054+3855 and RX J1153+3517 are rare high redshift X-ray bright QSO or accreting binary systems with huge magnetic fields. For the BL Lac objects I suggest an unified scenario in which giant elliptical galaxies, formed by merging events of spiral galaxies at z > 2, start as powerful, radio dominated BL Lacs. As the jet gets less powerful, the BL Lacs start to get more X-ray dominated, showing less total luminosities (for z < 1). This effect is seen in the different evolutionary behavior detected in high and low frequency cut off BL Lac objects (HBL and LBL, respectively). The model of negative evolution is supported by assumptions about the energetic effects

Evidence for an intermediate conformational state of LacY.

PubMed

Jiang, Xiaoxu; Guan, Lan; Zhou, Yonggang; Hong, Wen-Xu; Zhang, Qinghai; Kaback, H Ronald

2012-03-20

LacY mutant Cys154 → Gly exhibits a periplasmic-closed crystal structure identical to the WT, but is periplasmic-open in the membrane. The mutant hardly catalyzes transport, but binds galactosides from either side of the membrane with the same affinity and is resistant to site-directed proteolysis relative to the pseudo-WT. Site-directed alkylation was also applied to 11 single-Cys mutants in Cys154 → Gly LacY in right-side-out membrane vesicles or after solubilization and purification in dodecyl-β-D-maltopyranoside (DDM). Unlike the pseudo-WT, Cys replacements on the periplasmic side of the Cys154 → Gly mutant label rapidly in the membrane without sugar, but labeling decreases markedly after the mutant proteins are purified. Thus, Cys154 → Gly LacY likely favors a higher-energy intermediate periplasmic-open conformation in situ, but collapses to a lower-energy periplasmic-closed conformation in DDM after purification. Notably, branched-chain or neopentyl glycol maltoside detergents stabilize Cys154 → Gly LacY in the membrane-embedded form.

Bacterial recognition of thermal glycation products derived from porcine serum albumin with lactose.

PubMed

Sarabia-Sainz, Andre-I; Ramos-Clamont, Gabriela; Winzerling, Joy; Vázquez-Moreno, Luz

2011-01-01

Recently, glyco-therapy is proposed to prevent the interaction of bacterial lectins with host ligands (glycoconjugates). This interaction represents the first step in infection. Neoglycans referred to as PSA-Lac (PSA-Glu (β1-4) Gal) were obtained by conjugation of porcine serum albumin (PSA) with lactose at 80 °C, 100 °C and 120 ºC. Characterization studies of the products showed that PSA could contain 1, 38 or 41 added lactoses, depending on the reaction temperature. These neoglycans were approximately 10 times more glycated than PSA-Lac obtained in previous work. Lactose conjugation occurred only at lysines and PSA-Lac contained terminal galactoses as confirmed by Ricinus communis lectin recognition. Furthermore, Escherichia coli K88+, K88ab, K88ac and K88ad adhesins showed affinity toward all PSA-Lac neoglycans, and the most effective was the PSA-Lac obtained after 100 ºC treatment. In vitro, this neoglycan partially inhibited the adhesion of E. coli K88+ to piglet mucin (its natural ligand). These results provide support for the hypothesis that glycated proteins can be used as an alternative for bioactive compounds for disease prevention.

Water quality and hydrology of the Lac Vieux Desert watershed, Gogebic County, Michigan, and Vilas County, Wisconsin, 2002-04

USGS Publications Warehouse

Weaver, T.L.; Neff, B.P.; Ellis, J.M.

2005-01-01

, could result in considerable degradation in lake-water quality.The estimated water balance includes the following inputs from the surrounding watershed: direct precipitation (35 percent); runoff, composed of streamflow and overland flow (50 percent); and ground-water flow (15 percent). Outputs from Lac Vieux Desert include streamflow into the Wisconsin River (68 percent) and evaporation from the lake surface (32 percent). Seasonal regulation of Lac Vieux Desert outflow results in an artificially high lake stage throughout the year, except from late winter to very early spring, prior to snowmelt and runoff. Regulation of Lac Vieux Desert outflow causes Wisconsin River streamflow to be artificially low during spring and summer and artificially high in fall and winter.Recent studies indicate that lake-level regulation over the past century may have affected wild rice growth and propagation in Lac Vieux Desert. As per licensing agreement between the Federal Energy Regulatory Commission and the Wisconsin Valley Improvement Company (operators of the dam at the outlet), the maximum lake level of Lac Vieux Desert was lowered about 0.8 feet to investigate the relation between lake-level regulation and propagation of wild rice from 2003 through 2012. Recent plantings of wild rice by the Lac Vieux Desert Band have been successful, indicating that suitable habitat and hydrologic regime were present in 2004-05.

Bacterial dispersion in relation to operating room clothing.

PubMed Central

Whyte, W.; Vesley, D.; Hodgson, R.

1976-01-01

The effect of operating clothing on the dispersal of bacterial particles from the wearers was studied in a dispersal chamber. A comparison was made of six gowns as well as four types of trousers. The gowns were of three basic types, namely a conventional cotton type, disposable types made of non-woven fabric and those of the total-body exhaust system (Charnley type). The dispersal chamber could simulate conditions as expected both in down-flow unidirectional ultra-clean systems and in a conventional turbulent plenum-ventilated system. It was found that the disposable gowns would reduce the dispersal rate by about 30% in the simulated conventionally ventilated system and about 65% in the laminar flow system. The total-body exhaust system (Charnley) would reduce the count by 10-fold in the conventional ventilated system and by 66-fold in the laminar-flow system. The poor performance of the gowns in conventionally ventilated systems was caused by the dispersal of bacterial particles from underneath the gown (about 80%). This was not reduced by the disposable gown and only partially by the Charnley type. This small drop would be further decreased in a conventionally ventilated operating-room as only scrubbed staff would wear the gown. In order to overcome this poor performance in conventionally ventilated operating-rooms impervious trousers would be required. Four types were studied and it was demonstrated that those made either from Ventile or non-woven fabric would reduce the bacterial dispersion fourfold. As these tests had been carried out in an artificial environment checks were carried out in the unidirectional-flow operating-room during total-hip arthroplasty. This was done by comparing conventional cotton gowns with non-woven gowns and total-body exhaust gowns. The results showed good correlation between the operating room and the chamber with the non-woven fabric gown but the total-body exhaust system did not perform as well in the operating room (12-fold

Solving a discrete model of the lac operon using Z3

NASA Astrophysics Data System (ADS)

Gutierrez, Natalia A.

2014-05-01

A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.

Tamoxifen mutagenesis and carcinogenesis in livers of lambda/lacI transgenic rats: selective influence of phenobarbital promotion.

PubMed

Styles, J A; Davies, R; Fenwick, S; Walker, J; White, I N; Smith, L L

2001-01-10

Administration of tamoxifen (TAM) (20 mg/kg per day p.o.) for 6 weeks to female lambda/lacI transgenic rats caused a 4-fold increase in mutation frequency (MF) at the lacI gene locus in the livers of dosed animals compared with controls. After cessation of dosing, the MF showed a further increase with time at 2, 12 and 24 weeks, respectively. Phenobarbital promotion of similarly treated animals resulted in no increase in mutation frequency compared with TAM alone. Treatment with phenobarbital or TAM+phenobarbital resulted in time-dependent increases in liver weight compared with the corresponding controls. There was an increase in cell proliferation in the phenobarbital and TAM+phenobarbital groups, and at 24 weeks in the TAM dosed animals compared with controls. There was also a progressive increase in the number of GST-P expressing foci in the livers of TAM and TAM + phenobarbital rats compared with controls. The induction of cell proliferation and GSTP foci in the rat liver by phenobarbital is consistent with its ability to promote tamoxifen-initiated liver tumours in the rat. If the lacI gene is regarded as being representative of the rat genome in general (albeit that the gene is bacterial) the above observations suggest that promotion by tamoxifen confers selective advantage on mutated genes at loci that contribute to the tumour phenotype and that promotion of rat liver tumours by tamoxifen is not dependent simply upon the enhancement of cellular proliferation.

Design of the lac gene circuit revisited

PubMed Central

Savageau, Michael A.

2011-01-01

The lactose (lac) operon of Escherichia coli serves as the paradigm for gene regulation, not only for bacteria, but also for all biological systems from simple phage to humans. The details of the systems may differ, but the key conceptual framework remains, and the original system continues to reveal deeper insights with continued experimental and theoretical study. Nearly as long lasting in impact as the pivotal work of Jacob and Monod is the classic experiment of Novick and Weiner in which they demonstrated all-or-none gene expression in response to an artificial inducer. These results are often cited in claims that normal gene expression is in fact a discontinuous bistable phenomenon. In this paper, I review several levels of analysis of the lac system and introduce another perspective based on the construction of the system design space. These represent variations on a theme, based on a simply stated design principle, that captures the key qualitative features of the system in a largely mechanism-independent fashion. Moreover, this principle can be readily interpreted in terms of specific mechanisms to make predictions regarding monostable vs. bistable behavior. The regions of design space representing bifurcations are compared with the corresponding regions identified through bifurcation analysis. I present evidence based on biological considerations as well as modeling and analysis to suggest that induction of the lac system in its natural setting is a monostable continuously graded phenomenon. Nevertheless, it must be acknowledged that the lac stability question remains unsettled, and it undoubtedly will remain so until there are definitive experimental results. PMID:21414326

Centralized Drinking Water Treatment Operations Shape Bacterial and Fungal Community Structure.

PubMed

Ma, Xiao; Vikram, Amit; Casson, Leonard; Bibby, Kyle

2017-07-05

Drinking water microbial communities impact opportunistic pathogen colonization and corrosion of water distribution systems, and centralized drinking water treatment represents a potential control for microbial community structure in finished drinking water. In this article, we examine bacterial and fungal abundance and diversity, as well as the microbial community taxonomic structure following each unit operation in a conventional surface water treatment plant. Treatment operations drove the microbial composition more strongly than sampling time. Both bacterial and fungal abundance and diversity decreased following sedimentation and filtration; however, only bacterial abundance and diversity was significantly impacted by free chlorine disinfection. Similarly, each treatment step was found to shift bacterial and fungal community beta-diversity, with the exception of disinfection on the fungal community structure. We observed the enrichment of bacterial and fungal taxa commonly found in drinking water distribution systems through the treatment process, for example, Sphingomonas following filtration and Leptospirillium and Penicillium following disinfection. Study results suggest that centralized drinking water treatment processes shape the final drinking water microbial community via selection of community members and that the bacterial community is primarily driven by disinfection while the eukaryotic community is primarily controlled by physical treatment processes.

LacI Transcriptional Regulatory Networks in Clostridium thermocellum DSM1313

DOE PAGES

Wilson, Charlotte M.; Klingeman, Dawn M.; Schlachter, Caleb; ...

2016-12-21

Organisms regulate gene expression in response to the environment to coordinate metabolic reactions.Clostridium thermocellumexpresses enzymes for both lignocellulose solubilization and its fermentation to produce ethanol. In one LacI regulator termed GlyR3 inC. thermocellumATCC 27405 we identified a repressor of neighboring genes with repression relieved by laminaribiose (a β-1,3 disaccharide). To better understand the threeC. thermocellumLacI regulons, deletion mutants were constructed using the genetically tractable DSM1313 strain. DSM1313lacIgenes Clo1313_2023, Clo1313_0089, and Clo1313_0396 encode homologs of GlyR1, GlyR2, and GlyR3 from strain ATCC 27405, respectively. Furthermore, growth on cellobiose or pretreated switchgrass was unaffected by any of the gene deletions under controlled-pHmore » fermentations. Global gene expression patterns from time course analyses identified glycoside hydrolase genes encoding hemicellulases, including cellulosomal enzymes, that were highly upregulated (5- to 100-fold) in the absence of each LacI regulator, suggesting that these were repressed under wild-type conditions and that relatively few genes were controlled by each regulator under the conditions tested. Clo1313_2022, encoding lichenase enzyme LicB, was derepressed in a ΔglyR1strain. Higher expression of Clo1313_1398, which encodes the Man5A mannanase, was observed in a ΔglyR2strain, and α-mannobiose was identified as a probable inducer for GlyR2-regulated genes. For the ΔglyR3strain, upregulation of the two genes adjacent toglyR3in thecelC-glyR3-licAoperon was consistent with earlier studies. Electrophoretic mobility shift assays have confirmed LacI transcription factor binding to specific regions of gene promoters. IMPORTANCEUnderstandingC. thermocellumgene regulation is of importance for improved fundamental knowledge of this industrially relevant bacterium. Most LacI transcription factors regulate local genomic regions; however, a small number of those

Flood Control Project Lac Qui Parle, Emergency Plan

DTIC Science & Technology

1988-10-01

elevation of the breach (924.0 as shown in Table 1), is approximately 22.2 feet. The value of the envelope curve shown on Plate D-10 for a hydraulic...approximately 83% of the computed maximum outflow. Several failure scenarios for Lac qui Parle Dam were studied. The case of failure concurrent with a PKF ...discharge would plot very close to Lac qui Parle in Plate D-10. Plate D-10 shows that the value of the envelope curve for a hydraulic depth of 18.8 feet

Are some BL Lac objects artefacts of gravitational lensing?

NASA Technical Reports Server (NTRS)

Ostriker, J. P.; Vietri, M.

1985-01-01

It is proposed here that a significant fraction of BL Lac objects are optically violently variable quasars whose continuum emission has been greatly amplified, relative to the line emission, by pointlike gravitational lenses in intervening galaxies. Several anomalous physical and statistical properties of BL Lacs can be understood on the basis of this model, which is immediately testable on the basis of absorption line studies and by direct imaging.

Louisiana SIP: LAC 33:III Ch 2147. Limiting Volatile Organic Compound (VOC) Emissions from Reactor Processes and Distillation Operations in Synthetic Organic Chemical manufacturing Industry (SOCMI); SIP effective 2011-08-04 (LAd34) to 2017-09-27

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch 2147. Limiting Volatile Organic Compound (VOC) Emissions from Reactor Processes and Distillation Operations in Synthetic Organic Chemical manufacturing Industry (SOCMI); SIP effective 2011-08-04 (LAd34) to 2017-09-27

The REX survey as a Tool to Test the Beaming Model for BL Lacs

NASA Astrophysics Data System (ADS)

Caccianiga, A.; della Ceca, R.; Gioia, I. M.; Maccacaro, T.; Wolter, A.

We present the preliminary properties of the BL Lacs discovered in the REX survey (Caccianiga et al. 1998). In particular, we discuss a few sources with optical spectral properties ``intermediate'' between those of BL Lacs and those of elliptical galaxies. These objects could harbour weak (in the optical band) sources of non-thermal continuum in their nuclei and, if confirmed, they could represent the faint tail of the BL Lac population. The existence of such ``weak'' BL Lacs is matter of discussion in recent literature (e.g. Marcha et al. 1996) and could lead to a revision of the defining criteria of a BL Lac and, consequently, of their cosmological and statistical properties.

The Radio-optical Spectra of BL Lacs and Possible Relatives

NASA Astrophysics Data System (ADS)

Dennett-Thorpe, J.

I consider the suggestion that, in a complete sample of flat-spectrum radio sources with available optical spectra (Marcha et al 1996), the strong emission line objects, or those with passive elliptical spectra are close relatives of the BL Lacs. New observations at four frequencies from 8 to 43GHz are presented, together with evidence for radio variability. Combined with other radio and optical data from the literature, we are able to construct the non-thermal SEDs and use these to address the questions: are the optically passive objects potentially `unrecognised' BL Lacs (either intrinsically weak and/or hidden by starlight)? What is the relationship between the surprising number of strong emission-line objects and the BL Lacs?

Lactose metabolism by Staphylococcus aureus: characterization of lacABCD, the structural genes of the tagatose 6-phosphate pathway.

PubMed Central

Rosey, E L; Oskouian, B; Stewart, G C

1991-01-01

The nucleotide and deduced amino acid sequences of the lacA and lacB genes of the Staphylococcus aureus lactose operon (lacABCDFEG) are presented. The primary translation products are polypeptides of 142 (Mr = 15,425) and 171 (Mr = 18,953) amino acids, respectively. The lacABCD loci were shown to encode enzymes of the tagatose 6-phosphate pathway through both in vitro studies and complementation analysis in Escherichia coli. A serum aldolase assay, modified to allow detection of the tagatose 6-phosphate pathway enzymes utilizing galactose 6-phosphate or fructose phosphate analogs as substrate, is described. Expression of both lacA and lacB was required for galactose 6-phosphate isomerase activity. LacC (34 kDa) demonstrated tagatose 6-phosphate kinase activity and was found to share significant homology with LacC from Lactococcus lactis and with both the minor 6-phosphofructokinase (PfkB) and 1-phosphofructokinase (FruK) from E. coli. Detection of tagatose 1,6-bisphosphate aldolase activity was dependent on expression of the 36-kDa protein specified by lacD. The LacD protein is highly homologous with LacD of L. lactis. Thus, the lacABCD genes comprise the tagatose 6-phosphate pathway and are cotranscribed with genes lacFEG, which specify proteins for transport and cleavage of lactose in S. aureus. PMID:1655695

Radio-weak BL Lac Objects in the Fermi Era

NASA Astrophysics Data System (ADS)

Massaro, F.; Marchesini, E. J.; D'Abrusco, R.; Masetti, N.; Andruchow, I.; Smith, Howard A.

2017-01-01

The existence of “radio-weak BL Lac objects” (RWBLs) has been an open question, and has remained unsolved since the discovery that quasars could be radio-quiet or radio-loud. Recently, several groups identified RWBL candidates, mostly found while searching for low-energy counterparts of the unidentified or unassociated gamma-ray sources listed in the Fermi catalogs. Confirming RWBLs is a challenging task since they could be confused with white dwarfs (WDs) or weak emission line quasars (WELQs) when there are not sufficient data to precisely draw their broadband spectral energy distribution, and their classification is mainly based on a featureless optical spectra. Motivated by the recent discovery that Fermi BL Lacs appear to have very peculiar mid-IR emission, we show that it is possible to distinguish between WDs, WELQs, and BL Lacs using the [3.4]-[4.6]-[12] μm color-color plot built using the WISE magnitudes when the optical spectrum is available. On the basis of this analysis, we identify WISE J064459.38+603131 and WISE J141046.00+740511.2 as the first two genuine RWBLs, both potentially associated with Fermi sources. Finally, to strengthen our identification of these objects as true RWBLs, we present multifrequency observations for these two candidates to show that their spectral behavior is indeed consistent with that of the BL Lac population.

Preparation of a Ammonia-Treated Lac Dye and Structure Elucidation of Its Main Component.

PubMed

Nishizaki, Yuzo; Ishizuki, Kyoko; Akiyama, Hiroshi; Tada, Atsuko; Sugimoto, Naoki; Sato, Kyoko

2016-01-01

Lac dye and cochineal extract contain laccaic acids and carminic acid as the main pigments, respectively. Both laccaic acids and carminic acid are anthraquinone derivatives. 4-Aminocarminic acid (acid-stable carmine), an illegal colorant, has been detected in several processed foods. 4-Aminocarminic acid is obtained by heating cochineal extract (carminic acid) in ammonia solution. We attempted to prepare ammonia-treated lac dye and to identify the structures of the main pigment components. Ammonia-treated lac dye showed acid stability similar to that of 4-aminocarminic acid. The structures of the main pigments in ammonia-treated lac dye were analyzed using LC/MS. One of the main pigments was isolated and identified as 4-aminolaccaic acid C using various NMR techniques, including 2D-INADEQUATE. These results indicated that ammonia-treatment of lac dye results in the generation of 4-aminolaccaic acids.

Time-dependent inhomogeneous jet models for BL Lac objects

NASA Technical Reports Server (NTRS)

Marlowe, A. T.; Urry, C. M.; George, I. M.

1992-01-01

Relativistic beaming can explain many of the observed properties of BL Lac objects (e.g., rapid variability, high polarization, etc.). In particular, the broadband radio through X-ray spectra are well modeled by synchrotron-self Compton emission from an inhomogeneous relativistic jet. We have done a uniform analysis on several BL Lac objects using a simple but plausible inhomogeneous jet model. For all objects, we found that the assumed power-law distribution of the magnetic field and the electron density can be adjusted to match the observed BL Lac spectrum. While such models are typically unconstrained, consideration of spectral variability strongly restricts the allowed parameters, although to date the sampling has generally been too sparse to constrain the current models effectively. We investigate the time evolution of the inhomogeneous jet model for a simple perturbation propagating along the jet. The implications of this time evolution model and its relevance to observed data are discussed.

Time-dependent inhomogeneous jet models for BL Lac objects

NASA Astrophysics Data System (ADS)

Marlowe, A. T.; Urry, C. M.; George, I. M.

1992-05-01

Relativistic beaming can explain many of the observed properties of BL Lac objects (e.g., rapid variability, high polarization, etc.). In particular, the broadband radio through X-ray spectra are well modeled by synchrotron-self Compton emission from an inhomogeneous relativistic jet. We have done a uniform analysis on several BL Lac objects using a simple but plausible inhomogeneous jet model. For all objects, we found that the assumed power-law distribution of the magnetic field and the electron density can be adjusted to match the observed BL Lac spectrum. While such models are typically unconstrained, consideration of spectral variability strongly restricts the allowed parameters, although to date the sampling has generally been too sparse to constrain the current models effectively. We investigate the time evolution of the inhomogeneous jet model for a simple perturbation propagating along the jet. The implications of this time evolution model and its relevance to observed data are discussed.

Tunable Control of an Escherichia coli Expression System for the Overproduction of Membrane Proteins by Titrated Expression of a Mutant lac Repressor.

PubMed

Kim, Seong Keun; Lee, Dae-Hee; Kim, Oh Cheol; Kim, Jihyun F; Yoon, Sung Ho

2017-09-15

Most inducible expression systems suffer from growth defects, leaky basal induction, and inhomogeneous expression levels within a host cell population. These difficulties are most prominent with the overproduction of membrane proteins that are toxic to host cells. Here, we developed an Escherichia coli inducible expression system for membrane protein production based on titrated expression of a mutant lac repressor (mLacI). Performance of the mLacI inducible system was evaluated in conjunction with commonly used lac operator-based expression vectors using a T7 or tac promoter. Remarkably, expression of a target gene can be titrated by the dose-dependent addition of l-rhamnose, and the expression levels were homogeneous in the cell population. The developed system was successfully applied to overexpress three membrane proteins that were otherwise difficult to produce in E. coli. This gene expression control system can be easily applied to a broad range of existing protein expression systems and should be useful in constructing genetic circuits that require precise output signals.

LAC indicators: an evaluation of progress and list of proposed indicators

Treesearch

Alan E. Watson; David N. Cole

1992-01-01

One of the most critical, and difficult, steps in the Limits of Acceptable Change (LAC) process is the selection of indicators. To help with this step, this paper (I) briefly reviews some desirable characteristics of indicators and (2) lists indicators that have been proposed or adopted in LAC plans. From a comparison of this list of indicators and desirable...

RADIO-WEAK BL LAC OBJECTS IN THE FERMI ERA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Massaro, F.; Marchesini, E. J.; D’Abrusco, R.

2017-01-10

The existence of “radio-weak BL Lac objects” (RWBLs) has been an open question, and has remained unsolved since the discovery that quasars could be radio-quiet or radio-loud. Recently, several groups identified RWBL candidates, mostly found while searching for low-energy counterparts of the unidentified or unassociated gamma-ray sources listed in the Fermi catalogs. Confirming RWBLs is a challenging task since they could be confused with white dwarfs (WDs) or weak emission line quasars (WELQs) when there are not sufficient data to precisely draw their broadband spectral energy distribution, and their classification is mainly based on a featureless optical spectra. Motivated bymore » the recent discovery that Fermi BL Lacs appear to have very peculiar mid-IR emission, we show that it is possible to distinguish between WDs, WELQs, and BL Lacs using the [3.4]–[4.6]–[12] μ m color–color plot built using the WISE magnitudes when the optical spectrum is available. On the basis of this analysis, we identify WISE J064459.38+603131 and WISE J141046.00+740511.2 as the first two genuine RWBLs, both potentially associated with Fermi sources. Finally, to strengthen our identification of these objects as true RWBLs, we present multifrequency observations for these two candidates to show that their spectral behavior is indeed consistent with that of the BL Lac population.« less

Population Dynamics of a Lac(-) Strain of Escherichia Coli during Selection for Lactose Utilization

PubMed Central

Foster, P. L.

1994-01-01

During selection for lactose utilization, Lac(+) revertants of FC40, a Lac(-) strain of Escherichia coli, appear at a high rate. Yet, no Lac(+) revertants appear in the absence of lactose, or in its presence if the cells have another, unfulfilled requirement for growth. This study investigates more fully the population dynamics of FC40 when incubated in the absence of a carbon source or when undergoing selection for lactose utilization. In the absence of a carbon source, the viable cell numbers do not change over 6 days. When incubated in liquid lactose medium, Lac(-) cells do not undergo any measurable increase in numbers or in turbidity for at least 2 days. When FC40 is plated on lactose minimum medium in the presence of scavenger cells, the upper limit to the amount of growth of Lac(-) cells during 5 days is one doubling, and there is no evidence for turnover (i.e., a balance between growth and death). The presence of a minority population that could form microcolonies was not detected. The implications of these results, plus the fact that the appearance of Lac(+) revertants during lactose selection is nearly constant with time, are discussed in reference to several models that have been postulated to account for adaptive mutations. PMID:7828809

Complex genomic rearrangement in CCS-LacZ transgenic mice.

PubMed

Stroud, Dina Myers; Darrow, Bruce J; Kim, Sang Do; Zhang, Jie; Jongbloed, Monique R M; Rentschler, Stacey; Moskowitz, Ivan P G; Seidman, Jonathan; Fishman, Glenn I

2007-02-01

The cardiac conduction system (CCS)-lacZ insertional mouse mutant strain genetically labels the developing and mature CCS. This pattern of expression is presumed to reflect the site of transgene integration rather than regulatory elements within the transgene proper. We sought to characterize the genomic structure of the integration locus and identify nearby gene(s) that might potentially confer the observed CCS-specific transcription. We found rearrangement of chromosome 7 between regions D1 and E1 with altered transcription of multiple genes in the D1 region. Several lines of evidence suggested that regulatory elements from at least one gene, Slco3A1, influenced CCS-restricted reporter gene expression. In embryonic hearts, Slco3A1 was expressed in a spatial pattern similar to the CCS-lacZ transgene and was similarly neuregulin-responsive. At later stages, however, expression patterns of the transgene and Slco3A1 diverged, suggesting that the Slco3A1 locus may be necessary, but not sufficient to confer CCS-specific transgene expression in the CCS-lacZ line. (c) 2007 Wiley-Liss, Inc.

Aflatoxin B₁ and M₁ Degradation by Lac2 from Pleurotus pulmonarius and Redox Mediators.

PubMed

Loi, Martina; Fanelli, Francesca; Zucca, Paolo; Liuzzi, Vania C; Quintieri, Laura; Cimmarusti, Maria T; Monaci, Linda; Haidukowski, Miriam; Logrieco, Antonio F; Sanjust, Enrico; Mulè, Giuseppina

2016-08-23

Laccases (LCs) are multicopper oxidases that find application as versatile biocatalysts for the green bioremediation of environmental pollutants and xenobiotics. In this study we elucidate the degrading activity of Lac2 pure enzyme form Pleurotus pulmonarius towards aflatoxin B₁ (AFB₁) and M₁ (AFM₁). LC enzyme was purified using three chromatographic steps and identified as Lac2 through zymogram and LC-MS/MS. The degradation assays were performed in vitro at 25 °C for 72 h in buffer solution. AFB₁ degradation by Lac2 direct oxidation was 23%. Toxin degradation was also investigated in the presence of three redox mediators, (2,2'-azino-bis-[3-ethylbenzothiazoline-6-sulfonic acid]) (ABTS) and two naturally-occurring phenols, acetosyringone (AS) and syringaldehyde (SA). The direct effect of the enzyme and the mediated action of Lac2 with redox mediators univocally proved the correlation between Lac2 activity and aflatoxins degradation. The degradation of AFB₁ was enhanced by the addition of all mediators at 10 mM, with AS being the most effective (90% of degradation). AFM₁ was completely degraded by Lac2 with all mediators at 10 mM. The novelty of this study relies on the identification of a pure enzyme as capable of degrading AFB₁ and, for the first time, AFM₁, and on the evidence that the mechanism of an effective degradation occurs via the mediation of natural phenolic compounds. These results opened new perspective for Lac2 application in the food and feed supply chains as a biotransforming agent of AFB₁ and AFM₁.

Single-molecule manipulation reveals supercoiling-dependent modulation of lac repressor-mediated DNA looping

PubMed Central

Normanno, Davide; Vanzi, Francesco; Pavone, Francesco Saverio

2008-01-01

Gene expression regulation is a fundamental biological process which deploys specific sets of genomic information depending on physiological or environmental conditions. Several transcription factors (including lac repressor, LacI) are present in the cell at very low copy number and increase their local concentration by binding to multiple sites on DNA and looping the intervening sequence. In this work, we employ single-molecule manipulation to experimentally address the role of DNA supercoiling in the dynamics and stability of LacI-mediated DNA looping. We performed measurements over a range of degrees of supercoiling between −0.026 and +0.026, in the absence of axial stretching forces. A supercoiling-dependent modulation of the lifetimes of both the looped and unlooped states was observed. Our experiments also provide evidence for multiple structural conformations of the LacI–DNA complex, depending on torsional constraints. The supercoiling-dependent modulation demonstrated here adds an important element to the model of the lac operon. In fact, the complex network of proteins acting on the DNA in a living cell constantly modifies its topological and mechanical properties: our observations demonstrate the possibility of establishing a signaling pathway from factors affecting DNA supercoiling to transcription factors responsible for the regulation of specific sets of genes. PMID:18310101

Poly-LacNAc as an Age-Specific Ligand for Rotavirus P[11] in Neonates and Infants

PubMed Central

Liu, Yang; Huang, Pengwei; Jiang, Baoming; Tan, Ming; Morrow, Ardythe L.; Jiang, Xi

2013-01-01

Rotavirus (RV) P[11] is an unique genotype that infects neonates. The mechanism of such age-specific host restriction remains unknown. In this study, we explored host mucosal glycans as a potential age-specific factor for attachment of P[11] RVs. Using in vitro binding assays, we demonstrated that VP8* of a P[11] RV (N155) could bind saliva of infants (60.3%, N = 151) but not of adults (0%, N = 48), with a significantly negative correlation between binding of VP8* and ages of infants (P<0.01). Recognition to the infant saliva did not correlate with the ABO, secretor and Lewis histo-blood group antigens (HBGAs) but with the binding of the lectin Lycopersicon esculentum (LEA) that is known to recognize the oligomers of N-acetyllactosamine (LacNAc), a precursor of human HBGAs. Direct evidence of LacNAc involvement in P[11] binding was obtained from specific binding of VP8* with homopolymers of LacNAc in variable lengths through a glycan array analysis of 611 glycans. These results were confirmed by strong binding of VP8* to the Lec2 cell line that expresses LacNAc oligomers but not to the Lec8 cell line lacking the LacNAc. In addition, N155 VP8* and authentic P[11] RVs (human 116E and bovine B223) hemagglutinated human red blood cells that are known to express poly-LacNAc. The potential role of poly-LacNAc in host attachment and infection of RVs has been obtained by abrogation of 116E replication by the PAA-conjugated poly-LacNAc, human milk, and LEA positive infant saliva. Overall, our results suggested that the poly-LacNAc could serve as an age-specific receptor for P[11] RVs and well explained the epidemiology that P[11] RVs mainly infect neonates and young children. PMID:24244290

Program Evaluation of Community College Learning Assistance Centers: What Do LAC Directors Think?

ERIC Educational Resources Information Center

Franklin, Doug; Blankenberger, Bob

2016-01-01

Objective: This study seeks to determine the nature of current program evaluation practices for learning assistance centers (LACs), the practices being used for program evaluation, and whether LAC directors believe their practices are appropriate for evaluating program effectiveness. Method: We conducted a survey (n = 61) of community college LAC…

VizieR Online Data Catalog: The CLASS BL Lac sample (Marcha+, 2013)

NASA Astrophysics Data System (ADS)

Marcha, M. J. M.; Caccianiga, A.

2014-04-01

This paper presents a new sample of BL Lac objects selected from a deep (30mJy) radio survey of flat spectrum radio sources (the CLASS blazar survey). The sample is one of the largest well-defined samples in the low-power regime with a total of 130 sources of which 55 satisfy the 'classical' optical BL Lac selection criteria, and the rest have indistinguishable radio properties. The primary goal of this study is to establish the radio luminosity function (RLF) on firm statistical ground at low radio luminosities where previous samples have not been able to investigate. The gain of taking a peek at lower powers is the possibility to search for the flattening of the luminosity function which is a feature predicted by the beaming model but which has remained elusive to observational confirmation. In this study, we extend for the first time the BL Lac RLF down to very low radio powers ~1022W/Hz, i.e. two orders of magnitude below the RLF currently available in the literature. In the process, we confirm the importance of adopting a broader, and more physically meaningful set of classification criteria to avoid the systematic missing of low-luminosity BL Lacs. Thanks to the good statistics we confirm the existence of weak but significant positive cosmological evolution for the BL Lac population, and we detect, for the first time the flattening of the RLF at L~1025W/Hz in agreement with the predictions of the beaming model. (1 data file).

Development of enzymatically-active bacterial cellulose membranes through stable immobilization of an engineered β-galactosidase.

PubMed

Estevinho, Berta N; Samaniego, Nuria; Talens-Perales, David; Fabra, Maria José; López-Rubio, Amparo; Polaina, Julio; Marín-Navarro, Julia

2018-08-01

Enzymatically-active bacterial cellulose (BC) was prepared by non-covalent immobilization of a hybrid enzyme composed by a β-galactosidase from Thermotoga maritima (TmLac) and a carbohydrate binding module (CBM2) from Pyrococcus furiosus. TmLac-CBM2 protein was bound to BC, with higher affinity at pH 6.5 than at pH 8.5 and with high specificity compared to the non-engineered enzyme. Both hydrated (HBC) and freeze-dried (DBC) bacterial cellulose showed equivalent enzyme binding efficiencies. Initial reaction rate of HBC-bound enzyme was higher than DBC-bound and both of them were lower than the free enzyme. However, enzyme performance was similar in all three cases for the hydrolysis of 5% lactose to a high extent. Reuse of the immobilized enzyme was limited by the stability of the β-galactosidase module, whereas the CBM2 module provided stable attachment of the hybrid enzyme to the BC support, after long incubation periods (3 h) at 75 °C. Copyright © 2018 Elsevier B.V. All rights reserved.

Period Variations of the Eclipsing Binary Systems T LMi and VX Lac

NASA Astrophysics Data System (ADS)

Yılmaz, M.; İzci, D. D.; Gümüş, D.; Özavci, İ.; Selam, S. O.

2015-07-01

We present a period analysis of the two Algol-type eclipsing binary systems T LMi and VX Lac using all available times of minimum in the literature, as well as new minima obtained at the Ankara University Kreiken Observatory. The period analysis of T LMi suggests mass transfer between the components and also a third body that is dynamically bound to the binary system. The analysis of VX Lac also suggests mass transfer between the components, and the presence of a third and a fourth body under the assumption of a Light-Time Effect. In addition, the periodic variation of VX Lac was examined under the hypothesis of magnetic activity, and the corresponding parameters were derived. We report here the orbital parameters for both systems, along with the ones related to mass transfer, and those for the third and fourth bodies.

Lactosylated Gramicidin-based lipid nanoparticles (Lac-GLN) for targeted delivery of anti-miR-155 to hepatocellular carcinoma

PubMed Central

Zhang, Mengzi; Zhou, Xiaoju; Wang, Bo; Yung, Bryant C.; Lee, Ly J.; Ghoshal, Kalpana; Lee, Robert J.

2013-01-01

Lactosylated gramicidin-containing lipid nanoparticles (Lac-GLN) were developed for delivery of anti-microRNA-155 (anti-miR-155) to hepatocellular carcinoma (HCC) cells. MiR-155 is an oncomiR frequently elevated in HCC. The Lac-GLN formulation contained N-lactobionyl-dioleoyl phosphatidylethanolamine (Lac-DOPE), a ligand for the asialoglycoprotein receptor (ASGR), and an antibiotic peptide gramicidin A. The nanoparticles exhibited a mean particle diameter of 73 nm, zeta potential of +3.5 mV, anti-miR encapsulation efficiency of 88%, and excellent colloidal stability at 4°C. Lac-GLN effectively delivered anti-miR-155 to HCC cells with a 16.1- and 4.1-fold up-regulation of miR-155 targets C/EBPβ and FOXP3 genes, respectively, and exhibited significant greater efficiency over Lipofectamine 2000. In mice, intravenous injection of Lac-GLN containing Cy3-anti-miR-155 led to preferential accumulation of the anti-miR-155 in hepatocytes. Intravenous administration of 1.5 mg/kg anti-miR-155 loaded Lac-GLN resulted in up-regulation of C/EBPβ and FOXP3 by 6.9- and 2.2- fold, respectively. These results suggest potential application of Lac-GLN as a liver-specific delivery vehicle for anti-miR therapy. PMID:23567045

High density growth of T7 expression strains with auto-induction option

DOEpatents

Studier, F. William

2010-07-20

A bacterial growth medium for promoting auto-induction of transcription of cloned DNA in cultures of bacterial cells grown batchwise is disclosed. The transcription is under the control of a lac repressor. Also disclosed is a bacterial growth medium for improving the production of a selenomethionine-containing protein or polypeptide in a bacterial cell, the protein or polypeptide being produced by recombinant DNA techniques from a lac or T7lac promoter, the bacterial cell encoding a vitamin B12-dependent homocysteine methylase. Finally, disclosed is a bacterial growth medium for suppressing auto-induction of expression in cultures of bacterial cells grown batchwise, said transcription being under the control of lac repressor.

Aflatoxin B1 and M1 Degradation by Lac2 from Pleurotus pulmonarius and Redox Mediators

PubMed Central

Loi, Martina; Fanelli, Francesca; Zucca, Paolo; Liuzzi, Vania C.; Quintieri, Laura; Cimmarusti, Maria T.; Monaci, Linda; Haidukowski, Miriam; Logrieco, Antonio F.; Sanjust, Enrico; Mulè, Giuseppina

2016-01-01

Laccases (LCs) are multicopper oxidases that find application as versatile biocatalysts for the green bioremediation of environmental pollutants and xenobiotics. In this study we elucidate the degrading activity of Lac2 pure enzyme form Pleurotus pulmonarius towards aflatoxin B1 (AFB1) and M1 (AFM1). LC enzyme was purified using three chromatographic steps and identified as Lac2 through zymogram and LC-MS/MS. The degradation assays were performed in vitro at 25 °C for 72 h in buffer solution. AFB1 degradation by Lac2 direct oxidation was 23%. Toxin degradation was also investigated in the presence of three redox mediators, (2,2′-azino-bis-[3-ethylbenzothiazoline-6-sulfonic acid]) (ABTS) and two naturally-occurring phenols, acetosyringone (AS) and syringaldehyde (SA). The direct effect of the enzyme and the mediated action of Lac2 with redox mediators univocally proved the correlation between Lac2 activity and aflatoxins degradation. The degradation of AFB1 was enhanced by the addition of all mediators at 10 mM, with AS being the most effective (90% of degradation). AFM1 was completely degraded by Lac2 with all mediators at 10 mM. The novelty of this study relies on the identification of a pure enzyme as capable of degrading AFB1 and, for the first time, AFM1, and on the evidence that the mechanism of an effective degradation occurs via the mediation of natural phenolic compounds. These results opened new perspective for Lac2 application in the food and feed supply chains as a biotransforming agent of AFB1 and AFM1. PMID:27563923

A new regulatory mechanism for bacterial lipoic acid synthesis

PubMed Central

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-01

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

A new regulatory mechanism for bacterial lipoic acid synthesis.

PubMed

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-22

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

STRUCTURED JETS IN BL LAC OBJECTS: EFFICIENT PeV NEUTRINO FACTORIES?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tavecchio, Fabrizio; Ghisellini, Gabriele; Guetta, Dafne

2014-09-20

The origin of high-energy neutrinos (0.1–1 PeV range) detected by IceCube remains a mystery. In this work, we explore the possibility that efficient neutrino production can occur in structured jets of BL Lac objects, characterized by a fast inner spine surrounded by a slower layer. This scenario has been widely discussed in the framework of the high-energy emission models for BL Lac objects and radio galaxies. One of the relevant consequences of a velocity structure is the enhancement of the inverse Compton emission caused by the radiative coupling of the two zones. We show that a similar boosting could occurmore » for the neutrino output of the spine through the photo-meson reaction of high-energy protons scattering off the amplified soft target photon field of the layer. Assuming the local density and the cosmological evolution of γ-ray BL Lac object derived from Fermi Large Area Telescope data, we calculate the expected diffuse neutrino intensity, which can match the IceCube data for a reasonable choice of parameters.« less

Repressor-mediated tissue-specific gene expression in plants

DOEpatents

Meagher, Richard B [Athens, GA; Balish, Rebecca S [Oxford, OH; Tehryung, Kim [Athens, GA; McKinney, Elizabeth C [Athens, GA

2009-02-17

Plant tissue specific gene expression by way of repressor-operator complexes, has enabled outcomes including, without limitation, male sterility and engineered plants having root-specific gene expression of relevant proteins to clean environmental pollutants from soil and water. A mercury hyperaccumulation strategy requires that mercuric ion reductase coding sequence is strongly expressed. The actin promoter vector, A2pot, engineered to contain bacterial lac operator sequences, directed strong expression in all plant vegetative organs and tissues. In contrast, the expression from the A2pot construct was restricted primarily to root tissues when a modified bacterial repressor (LacIn) was coexpressed from the light-regulated rubisco small subunit promoter in above-ground tissues. Also provided are analogous repressor operator complexes for selective expression in other plant tissues, for example, to produce male sterile plants.

Interplay of protein and DNA structure revealed in simulations of the lac operon.

PubMed

Czapla, Luke; Grosner, Michael A; Swigon, David; Olson, Wilma K

2013-01-01

The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.

UVB-induced mutagenesis in hairless {lambda}lacZ-transgenic mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frijhoff, A.F.W.; Rebel, H.; Mientjes, E.J.

UVB-induced mutagenesis was studied in hairless 40.6 transgenic mice (Muta{trademark}Mouse), which contain the {lambda}gt1OlacZ shuttle vector as a target for mutagenesis. Mice were exposed at the dorsal side to either single doses of 200, 500, 800, or 1000 J/m{sup 2} UVB or to two successive irradiations of either 200 and 800 J/m{sup 2} UVB, with intervals of 1,3, or 5 days, or to 800 and 200 J/m{sup 2} UVB with a 5-day interval. At 23 days after the last exposure, lacZ mutant frequencies (MF) were determined in the epidermis. The lacZ MF increased linearly with increasing dose of UVB. Themore » mutagenic effect of two successive irradiations appeared to be additive. The UV-induced mutation spectrum was dominated by G:C{r_arrow}A:T transitions at dipyrimidine sites. DNA-sequence analysis of spontaneously mutated phages showed a diverse spectrum consisting of insertions, deletions and G:C {r_arrow} A:T transitions at CpG sites. the results indicate that the hairless {lambda}lacZ-transgenic mouse is a suitable in vivo model for studying UVB-induced mutations. 29 refs., 5 tabs.« less

THE CONTRIBUTION OF FERMI -2LAC BLAZARS TO DIFFUSE TEV–PEV NEUTRINO FLUX

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aartsen, M. G.; Abraham, K.; Ackermann, M.

2017-01-20

The recent discovery of a diffuse cosmic neutrino flux extending up to PeV energies raises the question of which astrophysical sources generate this signal. Blazars are one class of extragalactic sources which may produce such high-energy neutrinos. We present a likelihood analysis searching for cumulative neutrino emission from blazars in the 2nd Fermi -LAT AGN catalog (2LAC) using IceCube neutrino data set 2009-12, which was optimized for the detection of individual sources. In contrast to those in previous searches with IceCube, the populations investigated contain up to hundreds of sources, the largest one being the entire blazar sample in themore » 2LAC catalog. No significant excess is observed, and upper limits for the cumulative flux from these populations are obtained. These constrain the maximum contribution of 2LAC blazars to the observed astrophysical neutrino flux to 27% or less between around 10 TeV and 2 PeV, assuming the equipartition of flavors on Earth and a single power-law spectrum with a spectral index of −2.5. We can still exclude the fact that 2LAC blazars (and their subpopulations) emit more than 50% of the observed neutrinos up to a spectral index as hard as −2.2 in the same energy range. Our result takes into account the fact that the neutrino source count distribution is unknown, and it does not assume strict proportionality of the neutrino flux to the measured 2LAC γ -ray signal for each source. Additionally, we constrain recent models for neutrino emission by blazars.« less

Wind Resource Assessment Report: Mille Lacs Indian Reservation, Minnesota

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jimenez, Antonio C.; Robichaud, Robi

The U.S. Environmental Protection Agency (EPA) launched the RE-Powering America's Land initiative to encourage development of renewable energy on potentially contaminated land and mine sites. EPA collaborated with the U.S. Department of Energy's (DOE's) National Renewable Energy Laboratory (NREL) and the Mille Lacs Band of Chippewa Indians to evaluate the wind resource and examine the feasibility of a wind project at a contaminated site located on the Mille Lacs Indian Reservation in Minnesota. The wind monitoring effort involved the installation of a 60-m met tower and the collection of 18 months of wind data at multiple heights above the ground.more » This report focuses on the wind resource assessment, the estimated energy production of wind turbines, and an assessment of the economic feasibility of a potential wind project sited this site.« less

Development of a new fluorescent reporter:operator system: location of AraC regulated genes in Escherichia coli K-12.

PubMed

Sellars, Laura E; Bryant, Jack A; Sánchez-Romero, María-Antonia; Sánchez-Morán, Eugenio; Busby, Stephen J W; Lee, David J

2017-08-03

In bacteria, many transcription activator and repressor proteins regulate multiple transcription units that are often distally distributed on the bacterial genome. To investigate the subcellular location of DNA bound proteins in the folded bacterial nucleoid, fluorescent reporters have been developed which can be targeted to specific DNA operator sites. Such Fluorescent Reporter-Operator System (FROS) probes consist of a fluorescent protein fused to a DNA binding protein, which binds to an array of DNA operator sites located within the genome. Here we have developed a new FROS probe using the Escherichia coli MalI transcription factor, fused to mCherry fluorescent protein. We have used this in combination with a LacI repressor::GFP protein based FROS probe to assess the cellular location of commonly regulated transcription units that are distal on the Escherichia coli genome. We developed a new DNA binding fluorescent reporter, consisting of the Escherichia coli MalI protein fused to the mCherry fluorescent protein. This was used in combination with a Lac repressor:green fluorescent protein fusion to examine the spatial positioning and possible co-localisation of target genes, regulated by the Escherichia coli AraC protein. We report that induction of gene expression with arabinose does not result in co-localisation of AraC-regulated transcription units. However, measurable repositioning was observed when gene expression was induced at the AraC-regulated promoter controlling expression of the araFGH genes, located close to the DNA replication terminus on the chromosome. Moreover, in dividing cells, arabinose-induced expression at the araFGH locus enhanced chromosome segregation after replication. Regions of the chromosome regulated by AraC do not colocalise, but transcription events can induce movement of chromosome loci in bacteria and our observations suggest a role for gene expression in chromosome segregation.

Bacterial Contamination of Anaesthetic and Vasopressor Drugs in the Operating Theatres

PubMed Central

Rueangchira-Urai, Rongrong; Rujirojindakul, Panthila; Geater, Alan Frederick; McNeil, Edward

2017-01-01

Objective The aim of this study was to determine the incidence of bacterial and fungal contamination in anaesthetic and vasopressor drugs before and after use in operating theatres. Methods A cross-sectional study was conducted in the operating theatres of a university hospital. We collected 945 samples of three different drugs, namely, propofol, vecuronium and ephedrine, from 20 operating rooms and refrigerators where the unused drugs were stored. Each drug was divided into two groups, the pre-use group and the post-use group. The pre-use drugs were cultured before the patient received the drug. The post-use drugs were cultured after the patient had received the drug or after the drugs had been transferred to other syringes. The culture results were reported as either positive or negative. Results Out of the 945 drug samples, 26 (2.8%, 95% confidence interval=1.8%–4.0%) gave a positive culture. Of the 317 propofol samples, 20 (6.3%) were found to have bacterial contamination, 11 in the pre-use group and 9 in the post-use group. Of the 318 ephedrine samples, 6 (1.9%) were found to be positive on culture, one in the pre-use group and five in the post-use group. Vecuronium gave no positive cultures. All organisms were non-pathogenic, and no fungal contamination was found. Conclusion The incidence of bacterial contamination in anaesthetic and vasopressor drugs was 2.8%. Anaesthetic teams must be aware of contamination issues in anaesthetic drugs that have been prepared for later use and, in order to reduce the risk of contamination, they must improve the methods of administering drugs to patients. PMID:28377840

Isolating LacZ-expressing cells from mouse inner ear tissues using flow cytometry.

PubMed

Jan, Taha A; Chai, Renjie; Sayyid, Zahra N; Cheng, Alan G

2011-12-23

Isolation of specific cell types allows one to analyze rare cell populations such as stem/progenitor cells. Such an approach to studying inner ear tissues presents a unique challenge because of the paucity of cells of interest and few transgenic reporter mouse models. Here, we describe a protocol using fluorescence-conjugated probes to selectively label LacZ-positive cells from the neonatal cochleae. The most common underlying pathology of sensorineural hearing loss is the irreversible damage and loss of cochlear sensory hair cells, which are required to transduce sound waves to neural impulses. Recent evidence suggests that the murine auditory and vestibular organs harbor stem/progenitor cells that may have regenerative potential. These findings warrant further investigation, including identifying specific cell types with stem/progenitor cell characteristics. The Wnt signaling pathway has been demonstrated to play a critical role in maintaining stem/progenitor cell populations in several organ systems. We have recently identified Wnt-responsive Axin2-expressing cells in the neonatal cochlea, but their function is largely unknown. To better understand the behavior of these Wnt-responsive cells in vitro, we have developed a method of isolating Axin2-expressing cells from cochleae of Axin2-LacZ reporter mice. Using flow cytometry to isolate Axin2-LacZ positive cells from the neonatal cochleae, we could in turn execute a variety of experiments on live cells to interrogate their behavior as stem/progenitor cells. Here, we describe in detail the steps for the microdissection of neonatal cochlea, dissociation of these tissues, labeling of the LacZ-positive cells using a fluorogenic substrate, and cell sorting. Techniques for dissociating cochleae into single cells and isolating cochlear cells via flow cytometry have been described. We have made modifications to these techniques to establish a novel protocol to isolate LacZ-expressing cells from the neonatal cochlea.

Gtl2lacZ, an insertional mutation on mouse chromosome 12 with parental origin-dependent phenotype.

PubMed

Schuster-Gossler, K; Simon-Chazottes, D; Guenet, J L; Zachgo, J; Gossler, A

1996-01-01

We have produced a transgenic mouse line, Gtl2lacZ (Gene trap locus 2), that carries an insertional mutation with a dominant modified pattern of inheritance:heterozygous Gtl2lacZ mice that inherited the transgene from the father show a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype is strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. On a mixed genetic background this pattern of inheritance was reversible upon transmission of the transgene through the germ line of the opposite sex. On a predominantly 129/Sv genetic background, however, transgene passage through the female germ line modified the transgene effect, such that the penetrance of the mutation was drastically reduced and the phenotype was no longer obvious after subsequent male germ line transmission. Expression of the transgene, however, was neither affected by genetic background nor by parental legacy. Gtl2lacZ maps to mouse Chromosome 12 in a region that displays imprinting effects associated with maternal and paternal disomy. Our results suggest that the transgene insertion in Gtl2lacZ mice affects an endogenous gene(s) required for fetal and postnatal growth and that this gene(s) is predominantly paternally expressed.

Probing BL Lac and Cluster Evolution via a Wide-angle, Deep X-ray Selected Sample

NASA Astrophysics Data System (ADS)

Perlman, E.; Jones, L.; White, N.; Angelini, L.; Giommi, P.; McHardy, I.; Wegner, G.

1994-12-01

The WARPS survey (Wide-Angle ROSAT Pointed Survey) has been constructed from the archive of all public ROSAT PSPC observations, and is a subset of the WGACAT catalog. WARPS will include a complete sample of >= 100 BL Lacs at F_x >= 10(-13) erg s(-1) cm(-2) . A second selection technique will identify ~ 100 clusters at 0.15Lacs are known and the largest complete samples are also small, with 20-50 objects each. Current data shows a discrepancy between XBL (X-ray selected BL Lac) and RBL (Radio-selected BL Lac) evolution, with = 0.304 +/- 0.062 for XBLs but = 0.60 +/- 0.05 for RBLs. Models of the X-ray luminosity function (XLF) are also poorly constrained. WARPS will allow us to compute an accurate XLF, decreasing the error bars above by over a factor of two. We will also test for low-luminosity BL Lacs, whose non-thermal nuclear sources are dim compared to the host galaxy. Browne and Marcha (1993) claim the EMSS missed most of these objects and is incomplete. If their predictions are correct, 20-40% of the BL Lacs we find will fall in this category, enabling us to probe the evolution and internal workings of BL Lacs at lower luminosities than ever before. By removing likely QSOs before optical spectroscopy, WARPS requires only modest amounts of telescope time. It will extend measurement of the cluster XLF both to higher redshifts (z>0.5) and lower luminosities (LX<1x10(44) erg s(-1) ) than previous measurements, confirming or rejecting the 3sigma detection of negative evolution found in the EMSS, and constraining Cold Dark Matter cosmologies. Faint NELGs are a recently discovered major contributor to the X-ray background. They are a mixture of Sy2s, starbursts and galaxies of unknown type. Detailed classification and evolution of their XLF will be determined for the first time.

Louisiana SIP: LAC 33:III Ch. 7 Section 701. Purpose and Information Regarding Standards for PM10, SO2, CO, Atmospheric Oxidants, NOx and Pb; SIP effective 1989-05-08 (LAc49) to 2011-08-03 (LAd34 - Revised)

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch. 7 Section 701. Purpose and Information Regarding Standards for PM10, SO2, CO, Atmospheric Oxidants, NOx and Pb; SIP effective 1989-05-08 (LAc49) to 2011-08-03 (LAd34 - Revised)

X-Ray Spectral Variability Signatures of Flares in BL Lac Objects

NASA Technical Reports Server (NTRS)

Boettcher, Markus; Chiang, James; White, Nicholas E. (Technical Monitor)

2002-01-01

We are presenting a detailed parameter study of the time-dependent electron injection and kinematics and the self-consistent radiation transport in jets of intermediate and low-frequency peaked BL Lac objects. Using a time-dependent, combined synchrotron-self-Compton and external-Compton jet model, we study the influence of variations of several essential model parameters, such as the electron injection compactness, the relative contribution of synchrotron to external soft photons to the soft photon compactness, the electron- injection spectral index, and the details of the time profiles of the electron injection episodes giving rise to flaring activity. In the analysis of our results, we focus on the expected X-ray spectral variability signatures in a region of parameter space particularly well suited to reproduce the broadband spectral energy distributions of intermediate and low-frequency peaked BL Lac objects. We demonstrate that SSC- and external-Compton dominated models for the gamma-ray emission from blazars are producing significantly different signatures in the X-ray variability, in particular in the soft X-ray light curves and the spectral hysteresis at soft X-ray energies, which can be used as a powerful diagnostic to unveil the nature of the high-energy emission from BL Lac objects.

An in vitro bioassay for xenobiotics using the SXR-driven human CYP3A4/lacZ reporter gene.

PubMed

Lee, Mi R; Kim, Yeon J; Hwang, Dae Y; Kang, Tae S; Hwang, Jin H; Lim, Chae H; Kang, Hyung K; Goo, Jun S; Lim, Hwa J; Ahn, Kwang S; Cho, Jung S; Chae, Kap R; Kim, Yong K

2003-01-01

The dose and time effect of nine xenobiotics, including 17beta-estradiol, corticosterone, dexamethasone, progesterone, nifedipine, bisphenol A, rifampicin, methamphetamine, and nicotine were investigated, in vitro, using human steroid and xenobiotics receptor (SXR)-binding sites on the human CYP3A4 promoter, which can enhance the linked lacZ reporter gene transcription. To test this, liver-specific SAP (human serum amyloid P component)-SXR (SAP/SXR) and human CYP3A4 promoter-regulated lacZ (hCYP3A4/lacZ) constructs were transiently transfected into HepG2 and NIH3T3 cells to compare the xenobiotic responsiveness between human and nonhuman cell lines. In the HepG2 cells, rifampicin, followed by corticosterone, nicotine, methamphetamine, and dexamethasone, exhibited enhanced levels of the lacZ transcript, whereas those of bisphenol A and nifedipine were found to be reduced. No significant responses were observed with 17beta-estradiol or progesterone. In addition, 17beta-estradiol and progesterone did not change the levels of the lacZ transcripts in the HepG2 cells, but did induce significant increases in the transcripts of the NIH3T3 cells. Treatment with corticosterone and dexamethasone, which were highly expressed in the HepG2 cells, did not affect the levels of the lacZ transcript in NIH3T3 cells. These results show that lacZ transcripts can be measured, rapidly and reproducibly, using reverse transcriptase-polymerase chain reaction (RT-PCR) based on the expression of the hCYP3A4/lacZ reporter gene, and was mediated by the SXR. Thus, this in vitro reporter gene bioassay is useful for measuring xenobiotic activities, and is a means to a better relevant bioassay, using human cells, human genes and human promoters, in order to get a closer look at actual human exposure.

Characterization of pLAC1, a cryptic plasmid isolated from Lactobacillus acidipiscis and comparative analysis with its related plasmids.

PubMed

Asteri, Ioanna-Areti; Papadimitriou, Konstantinos; Boutou, Effrossyni; Anastasiou, Rania; Pot, Bruno; Vorgias, Constantinos E; Tsakalidou, Effie

2010-07-15

The pLAC1 plasmid of Lactobacillus acidipiscis ACA-DC 1533, a strain isolated from traditional Kopanisti cheese, was characterised. Nucleotide sequence analysis revealed a circular molecule of 3478bp with a G+C content of 37.2%. Ab initio annotation indicated four putative open reading frames (orfs). orf1 and orf4 were found to encode a replication initiation protein (Rep) and a mobilization protein (Mob), respectively. The deduced products of orf2 and orf3 revealed no significant homology to other known proteins. However, in silico examination of the plasmid sequence supported the existence of a novel operon that includes rep, orf2 and orf3 in pLAC1 and that this operon is highly conserved also in plasmids pLB925A02, pSMA23, pLC88 and pC7. RT-PCR experiments allowed us to verify that these three genes are co-transcribed as a single polycistronic mRNA species. Furthermore, phylogenetic analysis of pLAC1 Rep and Mob proteins demonstrated that they may have derived from different plasmid origins, suggesting that pLAC1 is a product of a modular evolution process. Comparative analysis of full length nucleotide sequences of pLAC1 and related Lactobacillus plasmids showed that pLAC1 shares a very similar replication backbone with pLB925A02, pSMA23 and pLC88. In contrast, mob of pLAC1 was almost identical with the respective gene of plasmids pLAB1000, pLB4 and pPB1. These findings lead to the conclusion that pLAC1 acquired mob probably via an ancestral recombination event. Our overall work highlights the importance of characterizing plasmids deriving from non-starter 'wild' isolates in order to better appreciate plasmid divergence and evolution of lactic acid bacteria. 2010 Elsevier B.V. All rights reserved.

Light Curve and Orbital Period Analysis of VX Lac

NASA Astrophysics Data System (ADS)

Yılmaz, M.; Nelson, R. H.; Şenavcı, H. V.; İzci, D.; Özavcı, İ.; Gümüş, D.

2017-04-01

In this study, we performed simultaneously light curve and radial velocity, and also period analyses of the eclipsing binary system VX Lac. Four color (BVRI) light curves of the system were analysed using the W-D code. The results imply that VX Lac is a classic Algol-type binary with a mass ratio of q=0.27, of which the less massive secondary component fills its Roche lobe. The orbital period behaviour of the system was analysed by assuming the light time effect (LITE) from a third body. The O-C analysis yielded a mass transfer rate of dM/dt=1.86×10-8M⊙yr-1 and the minimal mass of the third body to be M3=0.31M⊙. The residuals from mass transfer and the third body were also analysed because another cyclic variation is seen in O-C diagram. This periodic variation was examined under the hypotheses of stellar magnetic activity and fourth body.

New High-z BL Lacs Using the Photometric Method with Swift and SARA

NASA Astrophysics Data System (ADS)

Kaur, A.; Rau, A.; Ajello, M.; Domínguez, A.; Paliya, V. S.; Greiner, J.; Hartmann, D. H.; Schady, P.

2018-06-01

BL Lacertae (BL Lac) objects are prominent members of the third Fermi Large Area Telescope catalog of γ-ray sources. Half of the members of the BL Lac population (∼300) lack redshift measurements, which is due to the absence of lines in their optical spectra, thereby making it difficult to utilize spectroscopic methods. Our photometric dropout technique can be used to establish the redshift for a fraction of these sources. This work employed six filters mounted on the Swift-UVOT and four optical filters on two telescopes, the 0.65 m SARA-CTIO in Chile and 1.0 m SARA-ORM in the Canary Islands, Spain. A sample of 15 sources was extracted from the Swift archival data for which six filter UVOT observations were conducted. By complementing the Swift observations with the SARA ones, we were able to discover two high-redshift sources: 3FGL J1155.4-3417 and 3FGL J1156.7–2250 at z={1.83}-0.13+0.10 and z={1.73}-0.19+0.11, respectively, resulting from the dropouts in the power-law template fits to these data. The discoveries add to the important (26 total) sample of high-redshift BL Lacs. While the sample of high-z BL Lacs is still rather small, these objects do not seem to fit well within known schemes of the blazar population and represent the best probes of the extragalactic background light.

Escherichia coli DNA contamination in AmpliTaq Gold polymerase interferes with TaqMan analysis of lacZ.

PubMed

Koponen, Jonna K; Turunen, Anna-Mari; Ylä-Herttuala, Seppo

2002-03-01

Real-time PCR is a powerful method for the quantification of gene expression in biological samples. This method uses TaqMan chemistry based on the 5' -exonuclease activity of the AmpliTaq Gold DNA polymerase which releases fluorescence from hybridized probes during synthesis of each new PCR product. Many gene therapy studies use lacZ, encoding Escherichia coli beta-galactosidase, as a marker gene. Our results demonstrate that E. coli DNA contamination in AmpliTaq Gold polymerase interferes with TaqMan analysis of lacZ gene expression and decreases sensitivity of the method below the level required for biodistribution and long-term gene expression studies. In biodistribution analyses the contamination can lead to false-negative results by masking low-level lacZ expression in target and ectopic tissues, and false-positive results if sufficient controls are not used. We conclude that, to get reliable TaqMan results with lacZ, adequate controls should be included in each run to rule out contamination from AmpliTaq Gold polymerase.

Mobile laminar air flow screen for additional operating room ventilation: reduction of intraoperative bacterial contamination during total knee arthroplasty.

PubMed

Sossai, D; Dagnino, G; Sanguineti, F; Franchin, F

2011-12-01

Surgical site infections are important complications in orthopedic surgery. A mobile laminar air flow (LAF) screen could represent a useful addition to an operating room (OR) with conventional turbulent air ventilation (12.5 air changes/h), as it could decrease the bacterial count near the operating field. The purpose of this study was to evaluate LAF efficacy at reducing bacterial contamination in the surgical area during 34 total knee arthroplasties (TKAs). The additional unit was used in 17 operations; the LAF was positioned beside the operating table between two of the surgeons, with the air flow directed towards the surgical area (wound). The whole team wore conventional OR clothing and the correct hygiene procedures and rituals were used. Bacterial air contamination (CFU/m(3)) was evaluated in the wound area in 17 operations with the LAF unit and 17 without the LAF unit. The LAF unit reduced the mean bacterial count in the wound area from 23.5 CFU/m(3) without the LAF to 3.5 CFU/m(3) with the LAF (P < 0.0001), which is below the suggested limit for an OR with ultraclean laminar ventilation. There were no significant differences in the mean bacterial count in the instrument table area: 28.6 CFU/m(3) were recorded with the LAF (N = 6) unit and 30.8 CFU/m(3) (N = 6) without the LAF unit (P = 0.631). During six operations with LAF and six without LAF, particle counts were performed and the number of 0.5 μm particles was analyzed. The particle counts decreased significantly when the LAF unit was used (P = 0.003). When a mobile LAF unit was added to the standard OR ventilation, bacterial contamination of the wound area significantly decreased to below the accepted level for an ultraclean OR, preventing SSI infections.

Validation of the LacTek test applied to spiked extracts of tissue samples: determination of performance characteristics.

PubMed

Mitchell, J M; Yee, A J; McNab, W B; Griffiths, M W; McEwen, S A

1999-01-01

LacTek tests are competitive enzyme-linked immunosorbent assays intended for rapid detection of antimicrobial residues in bovine milk. In this study, the LacTek test protocol was modified for use with extracts of bovine tissue to detect beta-lactam, tetracycline, and sulfamethazine residues. Test performance characteristics--precision, accuracy, ruggedness, practicability, and analytical specificity and sensitivity--were investigated. Results suggest that LacTek tests can be easily adapted to detect antimicrobial residues in extracts of lean ground beef. However, positive samples may not contain residues at violative concentrations (i.e., Canadian maximum residue limits), and therefore, additional analysis would be required for final confirmation and quantitation (e.g., chromatography).

Bistability of the lac operon during growth of Escherichia coli on lactose and lactose+glucose.

PubMed

Narang, Atul; Pilyugin, Sergei S

2008-05-01

The lac operon of Escherichia coli can exhibit bistability. Early studies showed that bistability occurs during growth on TMG/succinate and lactose+glucose, but not during growth on lactose. More recently, studies with lacGFP-transfected cells show bistability during growth on TMG/succinate, but not during growth on lactose and lactose+glucose. In the literature, these results are invariably attributed to variations in the destabilizing effect of the positive feedback generated by induction. Specifically, during growth on TMG/succinate, lac induction generates strong positive feedback because the permease stimulates the accumulation of intracellular TMG, which in turn, promotes the synthesis of even more permease. This positive feedback is attenuated during growth on lactose because hydrolysis of intracellular lactose by beta-galactosidase suppresses the stimulatory effect of the permease. It is attenuated even more during growth on lactose + glucose because glucose inhibits the uptake of lactose. But it is clear that the stabilizing effect of dilution also changes dramatically as a function of the medium composition. For instance, during growth on TMG/succinate, the dilution rate of lac permease is proportional to its activity, e, because the specific growth rate is independent of e (it is completely determined by the concentration of succinate). However, during growth on lactose, the dilution rate of the permease is proportional to e2 because the specific growth rate is proportional to the specific lactose uptake rate, which in turn, proportional to e. We show that: (a) This dependence on e2 creates such a strong stabilizing effect that bistability is virtually impossible during growth on lactose, even in the face of the intense positive feedback generated by induction. (b) This stabilizing effect is weakened during growth on lactose+glucose because the specific growth rate on glucose is independent of e, so that the dilution rate once again contains a term that

Volatile compounds of Celta dry-cured 'lacón' as affected by cross-breeding with Duroc and Landrace genotypes.

PubMed

Lorenzo, José M; Fonseca, Sonia

2014-11-01

Dry-cured 'lacón' is a traditional cured meat product made in the north-west of Spain from the pigs' foreleg, with similar manufacturing process to that used in dry-cured ham. The aim of this study was to assess the influence of cross-breeding of Celta pig with Landrace or Duroc breeds on the formation of volatile compounds through the manufacture of 'lacón'. 'Lacón' from the crosses with Duroc presented lower final moisture (534 g kg(-1) ) and higher intra-muscular fat content [144 g kg(-1) dry matter (DM)] than 'lacón' from Celta pure breed (587 g kg(-1) and 36 g kg(-1) DM, respectively). Volatile compounds were extracted by solid-phase microextraction and analysed by gas chromatography-mass spectrometry. Volatile compounds from 'lacón' were affected by cross-breeding. The total amount of volatile compounds significantly (P < 0.001) increased during the manufacturing process, this increase being more marked in samples from the Landrace cross-breed. The most abundant group of flavour compounds at the end of the manufacturing process was esters in the three batches, followed by aldehydes, hydrocarbons and alcohols. The most abundant ester at the end of the process was hexanoic acid methyl ester, while the aldehyde found in a higher amount was hexanal. The profile of volatile compounds was affected by cross-breed, especially at the end of the 'lacón' dry-curing process. © 2014 Society of Chemical Industry.

LUNSORT list of lunar orbiter data by LAC area

NASA Technical Reports Server (NTRS)

Hixon, S.

1976-01-01

Lunar orbiter (missions 1-5) photographic data are listed sequentially according to the number (1 to 147) LAC (Lunar Aeronautical Chart) areas by use of a computer program called LUNSORT. This listing, as well as a similar one from Apollo would simplify the task of identifying images of a given Lunar area. Instructions and sample case are included.

