Sample records for bacterial regulatory proteins

  1. Hijacking Complement Regulatory Proteins for Bacterial Immune Evasion.

    PubMed

    Hovingh, Elise S; van den Broek, Bryan; Jongerius, Ilse

    2016-01-01

    The human complement system plays an important role in the defense against invading pathogens, inflammation and homeostasis. Invading microbes, such as bacteria, directly activate the complement system resulting in the formation of chemoattractants and in effective labeling of the bacteria for phagocytosis. In addition, formation of the membrane attack complex is responsible for direct killing of Gram-negative bacteria. In turn, bacteria have evolved several ways to evade complement activation on their surface in order to be able to colonize and invade the human host. One important mechanism of bacterial escape is attraction of complement regulatory proteins to the microbial surface. These molecules are present in the human body for tight regulation of the complement system to prevent damage to host self-surfaces. Therefore, recruitment of complement regulatory proteins to the bacterial surface results in decreased complement activation on the microbial surface which favors bacterial survival. This review will discuss recent advances in understanding the binding of complement regulatory proteins to the bacterial surface at the molecular level. This includes, new insights that have become available concerning specific conserved motives on complement regulatory proteins that are favorable for microbial binding. Finally, complement evasion molecules are of high importance for vaccine development due to their dominant role in bacterial survival, high immunogenicity and homology as well as their presence on the bacterial surface. Here, the use of complement evasion molecules for vaccine development will be discussed.

  2. Hijacking Complement Regulatory Proteins for Bacterial Immune Evasion

    PubMed Central

    Hovingh, Elise S.; van den Broek, Bryan; Jongerius, Ilse

    2016-01-01

    The human complement system plays an important role in the defense against invading pathogens, inflammation and homeostasis. Invading microbes, such as bacteria, directly activate the complement system resulting in the formation of chemoattractants and in effective labeling of the bacteria for phagocytosis. In addition, formation of the membrane attack complex is responsible for direct killing of Gram-negative bacteria. In turn, bacteria have evolved several ways to evade complement activation on their surface in order to be able to colonize and invade the human host. One important mechanism of bacterial escape is attraction of complement regulatory proteins to the microbial surface. These molecules are present in the human body for tight regulation of the complement system to prevent damage to host self-surfaces. Therefore, recruitment of complement regulatory proteins to the bacterial surface results in decreased complement activation on the microbial surface which favors bacterial survival. This review will discuss recent advances in understanding the binding of complement regulatory proteins to the bacterial surface at the molecular level. This includes, new insights that have become available concerning specific conserved motives on complement regulatory proteins that are favorable for microbial binding. Finally, complement evasion molecules are of high importance for vaccine development due to their dominant role in bacterial survival, high immunogenicity and homology as well as their presence on the bacterial surface. Here, the use of complement evasion molecules for vaccine development will be discussed. PMID:28066340

  3. Bacterial Iron–Sulfur Regulatory Proteins As Biological Sensor-Switches

    PubMed Central

    Crack, Jason C.; Green, Jeffrey; Hutchings, Matthew I.; Thomson, Andrew J.

    2012-01-01

    Abstract Significance: In recent years, bacterial iron–sulfur cluster proteins that function as regulators of gene transcription have emerged as a major new group. In all cases, the cluster acts as a sensor of the environment and enables the organism to adapt to the prevailing conditions. This can range from mounting a response to oxidative or nitrosative stress to switching between anaerobic and aerobic respiratory pathways. The sensitivity of these ancient cofactors to small molecule reactive oxygen and nitrogen species, in particular, makes them ideally suited to function as sensors. Recent Advances: An important challenge is to obtain mechanistic and structural information about how these regulators function and, in particular, how the chemistry occurring at the cluster drives the subsequent regulatory response. For several regulators, including FNR, SoxR, NsrR, IscR, and Wbl proteins, major advances in understanding have been gained recently and these are reviewed here. Critical Issues: A common theme emerging from these studies is that the sensitivity and specificity of the cluster of each regulatory protein must be exquisitely controlled by the protein environment of the cluster. Future Directions: A major future challenge is to determine, for a range of regulators, the key factors for achieving control of sensitivity/specificity. Such information will lead, eventually, to a system understanding of stress response, which often involves more than one regulator. Antioxid. Redox Signal. 17, 1215–1231. PMID:22239203

  4. Sequence-Specific Affinity Chromatography of Bacterial Small Regulatory RNA-Binding Proteins from Bacterial Cells.

    PubMed

    Gans, Jonathan; Osborne, Jonathan; Cheng, Juliet; Djapgne, Louise; Oglesby-Sherrouse, Amanda G

    2018-01-01

    Bacterial small RNA molecules (sRNAs) are increasingly recognized as central regulators of bacterial stress responses and pathogenesis. In many cases, RNA-binding proteins are critical for the stability and function of sRNAs. Previous studies have adopted strategies to genetically tag an sRNA of interest, allowing isolation of RNA-protein complexes from cells. Here we present a sequence-specific affinity purification protocol that requires no prior genetic manipulation of bacterial cells, allowing isolation of RNA-binding proteins bound to native RNA molecules.

  5. Detecting cis-regulatory binding sites for cooperatively binding proteins

    PubMed Central

    van Oeffelen, Liesbeth; Cornelis, Pierre; Van Delm, Wouter; De Ridder, Fedor; De Moor, Bart; Moreau, Yves

    2008-01-01

    Several methods are available to predict cis-regulatory modules in DNA based on position weight matrices. However, the performance of these methods generally depends on a number of additional parameters that cannot be derived from sequences and are difficult to estimate because they have no physical meaning. As the best way to detect cis-regulatory modules is the way in which the proteins recognize them, we developed a new scoring method that utilizes the underlying physical binding model. This method requires no additional parameter to account for multiple binding sites; and the only necessary parameters to model homotypic cooperative interactions are the distances between adjacent protein binding sites in basepairs, and the corresponding cooperative binding constants. The heterotypic cooperative binding model requires one more parameter per cooperatively binding protein, which is the concentration multiplied by the partition function of this protein. In a case study on the bacterial ferric uptake regulator, we show that our scoring method for homotypic cooperatively binding proteins significantly outperforms other PWM-based methods where biophysical cooperativity is not taken into account. PMID:18400778

  6. Dynamics of Bacterial Gene Regulatory Networks.

    PubMed

    Shis, David L; Bennett, Matthew R; Igoshin, Oleg A

    2018-05-20

    The ability of bacterial cells to adjust their gene expression program in response to environmental perturbation is often critical for their survival. Recent experimental advances allowing us to quantitatively record gene expression dynamics in single cells and in populations coupled with mathematical modeling enable mechanistic understanding on how these responses are shaped by the underlying regulatory networks. Here, we review how the combination of local and global factors affect dynamical responses of gene regulatory networks. Our goal is to discuss the general principles that allow extrapolation from a few model bacteria to less understood microbes. We emphasize that, in addition to well-studied effects of network architecture, network dynamics are shaped by global pleiotropic effects and cell physiology.

  7. Sequential Super-Resolution Imaging of Bacterial Regulatory Proteins: The Nucleoid and the Cell Membrane in Single, Fixed E. coli Cells.

    PubMed

    Spahn, Christoph; Glaesmann, Mathilda; Gao, Yunfeng; Foo, Yong Hwee; Lampe, Marko; Kenney, Linda J; Heilemann, Mike

    2017-01-01

    Despite their small size and the lack of compartmentalization, bacteria exhibit a striking degree of cellular organization, both in time and space. During the last decade, a group of new microscopy techniques emerged, termed super-resolution microscopy or nanoscopy, which facilitate visualizing the organization of proteins in bacteria at the nanoscale. Single-molecule localization microscopy (SMLM) is especially well suited to reveal a wide range of new information regarding protein organization, interaction, and dynamics in single bacterial cells. Recent developments in click chemistry facilitate the visualization of bacterial chromatin with a resolution of ~20 nm, providing valuable information about the ultrastructure of bacterial nucleoids, especially at short generation times. In this chapter, we describe a simple-to-realize protocol that allows determining precise structural information of bacterial nucleoids in fixed cells, using direct stochastic optical reconstruction microscopy (dSTORM). In combination with quantitative photoactivated localization microscopy (PALM), the spatial relationship of proteins with the bacterial chromosome can be studied. The position of a protein of interest with respect to the nucleoids and the cell cylinder can be visualized by super-resolving the membrane using point accumulation for imaging in nanoscale topography (PAINT). The combination of the different SMLM techniques in a sequential workflow maximizes the information that can be extracted from single cells, while maintaining optimal imaging conditions for each technique.

  8. Identifying Bacterial Immune Evasion Proteins Using Phage Display.

    PubMed

    Fevre, Cindy; Scheepmaker, Lisette; Haas, Pieter-Jan

    2017-01-01

    Methods aimed at identification of immune evasion proteins are mainly rely on in silico prediction of sequence, structural homology to known evasion proteins or use a proteomics driven approach. Although proven successful these methods are limited by a low efficiency and or lack of functional identification. Here we describe a high-throughput genomic strategy to functionally identify bacterial immune evasion proteins using phage display technology. Genomic bacterial DNA is randomly fragmented and ligated into a phage display vector that is used to create a phage display library expressing bacterial secreted and membrane bound proteins. This library is used to select displayed bacterial secretome proteins that interact with host immune components.

  9. Bacterial copper storage proteins.

    PubMed

    Dennison, Christopher; David, Sholto; Lee, Jaeick

    2018-03-30

    Copper is essential for most organisms as a cofactor for key enzymes involved in fundamental processes such as respiration and photosynthesis. However, copper also has toxic effects in cells, which is why eukaryotes and prokaryotes have evolved mechanisms for safe copper handling. A new family of bacterial proteins uses a Cys-rich four-helix bundle to safely store large quantities of Cu(I). The work leading to the discovery of these proteins, their properties and physiological functions, and how their presence potentially impacts the current views of bacterial copper handling and use are discussed in this review. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Bacterial Adaptation to Antibiotics through Regulatory RNAs.

    PubMed

    Felden, Brice; Cattoir, Vincent

    2018-05-01

    The extensive use of antibiotics has resulted in a situation where multidrug-resistant pathogens have become a severe menace to human health worldwide. A deeper understanding of the principles used by pathogens to adapt to, respond to, and resist antibiotics would pave the road to the discovery of drugs with novel mechanisms. For bacteria, antibiotics represent clinically relevant stresses that induce protective responses. The recent implication of regulatory RNAs (small RNAs [sRNAs]) in antibiotic response and resistance in several bacterial pathogens suggests that they should be considered innovative drug targets. This minireview discusses sRNA-mediated mechanisms exploited by bacterial pathogens to fight against antibiotics. A critical discussion of the newest findings in the field is provided, with emphasis on the implication of sRNAs in major mechanisms leading to antibiotic resistance, including drug uptake, active drug efflux, drug target modifications, biofilms, cell walls, and lipopolysaccharide (LPS) biosynthesis. Of interest is the lack of knowledge about sRNAs implicated in Gram-positive compared to Gram-negative bacterial resistance. Copyright © 2018 American Society for Microbiology.

  11. Transcriptional regulatory proteins as biosensing tools.

    PubMed

    Turner, Kendrick; Joel, Smita; Feliciano, Jessika; Feltus, Agatha; Pasini, Patrizia; Wynn, Daniel; Dau, Peter; Dikici, Emre; Deo, Sapna K; Daunert, Sylvia

    2017-06-22

    We have developed sensing systems employing different classes of transcriptional regulatory proteins genetically and chemically modified to incorporate a fluorescent reporter molecule for detection of arsenic, hydroxylated polychlorinated biphenyls (OH-PCBs), and cyclic AMP (cAMP). These are the first examples of optical sensing systems based on transcriptional regulatory proteins.

  12. Adaptation of Tri-molecular fluorescence complementation allows assaying of regulatory Csr RNA-protein interactions in bacteria.

    PubMed

    Gelderman, Grant; Sivakumar, Anusha; Lipp, Sarah; Contreras, Lydia

    2015-02-01

    sRNAs play a significant role in controlling and regulating cellular metabolism. One of the more interesting aspects of certain sRNAs is their ability to make global changes in the cell by interacting with regulatory proteins. In this work, we demonstrate the use of an in vivo Tri-molecular Fluorescence Complementation assay to detect and visualize the central regulatory sRNA-protein interaction of the Carbon Storage Regulatory system in E. coli. The Carbon Storage Regulator consists primarily of an RNA binding protein, CsrA, that alters the activity of mRNA targets and of an sRNA, CsrB, that modulates the activity of CsrA. We describe the construction of a fluorescence complementation system that detects the interactions between CsrB and CsrA. Additionally, we demonstrate that the intensity of the fluorescence of this system is able to detect changes in the affinity of the CsrB-CsrA interaction, as caused by mutations in the protein sequence of CsrA. While previous methods have adopted this technique to study mRNA or RNA localization, this is the first attempt to use this technique to study the sRNA-protein interaction directly in bacteria. This method presents a potentially powerful tool to study complex bacterial RNA protein interactions in vivo. © 2014 Wiley Periodicals, Inc.

  13. Bacterial Origin of a Mitochondrial Outer Membrane Protein Translocase

    PubMed Central

    Harsman, Anke; Niemann, Moritz; Pusnik, Mascha; Schmidt, Oliver; Burmann, Björn M.; Hiller, Sebastian; Meisinger, Chris; Schneider, André; Wagner, Richard

    2012-01-01

    Mitochondria are of bacterial ancestry and have to import most of their proteins from the cytosol. This process is mediated by Tom40, an essential protein that forms the protein-translocating pore in the outer mitochondrial membrane. Tom40 is conserved in virtually all eukaryotes, but its evolutionary origin is unclear because bacterial orthologues have not been identified so far. Recently, it was shown that the parasitic protozoon Trypanosoma brucei lacks a conventional Tom40 and instead employs the archaic translocase of the outer mitochondrial membrane (ATOM), a protein that shows similarities to both eukaryotic Tom40 and bacterial protein translocases of the Omp85 family. Here we present electrophysiological single channel data showing that ATOM forms a hydrophilic pore of large conductance and high open probability. Moreover, ATOM channels exhibit a preference for the passage of cationic molecules consistent with the idea that it may translocate unfolded proteins targeted by positively charged N-terminal presequences. This is further supported by the fact that the addition of a presequence peptide induces transient pore closure. An in-depth comparison of these single channel properties with those of other protein translocases reveals that ATOM closely resembles bacterial-type protein export channels rather than eukaryotic Tom40. Our results support the idea that ATOM represents an evolutionary intermediate between a bacterial Omp85-like protein export machinery and the conventional Tom40 that is found in mitochondria of other eukaryotes. PMID:22778261

  14. Bacterial ice crystal controlling proteins.

    PubMed

    Lorv, Janet S H; Rose, David R; Glick, Bernard R

    2014-01-01

    Across the world, many ice active bacteria utilize ice crystal controlling proteins for aid in freezing tolerance at subzero temperatures. Ice crystal controlling proteins include both antifreeze and ice nucleation proteins. Antifreeze proteins minimize freezing damage by inhibiting growth of large ice crystals, while ice nucleation proteins induce formation of embryonic ice crystals. Although both protein classes have differing functions, these proteins use the same ice binding mechanisms. Rather than direct binding, it is probable that these protein classes create an ice surface prior to ice crystal surface adsorption. Function is differentiated by molecular size of the protein. This paper reviews the similar and different aspects of bacterial antifreeze and ice nucleation proteins, the role of these proteins in freezing tolerance, prevalence of these proteins in psychrophiles, and current mechanisms of protein-ice interactions.

  15. Bacterial Ice Crystal Controlling Proteins

    PubMed Central

    Lorv, Janet S. H.; Rose, David R.; Glick, Bernard R.

    2014-01-01

    Across the world, many ice active bacteria utilize ice crystal controlling proteins for aid in freezing tolerance at subzero temperatures. Ice crystal controlling proteins include both antifreeze and ice nucleation proteins. Antifreeze proteins minimize freezing damage by inhibiting growth of large ice crystals, while ice nucleation proteins induce formation of embryonic ice crystals. Although both protein classes have differing functions, these proteins use the same ice binding mechanisms. Rather than direct binding, it is probable that these protein classes create an ice surface prior to ice crystal surface adsorption. Function is differentiated by molecular size of the protein. This paper reviews the similar and different aspects of bacterial antifreeze and ice nucleation proteins, the role of these proteins in freezing tolerance, prevalence of these proteins in psychrophiles, and current mechanisms of protein-ice interactions. PMID:24579057

  16. Spectroscopic studies on peptides and proteins with cysteine-containing heme regulatory motifs (HRM).

    PubMed

    Schubert, Erik; Florin, Nicole; Duthie, Fraser; Henning Brewitz, H; Kühl, Toni; Imhof, Diana; Hagelueken, Gregor; Schiemann, Olav

    2015-07-01

    The role of heme as a cofactor in enzymatic reactions has been studied for a long time and in great detail. Recently it was discovered that heme can also serve as a signalling molecule in cells but so far only few examples of this regulation have been studied. In order to discover new potentially heme-regulated proteins, we screened protein sequence databases for bacterial proteins that contain sequence features like a Cysteine-Proline (CP) motif, which is known for its heme-binding propensity. Based on this search we synthesized a series of these potential heme regulatory motifs (HRMs). We used cw EPR spectroscopy to investigate whether these sequences do indeed bind to heme and if the spin state of heme is changed upon interaction with the peptides. The corresponding proteins of two potential HRMs, FeoB and GlpF, were expressed and purified and their interaction with heme was studied by cw EPR and UV-Visible (UV-Vis) spectroscopy. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. The Role of Bacterial Enhancer Binding Proteins as Specialized Activators of σ54-Dependent Transcription

    PubMed Central

    2012-01-01

    Summary: Bacterial enhancer binding proteins (bEBPs) are transcriptional activators that assemble as hexameric rings in their active forms and utilize ATP hydrolysis to remodel the conformation of RNA polymerase containing the alternative sigma factor σ54. We present a comprehensive and detailed summary of recent advances in our understanding of how these specialized molecular machines function. The review is structured by introducing each of the three domains in turn: the central catalytic domain, the N-terminal regulatory domain, and the C-terminal DNA binding domain. The role of the central catalytic domain is presented with particular reference to (i) oligomerization, (ii) ATP hydrolysis, and (iii) the key GAFTGA motif that contacts σ54 for remodeling. Each of these functions forms a potential target of the signal-sensing N-terminal regulatory domain, which can act either positively or negatively to control the activation of σ54-dependent transcription. Finally, we focus on the DNA binding function of the C-terminal domain and the enhancer sites to which it binds. Particular attention is paid to the importance of σ54 to the bacterial cell and its unique role in regulating transcription. PMID:22933558

  18. Trans‐acting translational regulatory RNA binding proteins

    PubMed Central

    Harvey, Robert F.; Smith, Tom S.; Mulroney, Thomas; Queiroz, Rayner M. L.; Pizzinga, Mariavittoria; Dezi, Veronica; Villenueva, Eneko; Ramakrishna, Manasa

    2018-01-01

    The canonical molecular machinery required for global mRNA translation and its control has been well defined, with distinct sets of proteins involved in the processes of translation initiation, elongation and termination. Additionally, noncanonical, trans‐acting regulatory RNA‐binding proteins (RBPs) are necessary to provide mRNA‐specific translation, and these interact with 5′ and 3′ untranslated regions and coding regions of mRNA to regulate ribosome recruitment and transit. Recently it has also been demonstrated that trans‐acting ribosomal proteins direct the translation of specific mRNAs. Importantly, it has been shown that subsets of RBPs often work in concert, forming distinct regulatory complexes upon different cellular perturbation, creating an RBP combinatorial code, which through the translation of specific subsets of mRNAs, dictate cell fate. With the development of new methodologies, a plethora of novel RNA binding proteins have recently been identified, although the function of many of these proteins within mRNA translation is unknown. In this review we will discuss these methodologies and their shortcomings when applied to the study of translation, which need to be addressed to enable a better understanding of trans‐acting translational regulatory proteins. Moreover, we discuss the protein domains that are responsible for RNA binding as well as the RNA motifs to which they bind, and the role of trans‐acting ribosomal proteins in directing the translation of specific mRNAs. This article is categorized under: 1RNA Interactions with Proteins and Other Molecules > RNA–Protein Complexes2Translation > Translation Regulation3Translation > Translation Mechanisms PMID:29341429

  19. Trans-acting translational regulatory RNA binding proteins.

    PubMed

    Harvey, Robert F; Smith, Tom S; Mulroney, Thomas; Queiroz, Rayner M L; Pizzinga, Mariavittoria; Dezi, Veronica; Villenueva, Eneko; Ramakrishna, Manasa; Lilley, Kathryn S; Willis, Anne E

    2018-05-01

    The canonical molecular machinery required for global mRNA translation and its control has been well defined, with distinct sets of proteins involved in the processes of translation initiation, elongation and termination. Additionally, noncanonical, trans-acting regulatory RNA-binding proteins (RBPs) are necessary to provide mRNA-specific translation, and these interact with 5' and 3' untranslated regions and coding regions of mRNA to regulate ribosome recruitment and transit. Recently it has also been demonstrated that trans-acting ribosomal proteins direct the translation of specific mRNAs. Importantly, it has been shown that subsets of RBPs often work in concert, forming distinct regulatory complexes upon different cellular perturbation, creating an RBP combinatorial code, which through the translation of specific subsets of mRNAs, dictate cell fate. With the development of new methodologies, a plethora of novel RNA binding proteins have recently been identified, although the function of many of these proteins within mRNA translation is unknown. In this review we will discuss these methodologies and their shortcomings when applied to the study of translation, which need to be addressed to enable a better understanding of trans-acting translational regulatory proteins. Moreover, we discuss the protein domains that are responsible for RNA binding as well as the RNA motifs to which they bind, and the role of trans-acting ribosomal proteins in directing the translation of specific mRNAs. This article is categorized under: RNA Interactions with Proteins and Other Molecules > RNA-Protein Complexes Translation > Translation Regulation Translation > Translation Mechanisms. © 2018 Medical Research Council and University of Cambridge. WIREs RNA published by Wiley Periodicals, Inc.

  20. Engineered fluorescent proteins illuminate the bacterial periplasm

    PubMed Central

    Dammeyer, Thorben; Tinnefeld, Philip

    2012-01-01

    The bacterial periplasm is of special interest whenever cell factories are designed and engineered. Recombinantely produced proteins are targeted to the periplasmic space of Gram negative bacteria to take advantage of the authentic N-termini, disulfide bridge formation and easy accessibility for purification with less contaminating cellular proteins. The oxidizing environment of the periplasm promotes disulfide bridge formation - a prerequisite for proper folding of many proteins into their active conformation. In contrast, the most popular reporter protein in all of cell biology, Green Fluorescent Protein (GFP), remains inactive if translocated to the periplasmic space prior to folding. Here, the self-catalyzed chromophore maturation is blocked by formation of covalent oligomers via interchain disulfide bonds in the oxidizing environment. However, different protein engineering approaches addressing folding and stability of GFP resulted in improved proteins with enhanced folding properties. Recent studies describe GFP variants that are not only active if translocated in their folded form via the twin-arginine translocation (Tat) pathway, but actively fold in the periplasm following general secretory pathway (Sec) and signal recognition particle (SRP) mediated secretion. This mini-review highlights the progress that enables new insights into bacterial export and periplasmic protein organization, as well as new biotechnological applications combining the advantages of the periplasmic production and the Aequorea-based fluorescent reporter proteins. PMID:24688673

  1. N-Glycosylation of Campylobacter jejuni Surface Proteins Promotes Bacterial Fitness

    PubMed Central

    Nothaft, Harald; Zheng, Jing

    2013-01-01

    Campylobacter jejuni is the etiologic agent of human bacterial gastroenteritis worldwide. In contrast, despite heavy colonization, C. jejuni maintains a commensal mode of existence in chickens. The consumption of contaminated chicken products is thought to be the principal mode of C. jejuni transmission to the human population. C. jejuni harbors a system for N-linked protein glycosylation that has been well characterized and modifies more than 60 periplasmic and membrane-bound proteins. However, the precise role of this modification in the biology of C. jejuni remains unexplored. We hypothesized that the N-glycans protect C. jejuni surface proteins from the action of gut proteases. The C. jejuni pglB mutant, deficient in the expression of the oligosaccharyltransferase, exhibited reduced growth in medium supplemented with chicken cecal contents (CCC) compared with that of wild-type (WT) cells. Inactivation of the cecal proteases by heat treatment or with protease inhibitors completely restored bacterial viability and partially rescued bacterial growth. Physiological concentrations of trypsin, but not chymotrypsin, also reduced C. jejuni pglB mutant CFU. Live or dead staining indicated that CCC preferentially influenced C. jejuni growth as opposed to bacterial viability. We identified multiple chicken cecal proteases by mass fingerprinting. The use of protease inhibitors that target specific classes indicated that both metalloproteases and serine proteases were involved in the attenuated growth of the oligosaccharyltransferase mutant. In conclusion, protein N-linked glycosylation of surface proteins may enhance C. jejuni fitness by protecting bacterial proteins from cleavage due to gut proteases. PMID:23460522

  2. Computational Analysis of Uncharacterized Proteins of Environmental Bacterial Genome

    NASA Astrophysics Data System (ADS)

    Coxe, K. J.; Kumar, M.

    2017-12-01

    Betaproteobacteria strain CB is a gram-negative bacterium in the phylum Proteobacteria and are found naturally in soil and water. In this complex environment, bacteria play a key role in efficiently eliminating the organic material and other pollutants from wastewater. To investigate the process of pollutant removal from wastewater using bacteria, it is important to characterize the proteins encoded by the bacterial genome. Our study combines a number of bioinformatics tools to predict the function of unassigned proteins in the bacterial genome. The genome of Betaproteobacteria strain CB contains 2,112 proteins in which function of 508 proteins are unknown, termed as uncharacterized proteins (UPs). The localization of the UPs with in the cell was determined and the structure of 38 UPs was accurately predicted. These UPs were predicted to belong to various classes of proteins such as enzymes, transporters, binding proteins, signal peptides, transmembrane proteins and other proteins. The outcome of this work will help better understand wastewater treatment mechanism.

  3. Interactome of E. piscicida and grouper liver proteins reveals strategies of bacterial infection and host immune response.

    PubMed

    Li, Hui; Zhu, Qing-Feng; Peng, Xuan-Xian; Peng, Bo

    2017-01-03

    The occurrence of infectious diseases is related to heterogeneous protein interactions between a host and a microbe. Therefore, elucidating the host-pathogen interplay is essential. We previously revealed the protein interactome between Edwardsiella piscicida and fish gill cells, and the present study identified the protein interactome between E. piscicida and E. drummondhayi liver cells. E. drummondhayi liver cells and bacterial pull-down approaches were used to identify E. piscicida outer membrane proteins that bind to liver cells and fish liver cell proteins that interact with bacterial cells, respectively. Eight bacterial proteins and 11 fish proteins were characterized. Heterogeneous protein-protein interactions between these bacterial cells and fish liver cells were investigated through far-Western blotting and co-immunoprecipitation. A network was constructed based on 42 heterogeneous protein-protein interactions between seven bacterial proteins and 10 fish proteins. A comparison of the new interactome with the previously reported interactome showed that four bacterial proteins overlapped, whereas all of the identified fish proteins were new, suggesting a difference between bacterial tricks for evading host immunity and the host strategy for combating bacterial infection. Furthermore, these bacterial proteins were found to regulate the expression of host innate immune-related proteins. These findings indicate that the interactome contributes to bacterial infection and host immunity.

  4. Comparison of the structural basis for thermal stability between archaeal and bacterial proteins.

    PubMed

    Ding, Yanrui; Cai, Yujie; Han, Yonggang; Zhao, Bingqiang

    2012-01-01

    In this study, the structural basis for thermal stability in archaeal and bacterial proteins was investigated. There were many common factors that confer resistance to high temperature in both archaeal and bacterial proteins. These factors include increases in the Lys content, the bends and blanks of secondary structure, the Glu content of salt bridge; decreases in the number of main-side chain hydrogen bond and exposed surface area, and changes in the bends and blanks of amino acids. Certainly, the utilization of charged amino acids to form salt bridges is a primary factor. In both heat-resistant archaeal and bacterial proteins, most Glu and Asp participate in the formation of salt bridges. Other factors may influence either archaeal or bacterial protein thermostability, which includes the more frequent occurrence of shorter 3(10)-helices and increased hydrophobicity in heat-resistant archaeal proteins. However, there were increases in average helix length, the Glu content in salt bridges, temperature factors and decreases in the number of main-side chain hydrogen bonds, uncharged-uncharged hydrogen bonds, hydrophobicity, and buried and exposed polar surface area in heat-resistant bacterial proteins. Evidently, there are few similarities and many disparities between the heat-resistant mechanisms of archaeal and bacterial proteins.

  5. Learning about protein solubility from bacterial inclusion bodies

    PubMed Central

    Martínez-Alonso, Mónica; González-Montalbán, Nuria; García-Fruitós, Elena; Villaverde, Antonio

    2009-01-01

    The progressive solving of the conformation of aggregated proteins and the conceptual understanding of the biology of inclusion bodies in recombinant bacteria is providing exciting insights on protein folding and quality. Interestingly, newest data also show an unexpected functional and structural complexity of soluble recombinant protein species and picture the whole bacterial cell factory scenario as more intricate than formerly believed. PMID:19133126

  6. Feast/famine regulatory proteins (FFRPs): Escherichia coli Lrp, AsnC and related archaeal transcription factors.

    PubMed

    Yokoyama, Katsushi; Ishijima, Sanae A; Clowney, Lester; Koike, Hideaki; Aramaki, Hironori; Tanaka, Chikako; Makino, Kozo; Suzuki, Masashi

    2006-01-01

    Feast/famine regulatory proteins comprise a diverse family of transcription factors, which have been referred to in various individual identifications, including Escherichia coli leucine-responsive regulatory protein and asparagine synthase C gene product. A full length feast/famine regulatory protein consists of the N-terminal DNA-binding domain and the C-domain, which is involved in dimerization and further assembly, thereby producing, for example, a disc or a chromatin-like cylinder. Various ligands of the size of amino acids bind at the interface between feast/famine regulatory protein dimers, thereby altering their assembly forms. Also, the combination of feast/famine regulatory protein subunits forming the same assembly is altered. In this way, a small number of feast/famine regulatory proteins are able to regulate a large number of genes in response to various environmental changes. Because feast/famine regulatory proteins are shared by archaea and eubacteria, the genome-wide regulation by feast/famine regulatory proteins is traceable back to their common ancestor, being the prototype of highly differentiated transcription regulatory mechanisms found in organisms nowadays.

  7. Rehosting of Bacterial Chaperones for High-Quality Protein Production▿

    PubMed Central

    Martínez-Alonso, Mónica; Toledo-Rubio, Verónica; Noad, Rob; Unzueta, Ugutz; Ferrer-Miralles, Neus; Roy, Polly; Villaverde, Antonio

    2009-01-01

    Coproduction of DnaK/DnaJ in Escherichia coli enhances solubility but promotes proteolytic degradation of their substrates, minimizing the yield of unstable polypeptides. Higher eukaryotes have orthologs of DnaK/DnaJ but lack the linked bacterial proteolytic system. By coexpression of DnaK and DnaJ in insect cells with inherently misfolding-prone recombinant proteins, we demonstrate simultaneous improvement of soluble protein yield and quality and proteolytic stability. Thus, undesired side effects of bacterial folding modulators can be avoided by appropriate rehosting in heterologous cell expression systems. PMID:19820142

  8. Bacterial collagen-like proteins that form triple-helical structures

    PubMed Central

    Yu, Zhuoxin; An, Bo; Ramshaw, John A.M.; Brodsky, Barbara

    2014-01-01

    A large number of collagen-like proteins have been identified in bacteria during the past ten years, principally from analysis of genome databases. These bacterial collagens share the distinctive Gly-Xaa-Yaa repeating amino acid sequence of animal collagens which underlies their unique triple-helical structure. A number of the bacterial collagens have been expressed in E. coli, and they all adopt a triple-helix conformation. Unlike animal collagens, these bacterial proteins do not contain the post-translationally modified amino acid, hydroxyproline, which is known to stabilize the triple-helix structure and may promote self-assembly. Despite the absence of collagen hydroxylation, the triple-helix structures of the bacterial collagens studied exhibit a high thermal stability of 35–39 °C, close to that seen for mammalian collagens. These bacterial collagens are readily produced in large quantities by recombinant methods, either in the original amino acid sequence or in genetically manipulated sequences. This new family of recombinant, easy to modify collagens could provide a novel system for investigating structural and functional motifs in animal collagens and could also form the basis of new biomedical materials with designed structural properties and functions. PMID:24434612

  9. C-reactive Protein Versus Neutrophil/lymphocyte Ratio in Differentiating Bacterial and Non-bacterial Pneumonia in Children.

    PubMed

    Gauchan, E; Adhikari, S

    2016-09-01

    Pneumonia is a leading cause of childhood mortality in a low resource country. Simple laboratory markers can help differentiate between bacterial and non-bacterial pneumonias for appropriate management. In children aged one to 60 months with features of lower respiratory infection, C-reactive protein (CRP) and neutrophil-lymphocyte ratio (NLR) were used to differentiate between bacterial and non-bacterial pneumonias. The cutoff values for detecting bacterial pneumonias were evaluated by statistical tools. Bacterial pneumonia was diagnosed in 285 (43.6%) children out of 654 studied. At a cut-off value of 36 mg/L CRP was predictive of bacterial pneumonias with sensitivity and specificity of 61.8% and 91.3% respectively while the sensitivity and specificity for predicting bacterial pneumonia using NLR was 45.6% and 64% respectively with 1.28 used as a cut-off. Our study shows that CRP is superior to NLR in differentiating bacterial from non-bacterial pneumonias in children.

  10. Ribosome reinitiation at leader peptides increases translation of bacterial proteins.

    PubMed

    Korolev, Semen A; Zverkov, Oleg A; Seliverstov, Alexandr V; Lyubetsky, Vassily A

    2016-04-16

    Short leader genes usually do not encode stable proteins, although their importance in expression control of bacterial genomes is widely accepted. Such genes are often involved in the control of attenuation regulation. However, the abundance of leader genes suggests that their role in bacteria is not limited to regulation. Specifically, we hypothesize that leader genes increase the expression of protein-coding (structural) genes via ribosome reinitiation at the leader peptide in the case of a short distance between the stop codon of the leader gene and the start codon of the structural gene. For instance, in Actinobacteria, the frequency of leader genes at a distance of 10-11 bp is about 70 % higher than the mean frequency within the 1 to 65 bp range; and it gradually decreases as the range grows longer. A pronounced peak of this frequency-distance relationship is also observed in Proteobacteria, Bacteroidetes, Spirochaetales, Acidobacteria, the Deinococcus-Thermus group, and Planctomycetes. In contrast, this peak falls to the distance of 15-16 bp and is not very pronounced in Firmicutes; and no such peak is observed in cyanobacteria and tenericutes. Generally, this peak is typical for many bacteria. Some leader genes located close to a structural gene probably play a regulatory role as well.

  11. The crystal structure of a bacterial Sufu-like protein defines a novel group of bacterial proteins that are similar to the N-terminal domain of human Sufu

    PubMed Central

    Das, Debanu; Finn, Robert D; Abdubek, Polat; Astakhova, Tamara; Axelrod, Herbert L; Bakolitsa, Constantina; Cai, Xiaohui; Carlton, Dennis; Chen, Connie; Chiu, Hsiu-Ju; Chiu, Michelle; Clayton, Thomas; Deller, Marc C; Duan, Lian; Ellrott, Kyle; Farr, Carol L; Feuerhelm, Julie; Grant, Joanna C; Grzechnik, Anna; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K; Klock, Heath E; Knuth, Mark W; Kozbial, Piotr; Sri Krishna, S; Kumar, Abhinav; Lam, Winnie W; Marciano, David; Miller, Mitchell D; Morse, Andrew T; Nigoghossian, Edward; Nopakun, Amanda; Okach, Linda; Puckett, Christina; Reyes, Ron; Tien, Henry J; Trame, Christine B; van den Bedem, Henry; Weekes, Dana; Wooten, Tiffany; Xu, Qingping; Yeh, Andrew; Zhou, Jiadong; Hodgson, Keith O; Wooley, John; Elsliger, Marc-André; Deacon, Ashley M; Godzik, Adam; Lesley, Scott A; Wilson, Ian A

    2010-01-01

    Sufu (Suppressor of Fused), a two-domain protein, plays a critical role in regulating Hedgehog signaling and is conserved from flies to humans. A few bacterial Sufu-like proteins have previously been identified based on sequence similarity to the N-terminal domain of eukaryotic Sufu proteins, but none have been structurally or biochemically characterized and their function in bacteria is unknown. We have determined the crystal structure of a more distantly related Sufu-like homolog, NGO1391 from Neisseria gonorrhoeae, at 1.4 Å resolution, which provides the first biophysical characterization of a bacterial Sufu-like protein. The structure revealed a striking similarity to the N-terminal domain of human Sufu (r.m.s.d. of 2.6 Å over 93% of the NGO1391 protein), despite an extremely low sequence identity of ∼15%. Subsequent sequence analysis revealed that NGO1391 defines a new subset of smaller, Sufu-like proteins that are present in ∼200 bacterial species and has resulted in expansion of the SUFU (PF05076) family in Pfam. PMID:20836087

  12. Factors affecting the rate of breakdown of bacterial protein in rumen fluid.

    PubMed

    Wallace, R J; McPherson, C A

    1987-09-01

    1. The cellular proteins of Butyrivibrio fibrisolvens, Lactobacillus casei, Megasphaera elsdenii, Selenomonas ruminantium and Streptococcus bovis were labelled by growth in the presence of L-[14C]leucine, and the breakdown of labelled protein was measured in incubations of these bacteria with rumen fluid to which unlabelled 5 mM-L-leucine was added. The rate of protein breakdown was estimated from the rate of release of radioactivity into acid-soluble material. 2. Protein breakdown occurred at different rates in different species. The mean rates for B. fibrisolvens, L. casei, M. elsdenii, Sel. ruminantium and Str. bovis were 28.6, 18.1, 17.7, 10.5 and 5.3%/h respectively in samples of strained rumen fluid (SRF) with different protozoal populations. Rates of 3%/h or less were found in SRF from ciliate-free sheep or in faunated SRF from which protozoa had been removed by centrifugation. Further removal of mixed rumen bacteria had little effect. Suspensions of washed protozoa degraded bacterial protein at rates which were of the same order as those found in SRF. 3. The rate of breakdown of bacterial protein in different samples of SRF tended to increase as the numbers of small entodiniomorphid protozoa increased. The numbers of larger entodiniomorphs and holotrichs had no obvious influence on this rate. 4. Autoclaved and u.v.-treated bacteria were generally no different from live bacteria in their susceptibility to breakdown in SRF from faunated sheep, indicating that endogenous protein turnover was not a significant cause of bacterial protein catabolism. 5. The rate of bacterial protein breakdown was unrelated to the proteolytic activity of SRF. 6. It was concluded that predation by small protozoa is by far the most important cause of bacterial protein turnover in the rumen, with autolysis, other lytic factors and endogenous proteolysis being of minor importance.

  13. Bacterial Serine/Threonine Protein Kinases in Host-Pathogen Interactions*

    PubMed Central

    Canova, Marc J.; Molle, Virginie

    2014-01-01

    In bacterial pathogenesis, monitoring and adapting to the dynamically changing environment in the host and an ability to disrupt host immune responses are critical. The virulence determinants of pathogenic bacteria include the sensor/signaling proteins of the serine/threonine protein kinase (STPK) family that have a dual role of sensing the environment and subverting specific host defense processes. STPKs can sense a wide range of signals and coordinate multiple cellular processes to mount an appropriate response. Here, we review some of the well studied bacterial STPKs that are essential virulence factors and that modify global host responses during infection. PMID:24554701

  14. Bacterial serine/threonine protein kinases in host-pathogen interactions.

    PubMed

    Canova, Marc J; Molle, Virginie

    2014-04-04

    In bacterial pathogenesis, monitoring and adapting to the dynamically changing environment in the host and an ability to disrupt host immune responses are critical. The virulence determinants of pathogenic bacteria include the sensor/signaling proteins of the serine/threonine protein kinase (STPK) family that have a dual role of sensing the environment and subverting specific host defense processes. STPKs can sense a wide range of signals and coordinate multiple cellular processes to mount an appropriate response. Here, we review some of the well studied bacterial STPKs that are essential virulence factors and that modify global host responses during infection.

  15. The effect of temperature and bacterial growth phase on protein extraction by means of electroporation.

    PubMed

    Haberl-Meglič, Saša; Levičnik, Eva; Luengo, Elisa; Raso, Javier; Miklavčič, Damijan

    2016-12-01

    Different chemical and physical methods are used for extraction of proteins from bacteria, which are used in variety of fields. But on a large scale, many methods have severe drawbacks. Recently, extraction by means of electroporation showed a great potential to quickly obtain proteins from bacteria. Since many parameters are affecting the yield of extracted proteins, our aim was to investigate the effect of temperature and bacterial growth phase on the yield of extracted proteins. At the same time bacterial viability was tested. Our results showed that the temperature has a great effect on protein extraction, the best temperature post treatment being 4°C. No effect on bacterial viability was observed for all temperatures tested. Also bacterial growth phase did not affect the yield of extracted proteins or bacterial viability. Nevertheless, further experiments may need to be performed to confirm this observation, since only one incubation temperature (4°C) and one incubation time before and after electroporation (0.5 and 1h) were tested for bacterial growth phase. Based on our results we conclude that temperature is a key element for bacterial membrane to stay in a permeabilized state, so more proteins flow out of bacteria into surrounding media. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Advantages of mixing bioinformatics and visualization approaches for analyzing sRNA-mediated regulatory bacterial networks

    PubMed Central

    Bourqui, Romain; Benchimol, William; Gaspin, Christine; Sirand-Pugnet, Pascal; Uricaru, Raluca; Dutour, Isabelle

    2015-01-01

    The revolution in high-throughput sequencing technologies has enabled the acquisition of gigabytes of RNA sequences in many different conditions and has highlighted an unexpected number of small RNAs (sRNAs) in bacteria. Ongoing exploitation of these data enables numerous applications for investigating bacterial transacting sRNA-mediated regulation networks. Focusing on sRNAs that regulate mRNA translation in trans, recent works have noted several sRNA-based regulatory pathways that are essential for key cellular processes. Although the number of known bacterial sRNAs is increasing, the experimental validation of their interactions with mRNA targets remains challenging and involves expensive and time-consuming experimental strategies. Hence, bioinformatics is crucial for selecting and prioritizing candidates before designing any experimental work. However, current software for target prediction produces a prohibitive number of candidates because of the lack of biological knowledge regarding the rules governing sRNA–mRNA interactions. Therefore, there is a real need to develop new approaches to help biologists focus on the most promising predicted sRNA–mRNA interactions. In this perspective, this review aims at presenting the advantages of mixing bioinformatics and visualization approaches for analyzing predicted sRNA-mediated regulatory bacterial networks. PMID:25477348

  17. Advantages of mixing bioinformatics and visualization approaches for analyzing sRNA-mediated regulatory bacterial networks.

    PubMed

    Thébault, Patricia; Bourqui, Romain; Benchimol, William; Gaspin, Christine; Sirand-Pugnet, Pascal; Uricaru, Raluca; Dutour, Isabelle

    2015-09-01

    The revolution in high-throughput sequencing technologies has enabled the acquisition of gigabytes of RNA sequences in many different conditions and has highlighted an unexpected number of small RNAs (sRNAs) in bacteria. Ongoing exploitation of these data enables numerous applications for investigating bacterial transacting sRNA-mediated regulation networks. Focusing on sRNAs that regulate mRNA translation in trans, recent works have noted several sRNA-based regulatory pathways that are essential for key cellular processes. Although the number of known bacterial sRNAs is increasing, the experimental validation of their interactions with mRNA targets remains challenging and involves expensive and time-consuming experimental strategies. Hence, bioinformatics is crucial for selecting and prioritizing candidates before designing any experimental work. However, current software for target prediction produces a prohibitive number of candidates because of the lack of biological knowledge regarding the rules governing sRNA-mRNA interactions. Therefore, there is a real need to develop new approaches to help biologists focus on the most promising predicted sRNA-mRNA interactions. In this perspective, this review aims at presenting the advantages of mixing bioinformatics and visualization approaches for analyzing predicted sRNA-mediated regulatory bacterial networks. © The Author 2014. Published by Oxford University Press.

  18. Direct and Indirect Targeting of PP2A by Conserved Bacterial Type-III Effector Proteins

    PubMed Central

    Jin, Lin; Ham, Jong Hyun; Hage, Rosemary; Zhao, Wanying; Soto-Hernández, Jaricelis; Lee, Sang Yeol; Paek, Seung-Mann; Kim, Min Gab; Boone, Charles; Coplin, David L.; Mackey, David

    2016-01-01

    Bacterial AvrE-family Type-III effector proteins (T3Es) contribute significantly to the virulence of plant-pathogenic species of Pseudomonas, Pantoea, Ralstonia, Erwinia, Dickeya and Pectobacterium, with hosts ranging from monocots to dicots. However, the mode of action of AvrE-family T3Es remains enigmatic, due in large part to their toxicity when expressed in plant or yeast cells. To search for targets of WtsE, an AvrE-family T3E from the maize pathogen Pantoea stewartii subsp. stewartii, we employed a yeast-two-hybrid screen with non-lethal fragments of WtsE and a synthetic genetic array with full-length WtsE. Together these screens indicate that WtsE targets maize protein phosphatase 2A (PP2A) heterotrimeric enzyme complexes via direct interaction with B’ regulatory subunits. AvrE1, another AvrE-family T3E from Pseudomonas syringae pv. tomato strain DC3000 (Pto DC3000), associates with specific PP2A B’ subunit proteins from its susceptible host Arabidopsis that are homologous to the maize B’ subunits shown to interact with WtsE. Additionally, AvrE1 was observed to associate with the WtsE-interacting maize proteins, indicating that PP2A B’ subunits are likely conserved targets of AvrE-family T3Es. Notably, the ability of AvrE1 to promote bacterial growth and/or suppress callose deposition was compromised in Arabidopsis plants with mutations of PP2A genes. Also, chemical inhibition of PP2A activity blocked the virulence activity of both WtsE and AvrE1 in planta. The function of HopM1, a Pto DC3000 T3E that is functionally redundant to AvrE1, was also impaired in specific PP2A mutant lines, although no direct interaction with B’ subunits was observed. These results indicate that sub-component specific PP2A complexes are targeted by bacterial T3Es, including direct targeting by members of the widely conserved AvrE-family. PMID:27191168

  19. Identification of regulatory targets for the bacterial Nus factor complex.

    PubMed

    Baniulyte, Gabriele; Singh, Navjot; Benoit, Courtney; Johnson, Richard; Ferguson, Robert; Paramo, Mauricio; Stringer, Anne M; Scott, Ashley; Lapierre, Pascal; Wade, Joseph T

    2017-12-11

    Nus factors are broadly conserved across bacterial species, and are often essential for viability. A complex of five Nus factors (NusB, NusE, NusA, NusG and SuhB) is considered to be a dedicated regulator of ribosomal RNA folding, and has been shown to prevent Rho-dependent transcription termination. Here, we identify an additional cellular function for the Nus factor complex in Escherichia coli: repression of the Nus factor-encoding gene, suhB. This repression occurs primarily by translation inhibition, followed by Rho-dependent transcription termination. Thus, the Nus factor complex can prevent or promote Rho activity depending on the gene context. Conservation of putative NusB/E binding sites upstream of Nus factor genes suggests that Nus factor autoregulation occurs in many bacterial species. Additionally, many putative NusB/E binding sites are also found upstream of other genes in diverse species, and we demonstrate Nus factor regulation of one such gene in Citrobacter koseri. We conclude that Nus factors have an evolutionarily widespread regulatory function beyond ribosomal RNA, and that they are often autoregulatory.

  20. Bacterial-like PPP protein phosphatases: novel sequence alterations in pathogenic eukaryotes and peculiar features of bacterial sequence similarity.

    PubMed

    Kerk, David; Uhrig, R Glen; Moorhead, Greg B

    2013-01-01

    Reversible phosphorylation is a widespread modification affecting the great majority of eukaryotic cellular proteins, and whose effects influence nearly every cellular function. Protein phosphatases are increasingly recognized as exquisitely regulated contributors to these changes. The PPP (phosphoprotein phosphatase) family comprises enzymes, which catalyze dephosphorylation at serine and threonine residues. Nearly a decade ago, "bacterial-like" enzymes were recognized with similarity to proteins from various bacterial sources: SLPs (Shewanella-like phosphatases), RLPHs (Rhizobiales-like phosphatases), and ALPHs (ApaH-like phosphatases). A recent article from our laboratory appearing in Plant Physiology characterizes their extensive organismal distribution, abundance in plant species, predicted subcellular localization, motif organization, and sequence evolution. One salient observation is the distinct evolutionary trajectory followed by SLP genes and proteins in photosynthetic eukaryotes vs. animal and plant pathogens derived from photosynthetic ancestors. We present here a closer look at sequence data that emphasizes the distinctiveness of pathogen SLP proteins and that suggests that they might represent novel drug targets. A second observation in our original report was the high degree of similarity between the bacterial-like PPPs of eukaryotes and closely related proteins of the "eukaryotic-like" phyla Myxococcales and Planctomycetes. We here reflect on the possible implications of these observations and their importance for future research.

  1. The Regulatory Protein RosR Affects Rhizobium leguminosarum bv. trifolii Protein Profiles, Cell Surface Properties, and Symbiosis with Clover

    PubMed Central

    Rachwał, Kamila; Boguszewska, Aleksandra; Kopcińska, Joanna; Karaś, Magdalena; Tchórzewski, Marek; Janczarek, Monika

    2016-01-01

    Rhizobium leguminosarum bv. trifolii is capable of establishing a symbiotic relationship with plants from the genus Trifolium. Previously, a regulatory protein encoded by rosR was identified and characterized in this bacterium. RosR possesses a Cys2-His2-type zinc finger motif and belongs to Ros/MucR family of rhizobial transcriptional regulators. Transcriptome profiling of the rosR mutant revealed a role of this protein in several cellular processes, including the synthesis of cell-surface components and polysaccharides, motility, and bacterial metabolism. Here, we show that a mutation in rosR resulted in considerable changes in R. leguminosarum bv. trifolii protein profiles. Extracellular, membrane, and periplasmic protein profiles of R. leguminosarum bv. trifolii wild type and the rosR mutant were examined, and proteins with substantially different abundances between these strains were identified. Compared with the wild type, extracellular fraction of the rosR mutant contained greater amounts of several proteins, including Ca2+-binding cadherin-like proteins, a RTX-like protein, autoaggregation protein RapA1, and flagellins FlaA and FlaB. In contrast, several proteins involved in the uptake of various substrates were less abundant in the mutant strain (DppA, BraC, and SfuA). In addition, differences were observed in membrane proteins of the mutant and wild-type strains, which mainly concerned various transport system components. Using atomic force microscopy (AFM) imaging, we characterized the topography and surface properties of the rosR mutant and wild-type cells. We found that the mutation in rosR gene also affected surface properties of R. leguminosarum bv. trifolii. The mutant cells were significantly more hydrophobic than the wild-type cells, and their outer membrane was three times more permeable to the hydrophobic dye N-phenyl-1-naphthylamine. The mutation of rosR also caused defects in bacterial symbiotic interaction with clover plants. Compared with

  2. The Regulatory Protein RosR Affects Rhizobium leguminosarum bv. trifolii Protein Profiles, Cell Surface Properties, and Symbiosis with Clover.

    PubMed

    Rachwał, Kamila; Boguszewska, Aleksandra; Kopcińska, Joanna; Karaś, Magdalena; Tchórzewski, Marek; Janczarek, Monika

    2016-01-01

    Rhizobium leguminosarum bv. trifolii is capable of establishing a symbiotic relationship with plants from the genus Trifolium. Previously, a regulatory protein encoded by rosR was identified and characterized in this bacterium. RosR possesses a Cys2-His2-type zinc finger motif and belongs to Ros/MucR family of rhizobial transcriptional regulators. Transcriptome profiling of the rosR mutant revealed a role of this protein in several cellular processes, including the synthesis of cell-surface components and polysaccharides, motility, and bacterial metabolism. Here, we show that a mutation in rosR resulted in considerable changes in R. leguminosarum bv. trifolii protein profiles. Extracellular, membrane, and periplasmic protein profiles of R. leguminosarum bv. trifolii wild type and the rosR mutant were examined, and proteins with substantially different abundances between these strains were identified. Compared with the wild type, extracellular fraction of the rosR mutant contained greater amounts of several proteins, including Ca(2+)-binding cadherin-like proteins, a RTX-like protein, autoaggregation protein RapA1, and flagellins FlaA and FlaB. In contrast, several proteins involved in the uptake of various substrates were less abundant in the mutant strain (DppA, BraC, and SfuA). In addition, differences were observed in membrane proteins of the mutant and wild-type strains, which mainly concerned various transport system components. Using atomic force microscopy (AFM) imaging, we characterized the topography and surface properties of the rosR mutant and wild-type cells. We found that the mutation in rosR gene also affected surface properties of R. leguminosarum bv. trifolii. The mutant cells were significantly more hydrophobic than the wild-type cells, and their outer membrane was three times more permeable to the hydrophobic dye N-phenyl-1-naphthylamine. The mutation of rosR also caused defects in bacterial symbiotic interaction with clover plants. Compared with

  3. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins Involved in a Posttranscriptional Iron Regulatory Mechanism

    PubMed Central

    Figueroa-Angulo, Elisa E.; Calla-Choque, Jaeson S.; Mancilla-Olea, Maria Inocente; Arroyo, Rossana

    2015-01-01

    Iron homeostasis is highly regulated in vertebrates through a regulatory system mediated by RNA-protein interactions between the iron regulatory proteins (IRPs) that interact with an iron responsive element (IRE) located in certain mRNAs, dubbed the IRE-IRP regulatory system. Trichomonas vaginalis, the causal agent of trichomoniasis, presents high iron dependency to regulate its growth, metabolism, and virulence properties. Although T. vaginalis lacks IRPs or proteins with aconitase activity, possesses gene expression mechanisms of iron regulation at the transcriptional and posttranscriptional levels. However, only one gene with iron regulation at the transcriptional level has been described. Recently, our research group described an iron posttranscriptional regulatory mechanism in the T. vaginalis tvcp4 and tvcp12 cysteine proteinase mRNAs. The tvcp4 and tvcp12 mRNAs have a stem-loop structure in the 5'-coding region or in the 3'-UTR, respectively that interacts with T. vaginalis multifunctional proteins HSP70, α-Actinin, and Actin under iron starvation condition, causing translation inhibition or mRNA stabilization similar to the previously characterized IRE-IRP system in eukaryotes. Herein, we summarize recent progress and shed some light on atypical RNA-binding proteins that may participate in the iron posttranscriptional regulation in T. vaginalis. PMID:26703754

  4. 'Drugs from bugs': bacterial effector proteins as promising biological (immune-) therapeutics.

    PubMed

    Rüter, Christian; Hardwidge, Philip R

    2014-02-01

    Immune system malfunctions cause many of the most severe human diseases. The immune system has evolved primarily to control bacterial, viral, fungal, and parasitic infections. In turn, over millions of years of coevolution, microbial pathogens have evolved various mechanisms to control and modulate the host immune system for their own benefit and survival. For example, many bacterial pathogens use virulence proteins to modulate and exploit target cell mechanisms. Our understanding of these bacterial strategies opens novel possibilities to exploit 'microbial knowledge' to control excessive immune reactions. Gaining access to strategies of microbial pathogens could lead to potentially huge benefits for the therapy of inflammatory diseases. Most work on bacterial pathogen effector proteins has the long-term aim of neutralizing the infectious capabilities of the pathogen. However, attenuated pathogens and microbial products have been used for over a century with overwhelming success in the form of vaccines to induce specific immune responses that protect against the respective infectious diseases. In this review, we focus on bacterial effector and virulence proteins capable of modulating and suppressing distinct signaling pathways with potentially desirable immune-modulating effects for treating unrelated inflammatory diseases. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  5. Imparting albumin-binding affinity to a human protein by mimicking the contact surface of a bacterial binding protein.

    PubMed

    Oshiro, Satoshi; Honda, Shinya

    2014-04-18

    Attachment of a bacterial albumin-binding protein module is an attractive strategy for extending the plasma residence time of protein therapeutics. However, a protein fused with such a bacterial module could induce unfavorable immune reactions. To address this, we designed an alternative binding protein by imparting albumin-binding affinity to a human protein using molecular surface grafting. The result was a series of human-derived 6 helix-bundle proteins, one of which specifically binds to human serum albumin (HSA) with adequate affinity (KD = 100 nM). The proteins were designed by transferring key binding residues of a bacterial albumin-binding module, Finegoldia magna protein G-related albumin-binding domain (GA) module, onto the human protein scaffold. Despite 13-15 mutations, the designed proteins maintain the original secondary structure by virtue of careful grafting based on structural informatics. Competitive binding assays and thermodynamic analyses of the best binders show that the binding mode resembles that of the GA module, suggesting that the contacting surface of the GA module is mimicked well on the designed protein. These results indicate that the designed protein may act as an alternative low-risk binding module to HSA. Furthermore, molecular surface grafting in combination with structural informatics is an effective approach for avoiding deleterious mutations on a target protein and for imparting the binding function of one protein onto another.

  6. EspL is a bacterial cysteine protease effector that cleaves RHIM proteins to block necroptosis and inflammation.

    PubMed

    Pearson, Jaclyn S; Giogha, Cristina; Mühlen, Sabrina; Nachbur, Ueli; Pham, Chi L L; Zhang, Ying; Hildebrand, Joanne M; Oates, Clare V; Lung, Tania Wong Fok; Ingle, Danielle; Dagley, Laura F; Bankovacki, Aleksandra; Petrie, Emma J; Schroeder, Gunnar N; Crepin, Valerie F; Frankel, Gad; Masters, Seth L; Vince, James; Murphy, James M; Sunde, Margaret; Webb, Andrew I; Silke, John; Hartland, Elizabeth L

    2017-01-13

    Cell death signalling pathways contribute to tissue homeostasis and provide innate protection from infection. Adaptor proteins such as receptor-interacting serine/threonine-protein kinase 1 (RIPK1), receptor-interacting serine/threonine-protein kinase 3 (RIPK3), TIR-domain-containing adapter-inducing interferon-β (TRIF) and Z-DNA-binding protein 1 (ZBP1)/DNA-dependent activator of IFN-regulatory factors (DAI) that contain receptor-interacting protein (RIP) homotypic interaction motifs (RHIM) play a key role in cell death and inflammatory signalling 1-3 . RHIM-dependent interactions help drive a caspase-independent form of cell death termed necroptosis 4,5 . Here, we report that the bacterial pathogen enteropathogenic Escherichia coli (EPEC) uses the type III secretion system (T3SS) effector EspL to degrade the RHIM-containing proteins RIPK1, RIPK3, TRIF and ZBP1/DAI during infection. This requires a previously unrecognized tripartite cysteine protease motif in EspL (Cys47, His131, Asp153) that cleaves within the RHIM of these proteins. Bacterial infection and/or ectopic expression of EspL leads to rapid inactivation of RIPK1, RIPK3, TRIF and ZBP1/DAI and inhibition of tumour necrosis factor (TNF), lipopolysaccharide or polyinosinic:polycytidylic acid (poly(I:C))-induced necroptosis and inflammatory signalling. Furthermore, EPEC infection inhibits TNF-induced phosphorylation and plasma membrane localization of mixed lineage kinase domain-like pseudokinase (MLKL). In vivo, EspL cysteine protease activity contributes to persistent colonization of mice by the EPEC-like mouse pathogen Citrobacter rodentium. The activity of EspL defines a family of T3SS cysteine protease effectors found in a range of bacteria and reveals a mechanism by which gastrointestinal pathogens directly target RHIM-dependent inflammatory and necroptotic signalling pathways.

  7. A Transcriptional Regulatory Mechanism Finely Tunes the Firing of Type VI Secretion System in Response to Bacterial Enemies

    PubMed Central

    Lazzaro, Martina; Feldman, Mario F.

    2017-01-01

    ABSTRACT The ability to detect and measure danger from an environmental signal is paramount for bacteria to respond accordingly, deploying strategies that halt or counteract potential cellular injury and maximize survival chances. Type VI secretion systems (T6SSs) are complex bacterial contractile nanomachines able to target toxic effectors into neighboring bacteria competing for the same colonization niche. Previous studies support the concept that either T6SSs are constitutively active or they fire effectors in response to various stimuli, such as high bacterial density, cell-cell contact, nutrient depletion, or components from dead sibling cells. For Serratia marcescens, it has been proposed that its T6SS is stochastically expressed, with no distinction between harmless or aggressive competitors. In contrast, we demonstrate that the Rcs regulatory system is responsible for finely tuning Serratia T6SS expression levels, behaving as a transcriptional rheostat. When confronted with harmless bacteria, basal T6SS expression levels suffice for Serratia to eliminate the competitor. A moderate T6SS upregulation is triggered when, according to the aggressor-prey ratio, an unbalanced interplay between homologous and heterologous effectors and immunity proteins takes place. Higher T6SS expression levels are achieved when Serratia is challenged by a contender like Acinetobacter, which indiscriminately fires heterologous effectors able to exert lethal cellular harm, threatening the survival of the Serratia population. We also demonstrate that Serratia’s RcsB-dependent T6SS regulatory mechanism responds not to general stress signals but to the action of specific effectors from competitors, displaying an exquisite strategy to weigh risks and keep the balance between energy expenditure and fitness costs. PMID:28830939

  8. Proteinaceous determinants of surface colonization in bacteria: bacterial adhesion and biofilm formation from a protein secretion perspective

    PubMed Central

    Chagnot, Caroline; Zorgani, Mohamed A.; Astruc, Thierry; Desvaux, Mickaël

    2013-01-01

    Bacterial colonization of biotic or abiotic surfaces results from two quite distinct physiological processes, namely bacterial adhesion and biofilm formation. Broadly speaking, a biofilm is defined as the sessile development of microbial cells. Biofilm formation arises following bacterial adhesion but not all single bacterial cells adhering reversibly or irreversibly engage inexorably into a sessile mode of growth. Among molecular determinants promoting bacterial colonization, surface proteins are the most functionally diverse active components. To be present on the bacterial cell surface, though, a protein must be secreted in the first place. Considering the close association of secreted proteins with their cognate secretion systems, the secretome (which refers both to the secretion systems and their protein substrates) is a key concept to apprehend the protein secretion and related physiological functions. The protein secretion systems are here considered in light of the differences in the cell-envelope architecture between diderm-LPS (archetypal Gram-negative), monoderm (archetypal Gram-positive) and diderm-mycolate (archetypal acid-fast) bacteria. Besides, their cognate secreted proteins engaged in the bacterial colonization process are regarded from single protein to supramolecular protein structure as well as the non-classical protein secretion. This state-of-the-art on the complement of the secretome (the secretion systems and their cognate effectors) involved in the surface colonization process in diderm-LPS and monoderm bacteria paves the way for future research directions in the field. PMID:24133488

  9. Channel crossing: how are proteins shipped across the bacterial plasma membrane?

    PubMed

    Collinson, Ian; Corey, Robin A; Allen, William J

    2015-10-05

    The structure of the first protein-conducting channel was determined more than a decade ago. Today, we are still puzzled by the outstanding problem of protein translocation--the dynamic mechanism underlying the consignment of proteins across and into membranes. This review is an attempt to summarize and understand the energy transducing capabilities of protein-translocating machines, with emphasis on bacterial systems: how polypeptides make headway against the lipid bilayer and how the process is coupled to the free energy associated with ATP hydrolysis and the transmembrane protein motive force. In order to explore how cargo is driven across the membrane, the known structures of the protein-translocation machines are set out against the background of the historic literature, and in the light of experiments conducted in their wake. The paper will focus on the bacterial general secretory (Sec) pathway (SecY-complex), and its eukaryotic counterpart (Sec61-complex), which ferry proteins across the membrane in an unfolded state, as well as the unrelated Tat system that assembles bespoke channels for the export of folded proteins. © 2015 The Authors.

  10. Bacterial Adaptation of Respiration from Oxic to Microoxic and Anoxic Conditions: Redox Control

    PubMed Central

    Bueno, Emilio; Mesa, Socorro; Bedmar, Eulogio J.; Richardson, David J.

    2012-01-01

    Abstract Under a shortage of oxygen, bacterial growth can be faced mainly by two ATP-generating mechanisms: (i) by synthesis of specific high-affinity terminal oxidases that allow bacteria to use traces of oxygen or (ii) by utilizing other substrates as final electron acceptors such as nitrate, which can be reduced to dinitrogen gas through denitrification or to ammonium. This bacterial respiratory shift from oxic to microoxic and anoxic conditions requires a regulatory strategy which ensures that cells can sense and respond to changes in oxygen tension and to the availability of other electron acceptors. Bacteria can sense oxygen by direct interaction of this molecule with a membrane protein receptor (e.g., FixL) or by interaction with a cytoplasmic transcriptional factor (e.g., Fnr). A third type of oxygen perception is based on sensing changes in redox state of molecules within the cell. Redox-responsive regulatory systems (e.g., ArcBA, RegBA/PrrBA, RoxSR, RegSR, ActSR, ResDE, and Rex) integrate the response to multiple signals (e.g., ubiquinone, menaquinone, redox active cysteine, electron transport to terminal oxidases, and NAD/NADH) and activate or repress target genes to coordinate the adaptation of bacterial respiration from oxic to anoxic conditions. Here, we provide a compilation of the current knowledge about proteins and regulatory networks involved in the redox control of the respiratory adaptation of different bacterial species to microxic and anoxic environments. Antioxid. Redox Signal. 16, 819–852. PMID:22098259

  11. Measurement of the incorporation rates of four amino acids into proteins for estimating bacterial production.

    PubMed

    Servais, P

    1995-03-01

    In aquatic ecosystems, [(3)H]thymidine incorporation into bacterial DNA and [(3)H]leucine incorporation into proteins are usually used to estimate bacterial production. The incorporation rates of four amino acids (leucine, tyrosine, lysine, alanine) into proteins of bacteria were measured in parallel on natural freshwater samples from the basin of the river Meuse (Belgium). Comparison of the incorporation into proteins and into the total macromolecular fraction showed that these different amino acids were incorporated at more than 90% into proteins. From incorporation measurements at four subsaturated concentrations (range, 2-77 nm), the maximum incorporation rates were determined. Strong correlations (r > 0.91 for all the calculated correlations) were found between the maximum incorporation rates of the different tested amino acids over a range of two orders of magnitude of bacterial activity. Bacterial production estimates were calculated using theoretical and experimental conversion factors. The productions calculated from the incorporation rates of the four amino acids were in good concordance, especially when the experimental conversion factors were used (slope range, 0.91-1.11, and r > 0.91). This study suggests that the incorporation of various amino acids into proteins can be used to estimate bacterial production.

  12. Riboregulation of bacterial and archaeal transposition.

    PubMed

    Ellis, Michael J; Haniford, David B

    2016-05-01

    The coexistence of transposons with their hosts depends largely on transposition levels being tightly regulated to limit the mutagenic burden associated with frequent transposition. For 'DNA-based' (class II) bacterial transposons there is growing evidence that regulation through small noncoding RNAs and/or the RNA-binding protein Hfq are prominent mechanisms of defense against transposition. Recent transcriptomics analyses have identified many new cases of antisense RNAs (asRNA) that potentially could regulate the expression of transposon-encoded genes giving the impression that asRNA regulation of DNA-based transposons is much more frequent than previously thought. Hfq is a highly conserved bacterial protein that plays a central role in posttranscriptional gene regulation and stress response pathways in many bacteria. Three different mechanisms for Hfq-directed control of bacterial transposons have been identified to date highlighting the versatility of this protein as a regulator of bacterial transposons. There is also evidence emerging that some DNA-based transposons encode RNAs that could regulate expression of host genes. In the case of IS200, which appears to have lost its ability to transpose, contributing a regulatory RNA to its host could account for the persistence of this mobile element in a wide range of bacterial species. It remains to be seen how prevalent these transposon-encoded RNA regulators are, but given the relatively large amount of intragenic transcription in bacterial genomes, it would not be surprising if new examples are forthcoming. WIREs RNA 2016, 7:382-398. doi: 10.1002/wrna.1341 For further resources related to this article, please visit the WIREs website. © 2016 Wiley Periodicals, Inc.

  13. The Yersinia pestis gcvB gene encodes two small regulatory RNA molecules

    PubMed Central

    McArthur, Sarah D; Pulvermacher, Sarah C; Stauffer, George V

    2006-01-01

    Background In recent years it has become clear that small non-coding RNAs function as regulatory elements in bacterial virulence and bacterial stress responses. We tested for the presence of the small non-coding GcvB RNAs in Y. pestis as possible regulators of gene expression in this organism. Results In this study, we report that the Yersinia pestis KIM6 gcvB gene encodes two small RNAs. Transcription of gcvB is activated by the GcvA protein and repressed by the GcvR protein. The gcvB-encoded RNAs are required for repression of the Y. pestis dppA gene, encoding the periplasmic-binding protein component of the dipeptide transport system, showing that the GcvB RNAs have regulatory activity. A deletion of the gcvB gene from the Y. pestis KIM6 chromosome results in a decrease in the generation time of the organism as well as a change in colony morphology. Conclusion The results of this study indicate that the Y. pestis gcvB gene encodes two small non-coding regulatory RNAs that repress dppA expression. A gcvB deletion is pleiotropic, suggesting that the sRNAs are likely involved in controlling genes in addition to dppA. PMID:16768793

  14. Serum lipopolysaccharide-binding protein prediction of severe bacterial infection in cirrhotic patients with ascites.

    PubMed

    Albillos, Agustín; de-la-Hera, Antonio; Alvarez-Mon, Melchor

    2004-05-15

    Serum lipopolysaccharide-binding protein is increased in a subset of non-infected ascitic cirrhotic patients, a finding previously related to bacterial passage from the gut to the circulation without overt infection. We prospectively analysed the risk factors associated with a first episode of severe bacterial infection in 84 ascitic cirrhotics, followed up for a median of 46 weeks. The cumulative probability of such infection in patients with raised and normal lipopolysaccharide-binding protein was 32.4% and 8.0% (p=0.004), respectively. Increased lipopolysaccharide-binding protein was the only factor independently associated with severe bacterial infection in a multivariate analysis (relative risk 4.49, 95% CI 1.42-14.1). Monitoring of serum lipopolysaccharide-binding protein could, therefore, help to target cirrhotic patients with ascites for antibiotic prophylaxis.

  15. An Appetite for Modernizing the Regulatory Framework for Protein Content Claims in Canada

    PubMed Central

    Marinangeli, Christopher P. F.; Foisy, Samara; Shoveller, Anna K.; Porter, Cara; Musa-Veloso, Kathy; Sievenpiper, John L.; Jenkins, David J. A.

    2017-01-01

    The need for protein-rich plant-based foods continues as dietary guidelines emphasize their contribution to healthy dietary patterns that prevent chronic disease and promote environmental sustainability. However, the Canadian Food and Drug Regulations provide a regulatory framework that can prevent Canadian consumers from identifying protein-rich plant-based foods. In Canada, protein nutrient content claims are based on the protein efficiency ratio (PER) and protein rating method, which is based on a rat growth bioassay. PERs are not additive, and the protein rating of a food is underpinned by its Reasonable Daily Intake. The restrictive nature of Canada’s requirements for supporting protein claims therefore presents challenges for Canadian consumers to adapt to a rapidly changing food environment. This commentary will present two options for modernizing the regulatory framework for protein content claims in Canada. The first and preferred option advocates that protein quality not be considered in the determination of the eligibility of a food for protein content claims. The second and less preferred option, an interim solution, is a framework for adopting the protein digestibility corrected amino acid score as the official method for supporting protein content and quality claims and harmonizes Canada’s regulatory framework with that of the USA. PMID:28832556

  16. An Appetite for Modernizing the Regulatory Framework for Protein Content Claims in Canada.

    PubMed

    Marinangeli, Christopher P F; Foisy, Samara; Shoveller, Anna K; Porter, Cara; Musa-Veloso, Kathy; Sievenpiper, John L; Jenkins, David J A

    2017-08-23

    The need for protein-rich plant-based foods continues as dietary guidelines emphasize their contribution to healthy dietary patterns that prevent chronic disease and promote environmental sustainability. However, the Canadian Food and Drug Regulations provide a regulatory framework that can prevent Canadian consumers from identifying protein-rich plant-based foods. In Canada, protein nutrient content claims are based on the protein efficiency ratio (PER) and protein rating method, which is based on a rat growth bioassay. PERs are not additive, and the protein rating of a food is underpinned by its Reasonable Daily Intake. The restrictive nature of Canada's requirements for supporting protein claims therefore presents challenges for Canadian consumers to adapt to a rapidly changing food environment. This commentary will present two options for modernizing the regulatory framework for protein content claims in Canada. The first and preferred option advocates that protein quality not be considered in the determination of the eligibility of a food for protein content claims. The second and less preferred option, an interim solution, is a framework for adopting the protein digestibility corrected amino acid score as the official method for supporting protein content and quality claims and harmonizes Canada's regulatory framework with that of the USA.

  17. SURFACE INACTIVATION OF BACTERIAL VIRUSES AND OF PROTEINS

    PubMed Central

    Adams, Mark H.

    1948-01-01

    1. The seven bacterial viruses of the T group active against E. coli, are rapidly inactivated at gas-liquid interfaces. 2. The kinetics of this inactivation whether brought about by shaking or by bubbling with nitrogen are those of a first order reaction. 3. This inactivation may be prevented by the addition of enough protein to maintain the gas-liquid interface in a saturated condition. 4. The analogy between this phenomenon and the surface denaturation of proteins is pointed out and discussed. PMID:18917025

  18. Rab11-family of interacting protein 2 associates with chlamydial inclusions through its Rab-binding domain and promotes bacterial multiplication.

    PubMed

    Leiva, Natalia; Capmany, Anahí; Damiani, María Teresa

    2013-01-01

    Chlamydia trachomatis, an obligate intracellular pathogen, survives within host cells in a special compartment named 'inclusion' and takes advantage of host vesicular transport pathways for its growth and replication. Rab GTPases are key regulatory proteins of intracellular trafficking. Several Rabs, among them Rab11 and Rab14, are implicated in chlamydial development. FIP2, a member of the Rab11-Family of Interacting Proteins, presents at the C-terminus a Rab-binding domain that interacts with both Rab11 and Rab14. In this study, we determined and characterized the recruitment of endogenous and GFP-tagged FIP2 to the chlamydial inclusions. The recruitment of FIP2 is specific since other members of the Rab11-Family of Interacting Proteins do not associate with the chlamydial inclusions. The Rab-binding domain of FIP2 is essential for its association. Our results indicate that FIP2 binds to Rab11 at the chlamydial inclusion membrane through its Rab-binding domain. The presence of FIP2 at the chlamydial inclusion favours the recruitment of Rab14. Furthermore, our results show that FIP2 promotes inclusion development and bacterial replication. In agreement, the silencing of FIP2 decreases the bacterial progeny. C. trachomatis likely recruits FIP2 to hijack host intracellular trafficking to redirect vesicles full of nutrients towards the inclusion. © 2012 Blackwell Publishing Ltd.

  19. [Structure and function of the bacterial flagellar type III protein export system in Salmonella
].

    PubMed

    Minamino, Tohru

    2015-01-01

    The bacterial flagellum is a filamentous organelle that propels the bacterial cell body in liquid media. For construction of the bacterial flagellum beyond the cytoplasmic membrane, flagellar component proteins are transported by its specific protein export apparatus from the cytoplasm to the distal end of the growing flagellar structure. The flagellar export apparatus consists of a transmembrane export gate complex and a cytoplasmic ATPase ring complex. Flagellar substrate-specific chaperones bind to their cognate substrates in the cytoplasm and escort the substrates to the docking platform of the export gate. The export apparatus utilizes ATP and proton motive force across the cytoplasmic membrane as the energy sources to drive protein export and coordinates protein export with assembly by ordered export of substrates to parallel with their order of assembly. In this review, we summarize our current understanding of the structure and function of the flagellar protein export system in Salmonella enterica serovar Typhimurium.

  20. Tandem Affinity Purification of Protein Complexes from Eukaryotic Cells.

    PubMed

    Ma, Zheng; Fung, Victor; D'Orso, Iván

    2017-01-26

    The purification of active protein-protein and protein-nucleic acid complexes is crucial for the characterization of enzymatic activities and de novo identification of novel subunits and post-translational modifications. Bacterial systems allow for the expression and purification of a wide variety of single polypeptides and protein complexes. However, this system does not enable the purification of protein subunits that contain post-translational modifications (e.g., phosphorylation and acetylation), and the identification of novel regulatory subunits that are only present/expressed in the eukaryotic system. Here, we provide a detailed description of a novel, robust, and efficient tandem affinity purification (TAP) method using STREP- and FLAG-tagged proteins that facilitates the purification of protein complexes with transiently or stably expressed epitope-tagged proteins from eukaryotic cells. This protocol can be applied to characterize protein complex functionality, to discover post-translational modifications on complex subunits, and to identify novel regulatory complex components by mass spectrometry. Notably, this TAP method can be applied to study protein complexes formed by eukaryotic or pathogenic (viral and bacterial) components, thus yielding a wide array of downstream experimental opportunities. We propose that researchers working with protein complexes could utilize this approach in many different ways.

  1. Expression of Genes Involved in Bacteriocin Production and Self-Resistance in Lactobacillus brevis 174A Is Mediated by Two Regulatory Proteins.

    PubMed

    Noda, Masafumi; Miyauchi, Rumi; Danshiitsoodol, Narandalai; Matoba, Yasuyuki; Kumagai, Takanori; Sugiyama, Masanori

    2018-04-01

    We have previously shown that the lactic acid bacterium Lactobacillus brevis 174A, isolated from Citrus iyo fruit, produces a bacteriocin designated brevicin 174A, which is comprised of two antibacterial polypeptides (designated brevicins 174A-β and 174A-γ). We have also found a gene cluster, composed of eight open reading frames (ORFs), that contains genes for the biosynthesis of brevicin 174A, self-resistance to its own bacteriocin, and two transcriptional regulatory proteins. Some lactic acid bacterial strains have a system to start the production of bacteriocin at an adequate stage of growth. Generally, the system consists of a membrane-bound histidine protein kinase (HPK) that senses a specific environmental stimulus and a corresponding response regulator (RR) that mediates the cellular response. We have previously shown that although the HPK- and RR-encoding genes are not found on the brevicin 174A biosynthetic gene cluster in the 174A strain, two putative regulatory genes, designated breD and breG , are in the gene cluster. In the present study, we demonstrate that the expression of brevicin 174A production and self-resistance is positively controlled by two transcriptional regulatory proteins, designated BreD and BreG. BreD is expressed together with BreE as the self-resistance determinant of L. brevis 174A. DNase I footprinting analysis and a promoter assay demonstrated that BreD binds to the breED promoter as a positive autoregulator. The present study also demonstrates that BreG, carrying a transmembrane domain, binds to the common promoter of breB and breC , encoding brevicins 174A-β and 174A-γ, respectively, for positive regulation. IMPORTANCE The problem of the appearance of bacteria that are resistant to practical antibiotics and the increasing demand for safe foods have increased interest in replacing conventional antibiotics with bacteriocin produced by the lactic acid bacteria. This antibacterial substance can inhibit the growth of pathogenic

  2. Plant immunity: a lesson from pathogenic bacterial effector proteins.

    PubMed

    Cui, Haitao; Xiang, Tingting; Zhou, Jian-Min

    2009-10-01

    Phytopathogenic bacteria inject an array of effector proteins into host cells to alter host physiology and assist the infection process. Some of these effectors can also trigger disease resistance as a result of recognition in the plant cell by cytoplasmic immune receptors. In addition to effector-triggered immunity, plants immunity can be triggered upon the detection of Pathogen/Microbe-Associated Molecular Patterns by surface-localized immune receptors. Recent progress indicates that many bacterial effector proteins use a variety of biochemical properties to directly attack key components of PAMP-triggered immunity and effector-triggered immunity, providing new insights into the molecular basis of plant innate immunity. Emerging evidence indicate that the evolution of disease resistance in plants is intimately linked to the mechanism by which bacterial effectors promote parasitism. This review focuses on how these studies have conceptually advanced our understanding of plant-pathogen interactions.

  3. Chemiluminescence enzyme immunoassay using ProteinA-bacterial magnetite complex

    NASA Astrophysics Data System (ADS)

    Matsunaga, Tadashi; Sato, Rika; Kamiya, Shinji; Tanaka, Tsuyosi; Takeyama, Haruko

    1999-04-01

    Bacterial magnetic particles (BMPs) which have ProteinA expressed on their surface were constructed using magA which is a key gene in BMP biosynthesis in the magnetic bacterium Magnetospirillum sp. AMB-1. Homogenous chemiluminescence enzyme immunoassay using antibody bound ProteinA-BMP complexes was developed for detection of human IgG. A good correlation between the luminescence yield and the concentration of human IgG was obtained in the range of 1-10 3 ng/ml.

  4. Antimicrobial inflammasomes: unified signalling against diverse bacterial pathogens.

    PubMed

    Eldridge, Matthew J G; Shenoy, Avinash R

    2015-02-01

    Inflammasomes - molecular platforms for caspase-1 activation - have emerged as common hubs for a number of pathways that detect and respond to bacterial pathogens. Caspase-1 activation results in the secretion of bioactive IL-1β and IL-18 and pyroptosis, and thus launches a systemic immune and inflammatory response. In this review we discuss signal transduction leading to 'canonical' and 'non-canonical' activation of caspase-1 through the involvement of upstream caspases. Recent studies have identified a growing number of regulatory networks involving guanylate binding proteins, protein kinases, ubiquitylation and necroptosis related pathways that modulate inflammasome responses and immunity to bacterial infection. By being able to respond to extracellular, vacuolar and cytosolic bacteria, their cytosolic toxins or ligands for cell surface receptors, inflammasomes have emerged as important sentinels of infection. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Bacterial adhesion to protein-coated surfaces: An AFM and QCM-D study

    NASA Astrophysics Data System (ADS)

    Strauss, Joshua; Liu, Yatao; Camesano, Terri A.

    2009-09-01

    Bacterial adhesion to biomaterials, mineral surfaces, or other industrial surfaces is strongly controlled by the way bacteria interact with protein layers or organic matter and other biomolecules that coat the materials. Despite this knowledge, many studies of bacterial adhesion are performed under clean conditions, instead of in the presence of proteins or organic molecules. We chose fetal bovine serum (FBS) as a model protein, and prepared FBS films on quartz crystals. The thickness of the FBS layer was characterized using atomic force microscopy (AFM) imaging under liquid and quartz crystal microbalance with dissipation (QCM-D). Next, we characterized how the model biomaterial surface would interact with the nocosomial pathogen Staphylococcus epidermidis. An AFM probe was coated with S. epidermidis cells and used to probe a gold slide that had been coated with FBS or another protein, fibronectin (FN). These experiments show that AFM and QCM-D can be used in complementary ways to study the complex interactions between bacteria, proteins, and surfaces.

  6. The octamer-binding proteins form multi-protein--DNA complexes with the HSV alpha TIF regulatory protein.

    PubMed Central

    Kristie, T M; LeBowitz, J H; Sharp, P A

    1989-01-01

    The herpes simplex virus transactivator, alpha TIF, stimulates transcription of the alpha/immediate early genes via a cis-acting site containing an octamer element and a conserved flanking sequence. The alpha TIF protein, produced in a baculovirus expression system, nucleates the formation of at least two DNA--protein complexes on this regulatory element. Both of these complexes contain the ubiquitous Oct-1 protein, whose POU domain alone is sufficient to allow assembly of the alpha TIF-dependent complexes. A second member of the POU domain family, the lymphoid specific Oct-2 protein, can also be assembled into similar complexes at high concentrations of alpha TIF protein. These complexes contain at least two cellular proteins in addition to Oct-1. One of these proteins is present in both insect and HeLa cells and probably recognizes sequences in the cis element. The second cellular protein, only present in HeLa cells, probably binds by protein-protein interactions. Images PMID:2556266

  7. The octamer-binding proteins form multi-protein--DNA complexes with the HSV alpha TIF regulatory protein.

    PubMed

    Kristie, T M; LeBowitz, J H; Sharp, P A

    1989-12-20

    The herpes simplex virus transactivator, alpha TIF, stimulates transcription of the alpha/immediate early genes via a cis-acting site containing an octamer element and a conserved flanking sequence. The alpha TIF protein, produced in a baculovirus expression system, nucleates the formation of at least two DNA--protein complexes on this regulatory element. Both of these complexes contain the ubiquitous Oct-1 protein, whose POU domain alone is sufficient to allow assembly of the alpha TIF-dependent complexes. A second member of the POU domain family, the lymphoid specific Oct-2 protein, can also be assembled into similar complexes at high concentrations of alpha TIF protein. These complexes contain at least two cellular proteins in addition to Oct-1. One of these proteins is present in both insect and HeLa cells and probably recognizes sequences in the cis element. The second cellular protein, only present in HeLa cells, probably binds by protein-protein interactions.

  8. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  9. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

  10. Protein Kinase A Regulatory Subunits in Human Adipose Tissue

    PubMed Central

    Mantovani, Giovanna; Bondioni, Sara; Alberti, Luisella; Gilardini, Luisa; Invitti, Cecilia; Corbetta, Sabrina; Zappa, Marco A.; Ferrero, Stefano; Lania, Andrea G.; Bosari, Silvano; Beck-Peccoz, Paolo; Spada, Anna

    2009-01-01

    OBJECTIVE—In human adipocytes, the cAMP-dependent pathway mediates signals originating from β-adrenergic activation, thus playing a key role in the regulation of important metabolic processes, i.e., lipolysis and thermogenesis. Cyclic AMP effects are mainly mediated by protein kinase A (PKA), whose R2B regulatory isoform is the most expressed in mouse adipose tissue, where it protects against diet-induced obesity and fatty liver development. The aim of the study was to investigate possible differences in R2B expression, PKA activity, and lipolysis in adipose tissues from obese and nonobese subjects. RESEARCH DESIGN AND METHODS—The expression of the different PKA regulatory subunits was evaluated by immunohistochemistry, Western blot, and real-time PCR in subcutaneous and visceral adipose tissue samples from 20 nonobese and 67 obese patients. PKA activity and glycerol release were evaluated in total protein extract and adipocytes isolated from fresh tissue samples, respectively. RESULTS—Expression techniques showed that R2B was the most abundant regulatory protein, both at mRNA and protein level. Interestingly, R2B mRNA levels were significantly lower in both subcutaneous and visceral adipose tissues from obese than nonobese patients and negatively correlated with BMI, waist circumference, insulin levels, and homeostasis model assessment of insulin resistance. Moreover, both basal and stimulated PKA activity and glycerol release were significantly lower in visceral adipose tissue from obese patients then nonobese subjects. CONCLUSIONS—Our results first indicate that, in human adipose tissue, there are important BMI-related differences in R2B expression and PKA activation, which might be included among the multiple determinants involved in the different lipolytic response to β-adrenergic activation in obesity. PMID:19095761

  11. Evidence for a bacterial lipopolysaccharide-recognizing G-protein-coupled receptor in the bacterial engulfment by Entamoeba histolytica.

