New target for inhibition of bacterial RNA polymerase: 'switch region'.
Srivastava, Aashish; Talaue, Meliza; Liu, Shuang; Degen, David; Ebright, Richard Y; Sineva, Elena; Chakraborty, Anirban; Druzhinin, Sergey Y; Chatterjee, Sujoy; Mukhopadhyay, Jayanta; Ebright, Yon W; Zozula, Alex; Shen, Juan; Sengupta, Sonali; Niedfeldt, Rui Rong; Xin, Cai; Kaneko, Takushi; Irschik, Herbert; Jansen, Rolf; Donadio, Stefano; Connell, Nancy; Ebright, Richard H
2011-10-01
A new drug target - the 'switch region' - has been identified within bacterial RNA polymerase (RNAP), the enzyme that mediates bacterial RNA synthesis. The new target serves as the binding site for compounds that inhibit bacterial RNA synthesis and kill bacteria. Since the new target is present in most bacterial species, compounds that bind to the new target are active against a broad spectrum of bacterial species. Since the new target is different from targets of other antibacterial agents, compounds that bind to the new target are not cross-resistant with other antibacterial agents. Four antibiotics that function through the new target have been identified: myxopyronin, corallopyronin, ripostatin, and lipiarmycin. This review summarizes the switch region, switch-region inhibitors, and implications for antibacterial drug discovery. Copyright © 2011 Elsevier Ltd. All rights reserved.
Ulvatne, Hilde; Samuelsen, Ørjan; Haukland, Hanne H; Krämer, Manuela; Vorland, Lars H
2004-08-15
Most antimicrobial peptides have an amphipathic, cationic structure, and an effect on the cytoplasmic membrane of susceptible bacteria has been postulated as the main mode of action. Other mechanisms have been reported, including inhibition of cellular functions by binding to DNA, RNA and proteins, and the inhibition of DNA and/or protein synthesis. Lactoferricin B (Lfcin B), a cationic peptide derived from bovine lactoferrin, exerts slow inhibitory and bactericidal activity and does not lyse susceptible bacteria, indicating a possible intracellular target. In the present study incorporation of radioactive precursors into DNA, RNA and proteins was used to demonstrate effects of Lfcin B on macromolecular synthesis in bacteria. In Escherichia coli UC 6782, Lfcin B induces an initial increase in protein and RNA synthesis and a decrease in DNA synthesis. After 10 min, the DNA-synthesis increases while protein and RNA-synthesis decreases significantly. In Bacillus subtilis, however, all synthesis of macromolecules is inhibited for at least 20 min. After 20 min RNA-synthesis increases. The results presented here show that Lfcin B at concentrations not sufficient to kill bacterial cells inhibits incorporation of radioactive precursors into macromolecules in both Gram-positive and Gram-negative bacteria.
Origins of tmRNA: the missing link in the birth of protein synthesis?
Macé, Kevin; Gillet, Reynald
2016-09-30
The RNA world hypothesis refers to the early period on earth in which RNA was central in assuring both genetic continuity and catalysis. The end of this era coincided with the development of the genetic code and protein synthesis, symbolized by the apparition of the first non-random messenger RNA (mRNA). Modern transfer-messenger RNA (tmRNA) is a unique hybrid molecule which has the properties of both mRNA and transfer RNA (tRNA). It acts as a key molecule during trans-translation, a major quality control pathway of modern bacterial protein synthesis. tmRNA shares many common characteristics with ancestral RNA. Here, we present a model in which proto-tmRNAs were the first molecules on earth to support non-random protein synthesis, explaining the emergence of early genetic code. In this way, proto-tmRNA could be the missing link between the first mRNA and tRNA molecules and modern ribosome-mediated protein synthesis. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Probing the substrate specificity of the bacterial Pnkp/Hen1 RNA repair system using synthetic RNAs
Zhang, Can; Chan, Chio Mui; Wang, Pei; Huang, Raven H.
2012-01-01
Ribotoxins cleave essential RNAs involved in protein synthesis as a strategy for cell killing. RNA repair systems exist in nature to counteract the lethal actions of ribotoxins, as first demonstrated by the RNA repair system from bacteriophage T4 25 yr ago. Recently, we found that two bacterial proteins, named Pnkp and Hen1, form a stable complex and are able to repair ribotoxin-cleaved tRNAs in vitro. However, unlike the well-studied T4 RNA repair system, the natural RNA substrates of the bacterial Pnkp/Hen1 RNA repair system are unknown. Here we present comprehensive RNA repair assays with the recombinant Pnkp/Hen1 proteins from Anabaena variabilis using a total of 33 different RNAs as substrates that might mimic various damaged forms of RNAs present in living cells. We found that unlike the RNA repair system from bacteriophage T4, the bacterial Pnkp/Hen1 RNA repair system exhibits broad substrate specificity. Based on the experimental data presented here, a model of preferred RNA substrates of the Pnkp/Hen1 repair system is proposed. PMID:22190744
Gans, Jonathan; Osborne, Jonathan; Cheng, Juliet; Djapgne, Louise; Oglesby-Sherrouse, Amanda G
2018-01-01
Bacterial small RNA molecules (sRNAs) are increasingly recognized as central regulators of bacterial stress responses and pathogenesis. In many cases, RNA-binding proteins are critical for the stability and function of sRNAs. Previous studies have adopted strategies to genetically tag an sRNA of interest, allowing isolation of RNA-protein complexes from cells. Here we present a sequence-specific affinity purification protocol that requires no prior genetic manipulation of bacterial cells, allowing isolation of RNA-binding proteins bound to native RNA molecules.
Flavivirus RNA Synthesis in vitro
Padmanabhan, Radhakrishnan; Takhampunya, Ratree; Teramoto, Tadahisa; Choi, Kyung H.
2015-01-01
Summary Establishment of in vitro systems to study mechanisms of RNA synthesis for positive strand RNA viruses have been very useful in the past and have shed light on the composition of protein and RNA components, optimum conditions, the nature of the products formed, cis-acting RNA elements and trans-acting protein factors required for efficient synthesis. In this review, we summarize our current understanding regarding the requirements for flavivirus RNA synthesis in vitro. We describe details of reaction conditions, the specificity of template used by either the multi-component membrane-bound viral replicase complex or by purified, recombinant RNA-dependent RNA polymerase. We also discuss future perspectives to extend the boundaries of our knowledge. PMID:26272247
RNA-Seq for Bacterial Gene Expression.
Poulsen, Line Dahl; Vinther, Jeppe
2018-06-01
RNA sequencing (RNA-seq) has become the preferred method for global quantification of bacterial gene expression. With the continued improvements in sequencing technology and data analysis tools, the most labor-intensive and expensive part of an RNA-seq experiment is the preparation of sequencing libraries, which is also essential for the quality of the data obtained. Here, we present a straightforward and inexpensive basic protocol for preparation of strand-specific RNA-seq libraries from bacterial RNA as well as a computational pipeline for the data analysis of sequencing reads. The protocol is based on the Illumina platform and allows easy multiplexing of samples and the removal of sequencing reads that are PCR duplicates. © 2018 by John Wiley & Sons, Inc. © 2018 John Wiley & Sons, Inc.
Ares, Manuel
2012-09-01
In this bacterial RNA isolation protocol, an "RNA-protective" treatment is followed by lysozyme digestion of the peptidoglycan component of the cell wall. EDTA promotes the loss of the outer membrane of Gram-negative bacteria and allows the lysozyme better access to the peptidoglycan. Cells begin to lyse during digestion in hypotonic lysozyme buffer and lysis is completed by sodium dodecyl sulfate (SDS) and hot phenol:chloroform:isoamyl alcohol (PCA) extraction. SDS and hot phenol disrupt membranes, denature protein (including RNase), and strip proteins from RNA. The separation of the organic phase from the aqueous phase is achieved using Phase Lock Gel, an inert material with a density intermediate between the organic and aqueous samples. The sample is split into three phases: from bottom to top, these are phenol and chloroform (organic phase), the inert gel with the interface material, and the aqueous phase with the RNA. The gel acts as a physical barrier between the sample and the organic phase plus interface. Following organic extraction, the RNA is concentrated by ethanol precipitation.
Mahto, Santosh K.
2013-01-01
The bacterial decoding region of 16S ribosomal RNA has multiple modified nucleotides. In order to study the role of N4,2′-O-dimethylcytidine (m4Cm), the corresponding phosphoramidite was synthesized utilizing 5′-silyl-2′-ACE chemistry. Using solid-phase synthesis, m4Cm, 5-methylcytidine (m5C), 3-methyluridine (m3U), and 2′-O-methylcytidine (Cm) were site-specifically incorporated into small RNAs representing the decoding regions of different bacterial species. Biophysical studies were then used to provide insight into the stabilizing roles of the modified nucleotides. These studies reveal that methylation of cytidine and uridine has different effects. The same modifications at different positions or sequence contexts within similar RNA constructs also have contrasting roles, such as stabilizing or destabilizing the RNA helix. PMID:23566761
Bacterial RNA Biology on a Genome Scale.
Hör, Jens; Gorski, Stanislaw A; Vogel, Jörg
2018-06-07
Bacteria are an exceedingly diverse group of organisms whose molecular exploration is experiencing a renaissance. While the classical view of bacterial gene expression was relatively simple, the emerging view is more complex, encompassing extensive post-transcriptional control involving riboswitches, RNA thermometers, and regulatory small RNAs (sRNAs) associated with the RNA-binding proteins CsrA, Hfq, and ProQ, as well as CRISPR/Cas systems that are programmed by RNAs. Moreover, increasing interest in members of the human microbiota and environmental microbial communities has highlighted the importance of understudied bacterial species with largely unknown transcriptome structures and RNA-based control mechanisms. Collectively, this creates a need for global RNA biology approaches that can rapidly and comprehensively analyze the RNA composition of a bacterium of interest. We review such approaches with a focus on RNA-seq as a versatile tool to investigate the different layers of gene expression in which RNA is made, processed, regulated, modified, translated, and turned over. Copyright © 2017 Elsevier Inc. All rights reserved.
RNA turnover and protein synthesis in fish cells.
Smith, R W; Palmer, R M; Houlihan, D F
2000-03-01
Protein synthesis in fish has been previously correlated with RNA content. The present study investigates whether protein and RNA synthesis rates are similarly related. Protein and RNA synthesis rates were determined from 3H-phenylalanine and 3H-uridine incorporation, respectively, and expressed as % x day(-1) and half-lives, respectively. Three fibroblast cell lines were used: BF-2, RTP, CHSE 214, which are derived from the bluegill, rainbow trout and Chinook salmon, respectively. These cells contained similar RNA concentrations (approximately 175 microg RNA x mg(-1) cell protein). Therefore differences in protein synthesis rates, BF-2 (31.3 +/- 1.8)>RTP (25.1 +/- 1.7)>CHSE 214 (17.6 +/-1.1), were attributable to RNA translational efficiency. The most translationally efficient RNA (BF-2 cells), 1.8 mg protein synthesised x microg(-1) RNA x day(-1), corresponded to the lowest RNA half-life, 75.4 +/- 6.4 h. Translationally efficient RNA was also energetically efficient with BF-2 cells exploiting the least costly route of nucleotide supply (i.e. exogenous salvage) 3.5-6.0 times more than the least translationally efficient RNA (CHSE 214 cells). These data suggest that differential nucleotide supply, between intracellular synthesis and exogenous salvage, constitutes the area of pre-translational flexibility exploited to maintain RNA synthesis as a fixed energetic cost component of protein synthesis.
Regulation of Flavivirus RNA synthesis and replication
Selisko, Barbara; Wang, Chunling; Harris, Eva; Canard, Bruno
2014-01-01
RNA synthesis and replication of the members of the Flavivirus genus (including dengue, West Nile and Japanese encephalitis viruses) is regulated by a wide variety of mechanisms and actors. These include the sequestration of the RNA-dependent RNA polymerase (RdRp) for functions other than RNA synthesis, regulatory interactions with other viral and host proteins within the replication complex (RC), and regulatory elements within the RNA genome itself. In this review, we discuss our current knowledge of the multiple levels at which Flavivirus RNA synthesis is controlled. We aim to bring together two active research fields: the structural and functional biology of individual proteins of the RC and the impressive wealth of knowledge acquired regarding the viral genomic RNA. PMID:25462437
Cyclophilin B stimulates RNA synthesis by the HCV RNA dependent RNA polymerase.
Heck, Julie A; Meng, Xiao; Frick, David N
2009-04-01
Cyclophilins are cellular peptidyl isomerases that have been implicated in regulating hepatitis C virus (HCV) replication. Cyclophilin B (CypB) is a target of cyclosporin A (CsA), an immunosuppressive drug recently shown to suppress HCV replication in cell culture. Watashi et al. recently demonstrated that CypB is important for efficient HCV replication, and proposed that it mediates the anti-HCV effects of CsA through an interaction with NS5B [Watashi K, Ishii N, Hijikata M, Inoue D, Murata T, Miyanari Y, et al. Cyclophilin B is a functional regulator of hepatitis C virus RNA polymerase. Mol Cell 2005;19:111-22]. We examined the effects of purified CypB proteins on the enzymatic activity of NS5B. Recombinant CypB purified from insect cells directly stimulated NS5B-catalyzed RNA synthesis. CypB increased RNA synthesis by NS5B derived from genotype 1a, 1b, and 2a HCV strains. Stimulation appears to arise from an increase in productive RNA binding. NS5B residue Pro540, a previously proposed target of CypB peptidyl-prolyl isomerase activity, is not required for stimulation of RNA synthesis.
Cyclophilin B stimulates RNA synthesis by the HCV RNA dependent RNA polymerase
Heck, Julie A.; Meng, Xiao; Frick, David N.
2009-01-01
Cyclophilins are cellular peptidyl isomerases that have been implicated in regulating hepatitis C virus (HCV) replication. Cyclophilin B (CypB) is a target of cyclosporin A (CsA), an immunosuppressive drug recently shown to suppress HCV replication in cell culture. Watashi et al. recently demonstrated that CypB is important for efficient HCV replication, and proposed that it mediates the anti-HCV effects of CsA through an interaction with NS5B (Mol. Cell 19:111). We examined the effects of purified CypB proteins on the enzymatic activity of NS5B. Recombinant CypB purified from insect cells directly stimulated NS5B-catalyzed RNA synthesis. CypB increased RNA synthesis by NS5B derived from genotype 1a, 1b, and 2a HCV strains. Stimulation appears to arise from an increase in productive RNA binding. NS5B residue Pro540, a previously proposed target of CypB peptidyl-prolyl isomerase activity, is not required for stimulation of RNA synthesis. PMID:19174155
Bacterial RNA induces myocyte cellular dysfunction through the activation of PKR
Bleiblo, Farag; Michael, Paul; Brabant, Danielle; Ramana, Chilakamarti V.; Tai, TC; Saleh, Mazen; Parrillo, Joseph E.; Kumar, Anand
2012-01-01
Severe sepsis and the ensuing septic shock are serious life threatening conditions. These diseases are triggered by the host's over exuberant systemic response to the infecting pathogen. Several surveillance mechanisms have evolved to discriminate self from foreign RNA and accordingly trigger effective cellular responses to target the pathogenic threats. The RNA-dependent protein kinase (PKR) is a key component of the cytoplasmic RNA sensors involved in the recognition of viral double-stranded RNA (dsRNA). Here, we identify bacterial RNA as a distinct pathogenic pattern recognized by PKR. Our results indicate that natural RNA derived from bacteria directly binds to and activates PKR. We further show that bacterial RNA induces human cardiac myocyte apoptosis and identify the requirement for PKR in mediating this response. In addition to bacterial immunity, the results presented here may also have implications in cardiac pathophysiology. PMID:22833816
The RNA synthesis machinery of negative-stranded RNA viruses
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ortín, Juan, E-mail: jortin@cnb.csic.es; Martín-Benito, Jaime, E-mail: jmartinb@cnb.csic.es
The group of Negative-Stranded RNA Viruses (NSVs) includes many human pathogens, like the influenza, measles, mumps, respiratory syncytial or Ebola viruses, which produce frequent epidemics of disease and occasional, high mortality outbreaks by transmission from animal reservoirs. The genome of NSVs consists of one to several single-stranded, negative-polarity RNA molecules that are always assembled into mega Dalton-sized complexes by association to many nucleoprotein monomers. These RNA-protein complexes or ribonucleoproteins function as templates for transcription and replication by action of the viral RNA polymerase and accessory proteins. Here we review our knowledge on these large RNA-synthesis machines, including the structure ofmore » their components, the interactions among them and their enzymatic activities, and we discuss models showing how they perform the virus transcription and replication programmes. - Highlights: • Overall organisation of NSV RNA synthesis machines. • Structure and function of the ribonucleoprotein components: Atomic structure of the RNA polymerase complex. • Commonalities and differences between segmented- and non-segmented NSVs. • Transcription versus replication programmes.« less
Enhancement of RNA Synthesis, Protein Synthesis, and Abscission by Ethylene
Abeles, F. B.; Holm, R. E.
1966-01-01
Ethylene stimulated RNA and protein synthesis in bean (Phaseolus vulgaris L. var. Red Kidney) abscission zone explants prior to abscission. The effect of ethylene on RNA synthesis and abscission was blocked by actinomycin D. Carbon dioxide, which inhibits the effect of ethylene on abscission, also inhibited the influence of ethylene on protein synthesis. An aging period appears to be essential before bean explants respond to ethylene. Stimulation of protein synthesis by ethylene occurred only in receptive or senescent explants. Treatment of juvenile explants with ethylene, which has no effect on abscission also has no effect on protein synthesis. Evidence in favor of a hormonal role for ethylene during abscission is discussed. PMID:16656405
Todorov, I N; Shen, R A; Zheliabovskaia, S M; Galkin, A P
1976-10-01
A drastic inhibition of protein biosynthesis in rat liver in vivo by cycloheximide (CHI) (0.3 mg/100 g of body weight) first caused an increase of RNA synthesis (after 1 hour), which was then followed by its decrease. Partial gradual restoration of the protein synthesis level was shown to be accompanied by a repeated increase of RNA synthesis (12 hs) and its normalisation after 24 hs. The first maximum of RNA synthesis increase in the isolated nuclei system was AU-type RNA synthesis (sensitive to alpha-amanitine), the second one was due to GC-type RNA synthesis (resistant to this toxin). Purified chromatine template activity in the system with E. coli RNA polymerase (by 14%) an hour after CHI treatment, but 3 hrs later was decreased and subsequently restored (12 hrs after CHI injection). The changes of RNA biosynthesis induced by prolonged protein synthesis inhibition suggest the existence of continuous RNA synthesis control in nuclei. This control is realized by translation system using the feed back principle.
Fluctuations and synchrony of RNA synthesis in nucleoli.
Pliss, Artem; Kuzmin, Andrey N; Kachynski, Aliaksandr V; Baev, Alexander; Berezney, Ronald; Prasad, Paras N
2015-06-01
Ribosomal RNA (rRNA) sequences are synthesized at exceptionally high rates and, together with ribosomal proteins (r-proteins), are utilized as building blocks for the assembly of pre-ribosomal particles. Although it is widely acknowledged that tight regulation and coordination of rRNA and r-protein production are fundamentally important for the maintenance of cellular homeostasis, still little is known about the real-time kinetics of the ribosome component synthesis in individual cells. In this communication we introduce a label-free MicroRaman spectrometric approach for monitoring rRNA synthesis in live cultured cells. Remarkably high and rapid fluctuations of rRNA production rates were revealed by this technique. Strikingly, the changes in the rRNA output were synchronous for ribosomal genes located in separate nucleoli of the same cell. Our findings call for the development of new concepts to elucidate the coordination of ribosomal components production. In this regard, numerical modeling further demonstrated that the production of rRNA and r-proteins can be coordinated, regardless of the fluctuations in rRNA synthesis. Overall, our quantitative data reveal a spectacular interplay of inherently stochastic rates of RNA synthesis and the coordination of gene expression.
SPARTA: Simple Program for Automated reference-based bacterial RNA-seq Transcriptome Analysis.
Johnson, Benjamin K; Scholz, Matthew B; Teal, Tracy K; Abramovitch, Robert B
2016-02-04
Many tools exist in the analysis of bacterial RNA sequencing (RNA-seq) transcriptional profiling experiments to identify differentially expressed genes between experimental conditions. Generally, the workflow includes quality control of reads, mapping to a reference, counting transcript abundance, and statistical tests for differentially expressed genes. In spite of the numerous tools developed for each component of an RNA-seq analysis workflow, easy-to-use bacterially oriented workflow applications to combine multiple tools and automate the process are lacking. With many tools to choose from for each step, the task of identifying a specific tool, adapting the input/output options to the specific use-case, and integrating the tools into a coherent analysis pipeline is not a trivial endeavor, particularly for microbiologists with limited bioinformatics experience. To make bacterial RNA-seq data analysis more accessible, we developed a Simple Program for Automated reference-based bacterial RNA-seq Transcriptome Analysis (SPARTA). SPARTA is a reference-based bacterial RNA-seq analysis workflow application for single-end Illumina reads. SPARTA is turnkey software that simplifies the process of analyzing RNA-seq data sets, making bacterial RNA-seq analysis a routine process that can be undertaken on a personal computer or in the classroom. The easy-to-install, complete workflow processes whole transcriptome shotgun sequencing data files by trimming reads and removing adapters, mapping reads to a reference, counting gene features, calculating differential gene expression, and, importantly, checking for potential batch effects within the data set. SPARTA outputs quality analysis reports, gene feature counts and differential gene expression tables and scatterplots. SPARTA provides an easy-to-use bacterial RNA-seq transcriptional profiling workflow to identify differentially expressed genes between experimental conditions. This software will enable microbiologists with
Hydrocortisone Stimulation of RNA Synthesis in Induction of Hepatic Enzymes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kenney, Francis T.; Wicks, Wesley D.; Greenman, David L.
Increased synthesis of hepatic enzymes due to hydrocortisone is preceded by an increase in the rate of synthesis of nuclear RNA. Pulse-labeled RNA from liver nuclei was fractionated by a differential thermal phenol procedures, and the labeled RNA of each fraction was characterized by sucrose gradient centrifugation and base composition analysis. Hormone treatment increases the rate of synthesis of three types of RNA: (1) the nuclear precursor to ribosomal RNA, (2) a rapid turnover component with base composition similar to the tissue DNA, and (3) transfer RNA. Much of the total isotope incorporation into transfer RNA can be traced tomore » turnover of the terminal adenylate residue, but this type of labeling is insensitive to the hormone. The steroid also stimulates isotope incorporation into tissue precursor pools. The effect is abolished by actinomycin and thus is secondary to the hormonal stimulation of RNA synthesis. Growth hormone stimulates RNA synthesis in both intact and adrenalectomized rats, but induces the rapid turnover enzymes (tyrosine transaminase and tryptophan pyrrolase) only in the presence of functional adrenals. It therefore seems that glucocorticoids initiate both a generalized increase in synthesis of RNA and a selective induction of specific enzymes.« less
Catalysis and prebiotic RNA synthesis
NASA Technical Reports Server (NTRS)
Ferris, James P.
1993-01-01
The essential role of catalysis for the origins of life is discussed. The status of the prebiotic synthesis of 2',5'- and 3'5'-linked oligomers of RNA is reviewed. Examples of the role of metal ion and mineral catalysis in RNA oligomer formation are discussed.
USDA-ARS?s Scientific Manuscript database
RNA integrity is critical for successful RNA quantification. The level of integrity required differs among sources and extraction procedures and has not been determined for bacterial RNA. Three RNA isolation methods were evaluated for their ability to produce high quality RNA from D. dadantii. The i...
RNA Synthesis by in Vitro Selected Ribozymes for Recreating an RNA World
Martin, Lyssa L.; Unrau, Peter J.; Müller, Ulrich F.
2015-01-01
The RNA world hypothesis states that during an early stage of life, RNA molecules functioned as genome and as the only genome-encoded catalyst. This hypothesis is supported by several lines of evidence, one of which is the in vitro selection of catalytic RNAs (ribozymes) in the laboratory for a wide range of reactions that might have been used by RNA world organisms. This review focuses on three types of ribozymes that could have been involved in the synthesis of RNA, the core activity in the self-replication of RNA world organisms. These ribozyme classes catalyze nucleoside synthesis, triphosphorylation, and the polymerization of nucleoside triphosphates. The strengths and weaknesses regarding each ribozyme’s possible function in a self-replicating RNA network are described, together with the obstacles that need to be overcome before an RNA world organism can be generated in the laboratory. PMID:25610978
Montmorillonite Clay-Catalyzed Synthesis of RNA Oligomers
NASA Astrophysics Data System (ADS)
Ferris, J. P.; Miyakawa, S.; Huang, W.; Joshi, P.
2005-12-01
It is proposed that catalysis had a central role in the origins of life. This will be illustrated using the montmorillonite clay-catalyzed synthesis of oligomers of RNA from activated monomers, (Ferris and Ertem, 1993) a possible step in the origin of the RNA world (Ferris, 2005). Structural analysis of oligomers formed in the reaction of the activated monomer of 5'-AMP with that of 5'-CMP demonstrated that the oligomers formed were not produced by random synthesis but rather the sequences observed were directed by the montmorillonite catalyst (Miyakawa and Ferris, 2003). RNA oligomers containing up to 40 mers have been synthesized in reactions performed in water at 25 oC in the presence of montmorillonite (Huang and Ferris, 2003). Analysis of the structure elements in these oligomers from the 7 to 39 mers showed that they did not vary. Reaction of D, L-mixtures of the activated monomers of A and U resulted in the formation of greater amounts of the homochiral amounts of dimers and trimers of A than would be expected if there was no selectivity in the reaction. A limited number of the dimers and trimers of U were also formed but here the selectivity was for the formation of an excess of heterochiral products (Joshi et al., 2000). A postulate that explains why homochiral trimers of U are not formed and the significance of catalysis in prebiotic synthesis will be discussed. Ferris, J.P. (2005) Origins of life, molecular basis of. In R.A. Meyers, Ed. Encyclopedia of Molecular Cell Biology and Molecular Medicine, 10. Wiley-VCH Verlag, Weinheim, Germany. Ferris, J.P., and Ertem, G. (1993) Montmorillonite catalysis of RNA oligomer formation in aqueous solution. A model for the prebiotic formation of RNA. J. Am. Chem. Soc., 115, 12270-12275. Huang, W., and Ferris, J.P. (2003) Synthesis of 35-40 mers of RNA oligomers from unblocked monomers. A simple approach to the RNA world. Chem. Commun., 1458-1459. Joshi, P.C., Pitsch, S., and Ferris, J.P. (2000) Homochiral selection
Schnapp, A; Pfleiderer, C; Rosenbauer, H; Grummt, I
1990-09-01
Control of mouse ribosomal RNA synthesis in response to extracellular signals is mediated by TIF-IA, a regulatory factor whose amount or activity correlates with cell proliferation. Factor TIF-IA interacts with RNA polymerase I (pol I), thus converting it into a transcriptionally active holoenzyme, which is able to initiate specifically at the rDNA promoter in the presence of the other auxiliary transcription initiation factors, designated TIF-IB, TIF-IC and UBF. With regard to several criteria, the growth-dependent factor TIF-IA behaves like a bacterial sigma factor: (i) it associates physically with pol I, (ii) it is required for initiation of transcription, (iii) it is present in limiting amounts and (iv) under certain salt conditions, it is chromatographically separable from the polymerase. In addition, evidence is presented that dephosphorylation of pol I abolishes in vitro transcription initiation from the ribosomal gene promoter without significantly affecting the polymerizing activity of the enzyme at nonspecific templates. The involvement of both a regulatory factor and post-translational modification of the transcribing enzyme provides an efficient and versatile mechanism of rDNA transcription regulation which enables the cell to adapt ribosome synthesis rapidly to a variety of extracellular signals.
Lamichhane, Tek N; Abeydeera, N Dinuka; Duc, Anne-Cécile E; Cunningham, Philip R; Chow, Christine S
2011-01-28
Ribosomal RNA is the catalytic portion of ribosomes, and undergoes a variety of conformational changes during translation. Structural changes in ribosomal RNA can be facilitated by the presence of modified nucleotides. Helix 31 of bacterial 16S ribosomal RNA harbors two modified nucleotides, m²G966 and m⁵C967, that are highly conserved among bacteria, though the degree and nature of the modifications in this region are different in eukaryotes. Contacts between helix 31 and the P-site tRNA, initiation factors, and ribosomal proteins highlight the importance of this region in translation. In this work, a heptapeptide M13 phage-display library was screened for ligands that target the wild-type, naturally modified bacterial helix 31. Several peptides, including TYLPWPA, CVRPFAL, TLWDLIP, FVRPFPL, ATPLWLK, and DIRTQRE, were found to be prevalent after several rounds of screening. Several of the peptides exhibited moderate affinity (in the high nM to low µM range) to modified helix 31 in biophysical assays, including surface plasmon resonance (SPR), and were also shown to bind 30S ribosomal subunits. These peptides also inhibited protein synthesis in cell-free translation assays.
Ribozyme-catalysed RNA synthesis using triplet building blocks.
Attwater, James; Raguram, Aditya; Morgunov, Alexey S; Gianni, Edoardo; Holliger, Philipp
2018-05-15
RNA-catalyzed RNA replication is widely believed to have supported a primordial biology. However, RNA catalysis is dependent upon RNA folding, and this yields structures that can block replication of such RNAs. To address this apparent paradox we have re-examined the building blocks used for RNA replication. We report RNA-catalysed RNA synthesis on structured templates when using trinucleotide triphosphates (triplets) as substrates, catalysed by a general and accurate triplet polymerase ribozyme that emerged from in vitro evolution as a mutualistic RNA heterodimer. The triplets cooperatively invaded and unraveled even highly stable RNA secondary structures, and support non-canonical primer-free and bidirectional modes of RNA synthesis and replication. Triplet substrates thus resolve a central incongruity of RNA replication, and here allow the ribozyme to synthesise its own catalytic subunit '+' and '-' strands in segments and assemble them into a new active ribozyme. © 2018, Attwater et al.
Mahajan, Prashant; Kuppermann, Nathan; Mejias, Asuncion; Suarez, Nicolas; Chaussabel, Damien; Casper, T Charles; Smith, Bennett; Alpern, Elizabeth R; Anders, Jennifer; Atabaki, Shireen M; Bennett, Jonathan E; Blumberg, Stephen; Bonsu, Bema; Borgialli, Dominic; Brayer, Anne; Browne, Lorin; Cohen, Daniel M; Crain, Ellen F; Cruz, Andrea T; Dayan, Peter S; Gattu, Rajender; Greenberg, Richard; Hoyle, John D; Jaffe, David M; Levine, Deborah A; Lillis, Kathleen; Linakis, James G; Muenzer, Jared; Nigrovic, Lise E; Powell, Elizabeth C; Rogers, Alexander J; Roosevelt, Genie; Ruddy, Richard M; Saunders, Mary; Tunik, Michael G; Tzimenatos, Leah; Vitale, Melissa; Dean, J Michael; Ramilo, Octavio
Young febrile infants are at substantial risk of serious bacterial infections; however, the current culture-based diagnosis has limitations. Analysis of host expression patterns ("RNA biosignatures") in response to infections may provide an alternative diagnostic approach. To assess whether RNA biosignatures can distinguish febrile infants aged 60 days or younger with and without serious bacterial infections. Prospective observational study involving a convenience sample of febrile infants 60 days or younger evaluated for fever (temperature >38° C) in 22 emergency departments from December 2008 to December 2010 who underwent laboratory evaluations including blood cultures. A random sample of infants with and without bacterial infections was selected for RNA biosignature analysis. Afebrile healthy infants served as controls. Blood samples were collected for cultures and RNA biosignatures. Bioinformatics tools were applied to define RNA biosignatures to classify febrile infants by infection type. RNA biosignatures compared with cultures for discriminating febrile infants with and without bacterial infections and infants with bacteremia from those without bacterial infections. Bacterial infection confirmed by culture. Performance of RNA biosignatures was compared with routine laboratory screening tests and Yale Observation Scale (YOS) scores. Of 1883 febrile infants (median age, 37 days; 55.7% boys), RNA biosignatures were measured in 279 randomly selected infants (89 with bacterial infections-including 32 with bacteremia and 15 with urinary tract infections-and 190 without bacterial infections), and 19 afebrile healthy infants. Sixty-six classifier genes were identified that distinguished infants with and without bacterial infections in the test set with 87% (95% CI, 73%-95%) sensitivity and 89% (95% CI, 81%-93%) specificity. Ten classifier genes distinguished infants with bacteremia from those without bacterial infections in the test set with 94% (95% CI, 70
Prokaryotic RNA Associated to Bacterial Viability Induces Polymorphonuclear Neutrophil Activation.
Rodriguez-Rodrigues, Nahuel; Castillo, Luis A; Landoni, Verónica I; Martire-Greco, Daiana; Milillo, M Ayelén; Barrionuevo, Paula; Fernández, Gabriela C
2017-01-01
Polymorphonuclear neutrophils (PMN) are the first cellular line of antibacterial host defense. They sense pathogens through recognition of pathogen-associated molecular patterns (PAMPs) by innate pattern recognition receptors, such as Toll-like receptors (TLR). The aim of this study was to investigate whether PMN sense bacterial viability and explore which viability factor could be involved in this phenomenon. For this purpose, different functions were evaluated in isolated human PMN using live Escherichia coli (Ec) and heat-killed Ec (HK-Ec). We found that bacterial viability was indispensable to induce PMN activation, as measured by forward-scatter (FSC) increase, CD11b surface expression, chemotaxis, reactive oxygen species (ROS) generation and neutrophil extracellular trap (NET) formation. As uncapped non-polyadenylated prokaryotic mRNA has been recognized as a PAMP associated to bacterial viability by macrophages and dendritic cells, total prokaryotic RNA (pRNA) from live Ec was purified and used as a stimulus for PMN. pRNA triggered similar responses to those observed with live bacteria. No RNA could be isolated from HK-Ec, explaining the lack of effect of dead bacteria. Moreover, the supernatant of dead bacteria was able to induce PMN activation, and this was associated with the presence of pRNA in this supernatant, which is released in the killing process. The induction of bactericidal functions (ROS and NETosis) by pRNA were abolished when the supernatant of dead bacteria or isolated pRNA were treated with RNAse. Moreover, endocytosis was necessary for pRNA-induced ROS generation and NETosis, and priming was required for the induction of pRNA-induced ROS in whole blood. However, responses related to movement and degranulation (FSC increase, CD11b up-regulation, and chemotaxis) were still triggered when pRNA was digested with RNase, and were not dependent on pRNA endocytosis or PMN priming. In conclusion, our results indicate that PMN sense live bacteria
Prokaryotic RNA Associated to Bacterial Viability Induces Polymorphonuclear Neutrophil Activation
Rodriguez-Rodrigues, Nahuel; Castillo, Luis A.; Landoni, Verónica I.; Martire-Greco, Daiana; Milillo, M. Ayelén; Barrionuevo, Paula; Fernández, Gabriela C.
2017-01-01
Polymorphonuclear neutrophils (PMN) are the first cellular line of antibacterial host defense. They sense pathogens through recognition of pathogen-associated molecular patterns (PAMPs) by innate pattern recognition receptors, such as Toll-like receptors (TLR). The aim of this study was to investigate whether PMN sense bacterial viability and explore which viability factor could be involved in this phenomenon. For this purpose, different functions were evaluated in isolated human PMN using live Escherichia coli (Ec) and heat-killed Ec (HK-Ec). We found that bacterial viability was indispensable to induce PMN activation, as measured by forward-scatter (FSC) increase, CD11b surface expression, chemotaxis, reactive oxygen species (ROS) generation and neutrophil extracellular trap (NET) formation. As uncapped non-polyadenylated prokaryotic mRNA has been recognized as a PAMP associated to bacterial viability by macrophages and dendritic cells, total prokaryotic RNA (pRNA) from live Ec was purified and used as a stimulus for PMN. pRNA triggered similar responses to those observed with live bacteria. No RNA could be isolated from HK-Ec, explaining the lack of effect of dead bacteria. Moreover, the supernatant of dead bacteria was able to induce PMN activation, and this was associated with the presence of pRNA in this supernatant, which is released in the killing process. The induction of bactericidal functions (ROS and NETosis) by pRNA were abolished when the supernatant of dead bacteria or isolated pRNA were treated with RNAse. Moreover, endocytosis was necessary for pRNA-induced ROS generation and NETosis, and priming was required for the induction of pRNA-induced ROS in whole blood. However, responses related to movement and degranulation (FSC increase, CD11b up-regulation, and chemotaxis) were still triggered when pRNA was digested with RNase, and were not dependent on pRNA endocytosis or PMN priming. In conclusion, our results indicate that PMN sense live bacteria
Mahajan, Prashant; Kuppermann, Nathan; Mejias, Asuncion; Suarez, Nicolas; Chaussabel, Damien; Casper, T. Charles; Smith, Bennett; Alpern, Elizabeth R.; Anders, Jennifer; Atabaki, Shireen M.; Bennett, Jonathan E.; Blumberg, Stephen; Bonsu, Bema; Borgialli, Dominic; Brayer, Anne; Browne, Lorin; Cohen, Daniel M.; Crain, Ellen F.; Cruz, Andrea T.; Dayan, Peter S.; Gattu, Rajender; Greenberg, Richard; Hoyle, John D.; Jaffe, David M.; Levine, Deborah A.; Lillis, Kathleen; Linakis, James G.; Muenzer, Jared; Nigrovic, Lise E.; Powell, Elizabeth C.; Rogers, Alexander J.; Roosevelt, Genie; Ruddy, Richard M.; Saunders, Mary; Tunik, Michael G.; Tzimenatos, Leah; Vitale, Melissa; Dean, J. Michael; Ramilo, Octavio
2016-01-01
IMPORTANCE Young febrile infants are at substantial risk of serious bacterial infections; however, the current culture-based diagnosis has limitations. Analysis of host expression patterns (“RNA biosignatures”) in response to infections may provide an alternative diagnostic approach. OBJECTIVE To assess whether RNA biosignatures can distinguish febrile infants aged 60 days or younger with and without serious bacterial infections. DESIGN, SETTING, AND PARTICIPANTS Prospective observational study involving a convenience sample of febrile infants 60 days or younger evaluated for fever (temperature >38° C) in 22 emergency departments from December 2008 to December 2010 who underwent laboratory evaluations including blood cultures. A random sample of infants with and without bacterial infections was selected for RNA biosignature analysis. Afebrile healthy infants served as controls. Blood samples were collected for cultures and RNA biosignatures. Bioinformatics tools were applied to define RNA biosignatures to classify febrile infants by infection type. EXPOSURE RNA biosignatures compared with cultures for discriminating febrile infants with and without bacterial infections and infants with bacteremia from those without bacterial infections. MAIN OUTCOMES AND MEASURES Bacterial infection confirmed by culture. Performance of RNA biosignatures was compared with routine laboratory screening tests and Yale Observation Scale (YOS) scores. RESULTS Of 1883 febrile infants (median age, 37 days; 55.7%boys), RNA biosignatures were measured in 279 randomly selected infants (89 with bacterial infections—including 32 with bacteremia and 15 with urinary tract infections—and 190 without bacterial infections), and 19 afebrile healthy infants. Sixty-six classifier genes were identified that distinguished infants with and without bacterial infections in the test set with 87%(95%CI, 73%-95%) sensitivity and 89% (95%CI, 81%-93%) specificity. Ten classifier genes distinguished
Semen Bacterial Concentrations and HIV-1 RNA Shedding Among HIV-1-Seropositive Kenyan Men.
Korhonen, Christine J; Srinivasan, Sujatha; Huang, Dandi; Ko, Daisy L; Sanders, Eduard J; Peshu, Norbert M; Krieger, John N; Muller, Charles H; Coombs, Robert W; Fredricks, David N; Graham, Susan M
2017-03-01
HIV-1 is transmitted through semen from men to their sexual partners. Genital infections can increase HIV-1 RNA shedding in semen, but shedding also occurs in the absence of typical pathogens. We hypothesized that higher bacterial concentrations in semen would be associated with higher HIV-1 RNA levels. We analyzed semen samples from 42 HIV-1-seropositive Kenyan men using quantitative polymerase chain reaction (PCR) to assess bacterial concentrations and real-time PCR to measure HIV-1 RNA levels. Generalized estimation equations were used to evaluate associations between these 2 measures. Broad-range 16S rRNA gene PCR with pyrosequencing was performed on a subset of 13 samples to assess bacterial community composition. Bacteria were detected in 96.6% of 88 samples by quantitative PCR. Semen bacterial concentration and HIV-1 RNA levels were correlated 0.30 (P = 0.01). The association between bacterial concentration and HIV-1 RNA detection was not significant after adjustment for antiretroviral therapy (ART) (adjusted odds ratio: 1.27, 95% CI: 0.84 to 1.91). Factors associated with semen bacterial concentration included insertive anal sex (adjusted beta 0.92, 95% CI: 0.12 to 1.73) and ART use (adjusted beta: -0.77, 95% CI: -1.50 to 0.04). Among 13 samples with pyrosequencing data, Corynebacterium spp., Staphylococcus spp., and Streptococcus spp. were most frequently detected. Most of these HIV-1-infected men had bacteria in their semen. ART use was associated with undetectable semen HIV-1 RNA and lower semen bacterial concentrations, whereas insertive anal sex was associated with higher bacterial concentrations. Additional studies evaluating the relationship between semen bacteria, inflammation, mucosal immunity, and HIV-1 shedding are needed to understand implications for HIV-1 transmission.
THE ACTION OF α-AMANITIN ON RNA SYNTHESIS IN CHINESE HAMSTER OVARY CELLS
Kedinger, Claude; Simard, Rene
1974-01-01
α-Amanitin acts in vitro as a selective inhibitor of the nucleoplasmic form B RNA polymerases. Treatment of Chinese hamster ovary (CHO) cells with this drug leads principally to a severe fragmentation of the nucleoli. While the ultrastructural lesions induced by α-amanitin in CHO cells and in rat or mouse liver are quite similar, the results diverge concerning the effect on RNA synthesis. It has been shown that in rat or mouse liver α-amanitin blocks both extranucleolar and nucleolar RNA synthesis. Our autoradiographic and biochemical evidence indicates that in CHO cells high molecular weight extranucleolar RNA synthesis (HnRNA) is blocked by the α-amanitin treatment, whereas nucleolar RNA (preribosomal RNA) synthesis remains unaffected even several hours after the inhibition of extranucleolar RNA synthesis. Furthermore, the processing of this RNA as well as its transport to the cytoplasm seem only slightly affected by the treatment. Finally, under these conditions, the synthesis of the low molecular RNA species (4–5S) still occurs, though less actively. The results are interpreted as evidence for a selective impairment of HnRNA synthesis by α-amanitin in CHO cells. PMID:4474178
JAK kinases are required for the bacterial RNA and poly I:C induced tyrosine phosphorylation of PKR
Bleiblo, Farag; Michael, Paul; Brabant, Danielle; Ramana, Chilakamarti V; Tai, TC; Saleh, Mazen; Parrillo, Joseph E; Kumar, Anand; Kumar, Aseem
2013-01-01
Discriminating the molecular patterns associated with RNA is central to innate immunity. The protein kinase PKR is a cytosolic sensor involved in the recognition of viral dsRNA and triggering interferon-induced signaling. Here, we identified bacterial RNA as a novel distinct pattern recognized by PKR. We show that the tyrosine phosphorylation of PKR induced by either bacterial RNA or poly I:C is impaired in mutant cells lacking TYK2, JAK1, or JAK2 kinases. PKR was found to be a direct substrate for the activated JAKs. Our results indicated that the double-stranded structures of bacterial RNA are required to fully activate PKR. These results suggest that bacterial RNA signaling is analogous in some respects to that of viral RNA and interferons and may have implications in bacterial immunity. PMID:23236554
Evaluation of isolation methods for bacterial RNA quantitation in Dickeya dadantii
USDA-ARS?s Scientific Manuscript database
Dickeya dadantii is a difficult source for RNA of a sufficient quality for real-time qRT-PCR analysis of gene expression. Three RNA isolation methods were evaluated for their ability to produce high-quality RNA from this bacterium. Bacterial lysis with Trizol using standard protocols consistently ga...
Exploiting rRNA operon copy number to investigate bacterial reproductive strategies.
Roller, Benjamin R K; Stoddard, Steven F; Schmidt, Thomas M
2016-09-12
The potential for rapid reproduction is a hallmark of microbial life, but microbes in nature must also survive and compete when growth is constrained by resource availability. Successful reproduction requires different strategies when resources are scarce and when they are abundant 1,2 , but a systematic framework for predicting these reproductive strategies in bacteria has not been available. Here, we show that the number of ribosomal RNA operons (rrn) in bacterial genomes predicts two important components of reproduction-growth rate and growth efficiency-which are favoured under contrasting regimes of resource availability 3,4 . We find that the maximum reproductive rate of bacteria doubles with a doubling of rrn copy number, and the efficiency of carbon use is inversely related to maximal growth rate and rrn copy number. We also identify a feasible explanation for these patterns: the rate and yield of protein synthesis mirror the overall pattern in maximum growth rate and growth efficiency. Furthermore, comparative analysis of genomes from 1,167 bacterial species reveals that rrn copy number predicts traits associated with resource availability, including chemotaxis and genome streamlining. Genome-wide patterns of orthologous gene content covary with rrn copy number, suggesting convergent evolution in response to resource availability. Our findings imply that basic cellular processes adapt in contrasting ways to long-term differences in resource availability. They also establish a basis for predicting changes in bacterial community composition in response to resource perturbations using rrn copy number measurements 5 or inferences 6,7 .
Semen Bacterial Concentrations and HIV-1 RNA Shedding Among HIV-1–Seropositive Kenyan Men
Srinivasan, Sujatha; Huang, Dandi; Ko, Daisy L.; Sanders, Eduard J.; Peshu, Norbert M.; Krieger, John N.; Muller, Charles H.; Coombs, Robert W.; Fredricks, David N.; Graham, Susan M.
2017-01-01
Introduction: HIV-1 is transmitted through semen from men to their sexual partners. Genital infections can increase HIV-1 RNA shedding in semen, but shedding also occurs in the absence of typical pathogens. We hypothesized that higher bacterial concentrations in semen would be associated with higher HIV-1 RNA levels. Methods: We analyzed semen samples from 42 HIV-1–seropositive Kenyan men using quantitative polymerase chain reaction (PCR) to assess bacterial concentrations and real-time PCR to measure HIV-1 RNA levels. Generalized estimation equations were used to evaluate associations between these 2 measures. Broad-range 16S rRNA gene PCR with pyrosequencing was performed on a subset of 13 samples to assess bacterial community composition. Results: Bacteria were detected in 96.6% of 88 samples by quantitative PCR. Semen bacterial concentration and HIV-1 RNA levels were correlated 0.30 (P = 0.01). The association between bacterial concentration and HIV-1 RNA detection was not significant after adjustment for antiretroviral therapy (ART) (adjusted odds ratio: 1.27, 95% CI: 0.84 to 1.91). Factors associated with semen bacterial concentration included insertive anal sex (adjusted beta 0.92, 95% CI: 0.12 to 1.73) and ART use (adjusted beta: −0.77, 95% CI: −1.50 to 0.04). Among 13 samples with pyrosequencing data, Corynebacterium spp., Staphylococcus spp., and Streptococcus spp. were most frequently detected. Conclusion: Most of these HIV-1–infected men had bacteria in their semen. ART use was associated with undetectable semen HIV-1 RNA and lower semen bacterial concentrations, whereas insertive anal sex was associated with higher bacterial concentrations. Additional studies evaluating the relationship between semen bacteria, inflammation, mucosal immunity, and HIV-1 shedding are needed to understand implications for HIV-1 transmission. PMID:27861240
Minakuchi, M; Sugiyama, K; Kato, Y; Naito, T; Okuwaki, M; Kawaguchi, A; Nagata, K
2017-02-01
The genome of influenza virus (viral RNA [vRNA]) is associated with the nucleoprotein (NP) and viral RNA-dependent RNA polymerases and forms helical viral ribonucleoprotein (vRNP) complexes. The NP-vRNA complex is the biologically active template for RNA synthesis by the viral polymerase. Previously, we identified human pre-mRNA processing factor 18 (Prp18) as a stimulatory factor for viral RNA synthesis using a Saccharomyces cerevisiae replicon system and a single-gene deletion library of Saccharomyces cerevisiae (T. Naito, Y. Kiyasu, K. Sugiyama, A. Kimura, R. Nakano, A. Matsukage, and K. Nagata, Proc Natl Acad Sci USA, 104:18235-18240, 2007, https://doi.org/10.1073/pnas.0705856104). In infected Prp18 knockdown (KD) cells, the synthesis of vRNA, cRNA, and viral mRNAs was reduced. Prp18 was found to stimulate in vitro viral RNA synthesis through its interaction with NP. Analyses using in vitro RNA synthesis reactions revealed that Prp18 dissociates newly synthesized RNA from the template after the early elongation step to stimulate the elongation reaction. We found that Prp18 functions as a chaperone for NP to facilitate the formation of NP-RNA complexes. Based on these results, it is suggested that Prp18 accelerates influenza virus RNA synthesis as an NP chaperone for the processive elongation reaction. Templates for viral RNA synthesis of negative-stranded RNA viruses are not naked RNA but rather RNA encapsidated by viral nucleocapsid proteins forming vRNP complexes. However, viral basic proteins tend to aggregate under physiological ionic strength without chaperones. We identified the pre-mRNA processing factor Prp18 as a stimulatory factor for influenza virus RNA synthesis. We found that one of the targets of Prp18 is NP. Prp18 facilitates the elongation reaction of viral polymerases by preventing the deleterious annealing of newly synthesized RNA to the template. Prp18 functions as a chaperone for NP to stimulate the formation of NP-RNA complexes. Based on
Control of RNA synthesis in Escherichia coli after a shift to higher temperature.
Ryals, J; Little, R; Bremer, H
1982-01-01
Parameters of RNA synthesis were measured after a temperature upshift in a pair of Escherichia coli B/r strains that are isogenic except for having relA and relA+ loci, to examine the cause for a reported anomaly in the correlation between guanosine tetraphosphate (ppGpp) and stable RNA (rRNA, tRNA) synthesis under such conditions. Two main results were: (i) the specific stable RNA gene activity (stable RNA per total RNA synthesis) correlated in the conventionally expected fashion with the level of ppGpp but was obscured by a nonspecific increase in the RNA chain elongation rate due to the higher temperature; (ii) the temperature upshift caused a transient reduction in the RNA polymerase activity (transcribing per total enzyme) that accounts for the previously observed oscillating RNA synthesis rate after a temperature shift. PMID:6179925
Synthesis of RNA oligomers on heterogeneous templates
NASA Technical Reports Server (NTRS)
Ertem, G.; Ferris, J. P.
1996-01-01
The concept of an RNA world in the chemical origin of life is appealing, as nucleic acids are capable of both information storage and acting as templates that catalyse the synthesis of complementary molecules. Template-directed synthesis has been demonstrated for homogeneous oligonucleotides that, like natural nucleic acids, have 3',5' linkages between the nucleotide monomers. But it seems likely that prebiotic routes to RNA-like molecules would have produced heterogeneous molecules with various kinds of phosphodiester linkages and both linear and cyclic nucleotide chains. Here we show that such heterogeneity need be no obstacle to the templating of complementary molecules. Specifically, we show that heterogeneous oligocytidylates, formed by the montmorillonite clay-catalysed condensation of actuated monomers, can serve as templates for the synthesis of oligoguanylates. Furthermore, we show that oligocytidylates that are exclusively 2',5'-linked can also direct synthesis of oligoguanylates. Such heterogeneous templating reactions could have increased the diversity of the pool of protonucleic acids from which life ultimately emerged.
Faghih, Omeed; Zhang, Zhongsheng; Ranade, Ranae M; Gillespie, J Robert; Creason, Sharon A; Huang, Wenlin; Shibata, Sayaka; Barros-Álvarez, Ximena; Verlinde, Christophe L M J; Hol, Wim G J; Fan, Erkang; Buckner, Frederick S
2017-11-01
Antibiotic-resistant bacteria are widespread and pose a growing threat to human health. New antibiotics acting by novel mechanisms of action are needed to address this challenge. The bacterial methionyl-tRNA synthetase (MetRS) enzyme is essential for protein synthesis, and the type found in Gram-positive bacteria is substantially different from its counterpart found in the mammalian cytoplasm. Both previously published and new selective inhibitors were shown to be highly active against Gram-positive bacteria with MICs of ≤1.3 μg/ml against Staphylococcus , Enterococcus , and Streptococcus strains. Incorporation of radioactive precursors demonstrated that the mechanism of activity was due to the inhibition of protein synthesis. Little activity against Gram-negative bacteria was observed, consistent with the fact that Gram-negative bacterial species contain a different type of MetRS enzyme. The ratio of the MIC to the minimum bactericidal concentration (MBC) was consistent with a bacteriostatic mechanism. The level of protein binding of the compounds was high (>95%), and this translated to a substantial increase in MICs when the compounds were tested in the presence of serum. Despite this, the compounds were very active when they were tested in a Staphylococcus aureus murine thigh infection model. Compounds 1717 and 2144, given by oral gavage, resulted in 3- to 4-log decreases in the bacterial load compared to that in vehicle-treated mice, which was comparable to the results observed with the comparator drugs, vancomycin and linezolid. In summary, the research describes MetRS inhibitors with oral bioavailability that represent a class of compounds acting by a novel mechanism with excellent potential for clinical development. Copyright © 2017 American Society for Microbiology.
NUCLEAR ENVELOPE-ASSOCIATED RESUMPTION OF RNA SYNTHESIS IN LATE MITOSIS OF HELA CELLS
Simmons, T.; Heywood, P.; Hodge, L.
1973-01-01
The restitution of RNA synthesis in cultures progressing from metaphase into interphase (G1) has been investigated in synchronized HeLa S3 cells by using inhibitors of macro-molecular synthesis and the technique of electron microscope autoradiography. The rate of incorporation of radioactive uridine into RNA approached interphase levels in the absence of renewed protein synthesis. In contrast, maintenance of this rate in G1 was dependent upon renewed protein synthesis. Restoration of synthesis of heterogeneous nuclear RNA occurred under conditions that inhibited production of ribosomal precursor RNA. In autoradiographs of individual cells exposed to radioactive uridine, silver grains were first detected after nuclear envelope reformation at the periphery of the chromosome mass but before chromosomal decondensation. These data are consistent with the following interpretation. Multiple RNA polymerase activities persist through mitosis and are involved in the initiation of RNA synthesis in early telophase at sites on the nuclear envelope. PMID:4752403
[Effect of metalaxyl on the synthesis of RNA, DNA and protein in Phytophthora nicotianae].
Wollgiehn, R; Bräutigam, E; Schumann, B; Erge, D
1984-01-01
Metalaxyl is used to control diseases caused by fungi of the order of the Perenosporales. We investigated the action of this fungicid eon nucleic acid and protein synthesis in liquid cultures of Phytophthora nicotianae. The uptake of 32P, 3H-uridine, 3H-thymidine and 14C-leucine as precursors of nuclei acid and protein synthesis by the mycelium was not inhibited by metalaxyl. RNA synthesis as indicated by 3H-uridine incorporation was strongly inhibited (about 80%) by 0.5 micrograms/ml of metalaxyl. The inhibition was visible already few minutes after addition of the toxicant. Since the inhibition of incorporation of 3H-thymidine into DNA and of 14C-leucine into protein became significant 2-3 hours later, we conclude that metalaxyl primarily interfers with RNA synthesis. Synthesis of ribosomal RNA is more affected (more than 90%) than that of tRNA (about 55%) and poly(A)-containing RNA. Since in the presence of actinomycin, in contrast to metalaxyl, protein synthesis is inhibited immediately as a consequence of complete inhibition of RNA synthesis and of the short life-time of mRNA, it is also evident that mRNA synthesis is less strongly inhibited, at least during the early period of metalaxyl action. The molecular mechanism of metalaxyl inhibition of the transcription process remains open. The fungicide did not inhibit the activity of a partially purified RNA polymerase isolated from the fungus. On the other hand, the RNA synthesis (14C-UTP-incorporation) by a cell homogenate and by isolated nuclear fractions was inhibited significantly. Possibilities of the molecular action of metalaxyl are discussed. The RNA synthesis of some plant systems (cell cultures of Lycopersicon peruvianum, isolated nuclei from the same cell cultures, purified RNA polymerase from Spinacia oleracea chloroplasts) was not inhibited by metalaxyl, not even at high concentrations.