Louisiana SIP: LAC 33:III Ch 23 Subchap B, §2303--Aluminum Plants, §2303 Standards for Horizontal Stud Soderberg Primary Aluminum Plants and Prebake Primary Aluminum Plants; SIP effective 1989-05-08 (LAc49) to 2011-08-03 (LAad34 - Revised)

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch 23 Subchap B, §2303--Aluminum Plants, §2303 Standards for Horizontal Stud Soderberg Primary Aluminum Plants and Prebake Primary Aluminum Plants; SIP effective 1989-05-08 (LAc49) to 2011-08-03 (LAad34 - Revised)

Influence of salt content and processing time on sensory characteristics of cooked "lacón".

PubMed

Purriños, Laura; Bermúdez, Roberto; Temperán, Sara; Franco, Daniel; Carballo, Javier; Lorenzo, José M

2011-04-01

The influence of salt content and processing time on the sensory properties of cooked "lacón" were determined. "Lacón" is a traditional dry-cured and ripened meat product made in the north-west of Spain from the fore leg of the pig, following a similar process to that of dry-cured ham. Six batches of "lacón" were salted with different amounts of salt (LS (3 days of salting), MS (4 days of salting) and HS (5 days of salting)) and ripened during two times (56 and 84 days of dry-ripening). Cured odour in all batches studied, red colour and rancid odour in MS and HS batches, flavour intensity in MS batch and fat yellowness, rancid flavour and hardness in the HS batch were significantly different with respect to the time of processing. Appearance, odour, flavour and texture were not significantly affected by the salt content (P>0.05). However, the saltiness score showed significant differences with respect to the salt levels in all studied batches (56 and 84 days of process). The principal component analysis showed that physicochemical traits were the most important ones concerning the quality of dry-cured "lacón" and offered a good separation of the mean samples according to the dry ripening days and salt level. © 2010 The American Meat Science Association. Published by Elsevier Ltd. All rights reserved.

Constraining the red shifts of TeV BL Lac objects

NASA Astrophysics Data System (ADS)

Qin, Longhua; Wang, Jiancheng; Yan, Dahai; Yang, Chuyuan; Yuan, Zunli; Zhou, Ming

2018-01-01

We present a model-dependent method to estimate the red shifts of three TeV BL Lac objects (BL Lacs) through fitting their (quasi-)simultaneous multi-waveband spectral energy distributions (SEDs) with a one-zone leptonic synchrotron self-Compton model. Considering the impact of electron energy distributions (EEDs) on the results, we use three types of EEDs to fit the SEDs: a power-law EED with exponential cut-off (PLC), a log-parabola (PLLP) EED and the broken power-law (BPL) EED. We also use a parameter α to describe the uncertainties of the extragalactic background light models, as in Abdo et al. We then use a Markov chain Monte Carlo method to explore the multi-dimensional parameter space and obtain the uncertainties of the model parameters based on the observational data. We apply our method to obtain the red shifts of three TeV BL Lac objects in the marginalized 68 per cent confidence, and find that the PLC EED does not fit the SEDs. For 3C66A, the red shift is 0.14-0.31 and 0.16-0.32 in the BPL and PLLP EEDs. For PKS1424+240, the red shift is 0.55-0.68 and 0.55-0.67 in the BPL and PLLP EEDs. For PG1553+113, the red shift is 0.22-0.48 and 0.22-0.39 in the BPL and PLLP EEDs. We also estimate the red shift of PKS1424+240 in the high stage to be 0.46-0.67 in the PLLP EED, roughly consistent with that in the low stage.

Helicobacter pylori β1,3-N-acetylglucosaminyltransferase for versatile synthesis of type 1 and type 2 poly-LacNAcs on N-linked, O-linked and I-antigen glycans

PubMed Central

Peng, Wenjie; Pranskevich, Jennifer; Nycholat, Corwin; Gilbert, Michel; Wakarchuk, Warren; Paulson, James C; Razi, Nahid

2012-01-01

Poly-N-acetyllactosamine extensions on N- and O-linked glycans are increasingly recognized as biologically important structural features, but access to these structures has not been widely available. Here, we report a detailed substrate specificity and catalytic efficiency of the bacterial β3-N-acetylglucosaminyltransferase (β3GlcNAcT) from Helicobacter pylori that can be adapted to the synthesis of a rich diversity of glycans with poly-LacNAc extensions. This glycosyltransferase has surprisingly broad acceptor specificity toward type-1, -2, -3 and -4 galactoside motifs on both linear and branched glycans, found commonly on N-linked, O-linked and I-antigen glycans. This finding enables the production of complex ligands for glycan-binding studies. Although the enzyme shows preferential activity for type 2 (Galβ1-4GlcNAc) acceptors, it is capable of transferring N-acetylglucosamine (GlcNAc) in β1-3 linkage to type-1 (Galβ1-3GlcNAc) or type-3/4 (Galβ1-3GalNAcα/β) sequences. Thus, by alternating the use of the H. pylori β3GlcNAcT with galactosyltransferases that make the β1-4 or β1-3 linkages, various N-linked, O-linked and I-antigen acceptors could be elongated with type-2 and type-1 LacNAc repeats. Finally, one-pot incubation of di-LacNAc biantennary N-glycopeptide with the β3GlcNAcT and GalT-1 in the presence of uridine diphosphate (UDP)-GlcNAc and UDP-Gal, yielded products with 15 additional LacNAc units on the precursor, which was seen as a series of sequential ion peaks representing alternative additions of GlcNAc and Gal residues, on matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF MS) analysis. Overall, our data demonstrate a broader substrate specificity for the H. pylori β3GlcNAcT than previously recognized and demonstrate its ability as a potent resource for preparative chemo-enzymatic synthesis of complex glycans. PMID:22786570

Geology and ground-water resources of Fond du Lac County, Wisconsin

USGS Publications Warehouse

Newport, Thomas G.

1962-01-01

The principal water-bearing rocks underlying Fond du Lac County, Wis., are sandstones of Cambrian and Ordovician age and dolomite of Silurian age. Other aquifers include dolomite of Ordovician age and sand. and gravel of Quaternary age. Crystalline rocks of Precambrian age, which underlie all the water-bearing formations, form a practically impermeable basement complex and yield little or no water to wells. Ground water is the source of all public and most private and industrial water supplies in the county. The municipalities and industries obtain water chiefly from wells that penetrate the sandstones of Cambrian and Ordorician age. The Platteville formation and Galena dolomite of Ordovician age and the Niagara dolomite of Silurian age supply water to most domestic and stock wells and to a few industrial wells. Several buried valleys in the bedrock surface contain water-bearing deposits of sand and gravel. The source of the ground water in Fond du Lac County is local precipitation. Recharge to the water-bearing beds occurs in most of the county but is greatest where the bedrock formations are near the surface. Ground water is discharged by seeps and springs, by evaporation and transpiration, and by wells. Ground-water levels in wells fluctuate in response to recharge and to natural discharge and pumping. In areas not affected by pumping, water levels generally decline through the summer months because of natural discharge and lack of recharge, recover slightly in the fall after the first killing frost, decline during the winter, and recover in the spring when recharge is greatest. In areas of heavy pumping, the water levels are lowest in late summer and highest in late winter. Water levels in wells in the Fond du Lac area were about 5 to 50 feet above the land surface in 1885, but they had declined to as low as 185 feet below the land surface by 1957. Coefficients of transmissibility and storage of the sandstones of Cambrian and Ordovician age were determined by

Stellar Populations in BL Lac type Objects

NASA Astrophysics Data System (ADS)

Serote Roos, Margarida

The relationship between an Active Galactic Nucleus (AGN) and its host galaxy is a crucial question in the study of galaxy evolution. We present an estimate of the stellar contribution in a sample of low luminosity BL Lac type objects. We have performed stellar population synthesis for a sample of 19 objects selected from Marchã et al. (1996, MNRAS 281, 425). The stellar content is quantified using the equivalent widths of all absorption features available throughout the spectrum. The synthesis is done by a variant of the GPG method (Pelat: 1997, MNRAS 284, 365).

Bacterial diversity and active biomass in full-scale granular activated carbon filters operated at low water temperatures.

PubMed

Kaarela, Outi E; Härkki, Heli A; Palmroth, Marja R T; Tuhkanen, Tuula A

2015-01-01

Granular activated carbon (GAC) filtration enhances the removal of natural organic matter and micropollutants in drinking water treatment. Microbial communities in GAC filters contribute to the removal of the biodegradable part of organic matter, and thus help to control microbial regrowth in the distribution system. Our objectives were to investigate bacterial community dynamics, identify the major bacterial groups, and determine the concentration of active bacterial biomass in full-scale GAC filters treating cold (3.7-9.5°C), physicochemically pretreated, and ozonated lake water. Three sampling rounds were conducted to study six GAC filters of different operation times and flow modes in winter, spring, and summer. Total organic carbon results indicated that both the first-step and second-step filters contributed to the removal of organic matter. Length heterogeneity analysis of amplified 16S rRNA genes illustrated that bacterial communities were diverse and considerably stable over time. α-Proteobacteria, β-Proteobacteria, and Nitrospira dominated in all of the GAC filters, although the relative proportion of dominant phylogenetic groups in individual filters differed. The active bacterial biomass accumulation, measured as adenosine triphosphate, was limited due to low temperature, low flux of nutrients, and frequent backwashing. The concentration of active bacterial biomass was not affected by the moderate seasonal temperature variation. In summary, the results provided an insight into the biological component of GAC filtration in cold water temperatures and the operational parameters affecting it.

Analysis and Remediation of the 2013 LAC-MÉGANTIC Train Derailment

NASA Astrophysics Data System (ADS)

Brunke, Suzanne; Aubé, Guy; Legaré, Serge; Auger, Claude

2016-06-01

On July 6, 2013 a train owned by Montréal, Maine & Atlantic Railway (MMA) Company derailed in Lac-Mégantic, Quebec, Canada triggering the explosion of the tankers carrying crude oil. Several buildings in the downtown core were destroyed. The Sûreté du Québec confirmed the death of 47 people in the disaster. Through the Canadian Space Agency (CSA) Rapid Information Products and Services (RIPS) program, MDA developed value-added products that allowed stakeholders and all levels of government (municipal, provincial and federal) to get an accurate picture of the disaster. The goal of this RIPS Project was to identify the contribution that remote sensing technology can provide to disasters such as the train derailment and explosion at Lac-Mégantic through response and remediation monitoring. Through monitoring and analysis, the Lac-Mégantic train derailment response and remediation demonstrated how Earth observation data can be used for situational awareness in a disaster and in documenting the remediation process. Both high resolution optical and RADARSAT-2 SAR image products were acquired and analyzed over the disaster remediation period as each had a role in monitoring. High resolution optical imagery provided a very clear picture of the current state of remediation efforts, however it can be difficult to acquire due to cloud cover and weather conditions. The RADARSAT-2 SAR images can be acquired in all weather conditions at any time of day making it ideal for mission critical information gathering. MDA's automated change detection processing enabled rapid delivery of advanced information products.

Photometric Redshifts of High-z BL Lacs from 3FGL Catalog

NASA Astrophysics Data System (ADS)

Kaur, A.; Rau, Arne; Ajello, Marco; Paliya, Vaidehi; Hartmann, Dieter; Greiner, Jochen; Bolmer, Jan; Schady, Patricia

2017-08-01

Determining redshifts for BL Lacertae (BL Lac) objects using the traditional spectroscopic method is challenging due to the absence of strong emission lines in their optical spectra. We employ the photometric dropout technique to determine redshifts for this class of blazars using the combined 13 broad-band filters from Swift-UVOT and the multi-channel imager GROND at the MPG 2.2 m telescope at ESO's La Silla Observatory. The wavelength range covered by these 13 filters extends from far ultraviolet to the near-Infrared. We report results on 40 new Fermi detected BL Lacs with the photometric redshifts determinations for 5 sources, with 3FGL J1918.2-4110 being the most distance in our sample at z=2.16. Reliable upper limits are provided for 20 sources in this sample. Using the highest energy photons for these Fermi-LAT sources, we evaluate the consistency with the Gamma-ray horizon due to the extragalactic background light.

Evidence for the pulsational origin of the Long Secondary Periods: The red supergiant star V424 Lac (HD 216946)

NASA Astrophysics Data System (ADS)

Messina, Sergio

2007-10-01

The results of a long-term UBV photometric monitoring of the red supergiant (RSG) star V424 Lac are presented. V424 Lac shows multiperiodic brightness variations which can be attributed to pulsational oscillations. A much longer period ( P = 1601 d), that allows us to classify this star as a long secondary period variable star (LSPV) has been also detected. The B - V and U - B color variations related to the long secondary period (LSP) are similar to those related to the shorter periods, supporting the pulsational nature of LSP. The long period brightness variation of V424 Lac is accompanied by a near-UV (NUV) excess, which was spectroscopically detected in a previous study [Massey, P., Plez, B., Levesque, E.M., et al., 2005. ApJ 634, 1286] and which is now found to be variable from photometry. On the basis of the results found for V424 Lac, the NUV excess recently found in a number of RSGs may be due not solely to circumstellar dust but may also have a contribution from a still undetected LSP variability.

Deposition Mechanism and Microstructure of Laser-Assisted Cold-Sprayed (LACS) Al-12 wt.%Si Coatings: Effects of Laser Power

NASA Astrophysics Data System (ADS)

Olakanmi, E. O.; Tlotleng, M.; Meacock, C.; Pityana, S.; Doyoyo, M.

2013-06-01

Surface treatment is one of the most costly processes for treating metallic components against corrosion. Laser-assisted cold spray (LACS) has an opportunity to decrease those costs particularly in transportation systems, chemical industries, and renewable energy systems. This article highlights some of those potential applications. In the LACS process, a laser beam irradiates the substrate and the particles, thereby softening both of them. Consequently, the particles deform upon impact at the substrate and build up a coating. To circumvent the processing problems associated with cold-spray (CS) deposition of low-temperature, corrosion-resistant Al-12 wt.%Si coatings, a preliminary investigation detailing the effect of laser power on its LACS deposition mechanism and microstructural properties is presented. The deposition efficiency, the microstructure, and the microhardness of the LACS-deposited coatings produced by a 4.4-kW Nd:YAG laser system were evaluated. The outcome of this study shows that pore- and crack-free Al-12 wt.%Si coatings were deposited via softening by laser irradiation and adiabatic shearing phenomena at an optimum laser power of 2.5 kW.

A KPC-scale X-ray jet in the BL LAC Source S5 2007+777

NASA Technical Reports Server (NTRS)

Sambruna, Rita; Maraschi, Laura; Tavecchio, Fabrizio

2008-01-01

The BL Lac S3 2007++777, a classical radio-selected BL Lac from the sample of Stirkel et al. exhibiting an extended (19") radio jet. was observed with Chandra revealing an X-ray jet with simi1ar morphology. The hard X-ray spectrum and broad band SED is consistent with an IC/CMB origin for the X-ray emission, implying a highly relativistic flow at small angle to the line of sight with an unusually large deprojected length, 300 kpc. A structured jet consisting of a fast spine and slow wall is consistent with the observations.

Quantitative approaches to the study of bistability in the lac operon of Escherichia coli.

PubMed

Santillán, Moisés; Mackey, Michael C

2008-08-06

In this paper, the history and importance of the lac operon in the development of molecular and systems biology are briefly reviewed. We start by presenting a description of the regulatory mechanisms in this operon, taking into account the most recent discoveries. Then we offer a survey of the history of the lac operon, including the discovery of its main elements and the subsequent influence on the development of molecular and systems biology. Next the bistable behaviour of the operon is discussed, both with respect to its discovery and its molecular origin. A review of the literature in which this bistable phenomenon has been studied from a mathematical modelling viewpoint is then given. We conclude with some brief remarks.

Louisiana SIP: LAC 33:III Ch 61 Subchap A, §6121 to § 6131--Method 43 - Capture Efficiency Test Procedures; SIP effective 1994-06-06 (LAc60) to to 2011-08-03 (LAd34 - Moved to Chap 21 Subchap N §§ 2155-2160 and revised)

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch 61 Subchap A, §6121 to § 6131--Method 43 - Capture Efficiency Test Procedures; SIP effective 1994-06-06 (LAc60) to to 2011-08-03 (LAd34 - Moved to Chap 21 Subchap N §§ 2155-2160 and revised)

Lac Télé structure, Republic of Congo: Geological setting of a cryptozoological and biodiversity hotspot, and evidence against an impact origin

NASA Astrophysics Data System (ADS)

Master, Sharad

2010-11-01

Lac Télé is a large lake, ˜5.6 km in diameter, with an ovoid shape, situated at 17°10'E, 1°20'N, in the great tropical rain forest region of the Republic of Congo. This lake has attracted widespread attention, mainly because of the legends among the local people that it harbours a strange animal known as the Mokele-Mbembe, but also because it is situated in a region that is a hotbed of biodiversity and conservation efforts with respect to various endangered mammalian species, including gorillas and chimpanzees. Because of its appearance, Lac Télé has been regarded as a possible meteorite impact structure. Various expeditions, studying cryptozoology, conservation ecology, biodiversity, and the impact hypothesis, have visited Lac Télé in the past several decades. The Lac Télé structure is located in the NW part of the intracratonic Congo Basin, in a region dominated by Holocene alluvium, dense tropical rain forest, and swamps which form part of the basin of the Likouala aux Herbes, a multi-branched meandering river flowing over very low gradients into the Sangha river, a major tributary of the Congo river. Previous bathymetric studies have shown that the average depth of Lac Télé is only 4 m, including organic-rich silty sediments. The structure is that of a flat-bottomed dish. Modelling of the Lac Télé as an impact structure indicates a number of features which ought to be present. The absence of any of these features, coupled with the irregular ovoid shape, the palynological record, and the location of the structure at the intersection of major regional lineaments, is regarded as evidence against the impact hypothesis. Lac Télé as an isolated lake ecosystem is not unique in the Congo Basin, and there are several other similar small shallow isolated lakes surrounded by rain forest and marshes, some of which formed by damming of drainage systems by neotectonic faults. It is suggested that the formation of Lac Télé may be related to its location

p53 deficiency alters the yield and spectrum of radiation-induced lacZ mutants in the brain of transgenic mice

NASA Technical Reports Server (NTRS)

Chang, P. Y.; Kanazawa, N.; Lutze-Mann, L.; Winegar, R. A.

2001-01-01

Exposure to heavy particle radiation in the galacto-cosmic environment poses a significant risk in space exploration and the evaluation of radiation-induced genetic damage in tissues, especially in the central nervous system, is an important consideration in long-term manned space missions. We used a plasmid-based transgenic mouse model system, with the pUR288 lacZ transgene integrated in the genome of every cell of C57Bl/6(lacZ) mice, to evaluate the genetic damage induced by iron particle radiation. In order to examine the importance of genetic background on the radiation sensitivity of individuals, we cross-bred p53 wild-type lacZ transgenic mice with p53 nullizygous mice, producing lacZ transgenic mice that were either hemizygous or nullizygous for the p53 tumor suppressor gene. Animals were exposed to an acute dose of 1 Gy of iron particles and the lacZ mutation frequency (MF) in the brain was measured at time intervals from 1 to 16 weeks post-irradiation. Our results suggest that iron particles induced an increase in lacZ MF (2.4-fold increase in p53+/+ mice, 1.3-fold increase in p53+/- mice and 2.1-fold increase in p53-/- mice) and that this induction is both temporally regulated and p53 genotype dependent. Characterization of mutants based on their restriction patterns showed that the majority of the mutants arising spontaneously are derived from point mutations or small deletions in all three genotypes. Radiation induced alterations in the spectrum of deletion mutants and reorganization of the genome, as evidenced by the selection of mutants containing mouse genomic DNA. These observations are unique in that mutations in brain tissue after particle radiation exposure have never before been reported owing to technical limitations in most other mutation assays.

Diseases of captive yellow seahorse Hippocampus kuda Bleeker, pot-bellied seahorse Hippocampus abdominalis Lesson and weedy seadragon Phyllopteryx taeniolatus (Lacépède).

PubMed

LePage, V; Young, J; Dutton, C J; Crawshaw, G; Paré, J A; Kummrow, M; McLelland, D J; Huber, P; Young, K; Russell, S; Al-Hussinee, L; Lumsden, J S

2015-05-01

Seahorses, pipefish and seadragons are fish of the Family Syngnathidae. From 1998 to 2010, 172 syngnathid cases from the Toronto Zoo were submitted for post-mortem diagnostics and retrospectively examined. Among the submitted species were yellow seahorses Hippocampus kuda Bleeker (n=133), pot-bellied seahorses Hippocampus abdominalis Lesson (n=35) and weedy seadragons Phyllopteryx taeniolatus (Lacépède; n=4). The three most common causes of morbidity and mortality in this population were bacterial dermatitis, bilaterally symmetrical myopathy and mycobacteriosis, accounting for 24%, 17% and 15% of cases, respectively. Inflammatory processes were the most common diagnoses, present in 117 cases. Seven neoplasms were diagnosed, environmental aetiologies were identified in 46 cases, and two congenital defects were identified. © 2014 John Wiley & Sons Ltd.

Interlinkages between bacterial populations dynamics and the operational parameters in a moving bed membrane bioreactor treating urban sewage.

PubMed

Reboleiro-Rivas, P; Martín-Pascual, J; Morillo, J A; Juárez-Jiménez, B; Poyatos, J M; Rodelas, B; González-López, J

2016-01-01

Bacteria are key players in biological wastewater treatments (WWTs), thus a firm knowledge of the bacterial population dynamics is crucial to understand environmental/operational factors affecting the efficiency and stability of the biological depuration process. Unfortunately, little is known about the microbial ecology of the advanced biological WWTs combining suspended biomass (SB) and attached biofilms (AB). This study explored in depth the bacterial community structure and population dynamics in each biomass fraction from a pilot-scale moving bed membrane bioreactor (MBMBR) treating municipal sewage, by means of temperature-gradient gel electrophoresis (TGGE) and 454-pyrosequencing. Eight experimental phases were conducted, combining different carrier filling ratios, hydraulic retention times and concentrations of mixed liquor total suspended solids. The bacterial community, dominated by Proteobacteria (20.9-53.8%) and Actinobacteria (20.6-57.6%), was very similar in both biomass fractions and able to maintain its functional stability under all the operating conditions, ensuring a successful and steady depuration process. Multivariate statistical analysis demonstrated that solids concentration, carrier filling ratio, temperature and organic matter concentration in the influent were the significant factors explaining population dynamics. Bacterial diversity increased as carrier filling ratio increased (from 20% to 35%, v/v), and solids concentration was the main factor triggering the shifts of the community structure. These findings provide new insights on the influence of operational parameters on the biology of the innovative MBMBRs. Copyright © 2015 Elsevier Ltd. All rights reserved.

A plasmid-based lacZα gene assay for DNA polymerase fidelity measurement

PubMed Central

Keith, Brian J.; Jozwiakowski, Stanislaw K.; Connolly, Bernard A.

2013-01-01

A significantly improved DNA polymerase fidelity assay, based on a gapped plasmid containing the lacZα reporter gene in a single-stranded region, is described. Nicking at two sites flanking lacZα, and removing the excised strand by thermocycling in the presence of complementary competitor DNA, is used to generate the gap. Simple methods are presented for preparing the single-stranded competitor. The gapped plasmid can be purified, in high amounts and in a very pure state, using benzoylated–naphthoylated DEAE–cellulose, resulting in a low background mutation frequency (∼1 × 10−4). Two key parameters, the number of detectable sites and the expression frequency, necessary for measuring polymerase error rates have been determined. DNA polymerase fidelity is measured by gap filling in vitro, followed by transformation into Escherichia coli and scoring of blue/white colonies and converting the ratio to error rate. Several DNA polymerases have been used to fully validate this straightforward and highly sensitive system. PMID:23098700

Fermi LAT detection of a GeV flare from the BL Lac object PKS 2233-148

NASA Astrophysics Data System (ADS)

Ciprini, Stefano

2012-06-01

The Large Area Telescope (LAT), one of the two instruments on the Fermi Gamma-ray Space Telescope, has observed gamma-ray flaring activity from a source positionally consistent with the BL Lac object PKS 2233-148 (also known as 2FGL J2236.5-1431, Nolan et al. 2012, ApJS, 199, 31, and OY -156) placed at R.A.: 339.1420296 deg, Dec.: -14.5561633 (J2000, Petrov et al. 2008, AJ, 136, 580). No redshift for the source has been measured up to now, demonstrating the BL Lac object character type of this source.

Spectroscopic monitoring of the BL Lac object AO 0235+164

NASA Astrophysics Data System (ADS)

Raiteri, C. M.; Villata, M.; Capetti, A.; Heidt, J.; Arnaboldi, M.; Magazzù, A.

2007-03-01

Aims:Spectroscopic monitoring of BL Lac objects is a difficult task that nonetheless can provide important information on the different components of the active galactic nucleus. Methods: We performed optical spectroscopic monitoring of the BL Lac object AO 0235+164 (z=0.94) with the VLT and TNG telescopes from Aug. 2003 to Dec. 2004, during an extended WEBT campaign. The flux of this source is both contaminated and absorbed by a foreground galactic system at z=0.524, the stars of which can act as gravitational micro-lenses. Results: In this period the object was in an optically faint, though variable state, and a broad Mg II emission line was visible at all epochs. The spectroscopic analysis reveals an overall variation in the Mg II line flux of a factor 1.9, while the corresponding continuum flux density changed by a factor 4.3. Most likely, the photoionising radiation can be identified with the emission component that was earlier recognised to be present as a UV-soft-X-ray bump in the source spectral energy distribution and that is visible in the optical domain only in very faint optical states. We estimate an upper limit to the broad line region (BLR) size of a few light months from the historical minimum brightness level; from this we infer the maximum amplification of the Mg II line predicted by the microlensing scenario. Conclusions: .Unless we have strongly overestimated the size of the BLR, only very massive stars could significantly magnify the broad Mg II emission line, but the time scale of variations due to these (rare) events would be of several years. In contrast, the continuum flux, coming from much smaller emission regions in the jet, could be affected by microlensing from the more plausible MACHO deflectors, with variability time scales of the order of some months. Based on observations collected at the European Southern Observatory, Chile (ESO Programme 71.A-0174), and on observations made with the Italian Telescopio Nazionale Galileo (TNG

Characteristics of the LacTek test as applied to tissue samples: assessment of performance using incurred field samples.

PubMed

Mitchell, J M; McNab, W B; Yee, A J; Griffiths, M W; McEwen, S A; Spilsbury, L; Boison, J O

1998-08-01

The Lactek test, marketed for antimicrobial residue detection in milk, was validated for the detection of antimicrobial residues in tissues. A previous study found that the LacTek test could confidently identify tissue samples spiked with antimicrobial residues. However, the test could not reliably distinguish violative from nonviolative spiked samples relative to Canadian maximum residue limits (MRLs). The objectives of this study were to assess and compare the performance of the LacTek tests for beta-lactams, tetracyclines, gentamicin, and sulfamethazine on samples containing naturally incurred residues by running the test in parallel with the standard microbial inhibition test (MIT) presently used for the routine testing of tissues at our facility and to assess the agreement with high pressure liquid chromatographic (HPLC) determinative methods. Parallel testing with the official MIT found that the Lactek tests could be confidently used for testing tissue samples containing incurred residues. Among 1,008 MIT-positive samples, the LacTek test found that 90% contained beta-lactams and/or tetracyclines. A further 7.3% of violative residues could not be identified to an antimicrobial class. In addition, 9% of samples testing negative on the MIT were found to contain an antimicrobial residue by the LacTek tests. Comparative testing with HPLC methods found that there was very good agreement between the two tests and that most violations were due to penicillin G and oxytetracycline. Although the LacTek test cannot be used to distinguish violative from nonviolative residue levels, it does offer several advantages over the present MIT. These include speed, ease of use, the ability to identify residues to a specific class, and an improved sensitivity at the MRL level for the most commonly found antimicrobials in tissue.

Evaluating the potential of immobilized bacterial consortium for black liquor biodegradation.

PubMed

Paliwal, Rashmi; Uniyal, Shivani; Rai, J P N

2015-05-01

Two indigenous bacterial strains, Bacillus megaterium ETLB-1 (accession no. KC767548) and Pseudomonas plecoglossicida ETLB-3 (accession no. KC767547), isolated from soil contaminated with paper mill effluent, were co-immobilized on corncob cubes to investigate their biodegradation potential against black liquor (BL). Results exhibit conspicuous reduction in color and lignin of BL upto 913.46 Co-Pt and 531.45 mg l(-1), respectively. Reduction in chlorophenols up to 12 mg l(-1) was recorded with highest release of chloride ions, i.e., 1290 mg l(-1). Maximum enzyme activity for lignin peroxidase (LiP), manganese peroxidase (MnP), and laccase (LAC) was recorded as 5.06, 8.13, and 8.23 U ml(-1), respectively, during the treatment. Scanning electron microscopy (SEM) revealed successful immobilization of bacterial strains in porous structures of biomaterial. Gas chromatography/mass spectroscopy (GC/MS) showed formation of certain low molecular weight metabolites such as 4-hydroxy-benzoic acid, 3-hydroxy-4-methoxybenzaldehyde, ferulic acid, and t-cinnamic acid and removal of majority of the compounds (such as teratogenic phthalate derivatives) during the period of treatment. Results demonstrated that the indigenous bacterial consortium possesses excellent decolorization and lignin degradation capability which enables its commercial utilization in effluents treatment system.

Purified reconstituted lac carrier protein from Escherichia coli is fully functional.

PubMed

Viitanen, P; Garcia, M L; Kaback, H R

1984-03-01

Proteoliposomes reconstituted with lac carrier protein purified from the plasma membrane of Escherichia coli catalyze each of the translocation reactions typical of the beta-galactoside transport system (i.e., active transport, counterflow, facilitated influx and efflux) with turnover numbers and apparent Km values comparable to those observed in right-side-out membrane vesicles. Furthermore, detailed kinetic studies show that the reconstituted system exhibits properties analogous to those observed in membrane vesicles. Imposition of a membrane potential (delta psi, interior negative) causes a marked decrease in apparent Km (by a factor of 7 to 10) with a smaller increase in Vmax (approximately equal to 3-fold). At submaximal values of delta psi, the reconstituted carrier exhibits biphasic kinetics, with one component manifesting the kinetic parameters of active transport and the other exhibiting the characteristics of facilitated diffusion. Finally, at low lactose concentrations, the initial velocity of influx varies linearly with the square of the proton electro-chemical gradient. The results provide quantitative support for the contention that a single polypeptide species, the product of the lac y gene, is responsible for each of the transport reactions typical of the beta-galactoside transport system.

Parameters for the Operation of Bacterial Thiosalt Oxidation Ponds

PubMed Central

Silver, M.

1985-01-01

Shake flask and pH-controlled reactor tests were used to determine the mathematical parameters for a mixed-culture bacterial thiosalt treatment pond. Values determined were as follows: Km and Vmax (thiosulfate), 9.83 g/liter and 243.9 mg/liter per h, respectively; Ki (lead), 3.17 mg/liter; Ki (copper), 1.27 mg/liter; Q10 between 10 and 30°C, 1.95. From these parameters, the required bioxidation pond volume and residence time could be calculated. Soluble zinc (0.2 g/liter) and particulate mill products and by-products (0.25 g/liter) were not inhibitory. Correlation with an operating thiosalt biooxidation pond showed the parameters used to be valid for thiosalt concentrations up to at least 2 g/liter, lead concentrations of at least 10 mg/liter, and temperatures of >2°C. PMID:16346885

Deletion of p66Shc in mice increases the frequency of size-change mutations in the lacZ transgene.

PubMed

Beltrami, Elena; Ruggiero, Antonella; Busuttil, Rita; Migliaccio, Enrica; Pelicci, Pier Giuseppe; Vijg, Jan; Giorgio, Marco

2013-04-01

Upon oxidative challenge the genome accumulates adducts and breaks that activate the DNA damage response to repair, arrest, or eliminate the damaged cell. Thus, reactive oxygen species (ROS) generated by endogenous oxygen metabolism are thought to affect mutation frequency. However, few studies determined the mutation frequency when oxidative stress is reduced. To test whether in vivo spontaneous mutation frequency is altered in mice with reduced oxidative stress and cell death rate, we crossed p66Shc knockout (p66KO) mice, characterized by reduced intracellular concentration of ROS and by impaired apoptosis, with a transgenic line harboring multiple copies of the lacZ mutation reporter gene as part of a plasmid that can be recovered from organs into Escherichia coli to measure mutation rate. Liver and small intestine from 2- to 24-month-old, lacZ (p66Shc+/+) and lacZp66KO mice, were investigated revealing no difference in overall mutation frequency but a significant increase in the frequency of size-change mutations in the intestine of lacZp66KO mice. This difference was further increased upon irradiation of mice with X-ray. In addition, we found that knocking down cyclophilin D, a gene that facilitates mitochondrial apoptosis acting downstream of p66Shc, increased the size-change mutation frequency in small intestine. Size-change mutations also accumulated in death-resistant embryonic fibroblasts from lacZp66KO mice treated with H2 O2 . These results indicate that p66Shc plays a role in the accumulation of DNA rearrangements and suggest that p66Shc functions to clear damaged cells rather than affect DNA metabolism. © 2012 The Authors Aging Cell © 2012 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland.

The environment of x ray selected BL Lacs: Host galaxies and galaxy clustering

NASA Technical Reports Server (NTRS)

Wurtz, Ron; Stocke, John T.; Ellingson, Erica; Yee, Howard K. C.

1993-01-01

Using the Canada-France-Hawaii Telescope, we have imaged a complete, flux-limited sample of Einstein Medium Sensitivity Survey BL Lacertae objects in order to study the properties of BL Lac host galaxies and to use quantitative methods to determine the richness of their galaxy cluster environments.

Food-grade host/vector expression system for Lactobacillus casei based on complementation of plasmid-associated phospho-beta-galactosidase gene lacG.

PubMed

Takala, T M; Saris, P E J; Tynkkynen, S S H

2003-01-01

A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.

A micrometre-sized heat engine operating between bacterial reservoirs

NASA Astrophysics Data System (ADS)

Krishnamurthy, Sudeesh; Ghosh, Subho; Chatterji, Dipankar; Ganapathy, Rajesh; Sood, A. K.

2016-12-01

Artificial microscale heat engines are prototypical models to explore the mechanisms of energy transduction in a fluctuation-dominated regime. The heat engines realized so far on this scale have operated between thermal reservoirs, such that stochastic thermodynamics provides a precise framework for quantifying their performance. It remains to be seen whether these concepts readily carry over to situations where the reservoirs are out of equilibrium, a scenario of particular importance to the functioning of synthetic and biological microscale engines and motors. Here, we experimentally realize a micrometre-sized active Stirling engine by periodically cycling a colloidal particle in a time-varying optical potential across bacterial baths characterized by different degrees of activity. We find that the displacement statistics of the trapped particle becomes increasingly non-Gaussian with activity and contributes substantially to the overall power output and the efficiency. Remarkably, even for engines with the same energy input, differences in non-Gaussianity of reservoir noise results in distinct performances. At high activities, the efficiency of our engines surpasses the equilibrium saturation limit of Stirling efficiency, the maximum efficiency of a Stirling engine where the ratio of cold to hot reservoir temperatures is vanishingly small. Our experiments provide fundamental insights into the functioning of micromotors and engines operating out of equilibrium.

Bacterial strain changes during chronic otitis media surgery.

PubMed

Kim, G J; Yoo, S; Han, S; Bu, J; Hong, Y; Kim, D-K

2017-09-01

Cultures obtained from pre-operative middle-ear swabs from patients with chronic otitis media have traditionally been used to guide antibiotic selection. This study investigated changes in the bacterial strains of the middle ear during chronic otitis media surgery. Pre-operative bacterial cultures of otorrhoea, and peri-operative cultures of the granulation tissue in either the middle ear or mastoid cavity, were obtained. Post-operative cultures were selectively obtained when otorrhoea developed after surgery. Bacterial growth was observed in 45.5 per cent of pre-operative cultures, 13.5 per cent of peri-operative cultures and 4.5 per cent of post-operative cultures. Methicillin-resistant Staphylococcus aureus was identified as the most common bacteria in all pre-operative (32.4 per cent), peri-operative (52.4 per cent) and post-operative (71.4 per cent) tests, and the percentage of Methicillin-resistant S aureus increased from the pre- to the post-operative period. The bacterial culture results for post-operative otorrhoea showed low agreement with those for pre-operative or peri-operative culture, and strain re-identification was required.

Transcription of two adjacent carbohydrate utilization gene clusters in Bifidobacterium breve UCC2003 is controlled by LacI- and repressor open reading frame kinase (ROK)-type regulators.

PubMed

O'Connell, Kerry Joan; Motherway, Mary O'Connell; Liedtke, Andrea; Fitzgerald, Gerald F; Paul Ross, R; Stanton, Catherine; Zomer, Aldert; van Sinderen, Douwe

2014-06-01

Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control.

Transcription of Two Adjacent Carbohydrate Utilization Gene Clusters in Bifidobacterium breve UCC2003 Is Controlled by LacI- and Repressor Open Reading Frame Kinase (ROK)-Type Regulators

PubMed Central

O'Connell, Kerry Joan; O'Connell Motherway, Mary; Liedtke, Andrea; Fitzgerald, Gerald F.; Ross, R. Paul; Stanton, Catherine; Zomer, Aldert

2014-01-01

Members of the genus Bifidobacterium are commonly found in the gastrointestinal tracts of mammals, including humans, where their growth is presumed to be dependent on various diet- and/or host-derived carbohydrates. To understand transcriptional control of bifidobacterial carbohydrate metabolism, we investigated two genetic carbohydrate utilization clusters dedicated to the metabolism of raffinose-type sugars and melezitose. Transcriptomic and gene inactivation approaches revealed that the raffinose utilization system is positively regulated by an activator protein, designated RafR. The gene cluster associated with melezitose metabolism was shown to be subject to direct negative control by a LacI-type transcriptional regulator, designated MelR1, in addition to apparent indirect negative control by means of a second LacI-type regulator, MelR2. In silico analysis, DNA-protein interaction, and primer extension studies revealed the MelR1 and MelR2 operator sequences, each of which is positioned just upstream of or overlapping the correspondingly regulated promoter sequences. Similar analyses identified the RafR binding operator sequence located upstream of the rafB promoter. This study indicates that transcriptional control of gene clusters involved in carbohydrate metabolism in bifidobacteria is subject to conserved regulatory systems, representing either positive or negative control. PMID:24705323

Mutational spectra of the lacI transgene isolated from Big Blue{reg_sign} mice exposed to three carcinogenic aromatic amines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Staedtler, F.; Locher, F.; Sreenan, G.

1997-10-01

In order to evaluate the in vivo genotoxic potential of three putative genotoxic mouse liver carcinogens, high doses of 4-chloro-o-phenylenediamine, 2-nitro-p-phenylenediamine and 2, 4-diaminotoluene were tested short term in the Big Blue{reg_sign} transgenic mouse mutation assay. Small statistically significant increases in the lacI mutant frequencies in the liver by factors 1.7 to 2.0 were found. A representative number of 347 lacI mutants isolated from liver tissue of male and female animals were analyses by DNA sequencing. The mutational spectra were examined with the Adams-Skopek algorithm. The spontaneous mutational spectra from untreated male and female animals were similar and consistent withmore » spectral Big Blue{reg_sign} control data stored in the lacI database. Most of the background mutations were located in the 5{prime} portion of the coding region of the lacI gene. Single base substitutions were most prominent. G:C to A:T transitions and G:C to T:A transversions occurred predominatly and were preferentially located at CpG sites. Despite the increases observed in the mutant frequencies of the treated animals, the corresponding mutational spectra did not differ from the controls. However, it is possible that certain classes of point mutations were substantially increased but not detected due to the limited number of sequenced mutants. In two animals treated with 2, 4- diaminotoluene unusually high mutant frequencies and the multiple occurrence of certain mutations in the liver was observed. From one of these animals six lacI mutants isolated from colon tissue were all different. Since 2, 4-diaminotoluene was shown to induce liver cell proliferation these results may reflect clonal expansion of single mutated liver cells.« less

Using the Markov chain Monte Carlo method to study the physical properties of GeV-TeV BL Lac objects

NASA Astrophysics Data System (ADS)

Qin, Longhua; Wang, Jiancheng; Yang, Chuyuan; Yuan, Zunli; Mao, Jirong; Kang, Shiju

2018-01-01

We fit the spectral energy distributions (SEDs) of 46 GeV-TeV BL Lac objects in the frame of leptonic one-zone synchrotron self-Compton (SSC) model and investigate the physical properties of these objects. We use the Markov chain Monte Carlo (MCMC) method to obtain the basic parameters, such as magnetic field (B), the break energy of the relativistic electron distribution (γ ^' }b), and the electron energy spectral index. Based on the modeling results, we support the following scenarios for GeV-TeV BL Lac objects. (1) Some sources have large Doppler factors, implying other radiation mechanism should be considered. (2) Compared with flat spectrum quasars (FSRQs), GeV-TeV BL Lac objects have weaker magnetic fields and larger Doppler factors, which cause the ineffective cooling and shift the SEDs to higher bands. Their jet powers are around 4.0 × 1045 erg s-1, compared with radiation power, 5.0 × 1042 erg s-1, indicating that only a small fraction of jet power is transformed into the emission power. (3) For some BL Lacs with large Doppler factors, their jet components could have two substructures, e.g., the fast core and the slow sheath. For most GeV-TeV BL Lacs, Kelvin-Helmholtz instabilities are suppressed by their higher magnetic fields, leading to micro-variability or intro-day variability in the optical bands. (4) Combined with a sample of FSRQs, an anti-correlation between the peak luminosity, Lpk, and the peak frequency, νpk, is obtained, favoring the blazar sequence scenario. In addition, an anti-correlation between the jet power, Pjet, and the break Lorentz factor, γb, also supports the blazar sequence.

76 FR 78974 - Wisconsin Central Ltd.-Abandonment Exemption-in Fond Du Lac County, WI

Federal Register 2010, 2011, 2012, 2013, 2014

2011-12-20

... DEPARTMENT OF TRANSPORTATION Surface Transportation Board [Docket No. AB 303 (Sub-No. 38X)] Wisconsin Central Ltd.--Abandonment Exemption--in Fond Du Lac County, WI Wisconsin Central Ltd. (WCL) \\1\\ filed a verified notice of exemption under 49 CFR pt. 1152 subpart F--Exempt Abandonments to abandon...

Bacterial community dynamics in long-term operation of a pilot plant using aerobic granular sludge to treat pig slurry.

PubMed

Fra-Vázquez, A; Morales, N; Figueroa, M; Val Del Río, A; Regueiro, L; Campos, J L; Mosquera-Corral, A

2016-09-01

Aerobic granular sludge represents an interesting approach for simultaneous organic matter and nitrogen removal in wastewater treatment plants. However, the information about microbial communities in aerobic granular systems dealing with industrial wastewater like pig slurry is limited. Herein, bacterial diversity and dynamics were assessed in a pilot scale plant using aerobic granular sludge for organic matter and nitrogen elimination from swine slurry during more than 300 days. Results indicated that bacterial composition evolved throughout the operational period from flocculent activated sludge, used as inoculum, to mature aerobic granules. Bacterial diversity increased at the beginning of the granulation process and then declined due to the application of transient organic matter and nitrogen loads. The operational conditions of the pilot plant and the degree of granulation determined the microbial community of the aerobic granules. Brachymonas, Zoogloea and Thauera were attributed with structural function as they are able to produce extracellular polymeric substances to maintain the granular structure. Nitrogen removal was justified by partial nitrification (Nitrosomonas) and denitrification (Thauera and Zoogloea), while Comamonas was identified as the main organic matter oxidizing bacteria. Overall, clear links between bacterial dynamics and composition with process performance were found and will help to predict their biological functions in wastewater ecosystems improving the future control of the process. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:1212-1221, 2016. © 2016 American Institute of Chemical Engineers.

Comparison between S+L- assay and LacZ marker rescue assay for detecting replication-competent gammaretroviruses.

PubMed

Hashimoto-Gotoh, A; Yoshikawa, R; Miyazawa, T

2015-09-01

To avoid contamination of adventitious gammaretroviruses in biological products such as vaccines, it is necessary to check the master seed cells for manufacturing. There are several assays to detect infectious gammaretroviruses. Among these, sarcoma-positive, leukemia-negative (S+L-) assay is a classical infectivity assay, which is often recommended in governmental guidelines. The S+L- cells used in S+L- assay generate unique focus upon the infection of replication-competent gammaretroviruses. Although S+L- assay is well recognized for the detection, their applicability is questionable in some cases. On the other hand, LacZ marker rescue (LMR) assay detects infectious gammaretroviruses by transducing LacZ marker gene to the target cells, which shows lacZ-positive foci if the infectious virus is present. In this study, we compared LMR and S+L- assays for detection of a variety of endogenous and exogenous gammaretroviruses. As results, LMR assay could detect all gammaretroviruses examined. On the other hand, S+L- assay using feline S+L- cells, termed QN10S, could not detect porcine endogenous retrovirus (PERV) subgroups A/B. Further, S+L- mink cells could not detect feline leukemia virus subgroups B in addition to PERV-A/B. These data indicate that LMR assay is better suited to detect wider range of gammaretroviruses. Copyright © 2015 The International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

An emerging population of BL Lacs with extreme properties: towards a class of EBL and cosmic magnetic field probes?

NASA Astrophysics Data System (ADS)

Bonnoli, G.; Tavecchio, F.; Ghisellini, G.; Sbarrato, T.

2015-07-01

High-energy observations of extreme BL Lac objects, such as 1ES 0229+200 or 1ES 0347-121, recently focused interest both for blazar and jet physics and for the implication on the extragalactic background light and intergalactic magnetic field estimate. However, the number of these extreme highly peaked BL Lac objects (EHBL) is still rather small. Aiming at increase their number, we selected a group of EHBL candidates starting from the BL Lac sample of Plotkin et al. (2011), considering those undetected (or only barely detected) by the Large Area Telescope onboard Fermi and characterized by a high X-ray versus radio flux ratio. We assembled the multiwavelength spectral energy distribution of the resulting nine sources, profiting of publicly available archival observations performed by Swift, GALEX, and Fermi satellites, confirming their nature. Through a simple one-zone synchrotron self-Compton model we estimate the expected very high energy flux, finding that in the majority of cases it is within the reach of present generation of Cherenkov arrays or of the forthcoming Cherenkov Telescope Array.

A series of vectors to construct lacZ fusions for the study of gene expression in Schizosaccharomyces pombe.

PubMed

Lafuente, M J; Petit, T; Gancedo, C

1997-12-22

We have constructed a series of plasmids to facilitate the fusion of promoters with or without coding regions of genes of Schizosaccharomyces pombe to the lacZ gene of Escherichia coli. These vectors carry a multiple cloning region in which fission yeast DNA may be inserted in three different reading frames with respect to the coding region of lacZ. The plasmids were constructed with the ura4+ or the his3+ marker of S. pombe. Functionality of the plasmids was tested measuring in parallel the expression of fructose 1,6-bisphosphatase and beta-galactosidase under the control of the fbp1+ promoter in different conditions.

Experimental identification of specificity determinants in the domain linker of a LacI/GalR protein: bioinformatics-based predictions generate true positives and false negatives.

PubMed

Meinhardt, Sarah; Swint-Kruse, Liskin

2008-12-01

In protein families, conserved residues often contribute to a common general function, such as DNA-binding. However, unique attributes for each homolog (e.g. recognition of alternative DNA sequences) must arise from variation in other functionally-important positions. The locations of these "specificity determinant" positions are obscured amongst the background of varied residues that do not make significant contributions to either structure or function. To isolate specificity determinants, a number of bioinformatics algorithms have been developed. When applied to the LacI/GalR family of transcription regulators, several specificity determinants are predicted in the 18 amino acids that link the DNA-binding and regulatory domains. However, results from alternative algorithms are only in partial agreement with each other. Here, we experimentally evaluate these predictions using an engineered repressor comprising the LacI DNA-binding domain, the LacI linker, and the GalR regulatory domain (LLhG). "Wild-type" LLhG has altered DNA specificity and weaker lacO(1) repression compared to LacI or a similar LacI:PurR chimera. Next, predictions of linker specificity determinants were tested, using amino acid substitution and in vivo repression assays to assess functional change. In LLhG, all predicted sites are specificity determinants, as well as three sites not predicted by any algorithm. Strategies are suggested for diminishing the number of false negative predictions. Finally, individual substitutions at LLhG specificity determinants exhibited a broad range of functional changes that are not predicted by bioinformatics algorithms. Results suggest that some variants have altered affinity for DNA, some have altered allosteric response, and some appear to have changed specificity for alternative DNA ligands.

NPDES Permit – East Lake Sewage Lagoon – Mille Lacs Indian Reservation (Aitkin County, MN)

EPA Pesticide Factsheets

EPA proposes to reissue a NPDES permit for the treated wastewater discharges from the East Lake Sewage Lagoon located within the boundaries of the Mille Lacs Indian Reservation located in East Lake (McGregor), Minnesota (Aitkin County) to be issued by EPA.

The LAC Test: A New Look at Auditory Conceptualization and Literacy Development K-12.

ERIC Educational Resources Information Center

Lindamood, Charles; And Others

The Lindamood Auditory Conceptualization (LAC) Test was constructed with the recognition that the process of decoding involves an integration of the auditory, visual, and motor senses. Requiring the manipulation of colored blocks to indicate conceptualization of test patterns spoken by the examiner, subtest 1 entails coding of identity, number,…

Study of the counts, species and characteristics of the yeast population during the manufacture of dry-cured "lacón". Effect of salt level.

PubMed

Purriños, Laura; García Fontán, María C; Carballo, Javier; Lorenzo, José M

2013-05-01

The aim of this work was to study the yeast population during the manufacture of dry-cured "lacón" (a Spanish traditional meat product) and the effect of the salting time. For this study, six batches of "lacón" were manufactured with three different salting times (LS (3 days of salting), MS (4 days of salting) and HS (5 days of salting)). Yeast counts increased significantly (P < 0.001) during the whole process from 2.60 to 6.37 log cfu/g. An increased length of salting time did not affect yeast counts throughout the manufacture of dry-cured "lacón", although the highest yeast counts were obtained from LS batches. A total of 226 isolates were obtained from dry-cured "lacón" during drying-ripening stage, of which 151 were yeasts and were identified at the species level using molecular techniques. The total of 151 identified yeasts belonged to 4 different genera: Debaryomyces, Candida, Cryptococcus and Rhodotorula. Debaryomyces hansenii was the most abundant species isolated throughout the whole process as much in the interior as in the exterior of the pieces of three salt levels of "lacón" studied, while Candida zeylanoides was only isolated from the interior of MS and HS batches and from the exterior of LS and HS groups, but at lesser proportion than D. hansenii. Copyright © 2012. Published by Elsevier Ltd.

Temporal Variation of HCO+ 1_0 Galactic Absorption Lines Toward NRAO 150 and BL Lac

NASA Astrophysics Data System (ADS)

Han, Junghwan; Yun, Youngjoo; Park, Yong-Sun

2017-12-01

We present observations of HCO^+ 1-0 absorption lines toward two extragalactic compact radio sources, NRAO 150 and BL Lac with the Korean VLBI Network in order to investigate their time variation over 20 years by Galactic foreground clouds. It is found that the line shape of -17 km s^{-1} component changed marginally during 1993-1998 period and has remained unaltered thereafter for NRAO 150. Its behavior is different from that of H_2CO 1_{10}-1_{11}, suggesting chemical differentiation on ˜ 20 AU scale, the smallest ever seen. On the other hand, BL Lac exhibits little temporal variation for the HCO^+ and H_2CO lines. Our observation also suggests that Korea VLBI Network performs reliably in the spectrum mode in that the shapes of the new HCO^+ 1-0 spectra are in good agreement with the previous ones to an accuracy of a few percent except the time varying component toward NRAO 150.

Lac-L-TTA, a novel lactose-based amino acid-sugar conjugate for anti-metastatic applications.

PubMed

Roviello, Giovanni N; Iannitti, Roberta; Palumbo, Rosanna; Simonyan, Hayarpi; Vicidomini, Caterina; Roviello, Valentina

2017-08-01

Here we describe the synthesis, chromatographic purification, MS and NMR characterization of a new lactosyl-derivative, i.e. a lactosyl thiophenyl-substituted triazolyl-thione L-alanine (Lac-L-TTA). This amino acid-sugar conjugate was prepared by solution synthesis in analogy to the natural fructosyl-amino acids. Furthermore, we investigated the inhibition of PC-3 prostate cancer cell colony formation by this lactose derivative in comparison with the less polar fructose-based derivative, Fru-L-TTA. This let us to compare the properties of the artificial derivative, object of the present work, with the monosaccharide-based counterpart and to obtain a preliminary information on the influence of polarity on such biological activity. A significantly higher anticancer effect of Lac-L-TTA with respect to the fructose analogue emerged from our study suggesting that the anti-metastatic potential of fructosyl-amino acids can be enhanced by increasing the polarity of the compounds, for example by introducing disaccharide moieties in place of fructose.

Bacterial Community Dynamics in Full-Scale Activated Sludge Bioreactors: Operational and Ecological Factors Driving Community Assembly and Performance

PubMed Central

Valentín-Vargas, Alexis; Toro-Labrador, Gladys; Massol-Deyá, Arturo A.

2012-01-01

The assembling of bacterial communities in conventional activated sludge (CAS) bioreactors was thought, until recently, to be chaotic and mostly unpredictable. Studies done over the last decade have shown that specific, and often, predictable random and non-random factors could be responsible for that process. These studies have also motivated a “structure–function” paradigm that is yet to be resolved. Thus, elucidating the factors that affect community assembly in the bioreactors is necessary for predicting fluctuations in community structure and function. For this study activated sludge samples were collected during a one-year period from two geographically distant CAS bioreactors of different size. Combining community fingerprinting analysis and operational parameters data with a robust statistical analysis, we aimed to identify relevant links between system performance and bacterial community diversity and dynamics. In addition to revealing a significant β-diversity between the bioreactors’ communities, results showed that the largest bioreactor had a less dynamic but more efficient and diverse bacterial community throughout the study. The statistical analysis also suggests that deterministic factors, as opposed to stochastic factors, may have a bigger impact on the community structure in the largest bioreactor. Furthermore, the community seems to rely mainly on mechanisms of resistance and functional redundancy to maintain functional stability. We suggest that the ecological theories behind the Island Biogeography model and the species-area relationship were appropriate to predict the assembly of bacterial communities in these CAS bioreactors. These results are of great importance for engineers and ecologists as they reveal critical aspects of CAS systems that could be applied towards improving bioreactor design and operation. PMID:22880016

77 FR 2774 - Notice of Intent To Prepare a Supplemental Environmental Impact Statement: Fond du Lac...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-01-19

... Fredrichs, Assistant Division Administrator, Federal Highway Administration, Madison, Wisconsin. [FR Doc... capacity improvements to Wisconsin Highway 23 from U.S. Highway 151 to County Highway P in Fond du Lac and Sheboygan Counties, Wisconsin. FOR FURTHER INFORMATION CONTACT: Bethaney Bacher-Gresock, Environmental...

Very high energy observations of the BL Lac objects 3C 66A and OJ 287

NASA Astrophysics Data System (ADS)

Lindner, T.; Hanna, D. S.; Kildea, J.; Ball, J.; Bramel, D. A.; Carson, J.; Covault, C. E.; Driscoll, D.; Fortin, P.; Gingrich, D. M.; Jarvis, A.; Mueller, C.; Mukherjee, R.; Ong, R. A.; Ragan, K.; Scalzo, R. A.; Williams, D. A.; Zweerink, J.

2007-11-01

Using the Solar Tower Atmospheric Cherenkov Effect Experiment (STACEE), we have observed the BL Lac objects 3C 66A and OJ 287. These are members of the class of low-frequency-peaked BL Lac objects (LBLs) and are two of the three LBLs predicted by Costamante and Ghisellini [L. Costamante, G. Ghisellini, Astron. Astrophys. 384 (2002) 56] to be potential sources of very high energy (>100 GeV) gamma-ray emission. The third candidate, BL Lacertae, has recently been detected by the MAGIC collaboration [J. Albert et al., arXiv:astro-ph/0703084v1 (2007)]. Our observations have not produced detections; we calculate a 99% CL upper limit of flux from 3C 66A of 0.15 Crab flux units and from OJ 287 our limit is 0.52 Crab. These limits assume a Crab-like energy spectrum with an effective energy threshold of 185 GeV.

Bacterial burden in the operating room: impact of airflow systems.

PubMed

Hirsch, Tobias; Hubert, Helmine; Fischer, Sebastian; Lahmer, Armin; Lehnhardt, Marcus; Steinau, Hans-Ulrich; Steinstraesser, Lars; Seipp, Hans-Martin

2012-09-01

Wound infections present one of the most prevalent and frequent complications associated with surgical procedures. This study analyzes the impact of currently used ventilation systems in the operating room to reduce bacterial contamination during surgical procedures. Four ventilation systems (window-based ventilation, supported air nozzle canopy, low-turbulence displacement airflow, and low-turbulence displacement airflow with flow stabilizer) were analyzed. Two hundred seventy-seven surgical procedures in 6 operating rooms of 5 different hospitals were analyzed for this study. Window-based ventilation showed the highest intraoperative contamination (13.3 colony-forming units [CFU]/h) followed by supported air nozzle canopy (6.4 CFU/h; P = .001 vs window-based ventilation) and low-turbulence displacement airflow (3.4 and 0.8 CFU/h; P < .001 vs window-based ventilation and supported air nozzle canopy). The highest protection was provided by the low-turbulence displacement airflow with flow stabilizer (0.7 CFU/h), which showed a highly significant difference compared with the best supported air nozzle canopy theatre (3.9 CFU/h; P < .001). Furthermore, this system showed no increase of contamination in prolonged durations of surgical procedures. This study shows that intraoperative contamination can be significantly reduced by the use of adequate ventilation systems. Copyright © 2012 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Mosby, Inc. All rights reserved.

Gains in efficiency and scientific potential of continental climate reconstruction provided by the LRC LacCore Facility, University of Minnesota

NASA Astrophysics Data System (ADS)

Noren, A.; Brady, K.; Myrbo, A.; Ito, E.

2007-12-01

Lacustrine sediment cores comprise an integral archive for the determination of continental paleoclimate, for their potentially high temporal resolution and for their ability to resolve spatial variability in climate across vast sections of the globe. Researchers studying these archives now have a large, nationally-funded, public facility dedicated to the support of their efforts. The LRC LacCore Facility, funded by NSF and the University of Minnesota, provides free or low-cost assistance to any portion of research projects, depending on the specific needs of the project. A large collection of field equipment (site survey equipment, coring devices, boats/platforms, water sampling devices) for nearly any lacustrine setting is available for rental, and Livingstone-type corers and drive rods may be purchased. LacCore staff can accompany field expeditions to operate these devices and curate samples, or provide training prior to device rental. The Facility maintains strong connections to experienced shipping agents and customs brokers, which vastly improves transport and importation of samples. In the lab, high-end instrumentation (e.g., multisensor loggers, high-resolution digital linescan cameras) provides a baseline of fundamental analyses before any sample material is consumed. LacCore staff provide support and training in lithological description, including smear-slide, XRD, and SEM analyses. The LRC botanical macrofossil reference collection is a valuable resource for both core description and detailed macrofossil analysis. Dedicated equipment and space for various subsample analyses streamlines these endeavors; subsamples for several analyses may be submitted for preparation or analysis by Facility technicians for a fee (e.g., carbon and sulfur coulometry, grain size, pollen sample preparation and analysis, charcoal, biogenic silica, LOI, freeze drying). The National Lacustrine Core Repository now curates ~9km of sediment cores from expeditions around the world

The NuSTAR view on Hard-TeV BL Lacs

NASA Astrophysics Data System (ADS)

Costamante, L.; Bonnoli, G.; Tavecchio, F.; Ghisellini, G.; Tagliaferri, G.; Khangulyan, D.

2018-05-01

Hard-TeV BL Lacs are a new type of blazars characterized by a hard intrinsic TeV spectrum, locating the peak of their gamma-ray emission in the spectral energy distribution (SED) above 2-10 TeV. Such high energies are problematic for the Compton emission, using a standard one-zone leptonic model. We study six examples of this new type of BL Lacs in the hard X-ray band with NuSTAR. Together with simultaneous observations with the Neil Gehrels Swift Observatory, we fully constrain the peak of the synchrotron emission in their SED, and test the leptonic synchrotron self-Compton (SSC) model. We confirm the extreme nature of 5 objects also in the synchrotron emission. We do not find evidence of additional emission components in the hard X-ray band. We find that a one-zone SSC model can in principle reproduce the extreme properties of both peaks in the SED, from X-ray up to TeV energies, but at the cost of i) extreme electron energies with very low radiative efficiency, ii) conditions heavily out of equipartition (by 3 to 5 orders of magnitude), and iii) not accounting for the simultaneous UV data, which then should belong to a different emission component, possibly the same as the far-IR (WISE) data. We find evidence of this separation of the UV and X-ray emission in at least two objects. In any case, the TeV electrons must not "see" the UV or lower-energy photons, even if coming from different zones/populations, or the increased radiative cooling would steepen the VHE spectrum.

The NuSTAR view on hard-TeV BL Lacs

NASA Astrophysics Data System (ADS)

Costamante, L.; Bonnoli, G.; Tavecchio, F.; Ghisellini, G.; Tagliaferri, G.; Khangulyan, D.

2018-07-01

Hard-TeV BL Lacs are a new type of blazars characterized by a hard intrinsic TeV spectrum, locating the peak of their gamma-ray emission in the spectral energy distribution (SED) above 2-10 TeV. Such high energies are problematic for the Compton emission, using a standard one-zone leptonic model. We study six examples of this new type of BL Lacs in the hard X-ray band with NuSTAR. Together with simultaneous observations with the Neil Gehrels Swift Observatory, we fully constrain the peak of the synchrotron emission in their SED, and test the leptonic synchrotron self-Compton (SSC) model. We confirm the extreme nature of five objects also in the synchrotron emission. We do not find evidence of additional emission components in the hard X-ray band. We find that a one-zone SSC model can in principle reproduce the extreme properties of both peaks in the SED, from X-ray up to TeV energies, but at the cost of (i) extreme electron energies with very low radiative efficiency, (ii) conditions heavily out of equipartition (by three to five orders of magnitude), and (iii) not accounting for the simultaneous UV data, which then should belong to a different emission component, possibly the same as the far-IR (WISE) data. We find evidence of this separation of the UV and X-ray emission in at least two objects. In any case, the TeV electrons must not `see' the UV or lower energy photons, even if coming from different zones/populations, or the increased radiative cooling would steepen the very high energies spectrum.

An MSC2 Promoter-lacZ Fusion Gene Reveals Zinc-Responsive Changes in Sites of Transcription Initiation That Occur across the Yeast Genome

PubMed Central

Wu, Yi-Hsuan; Taggart, Janet; Song, Pamela Xiyao; MacDiarmid, Colin; Eide, David J.

2016-01-01

The Msc2 and Zrg17 proteins of Saccharomyces cerevisiae form a complex to transport zinc into the endoplasmic reticulum. ZRG17 is transcriptionally induced in zinc-limited cells by the Zap1 transcription factor. In this report, we show that MSC2 mRNA also increases (~1.5 fold) in zinc-limited cells. The MSC2 gene has two in-frame ATG codons at its 5’ end, ATG1 and ATG2; ATG2 is the predicted initiation codon. When the MSC2 promoter was fused at ATG2 to the lacZ gene, we found that unlike the chromosomal gene this reporter showed a 4-fold decrease in lacZ mRNA in zinc-limited cells. Surprisingly, β-galactosidase activity generated by this fusion gene increased ~7 fold during zinc deficiency suggesting the influence of post-transcriptional factors. Transcription of MSC2ATG2-lacZ was found to start upstream of ATG1 in zinc-replete cells. In zinc-limited cells, transcription initiation shifted to sites just upstream of ATG2. From the results of mutational and polysome profile analyses, we propose the following explanation for these effects. In zinc-replete cells, MSC2ATG2-lacZ mRNA with long 5’ UTRs fold into secondary structures that inhibit translation. In zinc-limited cells, transcripts with shorter unstructured 5’ UTRs are generated that are more efficiently translated. Surprisingly, chromosomal MSC2 did not show start site shifts in response to zinc status and only shorter 5’ UTRs were observed. However, the shifts that occur in the MSC2ATG2-lacZ construct led us to identify significant transcription start site changes affecting the expression of ~3% of all genes. Therefore, zinc status can profoundly alter transcription initiation across the yeast genome. PMID:27657924

NMR studies on the structure and dynamics of lac operator DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, S.C.

Nuclear Magnetic Resonance spectroscopy was used to elucidate the relationships between structure, dynamics and function of the gene regulatory sequence corresponding to the lactose operon operator of Escherichia coli. The length of the DNA fragments examined varied from 13 to 36 base pair, containing all or part of the operator sequence. These DNA fragments are either derived genetically or synthesized chemically. Resonances of the imino protons were assigned by one dimensional inter-base pair nuclear Overhauser enhancement (NOE) measurements. Imino proton exchange rates were measured by saturation recovery methods. Results from the kinetic measurements show an interesting dynamic heterogeneity with amore » maximum opening rate centered about a GTG/CAC sequence which correlates with the biological function of the operator DNA. This particular three base pair sequence occurs frequently and often symmetrically in prokaryotic nd eukaryotic DNA sites where one anticipates specific protein interaction for gene regulation. The observed sequence dependent imino proton exchange rate may be a reflection of variation of the local structure of regulatory DNA. The results also indicate that the observed imino proton exchange rates are length dependent.« less

Association between bacterial survival and free chlorine concentration during commercial fresh-cut produce wash operation.

PubMed

Luo, Yaguang; Zhou, Bin; Van Haute, Sam; Nou, Xiangwu; Zhang, Boce; Teng, Zi; Turner, Ellen R; Wang, Qin; Millner, Patricia D

2018-04-01

Determining the minimal effective free chlorine (FC) concentration for preventing pathogen survival and cross-contamination during produce washing is critical for developing science- and risk-based food safety practices. The correlation between dynamic FC concentrations and bacterial survival was investigated during commercial washing of chopped Romaine lettuce, shredded Iceberg lettuce, and diced cabbage as pathogen inoculation study during commercial operation is not feasible. Wash water was sampled every 30 min and assayed for organic loading, FC, and total aerobic mesophilic bacteria after chlorine neutralization. Water turbidity, chemical oxygen demand, and total dissolved solids increased significantly over time, with more rapid increases in diced cabbage water. Combined chlorine increased consistently while FC fluctuated in response to rates of chlorine dosing, product loading, and water replenishment. Total bacterial survival showed a strong correlation with real-time FC concentration. Under approximately 10 mg/L, increasing FC significantly reduced the frequency and population of surviving bacteria detected. Increasing FC further resulted in the reduction of the aerobic plate count to below the detection limit (50 CFU/100 mL), except for a few sporadic positive samples with low cell counts. This study confirms that maintaining at least 10 mg/L FC in wash water strongly reduced the likelihood of bacterial survival and thus potential cross contamination of washed produce. Published by Elsevier Ltd.

GLAST answers about high-energy peaked BL Lacs: double-humped {gamma}-ray peak and extreme accelerators?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Costamante, L.; Aharonian, F.; Khangulyan, D.

2007-07-12

An often overlooked fact is that the MeV-GeV emission from High-energy peaked BL Lacs (HBL) is basically unknown: there are only 3 objects of this type among all EGRET identified blazars with measured spectra. GLAST will be able to measure the spectrum for many of them, in particular TeV-blazars, and surprises are expected. GLAST will tell if the {gamma}-ray peak in some HBL is actually a ''double peak'', as suggested by the comparison of EGRET and HESS data in PKS 2155-304, We also remind and argue that a new class of BL Lacs could exist, where particles are shock-accelerated nearmore » the maximum possible rate, characterized by the synchrotron emission peaking in the GLAST band (100 MeV - few GeV). Such objects could easily have escaped detection or identification so far, and could now be unveiled by GLAST.« less

A hadronic origin for ultra-high-frequency-peaked BL Lac objects

NASA Astrophysics Data System (ADS)

Cerruti, M.; Zech, A.; Boisson, C.; Inoue, S.

2015-03-01

Current Cherenkov telescopes have identified a population of ultra-high-frequency peaked BL Lac objects (UHBLs), also known as extreme blazars, that exhibit exceptionally hard TeV spectra, including 1ES 0229+200, 1ES 0347-121, RGB J0710+591, 1ES 1101-232, and 1ES 1218+304. Although one-zone synchrotron-self-Compton (SSC) models have been generally successful in interpreting the high-energy emission observed in other BL Lac objects, they are problematic for UHBLs, necessitating very large Doppler factors and/or extremely high minimum Lorentz factors of the emitting leptonic population. In this context, we have investigated alternative scenarios where hadronic emission processes are important, using a newly developed (lepto-)hadronic numerical code to systematically explore the physical parameters of the emission region that reproduces the observed spectra while avoiding the extreme values encountered in pure SSC models. Assuming a fixed Doppler factor δ = 30, two principal parameter regimes are identified, where the high-energy emission is due to: (1) proton-synchrotron radiation, with magnetic fields B ˜ 1-100 G and maximum proton energies Ep; max ≲ 1019 eV; and (2) synchrotron emission from p-γ-induced cascades as well as SSC emission from primary leptons, with B ˜ 0.1-1 G and Ep; max ≲ 1017 eV. This can be realized with plausible, sub-Eddington values for the total (kinetic plus magnetic) power of the emitting plasma, in contrast to hadronic interpretations for other blazar classes that often warrant highly super-Eddington values.