    PubMed

    Brewer, Matthew T; Agbedanu, Prince N; Zamanian, Mostafa; Day, Tim A; Carlson, Steve A

    2013-11-01

    Entamoeba histolytica is the causative agent of amoebic dysentery, a worldwide protozoal disease that results in approximately 100,000 deaths annually. The virulence of E. histolytica may be due to interactions with the host bacterial flora, whereby trophozoites engulf colonic bacteria as a nutrient source. The engulfment process depends on trophozoite recognition of bacterial epitopes that activate phagocytosis pathways. E. histolytica GPCR-1 (EhGPCR-1) was previously recognized as a putative G-protein-coupled receptor (GPCR) used by Entamoeba histolytica during phagocytosis. In the present study, we attempted to characterize EhGPCR-1 by using heterologous GPCR expression in Saccharomyces cerevisiae. We discovered that bacterial lipopolysaccharide (LPS) is an activator of EhGPCR-1 and that LPS stimulates EhGPCR-1 in a concentration-dependent manner. Additionally, we demonstrated that Entamoeba histolytica prefers to engulf bacteria with intact LPS and that this engulfment process is sensitive to suramin, which prevents the interactions of GPCRs and G-proteins. Thus, EhGPCR-1 is an LPS-recognizing GPCR that is a potential drug target for treatment of amoebiasis, especially considering the well-established drug targeting to GPCRs.

  12. Newer systems for bacterial resistances to toxic heavy metals.

    PubMed Central

    Silver, S; Ji, G

    1994-01-01

    Bacterial plasmids contain specific genes for resistances to toxic heavy metal ions including Ag+, AsO2-, AsO4(3-), Cd2+, Co2+, CrO4(2-), Cu2+, Hg2+, Ni2+, Pb2+, Sb3+, and Zn2+. Recent progress with plasmid copper-resistance systems in Escherichia coli and Pseudomonas syringae show a system of four gene products, an inner membrane protein (PcoD), an outer membrane protein (PcoB), and two periplasmic Cu(2+)-binding proteins (PcoA and PcoC). Synthesis of this system is governed by two regulatory proteins (the membrane sensor PcoS and the soluble responder PcoR, probably a DNA-binding protein), homologous to other bacterial two-component regulatory systems. Chromosomally encoded Cu2+ P-type ATPases have recently been recognized in Enterococcus hirae and these are closely homologous to the bacterial cadmium efflux ATPase and the human copper-deficiency disease Menkes gene product. The Cd(2+)-efflux ATPase of gram-positive bacteria is a large P-type ATPase, homologous to the muscle Ca2+ ATPase and the Na+/K+ ATPases of animals. The arsenic-resistance system of gram-negative bacteria functions as an oxyanion efflux ATPase for arsenite and presumably antimonite. However, the structure of the arsenic ATPase is fundamentally different from that of P-type ATPases. The absence of the arsA gene (for the ATPase subunit) in gram-positive bacteria raises questions of energy-coupling for arsenite efflux. The ArsC protein product of the arsenic-resistance operons of both gram-positive and gram-negative bacteria is an intracellular enzyme that reduces arsenate [As(V)] to arsenite [As(III)], the substrate for the transport pump. Newly studied cation efflux systems for Cd2+, Zn2+, and Co2+ (Czc) or Co2+ and Ni2+ resistance (Cnr) lack ATPase motifs in their predicted polypeptide sequences. Therefore, not all plasmid-resistance systems that function through toxic ion efflux are ATPases. The first well-defined bacterial metallothionein was found in the cyanobacterium Synechococcus

  13. Sequence analyses and evolutionary relationships among the energy-coupling proteins Enzyme I and HPr of the bacterial phosphoenolpyruvate: sugar phosphotransferase system.

    PubMed Central

    Reizer, J.; Hoischen, C.; Reizer, A.; Pham, T. N.; Saier, M. H.

    1993-01-01

    We have previously reported the overexpression, purification, and biochemical properties of the Bacillus subtilis Enzyme I of the phosphoenolpyruvate: sugar phosphotransferase system (PTS) (Reizer, J., et al., 1992, J. Biol. Chem. 267, 9158-9169). We now report the sequencing of the ptsI gene of B. subtilis encoding Enzyme I (570 amino acids and 63,076 Da). Putative transcriptional regulatory signals are identified, and the pts operon is shown to be subject to carbon source-dependent regulation. Multiple alignments of the B. subtilis Enzyme I with (1) six other sequenced Enzymes I of the PTS from various bacterial species, (2) phosphoenolpyruvate synthase of Escherichia coli, and (3) bacterial and plant pyruvate: phosphate dikinases (PPDKs) revealed regions of sequence similarity as well as divergence. Statistical analyses revealed that these three types of proteins comprise a homologous family, and the phylogenetic tree of the 11 sequenced protein members of this family was constructed. This tree was compared with that of the 12 sequence HPr proteins or protein domains. Antibodies raised against the B. subtilis and E. coli Enzymes I exhibited immunological cross-reactivity with each other as well as with PPDK of Bacteroides symbiosus, providing support for the evolutionary relationships of these proteins suggested from the sequence comparisons. Putative flexible linkers tethering the N-terminal and the C-terminal domains of protein members of the Enzyme I family were identified, and their potential significance with regard to Enzyme I function is discussed. The codon choice pattern of the B. subtilis and E. coli ptsI and ptsH genes was found to exhibit a bias toward optimal codons in these organisms.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7686067

  14. Behind the lines–actions of bacterial type III effector proteins in plant cells

    PubMed Central

    Büttner, Daniela

    2016-01-01

    Pathogenicity of most Gram-negative plant-pathogenic bacteria depends on the type III secretion (T3S) system, which translocates bacterial effector proteins into plant cells. Type III effectors modulate plant cellular pathways to the benefit of the pathogen and promote bacterial multiplication. One major virulence function of type III effectors is the suppression of plant innate immunity, which is triggered upon recognition of pathogen-derived molecular patterns by plant receptor proteins. Type III effectors also interfere with additional plant cellular processes including proteasome-dependent protein degradation, phytohormone signaling, the formation of the cytoskeleton, vesicle transport and gene expression. This review summarizes our current knowledge on the molecular functions of type III effector proteins with known plant target molecules. Furthermore, plant defense strategies for the detection of effector protein activities or effector-triggered alterations in plant targets are discussed. PMID:28201715

  15. Targeted decay of a regulatory small RNA by an adaptor protein for RNase E and counteraction by an anti-adaptor RNA

    PubMed Central

    Göpel, Yvonne; Papenfort, Kai; Reichenbach, Birte; Vogel, Jörg; Görke, Boris

    2013-01-01

    Bacterial small RNAs (sRNAs) are well established to regulate diverse cellular processes, but how they themselves are regulated is less understood. Recently, we identified a regulatory circuit wherein the GlmY and GlmZ sRNAs of Escherichia coli act hierarchically to activate mRNA glmS, which encodes glucosamine-6-phosphate (GlcN6P) synthase. Although the two sRNAs are highly similar, only GlmZ is a direct activator that base-pairs with the glmS mRNA, aided by protein Hfq. GlmY, however, does not bind Hfq and activates glmS indirectly by protecting GlmZ from RNA cleavage. This complex regulation feedback controls the levels of GlmS protein in response to its product, GlcN6P, a key metabolite in cell wall biosynthesis. Here, we reveal the molecular basis for the regulated turnover of GlmZ, identifying RapZ (RNase adaptor protein for sRNA GlmZ; formerly YhbJ) as a novel type of RNA-binding protein that recruits the major endoribonuclease RNase E to GlmZ. This involves direct interaction of RapZ with the catalytic domain of RNase E. GlmY binds RapZ through a secondary structure shared by both sRNAs and therefore acts by molecular mimicry as a specific decoy for RapZ. Thus, in analogy to regulated proteolysis, RapZ is an adaptor, and GlmY is an anti-adaptor in regulated turnover of a regulatory small RNA. PMID:23475961

  16. Evolutionary analysis and lateral gene transfer of two-component regulatory systems associated with heavy-metal tolerance in bacteria.

    PubMed

    Bouzat, Juan L; Hoostal, Matthew J

    2013-05-01

    Microorganisms have adapted intricate signal transduction mechanisms to coordinate tolerance to toxic levels of metals, including two-component regulatory systems (TCRS). In particular, both cop and czc operons are regulated by TCRS; the cop operon plays a key role in bacterial tolerance to copper, whereas the czc operon is involved in the efflux of cadmium, zinc, and cobalt from the cell. Although the molecular physiology of heavy metal tolerance genes has been extensively studied, their evolutionary relationships are not well-understood. Phylogenetic relationships among heavy-metal efflux proteins and their corresponding two-component regulatory proteins revealed orthologous and paralogous relationships from species divergences and ancient gene duplications. The presence of heavy metal tolerance genes on bacterial plasmids suggests these genes may be prone to spread through horizontal gene transfer. Phylogenetic inferences revealed nine potential examples of lateral gene transfer associated with metal efflux proteins and two examples for regulatory proteins. Notably, four of the examples suggest lateral transfer across major evolutionary domains. In most cases, differences in GC content in metal tolerance genes and their corresponding host genomes confirmed lateral gene transfer events. Three-dimensional protein structures predicted for the response regulators encoded by cop and czc operons showed a high degree of structural similarity with other known proteins involved in TCRS signal transduction, which suggests common evolutionary origins of functional phenotypes and similar mechanisms of action for these response regulators.

  17. A predictive biophysical model of translational coupling to coordinate and control protein expression in bacterial operons

    PubMed Central

    Tian, Tian; Salis, Howard M.

    2015-01-01

    Natural and engineered genetic systems require the coordinated expression of proteins. In bacteria, translational coupling provides a genetically encoded mechanism to control expression level ratios within multi-cistronic operons. We have developed a sequence-to-function biophysical model of translational coupling to predict expression level ratios in natural operons and to design synthetic operons with desired expression level ratios. To quantitatively measure ribosome re-initiation rates, we designed and characterized 22 bi-cistronic operon variants with systematically modified intergenic distances and upstream translation rates. We then derived a thermodynamic free energy model to calculate de novo initiation rates as a result of ribosome-assisted unfolding of intergenic RNA structures. The complete biophysical model has only five free parameters, but was able to accurately predict downstream translation rates for 120 synthetic bi-cistronic and tri-cistronic operons with rationally designed intergenic regions and systematically increased upstream translation rates. The biophysical model also accurately predicted the translation rates of the nine protein atp operon, compared to ribosome profiling measurements. Altogether, the biophysical model quantitatively predicts how translational coupling controls protein expression levels in synthetic and natural bacterial operons, providing a deeper understanding of an important post-transcriptional regulatory mechanism and offering the ability to rationally engineer operons with desired behaviors. PMID:26117546

  18. Role and mechanism of the Hsp70 molecular chaperone machines in bacterial pathogens.

    PubMed

    Ghazaei, Ciamak

    2017-03-01

    Heat shock proteins are highly conserved, stress-inducible, ubiquitous proteins that maintain homeostasis in both eukaryotes and prokaryotes. Hsp70 proteins belong to the heat shock protein family and enhance bacterial survival in hostile environments. Hsp70, known as DnaK in prokaryotes, supports numerous processes such as the assembly and disassembly of protein complexes, the refolding of misfolded and clustered proteins, membrane translocation and the regulation of regulatory proteins. The chaperone-based activity of Hsp70 depends on dynamic interactions between its two domains, known as the ATPase domain and the substrate-binding domain. It also depends on interactions between these domains and other co-chaperone molecules such as the Hsp40 protein family member DnaJ and nucleotide exchange factors. DnaJ is the primary chaperone that interacts with nascent polypeptide chains and functions to prevent their premature release from the ribosome and misfolding before it is targeted by DnaK. Adhesion of bacteria to host cells is mediated by both host and bacterial Hsp70. Following infection of the host, bacterial Hsp70 (DnaK) is in a position to initiate bacterial survival processes and trigger an immune response by the host. Any mutations in the dnaK gene have been shown to decrease the viability of bacteria inside the host. This review will give insights into the structure and mechanism of Hsp70 and its role in regulating the protein activity that contributes to pathogenesis.

  19. Protein aggregation as bacterial inclusion bodies is reversible.

    PubMed

    Carrió, M M; Villaverde, A

    2001-01-26

    Inclusion bodies are refractile, intracellular protein aggregates usually observed in bacteria upon targeted gene overexpression. Since their occurrence has a major economical impact in protein production bio-processes, in vitro refolding strategies are under continuous exploration. In this work, we prove spontaneous in vivo release of both beta-galactosidase and P22 tailspike polypeptides from inclusion bodies resulting in their almost complete disintegration and in the concomitant appearance of soluble, properly folded native proteins with full biological activity. Since, in particular, the tailspike protein exhibits an unusually slow and complex folding pathway involving deep interdigitation of beta-sheet structures, its in vivo refolding indicates that bacterial inclusion body proteins are not collapsed into an irreversible unfolded state. Then, inclusion bodies can be observed as transient deposits of folding-prone polypeptides, resulting from an unbalanced equilibrium between in vivo protein precipitation and refolding that can be actively displaced by arresting protein synthesis. The observation that the formation of big inclusion bodies is reversible in vivo can be also relevant in the context of amyloid diseases, in which deposition of important amounts of aggregated protein initiates the pathogenic process.

  20. Gibbs motif sampling: detection of bacterial outer membrane protein repeats.

    PubMed Central

    Neuwald, A. F.; Liu, J. S.; Lawrence, C. E.

    1995-01-01

    The detection and alignment of locally conserved regions (motifs) in multiple sequences can provide insight into protein structure, function, and evolution. A new Gibbs sampling algorithm is described that detects motif-encoding regions in sequences and optimally partitions them into distinct motif models; this is illustrated using a set of immunoglobulin fold proteins. When applied to sequences sharing a single motif, the sampler can be used to classify motif regions into related submodels, as is illustrated using helix-turn-helix DNA-binding proteins. Other statistically based procedures are described for searching a database for sequences matching motifs found by the sampler. When applied to a set of 32 very distantly related bacterial integral outer membrane proteins, the sampler revealed that they share a subtle, repetitive motif. Although BLAST (Altschul SF et al., 1990, J Mol Biol 215:403-410) fails to detect significant pairwise similarity between any of the sequences, the repeats present in these outer membrane proteins, taken as a whole, are highly significant (based on a generally applicable statistical test for motifs described here). Analysis of bacterial porins with known trimeric beta-barrel structure and related proteins reveals a similar repetitive motif corresponding to alternating membrane-spanning beta-strands. These beta-strands occur on the membrane interface (as opposed to the trimeric interface) of the beta-barrel. The broad conservation and structural location of these repeats suggests that they play important functional roles. PMID:8520488

  1. Substrate specificity of bacterial DD-peptidases (penicillin-binding proteins).

    PubMed

    Pratt, R F

    2008-07-01

    The DD-peptidase enzymes (penicillin-binding proteins) catalyze the final transpeptidation reaction of bacterial cell wall (peptidoglycan) biosynthesis. Although there is now much structural information available about these enzymes, studies of their activity as enzymes lag. It is now established that representatives of two low-molecular-mass classes of DD-peptidases recognize elements of peptidoglycan structure and rapidly react with substrates and inhibitors incorporating these elements. No members of other DD-peptidase classes, including the high-molecular-mass enzymes, essential for bacterial growth, appear to interact strongly with any particular elements of peptidoglycan structure. Rational design of inhibitors for these enzymes is therefore challenging.

  2. Cross-regulatory protein-protein interactions between Hox and Pax transcription factors.

    PubMed

    Plaza, Serge; Prince, Frederic; Adachi, Yoshitsugu; Punzo, Claudio; Cribbs, David L; Gehring, Walter J

    2008-09-09

    Homeotic Hox selector genes encode highly conserved transcriptional regulators involved in the differentiation of multicellular organisms. Ectopic expression of the Antennapedia (ANTP) homeodomain protein in Drosophila imaginal discs induces distinct phenotypes, including an antenna-to-leg transformation and eye reduction. We have proposed that the eye loss phenotype is a consequence of a negative posttranslational control mechanism because of direct protein-protein interactions between ANTP and Eyeless (EY). In the present work, we analyzed the effect of various ANTP homeodomain mutations for their interaction with EY and for head development. Contrasting with the eye loss phenotype, we provide evidence that the antenna-to-leg transformation involves ANTP DNA-binding activity. In a complementary genetic screen performed in yeast, we isolated mutations located in the N terminus of the ANTP homeodomain that inhibit direct interactions with EY without abolishing DNA binding in vitro and in vivo. In a bimolecular fluorescence complementation assay, we detected the ANTP-EY interaction in vivo, these interactions occurring through the paired domain and/or the homeodomain of EY. These results demonstrate that the homeodomain supports multiple molecular regulatory functions in addition to protein-DNA and protein-RNA interactions; it is also involved in protein-protein interactions.

  3. Bacterial flagellar capping proteins adopt diverse oligomeric states

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Postel, Sandra; Deredge, Daniel; Bonsor, Daniel A.

    2016-09-24

    Flagella are crucial for bacterial motility and pathogenesis. The flagellar capping protein (FliD) regulates filament assembly by chaperoning and sorting flagellin (FliC) proteins after they traverse the hollow filament and exit the growing flagellum tip. In the absence of FliD, flagella are not formed, resulting in impaired motility and infectivity. Here, we report the 2.2 Å resolution X-ray crystal structure of FliD fromPseudomonas aeruginosa, the first high-resolution structure of any FliD protein from any bacterium. Using this evidence in combination with a multitude of biophysical and functional analyses, we find thatPseudomonasFliD exhibits unexpected structural similarity to other flagellar proteins atmore » the domain level, adopts a unique hexameric oligomeric state, and depends on flexible determinants for oligomerization. Considering that the flagellin filaments on which FliD oligomers are affixed vary in protofilament number between bacteria, our results suggest that FliD oligomer stoichiometries vary across bacteria to complement their filament assemblies.« less

  4. A Transcriptional Regulatory Mechanism Finely Tunes the Firing of Type VI Secretion System in Response to Bacterial Enemies.

    PubMed

    Lazzaro, Martina; Feldman, Mario F; García Véscovi, Eleonora

    2017-08-22

    The ability to detect and measure danger from an environmental signal is paramount for bacteria to respond accordingly, deploying strategies that halt or counteract potential cellular injury and maximize survival chances. Type VI secretion systems (T6SSs) are complex bacterial contractile nanomachines able to target toxic effectors into neighboring bacteria competing for the same colonization niche. Previous studies support the concept that either T6SSs are constitutively active or they fire effectors in response to various stimuli, such as high bacterial density, cell-cell contact, nutrient depletion, or components from dead sibling cells. For Serratia marcescens , it has been proposed that its T6SS is stochastically expressed, with no distinction between harmless or aggressive competitors. In contrast, we demonstrate that the Rcs regulatory system is responsible for finely tuning Serratia T6SS expression levels, behaving as a transcriptional rheostat. When confronted with harmless bacteria, basal T6SS expression levels suffice for Serratia to eliminate the competitor. A moderate T6SS upregulation is triggered when, according to the aggressor-prey ratio, an unbalanced interplay between homologous and heterologous effectors and immunity proteins takes place. Higher T6SS expression levels are achieved when Serratia is challenged by a contender like Acinetobacter , which indiscriminately fires heterologous effectors able to exert lethal cellular harm, threatening the survival of the Serratia population. We also demonstrate that Serratia 's RcsB-dependent T6SS regulatory mechanism responds not to general stress signals but to the action of specific effectors from competitors, displaying an exquisite strategy to weigh risks and keep the balance between energy expenditure and fitness costs. IMPORTANCE Serratia marcescens is among the health-threatening pathogens categorized by the WHO as research priorities to develop alternative antimicrobial strategies, and it was

  5. Subnuclear organization and trafficking of regulatory proteins: implications for biological control and cancer.

    PubMed

    Stein, G S; van Wijnen, A J; Stein, J L; Lian, J B; Montecino, M; Zaidi, K; Javed, A

    2000-01-01

    The regulated and regulatory components that interrelate nuclear structure and function must be experimentally established. A formidable challenge is to define further the control of transcription factor targeting to acceptor sites associated with the nuclear matrix. It will be important to determine whether acceptor proteins are associated with a pre-existing core-filament structural lattice or whether a compositely organized scaffold of regulatory factors is dynamically assembled. An inclusive model for all steps in the targeting of proteins to subnuclear sites cannot yet be proposed. However, this model must account for the apparent diversity of intranuclear targeting signals. It is also important to assess the extent to which regulatory discrimination is mediated by subnuclear domain-specific trafficking signals. Furthermore, the checkpoints that monitor subnuclear distribution of regulatory factors and the sorting steps that ensure both structural and functional fidelity of nuclear domains in which replication and expression of genes occur must be biochemically and mechanistically defined. There is emerging recognition that placement of regulatory components of gene expression must be temporally and spatially coordinated to facilitate biological control. The consequences of breaches in nuclear structure-function relationships are observed in an expanding series of diseases that include cancer [Weis et al., 1994; Rogaia et al., 1997; Yano et al., 1997; Rowley, 1998; Zeng et al., 1998; McNeil et al., 1999; Tao and Levine, 1999a] and neurological disorders [Skinner et al., 1997]. As the repertoire of architecture-associated regulatory factors and cofactors expands, workers in the field are becoming increasingly confident that nuclear organization contributes significantly to control of transcription. To gain increased appreciation for the complexities of subnuclear organization and gene regulation, we must continue to characterize mechanisms that direct

  6. Self-organization and positioning of bacterial protein clusters

    NASA Astrophysics Data System (ADS)

    Murray, Seán M.; Sourjik, Victor

    2017-10-01

    Many cellular processes require proteins to be precisely positioned within the cell. In some cases this can be attributed to passive mechanisms such as recruitment by other proteins in the cell or by exploiting the curvature of the membrane. However, in bacteria, active self-positioning is likely to play a role in multiple processes, including the positioning of the future site of cell division and cytoplasmic protein clusters. How can such dynamic clusters be formed and positioned? Here, we present a model for the self-organization and positioning of dynamic protein clusters into regularly repeating patterns based on a phase-locked Turing pattern. A single peak in the concentration is always positioned at the midpoint of the model cell, and two peaks are positioned at the midpoint of each half. Furthermore, domain growth results in peak splitting and pattern doubling. We argue that the model may explain the regular positioning of the highly conserved structural maintenance of chromosomes complexes on the bacterial nucleoid and that it provides an attractive mechanism for the self-positioning of dynamic protein clusters in other systems.

  7. Characterization of SIS1, a Saccharomyces cerevisiae homologue of bacterial dnaJ proteins

    PubMed Central

    1991-01-01

    The Saccharomyces cerevisiae SIS1 gene was identified as a high copy number suppressor of the slow growth phenotype of strains containing mutations in the SIT4 gene, which encodes a predicted serine/threonine protein phosphatase. The SIS1 protein is similar to bacterial dnaJ proteins in the amino-terminal third and carboxyl-terminal third of the proteins. In contrast, the middle third of SIS1 is not similar to dnaJ proteins. This region of SIS1 contains a glycine/methionine-rich region which, along with more amino-terminal sequences, is required for SIS1 to associate with a protein of apparent molecular mass of 40 kD. The SIS1 gene is essential. Strains limited for the SIS1 protein accumulate cells that appear blocked for migration of the nucleus from the mother cell into the daughter cell. In addition, many of the cells become very large and contain a large vacuole. The SIS1 protein is localized throughout the cell but is more concentrated at the nucleus. About one- fourth of the SIS1 protein is released from a nuclear fraction upon treatment with RNase. We also show that overexpression of YDJ1, another yeast protein with similarity to bacterial dnaJ proteins, can not substitute for SIS1. PMID:1714460

  8. Molecular dynamics simulations on interaction between bacterial proteins: Implication on pathogenic activities.

    PubMed

    Mondal, Manas; Chakrabarti, Jaydeb; Ghosh, Mahua

    2018-03-01

    We perform molecular dynamics simulation studies on interaction between bacterial proteins: an outer-membrane protein STY3179 and a yfdX protein STY3178 of Salmonella Typhi. STY3179 has been found to be involved in bacterial adhesion and invasion. STY3178 is recently biophysically characterized. It is a soluble protein having antibiotic binding and chaperon activity capabilities. These two proteins co-occur and are from neighboring gene in Salmonella Typhi-occurrence of homologs of both STY3178 and STY3179 are identified in many Gram-negative bacteria. We show using homology modeling, docking followed by molecular dynamics simulation that they can form a stable complex. STY3178 belongs to aqueous phase, while the beta barrel portion of STY3179 remains buried in DPPC bilayer with extra-cellular loops exposed to water. To understand the molecular basis of interaction between STY3178 and STY3179, we compute the conformational thermodynamics which indicate that these two proteins interact through polar and acidic residues belonging to their interfacial region. Conformational thermodynamics results further reveal instability of certain residues in extra-cellular loops of STY3179 upon complexation with STY3178 which is an indication for binding with host cell protein laminin. © 2017 Wiley Periodicals, Inc.

  9. Multi-location gram-positive and gram-negative bacterial protein subcellular localization using gene ontology and multi-label classifier ensemble.

    PubMed

    Wang, Xiao; Zhang, Jun; Li, Guo-Zheng

    2015-01-01

    It has become a very important and full of challenge task to predict bacterial protein subcellular locations using computational methods. Although there exist a lot of prediction methods for bacterial proteins, the majority of these methods can only deal with single-location proteins. But unfortunately many multi-location proteins are located in the bacterial cells. Moreover, multi-location proteins have special biological functions capable of helping the development of new drugs. So it is necessary to develop new computational methods for accurately predicting subcellular locations of multi-location bacterial proteins. In this article, two efficient multi-label predictors, Gpos-ECC-mPLoc and Gneg-ECC-mPLoc, are developed to predict the subcellular locations of multi-label gram-positive and gram-negative bacterial proteins respectively. The two multi-label predictors construct the GO vectors by using the GO terms of homologous proteins of query proteins and then adopt a powerful multi-label ensemble classifier to make the final multi-label prediction. The two multi-label predictors have the following advantages: (1) they improve the prediction performance of multi-label proteins by taking the correlations among different labels into account; (2) they ensemble multiple CC classifiers and further generate better prediction results by ensemble learning; and (3) they construct the GO vectors by using the frequency of occurrences of GO terms in the typical homologous set instead of using 0/1 values. Experimental results show that Gpos-ECC-mPLoc and Gneg-ECC-mPLoc can efficiently predict the subcellular locations of multi-label gram-positive and gram-negative bacterial proteins respectively. Gpos-ECC-mPLoc and Gneg-ECC-mPLoc can efficiently improve prediction accuracy of subcellular localization of multi-location gram-positive and gram-negative bacterial proteins respectively. The online web servers for Gpos-ECC-mPLoc and Gneg-ECC-mPLoc predictors are freely accessible

  10. Pathogenic Leptospira species express surface-exposed proteins belonging to the bacterial immunoglobulin superfamily

    PubMed Central

    Matsunaga, James; Barocchi, Michele A.; Croda, Julio; Young, Tracy A.; Sanchez, Yolanda; Siqueira, Isadora; Bolin, Carole A.; Reis, Mitermayer G.; Riley, Lee W.; Haake, David A.; Ko, Albert I.

    2005-01-01

    Summary Proteins with bacterial immunoglobulin-like (Big) domains, such as the Yersinia pseudotuberculosis invasin and Escherichia coli intimin, are surface-expressed proteins that mediate host mammalian cell invasion or attachment. Here, we report the identification and characterization of a new family of Big domain proteins, referred to as Lig (leptospiral Ig-like) proteins, in pathogenic Leptospira. Screening of L. interrogans and L. kirschneri expression libraries with sera from leptospirosis patients identified 13 lambda phage clones that encode tandem repeats of the 90 amino acid Big domain. Two lig genes, designated ligA and ligB, and one pseudo-gene, ligC, were identified. The ligA and ligB genes encode amino-terminal lipoprotein signal peptides followed by 10 or 11 Big domain repeats and, in the case of ligB, a unique carboxy-terminal non-repeat domain. The organization of ligC is similar to that of ligB but contains mutations that disrupt the reading frame. The lig sequences are present in pathogenic but not saprophytic Leptospira species. LigA and LigB are expressed by a variety of virulent leptospiral strains. Loss of Lig protein and RNA transcript expression is correlated with the observed loss of virulence during culture attenuation of pathogenic strains. High-pressure freeze substitution followed by immunocytochemical electron microscopy confirmed that the Lig proteins were localized to the bacterial surface. Immunoblot studies with patient sera found that the Lig proteins are a major antigen recognized during the acute host infection. These observations demonstrate that the Lig proteins are a newly identified surface protein of pathogenic Leptospira, which by analogy to other bacterial immunoglobulin superfamily virulence factors, may play a role in host cell attachment and invasion during leptospiral pathogenesis. PMID:12890019

  11. Pathogenic Leptospira species express surface-exposed proteins belonging to the bacterial immunoglobulin superfamily.

    PubMed

    Matsunaga, James; Barocchi, Michele A; Croda, Julio; Young, Tracy A; Sanchez, Yolanda; Siqueira, Isadora; Bolin, Carole A; Reis, Mitermayer G; Riley, Lee W; Haake, David A; Ko, Albert I

    2003-08-01

    Proteins with bacterial immunoglobulin-like (Big) domains, such as the Yersinia pseudotuberculosis invasin and Escherichia coli intimin, are surface-expressed proteins that mediate host mammalian cell invasion or attachment. Here, we report the identification and characterization of a new family of Big domain proteins, referred to as Lig (leptospiral Ig-like) proteins, in pathogenic Leptospira. Screening of L. interrogans and L. kirschneri expression libraries with sera from leptospirosis patients identified 13 lambda phage clones that encode tandem repeats of the 90 amino acid Big domain. Two lig genes, designated ligA and ligB, and one pseudogene, ligC, were identified. The ligA and ligB genes encode amino-terminal lipoprotein signal peptides followed by 10 or 11 Big domain repeats and, in the case of ligB, a unique carboxy-terminal non-repeat domain. The organization of ligC is similar to that of ligB but contains mutations that disrupt the reading frame. The lig sequences are present in pathogenic but not saprophytic Leptospira species. LigA and LigB are expressed by a variety of virulent leptospiral strains. Loss of Lig protein and RNA transcript expression is correlated with the observed loss of virulence during culture attenuation of pathogenic strains. High-pressure freeze substitution followed by immunocytochemical electron microscopy confirmed that the Lig proteins were localized to the bacterial surface. Immunoblot studies with patient sera found that the Lig proteins are a major antigen recognized during the acute host infection. These observations demonstrate that the Lig proteins are a newly identified surface protein of pathogenic Leptospira, which by analogy to other bacterial immunoglobulin superfamily virulence factors, may play a role in host cell attachment and invasion during leptospiral pathogenesis.

  12. Effective non-denaturing purification method for improving the solubility of recombinant actin-binding proteins produced by bacterial expression.

    PubMed

    Chung, Jeong Min; Lee, Sangmin; Jung, Hyun Suk

    2017-05-01

    Bacterial expression is commonly used to produce recombinant and truncated mutant eukaryotic proteins. However, heterologous protein expression may render synthesized proteins insoluble. The conventional method used to express a poorly soluble protein, which involves denaturation and refolding, is time-consuming and inefficient. There are several non-denaturing approaches that can increase the solubility of recombinant proteins that include using different bacterial cell strains, altering the time of induction, lowering the incubation temperature, and employing different detergents for purification. In this study, we compared several non-denaturing protocols to express and purify two insoluble 34 kDa actin-bundling protein mutants. The solubility of the mutant proteins was not affected by any of the approaches except for treatment with the detergent sarkosyl. These results indicate that sarkosyl can effectively improve the solubility of insoluble proteins during bacterial expression. Copyright © 2016. Published by Elsevier Inc.

  13. CONSTRUCTION AND ANALYSIS OF IPBR/XYLS HYBRID REGULATORY PROTEINS

    EPA Science Inventory

    IpbR and XylS are related regulatory proteins (having 56% identity). IpbR responds to isopropylbenzene as well as to a variety of hydrophobic chemicals to activate expression of the isopropylbenzene catabolic pathway operon of pRE4 from ipbOP. XylS responds to substituted benzoic...

  14. Bacterial hybrid histidine kinases in plant-bacteria interactions.

    PubMed

    Borland, Stéphanie; Prigent-Combaret, Claire; Wisniewski-Dyé, Florence

    2016-10-01

    Two-component signal transduction systems are essential for many bacteria to maintain homeostasis and adapt to environmental changes. Two-component signal transduction systems typically involve a membrane-bound histidine kinase that senses stimuli, autophosphorylates in the transmitter region and then transfers the phosphoryl group to the receiver domain of a cytoplasmic response regulator that mediates appropriate changes in bacterial physiology. Although usually found on distinct proteins, the transmitter and receiver modules are sometimes fused into a so-called hybrid histidine kinase (HyHK). Such structure results in multiple phosphate transfers that are believed to provide extra-fine-tuning mechanisms and more regulatory checkpoints than classical phosphotransfers. HyHK-based regulation may be crucial for finely tuning gene expression in a heterogeneous environment such as the rhizosphere, where intricate plant-bacteria interactions occur. In this review, we focus on roles fulfilled by bacterial HyHKs in plant-associated bacteria, providing recent findings on the mechanistic of their signalling properties. Recent insights into understanding additive regulatory properties fulfilled by the tethered receiver domain of HyHKs are also addressed.

  15. Evolutionary rewiring of bacterial regulatory networks

    PubMed Central

    Taylor, Tiffany B.; Mulley, Geraldine; McGuffin, Liam J.; Johnson, Louise J.; Brockhurst, Michael A.; Arseneault, Tanya; Silby, Mark W.; Jackson, Robert W.

    2015-01-01

    Bacteria have evolved complex regulatory networks that enable integration of multiple intracellular and extracellular signals to coordinate responses to environmental changes. However, our knowledge of how regulatory systems function and evolve is still relatively limited. There is often extensive homology between components of different networks, due to past cycles of gene duplication, divergence, and horizontal gene transfer, raising the possibility of cross-talk or redundancy. Consequently, evolutionary resilience is built into gene networks - homology between regulators can potentially allow rapid rescue of lost regulatory function across distant regions of the genome. In our recent study [Taylor, et al. Science (2015), 347(6225)] we find that mutations that facilitate cross-talk between pathways can contribute to gene network evolution, but that such mutations come with severe pleiotropic costs. Arising from this work are a number of questions surrounding how this phenomenon occurs. PMID:28357301

  16. Hierarchical protein export mechanism of the bacterial flagellar type III protein export apparatus.

    PubMed

    Minamino, Tohru

    2018-06-01

    The bacterial flagellum is supramolecular motility machinery consisting of the basal body, the hook and the filament. Flagellar proteins are translocated across the cytoplasmic membrane via a type III protein export apparatus, diffuse down the central channel of the growing structure and assemble at the distal end. Flagellar assembly begins with the basal body, followed by the hook and finally the filament. The completion of hook assembly is the most important morphological checkpoint of the sequential flagellar assembly process. When the hook reaches its mature length of about 55 nm in Salmonella enterica, the type III protein export apparatus switches export specificity from proteins required for the structure and assembly of the hook to those responsible for filament assembly, thereby terminating hook assembly and initiating filament assembly. Three flagellar proteins, namely FliK, FlhB and FlhA, are responsible for this substrate specificity switching. Upon completion of the switching event, interactions among FlhA, the cytoplasmic ATPase complex and flagellar type III export chaperones establish the assembly order of the filament at the hook tip. Here, we describe our current understanding of a hierarchical protein export mechanism used in flagellar type III protein export.

  17. Bacterial mimetics of endocrine secretory granules as immobilized in vivo depots for functional protein drugs

    PubMed Central

    Céspedes, María Virtudes; Fernández, Yolanda; Unzueta, Ugutz; Mendoza, Rosa; Seras-Franzoso, Joaquin; Sánchez-Chardi, Alejando; Álamo, Patricia; Toledo-Rubio, Verónica; Ferrer-Miralles, Neus; Vázquez, Esther; Schwartz, Simó; Abasolo, Ibane; Corchero, José Luis; Mangues, Ramon; Villaverde, Antonio

    2016-01-01

    In the human endocrine system many protein hormones including urotensin, glucagon, obestatin, bombesin and secretin, among others, are supplied from amyloidal secretory granules. These granules form part of the so called functional amyloids, which within the whole aggregome appear to be more abundant than formerly believed. Bacterial inclusion bodies (IBs) are non-toxic, nanostructured functional amyloids whose biological fabrication can be tailored to render materials with defined biophysical properties. Since under physiological conditions they steadily release their building block protein in a soluble and functional form, IBs are considered as mimetics of endocrine secretory granules. We have explored here if the in vivo implantation of functional IBs in a given tissue would represent a stable local source of functional protein. Upon intratumoral injection of bacterial IBs formed by a potent protein ligand of CXCR4 we have observed high stability and prevalence of the material in absence of toxicity, accompanied by apoptosis of CXCR4+ cells and tumor ablation. Then, the local immobilization of bacterial amyloids formed by therapeutic proteins in tumors or other tissues might represent a promising strategy for a sustained local delivery of protein drugs by mimicking the functional amyloidal architecture of the mammals’ endocrine system. PMID:27775083

  18. Protein export through the bacterial flagellar type III export pathway.

    PubMed

    Minamino, Tohru

    2014-08-01

    For construction of the bacterial flagellum, which is responsible for bacterial motility, the flagellar type III export apparatus utilizes both ATP and proton motive force across the cytoplasmic membrane and exports flagellar proteins from the cytoplasm to the distal end of the nascent structure. The export apparatus consists of a membrane-embedded export gate made of FlhA, FlhB, FliO, FliP, FliQ, and FliR and a water-soluble ATPase ring complex consisting of FliH, FliI, and FliJ. FlgN, FliS, and FliT act as substrate-specific chaperones that do not only protect their cognate substrates from degradation and aggregation in the cytoplasm but also efficiently transfer the substrates to the export apparatus. The ATPase ring complex facilitates the initial entry of the substrates into the narrow pore of the export gate. The export gate by itself is a proton-protein antiporter that uses the two components of proton motive force, the electric potential difference and the proton concentration difference, for different steps of the export process. A specific interaction of FlhA with FliJ located in the center of the ATPase ring complex allows the export gate to efficiently use proton motive force to drive protein export. The ATPase ring complex couples ATP binding and hydrolysis to its assembly-disassembly cycle for rapid and efficient protein export cycle. This article is part of a Special Issue entitled: Protein trafficking and secretion in bacteria. Guest Editors: Anastassios Economou and Ross Dalbey. © 2013 Elsevier B.V. All rights reserved.

  19. Insight into bacterial virulence mechanisms against host immune response via the Yersinia pestis-human protein-protein interaction network.

    PubMed

    Yang, Huiying; Ke, Yuehua; Wang, Jian; Tan, Yafang; Myeni, Sebenzile K; Li, Dong; Shi, Qinghai; Yan, Yanfeng; Chen, Hui; Guo, Zhaobiao; Yuan, Yanzhi; Yang, Xiaoming; Yang, Ruifu; Du, Zongmin

    2011-11-01

    A Yersinia pestis-human protein interaction network is reported here to improve our understanding of its pathogenesis. Up to 204 interactions between 66 Y. pestis bait proteins and 109 human proteins were identified by yeast two-hybrid assay and then combined with 23 previously published interactions to construct a protein-protein interaction network. Topological analysis of the interaction network revealed that human proteins targeted by Y. pestis were significantly enriched in the proteins that are central in the human protein-protein interaction network. Analysis of this network showed that signaling pathways important for host immune responses were preferentially targeted by Y. pestis, including the pathways involved in focal adhesion, regulation of cytoskeleton, leukocyte transendoepithelial migration, and Toll-like receptor (TLR) and mitogen-activated protein kinase (MAPK) signaling. Cellular pathways targeted by Y. pestis are highly relevant to its pathogenesis. Interactions with host proteins involved in focal adhesion and cytoskeketon regulation pathways could account for resistance of Y. pestis to phagocytosis. Interference with TLR and MAPK signaling pathways by Y. pestis reflects common characteristics of pathogen-host interaction that bacterial pathogens have evolved to evade host innate immune response by interacting with proteins in those signaling pathways. Interestingly, a large portion of human proteins interacting with Y. pestis (16/109) also interacted with viral proteins (Epstein-Barr virus [EBV] and hepatitis C virus [HCV]), suggesting that viral and bacterial pathogens attack common cellular functions to facilitate infections. In addition, we identified vasodilator-stimulated phosphoprotein (VASP) as a novel interaction partner of YpkA and showed that YpkA could inhibit in vitro actin assembly mediated by VASP.

  20. Aberrant intracellular localization of Varicella-Zoster virus regulatory proteins during latency

    PubMed Central

    Lungu, Octavian; Panagiotidis, Christos A.; Annunziato, Paula W.; Gershon, Anne A.; Silverstein, Saul J.

    1998-01-01

    Varicella-Zoster virus (VZV) is a herpesvirus that becomes latent in sensory neurons after primary infection (chickenpox) and subsequently may reactivate to cause zoster. The mechanism by which this virus maintains latency, and the factors involved, are poorly understood. Here we demonstrate, by immunohistochemical analysis of ganglia obtained at autopsy from seropositive patients without clinical symptoms of VZV infection that viral regulatory proteins are present in latently infected neurons. These proteins, which localize to the nucleus of cells during lytic infection, predominantly are detected in the cytoplasm of latently infected neurons. The restriction of regulatory proteins from the nucleus of latently infected neurons might interrupt the cascade of virus gene expression that leads to a productive infection. Our findings raise the possibility that VZV has developed a novel mechanism for maintenance of latency that contrasts with the transcriptional repression that is associated with latency of herpes simplex virus, the prototypic alpha herpesvirus. PMID:9618542

  1. Differential regulation of the androgen receptor by protein phosphatase regulatory subunits

    PubMed Central

    Grey, James; Jones, Dominic; Wilson, Laura; Nakjang, Sirintra; Clayton, Jake; Temperley, Richard; Clark, Emma; Gaughan, Luke; Robson, Craig

    2018-01-01

    The Androgen Receptor (AR) is a key molecule in the development, maintenance and progression of prostate cancer (PC). However, the relationship between the AR and co-regulatory proteins that facilitate AR activity in castrate resistant settings remain understudied. Here we show that protein phosphatase 1 regulatory subunits, identified from a phosphatase RNAi screen, direct PP1 catalytic subunits to a varied yet significant response in AR function. As such, we have characterised the PP1β holoenzyme, myosin phosphatase (MLCP), as a novel ligand independent regulator of the AR. Sustained MLCP activity through down-regulation of the MLCP inhibitory subunit, PPP1R14C, results in impaired AR nuclear translocation, protein stability and transcriptional activity in distinct models of PC progression, culminating in restoration of a non-malignant prostate genotype. Phenotypically, a marked reduction in cell proliferation and migration, characterised by G1 cell cycle arrest is observed, confirming PP1 holoenzyme disruption as a novel treatment approach in PC. PMID:29423094

  2. Screening host proteins required for bacterial adherence after H9N2 virus infection.

    PubMed

    Ma, Li-Li; Sun, Zhen-Hong; Xu, Yu-Lin; Wang, Shu-Juan; Wang, Hui-Ning; Zhang, Hao; Hu, Li-Ping; Sun, Xiao-Mei; Zhu, Lin; Shang, Hong-Qi; Zhu, Rui-Liang; Wei, Kai

    2018-01-01

    H9N2 subtype low pathogenic avian influenza virus (LPAIV) is distributed worldwide and causes great economic losses in the poultry industry, especially when complicated with other bacterial infections. Tissue damages caused by virus infection provide an opportunity for bacteria invasion, but this mechanism is not sufficient for low pathogenic strains. Moreover, although H9N2 virus infection was demonstrated to promote bacterial infection in several studies, its mechanism remained unclear. In this study, infection experiments in vivo and in vitro demonstrated that the adhesion of Escherichia coli (E. coli) to host cells significantly increased after H9N2 virus infection, and this increase was not caused by pathological damages. Subsequently, we constructed a late chicken embryo infection model and used proteomics techniques to analyze the expression of proteins associated with bacterial adhesion after H9N2 virus infection. A total of 279 significantly differential expressed proteins were detected through isobaric tags for relative and absolute quantitation (iTRAQ) coupled with nano-liquid chromatography-tandem mass spectrometry (nano-LC-MS/MS) analysis. The results of Kyoto encyclopedia of genes and genomes (KEGG) enrichment analysis showed that differentially expressed proteins were enriched in host innate immunity; cell proliferation, differentiation, and apoptosis; and pathogenicity-related signaling pathways. Finally, we screened out several proteins, such as TGF-β1, integrins, cortactin, E-cadherin, vinculin, and fibromodulin, which were probably associated with bacterial adhesion. The study analyzed the mechanism of secondary bacterial infection induced by H9N2 virus infection from a novel perspective, which provided theoretical and data support for investigating the synergistic infection mechanism between the H9N2 virus and bacteria. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Extractable Bacterial Surface Proteins in Probiotic–Host Interaction

    PubMed Central

    do Carmo, Fillipe L. R.; Rabah, Houem; De Oliveira Carvalho, Rodrigo D.; Gaucher, Floriane; Cordeiro, Barbara F.; da Silva, Sara H.; Le Loir, Yves; Azevedo, Vasco; Jan, Gwénaël

    2018-01-01

    Some Gram-positive bacteria, including probiotic ones, are covered with an external proteinaceous layer called a surface-layer. Described as a paracrystalline layer and formed by the self-assembly of a surface-layer-protein (Slp), this optional structure is peculiar. The surface layer per se is conserved and encountered in many prokaryotes. However, the sequence of the corresponding Slp protein is highly variable among bacterial species, or even among strains of the same species. Other proteins, including surface layer associated proteins (SLAPs), and other non-covalently surface-bound proteins may also be extracted with this surface structure. They can be involved a various functions. In probiotic Gram-positives, they were shown by different authors and experimental approaches to play a role in key interactions with the host. Depending on the species, and sometime on the strain, they can be involved in stress tolerance, in survival within the host digestive tract, in adhesion to host cells or mucus, or in the modulation of intestinal inflammation. Future trends include the valorization of their properties in the formation of nanoparticles, coating and encapsulation, and in the development of new vaccines. PMID:29670603

  4. Cyclic di-GMP differentially tunes a bacterial flagellar motor through a novel class of CheY-like regulators.

    PubMed

    Nesper, Jutta; Hug, Isabelle; Kato, Setsu; Hee, Chee-Seng; Habazettl, Judith Maria; Manfredi, Pablo; Grzesiek, Stephan; Schirmer, Tilman; Emonet, Thierry; Jenal, Urs

    2017-11-01

    The flagellar motor is a sophisticated rotary machine facilitating locomotion and signal transduction. Owing to its important role in bacterial behavior, its assembly and activity are tightly regulated. For example, chemotaxis relies on a sensory pathway coupling chemical information to rotational bias of the motor through phosphorylation of the motor switch protein CheY. Using a chemical proteomics approach, we identified a novel family of CheY-like (Cle) proteins in Caulobacter crescentus , which tune flagellar activity in response to binding of the second messenger c-di-GMP to a C-terminal extension. In their c-di-GMP bound conformation Cle proteins interact with the flagellar switch to control motor activity. We show that individual Cle proteins have adopted discrete cellular functions by interfering with chemotaxis and by promoting rapid surface attachment of motile cells. This study broadens the regulatory versatility of bacterial motors and unfolds mechanisms that tie motor activity to mechanical cues and bacterial surface adaptation.

  5. Identification of the interactome between fish plasma proteins and Edwardsiella tarda reveals tissue-specific strategies against bacterial infection.

    PubMed

    Li, Hui; Huang, Xiaoyan; Zeng, Zaohai; Peng, Xuan-Xian; Peng, Bo

    2016-09-01

    Elucidating the complex pathogen-host interaction is essential for a comprehensive understanding of how these remarkable agents invade their hosts and how the hosts defend against these invaders. During the infection, pathogens interact intensively with host to enable their survival, which can be revealed through their interactome. Edwardsiella tarda is a Gram-negative bacterial pathogen causing huge economic loss in aquaculture and a spectrum of intestinal and extraintestinal diseases in humans. E. tarda is an ideal model for host-pathogen investigation as it infects fish in three distinct steps: entering the host, circulating through the blood and establishing infection. We adopted a previous established proteomic approach that inactivated E. tarda cells and covalent crosslink fish plasma proteins were used to capture plasma proteins and bacterial outer membrane proteins, respectively. By the combinatorial use of proteomic and biochemical approaches, six plasma proteins and seven outer membrane proteins (OMPs) were identified. Interactions among these proteins were validated with protein-array, far-Western blotting and co-immunoprecipitation. At last, seventeen plasma protein-bacteria protein-protein interaction were confirmed to be involved in the interaction network, forming a complex interactome. Compared to our previous results, different host proteins were detected, whereas some of the bacterial proteins were similar, which indicates that hosts adopt tissue-specific strategies to cope with the same pathogen during infection. Thus, our results provide a robust demonstration of both bacterial initiators and host receptors or interacting proteins to further explore infection and anti-infective mechanisms between hosts and microbes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Bul Proteins, a Nonredundant, Antagonistic Family of Ubiquitin Ligase Regulatory Proteins

    PubMed Central

    Novoselova, Tatiana V.; Zahira, Kiran; Rose, Ruth-Sarah

    2012-01-01

    Like other Nedd4 ligases, Saccharomyces cerevisiae E3 Rsp5p utilizes adaptor proteins to interact with some substrates. Previous studies have indentified Bul1p and Bul2p as adaptor proteins that facilitate the ligase-substrate interaction. Here, we show the identification of a third member of the Bul family, Bul3p, the product of two adjacent open reading frames separated by a stop codon that undergoes readthrough translation. Combinatorial analysis of BUL gene deletions reveals that they regulate some, but not all, of the cellular pathways known to involve Rsp5p. Surprisingly, we find that Bul proteins can act antagonistically to regulate the same ubiquitin-dependent process, and the nature of this antagonistic activity varies between different substrates. We further show, using in vitro ubiquitination assays, that the Bul proteins have different specificities for WW domains and that the two forms of Bul3p interact differently with Rsp5p, potentially leading to alternate functional outcomes. These data introduce a new level of complexity into the regulatory interactions that take place between Rsp5p and its adaptors and substrates and suggest a more critical role for the Bul family of proteins in controlling adaptor-mediated ubiquitination. PMID:22307975

  7. Interplay of the modified nucleotide phosphoadenosine 5'-phosphosulfate (PAPS) with global regulatory proteins in Escherichia coli: modulation of cyclic AMP (cAMP)-dependent gene expression and interaction with the HupA regulatory protein.

    PubMed

    Longo, Francesca; Motta, Sara; Mauri, Pierluigi; Landini, Paolo; Rossi, Elio

    2016-11-25

    In the bacterium Escherichia coli, some intermediates of the sulfate assimilation and cysteine biosynthesis pathway can act as signal molecules and modulate gene expression. In addition to sensing and utilization of sulphur sources, these signaling mechanisms also impact more global cell processes, such as resistance to antimicrobial agents and biofilm formation. In a recent work, we have shown that inactivation of the cysH gene, encoding phosphoadenosine-phosphosulfate (PAPS) reductase, and the consequent increase in intracellular PAPS concentration, strongly affect production of several cell surface-associated structures, enhancing surface adhesion and cell aggregation. In order to identify the molecular mechanism relaying intracellular PAPS concentration to regulation of cell surface-associated structures, we looked for mutations able to suppress the effects of cysH inactivation. We found that mutations in the adenylate cyclase-encoding cyaA gene abolished the effects of PAPS accumulation; consistent with this result, cyclic AMP (cAMP)-dependent gene expression appears to be increased in the cysH mutant. Experiments aimed at the direct identification of proteins interacting with either CysC or CysH, i.e. the PAPS-related proteins APS kinase and PAPS reductase, allowed us to identify several regulators, namely, CspC, CspE, HNS and HupA. Protein-protein interaction between HupA and CysH was confirmed by a bacterial two hybrid system, and inactivation of the hupA gene enhanced the effects of the cysH mutation in terms of production of cell surface-associated factors. Our results indicate that PAPS can modulate different regulatory systems, providing evidence that this molecule acts as a global signal molecule in E. coli. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  8. Serum amyloid A is a retinol binding protein that transports retinol during bacterial infection

    PubMed Central

    Derebe, Mehabaw G; Zlatkov, Clare M; Gattu, Sureka; Ruhn, Kelly A; Vaishnava, Shipra; Diehl, Gretchen E; MacMillan, John B; Williams, Noelle S; Hooper, Lora V

    2014-01-01

    Retinol plays a vital role in the immune response to infection, yet proteins that mediate retinol transport during infection have not been identified. Serum amyloid A (SAA) proteins are strongly induced in the liver by systemic infection and in the intestine by bacterial colonization, but their exact functions remain unclear. Here we show that mouse and human SAAs are retinol binding proteins. Mouse and human SAAs bound retinol with nanomolar affinity, were associated with retinol in vivo, and limited the bacterial burden in tissues after acute infection. We determined the crystal structure of mouse SAA3 at a resolution of 2 Å, finding that it forms a tetramer with a hydrophobic binding pocket that can accommodate retinol. Our results thus identify SAAs as a family of microbe-inducible retinol binding proteins, reveal a unique protein architecture involved in retinol binding, and suggest how retinol is circulated during infection. DOI: http://dx.doi.org/10.7554/eLife.03206.001 PMID:25073702

  9. Multilayer regulatory mechanisms control cleavage factor I proteins in filamentous fungi

    PubMed Central

    Rodríguez-Romero, J.; Franceschetti, M.; Bueno, E.; Sesma, A.

    2015-01-01

    Cleavage factor I (CFI) proteins are core components of the polyadenylation machinery that can regulate several steps of mRNA life cycle, including alternative polyadenylation, splicing, export and decay. Here, we describe the regulatory mechanisms that control two fungal CFI protein classes in Magnaporthe oryzae: Rbp35/CfI25 complex and Hrp1. Using mutational, genetic and biochemical studies we demonstrate that cellular concentration of CFI mRNAs is a limited indicator of their protein abundance. Our results suggest that several post-transcriptional mechanisms regulate Rbp35/CfI25 complex and Hrp1 in the rice blast fungus, some of which are also conserved in other ascomycetes. With respect to Rbp35, these include C-terminal processing, RGG-dependent localization and cleavage, C-terminal autoregulatory domain and regulation by an upstream open reading frame of Rbp35-dependent TOR signalling pathway. Our proteomic analyses suggest that Rbp35 regulates the levels of proteins involved in melanin and phenylpropanoids synthesis, among others. The drastic reduction of fungal CFI proteins in carbon-starved cells suggests that the pre-mRNA processing pathway is altered. Our findings uncover broad and multilayer regulatory mechanisms controlling fungal polyadenylation factors, which have profound implications in pre-mRNA maturation. This area of research offers new avenues for fungicide design by targeting fungal-specific proteins that globally affect thousands of mRNAs. PMID:25514925

  10. STATIC AND KINETIC SITE-SPECIFIC PROTEIN-DNA PHOTOCROSSLINKING: ANALYSIS OF BACTERIAL TRANSCRIPTION INITIATION COMPLEXES

    PubMed Central

    Naryshkin, Nikolai; Druzhinin, Sergei; Revyakin, Andrei; Kim, Younggyu; Mekler, Vladimir; Ebright, Richard H.

    2009-01-01

    Static site-specific protein-DNA photocrosslinking permits identification of protein-DNA interactions within multiprotein-DNA complexes. Kinetic site-specific protein-DNA photocrosslinking--involving rapid-quench-flow mixing and pulsed-laser irradiation--permits elucidation of pathways and kinetics of formation of protein-DNA interactions within multiprotein-DNA complexes. We present detailed protocols for application of static and kinetic site-specific protein-DNA photocrosslinking to bacterial transcription initiation complexes. PMID:19378179

  11. Evaluation of phylogenetic footprint discovery for predicting bacterial cis-regulatory elements and revealing their evolution.

    PubMed

    Janky, Rekin's; van Helden, Jacques

    2008-01-23

    The detection of conserved motifs in promoters of orthologous genes (phylogenetic footprints) has become a common strategy to predict cis-acting regulatory elements. Several software tools are routinely used to raise hypotheses about regulation. However, these tools are generally used as black boxes, with default parameters. A systematic evaluation of optimal parameters for a footprint discovery strategy can bring a sizeable improvement to the predictions. We evaluate the performances of a footprint discovery approach based on the detection of over-represented spaced motifs. This method is particularly suitable for (but not restricted to) Bacteria, since such motifs are typically bound by factors containing a Helix-Turn-Helix domain. We evaluated footprint discovery in 368 Escherichia coli K12 genes with annotated sites, under 40 different combinations of parameters (taxonomical level, background model, organism-specific filtering, operon inference). Motifs are assessed both at the levels of correctness and significance. We further report a detailed analysis of 181 bacterial orthologs of the LexA repressor. Distinct motifs are detected at various taxonomical levels, including the 7 previously characterized taxon-specific motifs. In addition, we highlight a significantly stronger conservation of half-motifs in Actinobacteria, relative to Firmicutes, suggesting an intermediate state in specificity switching between the two Gram-positive phyla, and thereby revealing the on-going evolution of LexA auto-regulation. The footprint discovery method proposed here shows excellent results with E. coli and can readily be extended to predict cis-acting regulatory signals and propose testable hypotheses in bacterial genomes for which nothing is known about regulation.

  12. Ligand-free palladium-mediated site-specific protein labeling inside gram-negative bacterial pathogens.

    PubMed

    Li, Jie; Lin, Shixian; Wang, Jie; Jia, Shang; Yang, Maiyun; Hao, Ziyang; Zhang, Xiaoyu; Chen, Peng R

    2013-05-15

    Palladium, a key transition metal in advancing modern organic synthesis, mediates diverse chemical conversions including many carbon-carbon bond formation reactions between organic compounds. However, expanding palladium chemistry for conjugation of biomolecules such as proteins, particularly within their native cellular context, is still in its infancy. Here we report the site-specific protein labeling inside pathogenic Gram-negative bacterial cells via a ligand-free palladium-mediated cross-coupling reaction. Two rationally designed pyrrolysine analogues bearing an aliphatic alkyne or an iodophenyl handle were first encoded in different enteric bacteria, which offered two facial handles for palladium-mediated Sonogashira coupling reaction on proteins within these pathogens. A GFP-based bioorthogonal reaction screening system was then developed, allowing evaluation of both the efficiency and the biocompatibilty of various palladium reagents in promoting protein-small molecule conjugation. The identified simple compound-Pd(NO3)2 exhibited high efficiency and biocompatibility for site-specific labeling of proteins in vitro and inside living E. coli cells. This Pd-mediated protein coupling method was further utilized to label and visualize a Type-III Secretion (T3S) toxin-OspF in Shigella cells. Our strategy may be generally applicable for imaging and tracking various virulence proteins within Gram-negative bacterial pathogens.

  13. A bacterial type III secretion-based protein delivery tool for broad applications in cell biology.

    PubMed

    Ittig, Simon J; Schmutz, Christoph; Kasper, Christoph A; Amstutz, Marlise; Schmidt, Alexander; Sauteur, Loïc; Vigano, M Alessandra; Low, Shyan Huey; Affolter, Markus; Cornelis, Guy R; Nigg, Erich A; Arrieumerlou, Cécile

    2015-11-23

    Methods enabling the delivery of proteins into eukaryotic cells are essential to address protein functions. Here we propose broad applications to cell biology for a protein delivery tool based on bacterial type III secretion (T3S). We show that bacterial, viral, and human proteins, fused to the N-terminal fragment of the Yersinia enterocolitica T3S substrate YopE, are effectively delivered into target cells in a fast and controllable manner via the injectisome of extracellular bacteria. This method enables functional interaction studies by the simultaneous injection of multiple proteins and allows the targeting of proteins to different subcellular locations by use of nanobody-fusion proteins. After delivery, proteins can be freed from the YopE fragment by a T3S-translocated viral protease or fusion to ubiquitin and cleavage by endogenous ubiquitin proteases. Finally, we show that this delivery tool is suitable to inject proteins in living animals and combine it with phosphoproteomics to characterize the systems-level impact of proapoptotic human truncated BID on the cellular network. © 2015 Ittig et al.

  14. Influence of endurance training on skeletal muscle mitophagy regulatory proteins in type 2 diabetic men.

    PubMed

    Brinkmann, Christian; Przyklenk, Axel; Metten, Alexander; Schiffer, Thorsten; Bloch, Wilhelm; Brixius, Klara; Gehlert, Sebastian

    2017-11-01

    Mitophagy is a form of autophagy for the elimination of mitochondria. Mitochondrial content and function are reduced in the skeletal muscle of patients with type 2 diabetes mellitus (T2DM). Physical training has been shown to restore mitochondrial capacity in T2DM patients, but the role of mitophagy has not been examined in this context. This study analyzes the impact of a 3-month endurance training on important skeletal muscle mitophagy regulatory proteins and oxidative phosphorylation (OXPHOS) complexes in T2DM patients. Muscle biopsies were obtained from eight overweight/obese T2DM men (61±10 years) at T1 (6 weeks pre-training), T2 (1 week pre-training), and T3 (3 to 4 days post-training). Protein contents were determined by Western blotting. The training increased mitochondrial complex II significantly (T2-T3: +29%, p = 0.037). The protein contents of mitophagy regulatory proteins (phosphorylated form of forkhead box O3A (pFOXO3A), mitochondrial E3 ubiquitin protein ligase-1 (MUL1), Bcl-2/adenovirus E1B 19-kD interacting protein-3 (BNIP3), microtubule-associated protein 1 light chain-3B (the ratio LC3B-II/LC3B-I was determined)) did not differ significantly between T1, T2, and T3. The results imply that training-induced changes in OXPHOS subunits (significant increase in complex II) are not accompanied by changes in mitophagy regulatory proteins in T2DM men. Future studies should elucidate whether acute exercise might affect mitophagic processes in T2DM patients (and whether a transient regulation of mitophagy regulatory proteins is evident) to fully clarify the role of physical activity and mitophagy for mitochondrial health in this particular patient group.

  15. Protein deposition and its effect on bacterial adhesion to contact lenses.

    PubMed

    Omali, Negar Babaei; Zhu, Hua; Zhao, Zhenjun; Willcox, Mark D P

    2013-06-01

    Bacterial adhesion to contact lenses is believed to be the initial step for the development of several adverse reactions that occur during lens wear such as microbial keratitis. This study examined the effect of combinations of proteins on the adhesion of bacteria to contact lenses. Unworn balafilcon A and senofilcon A lenses were soaked in commercially available pure protein mixtures to achieve the same amount of various proteins as found ex vivo. These lenses were then exposed to Pseudomonas aeruginosa and Staphylococcus aureus. Following incubation, the numbers of P. aeruginosa or S. aureus that adhered to the lenses were measured. The possible effect of proteins on bacterial growth was investigated by incubating bacteria in medium containing protein. Although there was a significant (p < 0.003) increase in the total or viable counts of one strain of S. aureus (031) on balafilcon A lenses soaked in the lysozyme/lactoferrin combination, the protein adhered to lenses did not alter the adhesion of any other strains of P. aeruginosa or S. aureus (p > 0.05). Growth of S. aureus 031 (p < 0.0001) but not of P. aeruginosa 6294 was stimulated by addition of lysozyme/lactoferrin combination (2.8/0.5 mg/mL). Addition of lipocalin did not affect the growth of any strains tested (p > 0.05). Adsorption of amounts of lysozyme and lactoferrin or lipocalin equivalent to those extracted from worn contact lenses did not affect the adhesion of most strains of S. aureus or P. aeruginosa to lens surfaces.

  16. Clinical Prognosis in Neonatal Bacterial Meningitis: The Role of Cerebrospinal Fluid Protein.

    PubMed

    Tan, Jintong; Kan, Juan; Qiu, Gang; Zhao, Dongying; Ren, Fang; Luo, Zhongcheng; Zhang, Yongjun

    2015-01-01

    Neonates are at high risk of meningitis and of resulting neurologic complications. Early recognition of neonates at risk of poor prognosis would be helpful in providing timely management. From January 2008 to June 2014, we enrolled 232 term neonates with bacterial meningitis admitted to 3 neonatology departments in Shanghai, China. The clinical status on the day of discharge from these hospitals or at a postnatal age of 2.5 to 3 months was evaluated using the Glasgow Outcome Scale (GOS). Patients were classified into two outcome groups: good (167 cases, 72.0%, GOS = 5) or poor (65 cases, 28.0%, GOS = 1-4). Neonates with good outcome had less frequent apnea, drowsiness, poor feeding, bulging fontanelle, irritability and more severe jaundice compared to neonates with poor outcome. The good outcome group also had less pneumonia than the poor outcome group. Besides, there were statistically significant differences in hemoglobin, mean platelet volume, platelet distribution width, C-reaction protein, procalcitonin, cerebrospinal fluid (CSF) glucose and CSF protein. Multivariate logistic regression analyses suggested that poor feeding, pneumonia and CSF protein were the predictors of poor outcome. CSF protein content was significantly higher in patients with poor outcome. The best cut-offs for predicting poor outcome were 1,880 mg/L in CSF protein concentration (sensitivity 70.8%, specificity 86.2%). After 2 weeks of treatment, CSF protein remained higher in the poor outcome group. High CSF protein concentration may prognosticate poor outcome in neonates with bacterial meningitis.

  17. Bacterial co-expression of human Tau protein with protein kinase A and 14-3-3 for studies of 14-3-3/phospho-Tau interaction

    PubMed Central

    Tugaeva, Kristina V.; Tsvetkov, Philipp O.

    2017-01-01

    Abundant regulatory 14-3-3 proteins have an extremely wide interactome and coordinate multiple cellular events via interaction with specifically phosphorylated partner proteins. Notwithstanding the key role of 14-3-3/phosphotarget interactions in many physiological and pathological processes, they are dramatically underexplored. Here, we focused on the 14-3-3 interaction with human Tau protein associated with the development of several neurodegenerative disorders, including Alzheimer’s and Parkinson’s diseases. Among many known phosphorylation sites within Tau, protein kinase A (PKA) phosphorylates several key residues of Tau and induces its tight interaction with 14-3-3 proteins. However, the stoichiometry and mechanism of 14-3-3 interaction with phosphorylated Tau (pTau) are not clearly elucidated. In this work, we describe a simple bacterial co-expression system aimed to facilitate biochemical and structural studies on the 14-3-3/pTau interaction. We show that dual co-expression of human fetal Tau with PKA in Escherichia coli results in multisite Tau phosphorylation including also naturally occurring sites which were not previously considered in the context of 14-3-3 binding. Tau protein co-expressed with PKA displays tight functional interaction with 14-3-3 isoforms of a different type. Upon triple co-expression with 14-3-3 and PKA, Tau protein could be co-purified with 14-3-3 and demonstrates complex which is similar to that formed in vitro between individual 14-3-3 and pTau obtained from dual co-expression. Although used in this study for the specific case of the previously known 14-3-3/pTau interaction, our co-expression system may be useful to study of other selected 14-3-3/phosphotarget interactions and for validations of 14-3-3 complexes identified by other methods. PMID:28575131

  18. Diversity and Evolution of Bacterial Twin Arginine Translocase Protein, TatC, Reveals a Protein Secretion System That Is Evolving to Fit Its Environmental Niche

    PubMed Central

    Simone, Domenico; Bay, Denice C.; Leach, Thorin; Turner, Raymond J.

    2013-01-01

    Background The twin-arginine translocation (Tat) protein export system enables the transport of fully folded proteins across a membrane. This system is composed of two integral membrane proteins belonging to TatA and TatC protein families and in some systems a third component, TatB, a homolog of TatA. TatC participates in substrate protein recognition through its interaction with a twin arginine leader peptide sequence. Methodology/Principal Findings The aim of this study was to explore TatC diversity, evolution and sequence conservation in bacteria to identify how TatC is evolving and diversifying in various bacterial phyla. Surveying bacterial genomes revealed that 77% of all species possess one or more tatC loci and half of these classes possessed only tatC and tatA genes. Phylogenetic analysis of diverse TatC homologues showed that they were primarily inherited but identified a small subset of taxonomically unrelated bacteria that exhibited evidence supporting lateral gene transfer within an ecological niche. Examination of bacilli tatCd/tatCy isoform operons identified a number of known and potentially new Tat substrate genes based on their frequent association to tatC loci. Evolutionary analysis of these Bacilli isoforms determined that TatCy was the progenitor of TatCd. A bacterial TatC consensus sequence was determined and highlighted conserved and variable regions within a three dimensional model of the Escherichia coli TatC protein. Comparative analysis between the TatC consensus sequence and Bacilli TatCd/y isoform consensus sequences revealed unique sites that may contribute to isoform substrate specificity or make TatA specific contacts. Synonymous to non-synonymous nucleotide substitution analyses of bacterial tatC homologues determined that tatC sequence variation differs dramatically between various classes and suggests TatC specialization in these species. Conclusions/Significance TatC proteins appear to be diversifying within particular bacterial

  19. High-yield soluble expression, purification and characterization of human steroidogenic acute regulatory protein (StAR) fused to a cleavable Maltose-Binding Protein (MBP).

    PubMed

    Sluchanko, Nikolai N; Tugaeva, Kristina V; Faletrov, Yaroslav V; Levitsky, Dmitrii I

    2016-03-01

    Steroidogenic acute regulatory protein (StAR) is responsible for the rapid delivery of cholesterol to mitochondria where the lipid serves as a source for steroid hormones biosynthesis in adrenals and gonads. Despite many successful investigations, current understanding of the mechanism of StAR action is far from being completely clear. StAR was mostly obtained using denaturation/renaturation or in minor quantities in a soluble form at decreased temperatures that, presumably, limited the possibilities for its consequent detailed exploration. In our hands, existing StAR expression constructs could be bacterially expressed almost exclusively as insoluble forms, even upon decreased expression temperatures and in specific strains of Escherichia coli, and isolated protein tended to aggregate and was difficult to handle. To maximize the yield of soluble protein, optimized StAR sequence encompassing functional domain STARD1 (residues 66-285) was fused to the C-terminus of His-tagged Maltose-Binding Protein (MBP) with the possibility to cleave off the whole tag by 3C protease. The developed protocol of expression and purification comprising of a combination of subtractive immobilized metal affinity chromatography (IMAC) and size-exclusion chromatography allowed us to obtain up to 25 mg/1 L culture of completely soluble StAR protein, which was (i) homogenous according to SDS-PAGE, (ii) gave a single symmetrical peak on a gel-filtration, (iii) showed the characteristic CD spectrum and (iv) pH-dependent ability to bind a fluorescently-labeled cholesterol analogue. We conclude that our strategy provides fully soluble and native StAR protein which in future could be efficiently used for biotechnology and drug discovery aimed at modulation of steroids production. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Mechanisms of Host-Pathogen Protein Complex Formation and Bacterial Immune Evasion of Streptococcus suis Protein Fhb.

    PubMed

    Li, Xueqin; Liu, Peng; Gan, Shuzhen; Zhang, Chunmao; Zheng, Yuling; Jiang, Yongqiang; Yuan, Yuan

    2016-08-12

    Streptococcus suis serotype 2 (S. suis 2)-induced sepsis and meningitis are often accompanied by bacteremia. The evasion of polymorphonuclear leukocyte-mediated phagocytic clearance is central to the establishment of bacteremia caused by S. suis 2 and is facilitated by the ability of factor H (FH)-binding protein (Fhb) to bind FH on the bacterial surface, thereby impeding alternative pathway complement activation and phagocytic clearance. Here, C3b/C3d was found to bind to Fhb, along with FH, forming a large immune complex. The formation of this immune complex was mediated by domain II of Fhb via electrostatic and hydrophobic interactions, which, to our knowledge, is a new type of interaction. Interestingly, Fhb was found to be associated with the cell envelope and also present in the culture supernatant, where secreted Fhb inhibited complement activation via interactions with domain II, thereby enhancing antiphagocytic clearance by polymorphonuclear leukocytes. Thus, Fhb is a multifunctional bacterial protein, which binds host complement component C3 as well as FH and interferes with innate immune recognition in a secret protein manner. S. suis 2 therefore appears to have developed a new strategy to combat host innate immunity and enhance survival in host blood. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Mechanisms of Host-Pathogen Protein Complex Formation and Bacterial Immune Evasion of Streptococcus suis Protein Fhb*

    PubMed Central

    Li, Xueqin; Liu, Peng; Gan, Shuzhen; Zhang, Chunmao; Zheng, Yuling; Jiang, Yongqiang; Yuan, Yuan

    2016-01-01

    Streptococcus suis serotype 2 (S. suis 2)-induced sepsis and meningitis are often accompanied by bacteremia. The evasion of polymorphonuclear leukocyte-mediated phagocytic clearance is central to the establishment of bacteremia caused by S. suis 2 and is facilitated by the ability of factor H (FH)-binding protein (Fhb) to bind FH on the bacterial surface, thereby impeding alternative pathway complement activation and phagocytic clearance. Here, C3b/C3d was found to bind to Fhb, along with FH, forming a large immune complex. The formation of this immune complex was mediated by domain II of Fhb via electrostatic and hydrophobic interactions, which, to our knowledge, is a new type of interaction. Interestingly, Fhb was found to be associated with the cell envelope and also present in the culture supernatant, where secreted Fhb inhibited complement activation via interactions with domain II, thereby enhancing antiphagocytic clearance by polymorphonuclear leukocytes. Thus, Fhb is a multifunctional bacterial protein, which binds host complement component C3 as well as FH and interferes with innate immune recognition in a secret protein manner. S. suis 2 therefore appears to have developed a new strategy to combat host innate immunity and enhance survival in host blood. PMID:27342778

  2. Bioluminescence resonance energy transfer system for measuring dynamic protein-protein interactions in bacteria.

    PubMed

    Cui, Boyu; Wang, Yao; Song, Yunhong; Wang, Tietao; Li, Changfu; Wei, Yahong; Luo, Zhao-Qing; Shen, Xihui

    2014-05-20

    Protein-protein interactions are important for virtually every biological process, and a number of elegant approaches have been designed to detect and evaluate such interactions. However, few of these methods allow the detection of dynamic and real-time protein-protein interactions in bacteria. Here we describe a bioluminescence resonance energy transfer (BRET) system based on the bacterial luciferase LuxAB. We found that enhanced yellow fluorescent protein (eYFP) accepts the emission from LuxAB and emits yellow fluorescence. Importantly, BRET occurred when LuxAB and eYFP were fused, respectively, to the interacting protein pair FlgM and FliA. Furthermore, we observed sirolimus (i.e., rapamycin)-inducible interactions between FRB and FKBP12 and a dose-dependent abolishment of such interactions by FK506, the ligand of FKBP12. Using this system, we showed that osmotic stress or low pH efficiently induced multimerization of the regulatory protein OmpR and that the multimerization induced by low pH can be reversed by a neutralizing agent, further indicating the usefulness of this system in the measurement of dynamic interactions. This method can be adapted to analyze dynamic protein-protein interactions and the importance of such interactions in bacterial processes such as development and pathogenicity. Real-time measurement of protein-protein interactions in prokaryotes is highly desirable for determining the roles of protein complex in the development or virulence of bacteria, but methods that allow such measurement are not available. Here we describe the development of a bioluminescence resonance energy transfer (BRET) technology that meets this need. The use of endogenous excitation light in this strategy circumvents the requirement for the sophisticated instrument demanded by standard fluorescence resonance energy transfer (FRET). Furthermore, because the LuxAB substrate decanal is membrane permeable, the assay can be performed without lysing the bacterial cells

  3. Bioluminescence Resonance Energy Transfer System for Measuring Dynamic Protein-Protein Interactions in Bacteria

    PubMed Central

    Cui, Boyu; Wang, Yao; Song, Yunhong; Wang, Tietao; Li, Changfu; Wei, Yahong

    2014-01-01

    ABSTRACT Protein-protein interactions are important for virtually every biological process, and a number of elegant approaches have been designed to detect and evaluate such interactions. However, few of these methods allow the detection of dynamic and real-time protein-protein interactions in bacteria. Here we describe a bioluminescence resonance energy transfer (BRET) system based on the bacterial luciferase LuxAB. We found that enhanced yellow fluorescent protein (eYFP) accepts the emission from LuxAB and emits yellow fluorescence. Importantly, BRET occurred when LuxAB and eYFP were fused, respectively, to the interacting protein pair FlgM and FliA. Furthermore, we observed sirolimus (i.e., rapamycin)-inducible interactions between FRB and FKBP12 and a dose-dependent abolishment of such interactions by FK506, the ligand of FKBP12. Using this system, we showed that osmotic stress or low pH efficiently induced multimerization of the regulatory protein OmpR and that the multimerization induced by low pH can be reversed by a neutralizing agent, further indicating the usefulness of this system in the measurement of dynamic interactions. This method can be adapted to analyze dynamic protein-protein interactions and the importance of such interactions in bacterial processes such as development and pathogenicity. PMID:24846380

  4. Bacterial RecA Protein Promotes Adenoviral Recombination during In Vitro Infection

    PubMed Central

    Lee, Jeong Yoon; Lee, Ji Sun; Materne, Emma C.; Rajala, Rahul; Ismail, Ashrafali M.; Seto, Donald; Dyer, David W.

    2018-01-01

    presence of bacterial RecA protein facilitated homologous recombination between viruses. Genetic recombination led to evolution of an important external feature on the adenoviral capsid, namely, the penton base protein hypervariable loop 2, which contains the arginine-glycine-aspartic acid motif critical to viral internalization. We speculate that free Rec proteins present in gastrointestinal secretions upon bacterial cell death facilitate the evolution of human adenoviruses through homologous recombination, an example of viral commensalism and the complexity of virus-host interactions, including regional microbiota. PMID:29925671

  5. Object-adapted trapping and shape-tracking to probe a bacterial protein chain motor

    NASA Astrophysics Data System (ADS)

    Roth, Julian; Koch, Matthias; Rohrbach, Alexander

    2015-03-01

    The helical bacterium Spiroplasma is a motile plant and anthropod pathogen which swims by propagating pairs of kinks along its cell body. As a well suited model system for bacterial locomotion, understanding the cell's molecular motor is of vital interest also regarding the combat of bacterial diseases. The extensive deformations related to these kinks are caused by a contractile cytoskeletal protein ribbon representing a linear motor in contrast to common rotary motors as, e.g., flagella. We present new insights into the working of this motor through experiments with object-adapted optical traps and shape-tracking techniques. We use the given laser irradiation from the optical trap to hinder bacterial energy (ATP) production through the production of O2 radicals. The results are compared with experiments performed under the influence of an O2-Scavenger and ATP inhibitors, respectively. Our results show clear dependences of the kinking properties on the ATP concentration inside the bacterium. The experiments are supported by a theoretical model which we developed to describe the switching of the ribbon's protein subunits.

  6. The Iron-Responsive Fur/RyhB Regulatory Cascade Modulates the Shigella Outer Membrane Protease IcsP ▿ †

    PubMed Central

    Africa, Lia A. A.; Murphy, Erin R.; Egan, Nicholas R.; Wigley, Amanda F.; Wing, Helen J.

    2011-01-01

    Actin-based motility is central to the pathogenicity of the intracellular bacterial pathogen Shigella. Two Shigella outer membrane proteins, IcsA and IcsP, are required for efficient actin-based motility in the host cell cytoplasm, and the genes encoding both proteins are carried on the large virulence plasmid. IcsA triggers actin polymerization on the surface of the bacterium, leading to the formation of an actin tail that allows both intra- and intercellular spread. IcsP, an outer membrane protease, modulates the amount and distribution of the IcsA protein on the bacterial surface through proteolytic cleavage of IcsA. Transcription of icsP is increased in the presence of VirB, a DNA-binding protein that positively regulates many genes carried on the large virulence plasmid. In Shigella dysenteriae, the small regulatory RNA RyhB, which is a member of the iron-responsive Fur regulon, suppresses several virulence-associated phenotypes by downregulating levels of virB in response to iron limitation. Here we show that the Fur/RyhB regulatory pathway downregulates IcsP levels in response to low iron concentrations in Shigella flexneri and that this occurs at the level of transcription through the RyhB-dependent regulation of VirB. These observations demonstrate that in Shigella species the Fur/RyhB regulatory pathway provides a mechanism to finely tune the expression of icsP in response to the low concentrations of free iron predicted to be encountered within colonic epithelial cells. PMID:21859852

  7. Procalcitonin and C-reactive protein as markers of bacterial infection in critically ill children at onset of systemic inflammatory response syndrome.

    PubMed

    Simon, Liliana; Saint-Louis, Patrick; Amre, Devendra K; Lacroix, Jacques; Gauvin, France

    2008-07-01

    To compare the accuracy of procalcitonin and C-reactive protein as diagnostic markers of bacterial infection in critically ill children at the onset of systemic inflammatory response syndrome (SIRS). Prospective cohort study. Tertiary care, university-affiliated pediatric intensive care unit (PICU). Consecutive patients with SIRS. From June to December 2002, all PICU patients were screened daily to include cases of SIRS. At inclusion (onset of SIRS), procalcitonin and C-reactive protein levels as well as an array of cultures were obtained. Diagnosis of bacterial infection was made a posteriori by an adjudicating process (consensus of experts unaware of the results of procalcitonin and C-reactive protein). Baseline and daily data on severity of illness, organ dysfunction, and outcome were collected. Sixty-four patients were included in the study and were a posteriori divided into the following groups: bacterial SIRS (n = 25) and nonbacterial SIRS (n = 39). Procalcitonin levels were significantly higher in patients with bacterial infection compared with patients without bacterial infection (p = .01). The area under the receiver operating characteristic curve for procalcitonin was greater than that for C-reactive protein (0.71 vs. 0.65, respectively). A positive procalcitonin level (>or=2.5 ng/mL), when added to bedside clinical judgment, increased the likelihood of bacterial infection from 39% to 92%, while a negative C-reactive protein level (<40 mg/L) decreased the probability of bacterial infection from 39% to 2%. Procalcitonin is better than C-reactive protein for differentiating bacterial from nonbacterial SIRS in critically ill children, although the accuracy of both tests is moderate. Diagnostic accuracy could be enhanced by combining these tests with bedside clinical judgment.

  8. Repairing oxidized proteins in the bacterial envelope using respiratory chain electrons.

    PubMed

    Gennaris, Alexandra; Ezraty, Benjamin; Henry, Camille; Agrebi, Rym; Vergnes, Alexandra; Oheix, Emmanuel; Bos, Julia; Leverrier, Pauline; Espinosa, Leon; Szewczyk, Joanna; Vertommen, Didier; Iranzo, Olga; Collet, Jean-François; Barras, Frédéric

    2015-12-17

    The reactive species of oxygen and chlorine damage cellular components, potentially leading to cell death. In proteins, the sulfur-containing amino acid methionine is converted to methionine sulfoxide, which can cause a loss of biological activity. To rescue proteins with methionine sulfoxide residues, living cells express methionine sulfoxide reductases (Msrs) in most subcellular compartments, including the cytosol, mitochondria and chloroplasts. Here we report the identification of an enzymatic system, MsrPQ, repairing proteins containing methionine sulfoxide in the bacterial cell envelope, a compartment particularly exposed to the reactive species of oxygen and chlorine generated by the host defence mechanisms. MsrP, a molybdo-enzyme, and MsrQ, a haem-binding membrane protein, are widely conserved throughout Gram-negative bacteria, including major human pathogens. MsrPQ synthesis is induced by hypochlorous acid, a powerful antimicrobial released by neutrophils. Consistently, MsrPQ is essential for the maintenance of envelope integrity under bleach stress, rescuing a wide series of structurally unrelated periplasmic proteins from methionine oxidation, including the primary periplasmic chaperone SurA. For this activity, MsrPQ uses electrons from the respiratory chain, which represents a novel mechanism to import reducing equivalents into the bacterial cell envelope. A remarkable feature of MsrPQ is its capacity to reduce both rectus (R-) and sinister (S-) diastereoisomers of methionine sulfoxide, making this oxidoreductase complex functionally different from previously identified Msrs. The discovery that a large class of bacteria contain a single, non-stereospecific enzymatic complex fully protecting methionine residues from oxidation should prompt a search for similar systems in eukaryotic subcellular oxidizing compartments, including the endoplasmic reticulum.

  9. Human homologues of the bacterial heat-shock protein DnaJ are preferentially expressed in neurons.

    PubMed Central

    Cheetham, M E; Brion, J P; Anderton, B H

    1992-01-01

    The bacterial heat-shock protein DnaJ has been implicated in protein folding and protein complex dissociation. The DnaJ protein interacts with the prokaryotic analogue of Hsp70, DnaK, and accelerates the rate of ATP hydrolysis by DnaK. Several yeast homologues of DnaJ, with different proposed subcellular localizations and functions, have recently been isolated and are the only eukaryotic forms of DnaJ so far described. We have isolated cDNAs corresponding to two alternatively spliced transcripts of a novel human gene, HSJ1, which show sequence similarity to the bacterial DnaJ protein and the yeast homologues. The cDNA clones were isolated from a human brain-frontal-cortex expression library screened with a polyclonal antiserum raised to paired-helical-filament (PHF) proteins isolated from extracts of the brains of patients suffering from Alzheimer's disease. The similarity between the predicted human protein sequences and the bacterial and yeast proteins is highest at the N-termini, this region also shows a limited similarity to viral T-antigens and is a possible common motif involved in the interaction with DnaK/Hsp70. Northern-blot analysis has shown that human brain contains higher levels of mRNA for the DnaJ homologue than other tissues examined, and hybridization studies with riboprobes in situ show a restricted pattern of expression of the mRNA within the brain, with neuronal layers giving the strongest signal. These findings suggest that the DnaJ-DnaK (Hsp70) interaction is general to eukaryotes and, indeed, to higher organisms. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:1599432

  10. Selective Sorting of Cargo Proteins into Bacterial Membrane Vesicles*

    PubMed Central

    Haurat, M. Florencia; Aduse-Opoku, Joseph; Rangarajan, Minnie; Dorobantu, Loredana; Gray, Murray R.; Curtis, Michael A.; Feldman, Mario F.