Jang, Bora; Kim, Boyoung; Kim, Hyunsook; Kwon, Hyokyoung; Kim, Minjeong; Seo, Yunmi; Colas, Marion; Jeong, Hansaem; Jeong, Eun Hye; Lee, Kyuri; Lee, Hyukjin
2018-06-08
Enzymatic synthesis of RNA nanostructures is achieved by isothermal rolling circle transcription (RCT). Each arm of RNA nanostructures provides a functional role of Dicer substrate RNA inducing sequence specific RNA interference (RNAi). Three different RNAi sequences (GFP, RFP, and BFP) are incorporated within the three-arm junction RNA nanostructures (Y-RNA). The template and helper DNA strands are designed for the large-scale in vitro synthesis of RNA strands to prepare self-assembled Y-RNA. Interestingly, Dicer processing of Y-RNA is highly influenced by its physical structure and different gene silencing activity is achieved depending on its arm length and overhang. In addition, enzymatic synthesis allows the preparation of various Y-RNA structures using a single DNA template offering on demand regulation of multiple target genes.
A Mutation in the Bacillus subtilis rsbU Gene That Limits RNA Synthesis during Sporulation.
Rothstein, David M; Lazinski, David; Osburne, Marcia S; Sonenshein, Abraham L
2017-07-15
Mutants of Bacillis subtilis that are temperature sensitive for RNA synthesis during sporulation were isolated after selection with a 32 P suicide agent. Whole-genome sequencing revealed that two of the mutants carried an identical lesion in the rsbU gene, which encodes a phosphatase that indirectly activates SigB, the stress-responsive RNA polymerase sigma factor. The mutation appeared to cause RsbU to be hyperactive, because the mutants were more resistant than the parent strain to ethanol stress. In support of this hypothesis, pseudorevertants that regained wild-type levels of sporulation at high temperature had secondary mutations that prevented expression of the mutant rsbU gene. The properties of these RsbU mutants support the idea that activation of SigB diminishes the bacterium's ability to sporulate. IMPORTANCE Most bacterial species encode multiple RNA polymerase promoter recognition subunits (sigma factors). Each sigma factor directs RNA polymerase to different sets of genes; each gene set typically encodes proteins important for responses to specific environmental conditions, such as changes in temperature, salt concentration, and nutrient availability. A selection for mutants of Bacillus subtilis that are temperature sensitive for RNA synthesis during sporulation unexpectedly yielded strains with a point mutation in rsbU , a gene that encodes a protein that normally activates sigma factor B (SigB) under conditions of salt stress. The mutation appears to cause RsbU, and therefore SigB, to be active inappropriately, thereby inhibiting, directly or indirectly, the ability of the cells to transcribe sporulation genes. Copyright © 2017 American Society for Microbiology.
Sanders, Alison P; Gennings, Chris; Svensson, Katherine; Motta, Valeria; Mercado-Garcia, Adriana; Solano, Maritsa; Baccarelli, Andrea A; Tellez-Rojo, Martha M; Wright, Robert O; Burris, Heather H
2017-01-01
Bacterial vaginosis may lead to preterm birth through epigenetic programming of the inflammatory response, specifically via miRNA expression. We quantified bacterial 16S rRNA, cytokine mRNA and 800 miRNA from cervical swabs obtained from 80 women at 16-19 weeks' gestation. We generated bacterial and cytokine indices using weighted quantile sum regression and examined associations with miRNA and gestational age at delivery. Each decile of the bacterial and cytokine indices was associated with shorter gestations (p < 0.005). The bacterial index was associated with miR-494, 371a, 4286, 185, 320e, 888 and 23a (p < 0.05). miR-494 remained significant after false discovery rate correction (q < 0.1). The cytokine index was associated with 27 miRNAs (p < 0.05; q < 0.01). Future investigation into the role of bacterial vaginosis- and inflammation-associated miRNA and preterm birth is warranted.
Thébault, Patricia; Bourqui, Romain; Benchimol, William; Gaspin, Christine; Sirand-Pugnet, Pascal; Uricaru, Raluca; Dutour, Isabelle
2015-09-01
The revolution in high-throughput sequencing technologies has enabled the acquisition of gigabytes of RNA sequences in many different conditions and has highlighted an unexpected number of small RNAs (sRNAs) in bacteria. Ongoing exploitation of these data enables numerous applications for investigating bacterial transacting sRNA-mediated regulation networks. Focusing on sRNAs that regulate mRNA translation in trans, recent works have noted several sRNA-based regulatory pathways that are essential for key cellular processes. Although the number of known bacterial sRNAs is increasing, the experimental validation of their interactions with mRNA targets remains challenging and involves expensive and time-consuming experimental strategies. Hence, bioinformatics is crucial for selecting and prioritizing candidates before designing any experimental work. However, current software for target prediction produces a prohibitive number of candidates because of the lack of biological knowledge regarding the rules governing sRNA-mRNA interactions. Therefore, there is a real need to develop new approaches to help biologists focus on the most promising predicted sRNA-mRNA interactions. In this perspective, this review aims at presenting the advantages of mixing bioinformatics and visualization approaches for analyzing predicted sRNA-mediated regulatory bacterial networks. © The Author 2014. Published by Oxford University Press.
Structural model of an mRNA in complex with the bacterial chaperone Hfq
Peng, Yi; Curtis, Joseph E.; Fang, Xianyang; ...
2014-11-17
The Sm-like protein Hfq (host factor Q-beta phage) facilitates regulation by bacterial small noncoding RNAs (sRNAs) in response to stress and other environmental signals. In this paper, we present a low-resolution model of Escherichia coli Hfq bound to the rpoS mRNA, a bacterial stress response gene that is targeted by three different sRNAs. Selective 2'-hydroxyl acylation and primer extension, small-angle X-ray scattering, and Monte Carlo molecular dynamics simulations show that the distal face and lateral rim of Hfq interact with three sites in the rpoS leader, folding the RNA into a compact tertiary structure. These interactions are needed for sRNAmore » regulation of rpoS translation and position the sRNA target adjacent to an sRNA binding region on the proximal face of Hfq. Finally, our results show how Hfq specifically distorts the structure of the rpoS mRNA to enable sRNA base pairing and translational control.« less
Borisenko, A S; Kotus, E V; Kaloshin, A A
2008-01-01
Significant number of scientific publications devoted to inhibition of viral replication by antisense RNA (asRNA) genes shows that this approach is useful for gene therapy of viral infections. To investigate the possibility of suppression of HTLV-1 virus reproduction by asRNA we constructed recombinant plasmids containing asRNA genes against U3 long terminal repeats region and X gene under the control of promoter of myeloproliferative sarcoma virus (MPSV) or without such promoter. Using stable calcium-phosphate transfection method with subsequent selection in the presence of G-418, RaHOS line-based cell clones carrying both asRNA genes and sequences able to bind HTLV-1 transactivator proteins (i.e. "traps" of viral transactivators, TVT) were obtained. Data from dot-hybridization analysis of viral RNA extracted from RaHOS cell clones showed that TVT sequences are able to suppress the viral RNA synthesis on 90% and asRNA against X gene synthesis--on 50%.
Recombinant viral RdRps can initiate RNA synthesis from circular templates
RANJITH-KUMAR, C.T.; KAO, C.C.
2006-01-01
The crystal structure of the recombinant hepatitis C virus (HCV) RNA-dependent RNA polymerase (RdRp) revealed extensive interactions between the fingers and the thumb subdomains, resulting in a closed conformation with an established template channel that should specifically accept single-stranded templates. We made circularized RNA templates and found that they were efficiently used by the HCV RdRp to synthesize product RNAs that are significantly longer than the template, suggesting that RdRp could exist in an open conformation prior to template binding. RNA synthesis using circular RNA templates had properties similar to those previously documented for linear RNA, including a need for higher GTP concentration for initiation, usage of GTP analogs, sensitivity to salt, and involvement of active-site residues for product formation. Some products were resistant to challenge with the template competitor heparin, indicating that the elongation complexes remain bound to template and are competent for RNA synthesis. Other products were not elongated in the presence of heparin, indicating that the elongation complex was terminated. Lastly, recombinant RdRps from two other flaviviruses and from the Pseudomonas phage φ6 also could use circular RNA templates for RNA-dependent RNA synthesis, although the φ6 RdRp could only use circular RNAs made from the 3′-terminal sequence of the φ6 genome. PMID:16373481
Bourqui, Romain; Benchimol, William; Gaspin, Christine; Sirand-Pugnet, Pascal; Uricaru, Raluca; Dutour, Isabelle
2015-01-01
The revolution in high-throughput sequencing technologies has enabled the acquisition of gigabytes of RNA sequences in many different conditions and has highlighted an unexpected number of small RNAs (sRNAs) in bacteria. Ongoing exploitation of these data enables numerous applications for investigating bacterial transacting sRNA-mediated regulation networks. Focusing on sRNAs that regulate mRNA translation in trans, recent works have noted several sRNA-based regulatory pathways that are essential for key cellular processes. Although the number of known bacterial sRNAs is increasing, the experimental validation of their interactions with mRNA targets remains challenging and involves expensive and time-consuming experimental strategies. Hence, bioinformatics is crucial for selecting and prioritizing candidates before designing any experimental work. However, current software for target prediction produces a prohibitive number of candidates because of the lack of biological knowledge regarding the rules governing sRNA–mRNA interactions. Therefore, there is a real need to develop new approaches to help biologists focus on the most promising predicted sRNA–mRNA interactions. In this perspective, this review aims at presenting the advantages of mixing bioinformatics and visualization approaches for analyzing predicted sRNA-mediated regulatory bacterial networks. PMID:25477348
Zhao, Zhongliang; Dammert, Marcel A; Hoppe, Sven; Bierhoff, Holger; Grummt, Ingrid
2016-09-30
Attenuation of ribosome biogenesis in suboptimal growth environments is crucial for cellular homeostasis and genetic integrity. Here, we show that shutdown of rRNA synthesis in response to elevated temperature is brought about by mechanisms that target both the RNA polymerase I (Pol I) transcription machinery and the epigenetic signature of the rDNA promoter. Upon heat shock, the basal transcription factor TIF-IA is inactivated by inhibition of CK2-dependent phosphorylations at Ser170/172. Attenuation of pre-rRNA synthesis in response to heat stress is accompanied by upregulation of PAPAS, a long non-coding RNA (lncRNA) that is transcribed in antisense orientation to pre-rRNA. PAPAS interacts with CHD4, the adenosine triphosphatase subunit of NuRD, leading to deacetylation of histones and movement of the promoter-bound nucleosome into a position that is refractory to transcription initiation. The results exemplify how stress-induced inactivation of TIF-IA and lncRNA-dependent changes of chromatin structure ensure repression of rRNA synthesis in response to thermo-stress. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
The synthesis of polyadenylated messenger RNA in herpes simplex type I virus infected BHK cells.
Harris, T J; Wildy, P
1975-09-01
The pattern of polyadenylated messenger RNA (mRNA) synthesis in BHK cell monolayers, infected under defined conditions with herpes simplex type I virus has been investigated by polyacrylamide gel electrophoresis or pulse-labelled RNA isolated by oligo dT-cellulose chromatography. Two classes of mRNA molecules were synthesized in infected cells; these were not detected in uninfected cells. The rate of synthesis of the larger, 18 to 30S RNA class reached a maximum soon after injection and then declined, whereas the rate of synthesis of the 7 to 11 S RNA class did not reach a maximum until much later and did not decline. In the presence of cytosine arabinoside, the rate of mRNA synthesis in infected cells was reduced but the electrophoretic pattern remained the same.
RNA search engines empower the bacterial intranet.
Dendooven, Tom; Luisi, Ben F
2017-08-15
RNA acts not only as an information bearer in the biogenesis of proteins from genes, but also as a regulator that participates in the control of gene expression. In bacteria, small RNA molecules (sRNAs) play controlling roles in numerous processes and help to orchestrate complex regulatory networks. Such processes include cell growth and development, response to stress and metabolic change, transcription termination, cell-to-cell communication, and the launching of programmes for host invasion. All these processes require recognition of target messenger RNAs by the sRNAs. This review summarizes recent results that have provided insights into how bacterial sRNAs are recruited into effector ribonucleoprotein complexes that can seek out and act upon target transcripts. The results hint at how sRNAs and their protein partners act as pattern-matching search engines that efficaciously regulate gene expression, by performing with specificity and speed while avoiding off-target effects. The requirements for efficient searches of RNA patterns appear to be common to all domains of life. © 2017 The Author(s).
RNA search engines empower the bacterial intranet
Dendooven, Tom
2017-01-01
RNA acts not only as an information bearer in the biogenesis of proteins from genes, but also as a regulator that participates in the control of gene expression. In bacteria, small RNA molecules (sRNAs) play controlling roles in numerous processes and help to orchestrate complex regulatory networks. Such processes include cell growth and development, response to stress and metabolic change, transcription termination, cell-to-cell communication, and the launching of programmes for host invasion. All these processes require recognition of target messenger RNAs by the sRNAs. This review summarizes recent results that have provided insights into how bacterial sRNAs are recruited into effector ribonucleoprotein complexes that can seek out and act upon target transcripts. The results hint at how sRNAs and their protein partners act as pattern-matching search engines that efficaciously regulate gene expression, by performing with specificity and speed while avoiding off-target effects. The requirements for efficient searches of RNA patterns appear to be common to all domains of life. PMID:28710287
Riya, Shohei; Takeuchi, Yuki; Zhou, Sheng; Terada, Akihiko; Hosomi, Masaaki
2017-06-01
A pulse of nitrous oxide (N 2 O) emission has been observed following the disappearance of floodwater by drainage. However, its mechanism is not well understood. We conducted a column study to clarify the mechanism for N 2 O production during floodwater disappearance by using a microsensor and determining the bacterial gene expression. An increase in N 2 O flux was observed following floodwater disappearance after the addition of NH 4 + , with a corresponding increase in the concentrations of NO 3 - and dissolved N 2 O in the oxic and anoxic soil layers, respectively. The transcription level of the bacterial amoA mRNA did not change, while that of nirK mRNA increased sharply after an hour of floodwater disappearance. An additional anoxic soil slurry experiment demonstrated that the addition of NO 3 - induced the expression of nirK gene and caused a concomitant increase in N 2 O production. These findings suggest that NO 3 - production in the oxic layers is important as it provides a substrate and induces the synthesis of denitrification enzymes in the anoxic layer during N 2 O production.
Kuhn, Claus-D
2016-05-01
tRNAs undergo multiple conformational changes during the translation cycle that are required for tRNA translocation and proper communication between the ribosome and translation factors. Recent structural data on how destabilized tRNAs utilize the CCA-adding enzyme to proofread themselves put a spotlight on tRNA flexibility beyond the translation cycle. In analogy to tRNA surveillance, this review finds that other processes also exploit versatile tRNA folding to achieve, amongst others, specific aminoacylation, translational regulation by riboswitches or a block of bacterial translation. tRNA flexibility is thereby not restricted to the hinges utilized during translation. In contrast, the flexibility of tRNA is distributed all over its L-shape and is actively exploited by the tRNA-interacting partners to discriminate one tRNA from another. Since the majority of tRNA modifications also modulate tRNA flexibility it seems that cells devote enormous resources to tightly sense and regulate tRNA structure. This is likely required for error-free protein synthesis. © 2016 WILEY Periodicals, Inc.
Babina, Arianne M; Parker, Darren J; Li, Gene-Wei; Meyer, Michelle M
2018-06-20
In many bacteria, ribosomal proteins autogenously repress their own expression by interacting with RNA structures typically located in the 5'-UTRs of their mRNA transcripts. This regulation is necessary to maintain a balance between ribosomal proteins and rRNA to ensure proper ribosome production. Despite advances in non-coding RNA discovery and validation of RNA-protein regulatory interactions, the selective pressures that govern the formation and maintenance of such RNA cis-regulators in the context of an organism remain largely undetermined. To examine the impact disruptions to this regulation have on bacterial fitness, we introduced point mutations that abolish ribosomal protein binding and regulation into the RNA structure that controls expression of ribosomal proteins L20 and L35 within the Bacillus subtilis genome. Our studies indicate that removing this regulation results in reduced log phase growth, improper rRNA maturation, and the accumulation of a kinetically trapped or mis-assembled ribosomal particle at low temperatures, suggesting defects in ribosome synthesis. Such work emphasizes the important role regulatory RNAs play in the stoichiometric production of ribosomal components for proper ribosome composition and overall organism viability and reinforces the potential of targeting ribosomal protein production and ribosome assembly with novel antimicrobials. Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Synthesis and biological activity of artificial mRNA prepared with novel phosphorylating reagents
Nagata, Seigo; Hamasaki, Tomohiro; Uetake, Koichi; Masuda, Hirofumi; Takagaki, Kazuchika; Oka, Natsuhisa; Wada, Takeshi; Ohgi, Tadaaki; Yano, Junichi
2010-01-01
Though medicines that target mRNA are under active investigation, there has been little or no effort to develop mRNA itself as a medicine. Here, we report the synthesis of a 130-nt mRNA sequence encoding a 33-amino-acid peptide that includes the sequence of glucagon-like peptide-1, a peptide that stimulates glucose-dependent insulin secretion from the pancreas. The synthesis method used, which had previously been developed in our laboratory, was based on the use of 2-cyanoethoxymethyl as the 2′-hydroxy protecting group. We also developed novel, highly reactive phosphotriester pyrophosphorylating reagents to pyrophosphorylate the 5′-end of the 130-mer RNA in preparation for capping. We completed the synthesis of the artificial mRNA by the enzymatic addition of a 5′-cap and a 3′-poly(A) tail to the pyrophosphorylated 130-mer and showed that the resulting mRNA supported protein synthesis in a cell-free system and in whole cells. As far as we know, this is the first time that mRNA has been prepared from a chemically synthesized RNA sequence. As well as providing a research tool for the intracellular expression of peptides, the technology described here may be used for the production of mRNA for medical applications. PMID:20660478
Virus-Specific RNA Synthesis in Cells Infected by Infectious Pancreatic Necrosis Virus
Somogyi, Paul; Dobos, Peter
1980-01-01
Pulse-labeling experiments with [3H]uridine revealed that the rate of infections pancreatic necrosis virus-specific RNA synthesis was maximal at 8 to 10 h after infection and was completely diminished by 12 to 14 h. Three forms of RNA intermediates were detected: (i) a putative transcription intermediate (TRI) which comigrated in acrylamide gels with virion double-stranded RNA (dsRNA) after RNase treatment; (ii) a 24S genome length mRNA which could be resolved into two bands by polyacrylamide gel electrophoresis; and (iii) a 14S dsRNA component indistinguishable from virion RNA by gradient centrifugation and gel electrophoresis. The TRI (i) was LiCl precipitable; (ii) sedimented slightly faster and broader (14 to 16S) than the 14S virion dsRNA; (iii) had a lower electrophoretic mobility in acrylamide gels than dsRNA, barely entering acrylamide gels as a heterogenous component; (iv) yielded genome-sized pieces of dsRNA after RNase digestion; and (v) was the most abundant RNA form early in the infectious cycle. The 24S single-stranded RNA was thought to be the viral mRNA since it: (i) became labeled during short pulses; (ii) was found in the polysomal fraction of infected cells; and (iii) hybridized to denatured viral RNA, forming two segments of RNase-resistant RNA that comigrated with virion dsRNA in gels. The 24S mRNA component was formed before the synthesis of dsRNA, and radioactivity could be chased from 24S single-stranded RNA to dsRNA, indicating that 24S RNA may serve as template for the synthesis of complementary strands to form dsRNA. Similar to reovirus, infectious pancreatic necrosis viral 24S mRNA contained no polyadenylic acid tracts. Images PMID:16789184
NASA Technical Reports Server (NTRS)
Zhang, Zhengdong; Willson, Richard C.; Fox, George E.
2002-01-01
MOTIVATION: The phylogenetic structure of the bacterial world has been intensively studied by comparing sequences of 16S ribosomal RNA (16S rRNA). This database of sequences is now widely used to design probes for the detection of specific bacteria or groups of bacteria one at a time. The success of such methods reflects the fact that there are local sequence segments that are highly characteristic of particular organisms or groups of organisms. It is not clear, however, the extent to which such signature sequences exist in the 16S rRNA dataset. A better understanding of the numbers and distribution of highly informative oligonucleotide sequences may facilitate the design of hybridization arrays that can characterize the phylogenetic position of an unknown organism or serve as the basis for the development of novel approaches for use in bacterial identification. RESULTS: A computer-based algorithm that characterizes the extent to which any individual oligonucleotide sequence in 16S rRNA is characteristic of any particular bacterial grouping was developed. A measure of signature quality, Q(s), was formulated and subsequently calculated for every individual oligonucleotide sequence in the size range of 5-11 nucleotides and for 15mers with reference to each cluster and subcluster in a 929 organism representative phylogenetic tree. Subsequently, the perfect signature sequences were compared to the full set of 7322 sequences to see how common false positives were. The work completed here establishes beyond any doubt that highly characteristic oligonucleotides exist in the bacterial 16S rRNA sequence dataset in large numbers. Over 16,000 15mers were identified that might be useful as signatures. Signature oligonucleotides are available for over 80% of the nodes in the representative tree.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Leung, Daisy W.; Borek, Dominika; Luthra, Priya
During viral RNA synthesis, Ebola virus (EBOV) nucleoprotein (NP) alternates between an RNA-template-bound form and a template-free form to provide the viral polymerase access to the RNA template. In addition, newly synthesized NP must be prevented from indiscriminately binding to noncognate RNAs. Here, we investigate the molecular bases for these critical processes. We identify an intrinsically disordered peptide derived from EBOV VP35 (NPBP, residues 20–48) that binds NP with high affinity and specificity, inhibits NP oligomerization, and releases RNA from NP-RNA complexes in vitro. The structure of the NPBP/ΔNP NTD complex, solved to 3.7 Å resolution, reveals how NPBP peptidemore » occludes a large surface area that is important for NP-NP and NP-RNA interactions and for viral RNA synthesis. Together, our results identify a highly conserved viral interface that is important for EBOV replication and can be targeted for therapeutic development.« less
Leung, Daisy W.; Borek, Dominika; Luthra, Priya; ...
2015-04-01
During viral RNA synthesis, Ebola virus (EBOV) nucleoprotein (NP) alternates between an RNA-template-bound form and a template-free form to provide the viral polymerase access to the RNA template. In addition, newly synthesized NP must be prevented from indiscriminately binding to noncognate RNAs. Here, we investigate the molecular bases for these critical processes. We identify an intrinsically disordered peptide derived from EBOV VP35 (NPBP, residues 20–48) that binds NP with high affinity and specificity, inhibits NP oligomerization, and releases RNA from NP-RNA complexes in vitro. The structure of the NPBP/ΔNP NTD complex, solved to 3.7 Å resolution, reveals how NPBP peptidemore » occludes a large surface area that is important for NP-NP and NP-RNA interactions and for viral RNA synthesis. Together, our results identify a highly conserved viral interface that is important for EBOV replication and can be targeted for therapeutic development.« less
Leung, Daisy W; Borek, Dominika; Luthra, Priya; Binning, Jennifer M; Anantpadma, Manu; Liu, Gai; Harvey, Ian B; Su, Zhaoming; Endlich-Frazier, Ariel; Pan, Juanli; Shabman, Reed S; Chiu, Wah; Davey, Robert A; Otwinowski, Zbyszek; Basler, Christopher F; Amarasinghe, Gaya K
2015-04-21
During viral RNA synthesis, Ebola virus (EBOV) nucleoprotein (NP) alternates between an RNA-template-bound form and a template-free form to provide the viral polymerase access to the RNA template. In addition, newly synthesized NP must be prevented from indiscriminately binding to noncognate RNAs. Here, we investigate the molecular bases for these critical processes. We identify an intrinsically disordered peptide derived from EBOV VP35 (NPBP, residues 20-48) that binds NP with high affinity and specificity, inhibits NP oligomerization, and releases RNA from NP-RNA complexes in vitro. The structure of the NPBP/ΔNPNTD complex, solved to 3.7 Å resolution, reveals how NPBP peptide occludes a large surface area that is important for NP-NP and NP-RNA interactions and for viral RNA synthesis. Together, our results identify a highly conserved viral interface that is important for EBOV replication and can be targeted for therapeutic development. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
A bacterial Argonaute with noncanonical guide RNA specificity
Kaya, Emine; Doxzen, Kevin W.; Knoll, Kilian R.; Wilson, Ross C.; Strutt, Steven C.; Kranzusch, Philip J.; Doudna, Jennifer A.
2016-01-01
Eukaryotic Argonaute proteins induce gene silencing by small RNA-guided recognition and cleavage of mRNA targets. Although structural similarities between human and prokaryotic Argonautes are consistent with shared mechanistic properties, sequence and structure-based alignments suggested that Argonautes encoded within CRISPR-cas [clustered regularly interspaced short palindromic repeats (CRISPR)-associated] bacterial immunity operons have divergent activities. We show here that the CRISPR-associated Marinitoga piezophila Argonaute (MpAgo) protein cleaves single-stranded target sequences using 5′-hydroxylated guide RNAs rather than the 5′-phosphorylated guides used by all known Argonautes. The 2.0-Å resolution crystal structure of an MpAgo–RNA complex reveals a guide strand binding site comprising residues that block 5′ phosphate interactions. Using structure-based sequence alignment, we were able to identify other putative MpAgo-like proteins, all of which are encoded within CRISPR-cas loci. Taken together, our data suggest the evolution of an Argonaute subclass with noncanonical specificity for a 5′-hydroxylated guide. PMID:27035975
Yunus, Muhammad Amir; Lin, Xiaoyan; Bailey, Dalan; Karakasiliotis, Ioannis; Chaudhry, Yasmin; Vashist, Surender; Zhang, Guo; Thorne, Lucy; Kao, C. Cheng
2014-01-01
ABSTRACT All members of the Caliciviridae family of viruses produce a subgenomic RNA during infection. The subgenomic RNA typically encodes only the major and minor capsid proteins, but in murine norovirus (MNV), the subgenomic RNA also encodes the VF1 protein, which functions to suppress host innate immune responses. To date, the mechanism of norovirus subgenomic RNA synthesis has not been characterized. We have previously described the presence of an evolutionarily conserved RNA stem-loop structure on the negative-sense RNA, the complementary sequence of which codes for the viral RNA-dependent RNA polymerase (NS7). The conserved stem-loop is positioned 6 nucleotides 3′ of the start site of the subgenomic RNA in all caliciviruses. We demonstrate that the conserved stem-loop is essential for MNV viability. Mutant MNV RNAs with substitutions in the stem-loop replicated poorly until they accumulated mutations that revert to restore the stem-loop sequence and/or structure. The stem-loop sequence functions in a noncoding context, as it was possible to restore the replication of an MNV mutant by introducing an additional copy of the stem-loop between the NS7- and VP1-coding regions. Finally, in vitro biochemical data suggest that the stem-loop sequence is sufficient for the initiation of viral RNA synthesis by the recombinant MNV RNA-dependent RNA polymerase, confirming that the stem-loop forms the core of the norovirus subgenomic promoter. IMPORTANCE Noroviruses are a significant cause of viral gastroenteritis, and it is important to understand the mechanism of norovirus RNA synthesis. Here we describe the identification of an RNA stem-loop structure that functions as the core of the norovirus subgenomic RNA promoter in cells and in vitro. This work provides new insights into the molecular mechanisms of norovirus RNA synthesis and the sequences that determine the recognition of viral RNA by the RNA-dependent RNA polymerase. PMID:25392209
Yunus, Muhammad Amir; Lin, Xiaoyan; Bailey, Dalan; Karakasiliotis, Ioannis; Chaudhry, Yasmin; Vashist, Surender; Zhang, Guo; Thorne, Lucy; Kao, C Cheng; Goodfellow, Ian
2015-01-15
All members of the Caliciviridae family of viruses produce a subgenomic RNA during infection. The subgenomic RNA typically encodes only the major and minor capsid proteins, but in murine norovirus (MNV), the subgenomic RNA also encodes the VF1 protein, which functions to suppress host innate immune responses. To date, the mechanism of norovirus subgenomic RNA synthesis has not been characterized. We have previously described the presence of an evolutionarily conserved RNA stem-loop structure on the negative-sense RNA, the complementary sequence of which codes for the viral RNA-dependent RNA polymerase (NS7). The conserved stem-loop is positioned 6 nucleotides 3' of the start site of the subgenomic RNA in all caliciviruses. We demonstrate that the conserved stem-loop is essential for MNV viability. Mutant MNV RNAs with substitutions in the stem-loop replicated poorly until they accumulated mutations that revert to restore the stem-loop sequence and/or structure. The stem-loop sequence functions in a noncoding context, as it was possible to restore the replication of an MNV mutant by introducing an additional copy of the stem-loop between the NS7- and VP1-coding regions. Finally, in vitro biochemical data suggest that the stem-loop sequence is sufficient for the initiation of viral RNA synthesis by the recombinant MNV RNA-dependent RNA polymerase, confirming that the stem-loop forms the core of the norovirus subgenomic promoter. Noroviruses are a significant cause of viral gastroenteritis, and it is important to understand the mechanism of norovirus RNA synthesis. Here we describe the identification of an RNA stem-loop structure that functions as the core of the norovirus subgenomic RNA promoter in cells and in vitro. This work provides new insights into the molecular mechanisms of norovirus RNA synthesis and the sequences that determine the recognition of viral RNA by the RNA-dependent RNA polymerase. Copyright © 2015, American Society for Microbiology. All Rights
RNA SYNTHESIS IN THE MOUSE OOCYTE
Moore, G. P. M.; Lintern-Moore, Sue; Peters, Hannah; Faber, M.
1974-01-01
RNA synthesis in the oocyte and granulosa cell nuclei of growing follicles has been studied in the mouse ovary. The RNA precursor [3H]uridine was administered intraperitoneally to adult mice and the amount of label incorporated into ovarian RNA was quantitated autoradiographically using grain-counting procedures. Uridine incorporation into the nucleus is low in oocytes of small, resting follicles but increases during follicle growth and reaches a peak prior to the beginning of antrum formation. Thereafter uptake rapidly declines and is very low in the oocytes of maturing follicles. Uridine incorporation into granulosa cell nuclei, in contrast to that found in the oocyte, increases gradually during most of the period of follicle growth. Qualitative studies of the activity of endogenous, DNA-dependent RNA polymerases have also been made in fixed oocytes isolated from follicles at different stages of growth. Polymerase activity is demonstrable in the nucleolus and nucleoplasm of oocytes from growing follicles, but is absent from maturing oocytes of large follicles. PMID:4813213
RNA polymerase pausing and nascent RNA structure formation are linked through clamp domain movement
Hein, Pyae P.; Kolb, Kellie E.; Windgassen, Tricia; Bellecourt, Michael J.; Darst, Seth A.; Mooney, Rachel A.; Landick, Robert
2014-01-01
The rates of RNA synthesis and nascent RNA folding into biologically active structures are linked via pausing by RNA polymerase (RNAP). Structures that form within the RNA exit channel can increase pausing by interacting with bacterial RNAP or decrease pausing by preventing backtracking. Conversely, pausing is required for proper folding of some RNAs. Opening of the RNAP clamp domain is proposed to mediate some effects of nascent RNA structures. However, the connections among RNA structure formation, clamp movement, and catalytic activity remain uncertain. We assayed exit-channel structure formation in Escherichia coli RNAP together with disulfide crosslinks that favor closed or open clamp conformations and found that clamp position directly influences RNA structure formation and catalytic activity. We report that exit-channel RNA structures slow pause escape by favoring clamp opening and through interactions with the flap that slow translocation. PMID:25108353
Increased sensitivity to protein synthesis inhibitors in cells lacking tmRNA.
de la Cruz, J; Vioque, A
2001-01-01
tmRNA (also known as SsrA or 10Sa RNA) is involved in a trans-translation reaction that contributes to the recycling of stalled ribosomes at the 3' end of an mRNA lacking a stop codon or at an internal mRNA cluster of rare codons. Inactivation of the ssrA gene in most bacteria results in viable cells bearing subtle phenotypes, such as temperature-sensitive growth. Herein, we report on the functional characterization of the ssrA gene in the cyanobacterium Synechocystis sp. strain PCC6803. Deletion of the ssrA gene in Synechocystis resulted in viable cells with a growth rate identical to wild-type cells. However, null ssrA cells (deltassrA) were not viable in the presence of the protein synthesis inhibitors chloramphenicol, lincomycin, spiramycin, tylosin, erythromycin, and spectinomycin at low doses that do not significantly affect the growth of wild-type cells. Sensitivity of deltassrA cells similar to wild-type cells was observed with kasugamycin, fusidic acid, thiostrepton, and puromycin. Antibiotics unrelated to protein synthesis, such as ampicillin or rifampicin, had no differential effect on the deltassrA strain. Furthermore, deletion of the ssrA gene is sufficient to impair global protein synthesis when chloramphenicol is added at sublethal concentrations for the wild-type strain. These results indicate that ribosomes stalled by some protein synthesis inhibitors can be recycled by tmRNA. In addition, this suggests that the first elongation cycle with tmRNA, which incorporates a noncoded alanine on the growing peptide chain, may have mechanistic differences with the normal elongation cycles that bypasses the block produced by these specific antibiotics. tmRNA inactivation could be an useful therapeutic target to increase the sensitivity of pathogenic bacteria against antibiotics. PMID:11780628
Osman, Toba A M; Coutts, Robert H A; Buck, Kenneth W
2006-11-01
Cereal yellow dwarf virus (CYDV) RNA has a 5'-terminal genome-linked protein (VPg). We have expressed the VPg region of the CYDV genome in bacteria and used the purified protein (bVPg) to raise an antiserum which was able to detect free VPg in extracts of CYDV-infected oat plants. A template-dependent RNA-dependent RNA polymerase (RdRp) has been produced from a CYDV membrane-bound RNA polymerase by treatment with BAL 31 nuclease. The RdRp was template specific, being able to utilize templates from CYDV plus- and minus-strand RNAs but not those of three unrelated viruses, Red clover necrotic mosaic virus, Cucumber mosaic virus, and Tobacco mosaic virus. RNA synthesis catalyzed by the RdRp required a 3'-terminal GU sequence and the presence of bVPg. Additionally, synthesis of minus-strand RNA on a plus-strand RNA template required the presence of a putative stem-loop structure near the 3' terminus of CYDV RNA. The base-paired stem, a single-nucleotide (A) bulge in the stem, and the sequence of a tetraloop were all required for the template activity. Evidence was produced showing that minus-strand synthesis in vitro was initiated by priming by bVPg at the 3' end of the template. The data are consistent with a model in which the RdRp binds to the stem-loop structure which positions the active site to recognize the 3'-terminal GU sequence for initiation of RNA synthesis by the addition of an A residue to VPg.
Tethering of human Ago proteins to mRNA mimics the miRNA-mediated repression of protein synthesis.
Pillai, Ramesh S; Artus, Caroline G; Filipowicz, Witold
2004-10-01
MicroRNAs (miRNAs) are approximately 21-nt-long RNAs involved in regulating development, differentiation, and other processes in eukaryotes. In metazoa, nearly all miRNAs control gene expression by imperfectly base-pairing with the 3'-untranslated region (3'-UTR) of target mRNAs and repressing protein synthesis by an unknown mechanism. It is also unknown whether miRNA-mRNA duplexes containing mismatches and bulges provide specific features that are recognized by factors mediating the repression. miRNAs form part of ribonucleoprotein complexes, miRNPs, that contain Argonaute (Ago) and other proteins. Here we demonstrate that effects of miRNAs on translation can be mimicked in human HeLa cells by the miRNA-independent tethering of Ago proteins to the 3'-UTR of a reporter mRNA. Inhibition of protein synthesis occurred without a change in the reporter mRNA level and was dependent on the number, but not the position, of the hairpins tethering hAgo2 to the 3'-UTR. These findings indicate that a primary function of miRNAs is to guide their associated proteins to the mRNA. Copyright 2004 RNA Society
Petrova, Olga E.; Garcia-Alcalde, Fernando; Zampaloni, Claudia; Sauer, Karin
2017-01-01
Global transcriptomic analysis via RNA-seq is often hampered by the high abundance of ribosomal (r)RNA in bacterial cells. To remove rRNA and enrich coding sequences, subtractive hybridization procedures have become the approach of choice prior to RNA-seq, with their efficiency varying in a manner dependent on sample type and composition. Yet, despite an increasing number of RNA-seq studies, comparative evaluation of bacterial rRNA depletion methods has remained limited. Moreover, no such study has utilized RNA derived from bacterial biofilms, which have potentially higher rRNA:mRNA ratios and higher rRNA carryover during RNA-seq analysis. Presently, we evaluated the efficiency of three subtractive hybridization-based kits in depleting rRNA from samples derived from biofilm, as well as planktonic cells of the opportunistic human pathogen Pseudomonas aeruginosa. Our results indicated different rRNA removal efficiency for the three procedures, with the Ribo-Zero kit yielding the highest degree of rRNA depletion, which translated into enhanced enrichment of non-rRNA transcripts and increased depth of RNA-seq coverage. The results indicated that, in addition to improving RNA-seq sensitivity, efficient rRNA removal enhanced detection of low abundance transcripts via qPCR. Finally, we demonstrate that the Ribo-Zero kit also exhibited the highest efficiency when P. aeruginosa/Staphylococcus aureus co-culture RNA samples were tested. PMID:28117413
Studies on the Role of RNA Synthesis in Auxin Induction of Cell Enlargement 1
Nooden, Larry D.
1968-01-01
Selective inhibitors were used to study the connection between nucleic acid synthesis and indoleacetic acid (IAA) induction of cell enlargement. Actinomycin D (act D) and azaguanine (azaG) almost completely inhibit IAA-induced growth in aged artichoke tuber disks when they are added simultaneously with IAA. In contrast, when they are added 24 hours after the hormone, these inhibitors have little or no effect on the induced growth which continues for 48 hours or more with little or no inhibition. Inhibitors of protein synthesis still stop growth when applied 24 hours after the IAA, thus protein synthesis and presumably supporting metabolism are still essential. In corn coleoptile sections auxin-induced growth did not show any pronounced tendency to become less sensitive to act D as the IAA treatment progressed. Act D did not completely inhibit the response to IAA unless the sections were pretreated with act D for 6 hours. In contrast to act D, cordycepin produced almost complete inhibition of IAA-induced growth when added with the IAA. Although IAA has a very large and very rapid stimulatory effect (within 10 min) on incorporation of 32P-orthophosphate into RNA in disks, it did not cause a detectable change in the base composition of the RNA synthesized. Furthermore, the promotive effect could be accounted for through increased uptake of the 32P. That much of the RNA synthesis in these tissues is not necessary for auxin action is indicated by the results with fluorouracil (FU). FU strongly inhibits RNA synthesis, probably acting preferentially on ribosomal RNA synthesis, without inhibiting auxin-induced growth in the disks or coleoptile sections. FU also strongly inhibited respiration in auxin-treated disks indicating that the large promotion of respiration by auxin likewise may not be entirely necessary for growth. At least in the artichoke disks, RNA synthesis is required for auxin induction of cell enlargement and not for cell enlargement itself. The possible
Synthesis and properties of 2'-O-methyl-4'-thioRNA.
Takahashi, Mayumi; Inoue, Naonori; Minakawa, Noriaki; Matsuda, Akira
2005-01-01
In this presentation, we will discuss the synthesis and properties of 2'-O-methyl-4'-thioRNA, an RNA molecule consisting of 2'-O-methyl-4'-thionucleosides. We first synthesized 2'-O-methyl-4'-thiouridine and -cytidine derivatives via 2,2'-O-anhydro-4'-thiouridine. The RNA consisting of 2'-O-methyl-4'-thiopyrimidine nucleosides and 2'-O-methylpurine nucleosides, 2'-OMe-4'-thioRNA, was synthesized on a DNA synthesizer according to the standard phosphoramidite protocol.
Akt activation enhances ribosomal RNA synthesis through casein kinase II and TIF-IA.
Nguyen, Le Xuan Truong; Mitchell, Beverly S
2013-12-17
Transcription initiation factor I (TIF-IA) plays an essential role in regulating ribosomal RNA (rRNA) synthesis by tethering RNA polymerase I (Pol I) to the rDNA promoter. We have found that activated Akt enhances rRNA synthesis through the phosphorylation of casein kinase IIα (CK2α) on a threonine residue near its N terminus. CK2 in turn phosphorylates TIF-IA, thereby increasing rDNA transcription. Activated Akt also stabilizes TIF-IA, induces its translocation to the nucleolus, and enhances its interaction with Pol I. Treatment with AZD8055, an inhibitor of both Akt and mammalian target of rapamycin phosphorylation, but not with rapamycin, disrupts Akt-mediated TIF-IA stability, translocation, and activity. These data support a model in which activated Akt enhances rRNA synthesis both by preventing TIF-IA degradation and phosphorylating CK2α, which in turn phosphorylates TIF-IA. This model provides an explanation for the ability of activated Akt to promote cell proliferation and, potentially, transformation.
Regulation of early mRNA synthesis after bacteriophage T4 infection of Escherichia coli.
Linder, C H; Fast, R
1975-01-01
Regulation of T4-specific mRNA synthesis was studied during leucine starvation of a leucine-requiring stringent Escherichia coli B strain. This was done by imposing starvation prior to T4 infection and then letting RNA synthesis proceed for different time periods. Rifampin or streptolydigin was added to stop further RNA synthesis, and protein synthesis was restored by addition of leucine. Samples were withdrawn at different times, and the enzyme-forming capacities found that, during conditions which elicit the stringent response in uninfected bacteria, immediate early mRNA is not stringently regulated. This conclusion contradicts the earlier conclusion of others, obtained by measuring incorporation of radioactive uracil; this is explained by the observation of Edlin and Neuhard (1967), confirmed and extended by us to the T4-infected cell, that the incorporation of uracil into RNA of a stringent strain is virtually blocked by amino acid starvation, whereas that of adenine continues at 30 to 50% of the rate seen in the presence of the required amino acid. PMID:1099229
Improved deoxyribozymes for synthesis of covalently branched DNA and RNA.
Lee, Christine S; Mui, Timothy P; Silverman, Scott K
2011-01-01
A covalently branched nucleic acid can be synthesized by joining the 2'-hydroxyl of the branch-site ribonucleotide of a DNA or RNA strand to the activated 5'-phosphorus of a separate DNA or RNA strand. We have previously used deoxyribozymes to synthesize several types of branched nucleic acids for experiments in biotechnology and biochemistry. Here, we report in vitro selection experiments to identify improved deoxyribozymes for synthesis of branched DNA and RNA. Each of the new deoxyribozymes requires Mn²(+) as a cofactor, rather than Mg²(+) as used by our previous branch-forming deoxyribozymes, and each has an initially random region of 40 rather than 22 or fewer combined nucleotides. The deoxyribozymes all function by forming a three-helix-junction (3HJ) complex with their two oligonucleotide substrates. For synthesis of branched DNA, the best new deoxyribozyme, 8LV13, has k(obs) on the order of 0.1 min⁻¹, which is about two orders of magnitude faster than our previously identified 15HA9 deoxyribozyme. 8LV13 also functions at closer-to-neutral pH than does 15HA9 (pH 7.5 versus 9.0) and has useful tolerance for many DNA substrate sequences. For synthesis of branched RNA, two new deoxyribozymes, 8LX1 and 8LX6, were identified with broad sequence tolerances and substantial activity at pH 7.5, versus pH 9.0 for many of our previous deoxyribozymes that form branched RNA. These experiments provide new, and in key aspects improved, practical catalysts for preparation of synthetic branched DNA and RNA.
A Two-State Model for the Dynamics of the Pyrophosphate Ion Release in Bacterial RNA Polymerase
Da, Lin-Tai; Pardo Avila, Fátima; Wang, Dong; Huang, Xuhui
2013-01-01
The dynamics of the PPi release during the transcription elongation of bacterial RNA polymerase and its effects on the Trigger Loop (TL) opening motion are still elusive. Here, we built a Markov State Model (MSM) from extensive all-atom molecular dynamics (MD) simulations to investigate the mechanism of the PPi release. Our MSM has identified a simple two-state mechanism for the PPi release instead of a more complex four-state mechanism observed in RNA polymerase II (Pol II). We observed that the PPi release in bacterial RNA polymerase occurs at sub-microsecond timescale, which is ∼3-fold faster than that in Pol II. After escaping from the active site, the (Mg-PPi)2− group passes through a single elongated metastable region where several positively charged residues on the secondary channel provide favorable interactions. Surprisingly, we found that the PPi release is not coupled with the TL unfolding but correlates tightly with the side-chain rotation of the TL residue R1239. Our work sheds light on the dynamics underlying the transcription elongation of the bacterial RNA polymerase. PMID:23592966
A trans-acting leader RNA from a Salmonella virulence gene
Choi, Eunna; Han, Yoontak; Cho, Yong-Joon; Nam, Daesil; Lee, Eun-Jin
2017-01-01
Bacteria use flagella to move toward nutrients, find its host, or retract from toxic substances. Because bacterial flagellum is one of the ligands that activate the host innate immune system, its synthesis should be tightly regulated during host infection, which is largely unknown. Here, we report that a bacterial leader mRNA from the mgtCBR virulence operon in the intracellular pathogen Salmonella enterica serovar Typhimurium binds to the fljB coding region of mRNAs in the fljBA operon encoding the FljB phase 2 flagellin, a main component of bacterial flagella and the FljA repressor for the FliC phase 1 flagellin, and degrades fljBA mRNAs in an RNase E-dependent fashion during infection. A nucleotide substitution of the fljB flagellin gene that prevents the mgtC leader RNA-mediated down-regulation increases the fljB-encoded flagellin synthesis, leading to a hypermotile phenotype inside macrophages. Moreover, the fljB nucleotide substitution renders Salmonella hypervirulent, indicating that FljB-based motility must be compromised in the phagosomal compartment where Salmonella resides. This suggests that this pathogen promotes pathogenicity by producing a virulence protein and limits locomotion by a trans-acting leader RNA from the same virulence gene during infection. PMID:28874555
RNA-primed complementary-sense DNA synthesis of the geminivirus African cassava mosaic virus.
Saunders, K; Lucy, A; Stanley, J
1992-01-01
The plant DNA virus African cassava mosaic virus (ACMV) is believed to replicate by a rolling circle mechanism. To investigate complementary-sense DNA (lagging strand) synthesis, we have analysed the heterogenous form of complementary-sense DNA (H3 DNA) from infected Nicotiana benthamiana by two-dimensional agarose gel electrophoresis and blot hybridisation. The presence of an RNA moeity is demonstrated by comparison of results for nucleic acids resolved on neutral/alkaline and neutral/formamide gels, suggesting that complementary-sense DNA synthesis on the virus-sense single-stranded DNA template is preceded by the synthesis of an RNA primer. Hybridisation with probes to specific parts of ACMV DNA A genome indicates that synthesis of the putative RNA primer initiates between nucleotides 2581-221, a region that includes intergenic sequences that have been implicated in geminivirus DNA replication and the control of gene expression. Images PMID:1475192
Shailes, Hannah; Eleftherohorinou, Hariklia; Hoggart, Clive J; Cebey-Lopez, Miriam; Carter, Michael J; Janes, Victoria A; Gormley, Stuart; Shimizu, Chisato; Tremoulet, Adriana H; Barendregt, Anouk M; Salas, Antonio; Kanegaye, John; Pollard, Andrew J; Faust, Saul N; Patel, Sanjay; Kuijpers, Taco; Martinon-Torres, Federico; Burns, Jane C; Coin, Lachlan JM; Levin, Michael
2018-01-01
Importance As clinical features do not reliably distinguish bacterial from viral infection, many children worldwide receive unnecessary antibiotic treatment whilst bacterial infection is missed in others. Objective To identify a blood RNA expression signature that distinguishes bacterial from viral infection in febrile children. Design Febrile children presenting to participating hospitals in UK, Spain, Netherlands and USA between 2009-2013 were prospectively recruited, comprising a discovery group and validation group. Each group was classified after microbiological investigation into definite bacterial, definite viral infection or indeterminate infection. RNA expression signatures distinguishing definite bacterial from viral infection were identified in the discovery group and diagnostic performance assessed in the validation group. Additional validation was undertaken in separate studies of children with meningococcal disease (n=24) inflammatory diseases (n=48), and on published gene expression datasets. Exposures A 2-transcript RNA expression signature distinguishing bacterial infection from viral infection was evaluated against clinical and microbiological diagnosis. Main Outcomes Definite Bacterial and viral infection was confirmed by culture or molecular detection of the pathogens. Performance of the RNA signature was evaluated in the definite bacterial and viral group, and the indeterminate group. Results The discovery cohort of 240 children (median age 19 months, 62% males) included 52 with definite bacterial infection of whom 36 (69%) required intensive care; and 92 with definite viral infection of whom 32 (35%) required intensive care. 96 children had indeterminate infection. Bioinformatic analysis of RNA expression data identified a 38-transcript signature distinguishing bacterial from viral infection. A smaller (2-transcript) signature (FAM89A and IFI44L) was identified by removing highly correlated transcripts. When this 2-transcript signature was
Interaction of TIF-90 and filamin A in the regulation of rRNA synthesis in leukemic cells.
Nguyen, Le Xuan Truong; Chan, Steven M; Ngo, Tri Duc; Raval, Aparna; Kim, Kyeong Kyu; Majeti, Ravindra; Mitchell, Beverly S
2014-07-24
The transcription initiation factor I (TIF-IA) is an important regulator of the synthesis of ribosomal RNA (rRNA) through its facilitation of the recruitment of RNA polymerase I (Pol I) to the ribosomal DNA promoter. Activation of the phosphoinositide 3-kinase (PI3K)/protein kinase B (Akt) pathway, which occurs commonly in acute myelogenous leukemia, enhances rRNA synthesis through TIF-IA stabilization and phosphorylation. We have discovered that TIF-IA coexists with a splicing isoform, TIF-90, which is expressed preferentially in the nucleolus and at higher levels in proliferating and transformed hematopoietic cells. TIF-90 interacts directly with Pol I to increase rRNA synthesis as a consequence of Akt activation. Furthermore, TIF-90 binds preferentially to a 90-kDa cleavage product of the actin binding protein filamin A (FLNA) that inhibits rRNA synthesis. Increased expression of TIF-90 overcomes the inhibitory effect of this cleavage product and stimulates rRNA synthesis. Because activated Akt also reduces FLNA cleavage, these results indicate that activated Akt and TIF-90 function in parallel to increase rRNA synthesis and, as a consequence, cell proliferation in leukemic cells. These results provide evidence that the direct targeting of Akt would be an effective therapy in acute leukemias in which Akt is activated. © 2014 by The American Society of Hematology.
NASA Technical Reports Server (NTRS)
Raghavan, V.
1991-01-01
Pattern of 3H-uridine incorporation into RNA of spores of Onoclea sensibilis imbibed in complete darkness (non-germinating conditions) and induced to germinate in red light was followed by oligo-dT cellulose chromatography, gel electrophoresis coupled with fluorography and autoradiography. In dark-imbibed spores, RNA synthesis was initiated about 24 h after sowing, with most of the label accumulating in the high mol. wt. poly(A) -RNA fraction. There was no incorporation of the label into poly(A) +RNA until 48 h after sowing. In contrast, photo-induced spores began to synthesize all fractions of RNA within 12 h after sowing and by 24 h, incorporation of 3H-uridine into RNA of irradiated spores was nearly 70-fold higher than that into dark-imbibed spores. Protein synthesis, as monitored by 3H-arginine incorporation into the acid-insoluble fraction and by autoradiography, was initiated in spores within 1-2 h after sowing under both conditions. Autoradiographic experiments also showed that onset of protein synthesis in the cytoplasm of the germinating spore is independent of the transport of newly synthesized nuclear RNA. One-dimensional sodium dodecyl sulphate-polyacrylamide gel electrophoresis of 35S-methionine-labelled proteins revealed a good correspondence between proteins synthesized in a cell-free translation system directed by poly(A) +RNA of dormant spores and those synthesized in vivo by dark-imbibed and photo-induced spores. These results indicate that stored mRNAs of O. sensibilis spores are functionally competent and provide templates for the synthesis of proteins during dark-imbibition and germination.
Evolution of Protein Synthesis from an RNA World
Noller, Harry F.
2012-01-01
SUMMARY Because of the molecular complexity of the ribosome and protein synthesis, it is a challenge to imagine how translation could have evolved from a primitive RNA World. Two specific suggestions are made here to help to address this, involving separate evolution of the peptidyl transferase and decoding functions. First, it is proposed that translation originally arose not to synthesize functional proteins, but to provide simple (perhaps random) peptides that bound to RNA, increasing its available structure space, and therefore its functional capabilities. Second, it is proposed that the decoding site of the ribosome evolved from a mechanism for duplication of RNA. This process involved homodimeric “duplicator RNAs,” resembling the anticodon arms of tRNAs, which directed ligation of trinucleotides in response to an RNA template. PMID:20610545
Ruppitsch, W; Stöger, A; Indra, A; Grif, K; Schabereiter-Gurtner, C; Hirschl, A; Allerberger, F
2007-03-01
In a bioterrorism event a rapid tool is needed to identify relevant dangerous bacteria. The aim of the study was to assess the usefulness of partial 16S rRNA gene sequence analysis and the suitability of diverse databases for identifying dangerous bacterial pathogens. For rapid identification purposes a 500-bp fragment of the 16S rRNA gene of 28 isolates comprising Bacillus anthracis, Brucella melitensis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, Yersinia pestis, and eight genus-related and unrelated control strains was amplified and sequenced. The obtained sequence data were submitted to three public and two commercial sequence databases for species identification. The most frequent reason for incorrect identification was the lack of the respective 16S rRNA gene sequences in the database. Sequence analysis of a 500-bp 16S rDNA fragment allows the rapid identification of dangerous bacterial species. However, for discrimination of closely related species sequencing of the entire 16S rRNA gene, additional sequencing of the 23S rRNA gene or sequencing of the 16S-23S rRNA intergenic spacer is essential. This work provides comprehensive information on the suitability of partial 16S rDNA analysis and diverse databases for rapid and accurate identification of dangerous bacterial pathogens.
Recent advances in synthesis of bacterial rare sugar building blocks and their applications.
Emmadi, Madhu; Kulkarni, Suvarn S
2014-07-01
Covering: 1964 to 2013. Bacteria have unusual glycans on their surfaces which distinguish them from the host cells. These unique structures offer avenues for targeting bacteria with specific therapeutics and vaccine. However, these rare sugars are not accessible in acceptable purity and amounts by isolation from natural sources. Thus, procurement of orthogonally protected rare sugar building blocks through efficient chemical synthesis is regarded as a crucial step towards the development of glycoconjugate vaccines. This Highlight focuses on recent advances in the synthesis of the bacterial deoxy amino hexopyranoside building blocks and their application in constructing various biologically important bacterial O-glycans.
Translational autocontrol of the Escherichia coli hfq RNA chaperone gene.
Vecerek, Branislav; Moll, Isabella; Bläsi, Udo
2005-06-01
The conserved bacterial RNA chaperone Hfq has been shown to play an important role in post-transcriptional regulation. Here, we demonstrate that Hfq synthesis is autoregulated at the translational level. We have mapped two Hfq binding sites in the 5'-untranslated region of hfq mRNA and show that Hfq binding inhibits formation of the translation initiation complex. In vitro translation and in vivo studies further revealed that Hfq binding to both sites is required for efficient translational repression of hfq mRNA.