Analysis of LAC Observations of Clusters of Galaxies and Supernova Remnants

NASA Technical Reports Server (NTRS)

Hughes, J.

1996-01-01

The following publications are included and serve as the final report: The X-ray Spectrum of Abell 665; Clusters of Galaxies; Ginga Observation of an Oxygen-rich Supernova Remnant; Ginga Observations of the Coma Cluster and Studies of the Spatial Distribution of Iron; A Measurement of the Hubble Constant from the X-ray Properties and the Sunyaev-Zel'dovich Effect of Abell 2218; Non-polytropic Model for the Coma Cluster; and Abundance Gradients in Cooling Flow Clusters: Ginga LAC (Large Area Counter) and Einstein SSS (Solid State Spectrometer) Spectra of A496, A1795, A2142, and A2199.

Structure of LacY with an α-substituted galactoside: Connecting the binding site to the protonation site

PubMed Central

Kumar, Hemant; Finer-Moore, Janet S.; Kaback, H. Ronald; Stroud, Robert M.

2015-01-01

The X-ray crystal structure of a conformationally constrained mutant of the Escherichia coli lactose permease (the LacY double-Trp mutant Gly-46→Trp/Gly-262→Trp) with bound p-nitrophenyl-α-d-galactopyranoside (α-NPG), a high-affinity lactose analog, is described. With the exception of Glu-126 (helix IV), side chains Trp-151 (helix V), Glu-269 (helix VIII), Arg-144 (helix V), His-322 (helix X), and Asn-272 (helix VIII) interact directly with the galactopyranosyl ring of α-NPG to provide specificity, as indicated by biochemical studies and shown directly by X-ray crystallography. In contrast, Phe-20, Met-23, and Phe-27 (helix I) are within van der Waals distance of the benzyl moiety of the analog and thereby increase binding affinity nonspecifically. Thus, the specificity of LacY for sugar is determined solely by side-chain interactions with the galactopyranosyl ring, whereas affinity is increased by nonspecific hydrophobic interactions with the anomeric substituent. PMID:26157133

Residues in the H+ Translocation Site Define the pKa for Sugar Binding to LacY†

PubMed Central

Smirnova, Irina; Kasho, Vladimir; Sugihara, Junichi; Choe, Jun-Yong; Kaback, H. Ronald

2009-01-01

A remarkably high pKa of approximately 10.5 has been determined for sugar-binding affinity to the lactose permease of Escherichia coli (LacY), indicating that, under physiological conditions, substrate binds to fully protonated LacY. We have now systematically tested site-directed replacements for the residues involved in sugar binding, as well as H+ translocation and coupling, in order to determine which residues may be responsible for this alkaline pKa. Mutations in the sugar-binding site (Glu126, Trp151, Glu269) markedly decrease affinity for sugar but do not alter the pKa for binding. In contrast, replacements for residues involved in H+ translocation (Arg302, Tyr236, His322, Asp240, Glu325, Lys319) exhibit pKa values for sugar binding that are either shifted toward neutral pH or independent of pH. Values for the apparent dissociation constant for sugar binding (Kdapp) increase greatly for all mutants except neutral replacements for Glu325 or Lys319, which are characterized by remarkably high affinity sugar binding (i.e., low Kdapp) from pH 5.5 to pH 11. The pH dependence of the on- and off-rate constants for sugar binding measured directly by stopped-flow fluorometry implicates koff as a major factor for the affinity change at alkaline pH and confirms the effects of pH on Kdapp inferred from steady-state fluorometry. These results indicate that the high pKa for sugar binding by wild-type LacY cannot be ascribed to any single amino acid residue but appears to reside within a complex of residues involved in H+ translocation. There is structural evidence for water bound in this complex, and the water could be the site of protonation responsible for the pH dependence of sugar binding. PMID:19689129

An Analysis of Periodic Components in BL Lac Object S5 0716 +714 with MUSIC Method

NASA Astrophysics Data System (ADS)

Tang, J.

2012-01-01

Multiple signal classification (MUSIC) algorithms are introduced to the estimation of the period of variation of BL Lac objects.The principle of MUSIC spectral analysis method and theoretical analysis of the resolution of frequency spectrum using analog signals are included. From a lot of literatures, we have collected a lot of effective observation data of BL Lac object S5 0716 + 714 in V, R, I bands from 1994 to 2008. The light variation periods of S5 0716 +714 are obtained by means of the MUSIC spectral analysis method and periodogram spectral analysis method. There exist two major periods: (3.33±0.08) years and (1.24±0.01) years for all bands. The estimation of the period of variation of the algorithm based on the MUSIC spectral analysis method is compared with that of the algorithm based on the periodogram spectral analysis method. It is a super-resolution algorithm with small data length, and could be used to detect the period of variation of weak signals.

Anisotropy of magnetic susceptibility versus lattice- and shape-preferred orientation in the Lac Tio hemo-ilmenite ore body (Grenville province, Quebec)

NASA Astrophysics Data System (ADS)

Bolle, Olivier; Charlier, Bernard; Bascou, Jérôme; Diot, Hervé; McEnroe, Suzanne A.

2014-08-01

The Lac Tio hemo-ilmenite ore body crops out in the outer portion of the 1.06 Ga Lac Allard anorthosite, a member of the Havre-Saint-Pierre anorthosite suite from the Grenville province of North America. It is made up of ilmenitite (commonly with more than 95% hemo-ilmenite) associated with noritic lithologies and anorthosite. The present study compares the magnetic fabric of the ore body, as deduced from anisotropy of magnetic susceptibility (AMS) measurements, with the crystallographic and shape fabrics, obtained from lattice-preferred orientation (LPO) and shape-preferred orientation (SPO) measurements made using electron backscattered diffraction (EBSD) and 3D image analysis, respectively. Room-temperature hysteresis measurements, thermomagnetic curves and values of the bulk magnetic susceptibility reveal a magnetic mineralogy dominated by a mixed contribution of hemo-ilmenite and magnetite. The hemo-ilmenite grains display a LPO characterized by a strong preferred orientation of the basal (0001) plane of ilmenite along which hematite was exsolved. This LPO and the magnetic fabric fit well (angle between the crystallographic c-axis and the axis of minimum susceptibility ≤ ca. 15° for most samples), and the latter is thus strongly influenced by the hemo-ilmenite magneto-crystalline anisotropy. A magnetite SPO, concordant with the hemo-ilmenite LPO, may also influence and even dominate the magnetic fabric. The rock shape fabric is coaxial with the magnetic fabric that can thus be used to perform detailed structural mapping. Interpretation of the magnetic fabric and field structural data suggests that the Lac Tio ore body would be a sag point at the margin of the Lac Allard anorthosite, deformed by ballooning during the final stage of diapiric emplacement of the anorthosite body.

Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG.

PubMed

Díaz-Hernández, Orlando; Santillán, Moisés

2010-01-01

In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

Bistable Behavior of the Lac Operon in E. Coli When Induced with a Mixture of Lactose and TMG

PubMed Central

Díaz-Hernández, Orlando; Santillán, Moisés

2010-01-01

In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions. PMID:21423364

Extraordinary Activity in the BL Lac Object OJ 287

NASA Astrophysics Data System (ADS)

Hughes, P. A.; Aller, H. D.; Aller, M. F.

We present the results of a wavelet transform analysis of data for the BL Lac object OJ 287 acquired as part of the UMRAO variability program. We find clear evidence for a persistent modulation of the total flux and polarization with period 1.66 years, and for another signal that dominates activity in the 1980s with period 1.12 years. It appears that the longer time scale periodicity is associated with an otherwise quiescent jet, and the shorter time scale activity is associated with the passage of a shock, or shocks. The periodic behavior in polarization exhibits excursions in U which correspond to a direction 45circ from the VLBI jet axis. This behavior suggests a small amplitude, cyclic variation in the flow direction in that part of the flow that dominates cm-wavelength emission.

Characterisation and discrimination of various types of lac resin using gas chromatography mass spectrometry techniques with quaternary ammonium reagents.

PubMed

Sutherland, K; del Río, J C

2014-04-18

A variety of lac resin samples obtained from artists' suppliers, industrial manufacturers, and museum collections were analysed using gas chromatography mass spectrometry (GCMS) and reactive pyrolysis GCMS with quaternary ammonium reagents. These techniques allowed a detailed chemical characterisation of microgram-sized samples, based on the detection and identification of derivatives of the hydroxy aliphatic and cyclic (sesquiterpene) acids that compose the resin. Differences in composition could be related to the nature of the resin, e.g. wax-containing (unrefined), bleached, or aged samples. Furthermore, differences in the relative abundances of aliphatic hydroxyacids appear to be associated with the biological source of the resin. The diagnostic value of newly characterised lac components, including 8-hydroxyacids, is discussed here for the first time. Identification of derivatised components was aided by AMDIS deconvolution software, and discrimination of samples was enhanced by statistical evaluation of data using principal component analysis. The robustness of the analyses, together with the minimal sample size required, make these very powerful approaches for the characterisation of lac resin in museum objects. The value of such analyses for enhancing the understanding of museum collections is illustrated by two case studies of objects in the collection of the Philadelphia Museum of Art: a restorer's varnish on a painting by Luca Signorelli, and a pictorial inlay in an early nineteenth-century High Chest by George Dyer. Copyright © 2014 Elsevier B.V. All rights reserved.

Limits of acceptable change and natural resources planning: when is LAC useful, when is it not?

Treesearch

David N. Cole; Stephen F. McCool

1997-01-01

There are ways to improve the LAC process and its implementational procedures. One significant procedural modification is the addition of a new step. This step — which becomes the first step in the process — involves more explicitly defining goals and desired conditions. For other steps in the process, clarifications of concept and terminology are advanced, as are...

Development of volatile compounds during the manufacture of dry-cured "lacón," a Spanish traditional meat product.

PubMed

Purriños, Laura; Bermúdez, Roberto; Franco, Daniel; Carballo, Javier; Lorenzo, José M

2011-01-01

Volatile compounds were determined throughout the manufacture of dry-cured "lacón," a traditional dry-salted, and ripened meat product made in the north-west of Spain from the foreleg of the pig following a similar process to that of dry-cured ham. Volatiles were extracted by a purge-and-trap method and analyzed by gas chromatographic/mass spectrometry. One hundred and two volatile compounds were identified. In raw material, only 34 volatile compounds were found and at very low levels. The number of volatile compounds increased during processing. The substances identified belonged to several chemical classes: aldehydes (23), alcohols (9), ketones (15), hydrocarbons (37), esters (4), acids (3), furans (4), sulphur compounds (1), chloride compounds (1), and other compounds (4). Results indicated that the most abundant chemical family in flavor at the end of the manufacturing process was aldehydes, followed by hydrocarbons and ketones. Lipids were the most important precursor of flavor compounds of dry-cured "lacón."

An alkaline bacterial laccase for polymerization of natural precursors for hair dye synthesis.

PubMed

Kumar, Deepak; Kumar, Aditya; Sondhi, Sonica; Sharma, Prince; Gupta, Naveen

2018-03-01

In the present study, an extracellular alkali stable laccase (Lac DS) from Bacillus subtilis DS which has pH optima at 8.5 using p -phenylenediamine (PPD) as substrate has been reported. Lac DS retained 70% activity for 4 h at pH 8.5 and 90% activity for 24 h at 55 °C. The enzyme yield was enhanced by optimization of fermentation conditions. A 746-fold increase in yield was observed under optimized conditions using 150 µM MgSO 4 , 1.2% yeast extract, 0.35% tryptone, and 150 µM vanillic acid. Lac DS was used to polymerize natural dye precursor catechol, pyrogallol, syringaldehyde, syringic acid, ferulic acid and gallic acid to develop a range of natural hair colors such as black, golden yellow, and reddish brown. The results indicate that alkaline Lac DS is a suitable candidate to develop a user-friendly and commercially applicable hair dyeing process in the area of cosmetic industry.

Affinity purification of bacterial outer membrane vesicles (OMVs) utilizing a His-tag mutant.

PubMed

Alves, Nathan J; Turner, Kendrick B; DiVito, Kyle A; Daniele, Michael A; Walper, Scott A

To facilitate the rapid purification of bacterial outer membrane vesicles (OMVs), we developed two plasmid constructs that utilize a truncated, transmembrane protein to present an exterior histidine repeat sequence. We chose OmpA, a highly abundant porin protein, as the protein scaffold and utilized the lac promoter to allow for inducible control of the epitope-presenting construct. OMVs containing mutant OmpA-His6 were purified directly from Escherichia coli culture media on an immobilized metal affinity chromatography (IMAC) Ni-NTA resin. This enabling technology can be combined with other molecular tools directed at OMV packaging to facilitate the separation of modified/cargo-loaded OMV from their wt counterparts. In addition to numerous applications in the pharmaceutical and environmental remediation industries, this technology can be utilized to enhance basic research capabilities in the area of elucidating endogenous OMV function. Published by Elsevier Masson SAS.

Various mutations compensate for a deleterious lacZα insert in the replication enhancer of M13 bacteriophage

PubMed Central

Zygiel, Emily M.; Noren, Karen A.; Adamkiewicz, Marta A.; Aprile, Richard J.; Bowditch, Heather K.; Carroll, Christine L.; Cerezo, Maria Abigail S.; Dagher, Adelle M.; Hebert, Courtney R.; Hebert, Lauren E.; Mahame, Gloria M.; Milne, Stephanie C.; Silvestri, Kelly M.; Sutherland, Sara E.; Sylvia, Alexandria M.; Taveira, Caitlyn N.; VanValkenburgh, David J.; Noren, Christopher J.

2017-01-01

M13 and other members of the Ff class of filamentous bacteriophages have been extensively employed in myriad applications. The Ph.D. series of phage-displayed peptide libraries were constructed from the M13-based vector M13KE. As a direct descendent of M13mp19, M13KE contains the lacZα insert in the intergenic region between genes IV and II, where it interrupts the replication enhancer of the (+) strand origin. Phage carrying this 816-nucleotide insert are viable, but propagate in E. coli at a reduced rate compared to wild-type M13 phage, presumably due to a replication defect caused by the insert. We have previously reported thirteen compensatory mutations in the 5’-untranslated region of gene II, which encodes the replication initiator protein gIIp. Here we report several additional mutations in M13KE that restore a wild-type propagation rate. Several clones from constrained-loop variable peptide libraries were found to have ejected the majority of lacZα gene in order to reconstruct the replication enhancer, albeit with a small scar. In addition, new point mutations in the gene II 5’-untranslated region or the gene IV coding sequence have been spontaneously observed or synthetically engineered. Through phage propagation assays, we demonstrate that all these genetic modifications compensate for the replication defect in M13KE and restore the wild-type propagation rate. We discuss the mechanisms by which the insertion and ejection of the lacZα gene, as well as the mutations in the regulatory region of gene II, influence the efficiency of replication initiation at the (+) strand origin. We also examine the presence and relevance of fast-propagating mutants in phage-displayed peptide libraries. PMID:28445507

Various mutations compensate for a deleterious lacZα insert in the replication enhancer of M13 bacteriophage.

PubMed

Zygiel, Emily M; Noren, Karen A; Adamkiewicz, Marta A; Aprile, Richard J; Bowditch, Heather K; Carroll, Christine L; Cerezo, Maria Abigail S; Dagher, Adelle M; Hebert, Courtney R; Hebert, Lauren E; Mahame, Gloria M; Milne, Stephanie C; Silvestri, Kelly M; Sutherland, Sara E; Sylvia, Alexandria M; Taveira, Caitlyn N; VanValkenburgh, David J; Noren, Christopher J; Hall, Marilena Fitzsimons

2017-01-01

M13 and other members of the Ff class of filamentous bacteriophages have been extensively employed in myriad applications. The Ph.D. series of phage-displayed peptide libraries were constructed from the M13-based vector M13KE. As a direct descendent of M13mp19, M13KE contains the lacZα insert in the intergenic region between genes IV and II, where it interrupts the replication enhancer of the (+) strand origin. Phage carrying this 816-nucleotide insert are viable, but propagate in E. coli at a reduced rate compared to wild-type M13 phage, presumably due to a replication defect caused by the insert. We have previously reported thirteen compensatory mutations in the 5'-untranslated region of gene II, which encodes the replication initiator protein gIIp. Here we report several additional mutations in M13KE that restore a wild-type propagation rate. Several clones from constrained-loop variable peptide libraries were found to have ejected the majority of lacZα gene in order to reconstruct the replication enhancer, albeit with a small scar. In addition, new point mutations in the gene II 5'-untranslated region or the gene IV coding sequence have been spontaneously observed or synthetically engineered. Through phage propagation assays, we demonstrate that all these genetic modifications compensate for the replication defect in M13KE and restore the wild-type propagation rate. We discuss the mechanisms by which the insertion and ejection of the lacZα gene, as well as the mutations in the regulatory region of gene II, influence the efficiency of replication initiation at the (+) strand origin. We also examine the presence and relevance of fast-propagating mutants in phage-displayed peptide libraries.

Intelligent Local Avoided Collision (iLAC) MAC Protocol for Very High Speed Wireless Network

NASA Astrophysics Data System (ADS)

Hieu, Dinh Chi; Masuda, Akeo; Rabarijaona, Verotiana Hanitriniala; Shimamoto, Shigeru

Future wireless communication systems aim at very high data rates. As the medium access control (MAC) protocol plays the central role in determining the overall performance of the wireless system, designing a suitable MAC protocol is critical to fully exploit the benefit of high speed transmission that the physical layer (PHY) offers. In the latest 802.11n standard [2], the problem of long overhead has been addressed adequately but the issue of excessive colliding transmissions, especially in congested situation, remains untouched. The procedure of setting the backoff value is the heart of the 802.11 distributed coordination function (DCF) to avoid collision in which each station makes its own decision on how to avoid collision in the next transmission. However, collision avoidance is a problem that can not be solved by a single station. In this paper, we introduce a new MAC protocol called Intelligent Local Avoided Collision (iLAC) that redefines individual rationality in choosing the backoff counter value to avoid a colliding transmission. The distinguishing feature of iLAC is that it fundamentally changes this decision making process from collision avoidance to collaborative collision prevention. As a result, stations can avoid colliding transmissions with much greater precision. Analytical solution confirms the validity of this proposal and simulation results show that the proposed algorithm outperforms the conventional algorithms by a large margin.

POWERFUL HIGH-ENERGY EMISSION OF THE REMARKABLE BL Lac OBJECT S5 0716+714

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vittorini, V.; Chen, A. W.; Ferrari, A.

BL Lac objects of the intermediate subclass (IBLs) are known to emit a substantial fraction of their power in the energy range 0.1-10 GeV. Detecting gamma-ray emission from such sources provides therefore a direct probe of the emission mechanisms and of the underlying powerhouse. The gamma-ray satellite, AGILE, detected the remarkable IBL S5 0716+714 (z approx = 0.3) during a high state in the period from 2007 September-October, marked by two very intense flares reaching peak fluxes of 200 x 10{sup -8} photons cm{sup -2} s{sup -1} above 100 MeV, with simultaneous optical and X-ray observations. We present here amore » theoretical model for the two major flares and discuss the overall energetics of the source. We conclude that 0716+714 is among the brightest BL Lac's ever detected at gamma-ray energies. Because of its high power and lack of signs for ongoing accretion or surrounding gas, the source is an ideal candidate to test the maximal power extractable from a rotating supermassive black hole via the pure Blandford-Znajek (BZ) mechanism. We find that during the 2007 gamma-ray flares 0716+714 approached or just exceeded the upper limit set by BZ for a black hole of mass 10{sup 9} M{sub sun}.« less

Multiple conformations of the cytidine repressor DNA-binding domain coalesce to one upon recognition of a specific DNA surface.

PubMed

Moody, Colleen L; Tretyachenko-Ladokhina, Vira; Laue, Thomas M; Senear, Donald F; Cocco, Melanie J

2011-08-09

The cytidine repressor (CytR) is a member of the LacR family of bacterial repressors with distinct functional features. The Escherichia coli CytR regulon comprises nine operons whose palindromic operators vary in both sequence and, most significantly, spacing between the recognition half-sites. This suggests a strong likelihood that protein folding would be coupled to DNA binding as a mechanism to accommodate the variety of different operator architectures to which CytR is targeted. Such coupling is a common feature of sequence-specific DNA-binding proteins, including the LacR family repressors; however, there are no significant structural rearrangements upon DNA binding within the three-helix DNA-binding domains (DBDs) studied to date. We used nuclear magnetic resonance (NMR) spectroscopy to characterize the CytR DBD free in solution and to determine the high-resolution structure of a CytR DBD monomer bound specifically to one DNA half-site of the uridine phosphorylase (udp) operator. We find that the free DBD populates multiple distinct conformations distinguished by up to four sets of NMR peaks per residue. This structural heterogeneity is previously unknown in the LacR family. These stable structures coalesce into a single, more stable udp-bound form that features a three-helix bundle containing a canonical helix-turn-helix motif. However, this structure differs from all other LacR family members whose structures are known with regard to the packing of the helices and consequently their relative orientations. Aspects of CytR activity are unique among repressors; we identify here structural properties that are also distinct and that might underlie the different functional properties. © 2011 American Chemical Society

An Analysis of Light Periods of BL Lac Object S5 0716+714 with the MUSIC Algorithm

NASA Astrophysics Data System (ADS)

Tang, Jie

2012-07-01

The multiple signal classification (MUSIC) algorithm is introduced to the estimation of light periods of BL Lac objects. The principle of the MUSIC algorithm is given, together with a testing on its spectral resolution by using a simulative signal. From a lot of literature, we have collected a large number of effective observational data of the BL Lac object S5 0716+714 in the three optical wavebands V, R, and I from 1994 to 2008. The light periods of S5 0716+714 are obtained by means of the MUSIC algorithm and average periodogram algorithm, respectively. It is found that there exist two major periodic components, one is the period of (3.33±0.08) yr, another is the period of (1.24±0.01) yr. The comparison of the performances of periodicity analysis of two algorithms indicates that the MUSIC algorithm has a smaller requirement on the sample length, as well as a good spectral resolution and anti-noise ability, to improve the accuracy of periodicity analysis in the case of short sample length.

Construction of new cloning, lacZ reporter and scarless-markerless suicide vectors for genetic studies in Aggregatibacter actinomycetemcomitans

PubMed Central

Juárez-Rodríguez, María Dolores; Torres-Escobar, Ascención; Demuth, Donald R.

2013-01-01

To elucidate the putative function of a gene, effective tools are required for genetic characterization that facilitate its inactivation, deletion or modification on the bacterial chromosome. In the present study, the nucleotide sequence of the Escherichia coli/Aggregatibacter actinomycetemcomitans shuttle vector pYGK was determined, allowing us to redesign and construct a new shuttle cloning vector, pJT4, and promoterless lacZ transcriptional/translational fusion plasmids, pJT3 and pJT5. Plasmids pJT4 and pJT5 contain the origin of replication necessary to maintain shuttle vector replication. In addition, a new suicide vector, pJT1, was constructed for the generation of scarless and markerless deletion mutations of genes in the oral pathogen A. actinomycetemcomitans. Plasmid pJT1 is a pUC-based suicide vector that is counter-selectable for sucrose sensitivity. This vector does not leave antibiotic markers or scars on the chromosome after gene deletion and thus provides the option to combine several mutations in the same genetic background. The effectiveness of pJT1 was demonstrated by the construction of A. actinomycetemcomitans isogenic qseB single deletion (ΔqseB) mutant and lsrRK double deletion mutants (ΔlsrRK). These new vectors may offer alternatives for genetic studies in A. actinomycetemcomitans and other members of the HACEK (Haemophilus spp., A. actinomycetemcomitans, Cardiobacterium hominis, Eikenella corrodens, and Kingella kingae) group of Gram-negative bacteria. PMID:23353051

A low cost color-based bacterial biosensor for measuring arsenic in groundwater.

PubMed

Huang, Chi-Wei; Wei, Chia-Cheng; Liao, Vivian Hsiu-Chuan

2015-12-01

Using arsenic (As) contaminated groundwater for drinking or irrigation has caused major health problems for humans around the world, raising a need to monitor As level efficiently and economically. This study developed a color-based bacterial biosensor which is easy-to-use and inexpensive for measuring As and could be complementary to current As detecting techniques. The arsR-lacZ recombinant gene cassette in nonpathogenic strain Escherichia coli DH5α was used in the color-based biosensor which could be observed by eyes or measured by spectrometer. The developed bacterial biosensor demonstrates a quantitative range from 10 to 500μgL(-1) of As in 3-h reaction time. Furthermore, the biosensor was able to successfully detect and estimate As concentration in groundwater sample by measuring optical density at 595nm (OD595). Among different storage methods used in this study, biosensor in liquid at 4°C showed the longest shelf life about 9d, and liquid storage at RT and cell pellet could also be stored for about 3-5d. In conclusion, this study showed that the As biosensor with reliable color signal and economical preservation methods is useful for rapid screening of As pollutant, providing the potential for large scale screening and better management strategies for environmental quality control. Copyright © 2015 Elsevier Ltd. All rights reserved.

X-ray and TeV Gamma-Ray Emission from Parallel Electron-Positron or Electron-Proton Beams in BL Lac Objects

NASA Astrophysics Data System (ADS)

Krawczynski, Henric

2007-04-01

In this contribution we discuss models of the X-rays and TeV gamma-ray emission from BL Lac objects based on parallel electron-positron or electron-proton beams that form close to the central black hole owing to the strong electric fields generated by the accretion disk and possibly also by the black hole itself. Fitting the energy spectrum of the BL Lac object Mrk 501, we obtain tight constrains on the beam properties. Launching a sufficiently energetic beam requires rather strong magnetic fields close to the black hole 100-1000 G. However, the model fits imply that the magnetic field in the emission region is only 0.02 G. Thus, the particles are accelerated close to the black hole and propagate a considerable distance before instabilities trigger the dissipation of energy through synchrotron and self-Compton emission. We discuss various approaches to generate enough power to drive the jet and, at the same time, to accelerate particles to 20 TeV energies. Although the parallel beam model has its own problems, it explains some of the long-standing problems that plague models based on Fermi type particle acceleration, like the presence of a very high minimum Lorentz factor of accelerated particles. We conclude with a brief discussion of the implications of the model for the difference between the processes of jet formation in BL Lac type objects and in quasars.

78 FR 3911 - Big Stone National Wildlife Refuge, Big Stone and Lac Qui Parle Counties, MN; Final Comprehensive...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-01-17

... DEPARTMENT OF THE INTERIOR Fish and Wildlife Service [FWS-R3-R-2012-N259; FXRS1265030000-134-FF03R06000] Big Stone National Wildlife Refuge, Big Stone and Lac Qui Parle Counties, MN; Final Comprehensive... significant impact (FONSI) for the environmental assessment (EA) for Big Stone National Wildlife Refuge...

Enhanced phenol removal in an innovative lignite activated coke-assisted biological process.

PubMed

Zhang, Chen; Li, Jianfeng; Cheng, Fangqin; Liu, Yu

2018-07-01

In this study, a lignite activated coke (LAC)-assisted activated sludge (AS) process was developed for enhancing biodegradation of phenol, while the effects of LAC on sludge properties and microbial community structure were investigated. It was found that more than 90% of phenol was removed within 1 h in the LAC/AS, which was 3 times higher than the conventional AS process. Moreover, the floc size and settleability were also significantly improved in the LAC/AS. These results suggested that LAC could serve as the nucleating agent to promote the formation of compact floc, which was beneficial for toxicity mitigation and system stability. The microbial community analysis by 16S high-throughput pyrosequencing technology further revealed a more abundant bacterial richness and diversity in the LAC/AS process loaded with phenol, while some phenol degraders, such as Propionibacteriaceae were enriched. Engineering implications further suggests the LAC-assisted AS process is technically sound and economically viable. Copyright © 2018 Elsevier Ltd. All rights reserved.

Insights into mutagenesis using Escherichia coli chromosomal lacZ strains that enable detection of a wide spectrum of mutational events.

PubMed

Seier, Tracey; Padgett, Dana R; Zilberberg, Gal; Sutera, Vincent A; Toha, Noor; Lovett, Susan T

2011-06-01

Strand misalignments at DNA repeats during replication are implicated in mutational hotspots. To study these events, we have generated strains carrying mutations in the Escherichia coli chromosomal lacZ gene that revert via deletion of a short duplicated sequence or by template switching within imperfect inverted repeat (quasipalindrome, QP) sequences. Using these strains, we demonstrate that mutation of the distal repeat of a quasipalindrome, with respect to replication fork movement, is about 10-fold higher than the proximal repeat, consistent with more common template switching on the leading strand. The leading strand bias was lost in the absence of exonucleases I and VII, suggesting that it results from more efficient suppression of template switching by 3' exonucleases targeted to the lagging strand. The loss of 3' exonucleases has no effect on strand misalignment at direct repeats to produce deletion. To compare these events to other mutations, we have reengineered reporters (designed by Cupples and Miller 1989) that detect specific base substitutions or frameshifts in lacZ with the reverting lacZ locus on the chromosome rather than an F' element. This set allows rapid screening of potential mutagens, environmental conditions, or genetic loci for effects on a broad set of mutational events. We found that hydroxyurea (HU), which depletes dNTP pools, slightly elevated templated mutations at inverted repeats but had no effect on deletions, simple frameshifts, or base substitutions. Mutations in nucleotide diphosphate kinase, ndk, significantly elevated simple mutations but had little effect on the templated class. Zebularine, a cytosine analog, elevated all classes.

Indoor air bacterial load and antibiotic susceptibility pattern of isolates in operating rooms and surgical wards at jimma university specialized hospital, southwest ethiopia.

PubMed

Genet, Chalachew; Kibru, Gebre; Tsegaye, Wondewosen

2011-03-01

Surgical site infection is the second most common health care associated infection. One of the risk factors for such infection is bacterial contamination of operating rooms' and surgical wards' indoor air. In view of that, the microbiological quality of air can be considered as a mirror of the hygienic condition of these rooms. Thus, the objective of this study was to determine the bacterial load and antibiotic susceptibility pattern of isolates in operating rooms' and surgical wards' indoor air of Jimma University Specialized Hospital. A cross sectional study was conducted to measure indoor air microbial quality of operating rooms and surgical wards from October to January 2009/2010 on 108 indoor air samples collected in twelve rounds using purposive sampling technique by Settle Plate Method (Passive Air Sampling following 1/1/1 Schedule). Sample processing and antimicrobial susceptibility testing were done following standard bacteriological techniques. The data was analyzed using SPSS version 16 and interpreted according to scientifically determined baseline values initially suggested by Fisher. The mean aerobic colony counts obtained in OR-1(46cfu/hr) and OR-2(28cfu/hr) was far beyond the set 5-8cfu/hr acceptable standards for passive room. Similarly the highest mean aerobic colony counts of 465cfu/hr and 461cfu/hr were observed in Female room-1 and room-2 respectively when compared to the acceptable range of 250-450cfu/hr. In this study only 3 isolates of S. pyogenes and 48 isolates of S. aureus were identified. Over 66% of S. aureus was identified in Critical Zone of Operating rooms. All isolates of S. aureus showed 100% and 82.8% resistance to methicillin and ampicillin respectively. Higher degree of aerobic bacterial load was measured from operating rooms' and surgical wards' indoor air. Reducing foot trafficking, improving the ventilation system and routine cleaning has to be made to maintain the aerobic bacteria load with in optimal level.

Effect of the inclusion of chestnut in the finishing diet on volatile compounds during the manufacture of dry-cured "Lacón" from Celta pig breed.

PubMed

Lorenzo, José M; Franco, Daniel; Carballo, Javier

2014-01-01

The effect of the finishing diet on the volatile compounds throughout the manufacture of dry-cured "lacón" (a Spanish traditional meat product), from the Celta pig breed was studied. Thirty-six pigs were separated into three groups according to the type of feeding during the finish-fattening period of three months (concentrate, mixed diet and chestnut). From the pigs of each diet, four batches of dry-cured "lacón" were manufactured. From each batch, samples of fresh meat, meat after salting, after post-salting, and after 14, 28, 56 and 84 days of drying-ripening were taken. Volatiles were extracted by a purge-and-trap method and analyzed by gas chromatographic/mass spectrometry (GC/MS). Seventy-six volatile compounds were identified and quantified from dry-cured "lacón" samples in pigs finished with chestnut, eighty-two for concentrate fed pigs and eighty in pigs fed with the mixed diet. The number of identified volatile compounds increased during the manufacturing process; at 84 days of drying-ripening, in the dry-cured "lacón" samples from pigs finished with concentrate, mixed diet and chestnut, 54, 58 and 62 volatile compounds were detected, respectively. The most abundant group of flavour compounds at the end of the manufacturing process was hydrocarbons in the three feeding systems, followed by aldehydes, ketones and alcohols. Discriminant analysis selected six variables (dodecane, butadienol, pentenol, 2-pentenal, decen-3-ona and pyridine-2-methyl) and calculated two discriminating functions which allowed verification of chestnut in the finishing diet. © 2013.

Pesticides in surface water, bed sediment, and ground water adjacent to commercial cranberry bogs, Lac du Flambeau Reservation, Vilas County, Wisconsin

USGS Publications Warehouse

Saad, David A.

2005-01-01

In samples from the Trout River, which is used as a source of water to maintain lake levels in the Corn Lakes, the only pesticides detected were the non-targeted compounds atrazine and deethyl atrazine, indicating it was not a source of targeted compounds detected in the Corn Lakes. Only two pesticides (chlorpyrifos and metolachlor) were detected in bed-sediment samples collected from the lakes; chlorpyrifos from Little Trout Lake and metolachlor from the Corn Lakes. Four pesticides (the targeted compounds napropamide and norflurazon and the non-targeted compounds atrazine and deethyl atrazine) were detected in ground-water samples from two of four sampled monitor wells. The highest ground-water concentrations (up to 0.14 ?g/L napropamide and 0.56 ?g/L norflurazon) were measured in samples from the monitoring well located directly downgradient from the Corn Lakes and commercial cranberry operations. No pesticides were detected in samples from the reference well located upgradient from the Corn Lakes and cranberry operations. Further study is needed to identify additional pesticides as well as chronic effects on aquatic organisms to determine whether cranberry-related pesticides affect the lake ecosystems of the Lac du Flambeau Reservation.

HESS J1943+213: A Non-classical High-frequency-peaked BL Lac Object

NASA Astrophysics Data System (ADS)

Straal, S. M.; Gabányi, K. É.; van Leeuwen, J.; Clarke, T. E.; Dubner, G.; Frey, S.; Giacani, E.; Paragi, Z.

2016-05-01

HESS J1943+213 is an unidentified TeV source that is likely a high-frequency-peaked BL Lac (HBL) object, but that is also compatible with a pulsar wind nebula (PWN) nature. Each of these enormously different astronomical interpretations is supported by some of the observed unusual characteristics. In order to finally classify and understand this object, we took a three-pronged approach, through time-domain, high angular resolution, and multi-frequency radio studies. First, our deep time-domain observations with the Arecibo telescope failed to uncover the putative pulsar powering the proposed PWN. We conclude with ˜70% certainty that HESS J1943+213 does not host a pulsar. Second, long-baseline interferometry of the source with e-MERLIN at 1.5 and 5 GHz shows only a core, that is, a point source at ˜ 1-100 mas resolution. Its 2013 flux density is about one-third lower than that detected in the 2011 observations with similar resolution. This radio variability of the core strengthens the HBL object hypothesis. Third, additional evidence against the PWN scenario comes from the radio spectrum we compiled. The extended structure follows a power-law behavior with spectral index α \\=\\-0.54+/- 0.04 while the core component displays a flat spectrum (α \\=\\-0.03+/- 0.03). In contrast, the radio synchrotron emission of PWNe predicts a single power-law distribution. Overall, we rule out the PWN hypothesis and conclude that the source is a BL Lac object. The consistently high fraction (70%) of the flux density from the extended structure then leads us to conclude that HESS J1943+213 must be a non-classical HBL object.

Evaluation of a pulsed xenon ultraviolet disinfection system to decrease bacterial contamination in operating rooms.

PubMed

El Haddad, Lynn; Ghantoji, Shashank S; Stibich, Mark; Fleming, Jason B; Segal, Cindy; Ware, Kathy M; Chemaly, Roy F

2017-10-10

Environmental cleanliness is one of the contributing factors for surgical site infections in the operating rooms (ORs). To decrease environmental contamination, pulsed xenon ultraviolet (PX-UV), an easy and safe no-touch disinfection system, is employed in several hospital environments. The positive effect of this technology on environmental decontamination has been observed in patient rooms and ORs during the end-of-day cleaning but so far, no study explored its feasibility between surgical cases in the OR. In this study, 5 high-touch surfaces in 30 ORs were sampled after manual cleaning and after PX-UV intervention mimicking between-case cleaning to avoid the disruption of the ORs' normal flow. The efficacy of a 1-min, 2-min, and 8-min cycle were tested by measuring the surfaces' contaminants by quantitative cultures using Tryptic Soy Agar contact plates. We showed that combining standard between-case manual cleaning of surfaces with a 2-min cycle of disinfection using a portable xenon pulsed ultraviolet light germicidal device eliminated at least 70% more bacterial load after manual cleaning. This study showed the proof of efficacy of a 2-min cycle of PX-UV in ORs in eliminating bacterial contaminants. This method will allow a short time for room turnover and a potential reduction of pathogen transmission to patients and possibly surgical site infections.

Biosynthesis of Bacterial Cellulose/Carboxylic Multi-Walled Carbon Nanotubes for Enzymatic Biofuel Cell Application

PubMed Central

Lv, Pengfei; Feng, Quan; Wang, Qingqing; Li, Guohui; Li, Dawei; Wei, Qufu

2016-01-01

Novel nanocomposites comprised of bacterial cellulose (BC) with carboxylic multi-walled carbon nanotubes (c-MWCNTs) incorporated into the BC matrix were prepared through a simple method of biosynthesis. The biocathode and bioanode for the enzyme biological fuel cell (EBFC) were prepared using BC/c-MWCNTs composite injected by laccase (Lac) and glucose oxidase (GOD) with the aid of glutaraldehyde (GA) crosslinking. Biosynthesis of BC/c-MWCNTs composite was characterized by digital photos, scanning electron microscope (SEM), and Fourier Transform Infrared (FTIR). The experimental results indicated the successful incorporation of c-MWCNTs into the BC. The electrochemical and biofuel performance were evaluated by cyclic voltammetry (CV) and linear sweep voltammetry (LSV). The power density and current density of EBFCs were recorded at 32.98 µW/cm3 and 0.29 mA/cm3, respectively. Additionally, the EBFCs also showed acceptable stability. Preliminary tests on double cells indicated that renewable BC have great potential in the application field of EBFCs. PMID:28773310

Freshwater Recirculating Aquaculture System Operations Drive Biofilter Bacterial Community Shifts around a Stable Nitrifying Consortium of Ammonia-Oxidizing Archaea and Comammox Nitrospira

PubMed Central

Bartelme, Ryan P.; McLellan, Sandra L.; Newton, Ryan J.

2017-01-01

Recirculating aquaculture systems (RAS) are unique engineered ecosystems that minimize environmental perturbation by reducing nutrient pollution discharge. RAS typically employ a biofilter to control ammonia levels produced as a byproduct of fish protein catabolism. Nitrosomonas (ammonia-oxidizing), Nitrospira, and Nitrobacter (nitrite-oxidizing) species are thought to be the primary nitrifiers present in RAS biofilters. We explored this assertion by characterizing the biofilter bacterial and archaeal community of a commercial scale freshwater RAS that has been in operation for >15 years. We found the biofilter community harbored a diverse array of bacterial taxa (>1000 genus-level taxon assignments) dominated by Chitinophagaceae (~12%) and Acidobacteria (~9%). The bacterial community exhibited significant composition shifts with changes in biofilter depth and in conjunction with operational changes across a fish rearing cycle. Archaea also were abundant, and were comprised solely of a low diversity assemblage of Thaumarchaeota (>95%), thought to be ammonia-oxidizing archaea (AOA) from the presence of AOA ammonia monooxygenase genes. Nitrosomonas were present at all depths and time points. However, their abundance was >3 orders of magnitude less than AOA and exhibited significant depth-time variability not observed for AOA. Phylogenetic analysis of the nitrite oxidoreductase beta subunit (nxrB) gene indicated two distinct Nitrospira populations were present, while Nitrobacter were not detected. Subsequent identification of Nitrospira ammonia monooxygenase alpha subunit genes in conjunction with the phylogenetic placement and quantification of the nxrB genotypes suggests complete ammonia-oxidizing (comammox) and nitrite-oxidizing Nitrospira populations co-exist with relatively equivalent and stable abundances in this system. It appears RAS biofilters harbor complex microbial communities whose composition can be affected directly by typical system operations while

The Luminosity Function of the Host Galaxies of QSOs and BL Lac Objects

NASA Astrophysics Data System (ADS)

Carangelo, Nicoletta; Falomo, Renato; Treves, Aldo

A clear insight of the galaxies hosting active galactic nuclei is of fundamental importance for understanding the processes of galaxies and nuclei formation and their cosmic evolution. A good characterization of the host galaxies properties requires images of excellent quality in order to disentangle the light of the galaxy from that of the bright nucleus. To this aim HST has provided a major improvement of data on QSOs (Disney et al. 1995; Bahcall et al. 1996,1997; Boyce et al. 1998; McLure et al. 1999; Hamilton et al. 2000; Kukula et al. 2001) and BL Lacs (Scarpa et al. 2000, Urry et al. 2000).

Quasi-simultaneous observations of the BL Lac object MK 501 in X-ray, UV, visible, IR and radio frequencies

NASA Technical Reports Server (NTRS)

Kondo, D. M.; Worrall, D. M.; Mushotzky, R. F.; Hackney, R. L.; Hackney, K. H.; Oke, J. B.; Yee, H.; Neugebauer, G.; Matthews, K.; Feldman, P. A.

1980-01-01

Quasi-simultaneous observations of the BL Lacertae (Lac) objects MK 501 were performed for the first time at X-ray, ultraviolet, visible, infrared, and radio frequencies. The observed spectral slope from the X-ray to UV regions is positive and continuous, but that from the mid UV to visible light region becomes gradually flat and possibly turns down toward lower frequencies; the optical radio emission can not be accounted for by a single power law. Several theoretical models were considered for the emission mechanism. A quantitative comparison was performed with the synchrotron-self-Compton model; the total spectrum is found consistent with this model. The spectrum from visible light to X-ray is consistent with synchrotron radiation or with inverse-Compton scattering by a hot thermal cloud of electrons. The continuity of the spectral slope from X-ray to UV implied by the current data suggests that the previous estimates of the total luminosity of this BL Lac object is underestimated by a factor of about three or four.

Proteins mediating DNA loops effectively block transcription.

PubMed

Vörös, Zsuzsanna; Yan, Yan; Kovari, Daniel T; Finzi, Laura; Dunlap, David

2017-07-01

Loops are ubiquitous topological elements formed when proteins simultaneously bind to two noncontiguous DNA sites. While a loop-mediating protein may regulate initiation at a promoter, the presence of the protein at the other site may be an obstacle for RNA polymerases (RNAP) transcribing a different gene. To test whether a DNA loop alters the extent to which a protein blocks transcription, the lac repressor (LacI) was used. The outcome of in vitro transcription along templates containing two LacI operators separated by 400 bp in the presence of LacI concentrations that produced both looped and unlooped molecules was visualized with scanning force microscopy (SFM). An analysis of transcription elongation complexes, moving for 60 s at an average of 10 nt/s on unlooped DNA templates, revealed that they more often surpassed LacI bound to the lower affinity O2 operator than to the highest affinity Os operator. However, this difference was abrogated in looped DNA molecules where LacI became a strong roadblock independently of the affinity of the operator. Recordings of transcription elongation complexes, using magnetic tweezers, confirmed that they halted for several minutes upon encountering a LacI bound to a single operator. The average pause lifetime is compatible with RNAP waiting for LacI dissociation, however, the LacI open conformation visualized in the SFM images also suggests that LacI could straddle RNAP to let it pass. Independently of the mechanism by which RNAP bypasses the LacI roadblock, the data indicate that an obstacle with looped topology more effectively interferes with transcription. © 2017 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.

First analysis of eight Algol-type binaries: EI Aur, XY Dra, BP Dra, DD Her, VX Lac, WX Lib, RZ Lyn, and TY Tri

NASA Astrophysics Data System (ADS)

Zasche, P.

2016-01-01

The available photometry from the online databases were used for the first light curve analysis of eight eclipsing binary systems EI Aur, XY Dra, BP Dra, DD Her, VX Lac, WX Lib, RZ Lyn, and TY Tri. All these stars are of Algol-type, having the detached components and the orbital periods from 0.92 to 6.8 days. For the systems EI Aur and BP Dra the large amount of the third light was detected during the light curve solution. Moreover, 468 new times of minima for these binaries were derived, trying to identify the period variations. For the systems XY Dra and VX Lac the third bodies were detected with the periods 17.7, and 49.3 years, respectively.

76 FR 10894 - Notice of Issuance of Prevention of Significant Deterioration and Federal Operating Permits to...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-02-28

... (EPA). ACTION: Notice. SUMMARY: This notice announces that, on December 30, 2010, pursuant to title V of the Clean Air Act, EPA issued a title V Permit to Operate (title V permit) to the Mille Lacs Band... permits, which ended April 5, 2010, EPA received comments on the draft title V permit, and revised the...

Fermi LAT detection of a GeV flare from the BL Lac object Mrk 421

NASA Astrophysics Data System (ADS)

D'Ammando, F.; Orienti, M.

2012-07-01

The Large Area Telescope (LAT), one of the two instruments on the Fermi Gamma-ray Space Telescope, has observed gamma-ray flaring activity from a source positionally consistent with the BL Lac object Mrk 421 (also known as 2FGL J1104.4+3812, Nolan et al. 2012, ApJS, 199, 31; R.A.= 11h04m27.3139s, Dec.= +38d12m31.799s, J2000.0, Fey et al. 2004, AJ, 127, 3587) at redshift z=0.03 (De Vaucouleurs et al.

VLBA Observations of Low Luminosity Flat Spectrum Radio Galaxies and BL Lac Objects: Polarisation Properties

NASA Astrophysics Data System (ADS)

Bondi, M.; Dallacasa, D.; Stanghellini, C.; Marchã, M. J. M.

We obtained two-epoch VLBA observations at 5 GHz of a list of radio galaxies drawn from the 200 mJy sample (Marcha et al. 1996). The objects selected for milli-arcsecond scale observations are classified, on the basis of their optical spectroscopic and polarimetric properties, as BL Lac objects, normal weak line radio galaxies, broad line radio galaxies, and transition objects (those with intermediate properties). We present preliminary results on the radio polarization properties, on the milli-arcsecond scale, of objects with different optical properties and discuss structural variations detected from the two epochs.

The glpD gene is a novel reporter gene for E. coli that is superior to established reporter genes like lacZ and gusA.

PubMed

Wegener, Marius; Vogtmann, Kristina; Huber, Madeleine; Laass, Sebastian; Soppa, Jörg

2016-12-01

Reporter genes facilitate the characterization of promoter activities, transcript stabilities, translational efficiencies, or intracellular localization. Various reporter genes for Escherichia coli have been established, however, most of them have drawbacks like transcript instability or the inability to be used in genetic selections. Therefore, the glpD gene encoding glycerol-3-phosphate dehydrogenase was introduced as a novel reporter gene for E. coli. The enzymatic assay was optimized, and it was verified that growth on glycerol strictly depends on the presence of GlpD. The 5'-UTRs of three E. coli genes were chosen and cloned upstream of the new reporter gene glpD as well as the established reporter genes lacZ and gusA. Protein and transcript levels were quantified and translational efficiencies were calculated. The lacZ transcript was very unstable and its level highly depended on its translation, compromising its use as a reporter. The results obtained with gusA and glpD were similar, however, only glpD can be used for genetic selections. Therefore, glpD was found to be a superior novel reporter gene compared to the established reporter genes lacZ and gusA. Copyright © 2016 Elsevier B.V. All rights reserved.

Bacterial Acclimation Inside an Aqueous Battery.

PubMed

Dong, Dexian; Chen, Baoling; Chen, P

2015-01-01

Specific environmental stresses may lead to induced genomic instability in bacteria, generating beneficial mutants and potentially accelerating the breeding of industrial microorganisms. The environmental stresses inside the aqueous battery may be derived from such conditions as ion shuttle, pH gradient, free radical reaction and electric field. In most industrial and medical applications, electric fields and direct currents are used to kill bacteria and yeast. However, the present study focused on increasing bacterial survival inside an operating battery. Using a bacterial acclimation strategy, both Escherichia coli and Bacillus subtilis were acclimated for 10 battery operation cycles and survived in the battery for over 3 days. The acclimated bacteria changed in cell shape, growth rate and colony color. Further analysis indicated that electrolyte concentration could be one of the major factors determining bacterial survival inside an aqueous battery. The acclimation process significantly improved the viability of both bacteria E. coli and B. subtilis. The viability of acclimated strains was not affected under battery cycle conditions of 0.18-0.80 mA cm(-2) and 1.4-2.1 V. Bacterial addition within 1.0×10(10) cells mL(-1) did not significantly affect battery performance. Because the environmental stress inside the aqueous battery is specific, the use of this battery acclimation strategy may be of great potential for the breeding of industrial microorganisms.

Bacterial Acclimation Inside an Aqueous Battery

PubMed Central

Dong, Dexian; Chen, Baoling; Chen, P.

2015-01-01

Specific environmental stresses may lead to induced genomic instability in bacteria, generating beneficial mutants and potentially accelerating the breeding of industrial microorganisms. The environmental stresses inside the aqueous battery may be derived from such conditions as ion shuttle, pH gradient, free radical reaction and electric field. In most industrial and medical applications, electric fields and direct currents are used to kill bacteria and yeast. However, the present study focused on increasing bacterial survival inside an operating battery. Using a bacterial acclimation strategy, both Escherichia coli and Bacillus subtilis were acclimated for 10 battery operation cycles and survived in the battery for over 3 days. The acclimated bacteria changed in cell shape, growth rate and colony color. Further analysis indicated that electrolyte concentration could be one of the major factors determining bacterial survival inside an aqueous battery. The acclimation process significantly improved the viability of both bacteria E. coli and B. subtilis. The viability of acclimated strains was not affected under battery cycle conditions of 0.18-0.80 mA cm-2 and 1.4-2.1 V. Bacterial addition within 1.0×1010 cells mL-1 did not significantly affect battery performance. Because the environmental stress inside the aqueous battery is specific, the use of this battery acclimation strategy may be of great potential for the breeding of industrial microorganisms. PMID:26070088

Comparative analysis of the bacterial diversity in a lab-scale moving bed biofilm reactor (MBBR) applied to treat urban wastewater under different operational conditions.

PubMed

Calderón, Kadiya; Martín-Pascual, Jaime; Poyatos, José Manuel; Rodelas, Belén; González-Martínez, Alejandro; González-López, Jesús

2012-10-01

Different types of carriers were tested as support material in a lab-scale moving bed biofilm reactor (MBBR) used to treat urban wastewater under three different conditions of hydraulic retention time (HRT) and carrier filling ratios (FR). The bacterial diversity developed on the biofilms responsible of the treatment was studied using a cultivation-independent approach based on the polymerase chain reaction-temperature gradient gel electrophoresis technique (PCR-TGGE). Cluster analysis of TGGE fingerprints showed significant differences of community structure dependent upon the different operational conditions applied. Redundancy analysis (RDA) was used to determine the relationship between the operational conditions (type of carrier, HRT, FR) and bacterial biofilm diversity, demonstrating a significant effect of FR=50%. Phylogenetic analysis of PCR-reamplified and sequenced TGGE bands revealed that the prevalent Bacteria populations in the biofilm were related to Betaproteobacteria (46%), Firmicutes (34%),Alphaproteobacteria (14%) and Gammaproteobacteria (9%). Copyright © 2012 Elsevier Ltd. All rights reserved.

A five-residue sequence near the carboxyl terminus of the polytopic membrane protein lac permease is required for stability within the membrane.

PubMed Central

Roepe, P D; Zbar, R I; Sarkar, H K; Kaback, H R

1989-01-01

The lac permease (lacY gene product) of Escherichia coli contains 417 amino acid residues and is predicted to have a short hydrophilic amino terminus on the inner surface of the cytoplasmic membrane, multiple transmembrane hydrophobic segments in alpha-helical conformation, and a 17-amino acid residue hydrophilic carboxyl-terminal tail on the inner surface of the membrane. To assess the importance of the carboxyl terminus, the properties of several truncation mutants were studied. The mutants were constructed by site-directed mutagenesis such that stop codons were placed at specified positions, and the altered lacY genes were expressed at a relatively low rate from plasmid pACYC184. Permease truncated at position 407 or 401 retains full activity, and a normal complement of molecules is present in the membrane, as judged by immunoblot analyses. Thus, it is apparent that the carboxyl-terminal tail plays no direct role in membrane insertion of the permease, its stability, or in the mechanism of lactose/H+ symport. In marked contrast, when truncations are made at residues 396 (i.e., 4 amino acid residues from the carboxyl terminus of putative helix XII), 389, 372, or 346, the permease is no longer found in the membrane. Remarkably, however, when each of the mutated lacY genes is expressed at a high rate by means of the T7 RNA polymerase system [Tabor, S. & Richardson, C. C. (1985) Proc. Natl. Acad. Sci. USA 82, 1074-1079], all of the truncated permeases are present in the membrane, as indicated by [35S]methionine incorporation studies; however, permease truncated at residue 396, 389, 372, or 346 is defective with respect to lactose/H+ symport. Finally, pulse-chase experiments indicate that wild-type permease or permease truncated at residue 401 is stable, whereas permease truncated at or prior to residue 396 is degraded at a significant rate. The results are consistent with the notion that residues 396-401 in putative helix XII are important for protection against

Investigation of spore coat display of Bacillus subtilis β-galactosidase for developing of whole cell biocatalyst.

PubMed

Tavassoli, Setareh; Hinc, Krzysztof; Iwanicki, Adam; Obuchowski, Michal; Ahmadian, Gholamreza

2013-03-01

The production of highly efficient, recyclable and cost-effective enzymes is one of the most important goals in industrial biotechnology. Bacterial spores are highly resistant to harsh environmental conditions, easy to produce and are suitable for manipulation of genetic materials. These features make them a very efficient tool for biotechnology. Here, we show the use bacterial spores for presentation of functional enzyme. Spore coat display was used to produce a biocatalyst, which expresses β-galactiosidase (LacA). This enzyme is commonly used to produce lactose-free milk for lactose intolerant individuals. The lacA gene from Bacillus subtilis strain 168 was expressed on the surface of B. subtilis RH101(ΔcotC) spores using CotC as protein carrier. Presence of LacA protein is verified by western blotting. Results of β-galactiosidase assay show that the expressed enzyme retained its activity in condition of freezing and drying, as well as after recovery from the reaction's mixture.

Multi-epoch intranight optical monitoring of eight radio-quiet BL Lac candidates

NASA Astrophysics Data System (ADS)

Kumar, P.; Gopal-Krishna; Stalin, C. S.; Chand, H.; Srianand, R.; Petitjean, P.

2017-10-01

For a new sample of eight weak-line quasars (WLQs) we report a sensitive search in 20 intranight monitoring sessions, for blazar-like optical flux variations on hour-like and longer time-scale (day/month/year-like). The sample consists exclusively of the WLQs that are not radio-loud and either have been classified as 'radio-weak probable BL Lac candidates' and/or are known to have exhibited at least one episode of large, blazar-like optical variability. Whereas only a hint of intranight variability is seen for two of these WLQs, J104833.5+620305.0 (z = 0.219) and J133219.6+622715.9 (z = 3.15), statistically significant internight variability at a few per cent level is detected for three of the sources, including the radio-intermediate WLQ J133219.6+622715.9 (z = 3.15) and the well-known bona fide radio-quiet WLQs J121221.5+534128.0 (z = 3.10) and WLQ J153259.9-003944.1 (z = 4.62). In the rest frame, this variability is intraday and in the far-ultraviolet band. On the time-scale of a decade, we find for three of the WLQs large brightness changes, amounting to 1.655 ± 0.009, 0.163 ± 0.010 and 0.144 ± 0.018 mag, for J104833.5+620305.0, J123743.1+630144.9 and J232428.4+144324.4, respectively. Whereas the latter two are confirmed radio-quiet WLQs, the extragalactic nature of J104833.5+620305.0 remains to be well established, thanks to the absence of any feature(s) in its available optical spectra. This study forms a part of our ongoing campaign of intranight optical monitoring of radio-quiet WLQs, in order to improve the understanding of this enigmatic class of active galactic nuclei and to look among them for a possible tiny, elusive population of radio-quiet BL Lacs.

Somatostatin receptor 2 knockout/lacZ knockin mice show impaired motor coordination and reveal sites of somatostatin action within the striatum.

PubMed

Allen, Jeremy P; Hathway, Gareth J; Clarke, Neil J; Jowett, Mike I; Topps, Stephanie; Kendrick, Keith M; Humphrey, Patrick P A; Wilkinson, Lawrence S; Emson, Piers C

2003-05-01

The peptide somatostatin can modulate the functional output of the basal ganglia. The exact sites and mechanisms of this action, however, are poorly understood, and the physiological context in which somatostatin acts is unknown. Somatostatin acts as a neuromodulator via a family of five 7-transmembrane G protein-coupled receptors, SSTR1-5, one of which, SSTR2, is known to be functional in the striatum. We have investigated the role of SSTR2 in basal ganglia function using mice in which Sstr2 has been inactivated and replaced by the lacZ reporter gene. Analysis of Sstr2lacZ expression in the brain by beta-galactosidase histochemistry demonstrated a widespread pattern of expression. By comparison to previously published in situ hybridization and immunohistochemical data, Sstr2lacZ expression was shown to accurately recapitulate that of Sstr2 and thus provided a highly sensitive model to investigate cell-type-specific expression of Sstr2. In the striatum, Sstr2 expression was identified in medium spiny projection neurons restricted to the matrix compartment and in cholinergic interneurons. Sstr2 expression was not detected in any other nuclei of the basal ganglia except for a sparse number of nondopaminergic neurons in the substantia nigra. Microdialysis in the striatum showed Sstr2-null mice were selectively refractory to somatostatin-induced dopamine and glutamate release. In behavioural tests, Sstr2-null mice showed normal levels of locomotor activity and normal coordination in undemanding tasks. However, in beam-walking, a test of fine motor control, Sstr2-null mice were severely impaired. Together these data implicate an important neuromodulatory role for SSTR2 in the striatum.

Mutagenesis of the lac promoter region in M13 mp10 phage DNA by 4'-hydroxymethyl-4,5',8-trimethylpsoralen

DOE Office of Scientific and Technical Information (OSTI.GOV)

Piette, J.; Decuyper-Debergh, D.; Gamper, H.

Double-stranded M13 phage DNA (M13 mp10 replicative form) was photoreacted with 4'-hydroxymethyl-4,5',8-trimethylpsoralen, using light of wavelength greater than 320 nm or greater than 390 nm to generate predominantly crosslinks or monoadducts, respectively. The damaged DNAs were scored for inactivation and mutagenesis after transfection into Escherichia coli. The appearance of light-blue or colorless plaques on indicator medium showed that mutation had occurred in the lac insert of the viral DNA. A comparison of the consequences of the two phototreatments with psoralen supports the idea that crosslinks are both more lethal and more mutagenic than monoadducts. Numerous mutant clones partially or totallymore » deficient in beta-galactosidase were plaque-purified and amplified. The viral DNA of each clone was sequenced by the dideoxy chain-terminating procedure. All of the observed base-pair changes were mapped to the lac promoter region and consisted of 3 transition, 14 transversion, and 6 single base-pair frame-shift mutations. The predominant mutation was a T.A----G.C transversion.« less

Spectroscopy of 10 γ -Ray BL Lac Objects at High Redshift

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paiano, Simona; Falomo, Renato; Landoni, Marco

2017-08-01

We present optical spectra with high signal-to-noise ratio of 10 BL Lac objects detected at GeV energies by the Fermi satellite (3FGL catalog), which previous observations suggested are at relatively high redshift. The new observations, obtained at the 10 m Gran Telescopio Canarias, allowed us to find the redshift for J0814.5+2943 ( z = 0.703), and we can set a spectroscopic lower limit for J0008.0+4713 ( z > 1.659) and J1107.7+0222 ( z > 1.0735) on the basis of Mg ii intervening absorption features. In addition we confirm the redshifts for J0505.5+0416 ( z = 0.423) and J1450+5200 ( zmore » > 2.470). Finally we contradict the previous z estimates for five objects (J0049.7+0237, J0243.5+7119, J0802.0+1005, J1109.4+2411, and J2116.1+3339).« less

The addition of a mobile ultra-clean exponential laminar airflow screen to conventional operating room ventilation reduces bacterial contamination to operating box levels.

PubMed

Friberg, S; Ardnor, B; Lundholm, R; Friberg, B

2003-10-01

A mobile screen producing ultra-clean exponential laminar airflow (LAF) was investigated as an addition to conventional turbulent/mixing operating room (OR) ventilation (16 air changes/h). The evaluation was performed in a small OR (50 m(3)) during 60 standardized operations for groin hernia including mesh implantation. The additional ventilation was used in 50 of the operations. The LAF passed from the foot-end of the OR table over the instrument and surgical area. Strict hygiene OR procedures including tightly woven and non-woven OR clothing were used. Sedimentation rates were recorded at the level of the patients' chests (N=60) (i.e. the air had passed the surgical team) and in the periphery of the OR. In addition bacterial air contamination was studied above the patients' chests in all 10 operations without the additional LAF and in 12 with the LAF. The screen reduced the mean counts of sedimenting bacteria (cfu/m(2)/h) on the patients' chests from 775 without the screen to 355 (P=0.0003). The screen also reduced the mean air counts of bacteria (cfu/m(3)) above the patients' chests from 27 to 9 (P=0.0001). No significant differences in mean sedimentation rates (cfu/m(2)/h) existed in the periphery of the OR where 628 without and 574 with screen were recorded. During the follow-up period of six months no surgical site infections were detected. In conclusion when the mobile LAF screen was added to conventional OR ventilation the counts of aerobic airborne and sedimenting bacteria-carrying particles downstream of the surgical team were reduced to the levels achieved with complete ultra-clean LAF OR ventilation (operating box).

Evaluation of critical indicators in the process of acquiring supplies and services LAC-UFPE

NASA Astrophysics Data System (ADS)

Caetano, V. F.; Ferreira, C. V.; dos Santos, M. J.; Honorato, F. A.

2015-01-01

In laboratories linked to public universities and accredited by the NBR ISO/IEC 17025, to meet efficiently item 4.6 (procurement of supplies and services) is a challenge that can be accomplished by programming based on historical purchases and services. In this study, we evaluated the critical procurement items to meet the quality management system of the LAC-UFPE: reagents, certified reference material, of equipment parts, maintenance and calibration of equipment and instruments. It was found that the most critical item is the certified reference material, the purchase or repair of which must be expedited within 125 days prior to the receipt to occur within the desired period.

Evaluation of clinical methods for diagnosing bacterial vaginosis.

PubMed

Gutman, Robert E; Peipert, Jeffrey F; Weitzen, Sherry; Blume, Jeffrey

2005-03-01

To determine whether the current clinical criteria for diagnosing bacterial vaginosis can be simplified by using 2 clinical criteria rather than the standard 3 of 4 criteria (Amsel's criteria). This was a prospective observational study of 269 women undergoing a vaginal examination in the Women's Primary Care Center, Division of Research, or Colposcopy Clinic at Women & Infants Hospital. All 4 clinical criteria for diagnosing bacterial vaginosis were collected, and Gram stain was used as the gold standard. Sensitivity and specificity were calculated for each individual criterion, combinations of criteria, and a colorimetric pH and amine card. Receiver operating characteristic curve was generated to estimate the preferred pH and percentage of clue cells for diagnosing bacterial vaginosis. The prevalence of bacterial vaginosis in our study population was 38.7%. Vaginal pH was the most sensitive of all the criteria, at 89%, and a positive amine odor was the individual criteria with the highest specificity, at 93%. Similar specificity was seen with combinations of 2 criteria and Amsel's criteria. Receiver operating characteristic curve analysis yielded a preferred pH and percentage of clue cells of 5.0 and 20%, respectively. However, a pH of 4.5 or greater improves sensitivity with minimal loss of specificity. The clinical criteria for diagnosing bacterial vaginosis can be simplified to 2 clinical criteria without loss of sensitivity and specificity.

Optical and X-ray observations of the two BL Lac objects OJ 287 and MS 1458+22

NASA Astrophysics Data System (ADS)

Massaro, E.; Giommi, P.; Perri, M.; Tagliaferri, G.; Nesci, R.; Tosti, G.; Ciprini, S.; Montagni, F.; Ravasio, M.; Ghisellini, G.; Frasca, A.; Marilli, E.; Valentini, G.; Kurtanidze, O. M.; Nikolashvili, M. G.

2003-02-01

We present the results of recent BeppoSAX observations of the two BL Lac objects OJ 287 and MS 1458+22 in bright optical states and of simultaneous photometric measurements in the bandpasses from I to U. OJ 287 was observed in November 2001 and MS 1458+22 in February of the same year. The X-ray flux of OJ 287 was rather low, F(2-10 keV) = (1.35+/-0.15)x 10-12 erg cm-2 s-1 and its spectrum is well described by a single power law with an energy index 0.45+/-0.08, flatter than that measured in the optical, equal to 1.53+/-0.03. The X-ray emission of MS 1458+22 was characterized by a low flux level of F(2-10 keV) = (7.5+/-0.6)x 10-13 erg cm-2 s-1, with a steeper spectral index of 1.71+/-0.15, while in the optical it was 0.99+/-0.06. We show that the broad-band SEDs of these two sources can be well represented by log-parabolic spectral laws and evaluate their parameters. This law, already observed for the synchrotron components of other BL Lac sources, can be explained if the emitting particles are accelerated by some statistical mechanism having a probability of energy gain that is a decreasing function of the energy itself.

K88 Fimbrial Adhesin Targeting of Microspheres Containing Gentamicin Made with Albumin Glycated with Lactose.

PubMed

Sarabia-Sainz, Andre-I; Sarabia-Sainz, Hector Manuel; Montfort, Gabriela Ramos-Clamont; Mata-Haro, Veronica; Guzman-Partida, Ana María; Guzman, Roberto; Garcia-Soto, Mariano; Vazquez-Moreno, Luz

2015-09-16

The formulation and characterization of gentamicin-loaded microspheres as a delivery system targeting enterotoxigenic Escherichia coli K88 (E. coli K88) was investigated. Glycated albumin with lactose (BSA-glucose-β (4-1) galactose) was used as the microsphere matrix (MS-Lac) and gentamicin included as the transported antibiotic. The proposed target strategy was that exposed galactoses of MS-Lac could be specifically recognized by E. coli K88 adhesins, and the delivery of gentamicin would inhibit bacterial growth. Lactosylated microspheres (MS-Lac1, MS-Lac2 and MS-Lac3) were obtained using a water-in-oil emulsion, containing gentamicin, followed by crosslinking with different concentrations of glutaraldehyde. Electron microscopy displayed spherical particles with a mean size of 10-17 µm. In vitro release of gentamicin from MS-Lac was best fitted to a first order model, and the antibacterial activity of encapsulated and free gentamicin was comparable. MS-Lac treatments were recognized by plant galactose-specific lectins from Ricinus communis and Sophora japonica and by E. coli K88 adhesins. Results indicate MS-Lac1, produced with 4.2 mg/mL of crosslinker, as the best treatment and that lactosylated microsphere are promising platforms to obtain an active, targeted system against E. coli K88 infections.

K88 Fimbrial Adhesin Targeting of Microspheres Containing Gentamicin Made with Albumin Glycated with Lactose

PubMed Central

Sarabia-Sainz, Andre-i; Sarabia-Sainz, Hector Manuel; Ramos-Clamont Montfort, Gabriela; Mata-Haro, Veronica; Guzman-Partida, Ana María; Guzman, Roberto; Garcia-Soto, Mariano; Vazquez-Moreno, Luz

2015-01-01

The formulation and characterization of gentamicin-loaded microspheres as a delivery system targeting enterotoxigenic Escherichia coli K88 (E. coli K88) was investigated. Glycated albumin with lactose (BSA-glucose-β (4-1) galactose) was used as the microsphere matrix (MS-Lac) and gentamicin included as the transported antibiotic. The proposed target strategy was that exposed galactoses of MS-Lac could be specifically recognized by E. coli K88 adhesins, and the delivery of gentamicin would inhibit bacterial growth. Lactosylated microspheres (MS-Lac1, MS-Lac2 and MS-Lac3) were obtained using a water-in-oil emulsion, containing gentamicin, followed by crosslinking with different concentrations of glutaraldehyde. Electron microscopy displayed spherical particles with a mean size of 10–17 µm. In vitro release of gentamicin from MS-Lac was best fitted to a first order model, and the antibacterial activity of encapsulated and free gentamicin was comparable. MS-Lac treatments were recognized by plant galactose-specific lectins from Ricinus communis and Sophora japonica and by E. coli K88 adhesins. Results indicate MS-Lac1, produced with 4.2 mg/mL of crosslinker, as the best treatment and that lactosylated microsphere are promising platforms to obtain an active, targeted system against E. coli K88 infections. PMID:26389896

Contemporaneous broadband observations of three high-redshift BL Lac objects

DOE PAGES

Ackerman, M.