    2011-01-01

    In contrast to the well established multiple cellular roles of membrane vesicles in eukaryotic cell biology, outer membrane vesicles (OMV) produced via blebbing of prokaryotic membranes have frequently been regarded as cell debris or microscopy artifacts. Increasingly, however, bacterial membrane vesicles are thought to play a role in microbial virulence, although it remains to be determined whether OMV result from a directed process or from passive disintegration of the outer membrane. Here we establish that the human oral pathogen Porphyromonas gingivalis has a mechanism to selectively sort proteins into OMV, resulting in the preferential packaging of virulence factors into OMV and the exclusion of abundant outer membrane proteins from the protein cargo. Furthermore, we show a critical role for lipopolysaccharide in directing this sorting mechanism. The existence of a process to package specific virulence factors into OMV may significantly alter our current understanding of host-pathogen interactions. PMID:21056982

  11. Phylogenetic and Complementation Analysis of a Single-Stranded DNA Binding Protein Family from Lactococcal Phages Indicates a Non-Bacterial Origin

    PubMed Central

    Mariadassou, Mahendra; Bardowski, Jacek K.; Bidnenko, Elena

    2011-01-01

    Background The single-stranded-nucleic acid binding (SSB) protein superfamily includes proteins encoded by different organisms from Bacteria and their phages to Eukaryotes. SSB proteins share common structural characteristics and have been suggested to descend from an ancestor polypeptide. However, as other proteins involved in DNA replication, bacterial SSB proteins are clearly different from those found in Archaea and Eukaryotes. It was proposed that the corresponding genes in the phage genomes were transferred from the bacterial hosts. Recently new SSB proteins encoded by the virulent lactococcal bacteriophages (Orf14bIL67-like proteins) have been identified and characterized structurally and biochemically. Methodology/Principal Findings This study focused on the determination of phylogenetic relationships between Orf14bIL67-like proteins and other SSBs. We have performed a large scale phylogenetic analysis and pairwise sequence comparisons of SSB proteins from different phyla. The results show that, in remarkable contrast to other phage SSBs, the Orf14bIL67–like proteins form a distinct, self-contained and well supported phylogenetic group connected to the archaeal SSBs. Functional studies demonstrated that, despite the structural and amino acid sequence differences from bacterial SSBs, Orf14bIL67 protein complements the conditional lethal ssb-1 mutation of Escherichia coli. Conclusions/Significance Here we identified for the first time a group of phages encoded SSBs which are clearly distinct from their bacterial counterparts. All methods supported the recognition of these phage proteins as a new family within the SSB superfamily. Our findings suggest that unlike other phages, the virulent lactococcal phages carry ssb genes that were not acquired from their hosts, but transferred from an archaeal genome. This represents a unique example of a horizontal gene transfer between Archaea and bacterial phages. PMID:22073223

  12. Coupling MALDI-TOF mass spectrometry protein and specialized metabolite analyses to rapidly discriminate bacterial function

    PubMed Central

    Clark, Chase M.; Costa, Maria S.

    2018-01-01

    For decades, researchers have lacked the ability to rapidly correlate microbial identity with bacterial metabolism. Since specialized metabolites are critical to bacterial function and survival in the environment, we designed a data acquisition and bioinformatics technique (IDBac) that utilizes in situ matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to analyze protein and specialized metabolite spectra recorded from single bacterial colonies picked from agar plates. We demonstrated the power of our approach by discriminating between two Bacillus subtilis strains in <30 min solely on the basis of their differential ability to produce cyclic peptide antibiotics surfactin and plipastatin, caused by a single frameshift mutation. Next, we used IDBac to detect subtle intraspecies differences in the production of metal scavenging acyl-desferrioxamines in a group of eight freshwater Micromonospora isolates that share >99% sequence similarity in the 16S rRNA gene. Finally, we used IDBac to simultaneously extract protein and specialized metabolite MS profiles from unidentified Lake Michigan sponge-associated bacteria isolated from an agar plate. In just 3 h, we created hierarchical protein MS groupings of 11 environmental isolates (10 MS replicates each, for a total of 110 spectra) that accurately mirrored phylogenetic groupings. We further distinguished isolates within these groupings, which share nearly identical 16S rRNA gene sequence identity, based on interspecies and intraspecies differences in specialized metabolite production. IDBac is an attempt to couple in situ MS analyses of protein content and specialized metabolite production to allow for facile discrimination of closely related bacterial colonies. PMID:29686101

  13. Global versus Local Regulatory Roles for Lrp-Related Proteins: Haemophilus influenzae as a Case Study

    PubMed Central

    Friedberg, Devorah; Midkiff, Michael; Calvo, Joseph M.

    2001-01-01

    Lrp (leucine-responsive regulatory protein) plays a global regulatory role in Escherichia coli, affecting expression of dozens of operons. Numerous lrp-related genes have been identified in different bacteria and archaea, including asnC, an E. coli gene that was the first reported member of this family. Pairwise comparisons of amino acid sequences of the corresponding proteins shows an average sequence identity of only 29% for the vast majority of comparisons. By contrast, Lrp-related proteins from enteric bacteria show more than 97% amino acid identity. Is the global regulatory role associated with E. coli Lrp limited to enteric bacteria? To probe this question we investigated LrfB, an Lrp-related protein from Haemophilus influenzae that shares 75% sequence identity with E. coli Lrp (highest sequence identity among 42 sequences compared). A strain of H. influenzae having an lrfB null allele grew at the wild-type growth rate but with a filamentous morphology. A comparison of two-dimensional (2D) electrophoretic patterns of proteins from parent and mutant strains showed only two differences (comparable studies with lrp+ and lrp E. coli strains by others showed 20 differences). The abundance of LrfB in H. influenzae, estimated by Western blotting experiments, was about 130 dimers per cell (compared to 3,000 dimers per E. coli cell). LrfB expressed in E. coli replaced Lrp as a repressor of the lrp gene but acted only to a limited extent as an activator of the ilvIH operon. Thus, although LrfB resembles Lrp sufficiently to perform some of its functions, its low abundance is consonant with a more local role in regulating but a few genes, a view consistent with the results of the 2D electrophoretic analysis. We speculate that an Lrp having a global regulatory role evolved to help enteric bacteria adapt to their ecological niches and that it is unlikely that Lrp-related proteins in other organisms have a broad regulatory function. PMID:11395465

  14. Selective dye-labeling of newly synthesized proteins in bacterial cells.

    PubMed

    Beatty, Kimberly E; Xie, Fang; Wang, Qian; Tirrell, David A

    2005-10-19

    We describe fluorescence labeling of newly synthesized proteins in Escherichia coli cells by means of Cu(I)-catalyzed cycloaddition between alkynyl amino acid side chains and the fluorogenic dye 3-azido-7-hydroxycoumarin. The method involves co-translational labeling of proteins by the non-natural amino acids homopropargylglycine (Hpg) or ethynylphenylalanine (Eth) followed by treatment with the dye. As a demonstration, the model protein barstar was expressed and treated overnight with Cu(I) and 3-azido-7-hydroxycoumarin. Examination of treated cells by confocal microscopy revealed that strong fluorescence enhancement was observed only for alkynyl-barstar treated with Cu(I) and the reactive dye. The cellular fluorescence was punctate, and gel electrophoresis confirmed that labeled barstar was localized in inclusion bodies. Other proteins showed little fluorescence. Examination of treated cells by fluorimetry demonstrated that cultures supplemented with Eth or Hpg showed an 8- to 14-fold enhancement in fluorescence intensity after labeling. Addition of a protein synthesis inhibitor reduced the emission intensity to levels slightly above background, confirming selective labeling of newly synthesized proteins in the bacterial cell.

  15. GRIL-Seq, a method for identifying direct targets of bacterial small regulatory RNA by in vivo proximity ligation

    PubMed Central

    Han, Kook; Tjaden, Brian; Lory, Stephen

    2017-01-01

    The first step in the post-transcriptional regulatory function of most bacterial small non-coding RNAs (sRNAs) is base-pairing with partially complementary sequences of targeted transcripts. We present a simple method for identifying sRNA targets in vivo and defining processing sites of the regulated transcripts. The technique (referred to as GRIL-Seq) is based on preferential ligation of sRNAs to ends of base-paired targets in bacteria co-expressing T4 RNA ligase, followed by sequencing to identify the chimeras. In addition to the RNA chaperone Hfq, the GRIL-Seq method depends on the activity of the pyrophosphorylase RppH. Using PrrF1, an iron-regulated sRNA in Pseudomonas aeruginosa, we demonstrate that direct regulatory targets of this sRNA can be readily identified. Therefore, GRIL-Seq represents a powerful tool not only for identifying direct targets of sRNAs in a variety of environments, but can also result in uncovering novel roles for sRNAs and their targets in complex regulatory networks. PMID:28005055

  16. Loss of Regulatory Protein RfaH Attenuates Virulence of Uropathogenic Escherichia coli

    PubMed Central

    Nagy, Gábor; Dobrindt, Ulrich; Schneider, György; Khan, A. Salam; Hacker, Jörg; Emödy, Levente

    2002-01-01

    RfaH is a regulatory protein in Escherichia coli and Salmonella enterica serovar Typhimurium. Although it enhances expression of different factors that are proposed to play a role in bacterial virulence, a direct effect of RfaH on virulence has not been investigated so far. We report that inactivation of rfaH dramatically decreases the virulence of uropathogenic E. coli strain 536 in an ascending mouse model of urinary tract infection. The mortality rate caused by the wild-type strain in this assay is 100%, whereas that of its isogenic rfaH mutant does not exceed 18%. In the case of coinfection, the wild-type strain 536 shows higher potential to colonize the urinary tract even when it is outnumbered 100-fold by its rfaH mutant in the inoculum. In contrast to the wild-type strain, serum resistance of strain 536rfaH::cat is fully abolished. Furthermore, we give evidence that, besides a major decrease in the amount of hemin receptor ChuA (G. Nagy, U. Dobrindt, M. Kupfer, L. Emody, H. Karch, and J. Hacker, Infect. Immun. 69:1924-1928, 2001), loss of the RfaH protein results in an altered lipopolysaccharide phenotype as well as decreased expression of K15 capsule and alpha-hemolysin, whereas levels of other pathogenicity factors such as siderophores, flagella, Prf, and S fimbriae appear to be unaltered in strain 536rfaH::cat in comparison to the wild-type strain. trans complementation of the mutant strain with the rfaH gene restores wild-type levels of the affected virulence factors and consequently restitutes virulence in the mouse model of ascending urinary tract infection. PMID:12117951

  17. Multi-disciplinary methods to define RNA-protein interactions and regulatory networks.

    PubMed

    Ascano, Manuel; Gerstberger, Stefanie; Tuschl, Thomas

    2013-02-01

    The advent of high-throughput technologies including deep-sequencing and protein mass spectrometry is facilitating the acquisition of large and precise data sets toward the definition of post-transcriptional regulatory networks. While early studies that investigated specific RNA-protein interactions in isolation laid the foundation for our understanding of the existence of molecular machines to assemble and process RNAs, there is a more recent appreciation of the importance of individual RNA-protein interactions that contribute to post-transcriptional gene regulation. The multitude of RNA-binding proteins (RBPs) and their many RNA targets has only been captured experimentally in recent times. In this review, we will examine current multidisciplinary approaches toward elucidating RNA-protein networks and their regulation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Evolution of bacterial-like phosphoprotein phosphatases in photosynthetic eukaryotes features ancestral mitochondrial or archaeal origin and possible lateral gene transfer.

    PubMed

    Uhrig, R Glen; Kerk, David; Moorhead, Greg B

    2013-12-01

    Protein phosphorylation is a reversible regulatory process catalyzed by the opposing reactions of protein kinases and phosphatases, which are central to the proper functioning of the cell. Dysfunction of members in either the protein kinase or phosphatase family can have wide-ranging deleterious effects in both metazoans and plants alike. Previously, three bacterial-like phosphoprotein phosphatase classes were uncovered in eukaryotes and named according to the bacterial sequences with which they have the greatest similarity: Shewanella-like (SLP), Rhizobiales-like (RLPH), and ApaH-like (ALPH) phosphatases. Utilizing the wealth of data resulting from recently sequenced complete eukaryotic genomes, we conducted database searching by hidden Markov models, multiple sequence alignment, and phylogenetic tree inference with Bayesian and maximum likelihood methods to elucidate the pattern of evolution of eukaryotic bacterial-like phosphoprotein phosphatase sequences, which are predominantly distributed in photosynthetic eukaryotes. We uncovered a pattern of ancestral mitochondrial (SLP and RLPH) or archaeal (ALPH) gene entry into eukaryotes, supplemented by possible instances of lateral gene transfer between bacteria and eukaryotes. In addition to the previously known green algal and plant SLP1 and SLP2 protein forms, a more ancestral third form (SLP3) was found in green algae. Data from in silico subcellular localization predictions revealed class-specific differences in plants likely to result in distinct functions, and for SLP sequences, distinctive and possibly functionally significant differences between plants and nonphotosynthetic eukaryotes. Conserved carboxyl-terminal sequence motifs with class-specific patterns of residue substitutions, most prominent in photosynthetic organisms, raise the possibility of complex interactions with regulatory proteins.

  19. A polymorphism in a conserved posttranscriptional regulatory motif alters bone morphogenetic protein 2 (BMP2) RNA:protein interactions.

    PubMed

    Fritz, David T; Jiang, Shan; Xu, Junwang; Rogers, Melissa B

    2006-07-01

    The bone morphogenetic protein (BMP)2 gene has been genetically linked to osteoporosis and osteoarthritis. We have shown that the 3'-untranslated regions (UTR) of BMP2 genes from mammals to fishes are extraordinarily conserved. This indicates that the BMP2 3'-UTR is under stringent selective pressure. We present evidence that the conserved region is a strong posttranscriptional regulator of BMP2 expression. Polymorphisms in cis-regulatory elements have been proven to influence susceptibility to a growing number of diseases. A common single nucleotide polymorphism (SNP) disrupts a putative posttranscriptional regulatory motif, an AU-rich element, within the BMP2 3'-UTR. The affinity of specific proteins for the rs15705 SNP sequence differs from their affinity for the normal human sequence. More importantly, the in vitro decay rate of RNAs with the SNP is higher than that of RNAs with the normal sequence. Such changes in mRNA:protein interactions may influence the posttranscriptional mechanisms that control BMP2 gene expression. The consequent alterations in BMP2 protein levels may influence the development or physiology of bone or other BMP2-influenced tissues.

  20. UGT-29 protein expression and localization during bacterial infection in Caenorhabditis elegans

    NASA Astrophysics Data System (ADS)

    Wong, Rui-Rui; Lee, Song-Hua; Nathan, Sheila

    2014-09-01

    The nematode Caenorhabditis elegans is routinely used as an animal model to delineate complex molecular mechanisms involved in the host response to pathogen infection. Following up on an earlier study on host-pathogen interaction, we constructed a ugt-29::GFP transcriptional fusion transgenic worm strain to examine UGT-29 protein expression and localization upon bacterial infection. UGT-29 orthologs can be found in higher organisms including humans and is proposed as a member of the UDP-Glucoronosyl Transferase family of proteins which are involved in phase II detoxification of compounds detrimental to the host organism. Under uninfected conditions, UGT-29::GFP fusion protein was highly expressed in the C. elegans anterior pharynx and intestine, two major organs involved in detoxification. We further evaluated the localization of the enzyme in worms infected with the bacterial pathogen, Burkholderia pseudomallei. The infected ugt-29::GFP transgenic strain exhibited increased fluorescence in the pharynx and intestine with pronounced fluorescence also extending to body wall muscle. This transcriptional fusion GFP transgenic worm is a convenient and direct tool to provide information on UGT detoxification enzyme gene expression and could be a useful tool for a number of diverse applications.

  1. Communication: Microsecond dynamics of the protein and water affect electron transfer in a bacterial bc1 complex

    NASA Astrophysics Data System (ADS)

    Martin, Daniel R.; Matyushov, Dmitry V.

    2015-04-01

    Cross-membrane electron transport between cofactors localized in proteins of mitochondrial respiration and bacterial photosynthesis is the source of all biological energy. The statistics and dynamics of nuclear fluctuations in these protein/membrane/water heterogeneous systems are critical for their energetic efficiency. The results of 13 μs of atomistic molecular dynamics simulations of the membrane-bound bc1 bacterial complex are analyzed here. The reaction is affected by a broad spectrum of nuclear modes, with the slowest dynamics in the range of time-scales ˜0.1-1.6 μs contributing half of the reaction reorganization energy. Two reorganization energies are required to describe protein electron transfer due to dynamical arrest of protein conformations on the observation window. This mechanistic distinction allows significant lowering of activation barriers for reactions in proteins.

  2. Repairing oxidized proteins in the bacterial envelope using respiratory chain electrons

    PubMed Central

    Henry, Camille; Agrebi, Rym; Vergnes, Alexandra; Oheix, Emmanuel; Bos, Julia; Leverrier, Pauline; Espinosa, Leon; Szewczyk, Joanna; Vertommen, Didier; Iranzo, Olga; Collet, Jean-François; Barras, Frédéric

    2015-01-01

    The reactive species of oxygen (ROS) and chlorine (RCS) damage cellular components, potentially leading to cell death. In proteins, the sulfur-containing amino acid methionine (Met) is converted to methionine sulfoxide (Met-O), which can cause a loss of biological activity. To rescue proteins with Met-O residues, living cells express methionine sulfoxide reductases (Msrs) in most subcellular compartments, including the cytosol, mitochondria and chloroplasts 1-3. Here, we report the identification of an enzymatic system, MsrPQ, repairing Met-O containing proteins in the bacterial cell envelope, a compartment particularly exposed to the ROS and RCS generated by the host defense mechanisms. MsrP, a molybdo-enzyme, and MsrQ, a heme-binding membrane protein, are widely conserved throughout Gram-negative bacteria, including major human pathogens. MsrPQ synthesis is induced by hypochlorous acid (HOCl), a powerful antimicrobial released by neutrophils. Consistently, MsrPQ is essential for the maintenance of envelope integrity under bleach stress, rescuing a wide series of structurally unrelated periplasmic proteins from Met oxidation, including the primary periplasmic chaperone SurA. For this activity, MsrPQ uses electrons from the respiratory chain, which represents a novel mechanism to import reducing equivalents into the bacterial cell envelope. A remarkable feature of MsrPQ is its capacity to reduce both R- and S- diastereoisomers of Met-O, making this oxidoreductase complex functionally different from previously identified Msrs. The discovery that a large class of bacteria contain a single, non-stereospecific enzymatic complex fully protecting Met residues from oxidation should prompt search for similar systems in eukaryotic subcellular oxidizing compartments, including the endoplasmic reticulum (ER). PMID:26641313

  3. Adaptive Calcified Matrix Response of Dental Pulp to Bacterial Invasion Is Associated with Establishment of a Network of Glial Fibrillary Acidic Protein+/Glutamine Synthetase+ Cells

    PubMed Central

    Farahani, Ramin M.; Nguyen, Ky-Anh; Simonian, Mary; Hunter, Neil

    2010-01-01

    We report evidence for anatomical and functional changes of dental pulp in response to bacterial invasion through dentin that parallel responses to noxious stimuli reported in neural crest-derived sensory tissues. Sections of resin-embedded carious adult molar teeth were prepared for immunohistochemistry, in situ hybridization, ultrastructural analysis, and microdissection to extract mRNA for quantitative analyses. In odontoblasts adjacent to the leading edge of bacterial invasion in carious teeth, expression levels of the gene encoding dentin sialo-protein were 16-fold greater than in odontoblasts of healthy teeth, reducing progressively with distance from this site of the carious lesion. In contrast, gene expression for dentin matrix protein-1 by odontoblasts was completely suppressed in carious teeth relative to healthy teeth. These changes in gene expression were related to a gradient of deposited reactionary dentin that displayed a highly modified structure. In carious teeth, interodontoblastic dentin sialo-protein− cells expressing glutamine synthetase (GS) showed up-regulation of glial fibrillary acidic protein (GFAP). These cells extended processes that associated with odontoblasts. Furthermore, connexin 43 established a linkage between adjacent GFAP+/GS+ cells in carious teeth only. These findings indicate an adaptive pulpal response to encroaching caries that includes the deposition of modified, calcified, dentin matrix associated with networks of GFAP+/GS+ interodontoblastic cells. A regulatory role for the networks of GFAP+/GS+ cells is proposed, mediated by the secretion of glutamate to modulate odontoblastic response. PMID:20802180

  4. Fusobacterium nucleatum binding to complement regulatory protein CD46 modulates the expression and secretion of cytokines and matrix metalloproteinases by oral epithelial cells.

    PubMed

    Mahtout, Hayette; Chandad, Fatiha; Rojo, Jose M; Grenier, Daniel

    2011-02-01

    Periodontitis is a chronic inflammatory disease that results in the destruction of the supporting tissues of the teeth. Gingival epithelial cells are an important mechanical barrier and participate in the host inflammatory response to periodontopathogens. The aim of the present study is to investigate the capacity of Fusobacterium nucleatum to bind to the complement regulatory protein CD46 expressed by oral epithelial cells and to determine the impact of the binding on the gene expression and protein secretion of interleukin (IL)-6, IL-8, and matrix metalloproteinase (MMP)-9 by oral epithelial cells. Binding of recombinant human CD46 to the surface of F. nucleatum was demonstrated by immunologic assays. After stimulation of oral epithelial cells with F. nucleatum, gene expression was determined by real-time polymerase chain reaction analysis while protein secretion was monitored by enzyme-linked immunosorbent assays. Heat and protease treatments of bacterial cells reduced CD46 binding. F. nucleatum-bound CD46 mediated the cleavage of C3b in the presence of factor I. Stimulating oral epithelial cells with F. nucleatum at a multiplicity of infection of 50 resulted in a significant upregulation of the gene expression and protein secretion of IL-6, IL-8, and MMP-9 by oral epithelial cells. However, pretreating the epithelial cells with an anti-CD46 polyclonal antibody attenuated the production of IL-6, IL-8, and MMP-9 in response to F. nucleatum. Such an inhibitory effect was not observed with non-specific antibodies. The present study demonstrates that F. nucleatum can bind the complement regulatory protein CD46. The interaction of F. nucleatum with epithelial cell surface CD46 may contribute to increasing the levels of proinflammatory mediators and MMPs in periodontal sites and consequently modulate tissue destruction.

  5. Fuel of the Bacterial Flagellar Type III Protein Export Apparatus.

    PubMed

    Minamino, Tohru; Kinoshita, Miki; Namba, Keiichi

    2017-01-01

    The flagellar type III export apparatus utilizes ATP and proton motive force (PMF) across the cytoplasmic membrane as the energy sources and transports flagellar component proteins from the cytoplasm to the distal growing end of the growing structure to construct the bacterial flagellum beyond the cellular membranes. The flagellar type III export apparatus coordinates flagellar protein export with assembly by ordered export of substrates to parallel with their order of the assembly. The export apparatus is composed of a PMF-driven transmembrane export gate complex and a cytoplasmic ATPase complex. Since the ATPase complex is dispensable for flagellar protein export, PMF is the primary fuel for protein unfolding and translocation. Interestingly, the export gate complex can also use sodium motive force across the cytoplasmic membrane in addition to PMF when the ATPase complex does not work properly. Here, we describe experimental protocols, which have allowed us to identify the export substrate class and the primary fuel of the flagellar type III protein export apparatus in Salmonella enterica serovar Typhimurium.

  6. SigmoID: a user-friendly tool for improving bacterial genome annotation through analysis of transcription control signals

    PubMed Central

    Damienikan, Aliaksandr U.

    2016-01-01

    The majority of bacterial genome annotations are currently automated and based on a ‘gene by gene’ approach. Regulatory signals and operon structures are rarely taken into account which often results in incomplete and even incorrect gene function assignments. Here we present SigmoID, a cross-platform (OS X, Linux and Windows) open-source application aiming at simplifying the identification of transcription regulatory sites (promoters, transcription factor binding sites and terminators) in bacterial genomes and providing assistance in correcting annotations in accordance with regulatory information. SigmoID combines a user-friendly graphical interface to well known command line tools with a genome browser for visualising regulatory elements in genomic context. Integrated access to online databases with regulatory information (RegPrecise and RegulonDB) and web-based search engines speeds up genome analysis and simplifies correction of genome annotation. We demonstrate some features of SigmoID by constructing a series of regulatory protein binding site profiles for two groups of bacteria: Soft Rot Enterobacteriaceae (Pectobacterium and Dickeya spp.) and Pseudomonas spp. Furthermore, we inferred over 900 transcription factor binding sites and alternative sigma factor promoters in the annotated genome of Pectobacterium atrosepticum. These regulatory signals control putative transcription units covering about 40% of the P. atrosepticum chromosome. Reviewing the annotation in cases where it didn’t fit with regulatory information allowed us to correct product and gene names for over 300 loci. PMID:27257541

  7. Structural analysis of a set of proteins resulting from a bacterial genomics project.

    PubMed

    Badger, J; Sauder, J M; Adams, J M; Antonysamy, S; Bain, K; Bergseid, M G; Buchanan, S G; Buchanan, M D; Batiyenko, Y; Christopher, J A; Emtage, S; Eroshkina, A; Feil, I; Furlong, E B; Gajiwala, K S; Gao, X; He, D; Hendle, J; Huber, A; Hoda, K; Kearins, P; Kissinger, C; Laubert, B; Lewis, H A; Lin, J; Loomis, K; Lorimer, D; Louie, G; Maletic, M; Marsh, C D; Miller, I; Molinari, J; Muller-Dieckmann, H J; Newman, J M; Noland, B W; Pagarigan, B; Park, F; Peat, T S; Post, K W; Radojicic, S; Ramos, A; Romero, R; Rutter, M E; Sanderson, W E; Schwinn, K D; Tresser, J; Winhoven, J; Wright, T A; Wu, L; Xu, J; Harris, T J R

    2005-09-01

    The targets of the Structural GenomiX (SGX) bacterial genomics project were proteins conserved in multiple prokaryotic organisms with no obvious sequence homolog in the Protein Data Bank of known structures. The outcome of this work was 80 structures, covering 60 unique sequences and 49 different genes. Experimental phase determination from proteins incorporating Se-Met was carried out for 45 structures with most of the remainder solved by molecular replacement using members of the experimentally phased set as search models. An automated tool was developed to deposit these structures in the Protein Data Bank, along with the associated X-ray diffraction data (including refined experimental phases) and experimentally confirmed sequences. BLAST comparisons of the SGX structures with structures that had appeared in the Protein Data Bank over the intervening 3.5 years since the SGX target list had been compiled identified homologs for 49 of the 60 unique sequences represented by the SGX structures. This result indicates that, for bacterial structures that are relatively easy to express, purify, and crystallize, the structural coverage of gene space is proceeding rapidly. More distant sequence-structure relationships between the SGX and PDB structures were investigated using PDB-BLAST and Combinatorial Extension (CE). Only one structure, SufD, has a truly unique topology compared to all folds in the PDB. Copyright 2005 Wiley-Liss, Inc.

  8. GRIL-seq provides a method for identifying direct targets of bacterial small regulatory RNA by in vivo proximity ligation.

    PubMed

    Han, Kook; Tjaden, Brian; Lory, Stephen

    2016-12-22

    The first step in the post-transcriptional regulatory function of most bacterial small non-coding RNAs (sRNAs) is base pairing with partially complementary sequences of targeted transcripts. We present a simple method for identifying sRNA targets in vivo and defining processing sites of the regulated transcripts. The technique, referred to as global small non-coding RNA target identification by ligation and sequencing (GRIL-seq), is based on preferential ligation of sRNAs to the ends of base-paired targets in bacteria co-expressing T4 RNA ligase, followed by sequencing to identify the chimaeras. In addition to the RNA chaperone Hfq, the GRIL-seq method depends on the activity of the pyrophosphorylase RppH. Using PrrF1, an iron-regulated sRNA in Pseudomonas aeruginosa, we demonstrated that direct regulatory targets of this sRNA can readily be identified. Therefore, GRIL-seq represents a powerful tool not only for identifying direct targets of sRNAs in a variety of environments, but also for uncovering novel roles for sRNAs and their targets in complex regulatory networks.

  9. Architecture of the 99 bp DNA-six-protein regulatory complex of the lambda att site.

    PubMed

    Sun, Xingmin; Mierke, Dale F; Biswas, Tapan; Lee, Sang Yeol; Landy, Arthur; Radman-Livaja, Marta

    2006-11-17

    The highly directional and tightly regulated recombination reaction used to site-specifically excise the bacteriophage lambda chromosome out of its E. coli host chromosome requires the binding of six sequence-specific proteins to a 99 bp segment of the phage att site. To gain structural insights into this recombination pathway, we measured 27 FRET distances between eight points on the 99 bp regulatory DNA bound with all six proteins. Triangulation of these distances using a metric matrix distance-geometry algorithm provided coordinates for these eight points. The resulting path for the protein-bound regulatory DNA, which fits well with the genetics, biochemistry, and X-ray crystal structures describing the individual proteins and their interactions with DNA, provides a new structural perspective into the molecular mechanism and regulation of the recombination reaction and illustrates a design by which different families of higher-order complexes can be assembled from different numbers and combinations of the same few proteins.

  10. Sterol regulatory element binding protein-1 (SREBP1) gene expression is similarly increased in polycystic ovary syndrome and endometrial cancer.

    PubMed

    Shafiee, Mohamad N; Mongan, Nigel; Seedhouse, Claire; Chapman, Caroline; Deen, Suha; Abu, Jafaru; Atiomo, William

    2017-05-01

    Women with polycystic ovary syndrome have a three-fold higher risk of endometrial cancer. Insulin resistance and hyperlipidemia may be pertinent factors in the pathogenesis of both conditions. The aim of this study was to investigate endometrial sterol regulatory element binding protein-1 gene expression in polycystic ovary syndrome and endometrial cancer endometrium, and to correlate endometrial sterol regulatory element binding protein-1 gene expression with serum lipid profiles. A cross-sectional study was performed at Nottingham University Hospital, UK. A total of 102 women (polycystic ovary syndrome, endometrial cancer and controls; 34 participants in each group) were recruited. Clinical and biochemical assessments were performed before endometrial biopsies were obtained from all participants. Taqman real-time polymerase chain reaction for endometrial sterol regulatory element binding protein-1 gene and its systemic protein expression were analyzed. The body mass indices of women with polycystic ovary syndrome (29.28 ± 2.91 kg/m 2 ) and controls (28.58 ± 2.62 kg/m 2 ) were not significantly different. Women with endometrial cancer had a higher mean body mass index (32.22 ± 5.70 kg/m 2 ). Sterol regulatory element binding protein-1 gene expression was significantly increased in polycystic ovary syndrome and endometrial cancer endometrium compared with controls (p < 0.0001). Sterol regulatory element binding protein-1 gene expression was positively correlated with body mass index (r = 0.017, p = 0.921) and waist-hip ratio (r = 0.023, p = 0.544) in polycystic ovary syndrome, but this was not statistically significant. Similarly, statistically insignificant positive correlations were found between endometrial sterol regulatory element binding protein-1 gene expression and body mass index in endometrial cancer (r = 0.643, p = 0.06) and waist-hip ratio (r = 0.096, p = 0.073). Sterol regulatory element binding protein-1 gene expression

  11. An efficient tag derived from the common epitope of tospoviral NSs proteins for monitoring recombinant proteins expressed in both bacterial and plant systems.

    PubMed

    Cheng, Hao-Wen; Chen, Kuan-Chun; Raja, Joseph A J; Li, Jian-Xian; Yeh, Shyi-Dong

    2013-04-15

    NSscon (23 aa), a common epitope in the gene silencing suppressor NSs proteins of the members of the Watermelon silver mottle virus (WSMoV) serogroup, was previously identified. In this investigation, we expressed different green fluorescent protein (GFP)-fused deletions of NSscon in bacteria and reacted with NSscon monoclonal antibody (MAb). Our results indicated that the core 9 amino acids, "(109)KFTMHNQIF(117)", denoted as "nss", retain the reactivity of NSscon. In bacterial pET system, four different recombinant proteins labeled with nss, either at N- or C-extremes, were readily detectable without position effects, with sensitivity superior to that for the polyhistidine-tag. When the nss-tagged Zucchini yellow mosaic virus (ZYMV) helper component-protease (HC-Pro) and WSMoV nucleocapsid protein were transiently expressed by agroinfiltration in tobacco, they were readily detectable and the tag's possible efficacy for gene silencing suppression was not noticed. Co-immunoprecipitation of nss-tagged and non-tagged proteins expressed from bacteria confirmed the interaction of potyviral HC-Pro and coat protein. Thus, we conclude that this novel nss sequence is highly valuable for tagging recombinant proteins in both bacterial and plant expression systems. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Impact of fluorescent protein fusions on the bacterial flagellar motor.

    PubMed

    Heo, M; Nord, A L; Chamousset, D; van Rijn, E; Beaumont, H J E; Pedaci, F

    2017-10-03

    Fluorescent fusion proteins open a direct and unique window onto protein function. However, they also introduce the risk of perturbation of the function of the native protein. Successful applications of fluorescent fusions therefore rely on a careful assessment and minimization of the side effects, but such insight is still lacking for many applications. This is particularly relevant in the study of the internal dynamics of motor proteins, where both the chemical and mechanical reaction coordinates can be affected. Fluorescent proteins fused to the stator of the Bacterial Flagellar Motor (BFM) have previously been used to unveil the motor subunit dynamics. Here we report the effects on single motors of three fluorescent proteins fused to the stators, all of which altered BFM behavior. The torque generated by individual stators was reduced while their stoichiometry remained unaffected. MotB fusions decreased the switching frequency and induced a novel bias-dependent asymmetry in the speed in the two directions. These effects could be mitigated by inserting a linker at the fusion point. These findings provide a quantitative account of the effects of fluorescent fusions to the stator on BFM dynamics and their alleviation- new insights that advance the use of fluorescent fusions to probe the dynamics of protein complexes.

  13. Bacterial RNA Biology on a Genome Scale.

    PubMed

    Hör, Jens; Gorski, Stanislaw A; Vogel, Jörg

    2018-06-07

    Bacteria are an exceedingly diverse group of organisms whose molecular exploration is experiencing a renaissance. While the classical view of bacterial gene expression was relatively simple, the emerging view is more complex, encompassing extensive post-transcriptional control involving riboswitches, RNA thermometers, and regulatory small RNAs (sRNAs) associated with the RNA-binding proteins CsrA, Hfq, and ProQ, as well as CRISPR/Cas systems that are programmed by RNAs. Moreover, increasing interest in members of the human microbiota and environmental microbial communities has highlighted the importance of understudied bacterial species with largely unknown transcriptome structures and RNA-based control mechanisms. Collectively, this creates a need for global RNA biology approaches that can rapidly and comprehensively analyze the RNA composition of a bacterium of interest. We review such approaches with a focus on RNA-seq as a versatile tool to investigate the different layers of gene expression in which RNA is made, processed, regulated, modified, translated, and turned over. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions.

    PubMed

    Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade

    2015-11-14

    FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.

  15. Anticancer Activity of Bacterial Proteins and Peptides.

    PubMed

    Karpiński, Tomasz M; Adamczak, Artur

    2018-04-30

    Despite much progress in the diagnosis and treatment of cancer, tumour diseases constitute one of the main reasons of deaths worldwide. The side effects of chemotherapy and drug resistance of some cancer types belong to the significant current therapeutic problems. Hence, searching for new anticancer substances and medicines are very important. Among them, bacterial proteins and peptides are a promising group of bioactive compounds and potential anticancer drugs. Some of them, including anticancer antibiotics (actinomycin D, bleomycin, doxorubicin, mitomycin C) and diphtheria toxin, are already used in the cancer treatment, while other substances are in clinical trials (e.g., p28, arginine deiminase ADI) or tested in in vitro research. This review shows the current literature data regarding the anticancer activity of proteins and peptides originated from bacteria: antibiotics, bacteriocins, enzymes, nonribosomal peptides (NRPs), toxins and others such as azurin, p28, Entap and Pep27anal2. The special attention was paid to the still poorly understood active substances obtained from the marine sediment bacteria. In total, 37 chemical compounds or groups of compounds with antitumor properties have been described in the present article.

  16. Molecular control of vertebrate iron homeostasis by iron regulatory proteins

    PubMed Central

    Wallander, Michelle L.; Leibold, Elizabeth A.; Eisenstein, Richard S.

    2008-01-01

    Both deficiencies and excesses of iron represent major public health problems throughout the world. Understanding the cellular and organismal processes controlling iron homeostasis is critical for identifying iron-related diseases and in advancing the clinical treatments for such disorders of iron metabolism. Iron regulatory proteins (IRPs) 1 and 2 are key regulators of vertebrate iron metabolism. These RNA binding proteins post-transcriptionally control the stability or translation of mRNAs encoding proteins involved in iron homeostasis thereby controlling the uptake, utilization, storage or export of iron. Recent evidence provides insight into how IRPs selectively control the translation or stability of target mRNAs, how IRP RNA binding activity is controlled by iron-dependent and iron-independent effectors, and the pathological consequences of dysregulation of the IRP system. PMID:16872694

  17. Gene regulatory network of unfolded protein response genes in endoplasmic reticulum stress.

    PubMed

    Takayanagi, Sayuri; Fukuda, Riga; Takeuchi, Yuuki; Tsukada, Sakiko; Yoshida, Kenichi

    2013-01-01

    In the endoplasmic reticulum (ER), secretory and membrane proteins are properly folded and modified, and the failure of these processes leads to ER stress. At the same time, unfolded protein response (UPR) genes are activated to maintain homeostasis. Despite the thorough characterization of the individual gene regulation of UPR genes to date, further investigation of the mutual regulation among UPR genes is required to understand the complex mechanism underlying the ER stress response. In this study, we aimed to reveal a gene regulatory network formed by UPR genes, including immunoglobulin heavy chain-binding protein (BiP), X-box binding protein 1 (XBP1), C/EBP [CCAAT/enhancer-binding protein]-homologous protein (CHOP), PKR-like endoplasmic reticulum kinase (PERK), inositol-requiring 1 (IRE1), activating transcription factor 6 (ATF6), and ATF4. For this purpose, we focused on promoter-luciferase reporters for BiP, XBP1, and CHOP genes, which bear an ER stress response element (ERSE), and p5 × ATF6-GL3, which bears an unfolded protein response element (UPRE). We demonstrated that the luciferase activities of the BiP and CHOP promoters were upregulated by all the UPR genes, whereas those of the XBP1 promoter and p5 × ATF6-GL3 were upregulated by all the UPR genes except for BiP, CHOP, and ATF4 in HeLa cells. Therefore, an ERSE- and UPRE-centered gene regulatory network of UPR genes could be responsible for the robustness of the ER stress response. Finally, we revealed that BiP protein was degraded when cells were treated with DNA-damaging reagents, such as etoposide and doxorubicin; this finding suggests that the expression level of BiP is tightly regulated at the post-translational level, rather than at the transcriptional level, in the presence of DNA damage.

  18. RNA regulatory networks diversified through curvature of the PUF protein scaffold

    DOE PAGES

    Wilinski, Daniel; Qiu, Chen; Lapointe, Christopher P.; ...

    2015-09-14

    Proteins bind and control mRNAs, directing their localization, translation and stability. Members of the PUF family of RNA-binding proteins control multiple mRNAs in a single cell, and play key roles in development, stem cell maintenance and memory formation. Here we identified the mRNA targets of a S. cerevisiae PUF protein, Puf5p, by ultraviolet-crosslinking-affinity purification and high-throughput sequencing (HITS-CLIP). The binding sites recognized by Puf5p are diverse, with variable spacer lengths between two specific sequences. Each length of site correlates with a distinct biological function. Crystal structures of Puf5p–RNA complexes reveal that the protein scaffold presents an exceptionally flat and extendedmore » interaction surface relative to other PUF proteins. In complexes with RNAs of different lengths, the protein is unchanged. A single PUF protein repeat is sufficient to induce broadening of specificity. Changes in protein architecture, such as alterations in curvature, may lead to evolution of mRNA regulatory networks.« less

  19. RNA regulatory networks diversified through curvature of the PUF protein scaffold

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wilinski, Daniel; Qiu, Chen; Lapointe, Christopher P.

    Proteins bind and control mRNAs, directing their localization, translation and stability. Members of the PUF family of RNA-binding proteins control multiple mRNAs in a single cell, and play key roles in development, stem cell maintenance and memory formation. Here we identified the mRNA targets of a S. cerevisiae PUF protein, Puf5p, by ultraviolet-crosslinking-affinity purification and high-throughput sequencing (HITS-CLIP). The binding sites recognized by Puf5p are diverse, with variable spacer lengths between two specific sequences. Each length of site correlates with a distinct biological function. Crystal structures of Puf5p–RNA complexes reveal that the protein scaffold presents an exceptionally flat and extendedmore » interaction surface relative to other PUF proteins. In complexes with RNAs of different lengths, the protein is unchanged. A single PUF protein repeat is sufficient to induce broadening of specificity. Changes in protein architecture, such as alterations in curvature, may lead to evolution of mRNA regulatory networks.« less

  20. Factor H-IgG Chimeric Proteins as a Therapeutic Approach against the Gram-Positive Bacterial Pathogen Streptococcus pyogenes.

    PubMed

    Blom, Anna M; Magda, Michal; Kohl, Lisa; Shaughnessy, Jutamas; Lambris, John D; Ram, Sanjay; Ermert, David

    2017-12-01

    Bacteria can cause life-threatening infections, such as pneumonia, meningitis, or sepsis. Antibiotic therapy is a mainstay of treatment, although antimicrobial resistance has drastically increased over the years. Unfortunately, safe and effective vaccines against most pathogens have not yet been approved, and thus developing alternative treatments is important. We analyzed the efficiency of factor H (FH)6-7/Fc, a novel antibacterial immunotherapeutic protein against the Gram-positive bacterium Streptococcus pyogenes This protein is composed of two domains of complement inhibitor human FH (FH complement control protein modules 6 and 7) that bind to S. pyogenes , linked to the Fc region of IgG (FH6-7/Fc). FH6-7/Fc has previously been shown to enhance complement-dependent killing of, and facilitate bacterial clearance in, animal models of the Gram-negative pathogens Haemophilus influenzae and Neisseria meningitidis We hypothesized that activation of complement by FH6-7/Fc on the surface of Gram-positive bacteria such as S. pyogenes will enable professional phagocytes to eliminate the pathogen. We found that FH6-7/Fc alleviated S. pyogenes- induced sepsis in a transgenic mouse model expressing human FH ( S. pyogenes binds FH in a human-specific manner). Furthermore, FH6-7/Fc, which binds to protein H and selected M proteins, displaced FH from the bacterial surface, enhanced alternative pathway activation, and reduced bacterial blood burden by opsonophagocytosis in a C3-dependent manner in an ex vivo human whole-blood model. In conclusion, FH-Fc chimeric proteins could serve as adjunctive treatments against multidrug-resistant bacterial infections. Copyright © 2017 by The American Association of Immunologists, Inc.

  1. The use of in vitro transcription to probe regulatory functions of viral protein domains.

    PubMed

    Loewenstein, Paul M; Song, Chao-Zhong; Green, Maurice

    2007-01-01

    Adenoviruses (Ads), like other DNA tumor viruses, have evolved specific regulatory genes that facilitate virus replication by controlling the transcription of other viral genes as well as that of key cellular genes. In this regard, the E1A transcription unit contains multiple protein domains that can transcriptionally activate or repress cellular genes involved in the regulation of cell proliferation and cell differentiation. Studies using in vitro transcription have provided a basis for a molecular understanding of the interaction of viral regulatory proteins with the transcriptional machinery of the cell and continue to inform our understanding of transcription regulation. This chapter provides examples of the use of in vitro transcription to analyze transcriptional activation and transcriptional repression by purified, recombinant Ad E1A protein domains and single amino acid substitution mutants as well as the use of protein-affinity chromatography to identify host cell transcription factors involved in viral transcriptional regulation. A detailed description is provided of the methodology to prepare nuclear transcription extract, to prepare biologically active protein domains, to prepare affinity depleted transcription extracts, and to analyze transcription by primer extension and by run-off assay using naked DNA templates.

  2. Trafficking and processing of bacterial proteins by mammalian cells: Insights from chondroitinase ABC.

    PubMed

    Muir, Elizabeth; Raza, Mansoor; Ellis, Clare; Burnside, Emily; Love, Fiona; Heller, Simon; Elliot, Matthew; Daniell, Esther; Dasgupta, Debayan; Alves, Nuno; Day, Priscilla; Fawcett, James; Keynes, Roger

    2017-01-01

    There is very little reported in the literature about the relationship between modifications of bacterial proteins and their secretion by mammalian cells that synthesize them. We previously reported that the secretion of the bacterial enzyme Chondroitinase ABC by mammalian cells requires the strategic removal of at least three N-glycosylation sites. The aim of this study was to determine if it is possible to enhance the efficacy of the enzyme as a treatment for spinal cord injury by increasing the quantity of enzyme secreted or by altering its cellular location. To determine if the efficiency of enzyme secretion could be further increased, cells were transfected with constructs encoding the gene for chondroitinase ABC modified for expression by mammalian cells; these contained additional modifications of strategic N-glycosylation sites or alternative signal sequences to direct secretion of the enzyme from the cells. We show that while removal of certain specific N-glycosylation sites enhances enzyme secretion, N-glycosylation of at least two other sites, N-856 and N-773, is essential for both production and secretion of active enzyme. Furthermore, we find that the signal sequence directing secretion also influences the quantity of enzyme secreted, and that this varies widely amongst the cell types tested. Last, we find that replacing the 3'UTR on the cDNA encoding Chondroitinase ABC with that of β-actin is sufficient to target the enzyme to the neuronal growth cone when transfected into neurons. This also enhances neurite outgrowth on an inhibitory substrate. Some intracellular trafficking pathways are adversely affected by cryptic signals present in the bacterial gene sequence, whilst unexpectedly others are required for efficient secretion of the enzyme. Furthermore, targeting chondroitinase to the neuronal growth cone promotes its ability to increase neurite outgrowth on an inhibitory substrate. These findings are timely in view of the renewed prospects for

  3. PARS: a web server for the prediction of Protein Allosteric and Regulatory Sites.

    PubMed

    Panjkovich, Alejandro; Daura, Xavier

    2014-05-01

    The regulation of protein activity is a key aspect of life at the molecular level. Unveiling its details is thus crucial to understanding signalling and metabolic pathways. The most common and powerful mechanism of protein-function regulation is allostery, which has been increasingly calling the attention of medicinal chemists due to its potential for the discovery of novel therapeutics. In this context, PARS is a simple and fast method that queries protein dynamics and structural conservation to identify pockets on a protein structure that may exert a regulatory effect on the binding of a small-molecule ligand.

  4. Bacterial molecular networks: bridging the gap between functional genomics and dynamical modelling.

    PubMed

    van Helden, Jacques; Toussaint, Ariane; Thieffry, Denis

    2012-01-01

    This introductory review synthesizes the contents of the volume Bacterial Molecular Networks of the series Methods in Molecular Biology. This volume gathers 9 reviews and 16 method chapters describing computational protocols for the analysis of metabolic pathways, protein interaction networks, and regulatory networks. Each protocol is documented by concrete case studies dedicated to model bacteria or interacting populations. Altogether, the chapters provide a representative overview of state-of-the-art methods for data integration and retrieval, network visualization, graph analysis, and dynamical modelling.

  5. Recovery of bioactive protein from bacterial inclusion bodies using trifluoroethanol as solubilization agent.

    PubMed

    Upadhyay, Vaibhav; Singh, Anupam; Jha, Divya; Singh, Akansha; Panda, Amulya K

    2016-06-08

    Formation of inclusion bodies poses a major hurdle in recovery of bioactive recombinant protein from Escherichia coli. Urea and guanidine hydrochloride have routinely been used to solubilize inclusion body proteins, but many times result in poor recovery of bioactive protein. High pH buffers, detergents and organic solvents like n-propanol have been successfully used as mild solubilization agents for high throughput recovery of bioactive protein from bacterial inclusion bodies. These mild solubilization agents preserve native-like secondary structures of proteins in inclusion body aggregates and result in improved recovery of bioactive protein as compared to conventional solubilization agents. Here we demonstrate solubilization of human growth hormone inclusion body aggregates using 30% trifluoroethanol in presence of 3 M urea and its refolding into bioactive form. Human growth hormone was expressed in E. coli M15 (pREP) cells in the form of inclusion bodies. Different concentrations of trifluoroethanol with or without addition of low concentration (3 M) of urea were used for solubilization of inclusion body aggregates. Thirty percent trifluoroethanol in combination with 3 M urea was found to be suitable for efficient solubilization of human growth hormone inclusion bodies. Solubilized protein was refolded by dilution and purified by anion exchange and size exclusion chromatography. Purified protein was analyzed for secondary and tertiary structure using different spectroscopic tools and was found to be bioactive by cell proliferation assay. To understand the mechanism of action of trifluoroethanol, secondary and tertiary structure of human growth hormone in trifluoroethanol was compared to that in presence of other denaturants like urea and guanidine hydrochloride. Trifluoroethanol was found to be stabilizing the secondary structure and destabilizing the tertiary structure of protein. Finally, it was observed that trifluoroethanol can be used to solubilize

  6. Protein synthesis during acquisition of long-term facilitation is needed for the persistent loss of regulatory subunits of the Aplysia cAMP-dependent protein kinase.

    PubMed Central

    Bergold, P J; Sweatt, J D; Winicov, I; Weiss, K R; Kandel, E R; Schwartz, J H

    1990-01-01

    Depending on the number or the length of exposure, application of serotonin can produce either short-term or long-term presynaptic facilitation of Aplysia sensory-to-motor synapses. The cAMP-dependent protein kinase, a heterodimer of two regulatory and two catalytic subunits, has been shown to become stably activated only during long-term facilitation. Both acquisition of long-term facilitation and persistent activation of the kinase is blocked by anisomycin, an effective, reversible, and specific inhibitor of protein synthesis in Aplysia. We report here that 2-hr exposure of pleural sensory cells to serotonin lowers the concentration of regulatory subunits but does not change the concentration of catalytic subunits, as assayed 24 hr later; 5-min exposure to serotonin has no effect on either type of subunit. Increasing intracellular cAMP with a permeable analog of cAMP together with the phosphodiesterase inhibitor isobutyl methylxanthine also decreased regulatory subunits, suggesting that cAMP is the second messenger mediating serotonin action. Anisomycin blocked the loss of regulatory subunits only when applied with serotonin; application after the 2-hr treatment with serotonin had no effect. In the Aplysia accessory radula contractor muscle, prolonged exposure to serotonin or to the peptide transmitter small cardioactive peptide B, both of which produce large increases in intracellular cAMP, does not decrease regulatory subunits. This mechanism of regulating the cAMP-dependent protein kinase therefore may be specific to the nervous system. We conclude that during long-term facilitation, new protein is synthesized in response to the facilitatory stimulus, which changes the ratio of subunits of the cAMP-dependent protein kinase. This alteration in ratio could persistently activate the kinase and produce the persistent phosphorylation seen in long-term facilitated sensory cells. Images PMID:1692622

  7. Generation of Nanobodies against SlyD and development of tools to eliminate this bacterial contaminant from recombinant proteins.

    PubMed

    Hu, Yaozhong; Romão, Ema; Vertommen, Didier; Vincke, Cécile; Morales-Yánez, Francisco; Gutiérrez, Carlos; Liu, Changxiao; Muyldermans, Serge

    2017-09-01

    The gene for a protein domain, derived from a tumor marker, fused to His tag codons and under control of a T7 promotor was expressed in E. coli strain BL21 (DE3). The recombinant protein was purified from cell lysates through immobilized metal affinity chromatography and size-exclusion chromatography. A contaminating bacterial protein was consistently co-purified, even using stringent washing solutions containing 50 or 100 mM imidazole. Immunization of a dromedary with this contaminated protein preparation, and the subsequent generation and panning of the immune Nanobody library yielded several Nanobodies of which 2/3 were directed against the bacterial contaminant, reflecting the immunodominance of this protein to steer the dromedary immune response. Affinity adsorption of this contaminant using one of our specific Nanobodies followed by mass spectrometry identified the bacterial contaminant as FKBP-type peptidyl-prolyl cis-trans isomerase (SlyD) from E. coli. This SlyD protein contains in its C-terminal region 14 histidines in a stretch of 31 amino acids, which explains its co-purification on Ni-NTA resin. This protein is most likely present to varying extents in all recombinant protein preparations after immobilized metal affinity chromatography. Using our SlyD-specific Nb 5 we generated an immune-complex that could be removed either by immunocapturing or by size exclusion chromatography. Both methods allow us to prepare a recombinant protein sample where the SlyD contaminant was quantitatively eliminated. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Recombinant Expression Screening of P. aeruginosa Bacterial Inner Membrane Proteins

    PubMed Central

    2010-01-01

    Background Transmembrane proteins (TM proteins) make up 25% of all proteins and play key roles in many diseases and normal physiological processes. However, much less is known about their structures and molecular mechanisms than for soluble proteins. Problems in expression, solubilization, purification, and crystallization cause bottlenecks in the characterization of TM proteins. This project addressed the need for improved methods for obtaining sufficient amounts of TM proteins for determining their structures and molecular mechanisms. Results Plasmid clones were obtained that encode eighty-seven transmembrane proteins with varying physical characteristics, for example, the number of predicted transmembrane helices, molecular weight, and grand average hydrophobicity (GRAVY). All the target proteins were from P. aeruginosa, a gram negative bacterial opportunistic pathogen that causes serious lung infections in people with cystic fibrosis. The relative expression levels of the transmembrane proteins were measured under several culture growth conditions. The use of E. coli strains, a T7 promoter, and a 6-histidine C-terminal affinity tag resulted in the expression of 61 out of 87 test proteins (70%). In this study, proteins with a higher grand average hydrophobicity and more transmembrane helices were expressed less well than less hydrophobic proteins with fewer transmembrane helices. Conclusions In this study, factors related to overall hydrophobicity and the number of predicted transmembrane helices correlated with the relative expression levels of the target proteins. Identifying physical characteristics that correlate with protein expression might aid in selecting the "low hanging fruit", or proteins that can be expressed to sufficient levels using an E. coli expression system. The use of other expression strategies or host species might be needed for sufficient levels of expression of transmembrane proteins with other physical characteristics. Surveys like this

  9. Identification of high-confidence RNA regulatory elements by combinatorial classification of RNA-protein binding sites.

    PubMed

    Li, Yang Eric; Xiao, Mu; Shi, Binbin; Yang, Yu-Cheng T; Wang, Dong; Wang, Fei; Marcia, Marco; Lu, Zhi John

    2017-09-08

    Crosslinking immunoprecipitation sequencing (CLIP-seq) technologies have enabled researchers to characterize transcriptome-wide binding sites of RNA-binding protein (RBP) with high resolution. We apply a soft-clustering method, RBPgroup, to various CLIP-seq datasets to group together RBPs that specifically bind the same RNA sites. Such combinatorial clustering of RBPs helps interpret CLIP-seq data and suggests functional RNA regulatory elements. Furthermore, we validate two RBP-RBP interactions in cell lines. Our approach links proteins and RNA motifs known to possess similar biochemical and cellular properties and can, when used in conjunction with additional experimental data, identify high-confidence RBP groups and their associated RNA regulatory elements.

  10. Cardiac mitochondrial matrix and respiratory complex protein phosphorylation

    PubMed Central

    Covian, Raul

    2012-01-01

    It has become appreciated over the last several years that protein phosphorylation within the cardiac mitochondrial matrix and respiratory complexes is extensive. Given the importance of oxidative phosphorylation and the balance of energy metabolism in the heart, the potential regulatory effect of these classical signaling events on mitochondrial function is of interest. However, the functional impact of protein phosphorylation and the kinase/phosphatase system responsible for it are relatively unknown. Exceptions include the well-characterized pyruvate dehydrogenase and branched chain α-ketoacid dehydrogenase regulatory system. The first task of this review is to update the current status of protein phosphorylation detection primarily in the matrix and evaluate evidence linking these events with enzymatic function or protein processing. To manage the scope of this effort, we have focused on the pathways involved in energy metabolism. The high sensitivity of modern methods of detecting protein phosphorylation and the low specificity of many kinases suggests that detection of protein phosphorylation sites without information on the mole fraction of phosphorylation is difficult to interpret, especially in metabolic enzymes, and is likely irrelevant to function. However, several systems including protein translocation, adenine nucleotide translocase, cytochrome c, and complex IV protein phosphorylation have been well correlated with enzymatic function along with the classical dehydrogenase systems. The second task is to review the current understanding of the kinase/phosphatase system within the matrix. Though it is clear that protein phosphorylation occurs within the matrix, based on 32P incorporation and quantitative mass spectrometry measures, the kinase/phosphatase system responsible for this process is ill-defined. An argument is presented that remnants of the much more labile bacterial protein phosphoryl transfer system may be present in the matrix and that the

  11. The Impact of Protein Phosphorylation on Chlamydial Physiology

    PubMed Central

    Claywell, Ja E.; Matschke, Lea M.; Fisher, Derek J.

    2016-01-01

    Chlamydia are Gram negative bacterial pathogens responsible for disease in humans and economically important domesticated animals. As obligate intracellular bacteria, they must gain entry into a host cell where they propagate within a parasitophorous organelle that serves as an interactive interface between the bacterium and the host. Nutrient acquisition, growth, and evasion of host defense mechanisms occur from this location. In addition to these cellular and bacterial dynamics, Chlamydia differentiate between two morphologically distinct forms, the elementary body and reticulate body, that are optimized for either extracellular or intracellular survival, respectively. The mechanisms regulating and mediating these diverse physiological events remain largely unknown. Reversible phosphorylation, including classical two-component signaling systems, partner switching mechanisms, and the more recently appreciated bacterial Ser/Thr/Tyr kinases and phosphatases, has gained increasing attention for its role in regulating important physiological processes in bacteria including metabolism, development, and virulence. Phosphorylation modulates these events via rapid and reversible modification of protein substrates leading to changes in enzyme activity, protein oligomerization, cell signaling, and protein localization. The characterization of several conserved chlamydial protein kinases and phosphatases along with phosphoproteome analysis suggest that Chlamydia are capable of global and growth stage-specific protein phosphorylation. This mini review will highlight the current knowledge of protein phosphorylation in Chlamydia and its potential role in chlamydial physiology and, consequently, virulence. Comparisons with other minimal genome intracellular bacterial pathogens also will be addressed with the aim of illustrating the importance of this understudied regulatory mechanism on pathogenesis and the principle questions that remain unanswered. PMID:28066729

  12. Identification of the Actinobacillus pleuropneumoniae Leucine-Responsive Regulatory Protein and Its Involvement in the Regulation of In Vivo-Induced Genes▿

    PubMed Central

    Wagner, Trevor K.; Mulks, Martha H.

    2007-01-01

    Actinobacillus pleuropneumoniae is a gram-negative bacterial pathogen that causes a severe hemorrhagic pneumonia in swine. We have previously shown that the limitation of branched-chain amino acids (BCAAs) is a cue that induces the expression of a subset of A. pleuropneumoniae genes identified as specifically induced during infection of the natural host animal by using an in vivo expression technology screen. Leucine-responsive regulatory protein (Lrp) is a global regulator and has been shown in Escherichia coli to regulate many genes, including genes involved in BCAA biosynthesis. We hypothesized that A. pleuropneumoniae contains a regulator similar to Lrp and that this protein is involved in the regulation of a subset of genes important during infection and recently shown to have increased expression in the absence of BCAAs. We report the identification of an A. pleuropneumoniae serotype 1 gene encoding a protein with similarity to amino acid sequence and functional domains of other reported Lrp proteins. We further show that purified A. pleuropneumoniae His6-Lrp binds in vitro to the A. pleuropneumoniae promoter regions for ilvI, antisense cps1AB, lrp, and nqr. A genetically defined A. pleuropneumoniae lrp mutant was constructed using an allelic replacement and sucrose counterselection method. Analysis of expression from the ilvI and antisense cps1AB promoters in wild-type, lrp mutant, and complemented lrp mutant strains indicated that Lrp is required for induction of expression of ilvI under BCAA limitation. PMID:17060463

  13. Bacterial membrane proteomics.

    PubMed

    Poetsch, Ansgar; Wolters, Dirk

    2008-10-01

    About one quarter to one third of all bacterial genes encode proteins of the inner or outer bacterial membrane. These proteins perform essential physiological functions, such as the import or export of metabolites, the homeostasis of metal ions, the extrusion of toxic substances or antibiotics, and the generation or conversion of energy. The last years have witnessed completion of a plethora of whole-genome sequences of bacteria important for biotechnology or medicine, which is the foundation for proteome and other functional genome analyses. In this review, we discuss the challenges in membrane proteome analysis, starting from sample preparation and leading to MS-data analysis and quantification. The current state of available proteomics technologies as well as their advantages and disadvantages will be described with a focus on shotgun proteomics. Then, we will briefly introduce the most abundant proteins and protein families present in bacterial membranes before bacterial membrane proteomics studies of the last years will be presented. It will be shown how these works enlarged our knowledge about the physiological adaptations that take place in bacteria during fine chemical production, bioremediation, protein overexpression, and during infections. Furthermore, several examples from literature demonstrate the suitability of membrane proteomics for the identification of antigens and different pathogenic strains, as well as the elucidation of membrane protein structure and function.

  14. Multiple regulatory systems coordinate DNA replication with cell growth in Bacillus subtilis.

    PubMed

    Murray, Heath; Koh, Alan

    2014-10-01

    In many bacteria the rate of DNA replication is linked with cellular physiology to ensure that genome duplication is coordinated with growth. Nutrient-mediated growth rate control of DNA replication initiation has been appreciated for decades, however the mechanism(s) that connects these cell cycle activities has eluded understanding. In order to help address this fundamental question we have investigated regulation of DNA replication in the model organism Bacillus subtilis. Contrary to the prevailing view we find that changes in DnaA protein level are not sufficient to account for nutrient-mediated growth rate control of DNA replication initiation, although this regulation does require both DnaA and the endogenous replication origin. We go on to report connections between DNA replication and several essential cellular activities required for rapid bacterial growth, including respiration, central carbon metabolism, fatty acid synthesis, phospholipid synthesis, and protein synthesis. Unexpectedly, the results indicate that multiple regulatory systems are involved in coordinating DNA replication with cell physiology, with some of the regulatory systems targeting oriC while others act in a oriC-independent manner. We propose that distinct regulatory systems are utilized to control DNA replication in response to diverse physiological and chemical changes.

  15. Evolution of Salmonella-Host Cell Interactions through a Dynamic Bacterial Genome

    PubMed Central

    Ilyas, Bushra; Tsai, Caressa N.; Coombes, Brian K.

    2017-01-01

    Salmonella Typhimurium has a broad arsenal of genes that are tightly regulated and coordinated to facilitate adaptation to the various host environments it colonizes. The genome of Salmonella Typhimurium has undergone multiple gene acquisition events and has accrued changes in non-coding DNA that have undergone selection by regulatory evolution. Together, at least 17 horizontally acquired pathogenicity islands (SPIs), prophage-associated genes, and changes in core genome regulation contribute to the virulence program of Salmonella. Here, we review the latest understanding of these elements and their contributions to pathogenesis, emphasizing the regulatory circuitry that controls niche-specific gene expression. In addition to an overview of the importance of SPI-1 and SPI-2 to host invasion and colonization, we describe the recently characterized contributions of other SPIs, including the antibacterial activity of SPI-6 and adhesion and invasion mediated by SPI-4. We further discuss how these fitness traits have been integrated into the regulatory circuitry of the bacterial cell through cis-regulatory evolution and by a careful balance of silencing and counter-silencing by regulatory proteins. Detailed understanding of regulatory evolution within Salmonella is uncovering novel aspects of infection biology that relate to host-pathogen interactions and evasion of host immunity. PMID:29034217

  16. [Identification of proteins interacting with the circadian clock protein PER1 in tumors using bacterial two-hybrid system technique].

    PubMed

    Zhang, Yu; Yao, Youlin; Jiang, Siyuan; Lu, Yilu; Liu, Yunqiang; Tao, Dachang; Zhang, Sizhong; Ma, Yongxin

    2015-04-01

    To identify protein-protein interaction partners of PER1 (period circadian protein homolog 1), key component of the molecular oscillation system of the circadian rhythm in tumors using bacterial two-hybrid system technique. Human cervical carcinoma cell Hela library was adopted. Recombinant bait plasmid pBT-PER1 and pTRG cDNA plasmid library were cotransformed into the two-hybrid system reporter strain cultured in a special selective medium. Target clones were screened. After isolating the positive clones, the target clones were sequenced and analyzed. Fourteen protein coding genes were identified, 4 of which were found to contain whole coding regions of genes, which included optic atrophy 3 protein (OPA3) associated with mitochondrial dynamics and homo sapiens cutA divalent cation tolerance homolog of E. coli (CUTA) associated with copper metabolism. There were also cellular events related proteins and proteins which are involved in biochemical reaction and signal transduction-related proteins. Identification of potential interacting proteins with PER1 in tumors may provide us new insights into the functions of the circadian clock protein PER1 during tumorigenesis.

  17. Inhibition of Interferon Regulatory Factor 3 Activation by Paramyxovirus V Protein

    PubMed Central

    Irie, Takashi; Kiyotani, Katsuhiro; Igarashi, Tomoki; Yoshida, Asuka

    2012-01-01

    The V protein of Sendai virus (SeV) suppresses innate immunity, resulting in enhancement of viral growth in mouse lungs and viral pathogenicity. The innate immunity restricted by the V protein is induced through activation of interferon regulatory factor 3 (IRF3). The V protein has been shown to interact with melanoma differentiation-associated gene 5 (MDA5) and to inhibit beta interferon production. In the present study, we infected MDA5-knockout mice with V-deficient SeV and found that MDA5 was largely unrelated to the innate immunity that the V protein suppresses in vivo. We therefore investigated the target of the SeV V protein. We previously reported interaction of the V protein with IRF3. Here we extended the observation and showed that the V protein appeared to inhibit translocation of IRF3 into the nucleus. We also found that the V protein inhibited IRF3 activation when induced by a constitutive active form of IRF3. The V proteins of measles virus and Newcastle disease virus inhibited IRF3 transcriptional activation, as did the V protein of SeV, while the V proteins of mumps virus and Nipah virus did not, and inhibition by these proteins correlated with interaction of each V protein with IRF3. These results indicate that IRF3 is important as an alternative target of paramyxovirus V proteins. PMID:22532687

  18. Regulatory RNAs in Bacillus subtilis: a Gram-Positive Perspective on Bacterial RNA-Mediated Regulation of Gene Expression.

    PubMed

    Mars, Ruben A T; Nicolas, Pierre; Denham, Emma L; van Dijl, Jan Maarten

    2016-12-01

    Bacteria can employ widely diverse RNA molecules to regulate their gene expression. Such molecules include trans-acting small regulatory RNAs, antisense RNAs, and a variety of transcriptional attenuation mechanisms in the 5' untranslated region. Thus far, most regulatory RNA research has focused on Gram-negative bacteria, such as Escherichia coli and Salmonella. Hence, there is uncertainty about whether the resulting insights can be extrapolated directly to other bacteria, such as the Gram-positive soil bacterium Bacillus subtilis. A recent study identified 1,583 putative regulatory RNAs in B. subtilis, whose expression was assessed across 104 conditions. Here, we review the current understanding of RNA-based regulation in B. subtilis, and we categorize the newly identified putative regulatory RNAs on the basis of their conservation in other bacilli and the stability of their predicted secondary structures. Our present evaluation of the publicly available data indicates that RNA-mediated gene regulation in B. subtilis mostly involves elements at the 5' ends of mRNA molecules. These can include 5' secondary structure elements and metabolite-, tRNA-, or protein-binding sites. Importantly, sense-independent segments are identified as the most conserved and structured potential regulatory RNAs in B. subtilis. Altogether, the present survey provides many leads for the identification of new regulatory RNA functions in B. subtilis. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  19. Regulatory RNAs in Bacillus subtilis: a Gram-Positive Perspective on Bacterial RNA-Mediated Regulation of Gene Expression

    PubMed Central

    Mars, Ruben A. T.; Nicolas, Pierre; Denham, Emma L.

    2016-01-01

    SUMMARY Bacteria can employ widely diverse RNA molecules to regulate their gene expression. Such molecules include trans-acting small regulatory RNAs, antisense RNAs, and a variety of transcriptional attenuation mechanisms in the 5′ untranslated region. Thus far, most regulatory RNA research has focused on Gram-negative bacteria, such as Escherichia coli and Salmonella. Hence, there is uncertainty about whether the resulting insights can be extrapolated directly to other bacteria, such as the Gram-positive soil bacterium Bacillus subtilis. A recent study identified 1,583 putative regulatory RNAs in B. subtilis, whose expression was assessed across 104 conditions. Here, we review the current understanding of RNA-based regulation in B. subtilis, and we categorize the newly identified putative regulatory RNAs on the basis of their conservation in other bacilli and the stability of their predicted secondary structures. Our present evaluation of the publicly available data indicates that RNA-mediated gene regulation in B. subtilis mostly involves elements at the 5′ ends of mRNA molecules. These can include 5′ secondary structure elements and metabolite-, tRNA-, or protein-binding sites. Importantly, sense-independent segments are identified as the most conserved and structured potential regulatory RNAs in B. subtilis. Altogether, the present survey provides many leads for the identification of new regulatory RNA functions in B. subtilis. PMID:27784798

  20. Comprehensive assessment and performance improvement of effector protein predictors for bacterial secretion systems III, IV and VI.

    PubMed

    An, Yi; Wang, Jiawei; Li, Chen; Leier, André; Marquez-Lago, Tatiana; Wilksch, Jonathan; Zhang, Yang; Webb, Geoffrey I; Song, Jiangning; Lithgow, Trevor

    2018-01-01

    Bacterial effector proteins secreted by various protein secretion systems play crucial roles in host-pathogen interactions. In this context, computational tools capable of accurately predicting effector proteins of the various types of bacterial secretion systems are highly desirable. Existing computational approaches use different machine learning (ML) techniques and heterogeneous features derived from protein sequences and/or structural information. These predictors differ not only in terms of the used ML methods but also with respect to the used curated data sets, the features selection and their prediction performance. Here, we provide a comprehensive survey and benchmarking of currently available tools for the prediction of effector proteins of bacterial types III, IV and VI secretion systems (T3SS, T4SS and T6SS, respectively). We review core algorithms, feature selection techniques, tool availability and applicability and evaluate the prediction performance based on carefully curated independent test data sets. In an effort to improve predictive performance, we constructed three ensemble models based on ML algorithms by integrating the output of all individual predictors reviewed. Our benchmarks demonstrate that these ensemble models outperform all the reviewed tools for the prediction of effector proteins of T3SS and T4SS. The webserver of the proposed ensemble methods for T3SS and T4SS effector protein prediction is freely available at http://tbooster.erc.monash.edu/index.jsp. We anticipate that this survey will serve as a useful guide for interested users and that the new ensemble predictors will stimulate research into host-pathogen relationships and inspiration for the development of new bioinformatics tools for predicting effector proteins of T3SS, T4SS and T6SS. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  1. A conserved regulatory mechanism in bifunctional biotin protein ligases.

    PubMed

    Wang, Jingheng; Beckett, Dorothy

    2017-08-01

    Class II bifunctional biotin protein ligases (BirA), which catalyze post-translational biotinylation and repress transcription initiation, are broadly distributed in eubacteria and archaea. However, it is unclear if these proteins all share the same molecular mechanism of transcription regulation. In Escherichia coli the corepressor biotinoyl-5'-AMP (bio-5'-AMP), which is also the intermediate in biotin transfer, promotes operator binding and resulting transcription repression by enhancing BirA dimerization. Like E. coli BirA (EcBirA), Staphylococcus aureus, and Bacillus subtilis BirA (Sa and BsBirA) repress transcription in vivo in a biotin-dependent manner. In this work, sedimentation equilibrium measurements were performed to investigate the molecular basis of this biotin-responsive transcription regulation. The results reveal that, as observed for EcBirA, Sa, and BsBirA dimerization reactions are significantly enhanced by bio-5'-AMP binding. Thus, the molecular mechanism of the Biotin Regulatory System is conserved in the biotin repressors from these three organisms. © 2017 The Protein Society.

  2. The VirD2 pilot protein of Agrobacterium-transferred DNA interacts with the TATA box-binding protein and a nuclear protein kinase in plants

    PubMed Central

    Bakó, László; Umeda, Masaaki; Tiburcio, Antonio F.; Schell, Jeff; Koncz, Csaba

    2003-01-01

    The bacterial virulence protein VirD2 plays an important role in nuclear import and chromosomal integration of Agrobacterium-transferred DNA in fungal, plant, animal, and human cells. Here we show that in nuclei of alfalfa cells, VirD2 interacts with and is phosphorylated by CAK2Ms, a conserved plant ortholog of cyclin-dependent kinase-activating kinases. CAK2Ms binds to and phosphorylates the C-terminal regulatory domain of RNA polymerase II largest subunit, which can recruit the TATA box-binding protein. VirD2 is found in tight association with the TATA box-binding protein in vivo. These results indicate that recognition of VirD2 is mediated by widely conserved nuclear factors in eukaryotes. PMID:12900506

  3. Protein expression of preferred human codon-optimized Gaussia luciferase genes with an artificial open-reading frame in mammalian and bacterial cells.

    PubMed

    Inouye, Satoshi; Suzuki, Takahiro

    2016-12-01

    The protein expressions of three preferred human codon-optimized Gaussia luciferase genes (pGLuc, EpGLuc, and KpGLuc) were characterized in mammalian and bacterial cells by comparing them with those of wild-type Gaussia luciferase gene (wGLuc) and human codon-optimized Gaussia luciferase gene (hGLuc). Two synthetic genes of EpGLuc and KpGLuc containing the complete preferred human codons have an artificial open-reading frame; however, they had the similar protein expression levels to those of pGLuc and hGLuc in mammalian cells. In bacterial cells, the protein expressions of pGLuc, EpGLuc, and KpGLuc with approximately 65% GC content were the same and showed approximately 60% activities of wGLuc and hGLuc. The artificial open-reading frame in EpGLuc and KpGLuc did not affect the protein expression in mammalian and bacterial cells. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Legionella pneumophila effector WipA, a bacterial PPP protein phosphatase with PTP activity.

    PubMed

    Jia, Qian; Lin, Yun; Gou, Xuejing; He, Lei; Shen, Dong; Chen, Dongni; Xie, Wei; Lu, Yongjun

    2018-04-26

    The gram-negative bacterium Legionella pneumophila invades human's lung and causes Legionnaires' disease. To benefit its survival and replication in cellular milieu, L. pneumophila secrets at least 330 effector proteins into host cells. We found that the effector WipA has the protein tyrosine phosphatase (PTP) activity but does not depend on the classical CX5R motif for activity, suggesting that WipA is an unconventional PTP. Meanwhile, the presence of three other highly conserved motifs typically seen in protein serine/threonine phosphatases and the poor inhibition of WipA activity by okadaic acid led us to propose that WipA is a bacterial protein phosphatase. In addition, the determination of the 2.55-Å crystal structure of WipA revealed that WipA resembles cold-active protein tyrosine phosphatase (CAPTPase), and therefore very likely shares the same catalytic mechanism.

  5. Dual RNA regulatory control of a Staphylococcus aureus virulence factor.

    PubMed

    Chabelskaya, Svetlana; Bordeau, Valérie; Felden, Brice

    2014-04-01

    In pathogens, the accurate programming of virulence gene expression is essential for infection. It is achieved by sophisticated arrays of regulatory proteins and ribonucleic acids (sRNAs), but in many cases their contributions and connections are not yet known. Based on genetic, biochemical and structural evidence, we report that the expression pattern of a Staphylococcus aureus host immune evasion protein is enabled by the collaborative actions of RNAIII and small pathogenicity island RNA D (SprD). Their combined expression profiles during bacterial growth permit early and transient synthesis of Sbi to avoid host immune responses. Together, these two sRNAs use antisense mechanisms to monitor Sbi expression at the translational level. Deletion analysis combined with structural analysis of RNAIII in complex with its novel messenger RNA (mRNA) target indicate that three distant RNAIII domains interact with distinct sites of the sbi mRNA and that two locations are deep in the sbi coding region. Through distinct domains, RNAIII lowers production of two proteins required for avoiding innate host immunity, staphylococcal protein A and Sbi. Toeprints and in vivo mutational analysis reveal a novel regulatory module within RNAIII essential for attenuation of Sbi translation. The sophisticated translational control of mRNA by two differentially expressed sRNAs ensures supervision of host immune escape by a major pathogen.

  6. Modulating bacterial and gut mucosal interactions with engineered biofilm matrix proteins.

    PubMed

    Duraj-Thatte, Anna M; Praveschotinunt, Pichet; Nash, Trevor R; Ward, Frederick R; Joshi, Neel S

    2018-02-22

    Extracellular appendages play a significant role in mediating communication between bacteria and their host. Curli fibers are a class of bacterial fimbria that is highly amenable to engineering. We demonstrate the use of engineered curli fibers to rationally program interactions between bacteria and components of the mucosal epithelium. Commensal E. coli strains were engineered to produce recombinant curli fibers fused to the trefoil family of human cytokines. Biofilms formed from these strains bound more mucins than those producing wild-type curli fibers, and modulated mucin rheology as well. When treated with bacteria producing the curli-trefoil fusions mammalian cells behaved identically in terms of their migration behavior as when they were treated with the corresponding soluble trefoil factors. Overall, this demonstrates the potential utility of curli fibers as a scaffold for the display of bioactive domains and an untapped approach to rationally modulating host-microbe interactions using bacterial matrix proteins.

  7. The oral administration of bacterial extracts prevents asthma via the recruitment of regulatory T cells to the airways.

    PubMed

    Navarro, S; Cossalter, G; Chiavaroli, C; Kanda, A; Fleury, S; Lazzari, A; Cazareth, J; Sparwasser, T; Dombrowicz, D; Glaichenhaus, N; Julia, V

    2011-01-01

    The prevalence of asthma has steadily increased during the last decade, probably as the result of changes in the environment, including reduced microbial exposure during infancy. Accordingly, experimental studies have shown that deliberate infections with live pathogens prevent the development of allergic airway diseases in mice. Bacterial extracts are currently used in children suffering from repeated upper respiratory tract infections. In the present study, we have investigated whether bacterial extracts, commercially available as Broncho-Vaxom (BV), could prevent allergic airway disease in mice. Oral treatment with BV suppressed airway inflammation through interleukin-10 (IL-10)-dependent and MyD88 (myeloid differentiation primary response gene (88))-dependent mechanisms and induced the conversion of FoxP3 (forkhead box P3)(-) T cells into FoxP3(+) regulatory T cells. Furthermore, CD4(+) T cells purified from the trachea of BV-treated mice conferred protection against airway inflammation when adoptively transferred into sensitized mice. Therefore, treatment with BV could possibly be a safe and efficient strategy to prevent the development of allergic diseases in children.

  8. Global Regulatory Pathways in the Alphaproteobacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    none

    A major goal for microbiologists in the twenty-first century is to develop an understanding of the microbial cell in all its complexity. In addition to understanding the function of individual gene products we need to focus on how the cell regulates gene expression at a global level to respond to different environmental parameters. Development of genomic technologies such as complete genome sequencing, proteomics, and global comparisons of mRNA expression patterns allows us to begin to address this issue. This proposal focuses on a number of phylogenetically related bacteria that are involved in environmentally important processes such as carbon sequestration andmore » bioremediation. Genome sequencing projects of a number of these bacteria have revealed the presence of a small family of regulatory genes found thus far only in the alpha-proteobacteria. These genes encode proteins that are related to the global regulatory protein RosR in Rhizobium etli, which is involved in determining nodulation competitiveness in this bacterium. Our goal is to examine the function of the proteins encoded by this gene family in several of the bacteria containing homologs to RosR. We will construct gene disruption mutations in a number of these bacteria and characterize the resulting mutant strains using two-dimensional gel electrophoresis and genetic and biochemical techniques. We will thus determine if the other proteins also function as global regulators of gene expression. Using proteomics methods we will identify the specific proteins whose expression varies depending on the presence or absence of the RosR homolog. Over fifty loci regulated by RosR have been identified in R. etli using transposon mutagenesis; this will serve as out benchmark to which we will compare the other regulons. We expect to identify genes regulated by RosR homologs in several bacterial species, including, but not limited to Rhodopseudomonas palustris and Sphingomonas aromaticivorans. In this way we

  9. Motion of single MreB bacterial actin proteins in Caulobacter show treadmilling in vivo

    NASA Astrophysics Data System (ADS)

    Moerner, W. E.; Kim, Soyeon; Gitai, Zemer; Kinkhabwala, Anika; McAdams, Harley; Shapiro, Lucy

    2006-03-01

    Ensemble imaging of a bacterial actin homologue, the MreB protein, suggests that the MreB proteins form a dynamic filamentous spiral along the long axis of the cell in Caulobacter crescentus. MreB contracts and expands along the cell axis and plays an important role in cell shape and polarity maintenance, as well as chromosome segregation and translocation of the origin of replication during cell division. In this study we investigated the real-time polymerization of MreB in Caulobacter crescentus using single-molecule fluorescence imaging. With time-lapse imaging, polymerized MreB could be distinguished from cytoplasmic MreB monomers, because single monomeric MreB showed fast motion characteristic of Brownian diffusion, while single polymerized MreB displayed slow, directed motion. This directional movement of labeled MreB in the growing polymer implies that treadmilling is the predominant mechanism in MreB filament formation. These single-molecule imaging experiments provide the first available information on the velocity of bacterial actin polymerization in a living cell.

  10. Defense Against Cannibalism: The SdpI Family of Bacterial Immunity/Signal Transduction Proteins

    PubMed Central

    Povolotsky, Tatyana Leonidovna; Orlova, Ekaterina; Tamang, Dorjee G.

    2010-01-01

    The SdpI family consists of putative bacterial toxin immunity and signal transduction proteins. One member of the family in Bacillus subtilis, SdpI, provides immunity to cells from cannibalism in times of nutrient limitation. SdpI family members are transmembrane proteins with 3, 4, 5, 6, 7, 8, or 12 putative transmembrane α-helical segments (TMSs). These varied topologies appear to be genuine rather than artifacts due to sequencing or annotation errors. The basic and most frequently occurring element of the SdpI family has 6 TMSs. Homologues of all topological types were aligned to determine the homologous TMSs and loop regions, and the positive-inside rule was used to determine sidedness. The two most conserved motifs were identified between TMSs 1 and 2 and TMSs 4 and 5 of the 6 TMS proteins. These showed significant sequence similarity, leading us to suggest that the primordial precursor of these proteins was a 3 TMS–encoding genetic element that underwent intragenic duplication. Various deletional and fusional events, as well as intragenic duplications and inversions, may have yielded SdpI homologues with topologies of varying numbers and positions of TMSs. We propose a specific evolutionary pathway that could have given rise to these distantly related bacterial immunity proteins. We further show that genes encoding SdpI homologues often appear in operons with genes for homologues of SdpR, SdpI’s autorepressor. Our analyses allow us to propose structure–function relationships that may be applicable to most family members. Electronic supplementary material The online version of this article (doi:10.1007/s00232-010-9260-7) contains supplementary material, which is available to authorized users. PMID:20563570

  11. Biochemical Roles for Conserved Residues in the Bacterial Fatty Acid-binding Protein Family*

    PubMed Central

    Broussard, Tyler C.; Miller, Darcie J.; Jackson, Pamela; Nourse, Amanda; White, Stephen W.; Rock, Charles O.

    2016-01-01

    Fatty acid kinase (Fak) is a ubiquitous Gram-positive bacterial enzyme consisting of an ATP-binding protein (FakA) that phosphorylates the fatty acid bound to FakB. In Staphylococcus aureus, Fak is a global regulator of virulence factor transcription and is essential for the activation of exogenous fatty acids for incorporation into phospholipids. The 1.2-Å x-ray structure of S. aureus FakB2, activity assays, solution studies, site-directed mutagenesis, and in vivo complementation were used to define the functions of the five conserved residues that define the FakB protein family (Pfam02645). The fatty acid tail is buried within the protein, and the exposed carboxyl group is bound by a Ser-93-fatty acid carboxyl-Thr-61-His-266 hydrogen bond network. The guanidinium of the invariant Arg-170 is positioned to potentially interact with a bound acylphosphate. The reduced thermal denaturation temperatures of the T61A, S93A, and H266A FakB2 mutants illustrate the importance of the hydrogen bond network in protein stability. The FakB2 T61A, S93A, and H266A mutants are 1000-fold less active in the Fak assay, and the R170A mutant is completely inactive. All FakB2 mutants form FakA(FakB2)2 complexes except FakB2(R202A), which is deficient in FakA binding. Allelic replacement shows that strains expressing FakB2 mutants are defective in fatty acid incorporation into phospholipids and virulence gene transcription. These conserved residues are likely to perform the same critical functions in all bacterial fatty acid-binding proteins. PMID:26774272

  12. Two regulatory RNA elements affect TisB-dependent depolarization and persister formation.

    PubMed

    Berghoff, Bork A; Hoekzema, Mirthe; Aulbach, Lena; Wagner, E Gerhart H

    2017-03-01

    Bacterial survival strategies involve phenotypic diversity which is generated by regulatory factors and noisy expression of effector proteins. The question of how bacteria exploit regulatory RNAs to make decisions between phenotypes is central to a general understanding of these universal regulators. We investigated the TisB/IstR-1 toxin-antitoxin system of Escherichia coli to appreciate the role of the RNA antitoxin IstR-1 in TisB-dependent depolarization of the inner membrane and persister formation. Persisters are phenotypic variants that have become transiently drug-tolerant by arresting growth. The RNA antitoxin IstR-1 sets a threshold for TisB-dependent depolarization under DNA-damaging conditions, resulting in two sub-populations: polarized and depolarized cells. Furthermore, our data indicate that an inhibitory 5' UTR structure in the tisB mRNA serves as a regulatory RNA element that delays TisB translation to avoid inappropriate depolarization when DNA damage is low. Investigation of the persister sub-population further revealed that both regulatory RNA elements affect persister levels as well as persistence time. This work provides an intriguing example of how bacteria exploit regulatory RNAs to control phenotypic heterogeneity. © 2016 John Wiley & Sons Ltd.

  13. Guanine nucleotide-binding regulatory proteins in retinal pigment epithelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jiang, Meisheng; Tran, V.T.; Fong, H.K.W.