Regulation of Viral RNA Synthesis by the V Protein of Parainfluenza Virus 5
Yang, Yang; Zengel, James; Sun, Minghao; Sleeman, Katrina; Timani, Khalid Amine; Aligo, Jason; Rota, Paul
2015-01-01
ABSTRACT Paramyxoviruses include many important animal and human pathogens. The genome of parainfluenza virus 5 (PIV5), a prototypical paramyxovirus, encodes a V protein that inhibits viral RNA synthesis. In this work, the mechanism of inhibition was investigated. Using mutational analysis and a minigenome system, we identified regions in the N and C termini of the V protein that inhibit viral RNA synthesis: one at the very N terminus of V and the second at the C terminus of V. Furthermore, we determined that residues L16 and I17 are critical for the inhibitory function of the N-terminal region of the V protein. Both regions interact with the nucleocapsid protein (NP), an essential component of the viral RNA genome complex (RNP). Mutations at L16 and I17 abolished the interaction between NP and the N-terminal domain of V. This suggests that the interaction between NP and the N-terminal domain plays a critical role in V inhibition of viral RNA synthesis by the N-terminal domain. Both the N- and C-terminal regions inhibited viral RNA replication. The C terminus inhibited viral RNA transcription, while the N-terminal domain enhanced viral RNA transcription, suggesting that the two domains affect viral RNA through different mechanisms. Interestingly, V also inhibited the synthesis of the RNA of other paramyxoviruses, such as Nipah virus (NiV), human parainfluenza virus 3 (HPIV3), measles virus (MeV), mumps virus (MuV), and respiratory syncytial virus (RSV). This suggests that a common host factor may be involved in the replication of these paramyxoviruses. IMPORTANCE We identified two regions of the V protein that interact with NP and determined that one of these regions enhances viral RNA transcription via its interaction with NP. Our data suggest that a common host factor may be involved in the regulation of paramyxovirus replication and could be a target for broad antiviral drug development. Understanding the regulation of paramyxovirus replication will enable the
Is Bacterial Fatty Acid Synthesis a Valid Target for Antibacterial Drug Discovery?
Parsons, Joshua B.; Rock, Charles O.
2011-01-01
The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there isn’t a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements. PMID:21862391
Identification of Bacterial Populations in Drinking Water Using 16S rRNA-Based Sequence Analyses
Intracellular RNA is rapidly degraded in stressed cells and is more unstable outside of the cell than DNA. As a result, RNA-based methods have been suggested to study the active microbial fraction in environmental matrices. The aim of this study was to identify bacterial populati...
Hinsberger, Stefan; Hüsecken, Kristina; Groh, Matthias; Negri, Matthias; Haupenthal, Jörg; Hartmann, Rolf W
2013-11-14
The bacterial RNA polymerase (RNAP) is a validated target for broad spectrum antibiotics. However, the efficiency of drugs is reduced by resistance. To discover novel RNAP inhibitors, a pharmacophore based on the alignment of described inhibitors was used for virtual screening. In an optimization process of hit compounds, novel derivatives with improved in vitro potency were discovered. Investigations concerning the molecular mechanism of RNAP inhibition reveal that they prevent the protein-protein interaction (PPI) between σ(70) and the RNAP core enzyme. Besides of reducing RNA formation, the inhibitors were shown to interfere with bacterial lipid biosynthesis. The compounds were active against Gram-positive pathogens and revealed significantly lower resistance frequencies compared to clinically used rifampicin.
Kaempfer, Raymond; Kaufman, Jennifer
1972-01-01
The continued recycling of ribosomes during protein synthesis in rabbit reticulocyte lysates at 37° requires an initiation factor whose activity is rapidly lost in the absence of added heme. Partially purified factor (i) fully maintains the polysomes; (ii) inhibits the association of 40S and 60S ribosomal subunits into single ribosomes; (iii) promotes the quantitative entry of added 60S subunits into polysomes; (iv) allows the accumulation of ribosomal subunits, instead of single ribosomes, when initiation is blocked with aurin tricarboxylate; and (v) is absolutely required for the binding of globin messenger RNA to ribosomes. These properties suggest that this mammalian initiation factor functions analogously to bacterial IF-3. In addition, the translational control of globin synthesis by heme is exerted, directly or indirectly, through this factor. PMID:4508325
Inhibition of Dengue Virus RNA Synthesis by an Adenosine Nucleoside ▿ †
Chen, Yen-Liang; Yin, Zheng; Duraiswamy, Jeyaraj; Schul, Wouter; Lim, Chin Chin; Liu, Boping; Xu, Hao Ying; Qing, Min; Yip, Andy; Wang, Gang; Chan, Wai Ling; Tan, Hui Pen; Lo, Melissa; Liung, Sarah; Kondreddi, Ravinder Reddy; Rao, Ranga; Gu, Helen; He, Handan; Keller, Thomas H.; Shi, Pei-Yong
2010-01-01
We recently reported that (2R,3R,4R,5R)-2-(4-amino-pyrrolo[2,3-d]pyrimidin-7-yl)-3-ethynyl-5-hydroxy-methyl-tetrahydro-furan-3,4-diol is a potent inhibitor of dengue virus (DENV), with 50% effective concentration (EC50) and cytotoxic concentration (CC50) values of 0.7 μM and >100 μM, respectively. Here we describe the synthesis, structure-activity relationship, and antiviral characterization of the inhibitor. In an AG129 mouse model, a single-dose treatment of DENV-infected mice with the compound suppressed peak viremia and completely prevented death. Mode-of-action analysis using a DENV replicon indicated that the compound blocks viral RNA synthesis. Recombinant adenosine kinase could convert the compound to a monophosphate form. Suppression of host adenosine kinase, using a specific inhibitor (iodotubercidin) or small interfering RNA (siRNA), abolished or reduced the compound's antiviral activity in cell culture. Studies of rats showed that 14C-labeled compound was converted to mono-, di-, and triphosphate metabolites in vivo. Collectively, the results suggest that this adenosine inhibitor is phosphorylated to an active (triphosphate) form which functions as a chain terminator for viral RNA synthesis. PMID:20457821
Yeh, Po-Yuan; Wu, Hung-Yi
2014-07-30
It has been demonstrated that, in addition to genomic RNA, sgmRNA is able to serve as a template for the synthesis of the negative-strand [(-)-strand] complement. However, the cis-acting elements on the positive-strand [(+)-strand] sgmRNA required for (-)-strand sgmRNA synthesis have not yet been systematically identified. In this study, we employed real-time quantitative reverse transcription polymerase chain reaction to analyze the cis-acting elements on bovine coronavirus (BCoV) sgmRNA 7 required for the synthesis of its (-)-strand counterpart by deletion mutagenesis. The major findings are as follows. (1) Deletion of the 5'-terminal leader sequence on sgmRNA 7 decreased the synthesis of the (-)-strand sgmRNA complement. (2) Deletions of the 3' untranslated region (UTR) bulged stem-loop showed no effect on (-)-strand sgmRNA synthesis; however, deletion of the 3' UTR pseudoknot decreased the yield of (-)-strand sgmRNA. (3) Nucleotides positioned from -15 to -34 of the sgmRNA 7 3'-terminal region are required for efficient (-)-strand sgmRNA synthesis. (4) Nucleotide species at the 3'-most position (-1) of sgmRNA 7 is correlated to the efficiency of (-)-strand sgmRNA synthesis. These results together suggest, in principle, that the 5'- and 3'-terminal sequences on sgmRNA 7 harbor cis-acting elements are critical for efficient (-)-strand sgmRNA synthesis in BCoV.
Christen, Matthias; Deutsch, Samuel; Christen, Beat
2015-08-21
Recent advances in synthetic biology have resulted in an increasing demand for the de novo synthesis of large-scale DNA constructs. Any process improvement that enables fast and cost-effective streamlining of digitized genetic information into fabricable DNA sequences holds great promise to study, mine, and engineer genomes. Here, we present Genome Calligrapher, a computer-aided design web tool intended for whole genome refactoring of bacterial chromosomes for de novo DNA synthesis. By applying a neutral recoding algorithm, Genome Calligrapher optimizes GC content and removes obstructive DNA features known to interfere with the synthesis of double-stranded DNA and the higher order assembly into large DNA constructs. Subsequent bioinformatics analysis revealed that synthesis constraints are prevalent among bacterial genomes. However, a low level of codon replacement is sufficient for refactoring bacterial genomes into easy-to-synthesize DNA sequences. To test the algorithm, 168 kb of synthetic DNA comprising approximately 20 percent of the synthetic essential genome of the cell-cycle bacterium Caulobacter crescentus was streamlined and then ordered from a commercial supplier of low-cost de novo DNA synthesis. The successful assembly into eight 20 kb segments indicates that Genome Calligrapher algorithm can be efficiently used to refactor difficult-to-synthesize DNA. Genome Calligrapher is broadly applicable to recode biosynthetic pathways, DNA sequences, and whole bacterial genomes, thus offering new opportunities to use synthetic biology tools to explore the functionality of microbial diversity. The Genome Calligrapher web tool can be accessed at https://christenlab.ethz.ch/GenomeCalligrapher .
Translational autocontrol of the Escherichia coli hfq RNA chaperone gene
VEČEREK, BRANISLAV; MOLL, ISABELLA; BLÄSI, UDO
2005-01-01
The conserved bacterial RNA chaperone Hfq has been shown to play an important role in post-transcriptional regulation. Here, we demonstrate that Hfq synthesis is autoregulated at the translational level. We have mapped two Hfq binding sites in the 5′-untranslated region of hfq mRNA and show that Hfq binding inhibits formation of the translation initiation complex. In vitro translation and in vivo studies further revealed that Hfq binding to both sites is required for efficient translational repression of hfq mRNA. PMID:15872186
Mullinix, K P; Wetekam, W; Deeley, R G; Gordon, J I; Meyers, M; Kent, K A; Goldberger, R F
1976-01-01
We have investigated the estrogen-mediated induction of vitellogenin synthesis in rooster liver. We compared the concentrations of vitellogenin messenger RNA (mRNA) in the liver with the concentrations of vitellogenin in the sera of roosters that had recieved various treatments with estrogen. We found no vitellogenin mRNA in the livers of the unstimulated roosters. An initial injection of estrogen was attended by de novo synthesis of vitellogenin mRNA in the liver and accumulation of vitellogenin in the serum. When vitellogenin was no longer present in the serum or liver (the "post-estrogen-serum-negative" state), the liver was found to contain appreciable amounts of vitellogenin mRNA. This mRNA was of the same size as that found in the liver of the rooster actively synthesizing vitellogenin in response to estrogen. Whereas vitellogenin mRNA was in large polysomes in the livers of the roosters actively synthesizing vitellogenin, the vitellogenin mRNA in the liver of the post-estrogen-serum-negative rooster was not associated with polysomes. The possible relevance of these findings to the fact that the rooster responds differently to a primary stimulation with estrogen than to subsequent stimulations is discussed. PMID:1064017
Inkinen, J; Jayaprakash, B; Santo Domingo, J W; Keinänen-Toivola, M M; Ryu, H; Pitkänen, T
2016-06-01
Next-generation sequencing of 16S ribosomal RNA genes (rDNA) and ribosomal RNA (rRNA) was used to characterize water and biofilm microbiome collected from a drinking water distribution system of an office building after its first year of operation. The total bacterial community (rDNA) and active bacterial members (rRNA) sequencing databases were generated by Illumina MiSeq PE250 platform. As estimated by Chao1 index, species richness in cold water system was lower (180-260) in biofilms (Sphingomonas spp., Methylobacterium spp., Limnohabitans spp., Rhizobiales order) than in waters (250-580), (also Methylotenera spp.) (P = 0·005, n = 20). Similarly species richness (Chao1) was slightly higher (210-580) in rDNA libraries compared to rRNA libraries (150-400; P = 0·054, n = 24). Active Mycobacterium spp. was found in cross-linked polyethylene (PEX), but not in corresponding copper pipeline biofilm. Nonpathogenic Legionella spp. was found in rDNA libraries but not in rRNA libraries. Microbial communities differed between water and biofilms, between cold and hot water systems, locations in the building and between water rRNA and rDNA libraries, as shown by clear clusters in principal component analysis (PcoA). By using the rRNA method, we found that not all bacterial community members were active (e.g. Legionella spp.), whereas other members showed increased activity in some locations; for example, Pseudomonas spp. in hot water circulations' biofilm and order Rhizobiales and Limnohabitans spp. in stagnated locations' water and biofilm. rRNA-based methods may be better than rDNA-based methods for evaluating human health implications as rRNA methods can be used to describe the active bacterial fraction. This study indicates that copper as a pipeline material might have an adverse impact on the occurrence of Mycobacterium spp. The activity of Legionella spp. maybe questionable when detected solely by using DNA-based methods. © 2016 The Society for Applied
Chromophore-assisted light inactivation of pKi-67 leads to inhibition of ribosomal RNA synthesis.
Rahmanzadeh, R; Hüttmann, G; Gerdes, J; Scholzen, T
2007-06-01
Expression of the nuclear Ki-67 protein (pKi-67) is strongly associated with cell proliferation. For this reason, antibodies against this protein are widely used as prognostic tools for the assessment of cell proliferation in biopsies from cancer patients. Despite this broad application in histopathology, functional evidence for the physiological role of pKi-67 is still missing. Recently, we proposed a function of pKi-67 in the early steps of ribosomal RNA (rRNA) synthesis. Here, we have examined the involvement of pKi-67 in this process by photochemical inhibition using chromophore-assisted light inactivation (CALI). Anti-pKi-67 antibodies were labelled with the fluorochrome fluorescein 5(6)-isothiocyanate and were irradiated after binding to their target protein. Performing CALI in vitro on cell lysates led to specific cross-linking of pKi-67. Moreover, the upstream binding factor (UBF) necessary for rRNA transcription was also partly subjected to cross-link formation, indicating a close spatial proximity of UBF and pKi-67. CALI in living cells, using micro-injected antibody, caused a striking relocalization of UBF from foci within the nucleoli to spots located at the nucleolar rim or within the nucleoplasm. pKi-67-CALI resulted in dramatic inhibition of RNA polymerase I-dependent nucleolar rRNA synthesis, whereas RNA polymerase II-dependent nucleoplasmic RNA synthesis remained almost unaltered. Our data presented here argue for a crucial role of pKi-67 in RNA polymerase I-dependent nucleolar rRNA synthesis.
Martin, N C; Underbrink-Lyon, K
1981-01-01
We have used a cloned yeast mitochondrial tRNAUCNSer gene as a probe to detect RNA species that are transcripts from this gene in wild-type Saccharomyces cerevisiae and in petite deletion mutants. In RNA from wild-type cells, the tRNA is the most prominent transcript of the gene. In RNA from deletion mutants that retain this gene but have lost other regions of mtDNA, high molecular weight transcripts containing the tRNAUCNSer sequences accumulate but tRNAUCNSer is not made. tRNAUCNSer synthesis can be restored in these mutants when they are mated to other deletion mutants that retain a different portion of the mitochondrial genome. Protein synthesis is not necessary for the restoration, and the restoration is not due to a nuclear effect or to an effect of mating alone, because strains without mtDNA are not able to restore tRNA synthesis. These results definitively demonstrate the existence of a yeast mitochondrial locus that is necessary for tRNA synthesis and, because the restoration of tRNAUCNSer synthesis appears to result from intergenic complementation, not recombination, indicate that this locus acts in trans. Images PMID:6795621
Barry, Kevin C; Ingolia, Nicholas T; Vance, Russell E
2017-01-01
The inducible innate immune response to infection requires a concerted process of gene expression that is regulated at multiple levels. Most global analyses of the innate immune response have focused on transcription induced by defined immunostimulatory ligands, such as lipopolysaccharide. However, the response to pathogens involves additional complexity, as pathogens interfere with virtually every step of gene expression. How cells respond to pathogen-mediated disruption of gene expression to nevertheless initiate protective responses remains unclear. We previously discovered that a pathogen-mediated blockade of host protein synthesis provokes the production of specific pro-inflammatory cytokines. It remains unclear how these cytokines are produced despite the global pathogen-induced block of translation. We addressed this question by using parallel RNAseq and ribosome profiling to characterize the response of macrophages to infection with the intracellular bacterial pathogen Legionella pneumophila. Our results reveal that mRNA superinduction is required for the inducible immune response to a bacterial pathogen. DOI: http://dx.doi.org/10.7554/eLife.22707.001 PMID:28383283
RNA Imaging with Dimeric Broccoli in Live Bacterial and Mammalian Cells
Filonov, Grigory S.
2016-01-01
RNA spatial dynamics play a crucial role in cell physiology and thus the ability to monitor RNA localization in live cells can provide insight into important biological problems. This article focuses on imaging RNAs using an “RNA mimic of GFP”. This approach relies on a RNA aptamer, called dimeric Broccoli, which binds to and switches on the fluorescence of DFHBI, a small molecule mimicking the fluorophore in GFP. Dimeric Broccoli is tagged to heterologously expressed RNAs and upon DFHBI binding the fluorescent signal of dimeric Broccoli reports the transcript’s localization in cells. This protocol describes the process of validating the fluorescence of dimeric Broccoli-labeled transcripts in vitro and in cells, flow cytometry analysis to determine overall fluorescence levels in cells, and fluorescence imaging in bacterial and mammalian cells. Overall, the current protocol should be useful for researchers seeking to image high abundance RNAs, such as transcribed off the T7 promoter in bacteria or off Pol III-dependent promoters in mammalian cells. PMID:26995352
A genetically encoded fluorescent tRNA is active in live-cell protein synthesis
Masuda, Isao; Igarashi, Takao; Sakaguchi, Reiko; Nitharwal, Ram G.; Takase, Ryuichi; Han, Kyu Young; Leslie, Benjamin J.; Liu, Cuiping; Gamper, Howard; Ha, Taekjip; Sanyal, Suparna
2017-01-01
Abstract Transfer RNAs (tRNAs) perform essential tasks for all living cells. They are major components of the ribosomal machinery for protein synthesis and they also serve in non-ribosomal pathways for regulation and signaling metabolism. We describe the development of a genetically encoded fluorescent tRNA fusion with the potential for imaging in live Escherichia coli cells. This tRNA fusion carries a Spinach aptamer that becomes fluorescent upon binding of a cell-permeable and non-toxic fluorophore. We show that, despite having a structural framework significantly larger than any natural tRNA species, this fusion is a viable probe for monitoring tRNA stability in a cellular quality control mechanism that degrades structurally damaged tRNA. Importantly, this fusion is active in E. coli live-cell protein synthesis allowing peptidyl transfer at a rate sufficient to support cell growth, indicating that it is accommodated by translating ribosomes. Imaging analysis shows that this fusion and ribosomes are both excluded from the nucleoid, indicating that the fusion and ribosomes are in the cytosol together possibly engaged in protein synthesis. This fusion methodology has the potential for developing new tools for live-cell imaging of tRNA with the unique advantage of both stoichiometric labeling and broader application to all cells amenable to genetic engineering. PMID:27956502
A new regulatory mechanism for bacterial lipoic acid synthesis
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-01
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID
A new regulatory mechanism for bacterial lipoic acid synthesis.
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-22
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015
Asphalt, water, and the prebiotic synthesis of ribose, ribonucleosides, and RNA.
Benner, Steven A; Kim, Hyo-Joong; Carrigan, Matthew A
2012-12-18
RNA has been called a "prebiotic chemist's nightmare" because of its combination of large size, carbohydrate building blocks, bonds that are thermodynamically unstable in water, and overall intrinsic instability. However, a discontinuous synthesis model is well-supported by experimental work that might produce RNA from atmospheric CO(2), H(2)O, and N(2). For example, electrical discharge in such atmospheres gives formaldehyde (HCHO) in large amounts and glycolaldehyde (HOCH(2)CHO) in small amounts. When rained into alkaline aquifers generated by serpentinizing rocks, these substances were undoubtedly converted to carbohydrates including ribose. Likewise, atmospherically generated HCN was undoubtedly converted in these aquifers to formamide and ammonium formate, precursors for RNA nucleobases. Finally, high reduction potentials maintained by mantle-derived rocks and minerals would allow phosphite to be present in equilibrium with phosphate, mobilizing otherwise insoluble phosphorus for the prebiotic synthesis of phosphite and phosphate esters after oxidation. So why does the community not view this discontinuous synthesis model as compelling evidence for the RNA-first hypothesis for the origin of life? In part, the model is deficient because no experiments have joined together those steps without human intervention. Further, many steps in the model have problems. Some are successful only if reactive compounds are presented in a specific order in large amounts. Failing controlled addition, the result produces complex mixtures that are inauspicious precursors for biology, a situation described as the "asphalt problem". Many bonds in RNA are thermodynamically unstable with respect to hydrolysis in water, creating a "water problem". Finally, some bonds in RNA appear to be "impossible" to form under any conditions considered plausible for early Earth. To get a community-acceptable "RNA first" model for the origin of life, the discontinuous synthesis model must be
The Battle of RNA Synthesis: Virus versus Host.
Harwig, Alex; Landick, Robert; Berkhout, Ben
2017-10-21
Transcription control is the foundation of gene regulation. Whereas a cell is fully equipped for this task, viruses often depend on the host to supply tools for their transcription program. Over the course of evolution and adaptation, viruses have found diverse ways to optimally exploit cellular host processes such as transcription to their own benefit. Just as cells are increasingly understood to employ nascent RNAs in transcription regulation, recent discoveries are revealing how viruses use nascent RNAs to benefit their own gene expression. In this review, we first outline the two different transcription programs used by viruses, i.e., transcription (DNA-dependent) and RNA-dependent RNA synthesis. Subsequently, we use the distinct stages (initiation, elongation, termination) to describe the latest insights into nascent RNA-mediated regulation in the context of each relevant stage.
Xie, Xuping; Zou, Jing; Puttikhunt, Chunya; Yuan, Zhiming; Shi, Pei-Yong
2015-01-15
Flavivirus nonstructural protein 2A (NS2A) plays important roles in both viral RNA synthesis and virion assembly. The molecular details of how the NS2A protein modulates the two distinct events have not been defined. To address this question, we have performed a systematic mutagenesis of NS2A using dengue virus (DENV) serotype 2 (DENV-2) as a model. We identified two sets of NS2A mutations with distinct defects during a viral infection cycle. One set of NS2A mutations (D125A and G200A) selectively abolished viral RNA synthesis. Mechanistically, the D125A mutation abolished viral RNA synthesis through blocking the N-terminal cleavage of the NS2A protein, leading to an unprocessed NS1-NS2A protein; this result suggests that amino acid D125 (far downstream of the N terminus of NS2A) may contribute to the recognition of host protease at the NS1-NS2A junction. The other set of NS2A mutations (G11A, E20A, E100A, Q187A, and K188A) specifically impaired virion assembly without significantly affecting viral RNA synthesis. Remarkably, mutants defective in virion assembly could be rescued by supplying in trans wild-type NS2A molecules expressed from a replicative replicon, by wild-type NS2A protein expressed alone, by a mutant NS2A (G200A) that is lethal for viral RNA synthesis, or by a different mutant NS2A that is defective in virion assembly. In contrast, none of the mutants defective in viral RNA synthesis could be rescued by trans-complementation. Collectively, the results indicate that two distinct sets of NS2A molecules are responsible for DENV RNA synthesis and virion assembly. Dengue virus (DENV) represents the most prevalent mosquito-borne human pathogen. Understanding the replication of DENV is essential for development of vaccines and therapeutics. Here we characterized the function of DENV-2 NS2A using a systematic mutagenesis approach. The mutagenesis results revealed two distinct sets of NS2A mutations: one set of mutations that result in defects in viral RNA
Poliovirus RNA synthesis in vitro: structural elements and antibody inhibition
DOE Office of Scientific and Technical Information (OSTI.GOV)
Semler, B.L.; Hanecak, R.; Dorner, L.F.
1983-01-01
The poliovirus RNA polymerase complex has been analyzed by immunoautoradiography using antibody probes derived from purified replicase (P3) region viral polypeptides. Antibody preparations made against the polio RNA polymerase, P3-4b, detected a previously unreported cellular protein that copurifies with the RNA polymerase. An IgG fraction purified from rabbit antiserum to polypeptide P3-2, a precursor fo the RNA polymerase, specifically inhibits poliovirus RNA synthesis in vitro. The authors have also immunoprecipitated a 60,000-dalton protein (P3-4a) with antiserum to protein P3-4b and have determined the precise genomic map position of this protein by automated Edman degradation. Protein P3-4a originates by cleavage ofmore » the RNA polymerase precursor at a glutamine-glucine amino acid pair not previously reported to be a viral cleavage site.« less
Synthesis of arborane triterpenols by a bacterial oxidosqualene cyclase
NASA Astrophysics Data System (ADS)
Banta, Amy B.; Wei, Jeremy H.; Gill, Clare C. C.; Giner, José-Luis; Welander, Paula V.
2017-01-01
Cyclic triterpenoids are a broad class of polycyclic lipids produced by bacteria and eukaryotes. They are biologically relevant for their roles in cellular physiology, including membrane structure and function, and biochemically relevant for their exquisite enzymatic cyclization mechanism. Cyclic triterpenoids are also geobiologically significant as they are readily preserved in sediments and are used as biomarkers for ancient life throughout Earth's history. Isoarborinol is one such triterpenoid whose only known biological sources are certain angiosperms and whose diagenetic derivatives (arboranes) are often used as indicators of terrestrial input into aquatic environments. However, the occurrence of arborane biomarkers in Permian and Triassic sediments, which predates the accepted origin of angiosperms, suggests that microbial sources of these lipids may also exist. In this study, we identify two isoarborinol-like lipids, eudoraenol and adriaticol, produced by the aerobic marine heterotrophic bacterium Eudoraea adriatica. Phylogenetic analysis demonstrates that the E. adriatica eudoraenol synthase is an oxidosqualene cyclase homologous to bacterial lanosterol synthases and distinct from plant triterpenoid synthases. Using an Escherichia coli heterologous sterol expression system, we demonstrate that substitution of four amino acid residues in a bacterial lanosterol synthase enabled synthesis of pentacyclic arborinols in addition to tetracyclic sterols. This variant provides valuable mechanistic insight into triterpenoid synthesis and reveals diagnostic amino acid residues to differentiate between sterol and arborinol synthases in genomic and metagenomic datasets. Our data suggest that there may be additional bacterial arborinol producers in marine and freshwater environments that could expand our understanding of these geologically informative lipids.
Synthesis of arborane triterpenols by a bacterial oxidosqualene cyclase
Banta, Amy B.; Wei, Jeremy H.; Gill, Clare C. C.; Giner, José-Luis; Welander, Paula V.
2017-01-01
Cyclic triterpenoids are a broad class of polycyclic lipids produced by bacteria and eukaryotes. They are biologically relevant for their roles in cellular physiology, including membrane structure and function, and biochemically relevant for their exquisite enzymatic cyclization mechanism. Cyclic triterpenoids are also geobiologically significant as they are readily preserved in sediments and are used as biomarkers for ancient life throughout Earth's history. Isoarborinol is one such triterpenoid whose only known biological sources are certain angiosperms and whose diagenetic derivatives (arboranes) are often used as indicators of terrestrial input into aquatic environments. However, the occurrence of arborane biomarkers in Permian and Triassic sediments, which predates the accepted origin of angiosperms, suggests that microbial sources of these lipids may also exist. In this study, we identify two isoarborinol-like lipids, eudoraenol and adriaticol, produced by the aerobic marine heterotrophic bacterium Eudoraea adriatica. Phylogenetic analysis demonstrates that the E. adriatica eudoraenol synthase is an oxidosqualene cyclase homologous to bacterial lanosterol synthases and distinct from plant triterpenoid synthases. Using an Escherichia coli heterologous sterol expression system, we demonstrate that substitution of four amino acid residues in a bacterial lanosterol synthase enabled synthesis of pentacyclic arborinols in addition to tetracyclic sterols. This variant provides valuable mechanistic insight into triterpenoid synthesis and reveals diagnostic amino acid residues to differentiate between sterol and arborinol synthases in genomic and metagenomic datasets. Our data suggest that there may be additional bacterial arborinol producers in marine and freshwater environments that could expand our understanding of these geologically informative lipids. PMID:28028245
Tanner, Michael A.; Shoskes, Daniel; Shahed, Asha; Pace, Norman R.
1999-01-01
The etiology of chronic prostatitis syndromes in men is controversial, particularly when positive cultures for established uropathogens are lacking. Although identification of bacteria in prostatic fluid has relied on cultivation and microscopy, most microorganisms in the environment, including some human pathogens, are resistant to cultivation. We report here on an rRNA-based molecular phylogenetic approach to the identification of bacteria in prostate fluid from prostatitis patients. Positive bacterial signals were seen for 65% of patients with chronic prostatitis overall. Seven of 11 patients with bacterial signals but none of 6 patients without bacterial signals were cured with antibiotic-based therapy. Results indicate the occurrence in the prostate fluid of a wide spectrum of bacterial species representing several genera. Most rRNA genes were closely related to those of species belonging to the genera Corynebacterium, Staphylococcus, Peptostreptococcus, Streptococcus, and Escherichia. Unexpectedly, a wide diversity of Corynebacterium species was found in high proportion compared to the proportions of other bacterial species found. A subset of these 16S rRNA sequences represent those of undescribed species on the basis of their positions in phylogenetic trees. These uncharacterized organisms were not detected in control samples, suggesting that the organisms have a role in the disease or are the consequence of the disease. These studies show that microorganisms associated with prostatitis generally occur as complex microbial communities that differ between patients. The results also indicate that microbial communities distinct from those associated with prostatitis may occur at low levels in normal prostatic fluid. PMID:10325338
DECOUPLING OF PROTEIN AND RNA SYNTHESIS DURING DEUTERIUM PARTHENOGENESIS IN SEA URCHIN EGGS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gross, P.R.; Spindel, W.; Cousineau, G.H.
1963-10-29
The parthenogenetic activation of cell division and suppression of nucleic acid synthesis by deuterium in eggs of sea urchins was investigated. D/ sub 2/O treatment was found to evoke a high rate of protein synthesis in the eggs that was maintained for several hours. However, eggs whose protein synthesis was activated and that were making labeled cytasters showed no increment in RNA synthesis over controls. (P.C.H.)
Schostag, Morten; Stibal, Marek; Jacobsen, Carsten S.; ...
2015-04-30
The active layer of soil overlaying permafrost in the Arctic is subjected to dramatic annual changes in temperature and soil chemistry, which likely affect bacterial activity and community structure. We studied seasonal variations in the bacterial community of active layer soil from Svalbard (78°N) by co-extracting DNA and RNA from 12 soil cores collected monthly over a year. PCR amplicons of 16S rRNA genes (DNA) and reverse transcribed transcripts (cDNA) were quantified and sequenced to test for the effect of low winter temperature and seasonal variation in concentration of easily degradable organic matter on the bacterial communities. The copy numbermore » of 16S rRNA genes and transcripts revealed no distinct seasonal changes indicating potential bacterial activity during winter despite soil temperatures well below -10°C. Multivariate statistical analysis of the bacterial diversity data (DNA and cDNA libraries) revealed a season-based clustering of the samples, and, e.g., the relative abundance of potentially active Cyanobacteria peaked in June and Alphaproteobacteria increased over the summer and then declined from October to November. The structure of the bulk (DNA-based) community was significantly correlated with pH and dissolved organic carbon, while the potentially active (RNA-based) community structure was not significantly correlated with any of the measured soil parameters. A large fraction of the 16S rRNA transcripts was assigned to nitrogen-fixing bacteria (up to 24% in June) and phototrophic organisms (up to 48% in June) illustrating the potential importance of nitrogen fixation in otherwise nitrogen poor Arctic ecosystems and of phototrophic bacterial activity on the soil surface.« less
Schostag, Morten; Stibal, Marek; Jacobsen, Carsten S.; Bælum, Jacob; Taş, Neslihan; Elberling, Bo; Jansson, Janet K.; Semenchuk, Philipp; Priemé, Anders
2015-01-01
The active layer of soil overlaying permafrost in the Arctic is subjected to dramatic annual changes in temperature and soil chemistry, which likely affect bacterial activity and community structure. We studied seasonal variations in the bacterial community of active layer soil from Svalbard (78°N) by co-extracting DNA and RNA from 12 soil cores collected monthly over a year. PCR amplicons of 16S rRNA genes (DNA) and reverse transcribed transcripts (cDNA) were quantified and sequenced to test for the effect of low winter temperature and seasonal variation in concentration of easily degradable organic matter on the bacterial communities. The copy number of 16S rRNA genes and transcripts revealed no distinct seasonal changes indicating potential bacterial activity during winter despite soil temperatures well below −10°C. Multivariate statistical analysis of the bacterial diversity data (DNA and cDNA libraries) revealed a season-based clustering of the samples, and, e.g., the relative abundance of potentially active Cyanobacteria peaked in June and Alphaproteobacteria increased over the summer and then declined from October to November. The structure of the bulk (DNA-based) community was significantly correlated with pH and dissolved organic carbon, while the potentially active (RNA-based) community structure was not significantly correlated with any of the measured soil parameters. A large fraction of the 16S rRNA transcripts was assigned to nitrogen-fixing bacteria (up to 24% in June) and phototrophic organisms (up to 48% in June) illustrating the potential importance of nitrogen fixation in otherwise nitrogen poor Arctic ecosystems and of phototrophic bacterial activity on the soil surface. PMID:25983731
O'Malley, Maureen A
2018-06-01
Since the 1940s, microbiologists, biochemists and population geneticists have experimented with the genetic mechanisms of microorganisms in order to investigate evolutionary processes. These evolutionary studies of bacteria and other microorganisms gained some recognition from the standard-bearers of the modern synthesis of evolutionary biology, especially Theodosius Dobzhansky and Ledyard Stebbins. A further period of post-synthesis bacterial evolutionary research occurred between the 1950s and 1980s. These experimental analyses focused on the evolution of population and genetic structure, the adaptive gain of new functions, and the evolutionary consequences of competition dynamics. This large body of research aimed to make evolutionary theory testable and predictive, by giving it mechanistic underpinnings. Although evolutionary microbiologists promoted bacterial experiments as methodologically advantageous and a source of general insight into evolution, they also acknowledged the biological differences of bacteria. My historical overview concludes with reflections on what bacterial evolutionary research achieved in this period, and its implications for the still-developing modern synthesis.
Osman, Toba A. M.; Coutts, Robert H. A.; Buck, Kenneth W.
2006-01-01
Cereal yellow dwarf virus (CYDV) RNA has a 5′-terminal genome-linked protein (VPg). We have expressed the VPg region of the CYDV genome in bacteria and used the purified protein (bVPg) to raise an antiserum which was able to detect free VPg in extracts of CYDV-infected oat plants. A template-dependent RNA-dependent RNA polymerase (RdRp) has been produced from a CYDV membrane-bound RNA polymerase by treatment with BAL 31 nuclease. The RdRp was template specific, being able to utilize templates from CYDV plus- and minus-strand RNAs but not those of three unrelated viruses, Red clover necrotic mosaic virus, Cucumber mosaic virus, and Tobacco mosaic virus. RNA synthesis catalyzed by the RdRp required a 3′-terminal GU sequence and the presence of bVPg. Additionally, synthesis of minus-strand RNA on a plus-strand RNA template required the presence of a putative stem-loop structure near the 3′ terminus of CYDV RNA. The base-paired stem, a single-nucleotide (A) bulge in the stem, and the sequence of a tetraloop were all required for the template activity. Evidence was produced showing that minus-strand synthesis in vitro was initiated by priming by bVPg at the 3′ end of the template. The data are consistent with a model in which the RdRp binds to the stem-loop structure which positions the active site to recognize the 3′-terminal GU sequence for initiation of RNA synthesis by the addition of an A residue to VPg. PMID:16928757
Facile synthesis of cobalt ferrite nanotubes using bacterial nanocellulose as template.
Menchaca-Nal, S; Londoño-Calderón, C L; Cerrutti, P; Foresti, M L; Pampillo, L; Bilovol, V; Candal, R; Martínez-García, R
2016-02-10
A facile method for the preparation of cobalt ferrite nanotubes by use of bacterial cellulose nanoribbons as a template is described. The proposed method relays on a simple coprecipitation operation, which is a technique extensively used for the synthesis of nanoparticles (either isolated or as aggregates) but not for the synthesis of nanotubes. The precursors employed in the synthesis are chlorides, and the procedure is carried out at low temperature (90 °C). By the method proposed a homogeneous distribution of cobalt ferrite nanotubes with an average diameter of 217 nm in the bacterial nanocellulose (BC) aerogel (3%) was obtained. The obtained nanotubes are formed by 26-102 nm cobalt ferrite clusters of cobalt ferrite nanoparticles with diameters in the 9-13 nm interval. The nanoparticles that form the nanotubes showed to have a certain crystalline disorder, which could be attributed in a greater extent to the small crystallite size, and, in a lesser extent, to microstrains existing in the crystalline lattice. The BC-templated-CoFe2O4 nanotubes exhibited magnetic behavior at room temperature. The magnetic properties showed to be influenced by a fraction of nanoparticles in superparamagnetic state. Copyright © 2015 Elsevier Ltd. All rights reserved.
Synthesis of capped RNA using a DMT group as a purification handle.
Veliath, Elizabeth; Gaffney, Barbara L; Jones, Roger A
2014-01-01
We report a new method for synthesis of capped RNA or 2'-OMe RNA that uses a N(2-)4,4'-dimethoxytrityl (DMT) group as a lipophilic purification handle to allow convenient isolation and purification of the capped RNA. The DMT group is easily removed under mild conditions without degradation of the cap. We have used this approach to prepare capped 10- and 20-mers. This method is compatible with the many condensation reactions that have been reported for preparation of capped RNA or cap analogues.
Initiation of translation in bacteria by a structured eukaryotic IRES RNA.
Colussi, Timothy M; Costantino, David A; Zhu, Jianyu; Donohue, John Paul; Korostelev, Andrei A; Jaafar, Zane A; Plank, Terra-Dawn M; Noller, Harry F; Kieft, Jeffrey S
2015-03-05
The central dogma of gene expression (DNA to RNA to protein) is universal, but in different domains of life there are fundamental mechanistic differences within this pathway. For example, the canonical molecular signals used to initiate protein synthesis in bacteria and eukaryotes are mutually exclusive. However, the core structures and conformational dynamics of ribosomes that are responsible for the translation steps that take place after initiation are ancient and conserved across the domains of life. We wanted to explore whether an undiscovered RNA-based signal might be able to use these conserved features, bypassing mechanisms specific to each domain of life, and initiate protein synthesis in both bacteria and eukaryotes. Although structured internal ribosome entry site (IRES) RNAs can manipulate ribosomes to initiate translation in eukaryotic cells, an analogous RNA structure-based mechanism has not been observed in bacteria. Here we report our discovery that a eukaryotic viral IRES can initiate translation in live bacteria. We solved the crystal structure of this IRES bound to a bacterial ribosome to 3.8 Å resolution, revealing that despite differences between bacterial and eukaryotic ribosomes this IRES binds directly to both and occupies the space normally used by transfer RNAs. Initiation in both bacteria and eukaryotes depends on the structure of the IRES RNA, but in bacteria this RNA uses a different mechanism that includes a form of ribosome repositioning after initial recruitment. This IRES RNA bridges billions of years of evolutionary divergence and provides an example of an RNA structure-based translation initiation signal capable of operating in two domains of life.
TIF-IA and Ebp1 regulate RNA synthesis in T cells.
Saudemont, Aurore
2015-04-16
In this issue of Blood, Nguyen et al show that mycophenolic acid (MPA) induces GTP depletion, which inhibits the function of transcription initiation factor I (TIF-IA) and impacts the interaction of TIF-IA with ErbB3-binding protein 1 (Ebp1), a key in regulating proliferating cell nuclear antigen (PCNA) expression and ribosomal RNA (rRNA) synthesis in T cells during activation.
Redundancy of primary RNA-binding functions of the bacterial transcription terminator Rho
Shashni, Rajesh; Qayyum, M. Zuhaib; Vishalini, V.; Dey, Debashish; Sen, Ranjan
2014-01-01
The bacterial transcription terminator, Rho, terminates transcription at half of the operons. According to the classical model derived from in vitro assays on a few terminators, Rho is recruited to the transcription elongation complex (EC) by recognizing specific sites (rut) on the nascent RNA. Here, we explored the mode of in vivo recruitment process of Rho. We show that sequence specific recognition of the rut site, in majority of the Rho-dependent terminators, can be compromised to a great extent without seriously affecting the genome-wide termination function as well as the viability of Escherichia coli. These terminators function optimally only through a NusG-assisted recruitment and activation of Rho. Our data also indicate that at these terminators, Rho-EC-bound NusG interaction facilitates the isomerization of Rho into a translocase-competent form by stabilizing the interactions of mRNA with the secondary RNA binding site, thereby overcoming the defects of the primary RNA binding functions. PMID:25081210
Reconstitution and structure of a bacterial Pnkp1RnlHen1 RNA repair complex
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Pei; Selvadurai, Kiruthika; Huang, Raven H.
Ribotoxins cleave essential RNAs for cell killing, and RNA repair neutralizes the damage inflicted by ribotoxins for cell survival. We report a new bacterial RNA repair complex that performs RNA repair linked to immunity. This new RNA repair complex is a 270-kDa heterohexamer composed of three proteins—Pnkp1, Rnl and Hen1—that are required to repair ribotoxin-cleaved RNA in vitro. The crystal structure of the complex reveals the molecular architecture of the heterohexamer as two rhomboid-shaped ring structures of Pnkp1–Rnl–Hen1 heterotrimer fused at the Pnkp1 dimer interface. The four active sites required for RNA repair are located on the inner rim ofmore » each ring. Furthermore, the architecture and the locations of the active sites of the Pnkp1–Rnl–Hen1 heterohexamer suggest an ordered series of repair reactions at the broken RNA ends that confer immunity to recurrent damage.« less
Solid-Phase Synthesis of RNA Analogs Containing Phosphorodithioate Linkages.
Yang, Xianbin
2017-09-18
The oligoribonucleotide phosphorodithioate (PS2-RNA) modification uses two sulfur atoms to replace two non-bridging oxygen atoms at an internucleotide phosphorodiester backbone linkage. Like a natural phosphodiester RNA backbone linkage, a PS2-modified backbone linkage is achiral at phosphorus. PS2-RNAs are highly stable to nucleases and several in vitro assays have demonstrated their biological activity. For example, PS2-RNAs silenced mRNA in vitro and bound to protein targets in the form of PS2-aptamers (thioaptamers). Thus, the interest in and promise of PS2-RNAs has drawn attention to synthesizing, isolating, and characterizing these compounds. RNA-thiophosphoramidite monomers are commercially available from AM Biotechnologies and this unit describes an effective methodology for solid-phase synthesis, deprotection, and purification of RNAs having PS2 internucleotide linkages. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
Mata Martin, Carmen; Sun, Zhe; Zhou, Yan Ning; Jin, Ding Jun
2018-01-01
In the fast-growing Escherichia coli cells, RNA polymerase (RNAP) molecules are concentrated and form foci at clusters of ribosomal RNA (rRNA) operons resembling eukaryotic nucleolus. The bacterial nucleolus-like organization, spatially compartmentalized at the surface of the compact bacterial chromosome (nucleoid), serves as transcription factories for rRNA synthesis and ribosome biogenesis, which influences the organization of the nucleoid. Unlike wild type that has seven rRNA operons in the genome in a mutant that has six (Δ6 rrn ) rRNA operons deleted in the genome, there are no apparent transcription foci and the nucleoid becomes uncompacted, indicating that formation of RNAP foci requires multiple copies of rRNA operons clustered in space and is critical for nucleoid compaction. It has not been determined, however, whether a multicopy plasmid-borne rRNA operon (p rrnB ) could substitute the multiple chromosomal rRNA operons for the organization of the bacterial nucleolus-like structure in the mutants of Δ6 rrn and Δ7 rrn that has all seven rRNA operons deleted in the genome. We hypothesized that extrachromosomal nucleolus-like structures are similarly organized and functional in trans from p rrnB in these mutants. In this report, using multicolor images of three-dimensional superresolution Structured Illumination Microscopy (3D-SIM), we determined the distributions of both RNAP and NusB that are a transcription factor involved in rRNA synthesis and ribosome biogenesis, p rrnB clustering, and nucleoid structure in these two mutants in response to environmental cues. Our results found that the extrachromosomal nucleolus-like organization tends to be spatially located at the poles of the mutant cells. In addition, formation of RNAP foci at the extrachromosomal nucleolus-like structure condenses the nucleoid, supporting the idea that active transcription at the nucleolus-like organization is a driving force in nucleoid compaction.
Eichler, Stefan; Christen, Richard; Höltje, Claudia; Westphal, Petra; Bötel, Julia; Brettar, Ingrid; Mehling, Arndt; Höfle, Manfred G.
2006-01-01
Bacterial community dynamics of a whole drinking water supply system (DWSS) were studied from source to tap. Raw water for this DWSS is provided by two reservoirs with different water characteristics in the Harz mountains of Northern Germany. Samples were taken after different steps of treatment of raw water (i.e., flocculation, sand filtration, and chlorination) and at different points along the supply system to the tap. RNA and DNA were extracted from the sampled water. The 16S rRNA or its genes were partially amplified by reverse transcription-PCR or PCR and analyzed by single-strand conformation polymorphism community fingerprints. The bacterial community structures of the raw water samples from the two reservoirs were very different, but no major changes of these structures occurred after flocculation and sand filtration. Chlorination of the processed raw water strongly affected bacterial community structure, as reflected by the RNA-based fingerprints. This effect was less pronounced for the DNA-based fingerprints. After chlorination, the bacterial community remained rather constant from the storage containers to the tap. Furthermore, the community structure of the tap water did not change substantially for several months. Community composition was assessed by sequencing of abundant bands and phylogenetic analysis of the sequences obtained. The taxonomic compositions of the bacterial communities from both reservoirs were very different at the species level due to their different limnologies. On the other hand, major taxonomic groups, well known to occur in freshwater, such as Alphaproteobacteria, Betaproteobacteria, and Bacteroidetes, were found in both reservoirs. Significant differences in the detection of the major groups were observed between DNA-based and RNA-based fingerprints irrespective of the reservoir. Chlorination of the drinking water seemed to promote growth of nitrifying bacteria. Detailed analysis of the community dynamics of the whole DWSS
Symbiont-mediated RNA interference in insects
Whitten, Miranda M. A.; Facey, Paul D.; Del Sol, Ricardo; Fernández-Martínez, Lorena T.; Evans, Meirwyn C.; Mitchell, Jacob J.; Bodger, Owen G.
2016-01-01
RNA interference (RNAi) methods for insects are often limited by problems with double-stranded (ds) RNA delivery, which restricts reverse genetics studies and the development of RNAi-based biocides. We therefore delegated to insect symbiotic bacteria the task of: (i) constitutive dsRNA synthesis and (ii) trauma-free delivery. RNaseIII-deficient, dsRNA-expressing bacterial strains were created from the symbionts of two very diverse pest species: a long-lived blood-sucking bug, Rhodnius prolixus, and a short-lived globally invasive polyphagous agricultural pest, western flower thrips (Frankliniella occidentalis). When ingested, the manipulated bacteria colonized the insects, successfully competed with the wild-type microflora, and sustainably mediated systemic knockdown phenotypes that were horizontally transmissible. This represents a significant advance in the ability to deliver RNAi, potentially to a large range of non-model insects. PMID:26911963
Synthesis of eukaryotic lipid biomarkers in the bacterial domain
NASA Astrophysics Data System (ADS)
Welander, P. V.; Banta, A. B.; Lee, A. K.; Wei, J. H.
2017-12-01
Lipid biomarkers are organic molecules preserved in sediments and sedimentary rocks that can function as geological proxies for certain microbial taxa or for specific environmental conditions. These molecular fossils provide a link between organisms and their environments in both modern and ancient settings and have afforded significant insight into ancient climatic events, mass extinctions, and various evolutionary transitions throughout Earth's history. However, the proper interpretation of lipid biomarkers is dependent on a broad understanding of their diagenetic precursors in modern systems. This includes understanding the taphonomic transformations that these molecules undergo, their biosynthetic pathways, and the ecological conditions that affect their cellular production. In this study, we focus on one group of lipid biomarkers - the sterols. These are polycyclic isoprenoidal lipids that have a high preservation potential and play a critical role in the physiology of most eukaryotes. However, the synthesis and function of these lipids in the bacterial domain has not been fully explored. Here we utilize a combination of bioinformatics, microbial genetics, and biochemistry to demonstrate that bacterial sterol producers are more prevalent in environmental metagenomic samples than in the genomic databases of cultured organisms and to identify novel proteins required to synthesize and modify sterols in bacteria. These proteins represent a distinct pathway for sterol synthesis exclusive to bacteria and indicate that sterol synthesis in bacteria may have evolved independently of eukaryotic sterol biosynthesis. Taken together, these results demonstrate how studies in extant bacteria can provide insight into the biological sources and the biosynthetic pathways of specific lipid biomarkers and in turn may allow for more robust interpretation of biomarker signatures.
MXD1 localizes in the nucleolus, binds UBF and impairs rRNA synthesis.
Lafita-Navarro, Maria Del Carmen; Blanco, Rosa; Mata-Garrido, Jorge; Liaño-Pons, Judit; Tapia, Olga; García-Gutiérrez, Lucía; García-Alegría, Eva; Berciano, María T; Lafarga, Miguel; León, Javier
2016-10-25
MXD1 is a protein that interacts with MAX, to form a repressive transcription factor. MXD1-MAX binds E-boxes. MXD1-MAX antagonizes the transcriptional activity of the MYC oncoprotein in most models. It has been reported that MYC overexpression leads to augmented RNA synthesis and ribosome biogenesis, which is a relevant activity in MYC-mediated tumorigenesis. Here we describe that MXD1, but not MYC or MNT, localizes to the nucleolus in a wide array of cell lines derived from different tissues (carcinoma, leukemia) as well as in embryonic stem cells. MXD1 also localizes in the nucleolus of primary tissue cells as neurons and Sertoli cells. The nucleolar localization of MXD1 was confirmed by co-localization with UBF. Co-immunoprecipitation experiments showed that MXD1 interacted with UBF and proximity ligase assays revealed that this interaction takes place in the nucleolus. Furthermore, chromatin immunoprecipitation assays showed that MXD1 was bound in the transcribed rDNA chromatin, where it co-localizes with UBF, but also in the ribosomal intergenic regions. The MXD1 involvement in rRNA synthesis was also suggested by the nucleolar segregation upon rRNA synthesis inhibition by actinomycin D. Silencing of MXD1 with siRNAs resulted in increased synthesis of pre-rRNA while enforced MXD1 expression reduces it. The results suggest a new role for MXD1, which is the control of ribosome biogenesis. This new MXD1 function would be important to curb MYC activity in tumor cells.
MXD1 localizes in the nucleolus, binds UBF and impairs rRNA synthesis
Lafita-Navarro, Maria del Carmen; Blanco, Rosa; Mata-Garrido, Jorge; Liaño-Pons, Judit; Tapia, Olga; García-Gutiérrez, Lucía; García-Alegría, Eva; Berciano, María T.; Lafarga, Miguel; León, Javier
2016-01-01
MXD1 is a protein that interacts with MAX, to form a repressive transcription factor. MXD1-MAX binds E-boxes. MXD1-MAX antagonizes the transcriptional activity of the MYC oncoprotein in most models. It has been reported that MYC overexpression leads to augmented RNA synthesis and ribosome biogenesis, which is a relevant activity in MYC-mediated tumorigenesis. Here we describe that MXD1, but not MYC or MNT, localizes to the nucleolus in a wide array of cell lines derived from different tissues (carcinoma, leukemia) as well as in embryonic stem cells. MXD1 also localizes in the nucleolus of primary tissue cells as neurons and Sertoli cells. The nucleolar localization of MXD1 was confirmed by co-localization with UBF. Co-immunoprecipitation experiments showed that MXD1 interacted with UBF and proximity ligase assays revealed that this interaction takes place in the nucleolus. Furthermore, chromatin immunoprecipitation assays showed that MXD1 was bound in the transcribed rDNA chromatin, where it co-localizes with UBF, but also in the ribosomal intergenic regions. The MXD1 involvement in rRNA synthesis was also suggested by the nucleolar segregation upon rRNA synthesis inhibition by actinomycin D. Silencing of MXD1 with siRNAs resulted in increased synthesis of pre-rRNA while enforced MXD1 expression reduces it. The results suggest a new role for MXD1, which is the control of ribosome biogenesis. This new MXD1 function would be important to curb MYC activity in tumor cells. PMID:27588501
RNA synthesis is modulated by G-quadruplex formation in Hepatitis C virus negative RNA strand.
Chloé, Jaubert; Amina, Bedrat; Laura, Bartolucci; Carmelo, Di Primo; Michel, Ventura; Jean-Louis, Mergny; Samir, Amrane; Marie-Line, Andreola
2018-05-25
DNA and RNA guanine-rich oligonucleotides can form non-canonical structures called G-quadruplexes or "G4" that are based on the stacking of G-quartets. The role of DNA and RNA G4 is documented in eukaryotic cells and in pathogens such as viruses. Yet, G4 have been identified only in a few RNA viruses, including the Flaviviridae family. In this study, we analysed the last 157 nucleotides at the 3'end of the HCV (-) strand. This sequence is known to be the minimal sequence required for an efficient RNA replication. Using bioinformatics and biophysics, we identified a highly conserved G4-prone sequence located in the stem-loop IIy' of the negative strand. We also showed that the formation of this G-quadruplex inhibits the in vitro RNA synthesis by the RdRp. Furthermore, Phen-DC3, a specific G-quadruplex binder, is able to inhibit HCV viral replication in cells in conditions where no cytotoxicity was measured. Considering that this domain of the negative RNA strand is well conserved among HCV genotypes, G4 ligands could be of interest for new antiviral therapies.
Gaal, T; Gourse, R L
1990-01-01
rRNA synthesis in Escherichia coli is subject to at least two regulation systems, growth rate-dependent control and stringent control. The inverse correlation between rRNA synthesis rates and guanosine 3'-diphosphate 5'-diphosphate (ppGpp) levels under various physiological conditions has led to the supposition that ppGpp is the mediator of both control mechanisms by inhibiting transcription from rrn P1 promoters. Recently, relA- spoT- strains have been constructed in which both ppGpp synthesis pathways most likely have been removed (M. Cashel, personal communication). We have confirmed that such strains produce no detectable ppGpp and therefore offer a direct means for testing the involvement of ppGpp in the regulation of rRNA synthesis in vivo. Stringent control was determined by measurement of rRNA synthesis after amino acid starvation, while growth rate control was determined by measurement of rRNA synthesis under different nutritional conditions. As expected, the relA- spoT- strain is relaxed for stringent control. However, growth rate-dependent regulation is unimpaired. These results indicate that growth rate regulation can occur in the absence of ppGpp and imply that ppGpp is not the mediator, or at least is not the sole mediator, of growth rate-dependent control. Therefore, growth rate-dependent control and stringent control may utilize different mechanisms for regulating stable RNA synthesis. PMID:2196571
Khulordava, Irakli; Miller, Geraldine; Haas, David; Li, Haijing; McKinsey, Joel; Vanderende, Daniel; Tang, Yi-Wei
2003-05-01
We report two cases of culture-negative bacterial endocarditis in which the organisms were identified by amplification and sequencing of the bacterial 16S rRNA gene. These results support an important role for polymerase chain reaction followed by direct sequencing to determine the etiology of culture-negative bacterial endocarditis and to guide appropriate antimicrobial therapy.
Riboregulation of the bacterial actin-homolog MreB by DsrA small noncoding RNA.
Cayrol, Bastien; Fortas, Emilie; Martret, Claire; Cech, Grzegorz; Kloska, Anna; Caulet, Stephane; Barbet, Marion; Trépout, Sylvain; Marco, Sergio; Taghbalout, Aziz; Busi, Florent; Wegrzyn, Grzegorz; Arluison, Véronique
2015-01-01
The bacterial actin-homolog MreB is a key player in bacterial cell-wall biosynthesis and is required for the maintenance of the rod-like morphology of Escherichia coli. However, how MreB cellular levels are adjusted to growth conditions is poorly understood. Here, we show that DsrA, an E. coli small noncoding RNA (sRNA), is involved in the post-transcriptional regulation of mreB. DsrA is required for the downregulation of MreB cellular concentration during environmentally induced slow growth-rates, mainly growth at low temperature and during the stationary phase. DsrA interacts in an Hfq-dependent manner with the 5' region of mreB mRNA, which contains signals for translation initiation and thereby affects mreB translation and stability. Moreover, as DsrA is also involved in the regulation of two transcriptional regulators, σ(S) and the nucleoid associated protein H-NS, which negatively regulate mreB transcription, it also indirectly contributes to mreB transcriptional down-regulation. By using quantitative analyses, our results evidence the complexity of this regulation and the tangled interplay between transcriptional and post-transcriptional control. As transcription factors and sRNA-mediated post-transcriptional regulators use different timescales, we propose that the sRNA pathway helps to adapt to changes in temperature, but also indirectly mediates long-term regulation of MreB concentration. The tight regulation and fine-tuning of mreB gene expression in response to cellular stresses is discussed in regard to the effect of the MreB protein on cell elongation.