2016-03-20

We have collected broadband spectral energy distributions (SEDs) of three BL Lac objects, 3FGL J0022.1-1855 (z=0.689), 3FGL J0630.9-2406 (z > ~1.239), and 3FGL J0811.2-7529 (z=0.774), detected by Fermi with relatively flat GeV spectra. By observing simultaneously in the near-IR to hard X-ray band, we can well characterize the high end of the synchrotron component of the SED. Thus, fitting the SEDs to synchro-Compton models of the dominant emission from the relativistic jet, we can constrain the underlying particle properties and predict the shape of the GeV Compton component. Standard extragalactic background light (EBL) models explain the high-energy absorption well, withmore » poorer fits for high UV models. The fits show clear evidence for EBL absorption in the Fermi spectrum of our highest redshift source 3FGL J0630.9-2406. While synchrotron self-Compton models adequately describe the SEDs, the situation may be complicated by possible external Compton components.« less

Bacterial Contamination of Anaesthetic and Vasopressor Drugs in the Operating Theatres: Ameliyathanelerde Anestetik ve Vazopressör İlaçların Bakteriyel Kontaminasyonu.

PubMed

Rueangchira-Urai, Rongrong; Rujirojindakul, Panthila; Geater, Alan Frederick; McNeil, Edward

2017-02-01

The aim of this study was to determine the incidence of bacterial and fungal contamination in anaesthetic and vasopressor drugs before and after use in operating theatres. A cross-sectional study was conducted in the operating theatres of a university hospital. We collected 945 samples of three different drugs, namely, propofol, vecuronium and ephedrine, from 20 operating rooms and refrigerators where the unused drugs were stored. Each drug was divided into two groups, the pre-use group and the post-use group. The pre-use drugs were cultured before the patient received the drug. The post-use drugs were cultured after the patient had received the drug or after the drugs had been transferred to other syringes. The culture results were reported as either positive or negative. Out of the 945 drug samples, 26 (2.8%, 95% confidence interval=1.8%-4.0%) gave a positive culture. Of the 317 propofol samples, 20 (6.3%) were found to have bacterial contamination, 11 in the pre-use group and 9 in the post-use group. Of the 318 ephedrine samples, 6 (1.9%) were found to be positive on culture, one in the pre-use group and five in the post-use group. Vecuronium gave no positive cultures. All organisms were non-pathogenic, and no fungal contamination was found. The incidence of bacterial contamination in anaesthetic and vasopressor drugs was 2.8%. Anaesthetic teams must be aware of contamination issues in anaesthetic drugs that have been prepared for later use and, in order to reduce the risk of contamination, they must improve the methods of administering drugs to patients.

Expression of the cloned ColE1 kil gene in normal and Kilr Escherichia coli.

PubMed Central

Altieri, M; Suit, J L; Fan, M L; Luria, S E

1986-01-01

The kil gene of the ColE1 plasmid was cloned under control of the lac promoter. Its expression under this promoter gave rise to the same pattern of bacterial cell damage and lethality as that which accompanies induction of the kil gene in the colicin operon by mitomycin C. This confirms that cell damage after induction is solely due to expression of kil and is independent of the cea or imm gene products. Escherichia coli derivatives resistant to the lethal effects of kil gene expression under either the normal or the lac promoter were isolated and found to fall into several classes, some of which were altered in sensitivity to agents that affect the bacterial envelope. PMID:2946661

The Gamma-Ray Bright BL Lac Object RX J1211+2242

NASA Technical Reports Server (NTRS)

Beckmann, V.; Favre, P.; Tavecchio, F.; Bussien, T.; Fliri, J.; Wolter, A.

2004-01-01

RX J1211+2242 is an optically faint (B approximately equal to 19.2mag) but X-ray bright (f2-10kev = 5 x l0(exp -12)erg per square centimeter per second) AGN, which has been shown to be a BL Lac object at redshift z = 0.455. The ROSAT X-ray, Calar Alto optical, and NVSS radio data suggest that the peak of the synchrotron emission of this object is at energies as high as several keV. BeppoSAX observations have been carried out simultaneously with optical observations in order to extend the coverage to higher energies. The new data indeed indicate a turn-over in the 2 - 10keV energy region. We propose that RX J1211+2242 is the counterpart of the unidentified EGRET source 3EG J1212+2304, making it a gamma-ray emitter with properties similar to, for example, Markarian 501 in its bright state, though being at a much larger distance.

Neuroprotective action of bacterial melanin in rats after corticospinal tract lesions.

PubMed

Petrosyan, Tigran R; Gevorkyan, Olga V; Meliksetyan, Irina B; Hovsepyan, Anna S; Manvelyan, Levon R

2012-04-01

Experiments were performed on 48 albino rats. Part of the experimental animals were initially trained to a balancing instrumental conditioned reflex (ICR). Unilateral bulbar pyramidotomy performed in all rats caused contralateral hemiparesis. On the next day following the operation 24 rats were injected intramuscularly with bacterial melanin solution. 12 of these rats were initially trained to ICR. Recovery periods of ICR and paralyzed hindlimb movements were registered for melanin injected rats (n=24) and for operated rats, not treated with melanin (n=24). In rats injected with bacterial melanin the posttraumatic recovery is shorter than in animals not treated with melanin. The fastest and complete recovery was registered in rats initially trained to ICR and injected after the operation with bacterial melanin. Electrophysiological experiments were performed in transected animals treated with melanin, transected animals without melanin treatment and intact animals. Spiking activity of motoneurons was registered in lumbar motoneurons of rats in response to high frequency stimulation above the corticospinal tract transection. Spiking activity was very similar in motoneurons of melanin injected and intact or non operated animals. In animals, not dosed with bacterial melanin after the operation, areactivity or no change in firing rate was registered in response to stimulus. Stimulation of the corticospinal tract of melanin injected rats produced potentiation of the motoneuronal firing rate and is an evidence of regeneration in corticospinal tract. Similarity in spiking activity of intact and melanin injected rats shows the recovery of conductance in pyramidal tract. Morphohistochemical examination was carried out to confirm the results of behavioral and electrophysiological experiments. Medulla slices were prepared to trace the regeneration of nerve fibers. Examination of transection area revealed that bacterial melanin increases vascularization, dilates the

A KPC-Scale X-Ray Jet in the BL Lac Source S5 2007+777

NASA Technical Reports Server (NTRS)

Sambruna, Rita M.; Donato, Davide; Cheung, C.C.; Tavecchio, F.; Maraschi, L.

2008-01-01

X-ray jets in AGN are commonly observed in FRII and FRI radiogalaxies, but rarely in BL Lacs, most probably due to their orientation close to the line of sight and the ensuing foreshortening effects. Only three BL Lacs are known so far to contain a kpc-scale X-ray jet. In this paper, we present the evidence for the existence of a fourth extended X-ray jet in the classical radio-selected source S5 2007+777, which for its hybrid FRI/II radio morphology has been classified as a HYMOR (HYbrid MOrphology Radio source). Our Chandra ACISS observations of this source revealed an X-ray counterpart to the 19"-long radio jet. Interestingly, the X-ray properties of the kpc-scale jet in S5 2007+777 are very similar to those observed in FRII jets. First, the X-ray morphology closely mirrors the radio one, with the X-rays being concentrated in the discrete radio knots. Second, the X-ray continuum of the jet/brightest knot is described by a very hard power law, with photon index gamma(sub x) approximately 1. Third, the optical upper limit from archival HST data implies a concave radio-to-X-ray SED. If the X-ray emission is attributed to IC/CMB with equipartition, strong beaming (delta= 13) is required, implying a very large scale (Mpc) jet. The beaming requirement can be somewhat relaxed assuming a magnetic field lower than equipartition. Alternatively, synchrotron emission from a second population of very high-energy electrons is viable. Comparison to other HYMOR jets detected with Chandra is discussed, as well as general implications for the origin of the FRI/II division.

Rapid, synchronous, and stable induction of type 1 piliation in Escherichia coli by using a chromosomal lacUV5 promoter.

PubMed Central

Woodall, L D; Russell, P W; Harris, S L; Orndorff, P E

1993-01-01

Type 1 pili are filamentous proteinaceous appendages produced by certain members of the family Enterobacteriaceae. In Escherichia coli, the adhesive properties of these pili are due to the binding of at least one minor pilus component to mannose, a sugar common to cell surface molecules of many eukaryotic cells. The study of pilus assembly may be benefited by a rapid way of inducing pilus synthesis de novo. We describe herein the construction and characterization of a strain in which piliation can be rapidly induced by the addition of lactose or its analog isopropyl-beta-D-thiogalactopyranoside. This was accomplished by placing the chromosomal fimA gene (encoding the major structural subunit of pili) under lacUV5 promoter control. Further experiments suggested that transcription of genes downstream of fimA, whose products are required for normal pilus assembly and function, may also be controlled by the lacUV5 promoter. The construction described herein may have a variety of applications apart from aiding the study of pilus assembly since its adhesive properties can be rapidly and easily turned on and off. Images PMID:8097517

A 400-year phytolith-based reconstruction of wild rice (Zizania palustris) abundance from Mud Lake core sediments, Fond du Lac Band of Lake Superior Chippewa Reservation, Minnesota, USA.

NASA Astrophysics Data System (ADS)

Munoz, R.; Caylor, E.; Yost, C. L.; Drake, C.; Ladwig, J. L.; Myrbo, A.; Howes, T.

2014-12-01

Wild rice (Zizania palustris L.) is an aquatic grass with spiritual and subsistence significance to Native people of the Great Lakes region of North America. Mud Lake (Mashkiigwaagamaag), located on the Fond du Lac Band of Lake Superior Chippewa Reservation in Carlton County, Minnesota, USA, once supported an extensive population of wild rice (manoomin). However, early 20th century attempts to ditch and drain surrounding wetlands for landuse intensification severely altered the natural hydrological system that supports wild rice. Fond du Lac Resource Management (FDLRM) technicians are currently working to increase the wild rice population in Mud Lake. As part of these efforts, this phytolith study was undertaken to better understand how wild rice abundance has fluctuated over the past 400 years, with particular emphasis on the 19th and 20th centuries. Phytoliths are microscopic opal silica plant remains that are incorporated into soils and lake sediments after the plant-parts that contain them decay. Wild rice produces phytolith morphotypes that are unequivocally diagnostic. Mud Lake core MNMN-MUD11-1C-1P-1 (46°43'38.39"N, 92°42'2.45"W) was piston cored by LacCore (National Lacustrine Core Facility) and FDLRM technicians on 24 May 2011. Initial core descriptions, multi-sensor core logging, phytolith sampling and phytolith extractions were completed during the summer of 2014 at LacCore. Wild rice phytolith identification and quantification was conducted on twelve samples using brightfield microscopy at 400x magnification. Wild rice phytolith concentration values ranged from 68 to 2,300 phytoliths/cm3. Wild rice accumulation rates ranged from 9 to 383 phytoliths/ cm2/yr, peaking in 1952 AD. Wild rice abundance in Mud Lake appears to be influenced by a complex set of variables that include anthropogenic disturbance, climatic events and aquatic plant community succession.

Bacterial communities in the phylloplane of Prunus species.

PubMed

Jo, Yeonhwa; Cho, Jin Kyong; Choi, Hoseong; Chu, Hyosub; Lian, Sen; Cho, Won Kyong

2015-04-01

Bacterial populations in the phylloplane of four different Prunus species were investigated by 16 S rRNA pyrosequencing. Bioinformatic analysis identified an average of 510 operational taxonomic units belonging to 159 genera in 76 families. The two genera, Sphingomonas and Methylobacterium, were dominant in the phylloplane of four Prunus species. Twenty three genera were commonly identified in the four Prunus species, indicating a high level of bacterial diversity dependent on the plant species. Our study based on 16 S rRNA sequencing reveals the complexity of bacterial diversity in the phylloplane of Prunus species in detail. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Two-Swim Operators in the Modified Bacterial Foraging Algorithm for the Optimal Synthesis of Four-Bar Mechanisms

PubMed Central

Hernández-Ocaña, Betania; Pozos-Parra, Ma. Del Pilar; Mezura-Montes, Efrén; Portilla-Flores, Edgar Alfredo; Vega-Alvarado, Eduardo; Calva-Yáñez, Maria Bárbara

2016-01-01

This paper presents two-swim operators to be added to the chemotaxis process of the modified bacterial foraging optimization algorithm to solve three instances of the synthesis of four-bar planar mechanisms. One swim favors exploration while the second one promotes fine movements in the neighborhood of each bacterium. The combined effect of the new operators looks to increase the production of better solutions during the search. As a consequence, the ability of the algorithm to escape from local optimum solutions is enhanced. The algorithm is tested through four experiments and its results are compared against two BFOA-based algorithms and also against a differential evolution algorithm designed for mechanical design problems. The overall results indicate that the proposed algorithm outperforms other BFOA-based approaches and finds highly competitive mechanisms, with a single set of parameter values and with less evaluations in the first synthesis problem, with respect to those mechanisms obtained by the differential evolution algorithm, which needed a parameter fine-tuning process for each optimization problem. PMID:27057156

Two-Swim Operators in the Modified Bacterial Foraging Algorithm for the Optimal Synthesis of Four-Bar Mechanisms.

PubMed

Hernández-Ocaña, Betania; Pozos-Parra, Ma Del Pilar; Mezura-Montes, Efrén; Portilla-Flores, Edgar Alfredo; Vega-Alvarado, Eduardo; Calva-Yáñez, Maria Bárbara

2016-01-01

This paper presents two-swim operators to be added to the chemotaxis process of the modified bacterial foraging optimization algorithm to solve three instances of the synthesis of four-bar planar mechanisms. One swim favors exploration while the second one promotes fine movements in the neighborhood of each bacterium. The combined effect of the new operators looks to increase the production of better solutions during the search. As a consequence, the ability of the algorithm to escape from local optimum solutions is enhanced. The algorithm is tested through four experiments and its results are compared against two BFOA-based algorithms and also against a differential evolution algorithm designed for mechanical design problems. The overall results indicate that the proposed algorithm outperforms other BFOA-based approaches and finds highly competitive mechanisms, with a single set of parameter values and with less evaluations in the first synthesis problem, with respect to those mechanisms obtained by the differential evolution algorithm, which needed a parameter fine-tuning process for each optimization problem.

Learning and evolution in bacterial taxis: an operational amplifier circuit modeling the computational dynamics of the prokaryotic 'two component system' protein network.

PubMed

Di Paola, Vieri; Marijuán, Pedro C; Lahoz-Beltra, Rafael

2004-01-01

Adaptive behavior in unicellular organisms (i.e., bacteria) depends on highly organized networks of proteins governing purposefully the myriad of molecular processes occurring within the cellular system. For instance, bacteria are able to explore the environment within which they develop by utilizing the motility of their flagellar system as well as a sophisticated biochemical navigation system that samples the environmental conditions surrounding the cell, searching for nutrients or moving away from toxic substances or dangerous physical conditions. In this paper we discuss how proteins of the intervening signal transduction network could be modeled as artificial neurons, simulating the dynamical aspects of the bacterial taxis. The model is based on the assumption that, in some important aspects, proteins can be considered as processing elements or McCulloch-Pitts artificial neurons that transfer and process information from the bacterium's membrane surface to the flagellar motor. This simulation of bacterial taxis has been carried out on a hardware realization of a McCulloch-Pitts artificial neuron using an operational amplifier. Based on the behavior of the operational amplifier we produce a model of the interaction between CheY and FliM, elements of the prokaryotic two component system controlling chemotaxis, as well as a simulation of learning and evolution processes in bacterial taxis. On the one side, our simulation results indicate that, computationally, these protein 'switches' are similar to McCulloch-Pitts artificial neurons, suggesting a bridge between evolution and learning in dynamical systems at cellular and molecular levels and the evolutive hardware approach. On the other side, important protein 'tactilizing' properties are not tapped by the model, and this suggests further complexity steps to explore in the approach to biological molecular computing.

Fermi LAT detection of a GeV flare from the high redshift BL Lac object PKS 2131-021

NASA Astrophysics Data System (ADS)

Ciprini, Stefano

2012-08-01

The Large Area Telescope (LAT), one of the two instruments on the Fermi Gamma-ray Space Telescope, has observed gamma-ray flaring activity from a source positionally consistent with the BL Lac object PKS 2131-021 (also known as 2FGL J2133.8-0154, Nolan et al. 2012, ApJS, 199, 31, and 4C -02.81) placed at radio coordinates R.A.: 323.5429567 deg, Dec.: -1.8881217 deg (J2000, Johnston et al. 1995, AJ, 110, 880).

Multiple reservoirs contribute to intraoperative bacterial transmission.

PubMed

Loftus, Randy W; Brown, Jeremiah R; Koff, Matthew D; Reddy, Sundara; Heard, Stephen O; Patel, Hetal M; Fernandez, Patrick G; Beach, Michael L; Corwin, Howard L; Jensen, Jens T; Kispert, David; Huysman, Bridget; Dodds, Thomas M; Ruoff, Kathryn L; Yeager, Mark P

2012-06-01

Intraoperative stopcock contamination is a frequent event associated with increased patient mortality. In the current study we examined the relative contributions of anesthesia provider hands, the patient, and the patient environment to stopcock contamination. Our secondary aims were to identify risk factors for stopcock contamination and to examine the prior association of stopcock contamination with 30-day postoperative infection and mortality. Additional microbiological analyses were completed to determine the prevalence of bacterial pathogens within intraoperative bacterial reservoirs. Pulsed-field gel electrophoresis was used to assess the contribution of reservoir bacterial pathogens to 30-day postoperative infections. In a multicenter study, stopcock transmission events were observed in 274 operating rooms, with the first and second cases of the day in each operating room studied in series to identify within- and between-case transmission events. Reservoir bacterial cultures were obtained and compared with stopcock set isolates to determine the origin of stopcock contamination. Between-case transmission was defined by the isolation of 1 or more bacterial isolates from the stopcock set of a subsequent case (case 2) that were identical to reservoir isolates from the preceding case (case 1). Within-case transmission was defined by the isolation of 1 or more bacterial isolates from a stopcock set that were identical to bacterial reservoirs from the same case. Bacterial pathogens within these reservoirs were identified, and their potential contribution to postoperative infections was evaluated. All patients were followed for 30 days postoperatively for the development of infection and all-cause mortality. Stopcock contamination was detected in 23% (126 out of 548) of cases with 14 between-case and 30 within-case transmission events confirmed. All 3 reservoirs contributed to between-case (64% environment, 14% patient, and 21% provider) and within-case (47

Seeing red; the development of pON.mCherry, a broad-host range constitutive expression plasmid for Gram-negative bacteria.

PubMed

Gebhardt, Michael J; Jacobson, Rachael K; Shuman, Howard A

2017-01-01

The development of plasmid-mediated gene expression control in bacteria revolutionized the field of bacteriology. Many of these expression control systems rely on the addition of small molecules, generally metabolites or non-metabolized analogs thereof, to the growth medium to induce expression of the genes of interest. The paradigmatic example of an expression control system is the lac system from Escherichia coli, which typically relies on the Ptac promoter and the Lac repressor, LacI. In many cases, however, constitutive gene expression is desired, and other experimental approaches require the coordinated control of multiple genes. While multiple systems have been developed for use in E. coli and its close relatives, the utility and/or functionality of these tools does not always translate to other species. For example, for the Gram-negative pathogen, Legionella pneumophila, a causative agent of Legionnaires' Disease, the aforementioned Ptac system represents the only well-established expression control system. In order to enhance the tools available to study bacterial gene expression in L. pneumophila, we developed a plasmid, pON.mCherry, which confers constitutive gene expression from a mutagenized LacI binding site. We demonstrate that pON.mCherry neither interferes with other plasmids harboring an intact LacI-Ptac expression system nor alters the growth of Legionella species during intracellular growth. Furthermore, the broad-host range plasmid backbone of pON.mCherry allows constitutive gene expression in a wide variety of Gram-negative bacterial species, making pON.mCherry a useful tool for the greater research community.

Genotype to Phenotype Mapping of the E. coli lac Promoter

NASA Astrophysics Data System (ADS)

Otwinowski, Jakub; Nemenman, Ilya

2014-03-01

Genotype-to-phenotype maps and the related fitness landscapes that include epistatic interactions are difficult to measure because of their high dimensional structure. Here we construct such a map using the recently collected corpora of high-throughput sequence data from the 75 base pairs long mutagenized E. coli lac promoter region, where each sequence is associated with induced transcriptional activity measured by a fluorescent reporter. We find that the additive (non-epistatic) contributions of individual mutations account for about two-thirds of the explainable phenotype variance, while pairwise epistasis explains about 7% of the variance for the full mutagenized sequence and about 15% for the subsequence associated with protein binding sites. Surprisingly, there is no evidence for third order epistatic contributions, and our inferred fitness landscape is essentially single peaked, with a small amount of antagonistic epistasis. We identify transcription factor (CRP) and RNA polymerase binding sites in the promotor region and their interactions. We conclude with a cautionary note that inferred properties of fitness landscapes may be severely influenced by biases in the sequence data. Funded in part by HFSP and James S. McDonnell Foundation.

Multiple Ant Species Tending Lac Insect Kerria yunnanensis (Hemiptera: Kerriidae) Provide Asymmetric Protection against Parasitoids

PubMed Central

Li, Qiao; Hoffmann, Benjamin D.; Zhang, Wei

2014-01-01

This study investigated the effects of ant attendance on the parasitoid community and parasitism of lac insect Kerria yunnanensis aggregations in Yunnan province, China. We manipulated ant attendance to establish three treatments: (1) ant exclusion; (2) low ant attendance by several ant species; and (3) high ant attendance by Crematogaster macaoensis. Five parasitoid species were collected, with two species contributing 82.7 and 13.2% of total abundance respectively. Total parasitoid abundance was lowest in the February sample when K. yunnanensis was in its younger life stage, being significantly lower in the ant exclusion treatment. In April, all three treatments had significantly different parasitoid abundances, being highest in the ant exclusion treatment and the lowest in the high ant attendance treatment. When ants were present, there were strong negative relationships between total parasitoid abundance and ant abundance, with the relationships being dependent upon the ant species composition and abundance. The patterns of total parasitoid abundance were driven by the two most abundant parasitoid species. Parasitoid species richness did not differ among treatments or between sample times, however, multivariate analysis confirmed that overall parasitoid community structure differed significantly among treatments and between sample times, with the high ant attendance treatment differing most from the other two treatments. Interestingly the absence of ants did not result in increased parasitism from four of the five parasitoids. Ants in lac insect farming systems have a clear role for agricultural pest management. A full understanding of the asymmetric abilities of ants to influence parasitoid communities, and affect parasitism of hosts will require further experimental manipulation to assess the relative roles of 1) the abundance of each individual ant species on parasitoid access to hosts, 2) competition among parasitoids, and 3) the interaction between the

Bacterial community structure in the drinking water microbiome is governed by filtration processes.

PubMed

Pinto, Ameet J; Xi, Chuanwu; Raskin, Lutgarde

2012-08-21

The bacterial community structure of a drinking water microbiome was characterized over three seasons using 16S rRNA gene based pyrosequencing of samples obtained from source water (a mix of a groundwater and a surface water), different points in a drinking water plant operated to treat this source water, and in the associated drinking water distribution system. Even though the source water was shown to seed the drinking water microbiome, treatment process operations limit the source water's influence on the distribution system bacterial community. Rather, in this plant, filtration by dual media rapid sand filters played a primary role in shaping the distribution system bacterial community over seasonal time scales as the filters harbored a stable bacterial community that seeded the water treatment processes past filtration. Bacterial taxa that colonized the filter and sloughed off in the filter effluent were able to persist in the distribution system despite disinfection of finished water by chloramination and filter backwashing with chloraminated backwash water. Thus, filter colonization presents a possible ecological survival strategy for bacterial communities in drinking water systems, which presents an opportunity to control the drinking water microbiome by manipulating the filter microbial community. Grouping bacterial taxa based on their association with the filter helped to elucidate relationships between the abundance of bacterial groups and water quality parameters and showed that pH was the strongest regulator of the bacterial community in the sampled drinking water system.

Development of a bacterial screen for novel hypoxanthine-guanine phosphoribosyltransferase substrates.

PubMed

Shivashankar, K; Subbayya, I N; Balaram, H

2001-10-01

The lack of de novo purine biosynthesis in many parasitic protozoans makes the enzymes in the salvage of purines attractive chemotherapeutic targets. Hypoxanthine-guanine phosphoribosyltransferase (HGPRT) is a key enzyme for purine salvage and bacterial complementation screens for HGPRT inhibitors are known. The low KMS for purine bases makes purine analogs unattractive as competitive inhibitors for this enzyme. Despite the availability of many crystal structures of HGPRTs, it is only recently that selective inhibitors of the enzyme have been developed. Therefore, novel purine analogs which act as substrates for the HGPRT reaction and thereby inhibit downstream enzymes or get incorporated into the nucleotide pool are an attractive altenative for drug design. We have used a combination of two E. coli strains Sphi606 (ara, deltapro-gpt-lac, thi, hpt) and Sphi609 (ara, deltapro-gpt-lac, thi, hpt, pup, purH,J, strA) to identify inhibitors and substrates of HGPRT. E. coli Sphi609 is deficient in both de novo synthesis as well as salvage enzymes of purine nucleotide synthesis, while E. coli Sphi606 is deficient in salvage enzymes only. Hence, expression of functional HGPRTs in E. coli Sphi606 grown in minimal medium makes it susceptible to HGPRT substrates, which inhibit downstream processes. Growth of E. coli Sphi609 in minimal medium can be made conditional for the expression of a functional HGPRT and this growth would be susceptible to both HGPRT substrate analogs and inhibitors. A substance that strictly acts as an inhibitor will affect growth of transformed E. coli Sphi609 only. For this purpose, we compared the human and P. falciparum enzymes with known HGPRT substrate analogs. Our data with 6-mercaptopurine, 6-thioguanine and allopurinol show that these compounds act by being substrates for HGPRT. Our results with allopurinol suggest that it is a better substrate for P. falciparum HGXPRT than the human enzyme. Therefore, species-specific substrates can be tested

Outreach, Diversity, and Education Supported by NSF Facilities LacCore and the Continental Scientific Drilling Coordination Office (CSDCO), University of Minnesota

NASA Astrophysics Data System (ADS)

Myrbo, A.

2015-12-01

Climatic and environmental change are a powerful hook to engage students and the public with geoscience. Recent lake sediments often feature visual and compositional evidence of anthropogenic changes, which can pique curiosity and serve as a gateway for interest in more remote past changes. Cores provide an integrative, place-based geoscience education/outreach platform: lake dynamics incorporate principles of chemistry, physics, and biology; lake basin formation and sedimentary signals trace back to numerous geoscience subdisciplines. Lakes reflect local changes, and so are inherently place-based and relevant to both rural and urban populations. The esthetics of lakes in the landscape and sediments under the microscope spark the artistic sensibilities of those who do not consider themselves scientists: lakes are readymade for STEAM education. LacCore has exploited the magic of lake sediment cores in its 15 years as an NSF Facility, and now expands to additional environments as the NSF Continental Scientific Drilling Coordination Office. Part of scaling up is the formalization of major support for the Broader Impacts (BI) activities of Facility users. LacCore/CSDCO now musters its collaborative experiences in site REUs and other undergrad research projects, in-depth training of students, teachers, and faculty, a long list of informal education experiences, and common-good software development, to provide assistance to researchers seeking meaningful broader impacts and educators seeking extra- or co-curricular field and laboratory research experiences for their students. Outreach, diversity, and education support includes dissemination of best practices, as well as coordination, administration, and basic capacity for such activities in collaboration with project PIs and students, through no-cost support, or collaborative proposals or supplements from NSF where necessary for project scale. Community-driven research and broadening participation are central to the

Water- and Bed-Sediment Quality of Seguchie Creek and Selected Wetlands Tributary to Mille Lacs Lake in Crow Wing County, Minnesota, October 2003 to October 2006

USGS Publications Warehouse

Fallon, James D.; Yaeger, Christine S.

2009-01-01

Mille Lacs Lake and its tributaries, located in east-central Minnesota, are important resources to the public. In addition, many wetlands and lakes that feed Mille Lacs Lake are of high resource quality and vulnerable to degradation. Construction of a new four-lane expansion of U.S. Highway 169 has been planned along the western part of the drainage area of Mille Lacs Lake in Crow Wing County. Concerns exist that the proposed highway could affect the resource quality of surface waters tributary to Mille Lacs Lake. Baseline water- and bed-sediment quality characteristics of surface waters tributary to Mille Lacs Lake were needed prior to the proposed highway construction. The U.S. Geological Survey, in cooperation with the Minnesota Department of Transportation, characterized the water- and bed-sediment quality at selected locations that the proposed route intersects from October 2003 to October 2006. Locations included Seguchie Creek upstream and downstream from the proposed route and three wetlands draining to Mille Lacs Lake. The mean streamflow of Seguchie Creek increased between the two sites: flow at the downstream streamflow-gaging station of 0.22 cubic meter per second was 5.6 percent greater than the mean streamflow at the upstream streamflow-gaging station of 0.21 cubic meter per second. Because of the large amount of storage immediately upstream from both gaging stations, increases in flow were gradual even during intense precipitation. The ranges of most constituent concentrations in water were nearly identical between the two sampling sites on Seguchie Creek. No concentrations exceeded applicable water-quality standards set by the State of Minnesota. Dissolved-oxygen concentrations at the downstream gaging station were less than the daily minimum standard of 4.0 milligrams per liter for 6 of 26 measurements. Constituent loads in Seguchie Creek were greater at the downstream site than the upstream site for all measured, including dissolved chloride (1

Intensive Variables in Primary Kimberlite Magmas (Lac de Gras, N.W.T., Canada) and Application for Diamond Preservation

NASA Astrophysics Data System (ADS)

Fedortchouk, Y.; Canil, D.; Carlson, J. A.

2002-12-01

Crystallization temperatures (T) and oxygen fugacity (fO2) are not well constrained for kimberlites. Knowledge of these intensive variables of kimberlite melt is important for understanding the origin and evolution of kimberlites and prediction of diamond preservation in the magma. Difficulties in interpreting the equilibrium mineral assemblages in kimberlites and the high degree of secondary alteration usually complicate use of mineral geothermometers and oxygen barometers. Some of Lac de Gras (N.W.T., Canada) kimberlites are extremely fresh and provide opportunity to apply mineral thermobarometers. The presence of numerous chromite inclusions in the rims of olivine phenocrysts allows application of the olivine-spinel thermometer and oxygen barometer to constrain T and fO2 of the melt. We performed T and fO2 calculations on samples from three kimberlite pipes - the Leslie, Aaron and Grizzly. The T obtained from olivine - chromite pairs for crystallization of olivine phenocryst rims are 1050° to 1100°C +/- 50°C (calculated at 1 GPa). Few olivine - chromite pairs from Leslie and Grizzly record higher temperatures of 1250° - 1350°C. The cores of olivine phenocrysts usually lack chromite inclusions and their crystallization T and fO2 could not be estimated. The fO2 recorded by coexisting olivine and chromite are +0.3 to 1.0 +/- 0.4 log units more oxidized than the nickel-nickel oxide (NNO) buffer. The established fO2 of kimberlites would require fO2 in their mantle source to be higher than that of cratonic mantle and oceanic lithosphere producing MORB's but comparable to the source of subduction-related magmas. The T and fO2 for the Lac de Gras kimberlites constrain the path of any mantle material entrained in these magmas in fO2-T-P space and provide limits on diamond destructive processes. Diamonds are not stable in kimberlite magma and are oxidized to CO2 or converted into graphite. The former process is more favorable for their preservation. The results of

California Black Oak Drying Problems and the Bacterial Factor.

DTIC Science & Technology

1979-01-01

operations in Anderson area and to adjacent kilns by spacing stickers 18 inches apart and Georgia and wondered if bacterial tree drying softwood lumber at...on stickers in a weighted, volatile fatty acids which are the sapwood , and then from the outer, covered pile placed outdoors on the characteristic of...1. JT~~~ Figure 1 —Scanning electron micrographs of nonintected sapwood (A-B) and bacterially infected heartwood (C-D) from

New Light Curves and Analysis of the Overcontact Binaries PP Lac and DK Sge

NASA Astrophysics Data System (ADS)

Sanders, S. J.; Hargis, J. R.; Bradstreet, D. H.

2004-12-01

As a by-product of the ongoing work with the Catalog and AtLas of Eclipsing Binaries database (CALEB; Bradstreet et al. 2004), several hundred eclipsing binary systems have been identified that have either unpublished or poor quality light curves. We present new V & Rc light curves for the overcontact systems PP Lac and DK Sge, both chosen because their deep eclipses (peak-to-peak amplitudes of nearly 0.7 mag) help constrain the light curve modelling. Data were obtained using the 41-cm telescope at the Eastern University Observatory equipped with an SBIG ST-10XME CCD. PP Lac (P= 0.40116 d) is a W-type contact binary with only one previously published light curve (Dumont & Maraziti 1990), but the data are sparse and almost non-existent at primary eclipse. Modelling of these data gave varying results; the published mass ratios differ by nearly 0.3. Our data confirms the noted differing eclipse depths but we find the primary eclipse to be total. We present a new light curve solution using Binary Maker 3 (Bradstreet & Steelman 2002) and Wilson-Devinney, finding the mass ratio to be well-constrained by the duration of total eclipse. A period study will be presented using previously existing and newly derived times of minimum light. DK Sge (P=0.62182 d) appears to be an A-type contact binary with no published light curve. The eclipses are partial, with the primary eclipse being deeper by about 0.08 mag. The maxima show evidence of a slight asymmetry, although the light curve appears to be repeatable over the 1 month of observations. We present the first light curve solution using Binary Maker 3 and Wilson-Devinney, but have limited mass ratio constraints due to the absence of radial velocity data. A period study will be presented using previously existing and newly derived times of minimum light.

Fermi-LAT detection of a GeV flare from the BL Lac object 1ES 2322-409

NASA Astrophysics Data System (ADS)

Ciprini, Stefano

2013-10-01

The Large Area Telescope (LAT), one of the two instruments on the Fermi Gamma-ray Space Telescope, has observed an increasing gamma-ray flux from a source positionally consistent with the BL Lac object 1ES 2322-409 (also know as 2FGL J2324.7-4042, Nolan et al. 2012, ApJS, 199, 31, and as 1FHL J2324.6-4041, Ackermann et al., ApJS, submitted, arXiv:1306.6772), with 2MASS counterpart coordinates, (J2000.0), R.A.: 351.18612 deg, Dec: -40.68036 deg (Mao 2011, New Ast., 16, 503).

Attachment to place in advanced age: A study of the LiLACS NZ cohort.

PubMed

Wiles, Janine L; Rolleston, Anna; Pillai, Avinesh; Broad, Joanna; Teh, Ruth; Gott, Merryn; Kerse, Ngaire

2017-07-01

An extensive body of research theorises that attachment to place is positively associated with health, particularly for older people. Building on this, we measure how indicators of attachment to place are associated with health for in people of advanced age in New Zealand. We use data from a cohort study (LiLACS NZ), which includes an indigenous Māori cohort aged 80-90 years and a non-Māori cohort aged 85 years from a mixed urban/rural region in New Zealand. Each cohort undertook a comprehensive interview and health assessment (n = 267 Māori and n = 404 non-Māori). Using multivariate regression analyses, we explore participants' feelings for and connectedness with their home, community and neighbourhood; nature and the outdoors; expectations about and enthusiasm for residential mobility; and how all these are associated with measures of health (e.g., SF-12 physical and mental health related quality of life) and functional status (e.g., NEADL). We demonstrate that people in advanced age hold strong feelings of attachment to place. We also establish some positive associations between attachment to place and health in advanced age, and show how these differ for the indigenous and non-indigenous cohorts. For older Māori there were strong associations between various health measures and the importance of nature and the outdoors, and connectedness to neighbourhood and community. For older non-Māori, there were strong associations between health and liking home and neighbourhood, and feeling connected to their community and neighbourhood. Place attachment, and particularly its relationship to health, operates in different ways for different groups. Copyright © 2017 Elsevier Ltd. All rights reserved.

Bacterial carbon utilization in vertical subsurface flow constructed wetlands.

PubMed

Tietz, Alexandra; Langergraber, Günter; Watzinger, Andrea; Haberl, Raimund; Kirschner, Alexander K T

2008-03-01

Subsurface vertical flow constructed wetlands with intermittent loading are considered as state of the art and can comply with stringent effluent requirements. It is usually assumed that microbial activity in the filter body of constructed wetlands, responsible for the removal of carbon and nitrogen, relies mainly on bacterially mediated transformations. However, little quantitative information is available on the distribution of bacterial biomass and production in the "black-box" constructed wetland. The spatial distribution of bacterial carbon utilization, based on bacterial (14)C-leucine incorporation measurements, was investigated for the filter body of planted and unplanted indoor pilot-scale constructed wetlands, as well as for a planted outdoor constructed wetland. A simple mass-balance approach was applied to explain the bacterially catalysed organic matter degradation in this system by comparing estimated bacterial carbon utilization rates with simultaneously measured carbon reduction values. The pilot-scale constructed wetlands proved to be a suitable model system for investigating microbial carbon utilization in constructed wetlands. Under an ideal operating mode, the bulk of bacterial productivity occurred within the first 10cm of the filter body. Plants seemed to have no significant influence on productivity and biomass of bacteria, as well as on wastewater total organic carbon removal.

Electrotransformation and expression of bacterial genes encoding hygromycin phosphotransferase and beta-galactosidase in the pathogenic fungus Histoplasma capsulatum.

PubMed

Woods, J P; Heinecke, E L; Goldman, W E

1998-04-01

We developed an efficient electrotransformation system for the pathogenic fungus Histoplasma capsulatum and used it to examine the effects of features of the transforming DNA on transformation efficiency and fate of the transforming DNA and to demonstrate fungal expression of two recombinant Escherichia coli genes, hph and lacZ. Linearized DNA and plasmids containing Histoplasma telomeric sequences showed the greatest transformation efficiencies, while the plasmid vector had no significant effect, nor did the derivation of the selectable URA5 marker (native Histoplasma gene or a heterologous Podospora anserina gene). Electrotransformation resulted in more frequent multimerization, other modification, or possibly chromosomal integration of transforming telomeric plasmids when saturating amounts of DNA were used, but this effect was not observed with smaller amounts of transforming DNA. We developed another selection system using a hygromycin B resistance marker from plasmid pAN7-1, consisting of the E. coli hph gene flanked by Aspergillus nidulans promoter and terminator sequences. Much of the heterologous fungal sequences could be removed without compromising function in H. capsulatum, allowing construction of a substantially smaller effective marker fragment. Transformation efficiency increased when nonselective conditions were maintained for a time after electrotransformation before selection with the protein synthesis inhibitor hygromycin B was imposed. Finally, we constructed a readily detectable and quantifiable reporter gene by fusing Histoplasma URA5 with E. coli lacZ, resulting in expression of functional beta-galactosidase in H. capsulatum. Demonstration of expression of bacterial genes as effective selectable markers and reporters, together with a highly efficient electrotransformation system, provide valuable approaches for molecular genetic analysis and manipulation of H. capsulatum, which have proven useful for examination of targeted gene disruption

Identification of a Dehydrogenase Required for Lactose Metabolism in Caulobacter crescentus▿ †‡

PubMed Central

Arellano, Benjamin H.; Ortiz, Janett D.; Manzano, Janet; Chen, Joseph C.

2010-01-01

Caulobacter crescentus, which thrives in freshwater environments with low nutrient levels, serves as a model system for studying bacterial cell cycle regulation and organelle development. We examined its ability to utilize lactose (i) to gain insight into the metabolic capacities of oligotrophic bacteria and (ii) to obtain an additional genetic tool for studying this model organism, aiming to eliminate the basal enzymatic activity that hydrolyzes the chromogenic substrate 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-gal). Using a previously isolated transposon mutant, we identified a gene, lacA, that is required for growth on lactose as the sole carbon source and for turning colonies blue in the presence of X-gal. LacA, which contains a glucose-methanol-choline (GMC) oxidoreductase domain, has homology to the flavin subunit of Pectobacterium cypripedii's gluconate dehydrogenase. Sequence comparisons indicated that two genes near lacA, lacB and lacC, encode the other subunits of the membrane-bound dehydrogenase. In addition to lactose, all three lac genes are involved in the catabolism of three other β-galactosides (lactulose, lactitol, and methyl-β-d-galactoside) and two glucosides (salicin and trehalose). Dehydrogenase assays confirmed that the lac gene products oxidize lactose, salicin, and trehalose. This enzymatic activity is inducible, and increased lac expression in the presence of lactose and salicin likely contributes to the induction. Expression of lacA also depends on the presence of the lac genes, implying that the dehydrogenase participates in induction. The involvement of a dehydrogenase suggests that degradation of lactose and other sugars in C. crescentus may resemble a proposed pathway in Agrobacterium tumefaciens. PMID:20190087

Formation of DNA adducts and induction of lacI mutations in Big Blue Rat-2 cells treated with temozolomide: implications for the treatment of low-grade adult and pediatric brain tumors.

PubMed

Bodell, William J; Gaikwad, Nilesh W; Miller, Douglas; Berger, Mitchel S

2003-06-01

Temozolomide (TMZ) is a chemotherapeutic agent used in the treatment of high-grade brain tumors. Treatment of patients with alkylating chemotherapeutic agents has been established to increase their risk for acute myelogenous leukemia. The formation of DNA adducts and induction of mutations are likely to play a role in the etiology of therapy-related acute myeloid leukemia. To evaluate this issue for TMZ, we have measured the formation of DNA adducts and induction of lacI mutations in Big Blue Rat-2 cells treated with TMZ. Treatment of Big Blue Rat-2 cells with either 0, 0.5, or 1 mM TMZ resulted in lacI mutant frequencies of 9.1 +/- 2.9 x 10(-5), 48.9 +/- 12 x 10(-5), and 89.7 +/- 40.3 x 10(-5), respectively. Comparison of the mutant frequencies demonstrated that 0.5 and 1 mM TMZ treatments increased the mutant frequencies by 5.3- and 9.8-fold and that this increase was significant (P < 0.001). Sequence analysis of the lacI mutants from the TMZ treatment group demonstrated that they were GC-->AT transitions at non-CpG sites, which is significantly different from the mutation spectrum observed in the control treatment group. Treatment of Big Blue Rat-2 cells with various concentrations of TMZ produced a linear increase in the levels of N7-methylguanine and O(6)-methylguanine. The lacI mutation spectrum induced by TMZ treatment is consistent with these mutations being produced by O(6)-MeG. This study establishes TMZ has significant mutagenic potential and suggests that careful consideration in the use of TMZ for the treatment of low-grade adult and pediatric brain tumors should be given.

Predictive value of decoy receptor 3 in postoperative nosocomial bacterial meningitis.

PubMed

Liu, Yong-Juan; Shao, Li-Hua; Wang, Qian; Zhang, Jian; Ma, Rui-Ping; Liu, Hai-Hong; Dong, Xiao-Meng; Ma, Li-Xian

2014-11-03

Nosocomial bacterial meningitis requires timely treatment, but what is difficult is the prompt and accurate diagnosis of this disease. The aim of this study was to assess the potential role of decoy receptor 3 (DcR3) levels in the differentiation of bacterial meningitis from non-bacterial meningitis. A total of 123 patients were recruited in this study, among them 80 patients being with bacterial meningitis and 43 patients with non-bacterial meningitis. Bacterial meningitis was confirmed by bacterial culture of cerebrospinal fluid (CSF) culture and enzyme-linked immunosorbent assay (ELISA) was used to detect the level of DcR3 in CSF. CSF levels of DcR3 were statistically significant between patients with bacterial meningitis and those with non-bacterial meningitis (p<0.001). A total of 48.75% of patients with bacterial meningitis received antibiotic>24 h before CSF sampling, which was much higher than that of non-bacterial meningitis. CSF leucocyte count yielded the highest diagnostic value, with an area under the receiver operating characteristic curve (ROC) of 0.928, followed by DcR3. At a critical value of 0.201 ng/mL for DcR3, the sensitivity and specificity were 78.75% and 81.40% respectively. DcR3 in CSF may be a valuable predictor for differentiating patients with bacterial meningitis from those with non-bacterial meningitis. Further studies are needed for the validation of this study.

Predictive Value of Decoy Receptor 3 in Postoperative Nosocomial Bacterial Meningitis

PubMed Central

Liu, Yong-Juan; Shao, Li-Hua; Wang, Qian; Zhang, Jian; Ma, Rui-Ping; Liu, Hai-Hong; Dong, Xiao-Meng; Ma, Li-Xian

2014-01-01

Nosocomial bacterial meningitis requires timely treatment, but what is difficult is the prompt and accurate diagnosis of this disease. The aim of this study was to assess the potential role of decoy receptor 3 (DcR3) levels in the differentiation of bacterial meningitis from non-bacterial meningitis. A total of 123 patients were recruited in this study, among them 80 patients being with bacterial meningitis and 43 patients with non-bacterial meningitis. Bacterial meningitis was confirmed by bacterial culture of cerebrospinal fluid (CSF) culture and enzyme-linked immunosorbent assay (ELISA) was used to detect the level of DcR3 in CSF. CSF levels of DcR3 were statistically significant between patients with bacterial meningitis and those with non-bacterial meningitis (p < 0.001). A total of 48.75% of patients with bacterial meningitis received antibiotic >24 h before CSF sampling, which was much higher than that of non-bacterial meningitis. CSF leucocyte count yielded the highest diagnostic value, with an area under the receiver operating characteristic curve (ROC) of 0.928, followed by DcR3. At a critical value of 0.201 ng/mL for DcR3, the sensitivity and specificity were 78.75% and 81.40% respectively. DcR3 in CSF may be a valuable predictor for differentiating patients with bacterial meningitis from those with non-bacterial meningitis. Further studies are needed for the validation of this study. PMID:25372942

Study of the lactic acid bacteria throughout the manufacture of dry-cured lacón (a Spanish traditional meat product). Effect of some additives.

PubMed

Lorenzo, José M; García Fontán, María C; Cachaldora, Aida; Franco, Inmaculada; Carballo, Javier

2010-04-01

Total aerobic mesophilic microflora (on SPC agar), lactic acid bacteria (on MRS agar) and lactobacilli (on Rogosa agar) were enumerated in samples from the surface and the interior of the pieces throughout the manufacture of six batches of lacón. Three of the batches were made without additives and three with additives (glucose (2 g/kg), sodium nitrite (E(250)) (125 mg/kg), sodium nitrate (E(251)) (175 mg/kg), sodium ascorbate (E(301)) (500 mg/kg), and sodium citrate (E(331)) (100 mg/kg)). The counts decreased throughout the manufacturing process, particularly after the salting stage. The use of additives did not affect the counts or the evolution of the microbial groups, except for the lactobacilli, which were present in higher numbers in the batches with additives. In four batches (two without and two with additives), from MRS agar and from Rogosa agar plates, 10 colonies were randomly taken from each sampling point of each batch (five from the surface sample and five from the interior sample) and from each culture medium; a total of 224 strains from MRS agar, and 176 strains from Rogosa agar that were identified by classical methods. The MRS agar displayed moderate selectivity for the isolation of lactic acid bacteria, and only 59% of the isolated strains belonged to this microbial group. Homofermentative and facultative heterofermentative lactobacilli (particularly Lactobacillus curvatus and Lactobacillus sakei) were the most abundant species isolated on this medium. The selectivity of the Rogosa agar for lactobacilli was extremely high. The species of lactobacilli isolated on this medium at different stages of manufacture of the four batches of lacón were consistent with those isolated from MRS agar. The use of additives in the lacón did not appreciably affect the kinds and proportions of species isolated on either MRS agar or Rogosa agar.

Bacterial endophthalmitis after resident-performed cataract surgery.

PubMed

Hollander, David A; Vagefi, M Reza; Seiff, Stuart R; Stewart, Jay M

2006-05-01

To determine if there is an increased rate of postoperative bacterial endophthalmitis after resident-performed cataract extraction relative to the reported rates of experienced surgeons. Retrospective, observational case series. The operative reports of the resident-performed cataract surgeries at San Francisco General Hospital between 1983 and 2002 were reviewed. Cases of culture-positive bacterial endophthalmitis and vitreous loss were identified. Between 1983 and 2002, three cases (0.11%) of culture-positive bacterial endophthalmitis occurred after 2718 resident-performed cataract extractions. The overall vitreous loss rate was 6.7%. Two endophthalmitis cases were acute (Staphylococcus epidermidis, Streptococcus viridans), presenting within five days of surgeries complicated by vitreous loss, and one case was delayed-onset (Corynebacterium species) after Nd:YAG posterior capsulotomy after uncomplicated cataract extraction. Despite higher rates of vitreous loss, the rate of endophthalmitis following resident-performed cataract surgery remains comparable with the rates of more experienced surgeons.

De novo generation of plant centromeres at tandem repeats.

PubMed

Teo, Chee How; Lermontova, Inna; Houben, Andreas; Mette, Michael Florian; Schubert, Ingo

2013-06-01

Artificial minichromosomes are highly desirable tools for basic research, breeding, and biotechnology purposes. We present an option to generate plant artificial minichromosomes via de novo engineering of plant centromeres in Arabidopsis thaliana by targeting kinetochore proteins to tandem repeat arrays at non-centromeric positions. We employed the bacterial lactose repressor/lactose operator system to guide derivatives of the centromeric histone H3 variant cenH3 to LacO operator sequences. Tethering of cenH3 to non-centromeric loci led to de novo assembly of kinetochore proteins and to dicentric carrier chromosomes which potentially form anaphase bridges. This approach will be further developed and may contribute to generating minichromosomes from preselected genomic regions, potentially even in a diploid background.

Marine mesocosm bacterial colonisation of volcanic ash

NASA Astrophysics Data System (ADS)

Witt, Verena; Cimarelli, Corrado; Ayris, Paul; Kueppers, Ulrich; Erpenbeck, Dirk; Dingwell, Donald; Woerheide, Gert

2015-04-01

Volcanic eruptions regularly eject large quantities of ash particles into the atmosphere, which can be deposited via fallout into oceanic environments. Such fallout has the potential to alter pH, light and nutrient availability at local scales. Shallow-water coral reef ecosystems - "rainforests of the sea" - are highly sensitive to disturbances, such as ocean acidification, sedimentation and eutrophication. Therefore, wind-delivered volcanic ash may lead to burial and mortality of such reefs. Coral reef ecosystem resilience may depend on pioneer bacterial colonisation of the ash layer, supporting subsequent establishment of the micro- and ultimately the macro-community. However, which bacteria are involved in pioneer colonisation remain unknown. We hypothesize that physico-chemical properties (i.e., morphology, mineralogy) of the ash may dictate bacterial colonisation. The effect of substrate properties on bacterial colonisation was tested by exposing five substrates: i) quartz sand ii) crystalline ash (Sakurajima, Japan) iii) volcanic glass iv) carbonate reef sand and v) calcite sand of similar grain size, in controlled marine coral reef aquaria under low light conditions for six months. Bacterial communities were screened every month by Automated Ribosomal Intergenic Spacer Analysis of the 16S-23S rRNA Internal Transcribed Spacer region. Multivariate statistics revealed discrete groupings of bacterial communities on substrates of volcanic origin (ash and glass) and reef origin (three sands). Analysis of Similarity supported significantly different communities associated with all substrates (p=0.0001), only quartz did not differ from both carbonate and calcite sands. The ash substrate exhibited the most diverse bacterial community with the most substrate-specific bacterial operational taxonomic units. Our findings suggest that bacterial diversity and community composition during colonisation of volcanic ash in a coral reef-like environment is controlled by the

Marine Mesocosm Bacterial Colonisation of Volcanic Ash

NASA Astrophysics Data System (ADS)

Witt, V.; Cimarelli, C.; Ayris, P. M.; Kueppers, U.; Erpenbeck, D.; Dingwell, D. B.; Woerheide, G.

2014-12-01

Explosive volcanic eruptions regularly eject large quantities of ash particles into the atmosphere, which can be deposited via fallout into oceanic environments. Such fallout has the potential to alter pH, light and nutrient availability at local or regional scales. Shallow-water coral reef ecosystems - "rainforests of the sea" - are highly sensitive to disturbances, such as ocean acidification, sedimentation and eutrophication. Therefore, ash deposition may lead to burial and mortality of such reefs. Coral reef ecosystem resilience may depend on pioneer bacterial colonisation of the ash layer, supporting subsequent establishment of the micro- and ultimately the macro-community. However, it is currently unknown which bacteria are involved in pioneer colonisation. We hypothesize that physico-chemical properties (i.e., morphology, chemistry, mineralogy) of the ash may dictate bacterial colonisation. We have tested the effect of substrate properties on bacterial diversity and abundance colonising five substrates: i) quartz sand ii) crystalline ash from the Sakurajima volcano (Japan) iii) volcanic glass iv) carbonate reef sand and v) calcite sand of similar grain size - by incubation in a controlled marine mesocosm (coral reef aquarium) under low light conditions for three months. Bacterial communities were screened every month by Automated Ribosomal Intergenic Spacer Analysis of the 16S-23S rRNA Internal Transcribed Spacer region. Multivariate statistics revealed discrete groupings of bacterial communities on substrates of volcanic origin (ash and glass) and reef origin (three sands). Analysis Of Similarity supports significantly different communities associated with all substrates (p=0.0001), only quartz did not differ from both carbonate and calcite sands. The ash substrate exhibited the most diverse bacterial community and carried the most substrate-specific bacterial operational taxonomic units. Our findings suggest that bacterial diversity and community

Bacterial prostatitis.

PubMed

Gill, Bradley C; Shoskes, Daniel A

2016-02-01

The review provides the infectious disease community with a urologic perspective on bacterial prostatitis. Specifically, the article briefly reviews the categorization of prostatitis by type and provides a distillation of new findings published on bacterial prostatitis over the past year. It also highlights key points from the established literature. Cross-sectional prostate imaging is becoming more common and may lead to more incidental diagnoses of acute bacterial prostatitis. As drug resistance remains problematic in this condition, the reemergence of older antibiotics such as fosfomycin, has proven beneficial. With regard to chronic bacterial prostatitis, no clear clinical risk factors emerged in a large epidemiological study. However, bacterial biofilm formation has been associated with more severe cases. Surgery has a limited role in bacterial prostatitis and should be reserved for draining of a prostatic abscess or the removal of infected prostatic stones. Prostatitis remains a common and bothersome clinical condition. Antibiotic therapy remains the basis of treatment for both acute and chronic bacterial prostatitis. Further research into improving prostatitis treatment is indicated.

Burn care in Los Angeles, California: LAC+USC experience 1994-2004.

PubMed

Garner, Warren L; Reiss, Matthew

2005-01-01

The LAC+USC Burn Center has admitted 3118 patients for treatment in the last 10 years. A majority of patients were young adults (1868), with the second largest group being small children (543). The ethnicity of the patients reflects the diverse nature of the population of Los Angeles County. Forty-eight percent of injuries were less than 5% TBSA and approximately 2% were greater than 60% TBSA. Eighty-two percent were accidental injuries. Sixty percent of admitted patients underwent skin grafting. Mortality was negligible in the group with burns over less than 10% of their body and very high (15/19), 79% in the most severely burned group. Further, there was a high correlation between age and mortality. Complications during treatment included: deep venous thrombosis 1% per year; pulmonary emboli in 5 patients; endotracheal tube dislodgment early or self-extubation about 1 month (11.3 per year); 4.5 patients per year who developed acute renal failure; abdominal compartment syndrome developed in 4.7 patients each year; heterotopic ossification was seen in 4 patients (0.4%); 4 patients (0.4%) developed stage II-IV pressure sores; hypothermia was present in 0.8% of patients.

Bacterial Sialidase

NASA Technical Reports Server (NTRS)

2004-01-01

Data shows that elevated sialidase in bacterial vaginosis patients correlates to premature births in women. Bacterial sialidase also plays a significant role in the unusual colonization of Pseudomonas aeruginosa in cystic fibrosis patients. Crystals of Salmonella sialidase have been reproduced and are used for studying the inhibitor-enzyme complexes. These inhibitors may also be used to inhibit a trans-sialidase of Trypanosome cruzi, a very similar enzyme to bacterial sialidase, therefore preventing T. cruzi infection, the causitive agent of Chagas' disease. The Center for Macromolecular Crystallography suggests that inhibitors of bacterial sialidases can be used as prophylactic drugs to prevent bacterial infections in these critical cases.

Influence of the salting time on volatile compounds during the manufacture of dry-cured pork shoulder "lacón".

PubMed

Purriños, Laura; Franco, Daniel; Carballo, Javier; Lorenzo, José M

2012-12-01

The effect of the length of salting time on volatile compounds throughout the manufacture of dry-cured "lacón" was studied using a purge-and-trap extraction and GC/MS analysis. For this study, six treatments of "lacón" were salted with different amounts of salt (LS (3 days of salting), MS (4 days of salting) and HS (5 days of salting)). The total area of volatile compounds increased significantly (P<0.001) as the length of salting time increased. Significant differences were found for the total area of all aldehydes for each salting time at the end of process. Hexanal presented the most relative abundance, showing highest content in HS treatments while LS treatments showed the lowest one at the end of salting, post-salting and drying-ripening stage. The influence of salting time on the content of 3-Octen-2-one was significant on salting stage (P<0.001) and drying-ripening stage (P<0.01). The salting time affected (P<0.001) the relative abundance of esters at the end of salting and at the end of drying-ripening stage. The salting time affected significantly (P<0.001) on alcohols content at the end of drying-ripening process. However, no significant effect of salt level (P>0.05) was detected on total hydrocarbons and total furans at the end of process. Copyright © 2012 Elsevier Ltd. All rights reserved.

Plans of lightning and airglow measurements with LAC/Akatsuki

NASA Astrophysics Data System (ADS)

Takahashi, Yukihiro; Hoshino, Naoya; Sato, Mitsuteru; Yair, Yoav; Galand, Marina; Fukuhara, Tetsuya

Though there are extensive researches on the existence of lightning discharge in Venus over few decades, this issue is still under controversial. Recently it is reported that the magnetometer on board Venus Express detected whistler mode waves whose source could be lightning discharge occurring well below the spacecraft. However, it is too early to determine the origin of these waves. On the other hand, night airglow is expected to provide essential information on the atmospheric circulation in the upper atmosphere of Venus. But the number of consecutive images of airglow obtained by spacecraft is limited and even the variations of most enhanced location is still unknown. In order to identify the discharge phenomena in the atmosphere of Venus separating from noises and to know the daily variation of airglow distribution in night-side disk, we plan to observe the lightning and airglow optical emissions with high-speed and high-sensitivity optical detector with narrow-band filters on board Akatsuki. We are ready to launch the flight model of lightning and airglow detector, LAC (Lightning and Airglow Camera). Main difference from other previous equipments which have provided evidences of lightning existence in Venus is the high-speed sampling rate at 32 us interval for each pixel, enabling us to distinguish the optical lightning flash from other pulsing noises. In this presentation the observation strategies, including ground-based support with optical telescopes, are shown and discussed.

Bacterial and fungal endophthalmitis in upper Egypt: related species and risk factors.

PubMed

Gharamah, A A; Moharram, A M; Ismail, M A; Al-Hussaini, A K

2012-08-01

To study risk factors, contributing factors of bacterial and fungal endophthalmitis in Upper Egypt, test the isolated species sensitive to some therapeutic agents, and to investigate the air-borne bacteria and fungi in opthalmology operating rooms. Thirty one cases of endophthalmitis were clinically diagnosed and microbiologically studied. Indoor air-borne bacteria and fungi inside four air-conditioned operating rooms in the Ophthalmology Department at Assiut University Hospitals were also investigated. The isolated microbes from endophthalmitis cases were tested for their ability to produce some extracellular enzymes including protease, lipase, urease, phosphatase and catalase. Also the ability of 5 fungal isolates from endophthalmitis origin to produce mycotoxins and their sensitivity to some therapeutic agents were studied. Results showed that bacteria and fungi were responsihle for infection in 10 and 6 cases of endophthalmitis, respectively and only 2 cases produced a mixture of bacteria and fungi. Trauma was the most prevalent risk factor of endophthalmitis where 58.1% of the 31 cases were due to trauma. In ophthalmology operating rooms, different bacterial and fungal species were isolated. 8 bacterial and 5 fungal isolates showed their ability to produce enzymes while only 3 fungal isolates were able to produce mycotoxins. Terbinafine showed the highest effect against most isolates in vitro. The ability of bacterial and fungal isolates to produce extracellular enzymes and mycotoxins may be aid in the invasion and destruction of eye tissues. Microbial contamination of operating rooms with air-borne bacteria and fungi in the present work may be a source of postoperative endophthalmitis.

Different bacterial communities in ectomycorrhizae and surrounding soil

PubMed Central

Vik, Unni; Logares, Ramiro; Blaalid, Rakel; Halvorsen, Rune; Carlsen, Tor; Bakke, Ingrid; Kolstø, Anne-Brit; Økstad, Ole Andreas; Kauserud, Håvard

2013-01-01

Several eukaryotic symbioses have shown to host a rich diversity of prokaryotes that interact with their hosts. Here, we study bacterial communities associated with ectomycorrhizal root systems of Bistorta vivipara compared to bacterial communities in bulk soil using pyrosequencing of 16S rRNA amplicons. A high richness of Operational Taxonomic Units (OTUs) was found in plant roots (3,571 OTUs) and surrounding soil (3,476 OTUs). The community composition differed markedly between these two environments. Actinobacteria, Armatimonadetes, Chloroflexi and OTUs unclassified at phylum level were significantly more abundant in plant roots than in soil. A large proportion of the OTUs, especially those in plant roots, presented low similarity to Sanger 16S rRNA reference sequences, suggesting novel bacterial diversity in ectomycorrhizae. Furthermore, the bacterial communities of the plant roots were spatially structured up to a distance of 60 cm, which may be explained by bacteria using fungal hyphae as a transport vector. The analyzed ectomycorrhizae presents a distinct microbiome, which likely influence the functioning of the plant-fungus symbiosis. PMID:24326907

Lanthanum-mediated dehydrogenation of butenes: Spectroscopy and formation of La(C4H6) isomers

NASA Astrophysics Data System (ADS)

Cao, Wenjin; Hewage, Dilrukshi; Yang, Dong-Sheng

2018-01-01

La atom reactions with 1-butene, 2-butene, and isobutene are carried out in a laser-vaporization molecular beam source. The three reactions yield the same La-hydrocarbon products from the dehydrogenation and carbon-carbon bond cleavage and coupling of the butenes. The dehydrogenated species La(C4H6) is the major product, which is characterized with mass-analyzed threshold ionization (MATI) spectroscopy and quantum chemical computations. The MATI spectrum of La(C4H6) produced from the La+1-butene reaction exhibits two band systems, whereas the MATI spectra produced from the La+2-butene and isobutene reactions display only a single band system. Each of these spectra shows a strong origin band and several vibrational progressions. The two band systems from the spectrum of the 1-butene reaction are assigned to the ionization of two isomers: La[C(CH2)3] (Iso A) and La(CH2CHCHCH2) (Iso B), and the single band system from the spectra of the 2-butene and isobutene reactions is attributed to Iso B and Iso A, respectively. The ground electronic states are 2A1 (C3v) for Iso A and 2A' (Cs) for Iso B. The ionization of the doublet state of each isomer removes a La 6s-based electron and leads to the 1A1 ion of Iso A and the 1A' ion of Iso B. The formation of both isomers consists of La addition to the C=C double bond, La insertion into two C(sp3)—H bonds, and H2 elimination. In addition to these steps, the formation of Iso A from the La+1-butene reaction may involve the isomerization of 1-butene to isobutene prior to the C—H bond activation, whereas the formation of Iso B from the La+trans-2-butene reaction may include the trans- to cis-butene isomerization after the C—H bond activation.

[Cerebral aneurysms complicating bacterial endocarditis. Seven cases (author's transl)].

PubMed

Pecker, J; Vallée, B; Camuzet, J P; Faivre, J; Javalet, A

The authors report seven cases of cerebral aneurysms complicating bacterial endocarditis. The evolution was good in three cases, two of which without sequelae. The bacteries involved were staphylococcus, streptococcus, and enterobacter. The cardiopathy was mitral in four cases. Two patients presented an isolated focal neurological impairment, while the other five presented a severe coma either isolated (one case) or associated with focal neurological deficits (four cases). An intracerebral hematoma was diagnosed in five cases (four died). Only one patient was not operated. The surgical treatment was as follows: one carotid ligation (good result), two evacuations of intracerebral hematomas (both died), two evacuations of intracerebral hematomas with clipping of the aneurysms (one died, one had a fair result in despite of residual hemiplegia), one clipping of aneurysm (good result). Repeated cerebral angiographies should be systematically performed in cases of bacterial endocarditis in order to disclose and follow up cerebral aneurysms which may occur in this condition. Except in cases of emergency, surgery should be differed, in particular, in cases of proximal or multiple aneurysms. Aneurysms of the peripheral cortical arteries are more accessible to treatment and may be operated in the acute phase.

Promiscuity in mice is associated with increased vaginal bacterial diversity

NASA Astrophysics Data System (ADS)

Macmanes, Matthew David

2011-11-01

Differences in the number of sexual partners (i.e., mating system) have the potential to exert a strong influence on the bacterial communities present in reproductive structures like the vagina. Because this structure serves as a conduit for gametes, bacteria present there may have a pronounced, direct effect on host reproductive success. As a first step towards the identification of the relationship between sexual behavior and potentially pathogenic bacterial communities inhabiting vital reproductive structures, as well as their potential effects on fitness, I sought to quantify differences in bacterial diversity in a promiscuous and monogamous mammal species. To accomplish this, I used two sympatric species of Peromyscus rodents— Peromyscus californicus and Peromyscus maniculatus that differ with regard to the number of sexual partners per individual to test the hypothesis that bacterial diversity should be greater in the promiscuous P. maniculatus relative to the monogamous P. californicus. As predicted, phylogenetically controlled and operational taxonomic unit-based indices of bacterial diversity indicated that diversity is greater in the promiscuous species. These results provide important new insights into the effects of mating system on bacterial diversity in free-living vertebrates, and may suggest a potential cost of promiscuity.

Soil bacterial diversity in degraded and restored lands of Northeast Brazil.

PubMed

Araújo, Ademir Sérgio Ferreira; Borges, Clovis Daniel; Tsai, Siu Mui; Cesarz, Simone; Eisenhauer, Nico

2014-11-01

Land degradation deteriorates biological productivity and affects environmental, social, and economic sustainability, particularly so in the semi-arid region of Northeast Brazil. Although some studies exist reporting gross measures of soil microbial parameters and processes, limited information is available on how land degradation and restoration strategies influence the diversity and composition of soil microbial communities. In this study we compare the structure and diversity of bacterial communities in degraded and restored lands in Northeast Brazil and determine the soil biological and chemical properties influencing bacterial communities. We found that land degradation decreased the diversity of soil bacteria as indicated by both reduced operational taxonomic unit (OTU) richness and Shannon index. Soils under native vegetation and restoration had significantly higher bacterial richness and diversity than degraded soils. Redundancy analysis revealed that low soil bacterial diversity correlated with a high respiratory quotient, indicating stressed microbial communities. By contrast, soil bacterial communities in restored land positively correlated with high soil P levels. Importantly, however, we found significant differences in the soil bacterial community composition under native vegetation and in restored land, which may indicate differences in their functioning despite equal levels of bacterial diversity.

Olsenella umbonata sp. nov., a microaerotolerant anaerobic lactic acid bacterium from the sheep rumen and pig jejunum, and emended descriptions of Olsenella, Olsenella uli and Olsenella profusa.

PubMed

Kraatz, Mareike; Wallace, R John; Svensson, Liselott

2011-04-01

Strain A2 is an anaerobic, variably Gram-stain-positive, non-spore-forming, small and irregularly rod-shaped bacterium from the ruminal fluid of a sheep that has been described informally as a representative of 'Olsenella (basonym Atopobium) oviles'. Three phenotypically similar bacterial strains (lac15, lac16 and lac31(T)) were isolated in concert with Veillonella magna lac18(T) from the mucosal jejunum of a pig. A phylogenetic analysis based on 16S rRNA gene sequences revealed that strains A2, lac15, lac16 and lac31(T) formed a genetically coherent group (100 % interstrain sequence similarity) within the bigeneric Olsenella-Atopobium branch of the family Coriobacteriaceae, class Actinobacteria. This group was most closely related to the type strains of the two recognized Olsenella species, namely Olsenella uli (sequence similarity of 96.85 %) and Olsenella profusa (sequence similarity of 97.20 %). The sequence similarity to the type strain of Atopobium minutum, the type species of the genus Atopobium, was 92.33 %. Unlike those of O. uli and O. profusa, outgrown colonies of strains A2, lac15, lac16 and lac31(T) were opaque and greyish-white with an umbonate elevation on solid culture media. The four novel strains were characterized as being well-adapted and presumably indigenous to the gastrointestinal tract of homoeothermic vertebrates: they were mesophilic, microaerotolerant, neutrophilic and acidotolerant, bile-resistant, mucin-utilizing and markedly peptidolytic lactic acid bacteria. The results of DNA-DNA hybridizations, cellular fatty acid analysis and other differential phenotypic (physiological and biochemical) tests confirmed that strains A2, lac15, lac16 and lac31(T) represent a novel species of the genus Olsenella. On the basis of the genotypic and phenotypic results, we therefore describe Olsenella umbonata sp. nov., with lac31(T) ( = CCUG 58604(T)  = DSM 22620(T)  = JCM 16156(T)) as the type strain and A2 ( = CCUG 58212 �

Sunflower (Helianthus annuus) long-chain acyl-coenzyme A synthetases expressed at high levels in developing seeds.