    1991-05-01

    The expression of GTP-binding regulatory proteins (G proteins) in retinal pigment epithelial (RPE) cells was analyzed by RNA blot hybridization and cDNA amplification. Both adult and fetal human RPE cells contain mRNA for multiple G protein {alpha} subunits (G{alpha}) including G{sub s}{alpha}, G{sub i-1}{alpha}, G{sub i-2}{alpha}, G{sub i-3}{alpha}, and G{sub z}{alpha} (or G{sub x}{alpha}), where G{sub s} and G{sub i} are proteins that stimulate or inhibit adenylyl cyclase, respectively, and G{sub z} is a protein that may mediate pertussis toxin-insensitive events. Other G{alpha}-related mRNA transcripts were detected in fetal RPE cells by low-stringency hybridization to G{sub i-2}{alpha} and G{sub s}{alpha}more » protein-coding cDNA probes. The diversity of G proteins in RPE cells was further studied by cDNA amplification with reverse transcriptase and the polymerase chain reaction. This approach revealed that, besides the above mentioned members of the G{alpha} gene family, at least two other G{alpha} subunits are expressed in RPE cells. Human retinal cDNA clones that encode one of the additional G{alpha} subunits were isolated and characterized. The results indicate that this G{alpha} subunit belongs to a separate subfamily of G proteins that may be insensitive to inhibition by pertussis toxin.« less

  14. Perturbation of bacterial ice nucleation activity by a grass antifreeze protein.

    PubMed

    Tomalty, Heather E; Walker, Virginia K

    2014-09-26

    Certain plant-associating bacteria produce ice nucleation proteins (INPs) which allow the crystallization of water at high subzero temperatures. Many of these microbes are considered plant pathogens since the formed ice can damage tissues, allowing access to nutrients. Intriguingly, certain plants that host these bacteria synthesize antifreeze proteins (AFPs). Once freezing has occurred, plant AFPs likely function to inhibit the growth of large damaging ice crystals. However, we postulated that such AFPs might also serve as defensive mechanisms against bacterial-mediated ice nucleation. Recombinant AFP derived from the perennial ryegrass Lolium perenne (LpAFP) was combined with INP preparations originating from the grass epiphyte, Pseudomonas syringae. The presence of INPs had no effect on AFP activity, including thermal hysteresis and ice recrystallization inhibition. Strikingly, the ice nucleation point of the INP was depressed up to 1.9°C in the presence of LpAFP, but a recombinant fish AFP did not lower the INP-imposed freezing point. Assays with mutant LpAFPs and the visualization of bacterially-displayed fluorescent plant AFP suggest that INP and LpAFP can interact. Thus, we postulate that in addition to controlling ice growth, plant AFPs may also function as a defensive strategy against the damaging effects of ice-nucleating bacteria. Crown Copyright © 2014. Published by Elsevier Inc. All rights reserved.

  15. Effect of ceramide-1-phosphate transfer protein on intestinal bacterial translocation in severe acute pancreatitis.

    PubMed

    Wang, Jiang; Li, Chang; Jiang, Yingjian; Zheng, Hongmei; Li, Dehui; Liang, Yibo; Deng, Wensheng; Zhang, Dianliang

    2017-02-01

    The aim of the study was to investigate the effects of ceramide-1-phosphate transfer protein (CPTP) on the intestinal epithelial tight junction proteins in patients with severe acute pancreatitis (SAP). Fifty patients with SAP were classified into two groups according to the presence of bacterial translocation (BT) in the blood. Thirty healthy individuals were included in the control group. The presence of BT was analyzed by polymerase chain reaction. The expression of tight junction proteins and CPTP was determined using immunohistochemistry and western blotting. Bacterial DNA was detected in the peripheral blood of 62.0% of the patients with SAP. The expression of CPTP and tight junction proteins in SAP patients was lower than that in healthy controls. Among the patients with SAP, those positive for BT(+) showed a lower level of CPTP and occluding (OC) and zonula occludens-1 (ZO-1) expression and a higher level of IVA cPLA2 expression than BT(-) patients. Moreover, the expression of CPTP was significantly associated with ZO-1 and showed a negative correlation with expression of IVA cPLA2 in SAP-BT(+) patients. CPTP affects the expression of tight junction proteins and may protects the intestinal epithelial barrier by downregulating the expression of IVA cPLA2. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  16. Comparative Genomic Analyses of the Bacterial Phosphotransferase System

    PubMed Central

    Barabote, Ravi D.; Saier, Milton H.

    2005-01-01

    We report analyses of 202 fully sequenced genomes for homologues of known protein constituents of the bacterial phosphoenolpyruvate-dependent phosphotransferase system (PTS). These included 174 bacterial, 19 archaeal, and 9 eukaryotic genomes. Homologues of PTS proteins were not identified in archaea or eukaryotes, showing that the horizontal transfer of genes encoding PTS proteins has not occurred between the three domains of life. Of the 174 bacterial genomes (136 bacterial species) analyzed, 30 diverse species have no PTS homologues, and 29 species have cytoplasmic PTS phosphoryl transfer protein homologues but lack recognizable PTS permeases. These soluble homologues presumably function in regulation. The remaining 77 species possess all PTS proteins required for the transport and phosphorylation of at least one sugar via the PTS. Up to 3.2% of the genes in a bacterium encode PTS proteins. These homologues were analyzed for family association, range of protein types, domain organization, and organismal distribution. Different strains of a single bacterial species often possess strikingly different complements of PTS proteins. Types of PTS protein domain fusions were analyzed, showing that certain types of domain fusions are common, while others are rare or prohibited. Select PTS proteins were analyzed from different phylogenetic standpoints, showing that PTS protein phylogeny often differs from organismal phylogeny. The results document the frequent gain and loss of PTS protein-encoding genes and suggest that the lateral transfer of these genes within the bacterial domain has played an important role in bacterial evolution. Our studies provide insight into the development of complex multicomponent enzyme systems and lead to predictions regarding the types of protein-protein interactions that promote efficient PTS-mediated phosphoryl transfer. PMID:16339738

  17. Selective molecular transport through the protein shell of a bacterial microcompartment organelle

    DOE PAGES

    Chowdhury, Chiranjit; Chun, Sunny; Pang, Allan; ...

    2015-02-23

    Bacterial microcompartments are widespread prokaryotic organelles that have important and diverse roles ranging from carbon fixation to enteric pathogenesis. Current models for microcompartment function propose that their outer protein shell is selectively permeable to small molecules, but whether a protein shell can mediate selective permeability and how this occurs are unresolved questions. In this paper, biochemical and physiological studies of structure-guided mutants are used to show that the hexameric PduA shell protein of the 1,2-propanediol utilization (Pdu) microcompartment forms a selectively permeable pore tailored for the influx of 1,2-propanediol (the substrate of the Pdu microcompartment) while restricting the efflux ofmore » propionaldehyde, a toxic intermediate of 1,2-propanediol catabolism. Crystal structures of various PduA mutants provide a foundation for interpreting the observed biochemical and phenotypic data in terms of molecular diffusion across the shell. Finally and overall, these studies provide a basis for understanding a class of selectively permeable channels formed by nonmembrane proteins.« less

  18. Meat, dairy and plant proteins alter bacterial composition of rat gut bacteria.

    PubMed

    Zhu, Yingying; Lin, Xisha; Zhao, Fan; Shi, Xuebin; Li, He; Li, Yingqiu; Zhu, Weiyun; Xu, Xinglian; Li, Chunbao; Lu, Chunbao; Zhou, Guanghong

    2015-10-14

    Long-term consumption of red meat has been considered a potential risk to gut health, but this is based on clinic investigations, excessive intake of fat, heme and some injurious compounds formed during cooking or additions to processed meat products. Whether intake of red meat protein affects gut bacteria and the health of the host remains unclear. In this work, we compared the composition of gut bacteria in the caecum, by sequencing the V4-V5 region of 16S ribosomal RNA gene, obtained from rats fed with proteins from red meat (beef and pork), white meat (chicken and fish) and other sources (casein and soy). The results showed significant differences in profiles of gut bacteria between the six diet groups. Rats fed with meat proteins had a similar overall structure of caecal bacterial communities separated from those fed non-meat proteins. The beneficial genus Lactobacillus was higher in the white meat than in the red meat or non-meat protein groups. Also, rats fed with meat proteins and casein had significantly lower levels of lipopolysaccharide-binding proteins, suggesting that the intake of meat proteins may maintain a more balanced composition of gut bacteria, thereby reducing the antigen load and inflammatory response in the host.

  19. Meat, dairy and plant proteins alter bacterial composition of rat gut bacteria

    PubMed Central

    Zhu, Yingying; Lin, Xisha; Zhao, Fan; Shi, Xuebin; Li, He; Li, Yingqiu; Zhu, Weiyun; Xu, Xinglian; Lu, Chunbao; Zhou, Guanghong

    2015-01-01

    Long-term consumption of red meat has been considered a potential risk to gut health, but this is based on clinic investigations, excessive intake of fat, heme and some injurious compounds formed during cooking or additions to processed meat products. Whether intake of red meat protein affects gut bacteria and the health of the host remains unclear. In this work, we compared the composition of gut bacteria in the caecum, by sequencing the V4-V5 region of 16S ribosomal RNA gene, obtained from rats fed with proteins from red meat (beef and pork), white meat (chicken and fish) and other sources (casein and soy). The results showed significant differences in profiles of gut bacteria between the six diet groups. Rats fed with meat proteins had a similar overall structure of caecal bacterial communities separated from those fed non-meat proteins. The beneficial genus Lactobacillus was higher in the white meat than in the red meat or non-meat protein groups. Also, rats fed with meat proteins and casein had significantly lower levels of lipopolysaccharide-binding proteins, suggesting that the intake of meat proteins may maintain a more balanced composition of gut bacteria, thereby reducing the antigen load and inflammatory response in the host. PMID:26463271

  20. Differential protein expression in alligator leukocytes in response to bacterial lipopolysaccharide injection.

    PubMed

    Merchant, Mark; Kinney, Clint; Sanders, Paige

    2009-12-01

    Blood was collected from three juvenile alligators (Alligator mississippiensis) before, and again 24h after, injection with bacterial lipopolysaccharide (LPS). The leukocytes were collected from both samples, and the proteins were extracted. Each group of proteins was labeled with a different fluorescent dye and the differences in protein expression were analyzed by two dimensional differential in-gel expressions (2D-DIGE). The proteins which appeared to be increased or decreased by treatment with LPS were selected and analyzed by MALDI-TOF to determine mass and LC-MS/MS to acquire the partial protein sequences. The peptide sequences were compared to the NCBI protein sequence database to determine homology with other sequences from other species. Several proteins of interest appeared to be increased upon LPS stimulation. Proteins with homology to human transgelin-2, fish glucose-6-phosphate dehydrogenase, amphibian α-enolase, alligator lactate dehydrogenase, fish ubiquitin-activating enzyme, and fungal β-tubulin were also increased after LPS injection. Proteins with homology to fish vimentin 4, murine heterogeneous nuclear ribonucleoprotein A3, and avian calreticulin were found to be decreased in response to LPS. In addition, five proteins, four of which were up-regulated (827, 560, 512, and 650%) and one that exhibited repressed expression (307%), did not show homology to any protein in the database, and thus may represent newly discovered proteins. We are using this biochemical approach to isolate and characterize alligator proteins with potential relevant immune function.

  1. Overexpression of KH-type splicing regulatory protein regulates proliferation, migration, and implantation ability of osteosarcoma.

    PubMed

    Pruksakorn, Dumnoensun; Teeyakasem, Pimpisa; Klangjorhor, Jeerawan; Chaiyawat, Parunya; Settakorn, Jongkolnee; Diskul-Na-Ayudthaya, Penchatr; Chokchaichamnankit, Daranee; Pothacharoen, Peraphan; Srisomsap, Chantragan

    2016-09-01

    Osteosarcoma is a common malignant bone tumor in children and adolescents. The current 5-year survival rate is ~60% and that seems to be reaching a plateau. In order to improve treatment outcomes of osteosarcoma, a better understanding of tumorigenesis and underlying molecular mechanisms is required for searching out possible new treatment targets. This study aimed to identify the potential proteins involving the pathogenesis of osteosarcoma using a proteomics approach. Proteins extracted from primary cell culture of osteosarcoma (n=7) and osteoblasts of cancellous bone (n=7) were studied. Using 2-DE based proteomics and LC-MS/MS analysis, we successfully determined seven differentially expressed protein spots. Four upregulated proteins and three downregulated proteins were observed in this study in which KH-type splicing regulatory protein (KSRP) was selected for further exploration. KSRP was significantly upregulated in osteosarcoma cells compared to osteoblasts using western blot assay. In addition, immunohistochemistry demonstrated that KSRP was also highly expressed in osteosarcoma tissue of independent cases from the experimental group. More importantly, KSRP silencing of osteosarcoma cell lines significantly decreased cell proliferation, migration ability, as well as implantation and growth ability in chick chorioallantoic membrane assay. Taken together, these findings demonstrate, that KSRP plays important roles in regulatory controls of osteosarcoma pathogenesis and serves as a potentially therapeutic target of osteosarcoma.

  2. The participation of outer membrane proteins in the bacterial sensitivity to nanosilver.

    PubMed

    Kędziora, Anna; Krzyżewska, Eva; Dudek, Bartłomiej; Bugla-Płoskońska, Gabriela

    2016-06-13

    The presented study is to analyze the participation of outer membrane proteins of Gram- negative bacteria in sensitivity to silver nanomaterials. The mechanism of interaction of silver with the bacterial cell is best described in this group of microorganisms. There are several theories regarding the effectiveness of antimicrobial ions and nanosilver, and at the indicated differences in the way they work. Outer membrane proteins of Gram-negative bacteria are involved in the procurement of silver from the environment and contribute to the development mechanisms of resistance to nanometals. They are measurable parameter in the field of cell phenotypic response to the presence of Gram-negative bacteria in the environment silver nanoforms: its properties, chemical composition, content or times of action. Proteomic methods (including two dimensional electrophoresis and MALDI‑TOF MS) are therefore relevant techniques for determining the susceptibility of bacteria to silver and the changes taking place in the outer membrane under the influence: uptime/exposure and physical and chemical parameters of silver nanomaterials. Many products containing nanosilver is still in the research phase in terms of physico‑chemical characteristics and biological activity, others have been already implemented in many industries. During the very fast nanotechnology developing and introduction to the market products based on the nanosilver the bacterial answer to nanosilver is needed.

  3. Multiple Regulatory Systems Coordinate DNA Replication with Cell Growth in Bacillus subtilis

    PubMed Central

    Murray, Heath; Koh, Alan

    2014-01-01

    In many bacteria the rate of DNA replication is linked with cellular physiology to ensure that genome duplication is coordinated with growth. Nutrient-mediated growth rate control of DNA replication initiation has been appreciated for decades, however the mechanism(s) that connects these cell cycle activities has eluded understanding. In order to help address this fundamental question we have investigated regulation of DNA replication in the model organism Bacillus subtilis. Contrary to the prevailing view we find that changes in DnaA protein level are not sufficient to account for nutrient-mediated growth rate control of DNA replication initiation, although this regulation does require both DnaA and the endogenous replication origin. We go on to report connections between DNA replication and several essential cellular activities required for rapid bacterial growth, including respiration, central carbon metabolism, fatty acid synthesis, phospholipid synthesis, and protein synthesis. Unexpectedly, the results indicate that multiple regulatory systems are involved in coordinating DNA replication with cell physiology, with some of the regulatory systems targeting oriC while others act in a oriC-independent manner. We propose that distinct regulatory systems are utilized to control DNA replication in response to diverse physiological and chemical changes. PMID:25340815

  4. Crystal structure of bacterial cell-surface alginate-binding protein with an M75 peptidase motif

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maruyama, Yukie; Ochiai, Akihito; Mikami, Bunzo

    Research highlights: {yields} Bacterial alginate-binding Algp7 is similar to component EfeO of Fe{sup 2+} transporter. {yields} We determined the crystal structure of Algp7 with a metal-binding motif. {yields} Algp7 consists of two helical bundles formed through duplication of a single bundle. {yields} A deep cleft involved in alginate binding locates around the metal-binding site. {yields} Algp7 may function as a Fe{sup 2+}-chelated alginate-binding protein. -- Abstract: A gram-negative Sphingomonas sp. A1 directly incorporates alginate polysaccharide into the cytoplasm via the cell-surface pit and ABC transporter. A cell-surface alginate-binding protein, Algp7, functions as a concentrator of the polysaccharide in the pit.more » Based on the primary structure and genetic organization in the bacterial genome, Algp7 was found to be homologous to an M75 peptidase motif-containing EfeO, a component of a ferrous ion transporter. Despite the presence of an M75 peptidase motif with high similarity, the Algp7 protein purified from recombinant Escherichia coli cells was inert on insulin B chain and N-benzoyl-Phe-Val-Arg-p-nitroanilide, both of which are substrates for a typical M75 peptidase, imelysin, from Pseudomonas aeruginosa. The X-ray crystallographic structure of Algp7 was determined at 2.10 A resolution by single-wavelength anomalous diffraction. Although a metal-binding motif, HxxE, conserved in zinc ion-dependent M75 peptidases is also found in Algp7, the crystal structure of Algp7 contains no metal even at the motif. The protein consists of two structurally similar up-and-down helical bundles as the basic scaffold. A deep cleft between the bundles is sufficiently large to accommodate macromolecules such as alginate polysaccharide. This is the first structural report on a bacterial cell-surface alginate-binding protein with an M75 peptidase motif.« less

  5. Role of regulatory subunits and protein kinase inhibitor (PKI) in determining nuclear localization and activity of the catalytic subunit of protein kinase A.

    PubMed

    Wiley, J C; Wailes, L A; Idzerda, R L; McKnight, G S

    1999-03-05

    Regulation of protein kinase A by subcellular localization may be critical to target catalytic subunits to specific substrates. We employed epitope-tagged catalytic subunit to correlate subcellular localization and gene-inducing activity in the presence of regulatory subunit or protein kinase inhibitor (PKI). Transiently expressed catalytic subunit distributed throughout the cell and induced gene expression. Co-expression of regulatory subunit or PKI blocked gene induction and prevented nuclear accumulation. A mutant PKI lacking the nuclear export signal blocked gene induction but not nuclear accumulation, demonstrating that nuclear export is not essential to inhibit gene induction. When the catalytic subunit was targeted to the nucleus with a nuclear localization signal, it was not sequestered in the cytoplasm by regulatory subunit, although its activity was completely inhibited. PKI redistributed the nuclear catalytic subunit to the cytoplasm and blocked gene induction, demonstrating that the nuclear export signal of PKI can override a strong nuclear localization signal. With increasing PKI, the export process appeared to saturate, resulting in the return of catalytic subunit to the nucleus. These results demonstrate that both the regulatory subunit and PKI are able to completely inhibit the gene-inducing activity of the catalytic subunit even when the catalytic subunit is forced to concentrate in the nuclear compartment.

  6. Soy protein films for wound-healing applications: antibiotic release, bacterial inhibition and cellular response.

    PubMed

    Peles, Zachi; Binderman, Itzhak; Berdicevsky, Israela; Zilberman, Meital

    2013-05-01

    Use of naturally derived materials is becoming widespread in the biomedical field. Soy protein has advantages over the various types of natural proteins employed for biomedical applications, due to its low price, non-animal origin and relatively long storage time and stability. In the current study, soy protein isolate (SPI) was investigated as a matrix for wound-dressing applications. The antibiotic drug gentamicin was incorporated into the matrix for local controlled release and thus continuous bactericidal effect. Homogeneous high-quality films were cast from aqueous solutions and tested for the effects of gentamicin release on bacterial inhibition. The cytotoxicity and in vitro biocompatibility of these films were also examined. The gentamicin release profiles exhibited a moderate burst effect followed by a decreasing release rate, which was maintained for at least 4 weeks, thus enabling a suitable bacterial inhibition effect. The materials released from the films during an indirect cytotoxicity test were found to be safe, except for a slight inhibitory effect in the presence of high concentrations of glycerol. The biocompatibility test showed confluent cell cultures in close proximity to the SPI films. It is clear that these new antibiotic-eluting SPI films exhibit a high potential for use as wound dressings. Copyright © 2012 John Wiley & Sons, Ltd.

  7. Emerging therapeutic delivery capabilities and challenges utilizing enzyme/protein packaged bacterial vesicles.

    PubMed

    Alves, Nathan J; Turner, Kendrick B; Medintz, Igor L; Walper, Scott A

    2015-07-01

    Nanoparticle-based therapeutics are poised to play a critical role in treating disease. These complex multifunctional drug delivery vehicles provide for the passive and active targeted delivery of numerous small molecule, peptide and protein-derived pharmaceuticals. This article will first discuss some of the current state of the art nanoparticle classes (dendrimers, lipid-based, polymeric and inorganic), highlighting benefits/drawbacks associated with their implementation. We will then discuss an emerging class of nanoparticle therapeutics, bacterial outer membrane vesicles, that can provide many of the nanoparticle benefits while simplifying assembly. Through molecular biology techniques; outer membrane vesicle hijacking potentially allows for stringent control over nanoparticle production allowing for targeted protein packaged nanoparticles to be fully synthesized by bacteria.

  8. Structure-function analysis of the extracellular domain of the pneumococcal cell division site positioning protein MapZ

    NASA Astrophysics Data System (ADS)

    Manuse, Sylvie; Jean, Nicolas L.; Guinot, Mégane; Lavergne, Jean-Pierre; Laguri, Cédric; Bougault, Catherine M.; Vannieuwenhze, Michael S.; Grangeasse, Christophe; Simorre, Jean-Pierre

    2016-06-01

    Accurate placement of the bacterial division site is a prerequisite for the generation of two viable and identical daughter cells. In Streptococcus pneumoniae, the positive regulatory mechanism involving the membrane protein MapZ positions precisely the conserved cell division protein FtsZ at the cell centre. Here we characterize the structure of the extracellular domain of MapZ and show that it displays a bi-modular structure composed of two subdomains separated by a flexible serine-rich linker. We further demonstrate in vivo that the N-terminal subdomain serves as a pedestal for the C-terminal subdomain, which determines the ability of MapZ to mark the division site. The C-terminal subdomain displays a patch of conserved amino acids and we show that this patch defines a structural motif crucial for MapZ function. Altogether, this structure-function analysis of MapZ provides the first molecular characterization of a positive regulatory process of bacterial cell division.

  9. Tolerance to oxidative stress is required for maximal xylem colonization by the xylem-limited bacterial phytopathogen, Xylella fastidiosa.

    PubMed

    Wang, Peng; Lee, Yunho; Igo, Michele M; Roper, M Caroline

    2017-09-01

    Bacterial plant pathogens often encounter reactive oxygen species (ROS) during host invasion. In foliar bacterial pathogens, multiple regulatory proteins are involved in the sensing of oxidative stress and the activation of the expression of antioxidant genes. However, it is unclear whether xylem-limited bacteria, such as Xylella fastidiosa, experience oxidative stress during the colonization of plants. Examination of the X. fastidiosa genome uncovered only one homologue of oxidative stress regulatory proteins, OxyR. Here, a knockout mutation in the X. fastidiosa oxyR gene was constructed; the resulting strain was significantly more sensitive to hydrogen peroxide (H 2 O 2 ) relative to the wild-type. In addition, during early stages of grapevine infection, the survival rate was 1000-fold lower for the oxyR mutant than for the wild-type. This supports the hypothesis that grapevine xylem represents an oxidative environment and that X. fastidiosa must overcome this challenge to achieve maximal xylem colonization. Finally, the oxyR mutant exhibited reduced surface attachment and cell-cell aggregation and was defective in biofilm maturation, suggesting that ROS could be a potential environmental cue stimulating biofilm development during the early stages of host colonization. © 2016 BSPP AND JOHN WILEY & SONS LTD.

  10. Bacterial and cellular RNAs at work during Listeria infection.

    PubMed

    Sesto, Nina; Koutero, Mikael; Cossart, Pascale

    2014-01-01

    Listeria monocytogenes is an intracellular pathogen that can enter and invade host cells. In the course of its infection, RNA-mediated regulatory mechanisms provide a fast and versatile response for both the bacterium and the host. They regulate a variety of processes, such as environment sensing and virulence in pathogenic bacteria, as well as development, cellular differentiation, metabolism and immune responses in eukaryotic cells. The aim of this article is to summarize first the RNA-mediated regulatory mechanisms that play a role in the Listeria lifestyle and in its virulence, and then the host miRNA responses to Listeria infection. Finally, we discuss the potential cross-talk between bacterial RNAs and host RNA regulatory mechanisms as new mechanisms of bacterial virulence.

  11. The Protein Interactome of Streptococcus pneumoniae and Bacterial Meta-interactomes Improve Function Predictions.

    PubMed

    Wuchty, S; Rajagopala, S V; Blazie, S M; Parrish, J R; Khuri, S; Finley, R L; Uetz, P

    2017-01-01

    The functions of roughly a third of all proteins in Streptococcus pneumoniae , a significant human-pathogenic bacterium, are unknown. Using a yeast two-hybrid approach, we have determined more than 2,000 novel protein interactions in this organism. We augmented this network with meta-interactome data that we defined as the pool of all interactions between evolutionarily conserved proteins in other bacteria. We found that such interactions significantly improved our ability to predict a protein's function, allowing us to provide functional predictions for 299 S. pneumoniae proteins with previously unknown functions. IMPORTANCE Identification of protein interactions in bacterial species can help define the individual roles that proteins play in cellular pathways and pathogenesis. Very few protein interactions have been identified for the important human pathogen S. pneumoniae . We used an experimental approach to identify over 2,000 new protein interactions for S. pneumoniae , the most extensive interactome data for this bacterium to date. To predict protein function, we used our interactome data augmented with interactions from other closely related bacteria. The combination of the experimental data and meta-interactome data significantly improved the prediction results, allowing us to assign possible functions to a large number of poorly characterized proteins.

  12. Polarity proteins and actin regulatory proteins are unlikely partners that regulate cell adhesion in the seminiferous epithelium during spermatogenesis

    PubMed Central

    Cheng, C. Yan; Wong, Elissa W.P.; Lie, Pearl P.Y.; Mruk, Dolores D.; Xiao, Xiang; Li, Michelle W.M.; Lui, Wing-Yee; Lee, Will M.

    2014-01-01

    Summary In mammalian testis, spermatogenesis takes place in the seminiferous epithelium of the seminiferous tubule, which is composed of a series of cellular events. These include: (i) spermatogonial stem cell (SSC) renewal via mitosis and differentiation of SSC to spermatogenia, (ii) meiosis, (iii) spermiogenesis, and (iv) spermiation. Throughout these events, developing germ cells remain adhered to the Sertoli cell in the seminiferous epithelium amidst extensive cellular, biochemical, molecular and morphological changes to obtain structural support and nourishment. These events are coordinated via signal transduction at the cell-cell interface through cell junctions, illustrating the significance of cell junctions and adhesion in spermatogenesis. Additionally, developing germ cells migrate progressively across the seminiferous epithelium from the stem cell niche, which is located in the basal compartment near the basement membrane of the tunica propria adjacent to the interstitium. Recent studies have shown that some apparently unrelated proteins, such as polarity proteins and actin regulatory proteins, are in fact working in concert and synergistically to coordinate the continuous cyclic changes of adhesion at the Sertoli-Sertoli and Sertoli-germ cell interface in the seminiferous epithelium during the epithelial cycle of spermatogenesis, such that developing germ cells remain attached to the Sertoli cell in the epithelium while they alter in cell shape and migrate across the epithelium. In this review, we highlight the physiological significance of endocytic vesicle-mediated protein trafficking events under the influence of polarity and actin regulatory proteins in conferring cyclic events of cell adhesion and de-adhesion. Furthermore, these recent findings have unraveled some unexpected molecules to be targeted for male contraceptive development, which are also targets of toxicant-induced male reproductive dysfunction. PMID:21938683

  13. Bacterial actin MreB assembles in complex with cell shape protein RodZ.

    PubMed

    van den Ent, Fusinita; Johnson, Christopher M; Persons, Logan; de Boer, Piet; Löwe, Jan

    2010-03-17

    Bacterial actin homologue MreB is required for cell shape maintenance in most non-spherical bacteria, where it assembles into helical structures just underneath the cytoplasmic membrane. Proper assembly of the actin cytoskeleton requires RodZ, a conserved, bitopic membrane protein that colocalises to MreB and is essential for cell shape determination. Here, we present the first crystal structure of bacterial actin engaged with a natural partner and provide a clear functional significance of the interaction. We show that the cytoplasmic helix-turn-helix motif of Thermotoga maritima RodZ directly interacts with monomeric as well as filamentous MreB and present the crystal structure of the complex. In vitro and in vivo analyses of mutant T. maritima and Escherichia coli RodZ validate the structure and reveal the importance of the MreB-RodZ interaction in the ability of cells to propagate as rods. Furthermore, the results elucidate how the bacterial actin cytoskeleton might be anchored to the membrane to help constrain peptidoglycan synthesis in the periplasm.

  14. The host antimicrobial peptide Bac71-35 binds to bacterial ribosomal proteins and inhibits protein synthesis.

    PubMed

    Mardirossian, Mario; Grzela, Renata; Giglione, Carmela; Meinnel, Thierry; Gennaro, Renato; Mergaert, Peter; Scocchi, Marco

    2014-12-18

    Antimicrobial peptides (AMPs) are molecules from innate immunity with high potential as novel anti-infective agents. Most of them inactivate bacteria through pore formation or membrane barrier disruption, but others cross the membrane without damages and act inside the cells, affecting vital processes. However, little is known about their intracellular bacterial targets. Here we report that Bac71-35, a proline-rich AMP belonging to the cathelicidin family, can reach high concentrations (up to 340 μM) inside the E. coli cytoplasm. The peptide specifically and completely inhibits in vitro translation in the micromolar concentration range. Experiments of incorporation of radioactive precursors in macromolecules with E. coli cells confirmed that Bac71-35 affects specifically protein synthesis. Ribosome coprecipitation and crosslinking assays showed that the peptide interacts with ribosomes, binding to a limited subset of ribosomal proteins. Overall, these results indicate that the killing mechanism of Bac71-35 is based on a specific block of protein synthesis. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Growth performance and carcase quality in broiler chickens fed on bacterial protein grown on natural gas.

    PubMed

    Øverland, M; Schøyen, H F; Skrede, A

    2010-10-01

    1. The effects of increasing concentrations (0, 40, 80 or 120 g/kg) of bacterial protein meal (BPM) and bacterial protein autolysate (BPA) grown on natural gas on growth performance and carcase quality in broiler chickens were examined. 2. Adding BPM to diets reduced feed intake and improved gain: feed from 0 to 21 d and overall to 35 d, but did not significantly affect weight gain compared to the soybean meal based control diet. 3. Increasing concentrations of BPA significantly reduced growth rate, feed intake, gain: feed, carcase weight and dressing percentage, but significantly increased carcase dry matter, fat and energy content. 4. Adding BPM to diets had no effect on viscosity of diets and jejunal digesta, and minor effects on litter quality, whereas BPA increased the viscosity of diets and jejunal digesta, improved litter quality at 21 d, but decreased litter quality at 32 d. 5. To conclude, broiler chickens performed better on a BPM product with intact proteins than on an autolysate with ruptured cell walls and a high content of free amino acids and low molecular-weight peptides.

  16. STUDIES ON THE BACTERIOPHAGE OF D'HERELLE : IX. EVIDENCE OF HYDROLYSIS OF BACTERIAL PROTEIN DURING LYSIS.

    PubMed

    Hetler, D M; Bronfenbrenner, J

    1928-07-31

    1. During the process of lysis by bacteriophage, there is an appreciable increase in the amount of free amino acid present in the culture. 2. The increase of free amino acid is due to hydrolysis of bacterial protein.

  17. The Protein Interactome of Streptococcus pneumoniae and Bacterial Meta-interactomes Improve Function Predictions

    PubMed Central

    Rajagopala, S. V.; Blazie, S. M.; Parrish, J. R.; Khuri, S.; Finley, R. L.

    2017-01-01

    ABSTRACT The functions of roughly a third of all proteins in Streptococcus pneumoniae, a significant human-pathogenic bacterium, are unknown. Using a yeast two-hybrid approach, we have determined more than 2,000 novel protein interactions in this organism. We augmented this network with meta-interactome data that we defined as the pool of all interactions between evolutionarily conserved proteins in other bacteria. We found that such interactions significantly improved our ability to predict a protein’s function, allowing us to provide functional predictions for 299 S. pneumoniae proteins with previously unknown functions. IMPORTANCE Identification of protein interactions in bacterial species can help define the individual roles that proteins play in cellular pathways and pathogenesis. Very few protein interactions have been identified for the important human pathogen S. pneumoniae. We used an experimental approach to identify over 2,000 new protein interactions for S. pneumoniae, the most extensive interactome data for this bacterium to date. To predict protein function, we used our interactome data augmented with interactions from other closely related bacteria. The combination of the experimental data and meta-interactome data significantly improved the prediction results, allowing us to assign possible functions to a large number of poorly characterized proteins. PMID:28744484

  18. Small Proteins Can No Longer Be Ignored

    PubMed Central

    Storz, Gisela; Wolf, Yuri I.; Ramamurthi, Kumaran S.

    2014-01-01

    Small proteins, here defined as proteins of 50 amino acids or less in the absence of processing, have traditionally been overlooked due to challenges in their annotation and biochemical detection. In the past several years however, increasing numbers of small proteins have been identified either through the realization that mutations in “intergenic” regions actually are within unannotated small protein genes, or through the discovery that some small, regulatory RNAs (sRNAs) encode small proteins. These insights together with comparative sequence analysis indicate that tens if not hundreds of small proteins are synthesized in a given organism. This review will summarize what has been learned about the functions of several of these bacterial small proteins, most of which act at the membrane, illustrating the astonishing range of processes in which the small proteins act and pointing to several general conclusions. Important questions for future studies of these overlooked proteins also will be discussed. PMID:24606146

  19. Cytosolic Na+ Controls an Epithelial Na+ Channel Via the Go Guanine Nucleotide-Binding Regulatory Protein

    NASA Astrophysics Data System (ADS)

    Komwatana, P.; Dinudom, A.; Young, J. A.; Cook, D. I.

    1996-07-01

    In tight Na+-absorbing epithelial cells, the rate of Na+ entry through amiloride-sensitive apical membrane Na+ channels is matched to basolateral Na+ extrusion so that cell Na+ concentration and volume remain steady. Control of this process by regulation of apical Na+ channels has been attributed to changes in cytosolic Ca2+ concentration or pH, secondary to changes in cytosolic Na+ concentration, although cytosolic Cl- seems also to be involved. Using mouse mandibular gland duct cells, we now demonstrate that increasing cytosolic Na+ concentration inhibits apical Na+ channels independent of changes in cytosolic Ca2+, pH, or Cl-, and the effect is blocked by GDP-β -S, pertussis toxin, and antibodies against the α -subunits of guanine nucleotide-binding regulatory proteins (Go). In contrast, the inhibitory effect of cytosolic anions is blocked by antibodies to inhibitory guanine nucleotide-binding regulatory proteins (Gi1/Gi2. It thus appears that apical Na+ channels are regulated by Go and Gi proteins, the activities of which are controlled, respectively, by cytosolic Na+ and Cl-.

  20. Zinc deficiency-induced iron accumulation, a consequence of alterations in iron regulatory protein-binding activity, iron transporters, and iron storage proteins.

    PubMed

    Niles, Brad J; Clegg, Michael S; Hanna, Lynn A; Chou, Susan S; Momma, Tony Y; Hong, Heeok; Keen, Carl L

    2008-02-22

    One consequence of zinc deficiency is an elevation in cell and tissue iron concentrations. To examine the mechanism(s) underlying this phenomenon, Swiss 3T3 cells were cultured in zinc-deficient (D, 0.5 microM zinc), zinc-supplemented (S, 50 microM zinc), or control (C, 4 microM zinc) media. After 24 h of culture, cells in the D group were characterized by a 50% decrease in intracellular zinc and a 35% increase in intracellular iron relative to cells in the S and C groups. The increase in cellular iron was associated with increased transferrin receptor 1 protein and mRNA levels and increased ferritin light chain expression. The divalent metal transporter 1(+)iron-responsive element isoform mRNA was decreased during zinc deficiency-induced iron accumulation. Examination of zinc-deficient cells revealed increased binding of iron regulatory protein 2 (IRP2) and decreased binding of IRP1 to a consensus iron-responsive element. The increased IRP2-binding activity in zinc-deficient cells coincided with an increased level of IRP2 protein. The accumulation of IRP2 protein was independent of zinc deficiency-induced intracellular nitric oxide production but was attenuated by the addition of the antioxidant N-acetylcysteine or ascorbate to the D medium. These data support the concept that zinc deficiency can result in alterations in iron transporter, storage, and regulatory proteins, which facilitate iron accumulation.

  1. RNA regulators responding to ribosomal protein S15 are frequent in sequence space

    PubMed Central

    Slinger, Betty L.; Meyer, Michelle M.

    2016-01-01

    There are several natural examples of distinct RNA structures that interact with the same ligand to regulate the expression of homologous genes in different organisms. One essential question regarding this phenomenon is whether such RNA regulators are the result of convergent or divergent evolution. Are the RNAs derived from some common ancestor and diverged to the point where we cannot identify the similarity, or have multiple solutions to the same biological problem arisen independently? A key variable in assessing these alternatives is how frequently such regulators arise within sequence space. Ribosomal protein S15 is autogenously regulated via an RNA regulator in many bacterial species; four apparently distinct regulators have been functionally validated in different bacterial phyla. Here, we explore how frequently such regulators arise within a partially randomized sequence population. We find many RNAs that interact specifically with ribosomal protein S15 from Geobacillus kaustophilus with biologically relevant dissociation constants. Furthermore, of the six sequences we characterize, four show regulatory activity in an Escherichia coli reporter assay. Subsequent footprinting and mutagenesis analysis indicates that protein binding proximal to regulatory features such as the Shine–Dalgarno sequence is sufficient to enable regulation, suggesting that regulation in response to S15 is relatively easily acquired. PMID:27580716

  2. A census of membrane-bound and intracellular signal transduction proteins in bacteria: Bacterial IQ, extroverts and introverts

    PubMed Central

    Galperin, Michael Y

    2005-01-01

    Background Analysis of complete microbial genomes showed that intracellular parasites and other microorganisms that inhabit stable ecological niches encode relatively primitive signaling systems, whereas environmental microorganisms typically have sophisticated systems of environmental sensing and signal transduction. Results This paper presents results of a comprehensive census of signal transduction proteins – histidine kinases, methyl-accepting chemotaxis receptors, Ser/Thr/Tyr protein kinases, adenylate and diguanylate cyclases and c-di-GMP phosphodiesterases – encoded in 167 bacterial and archaeal genomes, sequenced by the end of 2004. The data have been manually checked to avoid false-negative and false-positive hits that commonly arise during large-scale automated analyses and compared against other available resources. The census data show uneven distribution of most signaling proteins among bacterial and archaeal phyla. The total number of signal transduction proteins grows approximately as a square of genome size. While histidine kinases are found in representatives of all phyla and are distributed according to the power law, other signal transducers are abundant in certain phylogenetic groups but virtually absent in others. Conclusion The complexity of signaling systems differs even among closely related organisms. Still, it usually can be correlated with the phylogenetic position of the organism, its lifestyle, and typical environmental challenges it encounters. The number of encoded signal transducers (or their fraction in the total protein set) can be used as a measure of the organism's ability to adapt to diverse conditions, the 'bacterial IQ', while the ratio of transmembrane receptors to intracellular sensors can be used to define whether the organism is an 'extrovert', actively sensing the environmental parameters, or an 'introvert', more concerned about its internal homeostasis. Some of the microorganisms with the highest IQ, including the

  3. A census of membrane-bound and intracellular signal transduction proteins in bacteria: bacterial IQ, extroverts and introverts.

    PubMed

    Galperin, Michael Y

    2005-06-14

    Analysis of complete microbial genomes showed that intracellular parasites and other microorganisms that inhabit stable ecological niches encode relatively primitive signaling systems, whereas environmental microorganisms typically have sophisticated systems of environmental sensing and signal transduction. This paper presents results of a comprehensive census of signal transduction proteins--histidine kinases, methyl-accepting chemotaxis receptors, Ser/Thr/Tyr protein kinases, adenylate and diguanylate cyclases and c-di-GMP phosphodiesterases--encoded in 167 bacterial and archaeal genomes, sequenced by the end of 2004. The data have been manually checked to avoid false-negative and false-positive hits that commonly arise during large-scale automated analyses and compared against other available resources. The census data show uneven distribution of most signaling proteins among bacterial and archaeal phyla. The total number of signal transduction proteins grows approximately as a square of genome size. While histidine kinases are found in representatives of all phyla and are distributed according to the power law, other signal transducers are abundant in certain phylogenetic groups but virtually absent in others. The complexity of signaling systems differs even among closely related organisms. Still, it usually can be correlated with the phylogenetic position of the organism, its lifestyle, and typical environmental challenges it encounters. The number of encoded signal transducers (or their fraction in the total protein set) can be used as a measure of the organism's ability to adapt to diverse conditions, the 'bacterial IQ', while the ratio of transmembrane receptors to intracellular sensors can be used to define whether the organism is an 'extrovert', actively sensing the environmental parameters, or an 'introvert', more concerned about its internal homeostasis. Some of the microorganisms with the highest IQ, including the current leader Wolinella succinogenes

  4. Comparison of structure, function and regulation of plant cold shock domain proteins to bacterial and animal cold shock domain proteins.

    PubMed

    Chaikam, Vijay; Karlson, Dale T

    2010-01-01

    The cold shock domain (CSD) is among the most ancient and well conserved nucleic acid binding domains from bacteria to higher animals and plants. The CSD facilitates binding to RNA, ssDNA and dsDNA and most functions attributed to cold shock domain proteins are mediated by this nucleic acid binding activity. In prokaryotes, cold shock domain proteins only contain a single CSD and are termed cold shock proteins (Csps). In animal model systems, various auxiliary domains are present in addition to the CSD and are commonly named Y-box proteins. Similar to animal CSPs, plant CSPs contain auxiliary C-terminal domains in addition to their N-terminal CSD. Cold shock domain proteins have been shown to play important roles in development and stress adaptation in wide variety of organisms. In this review, the structure, function and regulation of plant CSPs are compared and contrasted to the characteristics of bacterial and animal CSPs. [BMB reports 2010; 43(1): 1-8].

  5. De novo generation of infectious prions with bacterially expressed recombinant prion protein.

    PubMed

    Zhang, Zhihong; Zhang, Yi; Wang, Fei; Wang, Xinhe; Xu, Yuanyuan; Yang, Huaiyi; Yu, Guohua; Yuan, Chonggang; Ma, Jiyan

    2013-12-01

    The prion hypothesis is strongly supported by the fact that prion infectivity and the pathogenic conformer of prion protein (PrP) are simultaneously propagated in vitro by the serial protein misfolding cyclic amplification (sPMCA). However, due to sPMCA's enormous amplification power, whether an infectious prion can be formed de novo with bacterially expressed recombinant PrP (rPrP) remains to be satisfactorily resolved. To address this question, we performed unseeded sPMCA with rPrP in a laboratory that has never been exposed to any native prions. Two types of proteinase K (PK)-resistant and self-perpetuating recombinant PrP conformers (rPrP-res) with PK-resistant cores of 17 or 14 kDa were generated. A bioassay revealed that rPrP-res(17kDa) was highly infectious, causing prion disease in wild-type mice with an average survival time of about 172 d. In contrast, rPrP-res(14kDa) completely failed to induce any disease. Our findings reveal that sPMCA is sufficient to initiate various self-perpetuating PK-resistant rPrP conformers, but not all of them possess in vivo infectivity. Moreover, generating an infectious prion in a prion-free environment establishes that an infectious prion can be formed de novo with bacterially expressed rPrP.

  6. Effects of PKA phosphorylation on the conformation of the Na,K-ATPase regulatory protein FXYD1

    PubMed Central

    Teriete, Peter; Thai, Khang; Choi, Jungyuen; Marassi, Francesca M.

    2009-01-01

    FXYD1 (phospholemman) is a member of an evolutionarily conserved family of membrane proteins that regulate the function of the Na,K-ATPase enzyme complex in specific tissues and specific physiological states. In heart and skeletal muscle sarcolemma, FXYD1 is also the principal substrate of hormone-regulated phosphorylation by c-AMP dependent protein kinase A and by protein kinase C, which phosphorylate the protein at conserved Ser residues in its cytoplasmic domain, altering its Na,K-ATPase regulatory activity. FXYD1 adopts an L-shaped α-helical structure with the transmembrane helix loosely connected to a cytoplasmic amphipathic helix that rests on the membrane surface. In this paper we describe NMR experiments showing that neither PKA phosphorylation at Ser68 nor the physiologically relevant phosphorylation mimicking mutation Ser68Asp induces major changes in the protein conformation. The results, viewed in light of a model of FXYD1 associated with the Na,K-ATPase α and β subunits, indicate that the effects of phosphorylation on the Na,K-ATPase regulatory activity of FXYD1 could be due primarily to changes in electrostatic potential near the membrane surface and near the Na+/K+ ion binding site of the Na,K-ATPase α subunit. PMID:19761758

  7. Reconstitution of a nanomachine driving the assembly of proteins into bacterial outer membranes

    NASA Astrophysics Data System (ADS)

    Shen, Hsin-Hui; Leyton, Denisse L.; Shiota, Takuya; Belousoff, Matthew J.; Noinaj, Nicholas; Lu, Jingxiong; Holt, Stephen A.; Tan, Khershing; Selkrig, Joel; Webb, Chaille T.; Buchanan, Susan K.; Martin, Lisandra L.; Lithgow, Trevor

    2014-10-01

    In biological membranes, various protein secretion devices function as nanomachines, and measuring the internal movements of their component parts is a major technological challenge. The translocation and assembly module (TAM) is a nanomachine required for virulence of bacterial pathogens. We have reconstituted a membrane containing the TAM onto a gold surface for characterization by quartz crystal microbalance with dissipation (QCM-D) and magnetic contrast neutron reflectrometry (MCNR). The MCNR studies provided structural resolution down to 1 Å, enabling accurate measurement of protein domains projecting from the membrane layer. Here we show that dynamic movements within the TamA component of the TAM are initiated in the presence of a substrate protein, Ag43, and that these movements recapitulate an initial stage in membrane protein assembly. The reconstituted system provides a powerful new means to study molecular movements in biological membranes, and the technology is widely applicable to studying the dynamics of diverse cellular nanomachines.

  8. Polymorphisms of 20 regulatory proteins between Mycobacterium tuberculosis and Mycobacterium bovis.

    PubMed

    Bigi, María M; Blanco, Federico Carlos; Araújo, Flabio R; Thacker, Tyler C; Zumárraga, Martín J; Cataldi, Angel A; Soria, Marcelo A; Bigi, Fabiana

    2016-08-01

    Mycobacterium tuberculosis and Mycobacterium bovis are responsible for tuberculosis in humans and animals, respectively. Both species are closely related and belong to the Mycobacterium tuberculosis complex (MTC). M. tuberculosis is the most ancient species from which M. bovis and other members of the MTC evolved. The genome of M. bovis is over >99.95% identical to that of M. tuberculosis but with seven deletions ranging in size from 1 to 12.7 kb. In addition, 1200 single nucleotide mutations in coding regions distinguish M. bovis from M. tuberculosis. In the present study, we assessed 75 M. tuberculosis genomes and 23 M. bovis genomes to identify non-synonymous mutations in 202 coding sequences of regulatory genes between both species. We identified species-specific variants in 20 regulatory proteins and confirmed differential expression of hypoxia-related genes between M. bovis and M. tuberculosis. © 2016 The Societies and John Wiley & Sons Australia, Ltd.

  9. Localization of a bacterial group II intron-encoded protein in eukaryotic nuclear splicing-related cell compartments.

    PubMed

    Nisa-Martínez, Rafael; Laporte, Philippe; Jiménez-Zurdo, José Ignacio; Frugier, Florian; Crespi, Martin; Toro, Nicolás

    2013-01-01

    Some bacterial group II introns are widely used for genetic engineering in bacteria, because they can be reprogrammed to insert into the desired DNA target sites. There is considerable interest in developing this group II intron gene targeting technology for use in eukaryotes, but nuclear genomes present several obstacles to the use of this approach. The nuclear genomes of eukaryotes do not contain group II introns, but these introns are thought to have been the progenitors of nuclear spliceosomal introns. We investigated the expression and subcellular localization of the bacterial RmInt1 group II intron-encoded protein (IEP) in Arabidopsis thaliana protoplasts. Following the expression of translational fusions of the wild-type protein and several mutant variants with EGFP, the full-length IEP was found exclusively in the nucleolus, whereas the maturase domain alone targeted EGFP to nuclear speckles. The distribution of the bacterial RmInt1 IEP in plant cell protoplasts suggests that the compartmentalization of eukaryotic cells into nucleus and cytoplasm does not prevent group II introns from invading the host genome. Furthermore, the trafficking of the IEP between the nucleolus and the speckles upon maturase inactivation is consistent with the hypothesis that the spliceosomal machinery evolved from group II introns.

  10. Localization of a Bacterial Group II Intron-Encoded Protein in Eukaryotic Nuclear Splicing-Related Cell Compartments

    PubMed Central

    Nisa-Martínez, Rafael; Laporte, Philippe; Jiménez-Zurdo, José Ignacio; Frugier, Florian; Crespi, Martin; Toro, Nicolás

    2013-01-01

    Some bacterial group II introns are widely used for genetic engineering in bacteria, because they can be reprogrammed to insert into the desired DNA target sites. There is considerable interest in developing this group II intron gene targeting technology for use in eukaryotes, but nuclear genomes present several obstacles to the use of this approach. The nuclear genomes of eukaryotes do not contain group II introns, but these introns are thought to have been the progenitors of nuclear spliceosomal introns. We investigated the expression and subcellular localization of the bacterial RmInt1 group II intron-encoded protein (IEP) in Arabidopsis thaliana protoplasts. Following the expression of translational fusions of the wild-type protein and several mutant variants with EGFP, the full-length IEP was found exclusively in the nucleolus, whereas the maturase domain alone targeted EGFP to nuclear speckles. The distribution of the bacterial RmInt1 IEP in plant cell protoplasts suggests that the compartmentalization of eukaryotic cells into nucleus and cytoplasm does not prevent group II introns from invading the host genome. Furthermore, the trafficking of the IEP between the nucleolus and the speckles upon maturase inactivation is consistent with the hypothesis that the spliceosomal machinery evolved from group II introns. PMID:24391881

  11. pLoc-mGneg: Predict subcellular localization of Gram-negative bacterial proteins by deep gene ontology learning via general PseAAC.

    PubMed

    Cheng, Xiang; Xiao, Xuan; Chou, Kuo-Chen

    2017-10-06

    Information of the proteins' subcellular localization is crucially important for revealing their biological functions in a cell, the basic unit of life. With the avalanche of protein sequences generated in the postgenomic age, it is highly desired to develop computational tools for timely identifying their subcellular locations based on the sequence information alone. The current study is focused on the Gram-negative bacterial proteins. Although considerable efforts have been made in protein subcellular prediction, the problem is far from being solved yet. This is because mounting evidences have indicated that many Gram-negative bacterial proteins exist in two or more location sites. Unfortunately, most existing methods can be used to deal with single-location proteins only. Actually, proteins with multi-locations may have some special biological functions important for both basic research and drug design. In this study, by using the multi-label theory, we developed a new predictor called "pLoc-mGneg" for predicting the subcellular localization of Gram-negative bacterial proteins with both single and multiple locations. Rigorous cross-validation on a high quality benchmark dataset indicated that the proposed predictor is remarkably superior to "iLoc-Gneg", the state-of-the-art predictor for the same purpose. For the convenience of most experimental scientists, a user-friendly web-server for the novel predictor has been established at http://www.jci-bioinfo.cn/pLoc-mGneg/, by which users can easily get their desired results without the need to go through the complicated mathematics involved. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Modeling the cost and benefit of proteome regulation in a growing bacterial cell

    NASA Astrophysics Data System (ADS)

    Sharma, Pooja; Pratim Pandey, Parth; Jain, Sanjay

    2018-07-01

    Escherichia coli cells differentially regulate the production of metabolic and ribosomal proteins in order to stay close to an optimal growth rate in different environments, and exhibit the bacterial growth laws as a consequence. We present a simple mathematical model of a growing-dividing cell in which an internal dynamical mechanism regulates the allocation of proteomic resources between different protein sectors. The model allows an endogenous determination of the growth rate of the cell as a function of cellular and environmental parameters, and reproduces the bacterial growth laws. We use the model and its variants to study the balance between the cost and benefit of regulation. A cost is incurred because cellular resources are diverted to produce the regulatory apparatus. We show that there is a window of environments or a ‘niche’ in which the unregulated cell has a higher fitness than the regulated cell. Outside this niche there is a large space of constant and time varying environments in which regulation is an advantage. A knowledge of the ‘niche boundaries’ allows one to gain an intuitive understanding of the class of environments in which regulation is an advantage for the organism and which would therefore favour the evolution of regulation. The model allows us to determine the ‘niche boundaries’ as a function of cellular parameters such as the size of the burden of the regulatory apparatus. This class of models may be useful in elucidating various tradeoffs in cells and in making in-silico predictions relevant for synthetic biology.

  13. Modular architecture of protein structures and allosteric communications: potential implications for signaling proteins and regulatory linkages

    PubMed Central

    del Sol, Antonio; Araúzo-Bravo, Marcos J; Amoros, Dolors; Nussinov, Ruth

    2007-01-01

    Background Allosteric communications are vital for cellular signaling. Here we explore a relationship between protein architectural organization and shortcuts in signaling pathways. Results We show that protein domains consist of modules interconnected by residues that mediate signaling through the shortest pathways. These mediating residues tend to be located at the inter-modular boundaries, which are more rigid and display a larger number of long-range interactions than intra-modular regions. The inter-modular boundaries contain most of the residues centrally conserved in the protein fold, which may be crucial for information transfer between amino acids. Our approach to modular decomposition relies on a representation of protein structures as residue-interacting networks, and removal of the most central residue contacts, which are assumed to be crucial for allosteric communications. The modular decomposition of 100 multi-domain protein structures indicates that modules constitute the building blocks of domains. The analysis of 13 allosteric proteins revealed that modules characterize experimentally identified functional regions. Based on the study of an additional functionally annotated dataset of 115 proteins, we propose that high-modularity modules include functional sites and are the basic functional units. We provide examples (the Gαs subunit and P450 cytochromes) to illustrate that the modular architecture of active sites is linked to their functional specialization. Conclusion Our method decomposes protein structures into modules, allowing the study of signal transmission between functional sites. A modular configuration might be advantageous: it allows signaling proteins to expand their regulatory linkages and may elicit a broader range of control mechanisms either via modular combinations or through modulation of inter-modular linkages. PMID:17531094

  14. Sibling rivalry: related bacterial small RNAs and their redundant and non-redundant roles

    PubMed Central

    Caswell, Clayton C.; Oglesby-Sherrouse, Amanda G.; Murphy, Erin R.

    2014-01-01

    Small RNA molecules (sRNAs) are now recognized as key regulators controlling bacterial gene expression, as sRNAs provide a quick and efficient means of positively or negatively altering the expression of specific genes. To date, numerous sRNAs have been identified and characterized in a myriad of bacterial species, but more recently, a theme in bacterial sRNAs has emerged: the presence of more than one highly related sRNAs produced by a given bacterium, here termed sibling sRNAs. Sibling sRNAs are those that are highly similar at the nucleotide level, and while it might be expected that sibling sRNAs exert identical regulatory functions on the expression of target genes based on their high degree of relatedness, emerging evidence is demonstrating that this is not always the case. Indeed, there are several examples of bacterial sibling sRNAs with non-redundant regulatory functions, but there are also instances of apparent regulatory redundancy between sibling sRNAs. This review provides a comprehensive overview of the current knowledge of bacterial sibling sRNAs, and also discusses important questions about the significance and evolutionary implications of this emerging class of regulators. PMID:25389522

  15. Sibling rivalry: related bacterial small RNAs and their redundant and non-redundant roles.

    PubMed

    Caswell, Clayton C; Oglesby-Sherrouse, Amanda G; Murphy, Erin R

    2014-01-01

    Small RNA molecules (sRNAs) are now recognized as key regulators controlling bacterial gene expression, as sRNAs provide a quick and efficient means of positively or negatively altering the expression of specific genes. To date, numerous sRNAs have been identified and characterized in a myriad of bacterial species, but more recently, a theme in bacterial sRNAs has emerged: the presence of more than one highly related sRNAs produced by a given bacterium, here termed sibling sRNAs. Sibling sRNAs are those that are highly similar at the nucleotide level, and while it might be expected that sibling sRNAs exert identical regulatory functions on the expression of target genes based on their high degree of relatedness, emerging evidence is demonstrating that this is not always the case. Indeed, there are several examples of bacterial sibling sRNAs with non-redundant regulatory functions, but there are also instances of apparent regulatory redundancy between sibling sRNAs. This review provides a comprehensive overview of the current knowledge of bacterial sibling sRNAs, and also discusses important questions about the significance and evolutionary implications of this emerging class of regulators.

  16. The selective phosphorylation of a guanine nucleotide-binding regulatory protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Carlson, K.E.

    1989-01-01

    Receptor-activated signal transduction pathways regulate the responsiveness of cells to external stimuli. These transduction pathways themselves are subject to regulation, most commonly by phosphorylation. Guanine nucleotide-binding regulatory proteins (G Proteins), as requisite signal transducing elements for many plasma membrane receptors, are considered likely targets for regulation by phosphorylation. Protein kinase C (PKC) has been shown to phosphorylate the {alpha} subunit of G{sub i} and other G proteins in solution. However, the occurrence of the phosphorylation of G{sub 1} within intact cells in response to activation of PKC has not been rigorously demonstrated. In this thesis, the extent to which themore » {alpha} subunits of G{sub i} undergo phosphorylation within human platelets in response to activation of PKC was examined by means of radiolabeling and immunoprecipitation. Incubation of platelets with phorbol-12-myristate-13-acetate (PMA), a potent activator of PKC, promoted the phosphorylation of several proteins within saponin-permeabilized and intact platelets incubated with ({gamma}{sup 32}P)ATP and ({sup 32}P)H{sub 3}PO{sub 4}, respectively. None of the phosphoproteins, however, were precipitated by either of two antisera containing antibodies differing in specificities for epitopes within G{sub i{alpha}}-despite precipitation of a substantial fraction of the subunit itself. In contrast, other antisera, containing antibodies specific for the recently describe G{sub z{alpha}}, or antibodies for both G{sub z{alpha}} and G{sub i{alpha}}, precipitated a 40-kDa phosphoprotein.« less

  17. Computational architecture of the yeast regulatory network

    NASA Astrophysics Data System (ADS)

    Maslov, Sergei; Sneppen, Kim

    2005-12-01

    The topology of regulatory networks contains clues to their overall design principles and evolutionary history. We find that while in- and out-degrees of a given protein in the regulatory network are not correlated with each other, there exists a strong negative correlation between the out-degree of a regulatory protein and in-degrees of its targets. Such correlation positions large regulatory modules on the periphery of the network and makes them rather well separated from each other. We also address the question of relative importance of different classes of proteins quantified by the lethality of null-mutants lacking one of them as well as by the level of their evolutionary conservation. It was found that in the yeast regulatory network highly connected proteins are in fact less important than their low-connected counterparts.

  18. RNA search engines empower the bacterial intranet.

    PubMed

    Dendooven, Tom; Luisi, Ben F

    2017-08-15

    RNA acts not only as an information bearer in the biogenesis of proteins from genes, but also as a regulator that participates in the control of gene expression. In bacteria, small RNA molecules (sRNAs) play controlling roles in numerous processes and help to orchestrate complex regulatory networks. Such processes include cell growth and development, response to stress and metabolic change, transcription termination, cell-to-cell communication, and the launching of programmes for host invasion. All these processes require recognition of target messenger RNAs by the sRNAs. This review summarizes recent results that have provided insights into how bacterial sRNAs are recruited into effector ribonucleoprotein complexes that can seek out and act upon target transcripts. The results hint at how sRNAs and their protein partners act as pattern-matching search engines that efficaciously regulate gene expression, by performing with specificity and speed while avoiding off-target effects. The requirements for efficient searches of RNA patterns appear to be common to all domains of life. © 2017 The Author(s).

  19. RNA search engines empower the bacterial intranet

    PubMed Central

    Dendooven, Tom

    2017-01-01

    RNA acts not only as an information bearer in the biogenesis of proteins from genes, but also as a regulator that participates in the control of gene expression. In bacteria, small RNA molecules (sRNAs) play controlling roles in numerous processes and help to orchestrate complex regulatory networks. Such processes include cell growth and development, response to stress and metabolic change, transcription termination, cell-to-cell communication, and the launching of programmes for host invasion. All these processes require recognition of target messenger RNAs by the sRNAs. This review summarizes recent results that have provided insights into how bacterial sRNAs are recruited into effector ribonucleoprotein complexes that can seek out and act upon target transcripts. The results hint at how sRNAs and their protein partners act as pattern-matching search engines that efficaciously regulate gene expression, by performing with specificity and speed while avoiding off-target effects. The requirements for efficient searches of RNA patterns appear to be common to all domains of life. PMID:28710287

  20. Serum C-reactive protein as a diagnostic biomarker in dogs with bacterial respiratory diseases.

    PubMed

    Viitanen, S J; Laurila, H P; Lilja-Maula, L I; Melamies, M A; Rantala, M; Rajamäki, M M

    2014-01-01

    C-reactive protein (CRP) is a major acute-phase protein in dogs. Serum concentrations are low in healthy animals, but increase rapidly after inflammatory stimuli. The aim of the study was to investigate CRP concentrations in various respiratory diseases of dogs and to determine if CRP can be used as a biomarker in the diagnosis of bacterial respiratory diseases. A total of 106 privately owned dogs with respiratory diseases (17 with bacterial tracheobronchitis [BTB], 20 with chronic bronchitis [CB], 20 with eosinophilic bronchopneumopathy [EBP], 12 with canine idiopathic pulmonary fibrosis [CIPF], 15 with cardiogenic pulmonary edema [CPE], and 22 with bacterial pneumonia [BP]) and 72 healthy controls. The study was conducted as a prospective cross-sectional observational study. CRP was measured in serum samples. Diagnosis was confirmed by clinical and laboratory findings, diagnostic imaging, and selected diagnostic methods such as cytological and microbiological analysis of respiratory samples, echocardiography, and histopathology. Dogs with BP had significantly higher CRP concentrations (median, 121 mg/L; interquartile range, 68-178 mg/L) than dogs with BTB (23, 15-38, P = .0003), CB (13, 8-14, P < .0001), EBP (5, 5-15, P < .0001), CIPF (17, 10-20, P < .0001), or CPE (19, 13-32, P < .0001) and healthy controls (14, 8-20, P < .0001). Dogs with BTB had significantly higher CRP concentrations than dogs with CB (P = .001) or EBP (P < .0001) and healthy controls (P = .029). These results indicate that CRP has potential for use as an additional biomarker, especially in the diagnostics of BP. Copyright © 2013 by the American College of Veterinary Internal Medicine.

  1. Epicocconone, a sensitive and specific fluorescent dye for in situ quantification of extracellular proteins within bacterial biofilms.

    PubMed

    Randrianjatovo, I; Girbal-Neuhauser, E; Marcato-Romain, C-E

    2015-06-01

    Biofilms are ecosystems of closely associated bacteria encapsulated in an extracellular matrix mainly composed of polysaccharides and proteins. A novel approach was developed for in situ quantification of extracellular proteins (ePNs) in various bacterial biofilms using epicocconone, a natural, fluorescent compound that binds amine residues of proteins. Six commercial proteins were tested for their reaction with epicocconone, and bovine serum albumin (BSA) was selected for assay optimization. The optimized protocol, performed as a microassay, allowed protein amounts as low as 0.7 μg to as high as 50 μg per well to be detected. Addition of monosaccharides or polysaccharides (glucose, dextran or alginate) to the standard BSA solutions (0 to 250 μg ml(-1)) showed little or no sugar interference up to 2000 μg ml(-1), thus providing an assessment of the specificity of epicocconone for proteins. The optimized protocol was then applied to three different biofilms, and in situ quantification of ePN showed contrasted protein amounts of 22.1 ± 3.1, 38.3 ± 7.1 and 0.3 ± 0.1 μg equivalent BSA of proteins for 48-h biofilms of Pseudomonas aeruginosa, Bacillus licheniformis and Weissella confusa, respectively. Possible interference due to global matrix compounds on the in situ quantification of proteins was also investigated by applying the standard addition method (SAM). Low error percentages were obtained, indicating a correct quantification of both the ePN and the added proteins. For the first time, a specific and sensitive assay has been developed for in situ determination of ePN produced by bacterial cells. This advance should lead to an accurate, rapid tool for further protein labelling and microscopic observation of the extracellular matrix of biofilms.

  2. Network Modeling Reveals Prevalent Negative Regulatory Relationships between Signaling Sectors in Arabidopsis Immune Signaling

    PubMed Central

    Sato, Masanao; Tsuda, Kenichi; Wang, Lin; Coller, John; Watanabe, Yuichiro; Glazebrook, Jane; Katagiri, Fumiaki

    2010-01-01

    Biological signaling processes may be mediated by complex networks in which network components and network sectors interact with each other in complex ways. Studies of complex networks benefit from approaches in which the roles of individual components are considered in the context of the network. The plant immune signaling network, which controls inducible responses to pathogen attack, is such a complex network. We studied the Arabidopsis immune signaling network upon challenge with a strain of the bacterial pathogen Pseudomonas syringae expressing the effector protein AvrRpt2 (Pto DC3000 AvrRpt2). This bacterial strain feeds multiple inputs into the signaling network, allowing many parts of the network to be activated at once. mRNA profiles for 571 immune response genes of 22 Arabidopsis immunity mutants and wild type were collected 6 hours after inoculation with Pto DC3000 AvrRpt2. The mRNA profiles were analyzed as detailed descriptions of changes in the network state resulting from the genetic perturbations. Regulatory relationships among the genes corresponding to the mutations were inferred by recursively applying a non-linear dimensionality reduction procedure to the mRNA profile data. The resulting static network model accurately predicted 23 of 25 regulatory relationships reported in the literature, suggesting that predictions of novel regulatory relationships are also accurate. The network model revealed two striking features: (i) the components of the network are highly interconnected; and (ii) negative regulatory relationships are common between signaling sectors. Complex regulatory relationships, including a novel negative regulatory relationship between the early microbe-associated molecular pattern-triggered signaling sectors and the salicylic acid sector, were further validated. We propose that prevalent negative regulatory relationships among the signaling sectors make the plant immune signaling network a “sector-switching” network, which

  3. Putative bacterial volatile-mediated growth in soybean (Glycine max L. Merrill) and expression of induced proteins under salt stress.

    PubMed

    Vaishnav, A; Kumari, S; Jain, S; Varma, A; Choudhary, D K

    2015-08-01

    Plant root-associated rhizobacteria elicit plant immunity referred to as induced systemic tolerance (IST) against multiple abiotic stresses. Among multibacterial determinants involved in IST, the induction of IST and promotion of growth by putative bacterial volatile compounds (VOCs) is reported in the present study. To characterize plant proteins induced by putative bacterial VOCs, proteomic analysis was performed by MALDI-MS/MS after exposure of soybean seedlings to a new strain of plant growth promoting rhizobacteria (PGPR) Pseudomonas simiae strain AU. Furthermore, expression analysis by Western blotting confirmed that the vegetative storage protein (VSP), gamma-glutamyl hydrolase (GGH) and RuBisCo large chain proteins were significantly up-regulated by the exposure to AU strain and played a major role in IST. VSP has preponderant roles in N accumulation and mobilization, acid phosphatase activity and Na(+) homeostasis to sustain plant growth under stress condition. More interestingly, plant exposure to the bacterial strain significantly reduced Na(+) and enhanced K(+) and P content in root of soybean seedlings under salt stress. In addition, high accumulation of proline and chlorophyll content also provided evidence of protection against osmotic stress during the elicitation of IST by bacterial exposure. The present study reported for the first time that Ps. simiae produces a putative volatile blend that can enhance soybean seedling growth and elicit IST against 100 mmol l(-1) NaCl stress condition. The identification of such differentially expressed proteins provide new targets for future studies that will allow assessment of their physiological roles and significance in the response of glycophytes to stresses. Further work should uncover more about the chemical side of VOC compounds and a detailed study about their molecular mechanism responsible for plant growth. © 2015 The Society for Applied Microbiology.

  4. Increased bacterial cell density and recombinant protein yield using a commercial microbial cultivation system.

    PubMed

    Peck, Grantley R; Bowden, Timothy R; Shiell, Brian J; Michalski, Wojtek P

    2014-01-01

    EnBase (BioSilta, Finland) is a microbial cultivation system that replicates fed-batch systems through sustained release of glucose by enzymatic degradation of a polymeric substrate. Achievable bacterial cell densities and recombinant capripoxvirus protein expression levels, solubility, and antigenicity using the EnBase system were assessed. BL21-AI Escherichia coli expressing capripoxvirus proteins achieved up to eightfold higher cell densities when grown in EnBase media compared with standard media. Greater yields of capripoxvirus proteins were attained using EnBase media, either through increases in the amount of expressed protein per cell in conjunction with higher cell density or through the increase in cell density alone. Addition of EnBase booster enhanced protein yield for one of the proteins tested but reduced yield for the other. However, the amount of soluble forms of the capripoxvirus proteins tested was not different from that observed from cultures grown under standard conditions. Purified capripoxvirus proteins expressed using EnBase or standard media were assessed for their performance by enzyme-linked immunosorbent assay (ELISA) and were shown to be equally capable of specifically binding capripoxvirus antibodies.

  5. A symbiont-produced protein and bacterial symbiosis in Amoeba proteus.

    PubMed

    Pak, J W; Jeon, K W

    1997-01-01

    Gram symbiotic X-bacteria present in the xD strain of Amoeba proteus as required cell components, synthesize and export a large amount of a 29-kDa protein (S29x) into the host's cytoplasm across bacterial and symbiosome membranes. The S29x protein produced by E. coli transformed with the s29x gene is also rapidly secreted into the culture medium. Inside amoebae, S29x enters the host's nucleus as detected by confocal and immunoelectron microscopy, although it is not clear if S29x is selectively accumulated inside the nucleus. The deduced amino-acid sequence of S29x has a stretch of basic amino acids that could act as a nuclear localization signal, but there is no signal peptide at the N-terminus and the transport of S29x is energy independent. The functions of S29x are not known, but in view of its prominent presence inside the amoeba's nucleus, S29x is suspected to be involved in affecting the expression of amoeba's nuclear gene(s).

  6. Characterization of the Bacteroides fragilis bfr Gene Product Identifies a Bacterial DPS-Like Protein and Suggests Evolutionary Links in the Ferritin Superfamily

    PubMed Central

    Gauss, George H.; Reott, Michael A.; Rocha, Edson R.; Young, Mark J.; Douglas, Trevor

    2012-01-01

    A factor contributing to the pathogenicity of Bacteroides fragilis, the most common anaerobic species isolated from clinical infections, is the bacterium's extreme aerotolerance, which allows survival in oxygenated tissues prior to anaerobic abscess formation. We investigated the role of the bacterioferritin-related (bfr) gene in the B. fragilis oxidative stress response. The bfr mRNA levels are increased in stationary phase or in response to O2 or iron. In addition, bfr null mutants exhibit reduced aerotolerance, and the bfr gene product protects DNA from hydroxyl radical cleavage in vitro. Crystallographic studies revealed a protein with a dodecameric structure and greater similarity to an archaeal DNA protection in starved cells (DPS)-like protein than to the 24-subunit bacterioferritins. Similarity to the DPS-like (DPSL) protein extends to the subunit and includes a pair of conserved cysteine residues juxtaposed to a buried dimetal binding site within the four-helix bundle. Compared to archaeal DPSLs, however, this bacterial DPSL protein contains several unique features, including a significantly different conformation in the C-terminal tail that alters the number and location of pores leading to the central cavity and a conserved metal binding site on the interior surface of the dodecamer. Combined, these characteristics confirm this new class of miniferritin in the bacterial domain, delineate the similarities and differences between bacterial DPSL proteins and their archaeal homologs, allow corrected annotations for B. fragilis bfr and other dpsl genes within the bacterial domain, and suggest an evolutionary link within the ferritin superfamily that connects dodecameric DPS to the (bacterio)ferritin 24-mer. PMID:22020642

  7. Artificial acceleration of mammalian cell reprogramming by bacterial proteins.

    PubMed

    Ikeda, Takashi; Uchiyama, Ikuo; Iwasaki, Mio; Sasaki, Tetsuhiko; Nakagawa, Masato; Okita, Keisuke; Masui, Shinji

    2017-10-01

    The molecular mechanisms of cell reprogramming and differentiation involve various signaling factors. Small molecule compounds have been identified to artificially influence these factors through interacting cellular proteins. Although such small molecule compounds are useful to enhance reprogramming and differentiation and to show the mechanisms that underlie these events, the screening usually requires a large number of compounds to identify only a very small number of hits (e.g., one hit among several tens of thousands of compounds). Here, we show a proof of concept that xenospecific gene products can affect the efficiency of cell reprogramming to pluripotency. Thirty genes specific for the bacterium Wolbachia pipientis were forcibly expressed individually along with reprogramming factors (Oct4, Sox2, Klf4 and c-Myc) that can generate induced pluripotent stem cells in mammalian cells, and eight were found to affect the reprogramming efficiency either positively or negatively (hit rate 26.7%). Mechanistic analysis suggested one of these proteins interacted with cytoskeleton to promote reprogramming. Our results raise the possibility that xenospecific gene products provide an alternative way to study the regulatory mechanism of cell identity. © 2017 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  8. Artemin protects cells and proteins against oxidative and salt stress.

    PubMed

    Takalloo, Zeinab; Sajedi, Reza H; Hosseinkhani, Saman; Moazzenzade, Taghi

    2017-02-01

    Artemin is an abundant thermostable protein in Artemia encysted embryos under environmental stresses. It is confirmed that high regulatory expression of artemin is relevant to stress resistance in this crustacean. Here, the protective role of artemin from Artemia urmiana has been investigated on survival of bacterial cells under salt and oxidative shocks. Also, for continuous monitoring of the effect of artemin in prevention of proteins aggregation/inactivation, co-expression of artemin and luciferase (as an intracellular reporter) in bacterial cells was performed. According to the results, residual activity of luciferase in artemin expressing E. coli cells exposing to different concentrations of H 2 O 2 and NaCl was significantly higher than non-expressing cells. The luciferase activity was rapidly lost in control cells under salt treatments while in co-transformed cells, the activity was considerably retained at higher salt concentrations. Also, analysis from cell viability assays showed that artemin-expressing cells exhibited more resistance to both stress conditions. In the present study, we document for the first time that artemin can protect proteins and bacterial cells against oxidative and salt stress conditions. These results can declare the resistance property of this crustacean against harsh environmental conditions. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. S-layer proteins from Lactobacillus sp. inhibit bacterial infection by blockage of DC-SIGN cell receptor.

    PubMed

    Prado Acosta, Mariano; Ruzal, Sandra M; Cordo, Sandra M

    2016-11-01

    Many species of Lactobacillus sp. possess Surface(s) layer proteins in their envelope. Among other important characteristics S-layer from Lactobacillus acidophilus binds to the cellular receptor DC-SIGN (Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin; CD209), which is involved in adhesion and infection of several families of bacteria. In this report we investigate the activity of new S-layer proteins from the Lactobacillus family (Lactobacillus acidophilus, Lactobacillus brevis, Lactobacillus helveticus and Lactobacillus kefiri) over the infection of representative microorganisms important to human health. After the treatment of DC-SIGN expressing cells with these proteins, we were able to diminish bacterial infection by up to 79% in both gram negative and mycobacterial models. We discovered that pre-treatment of the bacteria with S-layers from Lactobacillus acidophilus and Lactobacillus brevis reduced bacteria viability but also prevent infection by the pathogenic bacteria. We also proved the importance of the glycosylation of the S-layer from Lactobacillus kefiri in the binding to the receptor and thus inhibition of infection. This novel characteristic of the S-layers proteins may contribute to the already reported pathogen exclusion activity for these Lactobacillus probiotic strains; and might be also considered as a novel enzymatic antimicrobial agents to inhibit bacterial infection and entry to host cells. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Serum protein electrophoresis: an interesting diagnosis tool to distinguish viral from bacterial community-acquired pneumonia.

    PubMed

    Davido, B; Badr, C; Lagrange, A; Makhloufi, S; De Truchis, P; Perronne, C; Salomon, J; Dinh, A

    2016-06-01

    29-69 % of pneumonias are microbiologically documented because it can be considered as an invasive procedure with variable test sensitivity. However, it drastically impacts therapeutic strategy in particular the use of antibiotics. Serum protein electrophoresis (SPEP) is a routine and non-invasive test commonly used to identify serum protein disorders. As virus and bacteria may induce different globulins production, we hypothesize that SPEP can be used as an etiological diagnosis test. Retrospective study conducted from 1/1/13 until 5/1/15 among patient hospitalized for an acute community-acquired pneumonia based on fever, crackles and radiological abnormalities. α/β, α/γ, β/γ globulins and albumin/globulin (A/G) ratio were calculated from SPEP. Data were analyzed in 3 groups: documented viral (DVP) or bacterial pneumonia (DBP) and supposedly bacterial pneumonia (SBP). We used ANOVA statistic test with multiple comparisons using CI95 and ROC curve to compare them. 109 patients included divided into DBP (n = 16), DVP (n = 26) and SBP (n = 67). Mean age was 62 ± 18 year-old with a sex ratio M/F of 1.3. Underlying conditions (e.g. COPD, diabetes) were comparable between groups in multivariate analysis. Means of A/G ratio were 0.80 [0.76-0.84], 0.96 [0.91-1.01], 1.08 [0.99-1.16] respectively for DBP, SBP and DVP (p = 0.0002). A/G ratio cut-off value of 0.845 has a sensitivity of 87.5 % and a specificity of 73.1 %. A/G ratio seems to be an easy diagnostic tool to differentiate bacterial from viral pneumonia. A/G ratio cut-off value below 0.845 seems to be predictable of a bacterial origin and support the use of antibiotics.

  11. Subcutaneous immunization with inactivated bacterial components and purified protein of Escherichia coli, Fusobacterium necrophorum and Trueperella pyogenes prevents puerperal metritis in Holstein dairy cows.

    PubMed

    Machado, Vinícius Silva; Bicalho, Marcela Luccas de Souza; Meira Junior, Enoch Brandão de Souza; Rossi, Rodolfo; Ribeiro, Bruno Leonardo; Lima, Svetlana; Santos, Thiago; Kussler, Arieli; Foditsch, Carla; Ganda, Erika Korzune; Oikonomou, Georgios; Cheong, Soon Hon; Gilbert, Robert Owen; Bicalho, Rodrigo Carvalho

    2014-01-01

    In this study we evaluate the efficacy of five vaccine formulations containing different combinations of proteins (FimH; leukotoxin, LKT; and pyolysin, PLO) and/or inactivated whole cells (Escherichia coli, Fusobacterium necrophorum, and Trueperella pyogenes) in preventing postpartum uterine diseases. Inactivated whole cells were produced using two genetically distinct strains of each bacterial species (E. coli, F. necrophorum, and T. pyogenes). FimH and PLO subunits were produced using recombinant protein expression, and LKT was recovered from culturing a wild F. necrophorum strain. Three subcutaneous vaccines were formulated: Vaccine 1 was composed of inactivated bacterial whole cells and proteins; Vaccine 2 was composed of proteins only; and Vaccine 3 was composed of inactivated bacterial whole cells only. Two intravaginal vaccines were formulated: Vaccine 4 was composed of inactivated bacterial whole cells and proteins; and Vaccine 5 was composed of PLO and LKT. To evaluate vaccine efficacy, a randomized clinical trial was conducted at a commercial dairy farm; 371 spring heifers were allocated randomly into one of six different treatments groups: control, Vaccine 1, Vaccine 2, Vaccine 3, Vaccine 4 and Vaccine 5. Late pregnant heifers assigned to one of the vaccine groups were each vaccinated twice: at 230 and 260 days of pregnancy. When vaccines were evaluated grouped as subcutaneous and intravaginal, the subcutaneous ones were found to significantly reduce the incidence of puerperal metritis. Additionally, subcutaneous vaccination significantly reduced rectal temperature at 6±1 days in milk. Reproduction was improved for cows that received subcutaneous vaccines. In general, vaccination induced a significant increase in serum IgG titers against all antigens, with subcutaneous vaccination again being more effective. In conclusion, subcutaneous vaccination with inactivated bacterial components and/or protein subunits of E. coli, F. necrophorum and T. pyogenes

  12. Structure of the complex between teicoplanin and a bacterial cell-wall peptide: use of a carrier-protein approach

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Economou, Nicoleta J.; Zentner, Isaac J.; Lazo, Edwin

    2013-04-01

    Using a carrier-protein strategy, the structure of teicoplanin bound to its bacterial cell-wall target has been determined. The structure reveals the molecular determinants of target recognition, flexibility in the antibiotic backbone and intrinsic radiation sensitivity of teicoplanin. Multidrug-resistant bacterial infections are commonly treated with glycopeptide antibiotics such as teicoplanin. This drug inhibits bacterial cell-wall biosynthesis by binding and sequestering a cell-wall precursor: a d-alanine-containing peptide. A carrier-protein strategy was used to crystallize the complex of teicoplanin and its target peptide by fusing the cell-wall peptide to either MBP or ubiquitin via native chemical ligation and subsequently crystallizing the protein–peptide–antibiotic complex.more » The 2.05 Å resolution MBP–peptide–teicoplanin structure shows that teicoplanin recognizes its ligand through a combination of five hydrogen bonds and multiple van der Waals interactions. Comparison of this teicoplanin structure with that of unliganded teicoplanin reveals a flexibility in the antibiotic peptide backbone that has significant implications for ligand recognition. Diffraction experiments revealed an X-ray-induced dechlorination of the sixth amino acid of the antibiotic; it is shown that teicoplanin is significantly more radiation-sensitive than other similar antibiotics and that ligand binding increases radiosensitivity. Insights derived from this new teicoplanin structure may contribute to the development of next-generation antibacterials designed to overcome bacterial resistance.« less

  13. Engineering A-kinase Anchoring Protein (AKAP)-selective Regulatory Subunits of Protein Kinase A (PKA) through Structure-based Phage Selection*

    PubMed Central

    Gold, Matthew G.; Fowler, Douglas M.; Means, Christopher K.; Pawson, Catherine T.; Stephany, Jason J.; Langeberg, Lorene K.; Fields, Stanley; Scott, John D.

    2013-01-01

    PKA is retained within distinct subcellular environments by the association of its regulatory type II (RII) subunits with A-kinase anchoring proteins (AKAPs). Conventional reagents that universally disrupt PKA anchoring are patterned after a conserved AKAP motif. We introduce a phage selection procedure that exploits high-resolution structural information to engineer RII mutants that are selective for a particular AKAP. Selective RII (RSelect) sequences were obtained for eight AKAPs following competitive selection screening. Biochemical and cell-based experiments validated the efficacy of RSelect proteins for AKAP2 and AKAP18. These engineered proteins represent a new class of reagents that can be used to dissect the contributions of different AKAP-targeted pools of PKA. Molecular modeling and high-throughput sequencing analyses revealed the molecular basis of AKAP-selective interactions and shed new light on native RII-AKAP interactions. We propose that this structure-directed evolution strategy might be generally applicable for the investigation of other protein interaction surfaces. PMID:23625929

  14. Subcellular localization for Gram positive and Gram negative bacterial proteins using linear interpolation smoothing model.

    PubMed

    Saini, Harsh; Raicar, Gaurav; Dehzangi, Abdollah; Lal, Sunil; Sharma, Alok

    2015-12-07

    Protein subcellular localization is an important topic in proteomics since it is related to a protein׳s overall function, helps in the understanding of metabolic pathways, and in drug design and discovery. In this paper, a basic approximation technique from natural language processing called the linear interpolation smoothing model is applied for predicting protein subcellular localizations. The proposed approach extracts features from syntactical information in protein sequences to build probabilistic profiles using dependency models, which are used in linear interpolation to determine how likely is a sequence to belong to a particular subcellular location. This technique builds a statistical model based on maximum likelihood. It is able to deal effectively with high dimensionality that hinders other traditional classifiers such as Support Vector Machines or k-Nearest Neighbours without sacrificing performance. This approach has been evaluated by predicting subcellular localizations of Gram positive and Gram negative bacterial proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Transmigration of polymorphnuclear neutrophils and monocytes through the human blood-cerebrospinal fluid barrier after bacterial infection in vitro.

    PubMed

    Steinmann, Ulrike; Borkowski, Julia; Wolburg, Hartwig; Schröppel, Birgit; Findeisen, Peter; Weiss, Christel; Ishikawa, Hiroshi; Schwerk, Christian; Schroten, Horst; Tenenbaum, Tobias

    2013-02-28

    Bacterial invasion through the blood-cerebrospinal fluid barrier (BCSFB) during bacterial meningitis causes secretion of proinflammatory cytokines/chemokines followed by the recruitment of leukocytes into the CNS. In this study, we analyzed the cellular and molecular mechanisms of polymorphonuclear neutrophil (PMN) and monocyte transepithelial transmigration (TM) across the BCSFB after bacterial infection. Using an inverted transwell filter system of human choroid plexus papilloma cells (HIBCPP), we studied leukocyte TM rates, the migration route by immunofluorescence, transmission electron microscopy and focused ion beam/scanning electron microscopy, the secretion of cytokines/chemokines by cytokine bead array and posttranslational modification of the signal regulatory protein (SIRP) α via western blot. PMNs showed a significantly increased TM across HIBCPP after infection with wild-type Neisseria meningitidis (MC58). In contrast, a significantly decreased monocyte transmigration rate after bacterial infection of HIBCPP could be observed. Interestingly, in co-culture experiments with PMNs and monocytes, TM of monocytes was significantly enhanced. Analysis of paracellular permeability and transepithelial electrical resistance confirmed an intact barrier function during leukocyte TM. With the help of the different imaging techniques we could provide evidence for para- as well as for transcellular migrating leukocytes. Further analysis of secreted cytokines/chemokines showed a distinct pattern after stimulation and transmigration of PMNs and monocytes. Moreover, the transmembrane glycoprotein SIRPα was deglycosylated in monocytes, but not in PMNs, after bacterial infection. Our findings demonstrate that PMNs and monoctyes differentially migrate in a human BCSFB model after bacterial infection. Cytokines and chemokines as well as transmembrane proteins such as SIRPα may be involved in this process.

  16. Protein prenylation: a new mode of host-pathogen interaction.

    PubMed

    Amaya, Moushimi; Baranova, Ancha; van Hoek, Monique L

    2011-12-09

    Post translational modifications are required for proteins to be fully functional. The three step process, prenylation, leads to farnesylation or geranylgeranylation, which increase the hydrophobicity of the prenylated protein for efficient anchoring into plasma membranes and/or organellar membranes. Prenylated proteins function in a number of signaling and regulatory pathways that are responsible for basic cell operations. Well characterized prenylated proteins include Ras, Rac and Rho. Recently, pathogenic prokaryotic proteins, such as SifA and AnkB, have been shown to be prenylated by eukaryotic host cell machinery, but their functions remain elusive. The identification of other bacterial proteins undergoing this type of host-directed post-translational modification shows promise in elucidating host-pathogen interactions to develop new therapeutics. This review incorporates new advances in the study of protein prenylation into a broader aspect of biology with a focus on host-pathogen interaction. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. The structure of the regulatory domain of the adenylyl cyclase Rv1264 from Mycobacterium tuberculosis with bound oleic acid.