The "Speedy" Synthesis of Atom-Specific (15)N Imino/Amido-Labeled RNA.
Neuner, Sandro; Santner, Tobias; Kreutz, Christoph; Micura, Ronald
2015-08-10
Although numerous reports on the synthesis of atom-specific (15)N-labeled nucleosides exist, fast and facile access to the corresponding phosphoramidites for RNA solid-phase synthesis is still lacking. This situation represents a severe bottleneck for NMR spectroscopic investigations on functional RNAs. Here, we present optimized procedures to speed up the synthesis of (15)N(1) adenosine and (15)N(1) guanosine amidites, which are the much needed counterparts of the more straightforward-to-achieve (15)N(3) uridine and (15)N(3) cytidine amidites in order to tap full potential of (1)H/(15)N/(15)N-COSY experiments for directly monitoring individual Watson-Crick base pairs in RNA. Demonstrated for two preQ1 riboswitch systems, we exemplify a versatile concept for individual base-pair labeling in the analysis of conformationally flexible RNAs when competing structures and conformational dynamics are encountered. © 2015 WILEY‐VCH Verlag GmbH & Co. KGaA, Weinheim.
Nagata, Tetsuji
2012-01-01
For the purpose of studying the aging changes of macromolecular synthesis in the pancreatic acinar cells of experimental animals, we studied 10 groups of aging mice during development and aging from fetal day 19 to postnatal month 24. They were injected with 3H-uridine, a precursor for RNA synthesis, sacrificed and the pancreatic tissues were taken out, fixed and processed for light and electron microscopic radioautography. On many radioautograms the localization of silver grains demonstrating RNA synthesis in pancreatic acinar cells in respective aging groups were analyzed qualitatively. The number of mitochondria per cell, the number of labeled mitochondria with silver grains and the number of silver grains in each cell in respective aging groups were analyzed quantitatively in relation to the aging of animals. The results revealed that the RNA synthetic activity as expressed by the incorporations of RNA precursor, i.e., the number of silver grains in cell nuclei, cell organelles, changed due to the aging of animals. The number of mitochondria, the number of labeled mitochondria and the mitochondrial labeling index labeled with silver grains were counted in each pancreatic acinar cell. It was demonstrated that the number of mitochondria, the number of labeled mitochondria and the labeling indices showing RNA synthesis at various ages increased from embryonic day 19 to postnatal newborn day 1, 3, 9, 14, adult month 1, 2 and 6, reaching the maxima, then decreased to senile stage at postnatal year 1 to 2, indicating the aging changes. Based upon our findings, available literature on macromolecular synthesis in mitochondria of various cells are reviewed.
Redundancy of primary RNA-binding functions of the bacterial transcription terminator Rho.
Shashni, Rajesh; Qayyum, M Zuhaib; Vishalini, V; Dey, Debashish; Sen, Ranjan
2014-09-01
The bacterial transcription terminator, Rho, terminates transcription at half of the operons. According to the classical model derived from in vitro assays on a few terminators, Rho is recruited to the transcription elongation complex (EC) by recognizing specific sites (rut) on the nascent RNA. Here, we explored the mode of in vivo recruitment process of Rho. We show that sequence specific recognition of the rut site, in majority of the Rho-dependent terminators, can be compromised to a great extent without seriously affecting the genome-wide termination function as well as the viability of Escherichia coli. These terminators function optimally only through a NusG-assisted recruitment and activation of Rho. Our data also indicate that at these terminators, Rho-EC-bound NusG interaction facilitates the isomerization of Rho into a translocase-competent form by stabilizing the interactions of mRNA with the secondary RNA binding site, thereby overcoming the defects of the primary RNA binding functions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Miscoding-induced stalling of substrate translocation on the bacterial ribosome.
Alejo, Jose L; Blanchard, Scott C
2017-10-10
Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.
Miscoding-induced stalling of substrate translocation on the bacterial ribosome
Alejo, Jose L.; Blanchard, Scott C.
2017-01-01
Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G–catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors. PMID:28973849
Mohr, Sabine; Ghanem, Eman; Smith, Whitney; Sheeter, Dennis; Qin, Yidan; King, Olga; Polioudakis, Damon; Iyer, Vishwanath R; Hunicke-Smith, Scott; Swamy, Sajani; Kuersten, Scott; Lambowitz, Alan M
2013-07-01
Mobile group II introns encode reverse transcriptases (RTs) that function in intron mobility ("retrohoming") by a process that requires reverse transcription of a highly structured, 2-2.5-kb intron RNA with high processivity and fidelity. Although the latter properties are potentially useful for applications in cDNA synthesis and next-generation RNA sequencing (RNA-seq), group II intron RTs have been difficult to purify free of the intron RNA, and their utility as research tools has not been investigated systematically. Here, we developed general methods for the high-level expression and purification of group II intron-encoded RTs as fusion proteins with a rigidly linked, noncleavable solubility tag, and we applied them to group II intron RTs from bacterial thermophiles. We thus obtained thermostable group II intron RT fusion proteins that have higher processivity, fidelity, and thermostability than retroviral RTs, synthesize cDNAs at temperatures up to 81°C, and have significant advantages for qRT-PCR, capillary electrophoresis for RNA-structure mapping, and next-generation RNA sequencing. Further, we find that group II intron RTs differ from the retroviral enzymes in template switching with minimal base-pairing to the 3' ends of new RNA templates, making it possible to efficiently and seamlessly link adaptors containing PCR-primer binding sites to cDNA ends without an RNA ligase step. This novel template-switching activity enables facile and less biased cloning of nonpolyadenylated RNAs, such as miRNAs or protein-bound RNA fragments. Our findings demonstrate novel biochemical activities and inherent advantages of group II intron RTs for research, biotechnological, and diagnostic methods, with potentially wide applications.
Sacher, Joseph A.; Salminen, Seppo O.
1969-01-01
The effects of ethylene on permeability and RNA and protein synthesis were assayed over a 6 to 26 hr period in tissue sections from avocado (Persea gratissima Gaertn. F., var. Fuerte), both pulp and peel of banana (Musa sapientum L., var. Gros Michel), bean endocarp (Phaseolus vulgaris L., var. Kentucky Wonder Pole beans) and leaves of Rhoeo discolor. Ethylene had no effect on permeability in 4 of the 5 tissues, but sometimes enhanced solute uptake in banana peel; it had either no effect or an inhibitory effect on synthesis of RNA and protein in sections from fruits of avocado and banana. Auxin (α-naphthalene acetic acid) stimulated synthesis of RNA and protein in bean endocarp and Rhoeo leaf sections, whereas ethylene inhibited both basal and auxin-induced synthesis. It is concluded that in these tissues the auxin effect is not an ethylene effect. PMID:16657212
Insights into RNA synthesis, capping, and proofreading mechanisms of SARS-coronavirus.
Sevajol, Marion; Subissi, Lorenzo; Decroly, Etienne; Canard, Bruno; Imbert, Isabelle
2014-12-19
The successive emergence of highly pathogenic coronaviruses (CoVs) such as the Severe Acute Respiratory Syndrome (SARS-CoV) in 2003 and the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) in 2012 has stimulated a number of studies on the molecular biology. This research has provided significant new insight into functions and activities of the replication/transcription multi-protein complex. The latter directs both continuous and discontinuous RNA synthesis to replicate and transcribe the large coronavirus genome made of a single-stranded, positive-sense RNA of ∼30 kb. In this review, we summarize our current understanding of SARS-CoV enzymes involved in RNA biochemistry, such as the in vitro characterization of a highly active and processive RNA polymerase complex which can associate with methyltransferase and 3'-5' exoribonuclease activities involved in RNA capping, and RNA proofreading, respectively. The recent discoveries reveal fascinating RNA-synthesizing machinery, highlighting the unique position of coronaviruses in the RNA virus world. Copyright © 2014 Elsevier B.V. All rights reserved.
Cerca, Nuno; Martins, Silvia; Cerca, Filipe; Jefferson, Kimberly K; Pier, Gerald B; Oliveira, Rosário; Azeredo, Joana
2005-08-01
To quantitatively compare the antibiotic susceptibility of biofilms formed by the coagulase-negative staphylococci (CoNS) Staphylococcus epidermidis and Staphylococcus haemolyticus with the susceptibility of planktonic cultures. Several CoNS strains were grown planktonically or as biofilms to determine the effect of the mode of growth on the level of susceptibility to antibiotics with different mechanisms of action. The utility of a new, rapid colorimetric method that is based on the reduction of a tetrazolium salt (XTT) to measure cell viability was tested by comparison with standard bacterial enumeration techniques. A 6 h kinetic study was performed using dicloxacillin, cefazolin, vancomycin, tetracycline and rifampicin at the peak serum concentration of each antibiotic. In planktonic cells, inhibitors of cell wall synthesis were highly effective over a 3 h period. Biofilms were much less susceptible than planktonic cultures to all antibiotics tested, particularly inhibitors of cell wall synthesis. The susceptibility to inhibitors of protein and RNA synthesis was affected by the biofilm phenotype to a lesser degree. Standard bacterial enumeration techniques and the XTT method produced equivalent results both in biofilms and planktonic assays. This study provides a more accurate comparison between the antibiotic susceptibilities of planktonic versus biofilm populations, because the cell densities in the two populations were similar and because we measured the concentration required to inhibit bacterial metabolism rather than to eradicate the entire bacterial population. While the biofilm phenotype is highly resistant to antibiotics that target cell wall synthesis, it is fairly susceptible to antibiotics that target RNA and protein synthesis.
Cerca, Nuno; Martins, Silvia; Cerca, Filipe; Jefferson, Kimberly K.; Pier, Gerald B.; Oliveira, Rosário; Azeredo, Joana
2005-01-01
Objectives To quantitatively compare the antibiotic susceptibility of biofilms formed by the coagulase-negative staphylococci (CoNS) Staphylococcus epidermidis and Staphylococcus haemolyticus with the susceptibility of planktonic cultures. Methods Several CoNS strains were grown planktonically or as biofilms to determine the effect of the mode of growth on the level of susceptibility to antibiotics with different mechanisms of action. The utility of a new, rapid colorimetric method that is based on the reduction of a tetrazolium salt (XTT) to measure cell viability was tested by comparison with standard bacterial enumeration techniques. A 6 h kinetic study was performed using dicloxacillin, cefazolin, vancomycin, tetracycline and rifampicin at the peak serum concentration of each antibiotic. Results In planktonic cells, inhibitors of cell wall synthesis were highly effective over a 3 h period. Biofilms were much less susceptible than planktonic cultures to all antibiotics tested, particularly inhibitors of cell wall synthesis. The susceptibility to inhibitors of protein and RNA synthesis was affected by the biofilm phenotype to a lesser degree. Standard bacterial enumeration techniques and the XTT method produced equivalent results both in biofilms and planktonic assays. Conclusions This study provides a more accurate comparison between the antibiotic susceptibilities of planktonic versus biofilm populations, because the cell densities in the two populations were similar and because we measured the concentration required to inhibit bacterial metabolism rather than to eradicate the entire bacterial population. While the biofilm phenotype is highly resistant to antibiotics that target cell wall synthesis, it is fairly susceptible to antibiotics that target RNA and protein synthesis. PMID:15980094
The “Speedy” Synthesis of Atom-Specific 15N Imino/Amido-Labeled RNA
Kreutz, Christoph; Micura, Ronald
2016-01-01
Although numerous reports on the synthesis of atom-specific 15N-labeled nucleosides exist, fast and facile access to the corresponding phosphoramidites for RNA solid-phase synthesis is still lacking. This situation represents a severe bottleneck for NMR spectroscopic investigations on functional RNAs. Here, we present optimized procedures to speed up the synthesis of 15N(1) adenosine and 15N(1) guanosine amidites, which are the much needed counterparts of the more straightforward-to-achieve 15N(3) uridine and 15N(3) cytidine amidites in order to tap full potential of 1H/15N/15N-COSY experiments for directly monitoring individual Watson–Crick base pairs in RNA. Demonstrated for two preQ1 riboswitch systems, we exemplify a versatile concept for individual base-pair labeling in the analysis of conformationally flexible RNAs when competing structures and conformational dynamics are encountered. PMID:26237536
Reiness, G; Yang, H L; Zubay, G; Cashel, M
1975-01-01
A cell-free system derived from E. coli is described in which mature-sized 16S and 23S ribosomal RNAs (rRNA) are synthesized at a high relative rate, comprising 17-25% of the total transcription. The addition of guanosine tetraphosphate (ppGpp) to this system results in up to a 5-fold selective inhibition of rRNA accumulation. This effect is exerted at the level of synthesis rather than degradation. It is concluded that ppGpp, which is produced in large amounts by E. coli during amino-acid deprivation, could mediate the decrease in rRNA synthesis that accompanies such deprivation. The expression of other genes has also been investigated. No selective reduction of transfer RNA synthesis by ppGpp is observed. The trp and lac operons are found to be stimulated at the transcriptional level by the presence of this nucleotide. It is hypothesized that ppGpp interacts with the RNA polymerase in such a manner as to alter the affinity of the enzyme for promoters in an operon-specific fashion. PMID:1103124
Donovan, Jesse; Rath, Sneha; Kolet-Mandrikov, David; Korennykh, Alexei
2017-11-01
Mammalian cells respond to double-stranded RNA (dsRNA) by activating a translation-inhibiting endoribonuclease, RNase L. Consensus in the field indicates that RNase L arrests protein synthesis by degrading ribosomal RNAs (rRNAs) and messenger RNAs (mRNAs). However, here we provide evidence for a different and far more efficient mechanism. By sequencing abundant RNA fragments generated by RNase L in human cells, we identify site-specific cleavage of two groups of noncoding RNAs: Y-RNAs, whose function is poorly understood, and cytosolic tRNAs, which are essential for translation. Quantitative analysis of human RNA cleavage versus nascent protein synthesis in lung carcinoma cells shows that RNase L stops global translation when tRNAs, as well as rRNAs and mRNAs, are still intact. Therefore, RNase L does not have to degrade the translation machinery to stop protein synthesis. Our data point to a rapid mechanism that transforms a subtle RNA cleavage into a cell-wide translation arrest. © 2017 Donovan et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Jayaprakash, K N; Peng, Chang Geng; Butler, David; Varghese, Jos P; Maier, Martin A; Rajeev, Kallanthottathil G; Manoharan, Muthiah
2010-12-03
Novel non-nucleoside alkyne monomers compatible with oligonucleotide synthesis were designed, synthesized, and efficiently incorporated into RNA and RNA analogues during solid-phase synthesis. These modifications allowed site-specific conjugation of ligands to the RNA oligonucleotides through copper-assisted (CuAAC) and copper-free strain-promoted azide-alkyne cycloaddition (SPAAC) reactions. The SPAAC click reactions of cyclooctyne-oligonucleotides with various classes of azido-functionalized ligands in solution phase and on solid phase were efficient and quantitative and occurred under mild reaction conditions. The SPAAC reaction provides a method for the synthesis of oligonucleotide-ligand conjugates uncontaminated with copper ions.
Using DGGE and 16S rRNA gene sequence analysis to evaluate changes in oral bacterial composition.
Chen, Zhou; Trivedi, Harsh M; Chhun, Nok; Barnes, Virginia M; Saxena, Deepak; Xu, Tao; Li, Yihong
2011-01-01
To investigate whether a standard dental prophylaxis followed by tooth brushing with an antibacterial dentifrice will affect the oral bacterial community, as determined by denaturing gradient gel electrophoresis (DGGE) combined with 16S rRNA gene sequence analysis. Twenty-four healthy adults were instructed to brush their teeth using commercial dentifrice for 1 week during a washout period. An initial set of pooled supragingival plaque samples was collected from each participant at baseline (0 h) before prophylaxis treatment. The subjects were given a clinical examination and dental prophylaxis and asked to brush for 1 min with a dentifrice containing 0.3% triclosan, 2.0% PVM/MA copolymer and 0.243% sodium fluoride (Colgate Total). On the following day, a second set of pooled supragingival plaque samples (24 h) was collected. Total bacterial genomic DNA was isolated from the samples. Differences in the microbial composition before and after the prophylactic procedure and tooth brushing were assessed by comparing the DGGE profiles and 16S rRNA gene segments sequence analysis. Two distinct clusters of DGGE profiles were found, suggesting that a shift in the microbial composition had occurred 24 h after the prophylaxis and brushing. A detailed sequencing analysis of 16S rRNA gene segments further identified 6 phyla and 29 genera, including known and unknown bacterial species. Importantly, an increase in bacterial diversity was observed after 24 h, including members of the Streptococcaceae family, Prevotella, Corynebacterium, TM7 and other commensal bacteria. The results suggest that the use of a standard prophylaxis followed by the use of the dentifrice containing 0.3% triclosan, 2.0% PVM/MA copolymer and 0.243% sodium fluoride may promote a healthier composition within the oral bacterial community.
The parable of the caveman and the Ferrari: protein synthesis and the RNA world
Noller, Harry F.
2017-01-01
The basic steps of protein synthesis are carried out by the ribosome, a very large and complex ribonucleoprotein particle. In keeping with its proposed emergence from an RNA world, all three of its core mechanisms—aminoacyl-tRNA selection, catalysis of peptide bond formation and coupled translocation of mRNA and tRNA—are embodied in the properties of ribosomal RNA, while its proteins play a supportive role. This article is part of the themed issue ‘Perspectives on the ribosome’. PMID:28138073
Liu, Xiuju; Huang, Henry; Wilkinson, Scott C.; Zhong, Diansheng; Khuri, Fadlo R.; Fu, Haian; Marcus, Adam; He, Yulong; Zhou, Wei
2016-01-01
We analyzed the mechanism underlying 5-aminoimidazole-4-carboxamide riboside (AICAR) mediated apoptosis in LKB1-null non-small cell lung cancer (NSCLC) cells. Metabolic profile analysis revealed depletion of the intracellular pyrimidine pool after AICAR treatment, but uridine was the only nucleotide precursor capable of rescuing this apoptosis, suggesting the involvement of RNA metabolism. Because half of RNA transcription in cancer is for pre-ribosomal RNA (rRNA) synthesis, which is suppressed by over 90% after AICAR treatment, we evaluated the role of TIF-IA-mediated rRNA synthesis. While the depletion of TIF-IA by RNAi alone promoted apoptosis in LKB1-null cells, the overexpression of a wild-type or a S636A TIF-IA mutant, but not a S636D mutant, attenuated AICAR-induced apoptosis. In LKB1-null H157 cells, pre-rRNA synthesis was not suppressed by AICAR when wild-type LKB1 was present, and cellular fractionation analysis indicated that TIF-IA quickly accumulated in the nucleus in the presence of a wild-type LKB1 but not a kinase-dead mutant. Furthermore, ectopic expression of LKB1 was capable of attenuating AICAR-induced death in AMPK-null cells. Because LKB1 promotes cell survival by modulating TIF-IA-mediated pre-rRNA synthesis, this discovery suggested that targeted depletion of uridine related metabolites may be exploited in the clinic to eliminate LKB1-null cancer cells. PMID:26506235
Liu, Fakeng; Jin, Rui; Liu, Xiuju; Huang, Henry; Wilkinson, Scott C; Zhong, Diansheng; Khuri, Fadlo R; Fu, Haian; Marcus, Adam; He, Yulong; Zhou, Wei
2016-01-19
We analyzed the mechanism underlying 5-aminoimidazole-4-carboxamide riboside (AICAR) mediated apoptosis in LKB1-null non-small cell lung cancer (NSCLC) cells. Metabolic profile analysis revealed depletion of the intracellular pyrimidine pool after AICAR treatment, but uridine was the only nucleotide precursor capable of rescuing this apoptosis, suggesting the involvement of RNA metabolism. Because half of RNA transcription in cancer is for pre-ribosomal RNA (rRNA) synthesis, which is suppressed by over 90% after AICAR treatment, we evaluated the role of TIF-IA-mediated rRNA synthesis. While the depletion of TIF-IA by RNAi alone promoted apoptosis in LKB1-null cells, the overexpression of a wild-type or a S636A TIF-IA mutant, but not a S636D mutant, attenuated AICAR-induced apoptosis. In LKB1-null H157 cells, pre-rRNA synthesis was not suppressed by AICAR when wild-type LKB1 was present, and cellular fractionation analysis indicated that TIF-IA quickly accumulated in the nucleus in the presence of a wild-type LKB1 but not a kinase-dead mutant. Furthermore, ectopic expression of LKB1 was capable of attenuating AICAR-induced death in AMPK-null cells. Because LKB1 promotes cell survival by modulating TIF-IA-mediated pre-rRNA synthesis, this discovery suggested that targeted depletion of uridine related metabolites may be exploited in the clinic to eliminate LKB1-null cancer cells.
Novel Bacterial Proteins and Lipids Reveal the Diversity of Triterpenoid Biomarker Synthesis
NASA Astrophysics Data System (ADS)
Wei, J. H.; Banta, A. B.; Gill, C. C. C.; Giner, J. L.; Welander, P. V.
2017-12-01
Lipids preserved in sediments and rocks function as organic biomarkers providing evidence for the types of organisms that lived in ancient environments. We use a combined approach utilizing comparative genomics, molecular biology, and lipid analysis to discover novel cyclic triteprenoid lipids and their biosynthetic pathways in bacteria. Here, we present two cases of bacterial synthesis of pentacylic triterpenols previously thought to be indicative of eukaryotes, which address current incongruities in the fossil record. Cyclic triterpenoid lipids, such as hopanoids and sterols, are generally associated with bacteria and eukaryotes, respectively. The pentacyclic triterpenoid tetrahymanol, first discovered in the ciliate Tetrahymena pyriformis, and its diagenetic product gammacerane, have been previously interpreted as markers for eukaryotes and linked to water column stratification. Yet the occurrence of tetrahymanol in bacteria implies our knowledge of extant tetrahymanol producers is not complete. Through comparative genomics we identified a new gene required for tetrahymanol synthesis in the bacterium Methylomicrobium alcaliphilum. This gene encodes a novel enzyme, Tetrahymanol synthase (THS), that synthesizes tetrahymanol from the hopanoid diploptene demonstrating a pathway for tetrahymanol production in bacteria distinct from that in eukaryotes. We bionformatically identified THS homologs in 104 bacterial genomes and 472 metagenomes, implying a great diversity of tetrahymanol producers. Lipids of the arborane class, such as iso-arborinol, are commonly found in modern angiosperms. Arobranes are synthesized by the enzyme oxidosqualene cyclase (OSC), which in plants can form both tetra and pentacyclic molecules. While bacteria are known to produce tetracyclic sterol compounds, bacterial synthesis of pentacyclic arborane class triterpenols of this class were previously undiscovered. We have identified a bacterium, Eudoraea adriatica, whose OSC synthesizes
Davis, William G; Blackwell, Jerry L; Shi, Pei-Yong; Brinton, Margo A
2007-09-01
RNase footprinting and nitrocellulose filter binding assays were previously used to map one major and two minor binding sites for the cell protein eEF1A on the 3'(+) stem-loop (SL) RNA of West Nile virus (WNV) (3). Base substitutions in the major eEF1A binding site or adjacent areas of the 3'(+) SL were engineered into a WNV infectious clone. Mutations that decreased, as well as ones that increased, eEF1A binding in in vitro assays had a negative effect on viral growth. None of these mutations affected the efficiency of translation of the viral polyprotein from the genomic RNA, but all of the mutations that decreased in vitro eEF1A binding to the 3' SL RNA also decreased viral minus-strand RNA synthesis in transfected cells. Also, a mutation that increased the efficiency of eEF1A binding to the 3' SL RNA increased minus-strand RNA synthesis in transfected cells, which resulted in decreased synthesis of genomic RNA. These results strongly suggest that the interaction between eEF1A and the WNV 3' SL facilitates viral minus-strand synthesis. eEF1A colocalized with viral replication complexes (RC) in infected cells and antibody to eEF1A coimmunoprecipitated viral RC proteins, suggesting that eEF1A facilitates an interaction between the 3' end of the genome and the RC. eEF1A bound with similar efficiencies to the 3'-terminal SL RNAs of four divergent flaviviruses, including a tick-borne flavivirus, and colocalized with dengue virus RC in infected cells. These results suggest that eEF1A plays a similar role in RNA replication for all flaviviruses.
The mechanism of montmorillonite catalysis in RNA synthesis
NASA Astrophysics Data System (ADS)
Joshi, Prakash
The formation of complex prebiotic molecules on the early Earth is likely to have involved a component of mineral catalysis. Amongst the variety of clay minerals that have been investigated by us for their ability to catalyze the formation of RNA oligomers is montmorillonite. These are 2:1 layer silicates that have a wide range of chemical compositions [(Na,Ca)0.33(Al,Fe,Mg)2(Si,Al)4O10(OH)2.nH2O]. They are commonly produced by the weathering of silicic volcanic ashes to form Bentonite. Once formed, montmorillonites gradually transform to Illites at a modest pressure and temperature. Of the many samples of montmorillonite that we have experimentally examined, a selected subset has been observed to be catalytic for RNA synthesis (Joshi et. al., 2009; Aldersley et al., 2011). Those that have been observed to be excellent catalysts come from a restricted range of elemental compositions. The recent identification of phyllosilicates including montmorillonite on Mars (Bishop et al., 2008) raises the possibility that such processes may have taken place there too. The extent of catalysis depended not only upon the magnitude of the negative charge on the montmorillonite lattice and the number of cations associated with it, but also on the pH at which the reaction is promoted. The isotherm and catalysis studies were extended to provide binding information and catalytic outcomes over a wide pH range. When cations in raw montmorillonite are completely replaced by sodium ions, the resulting Na+-montmorillonite does not catalyze oligomer formation because the ions saturate the interlayer between the platelets of montmorillonite, which blocks the binding of the activated monomers. Acid washed montmorillonite titrated to pH 6-8 with alkali metal ions, serves as the model catalyst for this RNA synthesis (Aldersley et. al., 2011). The optimal binding occurred in the region of maximal oligomer formation. X-ray diffraction studies revealed changes in layer separations of
Maciąg-Dorszyńska, Monika; Węgrzyn, Grzegorz; Guzow-Krzemińska, Beata
2014-04-01
Usnic acid, a compound produced by various lichen species, has been demonstrated previously to inhibit growth of different bacteria and fungi; however, mechanism of its antimicrobial activity remained unknown. In this report, we demonstrate that usnic acid causes rapid and strong inhibition of RNA and DNA synthesis in Gram-positive bacteria, represented by Bacillus subtilis and Staphylococcus aureus, while it does not inhibit production of macromolecules (DNA, RNA, and proteins) in Escherichia coli, which is resistant to even high doses of this compound. However, we also observed slight inhibition of RNA synthesis in a Gram-negative bacterium, Vibrio harveyi. Inhibition of protein synthesis in B. subtilis and S. aureus was delayed, which suggest indirect action (possibly through impairment of transcription) of usnic acid on translation. Interestingly, DNA synthesis was halted rapidly in B. subtilis and S. aureus, suggesting interference of usnic acid with elongation of DNA replication. We propose that inhibition of RNA synthesis may be a general mechanism of antibacterial action of usnic acid, with additional direct mechanisms, such as impairment of DNA replication in B. subtilis and S. aureus. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Synthesis and RNA polymerase incorporation of the degenerate ribonucleotide analogue rPTP.
Moriyama, K; Negishi, K; Briggs, M S; Smith, C L; Hill, F; Churcher, M J; Brown, D M; Loakes, D
1998-01-01
The synthesis and enzymatic incorporation into RNA of the hydrogen bond degenerate nucleoside analogue 6-(beta-d-ribofuranosyl)-3, 4-dihydro-8H-pyrimido[4,5-c]-[1,2]oxazin-7-one (P) is described. The 5'-triphosphate of this analogue is readily incorporated by T3, T7 and SP6 RNA polymerases into RNA transcripts, being best incorporated in place of UTP, but also in place of CTP. When all the uridine residues in an HIV-1 TAR RNA transcript are replaced by P the transcript has similar characteristics to the wild-type TAR RNA, as demonstrated by similar melting temperatures and CD spectra. The P-substituted TAR transcript binds to the Tat peptide ADP-1 with only 4-fold lowered efficiency compared with wild-type TAR. PMID:9547267
Synthesis and RNA polymerase incorporation of the degenerate ribonucleotide analogue rPTP.
Moriyama, K; Negishi, K; Briggs, M S; Smith, C L; Hill, F; Churcher, M J; Brown, D M; Loakes, D
1998-05-01
The synthesis and enzymatic incorporation into RNA of the hydrogen bond degenerate nucleoside analogue 6-(beta-d-ribofuranosyl)-3, 4-dihydro-8H-pyrimido[4,5-c]-[1,2]oxazin-7-one (P) is described. The 5'-triphosphate of this analogue is readily incorporated by T3, T7 and SP6 RNA polymerases into RNA transcripts, being best incorporated in place of UTP, but also in place of CTP. When all the uridine residues in an HIV-1 TAR RNA transcript are replaced by P the transcript has similar characteristics to the wild-type TAR RNA, as demonstrated by similar melting temperatures and CD spectra. The P-substituted TAR transcript binds to the Tat peptide ADP-1 with only 4-fold lowered efficiency compared with wild-type TAR.
Smith, Richard W; Ottema, Colin
2006-03-01
Rapidly growing African catfish yolk sac larvae were investigated during the first 22 h after hatching. Body compartment protein concentration increased fourfold yet oxygen consumption remained constant (mean=21.3 +/- 3.2 nmol O2 mg(-1) protein h(-1)), suggesting fast growth results mainly from yolk sac protein absorption. The protein synthesis rates at 1-2 and 5-6 h also equaled the highest conceivable rates of muscle protein synthesis; 11.6-11.9% and 7.4-7.9% day(-1), respectively. Therefore the corresponding energetic costs of protein synthesis were almost the theoretical minimum; 13.0 +/- 1.7-16.3 +/- 2.8 micromol O2 mg(-1) protein synthesised. Total protein synthesis expenditure (74.5-77.7 micromol O2 g(-1) protein h(-1)) was also less than other yolk sac larvae. These protein synthesis rates resulted from high RNA concentrations (113.2 +/- 3.4 microg RNA mg(-1) protein) and were also correlated with RNA translational efficiency. High translational efficiency (1 h; 1.2+/-0.1 mg protein synthesised microg(-1) RNA day(-1)) equaled high synthesis rate (36.8 +/- 5.4 microg RNA microg(-1) DNA day(-1)) and both declined over 22 h. This investigation suggests rapid growth combines growth efficiency and compensatory energy partitioning. This accommodates the ontogenetic and phylogenetic standpoints imposed by energy budget limitations.
Multilevel Regulation of Bacterial Gene Expression with the Combined STAR and Antisense RNA System.
Lee, Young Je; Kim, Soo-Jung; Moon, Tae Seok
2018-03-16
Synthetic small RNA regulators have emerged as a versatile tool to predictably control bacterial gene expression. Owing to their simple design principles, small size, and highly orthogonal behavior, these engineered genetic parts have been incorporated into genetic circuits. However, efforts to achieve more sophisticated cellular functions using RNA regulators have been hindered by our limited ability to integrate different RNA regulators into complex circuits. Here, we present a combined RNA regulatory system in Escherichia coli that uses small transcription activating RNA (STAR) and antisense RNA (asRNA) to activate or deactivate target gene expression in a programmable manner. Specifically, we demonstrated that the activated target output by the STAR system can be deactivated by expressing two different types of asRNAs: one binds to and sequesters the STAR regulator, affecting the transcription process, while the other binds to the target mRNA, affecting the translation process. We improved deactivation efficiencies (up to 96%) by optimizing each type of asRNA and then integrating the two optimized asRNAs into a single circuit. Furthermore, we demonstrated that the combined STAR and asRNA system can control gene expression in a reversible way and can regulate expression of a gene in the genome. Lastly, we constructed and simultaneously tested two A AND NOT B logic gates in the same cell to show sophisticated multigene regulation by the combined system. Our approach establishes a methodology for integrating multiple RNA regulators to rationally control multiple genes.
Glutamyl-gamma-boronate inhibitors of bacterial Glu-tRNA(Gln) amidotransferase.
Decicco, C P; Nelson, D J; Luo, Y; Shen, L; Horiuchi, K Y; Amsler, K M; Foster, L A; Spitz, S M; Merrill, J J; Sizemore, C F; Rogers, K C; Copeland, R A; Harpel, M R
2001-09-17
Analogues of glutamyl-gamma-boronate (1) were synthesized as mechanism-based inhibitors of bacterial Glu-tRNA(Gln) amidotransferase (Glu-AdT) and were designed to engage a putative catalytic serine nucleophile required for the glutaminase activity of the enzyme. Although 1 provides potent enzyme inhibition, structure-activity studies revealed a narrow range of tolerated chemical changes that maintained activity. Nonetheless, growth inhibition of organisms that require Glu-AdT by the most potent enzyme inhibitors appears to validate mechanism-based inhibitor design of Glu-AdT as an approach to antimicrobial development.
Čavužić, Mirela; Liu, Yuchen
2017-01-01
Post-translational tRNA modifications have very broad diversity and are present in all domains of life. They are important for proper tRNA functions. In this review, we emphasize the recent advances on the biosynthesis of sulfur-containing tRNA nucleosides including the 2-thiouridine (s2U) derivatives, 4-thiouridine (s4U), 2-thiocytidine (s2C), and 2-methylthioadenosine (ms2A). Their biosynthetic pathways have two major types depending on the requirement of iron–sulfur (Fe–S) clusters. In all cases, the first step in bacteria and eukaryotes is to activate the sulfur atom of free l-cysteine by cysteine desulfurases, generating a persulfide (R-S-SH) group. In some archaea, a cysteine desulfurase is missing. The following steps of the bacterial s2U and s4U formation are Fe–S cluster independent, and the activated sulfur is transferred by persulfide-carrier proteins. By contrast, the biosynthesis of bacterial s2C and ms2A require Fe–S cluster dependent enzymes. A recent study shows that the archaeal s4U synthetase (ThiI) and the eukaryotic cytosolic 2-thiouridine synthetase (Ncs6) are Fe–S enzymes; this expands the role of Fe–S enzymes in tRNA thiolation to the Archaea and Eukarya domains. The detailed reaction mechanisms of Fe–S cluster depend s2U and s4U formation await further investigations. PMID:28287455
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stern, D.F.; Sefton, B.M.
Infection of cells with the avian coronavirus infectious bronchitis virus results in the synthesis of five major subgenomic RNAs. These RNAs and the viral genome form a 3' coterminal nested set. We found that the rates of inactivation of synthesis of the RNAs by UV light were different and increased with the length of the transcript. These results show that each RNA is transcribed from a unique promoter and that extensive processing of the primary transcripts probably does not occur.
16S rRNA beacons for bacterial monitoring during human space missions.
Larios-Sanz, Maia; Kourentzi, Katerina D; Warmflash, David; Jones, Jeffrey; Pierson, Duane L; Willson, Richard C; Fox, George E
2007-04-01
Microorganisms are unavoidable in space environments and their presence has, at times, been a source of problems. Concerns about disease during human space missions are particularly important considering the significant changes the immune system incurs during spaceflight and the history of microbial contamination aboard the Mir space station. Additionally, these contaminants may have adverse effects on instrumentation and life-support systems. A sensitive, highly specific system to detect, characterize, and monitor these microbial populations is essential. Herein we describe a monitoring approach that uses 16S rRNA targeted molecular beacons to successfully detect several specific bacterial groupings. This methodology will greatly simplify in-flight monitoring by minimizing sample handling and processing. We also address and provide solutions to target accessibility problems encountered in hybridizations that target 16S rRNA.
Donini, Pierluigi
1970-01-01
Starvation for a required amino acid of normal or RCstrEscherichia coli infected with T-even phages arrests further synthesis of phage deoxyribonucleic acid (DNA). This amino acid control over phage DNA synthesis does not occur in RCrelE. coli mutants. Heat inactivation of a temperature-sensitive aminoacyl-transfer ribonucleic acid (RNA) synthetase similarly causes an arrest of phage DNA synthesis in infected cells of RCstr phenotype but not in cells of RCrel phenotype. Inhibition of phage DNA synthesis in amino acid-starved RCstr host cells can be reversed by addition of chloramphenicol to the culture. Thus, the general features of amino acid control over T-even phage DNA synthesis are entirely analogous to those known for amino acid control over net RNA synthesis of uninfected bacteria. This analogy shows that the bacterial rel locus controls a wider range of macromolecular syntheses than had been previously thought. PMID:4914067
NASA Technical Reports Server (NTRS)
Hughes-Fulford, M.; Gilbertson, V.
1999-01-01
The well-defined osteoblast line, MC3T3-E1 was used to examine fibronectin (FN) mRNA levels, protein synthesis, and extracellular FN matrix accumulation after growth activation in spaceflight. These osteoblasts produce FN extracellular matrix (ECM) known to regulate adhesion, differentiation, and function in adherent cells. Changes in bone ECM and osteoblast cell shape occur in spaceflight. To determine whether altered FN matrix is a factor in causing these changes in spaceflight, quiescent osteoblasts were launched into microgravity and were then sera activated with and without a 1-gravity field. Synthesis of FN mRNA, protein, and matrix were measured after activation in microgravity. FN mRNA synthesis is significantly reduced in microgravity (0-G) when compared to ground (GR) osteoblasts flown in a centrifuge simulating earth's gravity (1-G) field 2.5 h after activation. However, 27.5 h after activation there were no significant differences in mRNA synthesis. A small but significant reduction of FN protein was found in the 0-G samples 2.5 h after activation. Total FN protein 27.5 h after activation showed no significant difference between any of the gravity conditions, however, there was a fourfold increase in absolute amount of protein synthesized during the incubation. Using immunofluorescence, we found no significant differences in the amount or in the orientation of the FN matrix after 27.5 h in microgravity. These results demonstrate that FN is made by sera-activated osteoblasts even during exposure to microgravity. These data also suggest that after a total period of 43 h of spaceflight FN transcription, translation, or altered matrix assembly is not responsible for the altered cell shape or altered matrix formation of osteoblasts.
A dual switch controls bacterial enhancer-dependent transcription
Wiesler, Simone C.; Burrows, Patricia C.; Buck, Martin
2012-01-01
Bacterial RNA polymerases (RNAPs) are targets for antibiotics. Myxopyronin binds to the RNAP switch regions to block structural rearrangements needed for formation of open promoter complexes. Bacterial RNAPs containing the major variant σ54 factor are activated by enhancer-binding proteins (bEBPs) and transcribe genes whose products are needed in pathogenicity and stress responses. We show that (i) enhancer-dependent RNAPs help Escherichia coli to survive in the presence of myxopyronin, (ii) enhancer-dependent RNAPs partially resist inhibition by myxopyronin and (iii) ATP hydrolysis catalysed by bEBPs is obligatory for functional interaction of the RNAP switch regions with the transcription start site. We demonstrate that enhancer-dependent promoters contain two barriers to full DNA opening, allowing tight regulation of transcription initiation. bEBPs engage in a dual switch to (i) allow propagation of nucleated DNA melting from an upstream DNA fork junction and (ii) complete the formation of the transcription bubble and downstream DNA fork junction at the RNA synthesis start site, resulting in switch region-dependent RNAP clamp closure and open promoter complex formation. PMID:22965125
Bacterial persistence by RNA endonucleases
Maisonneuve, Etienne; Shakespeare, Lana J.; Jørgensen, Mikkel Girke; Gerdes, Kenn
2011-01-01
Bacteria form persisters, individual cells that are highly tolerant to different types of antibiotics. Persister cells are genetically identical to nontolerant kin but have entered a dormant state in which they are recalcitrant to the killing activity of the antibiotics. The molecular mechanisms underlying bacterial persistence are unknown. Here, we show that the ubiquitous Lon (Long Form Filament) protease and mRNA endonucleases (mRNases) encoded by toxin-antitoxin (TA) loci are required for persistence in Escherichia coli. Successive deletion of the 10 mRNase-encoding TA loci of E. coli progressively reduced the level of persisters, showing that persistence is a phenotype common to TA loci. In all cases tested, the antitoxins, which control the activities of the mRNases, are Lon substrates. Consistently, cells lacking lon generated a highly reduced level of persisters. Moreover, Lon overproduction dramatically increased the levels of persisters in wild-type cells but not in cells lacking the 10 mRNases. These results support a simple model according to which mRNases encoded by TA loci are activated in a small fraction of growing cells by Lon-mediated degradation of the antitoxins. Activation of the mRNases, in turn, inhibits global cellular translation, and thereby induces dormancy and persistence. Many pathogenic bacteria known to enter dormant states have a plethora of TA genes. Therefore, in the future, the discoveries described here may lead to a mechanistic understanding of the persistence phenomenon in pathogenic bacteria. PMID:21788497
NASA Astrophysics Data System (ADS)
Vukanti, R. V.; Mintz, E. M.; Leff, L. G.
2005-05-01
Bacterial responses to environmental signals are multifactorial and are coupled to changes in gene expression. An understanding of bacterial responses to environmental conditions is possible using microarray expression analysis. In this study, the utility of microarrays for examining changes in gene expression in Escherichia coli under different environmental conditions was assessed. RNA was isolated, hybridized to Affymetrix E. coli Genome 2.0 chips and analyzed using Affymetrix GCOS and Genespring software. Major limiting factors were obtaining enough quality RNA (107-108 cells to get 10μg RNA)and accounting for differences in growth rates under different conditions. Stabilization of RNA prior to isolation and taking extreme precautions while handling RNA were crucial. In addition, use of this method in ecological studies is limited by availability and cost of commercial arrays; choice of primers for cDNA synthesis, reproducibility, complexity of results generated and need to validate findings. This method may be more widely applicable with the development of better approaches for RNA recovery from environmental samples and increased number of available strain-specific arrays. Diligent experimental design and verification of results with real-time PCR or northern blots is needed. Overall, there is a great potential for use of this technology to discover mechanisms underlying organisms' responses to environmental conditions.
Jiang, Xuexia; Jiao, Nianzhi
2016-09-01
Bacteria play an important role in the marine biogeochemical cycles. However, research on the bacterial community structure of the Indian Ocean is scarce, particularly within the vertical dimension. In this study, we investigated the bacterial diversity of the pelagic, mesopelagic and bathypelagic zones of the southwestern Indian Ocean (50.46°E, 37.71°S). The clone libraries constructed by 16S rRNA gene sequence revealed that most phylotypes retrieved from the Indian Ocean were highly divergent from those retrieved from other oceans. Vertical differences were observed based on the analysis of natural bacterial community populations derived from the 16S rRNA gene sequences. Based on the analysis of the nasA gene sequences from GenBank database, a pair of general primers was developed and used to amplify the bacterial nitrate-assimilating populations. Environmental factors play an important role in mediating the bacterial communities in the Indian Ocean revealed by canonical correlation analysis.
Reid-Bayliss, Kate S; Loeb, Lawrence A
2017-08-29
Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.
Filone, Claire Marie; Hodges, Erin N.; Honeyman, Brian; Bushkin, G. Guy; Boyd, Karla; Platt, Andrew; Ni, Feng; Strom, Kyle; Hensley, Lisa; Snyder, John K.; Connor, John H.
2013-01-01
There are no approved therapeutics for the most deadly nonsegmented negative-strand (NNS) RNA viruses, including Ebola (EBOV). To identify new chemical scaffolds for development of broad-spectrum antivirals, we undertook a prototype-based lead identification screen. Using the prototype NNS virus, vesicular stomatitis virus (VSV), multiple inhibitory compounds were identified. Three compounds were investigated for broad-spectrum activity, and inhibited EBOV infection. The most potent, CMLDBU3402, was selected for further study. CMLDBU3402 did not show significant activity against segmented negative-strand RNA viruses suggesting proscribed broad-spectrum activity. Mechanistic analysis indicated that CMLDBU3402 blocked VSV viral RNA synthesis and inhibited EBOV RNA transcription, demonstrating a consistent mechanism of action against genetically distinct viruses. The identification of this chemical backbone as a broad-spectrum inhibitor of viral RNA synthesis offers significant potential for the development of new therapies for highly pathogenic viruses. PMID:23521799
DNA polymerase-α regulates type I interferon activation through cytosolic RNA:DNA synthesis
Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J.; Xing, Chao; Wang, Richard C.; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K.; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R.; Burstein, Ezra
2016-01-01
Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations disrupting nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts expression of POLA1, the gene encoding the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency results in increased type I interferon production. This enzyme is necessary for RNA:DNA primer synthesis during DNA replication and strikingly, POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Altogether, this work identified POLA1 as a critical regulator of the type I interferon response. PMID:27019227
Randrianjatovo-Gbalou, Irina; Rosario, Sandrine; Sismeiro, Odile; Varet, Hugo; Legendre, Rachel; Coppée, Jean-Yves; Huteau, Valérie; Pochet, Sylvie; Delarue, Marc
2018-05-21
Nucleic acid aptamers, especially RNA, exhibit valuable advantages compared to protein therapeutics in terms of size, affinity and specificity. However, the synthesis of libraries of large random RNAs is still difficult and expensive. The engineering of polymerases able to directly generate these libraries has the potential to replace the chemical synthesis approach. Here, we start with a DNA polymerase that already displays a significant template-free nucleotidyltransferase activity, human DNA polymerase theta, and we mutate it based on the knowledge of its three-dimensional structure as well as previous mutational studies on members of the same polA family. One mutant exhibited a high tolerance towards ribonucleotides (NTPs) and displayed an efficient ribonucleotidyltransferase activity that resulted in the assembly of long RNA polymers. HPLC analysis and RNA sequencing of the products were used to quantify the incorporation of the four NTPs as a function of initial NTP concentrations and established the randomness of each generated nucleic acid sequence. The same mutant revealed a propensity to accept other modified nucleotides and to extend them in long fragments. Hence, this mutant can deliver random natural and modified RNA polymers libraries ready to use for SELEX, with custom lengths and balanced or unbalanced ratios.
Grula, Marjori A.; Buller, Patricia L.; Weaver, Robert F.
1981-01-01
[3H]RNA was synthesized in nuclei isolated at various times postinfection from the fat bodies of Heliothis zea larvae infected with H. zea nuclear polyhedrosis virus and from cultured Spodoptera frugiperda cells infected with Autographa californica nuclear polyhedrosis virus. To detect virus-specific RNA synthesis, the [3H]RNA was hybridized to denatured viral DNA immobilized on nitrocellulose filters. Nuclear polyhedrosis virus-specific RNA synthesis in the infected nuclei isolated from H. zea larval fat bodies and S. frugiperda cells was only inhibited 20 to 25% by concentrations of α-amanitin sufficient to inhibit the host RNA polymerase II. In addition, a productive nuclear polyhedrosis virus infection was obtained in S. frugiperda cells grown in the presence of an α-amanitin concentration that inhibited 90% of the cellular RNA polymerase II activity. The cellular RNA polymerase II enzyme remained sensitive to α-amanitin during infection, and there was no evidence that a virus-coded, α-amanitin-resistant enzyme was synthesized after the onset of infection. The data suggest that the bulk of nuclear polyhedrosis virus-specific RNA synthesis in isolated nuclei is transcribed by an enzyme other than the host RNA polymerase II. PMID:16789208
Global Patterns of Bacterial Beta-Diversity in Seafloor and Seawater Ecosystems
Zinger, Lucie; Amaral-Zettler, Linda A.; Fuhrman, Jed A.; Horner-Devine, M. Claire; Huse, Susan M.; Welch, David B. Mark; Martiny, Jennifer B. H.; Sogin, Mitchell; Boetius, Antje; Ramette, Alban
2011-01-01
Background Marine microbial communities have been essential contributors to global biomass, nutrient cycling, and biodiversity since the early history of Earth, but so far their community distribution patterns remain unknown in most marine ecosystems. Methodology/Principal Findings The synthesis of 9.6 million bacterial V6-rRNA amplicons for 509 samples that span the global ocean's surface to the deep-sea floor shows that pelagic and benthic communities greatly differ, at all taxonomic levels, and share <10% bacterial types defined at 3% sequence similarity level. Surface and deep water, coastal and open ocean, and anoxic and oxic ecosystems host distinct communities that reflect productivity, land influences and other environmental constraints such as oxygen availability. The high variability of bacterial community composition specific to vent and coastal ecosystems reflects the heterogeneity and dynamic nature of these habitats. Both pelagic and benthic bacterial community distributions correlate with surface water productivity, reflecting the coupling between both realms by particle export. Also, differences in physical mixing may play a fundamental role in the distribution patterns of marine bacteria, as benthic communities showed a higher dissimilarity with increasing distance than pelagic communities. Conclusions/Significance This first synthesis of global bacterial distribution across different ecosystems of the World's oceans shows remarkable horizontal and vertical large-scale patterns in bacterial communities. This opens interesting perspectives for the definition of biogeographical biomes for bacteria of ocean waters and the seabed. PMID:21931760
Initiation of viral RNA-dependent RNA polymerization.
van Dijk, Alberdina A; Makeyev, Eugene V; Bamford, Dennis H
2004-05-01
This review summarizes the combined insights from recent structural and functional studies of viral RNA-dependent RNA polymerases (RdRPs) with the primary focus on the mechanisms of initiation of RNA synthesis. Replication of RNA viruses has traditionally been approached using a combination of biochemical and genetic methods. Recently, high-resolution structures of six viral RdRPs have been determined. For three RdRPs, enzyme complexes with metal ions, single-stranded RNA and/or nucleoside triphosphates have also been solved. These advances have expanded our understanding of the molecular mechanisms of viral RNA synthesis and facilitated further RdRP studies by informed site-directed mutagenesis. What transpires is that the basic polymerase right hand shape provides the correct geometrical arrangement of substrate molecules and metal ions at the active site for the nucleotidyl transfer catalysis, while distinct structural elements have evolved in the different systems to ensure efficient initiation of RNA synthesis. These elements feed the template, NTPs and ions into the catalytic cavity, correctly position the template 3' terminus, transfer the products out of the catalytic site and orchestrate the transition from initiation to elongation.
Circular RNA (circRNA) was an important bridge in the switch from the RNA world to the DNA world.
Soslau, Gerald
2018-06-14
osmolarity. Circular RNA, circRNA, is proposed as a critical stable RNA molecule that served as the genetic precursor for the switch to DNA and the replication of circRNA by a rolling circle mechanism gave rise to the RNA complexity required for the genetic functions of the cell. The replicating ribocyte would have required protein synthesis as well as RNA replication and a model for non-coded and primordial coded protein synthesis is proposed. Finally, the switch from the RNA to the DNA world would have involved the synthesis of an RNA:DNA hybrid prior to the formation of dsDNA. If the hybrid was a circular molecule that ultimately yielded a circular dsDNA molecule, it could predict that the primordial DNA cell would evolve into a bacterial cell with a single circular chromosome. One would hope that continued speculation of the origin of life will spur new directions of research that may never fully answer the questions of the past but add to our ability to regulate potentially harmful biological events in the present and in the future. Copyright © 2018 Elsevier Ltd. All rights reserved.
AKAP3 synthesis is mediated by RNA binding proteins and PKA signaling during mouse spermiogenesis.
Xu, Kaibiao; Yang, Lele; Zhao, Danyun; Wu, Yaoyao; Qi, Huayu
2014-06-01
Mammalian spermatogenesis is regulated by coordinated gene expression in a spatiotemporal manner. The spatiotemporal regulation of major sperm proteins plays important roles during normal development of the male gamete, of which the underlying molecular mechanisms are poorly understood. A-kinase anchoring protein 3 (AKAP3) is one of the major components of the fibrous sheath of the sperm tail that is formed during spermiogenesis. In the present study, we analyzed the expression of sperm-specific Akap3 and the potential regulatory factors of its protein synthesis during mouse spermiogenesis. Results showed that the transcription of Akap3 precedes its protein synthesis by about 2 wk. Nascent AKAP3 was found to form protein complex with PKA and RNA binding proteins (RBPs), including PIWIL1, PABPC1, and NONO, as revealed by coimmunoprecipitation and protein mass spectrometry. RNA electrophoretic gel mobility shift assay showed that these RBPs bind sperm-specific mRNAs, of which proteins are synthesized during the elongating stage of spermiogenesis. Biochemical and cell biological experiments demonstrated that PIWIL1, PABPC1, and NONO interact with each other and colocalize in spermatids' RNA granule, the chromatoid body. In addition, NONO was found in extracytoplasmic granules in round spermatids, whereas PIWIL1 and PABPC1 were diffusely localized in cytoplasm of elongating spermatids, indicating their participation at different steps of mRNA metabolism during spermatogenesis. Interestingly, type I PKA subunits colocalize with PIWIL1 and PABPC1 in the cytoplasm of elongating spermatids and cosediment with the RBPs in polysomal fractions on sucrose gradients. Further biochemical analyses revealed that activation of PKA positively regulates AKAP3 protein synthesis without changing its mRNA level in elongating spermatids. Taken together, these results indicate that PKA signaling directly participates in the regulation of protein translation in postmeiotic male germ cells
Courtney, S C; Scherbik, S V; Stockman, B M; Brinton, M A
2012-04-01
West Nile virus (WNV) recently became endemic in the United States and is a significant cause of human morbidity and mortality. Natural WNV strain infections do not induce stress granules (SGs), while W956IC (a lineage 2/1 chimeric WNV infectious clone) virus infections produce high levels of early viral RNA and efficiently induce SGs through protein kinase R (PKR) activation. Additional WNV chimeric viruses made by replacing one or more W956IC genes with the lineage 1 Eg101 equivalent in the W956IC backbone were analyzed. The Eg-NS4b+5, Eg-NS1+3+4a, and Eg-NS1+4b+5 chimeras produced low levels of viral RNA at early times of infection and inefficiently induced SGs, suggesting the possibility that interactions between viral nonstructural proteins and/or between viral nonstructural proteins and cell proteins are involved in suppressing early viral RNA synthesis and membrane remodeling during natural WNV strain infections. Detection of exposed viral double-stranded RNA (dsRNA) in W956IC-infected cells suggested that the enhanced early viral RNA synthesis surpassed the available virus-induced membrane protection and allowed viral dsRNA to activate PKR.
Synthesis, base pairing and structure studies of geranylated RNA.
Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia
2016-07-27
Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNA(Glu) UUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon-anticodon interaction during ribosome binding. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Martínez-Montero, Saúl; Deleavey, Glen F; Kulkarni, Anupriya; Martín-Pintado, Nerea; Lindovska, Petra; Thomson, Michael; González, Carlos; Götte, Matthias; Damha, Masad J
2014-06-20
We report on the synthesis and conformational properties of 2'-deoxy-2',4'-difluorouridine (2',4'-diF-rU) and cytidine (2',4'-diF-rC) nucleosides. NMR analysis and quantum mechanical calculations show that the strong stereoelectronic effects induced by the two fluorines essentially "lock" the conformation of the sugar in the North region of the pseudorotational cycle. Our studies also demonstrate that NS5B HCV RNA polymerase was able to accommodate 2',4'-diF-rU 5'-triphosphate (2',4'-diF-rUTP) and to link the monophosphate to the RNA primer strand. 2',4'-diF-rUTP inhibited RNA synthesis in dinucleotide-primed reactions, although with relatively high half-maximal inhibitory concentrations (IC50 > 50 μM). 2',4'-diF-rU/C represents rare examples of "locked" ribonucleoside mimics that lack a bicyclic ring structure.
Takizawa, Naoki; Kimura, Tomoyuki; Watanabe, Takumi; Shibasaki, Masakatsu
2018-06-01
Influenza virus infection is a major threat to global health. Although vaccines and anti-influenza virus drugs are available, annual influenza virus epidemics result in severe illness, and an influenza pandemic occurs every 20-30 years. To identify candidate anti-influenza virus compounds, we screened approximately 5,000 compounds in an in-house library. We identified MZ7465, a salcomine derivative, as a potent inhibitor of influenza virus propagation. We analyzed the antiviral propagation mechanism of the hit compound by determining the amounts of viral proteins and RNA in infected cells treated with or without the hit compound. Treatment of infected cells with MZ7465 decreased both viral protein and RNA synthesis. In addition, an in vitro assay showed that viral RNA synthesis was directly inhibited by MZ7465. These results suggest that salcomine and its derivatives are potential candidates for the treatment of influenza virus infections.