PubMed

Aznar-Moreno, Jose A; Venegas Calerón, Mónica; Martínez-Force, Enrique; Garcés, Rafael; Mullen, Robert; Gidda, Satinder K; Salas, Joaquín J

2014-03-01

Long chain fatty acid synthetases (LACSs) activate the fatty acid chains produced by plastidial de novo biosynthesis to generate acyl-CoA derivatives, important intermediates in lipid metabolism. Oilseeds, like sunflower, accumulate high levels of triacylglycerols (TAGs) in their seeds to nourish the embryo during germination. This requires that sunflower seed endosperm supports very active glycerolipid synthesis during development. Sunflower seed plastids produce large amounts of fatty acids, which must be activated through the action of LACSs, in order to be incorporated into TAGs. We cloned two different LACS genes from developing sunflower endosperm, HaLACS1 and HaLACS2, which displayed sequence homology with Arabidopsis LACS9 and LACS8 genes, respectively. These genes were expressed at high levels in developing seeds and exhibited distinct subcellular distributions. We generated constructs in which these proteins were fused to green fluorescent protein and performed transient expression experiments in tobacco cells. The HaLACS1 protein associated with the external envelope of tobacco chloroplasts, whereas HaLACS2 was strongly bound to the endoplasmic reticulum. Finally, both proteins were overexpressed in Escherichia coli and recovered as active enzymes in the bacterial membranes. Both enzymes displayed similar substrate specificities, with a very high preference for oleic acid and weaker activity toward stearic acid. On the basis of our findings, we discuss the role of these enzymes in sunflower oil synthesis. © 2013 Scandinavian Plant Physiology Society.

Water in the Cratonic Mantle: Insights from FTIR Data on Lac De Gras Xenoliths (Slave Craton, Canada)

NASA Technical Reports Server (NTRS)

Peslier, Anne H.; Brandon, Alan D.; Schaffer, Lillian Aurora; O'Reilly, Suzanne Yvette; Griffin, William L.; Morris, Richard V.; Graff, Trevor G.; Agresti, David G.

2014-01-01

The mantle lithosphere beneath the cratonic part of continents is the deepest (> 200 km) and oldest (>2-3 Ga) on Earth, remaining a conundrum as to how these cratonic roots could have resisted delamination by asthenospheric convection over time. Water, or trace H incorporated in mineral defects, could be a key player in the evolution of continental lithosphere because it influences melting and rheology of the mantle. Mantle xenoliths from the Lac de Gras kimberlite in the Slave craton were analyzed by FTIR. The cratonic mantle beneath Lac de Gras is stratified with shallow (<145 km) oxidized ultradepleted peridotites and pyroxenites with evidence for carbonatitic metasomatism, underlain by reduced and less depleted peridotites metasomatized by kimberlite melts. Peridotites analyzed so far have H O contents in ppm weight of 7-100 in their olivines, 58 to 255 in their orthopyroxenes (opx), 11 to 84 in their garnet, and 139 in one clinopyroxene. A pyroxenite contains 58 ppm H2O in opx and 5 ppm H2O in its olivine and garnet. Olivine and garnet from the deep peridotites have a range of water contents extending to higher values than those from the shallow ones. The FTIR spectra of olivines from the shallow samples have more prominent Group II OH bands compared to the olivines from the deep samples, consistent with a more oxidized mantle environment. The range of olivine water content is similar to that observed in Kaapvaal craton peridotites at the same depths (129-184 km) but does not extend to as high values as those from Udachnaya (Siberian craton). The Slave, Kaapvaal and Siberian cratons will be compared in terms of water content distribution, controls and role in cratonic root longevity.

[Acute care of patients with bacterial meningitis].

PubMed

Stetefeld, H R; Dohmen, C

2016-04-01

Bacterial meningitis is a life-threatening emergency that is still associated with high mortality and poor outcome. The purpose of this article is to provide a review of clinical presentation, diagnostic procedure, therapy, and prognosis in bacterial meningitis. Prognostic factors which could be influenced positively are identified and a focused procedure in the emergency setting and for the treatment of complications are provided. This work is based on a literature search (PubMed, guidelines) and personal experience (standard operating procedures, SOP). Despite improved health care, bacterial meningitis is still associated with high mortality and poor neurological outcome, which has remained largely unaltered during recent decades. Diagnosis and, more importantly, effective therapy of bacterial meningitis are often delayed, having an immediate negative influence on clinical outcome. Neurological and nonneurological complications often necessitate intensive care and may occur rapidly or in the further course of the disease. Immediate initiation of effective therapy is crucial to positively influence mortality and neurological outcome. Antibiotics should be administered within 30 min after admission. To achieve this, a focused and well-organized procedure in the emergency setting is necessary. Because of intra- and extracranial complications, patients need to be treated on intensive care units including neurological expertise and interdisciplinary support.

[Bacterial meningitis].

PubMed

Brouwer, M C; van de Beek, D

2012-05-01

Bacterial meningitis is a severe disease which affects 35.000 Europeans each year and has a mortality rate of about 20%. During the past 25 years the epidemiology of bacterial meningitis has changed significantly due to the implementation of vaccination against Haemophilus influenzae, Neisseria meningtidis group C and Streptococcus pneumoniae. Due to these vaccines, meningitis is now predominantly a disease occurring in adults, caused especially by Streptococcus pneumoniae, while it was formerly a child disease which was largely caused by Haemophilus influenzae. Bacterial meningitis is often difficult to recognize since the classical presentation with neck stiffness, reduced awareness and fever occurs in less than half of the patients. The only way to diagnose or exclude bacterial meningitis is by performing low-threshold cerebrospinal fluid examination with a suspicion of bacterial meningitis. The treatment consists of the prescription of antibiotics and dexamethasone.

Predicting postoperative fever and bacterial colonization on packing material following endoscopic endonasal surgery.

PubMed

Nomura, Kazuhiro; Yamanaka, Yurika; Sekine, Yasuhiro; Yamamoto, Hiroki; Esu, Yoshihiko; Hara, Mariko; Hasegawa, Masayo; Shinnabe, Akihiro; Kanazawa, Hiromi; Kakuta, Risako; Ozawa, Daiki; Hidaka, Hiroshi; Katori, Yukio; Yoshida, Naohiro

2017-01-01

Postoperative fever following endoscopic endonasal surgery is a rare occurrence of concern to surgeons. To elucidate preoperative and operative predictors of postoperative fever, we analyzed the characteristics of patients and their perioperative background in association with postoperative fever. A retrospective review of 371 patients who had undergone endoscopic endonasal surgery was conducted. Predictors, including intake of antibiotics, steroids, history of asthma, preoperative nasal bacterial culture, duration of operation, duration of packing and intraoperative intravenous antibiotics on the occurrence of postoperative fever, and bacterial colonization on the packing material, were analyzed retrospectively. Fever (≥38 °C) occurred in 63 (17 %) patients. Most incidences of fever occurred on postoperative day one. In majority of these cases, the fever subsided after removal of the packing material without further antibiotic administration. However, one patient who experienced persistent fever after the removal of packing material developed meningitis. History of asthma, prolonged operation time (≥108 min), and intravenous cefazolin administration instead of cefmetazole were associated with postoperative fever. Odds ratios (ORs) for each were 2.3, 4.6, and 2.0, respectively. Positive preoperative bacterial colonization was associated with postoperative bacterial colonization on the packing material (OR 2.3). Postoperative fever subsided in most patients after removal of the packing material. When this postoperative fever persists, its underlying cause should be examined.

Elevations of novel cytokines in bacterial meningitis in infants.

PubMed

Srinivasan, Lakshmi; Kilpatrick, Laurie; Shah, Samir S; Abbasi, Soraya; Harris, Mary C

2018-01-01

Bacterial meningitis is challenging to diagnose in infants, especially in the common setting of antibiotic pre-treatment, which diminishes yield of cerebrospinal fluid (CSF) cultures. Prior studies of diagnostic markers have not demonstrated sufficient accuracy. Interleukin-23 (IL-23), interleukin-18 (IL-18) and soluble receptor for advanced glycation end products (sRAGE) possess biologic plausibility, and may be useful as diagnostic markers in bacterial meningitis. In a prospective cohort study, we measured IL-23, IL-18 and sRAGE levels in CSF. We compared differences between infected and non-infected infants, and conducted receiver operating characteristic (ROC) analyses to identify individual markers and combinations of markers with the best diagnostic accuracy. 189 infants <6 months, including 8 with bacterial meningitis, 30 without meningitis, and 151 with indeterminate diagnosis (due to antibiotic pretreatment) were included. CSF IL-23, IL-18 and sRAGE levels were significantly elevated in infants with culture proven meningitis. Among individual markers, IL-23 possessed the greatest accuracy for diagnosis of bacterial meningitis (area under the curve (AUC) 0.9698). The combination of all three markers had an AUC of 1. IL-23, alone and in combination with IL-18 and sRAGE, identified bacterial meningitis with excellent accuracy. Following validation, these markers could aid clinicians in diagnosis of bacterial meningitis and decision-making regarding prolongation of antibiotic therapy.

Surface radiant flux densities inferred from LAC and GAC AVHRR data

NASA Astrophysics Data System (ADS)

Berger, F.; Klaes, D.

To infer surface radiant flux densities from current (NOAA-AVHRR, ERS-1/2 ATSR) and future meteorological (Envisat AATSR, MSG, METOP) satellite data, the complex, modular analysis scheme SESAT (Strahlungs- und Energieflüsse aus Satellitendaten) could be developed (Berger, 2001). This scheme allows the determination of cloud types, optical and microphysical cloud properties as well as surface and TOA radiant flux densities. After testing of SESAT in Central Europe and the Baltic Sea catchment (more than 400scenes U including a detailed validation with various surface measurements) it could be applied to a large number of NOAA-16 AVHRR overpasses covering the globe.For the analysis, two different spatial resolutions U local area coverage (LAC) andwere considered. Therefore, all inferred results, like global area coverage (GAC) U cloud cover, cloud properties and radiant properties, could be intercompared. Specific emphasis could be made to the surface radiant flux densities (all radiative balance compoments), where results for different regions, like Southern America, Southern Africa, Northern America, Europe, and Indonesia, will be presented. Applying SESAT, energy flux densities, like latent and sensible heat flux densities could also be determined additionally. A statistical analysis of all results including a detailed discussion for the two spatial resolutions will close this study.

Discovery of Very High Energy Gamma-Ray Emission from BL Lac object H1722+119 by the MAGIC Telescopes

NASA Astrophysics Data System (ADS)

Cortina, Juan

2013-05-01

H1722+119 is a BL Lac object, that was listed as candidate TeV blazar in Costamante & Ghisellini (2002) based on its X-ray and radio properties. Its redshift is uncertain; Sbarufatti et al. 2006 give z>0.17. The source has been detected by Fermi-LAT, in the Second Fermi Catalog with F(>1 GeV) (3.7+-0.3)e-09 cm^-2 s^-1 and with spectral index 1.92+-0.06. H1722+119 was observed for five nights by the MAGIC telescopes starting May 17th 2013 and collecting 11 hours of good quality data.

Cerebrospinal fluid cytokines in the diagnosis of bacterial meningitis in infants.

PubMed

Srinivasan, Lakshmi; Kilpatrick, Laurie; Shah, Samir S; Abbasi, Soraya; Harris, Mary C

2016-10-01

Bacterial meningitis poses diagnostic challenges in infants. Antibiotic pretreatment and low bacterial density diminish cerebrospinal fluid (CSF) culture yield, while laboratory parameters do not reliably identify bacterial meningitis. Pro and anti-inflammatory cytokines are elevated in bacterial meningitis and may be useful diagnostic adjuncts when CSF cultures are negative. In a prospective cohort study of infants, we used cytometric bead arrays to measure tumor necrosis factor alpha (TNF-α), interleukin 1 (IL-1), IL-6, IL-8, IL-10, and IL-12 in CSF. Receiver operating characteristic (ROC) analyses and Principal component analysis (PCA) were used to determine cytokine combinations that identified bacterial meningitis. Six hundred and eighty four infants < 6 mo were included; 11 had culture-proven bacterial meningitis. IL-6 and IL-10 were the individual cytokines possessing greatest accuracy in diagnosis of culture proven bacterial meningitis (ROC analyses; area under the concentration-time curve (AUC) 0.91; 0.9103 respectively), and performed as well as, or better than combinations identified using ROC and PCA. CSF cytokines were highly correlated with each other and with CSF white blood cell count (WBC) counts in infants with meningitis. A subset of antibiotic pretreated culture-negative subjects demonstrated cytokine patterns similar to culture positive subjects. CSF cytokine levels may aid diagnosis of bacterial meningitis, and facilitate decision-making regarding treatment for culture negative meningitis.

Nutrient status of the lowbush blueberry, Lac-Saint-Jean area, Quebec, Canada. [Vaccinium angustifolium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bouchard, A.R.; Gagnon, M.J.

1987-01-01

The lowbush blueberry (Vaccinium angustifolium Ait.) is an important commercial crop of the Lac-Saint-Jean area (Quebec, Canada). The major blueberry fields are located on sandy soils relatively poor in available mineral nutrients. The nutrients originate from a thin organic layer found on the top of these sandy soils. The leaf mineral contents (N, P, K, Mg, Ca, Mn, Fe, Cu, Zn and B) were measured in five blueberry fields during 1984 and 1985. Soil pH and soil available P, K, and Mg were also assessed. The results show that the leaf mineral contents are generally adequate. However, K and Znmore » might be occasionally deficient when compared to the actual established standards. The available Mg in soil was significantly correlated with the leaf Mg concentration. The data also suggest that the influence of the pH following the burn pruning seems to influence the nutrition of this species.« less

Comparison of three distinct clean air suits to decrease the bacterial load in the operating room: an observational study.

PubMed

Kasina, Piotr; Tammelin, Ann; Blomfeldt, Anne-Marie; Ljungqvist, Bengt; Reinmüller, Berit; Ottosson, Carin

2016-01-01

Lowering air-borne bacteria counts in the operating room is essential in prevention of surgical site infections in orthopaedic joint replacement surgery. This is mainly achieved by decreasing bacteria counts through dilution, with appropriate ventilation and by limiting the bacteria carrying skin particles, predominantly shed by the personnel. The aim of this study was to investigate if a single use polypropylene clothing system or a reusable polyester clothing system could offer similar air quality in the operating room as a mobile laminar airflow device-assisted reusable cotton/polyester clothing system. Prospective observational study design, comparing the performance of three Clean Air Suits by measuring Colony Forming Units (CFU)/m(3) of air during elective hip and knee arthroplasties, performed at a large university-affiliated hospital. The amount of CFU/m(3) of air was measured during 37 operations of which 13 were performed with staff dressed in scrub suits made of a reusable mixed material (69 % cotton, 30 % polyester, 1 % carbon fibre) accompanied by two mobile laminar airflow units. During 24 procedures no mobile laminar airflow units were used, 13 with staff using a reusable olefin fabric clothing (woven polypropylene) and 11 with staff dressed in single-use suits (non-woven spunbonded polypropylene). Air from the operating field was sampled through a filter, by a Sartorius MD8, and bacterial colonies were counted after incubation. There were 6-8 measurements from each procedure, in total 244 measurements. Statistical analysis was performed by Mann-Whitney U-test. The single-use polypropylene suit reduced the amount of CFU/m(3) to a significantly lower level than both other clothing systems. Single-use polypropylene clothing systems can replace mobile laminar airflow unit-assisted reusable mixed material-clothing systems. Measurements in standardized laboratory settings can only serve as guidelines as environments in real operation settings present a

The physical properties and orbital parameters of the triple system V402 Lac

NASA Astrophysics Data System (ADS)

Hoyman, B.; Kalomeni, B.; Yakut, K.

2018-04-01

We present first ground-based multi-colors photometric study of an eccentric, double-lined eclipsing binary system V402 Lac. Analyzing the data obtained in this study together with earlier studies in the literature we derived the orbital and physical parameters of this detached binary system of considerable interest. Derived physical parameters of the components are as follows; M1 = 2.95 ± 0.06M⊙ , M2 = 2.86 ± 0.06M⊙ , R1 = 2.61 ± 0.04R⊙ , R2 = 2.16 ± 0.03R⊙ , L1 = 98 ± 5L⊙ and L2 = 69 ± 3L⊙ . Using the newly obtained parameters the distance of the binary is determined to be 262 ± 33 pc. In addition, the system show apsidal motion whose period is determined to be 213 years. A possible third star (M3 sin i = 1.9M⊙) orbiting the binary system in an eccentric orbit (e = 0.23) with an orbital period of 20.5 years has been detected in this study with LTT.

Perforation and bacterial contamination of microscope covers in lumbar spinal decompressive surgery.

PubMed

Osterhoff, Georg; Spirig, José; Klasen, Jürgen; Kuster, Stefan P; Zinkernagel, Annelies S; Sax, Hugo; Min, Kan

2014-01-01

To determine the integrity of microscope covers and bacterial contamination at the end of lumbar spinal decompressive surgery. A prospective study of 25 consecutive lumbar spinal decompressions with the use of a surgical microscope was performed. For detection of perforations, the microscope covers were filled with water at the end of surgery and the presence of water leakage in 3 zones (objective, ocular and control panel) was examined. For detection of bacterial contamination, swabs were taken from the covers at the same locations before and after surgery. Among the 25 covers, 1 (4%) perforation was observed and no association between perforation and bacterial contamination was seen; 3 (4%) of 75 smears from the 25 covers showed post-operative bacterial contamination, i.e. 2 in the ocular zone and 1 in the optical zone, without a cover perforation. The incidence of microscope cover perforation was very low and was not shown to be associated with bacterial contamination. External sources of bacterial contamination seem to outweigh the problem of contamination due to failure of cover integrity. © 2014 S. Karger AG, Basel.

Perforation and Bacterial Contamination of Microscope Covers in Lumbar Spinal Decompressive Surgery

PubMed Central

Osterhoff, Georg; Spirig, José; Klasen, Jürgen; Kuster, Stefan P.; Zinkernagel, Annelies S.; Sax, Hugo; Min, Kan

2014-01-01

Objective To determine the integrity of microscope covers and bacterial contamination at the end of lumbar spinal decompressive surgery. Materials and Methods A prospective study of 25 consecutive lumbar spinal decompressions with the use of a surgical microscope was performed. For detection of perforations, the microscope covers were filled with water at the end of surgery and the presence of water leakage in 3 zones (objective, ocular and control panel) was examined. For detection of bacterial contamination, swabs were taken from the covers at the same locations before and after surgery. Results Among the 25 covers, 1 (4%) perforation was observed and no association between perforation and bacterial contamination was seen; 3 (4%) of 75 smears from the 25 covers showed post-operative bacterial contamination, i.e. 2 in the ocular zone and 1 in the optical zone, without a cover perforation. Conclusions The incidence of microscope cover perforation was very low and was not shown to be associated with bacterial contamination. External sources of bacterial contamination seem to outweigh the problem of contamination due to failure of cover integrity. PMID:24903448

[Testicular testosterone production in male mice of inbred strains PT and CBA/Lac after a long-term period of stable social hierarchy].

PubMed

Osadchuk, L V; Gutorova, N V; Kleshchev, M A

2014-04-01

Social dominance can alter testicular testosterone production, although there is pronounced variability in the relationship between social status and pattern of the testosterone response. The study designed to investigate how a long-term period of stable social hierarchy effects on testicular testosterone production in male mice of inbred strains PT and CBA/Lac. Paired males of different genotypes were housed together for 32 days beginning 38 day of age. Dyadic interactions of males generated dominance-subordination relationships during the first day after a social group has been produced and the social rank of each opponent was assessed by asymmetry in agonistic behaviour. Serum level of testosterone and its testicular content were evaluated in male mice of both inbred strains at 70 day of age after pair housing. Control animals were age- and genotype-matched single males that were housed in conventional cages. After a long-term period of pair housing, the serum testosterone level and its testicular content in males of both PT and CBA/Lac strains were not significantly different from the control. There were no significant differences in androgenic parameters between social ranks in male mice of both strains. The results indicate that in laboratory mice the pattern of testicular testosterone response to social hierarchy determined by a social situation, for example, a stability of social interactions, when the importance of aggressive competition for rank is minimal.

Substrate Type and Free Ammonia Determine Bacterial Community Structure in Full-Scale Mesophilic Anaerobic Digesters Treating Cattle or Swine Manure.

PubMed

Li, Jiabao; Rui, Junpeng; Yao, Minjie; Zhang, Shiheng; Yan, Xuefeng; Wang, Yuanpeng; Yan, Zhiying; Li, Xiangzhen

2015-01-01

The microbial-mediated anaerobic digestion (AD) process represents an efficient biological process for the treatment of organic waste along with biogas harvest. Currently, the key factors structuring bacterial communities and the potential core and unique bacterial populations in manure anaerobic digesters are not completely elucidated yet. In this study, we collected sludge samples from 20 full-scale anaerobic digesters treating cattle or swine manure, and investigated the variations of bacterial community compositions using high-throughput 16S rRNA amplicon sequencing. Clustering and correlation analysis suggested that substrate type and free ammonia (FA) play key roles in determining the bacterial community structure. The COD: [Formula: see text] (C:N) ratio of substrate and FA were the most important available operational parameters correlating to the bacterial communities in cattle and swine manure digesters, respectively. The bacterial populations in all of the digesters were dominated by phylum Firmicutes, followed by Bacteroidetes, Proteobacteria and Chloroflexi. Increased FA content selected Firmicutes, suggesting that they probably play more important roles under high FA content. Syntrophic metabolism by Proteobacteria, Chloroflexi, Synergistetes and Planctomycetes are likely inhibited when FA content is high. Despite the different manure substrates, operational conditions and geographical locations of digesters, core bacterial communities were identified. The core communities were best characterized by phylum Firmicutes, wherein Clostridium predominated overwhelmingly. Substrate-unique and abundant communities may reflect the properties of manure substrate and operational conditions. These findings extend our current understanding of the bacterial assembly in full-scale manure anaerobic digesters.

Antimicrobial and antiplasmid activities of essential oils.

PubMed

Schelz, Zsuzsanna; Molnar, Joseph; Hohmann, Judit

2006-06-01

The antimicrobial and antiplasmid activities of essential oils (orange oil, eucalyptus oil, fennel oil, geranium oil, juniper oil, peppermint oil, rosemary oil, purified turpentine oil, thyme oil, Australian tea tree oil) and of menthol, the main component of peppermint oil, were investigated. The antimicrobial activities were determined on the Gram (+) Staphylococcus epidermidis and the Gram (-) Escherichia coli F'lac K12 LE140, and on two yeast Saccharomyces cerevisiae 0425 delta/1 and 0425 52C strains. The antiplasmid activities were investigated on E. coli F'lac bacterial strain. Each of the oils exhibited antimicrobial activity and three of them antiplasmid action. The interaction of peppermint oil and menthol with the antibiotics was studied on the same bacterial strain with the checkerboard method. Peppermint oil and menthol displayed additive synergy with oxytetracycline. A new mechanism of plasmid curing was established for one of the oil components.

Ericoid Roots and Mycospheres Govern Plant-Specific Bacterial Communities in Boreal Forest Humus.

PubMed

Timonen, Sari; Sinkko, Hanna; Sun, Hui; Sietiö, Outi-Maaria; Rinta-Kanto, Johanna M; Kiheri, Heikki; Heinonsalo, Jussi

2017-05-01

In this study, the bacterial populations of roots and mycospheres of the boreal pine forest ericoid plants, heather (Calluna vulgaris), bilberry (Vaccinium myrtillus), and lingonberry (Vaccinium vitis-idaea), were studied by qPCR and next-generation sequencing (NGS). All bacterial communities of mycosphere soils differed from soils uncolonized by mycorrhizal mycelia. Colonization by mycorrhizal hyphae increased the total number of bacterial 16S ribosomal DNA (rDNA) gene copies in the humus but decreased the number of different bacterial operational taxonomic units (OTUs). Nevertheless, ericoid roots and mycospheres supported numerous OTUs not present in uncolonized humus. Bacterial communities in bilberry mycospheres were surprisingly similar to those in pine mycospheres but not to bacterial communities in heather and lingonberry mycospheres. In contrast, bacterial communities of ericoid roots were more similar to each other than to those of pine roots. In all sample types, the relative abundances of bacterial sequences belonging to Alphaproteobacteria and Acidobacteria were higher than the sequences belonging to other classes. Soil samples contained more Actinobacteria, Deltaproteobacteria, Opitutae, and Planctomycetia, whereas Armatimonadia, Betaproteobacteria, Gammaproteobacteria, and Sphingobacteriia were more common to roots. All mycosphere soils and roots harbored bacteria unique to that particular habitat. Our study suggests that the habitation by ericoid plants increases the overall bacterial diversity of boreal forest soils.

Mantle transition zone input to kimberlite magmatism near a subduction zone: Origin of anomalous Nd-Hf isotope systematics at Lac de Gras, Canada

NASA Astrophysics Data System (ADS)

Tappe, Sebastian; Graham Pearson, D.; Kjarsgaard, Bruce A.; Nowell, Geoff; Dowall, David

2013-06-01

Late Cretaceous-Eocene kimberlites from the Lac de Gras area, central Slave craton, show the most extreme Nd-Hf isotope decoupling observed for kimberlites worldwide. They are characterized by a narrow range of moderately enriched Nd isotope compositions (ɛNd(i)=-0.4 to -3.5) that contrasts strongly with their moderately depleted to highly enriched ɛHf(i) values (+3.9 to -9.9). Although digestion of cratonic mantle material in proto-kimberlite melt can theoretically produce steep arrays in Nd-Hf isotope space, the amount of contaminant required to explain the Lac de Gras data is unrealistic. Instead, it is more plausible that mixing of compositionally discrete melt components within an isotopically variable source region is responsible for the steep Nd-Hf isotope array. As development of strongly negative ΔɛHf requires isotopic aging of a precursor material with Sm/Nd≫Lu/Hf for billion-year timescales, a number of models have been proposed where ancient MORB crust trapped in the mantle transition zone is the ultimate source of the extreme Hf isotope signature. However, we provide a conceptual modification and demonstrate that OIB-type domains within ancient subducted oceanic lithosphere can produce much stronger negative ΔɛHf during long-term isolation. Provided that these OIB-type domains have lower melting points compared with associated MORB crust, they are among the first material to melt within the transition zone during thermal perturbations. The resulting hydrous alkali silicate melts react strongly with depleted peridotite at the top of the transition zone and transfer negative ΔɛHf signatures to less dense materials, which can be more easily entrained within upward flowing mantle. Once these entrained refertilized domains rise above 300 km depth, they may become involved in CO2- and H2O-fluxed redox melting of upper mantle peridotite beneath a thick cratonic lid. We argue that incorporation of ancient transition zone material, which includes

Ultrasound-assisted synthesis of 2,4-thiazolidinedione and rhodanine derivatives catalyzed by task-specific ionic liquid: [TMG][Lac

PubMed Central

2013-01-01

Background Synthesized arylidene derivatives of rhodanine and 2,4-thiazolidiendione have potent pharmacological activities, and these are also key substrates for the preparation of clinically used antidiabetics. Findings Some 1,1,3,3-tetramethylguanidine-based task-specific ionic liquids (TSILs) 1a-1e were prepared and employed to the catalyzed solvent-free Knoevenagel condensation of 2,4-thiazolidinedione 3a and rhodanine 3b with a variety of aldehydes. Conclusions Best results were obtained with 1,1,3,3-tetramethylguanidine lactate ([TMG][Lac]) 1c. The TSIL used can be easily recovered and recycled, yielding products 4–5 in excellent yields under ultrasonic environment without the formation of any side products or toxic waste. PMID:23458122

Ultrasound-assisted synthesis of 2,4-thiazolidinedione and rhodanine derivatives catalyzed by task-specific ionic liquid: [TMG][Lac].

PubMed

Suresh; Sandhu, Jagir Singh

2013-03-03

Synthesized arylidene derivatives of rhodanine and 2,4-thiazolidiendione have potent pharmacological activities, and these are also key substrates for the preparation of clinically used antidiabetics. Some 1,1,3,3-tetramethylguanidine-based task-specific ionic liquids (TSILs) 1a-1e were prepared and employed to the catalyzed solvent-free Knoevenagel condensation of 2,4-thiazolidinedione 3a and rhodanine 3b with a variety of aldehydes. Best results were obtained with 1,1,3,3-tetramethylguanidine lactate ([TMG][Lac]) 1c. The TSIL used can be easily recovered and recycled, yielding products 4-5 in excellent yields under ultrasonic environment without the formation of any side products or toxic waste.

Manoomin: place-based research with Native American students on wild rice lakes on the Fond du Lac Band of Lake Superior Chippewa Reservation, northern Minnesota

NASA Astrophysics Data System (ADS)

Ito, E.; Myrbo, A.; Dalbotten, D. M.; Pellerin, H.; Greensky, L.; Howes, T.; Wold, A.; McEathron, M. A.; Shanker, V.

2010-12-01

The manoomin project is a collaboration between Fond du Lac Tribal and Community College (Cloquet, MN), the Reservation’s Resource Management Division, and the University of Minnesota funded by the NSF GEO-OEDG Program. It builds on a successful seven-year history of collaboration between these parties, including regular science camps (gidaakiimanaanimigawig, Our Earth Lodge) for students of a wide range of ages. We are working as a team with Native students to study the history of wild rice (manoomin; Zizania palustris), a culturally important resource, growing on Reservation lakes. The joint project takes two main approaches: study of sediment core samples collected from Reservation lakes; and the collection of traditional knowledge about wild rice from the Elders. Science campers collect lake cores during winter with the assistance of the U of MN’s LacCore (National Lacustrine Core Facility) and Resource Management and visit LacCore to log, split and describe cores soon thereafter. Academic mentors with a range of specialties (phytoliths, pollen, plant macrofossils, sedimentology, geochemistry, magnetics) spend 1-2 weeks during the summer with small groups of college-age (>18, many nontraditional) student interns working on a particular paleoenvironmental proxy from the sediment cores. Younger students (middle and high school) also work in small teams in half day units with the same mentors. All campers become comfortable in an academic setting, gain experience working in research labs learning and practicing techniques, and jointly interpret collective results. The continuation of the project over five years (2009-2014) will allow these students to develop relationships with scientists and to receive mentoring beyond the laboratory as they make transitions into 2- and 4-year colleges and into graduate school. Their research provides historical and environmental information that is relevant to their own land that will be used by Resource Management which is

The utility of biomarkers in differentiating bacterial from non-bacterial lower respiratory tract infection in hospitalized children: difference of the diagnostic performance between acute pneumonia and bronchitis.

PubMed

Hoshina, Takayuki; Nanishi, Etsuro; Kanno, Shunsuke; Nishio, Hisanori; Kusuhara, Koichi; Hara, Toshiro

2014-10-01

The aim of this study is to investigate the utility of several biomarkers in differentiating bacterial community-acquired lower respiratory tract infection (CA-LRTI) from non-bacterial CA-LRTI in children and the difference of their diagnostic performance between pneumonia and bronchitis. A retrospective cohort study composed of 108 pediatric patients hospitalized for CA-LRTI was performed during 2010-2013. Based on the findings of chest X-ray and sputum samples, patients were divided into 4 categories, group of bacterial pneumonia or bronchitis, and non-bacterial (viral or etiology-unknown) pneumonia or bronchitis. Peripheral white blood cell and neutrophil counts, and serum C-reactive protein (CRP) and procalcitonin (PCT) levels were compared among the 4 groups. Finally, 54 patients were the subject of this study. In the patients with pneumonia, serum CRP and PCT levels were significantly elevated in the group of bacterial pneumonia (CRP: p = 0.02, PCT: p = 0.0008). The area under the receiver operating characteristic curve for PCT for distinguishing between bacterial and non-bacterial pneumonia was the largest, and sensitivity, specificity, positive predictive value and negative predictive value of PCT were best among 4 markers. On the other hand, in the patients with bronchitis, neutrophil count was significantly decreased in non-bacterial bronchitis whereas no significant differences of WBC count, CRP level or PCT level were seen. In conclusion, PCT was the most useful marker to differentiate bacterial pneumonia whereas neutrophil count contributed most to the discrimination of bacterial bronchitis. The diagnostic performance of biomarkers may be different between pneumonia and bronchitis. Copyright © 2014. Published by Elsevier Ltd.

Bacteriophage Amplification-Coupled Detection and Identification of Bacterial Pathogens

NASA Astrophysics Data System (ADS)

Cox, Christopher R.; Voorhees, Kent J.

Current methods of species-specific bacterial detection and identification are complex, time-consuming, and often require expensive specialized equipment and highly trained personnel. Numerous biochemical and genotypic identification methods have been applied to bacterial characterization, but all rely on tedious microbiological culturing practices and/or costly sequencing protocols which render them impractical for deployment as rapid, cost-effective point-of-care or field detection and identification methods. With a view towards addressing these shortcomings, we have exploited the evolutionarily conserved interactions between a bacteriophage (phage) and its bacterial host to develop species-specific detection methods. Phage amplification-coupled matrix assisted laser desorption time-of-flight mass spectrometry (MALDI-TOF-MS) was utilized to rapidly detect phage propagation resulting from species-specific in vitro bacterial infection. This novel signal amplification method allowed for bacterial detection and identification in as little as 2 h, and when combined with disulfide bond reduction methods developed in our laboratory to enhance MALDI-TOF-MS resolution, was observed to lower the limit of detection by several orders of magnitude over conventional spectroscopy and phage typing methods. Phage amplification has been combined with lateral flow immunochromatography (LFI) to develop rapid, easy-to-operate, portable, species-specific point-of-care (POC) detection devices. Prototype LFI detectors have been developed and characterized for Yersinia pestis and Bacillus anthracis, the etiologic agents of plague and anthrax, respectively. Comparable sensitivity and rapidity was observed when phage amplification was adapted to a species-specific handheld LFI detector, thus allowing for rapid, simple, POC bacterial detection and identification while eliminating the need for bacterial culturing or DNA isolation and amplification techniques.

Pyrosequencing analysis of bacterial diversity in dental unit waterlines.

PubMed

Costa, Damien; Mercier, Anne; Gravouil, Kevin; Lesobre, Jérôme; Delafont, Vincent; Bousseau, Anne; Verdon, Julien; Imbert, Christine

2015-09-15

Some infections cases due to exposure to output water from dental unit waterlines (DUWL) have been reported in the literature. However, this type of healthcare-associated risk has remained unclear and up until now the overall bacterial composition of DUWL has been poorly documented. In this study, 454 high-throughput pyrosequencing was used to investigate the bacterial community in seven dental offices (N = 7) and to identify potential bacterial pathogenic sequences. Dental unit waters (DUW) were collected from the tap water supplying units (Incoming Water; IW) to the output exposure point of the turbine handpiece (Output water; OW) following a stagnation period (OWS), and immediately after the last patient of the sampling day (OWA). A high bacterial diversity was revealed in DUW with 394 operational taxonomic units detected at the genus level. In addition to the inter-unit variability observed, results showed increased total bacterial cell concentration and shifts in bacterial community composition and abundance at the genus level, mainly within the Gamma- and Alpha-Proteobacteria class, as water circulated in the dental unit (DU). Results showed that 96.7%, 96.8% and 97.4% of the total sequences from IW, OWS and OWA respectively were common to the 3 defined water groups, thereby highlighting a common core microbiome. Results also suggested that stagnation and DU maintenance practices were critical to composition of the bacterial community. The presence of potentially pathogenic genera was detected, including Pseudomonas and Legionella spp. Emerging and opportunistic pathogenic genera such as Mycobacterium, Propionibacterium and Stenotrophomonas were likewise recovered in DUW. For the first time, an exhaustive evaluation of the bacterial communities present in DUW was performed taking into account the circulation of water within the DU. This study highlights an ignored diversity of the DUWL bacterial community. Our findings also contribute to a better

Reduction of forecast uncertainty in the context of hydropower production: a case study for two catchment in Lac-St-Jean, Canada

NASA Astrophysics Data System (ADS)

Brisson, Cathy; Boucher, Marie-Amélie; Latraverse, Marco

2014-05-01

This research focuses on the improvement of streamflow forecasts for two subcatchments in the Lac-St-Jean area, a northern part of the province of Quebec in Canada. Those two subcatchments, named Manouane and Passes-Dangereuses, are part of a bigger system, which comprises many reservoirs and six hydropower plants. This system is managed by Rio Tinto Alcan, an aluminium producer who needs this energy for its processes. Optimal management of the hydropower plants highly depends on the reliability of the inflow forecasts to the reservoirs and also on the reliability of observed streamflow. The latter are not directly measured, but rather deduced from the computation of a water balance. This water balance includes streamflow computation based on rating curves for river sections and upstream reservoirs and a modelling process using CEQUEAU hydrological model (Morin et al., 1981). In addition, mostly during the winter, the model has to account for a transfer of water from Lac Manouane reservoir to Passes-Dangereuses through Bonnard channel. Winter flow though Bonnard channel is controlled by a spillway, and represented in CEQUEAU by a transfer function and a fixed time delay (2 days). However, it is suspected that the evacuation function, as it is currently computed, is inaccurate. The main objective of this work is to reduce predictive uncertainty for Lac Manouane and Passes-Dangereuses catchment, for the one-day ahead horizon. This objective is twofold. First, the uncertainty related to the parameterization of the hydrological model had never been evaluated. It was to be investigated whether it is better to spatialize the calibration of the hydrological model. In its actual form, the calibration of the hydrological model CEQUEAU (Morin et al., 1981) is based exclusively on the downstream outflow. There is, however, intermediate streamflow measurements data available for an intermediate location. Our study shows that calibrating the model using streamflows for both

Bacterial meningitis.

PubMed

Heckenberg, Sebastiaan G B; Brouwer, Matthijs C; van de Beek, Diederik

2014-01-01

Bacterial meningitis is a neurologic emergency. Vaccination against common pathogens has decreased the burden of disease. Early diagnosis and rapid initiation of empiric antimicrobial and adjunctive therapy are vital. Therapy should be initiated as soon as blood cultures have been obtained, preceding any imaging studies. Clinical signs suggestive of bacterial meningitis include fever, headache, meningismus, and an altered level of consciousness but signs may be scarce in children, in the elderly, and in meningococcal disease. Host genetic factors are major determinants of susceptibility to meningococcal and pneumococcal disease. Dexamethasone therapy has been implemented as adjunctive treatment of adults with pneumococcal meningitis. Adequate and prompt treatment of bacterial meningitis is critical to outcome. In this chapter we review the epidemiology, pathophysiology, and management of bacterial meningitis. © 2014 Elsevier B.V. All rights reserved.

Diversity of bacterial communities and dissolved organic matter in a temperate estuary.

PubMed

Osterholz, Helena; Kirchman, David L; Niggemann, Jutta; Dittmar, Thorsten

2018-06-14

Relationships between bacterial community and dissolved organic matter (DOM) include microbial uptake, transformation and secretion, all of which influence DOM composition. In this study, we explore diversity and similarity metrics of dissolved organic molecules (Fourier-transform ion cyclotron resonance mass spectrometry) and bacterial communities (tag-sequencing of 16S rRNA genes) along the salinity gradient of the Delaware Estuary (USA). We found that even though mixing, discharge and seasonal changes explained most of the variation in DOM and bacterial communities, there was still a relationship, albeit weak, between the composition of DOM and bacterial communities in the estuary. Overall, many DOM molecular formulas (MFs) and bacterial operational taxonomic units (OTUs) reoccurred over years and seasons while the frequency of MF-OTU correlations varied. Diversity based on MFs and OTUs was significantly correlated, decreasing towards the open ocean. However, while the diversity of bacterial OTUs dropped markedly with low salinity, MF diversity decreased strongly only at high salinities. We hypothesize that the different turnover times of DOM and bacteria lead to different abundance distributions of OTUs and MFs. A significant portion of the detected DOM is of a more refractory nature with lifetimes largely exceeding the mixing time of the estuary, while bacterial community turnover times in the Delaware Estuary are estimated at several days.

Substrate Type and Free Ammonia Determine Bacterial Community Structure in Full-Scale Mesophilic Anaerobic Digesters Treating Cattle or Swine Manure

PubMed Central

Li, Jiabao; Rui, Junpeng; Yao, Minjie; Zhang, Shiheng; Yan, Xuefeng; Wang, Yuanpeng; Yan, Zhiying; Li, Xiangzhen

2015-01-01

The microbial-mediated anaerobic digestion (AD) process represents an efficient biological process for the treatment of organic waste along with biogas harvest. Currently, the key factors structuring bacterial communities and the potential core and unique bacterial populations in manure anaerobic digesters are not completely elucidated yet. In this study, we collected sludge samples from 20 full-scale anaerobic digesters treating cattle or swine manure, and investigated the variations of bacterial community compositions using high-throughput 16S rRNA amplicon sequencing. Clustering and correlation analysis suggested that substrate type and free ammonia (FA) play key roles in determining the bacterial community structure. The COD: NH4+-N (C:N) ratio of substrate and FA were the most important available operational parameters correlating to the bacterial communities in cattle and swine manure digesters, respectively. The bacterial populations in all of the digesters were dominated by phylum Firmicutes, followed by Bacteroidetes, Proteobacteria and Chloroflexi. Increased FA content selected Firmicutes, suggesting that they probably play more important roles under high FA content. Syntrophic metabolism by Proteobacteria, Chloroflexi, Synergistetes and Planctomycetes are likely inhibited when FA content is high. Despite the different manure substrates, operational conditions and geographical locations of digesters, core bacterial communities were identified. The core communities were best characterized by phylum Firmicutes, wherein Clostridium predominated overwhelmingly. Substrate-unique and abundant communities may reflect the properties of manure substrate and operational conditions. These findings extend our current understanding of the bacterial assembly in full-scale manure anaerobic digesters. PMID:26648921

Cerebrospinal fluid lactate level as a diagnostic biomarker for bacterial meningitis in children

PubMed Central

2014-01-01

Background Cerebrospinal fluid (CSF) lactate is a potential biomarker for bacterial meningitis in children. To this end, we performed a single-center retrospective cohort study of children from Sao Paulo, Brazil, with CSF pleocytosis to evaluate the ability of CSF lactate to distinguish between children with bacterial and aseptic meningitis. We determined the optimum cutoff point for CSF lactate using receiver-operator curve (ROC) analysis. Findings We identified 451 children of whom 40 (9%) had bacterial meningitis. Children with bacterial meningitis had a higher median CSF lactate level [9.6 mmol/l, interquartile range (IQR) 3.2-38.5 mmol/l bacterial meningitis vs. 2.0 mmol/l, IQR 1.2-2.8 mmol/l aseptic meningitis]. A CSF lactate cutoff point of 3.0 mmol/l had a sensitivity of 95% [95% confidence interval (CI) 83-99%), specificity of 94% (95% CI 90-96%) and negative predictive value of 99.3% (95% CI 97.7-99.9%) for bacterial meningitis. Conclusions In combination with a validated meningitis clinical prediction rule, the CSF lactate level can be used to distinguish between bacterial and aseptic meningitis in children with CSF pleocytosis. PMID:24576334

Cerebrospinal fluid lactate level as a diagnostic biomarker for bacterial meningitis in children.

PubMed

Mekitarian Filho, Eduardo; Horita, Sérgio Massaru; Gilio, Alfredo Elias; Nigrovic, Lise E

2014-02-27

Cerebrospinal fluid (CSF) lactate is a potential biomarker for bacterial meningitis in children. To this end, we performed a single-center retrospective cohort study of children from Sao Paulo, Brazil, with CSF pleocytosis to evaluate the ability of CSF lactate to distinguish between children with bacterial and aseptic meningitis. We determined the optimum cutoff point for CSF lactate using receiver-operator curve (ROC) analysis. We identified 451 children of whom 40 (9%) had bacterial meningitis. Children with bacterial meningitis had a higher median CSF lactate level [9.6 mmol/l, interquartile range (IQR) 3.2-38.5 mmol/l bacterial meningitis vs. 2.0 mmol/l, IQR 1.2-2.8 mmol/l aseptic meningitis]. A CSF lactate cutoff point of 3.0 mmol/l had a sensitivity of 95% [95% confidence interval (CI) 83-99%), specificity of 94% (95% CI 90-96%) and negative predictive value of 99.3% (95% CI 97.7-99.9%) for bacterial meningitis. In combination with a validated meningitis clinical prediction rule, the CSF lactate level can be used to distinguish between bacterial and aseptic meningitis in children with CSF pleocytosis.

Bacterial diversity of oil palm Elaeis guineensis basal stems

NASA Astrophysics Data System (ADS)

Amran, Afzufira; Jangi, Mohd Sanusi; Aqma, Wan Syaidatul; Yusof, Nurul Yuziana Mohd; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

Oil palm, Elaeis guineensis is one of the major industrial production crops in Malaysia. Basal stem rot, caused by the white fungus, Ganoderma boninense, is a disease that reduces oil palm yields in most production areas of the world. Understanding of bacterial community that is associated with Ganoderma infection will shed light on how this bacterial community contributes toward the severity of the infection. In this preliminary study, we assessed the bacterial community that inhabit the basal stems of E. guineensis based on 16S rRNA gene as a marker using next generation sequencing platform. This result showed that a total of 84,372 operational taxonomic-units (OTUs) were identified within six samples analyzed. A total 55,049 OTUs were assigned to known taxonomy whereas 29,323 were unassigned. Cyanobacteria, Bacteroidetes, Firmicutes and Proteobacteria were the most abundant phyla found in all six samples and the unique taxonomy assigned for each infected and healthy samples were also identified. The findings from this study will further enhance our knowledge in the interaction of bacterial communities against Ganoderma infection within the oil palm host plant and for a better management of the basal stems rot disease.

Bacterial communities in soil samples from the Mingyong Glacier of southwestern China.

PubMed

Li, Haoyu; Taj, Muhammad Kamran; Ji, Xiuling; Zhang, Qi; Lin, Liangbing; Zhou, Zhimei; Wei, Yunlin

2017-05-01

The present study was an effort to determine the bacterial diversity of soils in Mingyong Glacier located at the Meili Snow Mountains of southwestern China. Mingyong Glacier has different climatic zones within a very narrow area, and bacterial community diversity in this low temperature area remains largely unknown. In this study, soil samples were collected from four different climatic zones: M11A (dry warm valley), M14 (forest), M15 (grass land), and M16 (glacier zones). Phylogenetic analysis based on 16S rRNA gene V6 hypervariable region showed high bacterial abundance in the glacier. The number of Operational Taxonomic Units ranged from 2.24×10 3 to 5.56×10 3 in soil samples. Statistical analysis of 16S rRNA gene clone libraries results showed that bacterial diversity in zones M11A，M14 and M16 are higher than in zone M15. The bacterial community structures are clearly distinguishable, and phylogenetic analysis showed that the predominant phyla were Proteobacteria, Deinococcus-Thermus, Firmicutes, Actinobacteria, and Nitrospirae in Mingyong Glacier. Seventy-nine different orders from four zones have been isolated. Bacterial diversity and distribution of bacterial communities related to the anthropogenic perturbations in zone (M15) were confirmed by diversity index analysis, and the diversity index of other three zones was satisfactory through this analysis software. The results suggest that bacterial diversity and distribution analyses using bacterial 16S rRNA gene V6 hypervariable region were successful, and bacterial communities in this area not only had the same bacterial phyla compared to other glaciers but also had their own rare species.

Characterisation of the bacterial community structures in the intestine of Lampetra morii.

PubMed

Li, Yingying; Xie, Wenfang; Li, Qingwei

2016-07-01

The metagenomic analysis and 16S rDNA sequencing method were used to investigate the bacterial community in the intestines of Lampetra morii. The bacterial community structure in L. morii intestine was relatively simple. Eight different operational taxonomic units were observed. Chitinophagaceae_unclassified (26.5 %) and Aeromonas spp. (69.6 %) were detected as dominant members at the genus level. The non-dominant genera were as follows: Acinetobacter spp. (1.4 %), Candidatus Bacilloplasma (2.5 %), Enterobacteria spp. (1.5 %), Shewanella spp. (0.04 %), Vibrio spp. (0.09 %), and Yersinia spp. (1.8 %). The Shannon-Wiener (H) and Simpson (1-D) indexes were 0.782339 and 0.5546, respectively. The rarefaction curve representing the bacterial community richness and Shannon-Wiener curve representing the bacterial community diversity reached asymptote, which indicated that the sequence depth were sufficient to represent the majority of species richness and bacterial community diversity. The number of Aeromonas in lamprey intestine was two times higher after stimulation by lipopolysaccharide than PBS. This study provides data for understanding the bacterial community harboured in lamprey intestines and exploring potential key intestinal symbiotic bacteria essential for the L. morii immune response.

Air Quality Monitoring of the Post-Operative Recovery Room and Locations Surrounding Operating Theaters in a Medical Center in Taiwan

PubMed Central

Tang, Chin-Sheng; Wan, Gwo-Hwa

2013-01-01

To prevent surgical site infection (SSI), the airborne microbial concentration in operating theaters must be reduced. The air quality in operating theaters and nearby areas is also important to healthcare workers. Therefore, this study assessed air quality in the post-operative recovery room, locations surrounding the operating theater area, and operating theaters in a medical center. Temperature, relative humidity (RH), and carbon dioxide (CO2), suspended particulate matter (PM), and bacterial concentrations were monitored weekly over one year. Measurement results reveal clear differences in air quality in different operating theater areas. The post-operative recovery room had significantly higher CO2 and bacterial concentrations than other locations. Bacillus spp., Micrococcus spp., and Staphylococcus spp. bacteria often existed in the operating theater area. Furthermore, Acinetobacter spp. was the main pathogen in the post-operative recovery room (18%) and traumatic surgery room (8%). The mixed effect models reveal a strong correlation between number of people in a space and high CO2 concentration after adjusting for sampling locations. In conclusion, air quality in the post-operative recovery room and operating theaters warrants attention, and merits long-term surveillance to protect both surgical patients and healthcare workers. PMID:23573296

Air quality monitoring of the post-operative recovery room and locations surrounding operating theaters in a medical center in Taiwan.

PubMed

Tang, Chin-Sheng; Wan, Gwo-Hwa

2013-01-01

To prevent surgical site infection (SSI), the airborne microbial concentration in operating theaters must be reduced. The air quality in operating theaters and nearby areas is also important to healthcare workers. Therefore, this study assessed air quality in the post-operative recovery room, locations surrounding the operating theater area, and operating theaters in a medical center. Temperature, relative humidity (RH), and carbon dioxide (CO2), suspended particulate matter (PM), and bacterial concentrations were monitored weekly over one year. Measurement results reveal clear differences in air quality in different operating theater areas. The post-operative recovery room had significantly higher CO2 and bacterial concentrations than other locations. Bacillus spp., Micrococcus spp., and Staphylococcus spp. bacteria often existed in the operating theater area. Furthermore, Acinetobacter spp. was the main pathogen in the post-operative recovery room (18%) and traumatic surgery room (8%). The mixed effect models reveal a strong correlation between number of people in a space and high CO2 concentration after adjusting for sampling locations. In conclusion, air quality in the post-operative recovery room and operating theaters warrants attention, and merits long-term surveillance to protect both surgical patients and healthcare workers.

CSF lactate for accurate diagnosis of community-acquired bacterial meningitis.

PubMed

Giulieri, S; Chapuis-Taillard, C; Jaton, K; Cometta, A; Chuard, C; Hugli, O; Du Pasquier, R; Bille, J; Meylan, P; Manuel, O; Marchetti, O

2015-10-01

CSF lactate measurement is recommended when nosocomial meningitis is suspected, but its value in community-acquired bacterial meningitis is controversial. We evaluated the diagnostic performance of lactate and other CSF parameters in a prospective cohort of adult patients with acute meningitis. Diagnostic accuracy of lactate and other CSF parameters in patients with microbiologically documented episodes was assessed by receiver operating characteristic (ROC) curves. The cut-offs with the best diagnostic performance were determined. Forty-five of 61 patients (74%) had a documented bacterial (n = 18; S. pneumoniae, 11; N. meningitidis, 5; other, 2) or viral (n = 27 enterovirus, 21; VZV, 3; other, 3) etiology. CSF parameters were significantly different in bacterial vs. viral meningitis, respectively (p < 0.001 for all comparisons): white cell count (median 1333 vs. 143/mm(3)), proteins (median 4115 vs. 829 mg/l), CSF/blood glucose ratio (median 0.1 vs. 0.52), lactate (median 13 vs. 2.3 mmol/l). ROC curve analysis showed that CSF lactate had the highest accuracy for discriminating bacterial from viral meningitis, with a cutoff set at 3.5 mmol/l providing 100% sensitivity, specificity, PPV, NPV, and efficiency. CSF lactate had the best accuracy for discriminating bacterial from viral meningitis and should be included in the initial diagnostic workup of this condition.

Association between bacterial survival and free chlorine concentration during commercial fresh-cut produce wash operation

USDA-ARS?s Scientific Manuscript database

Determining minimal, effective free chlorine (FC) concentration for preventing pathogen survival and cross-contamination is critical for developing science- and risk-based food safety practices. The correlation between dynamic FC concentrations and bacterial survival was investigated under commerci...

First report of bacterial community from a Bat Guano using Illumina next-generation sequencing.

PubMed

De Mandal, Surajit; Zothansanga; Panda, Amritha Kumari; Bisht, Satpal Singh; Senthil Kumar, Nachimuthu

2015-06-01

V4 hypervariable region of 16S rDNA was analyzed for identifying the bacterial communities present in Bat Guano from the unexplored cave - Pnahkyndeng, Meghalaya, Northeast India. Metagenome comprised of 585,434 raw Illumina sequences with a 59.59% G+C content. A total of 416,490 preprocessed reads were clustered into 1282 OTUs (operational taxonomical units) comprising of 18 bacterial phyla. The taxonomic profile showed that the guano bacterial community is dominated by Chloroflexi, Actinobacteria and Crenarchaeota which account for 70.73% of all sequence reads and 43.83% of all OTUs. Metagenome sequence data are available at NCBI under the accession no. SRP051094. This study is the first to characterize Bat Guano bacterial community using next-generation sequencing approach.

First report of bacterial community from a Bat Guano using Illumina next-generation sequencing

PubMed Central

De Mandal, Surajit; Zothansanga; Panda, Amritha Kumari; Bisht, Satpal Singh; Senthil Kumar, Nachimuthu

2015-01-01

V4 hypervariable region of 16S rDNA was analyzed for identifying the bacterial communities present in Bat Guano from the unexplored cave — Pnahkyndeng, Meghalaya, Northeast India. Metagenome comprised of 585,434 raw Illumina sequences with a 59.59% G+C content. A total of 416,490 preprocessed reads were clustered into 1282 OTUs (operational taxonomical units) comprising of 18 bacterial phyla. The taxonomic profile showed that the guano bacterial community is dominated by Chloroflexi, Actinobacteria and Crenarchaeota which account for 70.73% of all sequence reads and 43.83% of all OTUs. Metagenome sequence data are available at NCBI under the accession no. SRP051094. This study is the first to characterize Bat Guano bacterial community using next-generation sequencing approach. PMID:26484190

On the Redshift of TeV BL Lac Objects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paiano, Simona; Falomo, Renato; Landoni, Marco

2017-03-10

We report results of a spectroscopic campaign carried out at the 10 m Gran Telescopio Canarias for a sample of 22 BL Lac objects detected (or candidates) at TeV energies, aiming to determine or constrain their redshift. This is of fundamental importance for the interpretation of their emission models and for population studies and is also mandatory for studying the interaction of high-energy photons with the extragalactic background light using TeV sources. Optical spectra with high signal-to-noise ratios in the range 4250–10000 Å were obtained to search for faint emission or absorption lines from both the host galaxy and themore » nucleus. We determine a new redshift for PKS 1424+240 ( z = 0.604) and a tentative one for 1ES 0033+595 ( z = 0.467). We are able to set new spectroscopic redshift lower limits for three other sources on the basis of Mg ii and Ca ii intervening absorption features: BZB J1243+3627 ( z > 0.483), BZB J1540+8155 ( z > 0.672), and BZB 0J2323+4210 ( z > 0.267). We confirm previous redshift estimates for four blazars: S3 0218+357 ( z = 0.944), 1ES 1215+303 ( z = 0.129), W Comae ( z = 0.102), and MS 1221.8+2452 ( z = 0.218). For the remaining targets, in seven cases (S2 0109+22, 3C 66A, VER J0521+211, S4 0954+65, BZB J1120+4214, S3 1227+25, BZB J2323+4210), we do not validate the proposed redshift. Finally, for all sources of still-unknown redshift, we set a lower limit based on the minimum equivalent width of absorption features expected from the host galaxy.« less

Predictive value of bacterial analysis of laparotomy wounds.

PubMed

Minutolo, Mario; Blandino, Giovanna; Arena, Manuel; Licciardello, Alessio; Di Stefano, Biagio; Lanteri, Raffaele; Puleo, Stefano; Licata, Antonio; Minutolo, Vincenzo

2014-01-01

Despite improvements in antibiotic prophylaxis, surgical site infections represent the most common postoperative complication with important clinical consequences for patients. The hypothesis that a bacterial analysis of the surgical wound in the operating room could predict the likelihood of developing a clinical infection, and might allow a tailored and preemptive approach, aimed to reduce the consequences of an infection, seems appealing. We would like to present a prospective study on the predictive value of the bacterial analysis of laparotomy wounds. Seventy eight prospective patients undergoing surgery were included in the study. To evaluate the risk factors associated with increased rate of wound infection, we performed a bacterial analysis of the wound. 48 patients out of 78 (61%) had positive cultures. 23 patients out of 32 patients (72%) who didn't receive antibiotic prophylaxis were positive to the wound culture whereas 25 patients out of 46 patients (54%) grew positive cultures in the group of patients that received antibiotic prophylaxis. None of the 30 patients with negative cultures developed clinical infection. Only 6 patients out of 48 patients who had positive cultures (12.5%) developed wound infection. Clinical infection occurred in 5 patients who had gram-negative contamination of the wound. No clinical infection occurred in patients who had gram-positive contamination. Wound cultures and their positivity are predictive tools to identify the patients that are at risk to develop wound infection. The positive predictive value of the bacterial analysis of the wound was 12.5%. Abdominal surgery, Bacterial analysis, Wound infection.

Engineering an allosteric transcription factor to respond to new ligands.

PubMed

Taylor, Noah D; Garruss, Alexander S; Moretti, Rocco; Chan, Sum; Arbing, Mark A; Cascio, Duilio; Rogers, Jameson K; Isaacs, Farren J; Kosuri, Sriram; Baker, David; Fields, Stanley; Church, George M; Raman, Srivatsan

2016-02-01

Genetic regulatory proteins inducible by small molecules are useful synthetic biology tools as sensors and switches. Bacterial allosteric transcription factors (aTFs) are a major class of regulatory proteins, but few aTFs have been redesigned to respond to new effectors beyond natural aTF-inducer pairs. Altering inducer specificity in these proteins is difficult because substitutions that affect inducer binding may also disrupt allostery. We engineered an aTF, the Escherichia coli lac repressor, LacI, to respond to one of four new inducer molecules: fucose, gentiobiose, lactitol and sucralose. Using computational protein design, single-residue saturation mutagenesis or random mutagenesis, along with multiplex assembly, we identified new variants comparable in specificity and induction to wild-type LacI with its inducer, isopropyl β-D-1-thiogalactopyranoside (IPTG). The ability to create designer aTFs will enable applications including dynamic control of cell metabolism, cell biology and synthetic gene circuits.

Industrial activated sludge exhibit unique bacterial community composition at high taxonomic ranks.

PubMed

Ibarbalz, Federico M; Figuerola, Eva L M; Erijman, Leonardo

2013-07-01

Biological degradation of domestic and industrial wastewater by activated sludge depends on a common process of separation of the diverse self-assembled and self-sustained microbial flocs from the treated wastewater. Previous surveys of bacterial communities indicated the presence of a common core of bacterial phyla in municipal activated sludge, an observation consistent with the concept of ecological coherence of high taxonomic ranks. The aim of this work was to test whether this critical feature brings about a common pattern of abundance distribution of high bacterial taxa in industrial and domestic activated sludge, and to relate the bacterial community structure of industrial activated sludge with relevant operational parameters. We have applied 454 pyrosequencing of 16S rRNA genes to evaluate bacterial communities in full-scale biological wastewater treatment plants sampled at different times, including seven systems treating wastewater from different industries and one plant that treats domestic wastewater, and compared our datasets with the data from municipal wastewater treatment plants obtained by three different laboratories. We observed that each industrial activated sludge system exhibited a unique bacterial community composition, which is clearly distinct from the common profile of bacterial phyla or classes observed in municipal plants. The influence of process parameters on the bacterial community structure was evaluated using constrained analysis of principal coordinates (CAP). Part of the differences in the bacterial community structure between industrial wastewater treatment systems were explained by dissolved oxygen and pH. Despite the ecological relevance of floc formation for the assembly of bacterial communities in activated sludge, the wastewater characteristics are likely to be the major determinant that drives bacterial composition at high taxonomic ranks. Copyright © 2013 Elsevier Ltd. All rights reserved.

Initiation of a lightning search using the lightning and airglow camera onboard the Venus orbiter Akatsuki

NASA Astrophysics Data System (ADS)

Takahashi, Yukihiro; Sato, Mitsuteru; Imai, Masataka; Lorenz, Ralph; Yair, Yoav; Aplin, Karen; Fischer, Georg; Nakamura, Masato; Ishii, Nobuaki; Abe, Takumi; Satoh, Takehiko; Imamura, Takeshi; Hirose, Chikako; Suzuki, Makoto; Hashimoto, George L.; Hirata, Naru; Yamazaki, Atsushi; Sato, Takao M.; Yamada, Manabu; Murakami, Shin-ya; Yamamoto, Yukio; Fukuhara, Tetsuya; Ogohara, Kazunori; Ando, Hiroki; Sugiyama, Ko-ichiro; Kashimura, Hiroki; Ohtsuki, Shoko

2018-05-01

The existence of lightning discharges in the Venus atmosphere has been controversial for more than 30 years, with many positive and negative reports published. The lightning and airglow camera (LAC) onboard the Venus orbiter, Akatsuki, was designed to observe the light curve of possible flashes at a sufficiently high sampling rate to discriminate lightning from other sources and can thereby perform a more definitive search for optical emissions. Akatsuki arrived at Venus during December 2016, 5 years following its launch. The initial operations of LAC through November 2016 have included a progressive increase in the high voltage applied to the avalanche photodiode detector. LAC began lightning survey observations in December 2016. It was confirmed that the operational high voltage was achieved and that the triggering system functions correctly. LAC lightning search observations are planned to continue for several years.

Perturbation of seafloor bacterial community structure by drilling waste discharge.

PubMed

Nguyen, Tan T; Cochrane, Sabine K J; Landfald, Bjarne

2018-04-01

Offshore drilling operations result in the generation of drill cuttings and localized smothering of the benthic habitats. This study explores bacterial community changes in the in the upper layers of the seafloor resulting from an exploratory drilling operation at 1400m water depth on the Barents Sea continental slope. Significant restructurings of the sediment microbiota were restricted to the sampling sites notably affected by the drilling waste discharge, i.e. at 30m and 50m distances from the drilling location, and to the upper 2cm of the seafloor. Three bacterial groups, the orders Clostridiales and Desulfuromonadales and the class Mollicutes, were almost exclusively confined to the upper two centimeters at 30m distance, thereby corroborating an observed increase in anaerobicity inflicted by the drilling waste deposition. The potential of these phylogenetic groups as microbial bioindicators of the spatial extent and persistence of drilling waste discharge should be further explored. Copyright © 2017 Elsevier Ltd. All rights reserved.

Time-resolved photometry of the nova remnants DM Gem, CP Lac, GI Mon, V400 Per, CT Ser and XX Tau

NASA Astrophysics Data System (ADS)

Rodríguez-Gil, P.; Torres, M. A. P.

2005-02-01

We present the first results of a photometric survey of poorly studied nova remnants in the Northern Hemisphere. The main results are as follows: DM Gem shows a modulation at 0.123 d (probably linked to the orbit) and rapid variations at ˜ 22 min. A moderate resolution spectrum taken at the time of the photometric observations shows intense He II 4686 and Bowen emission, characteristic of an intermediate polar or a SW Sex star. Variability at 0.127 d and intense flickering (or quasi-periodic oscillations) are the main features of the light curve of CP Lac. A 0.1-mag dip lasting for ˜ 45 min is observed in GI Mon, which could be an eclipse. A clear modulation (probably related to the orbital motion) either at 0.179 d or 0.152 d is observed in the B-band light curve of V400 Per. The results for CT Ser point to an orbital period close to 0.16 d. Intense flickering is also characteristic of this old nova. Finally, XX Tau shows a possible periodic signal near 0.14 d and displays fast variability at ˜ 24 min. Its brightness seems to be modulated at ˜ 5 d. We relate this long periodicity to the motion of an eccentric/tilted accretion disc in the binary. Based in part on observations made with the Jacobus Kapteyn Telescope, which was operated on the island of La Palma by the Isaac Newton Group in the Spanish Observatorio del Roque de los Muchachos of the Instituto de Astrofísica de Canarias (IAC), and on observations made with the IAC80 telescope, operated on the island of Tenerife by the IAC in the Spanish Observatorio del Teide of the IAC. Observations were also obtained at the FLWO Observatory, a facility of the Smithsonian Institution.

A comparative study of fungal and bacterial biofiltration treating a VOC mixture.

PubMed

Estrada, José M; Hernández, Sergio; Muñoz, Raúl; Revah, Sergio

2013-04-15

Bacterial biofilters usually exhibit a high microbial diversity and robustness, while fungal biofilters have been claimed to better withstand low moisture contents and pH values, and to be more efficient coping with hydrophobic volatile organic compounds (VOCs). However, there are only few systematic evaluations of both biofiltration technologies. The present study compared fungal and bacterial biofiltration for the treatment of a VOC mixture (propanal, methyl isobutyl ketone-MIBK, toluene and hexanol) under the same operating conditions. Overall, fungal biofiltration supported lower elimination capacities than its bacterial counterpart (27.7 ± 8.9 vs 40.2 ± 5.4 gCm(-3) reactor h(-1)), which exhibited a final pressure drop 60% higher than that of the bacterial biofilter due to mycelial growth. The VOC mineralization ratio was also higher in the bacterial bed (≈ 63% vs ≈ 43%). However, the substrate biodegradation preference order was similar for both biofilters (propanal>hexanol>MIBK>toluene) with propanal partially inhibiting the consumption of the rest of the VOCs. Both systems supported an excellent robustness versus 24h VOC starvation episodes. The implementation of a fungal/bacterial coupled system did not significantly improve the VOC removal performance compared to the individual biofilter performances. Copyright © 2013 Elsevier B.V. All rights reserved.

Comparison of bacterial communities of conventional and A-stage activated sludge systems

PubMed Central

Gonzalez-Martinez, Alejandro; Rodriguez-Sanchez, Alejandro; Lotti, Tommaso; Garcia-Ruiz, Maria-Jesus; Osorio, Francisco; Gonzalez-Lopez, Jesus; van Loosdrecht, Mark C. M.

2016-01-01

The bacterial community structure of 10 different wastewater treatment systems and their influents has been investigated through pyrosequencing, yielding a total of 283486 reads. These bioreactors had different technological configurations: conventional activated sludge (CAS) systems and very highly loaded A-stage systems. A-stage processes are proposed as the first step in an energy producing municipal wastewater treatment process. Pyrosequencing analysis indicated that bacterial community structure of all influents was similar. Also the bacterial community of all CAS bioreactors was similar. Bacterial community structure of A-stage bioreactors showed a more case-specific pattern. A core of genera was consistently found for all influents, all CAS bioreactors and all A-stage bioreactors, respectively, showing that different geographical locations in The Netherlands and Spain did not affect the functional bacterial communities in these technologies. The ecological roles of these bacteria were discussed. Influents and A-stage bioreactors shared several core genera, while none of these were shared with CAS bioreactors communities. This difference is thought to reside in the different operational conditions of the two technologies. This study shows that bacterial community structure of CAS and A-stage bioreactors are mostly driven by solids retention time (SRT) and hydraulic retention time (HRT), as suggested by multivariate redundancy analysis. PMID:26728449

Randomized Controlled Trial to Reduce Bacterial Colonization of Surgical Drains After Breast and Axillary Operations

PubMed Central

Degnim, Amy C.; Scow, Jeffrey S.; Hoskin, Tanya L.; Miller, Joyce P.; Loprinzi, Margie; Boughey, Judy C.; Jakub, James W.; Throckmorton, Alyssa; Patel, Robin; Baddour, Larry M.