    PubMed

    Findeisen, Felix; Linder, Jürgen U; Schultz, Anita; Schultz, Joachim E; Brügger, Britta; Wieland, Felix; Sinning, Irmgard; Tews, Ivo

    2007-06-22

    The universal secondary messenger cAMP is produced by adenylyl cyclases (ACs). Most bacterial and all eukaryotic ACs belong to class III of six divergent classes. A class III characteristic is formation of the catalytic pocket at a dimer interface and the presence of additional regulatory domains. Mycobacterium tuberculosis possesses 15 class III ACs, including Rv1264, which is activated at acidic pH due to pH-dependent structural transitions of the Rv1264 dimer. It has been shown by X-ray crystallography that the N-terminal regulatory and C-terminal catalytic domains of Rv1264 interact in completely different ways in the active and inhibited states. Here, we report an in-depth structural and functional analysis of the regulatory domain of Rv1264. The 1.6 A resolution crystal structure shows the protein in a tight, disk-shaped dimer, formed around a helical bundle, and involving a protein chain crossover. To understand pH regulation, we determined structures at acidic and basic pH values and employed structure-based mutagenesis in the holoenzyme to elucidate regulation using an AC activity assay. It has been shown that regulatory and catalytic domains must be linked in a single protein chain. The new studies demonstrate that the length of the linker segment is decisive for regulation. Several amino acids on the surface of the regulatory domain, when exchanged, altered the pH-dependence of AC activity. However, these residues are not conserved amongst a number of related ACs. The closely related mycobacterial Rv2212, but not Rv1264, is strongly activated by the addition of fatty acids. The structure resolved the presence of a deeply embedded fatty acid, characterised as oleic acid by mass spectrometry, which may serve as a hinge. From these data, we conclude that the regulatory domain is a structural scaffold used for distinct regulatory purposes.

  18. Extracytoplasmic function σ factors of the widely distributed group ECF41 contain a fused regulatory domain

    PubMed Central

    Wecke, Tina; Halang, Petra; Staroń, Anna; Dufour, Yann S; Donohue, Timothy J; Mascher, Thorsten

    2012-01-01

    Bacteria need signal transducing systems to respond to environmental changes. Next to one- and two-component systems, alternative σ factors of the extra-cytoplasmic function (ECF) protein family represent the third fundamental mechanism of bacterial signal transduction. A comprehensive classification of these proteins identified more than 40 phylogenetically distinct groups, most of which are not experimentally investigated. Here, we present the characterization of such a group with unique features, termed ECF41. Among analyzed bacterial genomes, ECF41 σ factors are widely distributed with about 400 proteins from 10 different phyla. They lack obvious anti-σ factors that typically control activity of other ECF σ factors, but their structural genes are often predicted to be cotranscribed with carboxymuconolactone decarboxylases, oxidoreductases, or epimerases based on genomic context conservation. We demonstrate for Bacillus licheniformis and Rhodobacter sphaeroides that the corresponding genes are preceded by a highly conserved promoter motif and are the only detectable targets of ECF41-dependent gene regulation. In contrast to other ECF σ factors, proteins of group ECF41 contain a large C-terminal extension, which is crucial for σ factor activity. Our data demonstrate that ECF41 σ factors are regulated by a novel mechanism based on the presence of a fused regulatory domain. PMID:22950025

  19. Bacterial Cell Mechanics.

    PubMed

    Auer, George K; Weibel, Douglas B

    2017-07-25

    Cellular mechanical properties play an integral role in bacterial survival and adaptation. Historically, the bacterial cell wall and, in particular, the layer of polymeric material called the peptidoglycan were the elements to which cell mechanics could be primarily attributed. Disrupting the biochemical machinery that assembles the peptidoglycan (e.g., using the β-lactam family of antibiotics) alters the structure of this material, leads to mechanical defects, and results in cell lysis. Decades after the discovery of peptidoglycan-synthesizing enzymes, the mechanisms that underlie their positioning and regulation are still not entirely understood. In addition, recent evidence suggests a diverse group of other biochemical elements influence bacterial cell mechanics, may be regulated by new cellular mechanisms, and may be triggered in different environmental contexts to enable cell adaptation and survival. This review summarizes the contributions that different biomolecular components of the cell wall (e.g., lipopolysaccharides, wall and lipoteichoic acids, lipid bilayers, peptidoglycan, and proteins) make to Gram-negative and Gram-positive bacterial cell mechanics. We discuss the contribution of individual proteins and macromolecular complexes in cell mechanics and the tools that make it possible to quantitatively decipher the biochemical machinery that contributes to bacterial cell mechanics. Advances in this area may provide insight into new biology and influence the development of antibacterial chemotherapies.

  20. Concepts and tools to exploit the potential of bacterial inclusion bodies in protein science and biotechnology.

    PubMed

    Gatti-Lafranconi, Pietro; Natalello, Antonino; Ami, Diletta; Doglia, Silvia Maria; Lotti, Marina

    2011-07-01

    Cells have evolved complex and overlapping mechanisms to protect their proteins from aggregation. However, several reasons can cause the failure of such defences, among them mutations, stress conditions and high rates of protein synthesis, all common consequences of heterologous protein production. As a result, in the bacterial cytoplasm several recombinant proteins aggregate as insoluble inclusion bodies. The recent discovery that aggregated proteins can retain native-like conformation and biological activity has opened the way for a dramatic change in the means by which intracellular aggregation is approached and exploited. This paper summarizes recent studies towards the direct use of inclusion bodies in biotechnology and for the detection of bottlenecks in the folding pathways of specific proteins. We also review the major biophysical methods available for revealing fine structural details of aggregated proteins and which information can be obtained through these techniques. © 2011 The Authors Journal compilation © 2011 FEBS.

  1. The WD40 Protein BamB Mediates Coupling of BAM Complexes into Assembly Precincts in the Bacterial Outer Membrane.

    PubMed

    Gunasinghe, Sachith D; Shiota, Takuya; Stubenrauch, Christopher J; Schulze, Keith E; Webb, Chaille T; Fulcher, Alex J; Dunstan, Rhys A; Hay, Iain D; Naderer, Thomas; Whelan, Donna R; Bell, Toby D M; Elgass, Kirstin D; Strugnell, Richard A; Lithgow, Trevor

    2018-05-29

    The β-barrel assembly machinery (BAM) complex is essential for localization of surface proteins on bacterial cells, but the mechanism by which it functions is unclear. We developed a direct stochastic optical reconstruction microscopy (dSTORM) methodology to view the BAM complex in situ. Single-cell analysis showed that discrete membrane precincts housing several BAM complexes are distributed across the E. coli surface, with a nearest neighbor distance of ∼200 nm. The auxiliary lipoprotein subunit BamB was crucial for this spatial distribution, and in situ crosslinking shows that BamB makes intimate contacts with BamA and BamB in neighboring BAM complexes within the precinct. The BAM complex precincts swell when outer membrane protein synthesis is maximal, visual proof that the precincts are active in protein assembly. This nanoscale interrogation of the BAM complex in situ suggests a model whereby bacterial outer membranes contain highly organized assembly precincts to drive integral protein assembly. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  2. Chirality Switching by Martensitic Transformation in Protein Cylindrical Crystals: Application to Bacterial Flagella

    NASA Astrophysics Data System (ADS)

    Komai, Ricardo Kiyohiro

    Martensitic transformations provide unique engineering properties that, when designed properly, become important parts of new technology. Martensitic transformations have been studied for many years in traditional alloys (iron, steel, titanium, etc.), however there is still much to be learned in regards to these transformations in biological materials. Olson and Hartman showed in 1982 that these transformations are also observed in bacterial flagella and T4 bacteriophage viral sheaths, allowing for propulsion of bacteria in a fluid environment and, for the virus, is responsible for the infection mechanism. This work demonstrates, using the bacterial flagella as an example, that these transformations can be modelled using thermodynamic methods that are also used to model the transformations in alloys. This thesis work attempts to explain the transformations that occur in bacterial flagella, which are capable of small strain, highly reversible martensitic transformations. The first stress/temperature phase diagrams of these flagella were created by adding the mechanical energy of the transformation of the flagella to limited chemical thermodynamics information of the transformation. Mechanical energy is critical to the transformation process because the bacterial body applies a torque to the radius of the flagella. Finally, work has begun and will be completed in regards to understanding the kinetics of the transformation of the flagella. The motion of the transformation interface can be predicted by using a Landau-Ginzburg model. The crystallography of the transformation in bacterial flagella is also being computed to determine the invariant lines of transformation that occur within this cylindrical crystal. This work has shown that it is possible to treat proteins in a similar manner that alloys are treated when using thermodynamic modelling. Much can be learned from translating what is known regarding phase transformations in hard material systems to soft, organic

  3. Interplay between intrinsic noise and the stochasticity of the cell cycle in bacterial colonies.

    PubMed

    Canela-Xandri, Oriol; Sagués, Francesc; Buceta, Javier

    2010-06-02

    Herein we report on the effects that different stochastic contributions induce in bacterial colonies in terms of protein concentration and production. In particular, we consider for what we believe to be the first time cell-to-cell diversity due to the unavoidable randomness of the cell-cycle duration and its interplay with other noise sources. To that end, we model a recent experimental setup that implements a protein dilution protocol by means of division events to characterize the gene regulatory function at the single cell level. This approach allows us to investigate the effect of different stochastic terms upon the total randomness experimentally reported for the gene regulatory function. In addition, we show that the interplay between intrinsic fluctuations and the stochasticity of the cell-cycle duration leads to different constructive roles. On the one hand, we show that there is an optimal value of protein concentration (alternatively an optimal value of the cell cycle phase) such that the noise in protein concentration attains a minimum. On the other hand, we reveal that there is an optimal value of the stochasticity of the cell cycle duration such that the coherence of the protein production with respect to the colony average production is maximized. The latter can be considered as a novel example of the recently reported phenomenon of diversity induced resonance. Copyright (c) 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  4. Evolution of context dependent regulation by expansion of feast/famine regulatory proteins.

    PubMed

    Plaisier, Christopher L; Lo, Fang-Yin; Ashworth, Justin; Brooks, Aaron N; Beer, Karlyn D; Kaur, Amardeep; Pan, Min; Reiss, David J; Facciotti, Marc T; Baliga, Nitin S

    2014-11-14

    Expansion of transcription factors is believed to have played a crucial role in evolution of all organisms by enabling them to deal with dynamic environments and colonize new environments. We investigated how the expansion of the Feast/Famine Regulatory Protein (FFRP) or Lrp-like proteins into an eight-member family in Halobacterium salinarum NRC-1 has aided in niche-adaptation of this archaeon to a complex and dynamically changing hypersaline environment. We mapped genome-wide binding locations for all eight FFRPs, investigated their preference for binding different effector molecules, and identified the contexts in which they act by analyzing transcriptional responses across 35 growth conditions that mimic different environmental and nutritional conditions this organism is likely to encounter in the wild. Integrative analysis of these data constructed an FFRP regulatory network with conditionally active states that reveal how interrelated variations in DNA-binding domains, effector-molecule preferences, and binding sites in target gene promoters have tuned the functions of each FFRP to the environments in which they act. We demonstrate how conditional regulation of similar genes by two FFRPs, AsnC (an activator) and VNG1237C (a repressor), have striking environment-specific fitness consequences for oxidative stress management and growth, respectively. This study provides a systems perspective into the evolutionary process by which gene duplication within a transcription factor family contributes to environment-specific adaptation of an organism.

  5. Optimal regulatory strategies for metabolic pathways in Escherichia coli depending on protein costs

    PubMed Central

    Wessely, Frank; Bartl, Martin; Guthke, Reinhard; Li, Pu; Schuster, Stefan; Kaleta, Christoph

    2011-01-01

    While previous studies have shed light on the link between the structure of metabolism and its transcriptional regulation, the extent to which transcriptional regulation controls metabolism has not yet been fully explored. In this work, we address this problem by integrating a large number of experimental data sets with a model of the metabolism of Escherichia coli. Using a combination of computational tools including the concept of elementary flux patterns, methods from network inference and dynamic optimization, we find that transcriptional regulation of pathways reflects the protein investment into these pathways. While pathways that are associated to a high protein cost are controlled by fine-tuned transcriptional programs, pathways that only require a small protein cost are transcriptionally controlled in a few key reactions. As a reason for the occurrence of these different regulatory strategies, we identify an evolutionary trade-off between the conflicting requirements to reduce protein investment and the requirement to be able to respond rapidly to changes in environmental conditions. PMID:21772263

  6. A simple model for DNA bridging proteins and bacterial or human genomes: bridging-induced attraction and genome compaction

    NASA Astrophysics Data System (ADS)

    Johnson, J.; Brackley, C. A.; Cook, P. R.; Marenduzzo, D.

    2015-02-01

    We present computer simulations of the phase behaviour of an ensemble of proteins interacting with a polymer, mimicking non-specific binding to a piece of bacterial DNA or eukaryotic chromatin. The proteins can simultaneously bind to the polymer in two or more places to create protein bridges. Despite the lack of any explicit interaction between the proteins or between DNA segments, our simulations confirm previous results showing that when the protein-polymer interaction is sufficiently strong, the proteins come together to form clusters. Furthermore, a sufficiently large concentration of bridging proteins leads to the compaction of the swollen polymer into a globular phase. Here we characterise both the formation of protein clusters and the polymer collapse as a function of protein concentration, protein-polymer affinity and fibre flexibility.

  7. Assembling the bacterial segrosome.

    PubMed

    Hayes, Finbarr; Barillà, Daniela

    2006-05-01

    Genome segregation in prokaryotes is a highly ordered process that integrates with DNA replication, cytokinesis and other fundamental facets of the bacterial cell cycle. The segrosome is the nucleoprotein complex that mediates DNA segregation in bacteria, its assembly and organization is best understood for plasmid partition. The recent elucidation of structures of the ParB plasmid segregation protein bound to centromeric DNA, and of the tertiary structures of other segregation proteins, are key milestones in the path to deciphering the molecular basis of bacterial DNA segregation.

  8. Isolation of cell-free bacterial inclusion bodies.

    PubMed

    Rodríguez-Carmona, Escarlata; Cano-Garrido, Olivia; Seras-Franzoso, Joaquin; Villaverde, Antonio; García-Fruitós, Elena

    2010-09-17

    Bacterial inclusion bodies are submicron protein clusters usually found in recombinant bacteria that have been traditionally considered as undesirable products from protein production processes. However, being fully biocompatible, they have been recently characterized as nanoparticulate inert materials useful as scaffolds for tissue engineering, with potentially wider applicability in biomedicine and material sciences. Current protocols for inclusion body isolation from Escherichia coli usually offer between 95 to 99% of protein recovery, what in practical terms, might imply extensive bacterial cell contamination, not compatible with the use of inclusion bodies in biological interfaces. Using an appropriate combination of chemical and mechanical cell disruption methods we have established a convenient procedure for the recovery of bacterial inclusion bodies with undetectable levels of viable cell contamination, below 10⁻¹ cfu/ml, keeping the particulate organization of these aggregates regarding size and protein folding features. The application of the developed protocol allows obtaining bacterial free inclusion bodies suitable for use in mammalian cell cultures and other biological interfaces.

  9. Functional analysis of two sterol regulatory element binding proteins in Penicillium digitatum

    PubMed Central

    Ruan, Ruoxin; Wang, Mingshuang; Liu, Xin; Sun, Xuepeng; Chung, Kuang-Ren

    2017-01-01

    The sterol regulatory element binding proteins (SREBPs) are key regulators for sterol homeostasis in most fungi. In the citrus postharvest pathogen Penicillium digitatum, the SREBP homolog is required for fungicide resistance and regulation of CYP51 expression. In this study, we identified another SREBP transcription factor PdSreB in P. digitatum, and the biological functions of both SREBPs were characterized and compared. Inactivation of PdsreA, PdsreB or both genes in P. digitatum reduced ergosterol contents and increased sensitivities to sterol 14-α-demethylation inhibitors (DMIs) and cobalt chloride. Fungal strains impaired at PdsreA but not PdsreB increased sensitivity to tridemorph and an iron chelator 2,2’-dipyridyl. Virulence assays on citrus fruit revealed that fungal strains impaired at PdsreA, PdsreB or both induce maceration lesions similar to those induced by wild-type. However, ΔPdsreA, ΔPdsreB or the double mutant strain rarely produce aerial mycelia on infected citrus fruit peels. RNA-Seq analysis showed the broad regulatory functions of both SREBPs in biosynthesis, transmembrane transportation and stress responses. Our results provide new insights into the conserved and differentiated regulatory functions of SREBP homologs in plant pathogenic fungi. PMID:28467453

  10. Automated Structure- and Sequence-Based Design of Proteins for High Bacterial Expression and Stability.

    PubMed

    Goldenzweig, Adi; Goldsmith, Moshe; Hill, Shannon E; Gertman, Or; Laurino, Paola; Ashani, Yacov; Dym, Orly; Unger, Tamar; Albeck, Shira; Prilusky, Jaime; Lieberman, Raquel L; Aharoni, Amir; Silman, Israel; Sussman, Joel L; Tawfik, Dan S; Fleishman, Sarel J

    2016-07-21

    Upon heterologous overexpression, many proteins misfold or aggregate, thus resulting in low functional yields. Human acetylcholinesterase (hAChE), an enzyme mediating synaptic transmission, is a typical case of a human protein that necessitates mammalian systems to obtain functional expression. We developed a computational strategy and designed an AChE variant bearing 51 mutations that improved core packing, surface polarity, and backbone rigidity. This variant expressed at ∼2,000-fold higher levels in E. coli compared to wild-type hAChE and exhibited 20°C higher thermostability with no change in enzymatic properties or in the active-site configuration as determined by crystallography. To demonstrate broad utility, we similarly designed four other human and bacterial proteins. Testing at most three designs per protein, we obtained enhanced stability and/or higher yields of soluble and active protein in E. coli. Our algorithm requires only a 3D structure and several dozen sequences of naturally occurring homologs, and is available at http://pross.weizmann.ac.il. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  11. Iron misregulation and neurodegenerative disease in mouse models that lack iron regulatory proteins

    PubMed Central

    Ghosh, Manik C.; Zhang, De-Liang; Rouault, Tracey A.

    2015-01-01

    Iron regulatory proteins 1 and 2 (IRP1 and IRP2) are two cytosolic proteins that maintain cellular iron homeostasis by binding to RNA stem loops known as iron responsive elements (IREs) that are found in the untranslated regions of target mRNAs that encode proteins involved in iron metabolism. IRPs modify expression of iron metabolism genes, and global and tissue-specific knockout mice have been made to evaluate the physiological significance of these iron regulatory proteins (Irps). Here, we will discuss the results of the studies that have been performed with mice engineered to lack expression of one or both Irps, and made in different strains using different methodologies. Both Irp1 and Irp2 knockout mice are viable, but the double knockout (Irp1−/−Irp2−/−) mice die before birth, indicating that these Irps play a crucial role in maintaining iron homeostasis. Irp1−/− mice develop polycythemia and pulmonary hypertension, and when these mice are challenged with a low iron diet, they die early of abdominal hemorrhages, suggesting that Irp1 plays an essential role in erythropoiesis and in the pulmonary and cardiovascular systems. Irp2−/− mice develop microcytic anemia, erythropoietic protoporphyria and a progressive neurological disorder, indicating that Irp2 has important functions in the nervous system and erythropoietic homeostasis. Several excellent review articles have recently been published on Irp knockout mice that mainly focus on Irp1−/− mice (referenced in the introduction). In this review, we will briefly describe the phenotypes and physiological implications of Irp1−/− mice, and will discuss the phenotypes observed for Irp2−/− mice in detail with a particular emphasis on the neurological problems of these mice. PMID:25771171

  12. Structure and function of Helicobacter pylori CagA, the first-identified bacterial protein involved in human cancer

    PubMed Central

    HATAKEYAMA, Masanori

    2017-01-01

    Chronic infection with Helicobacter pylori cagA-positive strains is the strongest risk factor of gastric cancer. The cagA gene-encoded CagA protein is delivered into gastric epithelial cells via bacterial type IV secretion, where it undergoes tyrosine phosphorylation at the Glu-Pro-Ile-Tyr-Ala (EPIYA) motifs. Delivered CagA then acts as a non-physiological scaffold/hub protein by interacting with multiple host signaling molecules, most notably the pro-oncogenic phosphatase SHP2 and the polarity-regulating kinase PAR1/MARK, in both tyrosine phosphorylation-dependent and -independent manners. CagA-mediated manipulation of intracellular signaling promotes neoplastic transformation of gastric epithelial cells. Transgenic expression of CagA in experimental animals has confirmed the oncogenic potential of the bacterial protein. Structural polymorphism of CagA influences its scaffold function, which may underlie the geographic difference in the incidence of gastric cancer. Since CagA is no longer required for the maintenance of established gastric cancer cells, studying the role of CagA during neoplastic transformation will provide an excellent opportunity to understand molecular processes underlying “Hit-and-Run” carcinogenesis. PMID:28413197

  13. Regulatory RNA binding proteins contribute to the transcriptome-wide splicing alterations in human cellular senescence.

    PubMed

    Dong, Qiongye; Wei, Lei; Zhang, Michael Q; Wang, Xiaowo

    2018-06-24

    Dysregulation of mRNA splicing has been observed in certain cellular senescence process. However, the common splicing alterations on the whole transcriptome shared by various types of senescence are poorly understood. In order to systematically identify senescence-associated transcriptomic changes in genome-wide scale, we collected RNA sequencing datasets of different human cell types with a variety of senescence-inducing methods from public databases and performed meta-analysis. First, we discovered that a group of RNA binding proteins were consistently down-regulated in diverse senescent samples and identified 406 senescence-associated common differential splicing events. Then, eight differentially expressed RNA binding proteins were predicted to regulate these senescence-associated splicing alterations through an enrichment analysis of their RNA binding information, including motif scanning and enhanced cross-linking immunoprecipitation data. In addition, we constructed the splicing regulatory modules that might contribute to senescence-associated biological processes. Finally, it was confirmed that knockdown of the predicted senescence-associated potential splicing regulators through shRNAs in HepG2 cell line could result in senescence-like splicing changes. Taken together, our work demonstrated a broad range of common changes in mRNA splicing switches and detected their central regulatory RNA binding proteins during senescence. These findings would help to better understand the coordinating splicing alterations in cellular senescence.

  14. Effects of a salivary stimulant, slaframine, on ruminal fermentation, bacterial protein synthesis and digestion in frequently fed steers.

    PubMed

    Froetschel, M A; Amos, H E; Evans, J J; Croom, W J; Hagler, W M

    1989-03-01

    Slaframine (SF), a parasympathomimetic salivary stimulant, was administered i.m. (10, 15 or 20 micrograms SF/kg BW) to ruminally and abomasally fistulated steers at 12-h intervals for 18-d periods in a latin square-designed experiment. Steers were fed semicontinuously (12 times daily) a 40:60 roughage:concentrate diet at twice their net energy requirement for maintenance. Ruminal digestion coefficients for DM, ADF and starch were 10 to 16% lower and linearly related in an inverse manner to the level of SF administered (P less than .05). Postruminal digestion of DM, ADF and starch increased as much as 46.7, 9.5 and 44.0%, respectively, in a fashion linearly related (P less than .05) to the level of SF administered. Total tract digestion of DM and ADF were not affected by SF; however, total tract starch digestion was increased as much as 5% and was related linearly (P less than .05) to SF treatment. With SF administration, as much as 13% more bacterial protein exited the rumen, resulting in a 16.5% linear improvement (P less than .1) in the efficiency of ruminal bacterial protein production per 100 g of OM fermented. Ruminal concentrations of VFA, ammonia and pH were not affected by SF. These results demonstrate a positive relationship between salivation and ruminal bacterial protein synthesis and suggest that feed utilization by ruminants may be improved by pharmacological stimulation of salivary secretions.

  15. The Yeast Saccharomyces cerevisiae: a versatile model system for the identification and characterization of bacterial virulence proteins.

    PubMed

    Siggers, Keri A; Lesser, Cammie F

    2008-07-17

    Microbial pathogens utilize complex secretion systems to deliver proteins into host cells. These effector proteins target and usurp host cell processes to promote infection and cause disease. While secretion systems are conserved, each pathogen delivers its own unique set of effectors. The identification and characterization of these effector proteins has been difficult, often limited by the lack of detectable signal sequences and functional redundancy. Model systems including yeast, worms, flies, and fish are being used to circumvent these issues. This technical review details the versatility and utility of yeast Saccharomyces cerevisiae as a system to identify and characterize bacterial effectors.

  16. Phylogenetic and Protein Sequence Analysis of Bacterial Chemoreceptors.

    PubMed

    Ortega, Davi R; Zhulin, Igor B

    2018-01-01

    Identifying chemoreceptors in sequenced bacterial genomes, revealing their domain architecture, inferring their evolutionary relationships, and comparing them to chemoreceptors of known function become important steps in genome annotation and chemotaxis research. Here, we describe bioinformatics procedures that enable such analyses, using two closely related bacterial genomes as examples.

  17. A Bacteriophage Capsid Protein Is an Inhibitor of a Conserved Transcription Terminator of Various Bacterial Pathogens.

    PubMed

    Ghosh, Gairika; Reddy, Jayavardhana; Sambhare, Susmit; Sen, Ranjan

    2018-01-01

    Rho is a hexameric molecular motor that functions as a conserved transcription terminator in the majority of bacterial species and is a potential drug target. Psu is a bacteriophage P4 capsid protein that inhibits Escherichia coli Rho by obstructing its ATPase and translocase activities. In this study, we explored the anti-Rho activity of Psu for Rho proteins from different pathogens. Sequence alignment and homology modeling of Rho proteins from pathogenic bacteria revealed the conserved nature of the Psu-interacting regions in all these proteins. We chose Rho proteins from various pathogens, including Mycobacterium smegmatis , Mycobacterium bovis , Mycobacterium tuberculosis , Xanthomonas campestris , Xanthomonas oryzae , Corynebacterium glutamicum , Vibrio cholerae , Salmonella enterica , and Pseudomonas syringae The purified recombinant Rho proteins of these organisms showed variable rates of ATP hydrolysis on poly(rC) as the substrate and were capable of releasing RNA from the E. coli transcription elongation complexes. Psu was capable of inhibiting these two functions of all these Rho proteins. In vivo pulldown assays revealed direct binding of Psu with many of these Rho proteins. In vivo expression of psu induced killing of M. smegmatis , M. bovis , X. campestris , and E. coli expressing S. enterica Rho indicating Psu-induced inhibition of Rho proteins of these strains under physiological conditions. We propose that the "universal" inhibitory function of the Psu protein against the Rho proteins from both Gram-negative and Gram-positive bacteria could be useful for designing peptides with antimicrobial functions and that these peptides could contribute to synergistic antibiotic treatment of the pathogens by compromising the Rho functions. IMPORTANCE Bacteriophage-derived protein factors modulating different bacterial processes could be converted into unique antimicrobial agents. Bacteriophage P4 capsid protein Psu is an inhibitor of the E. coli transcription

  18. Studies on Bacterial Proteins Corona Interaction with Saponin Imprinted ZnO Nanohoneycombs and Their Toxic Responses.

    PubMed

    Sharma, Deepali; Ashaduzzaman, Md; Golabi, Mohsen; Shriwastav, Amritanshu; Bisetty, Krishna; Tiwari, Ashutosh

    2015-11-04

    Molecular imprinting generates robust, efficient, and highly mesoporous surfaces for biointeractions. Mechanistic interfacial interaction between the surface of core substrate and protein corona is crucial to understand the substantial microbial toxic responses at a nanoscale. In this study, we have focused on the mechanistic interactions between synthesized saponin imprinted zinc oxide nanohoneycombs (SIZnO NHs), average size 80-125 nm, surface area 20.27 m(2)/g, average pore density 0.23 pore/nm and number-average pore size 3.74 nm and proteins corona of bacteria. The produced SIZnO NHs as potential antifungal and antibacterial agents have been studied on Sclerotium rolfsii (S. rolfsii), Pythium debarynum (P. debarynum) and Escherichia coli (E. coli), Staphylococcus aureus (S. aureus), respectively. SIZnO NHs exhibited the highest antibacterial (∼50%) and antifungal (∼40%) activity against Gram-negative bacteria (E. coli) and fungus (P. debarynum), respectively at concentration of 0.1 mol. Scanning electron spectroscopy (SEM) observation showed that the ZnO NHs ruptured the cell wall of bacteria and internalized into the cell. The molecular docking studies were carried out using binding proteins present in the gram negative bacteria (lipopolysaccharide and lipocalin Blc) and gram positive bacteria (Staphylococcal Protein A, SpA). It was envisaged that the proteins present in the bacterial cell wall were found to interact and adsorb on the surface of SIZnO NHs thereby blocking the active sites of the proteins used for cell wall synthesis. The binding affinity and interaction energies were higher in the case of binding proteins present in gram negative bacteria as compared to that of gram positive bacteria. In addition, a kinetic mathematical model (KMM) was developed in MATLAB to predict the internalization in the bacterial cellular uptake of the ZnO NHs for better understanding of their controlled toxicity. The results obtained from KMM exhibited a good

  19. Connecting the dots between bacterial biofilms and ice cream.

    PubMed

    Stanley-Wall, Nicola R; MacPhee, Cait E

    2015-12-18

    Emerging research is revealing a diverse array of interfacially-active proteins that are involved in varied biological process from foaming horse sweat to bacterial raincoat formation. We describe an interdisciplinary approach to study the molecular and biophysical mechanisms controlling the activity of an unusual bacterial protein called BslA. This protein is needed for biofilm formation and forms a protective layer or raincoat over the bacterial community, but also has a multitude of potential applications in multiphase formulations. Here we document our journey from fundamental research to an examination of the applications for this surface-active protein in ice cream.

  20. Connecting the dots between bacterial biofilms and ice cream

    NASA Astrophysics Data System (ADS)

    Stanley-Wall, Nicola R.; MacPhee, Cait E.

    2015-12-01

    Emerging research is revealing a diverse array of interfacially-active proteins that are involved in varied biological process from foaming horse sweat to bacterial raincoat formation. We describe an interdisciplinary approach to study the molecular and biophysical mechanisms controlling the activity of an unusual bacterial protein called BslA. This protein is needed for biofilm formation and forms a protective layer or raincoat over the bacterial community, but also has a multitude of potential applications in multiphase formulations. Here we document our journey from fundamental research to an examination of the applications for this surface-active protein in ice cream.

  1. Integrative FourD omics approach profiles the target network of the carbon storage regulatory system

    PubMed Central

    Sowa, Steven W.; Gelderman, Grant; Leistra, Abigail N.; Buvanendiran, Aishwarya; Lipp, Sarah; Pitaktong, Areen; Vakulskas, Christopher A.; Romeo, Tony; Baldea, Michael

    2017-01-01

    Abstract Multi-target regulators represent a largely untapped area for metabolic engineering and anti-bacterial development. These regulators are complex to characterize because they often act at multiple levels, affecting proteins, transcripts and metabolites. Therefore, single omics experiments cannot profile their underlying targets and mechanisms. In this work, we used an Integrative FourD omics approach (INFO) that consists of collecting and analyzing systems data throughout multiple time points, using multiple genetic backgrounds, and multiple omics approaches (transcriptomics, proteomics and high throughput sequencing crosslinking immunoprecipitation) to evaluate simultaneous changes in gene expression after imposing an environmental stress that accentuates the regulatory features of a network. Using this approach, we profiled the targets and potential regulatory mechanisms of a global regulatory system, the well-studied carbon storage regulatory (Csr) system of Escherichia coli, which is widespread among bacteria. Using 126 sets of proteomics and transcriptomics data, we identified 136 potential direct CsrA targets, including 50 novel ones, categorized their behaviors into distinct regulatory patterns, and performed in vivo fluorescence-based follow up experiments. The results of this work validate 17 novel mRNAs as authentic direct CsrA targets and demonstrate a generalizable strategy to integrate multiple lines of omics data to identify a core pool of regulator targets. PMID:28126921

  2. Transmigration of polymorphnuclear neutrophils and monocytes through the human blood-cerebrospinal fluid barrier after bacterial infection in vitro

    PubMed Central

    2013-01-01

    Background Bacterial invasion through the blood-cerebrospinal fluid barrier (BCSFB) during bacterial meningitis causes secretion of proinflammatory cytokines/chemokines followed by the recruitment of leukocytes into the CNS. In this study, we analyzed the cellular and molecular mechanisms of polymorphonuclear neutrophil (PMN) and monocyte transepithelial transmigration (TM) across the BCSFB after bacterial infection. Methods Using an inverted transwell filter system of human choroid plexus papilloma cells (HIBCPP), we studied leukocyte TM rates, the migration route by immunofluorescence, transmission electron microscopy and focused ion beam/scanning electron microscopy, the secretion of cytokines/chemokines by cytokine bead array and posttranslational modification of the signal regulatory protein (SIRP) α via western blot. Results PMNs showed a significantly increased TM across HIBCPP after infection with wild-type Neisseria meningitidis (MC58). In contrast, a significantly decreased monocyte transmigration rate after bacterial infection of HIBCPP could be observed. Interestingly, in co-culture experiments with PMNs and monocytes, TM of monocytes was significantly enhanced. Analysis of paracellular permeability and transepithelial electrical resistance confirmed an intact barrier function during leukocyte TM. With the help of the different imaging techniques we could provide evidence for para- as well as for transcellular migrating leukocytes. Further analysis of secreted cytokines/chemokines showed a distinct pattern after stimulation and transmigration of PMNs and monocytes. Moreover, the transmembrane glycoprotein SIRPα was deglycosylated in monocytes, but not in PMNs, after bacterial infection. Conclusions Our findings demonstrate that PMNs and monoctyes differentially migrate in a human BCSFB model after bacterial infection. Cytokines and chemokines as well as transmembrane proteins such as SIRPα may be involved in this process. PMID:23448224

  3. Evolution of context dependent regulation by expansion of feast/famine regulatory proteins

    DOE PAGES

    Plaisier, Christopher L.; Lo, Fang -Yin; Ashworth, Justin; ...

    2014-11-14

    Expansion of transcription factors is believed to have played a crucial role in evolution of all organisms by enabling them to deal with dynamic environments and colonize new environments. We investigated how the expansion of the Feast/Famine Regulatory Protein (FFRP) or Lrp-like proteins into an eight-member family in Halobacterium salinarum NRC-1 has aided in niche-adaptation of this archaeon to a complex and dynamically changing hypersaline environment. We mapped genome-wide binding locations for all eight FFRPs, investigated their preference for binding different effector molecules, and identified the contexts in which they act by analyzing transcriptional responses across 35 growth conditions thatmore » mimic different environmental and nutritional conditions this organism is likely to encounter in the wild. Integrative analysis of these data constructed an FFRP regulatory network with conditionally active states that reveal how interrelated variations in DNA-binding domains, effector-molecule preferences, and binding sites in target gene promoters have tuned the functions of each FFRP to the environments in which they act. We demonstrate how conditional regulation of similar genes by two FFRPs, AsnC (an activator) and VNG1237C (a repressor), have striking environment-specific fitness consequences for oxidative stress management and growth, respectively. This study provides a systems perspective into the evolutionary process by which gene duplication within a transcription factor family contributes to environment-specific adaptation of an organism.« less

  4. Translation elicits a growth rate-dependent, genome-wide, differential protein production in Bacillus subtilis.

    PubMed

    Borkowski, Olivier; Goelzer, Anne; Schaffer, Marc; Calabre, Magali; Mäder, Ulrike; Aymerich, Stéphane; Jules, Matthieu; Fromion, Vincent

    2016-05-17

    Complex regulatory programs control cell adaptation to environmental changes by setting condition-specific proteomes. In balanced growth, bacterial protein abundances depend on the dilution rate, transcript abundances and transcript-specific translation efficiencies. We revisited the current theory claiming the invariance of bacterial translation efficiency. By integrating genome-wide transcriptome datasets and datasets from a library of synthetic gfp-reporter fusions, we demonstrated that translation efficiencies in Bacillus subtilis decreased up to fourfold from slow to fast growth. The translation initiation regions elicited a growth rate-dependent, differential production of proteins without regulators, hence revealing a unique, hard-coded, growth rate-dependent mode of regulation. We combined model-based data analyses of transcript and protein abundances genome-wide and revealed that this global regulation is extensively used in B. subtilis We eventually developed a knowledge-based, three-step translation initiation model, experimentally challenged the model predictions and proposed that a growth rate-dependent drop in free ribosome abundance accounted for the differential protein production. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.

  5. DNA-binding by Haemophilus influenzae and Escherichia coli YbaB, members of a widely-distributed bacterial protein family.

    PubMed

    Cooley, Anne E; Riley, Sean P; Kral, Keith; Miller, M Clarke; DeMoll, Edward; Fried, Michael G; Stevenson, Brian

    2009-07-13

    Genes orthologous to the ybaB loci of Escherichia coli and Haemophilus influenzae are widely distributed among eubacteria. Several years ago, the three-dimensional structures of the YbaB orthologs of both E. coli and H. influenzae were determined, revealing a novel "tweezer"-like structure. However, a function for YbaB had remained elusive, with an early study of the H. influenzae ortholog failing to detect DNA-binding activity. Our group recently determined that the Borrelia burgdorferi YbaB ortholog, EbfC, is a DNA-binding protein. To reconcile those results, we assessed the abilities of both the H. influenzae and E. coli YbaB proteins to bind DNA to which B. burgdorferi EbfC can bind. Both the H. influenzae and the E. coli YbaB proteins bound to tested DNAs. DNA-binding was not well competed with poly-dI-dC, indicating some sequence preferences for those two proteins. Analyses of binding characteristics determined that both YbaB orthologs bind as homodimers. Different DNA sequence preferences were observed between H. influenzae YbaB, E. coli YbaB and B. burgdorferi EbfC, consistent with amino acid differences in the putative DNA-binding domains of these proteins. Three distinct members of the YbaB/EbfC bacterial protein family have now been demonstrated to bind DNA. Members of this protein family are encoded by a broad range of bacteria, including many pathogenic species, and results of our studies suggest that all such proteins have DNA-binding activities. The functions of YbaB/EbfC family members in each bacterial species are as-yet unknown, but given the ubiquity of these DNA-binding proteins among Eubacteria, further investigations are warranted.

  6. RNA-Seq of Bacillus licheniformis: active regulatory RNA features expressed within a productive fermentation.

    PubMed

    Wiegand, Sandra; Dietrich, Sascha; Hertel, Robert; Bongaerts, Johannes; Evers, Stefan; Volland, Sonja; Daniel, Rolf; Liesegang, Heiko

    2013-10-01

    The production of enzymes by an industrial strain requires a complex adaption of the bacterial metabolism to the conditions within the fermenter. Regulatory events within the process result in a dynamic change of the transcriptional activity of the genome. This complex network of genes is orchestrated by proteins as well as regulatory RNA elements. Here we present an RNA-Seq based study considering selected phases of an industry-oriented fermentation of Bacillus licheniformis. A detailed analysis of 20 strand-specific RNA-Seq datasets revealed a multitude of transcriptionally active genomic regions. 3314 RNA features encoded by such active loci have been identified and sorted into ten functional classes. The identified sequences include the expected RNA features like housekeeping sRNAs, metabolic riboswitches and RNA switches well known from studies on Bacillus subtilis as well as a multitude of completely new candidates for regulatory RNAs. An unexpectedly high number of 855 RNA features are encoded antisense to annotated protein and RNA genes, in addition to 461 independently transcribed small RNAs. These antisense transcripts contain molecules with a remarkable size range variation from 38 to 6348 base pairs in length. The genome of the type strain B. licheniformis DSM13 was completely reannotated using data obtained from RNA-Seq analyses and from public databases. The hereby generated data-sets represent a solid amount of knowledge on the dynamic transcriptional activities during the investigated fermentation stages. The identified regulatory elements enable research on the understanding and the optimization of crucial metabolic activities during a productive fermentation of Bacillus licheniformis strains.

  7. Structural differences in the bacterial flagellar motor among bacterial species.

    PubMed

    Terashima, Hiroyuki; Kawamoto, Akihiro; Morimoto, Yusuke V; Imada, Katsumi; Minamino, Tohru

    2017-01-01

    The bacterial flagellum is a supramolecular motility machine consisting of the basal body as a rotary motor, the hook as a universal joint, and the filament as a helical propeller. Intact structures of the bacterial flagella have been observed for different bacterial species by electron cryotomography and subtomogram averaging. The core structures of the basal body consisting of the C ring, the MS ring, the rod and the protein export apparatus, and their organization are well conserved, but novel and divergent structures have also been visualized to surround the conserved structure of the basal body. This suggests that the flagellar motors have adapted to function in various environments where bacteria live and survive. In this review, we will summarize our current findings on the divergent structures of the bacterial flagellar motor.

  8. Cyclosporin A and FK-506 both affect DNA binding of regulatory nuclear proteins to the human interleukin-2 promoter.

    PubMed

    Baumann, G; Geisse, S; Sullivan, M

    1991-03-01

    The structurally unrelated immunosuppressive drugs cyclosporin A (Sandimmun) and FK-506 both interfere with the process of T-cell proliferation by blocking the transcription of the T-cell growth factor interleukin-2 (IL-2). Here we demonstrate that the transcriptional activation of this gene requires the binding of regulatory nuclear proteins to a promoter element with sequence similarity to the consensus binding site for NF-kappa B-related transcription factors. We present evidence that the binding by regulatory nuclear proteins to the kappa B element of the IL-2 promoter is affected negatively by cyclosporin A and FK-506 at concentrations paralleling their immunosuppressive activity in vivo. The decrease in DNA-protein complex formation induced by the immunosuppressive drugs correlates with a decrease in IL-2 production. FK-506 is 10 to 100 times more potent than cyclosporin A in its ability to inhibit sequence-specific DNA binding and IL-2 production. Our findings suggest that the actions of both drugs converge at the level of DNA-protein interaction.

  9. Revisiting the Roco G-protein cycle.

    PubMed

    Terheyden, Susanne; Ho, Franz Y; Gilsbach, Bernd K; Wittinghofer, Alfred; Kortholt, Arjan

    2015-01-01

    Mutations in leucine-rich-repeat kinase 2 (LRRK2) are the most frequent cause of late-onset Parkinson's disease (PD). LRRK2 belongs to the Roco family of proteins which share a conserved Ras-like G-domain (Roc) and a C-terminal of Roc (COR) domain tandem. The nucleotide state of small G-proteins is strictly controlled by guanine-nucleotide-exchange factors (GEFs) and GTPase-activating proteins (GAPs). Because of contradictory structural and biochemical data, the regulatory mechanism of the LRRK2 Roc G-domain and the RocCOR tandem is still under debate. In the present study, we solved the first nucleotide-bound Roc structure and used LRRK2 and bacterial Roco proteins to characterize the RocCOR function in more detail. Nucleotide binding induces a drastic structural change in the Roc/COR domain interface, a region strongly implicated in patients with an LRRK2 mutation. Our data confirm previous assumptions that the C-terminal subdomain of COR functions as a dimerization device. We show that the dimer formation is independent of nucleotide. The affinity for GDP/GTP is in the micromolar range, the result of which is high dissociation rates in the s-1 range. Thus Roco proteins are unlikely to need GEFs to achieve activation. Monomeric LRRK2 and Roco G-domains have a similar low GTPase activity to small G-proteins. We show that GTPase activity in bacterial Roco is stimulated by the nucleotide-dependent dimerization of the G-domain within the complex. We thus propose that the Roco proteins do not require GAPs to stimulate GTP hydrolysis but stimulate each other by one monomer completing the catalytic machinery of the other.

  10. Expression of lysozymes from Erwinia amylovora phages and Erwinia genomes and inhibition by a bacterial protein.

    PubMed

    Müller, Ina; Gernold, Marina; Schneider, Bernd; Geider, Klaus

    2012-01-01

    Genes coding for lysozyme-inhibiting proteins (Ivy) were cloned from the chromosomes of the plant pathogens Erwinia amylovora and Erwinia pyrifoliae. The product interfered not only with activity of hen egg white lysozyme, but also with an enzyme from E. amylovora phage ΦEa1h. We have expressed lysozyme genes from the genomes of three Erwinia species in Escherichia coli. The lysozymes expressed from genes of the E. amylovora phages ΦEa104 and ΦEa116, Erwinia chromosomes and Arabidopsis thaliana were not affected by Ivy. The enzyme from bacteriophage ΦEa1h was fused at the N- or C-terminus to other peptides. Compared to the intact lysozyme, a His-tag reduced its lytic activity about 10-fold and larger fusion proteins abolished activity completely. Specific protease cleavage restored lysozyme activity of a GST-fusion. The bacteriophage-encoded lysozymes were more active than the enzymes from bacterial chromosomes. Viral lyz genes were inserted into a broad-host range vector, and transfer to E. amylovora inhibited cell growth. Inserted in the yeast Pichia pastoris, the ΦEa1h-lysozyme was secreted and also inhibited by Ivy. Here we describe expression of unrelated cloned 'silent' lyz genes from Erwinia chromosomes and a novel interference of bacterial Ivy proteins with a viral lysozyme. Copyright © 2012 S. Karger AG, Basel.

  11. Iron regulatory proteins and their role in controlling iron metabolism.

    PubMed

    Kühn, Lukas C

    2015-02-01

    Cellular iron homeostasis is regulated by post-transcriptional feedback mechanisms, which control the expression of proteins involved in iron uptake, release and storage. Two cytoplasmic proteins with mRNA-binding properties, iron regulatory proteins 1 and 2 (IRP1 and IRP2) play a central role in this regulation. Foremost, IRPs regulate ferritin H and ferritin L translation and thus iron storage, as well as transferrin receptor 1 (TfR1) mRNA stability, thereby adjusting receptor expression and iron uptake via receptor-mediated endocytosis of iron-loaded transferrin. In addition splice variants of iron transporters for import and export at the plasma-membrane, divalent metal transporter 1 (DMT1) and ferroportin are regulated by IRPs. These mechanisms have probably evolved to maintain the cytoplasmic labile iron pool (LIP) at an appropriate level. In certain tissues, the regulation exerted by IRPs influences iron homeostasis and utilization of the entire organism. In intestine, the control of ferritin expression limits intestinal iron absorption and, thus, whole body iron levels. In bone marrow, erythroid heme biosynthesis is coordinated with iron availability through IRP-mediated translational control of erythroid 5-aminolevulinate synthase mRNA. Moreover, the translational control of HIF2α mRNA in kidney by IRP1 coordinates erythropoietin synthesis with iron and oxygen supply. Besides IRPs, body iron absorption is negatively regulated by hepcidin. This peptide hormone, synthesized and secreted by the liver in response to high serum iron, downregulates ferroportin at the protein level and thereby limits iron absorption from the diet. Hepcidin will not be discussed in further detail here.

  12. Structure, dynamics and biophysics of the cytoplasmic protein–protein complexes of the bacterial phosphoenolpyruvate: Sugar phosphotransferase system

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Clore, G. Marius; Venditti, Vincenzo

    2013-10-01

    The bacterial phosphotransferase system (PTS) couples phosphoryl transfer, via a series of bimolecular protein–protein interactions, to sugar transport across the membrane. The multitude of complexes in the PTS provides a paradigm for studying protein interactions, and for understanding how the same binding surface can specifically recognize a diverse array of targets. Fifteen years of work aimed at solving the solution structures of all soluble protein–protein complexes of the PTS has served as a test bed for developing NMR and integrated hybrid approaches to study larger complexes in solution and to probe transient, spectroscopically invisible states, including encounter complexes. We reviewmore » these approaches, highlighting the problems that can be tackled with these methods, and summarize the current findings on protein interactions.« less

  13. Surfing on Protein Waves: Proteophoresis as a Mechanism for Bacterial Genome Partitioning

    NASA Astrophysics Data System (ADS)

    Walter, J.-C.; Dorignac, J.; Lorman, V.; Rech, J.; Bouet, J.-Y.; Nollmann, M.; Palmeri, J.; Parmeggiani, A.; Geniet, F.

    2017-07-01

    Efficient bacterial chromosome segregation typically requires the coordinated action of a three-component machinery, fueled by adenosine triphosphate, called the partition complex. We present a phenomenological model accounting for the dynamic activity of this system that is also relevant for the physics of catalytic particles in active environments. The model is obtained by coupling simple linear reaction-diffusion equations with a proteophoresis, or "volumetric" chemophoresis, force field that arises from protein-protein interactions and provides a physically viable mechanism for complex translocation. This minimal description captures most known experimental observations: dynamic oscillations of complex components, complex separation, and subsequent symmetrical positioning. The predictions of our model are in phenomenological agreement with and provide substantial insight into recent experiments. From a nonlinear physics view point, this system explores the active separation of matter at micrometric scales with a dynamical instability between static positioning and traveling wave regimes triggered by the dynamical spontaneous breaking of rotational symmetry.

  14. Localization of a bacterial group II intron-encoded protein in human cells.

    PubMed

    Reinoso-Colacio, Mercedes; García-Rodríguez, Fernando Manuel; García-Cañadas, Marta; Amador-Cubero, Suyapa; García Pérez, José Luis; Toro, Nicolás

    2015-08-05

    Group II introns are mobile retroelements that self-splice from precursor RNAs to form ribonucleoparticles (RNP), which can invade new specific genomic DNA sites. This specificity can be reprogrammed, for insertion into any desired DNA site, making these introns useful tools for bacterial genetic engineering. However, previous studies have suggested that these elements may function inefficiently in eukaryotes. We investigated the subcellular distribution, in cultured human cells, of the protein encoded by the group II intron RmInt1 (IEP) and several mutants. We created fusions with yellow fluorescent protein (YFP) and with a FLAG epitope. We found that the IEP was localized in the nucleus and nucleolus of the cells. Remarkably, it also accumulated at the periphery of the nuclear matrix. We were also able to identify spliced lariat intron RNA, which co-immunoprecipitated with the IEP, suggesting that functional RmInt1 RNPs can be assembled in cultured human cells.

  15. Localization of a bacterial group II intron-encoded protein in human cells

    PubMed Central

    Reinoso-Colacio, Mercedes; García-Rodríguez, Fernando Manuel; García-Cañadas, Marta; Amador-Cubero, Suyapa; Pérez, José Luis García; Toro, Nicolás

    2015-01-01

    Group II introns are mobile retroelements that self-splice from precursor RNAs to form ribonucleoparticles (RNP), which can invade new specific genomic DNA sites. This specificity can be reprogrammed, for insertion into any desired DNA site, making these introns useful tools for bacterial genetic engineering. However, previous studies have suggested that these elements may function inefficiently in eukaryotes. We investigated the subcellular distribution, in cultured human cells, of the protein encoded by the group II intron RmInt1 (IEP) and several mutants. We created fusions with yellow fluorescent protein (YFP) and with a FLAG epitope. We found that the IEP was localized in the nucleus and nucleolus of the cells. Remarkably, it also accumulated at the periphery of the nuclear matrix. We were also able to identify spliced lariat intron RNA, which co-immunoprecipitated with the IEP, suggesting that functional RmInt1 RNPs can be assembled in cultured human cells. PMID:26244523

  16. Advances in Bacterial Methionine Aminopeptidase Inhibition

    PubMed Central

    Helgren, Travis R.; Wangtrakuldee, Phumvadee; Staker, Bart L.; Hagen, Timothy J.

    2016-01-01

    Methionine aminopeptidases (MetAPs) are metalloenzymes that cleave the N-terminal methionine from newly synthesized peptides and proteins. These MetAP enzymes are present in bacteria, and knockout experiments have shown that MetAP activity is essential for cell life, suggesting that MetAPs are good antibacterial drug targets. MetAP enzymes are also present in the human host and selectivity is essential. There have been significant structural biology efforts and over 65 protein crystal structures of bacterial MetAPs are deposited into the PDB. This review highlights the available crystallographic data for bacterial MetAPs. Structural comparison of bacterial MetAPs with human MetAPs highlights differences that can lead to selectivity. In addition, this review includes the chemical diversity of molecules that bind and inhibit the bacterial MetAP enzymes. Analysis of the structural biology and chemical space of known bacterial MetAP inhibitors leads to a greater understanding of this antibacterial target and the likely development of potential antibacterial agents. PMID:26268344

  17. Finding trans-regulatory genes and protein complexes modulating meiotic recombination hotspots of human, mouse and yeast.

    PubMed

    Wu, Min; Kwoh, Chee-Keong; Li, Xiaoli; Zheng, Jie

    2014-09-11

    The regulatory mechanism of recombination is one of the most fundamental problems in genomics, with wide applications in genome wide association studies (GWAS), birth-defect diseases, molecular evolution, cancer research, etc. Recombination events cluster into short genomic regions called "recombination hotspots". Recently, a zinc finger protein PRDM9 was reported to regulate recombination hotspots in human and mouse genomes. In addition, a 13-mer motif contained in the binding sites of PRDM9 is found to be enriched in human hotspots. However, this 13-mer motif only covers a fraction of hotspots, indicating that PRDM9 is not the only regulator of recombination hotspots. Therefore, the challenge of discovering other regulators of recombination hotspots becomes significant. Furthermore, recombination is a complex process. Hence, multiple proteins acting as machinery, rather than individual proteins, are more likely to carry out this process in a precise and stable manner. Therefore, the extension of the prediction of individual trans-regulators to protein complexes is also highly desired. In this paper, we introduce a pipeline to identify genes and protein complexes associated with recombination hotspots. First, we prioritize proteins associated with hotspots based on their preference of binding to hotspots and coldspots. Second, using the above identified genes as seeds, we apply the Random Walk with Restart algorithm (RWR) to propagate their influences to other proteins in protein-protein interaction (PPI) networks. Hence, many proteins without DNA-binding information will also be assigned a score to implicate their roles in recombination hotspots. Third, we construct sub-PPI networks induced by top genes ranked by RWR for various species (e.g., yeast, human and mouse) and detect protein complexes in those sub-PPI networks. The GO term analysis show that our prioritizing methods and the RWR algorithm are capable of identifying novel genes associated with

  18. Steady-state levels of G-protein beta-subunit expression are regulated by treatment of cells with bacterial toxins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Watkins, D.C.; Northup, J.K.; Malbon, C.C.

    1987-05-01

    Cultures of 3T3-L1 cells were incubated with either 10 ng/ml cholera toxin or 10 ng/ml pertussis toxin from 4 days prior to the initiation of differentiation and throughout the subsequent incubation. Toxin concentrations were sufficient to completely prevent the labelling of alpha-subunits with (/sup 32/P)NAD/sup +/ and pertussis toxin and to prevent by more than 90% the labelling with (/sup 32/P)NAD/sup +/ and cholera toxin in membranes prepared from these cells. Neither toxin prevented the differentiation to the adipocyte phenotype. Neither toxin prevented the increases in the relative amounts of G-proteins which occur upon differentiation. Both toxins dramatically decreased themore » amount of beta-subunits. As measured by quantitative immunoblotting with antisera specific for both the 35 kDa and 36 kDa beta-subunits, levels of beta-subunit were decreased by more than 50% of steady-state level of control cells. Thus, bacterial toxins which modifies G-protein alpha-subunits are capable of modulating the levels of beta-subunits in vivo. The basis for the regulation of G-protein subunit expression by bacterial toxins is under study.« less

  19. SACE_5599, a putative regulatory protein, is involved in morphological differentiation and erythromycin production in Saccharopolyspora erythraea.

    PubMed

    Kirm, Benjamin; Magdevska, Vasilka; Tome, Miha; Horvat, Marinka; Karničar, Katarina; Petek, Marko; Vidmar, Robert; Baebler, Spela; Jamnik, Polona; Fujs, Štefan; Horvat, Jaka; Fonovič, Marko; Turk, Boris; Gruden, Kristina; Petković, Hrvoje; Kosec, Gregor

    2013-12-17

    Erythromycin is a medically important antibiotic, biosynthesized by the actinomycete Saccharopolyspora erythraea. Genes encoding erythromycin biosynthesis are organized in a gene cluster, spanning over 60 kbp of DNA. Most often, gene clusters encoding biosynthesis of secondary metabolites contain regulatory genes. In contrast, the erythromycin gene cluster does not contain regulatory genes and regulation of its biosynthesis has therefore remained poorly understood, which has for a long time limited genetic engineering approaches for erythromycin yield improvement. We used a comparative proteomic approach to screen for potential regulatory proteins involved in erythromycin biosynthesis. We have identified a putative regulatory protein SACE_5599 which shows significantly higher levels of expression in an erythromycin high-producing strain, compared to the wild type S. erythraea strain. SACE_5599 is a member of an uncharacterized family of putative regulatory genes, located in several actinomycete biosynthetic gene clusters. Importantly, increased expression of SACE_5599 was observed in the complex fermentation medium and at controlled bioprocess conditions, simulating a high-yield industrial fermentation process in the bioreactor. Inactivation of SACE_5599 in the high-producing strain significantly reduced erythromycin yield, in addition to drastically decreasing sporulation intensity of the SACE_5599-inactivated strains when cultivated on ABSM4 agar medium. In contrast, constitutive overexpression of SACE_5599 in the wild type NRRL23338 strain resulted in an increase of erythromycin yield by 32%. Similar yield increase was also observed when we overexpressed the bldD gene, a previously identified regulator of erythromycin biosynthesis, thereby for the first time revealing its potential for improving erythromycin biosynthesis. SACE_5599 is the second putative regulatory gene to be identified in S. erythraea which has positive influence on erythromycin yield. Like bld

  20. SACE_5599, a putative regulatory protein, is involved in morphological differentiation and erythromycin production in Saccharopolyspora erythraea

    PubMed Central

    2013-01-01

    Background Erythromycin is a medically important antibiotic, biosynthesized by the actinomycete Saccharopolyspora erythraea. Genes encoding erythromycin biosynthesis are organized in a gene cluster, spanning over 60 kbp of DNA. Most often, gene clusters encoding biosynthesis of secondary metabolites contain regulatory genes. In contrast, the erythromycin gene cluster does not contain regulatory genes and regulation of its biosynthesis has therefore remained poorly understood, which has for a long time limited genetic engineering approaches for erythromycin yield improvement. Results We used a comparative proteomic approach to screen for potential regulatory proteins involved in erythromycin biosynthesis. We have identified a putative regulatory protein SACE_5599 which shows significantly higher levels of expression in an erythromycin high-producing strain, compared to the wild type S. erythraea strain. SACE_5599 is a member of an uncharacterized family of putative regulatory genes, located in several actinomycete biosynthetic gene clusters. Importantly, increased expression of SACE_5599 was observed in the complex fermentation medium and at controlled bioprocess conditions, simulating a high-yield industrial fermentation process in the bioreactor. Inactivation of SACE_5599 in the high-producing strain significantly reduced erythromycin yield, in addition to drastically decreasing sporulation intensity of the SACE_5599-inactivated strains when cultivated on ABSM4 agar medium. In contrast, constitutive overexpression of SACE_5599 in the wild type NRRL23338 strain resulted in an increase of erythromycin yield by 32%. Similar yield increase was also observed when we overexpressed the bldD gene, a previously identified regulator of erythromycin biosynthesis, thereby for the first time revealing its potential for improving erythromycin biosynthesis. Conclusions SACE_5599 is the second putative regulatory gene to be identified in S. erythraea which has positive influence

  1. Bacterially produced human B7-1 protein encompassing its complete extracellular domain maintains its costimulatory activity in vitro.

    PubMed

    Shen, W; Wang, Y; Geng, Y; Si, L

    2000-08-01

    To investigate which of the two immunoglobulin (Ig)-like domains, immunoglobulin variable region homologous domain IgV (hB7-1 IgV), or immunoglobulin constant region homologous domain IgC (hB7-1 IgC) on human B7-1 molecule contain the receptor binding sites, and to evaluate if the B7-1 molecule expressed in bacteria has biological activity. PCR was used to amplify three fragments of hB7-1 IgV, hB7-1 IgC and complete extracellular region of human B7-1 containing both the IgV and IgC domains (hB7-1 IgV + IgC). Three recombinants, pQE9-hB7-1 IgV, pQE9-hB7-1 IgC and pQE9-Hb7-1 (IgV + IgC) were generated by cloning the PCR products into a prokaryote expression plasmid (pQE-9) and were introduced into the host stain M15. The relevant target hexahistidine-tagged proteins were identified by SDS-PAGE and Western blotting. With the presence of the first signal imitated by anti-CD3 antibody, T cell activation was observed by exposing purified T lymphocytes to each soluble form of the three bacterially-produced human B7-1 proteins and [3H]-TdR incorporation. Three recombinant proteins of human B7-1, hB7-1 IgV, hB7-1 IgC and hB7-1 (IgV + IgC) were produced and detected in both soluble and inclusive body forms from engineered bacterial cells. With the presence of anti-CD3 antibody, T lymphocytes proliferated when co-stimulated by bacterially produced hB7-1 (IgV + IgC), but not by either hB7-1 IgV or hB7-1 IgC. Functional glycoprotein human B7-1 could be produced in bacterial cells. Both extracellular immunoglobulin-like domains are necessary for B7-1 to react with its counter receptors.

  2. A reproducible and scalable procedure for preparing bacterial extracts for cell-free protein synthesis.

    PubMed

    Katsura, Kazushige; Matsuda, Takayoshi; Tomabechi, Yuri; Yonemochi, Mayumi; Hanada, Kazuharu; Ohsawa, Noboru; Sakamoto, Kensaku; Takemoto, Chie; Shirouzu, Mikako

    2017-11-01

    Cell-free protein synthesis is a useful method for preparing proteins for functional or structural analyses. However, batch-to-batch variability with regard to protein synthesis activity remains a problem for large-scale production of cell extract in the laboratory. To address this issue, we have developed a novel procedure for large-scale preparation of bacterial cell extract with high protein synthesis activity. The developed procedure comprises cell cultivation using a fermentor, harvesting and washing of cells by tangential flow filtration, cell disruption with high-pressure homogenizer and continuous diafiltration. By optimizing and combining these methods, ∼100 ml of the cell extract was prepared from 150 g of Escherichia coli cells. The protein synthesis activities, defined as the yield of protein per unit of absorbance at 260 nm of the cell extract, were shown to be reproducible, and the average activity of several batches was twice that obtained using a previously reported method. In addition, combinatorial use of the high-pressure homogenizer and diafiltration increased the scalability, indicating that the cell concentration at disruption varies from 0.04 to 1 g/ml. Furthermore, addition of Gam protein and examinations of the N-terminal sequence rendered the extract prepared here useful for rapid screening with linear DNA templates. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  3. Membrane cofactor protein (CD46) is a keratinocyte receptor for the M protein of the group A streptococcus.

    PubMed

    Okada, N; Liszewski, M K; Atkinson, J P; Caparon, M

    1995-03-28

    The pathogenic Gram-positive bacterium Streptococcus pyogenes (group A streptococcus) is the causative agent of numerous suppurative diseases of human skin. The M protein of S. pyogenes mediates the adherence of the bacterium to keratinocytes, the most numerous cell type in the epidermis. In this study, we have constructed and analyzed a series of mutant M proteins and have shown that the C repeat domain of the M molecule is responsible for cell recognition. The binding of factor H, a serum regulator of complement activation, to the C repeat region of M protein blocked bacterial adherence. Factor H is a member of a large family of complement regulatory proteins that share a homologous structural motif termed the short consensus repeat. Membrane cofactor protein (MCP), or CD46, is a short consensus repeat-containing protein found on the surface of keratinocytes, and purified MCP could competitively inhibit the adherence of S. pyogenes to these cells. Furthermore, the M protein was found to bind directly to MCP, whereas mutant M proteins that lacked the C repeat domain did not bind MCP, suggesting that recognition of MCP plays an important role in the ability of the streptococcus to adhere to keratinocytes.

  4. Receptors, mediators, and mechanisms involved in bacterial sepsis and septic shock.

    PubMed

    Van Amersfoort, Edwin S; Van Berkel, Theo J C; Kuiper, Johan

    2003-07-01

    Bacterial sepsis and septic shock result from the overproduction of inflammatory mediators as a consequence of the interaction of the immune system with bacteria and bacterial wall constituents in the body. Bacterial cell wall constituents such as lipopolysaccharide, peptidoglycans, and lipoteichoic acid are particularly responsible for the deleterious effects of bacteria. These constituents interact in the body with a large number of proteins and receptors, and this interaction determines the eventual inflammatory effect of the compounds. Within the circulation bacterial constituents interact with proteins such as plasma lipoproteins and lipopolysaccharide binding protein. The interaction of the bacterial constituents with receptors on the surface of mononuclear cells is mainly responsible for the induction of proinflammatory mediators by the bacterial constituents. The role of individual receptors such as the toll-like receptors and CD14 in the induction of proinflammatory cytokines and adhesion molecules is discussed in detail. In addition, the roles of a number of other receptors that bind bacterial compounds such as scavenger receptors and their modulating role in inflammation are described. Finally, the therapies for the treatment of bacterial sepsis and septic shock are discussed in relation to the action of the aforementioned receptors and proteins.

  5. Bacterial interactions in dental biofilm development.

    PubMed

    Hojo, K; Nagaoka, S; Ohshima, T; Maeda, N

    2009-11-01

    Recent analyses with ribosomal RNA-based technologies have revealed the diversity of bacterial populations within dental biofilms, and have highlighted their important contributions to oral health and disease. Dental biofilms are exceedingly complex and multispecies ecosystems, where oral bacteria interact cooperatively or competitively with other members. Bacterial interactions that influence dental biofilm communities include various different mechanisms. During the early stage of biofilm formation, it is known that planktonic bacterial cells directly attach to surfaces of the oral cavity or indirectly bind to other bacterial cells that have already colonized. Adherence through co-aggregation may be critical for the temporary retention of bacteria on dental surfaces, and may facilitate eventual bacterial colonization. It is likely that metabolic communication, genetic exchange, production of inhibitory factors (e.g., bacteriocins, hydrogen peroxide, etc.), and quorum-sensing are pivotal regulatory factors that determine the bacterial composition and/or metabolism. Since each bacterium can easily access a neighboring bacterial cell and its metabolites, genetic exchanges and metabolic communication may occur frequently in dental biofilms. Quorum-sensing is defined as gene regulation in response to cell density, which influences various functions, e.g., virulence and bacteriocin production. In this review, we discuss these important interactions among oral bacteria within the dental biofilm communities.

  6. A Simple and Rapid Method for Preparing a Cell-Free Bacterial Lysate for Protein Synthesis

    PubMed Central

    Kaduri, Maya; Shainsky-Roitman, Janna; Goldfeder, Mor; Ivanir, Eran; Benhar, Itai; Shoham, Yuval; Schroeder, Avi

    2016-01-01

    Cell-free protein synthesis (CFPS) systems are important laboratory tools that are used for various synthetic biology applications. Here, we present a simple and inexpensive laboratory-scale method for preparing a CFPS system from E. coli. The procedure uses basic lab equipment, a minimal set of reagents, and requires less than one hour to process the bacterial cell mass into a functional S30-T7 extract. BL21(DE3) and MRE600 E. coli strains were used to prepare the S30-T7 extract. The CFPS system was used to produce a set of fluorescent and therapeutic proteins of different molecular weights (up to 66 kDa). This system was able to produce 40–150 μg-protein/ml, with variations depending on the plasmid type, expressed protein and E. coli strain. Interestingly, the BL21-based CFPS exhibited stability and increased activity at 40 and 45°C. To the best of our knowledge, this is the most rapid and affordable lab-scale protocol for preparing a cell-free protein synthesis system, with high thermal stability and efficacy in producing therapeutic proteins. PMID:27768741

  7. Regulatory RNAs

    PubMed Central

    Vazquez-Anderson, Jorge; Contreras, Lydia M

    2013-01-01

    RNAs have many important functional properties, including that they are independently controllable and highly tunable. As a result of these advantageous properties, their use in a myriad of sophisticated devices has been widely explored. Yet, the exploitation of RNAs for synthetic applications is highly dependent on the ability to characterize the many new molecules that continue to be discovered by large-scale sequencing and high-throughput screening techniques. In this review, we present an exhaustive survey of the most recent synthetic bacterial riboswitches and small RNAs while emphasizing their virtues in gene expression management. We also explore the use of these RNA components as building blocks in the RNA synthetic biology toolbox and discuss examples of synthetic RNA components used to rewire bacterial regulatory circuitry. We anticipate that this field will expand its catalog of smart devices by mimicking and manipulating natural RNA mechanisms and functions. PMID:24356572

  8. HOXA1 and TALE proteins display cross-regulatory interactions and form a combinatorial binding code on HOXA1 targets

    PubMed Central

    De Kumar, Bony; Parker, Hugo J.; Paulson, Ariel; Parrish, Mark E.; Pushel, Irina; Singh, Narendra Pratap; Zhang, Ying; Slaughter, Brian D.; Unruh, Jay R.; Florens, Laurence; Zeitlinger, Julia; Krumlauf, Robb

    2017-01-01

    Hoxa1 has diverse functional roles in differentiation and development. We identify and characterize properties of regions bound by HOXA1 on a genome-wide basis in differentiating mouse ES cells. HOXA1-bound regions are enriched for clusters of consensus binding motifs for HOX, PBX, and MEIS, and many display co-occupancy of PBX and MEIS. PBX and MEIS are members of the TALE family and genome-wide analysis of multiple TALE members (PBX, MEIS, TGIF, PREP1, and PREP2) shows that nearly all HOXA1 targets display occupancy of one or more TALE members. The combinatorial binding patterns of TALE proteins define distinct classes of HOXA1 targets, which may create functional diversity. Transgenic reporter assays in zebrafish confirm enhancer activities for many HOXA1-bound regions and the importance of HOX-PBX and TGIF motifs for their regulation. Proteomic analyses show that HOXA1 physically interacts on chromatin with PBX, MEIS, and PREP family members, but not with TGIF, suggesting that TGIF may have an independent input into HOXA1-bound regions. Therefore, TALE proteins appear to represent a wide repertoire of HOX cofactors, which may coregulate enhancers through distinct mechanisms. We also discover extensive auto- and cross-regulatory interactions among the Hoxa1 and TALE genes, indicating that the specificity of HOXA1 during development may be regulated though a complex cross-regulatory network of HOXA1 and TALE proteins. This study provides new insight into a regulatory network involving combinatorial interactions between HOXA1 and TALE proteins. PMID:28784834

  9. Cross-regulatory protein–protein interactions between Hox and Pax transcription factors

    PubMed Central

    Plaza, Serge; Prince, Frederic; Adachi, Yoshitsugu; Punzo, Claudio; Cribbs, David L.; Gehring, Walter J.

    2008-01-01

    Homeotic Hox selector genes encode highly conserved transcriptional regulators involved in the differentiation of multicellular organisms. Ectopic expression of the Antennapedia (ANTP) homeodomain protein in Drosophila imaginal discs induces distinct phenotypes, including an antenna-to-leg transformation and eye reduction. We have proposed that the eye loss phenotype is a consequence of a negative posttranslational control mechanism because of direct protein–protein interactions between ANTP and Eyeless (EY). In the present work, we analyzed the effect of various ANTP homeodomain mutations for their interaction with EY and for head development. Contrasting with the eye loss phenotype, we provide evidence that the antenna-to-leg transformation involves ANTP DNA-binding activity. In a complementary genetic screen performed in yeast, we isolated mutations located in the N terminus of the ANTP homeodomain that inhibit direct interactions with EY without abolishing DNA binding in vitro and in vivo. In a bimolecular fluorescence complementation assay, we detected the ANTP–EY interaction in vivo, these interactions occurring through the paired domain and/or the homeodomain of EY. These results demonstrate that the homeodomain supports multiple molecular regulatory functions in addition to protein–DNA and protein–RNA interactions; it is also involved in protein–protein interactions. PMID:18755899

  10. Effect of early antibiotic administration on cecal bacterial communities and their metabolic profiles in pigs fed diets with different protein levels.

    PubMed

    Zhang, Chuanjian; Yu, Miao; Yang, Yuxiang; Mu, Chunlong; Su, Yong; Zhu, Weiyun

    2016-12-01

    This study investigated the effects of early antibiotic administration (EAA) on cecal bacterial communities and their metabolic profiles in pigs fed diets with different protein levels. Eighteen litters (total 180) of piglets on day (d) 7 were fed either a commercial creep feed or commercial creep feed + antibiotic (Olaquindox, Oxytetracycline Calcium and Kitasamycin) until d 42. On d 42, pigs within each group were further randomly fed a normal crude protein (CP) diet (20% and 18% CP from d 42 to d 77 and d 77 to d 120, respectively) or a low-CP diet (16% and 14% CP from d 42 to d 77 and d 77 to d 120, respectively), generating 4 groups, control-low CP (Con-LP), control-normal CP (Con-NP), antibiotic-low CP (Ant-LP) and antibiotic-normal CP (Ant-NP), respectively. On d 77 and d 120, 5 pigs per group were slaughtered and cecal materials were collected for bacterial analysis. With cecal bacteria, principle component analysis (PCA) of the denaturing gradient gel electrophoresis (DGGE) profile showed two distinct groups of samples from low-CP diet and samples from normal-CP diet. Real-time PCR showed that EAA did not have significant effect on major bacterial groups, only showed significant interactions (P < 0.05) with CP level for Lactobacillus counts on d 77 and Clostridium cluster XIVa counts on d 120 with higher values in the Con-NP group compared to the Ant-NP groups. Low-CP diet increased (P < 0.05) short-chain fatty acids (SCFA) producing bacteria counts (Bacteroidetes on d 77 and d 120; Clostridium cluster IV and Clostridium cluster XIVa on d 77), but decreased (P < 0.05) Escherichia coli counts on d 77 and d 120. For metabolites, EAA increased (P < 0.05) protein fermentation products (p-cresol, indole and skatole on d 77; ammonia, putrescine and spermidine on d 120), and showed significant interactions (P < 0.05) with CP level for p-cresol and skatole concentrations on d 77 and putrescine and spermidine concentrations on d 120 with higher values

  11. Gene Regulation, Two Component Regulatory Systems, and Adaptive Responses in Treponema Denticola.

    PubMed

    Marconi, Richard T

    2017-10-13

    The oral microbiome consists of a remarkably diverse group of 500-700 bacterial species. The microbial etiology of periodontal disease is similarly complex. Of the ~400 bacterial species identified in subgingival plaque, at least 50 belong to the genus Treponema. As periodontal disease develops and progresses, T. denticola transitions from a low to high abundance species in the subgingival crevice. Changes in the overall composition of the bacterial population trigger significant changes in the local physical, immunological and physiochemical conditions. For T. denticola to thrive in periodontal pockets, it must be nimble and adapt to rapidly changing environmental conditions. The purpose of this chapter is to review the current understanding of the molecular basis of these essential adaptive responses, with a focus on the role of two component regulatory systems with global regulatory potential.

  12. Regulatory function of Arabidopsis lipid transfer protein 1 (LTP1) in ethylene response and signaling.

    PubMed

    Wang, Honglin; Sun, Yue; Chang, Jianhong; Zheng, Fangfang; Pei, Haixia; Yi, Yanjun; Chang, Caren; Dong, Chun-Hai

    2016-07-01

    Ethylene as a gaseous plant hormone is directly involved in various processes during plant growth and development. Much is known regarding the ethylene receptors and regulatory factors in the ethylene signal transduction pathway. In Arabidopsis thaliana, REVERSION-TO-ETHYLENE SENSITIVITY1 (RTE1) can interact with and positively regulates the ethylene receptor ETHYLENE RESPONSE1 (ETR1). In this study we report the identification and characterization of an RTE1-interacting protein, a putative Arabidopsis lipid transfer protein 1 (LTP1) of unknown function. Through bimolecular fluorescence complementation, a direct molecular interaction between LTP1 and RTE1 was verified in planta. Analysis of an LTP1-GFP fusion in transgenic plants and plasmolysis experiments revealed that LTP1 is localized to the cytoplasm. Analysis of ethylene responses showed that the ltp1 knockout is hypersensitive to 1-aminocyclopropanecarboxylic acid (ACC), while LTP1 overexpression confers insensitivity. Analysis of double mutants etr1-2 ltp1 and rte1-3 ltp1 demonstrates a regulatory function of LTP1 in ethylene receptor signaling through the molecular association with RTE1. This study uncovers a novel function of Arabidopsis LTP1 in the regulation of ethylene response and signaling.

  13. Membrane lipid-protein interactions modify the regulatory role of adenosine-deaminase complexing protein: a phase fluorometry study of a malignancy marker

    NASA Astrophysics Data System (ADS)

    Parola, Abraham H.; Porat, Nurith; Caiolfa, Valeria R.; Gill, David; Kiesow, Lutz A.; Weisman, Mathew; Nemschitz, S.; Yaron, Dahlia; Singer, Karen; Solomon, Ethel

    1990-05-01

    The role of membrane lipid-protein interactions in malignant cell transformation was examined with adenosine deaminase (ADA) as a representative membrane protein. ADA's activity changes dramatically in transformed cells and accordingly it is a malignancy marker. Yet, the mechanisms controlling its variable activity are unknown. We undertook the spectroscopic deciphering of its interactions with its lipidic environment in normal and malignant cells. ADA exists in two interconvertible forms, small (45 KD) and large (21OKD). The large form consists of two small catalytic subunits (55-ADA) and a dimeric complexing protein ADCP. The physiological role of ADCP was not known either. Our studies were carried out at three levels.: 1. Solution enzyme kinetics, 2. The interaction of 55-ADA with ADCP reconstituted in liposomes: Effect of cholesterol and 3. Multifrequency phase modulation spectrofluorometry of pyrene-labeled 55-ADA bound to ADCP on the membranes of normal and RSV or RSV Ts68 transformed chick embryo fibroblasts. We found: 1. ADCP has an allosteric regulatory role on 55-ADA, which may be of physiological relevance: It inhibits 55-ADA activity at low physiological adenosine concentrations but accelerates deamination at high substrate concentration. 2. When reconstituted in DMPC liposomes, it retains 55-ADA activity (in its absence the activity is lost) and upon rigidification with cholesterol, a three fold increase in 55-ADA activity is attained, contrary to ADCP's regulatory activity when free of lipids. 3. The reduced ADA activity in transformed chick embryo fibroblasts is associated with increased membrane lipid fluidity (reduced order parameter), reduced accessibility of ADCP and increase rotational dynamics of the complex. We thus obtained spectroscopic deciphering of the vertical motion of ADCP, controlled by lipid-protein interaction, resulting in variable activity of this malignancy marker.

  14. ArsR arsenic-resistance regulatory protein from Cupriavidus metallidurans CH34

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Y.; van der Lelie, D.; Monchy, S.

    The Cupriavidus metallidurans CH34 arsR gene, which is part of the arsRIC{sub 2}BC{sub 1}HP operon, and its putative arsenic-resistance regulatory protein were identified and characterized. The arsenic-induced transcriptome of C. metallidurans CH34 showed that the genes most upregulated in the presence of arsenate were all located within the ars operon, with none of the other numerous heavy metal resistance systems present in CH34 being induced. A transcriptional fusion between the luxCDABE operon and the arsR promoter/operator (P/O) region was used to confirm the in vivo induction of the ars operon by arsenite and arsenate. The arsR gene was cloned intomore » expression vectors allowing for the overexpression of the ArsR protein as either his-tagged or untagged protein. The ability of the purified ArsR proteins to bind to the ars P/O region was analyzed in vitro by gel mobility shift assays. ArsR showed an affinity almost exclusively to its own ars P/O region. Dissociation of ArsR and its P/O region was metal dependent, and based on decreasing degrees of dissociation three groups of heavy metals could be distinguished: As(III), Bi(III), Co(II), Cu(II), Ni(II); Cd(II); Pb(II) and Zn(II), while no dissociation was observed in the presence of As(V).« less

  15. Sterol regulatory element-binding protein 1 inhibitors decrease pancreatic cancer cell viability and proliferation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Siqingaowa,; Sekar, Sathiya; Gopalakrishnan, Venkat

    Sterol regulatory element-binding protein1 (SREBP1) is a key regulatory factor that controls lipid homeostasis. Overactivation of SREBP1 and elevated lipid biogenesis are considered the major characteristics in malignancies of prostate cancer, endometrial cancer, and glioblastoma. However, the impact of SREBP1 activation in the progression of pancreatic cancer has not been explored. The present study examines the effect of suppression of SREBP1 activation by its inhibitors like fatostatin and PF429242 besides analyzing the impact of inhibitory effects on SREBP1 downstream signaling cascade such as fatty acid synthase (FAS), hydroxymethylglutaryl-CoA reductase (HMGCoAR), stearoyl-CoA desaturase-1 (SCD-1), and tumor suppressor protein p53 in MIAmore » PaCa-2 pancreatic cancer cells. Both fatostatin and PF429242 inhibited the growth of MIA PaCa-2 cells in a time and concentration-dependent manner with maximal inhibition attained at 72 h time period with IC{sub 50} values of 14.5 μM and 24.5 μM respectively. Detailed Western blot analysis performed using fatostatin and PF429242 at 72 h time point led to significant decrease in the levels of the active form of SREBP1 and its downstream signaling proteins such as FAS, SCD-1 and HMGCoAR and the mutant form of tumor suppressor protein, p53, levels in comparison to the levels observed in vehicle treated control group of MIA PaCa-2 pancreatic cells over the same time period. Our in vitro data suggest that SREBP1 may contribute to pancreatic tumor growth and its inhibitors could be considered as a potential target in the management of pancreatic cancer cell proliferation. - Highlights: • A significant increase in SREBP1 levels was observed in MIA PaCa-2 cells. • Fatostatin and PF429242 suppress SREBP1 activation and its downstream signaling proteins expression. • The inhibition of SREBP1reduces tumor suppressor protein p53 in MIA PaCa-2 cells. • SREBP1 inhibition may be beneficial in treatment of

  16. Identification of a novel calcium binding motif based on the detection of sequence insertions in the animal peroxidase domain of bacterial proteins.

    PubMed

    Santamaría-Hernando, Saray; Krell, Tino; Ramos-González, María-Isabel

    2012-01-01

    Proteins of the animal heme peroxidase (ANP) superfamily differ greatly in size since they have either one or two catalytic domains that match profile PS50292. The orf PP_2561 of Pseudomonas putida KT2440 that we have called PepA encodes a two-domain ANP. The alignment of these domains with those of PepA homologues revealed a variable number of insertions with the consensus G-x-D-G-x-x-[GN]-[TN]-x-D-D. This motif has also been detected in the structure of pseudopilin (pdb 3G20), where it was found to be involved in Ca(2+) coordination although a sequence analysis did not reveal the presence of any known calcium binding motifs in this protein. Isothermal titration calorimetry revealed that a peptide containing this consensus motif bound specifically calcium ions with affinities ranging between 33-79 µM depending on the pH. Microcalorimetric titrations of the purified N-terminal ANP-like domain of PepA revealed Ca(2+) binding with a K(D) of 12 µM and stoichiometry of 1.25 calcium ions per protein monomer. This domain exhibited peroxidase activity after its reconstitution with heme. These data led to the definition of a novel calcium binding motif that we have termed PERCAL and which was abundantly present in animal peroxidase-like domains of bacterial proteins. Bacterial heme peroxidases thus possess two different types of calcium binding motifs, namely PERCAL and the related hemolysin type calcium binding motif, with the latter being located outside the catalytic domains and in their C-terminal end. A phylogenetic tree of ANP-like catalytic domains of bacterial proteins with PERCAL motifs, including single domain peroxidases, was divided into two major clusters, representing domains with and without PERCAL motif containing insertions. We have verified that the recently reported classification of bacterial heme peroxidases in two families (cd09819 and cd09821) is unrelated to these insertions. Sequences matching PERCAL were detected in all kingdoms of life.

  17. Diagnostic value of lactate, procalcitonin, ferritin, serum-C-reactive protein, and other biomarkers in bacterial and viral meningitis

    PubMed Central

    Sanaei Dashti, Anahita; Alizadeh, Shekoofan; Karimi, Abdullah; Khalifeh, Masoomeh; Shoja, Seyed Abdolmajid

    2017-01-01

    Abstract There are many difficulties distinguishing bacterial from viral meningitis that could be reasonably solved using biomarkers. The aim of this study was to evaluate lactate, procalcitonin (PCT), ferritin, serum-CRP (C-reactive protein), and other known biomarkers in differentiating bacterial meningitis from viral meningitis in children. All children aged 28 days to 14 years with suspected meningitis who were admitted to Mofid Children's Hospital, Tehran, between October 2012 and November 2013, were enrolled in this prospective cross-sectional study. Children were divided into 2 groups of bacterial and viral meningitis, based on the results of cerebrospinal fluid (CSF) culture, polymerase chain reaction, and cytochemical profile. Diagnostic values of CSF parameters (ferritin, PCT, absolute neutrophil count [ANC], white blood cell count, and lactate) and serum parameters (PCT, ferritin, CRP, and erythrocyte sedimentation rate [ESR]) were evaluated. Among 50 patients with meningitis, 12 were diagnosed with bacterial meningitis. Concentrations of all markers were significantly different between bacterial and viral meningitis, except for serum (P = .389) and CSF (P = .136) PCT. The best rates of area under the receiver operating characteristic (ROC) curve (AUC) were achieved by lactate (AUC = 0.923) and serum-CRP (AUC = 0.889). The best negative predictive values (NPV) for bacterial meningitis were attained by ANC (100%) and lactate (97.1%). The results of our study suggest that ferritin and PCT are not strong predictive biomarkers. A combination of low CSF lactate, ANC, ESR, and serum-CRP could reasonably rule out the bacterial meningitis. PMID:28858084

  18. Photoaffinity labeling of regulatory subunits of protein kinase A in cardiac cell fractions of rats

    NASA Technical Reports Server (NTRS)

    Mednieks, M. I.; Popova, I.; Grindeland, R. E.

    1992-01-01

    Photoaffinity labeling in heart tissue of rats flown on Cosmos 2044 was used to measure the regulatory (R) subunits of adenosine monophosphate-dependent protein kinase. A significant decrease of RII subunits in the particulate cell fraction extract (S2; P less than 0.05 in all cases) was observed when extracts of tissue samples from vivarium controls were compared with those from flight animals. Photoaffinity labeling of the soluble fraction (S1) was observed to be unaffected by spaceflight or any of the simulation conditions. Proteins of the S2 fraction constitute a minor (less than 10 percent) component of the total, whereas the S1 fraction contained most of the cell proteins. Changes in a relatively minor aspect of adenosine monophosphate-mediated reactions are considered to be representative of a metabolic effect.