Cloning and expression of the gene for bacteriophage T7 RNA polymerase
Studier, F.W.; Davanloo, P.; Rosenberg, A.H.; Moffatt, B.A.; Dunn, J.J.
1997-12-02
This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the R7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells. 10 figs.
Cloning and expression of the gene for bacteriophage T7 RNA polymerase
Studier, F. William; Davanloo, Parichehre; Rosenberg, Alan H.; Moffatt, Barbara A.; Dunn, John J.
1999-02-09
This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the R7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells.
Cloning and expression of the gene for bacteriophage T7 RNA polymerase
Studier, F. William; Davanloo, Parichehre; Rosenberg, Alan H.; Moffatt, Barbara A.; Dunn, John J.
1997-12-02
This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the R7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells.
Cloning and expression of the gene for bacteriophage T7 RNA polymerase
Studier, F. William; Davanloo, Parichehre; Rosenberg, Alan H.; Moffatt, Barbara A.; Dunn, John J.
1990-01-01
This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the T7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells.
Cloning and expression of the gene for bacteriophage T7 RNA polymerase
Studier, F.W.; Davanloo, P.; Rosenberg, A.H.; Moffatt, B.A.; Dunn, J.J.
1999-02-09
This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the R7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells. 10 figs.
Steuten, Benedikt; Wagner, Rolf
2012-12-01
6S RNA is a bacterial transcriptional regulator,which accumulates during stationary phase and inhibits transcription from many promoters due to stable association with σ 70 -containing RNA polymerase. This inhibitory RNA polymerase ∼ 6S RNA complex dissociates during nutritional upshift, when cells undergo outgrowth from stationary phase, releasing active RNA polymerase ready for transcription. The release reaction depends on a characteristic property of 6S RNAs, namely to act as template for the de novo synthesis of small RNAs, termed pRNAs.Here, we used limited hydrolysis with structure-specific RNases and in-line probing of isolated 6S RNA and 6SRNA ∼ pRNA complexes to investigate the molecular details leading to the release reaction. Our results indicate that pRNA transcription induces the refolding of the 6S RNA secondary structure by disrupting part of the closing stem(conserved sequence regions CRI and CRIV) and formation of a new hairpin (conserved sequence regions CRIII and CRIV). Comparison of the dimethylsulfate modification pattern of 6S RNA in living cells at stationary growth and during outgrowth confirmed the conformational change observed in vitro. Based on our results, a model describing the individual steps of the release reaction is presented.
Liu, Long; Tian, Jiao; Nan, Hao; Tian, Mengmeng; Li, Yuan; Xu, Xiaodong; Huang, Baicheng; Zhou, Enmin; Hiscox, Julian A; Chen, Hongying
2016-06-01
Porcine reproductive and respiratory syndrome virus (PRRSV) nucleocapsid (N) protein is the main component of the viral capsid to encapsulate viral RNA, and it is also a multifunctional protein involved in the regulation of host cell processes. Nonstructural protein 9 (Nsp9) is the RNA-dependent RNA polymerase that plays a critical role in viral RNA transcription and replication. In this study, we demonstrate that PRRSV N protein is bound to Nsp9 by protein-protein interaction and that the contacting surface on Nsp9 is located in the two predicted α-helixes formed by 48 residues at the C-terminal end of the protein. Mutagenesis analyses identified E646, E608, and E611 on Nsp9 and Q85 on the N protein as the pivotal residues participating in the N-Nsp9 interaction. By overexpressing the N protein binding fragment of Nsp9 in infected Marc-145 cells, the synthesis of viral RNAs, as well as the production of infectious progeny viruses, was dramatically inhibited, suggesting that Nsp9-N protein association is involved in the process of viral RNA production. In addition, we show that PRRSV N interacts with cellular RNA helicase DHX9 and redistributes the protein into the cytoplasm. Knockdown of DHX9 increased the ratio of short subgenomic mRNAs (sgmRNAs); in contrast, DHX9 overexpression benefited the synthesis of longer sgmRNAs and the viral genomic RNA (gRNA). These results imply that DHX9 is recruited by the N protein in PRRSV infection to regulate viral RNA synthesis. We postulate that N and DHX9 may act as antiattenuation factors for the continuous elongation of nascent transcript during negative-strand RNA synthesis. It is unclear whether the N protein of PRRSV is involved in regulation of the viral RNA production process. In this report, we demonstrate that the N protein of the arterivirus PRRSV participates in viral RNA replication and transcription through interacting with Nsp9 and its RdRp and recruiting cellular RNA helicase to promote the production of
Ribonucleic Acid Synthesis by Cucumber Chromatin
Johnson, Kenneth D.; Purves, William K.
1970-01-01
When intact etiolated 2-day cucumber (Cucumis sativus) embryos were treated with indoleacetic acid (IAA), gibberellin A7 (GA7), or kinetin, chromatin derived from the embryonic axes exhibited an increased capacity to support RNA synthesis in either the presence or the absence of bacterial RNA polymerase. An IAA effect on cucumber RNA polymerase activity was evident after 4 hours of hormone treatment; the IAA effect on DNA template activity (bacterial RNA polymerase added) occurred after longer treatments (12 hours). GA7 also promoted template activity, but again only after a prior stimulation of endogenous chromatin activity. After 12 hours of kinetin treatment, both endogenous chromatin and DNA template activities were substantially above control values, but longer kinetin treatments caused these activities to decline in magnitude. When chromatin was prepared from hypocotyl segments that were floated on a GA7 solution, a GA-induced increase in endogenous chromatin activity occurred, but only if cotyledon tissue was left attached to the segments during the period of hormone treatment. Age of the seedling tissue had a profound influence on the chromatin characteristics. With progression of development from the 2-day to the 4-day stage, the endogenous chromatin activity declined while the DNA template activity increased. PMID:16657509
El Hage, Aziz; French, Sarah L.; Beyer, Ann L.; Tollervey, David
2010-01-01
Pre-rRNA transcription by RNA Polymerase I (Pol I) is very robust on active rDNA repeats. Loss of yeast Topoisomerase I (Top1) generated truncated pre-rRNA fragments, which were stabilized in strains lacking TRAMP (Trf4/Trf5–Air1/Air2–Mtr4 polyadenylation complexes) or exosome degradation activities. Loss of both Top1 and Top2 blocked pre-rRNA synthesis, with pre-rRNAs truncated predominately in the 18S 5′ region. Positive supercoils in front of Pol I are predicted to slow elongation, while rDNA opening in its wake might cause R-loop formation. Chromatin immunoprecipitation analysis showed substantial levels of RNA/DNA hybrids in the wild type, particularly over the 18S 5′ region. The absence of RNase H1 and H2 in cells depleted of Top1 increased the accumulation of RNA/DNA hybrids and reduced pre-rRNA truncation and pre-rRNA synthesis. Hybrid accumulation over the rDNA was greatly exacerbated when Top1, Top2, and RNase H were all absent. Electron microscopy (EM) analysis revealed Pol I pileups in the wild type, particularly over the 18S. Pileups were longer and more frequent in the absence of Top1, and their frequency was exacerbated when RNase H activity was also lacking. We conclude that the loss of Top1 enhances inherent R-loop formation, particularly over the 5′ region of the rDNA, imposing persistent transcription blocks when RNase H is limiting. PMID:20634320
Amicoumacin A inhibits translation by stabilizing mRNA interaction with the ribosome
Polikanov, Yury S.; Osterman, Ilya A.; Szal, Teresa; Tashlitsky, Vadim N.; Serebryakova, Marina V.; Kusochek, Pavel; Bulkley, David; Malanicheva, Irina A.; Efimenko, Tatyana A.; Efremenkova, Olga V.; Konevega, Andrey L.; Shaw, Karen J.; Bogdanov, Alexey A.; Rodnina, Marina V.; Dontsova, Olga A.; Mankin, Alexander S.; Steitz, Thomas A.; Sergiev, Petr V.
2014-01-01
SUMMARY We demonstrate that the antibiotic amicoumacin A (AMI) whose cellular target was unknown, is a potent inhibitor of protein synthesis. Resistance mutations in helix 24 of the 16S rRNA mapped the AMI binding site to the small ribosomal subunit. The crystal structure of bacterial ribosome in complex with AMI solved at 2.4 Å resolution revealed that the antibiotic makes contacts with universally conserved nucleotides of 16S rRNA in the E site and the mRNA backbone. Simultaneous interactions of AMI with 16S rRNA and mRNA and the in vivo experimental evidence suggest that it may inhibit the progression of the ribosome along mRNA. Consistent with this proposal, binding of AMI interferes with translocation in vitro. The inhibitory action of AMI can be partly compensated by mutations in the translation elongation factor G. PMID:25306919
Nucleolar TRF2 attenuated nucleolus stress-induced HCC cell-cycle arrest by altering rRNA synthesis.
Yuan, Fuwen; Xu, Chenzhong; Li, Guodong; Tong, Tanjun
2018-05-03
The nucleolus is an important organelle that is responsible for the biogenesis of ribosome RNA (rRNA) and ribosomal subunits assembly. It is also deemed to be the center of metabolic control, considering the critical role of ribosomes in protein translation. Perturbations of rRNA synthesis are closely related to cell proliferation and tumor progression. Telomeric repeat-binding factor 2 (TRF2) is a member of shelterin complex that is responsible for telomere DNA protection. Interestingly, it was recently reported to localize in the nucleolus of human cells in a cell-cycle-dependent manner, while the underlying mechanism and its role on the nucleolus remained unclear. In this study, we found that nucleolar and coiled-body phosphoprotein 1 (NOLC1), a nucleolar protein that is responsible for the nucleolus construction and rRNA synthesis, interacted with TRF2 and mediated the shuttle of TRF2 between the nucleolus and nucleus. Abating the expression of NOLC1 decreased the nucleolar-resident TRF2. Besides, the nucleolar TRF2 could bind rDNA and promoted rRNA transcription. Furthermore, in hepatocellular carcinoma (HCC) cell lines HepG2 and SMMC7721, TRF2 overexpression participated in the nucleolus stress-induced rRNA inhibition and cell-cycle arrest.
Bacterial fatty acid metabolism in modern antibiotic discovery.
Yao, Jiangwei; Rock, Charles O
2017-11-01
Bacterial fatty acid synthesis is essential for many pathogens and different from the mammalian counterpart. These features make bacterial fatty acid synthesis a desirable target for antibiotic discovery. The structural divergence of the conserved enzymes and the presence of different isozymes catalyzing the same reactions in the pathway make bacterial fatty acid synthesis a narrow spectrum target rather than the traditional broad spectrum target. Furthermore, bacterial fatty acid synthesis inhibitors are single-targeting, rather than multi-targeting like traditional monotherapeutic, broad-spectrum antibiotics. The single-targeting nature of bacterial fatty acid synthesis inhibitors makes overcoming fast-developing, target-based resistance a necessary consideration for antibiotic development. Target-based resistance can be overcome through multi-targeting inhibitors, a cocktail of single-targeting inhibitors, or by making the single targeting inhibitor sufficiently high affinity through a pathogen selective approach such that target-based mutants are still susceptible to therapeutic concentrations of drug. Many of the pathogens requiring new antibiotic treatment options encode for essential bacterial fatty acid synthesis enzymes. This review will evaluate the most promising targets in bacterial fatty acid metabolism for antibiotic therapeutics development and review the potential and challenges in advancing each of these targets to the clinic and circumventing target-based resistance. This article is part of a Special Issue entitled: Bacterial Lipids edited by Russell E. Bishop. Copyright © 2016 Elsevier B.V. All rights reserved.
Replication of tobacco mosaic virus RNA.
Buck, K W
1999-01-01
The replication of tobacco mosaic virus (TMV) RNA involves synthesis of a negative-strand RNA using the genomic positive-strand RNA as a template, followed by the synthesis of positive-strand RNA on the negative-strand RNA templates. Intermediates of replication isolated from infected cells include completely double-stranded RNA (replicative form) and partly double-stranded and partly single-stranded RNA (replicative intermediate), but it is not known whether these structures are double-stranded or largely single-stranded in vivo. The synthesis of negative strands ceases before that of positive strands, and positive and negative strands may be synthesized by two different polymerases. The genomic-length negative strand also serves as a template for the synthesis of subgenomic mRNAs for the virus movement and coat proteins. Both the virus-encoded 126-kDa protein, which has amino-acid sequence motifs typical of methyltransferases and helicases, and the 183-kDa protein, which has additional motifs characteristic of RNA-dependent RNA polymerases, are required for efficient TMV RNA replication. Purified TMV RNA polymerase also contains a host protein serologically related to the RNA-binding subunit of the yeast translational initiation factor, eIF3. Study of Arabidopsis mutants defective in RNA replication indicates that at least two host proteins are needed for TMV RNA replication. The tomato resistance gene Tm-1 may also encode a mutant form of a host protein component of the TMV replicase. TMV replicase complexes are located on the endoplasmic reticulum in close association with the cytoskeleton in cytoplasmic bodies called viroplasms, which mature to produce 'X bodies'. Viroplasms are sites of both RNA replication and protein synthesis, and may provide compartments in which the various stages of the virus mutiplication cycle (protein synthesis, RNA replication, virus movement, encapsidation) are localized and coordinated. Membranes may also be important for the
The Ebola Virus VP30-NP Interaction Is a Regulator of Viral RNA Synthesis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kirchdoerfer, Robert N.; Moyer, Crystal L.; Abelson, Dafna M.
Filoviruses are capable of causing deadly hemorrhagic fevers. All nonsegmented negative-sense RNA-virus nucleocapsids are composed of a nucleoprotein (NP), a phosphoprotein (VP35) and a polymerase (L). However, the VP30 RNA-synthesis co-factor is unique to the filoviruses. The assembly, structure, and function of the filovirus RNA replication complex remain unclear. Here, we have characterized the interactions of Ebola, Sudan and Marburg virus VP30 with NP using in vitro biochemistry, structural biology and cell-based mini-replicon assays. We have found that the VP30 C-terminal domain interacts with a short peptide in the C-terminal region of NP. Further, we have solved crystal structures ofmore » the VP30-NP complex for both Ebola and Marburg viruses. These structures reveal that a conserved, proline-rich NP peptide binds a shallow hydrophobic cleft on the VP30 C-terminal domain. Structure-guided Ebola virus VP30 mutants have altered affinities for the NP peptide. Correlation of these VP30-NP affinities with the activity for each of these mutants in a cell-based mini-replicon assay suggests that the VP30-NP interaction plays both essential and inhibitory roles in Ebola virus RNA synthesis.« less
Köhler, Karen; Duchardt-Ferner, Elke; Lechner, Marcus; Damm, Katrin; Hoch, Philipp G; Salas, Margarita; Hartmann, Roland K
2015-10-01
Bacterial 6S RNAs competitively inhibit binding of RNA polymerase (RNAP) holoenzymes to DNA promoters, thereby globally regulating transcription. RNAP uses 6S RNA itself as a template to synthesize short transcripts, termed pRNAs (product RNAs). Longer pRNAs (approx. ≥ 10 nt) rearrange the 6S RNA structure and thereby disrupt the 6S RNA:RNAP complex, which enables the enzyme to resume transcription at DNA promoters. We studied 6S RNA of the hyperthermophilic bacterium Aquifex aeolicus, representing the thermodynamically most stable 6S RNA known so far. Applying structure probing and NMR, we show that the RNA adopts the canonical rod-shaped 6S RNA architecture with little structure formation in the central bulge (CB) even at moderate temperatures (≤37 °C). 6S RNA:pRNA complex formation triggers an internal structure rearrangement of 6S RNA, i.e. formation of a so-called central bulge collapse (CBC) helix. The persistence of several characteristic NMR imino proton resonances upon pRNA annealing demonstrates that defined helical segments on both sides of the CB are retained in the pRNA-bound state, thus representing a basic framework of the RNA's architecture. RNA-seq analyses revealed pRNA synthesis from 6S RNA in A. aeolicus, identifying 9 to ∼17-mers as the major length species. A. aeolicus 6S RNA can also serve as a template for in vitro pRNA synthesis by RNAP from the mesophile Bacillus subtilis. Binding of a synthetic pRNA to A. aeolicus 6S RNA blocks formation of 6S RNA:RNAP complexes. Our findings indicate that A. aeolicus 6S RNA function in its hyperthermophilic host is mechanistically identical to that of other bacterial 6S RNAs. The use of artificial pRNA variants, designed to disrupt helix P2 from the 3'-CB instead of the 5'-CB but preventing formation of the CBC helix, indicated that the mechanism of pRNA-induced RNAP release has been evolutionarily optimized for transcriptional pRNA initiation in the 5'-CB. Copyright © 2015 Elsevier B
Synthesis, base pairing and structure studies of geranylated RNA
Wang, Rui; Vangaveti, Sweta; Ranganathan, Srivathsan V.; Basanta-Sanchez, Maria; Haruehanroengra, Phensinee; Chen, Alan; Sheng, Jia
2016-01-01
Natural RNAs utilize extensive chemical modifications to diversify their structures and functions. 2-Thiouridine geranylation is a special hydrophobic tRNA modification that has been discovered very recently in several bacteria, such as Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella Typhimurium. The geranylated residues are located in the first anticodon position of tRNAs specific for lysine, glutamine and glutamic acid. This big hydrophobic terpene functional group affects the codon recognition patterns and reduces frameshifting errors during translation. We aimed to systematically study the structure, function and biosynthesis mechanism of this geranylation pathway, as well as answer the question of why nature uses such a hydrophobic modification in hydrophilic RNA systems. Recently, we have synthesized the deoxy-analog of S-geranyluridine and showed the geranylated T-G pair is much stronger than the geranylated T-A pair and other mismatched pairs in the B-form DNA duplex context, which is consistent with the observation that the geranylated tRNAGluUUC recognizes GAG more efficiently than GAA. In this manuscript we report the synthesis and base pairing specificity studies of geranylated RNA oligos. We also report extensive molecular simulation studies to explore the structural features of the geranyl group in the context of A-form RNA and its effect on codon–anticodon interaction during ribosome binding. PMID:27307604
Ingestion of bacterially expressed double-stranded RNA inhibits gene expression in planarians.
Newmark, Phillip A; Reddien, Peter W; Cebrià, Francesc; Sánchez Alvarado, Alejandro
2003-09-30
Freshwater planarian flatworms are capable of regenerating complete organisms from tiny fragments of their bodies; the basis for this regenerative prowess is an experimentally accessible stem cell population that is present in the adult planarian. The study of these organisms, classic experimental models for investigating metazoan regeneration, has been revitalized by the application of modern molecular biological approaches. The identification of thousands of unique planarian ESTs, coupled with large-scale whole-mount in situ hybridization screens, and the ability to inhibit planarian gene expression through double-stranded RNA-mediated genetic interference, provide a wealth of tools for studying the molecular mechanisms that regulate tissue regeneration and stem cell biology in these organisms. Here we show that, as in Caenorhabditis elegans, ingestion of bacterially expressed double-stranded RNA can inhibit gene expression in planarians. This inhibition persists throughout the process of regeneration, allowing phenotypes with disrupted regenerative patterning to be identified. These results pave the way for large-scale screens for genes involved in regenerative processes.
Hussain, Tahir; Yogavel, Manickam; Sharma, Amit
2015-04-01
Aminoacyl-tRNA synthetases (aaRSs) are housekeeping enzymes that couple cognate tRNAs with amino acids to transmit genomic information for protein translation. The Plasmodium falciparum nuclear genome encodes two P. falciparum methionyl-tRNA synthetases (PfMRS), termed PfMRS(cyt) and PfMRS(api). Phylogenetic analyses revealed that the two proteins are of primitive origin and are related to heterokonts (PfMRS(cyt)) or proteobacteria/primitive bacteria (PfMRS(api)). We show that PfMRS(cyt) localizes in parasite cytoplasm, while PfMRS(api) localizes to apicoplasts in asexual stages of malaria parasites. Two known bacterial MRS inhibitors, REP3123 and REP8839, hampered Plasmodium growth very effectively in the early and late stages of parasite development. Small-molecule drug-like libraries were screened against modeled PfMRS structures, and several "hit" compounds showed significant effects on parasite growth. We then tested the effects of the hit compounds on protein translation by labeling nascent proteins with (35)S-labeled cysteine and methionine. Three of the tested compounds reduced protein synthesis and also blocked parasite growth progression from the ring stage to the trophozoite stage. Drug docking studies suggested distinct modes of binding for the three compounds, compared with the enzyme product methionyl adenylate. Therefore, this study provides new targets (PfMRSs) and hit compounds that can be explored for development as antimalarial drugs. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
When contemporary aminoacyl-tRNA synthetases invent their cognate amino acid metabolism
Roy, Hervé; Becker, Hubert Dominique; Reinbolt, Joseph; Kern, Daniel
2003-01-01
Faithful protein synthesis relies on a family of essential enzymes called aminoacyl-tRNA synthetases, assembled in a piecewise fashion. Analysis of the completed archaeal genomes reveals that all archaea that possess asparaginyl-tRNA synthetase (AsnRS) also display a second ORF encoding an AsnRS truncated from its anticodon binding-domain (AsnRS2). We show herein that Pyrococcus abyssi AsnRS2, in contrast to AsnRS, does not sustain asparaginyl-tRNAAsn synthesis but is instead capable of converting aspartic acid into asparagine. Functional analysis and complementation of an Escherichia coli asparagine auxotrophic strain show that AsnRS2 constitutes the archaeal homologue of the bacterial ammonia-dependent asparagine synthetase A (AS-A), therefore named archaeal asparagine synthetase A (AS-AR). Primary sequence- and 3D-based phylogeny shows that an archaeal AspRS ancestor originated AS-AR, which was subsequently transferred into bacteria by lateral gene transfer in which it underwent structural changes producing AS-A. This study provides evidence that a contemporary aminoacyl-tRNA synthetase can be recruited to sustain amino acid metabolism. PMID:12874385
Kokate, Mangesh; Garadkar, Kalyanrao; Gole, Anand
2016-12-01
We describe herein a unique approach to synthesize zinc oxide-silica-silver (ZnO-SiO2-Ag) nanocomposite, in a simple, one-pot process. The typical process for ZnO synthesis by alkaline precipitation of zinc salts has been tweaked to replace alkali by alkaline sodium silicate. The free acid from zinc salts helps in the synthesis of silica nanoparticles, whereas the alkalinity of sodium silicate precipitates the zinc salts. Addition of silver ions into the reaction pot prior to addition of sodium silicate, and subsequent reduction by borohydride, gives additional functionality of metallic centres for catalytic applications. The synthesis strategy is based on our recent work typically involving acid-base type of cross-reactions and demonstrates a novel strategy to synthesize nanocomposites in a one-pot approach. Each component in the composite offers a unique feature. ZnO besides displaying mild catalytic and anti-bacterial behaviour is an excellent and a cheap 3-D support for heterogeneous catalysis. Silver nanoparticles enhance the catalytic & anti-bacterial properties of ZnO. Silica is an important part of the composite; which not only "glues" the two nanoparticles thereby stabilizing the nanocomposite, but also significantly enhances the surface area of the composite; which is an attractive feature of any catalyst composite. The nanocomposite is found to show excellent catalytic performance with very high turnover frequencies (TOFs) when studied for catalytic reduction of Rhodamine B (RhB) and 4-Nitrophenol (4-NP). Additionally, the composite has been tested for its anti-bacterial properties on three different bacterial strains i.e. E. coli, B. Cereus and Bacillus firmus. The mechanism for enhancement of catalytic performance has been probed by understanding the role of silica in offering accessibility to the catalyst via its porous high surface area network. The nanocomposite has been characterized by a host of different analytical techniques. The uniqueness of
Brehm, Maria A.; Wundenberg, Torsten; Williams, Jason; Mayr, Georg W.; Shears, Stephen B.
2013-01-01
Summary Fundamental to the life and destiny of every cell is the regulation of protein synthesis through ribosome biogenesis, which begins in the nucleolus with the production of ribosomal RNA (rRNA). Nucleolar organization is a highly dynamic and tightly regulated process; the structural factors that direct nucleolar assembly and disassembly are just as important in controlling rRNA synthesis as are the catalytic activities that synthesize rRNA. Here, we report that a signaling enzyme, inositol 1,3,4,5,6-pentakisphosphate 2-kinase (IP5K) is also a structural component in the nucleolus. We demonstrate that IP5K has functionally significant interactions with three proteins that regulate rRNA synthesis: protein kinase CK2, TCOF1 and upstream-binding-factor (UBF). Through molecular modeling and mutagenic studies, we identified an Arg-Lys-Lys tripeptide located on the surface of IP5K that mediates its association with UBF. Nucleolar IP5K spatial dynamics were sensitive to experimental procedures (serum starvation or addition of actinomycin D) that inhibited rRNA production. We show that IP5K makes stoichiometrically sensitive contributions to the architecture of the nucleoli in intact cells, thereby influencing the degree of rRNA synthesis. Our study adds significantly to the biological significance of IP5K; previously, it was the kinase activity of this protein that had attracted attention. Our demonstration that IP5K ‘moonlights’ as a molecular scaffold offers an unexpected new example of how the biological sophistication of higher organisms can arise from gene products acquiring multiple functions, rather than by an increase in gene number. PMID:23203802
Brehm, Maria A; Wundenberg, Torsten; Williams, Jason; Mayr, Georg W; Shears, Stephen B
2013-01-15
Fundamental to the life and destiny of every cell is the regulation of protein synthesis through ribosome biogenesis, which begins in the nucleolus with the production of ribosomal RNA (rRNA). Nucleolar organization is a highly dynamic and tightly regulated process; the structural factors that direct nucleolar assembly and disassembly are just as important in controlling rRNA synthesis as are the catalytic activities that synthesize rRNA. Here, we report that a signaling enzyme, inositol 1,3,4,5,6-pentakisphosphate 2-kinase (IP5K) is also a structural component in the nucleolus. We demonstrate that IP5K has functionally significant interactions with three proteins that regulate rRNA synthesis: protein kinase CK2, TCOF1 and upstream-binding-factor (UBF). Through molecular modeling and mutagenic studies, we identified an Arg-Lys-Lys tripeptide located on the surface of IP5K that mediates its association with UBF. Nucleolar IP5K spatial dynamics were sensitive to experimental procedures (serum starvation or addition of actinomycin D) that inhibited rRNA production. We show that IP5K makes stoichiometrically sensitive contributions to the architecture of the nucleoli in intact cells, thereby influencing the degree of rRNA synthesis. Our study adds significantly to the biological significance of IP5K; previously, it was the kinase activity of this protein that had attracted attention. Our demonstration that IP5K 'moonlights' as a molecular scaffold offers an unexpected new example of how the biological sophistication of higher organisms can arise from gene products acquiring multiple functions, rather than by an increase in gene number.
Fontana, Mary F; Banga, Simran; Barry, Kevin C; Shen, Xihui; Tan, Yunhao; Luo, Zhao-Qing; Vance, Russell E
2011-02-01
The intracellular bacterial pathogen Legionella pneumophila causes an inflammatory pneumonia called Legionnaires' Disease. For virulence, L. pneumophila requires a Dot/Icm type IV secretion system that translocates bacterial effectors to the host cytosol. L. pneumophila lacking the Dot/Icm system is recognized by Toll-like receptors (TLRs), leading to a canonical NF-κB-dependent transcriptional response. In addition, L. pneumophila expressing a functional Dot/Icm system potently induces unique transcriptional targets, including proinflammatory genes such as Il23a and Csf2. Here we demonstrate that this Dot/Icm-dependent response, which we term the effector-triggered response (ETR), requires five translocated bacterial effectors that inhibit host protein synthesis. Upon infection of macrophages with virulent L. pneumophila, these five effectors caused a global decrease in host translation, thereby preventing synthesis of IκB, an inhibitor of the NF-κB transcription factor. Thus, macrophages infected with wildtype L. pneumophila exhibited prolonged activation of NF-κB, which was associated with transcription of ETR target genes such as Il23a and Csf2. L. pneumophila mutants lacking the five effectors still activated TLRs and NF-κB, but because the mutants permitted normal IκB synthesis, NF-κB activation was more transient and was not sufficient to fully induce the ETR. L. pneumophila mutants expressing enzymatically inactive effectors were also unable to fully induce the ETR, whereas multiple compounds or bacterial toxins that inhibit host protein synthesis via distinct mechanisms recapitulated the ETR when administered with TLR ligands. Previous studies have demonstrated that the host response to bacterial infection is induced primarily by specific microbial molecules that activate TLRs or cytosolic pattern recognition receptors. Our results add to this model by providing a striking illustration of how the host immune response to a virulent pathogen can also
Evaluation of ribosomal RNA removal protocols for Salmonella RNA-Seq projects
USDA-ARS?s Scientific Manuscript database
Next generation sequencing is a powerful technology and its application to sequencing entire RNA populations of food-borne pathogens will provide valuable insights. A problem unique to prokaryotic RNA-Seq is the massive abundance of ribosomal RNA. Unlike eukaryotic messenger RNA (mRNA), bacterial ...
Sano, Naoto; Yamashita, Yoshio; Fukuda, Kazumasa; Taniguchi, Hatsumi; Goto, Masaaki; Miyamoto, Hiroshi
2012-01-01
Intracystic fluid was aseptically collected from 11 patients with postoperative maxillary cyst (POMC), and DNA was extracted from the POMC fluid. Bacterial species were identified by sequencing after cloning of approximately 580 bp of the 16S rRNA gene. Identification of pathogenic bacteria was also performed by culture methods. The phylogenetic identity was determined by sequencing 517–596 bp in each of the 1139 16S rRNA gene clones. A total of 1114 clones were classified while the remaining 25 clones were unclassified. A total of 103 bacterial species belonging to 42 genera were identified in POMC fluid samples by 16S rRNA gene analysis. Species of Prevotella (91%), Neisseria (73%), Fusobacterium (73%), Porphyromonas (73%), and Propionibacterium (73%) were found to be highly prevalent in all patients. Streptococcus mitis (64%), Fusobacterium nucleatum (55%), Propionibacterium acnes (55%), Staphylococcus capitis (55%), and Streptococcus salivarius (55%) were detected in more than 6 of the 11 patients. The results obtained by the culture method were different from those obtained by 16S rRNA gene analysis, but both approaches may be necessary for the identification of pathogens, especially of bacteria that are difficult to detect by culture methods, and the development of rational treatments for patients with POMC. PMID:22685668
NASA Technical Reports Server (NTRS)
Golden, Barbara L.; Kundrot, Craig E.
2003-01-01
RNA molecules may be crystallized using variations of the methods developed for protein crystallography. As the technology has become available to syntheisize and purify RNA molecules in the quantities and with the quality that is required for crystallography, the field of RNA structure has exploded. The first consideration when crystallizing an RNA is the sequence, which may be varied in a rational way to enhance crystallizability or prevent formation of alternate structures. Once a sequence has been designed, the RNA may be synthesized chemically by solid-state synthesis, or it may be produced enzymatically using RNA polymerase and an appropriate DNA template. Purification of milligram quantities of RNA can be accomplished by HPLC or gel electrophoresis. As with proteins, crystallization of RNA is usually accomplished by vapor diffusion techniques. There are several considerations that are either unique to RNA crystallization or more important for RNA crystallization. Techniques for design, synthesis, purification, and crystallization of RNAs will be reviewed here.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hudson, Corey M.; Williams, Kelly P.
We report that the transfer-messenger RNA (tmRNA) and its partner protein SmpB act together in resolving problems arising when translating bacterial ribosomes reach the end of mRNA with no stop codon. Their genes have been found in nearly all bacterial genomes and in some organelles. The tmRNA Website serves tmRNA sequences, alignments and feature annotations, and has recently moved to http: //bioinformatics.sandia.gov/tmrna/. New features include software used to find the sequences, an update raising the number of unique tmRNA sequences from 492 to 1716, and a database of SmpB sequences which are served along with the tmRNA sequence from themore » same organism.« less
Hudson, Corey M.; Williams, Kelly P.
2014-11-05
We report that the transfer-messenger RNA (tmRNA) and its partner protein SmpB act together in resolving problems arising when translating bacterial ribosomes reach the end of mRNA with no stop codon. Their genes have been found in nearly all bacterial genomes and in some organelles. The tmRNA Website serves tmRNA sequences, alignments and feature annotations, and has recently moved to http: //bioinformatics.sandia.gov/tmrna/. New features include software used to find the sequences, an update raising the number of unique tmRNA sequences from 492 to 1716, and a database of SmpB sequences which are served along with the tmRNA sequence from themore » same organism.« less
Slabbinck, Bram; Waegeman, Willem; Dawyndt, Peter; De Vos, Paul; De Baets, Bernard
2010-01-30
Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for the discrimination of bacterial
2010-01-01
Background Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. Results In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. Conclusions FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for
Guo, Hongyan; Song, Xiaoguang; Xie, Chuanmiao; Huo, Yan; Zhang, Fujie; Chen, Xiaoying; Geng, Yunfeng; Fang, Rongxiang
2013-08-01
The P6 protein of Rice yellow stunt rhabdovirus (RYSV) is a virion structural protein that can be phosphorylated in vitro. However its exact function remains elusive. We found that P6 enhanced the virulence of Potato virus X (PVX) in Nicotiana benthamiana and N. tabacum plants, suggesting that it might function as a suppressor of RNA silencing. We examined the mechanism of P6-mediated silencing suppression by transiently expressing P6 in both N. benthamiana leaves and rice protoplasts. Our results showed that P6 could repress the production of secondary siRNAs and inhibit systemic green fluorescent protein RNA silencing but did not interfere with local RNA silencing in N. benthamiana plants or in rice protoplasts. Intriguingly, P6 and RDR6 had overlapping subcellular localization and P6 bound both rice and Arabidopsis RDR6 in vivo. Furthermore, transgenic rice plants expressing P6 showed enhanced susceptibility to infection by Rice stripe virus. Hence, we propose that P6 is part of the RYSV's counter-defense machinery against the plant RNA silencing system and plays a role mainly in affecting RDR6-mediated secondary siRNA synthesis. Our work provides a new perspective on how a plant-infecting nucleorhabdovirus may counteract host RNA silencing-mediated antiviral defense.
Researchers at the National Cancer Institute (NCI) developed a genetic assay for detecting transcription errors in RNA synthesis. This new assay extends the familiar concept of an Ames test which monitors DNA damage and synthesis errors to the previously inaccessible issue of RNA synthesis fidelity. The FDA requires genetic DNA focused tests for all drug approval as it assesses the in vivo mutagenic and carcinogenic potential of a drug. The new assay will open an approach to monitoring the impact of treatments on the accuracy of RNA synthesis. Errors in transcription have been hypothesized to be a component of aging and age-related diseases. The National Cancer Institute (NCI) seeks licensing partners for the genetic assay.
Initiation of poliovirus plus-strand RNA synthesis in a membrane complex of infected HeLa cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Takeda, N.; Kuhn, R.J.; Yang, C.F.
1986-10-01
An in vitro poliovirus RNA-synthesizing system derived from a crude membrance fraction of infected HeLa cells was used to analyze the mechanism of initiation of poliovirus plus-strand RNA synthesis. This system contains an activity that synthesizes the nucleotidyl proteins VPg-pU and VPg-pUpU. These molecules represent the 5'-terminal structure of nascent RNA molecules and of virion RNA. The membranous replication complex is also capable of synthesizing mucleotidyl proteins containing nine or more of the poliovirus 5'-proximal nucleotides as assayed by the formation of the RNase T/sub 1/-resistant oligonucleotide VPg-pUUAAAACAGp or by fingerprint analysis of the in vitro-synthesized /sup 32/P-RNA. Incubation ofmore » preformed VPg-pUpU with unlabeled nucleoside triphosphates resulted in the formation of VPg-pUUAAAACAGp. This reaction, which appeared to be an elongation of VPg-pUpU, was stimulated by the addition of a soluble fraction (S-10) obtained from uninfected HeLa cells. Preformed VPg-pU could be chased into VPg-pUpU in the presence of UTP. The data are consistent with a model that VPg-pU can function as a primer for poliovirus plus-strand RNA synthesis in the membranous replication complex and that the elongation reaction may be stimulated by a host cellular factor.« less
Bergström, Tomas; Kann, Nina; Adamiak, Beata; Hannoun, Charles; Kindler, Eveline; Jónsdóttir, Hulda R.; Muth, Doreen; Kint, Joeri; Forlenza, Maria; Müller, Marcel A.; Drosten, Christian; Thiel, Volker; Trybala, Edward
2014-01-01
Coronaviruses raise serious concerns as emerging zoonotic viruses without specific antiviral drugs available. Here we screened a collection of 16671 diverse compounds for anti-human coronavirus 229E activity and identified an inhibitor, designated K22, that specifically targets membrane-bound coronaviral RNA synthesis. K22 exerts most potent antiviral activity after virus entry during an early step of the viral life cycle. Specifically, the formation of double membrane vesicles (DMVs), a hallmark of coronavirus replication, was greatly impaired upon K22 treatment accompanied by near-complete inhibition of viral RNA synthesis. K22-resistant viruses contained substitutions in non-structural protein 6 (nsp6), a membrane-spanning integral component of the viral replication complex implicated in DMV formation, corroborating that K22 targets membrane bound viral RNA synthesis. Besides K22 resistance, the nsp6 mutants induced a reduced number of DMVs, displayed decreased specific infectivity, while RNA synthesis was not affected. Importantly, K22 inhibits a broad range of coronaviruses, including Middle East respiratory syndrome coronavirus (MERS–CoV), and efficient inhibition was achieved in primary human epithelia cultures representing the entry port of human coronavirus infection. Collectively, this study proposes an evolutionary conserved step in the life cycle of positive-stranded RNA viruses, the recruitment of cellular membranes for viral replication, as vulnerable and, most importantly, druggable target for antiviral intervention. We expect this mode of action to serve as a paradigm for the development of potent antiviral drugs to combat many animal and human virus infections. PMID:24874215
Synthesis of [18F]-labelled Maltose Derivatives as PET Tracers for Imaging Bacterial Infection
Namavari, Mohammad; Gowrishankar, Gayatri; Hoehne, Aileen; Jouannot, Erwan; Gambhir, Sanjiv S
2015-01-01
Purpose To develop novel positron emission tomography (PET) agents for visualization and therapy monitoring of bacterial infections. Procedures It is known that maltose and maltodextrins are energy sources for bacteria. Hence, 18F-labelled maltose derivatives could be a valuable tool for imaging bacterial infections. We have developed methods to synthesize 4-O-(α-D-glucopyranosyl)-6-deoxy-6-[18F]fluoro-D-glucopyranoside (6-[18F]fluoromaltose) and 4-O-(α-D-glucopyranosyl)-1-deoxy-1-[18F]fluoro-D-glucopyranoside (1-[18F]fluoromaltose) as bacterial infection PET imaging agents. 6-[18F]fluoromaltose was prepared from precursor 1,2,3-tri-O-acetyl-4-O-(2′,3′,-di-O-acetyl-4′,6′-benzylidene-α-D-glucopyranosyl)-6-deoxy-6-nosyl-D-glucopranoside (5). The synthesis involved the radio-fluorination of 5 followed by acidic and basic hydrolysis to give 6-[18F]fluoromaltose. In an analogous procedure, 1-[18F]fluoromaltose was synthesized from 2,3, 6-tri-O-acetyl-4-O-(2′,3′,4′,6-tetra-O-acetyl-α-D-glucopyranosyl)-1-deoxy-1-O-triflyl-D-glucopranoside (9). Stability of 6-[18F]fluoromaltose in phosphate-buffered saline (PBS) and human and mouse serum at 37 °C was determined. Escherichia coli uptake of 6-[18F]fluoromaltose was examined. Results A reliable synthesis of 1- and 6-[18F]fluoromaltose has been accomplished with 4–6 and 5–8 % radiochemical yields, respectively (decay-corrected with 95 % radiochemical purity). 6-[18F]fluoromaltose was sufficiently stable over the time span needed for PET studies (~96 % intact compound after 1-h and ~65 % after 2-h incubation in serum). Bacterial uptake experiments indicated that E. coli transports 6-[18F]fluoromaltose. Competition assays showed that the uptake of 6-[18F]fluoromaltose was completely blocked by co-incubation with 1 mM of the natural substrate maltose. Conclusion We have successfully synthesized 1- and 6-[18F]fluoromaltose via direct fluorination of appropriate protected maltose precursors. Bacterial uptake
DNA and RNA Synthesis in Animal Cells in Culture--Methods for Use in Schools
ERIC Educational Resources Information Center
Godsell, P. M.; Balls, M.
1973-01-01
Describes the experimental procedures used for detecting DNA and RNA synthesis in xenopus cells by autoradiography. The method described is suitable for senior high school laboratory classes or biology projects, if supervised by a teacher qualified to handle radioisotopes. (JR)
Burgos, Hector L; O'Connor, Kevin; Sanchez-Vazquez, Patricia; Gourse, Richard L
2017-11-01
Bacterial ribosome biogenesis is tightly regulated to match nutritional conditions and to prevent formation of defective ribosomal particles. In Escherichia coli , most ribosomal protein (r-protein) synthesis is coordinated with rRNA synthesis by a translational feedback mechanism: when r-proteins exceed rRNAs, specific r-proteins bind to their own mRNAs and inhibit expression of the operon. It was recently discovered that the second messenger nucleotide guanosine tetra and pentaphosphate (ppGpp), which directly regulates rRNA promoters, is also capable of regulating many r-protein promoters. To examine the relative contributions of the translational and transcriptional control mechanisms to the regulation of r-protein synthesis, we devised a reporter system that enabled us to genetically separate the cis -acting sequences responsible for the two mechanisms and to quantify their relative contributions to regulation under the same conditions. We show that the synthesis of r-proteins from the S20 and S10 operons is regulated by ppGpp following shifts in nutritional conditions, but most of the effect of ppGpp required the 5' region of the r-protein mRNA containing the target site for translational feedback regulation and not the promoter. These results suggest that most regulation of the S20 and S10 operons by ppGpp following nutritional shifts is indirect and occurs in response to changes in rRNA synthesis. In contrast, we found that the promoters for the S20 operon were regulated during outgrowth, likely in response to increasing nucleoside triphosphate (NTP) levels. Thus, r-protein synthesis is dynamic, with different mechanisms acting at different times. IMPORTANCE Bacterial cells have evolved complex and seemingly redundant strategies to regulate many high-energy-consuming processes. In E. coli , synthesis of ribosomal components is tightly regulated with respect to nutritional conditions by mechanisms that act at both the transcription and translation steps. In
Reza, Abu Musa Md Talimur; Choi, Yun-Jung; Kim, Jin-Hoi
2018-02-27
The Rag2 knockout (KO) mouse is a well-established immune-compromised animal model for biomedical research. A comparative study identified the deregulated expression of microRNAs (miRNAs) and messenger RNAs (mRNAs) in Rag2 KO mice. However, the interaction between deregulated genes and miRNAs in the alteration of systemic (cardiac, renal, hepatic, nervous, and hematopoietic) regulations and the synthesis of biomolecules (such as l-tryptophan, serotonin, melatonin, dopamine, alcohol, noradrenaline, putrescine, and acetate) are unclear. In this study, we analyzed both miRNA and mRNA expression microarray data from Rag2 KO and wild type mice to investigate the possible role of miRNAs in systemic regulation and biomolecule synthesis. A notable finding obtained from this analysis is that the upregulation of several genes which are target molecules of the downregulated miRNAs in Rag2 KO mice, can potentially trigger the degradation of l-tryptophan, thereby leading to the systemic impairment and alteration of biomolecules synthesis as well as changes in behavioral patterns (such as stress and fear responses, and social recognition memory) in Rag2 gene-depleted mice. These findings were either not observed or not explicitly described in other published Rag2 KO transcriptome analyses. In conclusion, we have provided an indication of miRNA-dependent regulations of clinical and pathological conditions in cardiac, renal, hepatic, nervous, and hematopoietic systems in Rag2 KO mice. These results may significantly contribute to the prediction of clinical disease caused by Rag2 deficiency.
Diverse Mechanisms of Sulfur Decoration in Bacterial tRNA and Their Cellular Functions
Zheng, Chenkang; Black, Katherine A.; Dos Santos, Patricia C.
2017-01-01
Sulfur-containing transfer ribonucleic acids (tRNAs) are ubiquitous biomolecules found in all organisms that possess a variety of functions. For decades, their roles in processes such as translation, structural stability, and cellular protection have been elucidated and appreciated. These thionucleosides are found in all types of bacteria; however, their biosynthetic pathways are distinct among different groups of bacteria. Considering that many of the thio-tRNA biosynthetic enzymes are absent in Gram-positive bacteria, recent studies have addressed how sulfur trafficking is regulated in these prokaryotic species. Interestingly, a novel proposal has been given for interplay among thionucleosides and the biosynthesis of other thiocofactors, through participation of shared-enzyme intermediates, the functions of which are impacted by the availability of substrate as well as metabolic demand of thiocofactors. This review describes the occurrence of thio-modifications in bacterial tRNA and current methods for detection of these modifications that have enabled studies on the biosynthesis and functions of S-containing tRNA across bacteria. It provides insight into potential modes of regulation and potential evolutionary events responsible for divergence in sulfur metabolism among prokaryotes. PMID:28327539
Morin, Benjamin; Liang, Bo; Gardner, Erica; Ross, Robin A; Whelan, Sean P J
2017-01-01
We report an in vitro RNA synthesis assay for the RNA-dependent RNA polymerase (RdRP) of rabies virus (RABV). We expressed RABV large polymerase protein (L) in insect cells from a recombinant baculovirus vector and the phosphoprotein cofactor (P) in Escherichia coli and purified the resulting proteins by affinity and size exclusion chromatography. Using chemically synthesized short RNA corresponding to the first 19 nucleotides (nt) of the rabies virus genome, we demonstrate that L alone initiates synthesis on naked RNA and that P serves to enhance the initiation and processivity of the RdRP. The L-P complex lacks full processivity, which we interpret to reflect the lack of the viral nucleocapsid protein (N) on the template. Using this assay, we define the requirements in P for stimulation of RdRP activity as residues 11 to 50 of P and formally demonstrate that ribavirin triphosphate (RTP) inhibits the RdRP. By comparing the properties of RABV RdRP with those of the related rhabdovirus, vesicular stomatitis virus (VSV), we demonstrate that both polymerases can copy the heterologous promoter sequence. The requirements for engagement of the N-RNA template of VSV by its polymerase are provided by the C-terminal domain (CTD) of P. A chimeric RABV P protein in which the oligomerization domain (OD) and the CTD were replaced by those of VSV P stimulated RABV RdRP activity on naked RNA but was insufficient to permit initiation on the VSV N-RNA template. This result implies that interactions between L and the template N are also required for initiation of RNA synthesis, extending our knowledge of ribonucleoprotein interactions that are critical for gene expression. The current understanding of the structural and functional significance of the components of the rabies virus replication machinery is incomplete. Although structures are available for the nucleocapsid protein in complex with RNA, and also for portions of P, information on both the structure and function of the L
Osman, Toba A M; Olsthoorn, René C L; Livieratos, Ioannis C
2014-09-22
Pepino mosaic virus (PepMV) is a mechanically-transmitted positive-strand RNA potexvirus, with a 6410 nt long single-stranded (ss) RNA genome flanked by a 5'-methylguanosine cap and a 3' poly-A tail. Computer-assisted folding of the 64 nt long PepMV 3'-untranslated region (UTR) resulted in the prediction of three stem-loop structures (hp1, hp2, and hp3 in the 3'-5' direction). The importance of these structures and/or sequences for promotion of negative-strand RNA synthesis and binding to the RNA dependent RNA polymerase (RdRp) was tested in vitro using a specific RdRp assay. Hp1, which is highly variable among different PepMV isolates, appeared dispensable for negative-strand synthesis. Hp2, which is characterized by a large U-rich loop, tolerated base-pair changes in its stem as long as they maintained the stem integrity but was very sensitive to changes in the U-rich loop. Hp3, which harbours the conserved potexvirus ACUUAA hexamer motif, was essential for template activity. Template-RNA polymerase binding competition experiments showed that the ACUUAA sequence represents a high-affinity RdRp binding element. Copyright © 2014 Elsevier B.V. All rights reserved.
Synthesis of orthogonally protected bacterial, rare-sugar and D-glycosamine building blocks.
Emmadi, Madhu; Kulkarni, Suvarn S
2013-10-01
Bacterial glycoconjugates comprise atypical deoxy amino sugars that are not present on the human cell surface, making them good targets for drug discovery and carbohydrate-based vaccine development. Unfortunately, they cannot be isolated with sufficient purity in acceptable amounts, and therefore chemical synthesis is a crucial step toward the development of these products. Here we describe a detailed protocol for the synthesis of orthogonally protected bacterial deoxy amino hexopyranoside (2,4-diacetamido-2,4,6-trideoxyhexose (DATDH), D-bacillosamine, D-fucosamine, and 2-acetamido-4-amino-2,4,6-trideoxy-D-galactose (AAT)), D-glucosamine and D-galactosamine building blocks starting from β-D-thiophenylmannoside. Readily available β-D-thiophenylmannoside was first converted into the corresponding 2,4-diols via deoxygenation or silylation at C6, followed by O3 acylation. The 2,4-diols were converted into 2,4-bis-trifluoromethanesulfonates, which underwent highly regioselective, one-pot, double-serial and double-parallel displacements by azide, phthalimide, acetate and nitrite ions as nucleophiles. Thus, D-rhamnosyl- and D-mannosyl 2,4-diols can be efficiently transformed into various rare sugars and D-galactosamine, respectively, as orthogonally protected thioglycoside building blocks on a gram scale in 1-2 d, in 54-85% overall yields, after a single chromatographic purification. This would otherwise take 1-2 weeks. D-Glucosamine building blocks can be prepared from β-D-thiophenylmannoside in four steps via C2 displacement of triflates by azide in 2 d and in 66-70% overall yields. These procedures have been applied to the synthesis of L-serine-linked trisaccharide of Neisseria meningitidis and a rare disaccharide fragment of the zwitterionic polysaccharide (ZPS) A1 (ZPS A1) of Bacteroides fragilis.
Laurila, Minni R L; Makeyev, Eugene V; Bamford, Dennis H
2002-05-10
Like most RNA polymerases, the polymerase of double-strand RNA bacteriophage phi6 (phi6pol) is capable of primer-independent initiation. Based on the recently solved phi6pol initiation complex structure, a four-amino acid-long loop (amino acids 630-633) has been suggested to stabilize the first two incoming NTPs through stacking interactions with tyrosine, Tyr(630). A similar loop is also present in the hepatitis C virus polymerase, another enzyme capable of de novo initiation. Here, we use a series of phi6pol mutants to address the role of this element. As predicted, mutants at the Tyr(630) position are inefficient in initiation de novo. Unexpectedly, when the loop is disordered by changing Tyr(630)-Lys(631)-Trp(632) to GSG, phi6pol becomes a primer-dependent enzyme, either extending complementary oligonucleotide or, when the template 3' terminus can adopt a hairpin-like conformation, utilizing a "copy-back" initiation mechanism. In contrast to the wild-type phi6pol, the GSG mutant does not require high GTP concentration for its optimal activity. These findings suggest a general model for the initiation of de novo RNA synthesis.
Ebner, Florian; Ivin, Masa; Kratochvill, Franz; Gratz, Nina; Villunger, Andreas; Sixt, Michael
2017-01-01
Protective responses against pathogens require a rapid mobilization of resting neutrophils and the timely removal of activated ones. Neutrophils are exceptionally short-lived leukocytes, yet it remains unclear whether the lifespan of pathogen-engaged neutrophils is regulated differently from that in the circulating steady-state pool. Here, we have found that under homeostatic conditions, the mRNA-destabilizing protein tristetraprolin (TTP) regulates apoptosis and the numbers of activated infiltrating murine neutrophils but not neutrophil cellularity. Activated TTP-deficient neutrophils exhibited decreased apoptosis and enhanced accumulation at the infection site. In the context of myeloid-specific deletion of Ttp, the potentiation of neutrophil deployment protected mice against lethal soft tissue infection with Streptococcus pyogenes and prevented bacterial dissemination. Neutrophil transcriptome analysis revealed that decreased apoptosis of TTP-deficient neutrophils was specifically associated with elevated expression of myeloid cell leukemia 1 (Mcl1) but not other antiapoptotic B cell leukemia/lymphoma 2 (Bcl2) family members. Higher Mcl1 expression resulted from stabilization of Mcl1 mRNA in the absence of TTP. The low apoptosis rate of infiltrating TTP-deficient neutrophils was comparable to that of transgenic Mcl1-overexpressing neutrophils. Our study demonstrates that posttranscriptional gene regulation by TTP schedules the termination of the antimicrobial engagement of neutrophils. The balancing role of TTP comes at the cost of an increased risk of bacterial infections. PMID:28504646
ERIC Educational Resources Information Center
Darnell, James E., Jr.
1985-01-01
Ribonucleic acid (RNA) converts genetic information into protein and usually must be processed to serve its function. RNA types, chemical structure, protein synthesis, translation, manufacture, and processing are discussed. Concludes that the first genes might have been spliced RNA and that humans might be closer than bacteria to primitive…
Control of Fur synthesis by the non-coding RNA RyhB and iron-responsive decoding.
Vecerek, Branislav; Moll, Isabella; Bläsi, Udo
2007-02-21
The Fe2+-dependent Fur protein serves as a negative regulator of iron uptake in bacteria. As only metallo-Fur acts as an autogeneous repressor, Fe2+scarcity would direct fur expression when continued supply is not obviously required. We show that in Escherichia coli post-transcriptional regulatory mechanisms ensure that Fur synthesis remains steady in iron limitation. Our studies revealed that fur translation is coupled to that of an upstream open reading frame (uof), translation of which is downregulated by the non-coding RNA (ncRNA) RyhB. As RyhB transcription is negatively controlled by metallo-Fur, iron depletion creates a negative feedback loop. RyhB-mediated regulation of uof-fur provides the first example for indirect translational regulation by a trans-encoded ncRNA. In addition, we present evidence for an iron-responsive decoding mechanism of the uof-fur entity. It could serve as a backup mechanism of the RyhB circuitry, and represents the first link between iron availability and synthesis of an iron-containing protein.
Wright, David P; Ulijasz, Andrew T
2014-01-01
Bacterial eukaryotic-like serine threonine kinases (eSTKs) and serine threonine phosphatases (eSTPs) have emerged as important signaling elements that are indispensable for pathogenesis. Differing considerably from their histidine kinase counterparts, few eSTK genes are encoded within the average bacterial genome, and their targets are pleiotropic in nature instead of exclusive. The growing list of important eSTK/P substrates includes proteins involved in translation, cell division, peptidoglycan synthesis, antibiotic tolerance, resistance to innate immunity and control of virulence factors. Recently it has come to light that eSTK/Ps also directly modulate transcriptional machinery in many microbial pathogens. This novel form of regulation is now emerging as an additional means by which bacteria can alter their transcriptomes in response to host-specific environmental stimuli. Here we focus on the ability of eSTKs and eSTPs in Gram-positive bacterial pathogens to directly modulate transcription, the known mechanistic outcomes of these modifications, and their roles as an added layer of complexity in controlling targeted RNA synthesis to enhance virulence potential. PMID:25603430
Zhang, Yan; Hong, Samuel; Ruangprasert, Ajchareeya; Skiniotis, Georgios; Dunham, Christine M
2018-03-06
Structured mRNAs positioned downstream of the ribosomal decoding center alter gene expression by slowing protein synthesis. Here, we solved the cryo-EM structure of the bacterial ribosome bound to an mRNA containing a 3' stem loop that regulates translation. Unexpectedly, the E-site tRNA adopts two distinct orientations. In the first structure, normal interactions with the 50S and 30S E site are observed. However, in the second structure, although the E-site tRNA makes normal interactions with the 50S E site, its anticodon stem loop moves ∼54 Å away from the 30S E site to interact with the 30S head domain and 50S uL5. This position of the E-site tRNA causes the uL1 stalk to adopt a more open conformation that likely represents an intermediate state during E-site tRNA dissociation. These results suggest that structured mRNAs at the entrance channel restrict 30S subunit movement required during translation to slow E-site tRNA dissociation. Copyright © 2018 Elsevier Ltd. All rights reserved.