2014-01-01

Objective To determine if bacterial colonization of drains can be reduced by local antiseptic interventions. Summary Background Drains are a potential source of bacterial entry into surgical wounds and may contribute to surgical site infection (SSI) after breast surgery. Methods Following IRB approval, patients undergoing total mastectomy and/or axillary lymph node dissection were randomized to standard drain care (control) or drain antisepsis (treated). Standard drain care comprised twice daily cleansing with alcohol swabs. Antisepsis drain care included 1) a chlorhexidine disc at the drain exit site and 2) irrigation of the drain bulb twice daily with dilute sodium hypochlorite (Dakin’s) solution. Cultures results of drain fluid and tubing were compared between control and antisepsis groups. Results Overall, 100 patients with 125 drains completed the study with 48 patients (58 drains) in the control group and 52 patients (67 drains) in the antisepsis group. Cultures of drain bulb fluid at one week were positive (1+ or greater growth) in 66% (38/58) of control drains compared to 21% of antisepsis drains (14/67), (p=0.0001). Drain tubing cultures demonstrated >50 CFU in 19% (8/43) of control drains versus 0% (0/53) of treated drains (p=0.004). SSI was diagnosed in 6 patients (6%) - 5 patients in the control group and 1 patient in the antisepsis group (p=0.06). Conclusions Simple and inexpensive local antiseptic interventions with a chlorhexidine disc and hypochlorite solution reduce bacterial colonization of drains. Based on these data, further study of drain antisepsis and its potential impact on SSI rate is warranted. PMID:23518704

ERRATIC FLARING OF BL LAC IN 2012–2013: MULTIWAVELENGTH OBSERVATIONS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wehrle, Ann E.; Grupe, Dirk; Jorstad, Svetlana G.

2016-01-10

BL Lac, the eponymous blazar, flared to historically high levels at millimeter, infrared, X-ray, and gamma-ray wavelengths in 2012. We present observations made with Herschel, Swift, NuSTAR, Fermi, the Submillimeter Array, CARMA, and the VLBA in 2012–2013, including three months with nearly daily sampling at several wavebands. We have also conducted an intensive campaign of 30 hr with every-orbit observations by Swift and NuSTAR, accompanied by Herschel, and Fermi observations. The source was highly variable at all bands. Time lags, correlations between bands, and the changing shapes of the spectral energy distributions can be explained by synchrotron radiation and inversemore » Compton emission from nonthermal seed photons originating from within the jet. The passage of four new superluminal very long baseline interferometry knots through the core and two stationary knots about 4 pc downstream accompanied the high flaring in 2012–2013. The seed photons for inverse Compton scattering may arise from the stationary knots and from a Mach disk near the core where relatively slow-moving plasma generates intense nonthermal radiation. The 95 spectral energy distributions obtained on consecutive days form the most densely sampled, broad wavelength coverage for any blazar. The observed spectral energy distributions and multi-waveband light curves are similar to simulated spectral energy distributions and light curves generated with a model in which turbulent plasma crosses a conical shock with a Mach disk.« less

Structural differences in the bacterial flagellar motor among bacterial species.

PubMed

Terashima, Hiroyuki; Kawamoto, Akihiro; Morimoto, Yusuke V; Imada, Katsumi; Minamino, Tohru

2017-01-01

The bacterial flagellum is a supramolecular motility machine consisting of the basal body as a rotary motor, the hook as a universal joint, and the filament as a helical propeller. Intact structures of the bacterial flagella have been observed for different bacterial species by electron cryotomography and subtomogram averaging. The core structures of the basal body consisting of the C ring, the MS ring, the rod and the protein export apparatus, and their organization are well conserved, but novel and divergent structures have also been visualized to surround the conserved structure of the basal body. This suggests that the flagellar motors have adapted to function in various environments where bacteria live and survive. In this review, we will summarize our current findings on the divergent structures of the bacterial flagellar motor.

The Effects of Saccharomyces boulardii on Bacterial Translocation in Rats with Obstructive Jaundice

PubMed Central

Geyik, Mehmet Faruk; Aldemir, Mustafa; Hosoglu, Salih; Ayaz, Celal; Satilmis, Selda; Buyukbayram, Huseyin; Kokoglu, Omer Faruk

2006-01-01

INTRODUCTION The aim of this study was to investigate the effect of Saccharomyces boulardii treatment on preventing bacterial translocation in an obstructive jaundice animal model. MATERIALS AND METHODS Sixty adult rats were divided into five groups: group 1 – the sham-operated group; group 2 – the common bile duct ligation group; group 3 – the S. boulardii group; group 4 – the ampicillin-sulbaktam group; and group 5 – the S. boulardii plus ampicillin-sulbaktam group. The saline, antibiotics and S. boulardii were given, respectively, for a 7-day period as a single dose per day via temporary orogastric intubation. Seven days following the obstructive jaundice, the animal had laparatomy under sterile conditions. Segments of ileum were removed for histopathological examination. Blood, liver, spleen and mesenteric lymph nodes were taken for microbiological culture. RESULTS Bacterial translocation rates were 0% in the sham-operated group, 83% in group 2, 42% in group 3, 42% in group 4 and 33% in group 5. Bacterial translocation significantly increased in group 2 compared to groups 3, 4 and 5 (P = 0.001). The bacterial counts (CFU/g) of group 2 were significantly higher than those of groups 3, 4 and 5 (P = 0.001). Histopathological examination of ileum specimens revealed a significant decrease in the heights of villi in groups 2–5 compared to the sham-operated group (P = 0.001). The mean villus height in groups 3 and 5 was significantly higher than that of group 4 (P = 0.001). CONCLUSIONS S. boulardii was found to be effective in the successful control of translocation and improvement of intestinal barrier function. PMID:16551414

Effect of mobile laminar airflow units on airborne bacterial contamination during neurosurgical procedures.

PubMed

von Vogelsang, A-C; Förander, P; Arvidsson, M; Löwenhielm, P

2018-03-24

Surgical site infections (SSIs) after neurosurgery are potentially life-threatening and entail great costs. SSIs may occur from airborne bacteria in the operating room, and ultraclean air is desired during infection-prone cleaning procedures. Door openings and the number of persons present in the operating room affect the air quality. Mobile laminar airflow (MLAF) units, with horizontal laminar airflow, have previously been shown to reduce airborne bacterial contamination. To assess the effect of MLAF units on airborne bacterial contamination during neurosurgical procedures. In a quasi-experimental design, bacteria-carrying particles (colony-forming units: cfu) during neurosurgical procedures were measured with active air-sampling in operating rooms with conventional turbulent ventilation, and with additional MLAF units. The MLAF units were shifted between operating rooms monthly. Colony-forming unit count and bacterial species detection were conducted after incubation. Data was collected for a period of 18 months. A total of 233 samples were collected during 45 neurosurgical procedures. The use of MLAF units significantly reduced the numbers of cfu in the surgical site area (P < 0.001) and above the instrument table (P < 0.001). Logistic regression showed that the only significant predictor affecting cfu count was the use of MLAF units (odds ratio: 41.6; 95% confidence interval: 11.3-152.8; P < 0.001). The most frequently detected bacteria were coagulase-negative staphylococci. MLAF successfully reduces cfu during neurosurgery to ultraclean air levels. MLAF units are valuable when the main operating room ventilation system is unable to produce ultraclean air in infection-prone clean neurosurgery. Copyright © 2018 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

Complete Genomes of Bacillus coagulans S-lac and Bacillus subtilis TO-A JPC, Two Phylogenetically Distinct Probiotics.

PubMed

Khatri, Indu; Sharma, Shailza; Ramya, T N C; Subramanian, Srikrishna

2016-01-01

Several spore-forming strains of Bacillus are marketed as probiotics due to their ability to survive harsh gastrointestinal conditions and confer health benefits to the host. We report the complete genomes of two commercially available probiotics, Bacillus coagulans S-lac and Bacillus subtilis TO-A JPC, and compare them with the genomes of other Bacillus and Lactobacillus. The taxonomic position of both organisms was established with a maximum-likelihood tree based on twenty six housekeeping proteins. Analysis of all probiotic strains of Bacillus and Lactobacillus reveal that the essential sporulation proteins are conserved in all Bacillus probiotic strains while they are absent in Lactobacillus spp. We identified various antibiotic resistance, stress-related, and adhesion-related domains in these organisms, which likely provide support in exerting probiotic action by enabling adhesion to host epithelial cells and survival during antibiotic treatment and harsh conditions.

Bacterial mycophagy: definition and diagnosis of a unique bacterial-fungal interaction.

PubMed

Leveau, Johan H J; Preston, Gail M

2008-01-01

This review analyses the phenomenon of bacterial mycophagy, which we define as a set of phenotypic behaviours that enable bacteria to obtain nutrients from living fungi and thus allow the conversion of fungal into bacterial biomass. We recognize three types of bacterial strategies to derive nutrition from fungi: necrotrophy, extracellular biotrophy and endocellular biotrophy. Each is characterized by a set of uniquely sequential and differently overlapping interactions with the fungal target. We offer a detailed analysis of the nature of these interactions, as well as a comprehensive overview of methodologies for assessing and quantifying their individual contributions to the mycophagy phenotype. Furthermore, we discuss future prospects for the study and exploitation of bacterial mycophagy, including the need for appropriate tools to detect bacterial mycophagy in situ in order to be able to understand, predict and possibly manipulate the way in which mycophagous bacteria affect fungal activity, turnover, and community structure in soils and other ecosystems.

Predicting serious bacterial infection in young children with fever without apparent source.

PubMed

Bleeker, S E; Moons, K G; Derksen-Lubsen, G; Grobbee, D E; Moll, H A

2001-11-01

The aim of this study was to design a clinical rule to predict the presence of a serious bacterial infection in children with fever without apparent source. Information was collected from the records of children aged 1-36 mo who attended the paediatric emergency department because of fever without source (temperature > or = 38 degrees C and no apparent source found after evaluation by a general practitioner or history by a paediatrician). Serious bacterial infection included bacterial meningitis, sepsis, bacteraemia, pneumonia, urinary tract infection, bacterial gastroenteritis, osteomyelitis and ethmoiditis. Using multivariate logistic regression and the area under the receiver operating characteristic curve (ROC area), the diagnostic value of predictors for serious bacterial infection was judged, resulting in a risk stratification. Twenty-five percent of the 231 patients enrolled in the study (mean age 1.1 y) had a serious bacterial infection. Independent predictors from history and examination included duration of fever, poor micturition, vomiting, age, temperature < 36.7 degrees C or > or = 40 degrees C at examination, chest-wall retractions and poor peripheral circulation (ROC area: 0.75). Independent predictors from laboratory tests were white blood cell count, serum C-reactive protein and the presence of >70 white blood cells in urinalysis (ROC area: 0.83). The risk stratification for serious bacterial infection ranged from 6% to 92%. The probability of a serious bacterial infection in the individual patient with fever without source can be estimated more precisely by using a limited number of symptoms, signs and laboratory tests.

Changes in soil bacterial community structure with increasing disturbance frequency.

PubMed

Kim, Mincheol; Heo, Eunjung; Kang, Hojeong; Adams, Jonathan

2013-07-01

Little is known of the responsiveness of soil bacterial community structure to disturbance. In this study, we subjected a soil microcosm to physical disturbance, sterilizing 90 % of the soil volume each time, at a range of frequencies. We analysed the bacterial community structure using 454 pyrosequencing of the 16S rRNA gene. Bacterial diversity was found to decline with the increasing disturbance frequencies. Total bacterial abundance was, however, higher at intermediate and high disturbance frequencies, compared to low and no-disturbance treatments. Changing disturbance frequency also led to changes in community composition, with changes in overall species composition and some groups becoming abundant at the expense of others. Some phylogenetic groups were found to be relatively more disturbance-sensitive or tolerant than others. With increasing disturbance frequency, phylogenetic species variability (an index of community composition) itself became more variable from one sample to another, suggesting a greater role of chance in community composition. Compared to the tightly clustered community of the original undisturbed soil, in all the aged disturbed soils the lists of most abundant operational taxonomic units (OTUs) in each replicate were very different, suggesting a possible role of stochasticity in resource colonization and exploitation in the aged and disturbed soils. For example, colonization may be affected by whichever localized concentrations of bacterial populations happen to survive the last disturbance and be reincorporated in abundance into each pot. Overall, it appears that the soil bacterial community is very sensitive to physical disturbance, losing diversity, and that certain groups have identifiable 'high disturbance' vs. 'low disturbance' niches.

Influence of electric current on bacterial viability in wastewater treatment.

PubMed

Wei, V; Elektorowicz, M; Oleszkiewicz, J A

2011-10-15

Minimizing the influence of electric current on bacterial viability in the electro-technologies such as electrophoresis and electrocoagulation is crucial in designing and operating the electric hybrid wastewater treatment system. In this study the biomass from a membrane bioreactor (MBR) was subjected to constant direct current and the bacterial viability was monitored against electrical intensity, duration as well as the spatial vicinity related to the electrodes. It was found that the bacterial viability was not significantly affected (less than 10% of death percentage) when the applied electric current density (CD) was less than 6.2 A/m2 after 4 h. The percentage of live cell dropped by 15% and 29% at CD of 12.3 A/m2 and 24.7 A/m2, respectively. The pH of electrolytic biomass fluid has shifted to alkaline (from nearly neutral to around pH 10) at CD above 12.3 A/m2, which could have been the contributing factor for the bacterial inactivation. The temperature change in the electrolytic media at all current densities during 4 h of experiment was less than 2 °C, thus temperature effects were negligible. Bacteria experienced different micro-environments in the electrochemical reactor. Bacterial cells on the cathode surface exhibited highest death rate, whereas bacteria outside the space between electrodes were the least affected. It was concluded that in an electro-technology integrated wastewater treatment process, sufficient mixing should be used to avoid localized inactivation of bacterial cells. Copyright © 2011 Elsevier Ltd. All rights reserved.

Cellular damage in bacterial meningitis: an interplay of bacterial and host driven toxicity.

PubMed

Weber, Joerg R; Tuomanen, Elaine I

2007-03-01

Bacterial meningitis is still an important infectious disease causing death and disability. Invasive bacterial infections of the CNS generate some of the most powerful inflammatory responses known in medicine. Although the components of bacterial cell surfaces are now chemically defined in exquisite detail and the interaction with several receptor pathways has been discovered, it is only very recently that studies combining these advanced biochemical and cell biological tools have been done. Additional to the immunological response direct bacterial toxicity has been identified as an important contributor to neuronal damage. A detailed understanding of the complex interaction of bacterial toxicity and host response may generate opportunities for innovative and specific neuroprotective therapies.

Bacterial surface adaptation

NASA Astrophysics Data System (ADS)

Utada, Andrew

2014-03-01

Biofilms are structured multi-cellular communities that are fundamental to the biology and ecology of bacteria. Parasitic bacterial biofilms can cause lethal infections and biofouling, but commensal bacterial biofilms, such as those found in the gut, can break down otherwise indigestible plant polysaccharides and allow us to enjoy vegetables. The first step in biofilm formation, adaptation to life on a surface, requires a working knowledge of low Reynolds number fluid physics, and the coordination of biochemical signaling, polysaccharide production, and molecular motility motors. These crucial early stages of biofilm formation are at present poorly understood. By adapting methods from soft matter physics, we dissect bacterial social behavior at the single cell level for several prototypical bacterial species, including Pseudomonas aeruginosa and Vibrio cholerae.

Temperature variation, bacterial diversity and fungal infection dynamics in the amphibian skin.

PubMed

Longo, Ana V; Zamudio, Kelly R

2017-09-01

Host-associated bacterial communities on the skin act as the first line of defence against invading pathogens. Yet, for most natural systems, we lack a clear understanding of how temperature variability affects structure and composition of skin bacterial communities and, in turn, promotes or limits the colonization of opportunistic pathogens. Here, we examine how natural temperature fluctuations might be related to changes in skin bacterial diversity over time in three amphibian populations infected by the pathogenic fungus Batrachochytrium dendrobatidis (Bd). Our focal host species (Eleutherodactylus coqui) is a direct-developing frog that has suffered declines at some populations in the last 20 years, while others have not experienced any changes. We quantified skin bacterial alpha- and beta-diversity at four sampling time points, a period encompassing two seasons and ample variation in natural infections and environmental conditions. Despite the different patterns of infection across populations, we detected an overall increase in bacterial diversity through time, characterized by the replacement of bacterial operational taxonomic units (OTUs). Increased frog body temperatures possibly allowed the colonization of bacteria as well as the recruitment of a subset of indicator OTUs, which could have promoted the observed changes in diversity patterns. Our results suggest that natural environmental fluctuations might be involved in creating opportunities for bacterial replacement, potentially attenuating pathogen transmission and thus contributing to host persistence in E. coqui populations. © 2017 John Wiley & Sons Ltd.

C-reactive Protein Versus Neutrophil/lymphocyte Ratio in Differentiating Bacterial and Non-bacterial Pneumonia in Children.

PubMed

Gauchan, E; Adhikari, S

2016-09-01

Pneumonia is a leading cause of childhood mortality in a low resource country. Simple laboratory markers can help differentiate between bacterial and non-bacterial pneumonias for appropriate management. In children aged one to 60 months with features of lower respiratory infection, C-reactive protein (CRP) and neutrophil-lymphocyte ratio (NLR) were used to differentiate between bacterial and non-bacterial pneumonias. The cutoff values for detecting bacterial pneumonias were evaluated by statistical tools. Bacterial pneumonia was diagnosed in 285 (43.6%) children out of 654 studied. At a cut-off value of 36 mg/L CRP was predictive of bacterial pneumonias with sensitivity and specificity of 61.8% and 91.3% respectively while the sensitivity and specificity for predicting bacterial pneumonia using NLR was 45.6% and 64% respectively with 1.28 used as a cut-off. Our study shows that CRP is superior to NLR in differentiating bacterial from non-bacterial pneumonias in children.

Kepler Observations of Rapid Optical Variability in the BL Lac Object W2r192+42

NASA Technical Reports Server (NTRS)

R.Edelson; Mushotzky, R.; Vaughn, S.; Scargle, J.; Gandhi, P.; Malkan, M.; Baumgartner, W.

2013-01-01

We present the first Kepler monitoring of a strongly variable BL Lac, W2R1926+42. The light curve covers 181 days with approx. 0.2% errors, 30 minute sampling and >90% duty cycle, showing numerous delta-I/I > 25% flares over timescales as short as a day. The flux distribution is highly skewed and non-Gaussian. The variability shows a strong rms-flux correlation with the clearest evidence to date for non-linearity in this relation. We introduce a method to measure periodograms from the discrete autocorrelation function, an approach that may be well-suited to a wide range of Kepler data. The periodogram is not consistent with a simple power-law, but shows a flattening at frequencies below 7x10(exp -5) Hz. Simple models of the power spectrum, such as a broken power law, do not produce acceptable fits, indicating that the Kepler blazar light curve requires more sophisticated mathematical and physical descriptions than currently in use.

A novel method of personnel cooling in an operating theatre environment.

PubMed

Casha, Aaron R; Manché, Alexander; Camilleri, Liberato; Gauci, Marilyn; Grima, Joseph N; Borg, Michael A

2014-10-01

An optimized theatre environment, including personal temperature regulation, can help maintain concentration, extend work times and may improve surgical outcomes. However, devices, such as cooling vests, are bulky and may impair the surgeon's mobility. We describe the use of a low-cost, low-energy 'bladeless fan' as a personal cooling device. The safety profile of this device was investigated by testing air quality using 0.5- and 5-µm particle counts as well as airborne bacterial counts on an operating table simulating a wound in a thoracic operation in a busy theatre environment. Particle and bacterial counts were obtained with both an empty and full theatre, with and without the 'bladeless fan'. The use of the 'bladeless fan' within the operating theatre during the simulated operation led to a minor, not statistically significant, lowering of both the particle and bacterial counts. In conclusion, the 'bladeless fan' is a safe, effective, low-cost and low-energy consumption solution for personnel cooling in a theatre environment that maintains the clean room conditions of the operating theatre. © The Author 2014. Published by Oxford University Press on behalf of the European Association for Cardio-Thoracic Surgery. All rights reserved.

Engineering an allosteric transcription factor to respond to new ligands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Taylor, Noah D.; Garruss, Alexander S.; Moretti, Rocco

Genetic regulatory proteins inducible by small molecules are useful synthetic biology tools as sensors and switches. Bacterial allosteric transcription factors (aTFs) are a major class of regulatory proteins, but few aTFs have been redesigned to respond to new effectors beyond natural aTF-inducer pairs. Altering inducer specificity in these proteins is difficult because substitutions that affect inducer binding may also disrupt allostery. In this paper, we engineered an aTF, the Escherichia coli lac repressor, LacI, to respond to one of four new inducer molecules: fucose, gentiobiose, lactitol and sucralose. Using computational protein design, single-residue saturation mutagenesis or random mutagenesis, along withmore » multiplex assembly, we identified new variants comparable in specificity and induction to wild-type LacI with its inducer, isopropyl β-D-1-thiogalactopyranoside (IPTG). Finally, the ability to create designer aTFs will enable applications including dynamic control of cell metabolism, cell biology and synthetic gene circuits.« less

Engineering an allosteric transcription factor to respond to new ligands

PubMed Central

Taylor, Noah D; Garruss, Alexander S; Moretti, Rocco; Chan, Sum; Arbing, Mark A; Cascio, Duilio; Rogers, Jameson K; Isaacs, Farren J; Kosuri, Sriram; Baker, David; Fields, Stanley; Church, George M; Raman, Srivatsan

2016-01-01

Genetic regulatory proteins inducible by small molecules are useful synthetic biology tools as sensors and switches. Bacterial allosteric transcription factors (aTFs) are a major class of regulatory proteins, but few aTFs have been redesigned to respond to new effectors beyond natural aTF-inducer pairs. Altering inducer specificity in these proteins is difficult because substitutions that affect inducer binding may also disrupt allostery. We engineered an aTF, the Escherichia coli lac repressor, LacI, to respond to one of four new inducer molecules: fucose, gentiobiose, lactitol or sucralose. Using computational protein design, single-residue saturation mutagenesis or random mutagenesis, along with multiplex assembly, we identified new variants comparable in specificity and induction to wild-type LacI with its inducer, isopropyl β-D-1-thiogalactopyranoside (IPTG). The ability to create designer aTFs will enable applications including dynamic control of cell metabolism, cell biology and synthetic gene circuits. PMID:26689263

Engineering an allosteric transcription factor to respond to new ligands

DOE PAGES

Taylor, Noah D.; Garruss, Alexander S.; Moretti, Rocco; ...

2015-12-21

Genetic regulatory proteins inducible by small molecules are useful synthetic biology tools as sensors and switches. Bacterial allosteric transcription factors (aTFs) are a major class of regulatory proteins, but few aTFs have been redesigned to respond to new effectors beyond natural aTF-inducer pairs. Altering inducer specificity in these proteins is difficult because substitutions that affect inducer binding may also disrupt allostery. In this paper, we engineered an aTF, the Escherichia coli lac repressor, LacI, to respond to one of four new inducer molecules: fucose, gentiobiose, lactitol and sucralose. Using computational protein design, single-residue saturation mutagenesis or random mutagenesis, along withmore » multiplex assembly, we identified new variants comparable in specificity and induction to wild-type LacI with its inducer, isopropyl β-D-1-thiogalactopyranoside (IPTG). Finally, the ability to create designer aTFs will enable applications including dynamic control of cell metabolism, cell biology and synthetic gene circuits.« less

Predictors of serious bacterial infections in pediatric burn patients with fever.

PubMed

Vyles, David; Sinha, Madhumita; Rosenberg, David I; Foster, Kevin N; Tran, Melissa; Drachman, David

2014-01-01

To determine predictors of serious bacterial infections in pediatric burn patients with fever (core temp ≥38.5°C), the authors conducted a retrospective review of medical records of pediatric (0-18 years) patients admitted to the Arizona Burn Center between 2008 and 2011 with greater than 5% TBSA and inpatient hospitalization for ≥72 hours. The study group comprised patients with a febrile episode during their inpatient stay. Serious bacterial infection (the primary outcome variable) was defined as: bacteremia, urinary tract infection, meningitis (blood, urine, or cerebrospinal fluid culture positive for a pathogen respectively), pneumonia, line, and wound infection. A generalized estimating equation analysis was done to predict the presence or absence of serious bacterial infection. Of 1082 pediatric burn patients hospitalized during the study period, 353 met the study eligibility criteria. A total of 108 patients (30.6%) had at least one fever episode (fever group). No difference in demographic characteristics was noted between the fever and no-fever groups; significant differences were observed for: third-degree TBSA, second-degree TBSA, total operating room visits, length of stay, Injury Severity Score, and death. A total of 47.2% of the patients had one or more episodes of fever with serious bacterial infection. In a generalized estimating equation predictive model, presence of a central line, second-, and third-degree TBSA were predictive of serious bacterial infection in burn patients with fever. In this study, individual clinical variables such as tachypnea and tachycardia were not predictive of serious bacterial infections, but the presence of a central line, and larger TBSA were significant predictors of serious bacterial infections. Younger age (P =.08) and ventilator support (P =.057) also approached significance as predictors of serious bacterial infections.

Architectural Design Drives the Biogeography of Indoor Bacterial Communities

PubMed Central

O’Connor, Timothy K.; Mhuireach, Gwynne; Northcutt, Dale; Kline, Jeff; Moriyama, Maxwell; Brown, G. Z.; Bohannan, Brendan J. M.; Green, Jessica L.

2014-01-01

Background Architectural design has the potential to influence the microbiology of the built environment, with implications for human health and well-being, but the impact of design on the microbial biogeography of buildings remains poorly understood. In this study we combined microbiological data with information on the function, form, and organization of spaces from a classroom and office building to understand how design choices influence the biogeography of the built environment microbiome. Results Sequencing of the bacterial 16S gene from dust samples revealed that indoor bacterial communities were extremely diverse, containing more than 32,750 OTUs (operational taxonomic units, 97% sequence similarity cutoff), but most communities were dominated by Proteobacteria, Firmicutes, and Deinococci. Architectural design characteristics related to space type, building arrangement, human use and movement, and ventilation source had a large influence on the structure of bacterial communities. Restrooms contained bacterial communities that were highly distinct from all other rooms, and spaces with high human occupant diversity and a high degree of connectedness to other spaces via ventilation or human movement contained a distinct set of bacterial taxa when compared to spaces with low occupant diversity and low connectedness. Within offices, the source of ventilation air had the greatest effect on bacterial community structure. Conclusions Our study indicates that humans have a guiding impact on the microbial biodiversity in buildings, both indirectly through the effects of architectural design on microbial community structure, and more directly through the effects of human occupancy and use patterns on the microbes found in different spaces and space types. The impact of design decisions in structuring the indoor microbiome offers the possibility to use ecological knowledge to shape our buildings in a way that will select for an indoor microbiome that promotes our

Compositional stability of a salivary bacterial population against supragingival microbiota shift following periodontal therapy.

PubMed

Yamanaka, Wataru; Takeshita, Toru; Shibata, Yukie; Matsuo, Kazuki; Eshima, Nobuoki; Yokoyama, Takeshi; Yamashita, Yoshihisa

2012-01-01

Supragingival plaque is permanently in contact with saliva. However, the extent to which the microbiota contributes to the salivary bacterial population remains unclear. We compared the compositional shift in the salivary bacterial population with that in supragingival plaque following periodontal therapy. Samples were collected from 19 patients with periodontitis before and after periodontal therapy (mean sample collection interval, 25.8 ± 2.6 months), and their bacterial composition was investigated using barcoded pyrosequencing analysis of the 16S rRNA gene. Phylogenetic community analysis using the UniFrac distance metric revealed that the overall bacterial community composition of saliva is distinct from that of supragingival plaque, both pre- and post-therapy. Temporal variation following therapy in the salivary bacterial population was significantly smaller than in the plaque microbiota, and the post-therapy saliva sample was significantly more similar to that pre-therapy from the same individual than to those from other subjects. Following periodontal therapy, microbial richness and biodiversity were significantly decreased in the plaque microbiota, but not in the salivary bacterial population. The operational taxonomic units whose relative abundances changed significantly after therapy were not common to the two microbiotae. These results reveal the compositional stability of salivary bacterial populations against shifts in the supragingival microbiota, suggesting that the effect of the supragingival plaque microbiota on salivary bacterial population composition is limited.

Bacterial diversity in different regions of gastrointestinal tract of Giant African Snail (Achatina fulica)

PubMed Central

Pawar, Kiran D; Banskar, Sunil; Rane, Shailendra D; Charan, Shakti S; Kulkarni, Girish J; Sawant, Shailesh S; Ghate, Hemant V; Patole, Milind S; Shouche, Yogesh S

2012-01-01

The gastrointestinal (GI) tract of invasive land snail Achatina fulica is known to harbor metabolically active bacterial communities. In this study, we assessed the bacterial diversity in the different regions of GI tract of Giant African snail, A. fulica by culture-independent and culture-dependent methods. Five 16S rRNA gene libraries from different regions of GI tract of active snails indicated that sequences affiliated to phylum γ-Proteobacteria dominated the esophagus, crop, intestine, and rectum libraries, whereas sequences affiliated to Tenericutes dominated the stomach library. On phylogenetic analysis, 30, 27, 9, 27, and 25 operational taxonomic units (OTUs) from esophagus, crop, stomach, intestine, and rectum libraries were identified, respectively. Estimations of the total bacterial diversity covered along with environmental cluster analysis showed highest bacterial diversity in the esophagus and lowest in the stomach. Thirty-three distinct bacterial isolates were obtained, which belonged to 12 genera of two major bacterial phyla namely γ-Proteobacteria and Firmicutes. Among these, Lactococcus lactis and Kurthia gibsonii were the dominant bacteria present in all GI tract regions. Quantitative real-time polymerase chain reaction (qPCR) analysis indicated significant differences in bacterial load in different GI tract regions of active and estivating snails. The difference in the bacterial load between the intestines of active and estivating snail was maximum. Principal component analysis (PCA) of terminal restriction fragment length polymorphism suggested that bacterial community structure changes only in intestine when snail enters estivation state. PMID:23233413

Soil bacterial diversity patterns and drivers along an elevational gradient on Shennongjia Mountain, China

PubMed Central

Zhang, Yuguang; Cong, Jing; Lu, Hui; Li, Guangliang; Xue, Yadong; Deng, Ye; Li, Hui; Zhou, Jizhong; Li, Diqiang

2015-01-01

Understanding biological diversity elevational pattern and the driver factors are indispensable to develop the ecological theories. Elevational gradient may minimize the impact of environmental factors and is the ideal places to study soil microbial elevational patterns. In this study, we selected four typical vegetation types from 1000 to 2800 m above the sea level on the northern slope of Shennongjia Mountain in central China, and analysed the soil bacterial community composition, elevational patterns and the relationship between soil bacterial diversity and environmental factors by using the 16S rRNA Illumina sequencing and multivariate statistical analysis. The results revealed that the dominant bacterial phyla were Acidobacteria, Actinobacteria, Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria and Verrucomicrobia, which accounted for over 75% of the bacterial sequences obtained from tested samples, and the soil bacterial operational taxonomic unit (OTU) richness was a significant monotonous decreasing (P < 0.01) trend with the elevational increasing. The similarity of soil bacterial population composition decreased significantly (P < 0.01) with elevational distance increased as measured by the Jaccard and Bray–Curtis index. Canonical correspondence analysis and Mantel test analysis indicated that plant diversity and soil pH were significantly correlated (P < 0.01) with the soil bacterial community. Therefore, the soil bacterial diversity on Shennongjia Mountain had a significant and different elevational pattern, and plant diversity and soil pH may be the key factors in shaping the soil bacterial spatial pattern. PMID:26032124

Diversity of Bacterial Communities in Container Habitats of Mosquitoes

PubMed Central

Ponnusamy, Loganathan; Xu, Ning; Stav, Gil; Wesson, Dawn M.; Schal, Coby

2010-01-01

We investigated the bacterial diversity of microbial communities in water-filled, human-made and natural container habitats of the mosquitoes Aedes aegypti and Aedes albopictus in suburban landscapes of New Orleans, Louisiana in 2003. We collected water samples from three classes of containers, including tires (n=12), cemetery urns (n=23), and miscellaneous containers that included two tree holes (n=19). Total genomic DNA was extracted from water samples, and 16S ribosomal DNA fragments (operational taxonomic units, OTUs) were amplified by PCR and separated by denaturing gradient gel electrophoresis (DGGE). The bacterial communities in containers represented diverse DGGE-DNA banding patterns that were not related to the class of container or to the local spatial distribution of containers. Mean richness and evenness of OTUs were highest in water samples from tires. Bacterial phylotypes were identified by comparative sequence analysis of 90 16S rDNA DGGE band amplicons. The majority of sequences were placed in five major taxa: Alpha-, Beta- and Gammaproteobacteria, Actinobacteria, Bacteroidetes, Cyanobacteria, Firmicutes, and an unclassified group; Proteobacteria and Bacteroidetes were the predominant heterotrophic bacteria in containers. The bacterial communities in human-made containers consisted mainly of undescribed species, and a phylogenetic analysis based on 16S rRNA sequences suggested that species composition was independent of both container type and the spatial distribution of containers. Comparative PCR-based, cultivation-independent rRNA surveys of microbial communities associated with mosquito habitats can provide significant insight into community organization and dynamics of bacterial species. PMID:18373113

Direct observation of bacterial deposition onto clean and organic-fouled polyamide membranes.

PubMed

Subramani, Arun; Huang, Xiaofei; Hoek, Eric M V

2009-08-01

Nanofiltration (NF) and reverse osmosis (RO) membranes are commonly applied to produce highly purified water from municipal wastewater effluents. In these applications, biofouling limits overall process performance and increases the cost of operation. Initial bacteria adhesion onto a membrane surface is a critical early step in the overall process of membrane biofouling. However, adsorption of effluent organic matter onto the membrane may precede bacterial deposition and change membrane surface properties. Herein we employed direct microscopic observation to elucidate mechanisms governing bacterial cell deposition onto clean and organic-fouled NF and RO membranes. Bovine serum albumin (BSA) and alginic acid (AA) were used as models for protein and polysaccharide rich organic matter in secondary wastewater effluents. In all experiments, organic fouling increased membrane hydraulic resistance and salt rejection, in addition to interfacial hydrophilicity and roughness. Even though surface hydrophilicity increased, the rougher surfaces presented by organic-fouled membranes produced nano-scale features that promoted localized bacterial deposition. An extended DLVO analysis of bacterial cells and membrane surface properties suggested that bacterial deposition correlated most strongly with the Lewis acid-base free energy of adhesion and root mean square (RMS) roughness, whereas van der Waals and electrostatic free energies were weakly correlated. This was true for both clean and organic-fouled membranes. Bacterial deposition rates were clearly influenced by an antagonistic interplay between macroscopic surface hydrophilicity and nano-scale surface roughness.

AUTOMATED BIOCHEMICAL IDENTIFICATION OF BACTERIAL FISH PATHOGENS USING THE ABBOTT QUANTUM II

EPA Science Inventory

The Quantum II, originally designed by Abbott Diagnostics for automated rapid identification of members of Enterobacteriaceae, was adapted for the identification of bacterial fish pathogens. he instrument operates as a spectrophotometer at a wavelength of 492.600 nm. ample cartri...

Glove and gown effects on intraoperative bacterial contamination.

PubMed

Ward, William G; Cooper, Joshua M; Lippert, Dylan; Kablawi, Rawan O; Neiberg, Rebecca H; Sherertz, Robert J

2014-03-01

Experiments were performed to determine the risk of bacterial contamination associated with changing outer gloves and using disposable spunlace paper versus reusable cloth gowns. Despite decades of research, there remains a lack of consensus regarding certain aspects of optimal aseptic technique including outer glove exchange while double-gloving and surgical gown type selection. In an initial glove study, 102 surgical team members were randomized to exchange or retain outer gloves 1 hour into clean orthopedic procedures; cultures were obtained 15 minutes later from the palm of the surgeon's dominant gloved hand and from the surgical gown sleeve. Surgical gown type selection was recorded. A laboratory strike-through study investigating bacterial transmission through cloth and paper gowns was performed with coagulase-negative staphylococci. In a follow-up glove study, 251 surgical team members, all wearing paper gowns, were randomized as in the first glove study. Glove study 1 revealed 4-fold higher levels of baseline bacterial contamination (31% vs 7%) on the sleeve of surgical team members wearing cloth gowns than those using paper gowns [odds ratio (95% confidence interval): 4.64 (1.72-12.53); P = 0.0016]. The bacterial strike-through study revealed that 26 of 27 cloth gowns allowed bacterial transmission through the material compared with 0 of 27 paper gowns (P < 0.001). In glove study 2, surgeons retaining outer gloves 1 hour into the case had a subsequent positive glove contamination rate of 23% compared with 13% among surgeons exchanging their original outer glove [odds ratio (95% confidence interval): 1.97 (1.02-3.80); P = 0.0419]. Paper gowns demonstrated less bacterial transmission in the laboratory and lower rates of contamination in the operating room. Disposable paper gowns are recommended for all surgical cases, especially those involving implants, because of the heightened risk of infection. Outer glove exchange just before handling implant materials

Treatment of grain with organic acids at 2 different dietary phosphorus levels modulates ruminal microbial community structure and fermentation patterns in vitro.

PubMed

Harder, H; Khol-Parisini, A; Metzler-Zebeli, B U; Klevenhusen, F; Zebeli, Q

2015-11-01

Recent data indicate positive effects of treating grain with citric (CAc) or lactic acid (LAc) on the hydrolysis of phytate phosphorus (P) and fermentation products of the grain. This study used a semicontinuous rumen simulation technique to evaluate the effects of processing of barley with 50.25 g/L (wt/vol) CAc or 76.25 g/L LAc on microbial composition, metabolic fermentation profile, and nutrient degradation at low or high dietary P supply. The low P diet [3.1g of P per kg of dry matter (DM) of dietary P sources only] was not supplemented with inorganic P, whereas the high P diet was supplemented with 0.5 g of inorganic P per kg of DM through mineral premix and 870 mg of inorganic P/d per incubation fermenter via artificial saliva. Target microbes were determined using quantitative PCR. Data showed depression of total bacteria but not of total protozoa or short-chain fatty acid (SCFA) concentration with the low P diet. In addition, the low P diet lowered the relative abundance of Ruminococcus albus and decreased neutral detergent fiber (NDF) degradation and acetate proportion, but increased the abundance of several predominantly noncellulolytic bacterial species and anaerobic fungi. Treatment of grain with LAc increased the abundance of total bacteria in the low P diet only, and this effect was associated with a greater concentration of SCFA in the ruminal fluid. Interestingly, in the low P diet, CAc treatment of barley increased the most prevalent bacterial group, the genus Prevotella, in ruminal fluid and increased NDF degradation to the same extent as did inorganic P supplementation in the high P diet. Treatment with either CAc or LAc lowered the abundance of Megasphaera elsdenii but only in the low P diet. On the other hand, CAc treatment increased the proportion of acetate in the low P diet, whereas LAc treatment decreased this variable at both dietary P levels. The propionate proportion was significantly increased by LAc at both P levels, whereas butyrate

Bacterial Community Dynamics in Dichloromethane-Contaminated Groundwater Undergoing Natural Attenuation

PubMed Central

Wright, Justin; Kirchner, Veronica; Bernard, William; Ulrich, Nikea; McLimans, Christopher; Campa, Maria F.; Hazen, Terry; Macbeth, Tamzen; Marabello, David; McDermott, Jacob; Mackelprang, Rachel; Roth, Kimberly; Lamendella, Regina

2017-01-01

The uncontrolled release of the industrial solvent methylene chloride, also known as dichloromethane (DCM), has resulted in widespread groundwater contamination in the United States. Here we investigate the role of groundwater bacterial communities in the natural attenuation of DCM at an undisclosed manufacturing site in New Jersey. This study investigates the bacterial community structure of groundwater samples differentially contaminated with DCM to better understand the biodegradation potential of these autochthonous bacterial communities. Bacterial community analysis was completed using high-throughput sequencing of the 16S rRNA gene of groundwater samples (n = 26) with DCM contamination ranging from 0.89 to 9,800,000 μg/L. Significant DCM concentration-driven shifts in overall bacterial community structure were identified between samples, including an increase in the abundance of Firmicutes within the most contaminated samples. Across all samples, a total of 6,134 unique operational taxonomic units (OTUs) were identified, with 16 taxa having strong correlations with increased DCM concentration. Putative DCM degraders such as Pseudomonas, Dehalobacterium and Desulfovibrio were present within groundwater across all levels of DCM contamination. Interestingly, each of these taxa dominated specific DCM contamination ranges respectively. Potential DCM degrading lineages yet to be cited specifically as a DCM degrading organisms, such as the Desulfosporosinus, thrived within the most heavily contaminated groundwater samples. Co-occurrence network analysis revealed aerobic and anaerobic bacterial taxa with DCM-degrading potential were present at the study site. Our 16S rRNA gene survey serves as the first in situ bacterial community assessment of contaminated groundwater harboring DCM concentrations ranging over seven orders of magnitude. Diversity analyses revealed known as well as potentially novel DCM degrading taxa within defined DCM concentration ranges

Bacterial Community Dynamics in Dichloromethane-Contaminated Groundwater Undergoing Natural Attenuation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wright, Justin; Kirchner, Veronica; Bernard, William

The uncontrolled release of the industrial solvent methylene chloride, also known as dichloromethane (DCM), has resulted in widespread groundwater contamination in the United States. Here we investigate the role of groundwater bacterial communities in the natural attenuation of DCM at an undisclosed manufacturing site in New Jersey. Here, we investigate the bacterial community structure of groundwater samples differentially contaminated with DCM to better understand the biodegradation potential of these autochthonous bacterial communities. Bacterial community analysis was completed using high-throughput sequencing of the 16S rRNA gene of groundwater samples (n = 26) with DCM contamination ranging from 0.89 to 9,800,000 μg/L.more » Significant DCM concentration-driven shifts in overall bacterial community structure were identified between samples, including an increase in the abundance of Firmicutes within the most contaminated samples. And across all samples, a total of 6,134 unique operational taxonomic units (OTUs) were identified, with 16 taxa having strong correlations with increased DCM concentration. Putative DCM degraders such as Pseudomonas, Dehalobacterium and Desulfovibrio were present within groundwater across all levels of DCM contamination. Interestingly, each of these taxa dominated specific DCM contamination ranges respectively. Potential DCM degrading lineages yet to be cited specifically as a DCM degrading organisms, such as the Desulfosporosinus, thrived within the most heavily contaminated groundwater samples. Co-occurrence network analysis revealed aerobic and anaerobic bacterial taxa with DCM-degrading potential were present at the study site. Our 16S rRNA gene survey serves as the first in situ bacterial community assessment of contaminated groundwater harboring DCM concentrations ranging over seven orders of magnitude. Diversity analyses revealed known as well as potentially novel DCM degrading taxa within defined DCM concentration ranges

Bacterial Community Dynamics in Dichloromethane-Contaminated Groundwater Undergoing Natural Attenuation

DOE PAGES

Wright, Justin; Kirchner, Veronica; Bernard, William; ...

2017-11-22

The uncontrolled release of the industrial solvent methylene chloride, also known as dichloromethane (DCM), has resulted in widespread groundwater contamination in the United States. Here we investigate the role of groundwater bacterial communities in the natural attenuation of DCM at an undisclosed manufacturing site in New Jersey. Here, we investigate the bacterial community structure of groundwater samples differentially contaminated with DCM to better understand the biodegradation potential of these autochthonous bacterial communities. Bacterial community analysis was completed using high-throughput sequencing of the 16S rRNA gene of groundwater samples (n = 26) with DCM contamination ranging from 0.89 to 9,800,000 μg/L.more » Significant DCM concentration-driven shifts in overall bacterial community structure were identified between samples, including an increase in the abundance of Firmicutes within the most contaminated samples. And across all samples, a total of 6,134 unique operational taxonomic units (OTUs) were identified, with 16 taxa having strong correlations with increased DCM concentration. Putative DCM degraders such as Pseudomonas, Dehalobacterium and Desulfovibrio were present within groundwater across all levels of DCM contamination. Interestingly, each of these taxa dominated specific DCM contamination ranges respectively. Potential DCM degrading lineages yet to be cited specifically as a DCM degrading organisms, such as the Desulfosporosinus, thrived within the most heavily contaminated groundwater samples. Co-occurrence network analysis revealed aerobic and anaerobic bacterial taxa with DCM-degrading potential were present at the study site. Our 16S rRNA gene survey serves as the first in situ bacterial community assessment of contaminated groundwater harboring DCM concentrations ranging over seven orders of magnitude. Diversity analyses revealed known as well as potentially novel DCM degrading taxa within defined DCM concentration ranges

Bacterial Prostatitis: Bacterial Virulence, Clinical Outcomes, and New Directions.

PubMed

Krieger, John N; Thumbikat, Praveen

2016-02-01

Four prostatitis syndromes are recognized clinically: acute bacterial prostatitis, chronic bacterial prostatitis, chronic prostatitis/chronic pelvic pain syndrome, and asymptomatic prostatitis. Because Escherichia coli represents the most common cause of bacterial prostatitis, we investigated the importance of bacterial virulence factors and antimicrobial resistance in E. coli strains causing prostatitis and the potential association of these characteristics with clinical outcomes. A structured literature review revealed that we have limited understanding of the virulence-associated characteristics of E. coli causing acute prostatitis. Therefore, we completed a comprehensive microbiological and molecular investigation of a unique strain collection isolated from healthy young men. We also considered new data from an animal model system suggesting certain E. coli might prove important in the etiology of chronic prostatitis/chronic pelvic pain syndrome. Our human data suggest that E. coli needs multiple pathogenicity-associated traits to overcome anatomic and immune responses in healthy young men without urological risk factors. The phylogenetic background and accumulation of an exceptional repertoire of extraintestinal pathogenic virulence-associated genes indicate that these E. coli strains belong to a highly virulent subset of uropathogenic variants. In contrast, antibiotic resistance confers little added advantage to E. coli strains in these healthy outpatients. Our animal model data also suggest that certain pathogenic E. coli may be important in the etiology of chronic prostatitis/chronic pelvic pain syndrome through mechanisms that are dependent on the host genetic background and the virulence of the bacterial strain.

Characteristics of aquatic bacterial community and the influencing factors in an urban river.

PubMed

Wang, Peng; Chen, Bo; Yuan, Ruiqiang; Li, Chuangqiong; Li, Yan

2016-11-01

Bacteria play a critical role in environmental and ecological processes in river ecosystems. We studied the bacterial community in the Ganjiang River, a major tributary of the Yangtze River, as it flowed through Nanchang, the largest city in the Ganjiang River basin. Water was sampled at five sites monthly during the wet season, and the bacterial community was characterized using Illumina high-throughput sequencing. A total of 811 operational taxonomic units (OTUs) were observed for all samples, ranging from 321 to 519 for each sample. The bacterial communities were maintained by a core of OTUs that persisted longitudinally and monthly. Actinobacteria (41.17% of total sequences) and Proteobacteria (31.80%) were the dominant phyla, while Firmicutes (mostly genus Lactococcus) became most abundant during flooding. Temperature and flow rate, rather than water chemistry, were the main factors influencing the bacterial community in river water. Temperature was the best individual parameter explaining the variations in OTU abundance, while flow rate was the best individual parameter explaining the variations in phylum abundance. Except for Proteobacteria, the relative abundance of bacterial phyla did not differ significantly between sites, and the degrees of influence of urban landscape on the bacterial community were estimated to be 17%-34%. Copyright © 2016 Elsevier B.V. All rights reserved.

Determination and Variation of Core Bacterial Community in a Two-Stage Full-Scale Anaerobic Reactor Treating High-Strength Pharmaceutical Wastewater.

PubMed

Ma, Haijun; Ye, Lin; Hu, Haidong; Zhang, Lulu; Ding, Lili; Ren, Hongqiang

2017-10-28

Knowledge on the functional characteristics and temporal variation of anaerobic bacterial populations is important for better understanding of the microbial process of two-stage anaerobic reactors. However, owing to the high diversity of anaerobic bacteria, close attention should be prioritized to the frequently abundant bacteria that were defined as core bacteria and putatively functionally important. In this study, using MiSeq sequencing technology, the core bacterial community of 98 operational taxonomic units (OTUs) was determined in a two-stage upflow blanket filter reactor treating pharmaceutical wastewater. The core bacterial community accounted for 61.66% of the total sequences and accurately predicted the sample location in the principal coordinates analysis scatter plot as the total bacterial OTUs did. The core bacterial community in the first-stage (FS) and second-stage (SS) reactors were generally distinct, in that the FS core bacterial community was indicated to be more related to a higher-level fermentation process, and the SS core bacterial community contained more microbes in syntrophic cooperation with methanogens. Moreover, the different responses of the FS and SS core bacterial communities to the temperature shock and influent disturbance caused by solid contamination were fully investigated. Co-occurring analysis at the Order level implied that Bacteroidales, Selenomonadales, Anaerolineales, Syneristales, and Thermotogales might play key roles in anaerobic digestion due to their high abundance and tight correlation with other microbes. These findings advance our knowledge about the core bacterial community and its temporal variability for future comparative research and improvement of the two-stage anaerobic system operation.

Complete Genomes of Bacillus coagulans S-lac and Bacillus subtilis TO-A JPC, Two Phylogenetically Distinct Probiotics

PubMed Central

Ramya, T. N. C.; Subramanian, Srikrishna

2016-01-01

Several spore-forming strains of Bacillus are marketed as probiotics due to their ability to survive harsh gastrointestinal conditions and confer health benefits to the host. We report the complete genomes of two commercially available probiotics, Bacillus coagulans S-lac and Bacillus subtilis TO-A JPC, and compare them with the genomes of other Bacillus and Lactobacillus. The taxonomic position of both organisms was established with a maximum-likelihood tree based on twenty six housekeeping proteins. Analysis of all probiotic strains of Bacillus and Lactobacillus reveal that the essential sporulation proteins are conserved in all Bacillus probiotic strains while they are absent in Lactobacillus spp. We identified various antibiotic resistance, stress-related, and adhesion-related domains in these organisms, which likely provide support in exerting probiotic action by enabling adhesion to host epithelial cells and survival during antibiotic treatment and harsh conditions. PMID:27258038

Impact of different-sized laminar air flow versus no laminar air flow on bacterial counts in the operating room during orthopedic surgery.

PubMed

Diab-Elschahawi, Magda; Berger, Jutta; Blacky, Alexander; Kimberger, Oliver; Oguz, Ruken; Kuelpmann, Ruediger; Kramer, Axel; Assadian, Ojan

2011-09-01

This study investigated the influence of the size of unidirectional ceiling distribution systems on counts of viable microorganisms recovered at defined sites in operating room (ORs) and on instrument tables during orthopedic surgery. We compared bacterial sedimentation during 80 orthopedic surgeries. A total of 19 surgeries were performed in ORs with a large (518 cm × 380 cm) unidirectional ceiling distribution (colloquially known as laminar air flow [LAF]) ventilation system, 21 procedures in ORs with a small (380 cm × 120 cm) LAF system, and 40 procedures in ORs with no LAF system. Bacterial sedimentation was evaluated using both settle plates and nitrocellulose membranes. Multivariate linear regression analysis revealed that the colony-forming unit count on nitrocellulose membranes positioned on the instrument table was significantly associated only with the size of the unidirectional LAF distribution system (P < .001), not with the duration of the surgical intervention (P = .753) or with the number of persons present during the surgical intervention (P = .291). Our findings indicate that simply having an LAF ventilation system in place will not provide bacteria-free conditions at the surgical site and on the instrument table. In view of the limited number of procedures studied, our findings require confirmation and further investigations on the ideal, but affordable, size of LAF ventilation systems. Copyright © 2011 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Mosby, Inc. All rights reserved.

First NuSTAR observations of the BL Lac - type blazar PKS 2155-304: constraints on the jet content and distribution of radiating particles

NASA Astrophysics Data System (ADS)

Madejski, Grzegorz; Nalewajko, Krzysztof; Madsen, Kristin; Chiang, James; Balokovic, Mislav; Paneque, David; Furniss, Amy; NuSTAR Team

2017-01-01

Current scenarios for emission mechanisms operating in relativistic jets in AGN involve synchrotron emission for the radio through UV spectrum, and inverse Compton for hard X-rays through γ-rays, but the particle content of relativistic jets - whether they are dominated by proton-electron, or e +/e- plasma - has not been established. Our first hard X-ray observations with NuSTAR of the BL Lac type blazar PKS 2155-304, augmented by XMM-Newton data, reveal the 0.5-60 keV spectrum as best-described by a soft power law component dominating below 10 keV (photon index of 3 at 2 keV), and a hard power-law tail (index 2), dominating in the 20-60 keV range. The hard X-ray tail can be smoothly joined to the quasi-simultaneous Fermi/LAT γ-ray spectrum by a synchrotron self-Compton component produced by an electron distribution with index p =2.2. The jet content needs to (globally) obey charge neutrality; assuming that the power-law electron distribution extends down to the Lorentz factor of 1, and one proton per electron, yields an unrealistically high total jet power of 1047 erg/s. This can be reduced by two orders of magnitude by considering a significant presence of e +/e- pairs with lepton-to-proton ratio of at least 30.

Gene Expression of Lytic Endopeptidases AlpA and AlpB from Lysobacter sp. XL1 in Pseudomonads.

PubMed

Tsfasman, Irina M; Lapteva, Yulia S; Krasovskaya, Ludmila A; Kudryakova, Irina V; Vasilyeva, Natalia V; Granovsky, Igor E; Stepnaya, Olga A

2015-01-01

Development of an efficient expression system for (especially secreted) bacterial lytic enzymes is a complicated task due to the specificity of their action. The substrate for such enzymes is peptidoglycan, the main structural component of bacterial cell walls. For this reason, expression of recombinant lytic proteins is often accompanied with lysis of the producing bacterium. This paper presents data on the construction of an inducible system for expression of the lytic peptidases AlpA and AlpB from Lysobacter sp. XL1 in Pseudomonas fluorescens Q2-87, which provides for the successful secretion of these proteins into the culture liquid. In this system, the endopeptidase gene under control of the T7lac promoter was integrated into the bacterial chromosome, as well as the Escherichia coli lactose operon repressor protein gene. The T7 pol gene under lac promoter control, which encodes the phage T7 RNA polymerase, is maintained in Pseudomonas cells on the plasmids. Media and cultivation conditions for the recombinant strains were selected to enable the production of AlpA and AlpB by a simple purification protocol. Production of recombinant lytic enzymes should contribute to the development of new-generation antimicrobial drugs whose application will not be accompanied by selection of resistant microorganisms. © 2015 S. Karger AG, Basel.

Development of a tape transport bacterial detection system

NASA Technical Reports Server (NTRS)

Witz, S.; Hartung, W. H.

1972-01-01

The feasibility of a tape transport chemiluminescence system for bacterial monitoring of regenerated water was demonstrated using a manually operated laboratory breadboard. The principle of detection is based on measuring the increase in chemiluminescence produced by the catalytic action of bacterial porphyrins on a luminol-hydrogen peroxide mixture. Viable organisms are distinguished from nonviable by comparing the signals of incubated and unincubated water samples. Using optimized protocols, sensitivities were obtained with 400 ml suspensions of E. coli and Cl. sporogenes. The sensitivity of the unincubated cycle E. coli (aerobe) was found to be 30 to 35 cells/m1, and that of the Cl. sporogenes (anaerobe) was 1000 to 10,000 cells/m1. The lower sensitivity toward Cl. sporogenes is attributed to several factors, namely the lower cytochrome content, the tendency to sporulate, long lag periods and the lower growth rate of Clostridia in general. The operational procedures used for processing the incubated and unincubated samples involved the following sequence: (1) concentrating the sample by filtration through a membrane filter, (2) washing with Dextrose-Thioglycollate Broth (3) incubating (0 to 4 hrs as required), (4) washing with 4M Urea, and (5) reacting with reagent in front of a photomultiplier tube. The signal output was recorded on a strip chart recorder.

Bacterial Selection during the Formation of Early-Stage Aerobic Granules in Wastewater Treatment Systems Operated Under Wash-Out Dynamics

PubMed Central

Weissbrodt, David G.; Lochmatter, Samuel; Ebrahimi, Sirous; Rossi, Pierre; Maillard, Julien; Holliger, Christof

2012-01-01

Aerobic granular sludge is attractive for high-rate biological wastewater treatment. Biomass wash-out conditions stimulate the formation of aerobic granules. Deteriorated performances in biomass settling and nutrient removal during start-up have however often been reported. The effect of wash-out dynamics was investigated on bacterial selection, biomass settling behavior, and metabolic activities during the formation of early-stage granules from activated sludge of two wastewater treatment plants (WWTP) over start-up periods of maximum 60 days. Five bubble-column sequencing batch reactors were operated with feast-famine regimes consisting of rapid pulse or slow anaerobic feeding followed by aerobic starvation. Slow-settling fluffy granules were formed when an insufficient superficial air velocity (SAV; 1.8 cm s−1) was applied, when the inoculation sludge was taken from a WWTP removing organic matter only, or when reactors were operated at 30°C. Fast-settling dense granules were obtained with 4.0 cm s−1 SAV, or when the inoculation sludge was taken from a WWTP removing all nutrients biologically. However, only carbon was aerobically removed during start-up. Fluffy granules and dense granules were displaying distinct predominant phylotypes, namely filamentous Burkholderiales affiliates and Zoogloea relatives, respectively. The latter were predominant in dense granules independently from the feeding regime. A combination of insufficient solid retention time and of leakage of acetate into the aeration phase during intensive biomass wash-out was the cause for the proliferation of Zoogloea spp. in dense granules, and for the deterioration of BNR performances. It is however not certain that Zoogloea-like organisms are essential in granule formation. Optimal operation conditions should be elucidated for maintaining a balance between organisms with granulation propensity and nutrient removing organisms in order to form granules with BNR activities in short

Bacterial Selection during the Formation of Early-Stage Aerobic Granules in Wastewater Treatment Systems Operated Under Wash-Out Dynamics.

PubMed

Weissbrodt, David G; Lochmatter, Samuel; Ebrahimi, Sirous; Rossi, Pierre; Maillard, Julien; Holliger, Christof

2012-01-01

Aerobic granular sludge is attractive for high-rate biological wastewater treatment. Biomass wash-out conditions stimulate the formation of aerobic granules. Deteriorated performances in biomass settling and nutrient removal during start-up have however often been reported. The effect of wash-out dynamics was investigated on bacterial selection, biomass settling behavior, and metabolic activities during the formation of early-stage granules from activated sludge of two wastewater treatment plants (WWTP) over start-up periods of maximum 60 days. Five bubble-column sequencing batch reactors were operated with feast-famine regimes consisting of rapid pulse or slow anaerobic feeding followed by aerobic starvation. Slow-settling fluffy granules were formed when an insufficient superficial air velocity (SAV; 1.8 cm s(-1)) was applied, when the inoculation sludge was taken from a WWTP removing organic matter only, or when reactors were operated at 30°C. Fast-settling dense granules were obtained with 4.0 cm s(-1) SAV, or when the inoculation sludge was taken from a WWTP removing all nutrients biologically. However, only carbon was aerobically removed during start-up. Fluffy granules and dense granules were displaying distinct predominant phylotypes, namely filamentous Burkholderiales affiliates and Zoogloea relatives, respectively. The latter were predominant in dense granules independently from the feeding regime. A combination of insufficient solid retention time and of leakage of acetate into the aeration phase during intensive biomass wash-out was the cause for the proliferation of Zoogloea spp. in dense granules, and for the deterioration of BNR performances. It is however not certain that Zoogloea-like organisms are essential in granule formation. Optimal operation conditions should be elucidated for maintaining a balance between organisms with granulation propensity and nutrient removing organisms in order to form granules with BNR activities in short

The Origin of Mutants Under Selection: How Natural Selection Mimics Mutagenesis (Adaptive Mutation)

PubMed Central

Maisnier-Patin, Sophie; Roth, John R.

2015-01-01

Selection detects mutants but does not cause mutations. Contrary to this dictum, Cairns and Foster plated a leaky lac mutant of Escherichia coli on lactose medium and saw revertant (Lac+) colonies accumulate with time above a nongrowing lawn. This result suggested that bacteria might mutagenize their own genome when growth is blocked. However, this conclusion is suspect in the light of recent evidence that revertant colonies are initiated by preexisting cells with multiple copies the conjugative F′lac plasmid, which carries the lac mutation. Some plated cells have multiple copies of the simple F′lac plasmid. This provides sufficient LacZ activity to support plasmid replication but not cell division. In nongrowing cells, repeated plasmid replication increases the likelihood of a reversion event. Reversion to lac+ triggers exponential cell growth leading to a stable Lac+ revertant colony. In 10% of these plated cells, the high-copy plasmid includes an internal tandem lac duplication, which provides even more LacZ activity—sufficient to support slow growth and formation of an unstable Lac+ colony. Cells with multiple copies of the F′lac plasmid have an increased mutation rate, because the plasmid encodes the error-prone (mutagenic) DNA polymerase, DinB. Without DinB, unstable and stable Lac+ revertant types form in equal numbers and both types arise with no mutagenesis. Amplification and selection are central to behavior of the Cairns–Foster system, whereas mutagenesis is a system-specific side effect or artifact caused by coamplification of dinB with lac. Study of this system has revealed several broadly applicable principles. In all populations, gene duplications are frequent stable genetic polymorphisms, common near-neutral mutant alleles can gain a positive phenotype when amplified under selection, and natural selection can operate without cell division when variability is generated by overreplication of local genome subregions. PMID:26134316

VERITAS Observations of the BL Lac Object PG 1553+113

NASA Astrophysics Data System (ADS)

Aliu, E.; Archer, A.; Aune, T.; Barnacka, A.; Behera, B.; Beilicke, M.; Benbow, W.; Berger, K.; Bird, R.; Buckley, J. H.; Bugaev, V.; Byrum, K.; Cardenzana, J. V.; Cerruti, M.; Chen, X.; Ciupik, L.; Connolly, M. P.; Cui, W.; Dickinson, H. J.; Dumm, J.; Eisch, J. D.; Errando, M.; Falcone, A.; Federici, S.; Feng, Q.; Finley, J. P.; Fortin, P.; Fortson, L.; Furniss, A.; Galante, N.; Gillanders, G. H.; Griffin, S.; Griffiths, S. T.; Grube, J.; Gyuk, G.; Håkansson, N.; Hanna, D.; Holder, J.; Hughes, G.; Humensky, T. B.; Johnson, C. A.; Kaaret, P.; Kar, P.; Kertzman, M.; Khassen, Y.; Kieda, D.; Krawczynski, H.; Krennrich, F.; Kumar, S.; Lang, M. J.; Madhavan, A.; McArthur, S.; McCann, A.; Meagher, K.; Millis, J.; Moriarty, P.; Nieto, D.; O'Faoláin de Bhróithe, A.; Ong, R. A.; Orr, M.; Otte, A. N.; Park, N.; Perkins, J. S.; Pohl, M.; Popkow, A.; Prokoph, H.; Pueschel, E.; Quinn, J.; Ragan, K.; Rajotte, J.; Reyes, L. C.; Reynolds, P. T.; Richards, G. T.; Roache, E.; Sembroski, G. H.; Shahinyan, K.; Staszak, D.; Telezhinsky, I.; Tucci, J. V.; Tyler, J.; Varlotta, A.; Vassiliev, V. V.; Wakely, S. P.; Weinstein, A.; Welsing, R.; Wilhelm, A.; Williams, D. A.; Zitzer, B.

2015-01-01

We present results from VERITAS observations of the BL Lac object PG 1553+113 spanning the years 2010, 2011, and 2012. The time-averaged spectrum, measured between 160 and 560 GeV, is well described by a power law with a spectral index of 4.33 ± 0.09. The time-averaged integral flux above 200 GeV measured for this period was (1.69 ± 0.06) × 10-11 photons cm-2 s-1, corresponding to 6.9% of the Crab Nebula flux. We also present the combined γ-ray spectrum from the Fermi Large Area Telescope and VERITAS covering an energy range from 100 MeV to 560 GeV. The data are well fit by a power law with an exponential cutoff at 101.9 ± 3.2 GeV. The origin of the cutoff could be intrinsic to PG 1553+113 or be due to the γ-ray opacity of our universe through pair production off the extragalactic background light (EBL). Given lower limits to the redshift of z > 0.395 based on optical/UV observations of PG 1553+113, the cutoff would be dominated by EBL absorption. Conversely, the small statistical uncertainties of the VERITAS energy spectrum have allowed us to provide a robust upper limit on the redshift of PG 1553+113 of z <= 0.62. A strongly elevated mean flux of (2.50 ± 0.14) × 10-11 photons cm-2 s-1 (10.3% of the Crab Nebula flux) was observed during 2012, with the daily flux reaching as high as (4.44 +/- 0.71) × 10-11 {photons} {cm}-2 {s}-1 (18.3% of the Crab Nebula flux) on MJD 56048. The light curve measured during the 2012 observing season is marginally inconsistent with a steady flux, giving a χ2 probability for a steady flux of 0.03%.

Distinct bacterial communities across a gradient of vegetation from a preserved Brazilian Cerrado.

PubMed

de Araujo, Ademir Sergio Ferreira; Bezerra, Walderly Melgaço; Dos Santos, Vilma Maria; Rocha, Sandra Mara Barbosa; Carvalho, Nilza da Silva; de Lyra, Maria do Carmo Catanho Pereira; Figueiredo, Marcia do Vale Barreto; de Almeida Lopes, Ângela Celis; Melo, Vania Maria Maciel

2017-04-01

The Cerrado biome in the Sete Cidades National Park, an Ecological Reserve in Northeastern Brazil, has conserved its native biodiversity and presents a variety of plants found in other savannas in Brazil. Despite this finding the soil microbial diversity and community structure are poorly understood. Therefore, we described soil bacterial diversity and distribution along a savanna vegetation gradient taking into account the prevailing environmental factors. The bacterial composition was retrieved by sequencing a fragment of the 16S ribosomal RNA gene. The bacterial operational taxonomic units (OTUs) were assigned to 37 different phyla, 96 classes, and 83 genera. At the phylum level, a core comprised by Proteobacteria, Acidobacteria, Actinobacteria, Firmicutes, Verrucomicrobia and Planctomycetes, was detected in all areas of Cerrado. 'Cerrado stricto sensu' and 'Cerradao' share more similarities between edaphic properties and vegetation and also present more similar bacterial communities, while 'Floresta decidual' and 'Campo graminoide' show the largest environmental differences and also more distinct bacterial communities. Proteobacteria (26%), Acidobacteria (21%) and Actinobacteria (21%) were the most abundant phyla within the four areas. All the samples present similar bacteria richness (alpha diversity) and the observed differences among them (beta diversity) were more related to the abundance of specific taxon OTUs compared to their presence or absence. Total organic C, N and P are the main abiotic factors structuring the bacterial communities. In summary, our findings show the bacterial community structure was clearly different across the Cerrado gradient, but that these environments share a bacterial phylum-core comprising Proteobacteria, Acidobacteria, Actinobacteria, Verrucomicrobia and Planctomycetes with other Brazilian savannas.

Comparative study of oncologic outcomes for laparoscopic vs. open surgery in transverse colon cancer.

PubMed

Kim, Woo Ram; Baek, Se Jin; Kim, Chang Woo; Jang, Hyun A; Cho, Min Soo; Bae, Sung Uk; Hur, Hyuk; Min, Byung Soh; Baik, Seung Hyuk; Lee, Kang Young; Kim, Nam Kyu; Sohn, Seung Kuk

2014-01-01

Laparoscopic resection for transverse colon cancer is a technically challenging procedure that has been excluded from various large randomized controlled trials of which the long-term outcomes still need to be verified. The purpose of this study was to evaluate long-term oncologic outcomes for transverse colon cancer patients undergoing laparoscopic colectomy (LAC) or open colectomy (OC). This retrospective review included patients with transverse colon cancer who received a colectomy between January 2006 and December 2010. Short-term and five-year oncologic outcomes were compared between these groups. A total of 131 patients were analyzed in the final study (LAC, 84 patients; OC, 47 patients). There were no significant differences in age, gender, body mass index, tumor location, operative procedure, or blood loss between groups, but the mean operative time in LAC was significantly longer (LAC, 246.8 minutes vs. OC, 213.8 minutes; P = 0.03). Hospital stay was much shorter for LAC than OC (9.1 days vs. 14.5 days, P < 0.01). Postoperative complication rates were not statistically different between the two groups. In terms of long-term oncologic data, the 5-year disease-free survival and overall survival were not statistically different between both groups, and subgroup analysis according to cancer stage also revealed no differences. LAC for transverse colon cancer is feasible and safe with comparable short- and long-term outcomes.

Changes in the bacterial community of soybean rhizospheres during growth in the field.

PubMed

Sugiyama, Akifumi; Ueda, Yoshikatsu; Zushi, Takahiro; Takase, Hisabumi; Yazaki, Kazufumi

2014-01-01

Highly diverse communities of bacteria inhabiting soybean rhizospheres play pivotal roles in plant growth and crop production; however, little is known about the changes that occur in these communities during growth. We used both culture-dependent physiological profiling and culture independent DNA-based approaches to characterize the bacterial communities of the soybean rhizosphere during growth in the field. The physiological properties of the bacterial communities were analyzed by a community-level substrate utilization assay with BioLog Eco plates, and the composition of the communities was assessed by gene pyrosequencing. Higher metabolic capabilities were found in rhizosphere soil than in bulk soil during all stages of the BioLog assay. Pyrosequencing analysis revealed that differences between the bacterial communities of rhizosphere and bulk soils at the phylum level; i.e., Proteobacteria were increased, while Acidobacteria and Firmicutes were decreased in rhizosphere soil during growth. Analysis of operational taxonomic units showed that the bacterial communities of the rhizosphere changed significantly during growth, with a higher abundance of potential plant growth promoting rhizobacteria, including Bacillus, Bradyrhizobium, and Rhizobium, in a stage-specific manner. These findings demonstrated that rhizosphere bacterial communities were changed during soybean growth in the field.