  19. MemStar: a one-shot Escherichia coli-based approach for high-level bacterial membrane protein production.

    PubMed

    Lee, Chiara; Kang, Hae Joo; Hjelm, Anna; Qureshi, Abdul Aziz; Nji, Emmanuel; Choudhury, Hassanul; Beis, Konstantinos; de Gier, Jan-Willem; Drew, David

    2014-10-16

    Optimising membrane protein production yields in Escherichiacoli can be time- and resource-consuming. Here, we present a simple and effective Membrane protein Single shot amplification recipe: MemStar. This one-shot amplification recipe is based on the E. coli strain Lemo21(DE3), the PASM-5052 auto-induction medium and, contradictorily, an IPTG induction step. Using MemStar, production yields for most bacterial membrane proteins tested were improved to reach an average of 5 mg L(-1) per OD600 unit, which is significantly higher than yields obtained with other common production strategies. With MemStar, we have been able to obtain new structural information for several transporters, including the sodium/proton antiporter NapA. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  20. Indole-based novel small molecules for the modulation of bacterial signalling pathways.

    PubMed

    Biswas, Nripendra Nath; Kutty, Samuel K; Barraud, Nicolas; Iskander, George M; Griffith, Renate; Rice, Scott A; Willcox, Mark; Black, David StC; Kumar, Naresh

    2015-01-21

    Gram-negative bacteria such as Pseudomonas aeruginosa use N-acylated L-homoserine lactones (AHLs) as autoinducers (AIs) for quorum sensing (QS), a major regulatory and cell-to-cell communication system for social adaptation, virulence factor production, biofilm formation and antibiotic resistance. Some bacteria use indole moieties for intercellular signaling and as regulators of various bacterial phenotypes important for evading the innate host immune response and antimicrobial resistance. A range of natural and synthetic indole derivatives have been found to act as inhibitors of QS-dependent bacterial phenotypes, complementing the bactericidal ability of traditional antibiotics. In this work, various indole-based AHL mimics were designed and synthesized via the 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC·HCl) and N,N'-dicyclohexylcarbodiimide (DCC) mediated coupling reactions of a variety of substituted or unsubstituted aminoindoles with different alkanoic acids. All synthesized compounds were tested for QS inhibition using a P. aeruginosa QS reporter strain by measuring the amount of green fluorescent protein (GFP) production. Docking studies were performed to examine their potential to bind and therefore inhibit the target QS receptor protein. The most potent compounds 11a, 11d and 16a showed 44 to 65% inhibition of QS activity at 250 μM concentration, and represent promising drug leads for the further development of anti-QS antimicrobial compounds.

  1. Small regulatory RNA-induced growth rate heterogeneity of Bacillus subtilis.

    PubMed

    Mars, Ruben A T; Nicolas, Pierre; Ciccolini, Mariano; Reilman, Ewoud; Reder, Alexander; Schaffer, Marc; Mäder, Ulrike; Völker, Uwe; van Dijl, Jan Maarten; Denham, Emma L

    2015-03-01

    Isogenic bacterial populations can consist of cells displaying heterogeneous physiological traits. Small regulatory RNAs (sRNAs) could affect this heterogeneity since they act by fine-tuning mRNA or protein levels to coordinate the appropriate cellular behavior. Here we show that the sRNA RnaC/S1022 from the Gram-positive bacterium Bacillus subtilis can suppress exponential growth by modulation of the transcriptional regulator AbrB. Specifically, the post-transcriptional abrB-RnaC/S1022 interaction allows B. subtilis to increase the cell-to-cell variation in AbrB protein levels, despite strong negative autoregulation of the abrB promoter. This behavior is consistent with existing mathematical models of sRNA action, thus suggesting that induction of protein expression noise could be a new general aspect of sRNA regulation. Importantly, we show that the sRNA-induced diversity in AbrB levels generates heterogeneity in growth rates during the exponential growth phase. Based on these findings, we hypothesize that the resulting subpopulations of fast- and slow-growing B. subtilis cells reflect a bet-hedging strategy for enhanced survival of unfavorable conditions.

  2. Immunoregulatory and immunostimulatory responses of bacterial lysates in respiratory infections and asthma.

    PubMed

    Kearney, Sean Christopher; Dziekiewicz, Marcin; Feleszko, Wojciech

    2015-05-01

    This review focuses on the current understanding of the molecular mechanisms of bacterial lysates, evidence of an induction of innate immunity, and the interaction with immunoregulators, dendritic cells, and regulatory T cells. Clinical relevance is summarized based on the observed mechanisms of action of bacterial lysates. Academic Search Complete, CENTRAL, Health Source: Nursing/Academic Edition, MEDLINE, and Cochrane databases. Three independent researchers focused on primary and secondary end points in systematic reviews, meta-analyses, and randomized controlled trials using bacterial lysates as a verum group or within a subpopulation of larger studies. Interventional and observational studies on novel applications also were included. Preclinical studies included murine models focusing on toll-like receptors (TLRs) and regulatory T cells and on the relation with asthma and respiratory immunity. Bacterial lysates have been observed to induce synergistic TLR-2/6- and TLR-9-dependent innate immunity. It has positive outcomes in decreasing recurrent respiratory tract infections in childhood and adult chronic obstructive pulmonary disease. This class of immunostimulants shows some evidence of mitigating infection morbidity in children and decreasing the frequency of inflammatory episodes (ie, wheezing exacerbations) in children with asthma. Preclinical studies suggest that regulatory T cells can be induced by bacterial lysates and might attenuate T-helper cell type 2 allergic responses. Although successful prevention against all common respiratory pathogens is not possible, bacterial lysates seem capable of targeting specific immunocompetent cells through pathogen recognition receptor activation. Current challenges include clarifying the duality of immunoregulatory and immunostimulatory responses in children at risk for allergy. Larger clinical trials are required to elicit efficacy in allergy prevention. Copyright © 2015 American College of Allergy, Asthma

  3. Bacterial Dose-Dependent Role of G Protein-Coupled Receptor Kinase 5 in Escherichia coli-Induced Pneumonia.

    PubMed

    Packiriswamy, Nandakumar; Steury, Michael; McCabe, Ian C; Fitzgerald, Scott D; Parameswaran, Narayanan

    2016-05-01

    G protein-coupled receptor kinase 5 (GRK5) is a serine/threonine kinase previously shown to mediate polymicrobial sepsis-induced inflammation. The goal of the present study was to examine the role of GRK5 in monomicrobial pulmonary infection by using an intratracheal Escherichia coli infection model of pneumonia. We used sublethal and lethal doses of E. coli to examine the mechanistic differences between low-grade and high-grade inflammation induced by E. coli infection. With a sublethal dose of E. coli, GRK5 knockout (KO) mice exhibited higher plasma CXCL1/KC levels and enhanced lung neutrophil recruitment early after infection, and lower bacterial loads, than wild-type (WT) mice. The inflammatory response was also diminished, and resolution of inflammation advanced, in the lungs of GRK5 KO mice. In contrast to the reduced bacterial loads in GRK5 KO mice following a sublethal dose, at a lethal dose of E. coli, the bacterial burdens remained high in GRK5 KO mice relative to those in WT mice. This occurred in spite of enhanced plasma CXCL1 levels as well as neutrophil recruitment in the KO mice. But the recruited neutrophils (following high-dose infection) exhibited decreased CD11b expression and reduced reactive oxygen species production, suggesting decreased neutrophil activation or increased neutrophil exhaustion in the GRK5 KO mice. In agreement with the increased bacterial burden, KO mice showed poorer survival than WT mice following E. coli infection at a lethal dose. Overall, our data suggest that GRK5 negatively regulates CXCL1/KC levels during bacterial pneumonia but that the role of GRK5 in the clinical outcome in this model is dependent on the bacterial dose. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  4. Integrative FourD omics approach profiles the target network of the carbon storage regulatory system.

    PubMed

    Sowa, Steven W; Gelderman, Grant; Leistra, Abigail N; Buvanendiran, Aishwarya; Lipp, Sarah; Pitaktong, Areen; Vakulskas, Christopher A; Romeo, Tony; Baldea, Michael; Contreras, Lydia M

    2017-02-28

    Multi-target regulators represent a largely untapped area for metabolic engineering and anti-bacterial development. These regulators are complex to characterize because they often act at multiple levels, affecting proteins, transcripts and metabolites. Therefore, single omics experiments cannot profile their underlying targets and mechanisms. In this work, we used an Integrative FourD omics approach (INFO) that consists of collecting and analyzing systems data throughout multiple time points, using multiple genetic backgrounds, and multiple omics approaches (transcriptomics, proteomics and high throughput sequencing crosslinking immunoprecipitation) to evaluate simultaneous changes in gene expression after imposing an environmental stress that accentuates the regulatory features of a network. Using this approach, we profiled the targets and potential regulatory mechanisms of a global regulatory system, the well-studied carbon storage regulatory (Csr) system of Escherichia coli, which is widespread among bacteria. Using 126 sets of proteomics and transcriptomics data, we identified 136 potential direct CsrA targets, including 50 novel ones, categorized their behaviors into distinct regulatory patterns, and performed in vivo fluorescence-based follow up experiments. The results of this work validate 17 novel mRNAs as authentic direct CsrA targets and demonstrate a generalizable strategy to integrate multiple lines of omics data to identify a core pool of regulator targets. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Function of fusion regulatory proteins (FRPs) in immune cells and virus-infected cells.

    PubMed

    Tsurudome, M; Ito, Y

    2000-01-01

    Two molecules that regulate cell fusion have been identified and designated fusion regulatory protein-1 (FRP-1) and FRP-2. FRP-1 is a complex composed of a glycosylated heavy chain and a nonglycosylated light chain that are disulfide linked. FRP-1 heavy chain is identical to 4F2/CD98 heavy chain, whereas FRP-2 is identical to integrin alpha3 subunit. The FRP-1 heavy chain is a multifunctional molecule: that is, fusion regulator, amino acid transporter, integrin regulator, comitogenic factor, Na+-Ca2+ exchanger, oncogenic protein, and so on. Several aspects of the structure and function of the FRP-1 system are reviewed: fusion regulatory molecular mechanisms, cross-talk between the FRP-1 and integrin, the FRP-1 system as amino acid transporter, and FRP-1-mediated T-cell activation. The FRP-1 system is involved in virus-mediated cell fusion and multinucleated giant cell formation of blood monocytes. Monoclonal antibodies against human FRP-1 heavy chain induce polykaryocytes that have properties as osteoclasts. Multiple steps participate in molecular mechanisms regulating cell fusion. The FRP-1 heavy chain supports amino acid transport activity and the FRP-1 light chains have recently been cloned as amino acid transporters that require association with the heavy chain to exhibit their activity. Novel pathways for monocyte-dependent regulation of T-cell activation have recently been found that are mediated by the FRP-1 system. In conclusion, the FRP-1 molecules are essential factors for basic cellular functions.

  6. In-Culture Cross-Linking of Bacterial Cells Reveals Large-Scale Dynamic Protein-Protein Interactions at the Peptide Level.

    PubMed

    de Jong, Luitzen; de Koning, Edward A; Roseboom, Winfried; Buncherd, Hansuk; Wanner, Martin J; Dapic, Irena; Jansen, Petra J; van Maarseveen, Jan H; Corthals, Garry L; Lewis, Peter J; Hamoen, Leendert W; de Koster, Chris G

    2017-07-07

    Identification of dynamic protein-protein interactions at the peptide level on a proteomic scale is a challenging approach that is still in its infancy. We have developed a system to cross-link cells directly in culture with the special lysine cross-linker bis(succinimidyl)-3-azidomethyl-glutarate (BAMG). We used the Gram-positive model bacterium Bacillus subtilis as an exemplar system. Within 5 min extensive intracellular cross-linking was detected, while intracellular cross-linking in a Gram-negative species, Escherichia coli, was still undetectable after 30 min, in agreement with the low permeability in this organism for lipophilic compounds like BAMG. We were able to identify 82 unique interprotein cross-linked peptides with <1% false discovery rate by mass spectrometry and genome-wide database searching. Nearly 60% of the interprotein cross-links occur in assemblies involved in transcription and translation. Several of these interactions are new, and we identified a binding site between the δ and β' subunit of RNA polymerase close to the downstream DNA channel, providing a clue into how δ might regulate promoter selectivity and promote RNA polymerase recycling. Our methodology opens new avenues to investigate the functional dynamic organization of complex protein assemblies involved in bacterial growth. Data are available via ProteomeXchange with identifier PXD006287.

  7. The Protein Interaction Network of Bacteriophage Lambda with Its Host, Escherichia coli

    PubMed Central

    Blasche, Sonja; Wuchty, Stefan; Rajagopala, Seesandra V.

    2013-01-01

    Although most of the 73 open reading frames (ORFs) in bacteriophage λ have been investigated intensively, the function of many genes in host-phage interactions remains poorly understood. Using yeast two-hybrid screens of all lambda ORFs for interactions with its host Escherichia coli, we determined a raw data set of 631 host-phage interactions resulting in a set of 62 high-confidence interactions after multiple rounds of retesting. These links suggest novel regulatory interactions between the E. coli transcriptional network and lambda proteins. Targeted host proteins and genes required for lambda infection are enriched among highly connected proteins, suggesting that bacteriophages resemble interaction patterns of human viruses. Lambda tail proteins interact with both bacterial fimbrial proteins and E. coli proteins homologous to other phage proteins. Lambda appears to dramatically differ from other phages, such as T7, because of its unusually large number of modified and processed proteins, which reduces the number of host-virus interactions detectable by yeast two-hybrid screens. PMID:24049175

  8. Secreted bacterial effectors that inhibit host protein synthesis are critical for induction of the innate immune response to virulent Legionella pneumophila.

    PubMed

    Fontana, Mary F; Banga, Simran; Barry, Kevin C; Shen, Xihui; Tan, Yunhao; Luo, Zhao-Qing; Vance, Russell E

    2011-02-01

    The intracellular bacterial pathogen Legionella pneumophila causes an inflammatory pneumonia called Legionnaires' Disease. For virulence, L. pneumophila requires a Dot/Icm type IV secretion system that translocates bacterial effectors to the host cytosol. L. pneumophila lacking the Dot/Icm system is recognized by Toll-like receptors (TLRs), leading to a canonical NF-κB-dependent transcriptional response. In addition, L. pneumophila expressing a functional Dot/Icm system potently induces unique transcriptional targets, including proinflammatory genes such as Il23a and Csf2. Here we demonstrate that this Dot/Icm-dependent response, which we term the effector-triggered response (ETR), requires five translocated bacterial effectors that inhibit host protein synthesis. Upon infection of macrophages with virulent L. pneumophila, these five effectors caused a global decrease in host translation, thereby preventing synthesis of IκB, an inhibitor of the NF-κB transcription factor. Thus, macrophages infected with wildtype L. pneumophila exhibited prolonged activation of NF-κB, which was associated with transcription of ETR target genes such as Il23a and Csf2. L. pneumophila mutants lacking the five effectors still activated TLRs and NF-κB, but because the mutants permitted normal IκB synthesis, NF-κB activation was more transient and was not sufficient to fully induce the ETR. L. pneumophila mutants expressing enzymatically inactive effectors were also unable to fully induce the ETR, whereas multiple compounds or bacterial toxins that inhibit host protein synthesis via distinct mechanisms recapitulated the ETR when administered with TLR ligands. Previous studies have demonstrated that the host response to bacterial infection is induced primarily by specific microbial molecules that activate TLRs or cytosolic pattern recognition receptors. Our results add to this model by providing a striking illustration of how the host immune response to a virulent pathogen can also

  9. Hypothalamic AMP-activated protein kinase mediates counter-regulatory responses to hypoglycaemia in rats.

    PubMed

    Han, S-M; Namkoong, C; Jang, P G; Park, I S; Hong, S W; Katakami, H; Chun, S; Kim, S W; Park, J-Y; Lee, K-U; Kim, M-S

    2005-10-01

    Appropriate counter-regulatory hormonal responses are essential for recovery from hypoglycaemia. Although the hypothalamus is known to be involved in these responses, the molecular mechanisms have not been fully elucidated. AMP-activated protein kinase (AMPK) functions as a cellular energy sensor, being activated during energy depletion. As AMPK is expressed in the hypothalamus, an important site of neuroendocrine regulation, the present study was undertaken to determine whether hypothalamic AMPK mediates counter-regulatory responses to hypoglycaemia. Hypoglycaemia was induced by i.p. injection of regular insulin (6 U/kg) in Sprague-Dawley rats. Hypothalamic AMPK phosphorylation and activities were determined 1 h after i.p. insulin injection. To investigate the role of hypothalamic AMPK activation in mediating counter-regulatory responses, an AMPK inhibitor, compound C, was pre-administered intracerebroventricularly (i.c.v.) or dominant-negative (DN)-AMPK was overexpressed in the hypothalamus before induction of hypoglycaemia. Insulin-induced hypoglycaemia increased hypothalamic AMPK phosphorylation and alpha2-AMPK activities in rats. The change was significant in the arcuate nucleus/ventromedial hypothalamus (ARC/VMH) and paraventricular nuclei (PVN). Prior i.c.v. administration of compound C attenuated hypoglycaemia-induced increases in plasma concentrations of corticosterone, glucagon and catecholamines, resulting in severe and prolonged hypoglycaemia. ARC/VMH DN-AMPK overexpression impaired early counter-regulation, as evidenced by reduced glucagon and catecholamine responses. In contrast, PVN DN-AMPK overexpression attenuated late counter-regulation and corticosterone responses. Systemic hypoglycaemia causes hypothalamic AMPK activation, which is important for counter-regulatory hormonal responses. Our data indicate that hypothalamic AMPK acts as a fuel gauge, sensing the whole-body energy state and regulating not only energy homeostasis but also

  10. Central role of a bacterial two-component gene regulatory system of previously unknown function in pathogen persistence in human saliva.

    PubMed

    Shelburne, Samuel A; Sumby, Paul; Sitkiewicz, Izabela; Granville, Chanel; DeLeo, Frank R; Musser, James M

    2005-11-01

    The molecular genetic mechanisms used by bacteria to persist in humans are poorly understood. Group A Streptococcus (GAS) causes the majority of bacterial pharyngitis cases in humans and is prone to persistently inhabit the upper respiratory tract. To gain information about how GAS survives in and infects the oropharynx, we analyzed the transcriptome of a serotype M1 strain grown in saliva. The dynamic pattern of changes in transcripts of genes [spy0874/0875, herein named sptR and sptS (sptR/S), for saliva persistence] encoding a two-component gene regulatory system of unknown function suggested that SptR/S contributed to persistence of GAS in saliva. Consistent with this idea, an isogenic nonpolar mutant strain (DeltasptR) was dramatically less able to survive in saliva compared with the parental strain. Iterative expression microarray analysis of bacteria grown in saliva revealed that transcripts of several known and putative GAS virulence factor genes were decreased significantly in the DeltasptR mutant strain. Compared with the parental strain, the isogenic mutant strain also had altered transcripts of multiple genes encoding proteins involved in complex carbohydrate acquisition and utilization pathways. Western immunoblot analysis and real-time PCR analysis of GAS in throat swabs taken from humans with pharyngitis confirmed the findings. We conclude that SptR/S optimizes persistence of GAS in human saliva, apparently by strategically influencing metabolic pathways and virulence factor production. The discovery of a genetic program that significantly increased persistence of a major human pathogen in saliva enhances understanding of how bacteria survive in the host and suggests new therapeutic strategies.

  11. HOXA1 and TALE proteins display cross-regulatory interactions and form a combinatorial binding code on HOXA1 targets.

    PubMed

    De Kumar, Bony; Parker, Hugo J; Paulson, Ariel; Parrish, Mark E; Pushel, Irina; Singh, Narendra Pratap; Zhang, Ying; Slaughter, Brian D; Unruh, Jay R; Florens, Laurence; Zeitlinger, Julia; Krumlauf, Robb

    2017-09-01

    Hoxa1 has diverse functional roles in differentiation and development. We identify and characterize properties of regions bound by HOXA1 on a genome-wide basis in differentiating mouse ES cells. HOXA1-bound regions are enriched for clusters of consensus binding motifs for HOX, PBX, and MEIS, and many display co-occupancy of PBX and MEIS. PBX and MEIS are members of the TALE family and genome-wide analysis of multiple TALE members (PBX, MEIS, TGIF, PREP1, and PREP2) shows that nearly all HOXA1 targets display occupancy of one or more TALE members. The combinatorial binding patterns of TALE proteins define distinct classes of HOXA1 targets, which may create functional diversity. Transgenic reporter assays in zebrafish confirm enhancer activities for many HOXA1-bound regions and the importance of HOX-PBX and TGIF motifs for their regulation. Proteomic analyses show that HOXA1 physically interacts on chromatin with PBX, MEIS, and PREP family members, but not with TGIF, suggesting that TGIF may have an independent input into HOXA1-bound regions. Therefore, TALE proteins appear to represent a wide repertoire of HOX cofactors, which may coregulate enhancers through distinct mechanisms. We also discover extensive auto- and cross-regulatory interactions among the Hoxa1 and TALE genes, indicating that the specificity of HOXA1 during development may be regulated though a complex cross-regulatory network of HOXA1 and TALE proteins. This study provides new insight into a regulatory network involving combinatorial interactions between HOXA1 and TALE proteins. © 2017 De Kumar et al.; Published by Cold Spring Harbor Laboratory Press.

  12. Computational studies of the 2D self-assembly of bacterial microcompartment shell proteins

    NASA Astrophysics Data System (ADS)

    Mahalik, Jyoti; Brown, Kirsten; Cheng, Xiaolin; Fuentes-Cabrera, Miguel

    Bacterial microcomartments (BMCs) are subcellular organelles that exist within wide variety of bacteria and function like nano-reactors. Among the different types of BMCs known, the carboxysome has been studied the most. The carboxysomes plays an important role in the transport of metabolites across its outer proteinaceous shell. Plenty of studies have investigated the structure of this shell, yet little is known about its self-assembly . Understanding the self-assembly process of BMCs' shell might allow disrupting their functioning and designing new synthetic nano-reactors. We have investigated the self-assembly process of a major protein component of the carboxysome's shell using a Monte Carlo technique that employed a coarse-grained protein model that was calibrated with the all-atomistic potential of mean force. The simulations reveal that this protein self-assembles into clusters that resemble what were seen experimentally in 2D layers. Further analysis of the simulation results suggests that the 2D self-assembly of carboxysome's facets is driven by nucleation-growth process, which in turn could play an important role in the hierarchical self-assembly of BMCs' shell in general. 1. Science Undergraduate Laboratory Internships, ORNL 2. Oak Ridge Leadership Computing Facility, ORNL.

  13. Symmetry and scale orient Min protein patterns in shaped bacterial sculptures

    NASA Astrophysics Data System (ADS)

    Wu, Fabai; van Schie, Bas G. C.; Keymer, Juan E.; Dekker, Cees

    2015-08-01

    The boundary of a cell defines the shape and scale of its subcellular organization. However, the effects of the cell's spatial boundaries as well as the geometry sensing and scale adaptation of intracellular molecular networks remain largely unexplored. Here, we show that living bacterial cells can be ‘sculpted’ into defined shapes, such as squares and rectangles, which are used to explore the spatial adaptation of Min proteins that oscillate pole-to-pole in rod-shaped Escherichia coli to assist cell division. In a wide geometric parameter space, ranging from 2 × 1 × 1 to 11 × 6 × 1 μm3, Min proteins exhibit versatile oscillation patterns, sustaining rotational, longitudinal, diagonal, stripe and even transversal modes. These patterns are found to directly capture the symmetry and scale of the cell boundary, and the Min concentration gradients scale with the cell size within a characteristic length range of 3-6 μm. Numerical simulations reveal that local microscopic Turing kinetics of Min proteins can yield global symmetry selection, gradient scaling and an adaptive range, when and only when facilitated by the three-dimensional confinement of the cell boundary. These findings cannot be explained by previous geometry-sensing models based on the longest distance, membrane area or curvature, and reveal that spatial boundaries can facilitate simple molecular interactions to result in far more versatile functions than previously understood.

  14. Iron homeostasis during transfusional iron overload in beta-thalassemia and sickle cell disease: changes in iron regulatory protein, hepcidin, and ferritin expression.

    PubMed

    Jenkins, Zandra A; Hagar, Ward; Bowlus, Christopher L; Johansson, Hans E; Harmatz, Paul; Vichinsky, Elliott P; Theil, Elizabeth C

    2007-06-01

    Hypertransfusional (>8 transfusions/year) iron in liver biopsies collected immediately after transfusions in beta-thalassemia and sickle cell disease correlated with increased expression (RNA) for iron regulatory proteins 1 and 2 (3-, 9- to 11-fold) and hepcidin RNA: (5- to 8-fold) (each p <.01), while ferritin H and L RNA remained constant. A different H:L ferritin ratio in RNA (0.03) and protein (0.2-0.6) indicated disease-specific trends and suggests novel post-transcriptional effects. Increased iron regulatory proteins could stabilize the transferrin receptor mRNA and, thereby, iron uptake. Increased hepcidin, after correction of anemia by transfusion, likely reflects excess liver iron. Finally, the absence of a detectable change in ferritin mRNA indicates insufficient oxidative stress to significantly activate MARE/ARE promoters.

  15. Bacterial expansins and related proteins from the world of microbes

    DOE PAGES

    Georgelis, Nikolaos; Nikolaidis, Nikolas; Cosgrove, Daniel J.

    2015-04-02

    The discovery of microbial expansins emerged from studies of the mechanism of plant cell growth and the molecular basis of plant cell wall extensibility. Expansins are wall-loosening proteins that are universal in the plant kingdom and are also found in a small set of phylogenetically diverse bacteria, fungi, and other organisms, most of which colonize plant surfaces. They loosen plant cell walls without detectable lytic activity. Bacterial expansins have attracted considerable attention recently for their potential use in cellulosic biomass conversion for biofuel production, as a means to disaggregate cellulosic structures by nonlytic means (“amorphogenesis”). Evolutionary analysis indicates that microbialmore » expansins originated by multiple horizontal gene transfers from plants. Crystallographic analysis of BsEXLX1, the expansin from Bacillus subtilis, shows that microbial expansins consist of two tightly packed domains: the N-terminal domain D1 has a double-ψ β-barrel fold similar to glycosyl hydrolase family-45 enzymes but lacks catalytic residues usually required for hydrolysis; the C-terminal domain D2 has a unique β-sandwich fold with three co-linear aromatic residues that bind β-1,4-glucans by hydrophobic interactions. Genetic deletion of expansin in Bacillus and Clavibacter cripples their ability to colonize plant tissues. In this paper, we assess reports that expansin addition enhances cellulose breakdown by cellulase and compare expansins with distantly related proteins named swollenin, cerato-platanin, and loosenin. Finally, we end in a speculative vein about the biological roles of microbial expansins and their potential applications. Advances in this field will be aided by a deeper understanding of how these proteins modify cellulosic structures.« less

  16. Towards revealing the structure of bacterial inclusion bodies.

    PubMed

    Wang, Lei

    2009-01-01

    Protein aggregation is a widely observed phenomenon in human diseases, biopharmaceutical production, and biological research. Protein aggregates are generally classified as highly ordered, such as amyloid fibrils, or amorphous, such as bacterial inclusion bodies. Amyloid fibrils are elongated filaments with diameters of 6-12 nm, they are comprised of residue-specific cross-beta structure, and display characteristic properties, such as binding with amyloid-specific dyes. Amyloid fibrils are associated with dozens of human pathological conditions, including Alzheimer disease and prion diseases. Distinguished from amyloid fibrils, bacterial inclusion bodies display apparent amorphous morphology. Inclusion bodies are formed during high-level recombinant protein production, and formation of inclusion bodies is a major concern in biotechnology. Despite of the distinctive morphological difference, bacterial inclusion bodies have been found to have some amyloid-like properties, suggesting that they might contain structures similar to amyloid-like fibrils. Recent structural data further support this hypothesis, and this review summarizes the latest progress towards revealing the structural details of bacterial inclusion bodies.

  17. Insight into structural remodeling of the FlhA ring responsible for bacterial flagellar type III protein export

    PubMed Central

    2018-01-01

    The bacterial flagellum is a supramolecular motility machine. Flagellar assembly begins with the basal body, followed by the hook and finally the filament. A carboxyl-terminal cytoplasmic domain of FlhA (FlhAC) forms a nonameric ring structure in the flagellar type III protein export apparatus and coordinates flagellar protein export with assembly. However, the mechanism of this process remains unknown. We report that a flexible linker of FlhAC (FlhAL) is required not only for FlhAC ring formation but also for substrate specificity switching of the protein export apparatus from the hook protein to the filament protein upon completion of the hook structure. FlhAL was required for cooperative ring formation of FlhAC. Alanine substitutions of residues involved in FlhAC ring formation interfered with the substrate specificity switching, thereby inhibiting filament assembly at the hook tip. These observations lead us to propose a mechanistic model for export switching involving structural remodeling of FlhAC. PMID:29707633

  18. Noninvasive Measurement of Bacterial Intracellular pH on a Single-Cell Level with Green Fluorescent Protein and Fluorescence Ratio Imaging Microscopy

    PubMed Central

    Olsen, Katja N.; Budde, Birgitte B.; Siegumfeldt, Henrik; Rechinger, K. Björn; Jakobsen, Mogens; Ingmer, Hanne

    2002-01-01

    We show that a pH-sensitive derivative of the green fluorescent protein, designated ratiometric GFP, can be used to measure intracellular pH (pHi) in both gram-positive and gram-negative bacterial cells. In cells expressing ratiometric GFP, the excitation ratio (fluorescence intensity at 410 and 430 nm) is correlated to the pHi, allowing fast and noninvasive determination of pHi that is ideally suited for direct analysis of individual bacterial cells present in complex environments. PMID:12147523

  19. Quantitative phosphoproteomics reveals the role of protein arginine phosphorylation in the bacterial stress response.

    PubMed

    Schmidt, Andreas; Trentini, Débora Broch; Spiess, Silvia; Fuhrmann, Jakob; Ammerer, Gustav; Mechtler, Karl; Clausen, Tim

    2014-02-01

    Arginine phosphorylation is an emerging protein modification implicated in the general stress response of Gram-positive bacteria. The modification is mediated by the arginine kinase McsB, which phosphorylates and inactivates the heat shock repressor CtsR. In this study, we developed a mass spectrometric approach accounting for the peculiar chemical properties of phosphoarginine. The improved methodology was used to analyze the dynamic changes in the Bacillus subtilis arginine phosphoproteome in response to different stress situations. Quantitative analysis showed that a B. subtilis mutant lacking the YwlE arginine phosphatase accumulated a strikingly large number of arginine phosphorylations (217 sites in 134 proteins), however only a minor fraction of these sites was increasingly modified during heat shock or oxidative stress. The main targets of McsB-mediated arginine phosphorylation comprise central factors of the stress response system including the CtsR and HrcA heat shock repressors, as well as major components of the protein quality control system such as the ClpCP protease and the GroEL chaperonine. These findings highlight the impact of arginine phosphorylation in orchestrating the bacterial stress response.

  20. Regulatory protein BBD18 of the lyme disease spirochete: essential role during tick acquisition?

    PubMed

    Hayes, Beth M; Dulebohn, Daniel P; Sarkar, Amit; Tilly, Kit; Bestor, Aaron; Ambroggio, Xavier; Rosa, Patricia A

    2014-04-01

    The Lyme disease spirochete Borrelia burgdorferi senses and responds to environmental cues as it transits between the tick vector and vertebrate host. Failure to properly adapt can block transmission of the spirochete and persistence in either vector or host. We previously identified BBD18, a novel plasmid-encoded protein of B. burgdorferi, as a putative repressor of the host-essential factor OspC. In this study, we investigate the in vivo role of BBD18 as a regulatory protein, using an experimental mouse-tick model system that closely resembles the natural infectious cycle of B. burgdorferi. We show that spirochetes that have been engineered to constitutively produce BBD18 can colonize and persist in ticks but do not infect mice when introduced by either tick bite or needle inoculation. Conversely, spirochetes lacking BBD18 can persistently infect mice but are not acquired by feeding ticks. Through site-directed mutagenesis, we have demonstrated that abrogation of spirochete infection in mice by overexpression of BBD18 occurs only with bbd18 alleles that can suppress OspC synthesis. Finally, we demonstrate that BBD18-mediated regulation does not utilize a previously described ospC operator sequence required by B. burgdorferi for persistence in immunocompetent mice. These data lead us to conclude that BBD18 does not represent the putative repressor utilized by B. burgdorferi for the specific downregulation of OspC in the mammalian host. Rather, we suggest that BBD18 exhibits features more consistent with those of a global regulatory protein whose critical role occurs during spirochete acquisition by feeding ticks. IMPORTANCE Lyme disease, caused by Borrelia burgdorferi, is the most common arthropod-borne disease in North America. B. burgdorferi is transmitted to humans and other vertebrate hosts by ticks as they take a blood meal. Transmission between vectors and hosts requires the bacterium to sense changes in the environment and adapt. However, the mechanisms

  1. Autonomous microfluidic sample preparation system for protein profile-based detection of aerosolized bacterial cells and spores.

    PubMed

    Stachowiak, Jeanne C; Shugard, Erin E; Mosier, Bruce P; Renzi, Ronald F; Caton, Pamela F; Ferko, Scott M; Van de Vreugde, James L; Yee, Daniel D; Haroldsen, Brent L; VanderNoot, Victoria A

    2007-08-01

    For domestic and military security, an autonomous system capable of continuously monitoring for airborne biothreat agents is necessary. At present, no system meets the requirements for size, speed, sensitivity, and selectivity to warn against and lead to the prevention of infection in field settings. We present a fully automated system for the detection of aerosolized bacterial biothreat agents such as Bacillus subtilis (surrogate for Bacillus anthracis) based on protein profiling by chip gel electrophoresis coupled with a microfluidic sample preparation system. Protein profiling has previously been demonstrated to differentiate between bacterial organisms. With the goal of reducing response time, multiple microfluidic component modules, including aerosol collection via a commercially available collector, concentration, thermochemical lysis, size exclusion chromatography, fluorescent labeling, and chip gel electrophoresis were integrated together to create an autonomous collection/sample preparation/analysis system. The cycle time for sample preparation was approximately 5 min, while total cycle time, including chip gel electrophoresis, was approximately 10 min. Sensitivity of the coupled system for the detection of B. subtilis spores was 16 agent-containing particles per liter of air, based on samples that were prepared to simulate those collected by wetted cyclone aerosol collector of approximately 80% efficiency operating for 7 min.

  2. Regulation of Phagocyte Migration by Signal Regulatory Protein-Alpha Signaling

    PubMed Central

    Alvarez-Zarate, Julian; Matlung, Hanke L.; Matozaki, Takashi; Kuijpers, Taco W.; Maridonneau-Parini, Isabelle; van den Berg, Timo K.

    2015-01-01

    Signaling through the inhibitory receptor signal regulatory protein-alpha (SIRPα) controls effector functions in phagocytes. However, there are also indications that interactions between SIRPα and its ligand CD47 are involved in phagocyte transendothelial migration. We have investigated the involvement of SIRPα signaling in phagocyte migration in vitro and in vivo using mice that lack the SIRPα cytoplasmic tail. During thioglycolate-induced peritonitis in SIRPα mutant mice, both neutrophil and macrophage influx were found to occur, but to be significantly delayed. SIRPα signaling appeared to be essential for an optimal transendothelial migration and chemotaxis, and for the amoeboid type of phagocyte migration in 3-dimensional environments. These findings demonstrate, for the first time, that SIRPα signaling can directly control phagocyte migration, and this may contribute to the impaired inflammatory phenotype that has been observed in the absence of SIRPα signaling. PMID:26057870

  3. Regulation of Phagocyte Migration by Signal Regulatory Protein-Alpha Signaling.

    PubMed

    Alvarez-Zarate, Julian; Matlung, Hanke L; Matozaki, Takashi; Kuijpers, Taco W; Maridonneau-Parini, Isabelle; van den Berg, Timo K

    2015-01-01

    Signaling through the inhibitory receptor signal regulatory protein-alpha (SIRPα) controls effector functions in phagocytes. However, there are also indications that interactions between SIRPα and its ligand CD47 are involved in phagocyte transendothelial migration. We have investigated the involvement of SIRPα signaling in phagocyte migration in vitro and in vivo using mice that lack the SIRPα cytoplasmic tail. During thioglycolate-induced peritonitis in SIRPα mutant mice, both neutrophil and macrophage influx were found to occur, but to be significantly delayed. SIRPα signaling appeared to be essential for an optimal transendothelial migration and chemotaxis, and for the amoeboid type of phagocyte migration in 3-dimensional environments. These findings demonstrate, for the first time, that SIRPα signaling can directly control phagocyte migration, and this may contribute to the impaired inflammatory phenotype that has been observed in the absence of SIRPα signaling.

  4. Identification of the Zinc Finger Protein ZRANB2 as a Novel Maternal Lipopolysaccharide-binding Protein That Protects Embryos of Zebrafish against Gram-negative Bacterial Infections*

    PubMed Central

    Wang, Xia; Du, Xiaoyuan; Li, Hongyan; Zhang, Shicui

    2016-01-01

    Zinc finger ZRANB2 proteins are widespread in animals, but their functions and mechanisms remain poorly defined. Here we clearly demonstrate that ZRANB2 is a newly identified LPS-binding protein present abundantly in the eggs/embryos of zebrafish. We also show that recombinant ZRANB2 (rZRANB2) acts as a pattern recognition receptor capable of identifying the bacterial signature molecule LPS as well as binding the Gram-negative bacteria Escherichia coli, Vibrio anguilarum, and Aeromonas hydrophila and functions as an antibacterial effector molecule capable of directly killing the bacteria. Furthermore, we reveal that N-terminal residues 11–37 consisting of the first ZnF_RBZ domain are indispensable for ZRANB2 antimicrobial activity. Importantly, microinjection of rZRANB2 into early embryos significantly enhanced the resistance of the embryos against pathogenic A. hydrophila challenge, and this enhanced bacterial resistance was markedly reduced by co-injection of anti-ZRANB2 antibody. Moreover, precipitation of ZRANB2 in the embryo extracts by preincubation with anti-ZRANB2 antibody caused a marked decrease in the antibacterial activity of the extracts against the bacteria tested. In addition, the N-terminal peptide Z1/37 or Z11/37 with in vitro antibacterial activity also promoted the resistance of embryos against A. hydrophila, but the peptide Z38/198 without in vitro antibacterial activity did not. Collectively, these results indicate that ZRANB2 is a maternal LPS-binding protein that can protect the early embryos of zebrafish against pathogenic attacks, a novel role ever assigned to ZRANB2 proteins. This work also provides new insights into the immunological function of the zinc finger proteins that are widely distributed in various animals. PMID:26740623

  5. The Positive Regulatory Roles of the TIFY10 Proteins in Plant Responses to Alkaline Stress

    PubMed Central

    Zhu, Dan; Li, Rongtian; Liu, Xin; Sun, Mingzhe; Wu, Jing; Zhang, Ning; Zhu, Yanming

    2014-01-01

    The TIFY family is a novel plant-specific protein family, and is characterized by a conserved TIFY motif (TIFF/YXG). Our previous studies indicated the potential roles of TIFY10/11 proteins in plant responses to alkaline stress. In the current study, we focused on the regulatory roles and possible physiological and molecular basis of the TIFY10 proteins in plant responses to alkaline stress. We demonstrated the positive function of TIFY10s in alkaline responses by using the AtTIFY10a and AtTIFY10b knockout Arabidopsis, as evidenced by the relatively lower germination rates of attify10a and attify10b mutant seeds under alkaline stress. We also revealed that ectopic expression of GsTIFY10a in Medicago sativa promoted plant growth, and increased the NADP-ME activity, citric acid content and free proline content but decreased the MDA content of transgenic plants under alkaline stress. Furthermore, expression levels of the stress responsive genes including NADP-ME, CS, H+-ppase and P5CS were also up-regulated in GsTIFY10a transgenic plants under alkaline stress. Interestingly, GsTIFY10a overexpression increased the jasmonate content of the transgenic alfalfa. In addition, we showed that neither GsTIFY10a nor GsTIFY10e exhibited transcriptional activity in yeast cells. However, through Y2H and BiFc assays, we demonstrated that GsTIFY10a, not GsTIFY10e, could form homodimers in yeast cells and in living plant cells. As expected, we also demonstrated that GsTIFY10a and GsTIFY10e could heterodimerize with each other in both yeast and plant cells. Taken together, our results provided direct evidence supporting the positive regulatory roles of the TIFY10 proteins in plant responses to alkaline stress. PMID:25375909

  6. Recurrent rewiring and emergence of RNA regulatory networks.

    PubMed

    Wilinski, Daniel; Buter, Natascha; Klocko, Andrew D; Lapointe, Christopher P; Selker, Eric U; Gasch, Audrey P; Wickens, Marvin

    2017-04-04

    Alterations in regulatory networks contribute to evolutionary change. Transcriptional networks are reconfigured by changes in the binding specificity of transcription factors and their cognate sites. The evolution of RNA-protein regulatory networks is far less understood. The PUF (Pumilio and FBF) family of RNA regulatory proteins controls the translation, stability, and movements of hundreds of mRNAs in a single species. We probe the evolution of PUF-RNA networks by direct identification of the mRNAs bound to PUF proteins in budding and filamentous fungi and by computational analyses of orthologous RNAs from 62 fungal species. Our findings reveal that PUF proteins gain and lose mRNAs with related and emergent biological functions during evolution. We demonstrate at least two independent rewiring events for PUF3 orthologs, independent but convergent evolution of PUF4/5 binding specificity and the rewiring of the PUF4/5 regulons in different fungal lineages. These findings demonstrate plasticity in RNA regulatory networks and suggest ways in which their rewiring occurs.

  7. A peptide export-import control circuit modulating bacterial development regulates protein phosphatases of the phosphorelay.

    PubMed

    Perego, M

    1997-08-05

    The phosphorelay signal transduction system activates developmental transcription in sporulation of Bacillus subtilis by phosphorylation of aspartyl residues of the Spo0F and Spo0A response regulators. The phosphorylation level of these response regulators is determined by the opposing activities of protein kinases and protein aspartate phosphatases that interpret positive and negative signals for development in a signal integration circuit. The RapA protein aspartate phosphatase of the phosphorelay is regulated by a peptide that directly inhibits its activity. This peptide is proteolytically processed from an inactive pre-inhibitor protein encoded in the phrA gene. The pre-inhibitor is cleaved by the protein export apparatus to a putative pro-inhibitor that is further processed to the active inhibitor peptide and internalized by the oligopeptide permease. This export-import circuit is postulated to be a mechanism for timing phosphatase activity where the processing enzymes regulate the rate of formation of the active inhibitor. The processing events may, in turn, be controlled by a regulatory hierarchy. Chromosome sequencing has revealed several other phosphatase-prepeptide gene pairs in B. subtilis, suggesting that the use of this mechanism may be widespread in signal transduction.

  8. A peptide export–import control circuit modulating bacterial development regulates protein phosphatases of the phosphorelay

    PubMed Central

    Perego, Marta

    1997-01-01

    The phosphorelay signal transduction system activates developmental transcription in sporulation of Bacillus subtilis by phosphorylation of aspartyl residues of the Spo0F and Spo0A response regulators. The phosphorylation level of these response regulators is determined by the opposing activities of protein kinases and protein aspartate phosphatases that interpret positive and negative signals for development in a signal integration circuit. The RapA protein aspartate phosphatase of the phosphorelay is regulated by a peptide that directly inhibits its activity. This peptide is proteolytically processed from an inactive pre-inhibitor protein encoded in the phrA gene. The pre-inhibitor is cleaved by the protein export apparatus to a putative pro-inhibitor that is further processed to the active inhibitor peptide and internalized by the oligopeptide permease. This export–import circuit is postulated to be a mechanism for timing phosphatase activity where the processing enzymes regulate the rate of formation of the active inhibitor. The processing events may, in turn, be controlled by a regulatory hierarchy. Chromosome sequencing has revealed several other phosphatase–prepeptide gene pairs in B. subtilis, suggesting that the use of this mechanism may be widespread in signal transduction. PMID:9238025

  9. A single active trehalose-6-P synthase (TPS) and a family of putative regulatory TPS-like proteins in Arabidopsis.

    PubMed

    Vandesteene, Lies; Ramon, Matthew; Le Roy, Katrien; Van Dijck, Patrick; Rolland, Filip

    2010-03-01

    Higher plants typically do not produce trehalose in large amounts, but their genome sequences reveal large families of putative trehalose metabolism enzymes. An important regulatory role in plant growth and development is also emerging for the metabolic intermediate trehalose-6-P (T6P). Here, we present an update on Arabidopsis trehalose metabolism and a resource for further detailed analyses. In addition, we provide evidence that Arabidopsis encodes a single trehalose-6-P synthase (TPS) next to a family of catalytically inactive TPS-like proteins that might fulfill specific regulatory functions in actively growing tissues.

  10. The T4 Phage DNA Mimic Protein Arn Inhibits the DNA Binding Activity of the Bacterial Histone-like Protein H-NS*

    PubMed Central

    Ho, Chun-Han; Wang, Hao-Ching; Ko, Tzu-Ping; Chang, Yuan-Chih; Wang, Andrew H.-J.

    2014-01-01

    The T4 phage protein Arn (Anti restriction nuclease) was identified as an inhibitor of the restriction enzyme McrBC. However, until now its molecular mechanism remained unclear. In the present study we used structural approaches to investigate biological properties of Arn. A structural analysis of Arn revealed that its shape and negative charge distribution are similar to dsDNA, suggesting that this protein could act as a DNA mimic. In a subsequent proteomic analysis, we found that the bacterial histone-like protein H-NS interacts with Arn, implying a new function. An electrophoretic mobility shift assay showed that Arn prevents H-NS from binding to the Escherichia coli hns and T4 p8.1 promoters. In vitro gene expression and electron microscopy analyses also indicated that Arn counteracts the gene-silencing effect of H-NS on a reporter gene. Because McrBC and H-NS both participate in the host defense system, our findings suggest that T4 Arn might knock down these mechanisms using its DNA mimicking properties. PMID:25118281

  11. Expression of the recombinant bacterial outer surface protein A in tobacco chloroplasts leads to thylakoid localization and loss of photosynthesis.

    PubMed

    Hennig, Anna; Bonfig, Katharina; Roitsch, Thomas; Warzecha, Heribert

    2007-11-01

    Bacterial lipoproteins play crucial roles in host-pathogen interactions and pathogenesis and are important targets for the immune system. A prominent example is the outer surface protein A (OspA) of Borrelia burgdorferi, which has been efficiently used as a vaccine for the prevention of Lyme disease. In a previous study, OspA could be produced in tobacco chloroplasts in a lipidated and immunogenic form. To further explore the potential of chloroplasts for the production of bacterial lipoproteins, the role of the N-terminal leader sequence was investigated. The amount of recombinant OspA could be increased up to ten-fold by the variation of the insertion site in the chloroplast genome. Analysis of OspA mutants revealed that replacement of the invariant cysteine residue as well as deletion of the leader sequence abolishes palmitolyation of OspA. Also, decoration of OspA with an N-terminal eukaryotic lipidation motif does not lead to palmitoylation in chloroplasts. Strikingly, the bacterial signal peptide of OspA efficiently targets the protein to thylakoids, and causes a mutant phenotype. Plants accumulating OspA at 10% total soluble protein could not grow without exogenously supplied sugars and rapidly died after transfer to soil under greenhouse conditions. The plants were found to be strongly affected in photosystem II, as revealed by the analyses of temporal and spatial dynamics of photosynthetic activity by chlorophyll fluorescence imaging. Thus, overexpression of OspA in chloroplasts is limited by its concentration-dependent interference with essential functions of chloroplastic membranes required for primary metabolism.

  12. Crossroads between Bacterial and Mammalian Glycosyltransferases

    PubMed Central

    Brockhausen, Inka

    2014-01-01

    Bacterial glycosyltransferases (GT) often synthesize the same glycan linkages as mammalian GT; yet, they usually have very little sequence identity. Nevertheless, enzymatic properties, folding, substrate specificities, and catalytic mechanisms of these enzyme proteins may have significant similarity. Thus, bacterial GT can be utilized for the enzymatic synthesis of both bacterial and mammalian types of complex glycan structures. A comparison is made here between mammalian and bacterial enzymes that synthesize epitopes found in mammalian glycoproteins, and those found in the O antigens of Gram-negative bacteria. These epitopes include Thomsen–Friedenreich (TF or T) antigen, blood group O, A, and B, type 1 and 2 chains, Lewis antigens, sialylated and fucosylated structures, and polysialic acids. Many different approaches can be taken to investigate the substrate binding and catalytic mechanisms of GT, including crystal structure analyses, mutations, comparison of amino acid sequences, NMR, and mass spectrometry. Knowledge of the protein structures and functions helps to design GT for specific glycan synthesis and to develop inhibitors. The goals are to develop new strategies to reduce bacterial virulence and to synthesize vaccines and other biologically active glycan structures. PMID:25368613

  13. Protein phosphorylation and its role in archaeal signal transduction

    PubMed Central

    Esser, Dominik; Hoffmann, Lena; Pham, Trong Khoa; Bräsen, Christopher; Qiu, Wen; Wright, Phillip C.; Albers, Sonja-Verena; Siebers, Bettina

    2016-01-01

    Reversible protein phosphorylation is the main mechanism of signal transduction that enables cells to rapidly respond to environmental changes by controlling the functional properties of proteins in response to external stimuli. However, whereas signal transduction is well studied in Eukaryotes and Bacteria, the knowledge in Archaea is still rather scarce. Archaea are special with regard to protein phosphorylation, due to the fact that the two best studied phyla, the Euryarchaeota and Crenarchaeaota, seem to exhibit fundamental differences in regulatory systems. Euryarchaeota (e.g. halophiles, methanogens, thermophiles), like Bacteria and Eukaryotes, rely on bacterial-type two-component signal transduction systems (phosphorylation on His and Asp), as well as on the protein phosphorylation on Ser, Thr and Tyr by Hanks-type protein kinases. Instead, Crenarchaeota (e.g. acidophiles and (hyper)thermophiles) only depend on Hanks-type protein phosphorylation. In this review, the current knowledge of reversible protein phosphorylation in Archaea is presented. It combines results from identified phosphoproteins, biochemical characterization of protein kinases and protein phosphatases as well as target enzymes and first insights into archaeal signal transduction by biochemical, genetic and polyomic studies. PMID:27476079

  14. P2RP: a Web-based framework for the identification and analysis of regulatory proteins in prokaryotic genomes.

    PubMed

    Barakat, Mohamed; Ortet, Philippe; Whitworth, David E

    2013-04-20

    Regulatory proteins (RPs) such as transcription factors (TFs) and two-component system (TCS) proteins control how prokaryotic cells respond to changes in their external and/or internal state. Identification and annotation of TFs and TCSs is non-trivial, and between-genome comparisons are often confounded by different standards in annotation. There is a need for user-friendly, fast and convenient tools to allow researchers to overcome the inherent variability in annotation between genome sequences. We have developed the web-server P2RP (Predicted Prokaryotic Regulatory Proteins), which enables users to identify and annotate TFs and TCS proteins within their sequences of interest. Users can input amino acid or genomic DNA sequences, and predicted proteins therein are scanned for the possession of DNA-binding domains and/or TCS domains. RPs identified in this manner are categorised into families, unambiguously annotated, and a detailed description of their features generated, using an integrated software pipeline. P2RP results can then be outputted in user-specified formats. Biologists have an increasing need for fast and intuitively usable tools, which is why P2RP has been developed as an interactive system. As well as assisting experimental biologists to interrogate novel sequence data, it is hoped that P2RP will be built into genome annotation pipelines and re-annotation processes, to increase the consistency of RP annotation in public genomic sequences. P2RP is the first publicly available tool for predicting and analysing RP proteins in users' sequences. The server is freely available and can be accessed along with documentation at http://www.p2rp.org.

  15. Looping and clustering model for the organization of protein-DNA complexes on the bacterial genome

    NASA Astrophysics Data System (ADS)

    Walter, Jean-Charles; Walliser, Nils-Ole; David, Gabriel; Dorignac, Jérôme; Geniet, Frédéric; Palmeri, John; Parmeggiani, Andrea; Wingreen, Ned S.; Broedersz, Chase P.

    2018-03-01

    The bacterial genome is organized by a variety of associated proteins inside a structure called the nucleoid. These proteins can form complexes on DNA that play a central role in various biological processes, including chromosome segregation. A prominent example is the large ParB-DNA complex, which forms an essential component of the segregation machinery in many bacteria. ChIP-Seq experiments show that ParB proteins localize around centromere-like parS sites on the DNA to which ParB binds specifically, and spreads from there over large sections of the chromosome. Recent theoretical and experimental studies suggest that DNA-bound ParB proteins can interact with each other to condense into a coherent 3D complex on the DNA. However, the structural organization of this protein-DNA complex remains unclear, and a predictive quantitative theory for the distribution of ParB proteins on DNA is lacking. Here, we propose the looping and clustering model, which employs a statistical physics approach to describe protein-DNA complexes. The looping and clustering model accounts for the extrusion of DNA loops from a cluster of interacting DNA-bound proteins that is organized around a single high-affinity binding site. Conceptually, the structure of the protein-DNA complex is determined by a competition between attractive protein interactions and loop closure entropy of this protein-DNA cluster on the one hand, and the positional entropy for placing loops within the cluster on the other. Indeed, we show that the protein interaction strength determines the ‘tightness’ of the loopy protein-DNA complex. Thus, our model provides a theoretical framework for quantitatively computing the binding profiles of ParB-like proteins around a cognate (parS) binding site.

  16. Influence of energy supply on expression of genes encoding for lipogenic enzymes and regulatory proteins in growing beef steers

    USDA-ARS?s Scientific Manuscript database

    Forty crossbred beef steers were used to determine the effects metabolizable energy (ME) intake and of site and complexity of carbohydrate (CHO) infusion on expression of genes encoding lipogenic enzymes and regulatory proteins in subcutaneous (SC), mesenteric (MES) and omental (OM) adipose. Treatm...

  17. Enoyl-Acyl Carrier Protein Reductase I (FabI) Is Essential for the Intracellular Growth of Listeria monocytogenes

    PubMed Central

    Ericson, Megan E.; Frank, Matthew W.

    2016-01-01

    Enoyl-acyl carrier protein reductase catalyzes the last step in each elongation cycle of type II bacterial fatty acid synthesis and is a key regulatory protein in bacterial fatty acid synthesis. Genes of the facultative intracellular pathogen Listeria monocytogenes encode two functional enoyl-acyl carrier protein isoforms based on their ability to complement the temperature-sensitive growth phenotype of Escherichia coli strain JP1111 [fabI(Ts)]. The FabI isoform was inactivated by the FabI selective inhibitor AFN-1252, but the FabK isoform was not affected by the drug, as expected. Inhibition of FabI by AFN-1252 decreased endogenous fatty acid synthesis by 80% and lowered the growth rate of L. monocytogenes in laboratory medium. Robust exogenous fatty acid incorporation was not detected in L. monocytogenes unless the pathway was partially inactivated by AFN-1252 treatment. However, supplementation with exogenous fatty acids did not restore normal growth in the presence of AFN-1252. FabI inactivation prevented the intracellular growth of L. monocytogenes, showing that neither FabK nor the incorporation of host cellular fatty acids was sufficient to support the intracellular growth of L. monocytogenes. Our results show that FabI is the primary enoyl-acyl carrier protein reductase of type II bacterial fatty acid synthesis and is essential for the intracellular growth of L. monocytogenes. PMID:27736774

  18. Enoyl-Acyl Carrier Protein Reductase I (FabI) Is Essential for the Intracellular Growth of Listeria monocytogenes.

    PubMed

    Yao, Jiangwei; Ericson, Megan E; Frank, Matthew W; Rock, Charles O

    2016-12-01

    Enoyl-acyl carrier protein reductase catalyzes the last step in each elongation cycle of type II bacterial fatty acid synthesis and is a key regulatory protein in bacterial fatty acid synthesis. Genes of the facultative intracellular pathogen Listeria monocytogenes encode two functional enoyl-acyl carrier protein isoforms based on their ability to complement the temperature-sensitive growth phenotype of Escherichia coli strain JP1111 [fabI(Ts)]. The FabI isoform was inactivated by the FabI selective inhibitor AFN-1252, but the FabK isoform was not affected by the drug, as expected. Inhibition of FabI by AFN-1252 decreased endogenous fatty acid synthesis by 80% and lowered the growth rate of L. monocytogenes in laboratory medium. Robust exogenous fatty acid incorporation was not detected in L. monocytogenes unless the pathway was partially inactivated by AFN-1252 treatment. However, supplementation with exogenous fatty acids did not restore normal growth in the presence of AFN-1252. FabI inactivation prevented the intracellular growth of L. monocytogenes, showing that neither FabK nor the incorporation of host cellular fatty acids was sufficient to support the intracellular growth of L. monocytogenes Our results show that FabI is the primary enoyl-acyl carrier protein reductase of type II bacterial fatty acid synthesis and is essential for the intracellular growth of L. monocytogenes. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  19. [Metabolism of cholesterol and fatty acids in nephrotic syndrome and its regulation by sterol regulatory element binding proteins (SREBP's). Effect of soy protein consumption].

    PubMed

    Tovar, Armando; Manzano, Natalia; Torres, Nimbe

    2005-01-01

    Hyperlipidemia occurs during nephrotic syndrome (NS). It is known that cholesterol and fatty acid biosynthesis is controlled by the transcription factors sterol regulatory element binding proteins (SREBPs). Soy protein consumption reduces the concentration of these lipids, although its mechanism of action is not well known. The aim of the present study was to establish whether soy protein consumption reduces cholesterol and triglycerides levels by regulating of SREBPs. Male Wistar rats with experimental NS were studied for 64 days. The results showed that rats fed with soy protein had significantly lower plasma cholesterol and triglyceride concentrations as well as proteinuria than rats fed with casein diet. These decrements were associated with a decrease in the expression of SREBP-1 and fatty acid biosynthetic enzymes. In addition, Western blot analysis revealed that in nuclear extracts from hepatocytes of rats fed with soy protein, there was a lower concentration of SREBP-1 than in rats fed with casein. The results of this study indicate that consumption of a soy protein diet has beneficial effects on nephrotic syndrome.

  20. Learning and evolution in bacterial taxis: an operational amplifier circuit modeling the computational dynamics of the prokaryotic 'two component system' protein network.

    PubMed

    Di Paola, Vieri; Marijuán, Pedro C; Lahoz-Beltra, Rafael

    2004-01-01

    Adaptive behavior in unicellular organisms (i.e., bacteria) depends on highly organized networks of proteins governing purposefully the myriad of molecular processes occurring within the cellular system. For instance, bacteria are able to explore the environment within which they develop by utilizing the motility of their flagellar system as well as a sophisticated biochemical navigation system that samples the environmental conditions surrounding the cell, searching for nutrients or moving away from toxic substances or dangerous physical conditions. In this paper we discuss how proteins of the intervening signal transduction network could be modeled as artificial neurons, simulating the dynamical aspects of the bacterial taxis. The model is based on the assumption that, in some important aspects, proteins can be considered as processing elements or McCulloch-Pitts artificial neurons that transfer and process information from the bacterium's membrane surface to the flagellar motor. This simulation of bacterial taxis has been carried out on a hardware realization of a McCulloch-Pitts artificial neuron using an operational amplifier. Based on the behavior of the operational amplifier we produce a model of the interaction between CheY and FliM, elements of the prokaryotic two component system controlling chemotaxis, as well as a simulation of learning and evolution processes in bacterial taxis. On the one side, our simulation results indicate that, computationally, these protein 'switches' are similar to McCulloch-Pitts artificial neurons, suggesting a bridge between evolution and learning in dynamical systems at cellular and molecular levels and the evolutive hardware approach. On the other side, important protein 'tactilizing' properties are not tapped by the model, and this suggests further complexity steps to explore in the approach to biological molecular computing.

  1. Isolation of biologically active nanomaterial (inclusion bodies) from bacterial cells.

    PubMed

    Peternel, Spela; Komel, Radovan

    2010-09-10

    In recent years bacterial inclusion bodies (IBs) were recognised as highly pure deposits of active proteins inside bacterial cells. Such active nanoparticles are very interesting for further downstream protein isolation, as well as for many other applications in nanomedicine, cosmetic, chemical and pharmaceutical industry.To prepare large quantities of a high quality product, the whole bioprocess has to be optimised. This includes not only the cultivation of the bacterial culture, but also the isolation step itself, which can be of critical importance for the production process.To determine the most appropriate method for the isolation of biologically active nanoparticles, three methods for bacterial cell disruption were analyzed. In this study, enzymatic lysis and two mechanical methods, high-pressure homogenization and sonication, were compared.During enzymatic lysis the enzyme lysozyme was found to attach to the surface of IBs, and it could not be removed by simple washing. As this represents an additional impurity in the engineered nanoparticles, we concluded that enzymatic lysis is not the most suitable method for IBs isolation.During sonication proteins are released (lost) from the surface of IBs and thus the surface of IBs appears more porous when compared to the other two methods. We also found that the acoustic output power needed to isolate the IBs from bacterial cells actually damages proteins structures, thereby causing a reduction in biological activity.High-pressure homogenization also caused some damage to IBs, however the protein loss from the IBs was negligible. Furthermore, homogenization had no side-effects on protein biological activity. The study shows that among the three methods tested, homogenization is the most appropriate method for the isolation of active nanoparticles from bacterial cells.

  2. Partitioning of genetic variation between regulatory and coding gene segments: the predominance of software variation in genes encoding introvert proteins.

    PubMed

    Mitchison, A

    1997-01-01

    In considering genetic variation in eukaryotes, a fundamental distinction can be made between variation in regulatory (software) and coding (hardware) gene segments. For quantitative traits the bulk of variation, particularly that near the population mean, appears to reside in regulatory segments. The main exceptions to this rule concern proteins which handle extrinsic substances, here termed extrovert proteins. The immune system includes an unusually large proportion of this exceptional category, but even so its chief source of variation may well be polymorphism in regulatory gene segments. The main evidence for this view emerges from genome scanning for quantitative trait loci (QTL), which in the case of the immune system points to a major contribution of pro-inflammatory cytokine genes. Further support comes from sequencing of major histocompatibility complex (Mhc) class II promoters, where a high level of polymorphism has been detected. These Mhc promoters appear to act, in part at least, by gating the back-signal from T cells into antigen-presenting cells. Both these forms of polymorphism are likely to be sustained by the need for flexibility in the immune response. Future work on promoter polymorphism is likely to benefit from the input from genome informatics.

  3. NRF2-ome: an integrated web resource to discover protein interaction and regulatory networks of NRF2.

    PubMed

    Türei, Dénes; Papp, Diána; Fazekas, Dávid; Földvári-Nagy, László; Módos, Dezső; Lenti, Katalin; Csermely, Péter; Korcsmáros, Tamás

    2013-01-01

    NRF2 is the master transcriptional regulator of oxidative and xenobiotic stress responses. NRF2 has important roles in carcinogenesis, inflammation, and neurodegenerative diseases. We developed an online resource, NRF2-ome, to provide an integrated and systems-level database for NRF2. The database contains manually curated and predicted interactions of NRF2 as well as data from external interaction databases. We integrated NRF2 interactome with NRF2 target genes, NRF2 regulating TFs, and miRNAs. We connected NRF2-ome to signaling pathways to allow mapping upstream NRF2 regulatory components that could directly or indirectly influence NRF2 activity totaling 35,967 protein-protein and signaling interactions. The user-friendly website allows researchers without computational background to search, browse, and download the database. The database can be downloaded in SQL, CSV, BioPAX, SBML, PSI-MI, and in a Cytoscape CYS file formats. We illustrated the applicability of the website by suggesting a posttranscriptional negative feedback of NRF2 by MAFG protein and raised the possibility of a connection between NRF2 and the JAK/STAT pathway through STAT1 and STAT3. NRF2-ome can also be used as an evaluation tool to help researchers and drug developers to understand the hidden regulatory mechanisms in the complex network of NRF2.

  4. Proteomic analysis reveals O-GlcNAc modification on proteins with key regulatory functions in Arabidopsis.

    PubMed

    Xu, Shou-Ling; Chalkley, Robert J; Maynard, Jason C; Wang, Wenfei; Ni, Weimin; Jiang, Xiaoyue; Shin, Kihye; Cheng, Ling; Savage, Dasha; Hühmer, Andreas F R; Burlingame, Alma L; Wang, Zhi-Yong

    2017-02-21

    Genetic studies have shown essential functions of O-linked N -acetylglucosamine (O-GlcNAc) modification in plants. However, the proteins and sites subject to this posttranslational modification are largely unknown. Here, we report a large-scale proteomic identification of O-GlcNAc-modified proteins and sites in the model plant Arabidopsis thaliana Using lectin weak affinity chromatography to enrich modified peptides, followed by mass spectrometry, we identified 971 O-GlcNAc-modified peptides belonging to 262 proteins. The modified proteins are involved in cellular regulatory processes, including transcription, translation, epigenetic gene regulation, and signal transduction. Many proteins have functions in developmental and physiological processes specific to plants, such as hormone responses and flower development. Mass spectrometric analysis of phosphopeptides from the same samples showed that a large number of peptides could be modified by either O-GlcNAcylation or phosphorylation, but cooccurrence of the two modifications in the same peptide molecule was rare. Our study generates a snapshot of the O-GlcNAc modification landscape in plants, indicating functions in many cellular regulation pathways and providing a powerful resource for further dissecting these functions at the molecular level.

  5. Nitrosylation of Nitric-Oxide-Sensing Regulatory Proteins Containing [4Fe-4S] Clusters Gives Rise to Multiple Iron-Nitrosyl Complexes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Serrano, Pauline N.; Wang, Hongxin; Crack, Jason C.

    The reaction of protein-bound iron–sulfur (Fe-S) clusters with nitric oxide (NO) plays key roles in NO-mediated toxicity and signaling. Elucidation of the mechanism of the reaction of NO with DNA regulatory proteins that contain Fe-S clusters has been hampered by a lack of information about the nature of the iron-nitrosyl products formed. Herein, we report nuclear resonance vibrational spectroscopy (NRVS) and density functional theory (DFT) calculations that identify NO reaction products in WhiD and NsrR, regulatory proteins that use a [4Fe-4S] cluster to sense NO. This work reveals that nitrosylation yields multiple products structurally related to Roussin's Red Ester (RRE,more » [Fe 2(NO) 4(Cys) 2]) and Roussin's Black Salt (RBS, [Fe 4(NO) 7S 3]. In the latter case, the absence of 32S/ 34S shifts in the Fe-S region of the NRVS spectra suggest that a new species, Roussin's Black Ester (RBE), may be formed, in which one or more of the sulfide ligands is replaced by Cys thiolates.« less

  6. Structural basis for specific recognition of multiple mRNA targets by a PUF regulatory protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Yeming; Opperman, Laura; Wickens, Marvin

    2011-11-02

    Caenorhabditis elegans fem-3 binding factor (FBF) is a founding member of the PUMILIO/FBF (PUF) family of mRNA regulatory proteins. It regulates multiple mRNAs critical for stem cell maintenance and germline development. Here, we report crystal structures of FBF in complex with 6 different 9-nt RNA sequences, including elements from 4 natural mRNAs. These structures reveal that FBF binds to conserved bases at positions 1-3 and 7-8. The key specificity determinant of FBF vs. other PUF proteins lies in positions 4-6. In FBF/RNA complexes, these bases stack directly with one another and turn away from the RNA-binding surface. A short regionmore » of FBF is sufficient to impart its unique specificity and lies directly opposite the flipped bases. We suggest that this region imposes a flattened curvature on the protein; hence, the requirement for the additional nucleotide. The principles of FBF/RNA recognition suggest a general mechanism by which PUF proteins recognize distinct families of RNAs yet exploit very nearly identical atomic contacts in doing so.« less

  7. Structural basis for specific recognition of multiple mRNA targets by a PUF regulatory protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Yeming; Opperman, Laura; Wickens, Marvin

    2010-08-19

    Caenorhabditis elegans fem-3 binding factor (FBF) is a founding member of the PUMILIO/FBF (PUF) family of mRNA regulatory proteins. It regulates multiple mRNAs critical for stem cell maintenance and germline development. Here, we report crystal structures of FBF in complex with 6 different 9-nt RNA sequences, including elements from 4 natural mRNAs. These structures reveal that FBF binds to conserved bases at positions 1-3 and 7-8. The key specificity determinant of FBF vs. other PUF proteins lies in positions 4-6. In FBF/RNA complexes, these bases stack directly with one another and turn away from the RNA-binding surface. A short regionmore » of FBF is sufficient to impart its unique specificity and lies directly opposite the flipped bases. We suggest that this region imposes a flattened curvature on the protein; hence, the requirement for the additional nucleotide. The principles of FBF/RNA recognition suggest a general mechanism by which PUF proteins recognize distinct families of RNAs yet exploit very nearly identical atomic contacts in doing so.« less

  8. Towards revealing the structure of bacterial inclusion bodies

    PubMed Central

    2009-01-01

    Protein aggregation is a widely observed phenomenon in human diseases, biopharmaceutical production, and biological research. Protein aggregates are generally classified as highly ordered, such as amyloid fibrils, or amorphous, such as bacterial inclusion bodies. Amyloid fibrils are elongated filaments with diameters of 6–12 nm, they are comprised of residue-specific cross-β structure, and display characteristic properties, such as binding with amyloid-specific dyes. Amyloid fibrils are associated with dozens of human pathological conditions, including Alzheimer disease and prion diseases. Distinguished from amyloid fibrils, bacterial inclusion bodies display apparent amorphous morphology. Inclusion bodies are formed during high-level recombinant protein production, and formation of inclusion bodies is a major concern in biotechnology. Despite of the distinctive morphological difference, bacterial inclusion bodies have been found to have some amyloid-like properties, suggesting that they might contain structures similar to amyloid-like fibrils. Recent structural data further support this hypothesis, and this review summarizes the latest progress towards revealing the structural details of bacterial inclusion bodies. PMID:19806034

  9. Mitochondrial Fusion and ERK Activity Regulate Steroidogenic Acute Regulatory Protein Localization in Mitochondria

    PubMed Central

    Duarte, Alejandra; Castillo, Ana Fernanda; Podestá, Ernesto J.; Poderoso, Cecilia

    2014-01-01

    The rate-limiting step in the biosynthesis of steroid hormones, known as the transfer of cholesterol from the outer to the inner mitochondrial membrane, is facilitated by StAR, the Steroidogenic Acute Regulatory protein. We have described that mitochondrial ERK1/2 phosphorylates StAR and that mitochondrial fusion, through the up-regulation of a fusion protein Mitofusin 2, is essential during steroidogenesis. Here, we demonstrate that mitochondrial StAR together with mitochondrial active ERK and PKA are necessary for maximal steroid production. Phosphorylation of StAR by ERK is required for the maintenance of this protein in mitochondria, observed by means of over-expression of a StAR variant lacking the ERK phosphorylation residue. Mitochondrial fusion regulates StAR levels in mitochondria after hormone stimulation. In this study, Mitofusin 2 knockdown and mitochondrial fusion inhibition in MA-10 Leydig cells diminished StAR mRNA levels and concomitantly mitochondrial StAR protein. Together our results unveil the requirement of mitochondrial fusion in the regulation of the localization and mRNA abundance of StAR. We here establish the relevance of mitochondrial phosphorylation events in the correct localization of this key protein to exert its action in specialized cells. These discoveries highlight the importance of mitochondrial fusion and ERK phosphorylation in cholesterol transport by means of directing StAR to the outer mitochondrial membrane to achieve a large number of steroid molecules per unit of StAR. PMID:24945345

  10. Plant nitrogen regulatory P-PII polypeptides

    DOEpatents

    Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun

    2004-11-23

    The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the invention may be used to engineer organisms to overexpress wild-type or mutant P-PII regulatory protein. Engineered plants that overexpress or underexpress P-PII regulatory protein may have increased nitrogen assimilation capacity. Engineered organisms may be used to produce P-PII proteins which, in turn, can be used for a variety of purposes including in vitro screening of herbicides. P-PII nucleotide sequences have additional uses as probes for isolating additional genomic clones having the promoters of P-PII gene. P-PII promoters are light- and/or sucrose-inducible and may be advantageously used in genetic engineering of plants.

  11. Physical stress and bacterial colonization

    PubMed Central

    Otto, Michael

    2014-01-01

    Bacterial surface colonizers are subject to a variety of physical stresses. During the colonization of human epithelia such as on the skin or the intestinal mucosa, bacteria mainly have to withstand the mechanical stress of being removed by fluid flow, scraping, or epithelial turnover. To that end, they express a series of molecules to establish firm attachment to the epithelial surface, such as fibrillar protrusions (pili) and surface-anchored proteins that bind to human matrix proteins. In addition, some bacteria – in particular gut and urinary tract pathogens – use internalization by epithelial cells and other methods such as directed inhibition of epithelial turnover to ascertain continued association with the epithelial layer. Furthermore, many bacteria produce multi-layered agglomerations called biofilms with a sticky extracellular matrix, providing additional protection from removal. This review will give an overview over the mechanisms human bacterial colonizers have to withstand physical stresses with a focus on bacterial adhesion. PMID:25212723

  12. Alteration of intracellular protein expressions as a key mechanism of the deterioration of bacterial denitrification caused by copper oxide nanoparticles.

    PubMed

    Su, Yinglong; Zheng, Xiong; Chen, Yinguang; Li, Mu; Liu, Kun

    2015-10-28

    The increasing production and utilization of copper oxide nanoparticles (CuO NPs) result in the releases into the environment. However, the influence of CuO NPs on bacterial denitrification, one of the most important pathways to transform nitrate to dinitrogen in environment, has seldom been studied. Here we reported that CuO NPs caused a significant alteration of key protein expressions of a model denitrifier, Paracoccus denitrificans, leading to severe inhibition to denitrification. Total nitrogen removal efficiency was decreased from 98.3% to 62.1% with the increase of CuO NPs from 0.05 to 0.25 mg/L. Cellular morphology and integrity studies indicated that nanoparticles entered the cells. The proteomic bioinformatics analysis showed that CuO NPs caused regulation of proteins involved in nitrogen metabolism, electron transfer and substance transport. The down-regulation of GtsB protein (responsible for glucose transport) decreased the production of NADH (electron donor for denitrification). Also, the expressions of key electron-transfer proteins (including NADH dehydrogenase and cytochrome) were suppressed by CuO NPs, which adversely affected electrons transfer for denitrification. Further investigation revealed that CuO NPs significantly inhibited the expressions and catalytic activities of nitrate reductase and nitrite reductase. These results provided a fundamental understanding of the negative influences of CuO NPs on bacterial denitrification.

  13. Alteration of intracellular protein expressions as a key mechanism of the deterioration of bacterial denitrification caused by copper oxide nanoparticles

    PubMed Central

    Su, Yinglong; Zheng, Xiong; Chen, Yinguang; Li, Mu; Liu, Kun

    2015-01-01

    The increasing production and utilization of copper oxide nanoparticles (CuO NPs) result in the releases into the environment. However, the influence of CuO NPs on bacterial denitrification, one of the most important pathways to transform nitrate to dinitrogen in environment, has seldom been studied. Here we reported that CuO NPs caused a significant alteration of key protein expressions of a model denitrifier, Paracoccus denitrificans, leading to severe inhibition to denitrification. Total nitrogen removal efficiency was decreased from 98.3% to 62.1% with the increase of CuO NPs from 0.05 to 0.25 mg/L. Cellular morphology and integrity studies indicated that nanoparticles entered the cells. The proteomic bioinformatics analysis showed that CuO NPs caused regulation of proteins involved in nitrogen metabolism, electron transfer and substance transport. The down-regulation of GtsB protein (responsible for glucose transport) decreased the production of NADH (electron donor for denitrification). Also, the expressions of key electron-transfer proteins (including NADH dehydrogenase and cytochrome) were suppressed by CuO NPs, which adversely affected electrons transfer for denitrification. Further investigation revealed that CuO NPs significantly inhibited the expressions and catalytic activities of nitrate reductase and nitrite reductase. These results provided a fundamental understanding of the negative influences of CuO NPs on bacterial denitrification. PMID:26508362

  14. The germin-like protein OsGLP2-1 enhances resistance to fungal blast and bacterial blight in rice.

    PubMed

    Liu, Qing; Yang, Jianyuan; Yan, Shijuan; Zhang, Shaohong; Zhao, Junliang; Wang, Wenjuan; Yang, Tifeng; Wang, Xiaofei; Mao, Xingxue; Dong, Jingfang; Zhu, Xiaoyuan; Liu, Bin

    2016-11-01

    This is the first report that GLP gene (OsGLP2-1) is involved in panicle blast and bacterial blight resistance in rice. In addition to its resistance to blast and bacterial blight, OsGLP2-1 has also been reported to co-localize with a QTLs for sheath blight resistance in rice. These suggest that the disease resistance provided by OsGLP2-1 is quantitative and broad spectrum. Its good resistance to these major diseases in rice makes it to be a promising target in rice breeding. Rice (Oryza sativa) blast caused by Magnaporthe oryzae and bacterial blight caused by Xanthomonas oryzae pv. oryzae are the two most destructive rice diseases worldwide. Germin-like protein (GLP) gene family is one of the important defense gene families which have been reported to be involved in disease resistance in plants. Although GLP proteins have been demonstrated to positively regulate leaf blast resistance in rice, their involvement in resistance to panicle blast and bacterial blight, has not been reported. In this study, we reported that one of the rice GLP genes, OsGLP2-1, was significantly induced by blast fungus. Overexpression of OsGLP2-1 quantitatively enhanced resistance to leaf blast, panicle blast and bacterial blight. The temporal and spatial expression analysis revealed that OsGLP2-1is highly expressed in leaves and panicles and sub-localized in the cell wall. Compared with empty vector transformed (control) plants, the OsGLP2-1 overexpressing plants exhibited higher levels of H 2 O 2 both before and after pathogen inoculation. Moreover, OsGLP2-1 was significantly induced by jasmonic acid (JA). Overexpression of OsGLP2-1 induced three well-characterized defense-related genes which are associated in JA-dependent pathway after pathogen infection. Higher endogenous level of JA was also identified in OsGLP2-1 overexpressing plants than in control plants both before and after pathogen inoculation. Together, these results suggest that OsGLP2-1 functions as a positive regulator to

  15. The Regulatory Small RNA MarS Supports Virulence of Streptococcus pyogenes.

    PubMed

    Pappesch, Roberto; Warnke, Philipp; Mikkat, Stefan; Normann, Jana; Wisniewska-Kucper, Aleksandra; Huschka, Franziska; Wittmann, Maja; Khani, Afsaneh; Schwengers, Oliver; Oehmcke-Hecht, Sonja; Hain, Torsten; Kreikemeyer, Bernd; Patenge, Nadja

    2017-09-25

    Small regulatory RNAs (sRNAs) play a role in the control of bacterial virulence gene expression. In this study, we investigated an sRNA that was identified in Streptococcus pyogenes (group A Streptococcus, GAS) but is conserved throughout various streptococci. In a deletion strain, expression of mga, the gene encoding the multiple virulence gene regulator, was reduced. Accordingly, transcript and proteome analyses revealed decreased expression of several Mga-activated genes. Therefore, and because the sRNA was shown to interact with the 5' UTR of the mga transcript in a gel-shift assay, we designated it MarS for m ga-activating regulatory sRNA. Down-regulation of important virulence factors, including the antiphagocytic M-protein, led to increased susceptibility of the deletion strain to phagocytosis and reduced adherence to human keratinocytes. In a mouse infection model, the marS deletion mutant showed reduced dissemination to the liver, kidney, and spleen. Additionally, deletion of marS led to increased tolerance towards oxidative stress. Our in vitro and in vivo results indicate a modulating effect of MarS on virulence gene expression and on the pathogenic potential of GAS.

  16. The use of cell microinjection for the in vivo analysis of viral transcriptional regulatory protein domains.

    PubMed

    Green, Maurice; Thorburn, Andrew; Kern, Robert; Loewenstein, Paul M

    2007-01-01

    Microinjection of mammalian cells provides a powerful method for analyzing in vivo functions of viral genes and viral gene products. By microinjection, a controlled amount (ranging from several to many thousands of copies) of a viral or cellular gene, a protein product of a gene, a polypeptide fragment encoding a specific protein domain, or an RNA molecule can be delivered into a target cell and the functional consequences analyzed. Microinjection can be used to deliver antibody targeted to a specific protein domain in order to analyze the requirement of the protein for specific cell functions such as cell cycle progression, transcription of specific genes, or intracellular transport. This chapter describes examples of the successful use of microinjection to probe adenovirus E1A regulatory mechanisms. Detailed methods are provided for manual and semiautomatic microinjection of mammalian cells as well as bioassay protocols for microinjected cells including immunofluorescence, colorimetic, in situ hybridization, and autoradiography.

  17. Using synthetic bacterial enhancers to reveal a looping-based mechanism for quenching-like repression

    PubMed Central

    Brunwasser-Meirom, Michal; Pollak, Yaroslav; Goldberg, Sarah; Levy, Lior; Atar, Orna; Amit, Roee

    2016-01-01

    We explore a model for ‘quenching-like' repression by studying synthetic bacterial enhancers, each characterized by a different binding site architecture. To do so, we take a three-pronged approach: first, we compute the probability that a protein-bound dsDNA molecule will loop. Second, we use hundreds of synthetic enhancers to test the model's predictions in bacteria. Finally, we verify the mechanism bioinformatically in native genomes. Here we show that excluded volume effects generated by DNA-bound proteins can generate substantial quenching. Moreover, the type and extent of the regulatory effect depend strongly on the relative arrangement of the binding sites. The implications of these results are that enhancers should be insensitive to 10–11 bp insertions or deletions (INDELs) and sensitive to 5–6 bp INDELs. We test this prediction on 61 σ54-regulated qrr genes from the Vibrio genus and confirm the tolerance of these enhancers' sequences to the DNA's helical repeat. PMID:26832446

  18. Using synthetic bacterial enhancers to reveal a looping-based mechanism for quenching-like repression.

    PubMed

    Brunwasser-Meirom, Michal; Pollak, Yaroslav; Goldberg, Sarah; Levy, Lior; Atar, Orna; Amit, Roee

    2016-02-02

    We explore a model for 'quenching-like' repression by studying synthetic bacterial enhancers, each characterized by a different binding site architecture. To do so, we take a three-pronged approach: first, we compute the probability that a protein-bound dsDNA molecule will loop. Second, we use hundreds of synthetic enhancers to test the model's predictions in bacteria. Finally, we verify the mechanism bioinformatically in native genomes. Here we show that excluded volume effects generated by DNA-bound proteins can generate substantial quenching. Moreover, the type and extent of the regulatory effect depend strongly on the relative arrangement of the binding sites. The implications of these results are that enhancers should be insensitive to 10-11 bp insertions or deletions (INDELs) and sensitive to 5-6 bp INDELs. We test this prediction on 61 σ(54)-regulated qrr genes from the Vibrio genus and confirm the tolerance of these enhancers' sequences to the DNA's helical repeat.

  19. Structure of Thermotoga maritima TM0439: implications for the mechanism of bacterial GntR transcription regulators with Zn2+-binding FCD domains

    PubMed Central

    Zheng, Meiying; Cooper, David R.; Grossoehme, Nickolas E.; Yu, Minmin; Hung, Li-Wei; Cieslik, Marcin; Derewenda, Urszula; Lesley, Scott A.; Wilson, Ian A.; Giedroc, David P.; Derewenda, Zygmunt S.

    2009-01-01

    The GntR superfamily of dimeric transcription factors, with more than 6200 members encoded in bacterial genomes, are characterized by N-terminal winged-helix DNA-binding domains and diverse C-terminal regulatory domains which provide a basis for the classification of the constituent families. The largest of these families, FadR, contains nearly 3000 proteins with all-α-helical regulatory domains classified into two related Pfam families: FadR_C and FCD. Only two crystal structures of FadR-family members, those of Escherichia coli FadR protein and LldR from Corynebacterium glutamicum, have been described to date in the literature. Here, the crystal structure of TM0439, a GntR regulator with an FCD domain found in the Thermotoga maritima genome, is described. The FCD domain is similar to that of the LldR regulator and contains a buried metal-binding site. Using atomic absorption spectroscopy and Trp fluorescence, it is shown that the recombinant protein contains bound Ni2+ ions but that it is able to bind Zn2+ with K d < 70 nM. It is concluded that Zn2+ is the likely physiological metal and that it may perform either structural or regulatory roles or both. Finally, the TM0439 structure is compared with two other FadR-family structures recently deposited by structural genomics consortia. The results call for a revision in the classification of the FadR family of transcription factors. PMID:19307717

  20. Regulatory CD4 T cells inhibit HIV-1 expression of other CD4 T cell subsets via interactions with cell surface regulatory proteins.

    PubMed

    Zhang, Mingce; Robinson, Tanya O; Duverger, Alexandra; Kutsch, Olaf; Heath, Sonya L; Cron, Randy Q

    2018-03-01

    During chronic HIV-1 infection, regulatory CD4 T cells (Tregs) frequently represent the largest subpopulation of CD4 T cell subsets, implying relative resistant to HIV-1. When HIV-1 infection of CD4 T cells was explored in vitro and ex vivo from patient samples, Tregs possessed lower levels of HIV-1 DNA and RNA in comparison with conventional effector and memory CD4 T cells. Moreover, Tregs suppressed HIV-1 expression in other CD4 T cells in an in vitro co-culture system. This suppression was mediated in part via multiple inhibitory surface proteins expressed on Tregs. Antibody blockade of CTLA-4, PD-1, and GARP on Tregs resulted in increased HIV-1 DNA integration and mRNA expression in neighboring CD4 T cells. Moreover, antibody blockade of Tregs inhibitory proteins resulted in increased HIV-1 LTR transcription in co-cultured CD4 T cells. Thus, Tregs inhibit HIV-1 infection of other CD4 T cell subsets via interactions with inhibitory cell surface proteins. Copyright © 2018 Elsevier Inc. All rights reserved.

  1. The Evolution of the Secreted Regulatory Protein Progranulin.

    PubMed

    Palfree, Roger G E; Bennett, Hugh P J; Bateman, Andrew

    2015-01-01

    Progranulin is a secreted growth factor that is active in tumorigenesis, wound repair, and inflammation. Haploinsufficiency of the human progranulin gene, GRN, causes frontotemporal dementia. Progranulins are composed of chains of cysteine-rich granulin modules. Modules may be released from progranulin by proteolysis as 6kDa granulin polypeptides. Both intact progranulin and some of the granulin polypeptides are biologically active. The granulin module occurs in certain plant proteases and progranulins are present in early diverging metazoan clades such as the sponges, indicating their ancient evolutionary origin. There is only one Grn gene in mammalian genomes. More gene-rich Grn families occur in teleost fish with between 3 and 6 members per species including short-form Grns that have no tetrapod counterparts. Our goals are to elucidate progranulin and granulin module evolution by investigating (i): the origins of metazoan progranulins (ii): the evolutionary relationships between the single Grn of tetrapods and the multiple Grn genes of fish (iii): the evolution of granulin module architectures of vertebrate progranulins (iv): the conservation of mammalian granulin polypeptide sequences and how the conserved granulin amino acid sequences map to the known three dimensional structures of granulin modules. We report that progranulin-like proteins are present in unicellular eukaryotes that are closely related to metazoa suggesting that progranulin is among the earliest extracellular regulatory proteins still employed by multicellular animals. From the genomes of the elephant shark and coelacanth we identified contemporary representatives of a precursor for short-from Grn genes of ray-finned fish that is lost in tetrapods. In vertebrate Grns pathways of exon duplication resulted in a conserved module architecture at the amino-terminus that is frequently accompanied by an unusual pattern of tandem nearly identical module repeats near the carboxyl-terminus. Polypeptide

  2. Unraveling novel broad-spectrum antibacterial targets in food and waterborne pathogens using comparative genomics and protein interaction network analysis.