Omadjela, Okako; Narahari, Adishesh; Strumillo, Joanna; Mélida, Hugo; Mazur, Olga; Bulone, Vincent; Zimmer, Jochen
2013-10-29
Cellulose is a linear extracellular polysaccharide. It is synthesized by membrane-embedded glycosyltransferases that processively polymerize UDP-activated glucose. Polymer synthesis is coupled to membrane translocation through a channel formed by the cellulose synthase. Although eukaryotic cellulose synthases function in macromolecular complexes containing several different enzyme isoforms, prokaryotic synthases associate with additional subunits to bridge the periplasm and the outer membrane. In bacteria, cellulose synthesis and translocation is catalyzed by the inner membrane-associated bacterial cellulose synthase (Bcs)A and BcsB subunits. Similar to alginate and poly-β-1,6 N-acetylglucosamine, bacterial cellulose is implicated in the formation of sessile bacterial communities, termed biofilms, and its synthesis is likewise stimulated by cyclic-di-GMP. Biochemical studies of exopolysaccharide synthesis are hampered by difficulties in purifying and reconstituting functional enzymes. We demonstrate robust in vitro cellulose synthesis reconstituted from purified BcsA and BcsB proteins from Rhodobacter sphaeroides. Although BcsA is the catalytically active subunit, the membrane-anchored BcsB subunit is essential for catalysis. The purified BcsA-B complex produces cellulose chains of a degree of polymerization in the range 200-300. Catalytic activity critically depends on the presence of the allosteric activator cyclic-di-GMP, but is independent of lipid-linked reactants. Our data reveal feedback inhibition of cellulose synthase by UDP but not by the accumulating cellulose polymer and highlight the strict substrate specificity of cellulose synthase for UDP-glucose. A truncation analysis of BcsB localizes the region required for activity of BcsA within its C-terminal membrane-associated domain. The reconstituted reaction provides a foundation for the synthesis of biofilm exopolysaccharides, as well as its activation by cyclic-di-GMP.
Omadjela, Okako; Narahari, Adishesh; Strumillo, Joanna; Mélida, Hugo; Mazur, Olga; Bulone, Vincent; Zimmer, Jochen
2013-01-01
Cellulose is a linear extracellular polysaccharide. It is synthesized by membrane-embedded glycosyltransferases that processively polymerize UDP-activated glucose. Polymer synthesis is coupled to membrane translocation through a channel formed by the cellulose synthase. Although eukaryotic cellulose synthases function in macromolecular complexes containing several different enzyme isoforms, prokaryotic synthases associate with additional subunits to bridge the periplasm and the outer membrane. In bacteria, cellulose synthesis and translocation is catalyzed by the inner membrane-associated bacterial cellulose synthase (Bcs)A and BcsB subunits. Similar to alginate and poly-β-1,6 N-acetylglucosamine, bacterial cellulose is implicated in the formation of sessile bacterial communities, termed biofilms, and its synthesis is likewise stimulated by cyclic-di-GMP. Biochemical studies of exopolysaccharide synthesis are hampered by difficulties in purifying and reconstituting functional enzymes. We demonstrate robust in vitro cellulose synthesis reconstituted from purified BcsA and BcsB proteins from Rhodobacter sphaeroides. Although BcsA is the catalytically active subunit, the membrane-anchored BcsB subunit is essential for catalysis. The purified BcsA-B complex produces cellulose chains of a degree of polymerization in the range 200–300. Catalytic activity critically depends on the presence of the allosteric activator cyclic-di-GMP, but is independent of lipid-linked reactants. Our data reveal feedback inhibition of cellulose synthase by UDP but not by the accumulating cellulose polymer and highlight the strict substrate specificity of cellulose synthase for UDP-glucose. A truncation analysis of BcsB localizes the region required for activity of BcsA within its C-terminal membrane-associated domain. The reconstituted reaction provides a foundation for the synthesis of biofilm exopolysaccharides, as well as its activation by cyclic-di-GMP. PMID:24127606
Keller, Peter M; Rampini, Silvana K; Bloemberg, Guido V
2010-06-01
We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis.
Synthesis of double-stranded RNA in a virus-enriched fraction from Agaricus bisporus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sriskantha, A.; Wach, P.; Schlagnhaufer, B.
Partially purified virus preparations from sporophores of Agaricus bisporus affected with LaFrance disease had up to a 15-fold-higher RNA-dependent RNA polymerase activity than did comparable preparations from health sporophores. Enzyme activity was dependent upon the presence of Mg/sup 2 +/ and the four nucleoside triphosphates and was insensitive to actinomycin D, ..cap alpha..-amanitin, and rifampin. The /sup 3/H-labeled enzyme reaction products were double-stranded RNA (dsRNA) as indicated by CF-11 cellulose column chromatography and by their ionic-strength-dependent sensitivity to hydrolysis by RNase A. The principal dsRNA products had estimated molecular weights of 4.3 /times/ 10/sup 6/ and 1.4 /times/ 10/sup 6/.more » Cs/sub 2/SO/sub 4/ equilibrium centrifugation of the virus preparation resolved a single peak of RNA polymerase activity that banded with a 35-nm spherical virus particle containing dsRNAs with molecular weights of 4.3 /times/ 10/sup 6/ and 1.4 /times/ 10/sup 6/. The data suggest that the RNA-dependent RNA polymerase associated with the 35-nm spherical virus is a replicase which catalyzes the synthesis of the genomic dsRNAs.« less
Wang, Yejun; MacKenzie, Keith D; White, Aaron P
2015-05-07
As sequencing costs are being lowered continuously, RNA-seq has gradually been adopted as the first choice for comparative transcriptome studies with bacteria. Unlike microarrays, RNA-seq can directly detect cDNA derived from mRNA transcripts at a single nucleotide resolution. Not only does this allow researchers to determine the absolute expression level of genes, but it also conveys information about transcript structure. Few automatic software tools have yet been established to investigate large-scale RNA-seq data for bacterial transcript structure analysis. In this study, 54 directional RNA-seq libraries from Salmonella serovar Typhimurium (S. Typhimurium) 14028s were examined for potential relationships between read mapping patterns and transcript structure. We developed an empirical method, combined with statistical tests, to automatically detect key transcript features, including transcriptional start sites (TSSs), transcriptional termination sites (TTSs) and operon organization. Using our method, we obtained 2,764 TSSs and 1,467 TTSs for 1331 and 844 different genes, respectively. Identification of TSSs facilitated further discrimination of 215 putative sigma 38 regulons and 863 potential sigma 70 regulons. Combining the TSSs and TTSs with intergenic distance and co-expression information, we comprehensively annotated the operon organization in S. Typhimurium 14028s. Our results show that directional RNA-seq can be used to detect transcriptional borders at an acceptable resolution of ±10-20 nucleotides. Technical limitations of the RNA-seq procedure may prevent single nucleotide resolution. The automatic transcript border detection methods, statistical models and operon organization pipeline that we have described could be widely applied to RNA-seq studies in other bacteria. Furthermore, the TSSs, TTSs, operons, promoters and unstranslated regions that we have defined for S. Typhimurium 14028s may constitute valuable resources that can be used for
Lloréns-Rico, Verónica; Serrano, Luis; Lluch-Senar, Maria
2014-07-29
RNA sequencing methods have already altered our view of the extent and complexity of bacterial and eukaryotic transcriptomes, revealing rare transcript isoforms (circular RNAs, RNA chimeras) that could play an important role in their biology. We performed an analysis of chimera formation by four different computational approaches, including a custom designed pipeline, to study the transcriptomes of M. pneumoniae and P. aeruginosa, as well as mixtures of both. We found that rare transcript isoforms detected by conventional pipelines of analysis could be artifacts of the experimental procedure used in the library preparation, and that they are protocol-dependent. By using a customized pipeline we show that optimal library preparation protocol and the pipeline to analyze the results are crucial to identify real chimeric RNAs.
Roles of tRNA in cell wall biosynthesis
Dare, Kiley; Ibba, Michael
2013-01-01
Recent research into various aspects of bacterial metabolism such as cell wall and antibiotic synthesis, degradation pathways, cellular stress, and amino acid biosynthesis has elucidated roles of aminoacyl-transfer ribonucleic acid (aa-tRNA) outside of translation. Although the two enzyme families responsible for cell wall modifications, aminoacyl-phosphatidylglycerol synthases (aaPGSs) and Fem, were discovered some time ago, they have recently become of intense interest for their roles in the antimicrobial resistance of pathogenic microorganisms. The addition of positively charged amino acids to phosphatidylglycerol (PG) by aaPGSs neutralizes the lipid bilayer making the bacteria less susceptible to positively charged antimicrobial agents. Fem transferases utilize aa-tRNA to form peptide bridges that link strands of peptidoglycan. These bridges vary among the bacterial species in which they are present and play a role in resistance to antibiotics that target the cell wall. Additionally, the formation of truncated peptides results in shorter peptide bridges and loss of branched linkages which makes bacteria more susceptible to antimicrobials. A greater understanding of the structure and substrate specificity of this diverse enzymatic family is necessary to aid current efforts in designing potential bactericidal agents. These two enzyme families are linked only by the substrate with which they modify the cell wall, aa-tRNA; their structure, cell wall modification processes and the physiological changes they impart on the bacterium differ greatly. PMID:22262511
Bacterial cellulose synthesis mechanism of facultative anaerobe Enterobacter sp. FY-07.
Ji, Kaihua; Wang, Wei; Zeng, Bing; Chen, Sibin; Zhao, Qianqian; Chen, Yueqing; Li, Guoqiang; Ma, Ting
2016-02-25
Enterobacter sp. FY-07 can produce bacterial cellulose (BC) under aerobic and anaerobic conditions. Three potential BC synthesis gene clusters (bcsI, bcsII and bcsIII) of Enterobacter sp. FY-07 have been predicted using genome sequencing and comparative genome analysis, in which bcsIII was confirmed as the main contributor to BC synthesis by gene knockout and functional reconstitution methods. Protein homology, gene arrangement and gene constitution analysis indicated that bcsIII had high identity to the bcsI operon of Enterobacter sp. 638; however, its arrangement and composition were same as those of BC synthesizing operon of G. xylinum ATCC53582 except for the flanking sequences. According to the BC biosynthesizing process, oxygen is not directly involved in the reactions of BC synthesis, however, energy is required to activate intermediate metabolites and synthesize the activator, c-di-GMP. Comparative transcriptome and metabolite quantitative analysis demonstrated that under anaerobic conditions genes involved in the TCA cycle were downregulated, however, genes in the nitrate reduction and gluconeogenesis pathways were upregulated, especially, genes in three pyruvate metabolism pathways. These results suggested that Enterobacter sp. FY-07 could produce energy efficiently under anaerobic conditions to meet the requirement of BC biosynthesis.
Bacterial cellulose synthesis mechanism of facultative anaerobe Enterobacter sp. FY-07
Ji, Kaihua; Wang, Wei; Zeng, Bing; Chen, Sibin; Zhao, Qianqian; Chen, Yueqing; Li, Guoqiang; Ma, Ting
2016-01-01
Enterobacter sp. FY-07 can produce bacterial cellulose (BC) under aerobic and anaerobic conditions. Three potential BC synthesis gene clusters (bcsI, bcsII and bcsIII) of Enterobacter sp. FY-07 have been predicted using genome sequencing and comparative genome analysis, in which bcsIII was confirmed as the main contributor to BC synthesis by gene knockout and functional reconstitution methods. Protein homology, gene arrangement and gene constitution analysis indicated that bcsIII had high identity to the bcsI operon of Enterobacter sp. 638; however, its arrangement and composition were same as those of BC synthesizing operon of G. xylinum ATCC53582 except for the flanking sequences. According to the BC biosynthesizing process, oxygen is not directly involved in the reactions of BC synthesis, however, energy is required to activate intermediate metabolites and synthesize the activator, c-di-GMP. Comparative transcriptome and metabolite quantitative analysis demonstrated that under anaerobic conditions genes involved in the TCA cycle were downregulated, however, genes in the nitrate reduction and gluconeogenesis pathways were upregulated, especially, genes in three pyruvate metabolism pathways. These results suggested that Enterobacter sp. FY-07 could produce energy efficiently under anaerobic conditions to meet the requirement of BC biosynthesis. PMID:26911736
Zhu, Shifeng; Jeong, Rae-Dong; Lim, Gah-Hyun; Yu, Keshun; Wang, Caixia; Chandra-Shekara, A C; Navarre, Duroy; Klessig, Daniel F; Kachroo, Aardra; Kachroo, Pradeep
2013-09-26
Plant viruses often encode suppressors of host RNA silencing machinery, which occasionally function as avirulence factors that are recognized by host resistance (R) proteins. For example, the Arabidopsis R protein, hypersensitive response to TCV (HRT), recognizes the turnip crinkle virus (TCV) coat protein (CP). HRT-mediated resistance requires the RNA-silencing component double-stranded RNA-binding protein 4 (DRB4) even though it neither is associated with the accumulation of TCV-specific small RNA nor requires the RNA silencing suppressor function of CP. HRT interacts with the cytosolic fraction of DRB4. Interestingly, TCV infection both increases the cytosolic DRB4 pool and inhibits the HRT-DRB4 interaction. The virulent R8A CP derivative, which induces a subset of HRT-derived responses, also disrupts this interaction. The differential localization of DRB4 in the presence of wild-type and R8A CP implies the importance of subcellular compartmentalization of DRB4. The requirement of DRB4 in resistance to bacterial infection suggests a universal role in R-mediated defense signaling. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Potential and use of bacterial small RNAs to combat drug resistance: a systematic review
Liu, Xiaodong; Zhang, Lin; Wong, Sunny Hei; Chan, Matthew TV; Wu, William KK
2017-01-01
Background Over the decades, new antibacterial agents have been developed in an attempt to combat drug resistance, but they remain unsuccessful. Recently, a novel class of bacterial gene expression regulators, bacterial small RNAs (sRNAs), has received increasing attention toward their involvement in antibiotic resistance. This systematic review aimed to discuss the potential of these small molecules as antibacterial drug targets. Methods Two investigators performed a comprehensive search of MEDLINE, EmBase, and ISI Web of Knowledge from inception to October 2016, without restriction on language. We included all in vitro and in vivo studies investigating the role of bacterial sRNA in antibiotic resistance. Risk of bias of the included studies was assessed by a modified guideline of Systematic Review Center for Laboratory Animal Experimentation (SYRCLE). Results Initial search yielded 432 articles. After exclusion of non-original articles, 20 were included in this review. Of these, all studies examined bacterial-type strains only. There were neither relevant in vivo nor clinical studies. The SYRCLE scores ranged from to 5 to 7, with an average of 5.9. This implies a moderate risk of bias. sRNAs influenced the antibiotics susceptibility through modulation of gene expression relevant to efflux pumps, cell wall synthesis, and membrane proteins. Conclusion Preclinical studies on bacterial-type strains suggest that modulation of sRNAs could enhance bacterial susceptibility to antibiotics. Further studies on clinical isolates and in vivo models are needed to elucidate the therapeutic value of sRNA modulation on treatment of multidrug-resistant bacterial infection. PMID:29290689
Direct modulation of T-box riboswitch-controlled transcription by protein synthesis inhibitors
Stamatopoulou, Vassiliki; Apostolidi, Maria; Li, Shuang; Lamprinou, Katerina; Papakyriakou, Athanasios
2017-01-01
Abstract Recently, it was discovered that exposure to mainstream antibiotics activate numerous bacterial riboregulators that control antibiotic resistance genes including metabolite-binding riboswitches and other transcription attenuators. However, the effects of commonly used antibiotics, many of which exhibit RNA-binding properties, on the widespread T-box riboswitches, remain unknown. In Staphylococcus aureus, a species-specific glyS T-box controls the supply of glycine for both ribosomal translation and cell wall synthesis, making it a promising target for next-generation antimicrobials. Here, we report that specific protein synthesis inhibitors could either significantly increase T-box-mediated transcription antitermination, while other compounds could suppress it, both in vitro and in vivo. In-line probing of the full-length T-box combined with molecular modelling and docking analyses suggest that the antibiotics that promote transcription antitermination stabilize the T-box:tRNA complex through binding specific positions on stem I and the Staphylococcal-specific stem Sa. By contrast, the antibiotics that attenuate T-box transcription bind to other positions on stem I and do not interact with stem Sa. Taken together, our results reveal that the transcription of essential genes controlled by T-box riboswitches can be directly modulated by commonly used protein synthesis inhibitors. These findings accentuate the regulatory complexities of bacterial response to antimicrobials that involve multiple riboregulators. PMID:28973457
Revealing the Bacterial Butyrate Synthesis Pathways by Analyzing (Meta)genomic Data
Vital, Marius; Howe, Adina Chuang
2014-01-01
ABSTRACT Butyrate-producing bacteria have recently gained attention, since they are important for a healthy colon and when altered contribute to emerging diseases, such as ulcerative colitis and type II diabetes. This guild is polyphyletic and cannot be accurately detected by 16S rRNA gene sequencing. Consequently, approaches targeting the terminal genes of the main butyrate-producing pathway have been developed. However, since additional pathways exist and alternative, newly recognized enzymes catalyzing the terminal reaction have been described, previous investigations are often incomplete. We undertook a broad analysis of butyrate-producing pathways and individual genes by screening 3,184 sequenced bacterial genomes from the Integrated Microbial Genome database. Genomes of 225 bacteria with a potential to produce butyrate were identified, including many previously unknown candidates. The majority of candidates belong to distinct families within the Firmicutes, but members of nine other phyla, especially from Actinobacteria, Bacteroidetes, Fusobacteria, Proteobacteria, Spirochaetes, and Thermotogae, were also identified as potential butyrate producers. The established gene catalogue (3,055 entries) was used to screen for butyrate synthesis pathways in 15 metagenomes derived from stool samples of healthy individuals provided by the HMP (Human Microbiome Project) consortium. A high percentage of total genomes exhibited a butyrate-producing pathway (mean, 19.1%; range, 3.2% to 39.4%), where the acetyl-coenzyme A (CoA) pathway was the most prevalent (mean, 79.7% of all pathways), followed by the lysine pathway (mean, 11.2%). Diversity analysis for the acetyl-CoA pathway showed that the same few firmicute groups associated with several Lachnospiraceae and Ruminococcaceae were dominating in most individuals, whereas the other pathways were associated primarily with Bacteroidetes. PMID:24757212
Hiramatsu, K; Harada, K; Tsuneyama, K; Sasaki, M; Fujita, S; Hashimoto, T; Kaneko, S; Kobayashi, K; Nakanuma, Y
2000-07-01
The etiopathogenesis of bile duct lesion in primary biliary cirrhosis is unknown, though the participation of bacteria and/or their components and products is suspected. In this study, we tried to detect and identify bacteria in the bile of patients with primary biliary cirrhosis by polymerase chain reaction using universal bacterial primers of the 16S ribosomal RNA gene. Gallbladder bile samples from 15 patients with primary biliary cirrhosis, 5 with primary sclerosing cholangitis, 5 with hepatitis C virus-related liver cirrhosis, 11 with cholecystolithiasis, and from 12 normal adult gallbladders were used. In addition to the culture study, partial bacterial 16S ribosomal RNA gene was amplified by polymerase chain reaction (PCR) taking advantage of universal primers that can amplify the gene of almost all bacterial species, and the amplicons were cloned and sequenced. Sequence homology with specific bacterial species was analyzed by database research. Bacterial contamination at every step of the bile sampling, DNA extraction and PCR study was avoided. Furthermore, to confirm whether bacterial DNA is detectable in liver explants, the same analysis was performed using 10 liver explants of patients with primary biliary cirrhosis. In primary biliary cirrhosis, 75% (p<0.0001) of 100 clones were identified as so-called gram-positive cocci while these cocci were positive in only 5% in cholecystolithiasis (p<0.0001). In cholecystolithiasis gram-negative rods were predominant instead. One bacterial species detected in a normal adult was not related to those detected in primary biliary cirrhosis and cholecystolithiasis patients. No bacterial DNA was detected by PCR amplification in 10 liver explants of patients with primary biliary cirrhosis. The present results raise several possible roles of gram-positive bacteria in bile in the etiopathogenesis of primary biliary cirrhosis. However, these results could also reflect an epiphenomenon due to decreased bile flow in the
Nogales, Balbina; Moore, Edward R. B.; Llobet-Brossa, Enrique; Rossello-Mora, Ramon; Amann, Rudolf; Timmis, Kenneth N.
2001-01-01
The bacterial diversity assessed from clone libraries prepared from rRNA (two libraries) and ribosomal DNA (rDNA) (one library) from polychlorinated biphenyl (PCB)-polluted soil has been analyzed. A good correspondence of the community composition found in the two types of library was observed. Nearly 29% of the cloned sequences in the rDNA library were identical to sequences in the rRNA libraries. More than 60% of the total cloned sequence types analyzed were grouped in phylogenetic groups (a clone group with sequence similarity higher than 97% [98% for Burkholderia and Pseudomonas-type clones]) represented in both types of libraries. Some of those phylogenetic groups, mostly represented by a single (or pair) of cloned sequence type(s), were observed in only one of the types of library. An important difference between the libraries was the lack of clones representative of the Actinobacteria in the rDNA library. The PCB-polluted soil exhibited a high bacterial diversity which included representatives of two novel lineages. The apparent abundance of bacteria affiliated to the beta-subclass of the Proteobacteria, and to the genus Burkholderia in particular, was confirmed by fluorescence in situ hybridization analysis. The possible influence on apparent diversity of low template concentrations was assessed by dilution of the RNA template prior to amplification by reverse transcription-PCR. Although differences in the composition of the two rRNA libraries obtained from high and low RNA concentrations were observed, the main components of the bacterial community were represented in both libraries, and therefore their detection was not compromised by the lower concentrations of template used in this study. PMID:11282645
RNA metabolism in the regulation of protein synthesis in plants. Progress report, 1975-1979
DOE Office of Scientific and Technical Information (OSTI.GOV)
Key, J L
1979-01-01
The major objectives of the research for the contract period covered by this report were (1) to gain an insight into the sequence organization of the DNA of soybean, emphasizing the arrangement of single copy or unique sequences and repetitive sequences of DNA throughout the genome, (2) to characterize soybean RNAs relative to nucleotide sequence complexity and kinetics of synthesis and turnover of poly A/sup +/ mRNA, and (3) to study ribosomal proteins directed to an analysis of possible changes in proteins which relate to the activation of 80S ribosomes and thus mRNA utilization and protein synthesis in response tomore » environmental stimuli. Even with greatly reduced funding compared to that requested, objectives 1 and 2 were substantially accomplished. Because of reduced funding and the 20-month no cost extension, relatively little progress was made on objective 3. Accordingly objectives 1 and 2 will be summarized in some detail; a brief account of progress is presented on objective 3.« less
Fluorescent pyrimidine ribonucleotide: synthesis, enzymatic incorporation and utilization
Srivatsan, Seergazhi G.
2008-01-01
Fluorescent nucleobase analogs that respond to changes in their microenvironment are valuable for studying RNA structure, dynamics and recognition. The most commonly used fluorescent ribonucleoside is 2-aminopurine, a highly responsive purine analog. Responsive isosteric fluorescent pyrimidine analogs are, however, rare. Appending 5-membered aromatic heterocycles at the 5-position on a pyrimidine core has recently been found to provide a family of responsive fluorescent nucleoside analogs with emission in the visible range. To explore the potential utility of this chromophore for studying RNA–ligand interactions, an efficient incorporation method is necessary. Here we describe the synthesis of the furan-containing ribonucleoside and its triphosphate, as well as their basic photophysical characteristics. We demonstrate that T7 RNA polymerase accepts this fluorescent ribonucleoside triphosphate as a substrate in in vitro transcription reactions and very efficiently incorporates it into RNA oligonucleotides, generating fluorescent constructs. Furthermore, we utilize this triphosphate for the enzymatic preparation of a fluorescent bacterial A-site, an RNA construct of potential therapeutic utility. We show that the binding of this RNA target to aminoglycoside antibiotics, its cognate ligands, can be effectively monitored by fluorescence spectroscopy. These observations are significant since isosteric emissive U derivatives are scarce and the trivial synthesis and effective enzymatic incorporation of the furan-containing U triphosphate make it accessible to the biophysical community. PMID:17256858
Sanz, Miguel A; García-Moreno, Manuel; Carrasco, Luis
2015-04-01
Infection of mammalian cells by Sindbis virus (SINV) profoundly blocks cellular mRNA translation. Experimental evidence points to viral non-structural proteins (nsPs), in particular nsP2, as the mediator of this inhibition. However, individual expression of nsP1, nsP2, nsP3 or nsP1-4 does not block cellular protein synthesis in BHK cells. Trans-complementation of a defective SINV replicon lacking most of the coding region for nsPs by the co-expression of nsP1-4 propitiates viral RNA replication at low levels, and inhibition of cellular translation is not observed. Exit of nuclear proteins including T-cell intracellular antigen and polypyrimidine tract-binding protein is clearly detected in SINV-infected cells, but not upon the expression of nsPs, even when the defective replicon was complemented. Analysis of a SINV variant with a point mutation in nsP2, exhibiting defects in the shut-off of host protein synthesis, indicates that both viral RNA replication and the release of nuclear proteins to the cytoplasm are greatly inhibited. Furthermore, nucleoside analogues that inhibit cellular and viral RNA synthesis impede the blockade of host mRNA translation, in addition to the release of nuclear proteins. Prevention of the shut-off of host mRNA translation by nucleoside analogues is not due to the inhibition of eIF2α phosphorylation, as this prevention is also observed in PKR(-/-) mouse embryonic fibroblasts that do not phosphorylate eIF2α after SINV infection. Collectively, our observations are consistent with the concept that for the inhibition of cellular protein synthesis to occur, viral RNA replication must take place at control levels, leading to the release of nuclear proteins to the cytoplasm. © 2014 John Wiley & Sons Ltd.
Denef, Vincent J.; Fujimoto, Masanori; Berry, Michelle A.; ...
2016-04-29
Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP). Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA genemore » sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate) water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. Furthermore, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Denef, Vincent J.; Fujimoto, Masanori; Berry, Michelle A.
Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP). Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA genemore » sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate) water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. Furthermore, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors.« less
A method for detecting genetic toxicity using the RNA synthesis response to DNA damage.
Morita, Yoko; Iwai, Shigenori; Kuraoka, Isao
2011-10-01
To date, biological risk assessment studies of chemicals that induce DNA lesions have been primarily based on the action of DNA polymerases during replication. However, DNA lesions interfere not only with replication but also with transcription. Therefore, detecting the damaging effects of DNA lesions during transcription might be important for estimating the safety of chemical mutagens and carcinogens. However, methods to address these effects have not been developed. Here, we report a simple, non-isotopic method for determining the toxicity of chemical agents by visualizing transcription in a mammalian cell system. The method is based on the measurement of the incorporation of bromouridine (as the uridine analogue) into the nascent RNA during RNA synthesis inhibition (RSI) induced by the stalling of RNA polymerases at DNA lesions on the transcribed DNA strand, which triggers transcription-coupled nucleotide excision repair (TC-NER). When we tested chemical agents (camptothecin, etoposide, 4-nitroquinoline-1-oxide, mitomycin C, methyl methanesulfonate, and cisplatin) in HeLa cells by the method, RSI indicative of genomic toxicity was observed in the nucleoli of the tested cells. This procedure provides the following advantages: 1) it uses common, affordable mammalian cells (HeLa cells, WI38VA13 cells, human dermal fibroblasts, or Chinese hamster ovary cells) rather than genetically modified microorganisms; 2) it can be completed within approximately 8 hr after the cells are prepared because RNA polymerase responses during TC-NER are faster than other DNA damage responses (replication, recombination, and apoptosis); and 3) it is safe because it uses non-radioactive bromouridine and antibodies to detect RNA synthesis on undamaged transcribed DNA strands.
NASA Technical Reports Server (NTRS)
Ertem, G.; Ferris, J. P.
1997-01-01
The synthesis of oligoguanylates [oligo(G)s] is catalyzed by a template of oligocytidylates [oligo(C)s] containing 2',5'- and 3',5'-linked phosphodiester bonds with and without incorporated C5'ppC groupings. An oligo(C) template containing exclusively 2',5'-phosphodiester bonds also serves as a template for the synthesis of complementary oligo(G)s. The oligo(C) template was prepared by the condensation of the 5'-phosphorimidazolide of cytidine on montmorillonite clay. These studies establish that RNA oligomers prepared by mineral catalysis, or other routes on the primitive earth, did not have to be exclusively 3',5'-linked to catalyze template-directed synthesis, since oligo(C)s containing a variety of linkage isomers serve as templates for the formation of complementary oligo(G)s. These findings support the postulate that origin of the RNA world was initiated by the RNA oligomers produced by polymerization of activated monomers formed by prebiotic processes.
Laquel, P.; Litvak, S.; Castroviejo, M.
1994-01-01
DNA primase synthesizes short RNA primers used by DNA polymerases to initiate DNA synthesis. Two proteins of approximately 60 and 50 kD were recognized by specific antibodies raised against yeast primase subunits, suggesting a high degree of analogy between wheat and yeast primase subunits. Gel-filtration chromatography of wheat primase showed two active forms of 60 and 110 to 120 kD. Ultraviolet-induced cross-linking with radioactive oligothymidilate revealed a highly labeled protein of 60 kD. After limited trypsin digestion of wheat (Triticum aestivum L.) primase, a major band of 48 kD and two minor bands of 38 and 17 kD were observed. In the absence of DNA polymerases, the purified primase synthesizes long RNA products. The size of the RNA product synthesized by wheat primase is considerably reduced by the presence of DNA polymerases, suggesting a modulatory effect of the association between these two enzymes. Lowering the primase concentration in the assay also favored short RNA primer synthesis. Several properties of the wheat DNA primase using oligoadenylate [oligo(rA)]-primed or unprimed polythymidilate templates were studied. The ability of wheat primase, without DNA polymerases, to elongate an oligo(rA) primer to long RNA products depends on the primer size, temperature, and the divalent cation concentration. Thus, Mn2+ ions led to long RNA products in a very wide range of concentrations, whereas with Mg2+ long products were observed around 15 mM. We studied the ability of purified wheat DNA polymerases to initiate DNA synthesis from an RNA primer: wheat DNA polymerase A showed the highest activity, followed by DNA polymerases B and CII, whereas DNA polymerase CI was unable to initiate DNA synthesis from an RNA primer. Results are discussed in terms of understanding the role of these polymerases in DNA replication in plants. PMID:12232187
Riboregulation of bacterial and archaeal transposition.
Ellis, Michael J; Haniford, David B
2016-05-01
The coexistence of transposons with their hosts depends largely on transposition levels being tightly regulated to limit the mutagenic burden associated with frequent transposition. For 'DNA-based' (class II) bacterial transposons there is growing evidence that regulation through small noncoding RNAs and/or the RNA-binding protein Hfq are prominent mechanisms of defense against transposition. Recent transcriptomics analyses have identified many new cases of antisense RNAs (asRNA) that potentially could regulate the expression of transposon-encoded genes giving the impression that asRNA regulation of DNA-based transposons is much more frequent than previously thought. Hfq is a highly conserved bacterial protein that plays a central role in posttranscriptional gene regulation and stress response pathways in many bacteria. Three different mechanisms for Hfq-directed control of bacterial transposons have been identified to date highlighting the versatility of this protein as a regulator of bacterial transposons. There is also evidence emerging that some DNA-based transposons encode RNAs that could regulate expression of host genes. In the case of IS200, which appears to have lost its ability to transpose, contributing a regulatory RNA to its host could account for the persistence of this mobile element in a wide range of bacterial species. It remains to be seen how prevalent these transposon-encoded RNA regulators are, but given the relatively large amount of intragenic transcription in bacterial genomes, it would not be surprising if new examples are forthcoming. WIREs RNA 2016, 7:382-398. doi: 10.1002/wrna.1341 For further resources related to this article, please visit the WIREs website. © 2016 Wiley Periodicals, Inc.
Crowe, Michael A; Sutherland, John D
2006-06-01
A robust and prebiotically plausible synthesis of RNA is a key requirement of the "RNA World" hypothesis, but, to date, no such synthesis has been demonstrated. Monomer synthesis strategies involving attachment of preformed nucleobases to sugars have failed, and, even if activated 5'-nucleotides could be made, the hydrolysis of these intermediates in water makes their efficient oligomerisation appear unlikely. We recently reported a synthesis of cytidine-2',3'-cyclic phosphate 1 (C>p) in which the nucleobase was assembled in stages on a sugar-phosphate template. However, 2',3'-cyclic nucleotides (N>p's) also undergo hydrolysis, in this case giving a mixture of the 2'- and 3'-monophosphates. This hydrolysis has previously been seen as making the, otherwise promising, oligomerisation of N>p's seem as unlikely as that of the 5'-activated nucleotides. We now find that cyanoacetylene, the reagent used for the second stage of nucleobase assembly in the synthesis of C>p, also reverses the effect of the hydrolysis by driving efficient cyclisation of C2'p and C3'p back to C>p. Excess cyanoacetylene also derivatises the nucleobase, but this modification is reversible at neutral pH. These findings significantly strengthen the case for N>p's in a prebiotic synthesis of RNA.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Niyogi, S.K.; Mitra, S.
Escherichia coli RNA polymerase binds specifically to the single-stranded circular DNA of coliphage M13 in the presence of a saturating concentration of the bacterial DNA binding protein presumably as an essential step in the synthesis of the RNA primer required for synthesizing the complementary DNA strand in parental replicative-form DNA. The RNA polymerase-protected DNA regions were isolated after extensive digestion with pancreatic DNase, S1 endonuclease of Aspergillus oryzae, and exonuclease I of E. coli. The physicochemical properties of the RNA polymerase-protected segments (called PI and PII) were compared with those of the naturally occurring hairpin regions.
Pilhofer, Martin; Rappl, Kristina; Eckl, Christina; Bauer, Andreas Peter; Ludwig, Wolfgang; Schleifer, Karl-Heinz; Petroni, Giulio
2008-01-01
In the past, studies on the relationships of the bacterial phyla Planctomycetes, Chlamydiae, Lentisphaerae, and Verrucomicrobia using different phylogenetic markers have been controversial. Investigations based on 16S rRNA sequence analyses suggested a relationship of the four phyla, showing the branching order Planctomycetes, Chlamydiae, Verrucomicrobia/Lentisphaerae. Phylogenetic analyses of 23S rRNA genes in this study also support a monophyletic grouping and their branching order—this grouping is significant for understanding cell division, since the major bacterial cell division protein FtsZ is absent from members of two of the phyla Chlamydiae and Planctomycetes. In Verrucomicrobia, knowledge about cell division is mainly restricted to the recent report of ftsZ in the closely related genera Prosthecobacter and Verrucomicrobium. In this study, genes of the conserved division and cell wall (dcw) cluster (ddl, ftsQ, ftsA, and ftsZ) were characterized in all verrucomicrobial subdivisions (1 to 4) with cultivable representatives (1 to 4). Sequence analyses and transcriptional analyses in Verrucomicrobia and genome data analyses in Lentisphaerae suggested that cell division is based on FtsZ in all verrucomicrobial subdivisions and possibly also in the sister phylum Lentisphaerae. Comprehensive sequence analyses of available genome data for representatives of Verrucomicrobia, Lentisphaerae, Chlamydiae, and Planctomycetes strongly indicate that their last common ancestor possessed a conserved, ancestral type of dcw gene cluster and an FtsZ-based cell division mechanism. This implies that Planctomycetes and Chlamydiae may have shifted independently to a non-FtsZ-based cell division mechanism after their separate branchings from their last common ancestor with Verrucomicrobia. PMID:18310338
Liang, Jichao; Luo, Ailing; Wang, Lingqian; Zhu, Jing; Xiong, Huayu; Chen, Yong
2017-01-01
Efficient and safe nonviral gene delivery systems are a prerequisite for the clinical application of therapeutic genes. In this paper, polyethyleneimine-capped silver nanoclusters (PEI-AgNCs) were prepared for the purpose of microRNA (miRNA) delivery. The resultant PEI-AgNCs were characterized by a photoluminescence assay and transmission electron microscopy. A cytotoxicity assay showed that PEI-AgNCs exhibit relatively low cytotoxicity. Interestingly, PEI-AgNCs were confirmed to transfect miRNA mimics more effectively than PEI in HepG2 and 293A cells. In this regard, hsa-miR-21 or hsa-miR-221 mimics (miR-21/221m) were transported into HepG2 cells by using PEI-AgNCs. The miR-21/221 expression was determined post-transfection by quantitative real-time polymerase chain reaction. Compared with the negative control, PEI-AgNCs/miR-21/221m groups exhibited higher miR-21/221 levels. In addition, AgNCs endow PEI with stronger antibacterial activity, and this advantage provided PEI-AgNCs the potential to prevent bacterial contamination during the transfection process. Furthermore, we showed that PEI-AgNCs are viable nanomaterials for plain imaging of the cells by laser scanning confocal microscopy, indicating great potential as an ideal fluorescent probe to track the transfection behavior. These results demonstrated that PEI-AgNCs are promising and novel nonviral vectors for gene delivery. PMID:29238194
Methylated nucleosides in tRNA and tRNA methyltransferases
Hori, Hiroyuki
2014-01-01
To date, more than 90 modified nucleosides have been found in tRNA and the biosynthetic pathways of the majority of tRNA modifications include a methylation step(s). Recent studies of the biosynthetic pathways have demonstrated that the availability of methyl group donors for the methylation in tRNA is important for correct and efficient protein synthesis. In this review, I focus on the methylated nucleosides and tRNA methyltransferases. The primary functions of tRNA methylations are linked to the different steps of protein synthesis, such as the stabilization of tRNA structure, reinforcement of the codon-anticodon interaction, regulation of wobble base pairing, and prevention of frameshift errors. However, beyond these basic functions, recent studies have demonstrated that tRNA methylations are also involved in the RNA quality control system and regulation of tRNA localization in the cell. In a thermophilic eubacterium, tRNA modifications and the modification enzymes form a network that responses to temperature changes. Furthermore, several modifications are involved in genetic diseases, infections, and the immune response. Moreover, structural, biochemical, and bioinformatics studies of tRNA methyltransferases have been clarifying the details of tRNA methyltransferases and have enabled these enzymes to be classified. In the final section, the evolution of modification enzymes is discussed. PMID:24904644
Helbling, Damian E; Johnson, David R; Lee, Tae Kwon; Scheidegger, Andreas; Fenner, Kathrin
2015-03-01
The rates at which wastewater treatment plant (WWTP) microbial communities biotransform specific substrates can differ by orders of magnitude among WWTP communities. Differences in taxonomic compositions among WWTP communities may predict differences in the rates of some types of biotransformations. In this work, we present a novel framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates. We selected ten WWTPs with substantial variation in their environmental and operational metrics and measured the in situ ammonia biotransformation rate constants in nine of them. We isolated total RNA from samples from each WWTP and analyzed 16S rRNA sequence reads. We then developed multivariate models between the measured abundances of specific bacterial 16S rRNA sequence reads and the ammonia biotransformation rate constants. We constructed model scenarios that systematically explored the effects of model regularization, model linearity and non-linearity, and aggregation of 16S rRNA sequences into operational taxonomic units (OTUs) as a function of sequence dissimilarity threshold (SDT). A large percentage (greater than 80%) of model scenarios resulted in well-performing and significant models at intermediate SDTs of 0.13-0.14 and 0.26. The 16S rRNA sequences consistently selected into the well-performing and significant models at those SDTs were classified as Nitrosomonas and Nitrospira groups. We then extend the framework by applying it to the biotransformation rate constants of ten micropollutants measured in batch reactors seeded with the ten WWTP communities. We identified phylogenetic groups that were robustly selected into all well-performing and significant models constructed with biotransformation rates of isoproturon, propachlor, ranitidine, and venlafaxine. These phylogenetic groups can be used as predictive biomarkers of WWTP microbial community activity towards these specific
Han, Kook; Tjaden, Brian; Lory, Stephen
2017-01-01
The first step in the post-transcriptional regulatory function of most bacterial small non-coding RNAs (sRNAs) is base-pairing with partially complementary sequences of targeted transcripts. We present a simple method for identifying sRNA targets in vivo and defining processing sites of the regulated transcripts. The technique (referred to as GRIL-Seq) is based on preferential ligation of sRNAs to ends of base-paired targets in bacteria co-expressing T4 RNA ligase, followed by sequencing to identify the chimeras. In addition to the RNA chaperone Hfq, the GRIL-Seq method depends on the activity of the pyrophosphorylase RppH. Using PrrF1, an iron-regulated sRNA in Pseudomonas aeruginosa, we demonstrate that direct regulatory targets of this sRNA can be readily identified. Therefore, GRIL-Seq represents a powerful tool not only for identifying direct targets of sRNAs in a variety of environments, but can also result in uncovering novel roles for sRNAs and their targets in complex regulatory networks. PMID:28005055
Beyer, Dieter; Kroll, Hein-Peter; Endermann, Rainer; Schiffer, Guido; Siegel, Stephan; Bauser, Marcus; Pohlmann, Jens; Brands, Michael; Ziegelbauer, Karl; Haebich, Dieter; Eymann, Christine; Brötz-Oesterhelt, Heike
2004-01-01
Phenylalanyl (Phe)-tRNA synthetase (Phe-RS) is an essential enzyme which catalyzes the transfer of phenylalanine to the Phe-specific transfer RNA (tRNAPhe), a key step in protein biosynthesis. Phenyl-thiazolylurea-sulfonamides were identified as a novel class of potent inhibitors of bacterial Phe-RS by high-throughput screening and chemical variation of the screening hit. The compounds inhibit Phe-RS of Escherichia coli, Haemophilus influenzae, Streptococcus pneumoniae, and Staphylococcus aureus, with 50% inhibitory concentrations in the nanomolar range. Enzyme kinetic measurements demonstrated that the compounds bind competitively with respect to the natural substrate Phe. All derivatives are highly selective for the bacterial Phe-RS versus the corresponding mammalian cytoplasmic and human mitochondrial enzymes. Phenyl-thiazolylurea-sulfonamides displayed good in vitro activity against Staphylococcus, Streptococcus, Haemophilus, and Moraxella strains, reaching MICs below 1 μg/ml. The antibacterial activity was partly antagonized by increasing concentrations of Phe in the culture broth in accordance with the competitive binding mode. Further evidence that inhibition of tRNAPhe charging is the antibacterial principle of this compound class was obtained by proteome analysis of Bacillus subtilis. Here, the phenyl-thiazolylurea-sulfonamides induced a protein pattern indicative of the stringent response. In addition, an E. coli strain carrying a relA mutation and defective in stringent response was more susceptible than its isogenic relA+ parent strain. In vivo efficacy was investigated in a murine S. aureus sepsis model and a S. pneumoniae sepsis model in rats. Treatment with the phenyl-thiazolylurea-sulfonamides reduced the bacterial titer in various organs by up to 3 log units, supporting the potential value of Phe-RS as a target in antibacterial therapy. PMID:14742205
Initiation, extension, and termination of RNA synthesis by a paramyxovirus polymerase.
Jordan, Paul C; Liu, Cheng; Raynaud, Pauline; Lo, Michael K; Spiropoulou, Christina F; Symons, Julian A; Beigelman, Leo; Deval, Jerome
2018-02-01
Paramyxoviruses represent a family of RNA viruses causing significant human diseases. These include measles virus, the most infectious virus ever reported, in addition to parainfluenza virus, and other emerging viruses. Paramyxoviruses likely share common replication machinery but their mechanisms of RNA biosynthesis activities and details of their complex polymerase structures are unknown. Mechanistic and functional details of a paramyxovirus polymerase would have sweeping implications for understanding RNA virus replication and for the development of new antiviral medicines. To study paramyxovirus polymerase structure and function, we expressed an active recombinant Nipah virus (NiV) polymerase complex assembled from the multifunctional NiV L protein bound to its phosphoprotein cofactor. NiV is an emerging highly pathogenic virus that causes severe encephalitis and has been declared a global public health concern due to its high mortality rate. Using negative-stain electron microscopy, we demonstrated NiV polymerase forms ring-like particles resembling related RNA polymerases. We identified conserved sequence elements driving recognition of the 3'-terminal genomic promoter by NiV polymerase, and leading to initiation of RNA synthesis, primer extension, and transition to elongation mode. Polyadenylation resulting from NiV polymerase stuttering provides a mechanistic basis for transcription termination. It also suggests a divergent adaptation in promoter recognition between pneumo- and paramyxoviruses. The lack of available antiviral therapy for NiV prompted us to identify the triphosphate forms of R1479 and GS-5734, two clinically relevant nucleotide analogs, as substrates and inhibitors of NiV polymerase activity by delayed chain termination. Overall, these findings provide low-resolution structural details and the mechanism of an RNA polymerase from a previously uncharacterized virus family. This work illustrates important functional differences yet remarkable
RNA binding and replication by the poliovirus RNA polymerase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oberste, M.S.
1988-01-01
RNA binding and RNA synthesis by the poliovirus RNA-dependent RNA polymerase were studied in vitro using purified polymerase. Templates for binding and RNA synthesis studies were natural RNAs, homopolymeric RNAs, or subgenomic poliovirus-specific RNAs synthesized in vitro from cDNA clones using SP6 or T7 RNA polymerases. The binding of the purified polymerase to poliovirion and other RNAs was studied using a protein-RNA nitrocellulose filter binding assay. A cellular poly(A)-binding protein was found in the viral polymerase preparations, but was easily separated from the polymerase by chromatography on poly(A) Sepharose. The binding of purified polymerase to {sup 32}P-labeled ribohomopolymeric RNAs wasmore » examined, and the order of binding observed was poly(G) >>> poly(U) > poly(C) > poly(A). The K{sub a} for polymerase binding to poliovirion RNA and to a full-length negative strand transcript was about 1 {times} 10{sup 9} M{sup {minus}1}. The polymerase binds to a subgenomic RNAs which contain the 3{prime} end of the genome with a K{sub a} similar to that for virion RNA, but binds less well to 18S rRNA, globin mRNA, and subgenomic RNAs which lack portions of the 3{prime} noncoding region.« less
Han, Kook; Tjaden, Brian; Lory, Stephen
2016-12-22
The first step in the post-transcriptional regulatory function of most bacterial small non-coding RNAs (sRNAs) is base pairing with partially complementary sequences of targeted transcripts. We present a simple method for identifying sRNA targets in vivo and defining processing sites of the regulated transcripts. The technique, referred to as global small non-coding RNA target identification by ligation and sequencing (GRIL-seq), is based on preferential ligation of sRNAs to the ends of base-paired targets in bacteria co-expressing T4 RNA ligase, followed by sequencing to identify the chimaeras. In addition to the RNA chaperone Hfq, the GRIL-seq method depends on the activity of the pyrophosphorylase RppH. Using PrrF1, an iron-regulated sRNA in Pseudomonas aeruginosa, we demonstrated that direct regulatory targets of this sRNA can readily be identified. Therefore, GRIL-seq represents a powerful tool not only for identifying direct targets of sRNAs in a variety of environments, but also for uncovering novel roles for sRNAs and their targets in complex regulatory networks.
Structural Characterization of an Alternative Mode of Tigecycline Binding to the Bacterial Ribosome
Schedlbauer, Andreas; Kaminishi, Tatsuya; Ochoa-Lizarralde, Borja; Dhimole, Neha; Zhou, Shu; López-Alonso, Jorge P.
2015-01-01
Although both tetracycline and tigecycline inhibit protein synthesis by sterically hindering the binding of tRNA to the ribosomal A site, tigecycline shows increased efficacy in both in vitro and in vivo activity assays and escapes the most common resistance mechanisms associated with the tetracycline class of antibiotics. These differences in activities are attributed to the tert-butyl-glycylamido side chain found in tigecycline. Our structural analysis by X-ray crystallography shows that tigecycline binds the bacterial 30S ribosomal subunit with its tail in an extended conformation and makes extensive interactions with the 16S rRNA nucleotide C1054. These interactions restrict the mobility of C1054 and contribute to the antimicrobial activity of tigecycline, including its resistance to the ribosomal protection proteins. PMID:25753625
Keller, Peter M.; Rampini, Silvana K.; Bloemberg, Guido V.
2010-01-01
We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis. PMID:20392909
Sroubek, Jakub; Krishnan, Yamini; McDonald, Thomas V.
2013-01-01
Human ether-á-gogo-related gene (HERG) encodes a potassium channel that is highly susceptible to deleterious mutations resulting in susceptibility to fatal cardiac arrhythmias. Most mutations adversely affect HERG channel assembly and trafficking. Why the channel is so vulnerable to missense mutations is not well understood. Since nothing is known of how mRNA structural elements factor in channel processing, we synthesized a codon-modified HERG cDNA (HERG-CM) where the codons were synonymously changed to reduce GC content, secondary structure, and rare codon usage. HERG-CM produced typical IKr-like currents; however, channel synthesis and processing were markedly different. Translation efficiency was reduced for HERG-CM, as determined by heterologous expression, in vitro translation, and polysomal profiling. Trafficking efficiency to the cell surface was greatly enhanced, as assayed by immunofluorescence, subcellular fractionation, and surface labeling. Chimeras of HERG-NT/CM indicated that trafficking efficiency was largely dependent on 5′ sequences, while translation efficiency involved multiple areas. These results suggest that HERG translation and trafficking rates are independently governed by noncoding information in various regions of the mRNA molecule. Noncoding information embedded within the mRNA may play a role in the pathogenesis of hereditary arrhythmia syndromes and could provide an avenue for targeted therapeutics.—Sroubek, J., Krishnan, Y., McDonald, T V. Sequence- and structure-specific elements of HERG mRNA determine channel synthesis and trafficking efficiency. PMID:23608144
Johnson, Christopher M; Chen, Yuqing; Lee, Heejin; Ke, Ailong; Weaver, Keith E; Dunny, Gary M
2014-03-04
Anti-Q is a small RNA encoded on pCF10, an antibiotic resistance plasmid of Enterococcus faecalis, which negatively regulates conjugation of the plasmid. In this study we sought to understand how Anti-Q is generated relative to larger transcripts of the same operon. We found that Anti-Q folds into a branched structure that functions as a factor-independent terminator. In vitro and in vivo, termination is dependent on the integrity of this structure as well as the presence of a 3' polyuridine tract, but is not dependent on other downstream sequences. In vitro, terminated transcripts are released from RNA polymerase after synthesis. In vivo, a mutant with reduced termination efficiency demonstrated loss of tight control of conjugation function. A search of bacterial genomes revealed the presence of sequences that encode Anti-Q-like RNA structures. In vitro and in vivo experiments demonstrated that one of these functions as a terminator. This work reveals a previously unappreciated flexibility in the structure of factor-independent terminators and identifies a mechanism for generation of functional small RNAs; it should also inform annotation of bacterial sequence features, such as terminators, functional sRNAs, and operons.
Johnson, Christopher M.; Chen, Yuqing; Lee, Heejin; Ke, Ailong; Weaver, Keith E.; Dunny, Gary M.
2014-01-01
Anti-Q is a small RNA encoded on pCF10, an antibiotic resistance plasmid of Enterococcus faecalis, which negatively regulates conjugation of the plasmid. In this study we sought to understand how Anti-Q is generated relative to larger transcripts of the same operon. We found that Anti-Q folds into a branched structure that functions as a factor-independent terminator. In vitro and in vivo, termination is dependent on the integrity of this structure as well as the presence of a 3′ polyuridine tract, but is not dependent on other downstream sequences. In vitro, terminated transcripts are released from RNA polymerase after synthesis. In vivo, a mutant with reduced termination efficiency demonstrated loss of tight control of conjugation function. A search of bacterial genomes revealed the presence of sequences that encode Anti-Q–like RNA structures. In vitro and in vivo experiments demonstrated that one of these functions as a terminator. This work reveals a previously unappreciated flexibility in the structure of factor-independent terminators and identifies a mechanism for generation of functional small RNAs; it should also inform annotation of bacterial sequence features, such as terminators, functional sRNAs, and operons. PMID:24550474
Direct modulation of T-box riboswitch-controlled transcription by protein synthesis inhibitors.
Stamatopoulou, Vassiliki; Apostolidi, Maria; Li, Shuang; Lamprinou, Katerina; Papakyriakou, Athanasios; Zhang, Jinwei; Stathopoulos, Constantinos
2017-09-29
Recently, it was discovered that exposure to mainstream antibiotics activate numerous bacterial riboregulators that control antibiotic resistance genes including metabolite-binding riboswitches and other transcription attenuators. However, the effects of commonly used antibiotics, many of which exhibit RNA-binding properties, on the widespread T-box riboswitches, remain unknown. In Staphylococcus aureus, a species-specific glyS T-box controls the supply of glycine for both ribosomal translation and cell wall synthesis, making it a promising target for next-generation antimicrobials. Here, we report that specific protein synthesis inhibitors could either significantly increase T-box-mediated transcription antitermination, while other compounds could suppress it, both in vitro and in vivo. In-line probing of the full-length T-box combined with molecular modelling and docking analyses suggest that the antibiotics that promote transcription antitermination stabilize the T-box:tRNA complex through binding specific positions on stem I and the Staphylococcal-specific stem Sa. By contrast, the antibiotics that attenuate T-box transcription bind to other positions on stem I and do not interact with stem Sa. Taken together, our results reveal that the transcription of essential genes controlled by T-box riboswitches can be directly modulated by commonly used protein synthesis inhibitors. These findings accentuate the regulatory complexities of bacterial response to antimicrobials that involve multiple riboregulators. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Impact of training sets on classification of high-throughput bacterial 16s rRNA gene surveys
Werner, Jeffrey J; Koren, Omry; Hugenholtz, Philip; DeSantis, Todd Z; Walters, William A; Caporaso, J Gregory; Angenent, Largus T; Knight, Rob; Ley, Ruth E
2012-01-01
Taxonomic classification of the thousands–millions of 16S rRNA gene sequences generated in microbiome studies is often achieved using a naïve Bayesian classifier (for example, the Ribosomal Database Project II (RDP) classifier), due to favorable trade-offs among automation, speed and accuracy. The resulting classification depends on the reference sequences and taxonomic hierarchy used to train the model; although the influence of primer sets and classification algorithms have been explored in detail, the influence of training set has not been characterized. We compared classification results obtained using three different publicly available databases as training sets, applied to five different bacterial 16S rRNA gene pyrosequencing data sets generated (from human body, mouse gut, python gut, soil and anaerobic digester samples). We observed numerous advantages to using the largest, most diverse training set available, that we constructed from the Greengenes (GG) bacterial/archaeal 16S rRNA gene sequence database and the latest GG taxonomy. Phylogenetic clusters of previously unclassified experimental sequences were identified with notable improvements (for example, 50% reduction in reads unclassified at the phylum level in mouse gut, soil and anaerobic digester samples), especially for phylotypes belonging to specific phyla (Tenericutes, Chloroflexi, Synergistetes and Candidate phyla TM6, TM7). Trimming the reference sequences to the primer region resulted in systematic improvements in classification depth, and greatest gains at higher confidence thresholds. Phylotypes unclassified at the genus level represented a greater proportion of the total community variation than classified operational taxonomic units in mouse gut and anaerobic digester samples, underscoring the need for greater diversity in existing reference databases. PMID:21716311
Maddocks, Oliver D.K.; Labuschagne, Christiaan F.; Adams, Peter D.; Vousden, Karen H.
2016-01-01
Summary Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids. PMID:26774282
Maddocks, Oliver D K; Labuschagne, Christiaan F; Adams, Peter D; Vousden, Karen H
2016-01-21
Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Fuentes, Eduardo N; Zuloaga, Rodrigo; Nardocci, Gino; Fernandez de la Reguera, Catalina; Simonet, Nicolas; Fumeron, Robinson; Valdes, Juan Antonio; Molina, Alfredo; Alvarez, Marco
2014-01-01
Ribosomal biogenesis controls cellular growth in living organisms, with the rate-limiting step of this process being the transcription of ribosomal DNA (rDNA). Considering that epigenetic mechanisms allow an organism to respond to environmental changes, the expression in muscle of several molecules that regulate epigenetic rRNA synthesis, as well as rDNA transcription, were evaluated during the seasonal acclimatization of the carp. First, the nucleotide sequences encoding the components forming the NoRC (ttf-I, tip5) and eNoSC (sirt1, nml, suv39h1), two chromatin remodeling complexes that silence rRNA synthesis, as well as the sequence of ubf1, a key regulator of rDNA transcription, were obtained. Subsequently the transcriptional regulation of the aforementioned molecules, and other key molecules involved in rRNA synthesis (mh2a1, mh2a2, h2a.z, h2a.z.7, nuc, p80), was assessed. The carp sequences for TTF-I, TIP5, SIRT1, NML, SUV39H1, and UBF1 showed a high conservation of domains and key amino acids in comparison with other fish and higher vertebrates. The mRNA contents in muscle for ttf-I, tip5, sirt1, nml, suv39h1, mh2a1, mh2a.z, and nuc were up-regulated during winter in comparison with summer, whereas the mRNA levels of mh2a2, ubf1, and p80 were down-regulated. Also, the contents of molecules involved in processing the rRNA (snoRNAs) and pRNA, a stabilizer of NoRC complex, were analyzed, finding that these non-coding RNAs were not affected by seasonal acclimatization. These results suggest that variations in the expression of rRNA and the molecules that epigenetically regulate its synthesis are contributing to the muscle plasticity induced by seasonal acclimatization in carp. Copyright © 2014 Elsevier Inc. All rights reserved.