Effect of honey on bacterial translocation and intestinal morphology in obstructive jaundice

PubMed Central

Gencay, Cem; Kilicoglu, Sibel Serin; Kismet, Kemal; Kilicoglu, Bulent; Erel, Serap; Muratoglu, Sabahattin; Sunay, Asli Elif; Erdemli, Esra; Akkus, Mehmet Ali

2008-01-01

AIM: To evaluate the effects of honey on bacterial translocation and intestinal villus histopathology in experimental obstructive jaundice. METHODS: Thirty Wistar-Albino rats were randomly divided into three groups each including 10 animals: group I, sham-operated; group II, ligation and section of the common bile duct (BDL); group III, bile duct ligation followed by oral supplementation of honey (BDL + honey) 10 g/kg per day. Liver, blood, spleen, mesenteric lymph nodes, and ileal samples were taken for microbiological, light and transmission electrone microscopic examination. RESULTS: Although the number of villi per centimeter and the height of the mucosa were higher in sham group, there was no statistically significant difference between sham and BDL + honey groups (P > 0.05). On the other hand, there was a statistically significant difference between BDL group and other groups (P < 0.05). The electron microscopic changes were also different between these groups. Sham and honey groups had similar incidence of bacterial translocation (P > 0.05). BDL group had significantly higher rates of bacterial translocation as compared with sham and honey groups. Bacterial translocation was predominantly detected in mesenteric lymph nodes. CONCLUSION: Supplementation of honey in presence of obstructive jaundice ameliorates bacterial translocation and improves ileal morphology. PMID:18528939

Bacterial diversity in different regions of gastrointestinal tract of Giant African snail (Achatina fulica).

PubMed

Pawar, Kiran D; Banskar, Sunil; Rane, Shailendra D; Charan, Shakti S; Kulkarni, Girish J; Sawant, Shailesh S; Ghate, Hemant V; Patole, Milind S; Shouche, Yogesh S

2012-12-01

The gastrointestinal (GI) tract of invasive land snail Achatina fulica is known to harbor metabolically active bacterial communities. In this study, we assessed the bacterial diversity in the different regions of GI tract of Giant African snail, A. fulica by culture-independent and culture-dependent methods. Five 16S rRNA gene libraries from different regions of GI tract of active snails indicated that sequences affiliated to phylum γ-Proteobacteria dominated the esophagus, crop, intestine, and rectum libraries, whereas sequences affiliated to Tenericutes dominated the stomach library. On phylogenetic analysis, 30, 27, 9, 27, and 25 operational taxonomic units (OTUs) from esophagus, crop, stomach, intestine, and rectum libraries were identified, respectively. Estimations of the total bacterial diversity covered along with environmental cluster analysis showed highest bacterial diversity in the esophagus and lowest in the stomach. Thirty-three distinct bacterial isolates were obtained, which belonged to 12 genera of two major bacterial phyla namely γ-Proteobacteria and Firmicutes. Among these, Lactococcus lactis and Kurthia gibsonii were the dominant bacteria present in all GI tract regions. Quantitative real-time polymerase chain reaction (qPCR) analysis indicated significant differences in bacterial load in different GI tract regions of active and estivating snails. The difference in the bacterial load between the intestines of active and estivating snail was maximum. Principal component analysis (PCA) of terminal restriction fragment length polymorphism suggested that bacterial community structure changes only in intestine when snail enters estivation state. © 2012 The Authors. Published by Blackwell Publishing Ltd.

Combined inadequacies of multiple B vitamins amplify colonic Wnt signaling and promote intestinal tumorigenesis in BAT-LacZ×Apc1638N mice

PubMed Central

Liu, Zhenhua; Ciappio, Eric D.; Crott, Jimmy W.; Brooks, Ryan S.; Nesvet, Jared; Smith, Donald E.; Choi, Sang-Woon; Mason, Joel B.

2011-01-01

The Wnt pathway is a pivotal signaling cascade in colorectal carcinogenesis. The purpose of this work is to determine whether depletion of folate and other metabolically related B vitamins induces in vivo activation of intestinal Wnt signaling and whether this occurs in parallel with increased tumorigenesis. A hybrid mouse was created by crossing a Wnt-reporter animal (BAT-LacZ) with a model of colorectal cancer (Apc1638N). A mild depletion of folate and vitamins B2, B6, and B12 was induced over 16 wk, and the control animals in each instance were pair fed a diet containing the basal requirement of these nutrients. The multiplicity of macroscopic tumors and aberrant crypt foci both increased by ∼50% in the hybrid mice fed the depletion diet (P<0.05). A 4-fold elevation in Wnt signaling was produced by the depletion diet (P<0.05) and was accompanied by significant changes in the expression of a number of Wnt-related genes in a pattern consistent with its activation. Proliferation and apoptosis of the colonic mucosa both changed in a protransformational direction (P<0.05). In summary, mild depletion of multiple B vitamins produces in vivo activation of colonic Wnt signaling, implicating it as a key pathway by which B-vitamin inadequacies enhance intestinal tumorigenesis.—Liu, Z., Ciappio, E. D., Crott, J. W., Brooks, R. S., Nesvet, J., Smith, D. E., Choi, S.-W., Mason, J. B. Combined inadequacies of multiple B vitamins amplify colonic Wnt signaling and promote intestinal tumorigenesis in BAT-LacZ×Apc1638N mice. PMID:21646397

Formation of Archean batholith-hosted gold veins at the Lac Herbin deposit, Val-d'Or district, Canada: Mineralogical and fluid inclusion constraints

NASA Astrophysics Data System (ADS)

Rezeau, Hervé; Moritz, Robert; Beaudoin, Georges

2017-03-01

The Lac Herbin deposit consists of a network of mineralized, parallel steep-reverse faults within the synvolcanic Bourlamaque granodiorite batholith at Val-d'Or in the Archean Abitibi greenstone belt. There are two related quartz-tourmaline-carbonate fault-fill vein sets in the faults, which consist of subvertical fault-fill veins associated with subhorizontal veins. The paragenetic sequence is characterized by a main vein filling ore stage including quartz, tourmaline, carbonate, and pyrite-hosted gold, chalcopyrite, tellurides, pyrrhotite, and cubanite inclusions. Most of the gold is located in fractures in deformed pyrite and quartz in equilibrium with chalcopyrite and carbonates, with local pyrrhotite, sphalerite, galena, cobaltite, pyrite, or tellurides. Petrography and microthermometry on quartz from the main vein filling ore stage reveal the presence of three unrelated fluid inclusion types: (1) gold-bearing aqueous-carbonic inclusions arranged in three-dimensional intragranular clusters in quartz crystals responsible for the main vein filling stage, (2) barren high-temperature, aqueous, moderately saline inclusions observed in healed fractures, postdating the aqueous-carbonic inclusions, and considered as a remobilizing agent of earlier precipitated gold in late fractures, and (3) barren low-temperature, aqueous, high saline inclusions in healed fractures, similar to the crustal brines reported throughout the Canadian Shield and considered to be unrelated to the gold mineralization. At the Lac Herbin deposit, the aqueous-carbonic inclusions are interpreted to have formed first and to represent the gold-bearing fluid, which were generated contemporaneous with regional greenschist facies metamorphism. In contrast, the high-temperature aqueous fluid dissolved gold from the main vein filling ore stage transported and reprecipitated it in late fractures during a subsequent local thermal event.

The protective role of endogenous bacterial communities in chironomid egg masses and larvae

PubMed Central

Senderovich, Yigal; Halpern, Malka

2013-01-01

Insects of the family Chironomidae, also known as chironomids, are distributed worldwide in a variety of water habitats. These insects display a wide range of tolerance toward metals and organic pollutions. Bacterial species known for their ability to degrade toxicants were identified from chironomid egg masses, leading to the hypothesis that bacteria may contribute to the survival of chironomids in polluted environments. To gain a better understanding of the bacterial communities that inhabit chironomids, the endogenous bacteria of egg masses and larvae were studied by 454-pyrosequencing. The microbial community of the egg masses was distinct from that of the larval stage, most likely due to the presence of one dominant bacterial Firmicutes taxon, which consisted of 28% of the total sequence reads from the larvae. This taxon may be an insect symbiont. The bacterial communities of both the egg masses and the larvae were found to include operational taxonomic units, which were closely related to species known as toxicant degraders. Furthermore, various bacterial species with the ability to detoxify metals were isolated from egg masses and larvae. Koch-like postulates were applied to demonstrate that chironomid endogenous bacterial species protect the insect from toxic heavy metals. We conclude that chironomids, which are considered pollution tolerant, are inhabited by stable endogenous bacterial communities that have a role in protecting their hosts from toxicants. This phenomenon, in which bacteria enable the continued existence of their host in hostile environments, may not be restricted only to chironomids. PMID:23804150

[Current treatment of bacterial vaginosis].

PubMed

Borisov, I

1999-01-01

Therapeutic options for the treatment of accurately diagnosed bacterial vaginosis are reviewed on the basis of current concepts for treatment of bacterial vaginosis. The importance for screening for bacterial vaginosis is pointed out especially before intrauterine procedures and in pregnant women at risk for premature deliveries. Treatment regimens for pregnant women are discussed as well. Emphasis is given to treatment modalities for recurrent bacterial vaginosis.

Local environmental pollution strongly influences culturable bacterial aerosols at an urban aquatic superfund site.

PubMed

Dueker, M Elias; O'Mullan, Gregory D; Juhl, Andrew R; Weathers, Kathleen C; Uriarte, Maria

2012-10-16

In polluted environments, when microbial aerosols originate locally, species composition of the aerosols should reflect the polluted source. To test the connection between local environmental pollution and microbial aerosols near an urban waterfront, we characterized bacterial aerosols at Newtown Creek (NTC), a public waterway and Superfund site in a densely populated area of New York, NY, USA. Culturable bacterial aerosol fallout rate and surface water bacterial concentrations were at least an order of magnitude greater at NTC than at a neighboring, less polluted waterfront and a nonurban coastal site in Maine. The NTC culturable bacterial aerosol community was significantly different in taxonomic structure from previous urban and coastal aerosol studies, particularly in relative abundances of Actinobacteria and Proteobacteria. Twenty-four percent of the operational taxonomic units in the NTC overall (air + water) bacterial isolate library were most similar to bacterial 16S rRNA gene sequences previously described in terrestrial or aquatic environments contaminated with sewage, hydrocarbons, heavy metals, and other industrial waste. This study is the first to examine the community composition and local deposition of bacterial aerosols from an aquatic Superfund site. The findings have important implications for the use of aeration remediation in polluted aquatic environments and suggest a novel pathway of microbial exposure in densely populated urban communities containing contaminated soil and water.

A calorimetric investigation of the interaction of the lac repressor with inducer.

PubMed

Donnér, J; Caruthers, M H; Gill, S J

1982-12-25

A calorimetric study has been made of the interaction between the lac repressor and isopropyl-1-thio-beta-D-galactopyranoside (IPTG). The buffer-corrected enthalpy of reaction at 25 degrees C was found to be -15.6, -24.7, -4.6 kJ/mol of bound IPTG at pH 7.0, pH 8.1, and pH 9.0, respectively. This large range of enthalpy values is in contrast to a maximum difference in the free energy of the reaction of only 1.5 kJ/mol of bound IPTG between these pH values. The reaction was found by calorimetric measurements in different buffers to be accompanied by an uptake of 0.29 mol of protons/mol of bound IPTG at pH 8.1. The pH dependency of the reaction enthalpy suggests differences in the extent of protonation of the binding site and the involvement of H bonding with IPTG. The lack of strong hydrophobic contributions in the IPTG binding process is revealed by the absence of any determinable heat capacity change for the reaction at pH 7.0. The presence of phosphate buffer significantly alters the enthalpy of IPTG binding at higher pH values, but has little effect upon the binding constant. This implies that highly negative phosphate species change the nature of the IPTG binding site without any displacement of phosphate upon IPTG binding.

Rapid and efficient introduction of a foreign gene into bacterial artificial chromosome-cloned varicella vaccine by Tn7-mediated site-specific transposition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Somboonthum, Pranee; Koshizuka, Tetsuo; Okamoto, Shigefumi

2010-06-20

Using a rapid and reliable system based on Tn7-mediated site-specific transposition, we have successfully constructed a recombinant Oka varicella vaccine (vOka) expressing the mumps virus (MuV) fusion protein (F). The backbone of the vector was our previously reported vOka-BAC (bacterial artificial chromosome) genome. We inserted the transposon Tn7 attachment sequence, LacZ{alpha}-mini-attTn7, into the region between ORF12 and ORF13 to generate a vOka-BAC-Tn genome. The MuV-F expressing cassette was transposed into the vOka-BAC genome at the mini-attTn7 transposition site. MuV-F protein was expressed in recombinant virus, rvOka-F infected cells. In addition, the MuV-F protein was cleaved in the rvOka-F infected cellsmore » as in MuV-infected cells. The growth of rvOka-F was similar to that of the original recombinant vOka without the F gene. Thus, we show that Tn7-mediated transposition is an efficient method for introducing a foreign gene expression cassette into the vOka-BAC genome as a live virus vector.« less

Bacterial Cell Mechanics.

PubMed

Auer, George K; Weibel, Douglas B

2017-07-25

Cellular mechanical properties play an integral role in bacterial survival and adaptation. Historically, the bacterial cell wall and, in particular, the layer of polymeric material called the peptidoglycan were the elements to which cell mechanics could be primarily attributed. Disrupting the biochemical machinery that assembles the peptidoglycan (e.g., using the β-lactam family of antibiotics) alters the structure of this material, leads to mechanical defects, and results in cell lysis. Decades after the discovery of peptidoglycan-synthesizing enzymes, the mechanisms that underlie their positioning and regulation are still not entirely understood. In addition, recent evidence suggests a diverse group of other biochemical elements influence bacterial cell mechanics, may be regulated by new cellular mechanisms, and may be triggered in different environmental contexts to enable cell adaptation and survival. This review summarizes the contributions that different biomolecular components of the cell wall (e.g., lipopolysaccharides, wall and lipoteichoic acids, lipid bilayers, peptidoglycan, and proteins) make to Gram-negative and Gram-positive bacterial cell mechanics. We discuss the contribution of individual proteins and macromolecular complexes in cell mechanics and the tools that make it possible to quantitatively decipher the biochemical machinery that contributes to bacterial cell mechanics. Advances in this area may provide insight into new biology and influence the development of antibacterial chemotherapies.

Nutrient, trace-element, and ecological history of Musky Bay, Lac Courte Oreilles, Wisconsin, as inferred from sediment cores

USGS Publications Warehouse

Fitzpatrick, Faith A.; Garrison, Paul J.; Fitzgerald, Sharon A.; Elder, John F.

2003-01-01

Sediment cores were collected from Musky Bay, Lac Courte Oreilles, and from surrounding areas in 1999 and 2001 to determine whether the water quality of Musky Bay has declined during the last 100 years or more as a result of human activity, specifically cottage development and cranberry farming. Selected cores were analyzed for sedimentation rates, nutrients, minor and trace elements, biogenic silica, diatom assemblages, and pollen over the past several decades. Two cranberry bogs constructed along Musky Bay in 1939 and the early 1950s were substantially expanded between 1950?62 and between 1980?98. Cottage development on Musky Bay has occurred at a steady rate since about 1930, although currently housing density on Musky Bay is one-third to one-half the housing density surrounding three other Lac Courte Oreilles bays. Sedimentation rates were reconstructed for a core from Musky Bay by use of three lead radioisotope models and the cesium-137 profile. The historical average mass and linear sedimentation rates for Musky Bay are 0.023 grams per square centimeter per year and 0.84 centimeters per year, respectively, for the period of about 1936?90. There is also limited evidence that sedimentation rates may have increased after the mid-1990s. Historical changes in input of organic carbon, nitrogen, phosphorus, and sulfur to Musky Bay could not be directly identified from concentration profiles of these elements because of the potential for postdepositional migration and recycling. Minor- and trace-element profiles from the Musky Bay core possibly reflect historical changes in the input of clastic material over time, as well as potential changes in atmospheric deposition inputs. The input of clastic material to the bay increased slightly after European settlement and possibly in the 1930s through 1950s. Concentrations of copper in the Musky Bay core increased steadily through the early to mid-1900s until about 1980 and appear to reflect inputs from atmospheric

Gut bacterial communities across tadpole ecomorphs in two diverse tropical anuran faunas

NASA Astrophysics Data System (ADS)

Vences, Miguel; Lyra, Mariana L.; Kueneman, Jordan G.; Bletz, Molly C.; Archer, Holly M.; Canitz, Julia; Handreck, Svenja; Randrianiaina, Roger-Daniel; Struck, Ulrich; Bhuju, Sabin; Jarek, Michael; Geffers, Robert; McKenzie, Valerie J.; Tebbe, Christoph C.; Haddad, Célio F. B.; Glos, Julian

2016-04-01

Animal-associated microbial communities can play major roles in the physiology, development, ecology, and evolution of their hosts, but the study of their diversity has yet focused on a limited number of host species. In this study, we used high-throughput sequencing of partial sequences of the bacterial 16S rRNA gene to assess the diversity of the gut-inhabiting bacterial communities of 212 specimens of tropical anuran amphibians from Brazil and Madagascar. The core gut-associated bacterial communities among tadpoles from two different continents strongly overlapped, with eight highly represented operational taxonomic units (OTUs) in common. In contrast, the core communities of adults and tadpoles from Brazil were less similar with only one shared OTU. This suggests a community turnover at metamorphosis. Bacterial diversity was higher in tadpoles compared to adults. Distinct differences in composition and diversity occurred among gut bacterial communities of conspecific tadpoles from different water bodies and after experimental fasting for 8 days, demonstrating the influence of both environmental factors and food on the community structure. Communities from syntopic tadpoles clustered by host species both in Madagascar and Brazil, and the Malagasy tadpoles also had species-specific isotope signatures. We recommend future studies to analyze the turnover of anuran gut bacterial communities at metamorphosis, compare the tadpole core communities with those of other aquatic organisms, and assess the possible function of the gut microbiota as a reservoir for protective bacteria on the amphibian skin.

76 FR 80331 - Foreign-Trade Subzone 41H Application for Expansion; Mercury Marine (Marine Propulsion Products...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-12-23

... Application for Expansion; Mercury Marine (Marine Propulsion Products), Fond du Lac and Oshkosh, WI An... of FTZ 41, on behalf of Mercury Marine, operator of Subzone 41H at Mercury Marine's marine propulsion... manufacturing of marine propulsion products at Mercury Marine's facilities located in Fond du Lac and Oshkosh...

In vitro bacterial isolate susceptibility to empirically selected antimicrobials in 111 dogs with bacterial pneumonia.

PubMed

Proulx, Alexandre; Hume, Daniel Z; Drobatz, Kenneth J; Reineke, Erica L

2014-01-01

To determine the proportion of airway bacterial isolates resistant to both empirically selected and recently administered antimicrobials, and to assess the impact of inappropriate initial empiric antimicrobials selection on length of hospital stay and survival to discharge in dogs with bacterial pneumonia. Retrospective study. University veterinary teaching hospital. One hundred and eleven dogs with a clinical diagnosis of bacterial pneumonia that had aerobic bacterial culture and susceptibility testing performed from a tracheal wash sample. None. Overall, 26% (29/111) of the dogs had at least 1 bacterial isolate that was resistant to empirically selected antimicrobials. In dogs with a history of antimicrobial administration within the preceding 4 weeks, a high incidence (57.4%, 31/54) of in vitro bacterial resistance to those antimicrobials was found: 64.7% (11/17) in the community-acquired pneumonia group, 55.2% (16/29) in the aspiration pneumonia group, and 50.0% (4/8) in the other causes of bacterial pneumonia group. No statistically significant association was found between bacterial isolate resistance to empirically selected antimicrobials and length of hospital stay or mortality. The high proportion of in vitro airway bacterial resistance to empiric antimicrobials would suggest that airway sampling for bacterial culture and susceptibility testing may be helpful in guiding antimicrobial therapy and recently administered antimicrobials should be avoided when empirically selecting antimicrobials. Although no relationship was found between inappropriate initial empiric antimicrobial selection and length of hospital stay or mortality, future prospective studies using standardized airway-sampling techniques, treatment modalities, and stratification of disease severity based on objective values, such as arterial blood gas analysis in all dogs with pneumonia, would be needed to determine if a clinical effect of in vitro bacterial resistance to empirically

Lack of Accuracy of Body Temperature for Detecting Serious Bacterial Infection in Febrile Episodes.

PubMed

De, Sukanya; Williams, Gabrielle J; Teixeira-Pinto, Armando; Macaskill, Petra; McCaskill, Mary; Isaacs, David; Craig, Jonathan C

2015-09-01

Body temperature is a time-honored marker of serious bacterial infection, but there are few studies of its test performance. The aim of our study was to determine the accuracy of temperature measured on presentation to medical care for detecting serious bacterial infection. Febrile children 0-5 years of age presenting to the emergency department of a tertiary care pediatric hospital were sampled consecutively. The accuracy of the axillary temperature measured at presentation was evaluated using logistic regression models to generate receiver operating characteristic curves. Reference standard tests for serious bacterial infection were standard microbiologic/radiologic tests and clinical follow-up. Age, clinicians' impression of appearance of the child (well versus unwell) and duration of illness were assessed as possible effect modifiers. Of 15,781 illness episodes 1120 (7.1%) had serious bacterial infection. The area under the receiver operating characteristic curve for temperature was 0.60 [95% confidence intervals (CI): 0.58-0.62]. A threshold of ≥ 38°C had a sensitivity of 0.67 (95% CI: 0.64-0.70), specificity of 0.45 (95% CI: 0.44-0.46), positive likelihood ratio of 1.2 (95% CI: 1.2-1.3) and negative likelihood ratio of 0.7 (95% CI: 0.7-0.8). Age and illness duration had a small but significant effect on the accuracy of temperature increasing its "rule-in" potential. Measured temperature at presentation to hospital is not an accurate marker of serious bacterial infection in febrile children. Younger age and longer duration of illness increase the rule-in potential of temperature but without substantial overall change in its test accuracy.

Simulation of Graphene Field-Effect Transistor Biosensors for Bacterial Detection.

PubMed

Wu, Guangfu; Meyyappan, Meyya; Lai, King Wai Chiu

2018-05-25

Foodborne illness is correlated with the existence of infectious pathogens such as bacteria in food and drinking water. Probe-modified graphene field effect transistors (G-FETs) have been shown to be suitable for Escherichia coli ( E. coli ) detection. Here, the G-FETs for bacterial detection are modeled and simulated with COMSOL Multiphysics to understand the operation of the biosensors. The motion of E. coli cells in electrolyte and the surface charge of graphene induced by E. coli are systematically investigated. The comparison between the simulation and experimental data proves the sensing probe size to be a key parameter affecting the surface charge of graphene induced by bacteria. Finally, the relationship among the change in source-drain current (∆ I ds ), graphene-bacteria distance and bacterial concentration is established. The shorter graphene-bacteria distance and higher bacterial concentration give rise to better sensing performance (larger ∆ I ds ) of the G-FETs biosensors. The simulation here could serve as a guideline for the design and optimization of G-FET biosensors for various applications.

Bovine pasteurellosis and other bacterial infections of the respiratory tract.

PubMed

Griffin, Dee

2010-03-01

Despite technological, biologic, and pharmacologic advances the bacterial component of the bovine respiratory disease (BRD) complex continues to have a major adverse effect on the health and wellbeing of stocker and feeder cattle. Overlooked in this disappointing assessment is evaluation of the effects that working with younger, lighter-weight cattle have on managing the bacterial component of the BRD complex. Most problems associated with BRD come from cattle taken from and comingled with cattle operations that have inconsistent or nonexistent cattle health management. This article reviews the biologic, clinical, and management aspects of Pasteurella multocida, Mannheimia haemolytica, Histophilus somni, and Mycoplasma bovis, primarily as related to current production management considerations of stocker and feeder cattle. Copyright 2010 Elsevier Inc. All rights reserved.

Consequences of organ choice in describing bacterial pathogen assemblages in a rodent population.

PubMed

Villette, P; Afonso, E; Couval, G; Levret, A; Galan, M; Tatard, C; Cosson, J F; Giraudoux, P

2017-10-01

High-throughput sequencing technologies now allow for rapid cost-effective surveys of multiple pathogens in many host species including rodents, but it is currently unclear if the organ chosen for screening influences the number and identity of bacteria detected. We used 16S rRNA amplicon sequencing to identify bacterial pathogens in the heart, liver, lungs, kidneys and spleen of 13 water voles (Arvicola terrestris) collected in Franche-Comté, France. We asked if bacterial pathogen assemblages within organs are similar and if all five organs are necessary to detect all of the bacteria present in an individual animal. We identified 24 bacteria representing 17 genera; average bacterial richness for each organ ranged from 1·5 ± 0·4 (mean ± standard error) to 2·5 ± 0·4 bacteria/organ and did not differ significantly between organs. The average bacterial richness when organ assemblages were pooled within animals was 4·7 ± 0·6 bacteria/animal; Operational Taxonomic Unit accumulation analysis indicates that all five organs are required to obtain this. Organ type influences bacterial assemblage composition in a systematic way (PERMANOVA, 999 permutations, pseudo-F 4,51 = 1·37, P = 0·001). Our results demonstrate that the number of organs sampled influences the ability to detect bacterial pathogens, which can inform sampling decisions in public health and wildlife ecology.

Principles of a clean operating room environment.

PubMed

Howard, James L; Hanssen, Arlen D

2007-10-01

Optimizing the operating room environment is necessary to minimize the prevalence of arthroplasty infection. Reduction of bacterial contamination in the operating room should be a primary focus of all members of the operating room team. However, in recent years, there has been a decline in the emphasis of the basic principles of antisepsis in many operating rooms. The purpose of this review is to highlight important considerations for optimizing the operating room environment. These principles should be actively promoted by orthopedic surgeons in their operating rooms as part of a comprehensive approach to minimizing arthroplasty infection.

Canopy soil bacterial communities altered by severing host tree limbs

PubMed Central

Dangerfield, Cody R.; Nadkarni, Nalini M.

2017-01-01

Trees of temperate rainforests host a large biomass of epiphytic plants, which are associated with soils formed in the forest canopy. Falling of epiphytic material results in the transfer of carbon and nutrients from the canopy to the forest floor. This study provides the first characterization of bacterial communities in canopy soils enabled by high-depth environmental sequencing of 16S rRNA genes. Canopy soil included many of the same major taxonomic groups of Bacteria that are also found in ground soil, but canopy bacterial communities were lower in diversity and contained different operational taxonomic units. A field experiment was conducted with epiphytic material from six Acer macrophyllum trees in Olympic National Park, Washington, USA to document changes in the bacterial communities of soils associated with epiphytic material that falls to the forest floor. Bacterial diversity and composition of canopy soil was highly similar, but not identical, to adjacent ground soil two years after transfer to the forest floor, indicating that canopy bacteria are almost, but not completely, replaced by ground soil bacteria. Furthermore, soil associated with epiphytic material on branches that were severed from the host tree and suspended in the canopy contained altered bacterial communities that were distinct from those in canopy material moved to the forest floor. Therefore, the unique nature of canopy soil bacteria is determined in part by the host tree and not only by the physical environmental conditions associated with the canopy. Connection to the living tree appears to be a key feature of the canopy habitat. These results represent an initial survey of bacterial diversity of the canopy and provide a foundation upon which future studies can more fully investigate the ecological and evolutionary dynamics of these communities. PMID:28894646

Canopy soil bacterial communities altered by severing host tree limbs.

PubMed

Dangerfield, Cody R; Nadkarni, Nalini M; Brazelton, William J

2017-01-01

Trees of temperate rainforests host a large biomass of epiphytic plants, which are associated with soils formed in the forest canopy. Falling of epiphytic material results in the transfer of carbon and nutrients from the canopy to the forest floor. This study provides the first characterization of bacterial communities in canopy soils enabled by high-depth environmental sequencing of 16S rRNA genes. Canopy soil included many of the same major taxonomic groups of Bacteria that are also found in ground soil, but canopy bacterial communities were lower in diversity and contained different operational taxonomic units. A field experiment was conducted with epiphytic material from six Acer macrophyllum trees in Olympic National Park, Washington, USA to document changes in the bacterial communities of soils associated with epiphytic material that falls to the forest floor. Bacterial diversity and composition of canopy soil was highly similar, but not identical, to adjacent ground soil two years after transfer to the forest floor, indicating that canopy bacteria are almost, but not completely, replaced by ground soil bacteria. Furthermore, soil associated with epiphytic material on branches that were severed from the host tree and suspended in the canopy contained altered bacterial communities that were distinct from those in canopy material moved to the forest floor. Therefore, the unique nature of canopy soil bacteria is determined in part by the host tree and not only by the physical environmental conditions associated with the canopy. Connection to the living tree appears to be a key feature of the canopy habitat. These results represent an initial survey of bacterial diversity of the canopy and provide a foundation upon which future studies can more fully investigate the ecological and evolutionary dynamics of these communities.

Facial bacterial infections: folliculitis.

PubMed

Laureano, Ana Cristina; Schwartz, Robert A; Cohen, Philip J

2014-01-01

Facial bacterial infections are most commonly caused by infections of the hair follicles. Wherever pilosebaceous units are found folliculitis can occur, with the most frequent bacterial culprit being Staphylococcus aureus. We review different origins of facial folliculitis, distinguishing bacterial forms from other infectious and non-infectious mimickers. We distinguish folliculitis from pseudofolliculitis and perifolliculitis. Clinical features, etiology, pathology, and management options are also discussed. Copyright © 2014. Published by Elsevier Inc.

Treatment of bacterial meningitis: an update.

PubMed

Shin, Seon Hee; Kim, Kwang Sik

2012-10-01

The introduction of protein conjugate vaccines for Haemophilus influenzae type b (Hib), Streptococcus pneumoniae (S. pneumoniae) and Neisseria meningitidis (N. menigitidis) has changed the epidemiology of bacterial meningitis. Bacterial meningitis continues to be an important cause of mortality and morbidity, and our incomplete knowledge of its pathogenesis and emergence of antimicrobial resistant bacteria contribute to such mortality and morbidity. An early empiric antibiotic treatment is critical for the management of patients with bacterial meningitis. This article gives an overview on optimal treatment strategies of bacterial meningitis, along with considerations of new insights on epidemiology, clinical and laboratory findings supportive of bacterial meningitis, chemoprophylaxis, selection of initial antimicrobial agents for suspected bacterial meningitis, antimicrobial resistance and utility of new antibiotics, status on anti-inflammatory agents and adjunctive therapy, and pathogenesis of bacterial meningitis. Prompt treatment of bacterial meningitis with an appropriate antibiotic is essential. Optimal antimicrobial treatment of bacterial meningitis requires bactericidal agents able to penetrate the blood-brain barrier (BBB), with efficacy in cerebrospinal fluid (CSF). Several new antibiotics have been introduced for the treatment of meningitis caused by resistant bacteria, but their use in human studies has been limited. More complete understanding of the microbial and host interactions that are involved in the pathogenesis of bacterial meningitis and associated neurologic sequelae is likely to help in developing new strategies for the prevention and therapy of bacterial meningitis.

Quality of Irrigation Water Affects Soil Functionality and Bacterial Community Stability in Response to Heat Disturbance.

PubMed

Frenk, Sammy; Hadar, Yitzhak; Minz, Dror

2018-02-15

Anthropogenic activities alter the structure and function of a bacterial community. Furthermore, bacterial communities structured by the conditions the anthropogenic activities present may consequently reduce their stability in response to an unpredicted acute disturbance. The present mesocosm-scale study exposed soil bacterial communities to different irrigation water types, including freshwater, fertilized freshwater, treated wastewater, and artificial wastewater, and evaluated their response to a disturbance caused by heat. These effectors may be considered deterministic and stochastic forces common in agricultural operations of arid and semiarid regions. Bacterial communities under conditions of high mineral and organic carbon availability (artificial wastewater) differed from the native bacterial community and showed a proteobacterial dominance. These bacterial communities had a lower resistance to the heat treatment disturbance than soils under conditions of low resource availability (high-quality treated wastewater or freshwater). The latter soil bacterial communities showed a higher abundance of operational taxonomic units (OTUs) classified as Bacilli These results were elucidated by soil under conditions of high resource availability, which lost higher degrees of functional potential and had a greater bacterial community composition change. However, the functional resilience, after the disturbance ended, was higher under a condition of high resource availability despite the bacterial community composition shift and the decrease in species richness. The functional resilience was directly connected to the high growth rates of certain Bacteroidetes and proteobacterial groups. A high stability was found in samples that supported the coexistence of both resistant OTUs and fast-growing OTUs. IMPORTANCE This report presents the results of a study employing a hypothesis-based experimental approach to reveal the forces involved in determining the stability of a

Small bowel bacterial overgrowth

MedlinePlus

Overgrowth - intestinal bacteria; Bacterial overgrowth - intestine; Small intestinal bacterial overgrowth; SIBO ... intestine does not have a high number of bacteria. Excess bacteria in the small intestine may use ...

VizieR Online Data Catalog: Swift and NuSTAR obs. of the BL Lac Mrk 421 (Kapanadze+, 2016)

NASA Astrophysics Data System (ADS)

Kapanadze, B.; Dorner, D.; Vercellone, S.; Romano, P.; Aller, H.; Aller, M.; Hughes, P.; Reynolds, M.; Kapanadze, S.; Tabagari, L.

2017-01-01

We retrieved the Swift-XRT data from the publicly available archive, maintained by HEASARC. We present the results of X-ray observations of the high-energy peaked BL Lac (HBL) source Mrk421 performed by Swift-XRT and NuSTAR during 2013 January-June. Along with the 0.3-10keV and 3-79keV data obtained with the Swift-XRT and NuSTAR instruments, we have processed and analyzed those obtained with the Ultraviolet-Optical Telescope (UVOT) and Large Area Telescope (LAT) onboard Fermi. We have also used the publicly available light curves from the observations performed with the Burst Alert Telescope (BAT) onboard Swift, Monitor of All Sky X-ray Image (MAXI), MAGIC, First G-APD Cherenkov Telescope (FACT), and the OVRO 40m telescope during the 2013 January-June period to draw conclusions about the interband correlations. (8 data files).

Complexity of Bacterial Communities in a River-Floodplain System (Danube, Austria)

PubMed Central

Besemer, Katharina; Moeseneder, Markus M.; Arrieta, Jesus M.; Herndl, Gerhard J.; Peduzzi, Peter

2005-01-01

Natural floodplains play an essential role in the processing and decomposition of organic matter and in the self-purification ability of rivers, largely due to the activity of bacteria. Knowledge about the composition of bacterial communities and its impact on organic-matter cycling is crucial for the understanding of ecological processes in river-floodplain systems. Particle-associated and free-living bacterial assemblages from the Danube River and various floodplain pools with different hydrological characteristics were investigated using terminal restriction fragment length polymorphism analysis. The particle-associated bacterial community exhibited a higher number of operational taxonomic units (OTUs) and was more heterogeneous in time and space than the free-living community. The temporal dynamics of the community structure were generally higher in isolated floodplain pools. The community structures of the river and the various floodplain pools, as well as those of the particle-associated and free-living bacteria, differed significantly. The compositional dynamics of the planktonic bacterial communities were related to changes in the algal biomass, temperature, and concentrations of organic and inorganic nutrients. The OTU richness of the free-living community was correlated with the concentration and origin of organic matter and the concentration of inorganic nutrients, while no correlation with the OTU richness of the particle-associated assemblage was found. Our results demonstrate the importance of the river-floodplain interactions and the influence of damming and regulation on the bacterial-community composition. PMID:15691909

Diverse bacterial communities exist on canine skin and are impacted by cohabitation and time.

PubMed

Torres, Sheila; Clayton, Jonathan B; Danzeisen, Jessica L; Ward, Tonya; Huang, Hu; Knights, Dan; Johnson, Timothy J

2017-01-01

It has previously been shown that domestic dogs and their household owners share bacterial populations, and that sharing of bacteria between humans is facilitated through the presence of dogs in the household. However, less is known regarding the bacterial communities of dogs, how these communities vary by location and over time, and how cohabitation of dogs themselves influences their bacterial community. Furthermore, the effects of factors such as breed, hair coat length, sex, shedding, and age on the canine skin microbiome is unknown. This study sampled the skin bacterial communities of 40 dogs belonging to 20 households longitudinally across three seasons (spring, summer, and winter). Significant differences in bacterial community structure between samples were identified when stratified by season, but not by dog sex, age, breed, hair type, or skin site. Cohabitating dogs were more likely to share bacteria of the skin than non-cohabitating dogs. Similar to human bacterial microbiomes, dogs' microbiomes were more similar to their own microbiomes over time than to microbiomes of other individuals. Dogs sampled during the same season were also more similar to each other than to dogs from different seasons, irrespective of household. However, there were very few core operational taxonomic units (OTUs) identified across all dogs sampled. Taxonomic classification revealed Propionibacterium acnes and Haemophilus sp. as key members of the dog skin bacterial community, along with Corynebacterium sp. and Staphylococcus epidermidis . This study shows that the skin bacterial community structure of dogs is highly individualized, but can be shared among dogs through cohabitation.

Bacterial reduction of Cr(VI) at technical scale--the Malaysian experience.

PubMed

Zakaria, Zainul Akmar; Ahmad, Wan Azlina; Zakaria, Zainoha; Razali, Firdausi; Karim, Norsuhada Abdul; Sum, Mohamad Md; Sidek, Mohd Saufi Mohd

2012-07-01

The bacterial reduction of Cr(VI) from industrial wastewater was evaluated using a 2.0-m(3) bioreactor. Liquid pineapple waste was used as a nutrient for the biofilm community formed inside the bioreactor. The use of rubber wood sawdust as packing material was able to immobilize more than 10(6) CFU mL(-1) of Acinetobacter haemolyticus cells after 3 days of contact time. Complete reduction of 15-240 mg L(-1) of Cr(VI) was achieved even after 3 months of bioreactor operation. Cr(VI) was not detected in the final effluent fraction indicating complete removal of Cr from solution from the flocculation/coagulation step and the unlikely re-oxidation of Cr(III) into Cr(VI). Impatiens balsamina L. and Gomphrena globosa L. showed better growth in the presence of soil-sludge mixture compared to Coleus scutellarioides (L.) Benth. Significant amounts of Cr accumulated at different sections of the plants indicate its potential application in Cr phytoremediation effort. The bacterial-based system was also determined not to be detrimental to human health based on the low levels of Cr detected in the hair and nail samples of the plant operators. Thus, it can be said that bacterial-based Cr(VI) treatment system is a feasible alternative to the conventional system especially for lower Cr(VI) concentrations, where sludge generated can be used as growth supplement for ornamental plant as well as not detrimental to the health of the workers.

Bacterial microbiome of the nose of healthy dogs and dogs with nasal disease

PubMed Central

Dorn, Elisabeth S.; Suchodolski, Jan S.; Nisar, Tariq; Ravindran, Prajesh; Weber, Karin; Hartmann, Katrin; Schulz, Bianka S.

2017-01-01

The role of bacterial communities in canine nasal disease has not been studied so far using next generation sequencing methods. Sequencing of bacterial 16S rRNA genes has revealed that the canine upper respiratory tract harbors a diverse microbial community; however, changes in the composition of nasal bacterial communities in dogs with nasal disease have not been described so far. Aim of the study was to characterize the nasal microbiome of healthy dogs and compare it to that of dogs with histologically confirmed nasal neoplasia and chronic rhinitis. Nasal swabs were collected from healthy dogs (n = 23), dogs with malignant nasal neoplasia (n = 16), and dogs with chronic rhinitis (n = 8). Bacterial DNA was extracted and sequencing of the bacterial 16S rRNA gene was performed. Data were analyzed using Quantitative Insights Into Microbial Ecology (QIIME). A total of 376 Operational Taxonomic Units out of 26 bacterial phyla were detected. In healthy dogs, Moraxella spp. was the most common species, followed by Phyllobacterium spp., Cardiobacteriaceae, and Staphylococcus spp. While Moraxella spp. were significantly decreased in diseased compared to healthy dogs (p = 0.005), Pasteurellaceae were significantly increased (p = 0.001). Analysis of similarities used on the unweighted UniFrac distance metric (p = 0.027) was significantly different when nasal microbial communities of healthy dogs were compared to those of dogs with nasal disease. The study showed that the canine nasal cavity is inhabited by a highly species-rich bacterial community, and suggests significant differences between the nasal microbiome of healthy dogs and dogs with nasal disease. PMID:28459886

Bacterial microbiome of the nose of healthy dogs and dogs with nasal disease.

PubMed

Tress, Barbara; Dorn, Elisabeth S; Suchodolski, Jan S; Nisar, Tariq; Ravindran, Prajesh; Weber, Karin; Hartmann, Katrin; Schulz, Bianka S

2017-01-01

The role of bacterial communities in canine nasal disease has not been studied so far using next generation sequencing methods. Sequencing of bacterial 16S rRNA genes has revealed that the canine upper respiratory tract harbors a diverse microbial community; however, changes in the composition of nasal bacterial communities in dogs with nasal disease have not been described so far. Aim of the study was to characterize the nasal microbiome of healthy dogs and compare it to that of dogs with histologically confirmed nasal neoplasia and chronic rhinitis. Nasal swabs were collected from healthy dogs (n = 23), dogs with malignant nasal neoplasia (n = 16), and dogs with chronic rhinitis (n = 8). Bacterial DNA was extracted and sequencing of the bacterial 16S rRNA gene was performed. Data were analyzed using Quantitative Insights Into Microbial Ecology (QIIME). A total of 376 Operational Taxonomic Units out of 26 bacterial phyla were detected. In healthy dogs, Moraxella spp. was the most common species, followed by Phyllobacterium spp., Cardiobacteriaceae, and Staphylococcus spp. While Moraxella spp. were significantly decreased in diseased compared to healthy dogs (p = 0.005), Pasteurellaceae were significantly increased (p = 0.001). Analysis of similarities used on the unweighted UniFrac distance metric (p = 0.027) was significantly different when nasal microbial communities of healthy dogs were compared to those of dogs with nasal disease. The study showed that the canine nasal cavity is inhabited by a highly species-rich bacterial community, and suggests significant differences between the nasal microbiome of healthy dogs and dogs with nasal disease.

Exploring bacterial infections: theoretical and experimental studies of the bacterial population dynamics and antibiotic treatment

NASA Astrophysics Data System (ADS)

Shao, Xinxian

Bacterial infections are very common in human society. Thus extensive research has been conducted to reveal the molecular mechanisms of the pathogenesis and to evaluate the antibiotics' efficacy against bacteria. Little is known, however, about the population dynamics of bacterial populations and their interactions with the host's immune system. In this dissertation, a stochatic model is developed featuring stochastic phenotypic switching of bacterial individuals to explain the single-variant bottleneck discovered in multi strain bacterial infections. I explored early events in a bacterial infection establishment using classical experiments of Moxon and Murphy on neonatal rats. I showed that the minimal model and its simple variants do not work. I proposed modifications to the model that could explain the data quantitatively. The bacterial infections are also commonly established in physical structures, as biofilms or 3-d colonies. In contrast, most research on antibiotic treatment of bacterial infections has been conducted in well-mixed liquid cultures. I explored the efficacy of antibiotics to treat such bacterial colonies, a broadly applicable method is designed and evaluated where discrete bacterial colonies on 2-d surfaces were exposed to antibiotics. I discuss possible explanations and hypotheses for the experimental results. To verify these hypotheses, we investigated the dynamics of bacterial population as 3-d colonies. We showed that a minimal mathematical model of bacterial colony growth in 3-d was able to account for the experimentally observed presence of a diffusion-limited regime. The model further revealed highly loose packing of the cells in 3-d colonies and smaller cell sizes in colonies than plancktonic cells in corresponding liquid culture. Further experimental tests of the model predictions have revealed that the ratio of the cell size in liquid culture to that in colony cultures was consistent with the model prediction, that the dead cells

Comparison of intestinal bacterial communities in grass carp, Ctenopharyngodon idellus, from two different habitats

NASA Astrophysics Data System (ADS)

Ni, Jiajia; Yu, Yuhe; Zhang, Tanglin; Gao, Lei

2012-09-01

The intestinal bacteria of vertebrates form a close relationship with their host. External and internal conditions of the host, including its habitat, affect the intestinal bacterial community. Similarly, the intestinal bacterial community can, in turn, influence the host, particularly with respect to disease resistance. We compared the intestinal bacterial communities of grass carp that were collected from farm-ponds or a lake. We conducted denaturing gradient gel electrophoresis of amplified 16S rRNA genes, from which 66 different operational taxonomic units were identified. Using both the unweighted pair-group method with arithmetic means clustering and principal component analysis ordination, we found that the intestinal bacterial communities from the two groups of pond fish were clustered together and inset into the clusters of wild fish, except for DF-7, and there was no significant correlation between genetic diversity of grass carp and their intestinal bacterial communities (Mantel one-tailed test, R=0.157, P=0.175). Cetobacterium appeared more frequently in the intestine of grass carp collected from pond. A more thorough understanding of the role played by intestinal microbiota on fish health would be of considerable benefit to the aquaculture industry.

Molecular characterization of soil bacterial community in a perhumid, low mountain forest.

PubMed

Lin, Yu-Te; Whitman, William B; Coleman, David C; Chih-Yu, Chiu

2011-01-01

Forest disturbance often results in changes in soil properties and microbial communities. In the present study, we characterized a soil bacterial community subjected to disturbance using 16S rRNA gene clone libraries. The community was from a disturbed broad-leaved, low mountain forest ecosystem at Huoshaoliao (HSL) located in northern Taiwan. This locality receives more than 4,000 mm annual precipitation, one of the highest precipitations in Taiwan. Based on the Shannon diversity index, Chao1 estimator, richness and rarefaction curve analysis, the bacterial community in HSL forest soils was more diverse than those previously investigated in natural and disturbed forest soils with colder or less humid weather conditions. Analysis of molecular variance also revealed that the bacterial community in disturbed soils significantly differed from natural forest soils. Most of the abundant operational taxonomic units (OTUs) in the disturbed soil community at HSL were less abundant or absent in other soils. The disturbances influenced the composition of bacterial communities in natural and disturbed forests and increased the diversity of the disturbed forest soil community. Furthermore, the warmer and humid weather conditions could also increase community diversity in HSL soils.

Two decades of warming increases diversity of a potentially lignolytic bacterial community

PubMed Central

Pold, Grace; Melillo, Jerry M.; DeAngelis, Kristen M.

2015-01-01

As Earth's climate warms, the massive stores of carbon found in soil are predicted to become depleted, and leave behind a smaller carbon pool that is less accessible to microbes. At a long-term forest soil-warming experiment in central Massachusetts, soil respiration and bacterial diversity have increased, while fungal biomass and microbially-accessible soil carbon have decreased. Here, we evaluate how warming has affected the microbial community's capability to degrade chemically-complex soil carbon using lignin-amended BioSep beads. We profiled the bacterial and fungal communities using PCR-based methods and completed extracellular enzyme assays as a proxy for potential community function. We found that lignin-amended beads selected for a distinct community containing bacterial taxa closely related to known lignin degraders, as well as members of many genera not previously noted as capable of degrading lignin. Warming tended to drive bacterial community structure more strongly in the lignin beads, while the effect on the fungal community was limited to unamended beads. Of those bacterial operational taxonomic units (OTUs) enriched by the warming treatment, many were enriched uniquely on lignin-amended beads. These taxa may be contributing to enhanced soil respiration under warming despite reduced readily available C availability. In aggregate, these results suggest that there is genetic potential for chemically complex soil carbon degradation that may lead to extended elevated soil respiration with long-term warming. PMID:26042112

The effects of the time of intranasal splinting on bacterial colonization, postoperative complications, and patient discomfort after septoplasty operations.

PubMed

Karatas, Abdullah; Pehlivanoglu, Filiz; Salviz, Mehti; Kuvat, Nuray; Cebi, Isil Taylan; Dikmen, Burak; Sengoz, Gonul

The main reason for nasal tampon placement after septoplasty is to prevent postoperative hemorrhage, while the secondary purpose is internal stabilization after operations involving the cartilaginous-bony skeleton of the nose. Silicone intranasal splints are as successful as other materials in controlling postoperative hemorrhages of septal origin. The possibility of leaving the splints intranasally for extended periods helps stabilize the septum in the midline. However, there is nothing in the literature about how long these splints can be retained inside the nasal cavity without increasing the risk of infection, postoperative complications, and patient discomfort. The current study aimed to evaluate the association between the duration of intranasal splinting and bacterial colonization, postoperative complications, and patient discomfort. Patients who had undergone septoplasty were divided into three groups according to the day of removal of the silicone splints. The splints were removed on the fifth, seventh, and tenth postoperative days. The removed splints were microbiologically cultured. Early and late complications were assessed, including local and systemic infections, tissue necrosis, granuloma formation, mucosal crusting, synechia, and septal perforation. Postoperative patient discomfort was evaluated by scoring the levels of pain and nasal obstruction. No significant difference was found in the rate of bacterial colonization among the different groups. Decreased mucosal crusting and synechia were detected with longer usage intervals of intranasal silicone splints. Postoperative pain and nasal obstruction were also diminished by the third postoperative day. Silicone splints were well tolerated by the patients and any negative effects on postoperative patient comfort were limited. In fact, prolonged splint usage intervals reduced late complications. Long-term silicone nasal splint usage is a reliable, effective, and comfortable method in patients with

Reducing bacterial contamination in an Orthopedic Theatre ventilated by natural ventilation, in a Developing Country.

PubMed

Thomas, Stephanie; Palmer, Rish; Phillipo, Edward; Chipungu, Geoffrey

2016-05-31

All surgical procedures have the potential for infection and some of the main sources are contamination from airborne particles, theatre personnel and the theatre environment.  There is strong evidence that the use of ultra-clean air flow systems in orthopedic operating theatres reduces the incidence of deep sepsis after surgery. In the developing world however, this is often an unrealistic solution. The aim of this study was to establish baseline levels of contamination in a working orthopedic theatre, at the Queen Elizabeth Central Hospital, Blantyre, Malawi. To feedback results to the theatre team, promote infection prevention discussion and work with the team to implement workable and realistic goals to improve the intra-operative environment. Samples were collected from theatre equipment available at the time of surgery, from theatre water and theatre air using passive air sampling techniques. Samples were immediately transferred to the Central Microbiology Laboratory for culture on basic culture media. Bacterial contamination of theatre equipment, intra-operative theatre air and water was detected. Results were discussed with the theatre and infection prevention team who were receptive to feedback with regards to infection prevention strategies and keen to develop simple measures which could be put in place to change practice. In this setting, we suggest that implementing workable and realistic goals such as, establishing baseline rates of bacterial contamination and introduction of strict protocols for asepsis and theatre etiquette, may reduce bacterial contamination rates and subsequent intra-operative infection in the absence of expensive engineering solutions.

Polarimetry of optically selected BL Lacertae candidates from the SDSS

NASA Astrophysics Data System (ADS)

Heidt, J.; Nilsson, K.

2011-05-01

We present and discuss polarimetric observations of 182 targets drawn from an optically selected sample of 240 probable BL Lac candidates out of the SDSS compiled by Collinge et al. (2005, AJ, 129, 2542). In contrast to most other BL Lac candidate samples extracted from the SDSS, its radio- and/or X-ray properties have not been taken into account for its derivation. Thus, because its selection is based on optical properties alone, it may be less prone to selection effects inherent in other samples derived at different frequencies, so it offers a unique opportunity to extract the first unbiased BL Lac luminosity function that is suitably large in size. We found 124 out of 182 targets (68%) to be polarized, 95 of the polarized targets (77%) to be highly polarized (>4%). The low-frequency peaked BL Lac candidates in the sample are on average only slightly more polarized than the high-frequency peaked ones. Compared to earlier studies, we found a high duty cycle in high polarization (˜ 66+2-14% to be >4% polarized) in high-frequency peaked BL Lac candidates. This may come from our polarization analysis, which minimizes the contamination by host galaxy light. No evidence of radio-quiet BL Lac objects in the sample was found. Our observations show that the probable sample of BL Lac candidates of Collinge et al. (2005) indeed contains a large number of bona fide BL Lac objects. High S/N spectroscopy and deep X-ray observations are required to construct the first luminosity function of optically selected BL Lac objects and to test more stringently for any radio-quiet BL Lac objects in the sample. Based on observations collected with the NTT on La Silla (Chile) operated by the European Southern Observatory in the course of the observing proposal 082.B-0133.Based on observations collected at the Centro Astronómico Hispano Alemán (CAHA), operated jointly by the Max-Planck-Institut für Astronomie and the Instituto de Astrofisica de Andalucia (CSIC).Based on observations

Comparative study of oncologic outcomes for laparoscopic vs. open surgery in transverse colon cancer

PubMed Central

Kim, Woo Ram; Baek, Se Jin; Kim, Chang Woo; Jang, Hyun A; Cho, Min Soo; Bae, Sung Uk; Hur, Hyuk; Min, Byung Soh; Lee, Kang Young; Kim, Nam Kyu; Sohn, Seung Kuk

2014-01-01

Purpose Laparoscopic resection for transverse colon cancer is a technically challenging procedure that has been excluded from various large randomized controlled trials of which the long-term outcomes still need to be verified. The purpose of this study was to evaluate long-term oncologic outcomes for transverse colon cancer patients undergoing laparoscopic colectomy (LAC) or open colectomy (OC). Methods This retrospective review included patients with transverse colon cancer who received a colectomy between January 2006 and December 2010. Short-term and five-year oncologic outcomes were compared between these groups. Results A total of 131 patients were analyzed in the final study (LAC, 84 patients; OC, 47 patients). There were no significant differences in age, gender, body mass index, tumor location, operative procedure, or blood loss between groups, but the mean operative time in LAC was significantly longer (LAC, 246.8 minutes vs. OC, 213.8 minutes; P = 0.03). Hospital stay was much shorter for LAC than OC (9.1 days vs. 14.5 days, P < 0.01). Postoperative complication rates were not statistically different between the two groups. In terms of long-term oncologic data, the 5-year disease-free survival and overall survival were not statistically different between both groups, and subgroup analysis according to cancer stage also revealed no differences. Conclusion LAC for transverse colon cancer is feasible and safe with comparable short- and long-term outcomes. PMID:24761404

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iyer, Sukanya; Karig, David K; Norred, Sarah E

Engineered gene circuits offer an opportunity to harness biological systems for biotechnological and biomedical applications. However, reliance on host E. coli promoters for the construction of circuit elements, such as logic gates, makes implementation of predictable, independently functioning circuits difficult. In contrast, T7 promoters offer a simple orthogonal expression system for use in a variety of cellular backgrounds and even in cell free systems. Here we develop a T7 promoter system that can be regulated by two different transcriptional repressors for the construction of a logic gate that functions in cells and in cell free systems. We first present LacImore » repressible T7lacO promoters that are regulated from a distal lac operator site for repression. We next explore the positioning of a tet operator site within the T7lacO framework to create T7 promoters that respond to tet and lac repressors and realize an IMPLIES gate. Finally, we demonstrate that these dual input sensitive promoters function in a commercially available E. coli cell-free protein expression system. Together, our results contribute to the first demonstration of multi-input regulation of T7 promoters and expand the utility of T7 promoters in cell based as well as cell-free gene circuits.« less

Epidemiology of bacterial hand infections.

PubMed

Houshian, Shirzad; Seyedipour, Sedigheh; Wedderkopp, Niels

2006-07-01

The aim of the study was to delineate and update the bacteriological spectrum, characterize patterns and sites of injury, evaluate laboratory tests and possible causes of complications in patients with bacterial hand infections. All hand infections operated on in the department of orthopedics at Odense University Hospital during the period 1992-2001 were reviewed retrospectively. A standard protocol was used to collect data for each patient. We also examined all laboratory reports and recorded the identity of the etiologic organism, if known, for all cases of bacterial hand infections. Four hundred and eighteen patients (296 men and 122 women) with hand infections were operated on between 1992 and 2001 in our department. The median age of the patients was 40 years (range 1-93). The average interval from primary injury to operation was 10 days (range 1-50). The etiology was laceration/puncture in 35%. The site of infection was subcutaneous in 45% followed by tendon, joint and bone in 27, 18 and 5%, respectively. The bacteria isolated from the patients showed that 184 cultures (44%) were pure Staphylococcus aureus followed by 49 cultures (11.7%) of mixed organisms. Body temperature and C-reactive protein (CRP) were normal in three quarters of all patients with hand infections in our series. However the erythrocyte sedimentation rate (ESR) was elevated in 50% of the patients and was a significantly better test for infection in this study than CRP (p = 0.002). Neither the severity of infection nor the etiology of infection was related in any way to the initial temperature, CRP or ESR in this study. Complications were noted in 14.8% of all patients, and were especially related to diabetes, and mixed infection. Despite modern antibiotics, hand infections with a variety of organisms continue to be a source of morbidity and possible long-term disability. Most hand infections are the result of minor wounds that have been neglected. A complete history and physical

Panamanian frog species host unique skin bacterial communities

PubMed Central

Belden, Lisa K.; Hughey, Myra C.; Rebollar, Eria A.; Umile, Thomas P.; Loftus, Stephen C.; Burzynski, Elizabeth A.; Minbiole, Kevin P. C.; House, Leanna L.; Jensen, Roderick V.; Becker, Matthew H.; Walke, Jenifer B.; Medina, Daniel; Ibáñez, Roberto; Harris, Reid N.

2015-01-01

Vertebrates, including amphibians, host diverse symbiotic microbes that contribute to host disease resistance. Globally, and especially in montane tropical systems, many amphibian species are threatened by a chytrid fungus, Batrachochytrium dendrobatidis (Bd), that causes a lethal skin disease. Bd therefore may be a strong selective agent on the diversity and function of the microbial communities inhabiting amphibian skin. In Panamá, amphibian population declines and the spread of Bd have been tracked. In 2012, we completed a field survey in Panamá to examine frog skin microbiota in the context of Bd infection. We focused on three frog species and collected two skin swabs per frog from a total of 136 frogs across four sites that varied from west to east in the time since Bd arrival. One swab was used to assess bacterial community structure using 16S rRNA amplicon sequencing and to determine Bd infection status, and one was used to assess metabolite diversity, as the bacterial production of anti-fungal metabolites is an important disease resistance function. The skin microbiota of the three Panamanian frog species differed in OTU (operational taxonomic unit, ~bacterial species) community composition and metabolite profiles, although the pattern was less strong for the metabolites. Comparisons between frog skin bacterial communities from Panamá and the US suggest broad similarities at the phylum level, but key differences at lower taxonomic levels. In our field survey in Panamá, across all four sites, only 35 individuals (~26%) were Bd infected. There was no clustering of OTUs or metabolite profiles based on Bd infection status and no clear pattern of west-east changes in OTUs or metabolite profiles across the four sites. Overall, our field survey data suggest that different bacterial communities might be producing broadly similar sets of metabolites across frog hosts and sites. Community structure and function may not be as tightly coupled in these skin symbiont

VERITAS Detection of γ-Ray Flaring Activity From the BL Lac Object 1ES 1727+502 During Bright Moonlight Observations

NASA Astrophysics Data System (ADS)

Archambault, S.; Archer, A.; Beilicke, M.; Benbow, W.; Bird, R.; Biteau, J.; Bouvier, A.; Bugaev, V.; Cardenzana, J. V.; Cerruti, M.; Chen, X.; Ciupik, L.; Connolly, M. P.; Cui, W.; Dickinson, H. J.; Dumm, J.; Eisch, J. D.; Errando, M.; Falcone, A.; Feng, Q.; Finley, J. P.; Fleischhack, H.; Fortin, P.; Fortson, L.; Furniss, A.; Gillanders, G. H.; Griffin, S.; Griffiths, S. T.; Grube, J.; Gyuk, G.; Håkansson, N.; Hanna, D.; Holder, J.; Humensky, T. B.; Johnson, C. A.; Kaaret, P.; Kar, P.; Kertzman, M.; Khassen, Y.; Kieda, D.; Krause, M.; Krennrich, F.; Kumar, S.; Lang, M. J.; Maier, G.; McArthur, S.; McCann, A.; Meagher, K.; Millis, J.; Moriarty, P.; Mukherjee, R.; Nieto, D.; O'Faoláin de Bhróithe, A.; Ong, R. A.; Otte, A. N.; Park, N.; Pohl, M.; Popkow, A.; Prokoph, H.; Pueschel, E.; Quinn, J.; Ragan, K.; Reyes, L. C.; Reynolds, P. T.; Richards, G. T.; Roache, E.; Santander, M.; Sembroski, G. H.; Shahinyan, K.; Smith, A. W.; Staszak, D.; Telezhinsky, I.; Tucci, J. V.; Tyler, J.; Varlotta, A.; Vincent, S.; Wakely, S. P.; Weinstein, A.; Welsing, R.; Wilhelm, A.; Williams, D. A.; Zitzer, B.; Veritas Collaboration; Hughes, Z. D.

2015-08-01

During moonlit nights, observations with ground-based Cherenkov telescopes at very high energies (VHEs, E\\gt 100 GeV) are constrained since the photomultiplier tubes (PMTs) in the telescope camera are extremely sensitive to the background moonlight. Observations with the VERITAS telescopes in the standard configuration are performed only with a moon illumination less than 35% of full moon. Since 2012, the VERITAS collaboration has implemented a new observing mode under bright moonlight, by either reducing the voltage applied to the PMTs (reduced-high-voltage; RHV configuration), or by utilizing UV-transparent filters. While these operating modes result in lower sensitivity and increased energy thresholds, the extension of the available observing time is useful for monitoring variable sources such as blazars and sources requiring spectral measurements at the highest energies. In this paper we report the detection of γ-ray flaring activity from the BL Lac object 1ES 1727+502 during RHV observations. This detection represents the first evidence of VHE variability from this blazar. The integral flux is (1.1+/- 0.2)× {10}-11 {{cm}}-2 {{{s}}}-1 above 250 GeV, which is about five times higher than the low-flux state. The detection triggered additional VERITAS observations during standard dark-time. Multiwavelength observations with the FLWO 48″ telescope, and the Swift and Fermi satellites are presented and used to produce the first spectral energy distribution (SED) of this object during γ-ray flaring activity. The SED is then fitted with a standard synchrotron-self-Compton model, placing constraints on the properties of the emitting region and of the acceleration mechanism at the origin of the relativistic particle population in the jet.

Regulation and Adaptive Evolution of Lactose Operon Expression in Lactobacillus delbrueckii

PubMed Central

Lapierre, Luciane; Mollet, Beat; Germond, Jacques-Edouard

2002-01-01

Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis are both used in the dairy industry as homofermentative lactic acid bacteria in the production of fermented milk products. After selective pressure for the fast fermentation of milk in the manufacture of yogurts, L. delbrueckii subsp. bulgaricus loses its ability to regulate lac operon expression. A series of mutations led to the constitutive expression of the lac genes. A complex of insertion sequence (IS) elements (ISL4 inside ISL5), inserted at the border of the lac promoter, induced the loss of the palindromic structure of one of the operators likely involved in the binding of regulatory factors. A lac repressor gene was discovered downstream of the β-galactosidase gene of L. delbrueckii subsp. lactis and was shown to be inactivated by several mutations in L. delbrueckii subsp. bulgaricus. Regulatory mechanisms of the lac gene expression of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis were compared by heterologous expression in Lactococcus lactis of the two lac promoters in front of a reporter gene (β-glucuronidase) in the presence or absence of the lac repressor gene. Insertion of the complex of IS elements in the lac promoter of L. delbrueckii subsp. bulgaricus increased the promoter's activity but did not prevent repressor binding; rather, it increased the affinity of the repressor for the promoter. Inactivation of the lac repressor by mutations was then necessary to induce the constitutive expression of the lac genes in L. delbrueckii subsp. bulgaricus. PMID:11807052

Bacterial Cellulose (BC) as a Functional Nanocomposite Biomaterial

NASA Astrophysics Data System (ADS)

Nandgaonkar, Avinav Ghanashyam

compressive tests. In our second study, we developed a one-pot in-situ biosynthetic method to fabricate structurally controllable bacterial cellulose (BC)/reduced graphene oxide (RGO) composites. The graphene oxide (GO) was highly reduced during a standard autoclave process using a traditional mannitol culture medium as the reducing agent. The electrical conductivity of the RGO was found to be 23.75 S m-1. The final BC/RGO composites were developed in three distinct forms: 1) sealed structures in the water, 2) aerogels characterized by a porous cross section and aligned longitudinal structure, and 3) films embedded within the RGO sheets. Because of the simplicity and non-toxic nature of this work, it can be used in biomedical and bioelectronics applications. The last study was on dye degradation using BC as the substrate. The surface of the BC was chemically oxidized to produce aldehyde groups to successfully covalently crosslink laccase. TiO2 and laccase (Lac) were co-immobilized on the surface of OBC and the dye degradation process was carried out under specific conditions. Compared with free laccase, the optimum pH of the immobilized laccase system shifted to lower pH, while the optimum temperature decreased from 55 °C to 50 °C. The dye degradation experiments showed that the optimum pH for dye degradation was pH 5.0-6.0, while the optimum temperature was ca. 40 ºC. Under UV illumination, the dye degradation efficiency significantly improved characteristic of a synergy in the system. This dissertation contributes to the basic research of bacterial cellulose which will result in novel ideas that can possibly result in future industrial applications. The research provides a fundamental underpinning of specialized structure-property relationships between BC and the materials used to fabricate the BC nanocomposites that have value-added applications that are environmentally safe and eco-friendly.

The Escherichia coli regulator of sigma 70 protein, Rsd, can up-regulate some stress-dependent promoters by sequestering sigma 70.

PubMed

Mitchell, Jennie E; Oshima, Taku; Piper, Sarah E; Webster, Christine L; Westblade, Lars F; Karimova, Gouzel; Ladant, Daniel; Kolb, Annie; Hobman, Jon L; Busby, Stephen J W; Lee, David J

2007-05-01

The Escherichia coli Rsd protein forms complexes with the RNA polymerase sigma(70) factor, but its biological role is not understood. Transcriptome analysis shows that overexpression of Rsd causes increased expression from some promoters whose expression depends on the alternative sigma(38) factor, and this was confirmed by experiments with lac fusions at selected promoters. The LP18 substitution in Rsd increases the Rsd-dependent stimulation of these promoter-lac fusions. Analysis with a bacterial two-hybrid system shows that the LP18 substitution in Rsd increases its interaction with sigma(70). Our experiments support a model in which the role of Rsd is primarily to sequester sigma(70), thereby increasing the levels of RNA polymerase containing the alternative sigma(38) factor.

The Escherichia coli Regulator of Sigma 70 Protein, Rsd, Can Up-Regulate Some Stress-Dependent Promoters by Sequestering Sigma 70▿

PubMed Central

Mitchell, Jennie E.; Oshima, Taku; Piper, Sarah E.; Webster, Christine L.; Westblade, Lars F.; Karimova, Gouzel; Ladant, Daniel; Kolb, Annie; Hobman, Jon L.; Busby, Stephen J. W.; Lee, David J.

2007-01-01

The Escherichia coli Rsd protein forms complexes with the RNA polymerase σ70 factor, but its biological role is not understood. Transcriptome analysis shows that overexpression of Rsd causes increased expression from some promoters whose expression depends on the alternative σ38 factor, and this was confirmed by experiments with lac fusions at selected promoters. The LP18 substitution in Rsd increases the Rsd-dependent stimulation of these promoter-lac fusions. Analysis with a bacterial two-hybrid system shows that the LP18 substitution in Rsd increases its interaction with σ70. Our experiments support a model in which the role of Rsd is primarily to sequester σ70, thereby increasing the levels of RNA polymerase containing the alternative σ38 factor. PMID:17351046

Louisiana SIP: LAC 33:III Ch 2132. Stage II Vapor Recovery Systems for Control of Vehicle Refuelling Emissions at Gasoline Dispensing Facilities; SIP effective 2011-08-04 (LAd34) and 2016-02-29 (LAd47) to 2017-09-27

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch 2132. Stage II Vapor Recovery Systems for Control of Vehicle Refuelling Emissions at Gasoline Dispensing Facilities; SIP effective 2011-08-04 (LAd34) and 2016-02-29 (LAd47) to 2017-09-27

Bacterial avirulence genes.

PubMed

Leach, J E; White, F F

1996-01-01

Although more than 30 bacterial avirulence genes have been cloned and characterized, the function of the gene products in the elictitation of resistance is unknown in all cases but one. The product of avrD from Pseudomonas syringae pv. glycinea likely functions indirectly to elicit resistance in soybean, that is, evidence suggests the gene product is an enzyme involved in elicitor production. In most if not all cases, bacterial avirulence gene function is dependent on interactions with the hypersensitive response and pathogenicity (hrp) genes. Many hrp genes are similar to genes involved in delivery of pathogenicity factors in mammalian bacterial pathogens. Thus, analogies between mammalian and plant pathogens may provide needed clues to elucidate how virulence gene products control induction of resistance.

Tracking the Remodeling of SNOMED CT's Bacterial Infectious Diseases.