    PubMed

    Jadhav, Ankush; Shanmugham, Buvaneswari; Rajendiran, Anjana; Pan, Archana

    2014-10-01

    Food and waterborne diseases are a growing concern in terms of human morbidity and mortality worldwide, even in the 21st century, emphasizing the need for new therapeutic interventions for these diseases. The current study aims at prioritizing broad-spectrum antibacterial targets, present in multiple food and waterborne bacterial pathogens, through a comparative genomics strategy coupled with a protein interaction network analysis. The pathways unique and common to all the pathogens under study (viz., methane metabolism, d-alanine metabolism, peptidoglycan biosynthesis, bacterial secretion system, two-component system, C5-branched dibasic acid metabolism), identified by comparative metabolic pathway analysis, were considered for the analysis. The proteins/enzymes involved in these pathways were prioritized following host non-homology analysis, essentiality analysis, gut flora non-homology analysis and protein interaction network analysis. The analyses revealed a set of promising broad-spectrum antibacterial targets, present in multiple food and waterborne pathogens, which are essential for bacterial survival, non-homologous to host and gut flora, and functionally important in the metabolic network. The identified broad-spectrum candidates, namely, integral membrane protein/virulence factor (MviN), preprotein translocase subunits SecB and SecG, carbon storage regulator (CsrA), and nitrogen regulatory protein P-II 1 (GlnB), contributed by the peptidoglycan pathway, bacterial secretion systems and two-component systems, were also found to be present in a wide range of other disease-causing bacteria. Cytoplasmic proteins SecG, CsrA and GlnB were considered as drug targets, while membrane proteins MviN and SecB were classified as vaccine targets. The identified broad-spectrum targets can aid in the design and development of antibacterial agents not only against food and waterborne pathogens but also against other pathogens. Copyright © 2014 Elsevier B.V. All rights

  3. Quantitative Phosphoproteomics Reveals the Role of Protein Arginine Phosphorylation in the Bacterial Stress Response*

    PubMed Central

    Schmidt, Andreas; Trentini, Débora Broch; Spiess, Silvia; Fuhrmann, Jakob; Ammerer, Gustav; Mechtler, Karl; Clausen, Tim

    2014-01-01

    Arginine phosphorylation is an emerging protein modification implicated in the general stress response of Gram-positive bacteria. The modification is mediated by the arginine kinase McsB, which phosphorylates and inactivates the heat shock repressor CtsR. In this study, we developed a mass spectrometric approach accounting for the peculiar chemical properties of phosphoarginine. The improved methodology was used to analyze the dynamic changes in the Bacillus subtilis arginine phosphoproteome in response to different stress situations. Quantitative analysis showed that a B. subtilis mutant lacking the YwlE arginine phosphatase accumulated a strikingly large number of arginine phosphorylations (217 sites in 134 proteins), however only a minor fraction of these sites was increasingly modified during heat shock or oxidative stress. The main targets of McsB-mediated arginine phosphorylation comprise central factors of the stress response system including the CtsR and HrcA heat shock repressors, as well as major components of the protein quality control system such as the ClpCP protease and the GroEL chaperonine. These findings highlight the impact of arginine phosphorylation in orchestrating the bacterial stress response. PMID:24263382

  4. Type III secretion system effector proteins: double agents in bacterial disease and plant defense.

    PubMed

    Alfano, James R; Collmer, Alan

    2004-01-01

    Many phytopathogenic bacteria inject virulence effector proteins into plant cells via a Hrp type III secretion system (TTSS). Without the TTSS, these pathogens cannot defeat basal defenses, grow in plants, produce disease lesions in hosts, or elicit the hypersensitive response (HR) in nonhosts. Pathogen genome projects employing bioinformatic methods to identify TTSS Hrp regulon promoters and TTSS pathway targeting signals suggest that phytopathogenic Pseudomonas, Xanthomonas, and Ralstonia spp. harbor large arsenals of effectors. The Hrp TTSS employs customized cytoplasmic chaperones, conserved export components in the bacterial envelope (also used by the TTSS of animal pathogens), and a more specialized set of TTSS-secreted proteins to deliver effectors across the plant cell wall and plasma membrane. Many effectors can act as molecular double agents that betray the pathogen to plant defenses in some interactions and suppress host defenses in others. Investigations of the functions of effectors within plant cells have demonstrated the plasma membrane and nucleus as subcellular sites for several effectors, revealed some effectors to possess cysteine protease or protein tyrosine phosphatase activity, and provided new clues to the coevolution of bacterium-plant interactions.

  5. Electroporation of Functional Bacterial Effectors into Mammalian Cells

    DOE PAGES

    Sontag, Ryan L.; Mihai, Cosmin; Orr, Galya; ...

    2015-01-19

    Electroporation was used to insert purified bacterial virulence effector proteins directly into living eukaryotic cells. Protein localization was monitored by confocal immunofluorescence microscopy. This method allows for studies on trafficking, function, and protein-protein interactions using active exogenous proteins, avoiding the need for heterologous expression in eukaryotic cells.

  6. Towards Spectral Library-free MALDI-TOF MS Bacterial Identification.

    PubMed

    Cheng, Ding; Qiao, Liang; Horvatovich, Péter

    2018-05-11

    Bacterial identification is of great importance in clinical diagnosis, environmental monitoring and food safety control. Among various strategies, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) has drawn significant interests, and has been clinically used. Nevertheless, current bioinformatics solutions use spectral libraries for the identification of bacterial strains. Spectral library generation requires acquisition of MALDI-TOF spectra from monoculture bacterial colonies, which is time-consuming and not possible for many species and strains. We propose a strategy for bacterial typing by MALDI-TOF using protein sequences from public database, i.e. UniProt. Ten genes were identified to encode proteins most often observed by MALD-TOF from bacteria through 500 times repeated a 10-fold double cross-validation procedure, using 403 MALDI-TOF spectra corresponding to 14 genera, 81 species and 403 strains, and the protein sequences of 1276 species in UniProt. The 10 genes were then used to annotate peaks on MALDI-TOF spectra of bacteria for bacterial identification. With the approach, bacteria can be identified at the genus level by searching against a database containing the protein sequences of 42 genera of bacteria from UniProt. Our approach identified 84.1% of the 403 spectra correctly at the genus level. Source code of the algorithm is available at https://github.com/dipcarbon/BacteriaMSLF.

  7. Endosulfan induced alteration in bacterial protein profile and RNA yield of Klebsiella sp. M3, Achromobacter sp. M6, and Rhodococcus sp. M2.

    PubMed

    Singh, Madhu; Singh, Dileep Kumar

    2014-01-30

    Three bacterial strains identified as Klebsiella sp. M3, Achromobacter sp. M6 and Rhodococcus sp. M2 were isolated by soil enrichment with endosulfan followed by shake flask enrichment technique. They were efficiently degrading endosulfan in the NSM (non sulfur medium) broth. Degradation of endosulfan was faster with the cell free extract of bacterial cells grown in the sulfur deficient medium (NSM) supplemented with endosulfan than that of nutrient rich medium (Luria Bertani). In the cell free extract of NSM supplemented with endosulfan as sole sulfur source, a unique band was visualized on SDS-PAGE but not with magnesium sulfate as the sole sulfur source in NSM and LB with endosulfan. Expression of a unique polypeptide band was speculated to be induced by endosulfan under sulfur starved condition. These unique polypeptide bands were identified as OmpK35 protein, sulfate binding protein and outer membrane porin protein, respectively, in Klebsiella sp. M3, Achromobacter sp. M6 and Rhodococcus sp. M2. Endosulfan showed dose dependent negative effect on total RNA yield of bacterial strains in nutrient rich medium. Absence of plasmid DNA indicated the presence of endosulfan metabolizing gene on genomic DNA. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. [Biofilm: set-up and organization of a bacterial community].

    PubMed

    Filloux, Alain; Vallet, Isabelle

    2003-01-01

    Bacterial attachment on various surfaces mostly takes place in the form of specialised bacterial communities, referred to as biofilm. The biofilm is formed through series of interactions between cells and adherence to surface, resulting in an organised structure. In this review we have been using Pseudomonas aeruginosa as a model microorganism to describe the series of events that occurred during this developmental process. P. aeruginosa is an opportunistic pathogen that has a wide variety of hosts and infectious sites. In addition to biofilm formation in certain tissues, inert surfaces, such as catheters, are also target for bacterial biofilm development. The use of convenient genetic screens has made possible the identification of numerous biofilm-defective mutants, which have been characterised further. These studies have allowed the proposal for a global model, in which key events are described for the different stages of biofilm formation. Briefly, flagellar mobility is crucial for approaching the surface, whereas type IV pili motility is preponderant for surface colonisation and microcolonies formation. These microcolonies are finally packed together and buried in an exopolysaccharide matrix to form the differentiated bio-film. It is obvious that the different stages of biofilm formation also involved perception of environmental stimuli. These stimuli, and their associated complex regulatory networks, have still to be fully characterised to understand the bacterial strategy, which initiates biofilm formation. One such regulatory system, called Quorum sensing, is one of the key player in the initial differentiation of biofilm. Finally, a better understanding, at the molecular level, of biofilm establishment and persistence should help for the design of antimicrobials that prevent bacterial infections.

  9. Coordination of genomic structure and transcription by the main bacterial nucleoid-associated protein HU

    PubMed Central

    Berger, Michael; Farcas, Anca; Geertz, Marcel; Zhelyazkova, Petya; Brix, Klaudia; Travers, Andrew; Muskhelishvili, Georgi

    2010-01-01

    The histone-like protein HU is a highly abundant DNA architectural protein that is involved in compacting the DNA of the bacterial nucleoid and in regulating the main DNA transactions, including gene transcription. However, the coordination of the genomic structure and function by HU is poorly understood. Here, we address this question by comparing transcript patterns and spatial distributions of RNA polymerase in Escherichia coli wild-type and hupA/B mutant cells. We demonstrate that, in mutant cells, upregulated genes are preferentially clustered in a large chromosomal domain comprising the ribosomal RNA operons organized on both sides of OriC. Furthermore, we show that, in parallel to this transcription asymmetry, mutant cells are also impaired in forming the transcription foci—spatially confined aggregations of RNA polymerase molecules transcribing strong ribosomal RNA operons. Our data thus implicate HU in coordinating the global genomic structure and function by regulating the spatial distribution of RNA polymerase in the nucleoid. PMID:20010798

  10. Multiparametric Flow Cytometry Using Near-Infrared Fluorescent Proteins Engineered from Bacterial Phytochromes

    PubMed Central

    Telford, William G.; Shcherbakova, Daria M.; Buschke, David; Hawley, Teresa S.; Verkhusha, Vladislav V.

    2015-01-01

    Engineering of fluorescent proteins (FPs) has followed a trend of achieving longer fluorescence wavelengths, with the ultimate goal of producing proteins with both excitation and emission in the near-infrared (NIR) region of the spectrum. Flow cytometers are now almost universally equipped with red lasers, and can now be equipped with NIR lasers as well. Most red-shifted FPs of the GFP-like family are maximally excited by orange lasers (590 to 610 nm) not commonly found on cytometers. This has changed with the development of the iRFP series of NIR FPs from the protein family of bacterial phytochromes. The shortest wavelength variants of this series, iRFP670 and iRFP682 showed maximal excitation with visible red lasers. The longer wavelength variants iRFP702, iRFP713 and iRFP720 could be optimally excited by NIR lasers ranging from 685 to 730 nm. Pairs of iRFPs could be detected simultaneously by using red and NIR lasers. Moreover, a novel spectral cytometry technique, which relies on spectral deconvolution rather than optical filters, allowed spectra of all five iRFPs to be analyzed simultaneously with no spectral overlap. Together, the combination of iRFPs with the advanced flow cytometry will allow to first image tissues expressing iRFPs deep in live animals and then quantify individual cell intensities and sort out the distinct primary cell subpopulations ex vivo. PMID:25811854

  11. Multiparametric flow cytometry using near-infrared fluorescent proteins engineered from bacterial phytochromes.

    PubMed

    Telford, William G; Shcherbakova, Daria M; Buschke, David; Hawley, Teresa S; Verkhusha, Vladislav V

    2015-01-01

    Engineering of fluorescent proteins (FPs) has followed a trend of achieving longer fluorescence wavelengths, with the ultimate goal of producing proteins with both excitation and emission in the near-infrared (NIR) region of the spectrum. Flow cytometers are now almost universally equipped with red lasers, and can now be equipped with NIR lasers as well. Most red-shifted FPs of the GFP-like family are maximally excited by orange lasers (590 to 610 nm) not commonly found on cytometers. This has changed with the development of the iRFP series of NIR FPs from the protein family of bacterial phytochromes. The shortest wavelength variants of this series, iRFP670 and iRFP682 showed maximal excitation with visible red lasers. The longer wavelength variants iRFP702, iRFP713 and iRFP720 could be optimally excited by NIR lasers ranging from 685 to 730 nm. Pairs of iRFPs could be detected simultaneously by using red and NIR lasers. Moreover, a novel spectral cytometry technique, which relies on spectral deconvolution rather than optical filters, allowed spectra of all five iRFPs to be analyzed simultaneously with no spectral overlap. Together, the combination of iRFPs with the advanced flow cytometry will allow to first image tissues expressing iRFPs deep in live animals and then quantify individual cell intensities and sort out the distinct primary cell subpopulations ex vivo.

  12. Isolation of biologically active nanomaterial (inclusion bodies) from bacterial cells

    PubMed Central

    2010-01-01

    Background In recent years bacterial inclusion bodies (IBs) were recognised as highly pure deposits of active proteins inside bacterial cells. Such active nanoparticles are very interesting for further downstream protein isolation, as well as for many other applications in nanomedicine, cosmetic, chemical and pharmaceutical industry. To prepare large quantities of a high quality product, the whole bioprocess has to be optimised. This includes not only the cultivation of the bacterial culture, but also the isolation step itself, which can be of critical importance for the production process. To determine the most appropriate method for the isolation of biologically active nanoparticles, three methods for bacterial cell disruption were analyzed. Results In this study, enzymatic lysis and two mechanical methods, high-pressure homogenization and sonication, were compared. During enzymatic lysis the enzyme lysozyme was found to attach to the surface of IBs, and it could not be removed by simple washing. As this represents an additional impurity in the engineered nanoparticles, we concluded that enzymatic lysis is not the most suitable method for IBs isolation. During sonication proteins are released (lost) from the surface of IBs and thus the surface of IBs appears more porous when compared to the other two methods. We also found that the acoustic output power needed to isolate the IBs from bacterial cells actually damages proteins structures, thereby causing a reduction in biological activity. High-pressure homogenization also caused some damage to IBs, however the protein loss from the IBs was negligible. Furthermore, homogenization had no side-effects on protein biological activity. Conclusions The study shows that among the three methods tested, homogenization is the most appropriate method for the isolation of active nanoparticles from bacterial cells. PMID:20831775

  13. Transient Receptor Potential Channel 1 Deficiency Impairs Host Defense and Proinflammatory Responses to Bacterial Infection by Regulating Protein Kinase Cα Signaling.

    PubMed

    Zhou, Xikun; Ye, Yan; Sun, Yuyang; Li, Xuefeng; Wang, Wenxue; Privratsky, Breanna; Tan, Shirui; Zhou, Zongguang; Huang, Canhua; Wei, Yu-Quan; Birnbaumer, Lutz; Singh, Brij B; Wu, Min

    2015-08-01

    Transient receptor potential channel 1 (TRPC1) is a nonselective cation channel that is required for Ca(2+) homeostasis necessary for cellular functions. However, whether TRPC1 is involved in infectious disease remains unknown. Here, we report a novel function for TRPC1 in host defense against Gram-negative bacteria. TRPC1(-/-) mice exhibited decreased survival, severe lung injury, and systemic bacterial dissemination upon infection. Furthermore, silencing of TRPC1 showed decreased Ca(2+) entry, reduced proinflammatory cytokines, and lowered bacterial clearance. Importantly, TRPC1 functioned as an endogenous Ca(2+) entry channel critical for proinflammatory cytokine production in both alveolar macrophages and epithelial cells. We further identified that bacterium-mediated activation of TRPC1 was dependent on Toll-like receptor 4 (TLR4), which induced endoplasmic reticulum (ER) store depletion. After activation of phospholipase Cγ (PLC-γ), TRPC1 mediated Ca(2+) entry and triggered protein kinase Cα (PKCα) activity to facilitate nuclear translocation of NF-κB/Jun N-terminal protein kinase (JNK) and augment the proinflammatory response, leading to tissue damage and eventually mortality. These findings reveal that TRPC1 is required for host defense against bacterial infections through the TLR4-TRPC1-PKCα signaling circuit. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  14. Identifying Functional Mechanisms of Gene and Protein Regulatory Networks in Response to a Broader Range of Environmental Stresses

    PubMed Central

    Li, Cheng-Wei; Chen, Bor-Sen

    2010-01-01

    Cellular responses to sudden environmental stresses or physiological changes provide living organisms with the opportunity for final survival and further development. Therefore, it is an important topic to understand protective mechanisms against environmental stresses from the viewpoint of gene and protein networks. We propose two coupled nonlinear stochastic dynamic models to reconstruct stress-activated gene and protein regulatory networks via microarray data in response to environmental stresses. According to the reconstructed gene/protein networks, some possible mutual interactions, feedforward and feedback loops are found for accelerating response and filtering noises in these signaling pathways. A bow-tie core network is also identified to coordinate mutual interactions and feedforward loops, feedback inhibitions, feedback activations, and cross talks to cope efficiently with a broader range of environmental stresses with limited proteins and pathways. PMID:20454442

  15. Platelet cytosolic 44-kDa protein is a substrate of cholera toxin-induced ADP-ribosylation and is not recognized by antisera against the. alpha. subunit of the stimulatory guanine nucleotide-binding regulatory protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Molina Y Vedia, L.M.; Reep, B.R.; Lapetina, E.G.

    1988-08-01

    ADP-ribosylation induced by cholera toxin and pertussis toxin was studied in particulate and cytosolic fractions of human platelets. Platelets were disrupted by a cycle of freezing and thawing in the presence of a hyposmotic buffer containing protease inhibitors. In both fractions, the A subunit of cholera toxin ADP-ribosylates two proteins with molecular masses of 42 and 44 kDa, whereas pertussis toxin ADP-ribosylates a 41-kDa polypeptide. Two antisera against the {alpha} subunit of the stimulatory guanine nucleotide-binding regulatory protein recognize only the 42-kDa polypeptide. Cholera toxin-induced ADP-ribosylation of the 42- and 44-kDa proteins is reduced by pretreatment of platelets with iloprost,more » a prostacyclin analog. The 44-kDa protein, which is substrate of cholera toxin, could be extracted completely from the membrane and recovered in the cytosolic fraction when the cells were disrupted by Dounce homogenization and the pellet was extensively washed. A 44-kDa protein can also be labeled with 8-azidoguanosine 5{prime}-({alpha}-{sup 32}P)triphosphate in the cytosol and membranes. These finding indicate that cholera and pertussis toxins produced covalent modifications of proteins present in particulate and cytosolic platelet fractions. Moreover, the 44-kDa protein might be an {alpha} subunit of a guanine nucleotide-binding regulatory protein that is not recognized by available antisera.« less

  16. Electron-shuttling antibiotics structure bacterial communities by modulating cellular levels of c-di-GMP

    PubMed Central

    Okegbe, Chinweike; Fields, Blanche L.; Cole, Stephanie J.; Beierschmitt, Christopher; Morgan, Chase J.; Price-Whelan, Alexa; Stewart, Richard C.; Lee, Vincent T.; Dietrich, Lars E. P.

    2017-01-01

    Diverse organisms secrete redox-active antibiotics, which can be used as extracellular electron shuttles by resistant microbes. Shuttle-mediated metabolism can support survival when substrates are available not locally but rather at a distance. Such conditions arise in multicellular communities, where the formation of chemical gradients leads to resource limitation for cells at depth. In the pathogenic bacterium Pseudomonas aeruginosa PA14, antibiotics called phenazines act as oxidants to balance the intracellular redox state of cells in anoxic biofilm subzones. PA14 colony biofilms show a profound morphogenic response to phenazines resulting from electron acceptor-dependent inhibition of ECM production. This effect is reminiscent of the developmental responses of some eukaryotic systems to redox control, but for bacterial systems its mechanistic basis has not been well defined. Here, we identify the regulatory protein RmcA and show that it links redox conditions to PA14 colony morphogenesis by modulating levels of bis-(3′,5′)-cyclic-dimeric-guanosine (c-di-GMP), a second messenger that stimulates matrix production, in response to phenazine availability. RmcA contains four Per-Arnt-Sim (PAS) domains and domains with the potential to catalyze the synthesis and degradation of c-di-GMP. Our results suggest that phenazine production modulates RmcA activity such that the protein degrades c-di-GMP and thereby inhibits matrix production during oxidizing conditions. RmcA thus forms a mechanistic link between cellular redox sensing and community morphogenesis analogous to the functions performed by PAS-domain–containing regulatory proteins found in complex eukaryotes. PMID:28607054

  17. An internal regulatory element controls troponin I gene expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yutzey, K.E.; Kline, R.L.; Konieczmy, S.F.

    1989-04-01

    During skeletal myogenesis, approximately 20 contractile proteins and related gene products temporally accumulate as the cells fuse to form multinucleated muscle fibers. In most instances, the contractile protein genes are regulated transcriptionally, which suggests that a common molecular mechanism may coordinate the expression of this diverse and evolutionarily unrelated gene set. Recent studies have examined the muscle-specific cis-acting elements associated with numerous contractile protein genes. All of the identified regulatory elements are positioned in the 5'-flanking regions, usually within 1,500 base pairs of the transcription start site. Surprisingly, a DNA consensus sequence that is common to each contractile protein genemore » has not been identified. In contrast to the results of these earlier studies, the authors have found that the 5'-flanking region of the quail troponin I (TnI) gene is not sufficient to permit the normal myofiber transcriptional activation of the gene. Instead, the TnI gene utilizes a unique internal regulatory element that is responsible for the correct myofiber-specific expression pattern associated with the TnI gene. This is the first example in which a contractile protein gene has been shown to rely primarily on an internal regulatory element to elicit transcriptional activation during myogenesis. The diversity of regulatory elements associated with the contractile protein genes suggests that the temporal expression of the genes may involve individual cis-trans regulatory components specific for each gene.« less

  18. An internal regulatory element controls troponin I gene expression.

    PubMed Central

    Yutzey, K E; Kline, R L; Konieczny, S F

    1989-01-01

    During skeletal myogenesis, approximately 20 contractile proteins and related gene products temporally accumulate as the cells fuse to form multinucleated muscle fibers. In most instances, the contractile protein genes are regulated transcriptionally, which suggests that a common molecular mechanism may coordinate the expression of this diverse and evolutionarily unrelated gene set. Recent studies have examined the muscle-specific cis-acting elements associated with numerous contractile protein genes. All of the identified regulatory elements are positioned in the 5'-flanking regions, usually within 1,500 base pairs of the transcription start site. Surprisingly, a DNA consensus sequence that is common to each contractile protein gene has not been identified. In contrast to the results of these earlier studies, we have found that the 5'-flanking region of the quail troponin I (TnI) gene is not sufficient to permit the normal myofiber transcriptional activation of the gene. Instead, the TnI gene utilizes a unique internal regulatory element that is responsible for the correct myofiber-specific expression pattern associated with the TnI gene. This is the first example in which a contractile protein gene has been shown to rely primarily on an internal regulatory element to elicit transcriptional activation during myogenesis. The diversity of regulatory elements associated with the contractile protein genes suggests that the temporal expression of the genes may involve individual cis-trans regulatory components specific for each gene. Images PMID:2725509

  19. Regulatory T Cell and Forkhead Box Protein 3 as Modulators of Immune Homeostasis

    PubMed Central

    Pereira, Leonn Mendes Soares; Gomes, Samara Tatielle Monteiro; Ishak, Ricardo; Vallinoto, Antonio Carlos Rosário

    2017-01-01

    The transcription factor forkhead box protein 3 (FOXP3) is an essential molecular marker of regulatory T cell (Treg) development in different microenvironments. Tregs are cells specialized in the suppression of inadequate immune responses and the maintenance of homeostatic tolerance. Studies have addressed and elucidated the role played by FOXP3 and Treg in countless autoimmune and infectious diseases as well as in more specific cases, such as cancer. Within this context, the present article reviews aspects of the immunoregulatory profile of FOXP3 and Treg in the management of immune homeostasis, including issues relating to pathology as well as immune tolerance. PMID:28603524

  20. The HD-GYP domain, cyclic di-GMP signaling, and bacterial virulence to plants.

    PubMed

    Dow, J Maxwell; Fouhy, Yvonne; Lucey, Jean F; Ryan, Robert P

    2006-12-01

    Cyclic di-GMP is an almost ubiquitous second messenger in bacteria that was first described as an allosteric activator of cellulose synthase but is now known to regulate a range of functions, including virulence in human and animal pathogens. Two protein domains, GGDEF and EAL, are implicated in the synthesis and degradation, respectively, of cyclic di-GMP. These domains are widely distributed in bacteria, including plant pathogens. The majority of proteins with GGDEF and EAL domains contain additional signal input domains, suggesting that their activities are responsive to environmental cues. Recent studies have demonstrated that a third domain, HD-GYP, is also active in cyclic di-GMP degradation. In the plant pathogen Xanthomonas campestris pv. campestris, a two-component signal transduction system comprising the HD-GYP domain regulatory protein RpfG and cognate sensor RpfC positively controls virulence. The signals recognized by RpfC may include the cell-cell signal DSF, which also acts to regulate virulence in X. campestris pv. campestris. Here, we review these recent advances in our understanding of cyclic di-GMP signaling with particular reference to one or more roles in the bacterial pathogenesis of plants.

  1. Oral mucosal lipids are antibacterial against Porphyromonas gingivalis, induce ultrastructural damage, and alter bacterial lipid and protein compositions.

    PubMed

    Fischer, Carol L; Walters, Katherine S; Drake, David R; Dawson, Deborah V; Blanchette, Derek R; Brogden, Kim A; Wertz, Philip W

    2013-09-01

    Oral mucosal and salivary lipids exhibit potent antimicrobial activity for a variety of Gram-positive and Gram-negative bacteria; however, little is known about their spectrum of antimicrobial activity or mechanisms of action against oral bacteria. In this study, we examine the activity of two fatty acids and three sphingoid bases against Porphyromonas gingivalis, an important colonizer of the oral cavity implicated in periodontitis. Minimal inhibitory concentrations, minimal bactericidal concentrations, and kill kinetics revealed variable, but potent, activity of oral mucosal and salivary lipids against P. gingivalis, indicating that lipid structure may be an important determinant in lipid mechanisms of activity against bacteria, although specific components of bacterial membranes are also likely important. Electron micrographs showed ultrastructural damage induced by sapienic acid and phytosphingosine and confirmed disruption of the bacterial plasma membrane. This information, coupled with the association of treatment lipids with P. gingivalis lipids revealed via thin layer chromatography, suggests that the plasma membrane is a likely target of lipid antibacterial activity. Utilizing a combination of two-dimensional in-gel electrophoresis and Western blot followed by mass spectroscopy and N-terminus degradation sequencing we also show that treatment with sapienic acid induces upregulation of a set of proteins comprising a unique P. gingivalis stress response, including proteins important in fatty acid biosynthesis, metabolism and energy production, protein processing, cell adhesion and virulence. Prophylactic or therapeutic lipid treatments may be beneficial for intervention of infection by supplementing the natural immune function of endogenous lipids on mucosal surfaces.

  2. Aromatic inhibitors derived from ammonia-pretreated lignocellulose hinder bacterial ethanologenesis by activating regulatory circuits controlling inhibitor efflux and detoxification

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Keating, David H.; Zhang, Yaoping; Ong, Irene M.

    2014-08-13

    Efficient microbial conversion of lignocellulosic hydrolysates to biofuels is a key barrier to the economically viable deployment of lignocellulosic biofuels. A chief contributor to this barrier is the impact on microbial processes and energy metabolism of lignocellulose-derived inhibitors, including phenolic carboxylates, phenolic amides (for ammonia-pretreated biomass), phenolic aldehydes, and furfurals. To understand the bacterial pathways induced by inhibitors present in ammonia-pretreated biomass hydrolysates, which are less well studied than acid-pretreated biomass hydrolysates, we developed and exploited synthetic mimics of ammonia-pretreated corn stover hydrolysate (ACSH). To determine regulatory responses to the inhibitors normally present in ACSH, we measured transcript and proteinmore » levels in an Escherichia coli ethanologen using RNA-seq and quantitative proteomics during fermentation to ethanol of synthetic hydrolysates containing or lacking the inhibitors. Our study identified four major regulators mediating these responses, the MarA/SoxS/Rob network, AaeR, FrmR, and YqhC. Induction of these regulons was correlated with a reduced rate of ethanol production, buildup of pyruvate, depletion of ATP and NAD(P)H, and an inhibition of xylose conversion. The aromatic aldehyde inhibitor 5-hydroxymethylfurfural appeared to be reduced to its alcohol form by the ethanologen during fermentation, whereas phenolic acid and amide inhibitors were not metabolized. Together, our findings establish that the major regulatory responses to lignocellulose-derived inhibitors are mediated by transcriptional rather than translational regulators, suggest that energy consumed for inhibitor efflux and detoxification may limit biofuel production, and identify a network of regulators for future synthetic biology efforts.« less

  3. Molecular insights into the enzymatic diversity of flavin-trafficking protein (Ftp; formerly ApbE) in flavoprotein biogenesis in the bacterial periplasm.

    PubMed

    Deka, Ranjit K; Brautigam, Chad A; Liu, Wei Z; Tomchick, Diana R; Norgard, Michael V

    2016-02-01

    We recently reported a flavin-trafficking protein (Ftp) in the syphilis spirochete Treponema pallidum (Ftp_Tp) as the first bacterial metal-dependent FAD pyrophosphatase that hydrolyzes FAD into AMP and FMN in the periplasm. Orthologs of Ftp_Tp in other bacteria (formerly ApbE) appear to lack this hydrolytic activity; rather, they flavinylate the redox subunit, NqrC, via their metal-dependent FMN transferase activity. However, nothing has been known about the nature or mechanism of metal-dependent Ftp catalysis in either Nqr- or Rnf-redox-containing bacteria. In the current study, we identified a bimetal center in the crystal structure of Escherichia coli Ftp (Ftp_Ec) and show via mutagenesis that a single amino acid substitution converts it from an FAD-binding protein to a Mg(2+)-dependent FAD pyrophosphatase (Ftp_Tp-like). Furthermore, in the presence of protein substrates, both types of Ftps are capable of flavinylating periplasmic redox-carrying proteins (e.g., RnfG_Ec) via the metal-dependent covalent attachment of FMN. A high-resolution structure of the Ftp-mediated flavinylated protein of Shewanella oneidensis NqrC identified an essential lysine in phosphoester-threonyl-FMN bond formation in the posttranslationally modified flavoproteins. Together, these discoveries broaden our understanding of the physiological capabilities of the bacterial periplasm, and they also clarify a possible mechanism by which flavoproteins are generated. © 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  4. Positioning cell wall synthetic complexes by the bacterial morphogenetic proteins MreB and MreD.

    PubMed

    White, Courtney L; Kitich, Aleksandar; Gober, James W

    2010-05-01

    In Caulobacter crescentus, intact cables of the actin homologue, MreB, are required for the proper spatial positioning of MurG which catalyses the final step in peptidoglycan precursor synthesis. Similarly, in the periplasm, MreC controls the spatial orientation of the penicillin binding proteins and a lytic transglycosylase. We have now found that MreB cables are required for the organization of several other cytosolic murein biosynthetic enzymes such as MraY, MurB, MurC, MurE and MurF. We also show these proteins adopt a subcellular pattern of localization comparable to MurG, suggesting the existence of cytoskeletal-dependent interactions. Through extensive two-hybrid analyses, we have now generated a comprehensive interaction map of components of the bacterial morphogenetic complex. In the cytosol, this complex contains both murein biosynthetic enzymes and morphogenetic proteins, including RodA, RodZ and MreD. We show that the integral membrane protein, MreD, is essential for lateral peptidoglycan synthesis, interacts with the precursor synthesizing enzymes MurG and MraY, and additionally, determines MreB localization. Our results suggest that the interdependent localization of MreB and MreD functions to spatially organize a complex of peptidoglycan precursor synthesis proteins, which is required for propagation of a uniform cell shape and catalytically efficient peptidoglycan synthesis.

  5. Proteomic analysis of the bacterial cell cycle

    PubMed Central

    Grünenfelder, Björn; Rummel, Gabriele; Vohradsky, Jiri; Röder, Daniel; Langen, Hanno; Jenal, Urs

    2001-01-01

    A global approach was used to analyze protein synthesis and stability during the cell cycle of the bacterium Caulobacter crescentus. Approximately one-fourth (979) of the estimated C. crescentus gene products were detected by two-dimensional gel electrophoresis, 144 of which showed differential cell cycle expression patterns. Eighty-one of these proteins were identified by mass spectrometry and were assigned to a wide variety of functional groups. Pattern analysis revealed that coexpression groups were functionally clustered. A total of 48 proteins were rapidly degraded in the course of one cell cycle. More than half of these unstable proteins were also found to be synthesized in a cell cycle-dependent manner, establishing a strong correlation between rapid protein turnover and the periodicity of the bacterial cell cycle. This is, to our knowledge, the first evidence for a global role of proteolysis in bacterial cell cycle control. PMID:11287652

  6. An RNA electrophoretic mobility shift and mutational analysis of rnp-4f 5′-UTR intron splicing regulatory proteins in Drosophila reveals a novel new role for a dADAR protein isoform

    PubMed Central

    Lakshmi, G. Girija; Ghosh, Sushmita; Jones, Gabriel P.; Parikh, Roshni; Rawlins, Bridgette A.; Vaughn, Jack C.

    2014-01-01

    Alternative splicing greatly enhances the diversity of proteins encoded by eukaryotic genomes, and is also important in gene expression control. In contrast to the great depth of knowledge as to molecular mechanisms in the splicing pathway itself, relatively little is known about the regulatory events behind this process. The 5′-UTR and 3′-UTR in pre-mRNAs play a variety of roles in controlling eukaryotic gene expression, including translational modulation, and nearly 4,000 of the roughly 14,000 protein coding genes in Drosophila contain introns of unknown functional significance in their 5′-UTR. Here we report the results of an RNA electrophoretic mobility shift analysis of Drosophila rnp-4f 5′-UTR intron 0 splicing regulatory proteins. The pre-mRNA potential regulatory element consists of an evolutionarily-conserved 177-nt stem-loop arising from pairing of intron 0 with part of adjacent exon 2. Incubation of in vitro transcribed probe with embryo protein extract is shown to result in two shifted RNA-protein bands, and protein extract from a dADAR null mutant fly line results in only one shifted band. A mutated stem-loop in which the conserved exon 2 primary sequence is changed but secondary structure maintained by introducing compensatory base changes results in diminished band shifts. To test the hypothesis that dADAR plays a role in intron splicing regulation in vivo, levels of unspliced rnp-4f mRNA in dADAR mutant were compared to wild-type via real-time qRT-PCR. The results show that during embryogenesis unspliced rnp-4f mRNA levels fall by up to 85% in the mutant, in support of the hypothesis. Taken together, these results demonstrate a novel role for dADAR protein in rnp-4f 5′-UTR alternative intron splicing regulation which is consistent with a previously proposed model. PMID:23026215

  7. Network perturbation by recurrent regulatory variants in cancer

    PubMed Central

    Cho, Ara; Lee, Insuk; Choi, Jung Kyoon

    2017-01-01

    Cancer driving genes have been identified as recurrently affected by variants that alter protein-coding sequences. However, a majority of cancer variants arise in noncoding regions, and some of them are thought to play a critical role through transcriptional perturbation. Here we identified putative transcriptional driver genes based on combinatorial variant recurrence in cis-regulatory regions. The identified genes showed high connectivity in the cancer type-specific transcription regulatory network, with high outdegree and many downstream genes, highlighting their causative role during tumorigenesis. In the protein interactome, the identified transcriptional drivers were not as highly connected as coding driver genes but appeared to form a network module centered on the coding drivers. The coding and regulatory variants associated via these interactions between the coding and transcriptional drivers showed exclusive and complementary occurrence patterns across tumor samples. Transcriptional cancer drivers may act through an extensive perturbation of the regulatory network and by altering protein network modules through interactions with coding driver genes. PMID:28333928

  8. Bacterial-based systems for expression and purification of recombinant Lassa virus proteins of immunological relevance

    PubMed Central

    Branco, Luis M; Matschiner, Alex; Fair, Joseph N; Goba, Augustine; Sampey, Darryl B; Ferro, Philip J; Cashman, Kathleen A; Schoepp, Randal J; Tesh, Robert B; Bausch, Daniel G; Garry, Robert F; Guttieri, Mary C

    2008-01-01

    Background There is a significant requirement for the development and acquisition of reagents that will facilitate effective diagnosis, treatment, and prevention of Lassa fever. In this regard, recombinant Lassa virus (LASV) proteins may serve as valuable tools in diverse antiviral applications. Bacterial-based systems were engineered for expression and purification of recombinant LASV nucleoprotein (NP), glycoprotein 1 (GP1), and glycoprotein 2 (GP2). Results Full-length NP and the ectodomains of GP1 and GP2 were generated as maltose-binding protein (MBP) fusions in the Rosetta strains of Escherichia coli (E. coli) using pMAL-c2x vectors. Average fusion protein yields per liter of culture for MBP-NP, MBP-GP1, and MBP-GP2 were 10 mg, 9 mg, and 9 mg, respectively. Each protein was captured from cell lysates using amylose resin, cleaved with Factor Xa, and purified using size-exclusion chromatography (SEC). Fermentation cultures resulted in average yields per liter of 1.6 mg, 1.5 mg, and 0.7 mg of purified NP, GP1 and GP2, respectively. LASV-specific antibodies in human convalescent sera specifically detected each of the purified recombinant LASV proteins, highlighting their utility in diagnostic applications. In addition, mouse hyperimmune ascitic fluids (MHAF) against a panel of Old and New World arenaviruses demonstrated selective cross reactivity with LASV proteins in Western blot and enzyme-linked immunosorbent assay (ELISA). Conclusion These results demonstrate the potential for developing broadly reactive immunological assays that employ all three arenaviral proteins individually and in combination. PMID:18538016

  9. APG: an Active Protein-Gene network model to quantify regulatory signals in complex biological systems.

    PubMed

    Wang, Jiguang; Sun, Yidan; Zheng, Si; Zhang, Xiang-Sun; Zhou, Huarong; Chen, Luonan

    2013-01-01

    Synergistic interactions among transcription factors (TFs) and their cofactors collectively determine gene expression in complex biological systems. In this work, we develop a novel graphical model, called Active Protein-Gene (APG) network model, to quantify regulatory signals of transcription in complex biomolecular networks through integrating both TF upstream-regulation and downstream-regulation high-throughput data. Firstly, we theoretically and computationally demonstrate the effectiveness of APG by comparing with the traditional strategy based only on TF downstream-regulation information. We then apply this model to study spontaneous type 2 diabetic Goto-Kakizaki (GK) and Wistar control rats. Our biological experiments validate the theoretical results. In particular, SP1 is found to be a hidden TF with changed regulatory activity, and the loss of SP1 activity contributes to the increased glucose production during diabetes development. APG model provides theoretical basis to quantitatively elucidate transcriptional regulation by modelling TF combinatorial interactions and exploiting multilevel high-throughput information.

  10. APG: an Active Protein-Gene Network Model to Quantify Regulatory Signals in Complex Biological Systems

    PubMed Central

    Wang, Jiguang; Sun, Yidan; Zheng, Si; Zhang, Xiang-Sun; Zhou, Huarong; Chen, Luonan

    2013-01-01

    Synergistic interactions among transcription factors (TFs) and their cofactors collectively determine gene expression in complex biological systems. In this work, we develop a novel graphical model, called Active Protein-Gene (APG) network model, to quantify regulatory signals of transcription in complex biomolecular networks through integrating both TF upstream-regulation and downstream-regulation high-throughput data. Firstly, we theoretically and computationally demonstrate the effectiveness of APG by comparing with the traditional strategy based only on TF downstream-regulation information. We then apply this model to study spontaneous type 2 diabetic Goto-Kakizaki (GK) and Wistar control rats. Our biological experiments validate the theoretical results. In particular, SP1 is found to be a hidden TF with changed regulatory activity, and the loss of SP1 activity contributes to the increased glucose production during diabetes development. APG model provides theoretical basis to quantitatively elucidate transcriptional regulation by modelling TF combinatorial interactions and exploiting multilevel high-throughput information. PMID:23346354

  11. Site-specific regulatory interaction between spinach leaf sucrose-phosphate synthase and 14-3-3 proteins

    NASA Technical Reports Server (NTRS)

    Toroser, D.; Athwal, G. S.; Huber, S. C.; Davies, E. (Principal Investigator)

    1998-01-01

    We report an Mg2+-dependent interaction between spinach leaf sucrose-phosphate synthase (SPS) and endogenous 14-3-3 proteins, as evidenced by co-elution during gel filtration and co-immunoprecipitation. The content of 14-3-3s associated with an SPS immunoprecipitate was inversely related to activity, and was specifically reduced when tissue was pretreated with 5-aminoimidazole-4-carboxamide riboside, suggesting metabolite control in vivo. A synthetic phosphopeptide based on Ser-229 was shown by surface plasmon resonance to bind a recombinant plant 14-3-3, and addition of the phosphorylated SPS-229 peptide was found to stimulate the SPS activity of an SPS:14-3-3 complex. Taken together, the results suggest a regulatory interaction of 14-3-3 proteins with Ser-229 of SPS.

  12. Evidence that intracellular magnesium is present in cells at a regulatory concentration for protein synthesis.

    PubMed Central

    Terasaki, M; Rubin, H

    1985-01-01

    When extracellular magnesium is reduced by a factor of 50 (from 1.0 to 0.02 mM), the total intracellular magnesium of a spontaneously transformed clone of 3T3 cells decreases by 30-50%. Protein synthesis rates in these cells were measured as the intracellular magnesium decreased. Protein synthesis rates and magnesium content were found to decrease in parallel with each other. At 3 hr, a decrease to 84% of control values of magnesium content was accompanied by a decrease to 85% of control values of leucine incorporation rates. A larger inhibition had occurred by 12 hr, when the magnesium had decreased to 67% and leucine incorporation rates had decreased to 57%. When magnesium was restored to magnesium-deprived cells, both magnesium content and leucine incorporation increased about 2-fold by 1 hr. In the experiments reported here, initial small changes in magnesium content are associated with changes in protein synthesis rates. This strongly suggests that magnesium is present at a regulatory rather than excess concentration for protein synthesis. The results are consistent with a role for intracellular magnesium in the regulation of protein synthesis and support the hypothesis that magnesium has a central role in the regulation of metabolism and growth. PMID:2997785

  13. Fitness advantages conferred by the L20-interacting RNA cis-regulator of ribosomal protein synthesis in Bacillus subtilis.

    PubMed

    Babina, Arianne M; Parker, Darren J; Li, Gene-Wei; Meyer, Michelle M

    2018-06-20

    In many bacteria, ribosomal proteins autogenously repress their own expression by interacting with RNA structures typically located in the 5'-UTRs of their mRNA transcripts. This regulation is necessary to maintain a balance between ribosomal proteins and rRNA to ensure proper ribosome production. Despite advances in non-coding RNA discovery and validation of RNA-protein regulatory interactions, the selective pressures that govern the formation and maintenance of such RNA cis-regulators in the context of an organism remain largely undetermined. To examine the impact disruptions to this regulation have on bacterial fitness, we introduced point mutations that abolish ribosomal protein binding and regulation into the RNA structure that controls expression of ribosomal proteins L20 and L35 within the Bacillus subtilis genome. Our studies indicate that removing this regulation results in reduced log phase growth, improper rRNA maturation, and the accumulation of a kinetically trapped or mis-assembled ribosomal particle at low temperatures, suggesting defects in ribosome synthesis. Such work emphasizes the important role regulatory RNAs play in the stoichiometric production of ribosomal components for proper ribosome composition and overall organism viability and reinforces the potential of targeting ribosomal protein production and ribosome assembly with novel antimicrobials. Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  14. Transcriptional regulatory elements in the noncoding region of human papillomavirus type 6

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Tzyy-Choou.

    1989-01-01

    The structure and function of the transcriptional regulatory region of human papillomavirus type 6 (HPV-6) has been investigated. To investigate tissue specific gene expression, a sensitive method to detect and localize HPV-6 viral DNA, mRNA and protein in plastic-embedded tissue sections of genital and respiratory tract papillomata by using in situ hybridization and immunoperoxidase assays has been developed. This method, using ultrathin sections and strand-specific {sup 3}H labeled riboprobes, offers the advantages of superior morphological preservation and detection of viral genomes at low copy number with good resolution, and the modified immunocytochemistry provides better sensitivity. The results suggest that genitalmore » tract epithelium is more permissive for HPV-6 replication than respiratory tract epithelium. To study the tissue tropism of HPV-6 at the level of regulation of viral gene expression, the polymerase chain reaction was used to isolate the noncoding region (NCR) of HPV-6 in independent isolates. Nucleotide sequence analysis of molecularly cloned DNA identified base substitutions, deletions/insertions and tandem duplications. Transcriptional regulatory elements in the NCR were assayed in recombinant plasmids containing the bacterial gene for chloramphenicol acetyl transferase.« less

  15. The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

    NASA Astrophysics Data System (ADS)

    Alejo, Jose Luis

    In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

  16. Re-directing bacterial microcompartment systems to enhance recombinant expression of lysis protein E from bacteriophage ΦX174 in Escherichia coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yung, Mimi C.; Bourguet, Feliza A.; Carpenter, Timothy S.

    Recombinant expression of toxic proteins remains a challenging problem. Furthermore, one potential method to shield toxicity and thus improve expression of these proteins is to encapsulate them within protein compartments to sequester them away from their targets. Many bacteria naturally produce so-called bacterial microcompartments (BMCs) in which enzymes comprising a biosynthetic pathway are encapsulated in a proteinaeous shell, which is in part thought to shield the cells from the toxicity of reaction intermediates. As a proof-of-concept, we attempted to encapsulate toxic, lysis protein E (E) from bacteriophage ΦX174 inside recombinant BMCs to enhance its expression and achieve higher yields duringmore » downstream purification.« less

  17. Re-directing bacterial microcompartment systems to enhance recombinant expression of lysis protein E from bacteriophage ΦX174 in Escherichia coli

    DOE PAGES

    Yung, Mimi C.; Bourguet, Feliza A.; Carpenter, Timothy S.; ...

    2017-04-26

    Recombinant expression of toxic proteins remains a challenging problem. Furthermore, one potential method to shield toxicity and thus improve expression of these proteins is to encapsulate them within protein compartments to sequester them away from their targets. Many bacteria naturally produce so-called bacterial microcompartments (BMCs) in which enzymes comprising a biosynthetic pathway are encapsulated in a proteinaeous shell, which is in part thought to shield the cells from the toxicity of reaction intermediates. As a proof-of-concept, we attempted to encapsulate toxic, lysis protein E (E) from bacteriophage ΦX174 inside recombinant BMCs to enhance its expression and achieve higher yields duringmore » downstream purification.« less

  18. A Retentive Memory of Tetrachloroethene Respiration in Sulfurospirillum halorespirans - involved Proteins and a possible link to Acetylation of a Two-Component Regulatory System.

    PubMed

    Türkowsky, Dominique; Esken, Jens; Goris, Tobias; Schubert, Torsten; Diekert, Gabriele; Jehmlich, Nico; von Bergen, Martin

    2018-06-15

    Organohalide respiration (OHR), comprising the reductive dehalogenation of halogenated organic compounds, is subject to a unique memory effect and long-term transcriptional downregulation of the involved genes in Sulfurospirillum multivorans. Gene expression ceases slowly over approximately 100 generations in the absence of tetrachloroethene (PCE). However, the molecular mechanisms of this regulation process are not understood. We show here that Sulfurospirillum halorespirans undergoes the same type of regulation when cultivated without chlorinated ethenes for a long period of time. In addition, we compared the proteomes of S. halorespirans cells cultivated in the presence of PCE with those of cells long- and short-term cultivated with nitrate as the sole electron acceptor. Important OHR-related proteins previously unidentified in S. multivorans include a histidine kinase, a putative quinol dehydrogenase membrane protein, and a PCE-induced porin. Since for some regulatory proteins a posttranslational regulation of activity by lysine acetylations is known, we also analyzed the acetylome of S. halorespirans, revealing that 32% of the proteome was acetylated in at least one condition. The data indicate that the response regulator and the histidine kinase of a two-component system most probably involved in induction of PCE respiration are highly acetylated during short-term cultivation with nitrate in the absence of PCE. The so far unique long-term downregulation of organohalide respiration is now identified in a second species suggesting a broader distribution of this regulatory phenomenon. An improved protein extraction method allowed the identification of proteins most probably involved in transcriptional regulation of OHR in Sulfurospirillum spp. Our data indicate that acetylations of regulatory proteins are involved in this extreme, sustained standby-mode of metabolic enzymes in the absence of a substrate. This first published acetylome of Epsilonproteobacteria

  19. Upstream mononucleotide A-repeats play a cis-regulatory role in mammals through the DICER1 and Ago proteins.

    PubMed

    Aporntewan, Chatchawit; Pin-on, Piyapat; Chaiyaratana, Nachol; Pongpanich, Monnat; Boonyaratanakornkit, Viroj; Mutirangura, Apiwat

    2013-10-01

    A-repeats are the simplest form of tandem repeats and are found ubiquitously throughout genomes. These mononucleotide repeats have been widely believed to be non-functional 'junk' DNA. However, studies in yeasts suggest that A-repeats play crucial biological functions, and their role in humans remains largely unknown. Here, we showed a non-random pattern of distribution of sense A- and T-repeats within 20 kb around transcription start sites (TSSs) in the human genome. Different distributions of these repeats are observed upstream and downstream of TSSs. Sense A-repeats are enriched upstream, whereas sense T-repeats are enriched downstream of TSSs. This enrichment directly correlates with repeat size. Genes with different functions contain different lengths of repeats. In humans, tissue-specific genes are enriched for short repeats of <10 bp, whereas housekeeping genes are enriched for long repeats of ≥10 bp. We demonstrated that DICER1 and Argonaute proteins are required for the cis-regulatory role of A-repeats. Moreover, in the presence of a synthetic polymer that mimics an A-repeat, protein binding to A-repeats was blocked, resulting in a dramatic change in the expression of genes containing upstream A-repeats. Our findings suggest a length-dependent cis-regulatory function of A-repeats and that Argonaute proteins serve as trans-acting factors, binding to A-repeats.

  20. Phosphoproteomics in bacteria: towards a systemic understanding of bacterial phosphorylation networks.

    PubMed

    Jers, Carsten; Soufi, Boumediene; Grangeasse, Christophe; Deutscher, Josef; Mijakovic, Ivan

    2008-08-01

    Bacteria use protein phosphorylation to regulate all kinds of physiological processes. Protein phosphorylation plays a role in several key steps of the infection process of bacterial pathogens, such as adhesion to the host, triggering and regulation of pathogenic functions as well as biochemical warfare; scrambling the host signaling cascades and impairing its defense mechanisms. Recent phosphoproteomic studies indicate that the bacterial protein phosphorylation networks could be more complex than initially expected, comprising promiscuous kinases that regulate several distinct cellular functions by phosphorylating different protein substrates. Recent advances in protein labeling with stable isotopes in the field of quantitative mass spectrometry phosphoproteomics will enable us to chart the global phosphorylation networks and to understand the implication of protein phosphorylation in cellular regulation on the systems scale. For the study of bacterial pathogens, in particular, this research avenue will enable us to dissect phosphorylation-related events during different stages of infection and stimulate our efforts to find inhibitors for key kinases and phosphatases implicated therein.

  1. A Novel, In-solution Separation of Endogenous Cardiac Sarcomeric Proteins and Identification of Distinct Charged Variants of Regulatory Light Chain*

    PubMed Central

    Scruggs, Sarah B.; Reisdorph, Rick; Armstrong, Mike L.; Warren, Chad M.; Reisdorph, Nichole; Solaro, R. John; Buttrick, Peter M.

    2010-01-01

    The molecular conformation of the cardiac myosin motor is modulated by intermolecular interactions among the heavy chain, the light chains, myosin binding protein-C, and titin and is governed by post-translational modifications (PTMs). In-gel digestion followed by LC/MS/MS has classically been applied to identify cardiac sarcomeric PTMs; however, this approach is limited by protein size, pI, and difficulties in peptide extraction. We report a solution-based work flow for global separation of endogenous cardiac sarcomeric proteins with a focus on the regulatory light chain (RLC) in which specific sites of phosphorylation have been unclear. Subcellular fractionation followed by OFFGEL electrophoresis resulted in isolation of endogenous charge variants of sarcomeric proteins, including regulatory and essential light chains, myosin heavy chain, and myosin-binding protein-C of the thick filament. Further purification of RLC using reverse-phase HPLC separation and UV detection enriched for RLC PTMs at the intact protein level and provided a stoichiometric and quantitative assessment of endogenous RLC charge variants. Digestion and subsequent LC/MS/MS unequivocally identified that the endogenous charge variants of cardiac RLC focused in unique OFFGEL electrophoresis fractions were unphosphorylated (78.8%), singly phosphorylated (18.1%), and doubly phosphorylated (3.1%) RLC. The novel aspects of this study are that 1) milligram amounts of endogenous cardiac sarcomeric subproteome were focused with resolution comparable with two-dimensional electrophoresis, 2) separation and quantification of post-translationally modified variants were achieved at the intact protein level, 3) separation of intact high molecular weight thick filament proteins was achieved in solution, and 4) endogenous charge variants of RLC were separated; a novel doubly phosphorylated form was identified in mouse, and singly phosphorylated, singly deamidated, and deamidated/phosphorylated forms were

  2. Cooperative Regulation of the Interferon Regulatory Factor-1 Tumor Suppressor Protein by Core Components of the Molecular Chaperone Machinery*

    PubMed Central

    Narayan, Vikram; Eckert, Mirjam; Zylicz, Alicja; Zylicz, Maciej; Ball, Kathryn L.

    2009-01-01

    Our understanding of the post-translational processes involved in regulating the interferon regulatory factor-1 (IRF-1) tumor suppressor protein is limited. The introduction of mutations within the C-terminal Mf1 domain (amino acids 301–325) impacts on IRF-1-mediated gene repression and growth suppression as well as the rate of IRF-1 degradation. However, nothing is known about the proteins that interact with this region to modulate IRF-1 function. A biochemical screen for Mf1-interacting proteins has identified an LXXLL motif that is required for binding of Hsp70 family members and cooperation with Hsp90 to regulate IRF-1 turnover and activity. These conclusions are supported by the finding that Hsp90 inhibitors suppress IRF-1-dependent transcription shortly after treatment, although at later time points inhibition of Hsp90 leads to an Hsp70-dependent depletion of nuclear IRF-1. Conversely, the half-life of IRF-1 is increased by Hsp90 in an ATPase-dependent manner leading to the accumulation of nuclear but not cytoplasmic IRF-1. This study begins to elucidate the role of the Mf1 domain of IRF-1 in orchestrating the recruitment of regulatory factors that can impact on both its turnover and transcriptional activity. PMID:19502235

  3. Transcriptomic analysis reveals tomato genes whose expression is induced specifically during effector-triggered immunity and identifies the Epk1 protein kinase which is required for the host response to three bacterial effector proteins.

    PubMed

    Pombo, Marina A; Zheng, Yi; Fernandez-Pozo, Noe; Dunham, Diane M; Fei, Zhangjun; Martin, Gregory B

    2014-01-01

    Plants have two related immune systems to defend themselves against pathogen attack. Initially,pattern-triggered immunity is activated upon recognition of microbe-associated molecular patterns by pattern recognition receptors. Pathogenic bacteria deliver effector proteins into the plant cell that interfere with this immune response and promote disease. However, some plants express resistance proteins that detect the presence of specific effectors leading to a robust defense response referred to as effector-triggered immunity. The interaction of tomato with Pseudomonas syringae pv. tomato is an established model system for understanding the molecular basis of these plant immune responses. We apply high-throughput RNA sequencing to this pathosystem to identify genes whose expression changes specifically during pattern-triggered or effector-triggered immunity. We then develop reporter genes for each of these responses that will enable characterization of the host response to the large collection of P. s. pv. tomato strains that express different combinations of effectors. Virus-induced gene silencing of 30 of the effector-triggered immunity-specific genes identifies Epk1 which encodes a predicted protein kinase from a family previously unknown to be involved in immunity. Knocked-down expression of Epk1 compromises effector-triggered immunity triggered by three bacterial effectors but not by effectors from non-bacterial pathogens. Epistasis experiments indicate that Epk1 acts upstream of effector-triggered immunity-associated MAP kinase signaling. Using RNA-seq technology we identify genes involved in specific immune responses. A functional genomics screen led to the discovery of Epk1, a novel predicted protein kinase required for plant defense activation upon recognition of three different bacterial effectors.

  4. Novel protein interactions with an actin homolog (MreB) of Helicobacter pylori determined by bacterial two-hybrid system.

    PubMed

    Zepeda Gurrola, Reyna Cristina; Fu, Yajuan; Rodríguez Luna, Isabel Cristina; Benítez Cardoza, Claudia Guadalupe; López López, María de Jesús; López Vidal, Yolanda; Gutíerrez, Germán Rubén Aguilar; Rodríguez Pérez, Mario A; Guo, Xianwu

    2017-08-01

    The bacterium Helicobacter pylori infects more than 50% of the world population and causes several gastroduodenal diseases, including gastric cancer. Nevertheless, we still need to explore some protein interactions that may be involved in pathogenesis. MreB, an actin homolog, showed some special characteristics in previous studies, indicating that it could have different functions. Protein functions could be realized via protein-protein interactions. In the present study, the MreB protein from H. pylori 26695 fused with two tags 10×His and GST in tandem was overexpressed and purified from Escherchia coli. The purified recombinant protein was used to perform a pull-down assay with H. pylori 26695 cell lysate. The pulled-down proteins were identified by mass spectrometry (MALDI-TOF), in which the known important proteins related to morphogenesis were absent but several proteins related to pathogenesis process were observed. The bacterial two-hybrid system was further used to evaluate the protein interactions and showed that new interactions of MreB respectively with VacA, UreB, HydB, HylB and AddA were confirmed but the interaction MreB-MreC was not validated. These results indicated that the protein MreB in H. pylori has a distinct interactome, does not participate in cell morphogenesis via MreB-MreC but could be related to pathogenesis. Copyright © 2017 Elsevier GmbH. All rights reserved.

  5. Double-stranded RNA-binding protein 4 is required for resistance signaling against viral and bacterial pathogens.

    PubMed

    Zhu, Shifeng; Jeong, Rae-Dong; Lim, Gah-Hyun; Yu, Keshun; Wang, Caixia; Chandra-Shekara, A C; Navarre, Duroy; Klessig, Daniel F; Kachroo, Aardra; Kachroo, Pradeep

    2013-09-26

    Plant viruses often encode suppressors of host RNA silencing machinery, which occasionally function as avirulence factors that are recognized by host resistance (R) proteins. For example, the Arabidopsis R protein, hypersensitive response to TCV (HRT), recognizes the turnip crinkle virus (TCV) coat protein (CP). HRT-mediated resistance requires the RNA-silencing component double-stranded RNA-binding protein 4 (DRB4) even though it neither is associated with the accumulation of TCV-specific small RNA nor requires the RNA silencing suppressor function of CP. HRT interacts with the cytosolic fraction of DRB4. Interestingly, TCV infection both increases the cytosolic DRB4 pool and inhibits the HRT-DRB4 interaction. The virulent R8A CP derivative, which induces a subset of HRT-derived responses, also disrupts this interaction. The differential localization of DRB4 in the presence of wild-type and R8A CP implies the importance of subcellular compartmentalization of DRB4. The requirement of DRB4 in resistance to bacterial infection suggests a universal role in R-mediated defense signaling. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Regulatory element-based prediction identifies new susceptibility regulatory variants for osteoporosis.

    PubMed

    Yao, Shi; Guo, Yan; Dong, Shan-Shan; Hao, Ruo-Han; Chen, Xiao-Feng; Chen, Yi-Xiao; Chen, Jia-Bin; Tian, Qing; Deng, Hong-Wen; Yang, Tie-Lin

    2017-08-01

    Despite genome-wide association studies (GWASs) have identified many susceptibility genes for osteoporosis, it still leaves a large part of missing heritability to be discovered. Integrating regulatory information and GWASs could offer new insights into the biological link between the susceptibility SNPs and osteoporosis. We generated five machine learning classifiers with osteoporosis-associated variants and regulatory features data. We gained the optimal classifier and predicted genome-wide SNPs to discover susceptibility regulatory variants. We further utilized Genetic Factors for Osteoporosis Consortium (GEFOS) and three in-house GWASs samples to validate the associations for predicted positive SNPs. The random forest classifier performed best among all machine learning methods with the F1 score of 0.8871. Using the optimized model, we predicted 37,584 candidate SNPs for osteoporosis. According to the meta-analysis results, a list of regulatory variants was significantly associated with osteoporosis after multiple testing corrections and contributed to the expression of known osteoporosis-associated protein-coding genes. In summary, combining GWASs and regulatory elements through machine learning could provide additional information for understanding the mechanism of osteoporosis. The regulatory variants we predicted will provide novel targets for etiology research and treatment of osteoporosis.

  7. Critical protein GAPDH and its regulatory mechanisms in cancer cells

    PubMed Central

    Zhang, Jin-Ying; Zhang, Fan; Hong, Chao-Qun; Giuliano, Armando E.; Cui, Xiao-Jiang; Zhou, Guang-Ji; Zhang, Guo-Jun; Cui, Yu-Kun

    2015-01-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), initially identified as a glycolytic enzyme and considered as a housekeeping gene, is widely used as an internal control in experiments on proteins, mRNA, and DNA. However, emerging evidence indicates that GAPDH is implicated in diverse functions independent of its role in energy metabolism; the expression status of GAPDH is also deregulated in various cancer cells. One of the most common effects of GAPDH is its inconsistent role in the determination of cancer cell fate. Furthermore, studies have described GAPDH as a regulator of cell death; other studies have suggested that GAPDH participates in tumor progression and serves as a new therapeutic target. However, related regulatory mechanisms of its numerous cellular functions and deregulated expression levels remain unclear. GAPDH is tightly regulated at transcriptional and posttranscriptional levels, which are involved in the regulation of diverse GAPDH functions. Several cancer-related factors, such as insulin, hypoxia inducible factor-1 (HIF-1), p53, nitric oxide (NO), and acetylated histone, not only modulate GAPDH gene expression but also affect protein functions via common pathways. Moreover, posttranslational modifications (PTMs) occurring in GAPDH in cancer cells result in new activities unrelated to the original glycolytic function of GAPDH. In this review, recent findings related to GAPDH transcriptional regulation and PTMs are summarized. Mechanisms and pathways involved in GAPDH regulation and its different roles in cancer cells are also described. PMID:25859407

  8. Depletion of Regulatory T Cells Augments a Vaccine-Induced T Effector Cell Response against the Liver-Stage of Malaria but Fails to Increase Memory

    PubMed Central

    Espinoza Mora, Maria del Rosario; Steeg, Christiane; Tartz, Susanne; Heussler, Volker; Sparwasser, Tim; Link, Andreas; Fleischer, Bernhard; Jacobs, Thomas

    2014-01-01

    Regulatory T cells (Treg) have been shown to restrict vaccine-induced T cell responses in different experimental models. In these studies CD4+CD25+ Treg were depleted using monoclonal antibodies against CD25, which might also interfere with CD25 on non-regulatory T cell populations and would have no effect on Foxp3+CD25− Treg. To obtain more insights in the specific function of Treg during vaccination we used mice that are transgenic for a bacterial artificial chromosome expressing a diphtheria toxin (DT) receptor-eGFP fusion protein under the control of the foxp3 gene locus (depletion of regulatory T cell mice; DEREG). As an experimental vaccine-carrier recombinant Bordetella adenylate cyclase toxoid fused with a MHC-class I-restricted epitope of the circumsporozoite protein (ACT-CSP) of Plasmodium berghei (Pb) was used. ACT-CSP was shown by us previously to introduce the CD8+ epitope of Pb-CSP into the MHC class I presentation pathway of professional antigen-presenting cells (APC). Using this system we demonstrate here that the number of CSP-specific T cells increases when Treg are depleted during prime but also during boost immunization. Importantly, despite this increase of T effector cells no difference in the number of antigen-specific memory cells was observed. PMID:25115805

  9. Quantitative proteomic analysis of bacterial enzymes released in cheese during ripening.

    PubMed

    Jardin, Julien; Mollé, Daniel; Piot, Michel; Lortal, Sylvie; Gagnaire, Valérie

    2012-04-02

    Due to increasingly available bacterial genomes in databases, proteomic tools have recently been used to screen proteins expressed by micro-organisms in food in order to better understand their metabolism in situ. While the main objective is the systematic identification of proteins, the next step will be to bridge the gap between identification and quantification of these proteins. For that purpose, a new mass spectrometry-based approach was applied, using isobaric tagging reagent for quantitative proteomic analysis (iTRAQ), which are amine specific and yield labelled peptides identical in mass. Experimental Swiss-type cheeses were manufactured from microfiltered milk using Streptococcus thermophilus ITG ST20 and Lactobacillus helveticus ITG LH1 as lactic acid starters. At three ripening times (7, 20 and 69 days), cheese aqueous phases were extracted and enriched in bacterial proteins by fractionation. Each sample, standardised in protein amount prior to proteomic analyses, was: i) analysed by 2D-electrophoresis for qualitative analysis and ii) submitted to trypsinolysis, and labelled with specific iTRAQ tag, one per ripening time. The three labelled samples were mixed together and analysed by nano-LC coupled on-line with ESI-QTOF mass spectrometer. Thirty proteins, both from bacterial or bovine origin, were identified and efficiently quantified. The free bacterial proteins detected were enzymes from the central carbon metabolism as well as stress proteins. Depending on the protein considered, the quantity of these proteins in the cheese aqueous extract increased from 2.5 to 20 fold in concentration from day 7 to day 69 of ripening. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. DNA sequence and characterization of GcvA, a LysR family regulatory protein for the Escherichia coli glycine cleavage enzyme system.

    PubMed Central

    Wilson, R L; Stauffer, G V

    1994-01-01

    The gene encoding GcvA, the trans-acting regulatory protein for the Escherichia coli glycine cleavage enzyme system, has been sequenced. The gcvA locus contains an open reading frame of 930 nucleotides that could encode a protein with a molecular mass of 34.4 kDa, consistent with the results of minicell analysis indicating that GcvA is a polypeptide of approximately 33 kDa. The deduced amino acid sequence of GcvA revealed that this protein shares similarity with the LysR family of activator proteins. The transcription start site was found to be 72 bp upstream of the presumed translation start site. A chromosomal deletion of gcvA resulted in the inability of cells to activate the expression of a gcvT-lacZ gene fusion when grown in the presence of glycine and an inability to repress gcvT-lacZ expression when grown in the presence of inosine. The regulation of gcvA was examined by constructing a gcvA-lacZ gene fusion in which beta-galactosidase synthesis is under the control of the gcvA regulatory region. Although gcvA expression appears to be autogenously regulated over a two- to threefold range, it is neither induced by glycine nor repressed by inosine. Images PMID:8188587

  11. Systematic comparison of the response properties of protein and RNA mediated gene regulatory motifs.

    PubMed

    Iyengar, Bharat Ravi; Pillai, Beena; Venkatesh, K V; Gadgil, Chetan J

    2017-05-30

    We present a framework enabling the dissection of the effects of motif structure (feedback or feedforward), the nature of the controller (RNA or protein), and the regulation mode (transcriptional, post-transcriptional or translational) on the response to a step change in the input. We have used a common model framework for gene expression where both motif structures have an activating input and repressing regulator, with the same set of parameters, to enable a comparison of the responses. We studied the global sensitivity of the system properties, such as steady-state gain, overshoot, peak time, and peak duration, to parameters. We find that, in all motifs, overshoot correlated negatively whereas peak duration varied concavely with peak time. Differences in the other system properties were found to be mainly dependent on the nature of the controller rather than the motif structure. Protein mediated motifs showed a higher degree of adaptation i.e. a tendency to return to baseline levels; in particular, feedforward motifs exhibited perfect adaptation. RNA mediated motifs had a mild regulatory effect; they also exhibited a lower peaking tendency and mean overshoot. Protein mediated feedforward motifs showed higher overshoot and lower peak time compared to the corresponding feedback motifs.

  12. Rifaximin has minor effects on bacterial composition, inflammation, and bacterial translocation in cirrhosis: A randomized trial.

    PubMed

    Kimer, Nina; Pedersen, Julie S; Tavenier, Juliette; Christensen, Jeffrey E; Busk, Troels M; Hobolth, Lise; Krag, Aleksander; Al-Soud, Waleed Abu; Mortensen, Martin S; Sørensen, Søren J; Møller, Søren; Bendtsen, Flemming

    2018-01-01

    Decompensated cirrhosis is characterized by disturbed hemodynamics, immune dysfunction, and high risk of infections. Translocation of viable bacteria and bacterial products from the gut to the blood is considered a key driver in this process. Intestinal decontamination with rifaximin may reduce bacterial translocation (BT) and decrease inflammation. A randomized, placebo-controlled trial investigated the effects of rifaximin on inflammation and BT in decompensated cirrhosis. Fifty-four out-patients with cirrhosis and ascites were randomized, mean age 56 years (± 8.4), and model for end-stage liver disease score 12 (± 3.9). Patients received rifaximin 550-mg BD (n = 36) or placebo BD (n = 18). Blood and fecal (n = 15) sampling were conducted at baseline and after 4 weeks. Bacterial DNA in blood was determined by real-time qPCR 16S rRNA gene quantification. Bacterial composition in feces was analyzed by 16S rRNA gene sequencing. Circulating markers of inflammation, including tumor necrosis factor alpha, interleukins 6, 10, and 18, stromal cell-derived factor 1-α, transforming growth factor β-1, and high sensitivity C-reactive protein, were unaltered by rifaximin treatment. Rifaximin altered abundance of bacterial taxa in blood marginally, only a decrease in Pseudomonadales was observed. In feces, rifaximin decreased bacterial richness, but effect on particular species was not observed. Subgroup analyses on patients with severely disturbed hemodynamics (n = 34) or activated lipopolysaccharide binding protein (n = 37) revealed no effect of rifaximin. Four weeks of treatment with rifaximin had no impact on the inflammatory state and only minor effects on BT and intestinal bacterial composition in stable, decompensated cirrhosis (NCT01769040). © 2017 Journal of Gastroenterology and Hepatology Foundation and John Wiley & Sons Australia, Ltd.

  13. Bacterial interactomes: Interacting protein partners share similar function and are validated in independent assays more frequently than previously reported.

    DOE PAGES

    Shatsky, Maxim; Allen, Simon; Gold, Barbara; ...

    2016-05-01

    Numerous affinity purification – mass-spectrometry (AP-MS) and yeast two hybrid (Y2H) screens have each defined thousands of pairwise protein-protein interactions (PPIs), most between functionally unrelated proteins. The accuracy of these networks, however, is under debate. Here we present an AP-MS survey of the bacterium Desulfovibrio vulgaris together with a critical reanalysis of nine published bacterial Y2H and AP-MS screens. We have identified 459 high confidence PPIs from D. vulgaris and 391 from Escherichia coli. Compared to the nine published interactomes, our two networks are smaller; are much less highly connected; have significantly lower false discovery rates; and are much moremore » enriched in protein pairs that are encoded in the same operon, have similar functions, and are reproducibly detected in other physical interaction assays. Lastly, our work establishes more stringent benchmarks for the properties of protein interactomes and suggests that bona fide PPIs much more frequently involve protein partners that are annotated with similar functions or that can be validated in independent assays than earlier studies suggested.« less

  14. A comparison of the endotoxin biosynthesis and protein oxidation pathways in the biogenesis of the outer membrane of Escherichia coli and Neisseria meningitidis

    PubMed Central

    Piek, Susannah; Kahler, Charlene M.

    2012-01-01

    The Gram-negative bacterial cell envelope consists of an inner membrane (IM) that surrounds the cytoplasm and an asymmetrical outer-membrane (OM) that forms a protective barrier to the external environment. The OM consists of lipopolysaccahride (LPS), phospholipids, outer membrane proteins (OMPs), and lipoproteins. Oxidative protein folding mediated by periplasmic oxidoreductases is required for the biogenesis of the protein components, mainly constituents of virulence determinants such as pili, flagella, and toxins, of the Gram-negative OM. Recently, periplasmic oxidoreductases have been implicated in LPS biogenesis of Escherichia coli and Neisseria meningitidis. Differences in OM biogenesis, in particular the transport pathways for endotoxin to the OM, the composition and role of the protein oxidation, and isomerization pathways and the regulatory networks that control them have been found in these two Gram-negative species suggesting that although form and function of the OM is conserved, the pathways required for the biosynthesis of the OM and the regulatory circuits that control them have evolved to suit the lifestyle of each organism. PMID:23267440

  15. A growing family: the expanding universe of the bacterial cytoskeleton

    PubMed Central

    Ingerson-Mahar, Michael; Gitai, Zemer

    2014-01-01

    Cytoskeletal proteins are important mediators of cellular organization in both eukaryotes and bacteria. In the past, cytoskeletal studies have largely focused on three major cytoskeletal families, namely the eukaryotic actin, tubulin, and intermediate filament (IF) proteins and their bacterial homologs MreB, FtsZ, and crescentin. However, mounting evidence suggests that these proteins represent only the tip of the iceberg, as the cellular cytoskeletal network is far more complex. In bacteria, each of MreB, FtsZ, and crescentin represents only one member of large families of diverse homologs. There are also newly identified bacterial cytoskeletal proteins with no eukaryotic homologs, such as WACA proteins and bactofilins. Furthermore, there are universally conserved proteins, such as the metabolic enzyme CtpS, that assemble into filamentous structures that can be repurposed for structural cytoskeletal functions. Recent studies have also identified an increasing number of eukaryotic cytoskeletal proteins that are unrelated to actin, tubulin, and IFs, such that expanding our understanding of cytoskeletal proteins is advancing the understanding of the cell biology of all organisms. Here, we summarize the recent explosion in the identification of new members of the bacterial cytoskeleton and describe a hypothesis for the evolution of the cytoskeleton from self-assembling enzymes. PMID:22092065

  16. RNA- and protein-mediated control of Listeria monocytogenes virulence gene expression

    PubMed Central

    Lebreton, Alice; Cossart, Pascale

    2017-01-01

    ABSTRACT The model opportunistic pathogen Listeria monocytogenes has been the object of extensive research, aiming at understanding its ability to colonize diverse environmental niches and animal hosts. Bacterial transcriptomes in various conditions reflect this efficient adaptability. We review here our current knowledge of the mechanisms allowing L. monocytogenes to respond to environmental changes and trigger pathogenicity, with a special focus on RNA-mediated control of gene expression. We highlight how these studies have brought novel concepts in prokaryotic gene regulation, such as the ‘excludon’ where the 5′-UTR of a messenger also acts as an antisense regulator of an operon transcribed in opposite orientation, or the notion that riboswitches can regulate non-coding RNAs to integrate complex metabolic stimuli into regulatory networks. Overall, the Listeria model exemplifies that fine RNA tuners act together with master regulatory proteins to orchestrate appropriate transcriptional programmes. PMID:27217337

  17. Physics of Bacterial Morphogenesis

    PubMed Central

    Sun, Sean X.; Jiang, Hongyuan

    2011-01-01

    Summary: Bacterial cells utilize three-dimensional (3D) protein assemblies to perform important cellular functions such as growth, division, chemoreception, and motility. These assemblies are composed of mechanoproteins that can mechanically deform and exert force. Sometimes, small-nucleotide hydrolysis is coupled to mechanical deformations. In this review, we describe the general principle for an understanding of the coupling of mechanics with chemistry in mechanochemical systems. We apply this principle to understand bacterial cell shape and morphogenesis and how mechanical forces can influence peptidoglycan cell wall growth. We review a model that can potentially reconcile the growth dynamics of the cell wall with the role of cytoskeletal proteins such as MreB and crescentin. We also review the application of mechanochemical principles to understand the assembly and constriction of the FtsZ ring. A number of potential mechanisms are proposed, and important questions are discussed. PMID:22126993

  18. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins.

    PubMed

    Figueroa-Angulo, Elisa E; Calla-Choque, Jaeson S; Mancilla-Olea, Maria Inocente; Arroyo, Rossana

    2015-11-26

    Iron homeostasis is highly regulated in vertebrates through a regulatory system mediated by RNA-protein interactions between the iron regulatory proteins (IRPs) that interact with an iron responsive element (IRE) located in certain mRNAs, dubbed the IRE-IRP regulatory system. Trichomonas vaginalis, the causal agent of trichomoniasis, presents high iron dependency to regulate its growth, metabolism, and virulence properties. Although T. vaginalis lacks IRPs or proteins with aconitase activity, possesses gene expression mechanisms of iron regulation at the transcriptional and posttranscriptional levels. However, only one gene with iron regulation at the transcriptional level has been described. Recently, our research group described an iron posttranscriptional regulatory mechanism in the T. vaginalis tvcp4 and tvcp12 cysteine proteinase mRNAs. The tvcp4 and tvcp12 mRNAs have a stem-loop structure in the 5'-coding region or in the 3'-UTR, respectively that interacts with T. vaginalis multifunctional proteins HSP70, α-Actinin, and Actin under iron starvation condition, causing translation inhibition or mRNA stabilization similar to the previously characterized IRE-IRP system in eukaryotes. Herein, we summarize recent progress and shed some light on atypical RNA-binding proteins that may participate in the iron posttranscriptional regulation in T. vaginalis.

  19. Regulatory elements of Caenorhabditis elegans ribosomal protein genes

    PubMed Central

    2012-01-01

    Background Ribosomal protein genes (RPGs) are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from those of all other species

  20. The Evolution of the Secreted Regulatory Protein Progranulin

    PubMed Central

    Palfree, Roger G. E.; Bennett, Hugh P. J.; Bateman, Andrew

    2015-01-01

    Progranulin is a secreted growth factor that is active in tumorigenesis, wound repair, and inflammation. Haploinsufficiency of the human progranulin gene, GRN, causes frontotemporal dementia. Progranulins are composed of chains of cysteine-rich granulin modules. Modules may be released from progranulin by proteolysis as 6kDa granulin polypeptides. Both intact progranulin and some of the granulin polypeptides are biologically active. The granulin module occurs in certain plant proteases and progranulins are present in early diverging metazoan clades such as the sponges, indicating their ancient evolutionary origin. There is only one Grn gene in mammalian genomes. More gene-rich Grn families occur in teleost fish with between 3 and 6 members per species including short-form Grns that have no tetrapod counterparts. Our goals are to elucidate progranulin and granulin module evolution by investigating (i): the origins of metazoan progranulins (ii): the evolutionary relationships between the single Grn of tetrapods and the multiple Grn genes of fish (iii): the evolution of granulin module architectures of vertebrate progranulins (iv): the conservation of mammalian granulin polypeptide sequences and how the conserved granulin amino acid sequences map to the known three dimensional structures of granulin modules. We report that progranulin-like proteins are present in unicellular eukaryotes that are closely related to metazoa suggesting that progranulin is among the earliest extracellular regulatory proteins still employed by multicellular animals. From the genomes of the elephant shark and coelacanth we identified contemporary representatives of a precursor for short-from Grn genes of ray-finned fish that is lost in tetrapods. In vertebrate Grns pathways of exon duplication resulted in a conserved module architecture at the amino-terminus that is frequently accompanied by an unusual pattern of tandem nearly identical module repeats near the carboxyl-terminus. Polypeptide

  1. Proteome analysis of Arabidopsis seedlings exposed to bacterial volatiles.

    PubMed

    Kwon, Young Sang; Ryu, Choong-Min; Lee, Soohyun; Park, Hyo Bee; Han, Ki Soo; Lee, Jung Han; Lee, Kyunghee; Chung, Woo Sik; Jeong, Mi-Jeong; Kim, Hee Kyu; Bae, Dong-Won

    2010-11-01

    Plant root-associated bacteria (rhizobacteria) elicit plant basal immunity referred to as induced systemic resistance (ISR) against multiple pathogens. Among multi-bacterial determinants involving such ISR, the induction of ISR and promotion of growth by bacterial volatile compounds was previously reported. To exploit global de novo expression of plant proteins by bacterial volatiles, proteomic analysis was performed after exposure of Arabidopsis plants to the rhizobacterium Bacillus subtilis GB03. Ethylene biosynthesis enzymes were significantly up-regulated. Analysis by quantitative reverse transcriptase polymerase chain reaction confirmed that ethylene biosynthesis-related genes SAM-2, ACS4, ACS12, and ACO2 as well as ethylene response genes, ERF1, GST2, and CHIB were up-regulated by the exposure to bacterial volatiles. More interestingly, the emission of bacterial volatiles significantly up-regulated both key defense mechanisms mediated by jasmonic acid and salicylic acid signaling pathways. In addition, high accumulation of antioxidant proteins also provided evidence of decreased sensitivity to reactive oxygen species during the elicitation of ISR by bacterial volatiles. The present results suggest that the proteomic analysis of plant defense responses in bacterial volatile-mediated ISR can reveal the mechanisms of plant basal defenses orchestrated by endogenous ethylene production pathways and the generation of reactive oxygen species.

  2. Signal Correlations in Ecological Niches Can Shape the Organization and Evolution of Bacterial Gene Regulatory Networks

    PubMed Central

    Dufour, Yann S.; Donohue, Timothy J.

    2015-01-01

    Transcriptional regulation plays a significant role in the biological response of bacteria to changing environmental conditions. Therefore, mapping transcriptional regulatory networks is an important step not only in understanding how bacteria sense and interpret their environment but also to identify the functions involved in biological responses to specific conditions. Recent experimental and computational developments have facilitated the characterization of regulatory networks on a genome-wide scale in model organisms. In addition, the multiplication of complete genome sequences has encouraged comparative analyses to detect conserved regulatory elements and infer regulatory networks in other less well-studied organisms. However, transcription regulation appears to evolve rapidly, thus, creating challenges for the transfer of knowledge to nonmodel organisms. Nevertheless, the mechanisms and constraints driving the evolution of regulatory networks have been the subjects of numerous analyses, and several models have been proposed. Overall, the contributions of mutations, recombination, and horizontal gene transfer are complex. Finally, the rapid evolution of regulatory networks plays a significant role in the remarkable capacity of bacteria to adapt to new or changing environments. Conversely, the characteristics of environmental niches determine the selective pressures and can shape the structure of regulatory network accordingly. PMID:23046950

  3. Treatment of bacterial meningitis: an update.

    PubMed

    Shin, Seon Hee; Kim, Kwang Sik

    2012-10-01

    The introduction of protein conjugate vaccines for Haemophilus influenzae type b (Hib), Streptococcus pneumoniae (S. pneumoniae) and Neisseria meningitidis (N. menigitidis) has changed the epidemiology of bacterial meningitis. Bacterial meningitis continues to be an important cause of mortality and morbidity, and our incomplete knowledge of its pathogenesis and emergence of antimicrobial resistant bacteria contribute to such mortality and morbidity. An early empiric antibiotic treatment is critical for the management of patients with bacterial meningitis. This article gives an overview on optimal treatment strategies of bacterial meningitis, along with considerations of new insights on epidemiology, clinical and laboratory findings supportive of bacterial meningitis, chemoprophylaxis, selection of initial antimicrobial agents for suspected bacterial meningitis, antimicrobial resistance and utility of new antibiotics, status on anti-inflammatory agents and adjunctive therapy, and pathogenesis of bacterial meningitis. Prompt treatment of bacterial meningitis with an appropriate antibiotic is essential. Optimal antimicrobial treatment of bacterial meningitis requires bactericidal agents able to penetrate the blood-brain barrier (BBB), with efficacy in cerebrospinal fluid (CSF). Several new antibiotics have been introduced for the treatment of meningitis caused by resistant bacteria, but their use in human studies has been limited. More complete understanding of the microbial and host interactions that are involved in the pathogenesis of bacterial meningitis and associated neurologic sequelae is likely to help in developing new strategies for the prevention and therapy of bacterial meningitis.

  4. Two-step membrane binding by the bacterial SRP receptor enable efficient and accurate Co-translational protein targeting.

    PubMed

    Hwang Fu, Yu-Hsien; Huang, William Y C; Shen, Kuang; Groves, Jay T; Miller, Thomas; Shan, Shu-Ou

    2017-07-28

    The signal recognition particle (SRP) delivers ~30% of the proteome to the eukaryotic endoplasmic reticulum, or the bacterial plasma membrane. The precise mechanism by which the bacterial SRP receptor, FtsY, interacts with and is regulated at the target membrane remain unclear. Here, quantitative analysis of FtsY-lipid interactions at single-molecule resolution revealed a two-step mechanism in which FtsY initially contacts membrane via a Dynamic mode, followed by an SRP-induced conformational transition to a Stable mode that activates FtsY for downstream steps. Importantly, mutational analyses revealed extensive auto-inhibitory mechanisms that prevent free FtsY from engaging membrane in the Stable mode; an engineered FtsY pre-organized into the Stable mode led to indiscriminate targeting in vitro and disrupted FtsY function in vivo. Our results show that the two-step lipid-binding mechanism uncouples the membrane association of FtsY from its conformational activation, thus optimizing the balance between the efficiency and fidelity of co-translational protein targeting.

  5. [Spontaneous bacterial peritonitis].