Figuerola, Eva L M; Erijman, Leonardo
2007-07-01
The description of the diversity and structure of microbial communities through quantification of the constituent populations is one of the major objectives in environmental microbiology. The implications of models for community assembly are practical as well as theoretical, because the extent of biodiversity is thought to influence the function of ecosystems. Current attempts to predict species diversity in different environments derive the numbers of individuals for each operational taxonomic unit (OTU) from the frequency of clones in 16S rDNA gene libraries, which are subjected to a number of inherent biases and artefacts. We show that diversity of the bacterial community present in a complex microbial ensemble can be estimated by fitting the data of the full-cycle rRNA approach to a model of species abundance distribution. Sequences from a 16S rDNA gene library from activated sludge were reliably assigned to OTUs at a genetic distance of 0.04. A group of 17 newly designed rRNA-targeted oligonucleotide probes were used to quantify by fluorescence in situ hybridization, OTUs represented with more than three clones in the 16S rDNA clone library. Cell abundance distribution was best described by a geometric series, after the goodness of fit was evaluated by the Kolmogorov-Smirnov test. Although a complete mechanistic understanding of all the ecological processes involved is still not feasible, describing the distribution pattern of a complex bacterial assemblage model can shed light on the way bacterial communities operate.
RNA-dependent RNA polymerases of dsRNA bacteriophages.
Makeyev, Eugene V; Grimes, Jonathan M
2004-04-01
Genome replication and transcription of riboviruses are catalyzed by an RNA-dependent RNA polymerase (RdRP). RdRPs are normally associated with other virus- or/and host-encoded proteins that modulate RNA polymerization activity and template specificity. The polymerase complex of double-stranded dsRNA viruses is a large icosahedral particle (inner core) containing RdRP as a minor constituent. In phi6 and other dsRNA bacteriophages from the Cystoviridae family, the inner core is composed of four virus-specific proteins. Of these, protein P2, or Pol subunit, has been tentatively identified as RdRP by sequence comparisons, but the role of this protein in viral RNA synthesis has not been studied until recently. Here, we overview the work on the Pol subunits of phi6 and related viruses from the standpoints of function, structure and evolution.
RNA synthetic mechanisms employed by diverse families of RNA viruses.
McDonald, Sarah M
2013-01-01
RNA viruses are ubiquitous in nature, infecting every known organism on the planet. These viruses can also be notorious human pathogens with significant medical and economic burdens. Central to the lifecycle of an RNA virus is the synthesis of new RNA molecules, a process that is mediated by specialized virally encoded enzymes called RNA-dependent RNA polymerases (RdRps). RdRps directly catalyze phosphodiester bond formation between nucleoside triphosphates in an RNA-templated manner. These enzymes are strikingly conserved in their structural and functional features, even among diverse RNA viruses belonging to different families. During host cell infection, the activities of viral RdRps are often regulated by viral cofactor proteins. Cofactors can modulate the type and timing of RNA synthesis by directly engaging the RdRp and/or by indirectly affecting its capacity to recognize template RNA. High-resolution structures of RdRps as apoenzymes, bound to RNA templates, in the midst of catalysis, and/or interacting with regulatory cofactor proteins, have dramatically increased our understanding of viral RNA synthetic mechanisms. Combined with elegant biochemical studies, such structures are providing a scientific platform for the rational design of antiviral agents aimed at preventing and treating RNA virus-induced diseases. Copyright © 2013 John Wiley & Sons, Ltd.
NASA Technical Reports Server (NTRS)
1997-01-01
It is generally believed that an RNA World existed at an early stage in the history of life. During this early period, RNA molecules are seen to be potentially involved in both catalysis and the storage of genetic information. Translation presents several interrelated themes of inquiry for exobiology. First, it is essential, for understanding the very origin of life, how peptides and eventually proteins might have come to be made on the early Earth in a template directed manner. Second, it is necessary to understand how a machinery of similar complexity to that found in the ribosomes of modern organisms came to exist by the time of the last common ancestor (as detected by 16S rRNA sequence studies). Third, the ribosomal RNAs themselves likely had a very early origin and studies of their history may be very informative about the nature of the RNA World. Moreover, studies of these RNAs will contribute to a better understanding of the potential roles of RNA in early evolution.During the past year we have ave conducted a comparative study of four completely sequenced bacterial genoames. We have focused initially on conservation of gene order. The second component of the project continues to build on the model system for studying the validity of variant 5S rRNA sequences in the vicinity of the modern Vibrio proteolyticus 5S rRNA that we established earlier. This system has made it possible to conduct a detailed and extensive analysis of a local portion of the sequence space. These core methods have been used to construct numerous mutants during the last several years. Although it has been a secondary focus, this work has continued over the last year such that we now have in excess of 125 V. proteolyticus derived constructs which have been made and characterized. We have also continued high resolution NMR work on RNA oligomers originally initiated by G. Kenneth Smith who was funded by a NASA Graduate Student Researcher's Fellowship Award until May of 1996. Mr. Smith
Repurposing Toremifene for Treatment of Oral Bacterial Infections.
Gerits, Evelien; Defraine, Valerie; Vandamme, Katleen; De Cremer, Kaat; De Brucker, Katrijn; Thevissen, Karin; Cammue, Bruno P A; Beullens, Serge; Fauvart, Maarten; Verstraeten, Natalie; Michiels, Jan
2017-03-01
The spread of antibiotic resistance and the challenges associated with antiseptics such as chlorhexidine have necessitated a search for new antibacterial agents against oral bacterial pathogens. As a result of failing traditional approaches, drug repurposing has emerged as a novel paradigm to find new antibacterial agents. In this study, we examined the effects of the FDA-approved anticancer agent toremifene against the oral bacteria Porphyromonas gingivalis and Streptococcus mutans We found that the drug was able to inhibit the growth of both pathogens, as well as prevent biofilm formation, at concentrations ranging from 12.5 to 25 μM. Moreover, toremifene was shown to eradicate preformed biofilms at concentrations ranging from 25 to 50 μM. In addition, we found that toremifene prevents P. gingivalis and S. mutans biofilm formation on titanium surfaces. A time-kill study indicated that toremifene is bactericidal against S. mutans Macromolecular synthesis assays revealed that treatment with toremifene does not cause preferential inhibition of DNA, RNA, or protein synthesis pathways, indicating membrane-damaging activity. Biophysical studies using fluorescent probes and fluorescence microscopy further confirmed the membrane-damaging mode of action. Taken together, our results suggest that the anticancer agent toremifene is a suitable candidate for further investigation for the development of new treatment strategies for oral bacterial infections. Copyright © 2017 American Society for Microbiology.
A two-way street: regulatory interplay between RNA polymerase and nascent RNA structure
Zhang, Jinwei; Landick, Robert
2016-01-01
The vectorial (5′-to-3′ at varying velocity) synthesis of RNA by cellular RNA polymerases creates a rugged kinetic landscape, demarcated by frequent, sometimes long-lived pauses. In addition to myriad gene-regulatory roles, these pauses temporally and spatially program the co-transcriptional, hierarchical folding of biologically active RNAs. Conversely, these RNA structures, which form inside or near the RNA exit channel, interact with the polymerase and adjacent protein factors to influence RNA synthesis by modulating pausing, termination, antitermination, and slippage. Here we review the evolutionary origin, mechanistic underpinnings, and regulatory consequences of this interplay between RNA polymerase and nascent RNA structure. We categorize and attempt to rationalize the extensive linkage between the transcriptional machinery and its product, and provide a framework for future studies. PMID:26822487
Heterologous Synthesis and Recovery of Advanced Biofuels from Bacterial Cell Factories.
Malik, Sana; Afzal, Ifrah; Mehmood, Muhammad Aamer; Al Doghaither, Huda; Rahimuddin, Sawsan Abdulaziz; Gull, Munazza; Nahid, Nazia
2018-01-01
Microbial engineering to produce advanced biofuels is currently the most encouraging approach in renewable energy. Heterologous synthesis of biofuels and other useful industrial chemicals using bacterial cell factories has radically diverted the attentions from the native synthesis of these compounds. However, recovery of biofuels from the media and cellular toxicity are the main hindrances to successful commercialization of advanced biofuels. Therefore, membrane transporter engineering is gaining increasing attentions from all over the world. The main objective of this review is to explore the ways to increase the microbial production of biofuels by counteracting the cellular toxicity and facilitating their easier recovery from media. Microbial synthesis of industrially viable compounds such as biofuels has been increased due to genomic revolution. Moreover, advancements in protein engineering, gene regulation, pathway portability, metabolic engineering and synthetic biology led the focus towards the development of robust and cost-effective systems for biofuel production. The most convenient way to combat cellular toxicity and to secrete biofuels is the use of membrane transport system. The use of membrane transporters is currently a serious oversight as do not involve chemical changes and contribute greatly to efflux biofuels in extracellular milieu. However, overexpression of transport systems can also be detrimental to cell, so, in future, structure-based engineering of transporters can be employed to evaluate optimum expression range, to increase biofuel specificity and transport rate through structural studies of biofuel molecules. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Leis, Jonathan P.; Hurwitz, Jerard
1972-01-01
The role of ribonucleic acid (RNA) in deoxyribonucleic acid (DNA) synthesis with the purified DNA polymerase from the avian myeloblastosis virus has been studied. The polymerase catalyzes the synthesis of DNA in the presence of four deoxynucleoside triphosphates, Mg2+, and a variety of RNA templates including those isolated from avian myeloblastosis, Rous sarcoma, and Rauscher leukemia viruses; phages f2, MS2, and Qβ; and synthetic homopolymers such as polyadenylate·polyuridylic acid. The enzyme does not initiate the synthesis of new chains but incorporates deoxynucleotides at 3′ hydroxyl ends of primer strands. The product is an RNA·DNA hybrid in which the two polynucleotide components are covalently linked. Free DNA has not been detected among the products formed with the purified enzyme in vitro. The DNA synthesized with avian myeloblastosis virus RNA after alkaline hydrolysis has a sedimentation coefficient of 6 to 7S. PMID:4333539
Synthesis, characterization, and evaluation of ionizable lysine-based lipids for siRNA delivery.
Walsh, Colin L; Nguyen, Juliane; Tiffany, Matthew R; Szoka, Francis C
2013-01-16
We report the synthesis and characterization of a series of ionizable lysine-based lipids (ILL), novel lipids containing a lysine headgroup linked to a long-chain dialkylamine through an amide linkage at the lysine α-amine. These ILLs contain two ionizable amines and a carboxylate, and exhibit pH-dependent lipid ionization that varies with lipid structure. The synthetic scheme employed allows for the simple, orthogonal manipulation of lipids. This provides a method for the development of a compositionally diverse library with varying ionizable headgroups, tail structures, and linker regions. A focused library of four ILLs was synthesized to determine the impact of hydrophobic fluidity, lipid net charge, and lipid pK(a) on the biophysical and siRNA transfection characteristics of this new class of lipids. We found that manipulation of lipid structure impacts the protonation behavior, electrostatically driven membrane disruption, and ability to promote siRNA mediated knockdown in vitro. ILL-siRNA liposomal formulations were tested in a murine Factor VII model; however, no significant siRNA-mediated knockdown was observed. These results indicate that ILL may be useful in vitro transfection reagents, but further optimization of this new class of lipids is required to develop an effective in vivo siRNA delivery system.
Novel Antimicrobial Peptides That Inhibit Gram Positive Bacterial Exotoxin Synthesis
Merriman, Joseph A.; Nemeth, Kimberly A.; Schlievert, Patrick M.
2014-01-01
Gram-positive bacteria, such as Staphylococcus aureus, cause serious human illnesses through combinations of surface virulence factors and secretion of exotoxins. Our prior studies using the protein synthesis inhibitor clindamycin and signal transduction inhibitors glycerol monolaurate and α-globin and β-globin chains of hemoglobin indicate that their abilities to inhibit exotoxin production by S. aureus are separable from abilities to inhibit growth of the organism. Additionally, our previous studies suggest that inhibition of exotoxin production, in absence of ability to kill S. aureus and normal flora lactobacilli, will prevent colonization by pathogenic S. aureus, while not interfering with lactobacilli colonization. These disparate activities may be important in development of novel anti-infective agents that do not alter normal flora. We initiated studies to explore the exotoxin-synthesis-inhibition activity of hemoglobin peptides further to develop potential agents to prevent S. aureus infections. We tested synthesized α-globin chain peptides, synthetic variants of α-globin chain peptides, and two human defensins for ability to inhibit exotoxin production without significantly inhibiting S. aureus growth. All of these peptides were weakly or not inhibitory to bacterial growth. However, the peptides were inhibitory to exotoxin production with increasing activity dependent on increasing numbers of positively-charged amino acids. Additionally, the peptides could be immobilized on agarose beads or have amino acid sequences scrambled and still retain exotoxin-synthesis-inhibition. The peptides are not toxic to human vaginal epithelial cells and do not inhibit growth of normal flora L. crispatus. These peptides may interfere with plasma membrane signal transduction in S. aureus due to their positive charges. PMID:24748386
A comparison of the suppression of human transferrin synthesis by lead and lipopolysaccharide.
Barnum-Huckins, K M; Martinez, A O; Rivera, E V; Adrian, E K; Herbert, D C; Weaker, F J; Walter, C A; Adrian, G S
1997-03-14
Transferrin, as the major iron-transport protein in serum and other body fluids, has a central role in managing iron the body receives. Liver is a major site of transferrin synthesis, and in this study we present evidence that liver synthesis of human transferrin is suppressed by both the toxic metal lead and bacterial lipopolysaccharide, an inducer of the hepatic acute phase response. The responses of intact endogenous transferrin in the human hepatoma cell line HepG2 and chimeric human transferrin-chloramphenicol acetyltransferase genes in transgenic mice were examined. In HepG2 cells, 35S-transferrin protein synthesis and mRNA levels were suppressed by 100 microM and 10 microM lead acetate as early as 24 h after the initial treatment. Yet, synthesis of two proteins known to respond in the hepatic acute phase reaction, complement C3 and albumin, was not altered by the lead treatment. In transgenic mouse liver, lead suppressed expression of chimeric human transferrin genes at both the protein and mRNA levels, but LPS only suppressed at the protein level. The study indicates that lead suppresses human transferrin synthesis by a mechanism that differs from the hepatic acute phase response and that lead may also affect iron metabolism in humans by interfering with transferrin levels.
McMahon, Kaylin M; Plebanek, Michael P; Thaxton, C Shad
2016-11-15
Efficient systemic administration of therapeutic short interfering RNA (siRNA) is challenging. High-density lipoproteins (HDL) are natural in vivo RNA delivery vehicles. Specifically, native HDLs: 1) Load single-stranded RNA; 2) Are anionic, which requires charge reconciliation between the RNA and HDL, and 3) Actively target scavenger receptor type B-1 (SR-B1) to deliver RNA. Emphasizing these particular parameters, we employed templated lipoprotein particles (TLP), mimics of spherical HDLs, and self-assembled them with single-stranded complements of, presumably, any highly unmodified siRNA duplex pair after formulation with a cationic lipid. Resulting siRNA templated lipoprotein particles (siRNA-TLP) are anionic and tunable with regard to RNA assembly and function. Data demonstrate that the siRNA-TLPs actively target SR-B1 to potently reduce androgen receptor (AR) and enhancer of zeste homolog 2 (EZH2) proteins in multiple cancer cell lines. Systemic administration of siRNA-TLPs demonstrated no off-target toxicity and significantly reduced the growth of prostate cancer xenografts. Thus, native HDLs inspired the synthesis of a hybrid siRNA delivery vehicle that can modularly load single-stranded RNA complements after charge reconciliation with a cationic lipid, and that function due to active targeting of SR-B1.
Plackett-Burman experimental design for bacterial cellulose-silica composites synthesis.
Guzun, Anicuta Stoica; Stroescu, Marta; Jinga, Sorin Ion; Voicu, Georgeta; Grumezescu, Alexandru Mihai; Holban, Alina Maria
2014-09-01
Bacterial cellulose-silica hybrid composites were prepared starting from wet bacterial cellulose (BC) membranes using Stöber reaction. The structure and surface morphology of hybrid composites were examined by FTIR and SEM. The SEM pictures revealed that the silica particles are attached to BC fibrils and are well dispersed in the BC matrix. The influence of silica particles upon BC crystallinity was studied using XRD analysis. Thermogravimetric (TG) analysis showed that the composites are stable up to 300°C. A Plackett-Burman design was applied in order to investigate the influence of process parameters upon silica particle sizes and silica content of BC-silica composites. The statistical model predicted that it is possible for silica particles size to vary the synthesis parameters in order to obtain silica particles deposed on BC membranes in the range from 34.5 to 500 nm, the significant parameters being ammonia concentration, reaction time and temperature. The silica content also varies depending on process parameters, the statistical model predicting that the most influential parameters are water-tetraethoxysilane (TEOS) ratio and reaction temperature. The antimicrobial behavior on Staphylococcus aureus of BC-silica composites functionalized with usnic acid (UA) was also studied, in order to create improved surfaces with antiadherence and anti-biofilm properties. Copyright © 2014 Elsevier B.V. All rights reserved.
A Two-Way Street: Regulatory Interplay between RNA Polymerase and Nascent RNA Structure.
Zhang, Jinwei; Landick, Robert
2016-04-01
The vectorial (5'-to-3' at varying velocity) synthesis of RNA by cellular RNA polymerases (RNAPs) creates a rugged kinetic landscape, demarcated by frequent, sometimes long-lived, pauses. In addition to myriad gene-regulatory roles, these pauses temporally and spatially program the co-transcriptional, hierarchical folding of biologically active RNAs. Conversely, these RNA structures, which form inside or near the RNA exit channel, interact with the polymerase and adjacent protein factors to influence RNA synthesis by modulating pausing, termination, antitermination, and slippage. Here, we review the evolutionary origin, mechanistic underpinnings, and regulatory consequences of this interplay between RNAP and nascent RNA structure. We categorize and rationalize the extensive linkage between the transcriptional machinery and its product, and provide a framework for future studies. Copyright © 2016 Elsevier Ltd. All rights reserved.
Electrostatic Interactions in Aminoglycoside-RNA Complexes
Kulik, Marta; Goral, Anna M.; Jasiński, Maciej; Dominiak, Paulina M.; Trylska, Joanna
2015-01-01
Electrostatic interactions often play key roles in the recognition of small molecules by nucleic acids. An example is aminoglycoside antibiotics, which by binding to ribosomal RNA (rRNA) affect bacterial protein synthesis. These antibiotics remain one of the few valid treatments against hospital-acquired infections by Gram-negative bacteria. It is necessary to understand the amplitude of electrostatic interactions between aminoglycosides and their rRNA targets to introduce aminoglycoside modifications that would enhance their binding or to design new scaffolds. Here, we calculated the electrostatic energy of interactions and its per-ring contributions between aminoglycosides and their primary rRNA binding site. We applied either the methodology based on the exact potential multipole moment (EPMM) or classical molecular mechanics force field single-point partial charges with Coulomb formula. For EPMM, we first reconstructed the aspherical electron density of 12 aminoglycoside-RNA complexes from the atomic parameters deposited in the University at Buffalo Databank. The University at Buffalo Databank concept assumes transferability of electron density between atoms in chemically equivalent vicinities and allows reconstruction of the electron densities from experimental structural data. From the electron density, we then calculated the electrostatic energy of interaction using EPMM. Finally, we compared the two approaches. The calculated electrostatic interaction energies between various aminoglycosides and their binding sites correlate with experimentally obtained binding free energies. Based on the calculated energetic contributions of water molecules mediating the interactions between the antibiotic and rRNA, we suggest possible modifications that could enhance aminoglycoside binding affinity. PMID:25650932
Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia
2017-01-01
Abstract Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an ‘all-or-none’ pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. PMID:28520982
Use of 16S rRNA Gene for Identification of a Broad Range of Clinically Relevant Bacterial Pathogens
Srinivasan, Ramya; Karaoz, Ulas; Volegova, Marina; MacKichan, Joanna; Kato-Maeda, Midori; Miller, Steve; Nadarajan, Rohan; Brodie, Eoin L.; Lynch, Susan V.
2015-01-01
According to World Health Organization statistics of 2011, infectious diseases remain in the top five causes of mortality worldwide. However, despite sophisticated research tools for microbial detection, rapid and accurate molecular diagnostics for identification of infection in humans have not been extensively adopted. Time-consuming culture-based methods remain to the forefront of clinical microbial detection. The 16S rRNA gene, a molecular marker for identification of bacterial species, is ubiquitous to members of this domain and, thanks to ever-expanding databases of sequence information, a useful tool for bacterial identification. In this study, we assembled an extensive repository of clinical isolates (n = 617), representing 30 medically important pathogenic species and originally identified using traditional culture-based or non-16S molecular methods. This strain repository was used to systematically evaluate the ability of 16S rRNA for species level identification. To enable the most accurate species level classification based on the paucity of sequence data accumulated in public databases, we built a Naïve Bayes classifier representing a diverse set of high-quality sequences from medically important bacterial organisms. We show that for species identification, a model-based approach is superior to an alignment based method. Overall, between 16S gene based and clinical identities, our study shows a genus-level concordance rate of 96% and a species-level concordance rate of 87.5%. We point to multiple cases of probable clinical misidentification with traditional culture based identification across a wide range of gram-negative rods and gram-positive cocci as well as common gram-negative cocci. PMID:25658760
Sterol Synthesis in Diverse Bacteria.
Wei, Jeremy H; Yin, Xinchi; Welander, Paula V
2016-01-01
Sterols are essential components of eukaryotic cells whose biosynthesis and function has been studied extensively. Sterols are also recognized as the diagenetic precursors of steranes preserved in sedimentary rocks where they can function as geological proxies for eukaryotic organisms and/or aerobic metabolisms and environments. However, production of these lipids is not restricted to the eukaryotic domain as a few bacterial species also synthesize sterols. Phylogenomic studies have identified genes encoding homologs of sterol biosynthesis proteins in the genomes of several additional species, indicating that sterol production may be more widespread in the bacterial domain than previously thought. Although the occurrence of sterol synthesis genes in a genome indicates the potential for sterol production, it provides neither conclusive evidence of sterol synthesis nor information about the composition and abundance of basic and modified sterols that are actually being produced. Here, we coupled bioinformatics with lipid analyses to investigate the scope of bacterial sterol production. We identified oxidosqualene cyclase (Osc), which catalyzes the initial cyclization of oxidosqualene to the basic sterol structure, in 34 bacterial genomes from five phyla (Bacteroidetes, Cyanobacteria, Planctomycetes, Proteobacteria, and Verrucomicrobia) and in 176 metagenomes. Our data indicate that bacterial sterol synthesis likely occurs in diverse organisms and environments and also provides evidence that there are as yet uncultured groups of bacterial sterol producers. Phylogenetic analysis of bacterial and eukaryotic Osc sequences confirmed a complex evolutionary history of sterol synthesis in this domain. Finally, we characterized the lipids produced by Osc-containing bacteria and found that we could generally predict the ability to synthesize sterols. However, predicting the final modified sterol based on our current knowledge of sterol synthesis was difficult. Some bacteria
CRM1 and its ribosome export adaptor NMD3 localize to the nucleolus and affect rRNA synthesis.
Bai, Baoyan; Moore, Henna M; Laiho, Marikki
2013-01-01
CRM1 is an export factor that together with its adaptor NMD3 transports numerous cargo molecules from the nucleus to cytoplasm through the nuclear pore. Previous studies have suggested that CRM1 and NMD3 are detected in the nucleolus. However, their localization with subnucleolar domains or participation in the activities of the nucleolus are unclear. We demonstrate here biochemically and using imaging analyses that CRM1 and NMD3 co-localize with nucleolar marker proteins in the nucleolus. In particular, their nucleolar localization is markedly increased by inhibition of RNA polymerase I (Pol I) transcription by actinomycin D or by silencing Pol I catalytic subunit, RPA194. We show that CRM1 nucleolar localization is dependent on its activity and the expression of NMD3, whereas NMD3 nucleolar localization is independent of CRM1. This suggests that NMD3 provides nucleolar tethering of CRM1. While inhibition of CRM1 by leptomycin B inhibited processing of 28S ribosomal (r) RNA, depletion of NMD3 did not, suggesting that their effects on 28S rRNA processing are distinct. Markedly, depletion of NMD3 and inhibition of CRM1 reduced the rate of pre-47S rRNA synthesis. However, their inactivation did not lead to nucleolar disintegration, a hallmark of Pol I transcription stress, suggesting that they do not directly regulate transcription. These results indicate that CRM1 and NMD3 have complex functions in pathways that couple rRNA synthetic and processing engines and that the rRNA synthesis rate may be adjusted according to proficiency in rRNA processing and export.
Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.
Levis, R; Schlesinger, S; Huang, H V
1990-04-01
Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.
Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.
Levis, R; Schlesinger, S; Huang, H V
1990-01-01
Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA. Images PMID:2319651
Podsiad, Amy; Standiford, Theodore J; Ballinger, Megan N; Eakin, Richard; Park, Pauline; Kunkel, Steven L; Moore, Bethany B; Bhan, Urvashi
2016-03-01
Postinfluenza bacterial pneumonia is associated with significant mortality and morbidity. MicroRNAs (miRNAs) are small, noncoding RNAs that regulate gene expression posttranscriptionally. miR-155 has recently emerged as a crucial regulator of innate immunity and inflammatory responses and is induced in macrophages during infection. We hypothesized upregulation of miR-155 inhibits IL-17 and increases susceptibility to secondary bacterial pneumonia. Mice were challenged with 100 plaque-forming units H1N1 intranasally and were infected with 10(7) colony-forming units of MRSA intratracheally at day 5 postviral challenge. Lungs were harvested 24 h later, and expression of miR-155, IL-17, and IL-23 was measured by real-time RT-PCR. Induction of miR-155 was 3.6-fold higher in dual-infected lungs compared with single infection. miR-155(-/-) mice were protected with significantly lower (4-fold) bacterial burden and no differences in viral load, associated with robust induction of IL-23 and IL-17 (2.2- and 4.8-fold, respectively) postsequential challenge with virus and bacteria, compared with WT mice. Treatment with miR-155 antagomir improved lung bacterial clearance by 4.2-fold compared with control antagomir postsequential infection with virus and bacteria. Moreover, lung macrophages collected from patients with postviral bacterial pneumonia also had upregulation of miR-155 expression compared with healthy controls, consistent with observations in our murine model. This is the first demonstration that cellular miRNAs regulate postinfluenza immune response to subsequent bacterial challenge by suppressing the IL-17 pathway in the lung. Our findings suggest that antagonizing certain microRNA might serve as a potential therapeutic strategy against secondary bacterial infection. Copyright © 2016 the American Physiological Society.
Israni, B; Rajam, M V
2017-04-01
RNA interference mediated gene silencing, which is triggered by double-stranded RNA (dsRNA), has become a important tool for functional genomics studies in various systems, including insects. Bacterially produced dsRNA employs the use of a bacterial strain lacking in RNaseIII activity and harbouring a vector with dual T7 promoter sites, which allow the production of intact dsRNA molecules. Here, we report an assessment of the functional relevance of the ecdysone receptor, insect intestinal mucin and sericotropin genes through silencing by dsRNA in two lepidopteran insect pests, Helicoverpa armigera and Plutella xylostella, both of which cause serious crop losses. Oral feeding of dsRNA led to significant reduction in transcripts of the target insect genes, which caused significant larval mortality with various moulting anomalies and an overall developmental delay. We also found a significant decrease in reproductive potential in female moths, with a drop in egg laying and compromised egg hatching from treated larvae as compared to controls. dsRNA was stable in the insect gut and was efficiently processed into small interfering RNAs (siRNAs), thus accounting for the phenotypes observed in the present work. The study revealed the importance of these genes in core insect processes, which are essential for insect development and survival. © 2016 The Royal Entomological Society.
Bulgari, Daniela; Casati, Paola; Brusetti, Lorenzo; Quaglino, Fabio; Brasca, Milena; Daffonchio, Daniele; Bianco, Piero Attilio
2009-08-01
Diversity of bacterial endophytes associated with grapevine leaf tissues was analyzed by cultivation and cultivation-independent methods. In order to identify bacterial endophytes directly from metagenome, a protocol for bacteria enrichment and DNA extraction was optimized. Sequence analysis of 16S rRNA gene libraries underscored five diverse Operational Taxonomic Units (OTUs), showing best sequence matches with gamma-Proteobacteria, family Enterobacteriaceae, with a dominance of the genus Pantoea. Bacteria isolation through cultivation revealed the presence of six OTUs, showing best sequence matches with Actinobacteria, genus Curtobacterium, and with Firmicutes genera Bacillus and Enterococcus. Length Heterogeneity-PCR (LH-PCR) electrophoretic peaks from single bacterial clones were used to setup a database representing the bacterial endophytes identified in association with grapevine tissues. Analysis of healthy and phytoplasma-infected grapevine plants showed that LH-PCR could be a useful complementary tool for examining the diversity of bacterial endophytes especially for diversity survey on a large number of samples.
Katsura, Kazushige; Matsuda, Takayoshi; Tomabechi, Yuri; Yonemochi, Mayumi; Hanada, Kazuharu; Ohsawa, Noboru; Sakamoto, Kensaku; Takemoto, Chie; Shirouzu, Mikako
2017-11-01
Cell-free protein synthesis is a useful method for preparing proteins for functional or structural analyses. However, batch-to-batch variability with regard to protein synthesis activity remains a problem for large-scale production of cell extract in the laboratory. To address this issue, we have developed a novel procedure for large-scale preparation of bacterial cell extract with high protein synthesis activity. The developed procedure comprises cell cultivation using a fermentor, harvesting and washing of cells by tangential flow filtration, cell disruption with high-pressure homogenizer and continuous diafiltration. By optimizing and combining these methods, ∼100 ml of the cell extract was prepared from 150 g of Escherichia coli cells. The protein synthesis activities, defined as the yield of protein per unit of absorbance at 260 nm of the cell extract, were shown to be reproducible, and the average activity of several batches was twice that obtained using a previously reported method. In addition, combinatorial use of the high-pressure homogenizer and diafiltration increased the scalability, indicating that the cell concentration at disruption varies from 0.04 to 1 g/ml. Furthermore, addition of Gam protein and examinations of the N-terminal sequence rendered the extract prepared here useful for rapid screening with linear DNA templates. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.
Chen, Jiandong
2016-01-01
ABSTRACT The l-arabinose-inducible araBAD promoter (PBAD) enables tightly controlled and tunable expression of genes of interest in a broad range of bacterial species. It has been used successfully to study bacterial sRNA regulation, where PBAD drives expression of target mRNA translational fusions. Here we report that in Escherichia coli, Spot 42 sRNA regulates PBAD promoter activity by affecting arabinose uptake. We demonstrate that Spot 42 sRNA represses araF, a gene encoding the AraF subunit of the high-affinity low-capacity arabinose transporter AraFGH, through direct base-pairing interactions. We further show that endogenous Spot 42 sRNA is sufficient to repress araF expression under various growth conditions. Finally, we demonstrate this posttranscriptional repression has a biological consequence, decreasing the induction of PBAD at low levels of arabinose. This problem can be circumvented using strategies reported previously for avoiding all-or-none induction behavior, such as through constitutive expression of the low-affinity high-capacity arabinose transporter AraE or induction with a higher concentration of inducers. This work adds araF to the set of Spot 42-regulated genes, in agreement with previous studies suggesting that Spot 42, itself negatively regulated by the cyclic AMP (cAMP) receptor protein-cAMP complex, reinforces the catabolite repression network. IMPORTANCE The bacterial arabinose-inducible system is widely used for titratable control of gene expression. We demonstrate here that a posttranscriptional mechanism mediated by Spot 42 sRNA contributes to the functionality of the PBAD system at subsaturating inducer concentrations by affecting inducer uptake. Our finding extends the inputs into the known transcriptional control for the PBAD system and has implications for improving its usage for tunable gene expression. PMID:27849174
Shiokawa, Koichiro; Aso, Mai; Kondo, Takeshi; Takai, Jun-Ichi; Yoshida, Junki; Mishina, Takamichi; Fuchimukai, Kota; Ogasawara, Tsukasa; Kariya, Taro; Tashiro, Kosuke; Igarashi, Kazuei
2010-02-01
We have been studying control mechanisms of gene expression in early embryogenesis in a South African clawed toad Xenopus laevis, especially during the period of midblastula transition (MBT), or the transition from the phase of active cell division (cleavage stage) to the phase of extensive morphogenesis (post-blastular stages). We first found that ribosomal RNA synthesis is initiated shortly after MBT in Xenopus embryos and those weak bases, such as amines and ammonium ion, selectively inhibit the initiation and subsequent activation of rRNA synthesis. We then found that rapidly labeled heterogeneous mRNA-like RNA is synthesized in embryos at pre-MBT stage. We then performed cloning and expression studies of several genes, such as those for activin receptors, follistatin and aldolases, and then reached the studies of S-adenosylmethionine decarboxylase (SAMDC), a key enzyme in polyamine metabolism. Here, we cloned a Xenopus SAMDC cDNA and performed experiments to overexpress the in vitro-synthesized SAMDC mRNA in Xenopus early embryos, and found that the maternally preset program of apoptosis occurs in cleavage stage embryos, which is executed when embryos reach the stage of MBT. In the present article, we first summarize results on SAMDC and the maternal program of apoptosis, and then describe our studies on small-molecular-weight substances like polyamines, amino acids, and amines in Xenopus embryos. Finally, we summarize our studies on weak bases, especially on ammonium ion, as the specific inhibitor of ribosomal RNA synthesis in Xenopus embryonic cells.
Cagliero, Cedric; Zhou, Yan Ning; Jin, Ding Jun
2014-01-01
In a fast-growing Escherichia coli cell, most RNA polymerase (RNAP) is allocated to rRNA synthesis forming transcription foci at clusters of rrn operons or bacterial nucleolus, and each of the several nascent nucleoids contains multiple pairs of replication forks. The composition of transcription foci has not been determined. In addition, how the transcription machinery is three-dimensionally organized to promote cell growth in concord with replication machinery in the nucleoid remains essentially unknown. Here, we determine the spatial and functional landscapes of transcription and replication machineries in fast-growing E. coli cells using super-resolution-structured illumination microscopy. Co-images of RNAP and DNA reveal spatial compartmentation and duplication of the transcription foci at the surface of the bacterial chromosome, encompassing multiple nascent nucleoids. Transcription foci cluster with NusA and NusB, which are the rrn anti-termination system and are associated with nascent rRNAs. However, transcription foci tend to separate from SeqA and SSB foci, which track DNA replication forks and/or the replisomes, demonstrating that transcription machinery and replisome are mostly located in different chromosomal territories to maintain harmony between the two major cellular functions in fast-growing cells. Our study suggests that bacterial chromosomes are spatially and functionally organized, analogous to eukaryotes. PMID:25416798
Cdk7 mediates RPB1-driven mRNA synthesis in Toxoplasma gondii
Deshmukh, Abhijit S.; Mitra, Pallabi; Maruthi, Mulaka
2016-01-01
Cyclin-dependent kinase 7 in conjunction with CyclinH and Mat1 activates cell cycle CDKs and is a part of the general transcription factor TFIIH. Role of Cdk7 is well characterized in model eukaryotes however its relevance in protozoan parasites has not been investigated. This important regulator of key processes warrants closer examination particularly in this parasite given its unique cell cycle progression and flexible mode of replication. We report functional characterization of TgCdk7 and its partners TgCyclinH and TgMat1. Recombinant Cdk7 displays kinase activity upon binding its cyclin partner and this activity is further enhanced in presence of Mat1. The activated kinase phosphorylates C-terminal domain of TgRPB1 suggesting its role in parasite transcription. Therefore, the function of Cdk7 in CTD phosphorylation and RPB1 mediated transcription was investigated using Cdk7 inhibitor. Unphosphorylated CTD binds promoter DNA while phosphorylation by Cdk7 triggers its dissociation from DNA with implications for transcription initiation. Inhibition of Cdk7 in the parasite led to strong reduction in Serine 5 phosphorylation of TgRPB1-CTD at the promoters of constitutively expressed actin1 and sag1 genes with concomitant reduction of both nascent RNA synthesis and 5′-capped transcripts. Therefore, we provide compelling evidence for crucial role of TgCdk7 kinase activity in mRNA synthesis. PMID:27759017
2'-O-methylation in mRNA disrupts tRNA decoding during translation elongation.
Choi, Junhong; Indrisiunaite, Gabriele; DeMirci, Hasan; Ieong, Ka-Weng; Wang, Jinfan; Petrov, Alexey; Prabhakar, Arjun; Rechavi, Gideon; Dominissini, Dan; He, Chuan; Ehrenberg, Måns; Puglisi, Joseph D
2018-03-01
Chemical modifications of mRNA may regulate many aspects of mRNA processing and protein synthesis. Recently, 2'-O-methylation of nucleotides was identified as a frequent modification in translated regions of human mRNA, showing enrichment in codons for certain amino acids. Here, using single-molecule, bulk kinetics and structural methods, we show that 2'-O-methylation within coding regions of mRNA disrupts key steps in codon reading during cognate tRNA selection. Our results suggest that 2'-O-methylation sterically perturbs interactions of ribosomal-monitoring bases (G530, A1492 and A1493) with cognate codon-anticodon helices, thereby inhibiting downstream GTP hydrolysis by elongation factor Tu (EF-Tu) and A-site tRNA accommodation, leading to excessive rejection of cognate aminoacylated tRNAs in initial selection and proofreading. Our current and prior findings highlight how chemical modifications of mRNA tune the dynamics of protein synthesis at different steps of translation elongation.
Chao, Yanjie; Vogel, Jörg
2016-02-04
Small RNAs (sRNAs) from conserved noncoding genes are crucial regulators in bacterial signaling pathways but have remained elusive in the Cpx response to inner membrane stress. Here we report that an alternative biogenesis pathway releasing the conserved mRNA 3' UTR of stress chaperone CpxP as an ∼60-nt sRNA provides the noncoding arm of the Cpx response. This so-called CpxQ sRNA, generated by general mRNA decay through RNase E, acts as an Hfq-dependent repressor of multiple mRNAs encoding extracytoplasmic proteins. Both CpxQ and the Cpx pathway are required for cell survival under conditions of dissipation of membrane potential. Our discovery of CpxQ illustrates how the conversion of a transcribed 3' UTR into an sRNA doubles the output of a single mRNA to produce two factors with spatially segregated functions during inner membrane stress: a chaperone that targets problematic proteins in the periplasm and a regulatory RNA that dampens their synthesis in the cytosol. Copyright © 2016 Elsevier Inc. All rights reserved.
Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu
2017-07-07
Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Zhang, Wen; Zhang, Manman; Gao, Chao; Zhang, Yipeng; Ge, Yongsheng; Guo, Shiting; Guo, Xiaoting; Zhou, Zikang; Liu, Qiuyuan; Zhang, Yingxin; Ma, Cuiqing; Tao, Fei; Xu, Ping
2017-01-01
l-Serine biosynthesis, a crucial metabolic process in most domains of life, is initiated by d-3-phosphoglycerate (d-3-PG) dehydrogenation, a thermodynamically unfavorable reaction catalyzed by d-3-PG dehydrogenase (SerA). d-2-Hydroxyglutarate (d-2-HG) is traditionally viewed as an abnormal metabolite associated with cancer and neurometabolic disorders. Here, we reveal that bacterial anabolism and catabolism of d-2-HG are involved in l-serine biosynthesis in Pseudomonas stutzeri A1501 and Pseudomonas aeruginosa PAO1. SerA catalyzes the stereospecific reduction of 2-ketoglutarate (2-KG) to d-2-HG, responsible for the major production of d-2-HG in vivo. SerA combines the energetically favorable reaction of d-2-HG production to overcome the thermodynamic barrier of d-3-PG dehydrogenation. We identified a bacterial d-2-HG dehydrogenase (D2HGDH), a flavin adenine dinucleotide (FAD)-dependent enzyme, that converts d-2-HG back to 2-KG. Electron transfer flavoprotein (ETF) and ETF-ubiquinone oxidoreductase (ETFQO) are also essential in d-2-HG metabolism through their capacity to transfer electrons from D2HGDH. Furthermore, while the mutant with D2HGDH deletion displayed decreased growth, the defect was rescued by adding l-serine, suggesting that the D2HGDH is functionally tied to l-serine synthesis. Substantial flux flows through d-2-HG, being produced by SerA and removed by D2HGDH, ETF, and ETFQO, maintaining d-2-HG homeostasis. Overall, our results uncover that d-2-HG–mediated coupling between SerA and D2HGDH drives bacterial l-serine synthesis. PMID:28827360
Harris, Kimberly A; Zhou, Zhiyuan; Peters, Michelle L; Wilkins, Sarah G; Breaker, Ronald R
2018-06-18
OLE (ornate, large, extremophilic) RNAs comprise a class of structured noncoding RNAs (ncRNAs) found in many extremophilic bacteria species. OLE RNAs constitute one of the longest and most widespread bacterial ncRNA classes whose major biochemical function remains unknown. In the Gram-positive alkaliphile Bacillus halodurans , OLE RNA is abundant, and localizes to the cell membrane by association with the transmembrane OLE-associated protein called OapA (formerly OAP). These characteristics, along with the well-conserved sequence and structural features of OLE RNAs, suggest that the OLE ribonucleoprotein (RNP) complex performs important biological functions. B. halodurans strains lacking OLE RNA ( ∆ole ) or OapA ( ∆oapA ) are less tolerant of cold (20 °C) and short-chain alcohols (e.g., ethanol). Here, we describe the effects of a mutant OapA (called PM1) that more strongly inhibits growth under cold or ethanol stress compared with strains lacking the oapA gene, even when wild-type OapA is present. This dominant-negative effect of PM1 is reversed by mutations that render OLE RNA nonfunctional. This finding demonstrates that the deleterious PM1 phenotype requires an intact RNP complex, and suggests that the complex has one or more additional undiscovered components. A genetic screen uncovered PM1 phenotype suppressor mutations in the ybzG gene, which codes for a putative RNA-binding protein of unknown biological function. We observe that YbzG protein (also called OapB) selectively binds OLE RNA in vitro, whereas a mutant version of the protein is not observed to bind OLE RNA. Thus, YbzG/OapB is an important component of the functional OLE RNP complex in B. halodurans .
Use of 16S rRNA gene for identification of a broad range of clinically relevant bacterial pathogens
Srinivasan, Ramya; Karaoz, Ulas; Volegova, Marina; ...
2015-02-06
According to World Health Organization statistics of 2011, infectious diseases remain in the top five causes of mortality worldwide. However, despite sophisticated research tools for microbial detection, rapid and accurate molecular diagnostics for identification of infection in humans have not been extensively adopted. Time-consuming culture-based methods remain to the forefront of clinical microbial detection. The 16S rRNA gene, a molecular marker for identification of bacterial species, is ubiquitous to members of this domain and, thanks to ever-expanding databases of sequence information, a useful tool for bacterial identification. In this study, we assembled an extensive repository of clinical isolates (n =more » 617), representing 30 medically important pathogenic species and originally identified using traditional culture-based or non-16S molecular methods. This strain repository was used to systematically evaluate the ability of 16S rRNA for species level identification. To enable the most accurate species level classification based on the paucity of sequence data accumulated in public databases, we built a Naïve Bayes classifier representing a diverse set of high-quality sequences from medically important bacterial organisms. We show that for species identification, a model-based approach is superior to an alignment based method. Overall, between 16S gene based and clinical identities, our study shows a genus-level concordance rate of 96% and a species-level concordance rate of 87.5%. We point to multiple cases of probable clinical misidentification with traditional culture based identification across a wide range of gram-negative rods and gram-positive cocci as well as common gram-negative cocci.« less
Peng, Mu; Zi, Xiaoxue; Wang, Qiuyu
2015-09-24
Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA) indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future.
Tsuzuki, Masayuki; Motomura, Kazuki; Kumakura, Naoyoshi; Takeda, Atsushi
2017-03-01
Accumulation of an mRNA species is determined by the balance between the synthesis and the degradation of the mRNA. Individual mRNA molecules are selectively and actively degraded through RNA degradation pathways, which include 5'-3' mRNA degradation pathway, 3'-5' mRNA degradation pathway, and RNA-dependent RNA polymerase-mediated mRNA degradation pathway. Recent studies have revealed that these RNA degradation pathways compete with each other in mRNA turnover in plants and that plants have a hidden layer of non-coding small-interfering RNA production from a set of mRNAs. In this review, we summarize the current information about plant mRNA degradation pathways in mRNA turnover and discuss the potential roles of a novel class of the endogenous siRNAs derived from plant mRNAs.
Kelly, L C; Colin, Y; Turpault, M-P; Uroz, S
2016-08-01
Understanding how minerals affect bacterial communities and their in situ activities in relation to environmental conditions are central issues in soil microbial ecology, as minerals represent essential reservoirs of inorganic nutrients for the biosphere. To determine the impact of mineral type and solution chemistry on soil bacterial communities, we compared the diversity, composition, and functional abilities of a soil bacterial community incubated in presence/absence of different mineral types (apatite, biotite, obsidian). Microcosms were prepared containing different liquid culture media devoid of particular essential nutrients, the nutrients provided only in the introduced minerals and therefore only available to the microbial community through mineral dissolution by biotic and/or abiotic processes. By combining functional screening of bacterial isolates and community analysis by bromodeoxyuridine DNA immunocapture and 16S rRNA gene pyrosequencing, we demonstrated that bacterial communities were mainly impacted by the solution chemistry at the taxonomic level and by the mineral type at the functional level. Metabolically active bacterial communities varied with solution chemistry and mineral type. Burkholderia were significantly enriched in the obsidian treatment compared to the biotite treatment and were the most effective isolates at solubilizing phosphorous or mobilizing iron, in all the treatments. A detailed analysis revealed that the 16S rRNA gene sequences of the OTUs or isolated strains assigned as Burkholderia in our study showed high homology with effective mineral-weathering bacteria previously recovered from the same experimental site.
Tuorto, Francesca; Herbst, Friederike; Alerasool, Nader; Bender, Sebastian; Popp, Oliver; Federico, Giuseppina; Reitter, Sonja; Liebers, Reinhard; Stoecklin, Georg; Gröne, Hermann-Josef; Dittmar, Gunnar; Glimm, Hanno; Lyko, Frank
2015-09-14
The Dnmt2 enzyme utilizes the catalytic mechanism of eukaryotic DNA methyltransferases to methylate several tRNAs at cytosine 38. Dnmt2 mutant mice, flies, and plants were reported to be viable and fertile, and the biological function of Dnmt2 has remained elusive. Here, we show that endochondral ossification is delayed in newborn Dnmt2-deficient mice, which is accompanied by a reduction of the haematopoietic stem and progenitor cell population and a cell-autonomous defect in their differentiation. RNA bisulfite sequencing revealed that Dnmt2 methylates C38 of tRNA Asp(GTC), Gly(GCC), and Val(AAC), thus preventing tRNA fragmentation. Proteomic analyses from primary bone marrow cells uncovered systematic differences in protein expression that are due to specific codon mistranslation by tRNAs lacking Dnmt2-dependent methylation. Our observations demonstrate that Dnmt2 plays an important role in haematopoiesis and define a novel function of C38 tRNA methylation in the discrimination of near-cognate codons, thereby ensuring accurate polypeptide synthesis. © 2015 The Authors. Published under the terms of the CC BY NC ND 4.0 license.
Dukhovny, Anna; Shlomai, Amir; Sklan, Ella H
2018-05-25
Viperin is a multifunctional interferon-inducible broad-spectrum antiviral protein. Viperin belongs to the S-Adenosylmethionine (SAM) superfamily of enzymes known to catalyze a wide variety of radical-mediated reactions. However, the exact mechanism by which viperin exerts its functions is still unclear. Interestingly, for many RNA viruses viperin was shown to inhibit viral RNA accumulation by interacting with different viral non-structural proteins. Here, we show that viperin inhibits RNA synthesis by bacteriophage T7 polymerase in mammalian cells. This inhibition is specific and occurs at the RNA level. Viperin expression significantly reduced T7-mediated cytoplasmic RNA levels. The data showing that viperin inhibits the bacteriophage T7 polymerase supports the conservation of viperin's antiviral activity between species. These results highlight the possibility that viperin might utilize a broader mechanism of inhibition. Accordingly, our results suggest a novel mechanism involving polymerase inhibition and provides a tractable system for future mechanistic studies of viperin.
Yan, Yong-Wei; Zou, Bin; Zhu, Ting; Hozzein, Wael N.
2017-01-01
RNA-seq-based SSU (small subunit) rRNA (ribosomal RNA) analysis has provided a better understanding of potentially active microbial community within environments. However, for RNA-seq library construction, high quantities of purified RNA are typically required. We propose a modified RNA-seq method for SSU rRNA-based microbial community analysis that depends on the direct ligation of a 5’ adaptor to RNA before reverse-transcription. The method requires only a low-input quantity of RNA (10–100 ng) and does not require a DNA removal step. The method was initially tested on three mock communities synthesized with enriched SSU rRNA of archaeal, bacterial and fungal isolates at different ratios, and was subsequently used for environmental samples of high or low biomass. For high-biomass salt-marsh sediments, enriched SSU rRNA and total nucleic acid-derived RNA-seq datasets revealed highly consistent community compositions for all of the SSU rRNA sequences, and as much as 46.4%-59.5% of 16S rRNA sequences were suitable for OTU (operational taxonomic unit)-based community and diversity analyses with complete coverage of V1-V2 regions. OTU-based community structures for the two datasets were also highly consistent with those determined by all of the 16S rRNA reads. For low-biomass samples, total nucleic acid-derived RNA-seq datasets were analyzed, and highly active bacterial taxa were also identified by the OTU-based method, notably including members of the previously underestimated genus Nitrospira and phylum Acidobacteria in tap water, members of the phylum Actinobacteria on a shower curtain, and members of the phylum Cyanobacteria on leaf surfaces. More than half of the bacterial 16S rRNA sequences covered the complete region of primer 8F, and non-coverage rates as high as 38.7% were obtained for phylum-unclassified sequences, providing many opportunities to identify novel bacterial taxa. This modified RNA-seq method will provide a better snapshot of diverse
Crowson, A Neil; Nuovo, Gerard J; Mihm, Martin C; Magro, Cynthia
2003-11-01
The classic pathology of skin disease discontinuous from the inflamed gastrointestinal (GI) tract in patients with Crohn's disease (CD) includes pyoderma gangrenosum (PG), erythema nodosum (EN), and so-called metastatic Crohn's disease. The purpose of this study was two-fold: First, we explored the full spectrum of cutaneous lesions associated with Crohn's disease, and second, we sought to explore a potential molecular basis of the skin lesions in patients with CD. In this regard, we analyzed skin and GI tract biopsies from affected patients for the consensus bacterial SrRNA to determine whether direct bacterial infection was associated with either condition. Formalin-fixed, paraffin-embedded sections were studied and correlated to clinical presentation and histories from 33 patients with CD. Consensus bacterial RNA sequences were analyzed using an RT in situ PCR assay on both skin biopsy and GI biopsy material. The GI tract material included biopsies from 3 patients who had skin lesions and from 7 patients in whom there were no known skin manifestations. There were 8 cases of neutrophilic dominant dermal infiltrates, including pyoderma gangrenosum, 6 cases of granuloma annulare/necrobiosis lipoidica-like lesions, 5 cases of sterile neutrophilic folliculitis, 5 cases of panniculitis, 4 cases of vasculitis, 2 cases of psoriasis, 2 cases of lichenoid and granulomatous inflammation, and 1 case of classic metastatic CD. Intracellular bacterial 16S rRNA was detected in 8 of 10 tissues of active CD in the GI tract, of which 3 of the cases tested were from patients who also developed skin lesions at some point in their clinical course; in contrast, none of the skin biopsies had detectable bacterial RNA. The dermatopathological manifestations of CD discontiguous from the involved GI tract mucosa have in common a vascular injury syndrome, typically with a prominent extravascular neutrophilic and/or histiocytic dermal infiltrate. In addition, this study, the first to
Two distinct RNase activities of CRISPR-C2c2 enable guide-RNA processing and RNA detection.
East-Seletsky, Alexandra; O'Connell, Mitchell R; Knight, Spencer C; Burstein, David; Cate, Jamie H D; Tjian, Robert; Doudna, Jennifer A
2016-10-13
Bacterial adaptive immune systems use CRISPRs (clustered regularly interspaced short palindromic repeats) and CRISPR-associated (Cas) proteins for RNA-guided nucleic acid cleavage. Although most prokaryotic adaptive immune systems generally target DNA substrates, type III and VI CRISPR systems direct interference complexes against single-stranded RNA substrates. In type VI systems, the single-subunit C2c2 protein functions as an RNA-guided RNA endonuclease (RNase). How this enzyme acquires mature CRISPR RNAs (crRNAs) that are essential for immune surveillance and how it carries out crRNA-mediated RNA cleavage remain unclear. Here we show that bacterial C2c2 possesses a unique RNase activity responsible for CRISPR RNA maturation that is distinct from its RNA-activated single-stranded RNA degradation activity. These dual RNase functions are chemically and mechanistically different from each other and from the crRNA-processing behaviour of the evolutionarily unrelated CRISPR enzyme Cpf1 (ref. 11). The two RNase activities of C2c2 enable multiplexed processing and loading of guide RNAs that in turn allow sensitive detection of cellular transcripts.
RNA-dependent RNA targeting by CRISPR-Cas9
Strutt, Steven C; Torrez, Rachel M; Kaya, Emine; Negrete, Oscar A
2018-01-01
Double-stranded DNA (dsDNA) binding and cleavage by Cas9 is a hallmark of type II CRISPR-Cas bacterial adaptive immunity. All known Cas9 enzymes are thought to recognize DNA exclusively as a natural substrate, providing protection against DNA phage and plasmids. Here, we show that Cas9 enzymes from both subtypes II-A and II-C can recognize and cleave single-stranded RNA (ssRNA) by an RNA-guided mechanism that is independent of a protospacer-adjacent motif (PAM) sequence in the target RNA. RNA-guided RNA cleavage is programmable and site-specific, and we find that this activity can be exploited to reduce infection by single-stranded RNA phage in vivo. We also demonstrate that Cas9 can direct PAM-independent repression of gene expression in bacteria. These results indicate that a subset of Cas9 enzymes have the ability to act on both DNA and RNA target sequences, and suggest the potential for use in programmable RNA targeting applications. PMID:29303478
Li, Meiju; Zhou, Mi; Adamowicz, Elizabeth; Basarab, John A; Guan, Le Luo
2012-02-24
Currently, knowledge regarding the ecology and function of bacteria attached to the epithelial tissue of the rumen wall is limited. In this study, the diversity of the bacterial community attached to the rumen epithelial tissue was compared to the rumen content bacterial community using 16S rRNA gene sequencing, PCR-DGGE, and qRT-PCR analysis. Sequence analysis of 2785 randomly selected clones from six 16S rDNA (∼1.4kb) libraries showed that the community structures of three rumen content libraries clustered together and were separated from the rumen tissue libraries. The diversity index of each library revealed that ruminal content bacterial communities (4.12/4.42/4.88) were higher than ruminal tissue communities (2.90/2.73/3.23), based on 97% similarity. The phylum Firmicutes was predominant in the ruminal tissue communities, while the phylum Bacteroidetes was predominant in the ruminal content communities. The phyla Fibrobacteres, Planctomycetes, and Verrucomicrobia were only detected in the ruminal content communities. PCR-DGGE analysis of the bacterial profiles of the rumen content and ruminal epithelial tissue samples from 22 steers further confirmed that there is a distinct bacterial community that inhibits the rumen epithelium. The distinctive epimural bacterial communities suggest that Firmicutes, together with other epithelial-specific species, may have additional functions other than food digestion. Copyright © 2011 Elsevier B.V. All rights reserved.