PubMed

Ochs, Christopher; Case, James T; Perl, Yehoshua

2016-01-01

SNOMED CT's content undergoes many changes from one release to the next. Over the last year SNOMED CT's Bacterial infectious disease subhierarchy has undergone significant editing to bring consistent modeling to its concepts. In this paper we analyze the stated and inferred structural modifications that affected the Bacterial infectious disease subhierarchy between the Jan 2015 and Jan 2016 SNOMED CT releases using a two-phased approach. First, we introduce a methodology for creating a human readable list of changes. Next, we utilize partial-area taxonomies, which are compact summaries of SNOMED CT's content and structure, to identify the "big picture" changes that occurred in the subhierarchy. We illustrate how partial-area taxonomies can be used to help identify groups of concepts that were affected by these editing operations and the nature of these changes. Modeling issues identified using our two-phase methodology are discussed.

Substorm wave base felsic hydroclastic deposits in the Archean Lac des Vents volcanic complex, Abitibi belt, Canada

NASA Astrophysics Data System (ADS)

Mueller, Wulf; Chown, E. H.; Potvin, Robin

1994-05-01

Volcaniclastic deposits of the 2.3-km-thick Archean Lac des Vents volcanic complex are an integral part of major submarine volcanic construction. The volcanic edifice, which formed on a subaqueous basalt plain, is comparable to modern seamounts resting on the ocean floor. The initial 770 m of the mafic-felsic edifice, subject of this study, is composed of massive, brecciated and pillowed basalts, massive to brecciated felsic lava flows and abundant felsic fragmental rocks of hydroclastic origin. Four distinct volcaniclastic lithofacies constitute the latter: (1) the pumice lapilli-tuff lithofacies; (2) the lapilli-tuff breccia lithofacies characterized by two sublithofacies; (3) the turbidite tuff and tuff-breccia lithofacies; and (4) the volcanic sandstone and breccia lithofacies. These four volcaniclastic lithofacies are considered to be the result of explosive and non-explosive hydrovolcanic fragmentation processes operating at depths below storm wave base (> 200 m). Primary deposition or limited remobilization of unconsolidated hydroclastic debris is shown by the preservation of delicate clasts and volcanic textures, and heat retention structures. The principal transport agents are high-concentration sediment gravity flows occurring under laminar and turbulent flow conditions. High- and low-density turbiditic tuffs and fine-grained tuff fallout deposits, are related to either the dissipating stages of volcanic eruptions or slumping of syneruptive volcanic debris on the flanks of a subaqueous volcanic edifice. Ubiquitous interstratification of volcaniclastic turbidites, shale, and pillowed basalt flows with the felsic lava flows and fragmental debris favours subaqueous deposition. These features combined with the absence of wave-induced sedimentary structures, imply deposition in water depths in excess of 200 m. Viscous feldspar-phyric massive and brecciated felsic flows, and associated volcaniclastics cross cut by felsic dykes, suggest vent proximity. The

Bacterial pneumonia as an influenza complication.

PubMed

Martin-Loeches, Ignacio; van Someren Gréve, Frank; Schultz, Marcus J

2017-04-01

The pathogenesis and impact of coinfection, in particular bacterial coinfection, in influenza are incompletely understood. This review summarizes results from studies on bacterial coinfection in the recent pandemic influenza outbreak. Systemic immune mechanisms play a key role in the development of coinfection based on the complexity of the interaction of the host and the viral and bacterial pathogens. Several studies were performed to determine the point prevalence of bacterial coinfection in influenza. Coinfection in influenza is frequent in critically ill patients with Streptococcus pneumoniae being the most frequent bacterial pathogen and higher rates of potentially resistant pathogens over the years. Bacterial pneumonia is certainly an influenza complication. The recent epidemiology findings have helped to partially resolve the contribution of different pathogens. Immunosuppression is a risk factor for bacterial coinfection in influenza, and the epidemiology of coinfection has changed over the years during the last influenza pandemic, and these recent findings should be taken into account during present outbreaks.

Zoonotic bacterial meningitis in human adults.

PubMed

van Samkar, Anusha; Brouwer, Matthijs C; van der Ende, Arie; van de Beek, Diederik

2016-09-13

To describe the epidemiology, etiology, clinical characteristics, treatment, outcome, and prevention of zoonotic bacterial meningitis in human adults. We identified 16 zoonotic bacteria causing meningitis in adults. Zoonotic bacterial meningitis is uncommon compared to bacterial meningitis caused by human pathogens, and the incidence has a strong regional distribution. Zoonotic bacterial meningitis is mainly associated with animal contact, consumption of animal products, and an immunocompromised state of the patient. In a high proportion of zoonotic bacterial meningitis cases, CSF analysis showed only a mildly elevated leukocyte count. The recommended antibiotic therapy differs per pathogen, and the overall mortality is low. Zoonotic bacterial meningitis is uncommon but is associated with specific complications. The suspicion should be raised in patients with bacterial meningitis who have recreational or professional contact with animals and in patients living in regions endemic for specific zoonotic pathogens. An immunocompromised state is associated with a worse prognosis. Identification of risk factors and underlying disease is necessary to improve treatment. © 2016 American Academy of Neurology.

Community-acquired bacterial meningitis.

PubMed

Costerus, Joost M; Brouwer, Matthijs C; Bijlsma, Merijn W; van de Beek, Diederik

2017-02-01

Bacterial meningitis is a medical emergency and is associated with a high disease burden. We reviewed recent progress in the management of patients with community-acquired bacterial meningitis. The worldwide burden of disease of bacterial meningitis remains high, despite the decreasing incidence following introduction of routine vaccination campaigns. Delay in diagnosis and treatment remain major concerns in the management of acute bacterial meningitis. European Society of Clinical Microbiology and Infectious Diseases guidelines strive for a door-to-antibiotic-time less than 1 h. Polymerase chain reaction (PCR) has emerged as an important diagnostic tool to identify the causative organism. Point-of-care tests using fast multiplex PCR have been developed, but additional value has not been proven. Although anecdotal observations advocate pressure-based management, a randomized controlled trial will need to be performed first to determine efficacy and safety of such an aggressive treatment approach. Adjunctive dexamethasone remains the only adjunctive therapy with proven efficacy. The incidence of bacterial meningitis has been decreasing after the implementation of effective vaccines. Treatment should be administered as soon as possible and time to treatment should not exceed 1 h.

VERITAS OBSERVATIONS OF THE BL LAC OBJECT PG 1553+113

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aliu, E.; Archer, A.; Beilicke, M.

2015-01-20

We present results from VERITAS observations of the BL Lac object PG 1553+113 spanning the years 2010, 2011, and 2012. The time-averaged spectrum, measured between 160 and 560 GeV, is well described by a power law with a spectral index of 4.33 ± 0.09. The time-averaged integral flux above 200 GeV measured for this period was (1.69 ± 0.06) × 10{sup –11} photons cm{sup –2} s{sup –1}, corresponding to 6.9% of the Crab Nebula flux. We also present the combined γ-ray spectrum from the Fermi Large Area Telescope and VERITAS covering an energy range from 100 MeV to 560 GeV.more » The data are well fit by a power law with an exponential cutoff at 101.9 ± 3.2 GeV. The origin of the cutoff could be intrinsic to PG 1553+113 or be due to the γ-ray opacity of our universe through pair production off the extragalactic background light (EBL). Given lower limits to the redshift of z > 0.395 based on optical/UV observations of PG 1553+113, the cutoff would be dominated by EBL absorption. Conversely, the small statistical uncertainties of the VERITAS energy spectrum have allowed us to provide a robust upper limit on the redshift of PG 1553+113 of z ≤ 0.62. A strongly elevated mean flux of (2.50 ± 0.14) × 10{sup –11} photons cm{sup –2} s{sup –1} (10.3% of the Crab Nebula flux) was observed during 2012, with the daily flux reaching as high as (4.44±0.71)×10{sup −11} photons cm{sup −2} s{sup −1} (18.3% of the Crab Nebula flux) on MJD 56048. The light curve measured during the 2012 observing season is marginally inconsistent with a steady flux, giving a χ{sup 2} probability for a steady flux of 0.03%.« less

[Spontaneous bacterial peritonitis].

PubMed

Velkey, Bálint; Vitális, Eszter; Vitális, Zsuzsanna

2017-01-01

Spontaneous bacterial peritonitis occurs most commonly in cirrhotic patients with ascites. Pathogens get into the circulation by intestinal translocation and colonize in peritoneal fluid. Diagnosis of spontaneous bacterial peritonitis is based on elevated polymorphonuclear leukocyte count in the ascites (>0,25 G/L). Ascites culture is often negative but aids to get information about antibiotic sensitivity in positive cases. Treatment in stable patient can be intravenous then orally administrated ciprofloxacin or amoxicillin/clavulanic acid, while in severe cases intravenous III. generation cephalosporin. Nosocomial spontaneous bacterial peritonitis often caused by Gram-positive bacteria and multi-resistant pathogens can also be expected thus carbapenem should be the choice of the empiric treatment. Antibiotic prophylaxis should be considered. Norfloxacin is used most commonly, but changes are expected due to increase in quinolone resistance. As a primary prophylaxis, a short-term antibiotic treatment is recommended after gastrointestinal bleeding for 5 days, while long-term prophylaxis is for patients with low ascites protein, and advanced disease (400 mg/day). Secondary prophylaxis is recommended for all patients recovered from spontaneous bacterial peritonitis. Due to increasing antibiotic use of antibiotics prophylaxis is debated to some degree. Orv. Hetil., 2017, 158(2), 50-57.

Spatial scales of bacterial community diversity at cold seeps (Eastern Mediterranean Sea)

PubMed Central

Pop Ristova, Petra; Wenzhöfer, Frank; Ramette, Alban; Felden, Janine; Boetius, Antje

2015-01-01

Cold seeps are highly productive, fragmented marine ecosystems that form at the seafloor around hydrocarbon emission pathways. The products of microbial utilization of methane and other hydrocarbons fuel rich chemosynthetic communities at these sites, with much higher respiration rates compared with the surrounding deep-sea floor. Yet little is known as to the richness, composition and spatial scaling of bacterial communities of cold seeps compared with non-seep communities. Here we assessed the bacterial diversity across nine different cold seeps in the Eastern Mediterranean deep-sea and surrounding seafloor areas. Community similarity analyses were carried out based on automated ribosomal intergenic spacer analysis (ARISA) fingerprinting and high-throughput 454 tag sequencing and were combined with in situ and ex situ geochemical analyses across spatial scales of a few tens of meters to hundreds of kilometers. Seep communities were dominated by Deltaproteobacteria, Epsilonproteobacteria and Gammaproteobacteria and shared, on average, 36% of bacterial types (ARISA OTUs (operational taxonomic units)) with communities from nearby non-seep deep-sea sediments. Bacterial communities of seeps were significantly different from those of non-seep sediments. Within cold seep regions on spatial scales of only tens to hundreds of meters, the bacterial communities differed considerably, sharing <50% of types at the ARISA OTU level. Their variations reflected differences in porewater sulfide concentrations from anaerobic degradation of hydrocarbons. This study shows that cold seep ecosystems contribute substantially to the microbial diversity of the deep-sea. PMID:25500510

Bacterial community in ancient permafrost alluvium at the Mammoth Mountain (Eastern Siberia).

PubMed

Brouchkov, Anatoli; Kabilov, Marsel; Filippova, Svetlana; Baturina, Olga; Rogov, Victor; Galchenko, Valery; Mulyukin, Andrey; Fursova, Oksana; Pogorelko, Gennady

2017-12-15

Permanently frozen (approx. 3.5Ma) alluvial Neogene sediments exposed in the Aldan river valley at the Mammoth Mountain (Eastern Siberia) are unique, ancient, and poorly studied permafrost environments. So far, the structure of the indigenous bacterial community has remained unknown. Use of 16S metagenomic analysis with total DNA isolation using DNA Spin Kit for Soil (MO-Bio) and QIAamp DNA Stool Mini Kit (Qiagen) has revealed the major and minor bacterial lineages in the permafrost alluvium sediments. In sum, 61 Operational Taxonomic Units (OTUs) with 31,239 reads (Qiagen kit) and 15,404 reads (Mo-Bio kit) could be assigned to the known taxa. Only three phyla, Bacteroidetes, Proteobacteria and Firmicutes, comprised >5% of the OTUs abundance and accounted for 99% of the total reads. OTUs pertaining to the top families (Chitinophagaceae, Caulobacteraceae, Sphingomonadaceae, Bradyrhizobiaceae, Halomonadaceae) held >90% of reads. The abundance of Actinobacteria was less (0.7%), whereas members of other phyla (Deinococcus-Thermus, Cyanobacteria/Chloroplast, Fusobacteria, and Acidobacteria) constituted a minor fraction of reads. The bacterial community in the studied ancient alluvium differs from other permafrost sediments, mainly by predominance of Bacteroidetes (>52%). The diversity of this preserved bacterial community has the potential to cause effects unknown if prompted to thaw and spread with changing climate. Therefore, this study elicits further reason to study how reintroduction of these ancient bacteria could affect the surrounding ecosystem, including current bacterial species. Copyright © 2017 Elsevier B.V. All rights reserved.

Organic carbon and nitrogen availability determine bacterial community composition in paddy fields of the Indo-Gangetic plain.

PubMed

Kumar, Arvind; Rai, Lal Chand

2017-07-01

Soil quality is an important factor and maintained by inhabited microorganisms. Soil physicochemical characteristics determine indigenous microbial population and rice provides food security to major population of the world. Therefore, this study aimed to assess the impact of physicochemical variables on bacterial community composition and diversity in conventional paddy fields which could reflect a real picture of the bacterial communities operating in the paddy agro-ecosystem. To fulfill the objective; soil physicochemical characterization, bacterial community composition and diversity analysis was carried out using culture-independent PCR-DGGE method from twenty soils distributed across eight districts. Bacterial communities were grouped into three clusters based on UPGMA cluster analysis of DGGE banding pattern. The linkage of measured physicochemical variables with bacterial community composition was analyzed by canonical correspondence analysis (CCA). CCA ordination biplot results were similar to UPGMA cluster analysis. High levels of species-environment correlations (0.989 and 0.959) were observed and the largest proportion of species data variability was explained by total organic carbon (TOC), available nitrogen, total nitrogen and pH. Thus, results suggest that TOC and nitrogen are key regulators of bacterial community composition in the conventional paddy fields. Further, high diversity indices and evenness values demonstrated heterogeneity and co-abundance of the bacterial communities.

Diagnosis of bacterial vaginosis by wet mount identification of bacterial morphotypes in vaginal fluid.

PubMed

Schmidt, H; Hansen, J G

2000-03-01

In order to develop a more practical way of diagnosing bacterial vaginosis (BV), we evaluated a scoring system, weighting small bacterial morphotypes versus lactobacillary morphotypes in wet mounts, assessed criteria for BV and normalcy from this scoring, and then evaluated their reproducibility and accuracy. We examined 754 women for pH, homogeneous vaginal discharge, amine odour, clue cells and the composite clinical diagnosis. We also examined wet mounts for small bacterial morphotypes and lactobacillary morphotypes, and weighted their quantitative presence as a bacterial morphotype score. The term 'small bacterial morphotypes' denotes a group of small bacillary forms comprising coccobacilli, tiny rods, and mobile curved rods. The different characteristics of BV were all gradually associated with increased bacterial morphotype scoring. We deemed a score of 0-1 as normal, 2-4 as intermediate phase, grade I, 5-6 as intermediate phase, grade II, and 7-8 indicative of BV. Reproducibility of the interpretation was high, both for the new grading system (weighted Kappa 0.90 in women perceiving and 0.81 in women not perceiving abnormal vaginal discharge) and for the new criterion for BV (non-weighted Kappa 0.91 and 0.84 in the 2 groups of women). The new criterion also proved highly concurrent with the composite clinical diagnosis (Kappa 0.91 and 0.81 in the 2 groups). In conclusion, the wet mount bacterial morphotype scoring is valid for grading of the disorder of the vaginal microbial ecosystem, and the new criterion for BV a more practical option than existing diagnostic methods.

Insight into the effects of different cropping systems on soil bacterial community and tobacco bacterial wilt rate.

PubMed

Niu, Jiaojiao; Chao, Jin; Xiao, Yunhua; Chen, Wu; Zhang, Chao; Liu, Xueduan; Rang, Zhongwen; Yin, Huaqun; Dai, Linjian

2017-01-01

Rotation is an effective strategy to control crop disease and improve plant health. However, the effects of crop rotation on soil bacterial community composition and structure, and crop health remain unclear. In this study, using 16S rRNA gene sequencing, we explored the soil bacterial communities under four different cropping systems, continuous tobacco cropping (control group), tobacco-maize rotation, tobacco-lily rotation, and tobacco-turnip rotation. Results of detrended correspondence analysis and dissimilarity tests showed that soil bacterial community composition and structure changed significantly among the four groups, such that Acidobacteria and Actinobacteria were more abundant in the maize rotation group (16.6 and 11.5%, respectively) than in the control (8.5 and 7.1%, respectively). Compared with the control group (57.78%), maize and lily were effective rotation crops in controlling tobacco bacterial wilt (about 23.54 and 48.67%). On the other hand, tobacco bacterial wilt rate was increased in the turnip rotation (59.62%) relative to the control. Further study revealed that the abundances of several bacterial populations were directly correlated with tobacco bacterial wilt. For example, Acidobacteria and Actinobacteria were significantly negatively correlated to the tobacco bacterial wilt rate, so they may be probiotic bacteria. Canonical correspondence analysis showed that soil pH and calcium content were key factors in determining soil bacterial communities. In conclusion, our study revealed the composition and structure of bacterial communities under four different cropping systems and may unveil molecular mechanisms for the interactions between soil microorganisms and crop health. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Bifidobacteria isolated from infants and cultured on human milk oligosaccharides affect intestinal epithelial function

PubMed Central

Chichlowski, Maciej; De Lartigue, Guillaume; German, J. Bruce; Raybould, Helen E.; Mills, David A.

2012-01-01

Objectives Human milk oligosaccharides (HMO) are the third most abundant component of breast milk. Our laboratory has previously revealed gene clusters specifically linked to HMO metabolism in select bifidobacteria isolated from fecal samples of infants. Our objective was to test the hypothesis that growth of select bifidobacteria on HMO stimulates the intestinal epithelium. Methods Caco-2 and HT-29 cells were incubated with lactose (LAC) or HMO-grown Bifidobacterium longum subsp. infantis (B. infantis) or B. bifidum. Bacterial adhesion and translocation was measured by real-time quantitative PCR. Expression of pro- and anti-inflammatory cytokines and tight junction proteins was analyzed by real time reverse transcriptase. Distribution of tight junction proteins was measured using immunofluorescent microscopy. Results We showed that HMO-grown B. infantis had significantly higher rate of adhesion to HT-29 cells compared to B. bifidum. B. infantis also induced expression of a cell membrane glycoprotein, P-selectin glycoprotein ligand -1. Both B. infantis and B. bifidum grown on HMO caused less occludin relocalization and higher expression of anti-inflammatory cytokine, interleukin (IL)-10 compared to LAC-grown bacteria in Caco-2 cells. B. bifidum grown on HMO showed higher expression of junctional adhesion molecule and occludin in Caco-2 cell and HT-29 cells. There were no significant differences between LAC or HMO treatments in bacterial translocation. Conclusions This study provides evidence for the specific relationship between HMO-grown bifidobacteria and intestinal epithelial cells. To our knowledge, this is the first study describing HMO-induced changes in the bifidobacteria-intestinal cells interaction. PMID:22383026

Growth of Bacterial Colonies

NASA Astrophysics Data System (ADS)

Warren, Mya; Hwa, Terence

2013-03-01

On hard agar gel, there is insufficient surface hydration for bacteria to swim or swarm. Instead, growth occurs in colonies of close-packed cells, which expand purely due to repulsive interactions: individual bacteria push each other out of the way through the force of their growth. In this way, bacterial colonies represent a new type of ``active'' granular matter. In this study, we investigate the physical, biochemical, and genetic elements that determine the static and dynamic aspects of this mode of bacterial growth for E. coli. We characterize the process of colony expansion empirically, and use discrete and continuum models to examine the extent to which our observations can be explained by the growth characteristics of non-communicating cells, coupled together by physical forces, nutrients, and waste products. Our results challenge the commonly accepted modes of bacterial colony growth and provide insight into sources of growth limitation in crowded bacterial communities.

Periodic growth of bacterial colonies

NASA Astrophysics Data System (ADS)

Yamazaki, Yoshihiro; Ikeda, Takemasa; Shimada, Hirotoshi; Hiramatsu, Fumiko; Kobayashi, Naoki; Wakita, Jun-ichi; Itoh, Hiroto; Kurosu, Sayuri; Nakatsuchi, Michio; Matsuyama, Tohey; Matsushita, Mitsugu

2005-06-01

The formation of concentric ring colonies by bacterial species Bacillus subtilis and Proteus mirabilis has been investigated experimentally, focusing our attention on the dependence of local cell density upon the bacterial motility. It has been confirmed that these concentric ring colonies reflect the periodic change of the bacterial motility between motile cell state and immotile cell state. We conclude that this periodic change is macroscopically determined neither by biological factors (i.e., biological clock) nor by chemical factors (chemotaxis as inhibitor). And our experimental results strongly suggest that the essential factor for the change of the bacterial motility during concentric ring formation is the local cell density.

Nanoparticle Approaches against Bacterial Infections

PubMed Central

Gao, Weiwei; Thamphiwatana, Soracha; Angsantikul, Pavimol; Zhang, Liangfang

2014-01-01

Despite the wide success of antibiotics, the treatment of bacterial infection still faces significant challenges, particularly the emergence of antibiotic resistance. As a result, nanoparticle drug delivery platforms including liposomes, polymeric nanoparticles, dendrimers, and various inorganic nanoparticles have been increasingly exploited to enhance the therapeutic effectiveness of existing antibiotics. This review focuses on areas where nanoparticle approaches hold significant potential to advance the treatment of bacterial infection. These areas include targeted antibiotic delivery, environmentally responsive antibiotic delivery, combinatorial antibiotic delivery, nanoparticle-enabled antibacterial vaccination, and nanoparticle-based bacterial detection. In each area we highlight the innovative antimicrobial nanoparticle platforms and review their progress made against bacterial infections. PMID:25044325

Bacterial symbionts and natural products.

PubMed

Crawford, Jason M; Clardy, Jon

2011-07-21

The study of bacterial symbionts of eukaryotic hosts has become a powerful discovery engine for chemistry. This highlight looks at four case studies that exemplify the range of chemistry and biology involved in these symbioses: a bacterial symbiont of a fungus and a marine invertebrate that produce compounds with significant anticancer activity, and bacterial symbionts of insects and nematodes that produce compounds that regulate multilateral symbioses.

Louisiana SIP: LAC 33:III Ch. 14 Subchap B, 1431 to 1434--Conformity to State or Federal Implementation Plans of Transportation Plans, Programs, and Projects Developed, Funded, or Approved Under Title 23 U.S.C. or the Federal Transit Laws

EPA Pesticide Factsheets

Louisiana SIP: LAC 33:III Ch. 14 Subchap B, 1431 to 1434--Conformity to State or Federal Implementation Plans of Transportation Plans, Programs, and Projects Developed, Funded, or Approved Under Title 23 U.S.C. or the Federal Transit Laws

Postviral Complications: Bacterial Pneumonia.

PubMed

Prasso, Jason E; Deng, Jane C

2017-03-01

Secondary bacterial pneumonia after viral respiratory infection remains a significant source of morbidity and mortality. Susceptibility is mediated by a variety of viral and bacterial factors, and complex interactions with the host immune system. Prevention and treatment strategies are limited to influenza vaccination and antibiotics/antivirals respectively. Novel approaches to identifying the individuals with influenza who are at increased risk for secondary bacterial pneumonias are urgently needed. Given the threat of further pandemics and the heightened prevalence of these viruses, more research into the immunologic mechanisms of this disease is warranted with the hope of discovering new potential therapies. Published by Elsevier Inc.

Community-acquired bacterial meningitis.

PubMed

van de Beek, Diederik; Brouwer, Matthijs; Hasbun, Rodrigo; Koedel, Uwe; Whitney, Cynthia G; Wijdicks, Eelco

2016-11-03

Meningitis is an inflammation of the meninges and subarachnoid space that can also involve the brain cortex and parenchyma. It can be acquired spontaneously in the community - community-acquired bacterial meningitis - or in the hospital as a complication of invasive procedures or head trauma (nosocomial bacterial meningitis). Despite advances in treatment and vaccinations, community-acquired bacterial meningitis remains one of the most important infectious diseases worldwide. Streptococcus pneumoniae and Neisseria meningitidis are the most common causative bacteria and are associated with high mortality and morbidity; vaccines targeting these organisms, which have designs similar to the successful vaccine that targets Haemophilus influenzae type b meningitis, are now being used in many routine vaccination programmes. Experimental and genetic association studies have increased our knowledge about the pathogenesis of bacterial meningitis. Early antibiotic treatment improves the outcome, but the growing emergence of drug resistance as well as shifts in the distribution of serotypes and groups are fuelling further development of new vaccines and treatment strategies. Corticosteroids were found to be beneficial in high-income countries depending on the bacterial species. Further improvements in the outcome are likely to come from dampening the host inflammatory response and implementing preventive measures, especially the development of new vaccines.

[Aseptic non-touch technique in the operating room: keep it simple].

PubMed

Pans, Solange J A; Molmans, Eva; Marczinski, Susanne C; Bijker, Jilles B; Snijdelaar, Dik G

2015-01-01

The Dutch national patient safety platform developed a protocol for the preparation of intravenous medication; the Aseptic Non-Touch Technique (ANTT). Use of ANTT on nursing wards has shown to reduce contamination of intravenous medication. Therefore it is dictated by the Dutch Healthcare Inspectorate that this technique has to be used at all departments in the hospital, including the operating theatre. However, because of the use of air treatment and operating theatre uniforms, the operating theatre cannot be compared with a nursing ward. In this study, the bacterial contamination of syringes prepared in the operating theatre by anesthesia nurses was determined. Simulation study 45 anesthesia nurses prepared 1000 syringes of 10 ml bacterial culture medium, using their routine method of drawing up iv medication from vials. Turbidity in a syringe after culturing for 14 days at 30° C was used as evidence for bacterial contamination. Using questionnaires, nurses were interviewed in what degree their working method equals ANTT-protocol. We calculated how much extra time must be invested when using the strict ANTT-protocol in the operating theatre. Six syringes (0,6%) were contaminated. Normal dermal bacteria were identified in all syringes. The nurses who prepared the contaminated syringes worked similar manner as their colleagues. It takes an additional 54 minutes per day per operating theatre to work strictly using the ANTT technique. Contamination rates of aseptic preparations in the OR are very low, and are as low as ANTT preparations in a GMP-certified hospital pharmacy. Therefore it is legitimate to develop a modified ANTT-protocol for use in the operating theatre.

Maize Endophytic Bacterial Diversity as Affected by Soil Cultivation History.

PubMed

Correa-Galeote, David; Bedmar, Eulogio J; Arone, Gregorio J

2018-01-01

The bacterial endophytic communities residing within roots of maize ( Zea mays L.) plants cultivated by a sustainable management in soils from the Quechua maize belt (Peruvian Andes) were examined using tags pyrosequencing spanning the V4 and V5 hypervariable regions of the 16S rRNA. Across four replicate libraries, two corresponding to sequences of endophytic bacteria from long time maize-cultivated soils and the other two obtained from fallow soils, 793 bacterial sequences were found that grouped into 188 bacterial operational taxonomic units (OTUs, 97% genetic similarity). The numbers of OTUs in the libraries from the maize-cultivated soils were significantly higher than those found in the libraries from fallow soils. A mean of 30 genera were found in the fallow soil libraries and 47 were in those from the maize-cultivated soils. Both alpha and beta diversity indexes showed clear differences between bacterial endophytic populations from plants with different soil cultivation history and that the soils cultivated for long time requires a higher diversity of endophytes. The number of sequences corresponding to main genera Sphingomonas, Herbaspirillum, Bradyrhizobium and Methylophilus in the maize-cultivated libraries were statistically more abundant than those from the fallow soils. Sequences of genera Dyella and Sreptococcus were significantly more abundant in the libraries from the fallow soils. Relative abundance of genera Burkholderia, candidatus Glomeribacter, Staphylococcus, Variovorax, Bacillus and Chitinophaga were similar among libraries. A canonical correspondence analysis of the relative abundance of the main genera showed that the four libraries distributed in two clearly separated groups. Our results suggest that cultivation history is an important driver of endophytic colonization of maize and that after a long time of cultivation of the soil the maize plants need to increase the richness of the bacterial endophytes communities.

Maize Endophytic Bacterial Diversity as Affected by Soil Cultivation History

PubMed Central

Correa-Galeote, David; Bedmar, Eulogio J.; Arone, Gregorio J.

2018-01-01

The bacterial endophytic communities residing within roots of maize (Zea mays L.) plants cultivated by a sustainable management in soils from the Quechua maize belt (Peruvian Andes) were examined using tags pyrosequencing spanning the V4 and V5 hypervariable regions of the 16S rRNA. Across four replicate libraries, two corresponding to sequences of endophytic bacteria from long time maize-cultivated soils and the other two obtained from fallow soils, 793 bacterial sequences were found that grouped into 188 bacterial operational taxonomic units (OTUs, 97% genetic similarity). The numbers of OTUs in the libraries from the maize-cultivated soils were significantly higher than those found in the libraries from fallow soils. A mean of 30 genera were found in the fallow soil libraries and 47 were in those from the maize-cultivated soils. Both alpha and beta diversity indexes showed clear differences between bacterial endophytic populations from plants with different soil cultivation history and that the soils cultivated for long time requires a higher diversity of endophytes. The number of sequences corresponding to main genera Sphingomonas, Herbaspirillum, Bradyrhizobium and Methylophilus in the maize-cultivated libraries were statistically more abundant than those from the fallow soils. Sequences of genera Dyella and Sreptococcus were significantly more abundant in the libraries from the fallow soils. Relative abundance of genera Burkholderia, candidatus Glomeribacter, Staphylococcus, Variovorax, Bacillus and Chitinophaga were similar among libraries. A canonical correspondence analysis of the relative abundance of the main genera showed that the four libraries distributed in two clearly separated groups. Our results suggest that cultivation history is an important driver of endophytic colonization of maize and that after a long time of cultivation of the soil the maize plants need to increase the richness of the bacterial endophytes communities. PMID:29662471

Tropical soil bacterial communities in Malaysia: pH dominates in the equatorial tropics too.

PubMed

Tripathi, Binu M; Kim, Mincheol; Singh, Dharmesh; Lee-Cruz, Larisa; Lai-Hoe, Ang; Ainuddin, A N; Go, Rusea; Rahim, Raha Abdul; Husni, M H A; Chun, Jongsik; Adams, Jonathan M

2012-08-01

The dominant factors controlling soil bacterial community variation within the tropics are poorly known. We sampled soils across a range of land use types--primary (unlogged) and logged forests and crop and pasture lands in Malaysia. PCR-amplified soil DNA for the bacterial 16S rRNA gene targeting the V1-V3 region was pyrosequenced using the 454 Roche machine. We found that land use in itself has a weak but significant effect on the bacterial community composition. However, bacterial community composition and diversity was strongly correlated with soil properties, especially soil pH, total carbon, and C/N ratio. Soil pH was the best predictor of bacterial community composition and diversity across the various land use types, with the highest diversity close to neutral pH values. In addition, variation in phylogenetic structure of dominant lineages (Alphaproteobacteria, Beta/Gammaproteobacteria, Acidobacteria, and Actinobacteria) is also significantly correlated with soil pH. Together, these results confirm the importance of soil pH in structuring soil bacterial communities in Southeast Asia. Our results also suggest that unlike the general diversity pattern found for larger organisms, primary tropical forest is no richer in operational taxonomic units of soil bacteria than logged forest, and agricultural land (crop and pasture) is actually richer than primary forest, partly due to selection of more fertile soils that have higher pH for agriculture and the effects of soil liming raising pH.

Messing with Bacterial Quorum Sensing

PubMed Central

González, Juan E.; Keshavan, Neela D.

2006-01-01

Quorum sensing is widely recognized as an efficient mechanism to regulate expression of specific genes responsible for communal behavior in bacteria. Several bacterial phenotypes essential for the successful establishment of symbiotic, pathogenic, or commensal relationships with eukaryotic hosts, including motility, exopolysaccharide production, biofilm formation, and toxin production, are often regulated by quorum sensing. Interestingly, eukaryotes produce quorum-sensing-interfering (QSI) compounds that have a positive or negative influence on the bacterial signaling network. This eukaryotic interference could result in further fine-tuning of bacterial quorum sensing. Furthermore, recent work involving the synthesis of structural homologs to the various quorum-sensing signal molecules has resulted in the development of additional QSI compounds that could be used to control pathogenic bacteria. The creation of transgenic plants that express bacterial quorum-sensing genes is yet another strategy to interfere with bacterial behavior. Further investigation on the manipulation of quorum-sensing systems could provide us with powerful tools against harmful bacteria. PMID:17158701

A Mouse Model of Acinetobacter baumannii-Associated Pneumonia Using a Clinically Isolated Hypervirulent Strain

PubMed Central

Harris, Greg; Kuo Lee, Rhonda; Lam, Christopher K.; Kanzaki, Gregory; Patel, Girishchandra B.; Xu, H. Howard

2013-01-01

Acinetobacter baumannii is an important emerging pathogen in health care-acquired infections and is responsible for severe nosocomial and community-acquired pneumonia. Currently available mouse models of A. baumannii pneumonia show poor colonization with little to no extrapulmonary dissemination. Here, we describe a mouse model of A. baumannii pneumonia using a clinical isolate (LAC-4 strain) that reliably reproduces the most relevant features of human pulmonary A. baumannii infection and pathology. Using this model, we have shown that LAC-4 infection induced rapid bacterial replication in the lungs, significant extrapulmonary dissemination, and severe bacteremia by 24 h postintranasal inoculation. Infected mice showed severe bronchopneumonia and dilatation and inflammatory cell infiltration in the perivascular space. More significantly, 100% of C57BL/6 and BALB/c mice succumbed to 108 CFU of LAC-4 inoculation within 48 h. When this model was used to assess the efficacy of antimicrobials, all mice treated with imipenem and tigecycline survived a lethal intranasal challenge, with minimal clinical signs and body weight loss. Moreover, intranasal immunization of mice with formalin-fixed LAC-4 protected 40% of mice from a lethal (100× 100% lethal dose) intraperitoneal challenge. Thus, this model offers a reproducible acute course of A. baumannii pneumonia without requiring additional manipulation of host immune status, which will facilitate the development of therapeutic agents and vaccines against A. baumannii pneumonia in humans. PMID:23689726

Proteolytic digestion of bacterial inclusion body proteins during dynamic transition between soluble and insoluble forms.

PubMed

Carrió, M M; Corchero, J L; Villaverde, A

1999-09-14

Inclusion bodies formed by two closely related hybrid proteins, namely VP1LAC and LACVP1, have been compared during their building in Escherichia coli. Features of these proteins are determinant of aggregation rates and protein composition of the bodies, generating insoluble particles with distinguishable volume evolution. Interestingly, in LACVP1 and less perceptibly in VP1LAC bodies, an important fraction of the aggregated polypeptide is lost at a given stage of body construction. Stable degradation intermediates of the more fragile LACVP1 are concomitantly found embedded in the bodies. When recombinant protein synthesis is arrested in growing cells, the amount of aggregated protein drops while the amount of soluble protein undergoes a sudden rise before proteolysis. This indicates an architectural plasticity during the in vivo building of the studied inclusion bodies by a dynamic transition between soluble and insoluble forms of the recombinant proteins involved. During this transition, protease-sensitive polypeptides can suffer an efficient proteolytic attack and the resulting fragments further aggregate as inclusion body components.

Inter-individual variability in copepod microbiomes reveals bacterial networks linked to host physiology.

PubMed

Datta, Manoshi S; Almada, Amalia A; Baumgartner, Mark F; Mincer, Tracy J; Tarrant, Ann M; Polz, Martin F

2018-06-06

Copepods harbor diverse bacterial communities, which collectively carry out key biogeochemical transformations in the ocean. However, bulk copepod sampling averages over the variability in their associated bacterial communities, thereby limiting our understanding of the nature and specificity of copepod-bacteria associations. Here, we characterize the bacterial communities associated with nearly 200 individual Calanus finmarchicus copepods transitioning from active growth to diapause. We find that all individual copepods sampled share a small set of "core" operational taxonomic units (OTUs), a subset of which have also been found associated with other marine copepod species in different geographic locations. However, most OTUs are patchily distributed across individual copepods, thereby driving community differences across individuals. Among patchily distributed OTUs, we identified groups of OTUs correlated with common ecological drivers. For instance, a group of OTUs positively correlated with recent copepod feeding served to differentiate largely active growing copepods from those entering diapause. Together, our results underscore the power of individual-level sampling for understanding host-microbiome relationships.

Bacterial 'immunity' against bacteriophages.

PubMed

Abedon, Stephen T

2012-01-01

Vertebrate animals possess multiple anti-pathogen defenses. Individual mechanisms usually are differentiated into those that are immunologically adaptive vs. more "primitive" anti-pathogen phenomena described as innate responses. Here I frame defenses used by bacteria against bacteriophages as analogous to these animal immune functions. Included are numerous anti-phage defenses in addition to the adaptive immunity associated with CRISPR/cas systems. As these other anti-pathogen mechanisms are non-adaptive they can be described as making up an innate bacterial immunity. This exercise was undertaken in light of the recent excitement over the discovery that CRISPR/cas systems can serve, as noted, as a form of bacterial adaptive immunity. The broader goal, however, is to gain novel insight into bacterial defenses against phages by fitting these mechanisms into considerations of how multicellular organisms also defend themselves against pathogens. This commentary can be viewed in addition as a bid toward integrating these numerous bacterial anti-phage defenses into a more unified immunology.

Dual system to reinforce biological containment of recombinant bacteria designed for rhizoremediation.

PubMed

Ronchel, M C; Ramos, J L

2001-06-01

Active biological containment (ABC) systems have been designed to control at will the survival or death of a bacterial population. These systems are based on the use of a killing gene, e.g., a porin-inducing protein such as the one encoded by the Escherichia coli gef gene, and a regulatory circuit that controls expression of the killing gene in response to the presence or absence of environmental signals. An ABC system for recombinant microorganisms that degrade a model pollutant was designed on the basis of the Pseudomonas putida TOL plasmid meta-cleavage regulatory circuit. The system consists of a fusion of the Pm promoter to lacI, whose expression is controlled by XylS with 3-methylbenzoate, and a fusion of a synthetic P(lac) promoter to gef. In the presence of the model pollutant, bacterial cells survived and degraded the target compound, whereas in the absence of the aromatic carboxylic acid cell death was induced. The system had two main drawbacks: (i) the slow death of the bacterial cells in soil versus the fast killing rate in liquid cultures in laboratory assays, and (ii) the appearance of mutants, at a rate of about 10(-8) per cell and generation, that did not die after the pollutant had been exhausted. We reinforced the ABC system by including it in a Deltaasd P. putida background. A P. putida Deltaasd mutant is viable only in complex medium supplemented with diaminopimelic acid, methionine, lysine, and threonine. We constructed a P. putida Deltaasd strain, called MCR7, with a Pm::asd fusion in the host chromosome. This strain was viable in the presence of 3-methylbenzoate because synthesis of the essential metabolites was achieved through XylS-dependent induction. In the P. putida MCR7 strain, an ABC system (Pm::lacI, xylS, P(lac)::gef) was incorporated into the host chromosome to yield strain MCR8. The number of MCR8 mutants that escaped killing was below our detection limit (<10(-9) mutants per cell and generation). The MCR8 strain survived and

Bacterial meningitis - principles of antimicrobial treatment.

PubMed

Jawień, Miroslaw; Garlicki, Aleksander M

2013-01-01

Bacterial meningitis is associated with significant morbidity and mortality despite the availability of effective antimicrobial therapy. The management approach to patients with suspected or proven bacterial meningitis includes emergent cerebrospinal fluid analysis and initiation of appropriate antimicrobial and adjunctive therapies. The choice of empirical antimicrobial therapy is based on the patient's age and underlying disease status; once the infecting pathogen is isolated, antimicrobial therapy can be modified for optimal treatment. Successful treatment of bacterial meningitis requires the knowledge on epidemiology including prevalence of antimicrobial resistant pathogens, pathogenesis of meningitis, pharmacokinetics and pharmacodynamics of antimicrobial agents. The emergence of antibiotic-resistant bacterial strains in recent years has necessitated the development of new strategies for empiric antimicrobial therapy for bacterial meningitis.

Stannous Fluoride Effects on Gene Expression of Streptococcus mutans and Actinomyces viscosus.

PubMed

Shi, Y; Li, R; White, D J; Biesbrock, A R

2018-02-01

A genome-wide transcriptional analysis was performed to elucidate the bacterial cellular response of Streptococcus mutans and Actinomyces viscosus to NaF and SnF 2 . The minimal inhibitory concentration (MIC) and minimal bactericidal concentration (MBC) of SnF 2 were predetermined before microarray study. Gene expression profiling microarray experiments were carried out in the absence (control) and presence (experimental) of 10 ppm and 100 ppm Sn 2+ (in the form of SnF 2 ) and fluoride controls for 10-min exposures (4 biological replicates/treatment). These Sn 2+ levels and treatment time were chosen because they have been shown to slow bacterial growth of S. mutans (10 ppm) and A. viscosus (100 ppm) without affecting cell viability. All data generated by microarray experiments were analyzed with bioinformatics tools by applying the following criteria: 1) a q value should be ≤0.05, and 2) an absolute fold change in transcript level should be ≥1.5. Microarray results showed SnF 2 significantly inhibited several genes encoding enzymes of the galactose pathway upon a 10-min exposure versus a negative control: lacA and lacB (A and B subunits of the galactose-6-P isomerase), lacC (tagatose-6-P kinase), lacD (tagatose-1,6-bP adolase), galK (galactokinase), galT (galactose-1-phosphate uridylyltransferase), and galE (UDP-glucose 4-epimerase). A gene fruK encoding fructose-1-phosphate kinase in the fructose pathway was also significantly inhibited. Several genes encoding fructose/mannose-specific enzyme IIABC components in the phosphotransferase system (PTS) were also downregulated, as was ldh encoding lactate dehydrogenase, a key enzyme involved in lactic acid synthesis. SnF 2 downregulated the transcription of most key enzyme genes involved in the galactose pathway and also suppressed several key genes involved in the PTS, which transports sugars into the cell in the first step of glycolysis.

Characterization of bacterial community associated to biofilms of corroded oil pipelines from the southeast of Mexico.

PubMed

Neria-González, Isabel; Wang, En Tao; Ramírez, Florina; Romero, Juan M; Hernández-Rodríguez, César

2006-06-01

Microbial communities associated to biofilms promote corrosion of oil pipelines. The community structure of bacteria in the biofilm formed in oil pipelines is the basic knowledge to understand the complexity and mechanisms of metal corrosion. To assess bacterial diversity, biofilm samples were obtained from X52 steel coupons corroded after 40 days of exposure to normal operation and flow conditions. The biofilm samples were directly used to extract metagenomic DNA, which was used as template to amplify 16S ribosomal gene by PCR. The PCR products of 16S ribosomal gene were also employed as template for sulfate-reducing bacteria (SRB) specific nested-PCR and both PCR products were utilized for the construction of gene libraries. The V3 region of the 16S rRNA gene was also amplified to analyse the bacterial diversity by analysis of denaturing gradient gel electrophoresis (DGGE). Ribosomal library and DGGE profiles exhibited limited bacterial diversity, basically including Citrobacter spp., Enterobacter spp. and Halanaerobium spp. while Desulfovibrio alaskensis and a novel clade within the genus Desulfonatronovibrio were detected from the nested PCR library. The biofilm samples were also taken for the isolation of SRB. Desulfovibrio alaskensis and Desulfovibrio capillatus, as well as some strains related to Citrobacter were isolated. SRB consists in a very small proportion of the community and Desulfovibrio spp. were the relatively abundant groups among the SRB. This is the first study directly exploring bacterial diversity in corrosive biofilms associated to steel pipelines subjected to normal operation conditions.

Potential risk for bacterial contamination in conventional reused ventilator systems and disposable closed ventilator-suction systems.

PubMed

Li, Ya-Chi; Lin, Hui-Ling; Liao, Fang-Chun; Wang, Sing-Siang; Chang, Hsiu-Chu; Hsu, Hung-Fu; Chen, Sue-Hsien; Wan, Gwo-Hwa

2018-01-01

Few studies have investigated the difference in bacterial contamination between conventional reused ventilator systems and disposable closed ventilator-suction systems. The aim of this study was to investigate the bacterial contamination rates of the reused and disposable ventilator systems, and the association between system disconnection and bacterial contamination of ventilator systems. The enrolled intubated and mechanically ventilated patients used a conventional reused ventilator system and a disposable closed ventilator-suction system, respectively, for a week; specimens were then collected from the ventilator circuit systems to evaluate human and environmental bacterial contamination. The sputum specimens from patients were also analyzed in this study. The detection rate of bacteria in the conventional reused ventilator system was substantially higher than that in the disposable ventilator system. The inspiratory and expiratory limbs of the disposable closed ventilator-suction system had higher bacterial concentrations than the conventional reused ventilator system. The bacterial concentration in the heated humidifier of the reused ventilator system was significantly higher than that in the disposable ventilator system. Positive associations existed among the bacterial concentrations at different locations in the reused and disposable ventilator systems, respectively. The predominant bacteria identified in the reused and disposable ventilator systems included Acinetobacter spp., Bacillus cereus, Elizabethkingia spp., Pseudomonas spp., and Stenotrophomonas (Xan) maltophilia. Both the reused and disposable ventilator systems had high bacterial contamination rates after one week of use. Disconnection of the ventilator systems should be avoided during system operation to decrease the risks of environmental pollution and human exposure, especially for the disposable ventilator system. ClinicalTrials.gov PRS / NCT03359148.

Sequence-Specific Affinity Chromatography of Bacterial Small Regulatory RNA-Binding Proteins from Bacterial Cells.

PubMed

Gans, Jonathan; Osborne, Jonathan; Cheng, Juliet; Djapgne, Louise; Oglesby-Sherrouse, Amanda G

2018-01-01

Bacterial small RNA molecules (sRNAs) are increasingly recognized as central regulators of bacterial stress responses and pathogenesis. In many cases, RNA-binding proteins are critical for the stability and function of sRNAs. Previous studies have adopted strategies to genetically tag an sRNA of interest, allowing isolation of RNA-protein complexes from cells. Here we present a sequence-specific affinity purification protocol that requires no prior genetic manipulation of bacterial cells, allowing isolation of RNA-binding proteins bound to native RNA molecules.

Bacterial detection: from microscope to smartphone.

PubMed

Gopinath, Subash C B; Tang, Thean-Hock; Chen, Yeng; Citartan, Marimuthu; Lakshmipriya, Thangavel

2014-10-15

The ubiquitous nature of bacteria enables them to survive in a wide variety of environments. Hence, the rise of various pathogenic species that are harmful to human health raises the need for the development of accurate sensing systems. Sensing systems are necessary for diagnosis and epidemiological control of pathogenic organism, especially in the food-borne pathogen and sanitary water treatment facility' bacterial populations. Bacterial sensing for the purpose of diagnosis can function in three ways: bacterial morphological visualization, specific detection of bacterial component and whole cell detection. This paper provides an overview of the currently available bacterial detection systems that ranges from microscopic observation to state-of-the-art smartphone-based detection. Copyright © 2014 Elsevier B.V. All rights reserved.

Time- and sediment depth-related variations in bacterial diversity and community structure in subtidal sands.

PubMed

Böer, Simone I; Hedtkamp, Stefanie I C; van Beusekom, Justus E E; Fuhrman, Jed A; Boetius, Antje; Ramette, Alban

2009-07-01

Bacterial community structure and microbial activity were determined together with a large number of contextual environmental parameters over 2 years in subtidal sands of the German Wadden Sea in order to identify the main factors shaping microbial community structure and activity in this habitat. Seasonal changes in temperature were directly reflected in bacterial activities and total community respiration, but could not explain variations in the community structure. Strong sediment depth-related patterns were observed for bacterial abundances, carbon production rates and extracellular enzymatic activities. Bacterial community structure also showed a clear vertical variation with higher operational taxonomic unit (OTU) numbers at 10-15 cm depth than in the top 10 cm, probably because of the decreasing disturbance by hydrodynamic forces with sediment depth. The depth-related variations in bacterial community structure could be attributed to vertical changes in bacterial abundances, chlorophyll a and NO(3)(-), indicating that spatial patterns of microbes are partially environmentally controlled. Time was the most important single factor affecting microbial community structure with an OTU replacement of up to 47% over 2 years and a contribution of 34% to the total variation. A large part of this variation was not related to any environmental parameters, suggesting that temporal variations in bacterial community structure are caused by yet unknown environmental drivers and/or by stochastic events in coastal sand habitats. Principal ecosystem functions such as benthic oxygen consumption and extracellular hydrolysis of organic matter were, however, at a high level at all times, indicating functional redundancy in the microbial communities.

Surgical management of bacterial meningitis.

PubMed Central

Humphreys, R. P.

1975-01-01

A variety of associated lesions may require the neurosurgeon's assistance in the management of bacterial meningitis. As treatment of this infection of the central nervous system proceeds, the surgeon will have to decide about the concurrent or subsequent operative treatment of congenital dysraphic states, paraneural infections, compound fractures or penetrating wounds of thecranium or spine, or infected bypass shunts for cerebrospinal fluid (CSF). In patients with intractable meningitic infections the surgeon may have to insert a ventricular drainage-irrigation system to permit adequate perfusion of the CSF pathways with antibiotic. Hydrocephalus or subdural effusions complicating meningitis may bring the patient to the surgeon long after the infection has been cured. This paper examines these problems and outlines the current principles of management. Images FIG. 1 FIG. 2 PMID:1098760

Transforming microbial genotyping: a robotic pipeline for genotyping bacterial strains.

PubMed

O'Farrell, Brian; Haase, Jana K; Velayudhan, Vimalkumar; Murphy, Ronan A; Achtman, Mark

2012-01-01

Microbial genotyping increasingly deals with large numbers of samples, and data are commonly evaluated by unstructured approaches, such as spread-sheets. The efficiency, reliability and throughput of genotyping would benefit from the automation of manual manipulations within the context of sophisticated data storage. We developed a medium- throughput genotyping pipeline for MultiLocus Sequence Typing (MLST) of bacterial pathogens. This pipeline was implemented through a combination of four automated liquid handling systems, a Laboratory Information Management System (LIMS) consisting of a variety of dedicated commercial operating systems and programs, including a Sample Management System, plus numerous Python scripts. All tubes and microwell racks were bar-coded and their locations and status were recorded in the LIMS. We also created a hierarchical set of items that could be used to represent bacterial species, their products and experiments. The LIMS allowed reliable, semi-automated, traceable bacterial genotyping from initial single colony isolation and sub-cultivation through DNA extraction and normalization to PCRs, sequencing and MLST sequence trace evaluation. We also describe robotic sequencing to facilitate cherrypicking of sequence dropouts. This pipeline is user-friendly, with a throughput of 96 strains within 10 working days at a total cost of < €25 per strain. Since developing this pipeline, >200,000 items were processed by two to three people. Our sophisticated automated pipeline can be implemented by a small microbiology group without extensive external support, and provides a general framework for semi-automated bacterial genotyping of large numbers of samples at low cost.

Transforming Microbial Genotyping: A Robotic Pipeline for Genotyping Bacterial Strains

PubMed Central

Velayudhan, Vimalkumar; Murphy, Ronan A.; Achtman, Mark

2012-01-01

Microbial genotyping increasingly deals with large numbers of samples, and data are commonly evaluated by unstructured approaches, such as spread-sheets. The efficiency, reliability and throughput of genotyping would benefit from the automation of manual manipulations within the context of sophisticated data storage. We developed a medium- throughput genotyping pipeline for MultiLocus Sequence Typing (MLST) of bacterial pathogens. This pipeline was implemented through a combination of four automated liquid handling systems, a Laboratory Information Management System (LIMS) consisting of a variety of dedicated commercial operating systems and programs, including a Sample Management System, plus numerous Python scripts. All tubes and microwell racks were bar-coded and their locations and status were recorded in the LIMS. We also created a hierarchical set of items that could be used to represent bacterial species, their products and experiments. The LIMS allowed reliable, semi-automated, traceable bacterial genotyping from initial single colony isolation and sub-cultivation through DNA extraction and normalization to PCRs, sequencing and MLST sequence trace evaluation. We also describe robotic sequencing to facilitate cherrypicking of sequence dropouts. This pipeline is user-friendly, with a throughput of 96 strains within 10 working days at a total cost of < €25 per strain. Since developing this pipeline, >200,000 items were processed by two to three people. Our sophisticated automated pipeline can be implemented by a small microbiology group without extensive external support, and provides a general framework for semi-automated bacterial genotyping of large numbers of samples at low cost. PMID:23144721

Disturbance opens recruitment sites for bacterial colonization in activated sludge.

PubMed

Vuono, David C; Munakata-Marr, Junko; Spear, John R; Drewes, Jörg E

2016-01-01

Little is known about the role of immigration in shaping bacterial communities or the factors that may dictate success or failure of colonization by bacteria from regional species pools. To address these knowledge gaps, the influence of bacterial colonization into an ecosystem (activated sludge bioreactor) was measured through a disturbance gradient (successive decreases in the parameter solids retention time) relative to stable operational conditions. Through a DNA sequencing approach, we show that the most abundant bacteria within the immigrant community have a greater probability of colonizing the receiving ecosystem, but mostly as low abundance community members. Only during the disturbance do some of these bacterial populations significantly increase in abundance beyond background levels and in few cases become dominant community members post-disturbance. Two mechanisms facilitate the enhanced enrichment of immigrant populations during disturbance: (i) the availability of resources left unconsumed by established species and (ii) the increased availability of niche space for colonizers to establish and displace resident populations. Thus, as a disturbance decreases local diversity, recruitment sites become available to promote colonization. This work advances our understanding of microbial resource management and diversity maintenance in complex ecosystems. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

Spatial distribution of marine airborne bacterial communities

PubMed Central

Seifried, Jasmin S; Wichels, Antje; Gerdts, Gunnar

2015-01-01

The spatial distribution of bacterial populations in marine bioaerosol samples was investigated during a cruise from the North Sea to the Baltic Sea via Skagerrak and Kattegat. The analysis of the sampled bacterial communities with a pyrosequencing approach revealed that the most abundant phyla were represented by the Proteobacteria (49.3%), Bacteroidetes (22.9%), Actinobacteria (16.3%), and Firmicutes (8.3%). Cyanobacteria were assigned to 1.5% of all bacterial reads. A core of 37 bacterial OTUs made up more than 75% of all bacterial sequences. The most abundant OTU was Sphingomonas sp. which comprised 17% of all bacterial sequences. The most abundant bacterial genera were attributed to distinctly different areas of origin, suggesting highly heterogeneous sources for bioaerosols of marine and coastal environments. Furthermore, the bacterial community was clearly affected by two environmental parameters – temperature as a function of wind direction and the sampling location itself. However, a comparison of the wind directions during the sampling and calculated backward trajectories underlined the need for more detailed information on environmental parameters for bioaerosol investigations. The current findings support the assumption of a bacterial core community in the atmosphere. They may be emitted from strong aerosolizing sources, probably being mixed and dispersed over long distances. PMID:25800495

Bacterial membrane proteomics.

PubMed

Poetsch, Ansgar; Wolters, Dirk

2008-10-01

About one quarter to one third of all bacterial genes encode proteins of the inner or outer bacterial membrane. These proteins perform essential physiological functions, such as the import or export of metabolites, the homeostasis of metal ions, the extrusion of toxic substances or antibiotics, and the generation or conversion of energy. The last years have witnessed completion of a plethora of whole-genome sequences of bacteria important for biotechnology or medicine, which is the foundation for proteome and other functional genome analyses. In this review, we discuss the challenges in membrane proteome analysis, starting from sample preparation and leading to MS-data analysis and quantification. The current state of available proteomics technologies as well as their advantages and disadvantages will be described with a focus on shotgun proteomics. Then, we will briefly introduce the most abundant proteins and protein families present in bacterial membranes before bacterial membrane proteomics studies of the last years will be presented. It will be shown how these works enlarged our knowledge about the physiological adaptations that take place in bacteria during fine chemical production, bioremediation, protein overexpression, and during infections. Furthermore, several examples from literature demonstrate the suitability of membrane proteomics for the identification of antigens and different pathogenic strains, as well as the elucidation of membrane protein structure and function.

Molecular diagnosis of bacterial vaginosis: Does adjustment for total bacterial load or human cellular content improve diagnostic performance?

PubMed

Plummer, E L; Garland, S M; Bradshaw, C S; Law, M G; Vodstrcil, L A; Hocking, J S; Fairley, C K; Tabrizi, S N

2017-02-01

We investigated the utility of quantitative PCR assays for diagnosis of bacterial vaginosis and found that while the best model utilized bacterial copy number adjusted for total bacterial load (sensitivity=98%, specificity=93%, AUC=0.95[95%CI=0.93,0.97]), adjusting for total bacterial or human cell load did not consistently increase the diagnostic performance of the assays. Copyright © 2017 Elsevier B.V. All rights reserved.

Presence of pathogenic Escherichia coli is correlated with bacterial community diversity and composition on pre-harvest cattle hides.

PubMed

Chopyk, Jessica; Moore, Ryan M; DiSpirito, Zachary; Stromberg, Zachary R; Lewis, Gentry L; Renter, David G; Cernicchiaro, Natalia; Moxley, Rodney A; Wommack, K Eric

2016-03-22

Since 1982, specific serotypes of Shiga toxin-producing Escherichia coli (STEC) have been recognized as significant foodborne pathogens acquired from contaminated beef and, more recently, other food products. Cattle are the major reservoir hosts of these organisms, and while there have been advancements in food safety practices and industry standards, STEC still remains prevalent within beef cattle operations with cattle hides implicated as major sources of carcass contamination. To investigate whether the composition of hide-specific microbial communities are associated with STEC prevalence, 16S ribosomal RNA (rRNA) bacterial community profiles were obtained from hide and fecal samples collected from a large commercial feedlot over a 3-month period. These community data were examined amidst an extensive collection of prevalence data on a subgroup of STEC that cause illness in humans, referred to as enterohemorrhagic E. coli (EHEC). Fecal 16S rRNA gene OTUs (operational taxonomic units) were subtracted from the OTUs found within each hide 16S rRNA amplicon library to identify hide-specific bacterial populations. Comparative analysis of alpha diversity revealed a significant correlation between low bacterial diversity and samples positive for the presence of E. coli O157:H7 and/or the non-O157 groups: O26, O111, O103, O121, O45, and O145. This trend occurred regardless of diversity metric or fecal OTU presence. The number of EHEC serogroups present in the samples had a compounding effect on the inverse relationship between pathogen presence and bacterial diversity. Beta diversity data showed differences in bacterial community composition between samples containing O157 and non-O157 populations, with certain OTUs demonstrating significant changes in relative abundance. The cumulative prevalence of the targeted EHEC serogroups was correlated with low bacterial community diversity on pre-harvest cattle hides. Understanding the relationship between indigenous hide

Waste treatment by bacterial additions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deutsch, D.J.; Stigall, E.; Barth, E.

1979-04-23

Companies such as General Environmental Science Corp. and Polybac Corp., which market specialized bacterial cultures for treating industrial wastes, claim that the cultures improve the operation of activated-sludge, trickling-filter, and lagoon-treatment plants, and provide faster system response to startups, variable and shock loads, and cold weather. The effectiveness of the special cultures is difficult to verify and has been questioned by environmental experts, including R. L. Raymond (Suntech Inc.) and E. Barth (EPA), although E. Stigall (EPA) believes they may aid plant recovery after upsets. A study by Business Communications Co. has predicted that the market for such additives willmore » reach $50 million by 1987, from $5 million in 1979. The use of such cultures in Exxon Corp.'s 1 million gal/day activated sludge system at the Benicia, Calif., oil refinery improved the system's performance by 32Vertical Bar3<, resulted in faster unit startups and more stable operation, and reduced foaming. J. T. Baker Co. has used successfully two broad-spectrum dried additives for ammonia removal and hydrocarbon degradation at its 3 million gal/day secondary treatment plant at Phillipsburg, N.J.« less

Bacterial diversity and composition in the fluid of pitcher plants of the genus Nepenthes.

PubMed

Takeuchi, Yayoi; Chaffron, Samuel; Salcher, Michaela M; Shimizu-Inatsugi, Rie; Kobayashi, Masaki J; Diway, Bibian; von Mering, Christian; Pernthaler, Jakob; Shimizu, Kentaro K

2015-07-01

Pitchers are modified leaves used by carnivorous plants for trapping prey. Their fluids contain digestive enzymes from the plant and they harbor abundant microbes. In this study, the diversity of bacterial communities was assessed in Nepenthes pitcher fluids and the composition of the bacterial community was compared to that in other environments, including the phyllosphere of Arabidopsis, animal guts and another pitcher plant, Sarracenia. Diversity was measured by 454 pyrosequencing of 16S rRNA gene amplicons. A total of 232,823 sequences were obtained after chimera and singleton removal that clustered into 3260 distinct operational taxonomic units (OTUs) (3% dissimilarity), which were taxonomically distributed over 17 phyla, 25 classes, 45 orders, 100 families, and 195 genera. Pyrosequencing and fluorescence in situ hybridization yielded similar estimates of community composition. Most pitchers contained high proportions of unique OTUs, and only 22 OTUs (<0.6%) were shared by ≥14/16 samples, suggesting a unique bacterial assemblage in each pitcher at the OTU level. Diversity analysis at the class level revealed that the bacterial communities of both opened and unopened pitchers were most similar to that of Sarracenia and to that in the phyllosphere. Therefore, the bacterial community in pitchers may be formed by environmental filtering and/or by phyllosphere bacteria. Copyright © 2015 The Authors. Published by Elsevier GmbH.. All rights reserved.

Arsenic uptake in bacterial calcite

NASA Astrophysics Data System (ADS)

Catelani, Tiziano; Perito, Brunella; Bellucci, Francesco; Lee, Sang Soo; Fenter, Paul; Newville, Matthew; Rimondi, Valentina; Pratesi, Giovanni; Costagliola, Pilario

2018-02-01

Bio-mediated processes for arsenic (As) uptake in calcite were investigated by means of X-ray Diffraction (XRD) and X-ray Absorption Spectroscopy (XAS) coupled with X-ray Fluorescence measurements. The environmental bacterial strain Bacillus licheniformis BD5, sampled at the Bullicame Hot Springs (Viterbo, Central Italy), was used to synthesize calcite from As-enriched growth media. Both liquid and solid cultures were applied to simulate planktonic and biofilm community environments, respectively. Bacterial calcite samples cultured in liquid media had an As enrichment factor (Kd) 50 times higher than that from solid media. The XRD analysis revealed an elongation of the crystal lattice along the c axis (by 0.03 Å) for biogenic calcite, which likely resulted from the substitution of larger arsenate for carbonate in the crystal. The XAS data also showed a clear difference in the oxidation state of sorbed As between bacterial and abiotic calcite. Abiotic chemical processes yielded predominantly As(V) uptake whereas bacterial precipitation processes led to the uptake of both As(III) and As(V). The presence of As(III) in bacterial calcite is proposed to result from subsequent reduction of arsenate to arsenite by bacterial activities. To the best of our knowledge, this is the first experimental observation of the incorporation of As(III) in the calcite crystal lattice, revealing a critical role of biochemical processes for the As cycling in nature.

Mechanism of salt-induced activity enhancement of a marine-derived laccase, Lac15.

PubMed

Li, Jie; Xie, Yanan; Wang, Rui; Fang, Zemin; Fang, Wei; Zhang, Xuecheng; Xiao, Yazhong

2018-04-01

Laccase (benzenediol: oxygen oxidoreductases, EC1.10.3.2) is a multi-copper oxidase capable of oxidizing a variety of phenolic and other aromatic organic compounds. The catalytic power of laccase makes it an attractive candidate for potential applications in many areas of industry including biodegradation of organic pollutants and synthesis of novel drugs. Most laccases are vulnerable to high salt and have limited applications. However, some laccases are not only tolerant to but also activated by certain concentrations of salt and thus have great application potential. The mechanisms of salt-induced activity enhancement of laccases are unclear as yet. In this study, we used dynamic light scattering, size exclusion chromatography, analytical ultracentrifugation, intrinsic fluorescence emission, circular dichroism, ultraviolet-visible light absorption, and an enzymatic assay to investigate the potential correlation between the structure and activity of the marine-derived laccase, Lac15, whose activity is promoted by low concentrations of NaCl. The results showed that low concentrations of NaCl exert little influence on the protein structure, which was partially folded in the absence of the salt; moreover, the partially folded rather than the fully folded state seemed to be favorable for enzyme activity, and this partially folded state was distinctive from the so-called 'molten globule' occasionally observed in active enzymes. More data indicated that salt might promote laccase activity through mechanisms involving perturbation of specific local sites rather than a change in global structure. Potential binding sites for chloride ions and their roles in enzyme activity promotion are proposed.

Bacterial interactions in dental biofilm development.

PubMed

Hojo, K; Nagaoka, S; Ohshima, T; Maeda, N

2009-11-01

Recent analyses with ribosomal RNA-based technologies have revealed the diversity of bacterial populations within dental biofilms, and have highlighted their important contributions to oral health and disease. Dental biofilms are exceedingly complex and multispecies ecosystems, where oral bacteria interact cooperatively or competitively with other members. Bacterial interactions that influence dental biofilm communities include various different mechanisms. During the early stage of biofilm formation, it is known that planktonic bacterial cells directly attach to surfaces of the oral cavity or indirectly bind to other bacterial cells that have already colonized. Adherence through co-aggregation may be critical for the temporary retention of bacteria on dental surfaces, and may facilitate eventual bacterial colonization. It is likely that metabolic communication, genetic exchange, production of inhibitory factors (e.g., bacteriocins, hydrogen peroxide, etc.), and quorum-sensing are pivotal regulatory factors that determine the bacterial composition and/or metabolism. Since each bacterium can easily access a neighboring bacterial cell and its metabolites, genetic exchanges and metabolic communication may occur frequently in dental biofilms. Quorum-sensing is defined as gene regulation in response to cell density, which influences various functions, e.g., virulence and bacteriocin production. In this review, we discuss these important interactions among oral bacteria within the dental biofilm communities.

Characterization of coastal urban watershed bacterial communities leads to alternative community-based indicators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, C.H.; Sercu, B.; Van De Werhorst, L.C.

2010-03-01

Microbial communities in aquatic environments are spatially and temporally dynamic due to environmental fluctuations and varied external input sources. A large percentage of the urban watersheds in the United States are affected by fecal pollution, including human pathogens, thus warranting comprehensive monitoring. Using a high-density microarray (PhyloChip), we examined water column bacterial community DNA extracted from two connecting urban watersheds, elucidating variable and stable bacterial subpopulations over a 3-day period and community composition profiles that were distinct to fecal and non-fecal sources. Two approaches were used for indication of fecal influence. The first approach utilized similarity of 503 operational taxonomicmore » units (OTUs) common to all fecal samples analyzed in this study with the watershed samples as an index of fecal pollution. A majority of the 503 OTUs were found in the phyla Firmicutes, Proteobacteria, Bacteroidetes, and Actinobacteria. The second approach incorporated relative richness of 4 bacterial classes (Bacilli, Bacteroidetes, Clostridia and a-proteobacteria) found to have the highest variance in fecal and non-fecal samples. The ratio of these 4 classes (BBC:A) from the watershed samples demonstrated a trend where bacterial communities from gut and sewage sources had higher ratios than from sources not impacted by fecal material. This trend was also observed in the 124 bacterial communities from previously published and unpublished sequencing or PhyloChip- analyzed studies. This study provided a detailed characterization of bacterial community variability during dry weather across a 3-day period in two urban watersheds. The comparative analysis of watershed community composition resulted in alternative community-based indicators that could be useful for assessing ecosystem health.« less

Changes in bacterial composition of biofilm in a metropolitan drinking water distribution system.

PubMed

Revetta, R P; Gomez-Alvarez, V; Gerke, T L; Santo Domingo, J W; Ashbolt, N J

2016-07-01

This study examined the development of bacterial biofilms within a metropolitan distribution system. The distribution system is fed with different source water (i.e. groundwater, GW and surface water, SW) and undergoes different treatment processes in separate facilities. The biofilm community was characterized using 16S rRNA gene clone libraries and functional potential analysis, generated from total DNA extracted from coupons in biofilm annular reactors fed with onsite drinking water for up to 18 months. Differences in the bacterial community structure were observed between GW and SW. Representatives that explained the dissimilarity were associated with the classes Betaproteobacteria, Alphaproteobacteria, Actinobacteria, Gammaproteobacteria and Firmicutes. After 9 months the biofilm bacterial community from both GW and SW were dominated by Mycobacterium species. The distribution of the dominant operational taxonomic unit (OTU) (Mycobacterium) positively correlated with the drinking water distribution system (DWDS) temperature. In this study, the biofilm community structure observed between GW and SW were dissimilar, while communities from different locations receiving SW did not show significant differences. The results suggest that source water and/or the water quality shaped by their respective treatment processes may play an important role in shaping the bacterial communities in the distribution system. In addition, several bacterial groups were present in all samples, suggesting that they are an integral part of the core microbiota of this DWDS. These results provide an ecological insight into biofilm bacterial structure in chlorine-treated drinking water influenced by different water sources and their respective treatment processes. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.