    PubMed

    Velkey, Bálint; Vitális, Eszter; Vitális, Zsuzsanna

    2017-01-01

    Spontaneous bacterial peritonitis occurs most commonly in cirrhotic patients with ascites. Pathogens get into the circulation by intestinal translocation and colonize in peritoneal fluid. Diagnosis of spontaneous bacterial peritonitis is based on elevated polymorphonuclear leukocyte count in the ascites (>0,25 G/L). Ascites culture is often negative but aids to get information about antibiotic sensitivity in positive cases. Treatment in stable patient can be intravenous then orally administrated ciprofloxacin or amoxicillin/clavulanic acid, while in severe cases intravenous III. generation cephalosporin. Nosocomial spontaneous bacterial peritonitis often caused by Gram-positive bacteria and multi-resistant pathogens can also be expected thus carbapenem should be the choice of the empiric treatment. Antibiotic prophylaxis should be considered. Norfloxacin is used most commonly, but changes are expected due to increase in quinolone resistance. As a primary prophylaxis, a short-term antibiotic treatment is recommended after gastrointestinal bleeding for 5 days, while long-term prophylaxis is for patients with low ascites protein, and advanced disease (400 mg/day). Secondary prophylaxis is recommended for all patients recovered from spontaneous bacterial peritonitis. Due to increasing antibiotic use of antibiotics prophylaxis is debated to some degree. Orv. Hetil., 2017, 158(2), 50-57.

  6. The innate immune rheostat: influence on lung inflammatory disease and secondary bacterial pneumonia.

    PubMed

    Hussell, Tracy; Cavanagh, Mary M

    2009-08-01

    The activity of innate immunity is not simply dictated by the presence of an antigen but also by the balance between negative regulatory and immune potentiator pathways. Even in the absence of antigen, innate immunity can 'inflame' if negative regulators are absent. This resting state is adaptable and dictated by environmental influences, host genetics and past infection history. A return to homoeostasis post inflammation may therefore not leave the tissue in an identical state to that prior to the inflammatory event. This adaptability makes us all unique and also explains the variable outcome experienced by a diverse population to the same inflammatory stimulus. Using murine models we have identified that influenza virus causes a long-term modification of the lung microenvironment by a de-sensitization to bacterial products and an increase in the myeloid negative regulator CD200R (CD200 receptor). These two events prevent subsequent inflammatory damage while the lung is healing, but also they may predispose to bacterial colonization of the lower respiratory tract should regulatory mechanisms overshoot. In the extreme, this leads to bacterial pneumonia, sepsis and death. A deeper understanding of the consequences arising from innate immune cell alteration during influenza infection and the subsequent development of bacterial complications has important implications for future drug development.

  7. Progressive response of large intestinal bacterial community and fermentation to the stepwise decrease of dietary crude protein level in growing pigs.

    PubMed

    Peng, Yu; Yu, Kaifan; Mu, Chunlong; Hang, Suqin; Che, Lianqiang; Zhu, Weiyun

    2017-07-01

    The study aimed to determine the effects of reduction of dietary crude protein (CP) level with balanced essential amino acids (EAA) on intestinal bacteria and their metabolites of growing pigs. Forty pigs (initial BW 13.50 ± 0.50 kg, 45 ± 2 days of age) were randomly assigned to four dietary treatments containing CP levels at 20.00% (normal crude protein, NP); 17.16% (medium crude protein, MP); 15.30% (low crude protein, LP); and 13.90% (extremely low crude protein, ELP), respectively. Crystalline AAs were added to meet the EAA requirement of pigs. After 4-week feeding, eight pigs per treatment (n = 8) were randomly selected and slaughtered for sampling of ileal, cecal, and colonic digesta and mucosa. Pigs with moderately reduced CP level had increased bacterial diversity, with the Shannon diversity indices for the colon digesta in the LP group and mucosa in the MP and LP groups significantly (P < 0.05) higher than those in the NP and ELP groups. As the CP level reduces, the Bifidobacterium population were linearly decreased (P < 0.05) both in ileum, cecum, and colon, and the ELP group had the lowest Bifidobacterium population in the cecum and colon, with its value significantly lower than NP and MP groups (P < 0.05). However, the ELP group had the highest population of Escherichia coli in the colon, with its value significantly higher than the LP group (P < 0.05). For bacterial metabolites, as CP level decreased, total short-chain fatty acid (T-SCFA), acetate, and butyrate were linearly increased (linear, P < 0.05) in the ileum, while all SCFAs except formate in the cecum and T-SCFA and acetate in the colon, were linearly decreased (P < 0.05). Reducing CP level led to a linear decrease of microbial crude protein (MCP) in the ileum (P < 0.05) and ammonia in all intestine segments (P < 0.05). The spermidine in cecum and total amines, cadaverine, methylamine, and spermidine in colon were shown a quadratic change (P < 0.05) as dietary CP

  8. Using FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements) to isolate active regulatory DNA

    PubMed Central

    Simon, Jeremy M.; Giresi, Paul G.; Davis, Ian J.; Lieb, Jason D.

    2013-01-01

    Eviction or destabilization of nucleosomes from chromatin is a hallmark of functional regulatory elements of the eukaryotic genome. Historically identified by nuclease hypersensitivity, these regulatory elements are typically bound by transcription factors or other regulatory proteins. FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements) is an alternative approach to identify these genomic regions and has proven successful in a multitude of eukaryotic cell and tissue types. Cells or dissociated tissues are crosslinked briefly with formaldehyde, lysed, and sonicated. Sheared chromatin is subjected to phenol-chloroform extraction and the isolated DNA, typically encompassing 1–3% of the human genome, is purified. We provide guidelines for quantitative analysis by PCR, microarrays, or next-generation sequencing. Regulatory elements enriched by FAIRE display high concordance with those identified by nuclease hypersensitivity or ChIP, and the entire procedure can be completed in three days. FAIRE exhibits low technical variability, which allows its use in large-scale studies of chromatin from normal or diseased tissues. PMID:22262007

  9. Infection of orthopedic implants with emphasis on bacterial adhesion process and techniques used in studying bacterial-material interactions

    PubMed Central

    Ribeiro, Marta; Monteiro, Fernando J.; Ferraz, Maria P.

    2012-01-01

    Staphylococcus comprises up to two-thirds of all pathogens in orthopedic implant infections and they are the principal causative agents of two major types of infection affecting bone: septic arthritis and osteomyelitis, which involve the inflammatory destruction of joint and bone. Bacterial adhesion is the first and most important step in implant infection. It is a complex process influenced by environmental factors, bacterial properties, material surface properties and by the presence of serum or tissue proteins. Properties of the substrate, such as chemical composition of the material, surface charge, hydrophobicity, surface roughness and the presence of specific proteins at the surface, are all thought to be important in the initial cell attachment process. The biofilm mode of growth of infecting bacteria on an implant surface protects the organisms from the host immune system and antibiotic therapy. The research for novel therapeutic strategies is incited by the emergence of antibiotic-resistant bacteria. This work will provide an overview of the mechanisms and factors involved in bacterial adhesion, the techniques that are currently being used studying bacterial-material interactions as well as provide insight into future directions in the field. PMID:23507884

  10. Soy protein supports cardiovascular health by downregulating hydroxymethylglutaryl-coenzyme A reductase and sterol regulatory element-binding protein-2 and increasing antioxidant enzyme activity in rats with dextran sodium sulfate-induced mild systemic inflammation.

    PubMed

    Marsh, Tanya G; Straub, Rachel K; Villalobos, Fatima; Hong, Mee Young

    2011-12-01

    Animal and human studies have indicated that the presence of soy in the diet improves cardiovascular health. Inflammation plays a pivotal role in the progression of cardiovascular disease (CVD). However, little is known about how dextran sodium sulfate (DSS)-induced systemic inflammation impacts overall heart health and, correspondingly, how soy protein modulates risk of CVD development in DSS-induced systemic inflammation. We hypothesized that soy protein-fed rats would have a lower risk of CVD by beneficial alteration of gene expression involving lipid metabolism and antioxidant capacity in DSS-induced systemic inflammation. Forty Sprague-Dawley rats were divided into 4 groups: casein, casein + DSS, soy protein, and soy protein + DSS. After 26 days, inflammation was induced in one group from each diet by incorporating 3% DSS in drinking water for 48 hours. Soy protein-fed rats had lower final body weights (P = .010), epididymal fat weights (P = .049), total cholesterol (P < .001), and low-density lipoprotein cholesterol (P < .001). In regard to gene expression, soy protein-fed rats had lower sterol regulatory element-binding protein-2 (P = .032) and hydroxymethylglutaryl-coenzyme A reductase (P = .028) levels and higher low-density lipoprotein receptor levels (P = .036). Antioxidant enzyme activity of superoxide dismutase and catalase was higher among the soy protein groups (P = .037 and P = .002, respectively). These results suggest that soy protein positively influences cardiovascular health by regulating serum lipids through modified expression of sterol regulatory element-binding protein-2 and its downstream genes (ie, hydroxymethylglutaryl-coenzyme A reductase and low-density lipoprotein receptor) and by promoting the antioxidant enzyme activity of superoxide dismutase and catalase. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. Bacterial Inclusion Bodies: Discovering Their Better Half.

    PubMed

    Rinas, Ursula; Garcia-Fruitós, Elena; Corchero, José Luis; Vázquez, Esther; Seras-Franzoso, Joaquin; Villaverde, Antonio

    2017-09-01

    Bacterial inclusion bodies (IBs) are functional, non-toxic amyloids occurring in recombinant bacteria showing analogies with secretory granules of the mammalian endocrine system. The scientific interest in these mesoscale protein aggregates has been historically masked by their status as a hurdle in recombinant protein production. However, progressive understanding of how the cell handles the quality of recombinant polypeptides and the main features of their intriguing molecular organization has stimulated the interest in inclusion bodies and spurred their use in diverse technological fields. The engineering and tailoring of IBs as functional protein particles for materials science and biomedicine is a good example of how formerly undesired bacterial byproducts can be rediscovered as promising functional materials for a broad spectrum of applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Channel-Forming Bacterial Toxins in Biosensing and Macromolecule Delivery

    PubMed Central

    Gurnev, Philip A.; Nestorovich, Ekaterina M.

    2014-01-01

    To intoxicate cells, pore-forming bacterial toxins are evolved to allow for the transmembrane traffic of different substrates, ranging from small inorganic ions to cell-specific polypeptides. Recent developments in single-channel electrical recordings, X-ray crystallography, protein engineering, and computational methods have generated a large body of knowledge about the basic principles of channel-mediated molecular transport. These discoveries provide a robust framework for expansion of the described principles and methods toward use of biological nanopores in the growing field of nanobiotechnology. This article, written for a special volume on “Intracellular Traffic and Transport of Bacterial Protein Toxins”, reviews the current state of applications of pore-forming bacterial toxins in small- and macromolecule-sensing, targeted cancer therapy, and drug delivery. We discuss the electrophysiological studies that explore molecular details of channel-facilitated protein and polymer transport across cellular membranes using both natural and foreign substrates. The review focuses on the structurally and functionally different bacterial toxins: gramicidin A of Bacillus brevis, α-hemolysin of Staphylococcus aureus, and binary toxin of Bacillus anthracis, which have found their “second life” in a variety of developing medical and technological applications. PMID:25153255

  13. Direct Imaging of Protein Organization in an Intact Bacterial Organelle Using High-Resolution Atomic Force Microscopy

    PubMed Central

    2016-01-01

    The function of bioenergetic membranes is strongly influenced by the spatial arrangement of their constituent membrane proteins. Atomic force microscopy (AFM) can be used to probe protein organization at high resolution, allowing individual proteins to be identified. However, previous AFM studies of biological membranes have typically required that curved membranes are ruptured and flattened during sample preparation, with the possibility of disruption of the native protein arrangement or loss of proteins. Imaging native, curved membranes requires minimal tip–sample interaction in both lateral and vertical directions. Here, long-range tip–sample interactions are reduced by optimizing the imaging buffer. Tapping mode AFM with high-resonance-frequency small and soft cantilevers, in combination with a high-speed AFM, reduces the forces due to feedback error and enables application of an average imaging force of tens of piconewtons. Using this approach, we have imaged the membrane organization of intact vesicular bacterial photosynthetic “organelles”, chromatophores. Despite the highly curved nature of the chromatophore membrane and lack of direct support, the resolution was sufficient to identify the photosystem complexes and quantify their arrangement in the native state. Successive imaging showed the proteins remain surprisingly static, with minimal rotation or translation over several-minute time scales. High-order assemblies of RC-LH1-PufX complexes are observed, and intact ATPases are successfully imaged. The methods developed here are likely to be applicable to a broad range of protein-rich vesicles or curved membrane systems, which are an almost ubiquitous feature of native organelles. PMID:28114766

  14. Crystal structures of the apo and ATP bound Mycobacterium tuberculosis nitrogen regulatory PII protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shetty, Nishant D.; Reddy, Manchi C.M.; Palaninathan, Satheesh K.

    2010-10-11

    PII constitutes a family of signal transduction proteins that act as nitrogen sensors in microorganisms and plants. Mycobacterium tuberculosis (Mtb) has a single homologue of PII whose precise role has as yet not been explored. We have solved the crystal structures of the Mtb PII protein in its apo and ATP bound forms to 1.4 and 2.4 {angstrom} resolutions, respectively. The protein forms a trimeric assembly in the crystal lattice and folds similarly to the other PII family proteins. The Mtb PII:ATP binary complex structure reveals three ATP molecules per trimer, each bound between the base of the T-loop ofmore » one subunit and the C-loop of the neighboring subunit. In contrast to the apo structure, at least one subunit of the binary complex structure contains a completely ordered T-loop indicating that ATP binding plays a role in orienting this loop region towards target proteins like the ammonium transporter, AmtB. Arg38 of the T-loop makes direct contact with the {gamma}-phosphate of the ATP molecule replacing the Mg{sup 2+} position seen in the Methanococcus jannaschii GlnK1 structure. The C-loop of a neighboring subunit encloses the other side of the ATP molecule, placing the GlnK specific C-terminal 3{sub 10} helix in the vicinity. Homology modeling studies with the E. coli GlnK:AmtB complex reveal that Mtb PII could form a complex similar to the complex in E. coli. The structural conservation and operon organization suggests that the Mtb PII gene encodes for a GlnK protein and might play a key role in the nitrogen regulatory pathway.« less

  15. MIPS bacterial genomes functional annotation benchmark dataset.

    PubMed

    Tetko, Igor V; Brauner, Barbara; Dunger-Kaltenbach, Irmtraud; Frishman, Goar; Montrone, Corinna; Fobo, Gisela; Ruepp, Andreas; Antonov, Alexey V; Surmeli, Dimitrij; Mewes, Hans-Wernen

    2005-05-15

    Any development of new methods for automatic functional annotation of proteins according to their sequences requires high-quality data (as benchmark) as well as tedious preparatory work to generate sequence parameters required as input data for the machine learning methods. Different program settings and incompatible protocols make a comparison of the analyzed methods difficult. The MIPS Bacterial Functional Annotation Benchmark dataset (MIPS-BFAB) is a new, high-quality resource comprising four bacterial genomes manually annotated according to the MIPS functional catalogue (FunCat). These resources include precalculated sequence parameters, such as sequence similarity scores, InterPro domain composition and other parameters that could be used to develop and benchmark methods for functional annotation of bacterial protein sequences. These data are provided in XML format and can be used by scientists who are not necessarily experts in genome annotation. BFAB is available at http://mips.gsf.de/proj/bfab

  16. Widespread presence of "bacterial-like" PPP phosphatases in eukaryotes.

    PubMed

    Andreeva, Alexandra V; Kutuzov, Mikhail A

    2004-11-19

    In eukaryotes, PPP (protein phosphatase P) family is one of the two known protein phosphatase families specific for Ser and Thr. The role of PPP phosphatases in multiple signaling pathways in eukaryotic cell has been extensively studied. Unlike eukaryotic PPP phosphatases, bacterial members of the family have broad substrate specificity or may even be Tyr-specific. Moreover, one group of bacterial PPPs are diadenosine tetraphosphatases, indicating that bacterial PPP phosphatases may not necessarily function as protein phosphatases. We describe the presence in eukaryotes of three groups of expressed genes encoding "non-conventional" phosphatases of the PPP family. These enzymes are more closely related to bacterial PPP phosphatases than to the known eukaryotic members of the family. One group, found exclusively in land plants, is most closely related to PPP phosphatases from some alpha-Proteobacteria, including Rhizobiales, Rhodobacterales and Rhodospirillaceae. This group is therefore termed Rhizobiales / Rhodobacterales / Rhodospirillaceae-like phosphatases, or Rhilphs. Phosphatases of the other group are found in Viridiplantae, Rhodophyta, Trypanosomatidae, Plasmodium and some fungi. They are structurally related to phosphatases from psychrophilic bacteria Shewanella and Colwellia, and are termed Shewanella-like phosphatases, or Shelphs. Phosphatases of the third group are distantly related to ApaH, bacterial diadenosine tetraphosphatases, and are termed ApaH-like phosphatases, or Alphs. Patchy distribution of Alphs in animals, plants, fungi, diatoms and kinetoplasts suggests that these phosphatases were present in the common ancestor of eukaryotes but were independently lost in many lineages. Rhilphs, Shelphs and Alphs form PPP clades, as divergent from "conventional" eukaryotic PPP phosphatases as they are from each other and from major bacterial clades. In addition, comparison of primary structures revealed a previously unrecognised (I/L/V)D(S/T)G motif

  17. Association of C-Reactive Protein With Bacterial and Respiratory Syncytial Virus-Associated Pneumonia Among Children Aged <5 Years in the PERCH Study.

    PubMed

    Higdon, Melissa M; Le, Tham; O'Brien, Katherine L; Murdoch, David R; Prosperi, Christine; Baggett, Henry C; Brooks, W Abdullah; Feikin, Daniel R; Hammitt, Laura L; Howie, Stephen R C; Kotloff, Karen L; Levine, Orin S; Scott, J Anthony G; Thea, Donald M; Awori, Juliet O; Baillie, Vicky L; Cascio, Stephanie; Chuananon, Somchai; DeLuca, Andrea N; Driscoll, Amanda J; Ebruke, Bernard E; Endtz, Hubert P; Kaewpan, Anek; Kahn, Geoff; Karani, Angela; Karron, Ruth A; Moore, David P; Park, Daniel E; Rahman, Mohammed Ziaur; Salaudeen, Rasheed; Seidenberg, Phil; Somwe, Somwe Wa; Sylla, Mamadou; Tapia, Milagritos D; Zeger, Scott L; Deloria Knoll, Maria; Madhi, Shabir A

    2017-06-15

    Lack of a gold standard for identifying bacterial and viral etiologies of pneumonia has limited evaluation of C-reactive protein (CRP) for identifying bacterial pneumonia. We evaluated the sensitivity and specificity of CRP for identifying bacterial vs respiratory syncytial virus (RSV) pneumonia in the Pneumonia Etiology Research for Child Health (PERCH) multicenter case-control study. We measured serum CRP levels in cases with World Health Organization-defined severe or very severe pneumonia and a subset of community controls. We evaluated the sensitivity and specificity of elevated CRP for "confirmed" bacterial pneumonia (positive blood culture or positive lung aspirate or pleural fluid culture or polymerase chain reaction [PCR]) compared to "RSV pneumonia" (nasopharyngeal/oropharyngeal or induced sputum PCR-positive without confirmed/suspected bacterial pneumonia). Receiver operating characteristic (ROC) curves were constructed to assess the performance of elevated CRP in distinguishing these cases. Among 601 human immunodeficiency virus (HIV)-negative tested controls, 3% had CRP ≥40 mg/L. Among 119 HIV-negative cases with confirmed bacterial pneumonia, 77% had CRP ≥40 mg/L compared with 17% of 556 RSV pneumonia cases. The ROC analysis produced an area under the curve of 0.87, indicating very good discrimination; a cut-point of 37.1 mg/L best discriminated confirmed bacterial pneumonia (sensitivity 77%) from RSV pneumonia (specificity 82%). CRP ≥100 mg/L substantially improved specificity over CRP ≥40 mg/L, though at a loss to sensitivity. Elevated CRP was positively associated with confirmed bacterial pneumonia and negatively associated with RSV pneumonia in PERCH. CRP may be useful for distinguishing bacterial from RSV-associated pneumonia, although its role in discriminating against other respiratory viral-associated pneumonia needs further study. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.

  18. Association of C-Reactive Protein With Bacterial and Respiratory Syncytial Virus–Associated Pneumonia Among Children Aged <5 Years in the PERCH Study

    PubMed Central

    Le, Tham; O’Brien, Katherine L.; Murdoch, David R.; Prosperi, Christine; Baggett, Henry C.; Brooks, W. Abdullah; Feikin, Daniel R.; Hammitt, Laura L.; Howie, Stephen R. C.; Kotloff, Karen L.; Levine, Orin S.; Scott, J. Anthony G.; Thea, Donald M.; Awori, Juliet O.; Baillie, Vicky L.; Cascio, Stephanie; Chuananon, Somchai; DeLuca, Andrea N.; Driscoll, Amanda J.; Ebruke, Bernard E.; Endtz, Hubert P.; Kaewpan, Anek; Kahn, Geoff; Karani, Angela; Karron, Ruth A.; Moore, David P.; Park, Daniel E.; Rahman, Mohammed Ziaur; Salaudeen, Rasheed; Seidenberg, Phil; Somwe, Somwe Wa; Sylla, Mamadou; Tapia, Milagritos D.; Zeger, Scott L.; Deloria Knoll, Maria; Madhi, Shabir A.; O’Brien, Katherine L.; Levine, Orin S.; Knoll, Maria Deloria; Feikin, Daniel R.; DeLuca, Andrea N.; Driscoll, Amanda J.; Fancourt, Nicholas; Fu, Wei; Hammitt, Laura L.; Higdon, Melissa M.; Kagucia, E. Wangeci; Karron, Ruth A.; Li, Mengying; Park, Daniel E.; Prosperi, Christine; Wu, Zhenke; Zeger, Scott L.; Watson, Nora L.; Crawley, Jane; Murdoch, David R.; Brooks, W. Abdullah; Endtz, Hubert P.; Zaman, Khalequ; Goswami, Doli; Hossain, Lokman; Jahan, Yasmin; Ashraf, Hasan; Howie, Stephen R. C.; Ebruke, Bernard E.; Antonio, Martin; McLellan, Jessica; Machuka, Eunice; Shamsul, Arifin; Zaman, Syed M.A.; Mackenzie, Grant; Scott, J. Anthony G.; Awori, Juliet O.; Morpeth, Susan C.; Kamau, Alice; Kazungu, Sidi; Ominde, Micah Silaba; Kotloff, Karen L.; Tapia, Milagritos D.; Sow, Samba O.; Sylla, Mamadou; Tamboura, Boubou; Onwuchekwa, Uma; Kourouma, Nana; Toure, Aliou; Madhi, Shabir A.; Moore, David P.; Adrian, Peter V.; Baillie, Vicky L.; Kuwanda, Locadiah; Mudau, Azwifarwi; Groome, Michelle J.; Mahomed, Nasreen; Baggett, Henry C.; Thamthitiwat, Somsak; Maloney, Susan A.; Bunthi, Charatdao; Rhodes, Julia; Sawatwong, Pongpun; Akarasewi, Pasakorn; Thea, Donald M.; Mwananyanda, Lawrence; Chipeta, James; Seidenberg, Phil; Mwansa, James; Wa Somwe, Somwe; Kwenda, Geoffrey; Anderson, Trevor P.; Mitchell, Joanne

    2017-01-01

    Abstract Background. Lack of a gold standard for identifying bacterial and viral etiologies of pneumonia has limited evaluation of C-reactive protein (CRP) for identifying bacterial pneumonia. We evaluated the sensitivity and specificity of CRP for identifying bacterial vs respiratory syncytial virus (RSV) pneumonia in the Pneumonia Etiology Research for Child Health (PERCH) multicenter case-control study. Methods. We measured serum CRP levels in cases with World Health Organization–defined severe or very severe pneumonia and a subset of community controls. We evaluated the sensitivity and specificity of elevated CRP for “confirmed” bacterial pneumonia (positive blood culture or positive lung aspirate or pleural fluid culture or polymerase chain reaction [PCR]) compared to “RSV pneumonia” (nasopharyngeal/oropharyngeal or induced sputum PCR-positive without confirmed/suspected bacterial pneumonia). Receiver operating characteristic (ROC) curves were constructed to assess the performance of elevated CRP in distinguishing these cases. Results. Among 601 human immunodeficiency virus (HIV)–negative tested controls, 3% had CRP ≥40 mg/L. Among 119 HIV-negative cases with confirmed bacterial pneumonia, 77% had CRP ≥40 mg/L compared with 17% of 556 RSV pneumonia cases. The ROC analysis produced an area under the curve of 0.87, indicating very good discrimination; a cut-point of 37.1 mg/L best discriminated confirmed bacterial pneumonia (sensitivity 77%) from RSV pneumonia (specificity 82%). CRP ≥100 mg/L substantially improved specificity over CRP ≥40 mg/L, though at a loss to sensitivity. Conclusions. Elevated CRP was positively associated with confirmed bacterial pneumonia and negatively associated with RSV pneumonia in PERCH. CRP may be useful for distinguishing bacterial from RSV-associated pneumonia, although its role in discriminating against other respiratory viral-associated pneumonia needs further study. PMID:28575375

  19. TRIP13 is a protein-remodeling AAA+ ATPase that catalyzes MAD2 conformation switching

    DOE PAGES

    Ye, Qiaozhen; Rosenberg, Scott C.; Moeller, Arne; ...

    2015-04-28

    The AAA+ family ATPase TRIP13 is a key regulator of meiotic recombination and the spindle assembly checkpoint, acting on signaling proteins of the conserved HORMA domain family. Here we present the structure of the Caenorhabditis elegans TRIP13 ortholog PCH-2, revealing a new family of AAA+ ATPase protein remodelers. PCH-2 possesses a substrate-recognition domain related to those of the protein remodelers NSF and p97, while its overall hexameric architecture and likely structural mechanism bear close similarities to the bacterial protein unfoldase ClpX. We find that TRIP13, aided by the adapter protein p31(comet), converts the HORMA-family spindle checkpoint protein MAD2 from amore » signaling-active ‘closed’ conformer to an inactive ‘open’ conformer. We propose that TRIP13 and p31(comet) collaborate to inactivate the spindle assembly checkpoint through MAD2 conformational conversion and disassembly of mitotic checkpoint complexes. A parallel HORMA protein disassembly activity likely underlies TRIP13's critical regulatory functions in meiotic chromosome structure and recombination.« less

  20. Paramyxovirus V Proteins Interact with the RIG-I/TRIM25 Regulatory Complex and Inhibit RIG-I Signaling.

    PubMed

    Sánchez-Aparicio, Maria T; Feinman, Leighland J; García-Sastre, Adolfo; Shaw, Megan L

    2018-03-15

    Paramyxovirus V proteins are known antagonists of the RIG-I-like receptor (RLR)-mediated interferon induction pathway, interacting with and inhibiting the RLR MDA5. We report interactions between the Nipah virus V protein and both RIG-I regulatory protein TRIM25 and RIG-I. We also observed interactions between these host proteins and the V proteins of measles virus, Sendai virus, and parainfluenza virus. These interactions are mediated by the conserved C-terminal domain of the V protein, which binds to the tandem caspase activation and recruitment domains (CARDs) of RIG-I (the region of TRIM25 ubiquitination) and to the SPRY domain of TRIM25, which mediates TRIM25 interaction with the RIG-I CARDs. Furthermore, we show that V interaction with TRIM25 and RIG-I prevents TRIM25-mediated ubiquitination of RIG-I and disrupts downstream RIG-I signaling to the mitochondrial antiviral signaling protein. This is a novel mechanism for innate immune inhibition by paramyxovirus V proteins, distinct from other known V protein functions such as MDA5 and STAT1 antagonism. IMPORTANCE The host RIG-I signaling pathway is a key early obstacle to paramyxovirus infection, as it results in rapid induction of an antiviral response. This study shows that paramyxovirus V proteins interact with and inhibit the activation of RIG-I, thereby interrupting the antiviral signaling pathway and facilitating virus replication. Copyright © 2018 American Society for Microbiology.

  1. Warfare between Host Immunity and Bacterial Weapons.

    PubMed

    Yu, Manda; Lai, Erh-Min

    2017-01-11

    Bacterial pathogens deploy protein secretion systems to facilitate infection and colonization of their hosts. In this issue of Cell Host & Microbe, Chen et al. (2017) report a new role for a type VI secretion effector in promoting bacterial colonization by preventing inflammasome activation induced by a type III secretion system. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Hesperidin Induces Apoptosis by Inhibiting Sp1 and Its Regulatory Protein in MSTO-211H Cells

    PubMed Central

    Lee, Kyung-Ae; Lee, Sang-Han; Lee, Yong-Jin; Baeg, Seung Mi; Shim, Jung-Hyun

    2012-01-01

    Hesperidin, a flavanone present in citrus fruits, has been studied as potential therapeutic agents that have anti-tumor activity and apoptotic effects in several cancers, but there is no report about the apoptotic effect of hesperidin in human malignant pleural mesothelioma through the specificity protein 1 (Sp1) protein. We investigated whether hesperidin inhibited cell growth and regulated Sp1 target proteins by suppressing the levels of Sp1 protein in MSTO-211H cells. The IC50 value of hesperidin was determined to be 152.3 μM in MSTO-211H cells for 48 h. Our results suggested that hesperidin (0-160 μM) decreased cell viability, and induced apoptotic cell death. Hesperidin increased Sub-G1 population in MSTO-211H cells. Hesperidin significantly suppressed mRNA/protein level of Sp1 and modulated the expression level of the Sp1 regulatory protein such as p27, p21, cyclin D1, Mcl-1, and survivin in mesothelioma cells. Also, hesperidin induced apoptotic signaling including: cleavages of Bid, caspase-3, and PARP, upregulation of Bax, and down-regulation of Bcl-xl in mesothelioma cells. These results show that hesperidin suppressed mesothelioma cell growth through inhibition of Sp1. In this study, we demonstrated that Sp1 acts as a novel molecular target of hesperidin in human malignant pleural mesothelioma. PMID:24130923

  3. Interplay of PDZ and protease domain of DegP ensures efficient elimination of misfolded proteins

    PubMed Central

    Krojer, Tobias; Pangerl, Karen; Kurt, Juliane; Sawa, Justyna; Stingl, Christoph; Mechtler, Karl; Huber, Robert; Ehrmann, Michael; Clausen, Tim

    2008-01-01

    Aberrant proteins represent an extreme hazard to cells. Therefore, molecular chaperones and proteases have to carry out protein quality control in each cellular compartment. In contrast to the ATP-dependent cytosolic proteases and chaperones, the molecular mechanisms of extracytosolic factors are largely unknown. To address this question, we studied the protease function of DegP, the central housekeeping protein in the bacterial envelope. Our data reveal that DegP processively degrades misfolded proteins into peptides of defined size by employing a molecular ruler comprised of the PDZ1 domain and the proteolytic site. Furthermore, peptide binding to the PDZ domain transforms the resting protease into its active state. This allosteric activation mechanism ensures the regulated and rapid elimination of misfolded proteins upon folding stress. In comparison to the cytosolic proteases, the regulatory features of DegP are established by entirely different mechanisms reflecting the convergent evolution of an extracytosolic housekeeping protease. PMID:18505836

  4. pLoc_bal-mGpos: Predict subcellular localization of Gram-positive bacterial proteins by quasi-balancing training dataset and PseAAC.

    PubMed

    Xiao, Xuan; Cheng, Xiang; Chen, Genqiang; Mao, Qi; Chou, Kuo-Chen

    2018-05-26

    Knowledge of protein subcellular localization is vitally important for both basic research and drug development. With the avalanche of protein sequences emerging in the post-genomic age, it is highly desired to develop computational tools for timely and effectively identifying their subcellular localization purely based on the sequence information alone. Recently, a predictor called "pLoc-mGpos" was developed for identifying the subcellular localization of Gram-positive bacterial proteins. Its performance is overwhelmingly better than that of the other predictors for the same purpose, particularly in dealing with multi-label systems in which some proteins, called "multiplex proteins", may simultaneously occur in two or more subcellular locations. Although it is indeed a very powerful predictor, more efforts are definitely needed to further improve it. This is because pLoc-mGpos was trained by an extremely skewed dataset in which some subset (subcellular location) was over 11 times the size of the other subsets. Accordingly, it cannot avoid the bias consequence caused by such an uneven training dataset. To alleviate such bias consequence, we have developed a new and bias-reducing predictor called pLoc_bal-mGpos by quasi-balancing the training dataset. Rigorous target jackknife tests on exactly the same experiment-confirmed dataset have indicated that the proposed new predictor is remarkably superior to pLoc-mGpos, the existing state-of-the-art predictor in identifying the subcellular localization of Gram-positive bacterial proteins. To maximize the convenience for most experimental scientists, a user-friendly web-server for the new predictor has been established at http://www.jci-bioinfo.cn/pLoc_bal-mGpos/, by which users can easily get their desired results without the need to go through the detailed mathematics. Copyright © 2018 Elsevier Inc. All rights reserved.

  5. Validating regulatory predictions from diverse bacteria with mutant fitness data

    DOE PAGES

    Sagawa, Shiori; Price, Morgan N.; Deutschbauer, Adam M.; ...

    2017-05-24

    Although transcriptional regulation is fundamental to understanding bacterial physiology, the targets of most bacterial transcription factors are not known. Comparative genomics has been used to identify likely targets of some of these transcription factors, but these predictions typically lack experimental support. Here, we used mutant fitness data, which measures the importance of each gene for a bacterium's growth across many conditions, to test regulatory predictions from RegPrecise, a curated collection of comparative genomics predictions. Because characterized transcription factors often have correlated fitness with one of their targets (either positively or negatively), correlated fitness patterns provide support for the comparative genomicsmore » predictions. At a false discovery rate of 3%, we identified significant cofitness for at least one target of 158 TFs in 107 ortholog groups and from 24 bacteria. Thus, high-throughput genetics can be used to identify a high-confidence subset of the sequence-based regulatory predictions.« less

  6. Validating regulatory predictions from diverse bacteria with mutant fitness data

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sagawa, Shiori; Price, Morgan N.; Deutschbauer, Adam M.

    Although transcriptional regulation is fundamental to understanding bacterial physiology, the targets of most bacterial transcription factors are not known. Comparative genomics has been used to identify likely targets of some of these transcription factors, but these predictions typically lack experimental support. Here, we used mutant fitness data, which measures the importance of each gene for a bacterium's growth across many conditions, to test regulatory predictions from RegPrecise, a curated collection of comparative genomics predictions. Because characterized transcription factors often have correlated fitness with one of their targets (either positively or negatively), correlated fitness patterns provide support for the comparative genomicsmore » predictions. At a false discovery rate of 3%, we identified significant cofitness for at least one target of 158 TFs in 107 ortholog groups and from 24 bacteria. Thus, high-throughput genetics can be used to identify a high-confidence subset of the sequence-based regulatory predictions.« less

  7. Self-assembling, protein-based intracellular bacterial organelles: emerging vehicles for encapsulating, targeting and delivering therapeutical cargoes

    PubMed Central

    2011-01-01

    Many bacterial species contain intracellular nano- and micro-compartments consisting of self-assembling proteins that form protein-only shells. These structures are built up by combinations of a reduced number of repeated elements, from 60 repeated copies of one unique structural element self-assembled in encapsulins of 24 nm to 10,000-20,000 copies of a few protein species assembled in a organelle of around 100-150 nm in cross-section. However, this apparent simplicity does not correspond to the structural and functional sophistication of some of these organelles. They package, by not yet definitely solved mechanisms, one or more enzymes involved in specific metabolic pathways, confining such reactions and sequestering or increasing the inner concentration of unstable, toxics or volatile intermediate metabolites. From a biotechnological point of view, we can use the self assembling properties of these particles for directing shell assembling and enzyme packaging, mimicking nature to design new applications in biotechnology. Upon appropriate engineering of the building blocks, they could act as a new family of self-assembled, protein-based vehicles in Nanomedicine to encapsulate, target and deliver therapeutic cargoes to specific cell types and/or tissues. This would provide a new, intriguing platform of microbial origin for drug delivery. PMID:22046962

  8. Co-expression of heat shock protein (HSP) 40 and HSP70 in Pinctada martensii response to thermal, low salinity and bacterial challenges.

    PubMed

    Li, Jun; Zhang, Yuehuan; Liu, Ying; Zhang, Yang; Xiao, Shu; Yu, Ziniu

    2016-01-01

    Heat shock protein (HSP) 40 proteins are a family of molecular chaperones that bind to HSP70 through their J-domain and regulate the function of HSP70 by stimulating its adenosine triphosphatase activity. In the present study, a HSP40 homolog named PmHSP40 was cloned from the hemocytes of pearl oyster Pinctada martensii using EST and rapid amplification of cDNA ends (RACE) techniques. The full-length cDNA of PmHSP40 was 1251 bp in length, which included a 5' untranslated region (UTR) of 75 bp, an open reading frame (ORF) of a 663 bp, and a 3' UTR of 513 bp. The deduced amino acid sequence of PmHSP40 contains a J domain in the N-terminus. In response to thermal and low salinity stress challenges, the expression of PmHSP40 in hemocytes and the gill were inducible in a time-dependent manner. After bacterial challenge, PmHSP40 transcripts in hemocytes increased and peaked at 6 h post injection. In the gill, PmHSP40 expression increased, similar to expression in hemocytes; however, transcript expression of PmHSP40 was significantly up-regulated at 12 h post injection. Furthermore, the transcripts of PmHSP70 showed similar kinetics as that of PmHSP40, with highest induction during thermal, low salinity stress and bacterial challenges. Altogether these results demonstrate that PmHSP40 is an inducible protein under thermal, low salinity and bacterial challenges, suggesting its involvement in both environmental and biological stresses, and in the innate immunity of the pearl oyster. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Disarming Bacterial Virulence through Chemical Inhibition of the DNA Binding Domain of an AraC-like Transcriptional Activator Protein*

    PubMed Central

    Yang, Ji; Hocking, Dianna M.; Cheng, Catherine; Dogovski, Con; Perugini, Matthew A.; Holien, Jessica K.; Parker, Michael W.; Hartland, Elizabeth L.; Tauschek, Marija; Robins-Browne, Roy M.

    2013-01-01

    The misuse of antibiotics during past decades has led to pervasive antibiotic resistance in bacteria. Hence, there is an urgent need for the development of new and alternative approaches to combat bacterial infections. In most bacterial pathogens the expression of virulence is tightly regulated at the transcriptional level. Therefore, targeting pathogens with drugs that interfere with virulence gene expression offers an effective alternative to conventional antimicrobial chemotherapy. Many Gram-negative intestinal pathogens produce AraC-like proteins that control the expression of genes required for infection. In this study we investigated the prototypical AraC-like virulence regulator, RegA, from the mouse attaching and effacing pathogen, Citrobacter rodentium, as a potential drug target. By screening a small molecule chemical library and chemical optimization, we identified two compounds that specifically inhibited the ability of RegA to activate its target promoters and thus reduced expression of a number of proteins required for virulence. Biophysical, biochemical, genetic, and computational analyses indicated that the more potent of these two compounds, which we named regacin, disrupts the DNA binding capacity of RegA by interacting with amino acid residues within a conserved region of the DNA binding domain. Oral administration of regacin to mice, commencing 15 min before or 12 h after oral inoculation with C. rodentium, caused highly significant attenuation of intestinal colonization by the mouse pathogen comparable to that of an isogenic regA-deletion mutant. These findings demonstrate that chemical inhibition of the DNA binding domains of transcriptional regulators is a viable strategy for the development of antimicrobial agents that target bacterial pathogens. PMID:24019519

  10. Development and characterization of bacterial cellulose reinforced biocomposite films based on protein from buckwheat distiller's dried grains.

    PubMed

    Wang, Xuejiao; Ullah, Niamat; Sun, Xuchun; Guo, Yan; Chen, Lin; Li, Zhixi; Feng, Xianchao

    2017-03-01

    Biocomposite films were manufactured by combining protein extracted from buckwheat distiller's dried grains with bacterial cellulose (BC). The film microstructures showed that BC is compatible with protein matrix and endows the film with high rigidity. Differential scanning calorimetry (DSC) showed that BC can promote thermal stability of the composite films. BC promoted the transition from a Newtonian to a non-Newtonian fluid and the shear thinning behavior of protein-BC solution. Fourier Transform Infrared (FTIR) spectroscopy showed the main functional groups' absorption peaks shifted to lower wavenumbers. Results of both FTIR and viscosity analysis proved the formation of intermolecular interactions through hydrogen bonds. These bonds affected film characteristics such as moisture content (MC), water solubility (WS), and water vapor permeability (WVP), which decreased with addition of BC. The WVP (6.68±0.78-5.95±0.54×10 -10 gm/Pasm 2 ) of the films were lower than other protein films. Tensile strength (TS) values of films containing 1.8% and 2.0% BC (14.98±0.97 and 15.03±2.04MPa) were significantly higher than that of pure protein films (4.26±0.66MPa). Combination of proteins extracted from a waste product and BC led to composite films with low water vapor permeability and excellent mechanical properties. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Specific interactions between DNA and regulatory protein controlled by ligand-binding: Ab initio molecular simulation

    NASA Astrophysics Data System (ADS)

    Matsushita, Y.; Murakawa, T.; Shimamura, K.; Oishi, M.; Ohyama, T.; Kurita, N.

    2015-02-01

    The catabolite activator protein (CAP) is one of the regulatory proteins controlling the transcription mechanism of gene. Biochemical experiments elucidated that the complex of CAP with cyclic AMP (cAMP) is indispensable for controlling the mechanism, while previous molecular simulations for the monomer of CAP+cAMP complex revealed the specific interactions between CAP and cAMP. However, the effect of cAMP-binding to CAP on the specific interactions between CAP and DNA is not elucidated at atomic and electronic levels. We here considered the ternary complex of CAP, cAMP and DNA in solvating water molecules and investigated the specific interactions between them at atomic and electronic levels using ab initio molecular simulations based on classical molecular dynamics and ab initio fragment molecular orbital methods. The results highlight the important amino acid residues of CAP for the interactions between CAP and cAMP and between CAP and DNA.

  12. Jellyfish modulate bacterial dynamic and community structure.

    PubMed

    Tinta, Tinkara; Kogovšek, Tjaša; Malej, Alenka; Turk, Valentina

    2012-01-01

    Jellyfish blooms have increased in coastal areas around the world and the outbreaks have become longer and more frequent over the past few decades. The Mediterranean Sea is among the heavily affected regions and the common bloom-forming taxa are scyphozoans Aurelia aurita s.l., Pelagia noctiluca, and Rhizostoma pulmo. Jellyfish have few natural predators, therefore their carcasses at the termination of a bloom represent an organic-rich substrate that supports rapid bacterial growth, and may have a large impact on the surrounding environment. The focus of this study was to explore whether jellyfish substrate have an impact on bacterial community phylotype selection. We conducted in situ jellyfish-enrichment experiment with three different jellyfish species. Bacterial dynamic together with nutrients were monitored to assess decaying jellyfish-bacteria dynamics. Our results show that jellyfish biomass is characterized by protein rich organic matter, which is highly bioavailable to 'jellyfish-associated' and 'free-living' bacteria, and triggers rapid shifts in bacterial population dynamics and composition. Based on 16S rRNA clone libraries and denaturing gradient gel electrophoresis (DGGE) analysis, we observed a rapid shift in community composition from unculturable Alphaproteobacteria to culturable species of Gammaproteobacteria and Flavobacteria. The results of sequence analyses of bacterial isolates and of total bacterial community determined by culture independent genetic analysis showed the dominance of the Pseudoalteromonadaceae and the Vibrionaceae families. Elevated levels of dissolved proteins, dissolved organic and inorganic nutrient release, bacterial abundance and carbon production as well as ammonium concentrations characterized the degradation process. The biochemical composition of jellyfish species may influence changes in the amount of accumulated dissolved organic and inorganic nutrients. Our results can contribute insights into possible changes in

  13. Effects of the Bacterial Extract OM-85 on Phagocyte Functions and the Stress Response

    PubMed Central

    Baladi, S.; Kantengwa, S.; Donati, Y. R. A.; Polla, B. S.

    1994-01-01

    The effects of the bacterial extract OM-85 on the respiratory burst, intracellular calcium and the stress response have been investigated in human peripheral blood monocytes from normal donors. Activation of the respiratory burst during bacterial phagocytosis has been previously associated with heat shock/stress proteins synthesis. Whereas OM-85 stimulated superoxide production and increased Ca2+ mobilization, it fared to induce synthesis of classical HSPs. The lack of stress protein induction was observed even in the presence of iron which potentiates both oxidative injury and stress protein induction during bacterial phagocytosis. However OM-85 induced a 75–78 kDa protein, which is likely to be a glucose regulated protein (GRP78), and enhanced intracellular expression of interleukin-lβ precursor. PMID:18472933

  14. Diagnostic value of lactate, procalcitonin, ferritin, serum-C-reactive protein, and other biomarkers in bacterial and viral meningitis: A cross-sectional study.

    PubMed

    Sanaei Dashti, Anahita; Alizadeh, Shekoofan; Karimi, Abdullah; Khalifeh, Masoomeh; Shoja, Seyed Abdolmajid

    2017-09-01

    There are many difficulties distinguishing bacterial from viral meningitis that could be reasonably solved using biomarkers. The aim of this study was to evaluate lactate, procalcitonin (PCT), ferritin, serum-CRP (C-reactive protein), and other known biomarkers in differentiating bacterial meningitis from viral meningitis in children.All children aged 28 days to 14 years with suspected meningitis who were admitted to Mofid Children's Hospital, Tehran, between October 2012 and November 2013, were enrolled in this prospective cross-sectional study. Children were divided into 2 groups of bacterial and viral meningitis, based on the results of cerebrospinal fluid (CSF) culture, polymerase chain reaction, and cytochemical profile. Diagnostic values of CSF parameters (ferritin, PCT, absolute neutrophil count [ANC], white blood cell count, and lactate) and serum parameters (PCT, ferritin, CRP, and erythrocyte sedimentation rate [ESR]) were evaluated.Among 50 patients with meningitis, 12 were diagnosed with bacterial meningitis. Concentrations of all markers were significantly different between bacterial and viral meningitis, except for serum (P = .389) and CSF (P = .136) PCT. The best rates of area under the receiver operating characteristic (ROC) curve (AUC) were achieved by lactate (AUC = 0.923) and serum-CRP (AUC = 0.889). The best negative predictive values (NPV) for bacterial meningitis were attained by ANC (100%) and lactate (97.1%).The results of our study suggest that ferritin and PCT are not strong predictive biomarkers. A combination of low CSF lactate, ANC, ESR, and serum-CRP could reasonably rule out the bacterial meningitis.

  15. A growing family: the expanding universe of the bacterial cytoskeleton.

    PubMed

    Ingerson-Mahar, Michael; Gitai, Zemer

    2012-01-01

    Cytoskeletal proteins are important mediators of cellular organization in both eukaryotes and bacteria. In the past, cytoskeletal studies have largely focused on three major cytoskeletal families, namely the eukaryotic actin, tubulin, and intermediate filament (IF) proteins and their bacterial homologs MreB, FtsZ, and crescentin. However, mounting evidence suggests that these proteins represent only the tip of the iceberg, as the cellular cytoskeletal network is far more complex. In bacteria, each of MreB, FtsZ, and crescentin represents only one member of large families of diverse homologs. There are also newly identified bacterial cytoskeletal proteins with no eukaryotic homologs, such as WACA proteins and bactofilins. Furthermore, there are universally conserved proteins, such as the metabolic enzyme CtpS, that assemble into filamentous structures that can be repurposed for structural cytoskeletal functions. Recent studies have also identified an increasing number of eukaryotic cytoskeletal proteins that are unrelated to actin, tubulin, and IFs, such that expanding our understanding of cytoskeletal proteins is advancing the understanding of the cell biology of all organisms. Here, we summarize the recent explosion in the identification of new members of the bacterial cytoskeleton and describe a hypothesis for the evolution of the cytoskeleton from self-assembling enzymes. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  16. Effects of dietary protein levels and 2-methylbutyrate on ruminal fermentation, nutrient degradability, bacterial populations and urinary purine derivatives in Simmental steers.

    PubMed

    Wang, C; Liu, Q; Guo, G; Huo, W J; Pei, C X; Zhang, S L; Yang, W Z

    2018-06-01

    The objective of this study was to evaluate the effects of dietary crude protein (CP) levels and 2-methylbutyrate (MB) supplementation on ruminal fermentation, bacterial populations, microbial enzyme activity and urinary excretion of purine derivatives (PD) in Simmental steers. Eight ruminally cannulated Simmental steers, averaging 18 months of age and 465 ± 8.6 kg of body weight (BW), were used in a replicated 4 × 4 Latin square design by a 2 × 2 factorial arrangement. Low protein (98.5 g CP/kg dry matter [LP] or high protein (128.7 g CP/kg dry matter [HP]) diets were fed with MB supplementation (0 g [MB-] or 16.8 g steer -1  day -1 [MB+]). Steers were fed a total mixed ration with dietary corn straw to concentrate ratio of 50:50 (dry matter [DM] basis). The CP × MB interaction was observed for ruminal total VFA, molar proportions of acetate and propionate, acetate to propionate ratio, ammonia-N, effective degradability of neutral detergent fibre (NDF) and CP, microbial enzyme activity, bacterial populations and total PD excretion (p < .05). Ruminal pH decreased (p < .05), but ruminal total VFA concentration increased (p < .05) with increasing dietary CP level or MB supplementation. Acetate molar proportion increased (p = .043) with MB supplementation, but was not affected by dietary CP level. Propionate molar proportion decreased (p < .05) with increasing dietary CP level or MB supplementation. Consequently, acetate-to-propionate ratio increased (p = .001) with MB supplementation, but was not affected by dietary CP level. Ruminal ammonia-N content increased (p = .034) with increasing dietary CP level, but decreased (p = .012) with MB supplementation. The effective degradability of NDF and CP increased (p < .05) with increasing dietary CP level or MB supplementation. Microbial enzyme activity, bacterial populations and total PD excretion also increased (p < .05) with increasing dietary CP level or MB supplementation. The

  17. New perspectives on bacterial ferredoxin evolution

    NASA Technical Reports Server (NTRS)

    George, D. G.; Hunt, L. T.; Yeh, L.-S. L.; Barker, W. C.

    1985-01-01

    Ferredoxins are low-molecular-weight, nonheme, iron proteins which function as electron carriers in a wide variety of electron transport chains. Howard et al. (1983) have suggested that the amino end of Azotobacter vinelandii ferredoxin shows a greater similarity to the carboxyl end of ferredoxin from Chromatium vinosum and that their half-chain sequences are homologous when the half-chains of either species are considered in inverse order. Examination of this proposition has made it necessary to reevaluate previous conclusions concerning the evolution of bacterial ferredoxin. Attention is given to the properties of the bacterial ferredoxin sequences, and the evolution of the bacterial ferredoxins.

  18. The 60 kDa heat shock proteins in the hyperthermophilic archaeon Sulfolobus shibatae.

    PubMed

    Kagawa, H K; Osipiuk, J; Maltsev, N; Overbeek, R; Quaite-Randall, E; Joachimiak, A; Trent, J D

    1995-11-10

    One of the most abundant proteins in the hyperthermophilic archaeon Sulfolobus shibatae is the 59 kDa heat shock protein (TF55) that is believed to form a homo-oligomeric double ring complex structurally similar to the bacterial chaperonins. We discovered a second protein subunit in the S. shibatae ring complex (referred to as alpha) that is stoichiometric with TF55 (renamed beta). The gene and flanking regions of alpha were cloned and sequenced and its inferred amino acid sequence has 54.4% identity and 74.4% similarity to beta. Transcription start sites for both alpha and beta were mapped and three potential transcription regulatory regions were identified. Northern analyses of cultures shifted from normal growth temperatures (70 to 75 degrees C) to heat shock temperatures (85 to 90 degrees C) indicated that the levels of alpha and beta mRNAs increased during heat shock, but at all temperatures their relative proportions remained constant. Monitoring protein synthesis by autoradiography of total proteins from cultures pulse labeled with L(-)[35S]methionine at normal and heat shock temperatures indicated significant increases in alpha and beta synthesis during heat shock. Under extreme heat shock conditions (> or = 90 degrees C) alpha and beta appeared to be the only two proteins synthesized. The purified alpha and beta subunits combined to form high molecular mass complexes with similar mobilities on native polyacrylamide gels to the complexes isolated directly from cells. Equal proportions of the two subunits gave the greatest yield of the complex, which we refer to as a "rosettasome". It is argued that the rosettasome consists of two homo-oligomeric rings; one of alpha and the other of beta. Polyclonal antibodies against alpha and beta from S. shibatae cross-reacted with proteins of similar molecular mass in 10 out of the 17 archaeal species tested, suggesting that the two rosettasome proteins are highly conserved among the archaea. The archaeal sequences were

  19. Evolutionary patterns of Escherichia coli small RNAs and their regulatory interactions.

    PubMed

    Peer, Asaf; Margalit, Hanah

    2014-07-01

    Most bacterial small RNAs (sRNAs) are post-transcriptional regulators of gene expression, exerting their regulatory function by base-pairing with their target mRNAs. While it has become evident that sRNAs play central regulatory roles in the cell, little is known about their evolution and the evolution of their regulatory interactions. Here we used the prokaryotic phylogenetic tree to reconstruct the evolutionary history of Escherichia coli sRNAs and their binding sites on target mRNAs. We discovered that sRNAs currently present in E. coli mainly accumulated inside the Enterobacteriales order, succeeding the appearance of other types of noncoding RNAs and concurrently with the evolution of a variant of the Hfq protein exhibiting a longer C-terminal region. Our analysis of the evolutionary ages of sRNA-mRNA interactions revealed that while all sRNAs were evolutionarily older than most of their known binding sites on mRNA targets, for quite a few sRNAs there was at least one binding site that coappeared with or preceded them. It is conceivable that the establishment of these first interactions forced selective pressure on the sRNAs, after which additional targets were acquired by fitting a binding site to the active region of the sRNA. This conjecture is supported by the appearance of many binding sites on target mRNAs only after the sRNA gain, despite the prior presence of the target gene in ancestral genomes. Our results suggest a selective mechanism that maintained the sRNAs across the phylogenetic tree, and shed light on the evolution of E. coli post-transcriptional regulatory network. © 2014 Peer and Margalit; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  20. Discovery of novel bacterial toxins by genomics and computational biology.

    PubMed

    Doxey, Andrew C; Mansfield, Michael J; Montecucco, Cesare

    2018-06-01

    Hundreds and hundreds of bacterial protein toxins are presently known. Traditionally, toxin identification begins with pathological studies of bacterial infectious disease. Following identification and cultivation of a bacterial pathogen, the protein toxin is purified from the culture medium and its pathogenic activity is studied using the methods of biochemistry and structural biology, cell biology, tissue and organ biology, and appropriate animal models, supplemented by bioimaging techniques. The ongoing and explosive development of high-throughput DNA sequencing and bioinformatic approaches have set in motion a revolution in many fields of biology, including microbiology. One consequence is that genes encoding novel bacterial toxins can be identified by bioinformatic and computational methods based on previous knowledge accumulated from studies of the biology and pathology of thousands of known bacterial protein toxins. Starting from the paradigmatic cases of diphtheria toxin, tetanus and botulinum neurotoxins, this review discusses traditional experimental approaches as well as bioinformatics and genomics-driven approaches that facilitate the discovery of novel bacterial toxins. We discuss recent work on the identification of novel botulinum-like toxins from genera such as Weissella, Chryseobacterium, and Enteroccocus, and the implications of these computationally identified toxins in the field. Finally, we discuss the promise of metagenomics in the discovery of novel toxins and their ecological niches, and present data suggesting the existence of uncharacterized, botulinum-like toxin genes in insect gut metagenomes. Copyright © 2018. Published by Elsevier Ltd.

  1. Bacterial Urease and its Role in Long-Lasting Human Diseases

    PubMed Central

    Konieczna, Iwona; Żarnowiec, Paulina; Kwinkowski, Marek; Kolesińska, Beata; Frączyk, Justyna; Kamiński, Zbigniew; Kaca, Wiesław

    2012-01-01

    Urease is a virulence factor found in various pathogenic bacteria. It is essential in colonization of a host organism and in maintenance of bacterial cells in tissues. Due to its enzymatic activity, urease has a toxic effect on human cells. The presence of ureolytic activity is an important marker of a number of bacterial infections. Urease is also an immunogenic protein and is recognized by antibodies present in human sera. The presence of such antibodies is connected with progress of several long-lasting diseases, like rheumatoid arthritis, atherosclerosis or urinary tract infections. In bacterial ureases, motives with a sequence and/or structure similar to human proteins may occur. This phenomenon, known as molecular mimicry, leads to the appearance of autoantibodies, which take part in host molecules destruction. Detection of antibodies-binding motives (epitopes) in bacterial proteins is a complex process. However, organic chemistry tools, such as synthetic peptide libraries, are helpful in both, epitope mapping as well as in serologic investigations. In this review, we present a synthetic report on a molecular organization of bacterial ureases - genetic as well as structural. We characterize methods used in detecting urease and ureolytic activity, including techniques applied in disease diagnostic processes and in chemical synthesis of urease epitopes. The review also provides a summary of knowledge about a toxic effect of bacterial ureases on human body and about occurrence of anti-urease antibodies in long-lasting diseases. PMID:23305365

  2. Bacterial cocaine esterase: a protein-based therapy for cocaine overdose and addiction

    PubMed Central

    Narasimhan, Diwahar; Woods, James H; Sunahara, Roger K

    2012-01-01

    Cocaine is highly addictive and there are no pharmacotherapeutic drugs available to treat acute cocaine toxicity or chronic abuse. Antagonizing an inhibitor such as cocaine using a small molecule has proven difficult. The alternative approach is to modify cocaine’s pharmacokinetic properties by sequestering or hydrolyzing it in serum and limiting access to its sites of action. We took advantage of a bacterial esterase (CocE) that has evolved to hydrolyze cocaine and have developed it as a therapeutic that rapidly and specifically clears cocaine from the subject. Native enzyme was unstable at 37°C, thus limiting CocE’s potential. Innovative computational methods based on the protein’s structure helped elucidate its mechanism of destabilization. Novel protein engineering methodologies were applied to substantially improve its stability in vitro and in vivo. These improvements rendered CocE as a powerful and efficacious therapeutic to treat cocaine intoxication and lead the way towards developing a therapy for addiction. PMID:22300094

  3. Release of complement regulatory proteins from ocular surface cells in infections.

    PubMed

    Cocuzzi, E; Guidubaldi, J; Bardenstein, D S; Chen, R; Jacobs, M R; Medof, E M

    2000-11-01

    The decay accelerating factor (DAF or CD55) and the membrane inhibitor of reactive lysis (MIRL or CD59), two complement regulatory proteins that protect self cells from autologous complement-mediated injury, are attached to corneal and cqonjunctival epithelial cells by glycosylphos-phatidylinositol (GPI) anchors. We sought to 1) determine the frequency with which bacteria recovered from patients with infections of the eye elaborate factors that can remove these surface proteins from ocular cells, 2) determine the spectrum of bacteria from other sites that have similar effects, and 3) establish the time interval required for reconstitution of the two regulators. Culture supernatants of 18 ocular isolates [P. aeruginosa (n = 3), S. marcescens (n = 1), S. epidermidis (n = 9), and S. aureus (n = 5)], and > 100 other clinical specimens isolated in the hospital's microbiology laboratory [P. mirabilis (n = 1), S. aureus (n = 65), S. epidermidis (n = 24), B. cereus (n = 12), H. influenzae (n = 15), and Enterobacter sp. (n = 21)] were incubated at 37 degrees C for various times with conjunctival epithelial cells, conjunctival fibroblasts or HeLa cells and the release of DAF and CD59 proteins from the surfaces of the cells analyzed by 2-site immunoradiometric assays and by Western blotting. The kinetics of recovery of DAF and CD59 expression on the cells was measured by flow cytometry. DAF and/or CD59 release from the cell monolayers varied from < 5% to > 99% at as much as a 1:81 dilution of the supernatant from some bacteria. On conjunctival epithelial cells, more than 8 hr was required for 44% recovery of DAF expression and for 50% recovery of CD59 expression. Bacteria produce phospholipases and/or other enzymes which can efficiently remove DAF and CD59 from ocular cell surfaces. This phenomenon may correlate with their in vivo pathogenicity.

  4. Bacterial Interactomes: Interacting Protein Partners Share Similar Function and Are Validated in Independent Assays More Frequently Than Previously Reported*

    PubMed Central

    Shatsky, Maxim; Allen, Simon; Gold, Barbara L.; Liu, Nancy L.; Juba, Thomas R.; Reveco, Sonia A.; Elias, Dwayne A.; Prathapam, Ramadevi; He, Jennifer; Yang, Wenhong; Szakal, Evelin D.; Liu, Haichuan; Singer, Mary E.; Geller, Jil T.; Lam, Bonita R.; Saini, Avneesh; Trotter, Valentine V.; Hall, Steven C.; Fisher, Susan J.; Brenner, Steven E.; Chhabra, Swapnil R.; Hazen, Terry C.; Wall, Judy D.; Witkowska, H. Ewa; Biggin, Mark D.; Chandonia, John-Marc; Butland, Gareth

    2016-01-01

    Numerous affinity purification-mass spectrometry (AP-MS) and yeast two-hybrid screens have each defined thousands of pairwise protein-protein interactions (PPIs), most of which are between functionally unrelated proteins. The accuracy of these networks, however, is under debate. Here, we present an AP-MS survey of the bacterium Desulfovibrio vulgaris together with a critical reanalysis of nine published bacterial yeast two-hybrid and AP-MS screens. We have identified 459 high confidence PPIs from D. vulgaris and 391 from Escherichia coli. Compared with the nine published interactomes, our two networks are smaller, are much less highly connected, and have significantly lower false discovery rates. In addition, our interactomes are much more enriched in protein pairs that are encoded in the same operon, have similar functions, and are reproducibly detected in other physical interaction assays than the pairs reported in prior studies. Our work establishes more stringent benchmarks for the properties of protein interactomes and suggests that bona fide PPIs much more frequently involve protein partners that are annotated with similar functions or that can be validated in independent assays than earlier studies suggested. PMID:26873250

  5. The N-terminal Region of the Ubiquitin Regulatory X (UBX) Domain-containing Protein 1 (UBXD1) Modulates Interdomain Communication within the Valosin-containing Protein p97*

    PubMed Central

    Trusch, Franziska; Matena, Anja; Vuk, Maja; Koerver, Lisa; Knævelsrud, Helene; Freemont, Paul S.; Meyer, Hemmo; Bayer, Peter

    2015-01-01

    Valosin-containing protein/p97 is an ATP-driven protein segregase that cooperates with distinct protein cofactors to control various aspects of cellular homeostasis. Mutations at the interface between the regulatory N-domain and the first of two ATPase domains (D1 and D2) deregulate the ATPase activity and cause a multisystem degenerative disorder, inclusion body myopathy associated with Paget disease of bone and frontotemporal dementia/amyotrophic lateral sclerosis. Intriguingly, the mutations affect only a subset of p97-mediated pathways correlating with unbalanced cofactor interactions and most prominently compromised binding of the ubiquitin regulatory X domain-containing protein 1 (UBXD1) cofactor during endolysosomal sorting of caveolin-1. However, how the mutations impinge on the p97-cofactor interplay is unclear so far. In cell-based endosomal localization studies, we identified a critical role of the N-terminal region of UBXD1 (UBXD1-N). Biophysical studies using NMR and CD spectroscopy revealed that UBXD1-N can be classified as intrinsically disordered. NMR titration experiments confirmed a valosin-containing protein/p97 interaction motif and identified a second binding site at helices 1 and 2 of UBXD1-N as binding interfaces for p97. In reverse titration experiments, we identified two distant epitopes on the p97 N-domain that include disease-associated residues and an additional interaction between UBXD1-N and the D1D2 barrel of p97 that was confirmed by fluorescence anisotropy. Functionally, binding of UBXD1-N to p97 led to a reduction of ATPase activity and partial protection from proteolysis. These findings indicate that UBXD1-N intercalates into the p97-ND1 interface, thereby modulating interdomain communication of p97 domains and its activity with relevance for disease pathogenesis. We propose that the polyvalent binding mode characterized for UBXD1-N is a more general principle that defines a subset of p97 cofactors. PMID:26475856

  6. Depolymerization dynamics of individual filaments of bacterial cytoskeletal protein FtsZ

    PubMed Central

    Mateos-Gil, Pablo; Paez, Alfonso; Hörger, Ines; Rivas, Germán; Vicente, Miguel; Tarazona, Pedro; Vélez, Marisela

    2012-01-01

    We report observation and analysis of the depolymerization filaments of the bacterial cytoskeletal protein FtsZ (filament temperature-sensitive Z) formed on a mica surface. At low concentration, proteins adsorbed on the surface polymerize forming curved filaments that close into rings that remain stable for some time before opening irreversibly and fully depolymerizing. The distribution of ring lifetimes (T) as a function of length (N), shows that the rate of ring aperture correlates with filament length. If this ring lifetime is expressed as a bond survival time, (Tb ≡ NT), this correlation is abolished, indicating that these rupture events occur randomly and independently at each monomer interface. After rings open irreversibly, depolymerization of the remaining filaments is fast, but can be slowed down and followed using a nonhydrolyzing GTP analogue. The histogram of depolymerization velocities of individual filaments has an asymmetric distribution that can be fit with a computer model that assumes two rupture rates, a slow one similar to the one observed for ring aperture, affecting monomers in the central part of the filaments, and a faster one affecting monomers closer to the open ends. From the quantitative analysis, we conclude that the depolymerization rate is affected both by nucleotide hydrolysis rate and by its exchange along the filament, that all monomer interfaces are equally competent for hydrolysis, although depolymerization is faster at the open ends than in central filament regions, and that all monomer–monomer interactions, regardless of the nucleotide present, can adopt a curved configuration. PMID:22566654

  7. Mass Spectrometric Detection of Bacterial Protein Toxins and Their Enzymatic Activity.

    PubMed

    Kalb, Suzanne R; Boyer, Anne E; Barr, John R

    2015-08-31

    Mass spectrometry has recently become a powerful technique for bacterial identification. Mass spectrometry approaches generally rely upon introduction of the bacteria into a matrix-assisted laser-desorption time-of-flight (MALDI-TOF) mass spectrometer with mass spectrometric recognition of proteins specific to that organism that form a reliable fingerprint. With some bacteria, such as Bacillus anthracis and Clostridium botulinum, the health threat posed by these organisms is not the organism itself, but rather the protein toxins produced by the organisms. One such example is botulinum neurotoxin (BoNT), a potent neurotoxin produced by C. botulinum. There are seven known serotypes of BoNT, A-G, and many of the serotypes can be further differentiated into toxin variants, which are up to 99.9% identical in some cases. Mass spectrometric proteomic techniques have been established to differentiate the serotype or toxin variant of BoNT produced by varied strains of C. botulinum. Detection of potent biological toxins requires high analytical sensitivity and mass spectrometry based methods have been developed to determine the enzymatic activity of BoNT and the anthrax lethal toxins produced by B. anthracis. This enzymatic activity, unique for each toxin, is assessed with detection of the toxin-induced cleavage of strategically designed peptide substrates by MALDI-TOF mass spectrometry offering unparalleled specificity. Furthermore, activity assays allow for the assessment of the biological activity of a toxin and its potential health risk. Such methods have become important diagnostics for botulism and anthrax. Here, we review mass spectrometry based methods for the enzymatic activity of BoNT and the anthrax lethal factor toxin.

  8. High concentrations of protein test substances may have non-toxic effects on Daphnia magna: implications for regulatory study designs and ecological risk assessments for GM crops.

    PubMed

    Raybould, Alan; Burns, Andrea; Hamer, Mick

    2014-01-01

    Laboratory testing for possible adverse effects of insecticidal proteins on non-target organisms (NTOs) is an important part of many ecological risk assessments for regulatory decision-making about the cultivation of insect-resistant genetically modified (IRGM) crops. To increase confidence in the risk assessments, regulatory guidelines for effects testing specify that representative surrogate species for NTOs are exposed to concentrations of insecticidal proteins that are in excess of worst-case predicted exposures in the field. High concentrations in effects tests are achieved by using protein test substances produced in microbes, such as Escherichia coli. In a study that exposed Daphnia magna to a single high concentration of a microbial test substance containing Vip3Aa20, the insecticidal protein in MIR162 maize, small reductions in growth were observed. These effects were surprising as many other studies strongly suggest that the activity of Vip3Aa20 is limited to Lepidoptera. A plausible explanation for the effect on growth is that high concentrations of test substance have a non-toxic effect on Daphnia, perhaps by reducing its feeding rate. A follow-up study tested that hypothesis by exposing D. magna to several concentrations of Vip3Aa20, and a high concentration of a non-toxic protein, bovine serum albumin (BSA). Vip3Aa20 and BSA had sporadic effects on the reproduction and growth of D. magna. The pattern of the effects suggests that they result from non-toxic effects of high concentrations of protein, and not from toxicity. The implications of these results for regulatory NTO effects testing and ERA of IRGM crops are discussed.

  9. A novel processing system of sterol regulatory element-binding protein-1c regulated by polyunsaturated fatty acid.

    PubMed

    Nakakuki, Masanori; Kawano, Hiroyuki; Notsu, Tatsuto; Imada, Kazunori; Mizuguchi, Kiyoshi; Shimano, Hitoshi

    2014-05-01

    The proteolytic cascade is the key step in transactivation of sterol regulatory element-binding proteins (SREBPs), a transcriptional factor of lipid synthesis. Proteolysis of SREBP-2 is strictly regulated by sterols, but that of SREBP-1c was not strongly sterol-regulated, but inhibited by polyunsaturated fatty acids (PUFAs). In this study, the proteolytic processing of SREBP-1 and -2 was examined by transfection studies of cDNA-encoding mutants in which all the known cleavage sites were disrupted. In cultured cells, sterol-regulated SREBP-2 processing was completely eliminated by mutation of cleavage sites. In contrast, the corresponding SREBP-1c mutants as well as wild type exhibited large amounts of cleaved products in the nuclear extracts from culture cells and murine liver in vivo. The nuclear form of the mutant SREBP-1c was induced by delipidated condition and suppressed by eicosapentaenoic acid, an n-3 PUFA, but not by sterols. This novel processing mechanism was affected by neither SREBP cleavage-activating protein (SCAP) nor insulin-induced gene (Insig)-1, unlike SREBP-2, but abolished by a serine protease inhibitor. Through analysis of deletion mutant, a site-2 protease recognition sequence (DRSR) was identified to be involved in this novel processing. These findings suggest that SREBP-1c cleavage could be subjected to a novel PUFA-regulated cleavage system in addition to the sterol-regulatory SCAP/Insig system.

  10. Analytical Chemistry in the Regulatory Science of Medical Devices.

    PubMed

    Wang, Yi; Guan, Allan; Wickramasekara, Samanthi; Phillips, K Scott

    2018-06-12

    In the United States, regulatory science is the science of developing new tools, standards, and approaches to assess the safety, efficacy, quality, and performance of all Food and Drug Administration-regulated products. Good regulatory science facilitates consumer access to innovative medical devices that are safe and effective throughout the Total Product Life Cycle (TPLC). Because the need to measure things is fundamental to the regulatory science of medical devices, analytical chemistry plays an important role, contributing to medical device technology in two ways: It can be an integral part of an innovative medical device (e.g., diagnostic devices), and it can be used to support medical device development throughout the TPLC. In this review, we focus on analytical chemistry as a tool for the regulatory science of medical devices. We highlight recent progress in companion diagnostics, medical devices on chips for preclinical testing, mass spectrometry for postmarket monitoring, and detection/characterization of bacterial biofilm to prevent infections.

  11. Gene calling and bacterial genome annotation with BG7.

    PubMed

    Tobes, Raquel; Pareja-Tobes, Pablo; Manrique, Marina; Pareja-Tobes, Eduardo; Kovach, Evdokim; Alekhin, Alexey; Pareja, Eduardo

    2015-01-01

    New massive sequencing technologies are providing many bacterial genome sequences from diverse taxa but a refined annotation of these genomes is crucial for obtaining scientific findings and new knowledge. Thus, bacterial genome annotation has emerged as a key point to investigate in bacteria. Any efficient tool designed specifically to annotate bacterial genomes sequenced with massively parallel technologies has to consider the specific features of bacterial genomes (absence of introns and scarcity of nonprotein-coding sequence) and of next-generation sequencing (NGS) technologies (presence of errors and not perfectly assembled genomes). These features make it convenient to focus on coding regions and, hence, on protein sequences that are the elements directly related with biological functions. In this chapter we describe how to annotate bacterial genomes with BG7, an open-source tool based on a protein-centered gene calling/annotation paradigm. BG7 is specifically designed for the annotation of bacterial genomes sequenced with NGS. This tool is sequence error tolerant maintaining their capabilities for the annotation of highly fragmented genomes or for annotating mixed sequences coming from several genomes (as those obtained through metagenomics samples). BG7 has been designed with scalability as a requirement, with a computing infrastructure completely based on cloud computing (Amazon Web Services).

  12. The RNA-binding protein tristetraprolin schedules apoptosis of pathogen-engaged neutrophils during bacterial infection

    PubMed Central

    Ebner, Florian; Ivin, Masa; Kratochvill, Franz; Gratz, Nina; Villunger, Andreas; Sixt, Michael

    2017-01-01

    Protective responses against pathogens require a rapid mobilization of resting neutrophils and the timely removal of activated ones. Neutrophils are exceptionally short-lived leukocytes, yet it remains unclear whether the lifespan of pathogen-engaged neutrophils is regulated differently from that in the circulating steady-state pool. Here, we have found that under homeostatic conditions, the mRNA-destabilizing protein tristetraprolin (TTP) regulates apoptosis and the numbers of activated infiltrating murine neutrophils but not neutrophil cellularity. Activated TTP-deficient neutrophils exhibited decreased apoptosis and enhanced accumulation at the infection site. In the context of myeloid-specific deletion of Ttp, the potentiation of neutrophil deployment protected mice against lethal soft tissue infection with Streptococcus pyogenes and prevented bacterial dissemination. Neutrophil transcriptome analysis revealed that decreased apoptosis of TTP-deficient neutrophils was specifically associated with elevated expression of myeloid cell leukemia 1 (Mcl1) but not other antiapoptotic B cell leukemia/lymphoma 2 (Bcl2) family members. Higher Mcl1 expression resulted from stabilization of Mcl1 mRNA in the absence of TTP. The low apoptosis rate of infiltrating TTP-deficient neutrophils was comparable to that of transgenic Mcl1-overexpressing neutrophils. Our study demonstrates that posttranscriptional gene regulation by TTP schedules the termination of the antimicrobial engagement of neutrophils. The balancing role of TTP comes at the cost of an increased risk of bacterial infections. PMID:28504646

  13. The TLR2 Antagonist Staphylococcal Superantigen-Like Protein 3 Acts as a Virulence Factor to Promote Bacterial Pathogenicity in vivo.

    PubMed

    Koymans, Kirsten J; Goldmann, Oliver; Karlsson, Christofer A Q; Sital, Wiedjai; Thänert, Robert; Bisschop, Adinda; Vrieling, Manouk; Malmström, Johan; van Kessel, Kok P M; de Haas, Carla J C; van Strijp, Jos A G; Medina, Eva

    2017-01-01

    Toll-like receptor (TLR) signaling is important in the initiation of immune responses and subsequent instigation of adaptive immunity. TLR2 recognizes bacterial lipoproteins and plays a central role in the host defense against bacterial infections, including those caused by Staphylococcus aureus. Many studies have demonstrated the importance of TLR2 in murine S. aureus infection. S. aureus evades TLR2 activation by secreting two proteins, staphylococcal superantigen-like protein 3 (SSL3) and 4 (SSL4). In this study, we demonstrate that antibodies against SSL3 and SSL4 are found in healthy individuals, indicating that humans are exposed to these proteins during S. aureus colonization or infection. To investigate the TLR2-antagonistic properties of SSL3 and SSL4, we compared the infection with wild-type and SSL3/4 knockout S. aureus strains in an intravenous murine infection model. Direct evaluation of the contribution of SSL3/4 to infection pathogenesis was hindered by the fact that the SSLs were not expressed in the murine system. To circumvent this limitation, an SSL3-overproducing strain (pLukM-SSL3) was generated, resulting in constitutive expression of SSL3. pLukM-SSL3 exhibited increased virulence compared to the parental strain in a murine model that was found to be TLR2 dependent. Altogether, these data indicate that SSL3 contributes to S. aureus virulence in vivo. © 2017 S. Karger AG, Basel.

  14. Molecular switch-like regulation in motor proteins.

    PubMed

    Tafoya, Sara; Bustamante, Carlos

    2018-06-19

    Motor proteins are powered by nucleotide hydrolysis and exert mechanical work to carry out many fundamental biological tasks. To ensure their correct and efficient performance, the motors' activities are allosterically regulated by additional factors that enhance or suppress their NTPase activity. Here, we review two highly conserved mechanisms of ATP hydrolysis activation and repression operating in motor proteins-the glutamate switch and the arginine finger-and their associated regulatory factors. We examine the implications of these regulatory mechanisms in proteins that are formed by multiple ATPase subunits. We argue that the regulatory mechanisms employed by motor proteins display features similar to those described in small GTPases, which require external regulatory elements, such as dissociation inhibitors, exchange factors and activating proteins, to switch the protein's function 'on' and 'off'. Likewise, similar regulatory roles are taken on by the motor's substrate, additional binding factors, and even adjacent subunits in multimeric complexes. However, in motor proteins, more than one regulatory factor and the two mechanisms described here often underlie the machine's operation. Furthermore, ATPase regulation takes place throughout the motor's cycle, which enables a more complex function than the binary 'active' and 'inactive' states.This article is part of a discussion meeting issue 'Allostery and molecular machines'. © 2018 The Author(s).

  15. Protein-protein interactions in the regulation of WRKY transcription factors.

    PubMed

    Chi, Yingjun; Yang, Yan; Zhou, Yuan; Zhou, Jie; Fan, Baofang; Yu, Jing-Quan; Chen, Zhixiang

    2013-03-01

    It has been almost 20 years since the first report of a WRKY transcription factor, SPF1, from sweet potato. Great progress has been made since then in establishing the diverse biological roles of WRKY transcription factors in plant growth, development, and responses to biotic and abiotic stress. Despite the functional diversity, almost all analyzed WRKY proteins recognize the TTGACC/T W-box sequences and, therefore, mechanisms other than mere recognition of the core W-box promoter elements are necessary to achieve the regulatory specificity of WRKY transcription factors. Research over the past several years has revealed that WRKY transcription factors physically interact with a wide range of proteins with roles in signaling, transcription, and chromatin remodeling. Studies of WRKY-interacting proteins have provided important insights into the regulation and mode of action of members of the important family of transcription factors. It has also emerged that the slightly varied WRKY domains and other protein motifs conserved within each of the seven WRKY subfamilies participate in protein-protein interactions and mediate complex functional interactions between WRKY proteins and between WRKY and other regulatory proteins in the modulation of important biological processes. In this review, we summarize studies of protein-protein interactions for WRKY transcription factors and discuss how the interacting partners contribute, at different levels, to the establishment of the complex regulatory and functional network of WRKY transcription factors.

  16. Additional regulatory activities of MrkH for the transcriptional expression of the Klebsiella pneumoniae mrk genes: Antagonist of H-NS and repressor.

    PubMed

    Ares, Miguel A; Fernández-Vázquez, José L; Pacheco, Sabino; Martínez-Santos, Verónica I; Jarillo-Quijada, Ma Dolores; Torres, Javier; Alcántar-Curiel, María D; González-Y-Merchand, Jorge A; De la Cruz, Miguel A

    2017-01-01

    Klebsiella pneumoniae is a common opportunistic pathogen causing nosocomial infections. One of the main virulence determinants of K. pneumoniae is the type 3 pilus (T3P). T3P helps the bacterial interaction to both abiotic and biotic surfaces and it is crucial for the biofilm formation. T3P is genetically organized in three transcriptional units: the mrkABCDF polycistronic operon, the mrkHI bicistronic operon and the mrkJ gene. MrkH is a regulatory protein encoded in the mrkHI operon, which positively regulates the mrkA pilin gene and its own expression. In contrast, the H-NS nucleoid protein represses the transcriptional expression of T3P. Here we reported that MrkH and H-NS positively and negatively regulate mrkJ expression, respectively, by binding to the promoter of mrkJ. MrkH protein recognized a sequence located at position -63.5 relative to the transcriptional start site of mrkJ gene. Interestingly, our results show that, in addition to its known function as classic transcriptional activator, MrkH also positively controls the expression of mrk genes by acting as an anti-repressor of H-NS; moreover, our results support the notion that high levels of MrkH repress T3P expression. Our data provide new insights about the complex regulatory role of the MrkH protein on the transcriptional control of T3P in K. pneumoniae.

  17. Additional regulatory activities of MrkH for the transcriptional expression of the Klebsiella pneumoniae mrk genes: Antagonist of H-NS and repressor

    PubMed Central

    Ares, Miguel A.; Fernández-Vázquez, José L.; Pacheco, Sabino; Martínez-Santos, Verónica I.; Jarillo-Quijada, Ma. Dolores; Torres, Javier; Alcántar-Curiel, María D.; González-y-Merchand, Jorge A.; De la Cruz, Miguel A.

    2017-01-01

    Klebsiella pneumoniae is a common opportunistic pathogen causing nosocomial infections. One of the main virulence determinants of K. pneumoniae is the type 3 pilus (T3P). T3P helps the bacterial interaction to both abiotic and biotic surfaces and it is crucial for the biofilm formation. T3P is genetically organized in three transcriptional units: the mrkABCDF polycistronic operon, the mrkHI bicistronic operon and the mrkJ gene. MrkH is a regulatory protein encoded in the mrkHI operon, which positively regulates the mrkA pilin gene and its own expression. In contrast, the H-NS nucleoid protein represses the transcriptional expression of T3P. Here we reported that MrkH and H-NS positively and negatively regulate mrkJ expression, respectively, by binding to the promoter of mrkJ. MrkH protein recognized a sequence located at position -63.5 relative to the transcriptional start site of mrkJ gene. Interestingly, our results show that, in addition to its known function as classic transcriptional activator, MrkH also positively controls the expression of mrk genes by acting as an anti-repressor of H-NS; moreover, our results support the notion that high levels of MrkH repress T3P expression. Our data provide new insights about the complex regulatory role of the MrkH protein on the transcriptional control of T3P in K. pneumoniae. PMID:28278272

  18. Engineering the bacterial shapes for enhanced inclusion bodies accumulation.

    PubMed

    Jiang, Xiao-Ran; Wang, Huan; Shen, Rui; Chen, Guo-Qiang

    2015-05-01

    Many bacteria can accumulate inclusion bodies such as sulfur, polyphosphate, glycogen, proteins or polyhydroxyalkanoates. To exploit bacteria as factories for effective production of inclusion bodies, a larger intracellular space is needed for more inclusion body accumulation. In this study, polyhydroxybutyrate (PHB) was investigated as an inclusion bodies representative to be accumulated by Escherichia coli JM109SG. Various approaches were taken to increase the bacterial cell sizes including deletion on actin-like protein gene mreB, weak expression of mreB in mreB deletion mutant, and weak expression of mreB in mreB deletion mutant under inducible expression of SulA, the inhibitor of division ring protein FtsZ. All of the methods resulted in different levels of increases in bacterial sizes and PHB granules accumulation. Remarkably, an increase of over 100% PHB accumulation was observed in recombinant E. coli overexpressing mreB in an mreB deletion mutant under inducible expression of FtsZ inhibiting protein SulA. The molecular mechanism of enlarged bacterial size was found to be directly relate to weakened cytoskeleton which was the result of broken skeleton helix. Copyright © 2015 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

  19. α -Actinin TvACTN3 of Trichomonas vaginalis is an RNA-binding protein that could participate in its posttranscriptional iron regulatory mechanism.

    PubMed

    Calla-Choque, Jaeson Santos; Figueroa-Angulo, Elisa Elvira; Ávila-González, Leticia; Arroyo, Rossana

    2014-01-01

    Trichomonas vaginalis is a sexually transmitted flagellated protist parasite responsible for trichomoniasis. This parasite is dependent on high levels of iron, favoring its growth and multiplication. Iron also differentially regulates some trichomonad virulence properties by unknown mechanisms. However, there is evidence to support the existence of gene regulatory mechanisms at the transcriptional and posttranscriptional levels that are mediated by iron concentration in T. vaginalis. Thus, the goal of this study was to identify an RNA-binding protein in T. vaginalis that interacts with the tvcp4 RNA stem-loop structure, which may participate in a posttranscriptional iron regulatory mechanism mediated by RNA-protein interactions. We performed RNA electrophoretic mobility shift assay (REMSA) and supershift, UV cross-linking, Northwestern blot, and western blot (WB) assays using cytoplasmic protein extracts from T. vaginalis with the tvcp4 RNA hairpin structure as a probe. We identified a 135-kDa protein isolated by the UV cross-linking assays as α-actinin 3 (TvACTN3) by MALDI-TOF-MS that was confirmed by LS-MS/MS and de novo sequencing. TvACTN3 is a cytoplasmic protein that specifically binds to hairpin RNA structures from trichomonads and humans when the parasites are grown under iron-depleted conditions. Thus, TvACTN3 could participate in the regulation of gene expression by iron in T. vaginalis through a parallel posttranscriptional mechanism similar to that of the IRE/IRP system.

  20. α-Actinin TvACTN3 of Trichomonas vaginalis Is an RNA-Binding Protein That Could Participate in Its Posttranscriptional Iron Regulatory Mechanism

    PubMed Central

    Calla-Choque, Jaeson Santos; Figueroa-Angulo, Elisa Elvira; Ávila-González, Leticia; Arroyo, Rossana

    2014-01-01

    Trichomonas vaginalis is a sexually transmitted flagellated protist parasite responsible for trichomoniasis. This parasite is dependent on high levels of iron, favoring its growth and multiplication. Iron also differentially regulates some trichomonad virulence properties by unknown mechanisms. However, there is evidence to support the existence of gene regulatory mechanisms at the transcriptional and posttranscriptional levels that are mediated by iron concentration in T. vaginalis. Thus, the goal of this study was to identify an RNA-binding protein in T. vaginalis that interacts with the tvcp4 RNA stem-loop structure, which may participate in a posttranscriptional iron regulatory mechanism mediated by RNA-protein interactions. We performed RNA electrophoretic mobility shift assay (REMSA) and supershift, UV cross-linking, Northwestern blot, and western blot (WB) assays using cytoplasmic protein extracts from T. vaginalis with the tvcp4 RNA hairpin structure as a probe. We identified a 135-kDa protein isolated by the UV cross-linking assays as α-actinin 3 (TvACTN3) by MALDI-TOF-MS that was confirmed by LS-MS/MS and de novo sequencing. TvACTN3 is a cytoplasmic protein that specifically binds to hairpin RNA structures from trichomonads and humans when the parasites are grown under iron-depleted conditions. Thus, TvACTN3 could participate in the regulation of gene expression by iron in T. vaginalis through a parallel posttranscriptional mechanism similar to that of the IRE/IRP system. PMID:24719864