Conserved gene clusters in bacterial genomes provide further support for the primacy of RNA
NASA Technical Reports Server (NTRS)
Siefert, J. L.; Martin, K. A.; Abdi, F.; Widger, W. R.; Fox, G. E.
1997-01-01
Five complete bacterial genome sequences have been released to the scientific community. These include four (eu)Bacteria, Haemophilus influenzae, Mycoplasma genitalium, M. pneumoniae, and Synechocystis PCC 6803, as well as one Archaeon, Methanococcus jannaschii. Features of organization shared by these genomes are likely to have arisen very early in the history of the bacteria and thus can be expected to provide further insight into the nature of early ancestors. Results of a genome comparison of these five organisms confirm earlier observations that gene order is remarkably unpreserved. There are, nevertheless, at least 16 clusters of two or more genes whose order remains the same among the four (eu)Bacteria and these are presumed to reflect conserved elements of coordinated gene expression that require gene proximity. Eight of these gene orders are essentially conserved in the Archaea as well. Many of these clusters are known to be regulated by RNA-level mechanisms in Escherichia coli, which supports the earlier suggestion that this type of regulation of gene expression may have arisen very early. We conclude that although the last common ancestor may have had a DNA genome, it likely was preceded by progenotes with an RNA genome.
Daugherty, B L; Hotta, K; Kumar, C; Ahn, Y H; Zhu, J D; Pestka, S
1989-01-01
A series of plasmids were constructed to generate RNA complementary to the beta-galactosidase messenger RNA under control of the phage lambda PL promoter. These plasmids generate anti-lacZ mRNA bearing or lacking a synthetic ribosome binding site adjacent to the lambda PL promoter and/or the lacZ ribosome binding site in reverse orientation. Fragments of lacZ DNA from the 5' and/or the 3' region were used in these constructions. When these anti-mRNA molecules were produced in Escherichia coli 294, maximal inhibition of beta-galactosidase synthesis occurred when a functional ribosome binding site was present near the 5' end of the anti-mRNA and the anti-mRNA synthesized was complementary to the 5' region of the mRNA corresponding to the lacZ ribosome binding site and/or the 5'-coding sequence. Anti-mRNAs producing maximal inhibition of beta-galactosidase synthesis exhibited an anti-lacZ mRNA:normal lacZ mRNA ratio of 100:1 or higher. Those showing lower levels of inhibition exhibited much lower anti-lacZ mRNA:normal lacZ mRNA ratios. A functional ribosome binding site at the 5'-end was found to decrease the decay rate of the anti-lacZ mRNAs. In addition, the incorporation of a transcription terminator just downstream of the antisense segment provided for more efficient inhibition of lacZ mRNA translation due to synthesis of smaller and more abundant anti-lacZ mRNAs. The optimal constructions produced undetectable levels of beta-galactosidase synthesis.
Bacterial Sigma Factors and Anti-Sigma Factors: Structure, Function and Distribution
Paget, Mark S.
2015-01-01
Sigma factors are multi-domain subunits of bacterial RNA polymerase (RNAP) that play critical roles in transcription initiation, including the recognition and opening of promoters as well as the initial steps in RNA synthesis. This review focuses on the structure and function of the major sigma-70 class that includes the housekeeping sigma factor (Group 1) that directs the bulk of transcription during active growth, and structurally-related alternative sigma factors (Groups 2–4) that control a wide variety of adaptive responses such as morphological development and the management of stress. A recurring theme in sigma factor control is their sequestration by anti-sigma factors that occlude their RNAP-binding determinants. Sigma factors are then released through a wide variety of mechanisms, often involving branched signal transduction pathways that allow the integration of distinct signals. Three major strategies for sigma release are discussed: regulated proteolysis, partner-switching, and direct sensing by the anti-sigma factor. PMID:26131973
High level bacterial contamination of secondary school students' mobile phones.
Kõljalg, Siiri; Mändar, Rando; Sõber, Tiina; Rööp, Tiiu; Mändar, Reet
2017-06-01
While contamination of mobile phones in the hospital has been found to be common in several studies, little information about bacterial abundance on phones used in the community is available. Our aim was to quantitatively determine the bacterial contamination of secondary school students' mobile phones. Altogether 27 mobile phones were studied. The contact plate method and microbial identification using MALDI-TOF mass spectrometer were used for culture studies. Quantitative PCR reaction for detection of universal 16S rRNA, Enterococcus faecalis 16S rRNA and Escherichia coli allantoin permease were performed, and the presence of tetracycline ( tet A, tet B, tet M), erythromycin ( erm B) and sulphonamide ( sul 1) resistance genes was assessed. We found a high median bacterial count on secondary school students' mobile phones (10.5 CFU/cm 2 ) and a median of 17,032 bacterial 16S rRNA gene copies per phone. Potentially pathogenic microbes ( Staphylococcus aureus , Acinetobacter spp. , Pseudomonas spp., Bacillus cereus and Neisseria flavescens ) were found among dominant microbes more often on phones with higher percentage of E. faecalis in total bacterial 16S rRNA. No differences in contamination level or dominating bacterial species between phone owner's gender and between phone types (touch screen/keypad) were found. No antibiotic resistance genes were detected on mobile phone surfaces. Quantitative study methods revealed high level bacterial contamination of secondary school students' mobile phones.
Ebola Virus VP35 Interaction with Dynein LC8 Regulates Viral RNA Synthesis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Luthra, Priya; Jordan, David S.; Leung, Daisy W.
2015-03-04
Ebola virus VP35 inhibits alpha/beta interferon production and functions as a viral polymerase cofactor. Previously, the 8-kDa cytoplasmic dynein light chain (LC8) was demonstrated to interact with VP35, but the functional consequences were unclear. Here we demonstrate that the interaction is direct and of high affinity and that binding stabilizes the VP35 N-terminal oligomerization domain and enhances viral RNA synthesis. Mutational analysis demonstrates that VP35 interaction is required for the functional effects of LC8.
Tanpure, Arun A.
2017-01-01
Abstract The synthesis of 2′‐O‐methyl‐5‐hydroxymethylcytidine (hm5Cm), 5‐hydroxymethylcytidine (hm5C) and 5‐formylcytidine (f5C) phosphoramidite monomers has been developed. Optimisation of mild post‐synthetic deprotection conditions enabled the synthesis of RNA containing all four naturally occurring cytosine modifications (hm5Cm, hm5C, f5C plus 5‐methylcytosine). Given the considerable interest in RNA modifications and epitranscriptomics, the availability of synthetic monomers and RNAs containing these modifications will be valuable for elucidating their biological function(s). PMID:28901692
Akata, Kentaro; Yatera, Kazuhiro; Yamasaki, Kei; Kawanami, Toshinori; Naito, Keisuke; Noguchi, Shingo; Fukuda, Kazumasa; Ishimoto, Hiroshi; Taniguchi, Hatsumi; Mukae, Hiroshi
2016-05-11
Aspiration pneumonia has been a growing interest in an aging population. Anaerobes are important pathogens, however, the etiology of aspiration pneumonia is not fully understood. In addition, the relationship between the patient clinical characteristics and the causative pathogens in pneumonia patients with aspiration risk factors are unclear. To evaluate the relationship between the patient clinical characteristics with risk factors for aspiration and bacterial flora in bronchoalveolar lavage fluid (BALF) in pneumonia patients, the bacterial floral analysis of 16S ribosomal RNA gene was applied in addition to cultivation methods in BALF samples. From April 2010 to February 2014, BALF samples were obtained from the affected lesions of pneumonia via bronchoscopy, and were evaluated by the bacterial floral analysis of 16S rRNA gene in addition to cultivation methods in patients with community-acquired pneumonia (CAP) and healthcare-associated pneumonia (HCAP). Factors associated with aspiration risks in these patients were analyzed. A total of 177 (CAP 83, HCAP 94) patients were enrolled. According to the results of the bacterial floral analysis, detection rate of oral streptococci as the most detected bacterial phylotypes in BALF was significantly higher in patients with aspiration risks (31.0 %) than in patients without aspiration risks (14.7 %) (P = 0.009). In addition, the percentages of oral streptococci in each BALF sample were significantly higher in patients with aspiration risks (26.6 ± 32.0 %) than in patients without aspiration risks (13.8 ± 25.3 %) (P = 0.002). A multiple linear regression analysis showed that an Eastern Cooperative Oncology Group (ECOG) performance status (PS) of ≥3, the presence of comorbidities, and a history of pneumonia within a previous year were significantly associated with a detection of oral streptococci in BALF. The bacterial floral analysis of 16S rRNA gene revealed that oral streptococci were mostly
Spatial pattern in Antarctica: what can we learn from Antarctic bacterial isolates?
Chong, Chun Wie; Goh, Yuh Shan; Convey, Peter; Pearce, David; Tan, Irene Kit Ping
2013-09-01
A range of small- to moderate-scale studies of patterns in bacterial biodiversity have been conducted in Antarctica over the last two decades, most suggesting strong correlations between the described bacterial communities and elements of local environmental heterogeneity. However, very few of these studies have advanced interpretations in terms of spatially associated patterns, despite increasing evidence of patterns in bacterial biogeography globally. This is likely to be a consequence of restricted sampling coverage, with most studies to date focusing only on a few localities within a specific Antarctic region. Clearly, there is now a need for synthesis over a much larger spatial to consolidate the available data. In this study, we collated Antarctic bacterial culture identities based on the 16S rRNA gene information available in the literature and the GenBank database (n > 2,000 sequences). In contrast to some recent evidence for a distinct Antarctic microbiome, our phylogenetic comparisons show that a majority (~75 %) of Antarctic bacterial isolates were highly similar (≥99 % sequence similarity) to those retrieved from tropical and temperate regions, suggesting widespread distribution of eurythermal mesophiles in Antarctic environments. However, across different Antarctic regions, the dominant bacterial genera exhibit some spatially distinct diversity patterns analogous to those recently proposed for Antarctic terrestrial macroorganisms. Taken together, our results highlight the threat of cross-regional homogenisation in Antarctic biodiversity, and the imperative to include microbiota within the framework of biosecurity measures for Antarctica.
Kabra, Ashish; Shahid, Salman; Pal, Ravi Kant; Yadav, Rahul; Pulavarti, S.V.S. Rama Krishna; Jain, Anupam; Tripathi, Sarita; Arora, Ashish
2017-01-01
Bacterial peptidyl-tRNA hydrolase (Pth; EC 3.1.1.29) hydrolyzes the peptidyl-tRNAs accumulated in the cytoplasm and thereby prevents cell death by alleviating tRNA starvation. X-ray and NMR studies of Vibrio cholerae Pth (VcPth) and mutants of its key residues involved in catalysis show that the activity and selectivity of the protein depends on the stereochemistry and dynamics of residues H24, D97, N118, and N14. D97-H24 interaction is critical for activity because it increases the nucleophilicity of H24. The N118 and N14 have orthogonally competing interactions with H24, both of which reduce the nucleophilicity of H24 and are likely to be offset by positioning of a peptidyl-tRNA substrate. The region proximal to H24 and the lid region exhibit slow motions that may assist in accommodating the substrate. Helix α3 exhibits a slow wobble with intermediate time scale motions of its N-cap residue N118, which may work as a flypaper to position the scissile ester bond of the substrate. Overall, the dynamics of interactions between the side chains of N14, H24, D97, and N118, control the catalysis of substrate by this enzyme. PMID:28096445
Kim, Jin Young; Carlson, Bradley A.; Xu, Xue-Ming; Zeng, Yu; Chen, Shawn; Gladyshev, Vadim N.; Lee, Byeong Jae; Hatfield, Dolph L.
2011-01-01
There are two isoforms of selenocysteine (Sec) tRNA[Ser]Sec that differ by a single methyl group, Um34. The non-Um34 isoform supports the synthesis of a subclass of selenoproteins, designated housekeeping, while the Um34 isoform supports the expression of another subclass, designated stress-related selenoproteins. Herein, we investigated the relationship between tRNA[Ser]Sec aminoacylation and Um34 synthesis which is the last step in the maturation of this tRNA. Mutation of the discriminator base at position 73 in tRNA[Ser]Sec dramatically reduced aminoacylation with serine, as did an inhibitor of seryl-tRNA synthetase, SB-217452. Although both the mutation and the inhibitor prevented Um34 synthesis, neither precluded the synthesis of any other of the known base modifications on tRNA[Ser]Sec following microinjection and incubation of the mutant tRNA[Ser]Sec transcript, or the wild type transcript along with inhibitor, in Xenopus oocytes. The data demonstrate that Sec tRNA[Ser]Sec must be aminoacylated for Um34 addition. The fact that selenium is required for Um34 methylation suggests that Sec must be attached to its tRNA for Um34 methylation. This would explain why selenium is essential for the function of Um34 methylase and provides further insights into the hierarchy of selenoprotein expression. PMID:21624347
Kim, Eun-Kyong; Martin, Vincent; Krishnamurthy, Ramanarayanan
2017-09-12
The prebiotic synthesis of canonical nucleobases from HCN is a cornerstone for the RNA world hypothesis. However, their role in the primordial pathways to RNA is still debated. The very same process starting from HCN also gives rise to orotic acid, which (via orotidine) plays a crucial role in extant biology in the de novo synthesis of uridine and cytidine, the informational base-pairs in RNA. However, orotidine itself is absent in RNA. Given the prebiotic and biological relevance of orotic acid vis-à-vis uracil, we investigated orotidine-containing RNA oligonucleotides and show that they have severely compromised base-pairing properties. While not unexpected, these results suggest that the emergence of extant RNA cannot just be a consequence of the plausible prebiotic formation of its chemical constituents/building blocks. In combination with other investigations on alternative prebiotic nucleobases, sugars, and linkers, these findings imply that the selection of the components of extant RNA occurred at a higher hierarchical level of an oligomer/polymer based on its functional properties-pointing to a systems chemistry emergence of RNA from a library of precursors. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Zuo, Yu; Xie, Wenfang; Pang, Yue; Li, Tiesong; Li, Qingwei; Li, Yingying
2017-01-01
The composition of the bacterial communities in the hindgut contents of Lampetrs japonica was surveyed by Illumina MiSeq of the 16S rRNA gene. An average of 32385 optimized reads was obtained from three samples. The rarefaction curve based on the operational taxonomic units tended to approach the asymptote. The rank abundance curve representing the species richness and evenness was calculated. The composition of microbe in six classification levels was also analyzed. Top 20 members in genera level were displayed as the classification tree. The abundance of microorganisms in different individuals was displayed as the pie charts at the branch nodes in the classification tree. The differences of top 50 genera in abundance between individuals of lamprey are displayed as a heatmap. The pairwise comparison of bacterial taxa abundance revealed that there are no significant differences of gut microbiota between three individuals of lamprey at a given rarefied depth. Also, the gut microbiota derived from L. japonica displays little similarity with other aquatic organism of Vertebrata after UPGMA analysis. The metabolic function of the bacterial communities was predicted through KEGG analysis. This study represents the first analysis of the bacterial community composition in the gut content of L. japonica. The investigation of the gut microbiota associated with L. japonica will broaden our understanding of this unique organism.
Zhu, Daochen; Tanabe, Shoko-Hosoi; Yang, Chong; Zhang, Weimin; Sun, Jianzhong
2013-01-01
Background Subseafloor sediments accumulate large amounts of organic and inorganic materials that contain a highly diverse microbial ecosystem. The aim of this study was to survey the bacterial community of subseafloor sediments from the South China Sea. Methodology/Principal Findings Pyrosequencing of over 265,000 amplicons of the V3 hypervariable region of the 16S ribosomal RNA gene was performed on 16 sediment samples collected from multiple locations in the northern region of the South China Sea from depths ranging from 35 to 4000 m. A total of 9,726 operational taxonomic units (OTUs; between 695 and 2819 unique OTUs per sample) at 97% sequence similarity level were generated. In total, 40 bacterial phyla including 22 formally described phyla and 18 candidate phyla, with Proteobacteria, Firmicutes, Planctomycetes, Actinobacteria and Chloroflexi being most diverse, were identified. The most abundant phylotype, accounting for 42.6% of all sequences, belonged to Gammaproteobacteria, which possessed absolute predominance in the samples analyzed. Among the 18 candidate phyla, 12 were found for the first time in the South China Sea. Conclusions This study provided a novel insight into the composition of bacterial communities of the South China Sea subseafloor. Furthermore, abundances and community similarity analysis showed that the compositions of the bacterial communities are very similar at phylum level at different depths from 35-4000 m. PMID:24205246
Zhu, Daochen; Tanabe, Shoko-Hosoi; Yang, Chong; Zhang, Weimin; Sun, Jianzhong
2013-01-01
Subseafloor sediments accumulate large amounts of organic and inorganic materials that contain a highly diverse microbial ecosystem. The aim of this study was to survey the bacterial community of subseafloor sediments from the South China Sea. Pyrosequencing of over 265,000 amplicons of the V3 hypervariable region of the 16S ribosomal RNA gene was performed on 16 sediment samples collected from multiple locations in the northern region of the South China Sea from depths ranging from 35 to 4000 m. A total of 9,726 operational taxonomic units (OTUs; between 695 and 2819 unique OTUs per sample) at 97% sequence similarity level were generated. In total, 40 bacterial phyla including 22 formally described phyla and 18 candidate phyla, with Proteobacteria, Firmicutes, Planctomycetes, Actinobacteria and Chloroflexi being most diverse, were identified. The most abundant phylotype, accounting for 42.6% of all sequences, belonged to Gammaproteobacteria, which possessed absolute predominance in the samples analyzed. Among the 18 candidate phyla, 12 were found for the first time in the South China Sea. This study provided a novel insight into the composition of bacterial communities of the South China Sea subseafloor. Furthermore, abundances and community similarity analysis showed that the compositions of the bacterial communities are very similar at phylum level at different depths from 35-4000 m.
Structural, Functional, and Genetic Analysis of Sorangicin Inhibition of Bacterial RNA Polymerase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Campbell,E.; Pavlova, O.; Zenkin, N.
2005-01-01
A combined structural, functional, and genetic approach was used to investigate inhibition of bacterial RNA polymerase (RNAP) by sorangicin (Sor), a macrolide polyether antibiotic. Sor lacks chemical and structural similarity to the ansamycin rifampicin (Rif), an RNAP inhibitor widely used to treat tuberculosis. Nevertheless, structural analysis revealed Sor binds in the same RNAP {beta} subunit pocket as Rif, with almost complete overlap of RNAP binding determinants, and functional analysis revealed that both antibiotics inhibit transcription by directly blocking the path of the elongating transcript at a length of 2-3 nucleotides. Genetic analysis indicates that Rif binding is extremely sensitive tomore » mutations expected to change the shape of the antibiotic binding pocket, while Sor is not. We suggest that conformational flexibility of Sor, in contrast to the rigid conformation of Rif, allows Sor to adapt to changes in the binding pocket. This has important implications for drug design against rapidly mutating targets.« less
A non-isotopic assay uses bromouridine and RNA synthesis to detect DNA damage responses.
Hasegawa, Mayu; Iwai, Shigenori; Kuraoka, Isao
2010-06-17
Individuals with inherited xeroderma pigmentosum (XP) disorder and Cockayne syndrome (CS) are deficient in nucleotide excision repair and experience hypersensitivity to sunlight. Although there are several diagnostic assays for these disorders, the recovery of RNA synthesis (RRS) assay that can discriminate between XP cells and CS cells is very laborious. Here, we report on a novel non-radioisotope RRS assay that uses bromouridine (a uridine analog) as an alternative to (3)H-uridine. This assay can easily detect RNA polymerase I transcription in nucleoli and RNA polymerase II transcription in nuclei. The non-RI RSS assay also can rapidly detect normal RRS activity in HeLa cells. Thus, this assay is useful as a novel and easy technique for CS diagnosis. Because RRS is thought to be related to transcription-coupled DNA repair, which is triggered by the blockage of transcriptional machinery by DNA lesions, this assay may be of use for analysis of DNA repair, transcription, and/or genetic toxicity. Copyright 2010 Elsevier B.V. All rights reserved.
Valiente Moro, Claire; Thioulouse, Jean; Chauve, Claude; Normand, Philippe; Zenner, Lionel
2009-01-01
Dermanyssus gallinae (Arthropoda, Mesostigmata) is suspected to be involved in the transmission of a wide variety of pathogens, but nothing is known about its associated non-pathogenic bacterial community. To address this question, we examined the composition of bacterial communities in D. gallinae collected from standard poultry farms in Brittany, France. Genetic fingerprints of bacterial communities were generated by temporal temperature gradient gel electrophoresis (TTGE) separation of individual polymerase chain reaction (PCR)-amplified 16S rRNA gene fragments, followed by DNA sequence analysis. Most of the sequences belonged to the Proteobacteria and Firmicute phyla, with a majority of sequences corresponding to the Enterobacteriales order and the Staphylococcus genus. By using statistical analysis, we showed differences in biodiversity between poultry farms. We also determined the major phylotypes that compose the characteristic microbiota associated with D. gallinae. Saprophytes, opportunistic pathogens and pathogenic agents such as Pasteurella multocida, Erysipelothrix rhusiopathiae and sequences close to the genus Aerococcus were identified. Endosymbionts such as Schineria sp., Spiroplasma sp. Anistosticta, "Candidatus Cardinium hertigii" and Rickettsiella sp. were also present in the subdominant bacterial community. Identification of potential targets within the symbiont community may be considered in the future as a means of ectoparasite control.
NASA Technical Reports Server (NTRS)
Booth, F. W.; Morrison, P. R.; Thomason, D. B.; Oganov, V. S.
1990-01-01
It is well known that some skeletal muscles atrophy as a result of weightlessness (Steffen and Musacchia 1986) and as a result of hindlimb suspension (Tischler et al., 1985, Thomason et al., 1987). Because the content of protein is determined by the rates of protein synthesis and degradation, a decrease in protein synthesis rate, or an increase in the protein degradation, or changes in both could produce the atrophy. Indeed, an increased protein degradation (Tischler et al., 1985) and a decreased protein synthesis (Thomason et al., 1988) have been observed in skeletal muscles of suspended hindlimbs of rats. Any decrease in protein synthesis rate could be caused by decreases in mRNA concentrations. Such decreases in the concentration and content of alpha-actin mRNA and cytochrome c mRNA have been noted in skeletal muscles of hindlimb suspended rats (Babij and Booth, 1988). From these findings researchers hypothesized that alpha-actin mRNA and cytochrome c mRNA would decrease in the triceps brachia muscle of Cosmos 1887 rats.
Mayer, Christine; Bierhoff, Holger; Grummt, Ingrid
2005-04-15
Cells respond to a variety of extracellular and intracellular forms of stress by down-regulating rRNA synthesis. We have investigated the mechanism underlying stress-dependent inhibition of RNA polymerase I (Pol I) transcription and show that the Pol I-specific transcription factor TIF-IA is inactivated upon stress. Inactivation is due to phosphorylation of TIF-IA by c-Jun N-terminal kinase (JNK) at a single threonine residue (Thr 200). Phosphorylation at Thr 200 impairs the interaction of TIF-IA with Pol I and the TBP-containing factor TIF-IB/SL1, thereby abrogating initiation complex formation. Moreover, TIF-IA is translocated from the nucleolus into the nucleoplasm. Substitution of Thr 200 by valine as well as knock-out of Jnk2 prevent inactivation and translocation of TIF-IA, leading to stress-resistance of Pol I transcription. Our data identify TIF-IA as a downstream target of the JNK pathway and suggest a critical role of JNK2 to protect rRNA synthesis against the harmful consequences of cellular stress.
Pankievicz, V C S; Camilios-Neto, D; Bonato, P; Balsanelli, E; Tadra-Sfeir, M Z; Faoro, H; Chubatsu, L S; Donatti, L; Wajnberg, G; Passetti, F; Monteiro, R A; Pedrosa, F O; Souza, E M
2016-04-01
Herbaspirillum seropedicae is a diazotrophic and endophytic bacterium that associates with economically important grasses promoting plant growth and increasing productivity. To identify genes related to bacterial ability to colonize plants, wheat seedlings growing hydroponically in Hoagland's medium were inoculated with H. seropedicae and incubated for 3 days. Total mRNA from the bacteria present in the root surface and in the plant medium were purified, depleted from rRNA and used for RNA-seq profiling. RT-qPCR analyses were conducted to confirm regulation of selected genes. Comparison of RNA profile of root attached and planktonic bacteria revealed extensive metabolic adaptations to the epiphytic life style. These adaptations include expression of specific adhesins and cell wall re-modeling to attach to the root. Additionally, the metabolism was adapted to the microxic environment and nitrogen-fixation genes were expressed. Polyhydroxybutyrate (PHB) synthesis was activated, and PHB granules were stored as observed by microscopy. Genes related to plant growth promotion, such as auxin production were expressed. Many ABC transporter genes were regulated in the bacteria attached to the roots. The results provide new insights into the adaptation of H. seropedicae to the interaction with the plant.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brown, P.C.; Papaconstantinou, J.
The treatment of Hepa-2 cells, a permanent mouse hepatoma cell line, for 72 h with hydrocortisone (10/sup -6/ M), N/sup 6/,O/sup 2/-dibutyryl cyclic AMP (10/sup -3/ M), or 8-bromo cyclic AMP(10/sup -3/ M) results in a 2-, 3-, or 4-fold increase, respectively, in rates of synthesis and secretion of mouse serum albumin. Simultaneous treatment with hydrocortisone and N/sup 6/,O/sup 2/-dibutyryl cyclic AMP results in a 10-fold stimulation in these parameters, an effect that is significantly more than additive for the two compounds tested. The number of albumin mRNA sequences, determined by hybridization of total cell RNA to albumin complementary DNA,more » was increased in direct proportion to the increases in albumin synthesis in all experiments. The relative rate of albumin synthesis approaches in vivo levels in cells treated simultaneously with hydrocortisone and N/sup 6/,O/sup 2/-dibutyryl cyclic AMP. We propose that these factors may be necessary to maintain the maximal level of differentiated function in the continuous culture of Hepa-2 cells.« less
Holden, Matthew T; Carter, Matthew C D; Wu, Cheng-Hsien; Wolfer, Jamison; Codner, Eric; Sussman, Michael R; Lynn, David M; Smith, Lloyd M
2015-11-17
The photolithographic fabrication of high-density DNA and RNA arrays on flexible and transparent plastic substrates is reported. The substrates are thin sheets of poly(ethylene terephthalate) (PET) coated with cross-linked polymer multilayers that present hydroxyl groups suitable for conventional phosphoramidite-based nucleic acid synthesis. We demonstrate that by modifying array synthesis procedures to accommodate the physical and chemical properties of these materials, it is possible to synthesize plastic-backed oligonucleotide arrays with feature sizes as small as 14 μm × 14 μm and feature densities in excess of 125 000/cm(2), similar to specifications attainable using rigid substrates such as glass or glassy carbon. These plastic-backed arrays are tolerant to a wide range of hybridization temperatures, and improved synthetic procedures are described that enable the fabrication of arrays with sequences up to 50 nucleotides in length. These arrays hybridize with S/N ratios comparable to those fabricated on otherwise identical arrays prepared on glass or glassy carbon. This platform supports the enzymatic synthesis of RNA arrays and proof-of-concept experiments are presented showing that the arrays can be readily subdivided into smaller arrays (or "millichips") using common laboratory-scale laser cutting tools. These results expand the utility of oligonucleotide arrays fabricated on plastic substrates and open the door to new applications for these important bioanalytical tools.
Dual RNA regulatory control of a Staphylococcus aureus virulence factor.
Chabelskaya, Svetlana; Bordeau, Valérie; Felden, Brice
2014-04-01
In pathogens, the accurate programming of virulence gene expression is essential for infection. It is achieved by sophisticated arrays of regulatory proteins and ribonucleic acids (sRNAs), but in many cases their contributions and connections are not yet known. Based on genetic, biochemical and structural evidence, we report that the expression pattern of a Staphylococcus aureus host immune evasion protein is enabled by the collaborative actions of RNAIII and small pathogenicity island RNA D (SprD). Their combined expression profiles during bacterial growth permit early and transient synthesis of Sbi to avoid host immune responses. Together, these two sRNAs use antisense mechanisms to monitor Sbi expression at the translational level. Deletion analysis combined with structural analysis of RNAIII in complex with its novel messenger RNA (mRNA) target indicate that three distant RNAIII domains interact with distinct sites of the sbi mRNA and that two locations are deep in the sbi coding region. Through distinct domains, RNAIII lowers production of two proteins required for avoiding innate host immunity, staphylococcal protein A and Sbi. Toeprints and in vivo mutational analysis reveal a novel regulatory module within RNAIII essential for attenuation of Sbi translation. The sophisticated translational control of mRNA by two differentially expressed sRNAs ensures supervision of host immune escape by a major pathogen.
RNA-dependent RNA targeting by CRISPR-Cas9
DOE Office of Scientific and Technical Information (OSTI.GOV)
Strutt, Steven C.; Torrez, Rachel M.; Kaya, Emine
Double-stranded DNA (dsDNA) binding and cleavage by Cas9 is a hallmark of type II CRISPR-Cas bacterial adaptive immunity. All known Cas9 enzymes are thought to recognize DNA exclusively as a natural substrate, providing protection against DNA phage and plasmids. Here, we show that Cas9 enzymes from both subtypes II-A and II-C can recognize and cleave single-stranded RNA (ssRNA) by an RNA-guided mechanism that is independent of a protospacer-adjacent motif (PAM) sequence in the target RNA. RNA-guided RNA cleavage is programmable and site-specific, and we find that this activity can be exploited to reduce infection by single-stranded RNA phage in vivo.more » We also demonstrate that Cas9 can direct PAM-independent repression of gene expression in bacteria. In conclusion, these results indicate that a subset of Cas9 enzymes have the ability to act on both DNA and RNA target sequences, and suggest the potential for use in programmable RNA targeting applications.« less
RNA-dependent RNA targeting by CRISPR-Cas9
Strutt, Steven C.; Torrez, Rachel M.; Kaya, Emine; ...
2018-01-05
Double-stranded DNA (dsDNA) binding and cleavage by Cas9 is a hallmark of type II CRISPR-Cas bacterial adaptive immunity. All known Cas9 enzymes are thought to recognize DNA exclusively as a natural substrate, providing protection against DNA phage and plasmids. Here, we show that Cas9 enzymes from both subtypes II-A and II-C can recognize and cleave single-stranded RNA (ssRNA) by an RNA-guided mechanism that is independent of a protospacer-adjacent motif (PAM) sequence in the target RNA. RNA-guided RNA cleavage is programmable and site-specific, and we find that this activity can be exploited to reduce infection by single-stranded RNA phage in vivo.more » We also demonstrate that Cas9 can direct PAM-independent repression of gene expression in bacteria. In conclusion, these results indicate that a subset of Cas9 enzymes have the ability to act on both DNA and RNA target sequences, and suggest the potential for use in programmable RNA targeting applications.« less
Suchodolski, Jan S; Dowd, Scot E; Wilke, Vicky; Steiner, Jörg M; Jergens, Albert E
2012-01-01
Canine idiopathic inflammatory bowel disease (IBD) is believed to be caused by a complex interaction of genetic, immunologic, and microbial factors. While mucosa-associated bacteria have been implicated in the pathogenesis of canine IBD, detailed studies investigating the enteric microbiota using deep sequencing techniques are lacking. The objective of this study was to evaluate mucosa-adherent microbiota in the duodenum of dogs with spontaneous idiopathic IBD using 16 S rRNA gene pyrosequencing. Biopsy samples of small intestinal mucosa were collected endoscopically from healthy dogs (n = 6) and dogs with moderate IBD (n = 7) or severe IBD (n = 7) as assessed by a clinical disease activity index. Total RNA was extracted from biopsy specimens and 454-pyrosequencing of the 16 S rRNA gene was performed on aliquots of cDNA from each dog. Intestinal inflammation was associated with significant differences in the composition of the intestinal microbiota when compared to healthy dogs. PCoA plots based on the unweighted UniFrac distance metric indicated clustering of samples between healthy dogs and dogs with IBD (ANOSIM, p<0.001). Proportions of Fusobacteria (p = 0.010), Bacteroidaceae (p = 0.015), Prevotellaceae (p = 0.022), and Clostridiales (p = 0.019) were significantly more abundant in healthy dogs. In contrast, specific bacterial genera within Proteobacteria, including Diaphorobacter (p = 0.044) and Acinetobacter (p = 0.040), were either more abundant or more frequently identified in IBD dogs. In conclusion, dogs with spontaneous IBD exhibit alterations in microbial groups, which bear resemblance to dysbiosis reported in humans with chronic intestinal inflammation. These bacterial groups may serve as useful targets for monitoring intestinal inflammation.
Hibbert, Benjamin; Fung, Irene; McAuley, Rebecca; Larivière, Katherine; MacNeil, Brian; Bafi-Yeboa, Nana; Livesey, John; Trudeau, Vance
2004-09-28
The role of catecholamine neuronal input on GABAergic activity in the hypothalamus, telencephalon, optic tectum, and cerebellum was investigated in early recrudescent female goldfish (Carassius auratus). A new quantitative technique was developed and validated, permitting concomitant quantification and correlational analysis of glutamic acid decarboxylase 65 (GAD65), GAD67, and GAD3 mRNA levels and in vivo GABA synthesis. Catecholamine depletion was achieved by the administration of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP; 50 microg/g body weight) and dopamine (DA) depletion verified by HPLC. Endogenous GABA levels were increased by intraperitoneal administration of gamma-vinyl GABA (GVG; 300 microg/g body weight), an inhibitor of the GABA catabolic enzyme GABA transaminase. Treatment with MPTP resulted in a greater than twofold increase in GABA synthesis rate in the optic tectum and telencephalon. The increase in GABA synthesis rate was highly correlated with an increase in GAD67, but not GAD65 or GAD3 mRNA levels. These results suggest that catecholaminergic input exerts inhibitory effects on GABA synthesis rates through the modulation of GAD67 in the optic tectum and telencephalon. Together with previously published observations in rodents and primates, it is suggested that catecholaminergic control of GABA synthesis must have evolved more than 200 million years ago, before the emergence of the teleost fishes.
High level bacterial contamination of secondary school students’ mobile phones
Kõljalg, Siiri; Mändar, Rando; Sõber, Tiina; Rööp, Tiiu; Mändar, Reet
2017-01-01
Introduction While contamination of mobile phones in the hospital has been found to be common in several studies, little information about bacterial abundance on phones used in the community is available. Our aim was to quantitatively determine the bacterial contamination of secondary school students’ mobile phones. Methods Altogether 27 mobile phones were studied. The contact plate method and microbial identification using MALDI-TOF mass spectrometer were used for culture studies. Quantitative PCR reaction for detection of universal 16S rRNA, Enterococcus faecalis 16S rRNA and Escherichia coli allantoin permease were performed, and the presence of tetracycline (tetA, tetB, tetM), erythromycin (ermB) and sulphonamide (sul1) resistance genes was assessed. Results We found a high median bacterial count on secondary school students’ mobile phones (10.5 CFU/cm2) and a median of 17,032 bacterial 16S rRNA gene copies per phone. Potentially pathogenic microbes (Staphylococcus aureus, Acinetobacter spp., Pseudomonas spp., Bacillus cereus and Neisseria flavescens) were found among dominant microbes more often on phones with higher percentage of E. faecalis in total bacterial 16S rRNA. No differences in contamination level or dominating bacterial species between phone owner’s gender and between phone types (touch screen/keypad) were found. No antibiotic resistance genes were detected on mobile phone surfaces. Conclusion Quantitative study methods revealed high level bacterial contamination of secondary school students’ mobile phones. PMID:28626737
Polypyrimidine tract-binding protein influences negative strand RNA synthesis of dengue virus.
Jiang, Linbin; Yao, Huiling; Duan, Xiaoqun; Lu, Xi; Liu, Yongming
2009-07-24
Flavivirus non-structural protein 4A (NS4A) induces membrane rearrangements to form viral replication complex and functions as interferon antagonist. However, other non-structural roles of NS4A protein in relation to virus life-cycle are poorly defined. This study elucidated if dengue virus (DENV) NS4A protein interacts with host proteins and contributes to viral pathogenesis by screening human liver cDNA yeast-two-hybrid library. Our study identified polypyrimidine tract-binding protein (PTB) as a novel interacting partner of DENV NS4A protein. We reported for the first time that PTB influenced DENV production. Gene-silencing studies showed that PTB did not have an effect on DENV entry and DENV RNA translation. Further functional studies revealed that PTB influenced DENV production by modulating negative strand RNA synthesis. This is the first study that enlightens the interaction of DENV NS4A protein with PTB, in addition to demonstrating the novel role of PTB in relation to mosquito-borne flavivirus life-cycle.
Clay catalyzed RNA synthesis under Martian conditions: Application for Mars return samples.
Joshi, Prakash C; Dubey, Krishna; Aldersley, Michael F; Sausville, Meaghen
2015-06-26
Catalysis by montmorillonites clay minerals is regarded as a feasible mechanism for the abiotic production and polymerization of key biomolecules on early Earth. We have investigated a montmorillonite-catalyzed reaction of the 5'-phosphorimidazolide of nucleosides as a model to probe prebiotic synthesis of RNA-type oligomers. Here we show that this model is specific for the generation of RNA oligomers despite deoxy-mononucleotides adsorbing equally well onto the montmorillonite catalytic surfaces. Optimum catalytic activity was observed over a range of pH (6-9) and salinity (1 ± 0.2 M NaCl). When the weathering steps of early Earth that generated catalytic montmorillonite were modified to meet Martian soil conditions, the catalytic activity remained intact without altering the surface layer charge. Additionally, the formation of oligomers up to tetramer was detected using as little as 0.1 mg of Na⁺-montmorillonite, suggesting that the catalytic activity of a Martian clay return sample can be investigated with sub-milligram scale samples. Copyright © 2015 Elsevier Inc. All rights reserved.
AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES
This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...
Bacterial transformation of terpenoids
NASA Astrophysics Data System (ADS)
Grishko, V. V.; Nogovitsina, Y. M.; Ivshina, I. B.
2014-04-01
Data on the bacterial transformation of terpenoids published in the literature in the past decade are analyzed. Possible pathways for chemo-, regio- and stereoselective modifications of terpenoids are discussed. Considerable attention is given to new technological approaches to the synthesis of terpenoid derivatives suitable for the use in the perfume and food industry and promising as drugs and chiral intermediates for fine organic synthesis. The bibliography includes 246 references.
Crossroads between Bacterial and Mammalian Glycosyltransferases
Brockhausen, Inka
2014-01-01
Bacterial glycosyltransferases (GT) often synthesize the same glycan linkages as mammalian GT; yet, they usually have very little sequence identity. Nevertheless, enzymatic properties, folding, substrate specificities, and catalytic mechanisms of these enzyme proteins may have significant similarity. Thus, bacterial GT can be utilized for the enzymatic synthesis of both bacterial and mammalian types of complex glycan structures. A comparison is made here between mammalian and bacterial enzymes that synthesize epitopes found in mammalian glycoproteins, and those found in the O antigens of Gram-negative bacteria. These epitopes include Thomsen–Friedenreich (TF or T) antigen, blood group O, A, and B, type 1 and 2 chains, Lewis antigens, sialylated and fucosylated structures, and polysialic acids. Many different approaches can be taken to investigate the substrate binding and catalytic mechanisms of GT, including crystal structure analyses, mutations, comparison of amino acid sequences, NMR, and mass spectrometry. Knowledge of the protein structures and functions helps to design GT for specific glycan synthesis and to develop inhibitors. The goals are to develop new strategies to reduce bacterial virulence and to synthesize vaccines and other biologically active glycan structures. PMID:25368613
Tuske, Steven; Sarafianos, Stefan G.; Wang, Xinyue; Hudson, Brian; Sineva, Elena; Mukhopadhyay, Jayanta; Birktoft, Jens J.; Leroy, Olivier; Ismail, Sajida; Clark, Arthur D.; Dharia, Chhaya; Napoli, Andrew; Laptenko, Oleg; Lee, Jookyung; Borukhov, Sergei; Ebright, Richard H.; Arnold, Eddy
2009-01-01
We define the target, mechanism, and structural basis of inhibition of bacterial RNA polymerase (RNAP) by the tetramic-acid antibiotic streptolydigin (Stl). Stl binds to a site adjacent to, but not overlapping, the RNAP active center and stabilizes an RNAP-active-center conformational state with a straight bridge helix. The results provide direct support for the proposals that alternative straight-bridge-helix and bent-bridge-helix RNAP-active-center conformations exist, and that cycling between straight-bridge-helix and bent-bridge-helix RNAP-active-center conformations is required for RNAP function. The results set bounds on models for RNAP function and suggest strategies for design of novel antibacterial agents. PMID:16122422
relA-dependent RNA polymerase activity in Escherichia coli.
Ryals, J; Bremer, H
1982-01-01
Parameters relating to RNA synthesis were measured after a temperature shift from 30 to 42 degrees C, in a relA+ and relA- isogenic pair of Escherichia coli strains containing a temperature-sensitive valyl tRNA synthetase. The following results were obtained: (i) the rRNA chain growth rate increased 2-fold in both strains; (ii) newly synthesized rRNA became unstable in both strains; (iii) the stable RNA gene activity (rRNA and tRNA, measured as stable RNA synthesis rate relative to the total instantaneous rate of RNA synthesis) decreased 1.7-fold in the relA+ strain and increased 1.9-fold in the relA mutant; and (iv) the RNA polymerase activity (measured by the percentage of total RNA polymerase enzyme active in transcription an any instant) decreased from 20 to 3.6% in the relA+ strain and remained unchanged (or increased at most to 22%) in the relA mutant. It is suggested that both rRNA gene activity and the RNA polymerase activity depend on the intracellular concentration of guanosine tetraphosphate, whereas the altered chain elongation rate and stability of rRNA are temperature or amino acid starvation effects, respectively, without involvement of relA function. PMID:6174501
Yao, Jiangwei; Rock, Charles O.
2015-01-01
Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887
DNA recognition by an RNA-guided bacterial Argonaute
Doudna, Jennifer A.
2017-01-01
Argonaute (Ago) proteins are widespread in prokaryotes and eukaryotes and share a four-domain architecture capable of RNA- or DNA-guided nucleic acid recognition. Previous studies identified a prokaryotic Argonaute protein from the eubacterium Marinitoga piezophila (MpAgo), which binds preferentially to 5′-hydroxylated guide RNAs and cleaves single-stranded RNA (ssRNA) and DNA (ssDNA) targets. Here we present a 3.2 Å resolution crystal structure of MpAgo bound to a 21-nucleotide RNA guide and a complementary 21-nucleotide ssDNA substrate. Comparison of this ternary complex to other target-bound Argonaute structures reveals a unique orientation of the N-terminal domain, resulting in a straight helical axis of the entire RNA-DNA heteroduplex through the central cleft of the protein. Additionally, mismatches introduced into the heteroduplex reduce MpAgo cleavage efficiency with a symmetric profile centered around the middle of the helix. This pattern differs from the canonical mismatch tolerance of other Argonautes, which display decreased cleavage efficiency for substrates bearing sequence mismatches to the 5′ region of the guide strand. This structural analysis of MpAgo bound to a hybrid helix advances our understanding of the diversity of target recognition mechanisms by Argonaute proteins. PMID:28520746
Bacterial communities in the phylloplane of Prunus species.
Jo, Yeonhwa; Cho, Jin Kyong; Choi, Hoseong; Chu, Hyosub; Lian, Sen; Cho, Won Kyong
2015-04-01
Bacterial populations in the phylloplane of four different Prunus species were investigated by 16 S rRNA pyrosequencing. Bioinformatic analysis identified an average of 510 operational taxonomic units belonging to 159 genera in 76 families. The two genera, Sphingomonas and Methylobacterium, were dominant in the phylloplane of four Prunus species. Twenty three genera were commonly identified in the four Prunus species, indicating a high level of bacterial diversity dependent on the plant species. Our study based on 16 S rRNA sequencing reveals the complexity of bacterial diversity in the phylloplane of Prunus species in detail. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Natsuizaka, Mitsuteru; Naganuma, Seiji; Kagawa, Shingo; Ohashi, Shinya; Ahmadi, Azal; Subramanian, Harry; Chang, Sanders; Nakagawa, Kei J.; Ji, Xinjun; Liebhaber, Stephen A.; Klein-Szanto, Andres J.; Nakagawa, Hiroshi
2012-01-01
Insulin-like growth factor binding protein (IGFBP)-3 regulates cell proliferation and apoptosis in esophageal squamous cell carcinoma (ESCC) cells. We have investigated how the hypoxic tumor microenvironment in ESCC fosters the induction of IGFBP3. RNA interference experiments revealed that hypoxia-inducible factor (HIF)-1α, but not HIF-2α, regulates IGFBP3 mRNA induction. By chromatin immunoprecipitation and transfection assays, HIF-1α was found to transactivate IGFBP3 through a novel hypoxia responsive element (HRE) located at 57 kb upstream from the transcription start site. Metabolic labeling experiments demonstrated hypoxia-mediated inhibition of global protein synthesis. 7-Methyl GTP-cap binding assays suggested that hypoxia suppresses cap-dependent translation. Experiments using pharmacological inhibitors for mammalian target of rapamycin (mTOR) suggested that a relatively weak mTOR activity may be sufficient for cap-dependent translation of IGFBP3 under hypoxic conditions. Bicistronic RNA reporter transfection assays did not validate the possibility of an internal ribosome entry site as a potential mechanism for cap-independent translation for IGFBP3 mRNA. Finally, IGFBP3 mRNA was found enriched to the polysomes. In aggregate, our study establishes IGFBP3 as a direct HIF-1α target gene and that polysome enrichment of IGFBP3 mRNA may permit continuous translation under hypoxic conditions.—Natsuizaka, M., Naganuma, S., Kagawa, S., Ohashi, S., Ahmadi, A., Subramanian, H., Chang, S., Nakagawa, K. J., Ji, X., Liebhaber, S. A., Klein-Szanto, A. J., Nakagawa, H. Hypoxia induces IGFBP3 in esophageal squamous cancer cells through HIF-1α-mediated mRNA transcription and continuous protein synthesis. PMID:22415309
Haque, Farzin; Guo, Peixuan
2015-01-01
RNA nanotechnology encompasses the use of RNA as a construction material to build homogeneous nanostructures by bottom-up self-assembly with defined size, structure, and stoichiometry; this pioneering concept demonstrated in 1998 (Guo et al., Molecular Cell 2:149-155, 1998; featured in Cell) has emerged as a new field that also involves materials engineering and synthetic structural biology (Guo, Nature Nanotechnology 5:833-842, 2010). The field of RNA nanotechnology has skyrocketed over the last few years, as evidenced by the burst of publications in prominent journals on RNA nanostructures and their applications in nanomedicine and nanotechnology. Rapid advances in RNA chemistry, RNA biophysics, and RNA biology have created new opportunities for translating basic science into clinical practice. RNA nanotechnology holds considerable promise in this regard. Increased evidence also suggests that substantial part of the 98.5 % of human genome (Lander et al. Nature 409:860-921, 2001) that used to be called "junk DNA" actually codes for noncoding RNA. As we understand more on how RNA structures are related to function, we can fabricate synthetic RNA nanoparticles for the diagnosis and treatment of diseases. This chapter provides a brief overview of the field regarding the design, construction, purification, and characterization of RNA nanoparticles for diverse applications in nanotechnology and nanomedicince.
Mapping interactions between the RNA chaperone FinO and its RNA targets
Arthur, David C.; Tsutakawa, Susan; Tainer, John A.; Frost, Laura S.; Glover, J. N. Mark
2011-01-01
Bacterial conjugation is regulated by two-component repression comprising the antisense RNA FinP, and its protein co-factor FinO. FinO mediates base-pairing of FinP to the 5′-untranslated region (UTR) of traJ mRNA, which leads to translational inhibition of the transcriptional activator TraJ and subsequent down regulation of conjugation genes. Yet, little is known about how FinO binds to its RNA targets or how this interaction facilitates FinP and traJ mRNA pairing. Here, we use solution methods to determine how FinO binds specifically to its minimal high affinity target, FinP stem–loop II (SLII), and its complement SLIIc from traJ mRNA. Ribonuclease footprinting reveals that FinO contacts the base of the stem and the 3′ single-stranded tails of these RNAs. The phosphorylation or oxidation of the 3′-nucleotide blocks FinO binding, suggesting FinO binds the 3′-hydroxyl of its RNA targets. The collective results allow the generation of an energy-minimized model of the FinO–SLII complex, consistent with small-angle X-ray scattering data. The repression complex model was constrained using previously reported cross-linking data and newly developed footprinting results. Together, these data lead us to propose a model of how FinO mediates FinP/traJ mRNA pairing to down regulate bacterial conjugation. PMID:21278162
NASA Technical Reports Server (NTRS)
Kozlov, I. A.; Politis, P. K.; Van Aerschot, A.; Busson, R.; Herdewijn, P.; Orgel, L. E.; Bada, J. L. (Principal Investigator); Dolan, M. (Principal Investigator)
1999-01-01
Hexitol nucleic acid (HNA) is an analogue of DNA containing the standard nucleoside bases, but with a phosphorylated 1,5-anhydrohexitol backbone. HNA oligomers form duplexes having the nucleic acid A structure with complementary DNA or RNA oligomers. The HNA decacytidylate oligomer is an efficient template for the oligomerization of the 5'-phosphoroimidazolides of guanosine or deoxyguanosine. Comparison of the oligomerization efficiencies on HNA, RNA, and DNA decacytidylate templates under various conditions suggests strongly that only nucleic acid double helices with the A structure support efficient template-directed synthesis when 5'-phosphoroimidazolides of nucleosides are used as substrates.
Suchodolski, Jan S.; Dowd, Scot E.; Wilke, Vicky; Steiner, Jörg M.; Jergens, Albert E.
2012-01-01
Background Canine idiopathic inflammatory bowel disease (IBD) is believed to be caused by a complex interaction of genetic, immunologic, and microbial factors. While mucosa-associated bacteria have been implicated in the pathogenesis of canine IBD, detailed studies investigating the enteric microbiota using deep sequencing techniques are lacking. The objective of this study was to evaluate mucosa-adherent microbiota in the duodenum of dogs with spontaneous idiopathic IBD using 16 S rRNA gene pyrosequencing. Methodology/Principal Findings Biopsy samples of small intestinal mucosa were collected endoscopically from healthy dogs (n = 6) and dogs with moderate IBD (n = 7) or severe IBD (n = 7) as assessed by a clinical disease activity index. Total RNA was extracted from biopsy specimens and 454-pyrosequencing of the 16 S rRNA gene was performed on aliquots of cDNA from each dog. Intestinal inflammation was associated with significant differences in the composition of the intestinal microbiota when compared to healthy dogs. PCoA plots based on the unweighted UniFrac distance metric indicated clustering of samples between healthy dogs and dogs with IBD (ANOSIM, p<0.001). Proportions of Fusobacteria (p = 0.010), Bacteroidaceae (p = 0.015), Prevotellaceae (p = 0.022), and Clostridiales (p = 0.019) were significantly more abundant in healthy dogs. In contrast, specific bacterial genera within Proteobacteria, including Diaphorobacter (p = 0.044) and Acinetobacter (p = 0.040), were either more abundant or more frequently identified in IBD dogs. Conclusions/Significance In conclusion, dogs with spontaneous IBD exhibit alterations in microbial groups, which bear resemblance to dysbiosis reported in humans with chronic intestinal inflammation. These bacterial groups may serve as useful targets for monitoring intestinal inflammation. PMID:22720094
Sepúlveda, Claudia S.; García, Cybele C.; Levingston Macleod, Jesica M.
2013-01-01
Several arenaviruses can cause severe hemorrhagic fever (HF) in humans, representing a public health threat in endemic areas of Africa and South America. The present study characterizes the potent virucidal activity of the carboxamide-derivatized aromatic disulfide NSC4492, an antiretroviral zinc finger-reactive compound, against Junín virus (JUNV), the causative agent of Argentine HF. The compound was able to inactivate JUNV in a time and temperature-dependent manner, producing more than 99 % reduction in virus titer upon incubation with virions at 37°C for 90 min. The ability of NSC4492-treated JUNV to go through different steps of the multiplication cycle was then evaluated. Inactivated virions were able to bind and enter into the host cell with similar efficiency as control infectious particles. In contrast, treatment with NSC4492 impaired the capacity of JUNV to drive viral RNA synthesis, as measured by quantitative RT-PCR, and blocked viral protein expression, as determined by indirect immunofluorescence. These results suggest that the disulfide NSC4492 targets on the arenavirus replication complex leading to impairment in viral RNA synthesis. Additionally, analysis of VLP produced in NSC4492-treated cells expressing JUNV matrix Z protein revealed that the compound may interact with Z resulting in an altered aggregation behavior of this protein, but without affecting its intrinsic self-budding properties. The potential perspectives of NSC4492 as an inactivating vaccinal compound for pathogenic arenaviruses are discussed. PMID:24278404
Bainbridge, Brian W; Hirano, Takanori; Grieshaber, Nicole; Davey, Mary E
2015-04-01
Bacterial cell surface glycans, such as capsular polysaccharides and lipopolysaccharides (LPS), influence host recognition and are considered key virulence determinants. The periodontal pathogen Porphyromonas gingivalis is known to display at least three different types of surface glycans: O-LPS, A-LPS, and K-antigen capsule. We have shown that PG0121 (in strain W83) encodes a DNABII histone-like protein and that this gene is transcriptionally linked to the K-antigen capsule synthesis genes, generating a large ∼19.4-kb transcript (PG0104-PG0121). Furthermore, production of capsule is deficient in a PG0121 mutant strain. In this study, we report on the identification of an antisense RNA (asRNA) molecule located within a 77-bp inverted repeat (77bpIR) element located near the 5' end of the locus. We show that overexpression of this asRNA decreases the amount of capsule produced, indicating that this asRNA can impact capsule synthesis in trans. We also demonstrate that deletion of the 77bpIR element and thereby synthesis of the large 19.4-kb transcript also diminishes, but does not eliminate, capsule synthesis. Surprisingly, LPS structures were also altered by deletion of the 77bpIR element, and reactivity to monoclonal antibodies specific to both O-LPS and A-LPS was eliminated. Additionally, reduced reactivity to these antibodies was also observed in a PG0106 mutant, indicating that this putative glycosyltransferase, which is required for capsule synthesis, is also involved in LPS synthesis in strain W83. We discuss our finding in the context of how DNABII proteins, an antisense RNA molecule, and the 77bpIR element may modulate expression of surface polysaccharides in P. gingivalis. The periodontal pathogen Porphyromonas gingivalis displays at least three different types of cell surface glycans: O-LPS, A-LPS, and K-antigen capsule. We have shown using Northern analysis that the K-antigen capsule locus encodes a large transcript (∼19.4 kb), encompassing a 77-bp
Bainbridge, Brian W.; Hirano, Takanori; Grieshaber, Nicole
2015-01-01
ABSTRACT Bacterial cell surface glycans, such as capsular polysaccharides and lipopolysaccharides (LPS), influence host recognition and are considered key virulence determinants. The periodontal pathogen Porphyromonas gingivalis is known to display at least three different types of surface glycans: O-LPS, A-LPS, and K-antigen capsule. We have shown that PG0121 (in strain W83) encodes a DNABII histone-like protein and that this gene is transcriptionally linked to the K-antigen capsule synthesis genes, generating a large ∼19.4-kb transcript (PG0104-PG0121). Furthermore, production of capsule is deficient in a PG0121 mutant strain. In this study, we report on the identification of an antisense RNA (asRNA) molecule located within a 77-bp inverted repeat (77bpIR) element located near the 5′ end of the locus. We show that overexpression of this asRNA decreases the amount of capsule produced, indicating that this asRNA can impact capsule synthesis in trans. We also demonstrate that deletion of the 77bpIR element and thereby synthesis of the large 19.4-kb transcript also diminishes, but does not eliminate, capsule synthesis. Surprisingly, LPS structures were also altered by deletion of the 77bpIR element, and reactivity to monoclonal antibodies specific to both O-LPS and A-LPS was eliminated. Additionally, reduced reactivity to these antibodies was also observed in a PG0106 mutant, indicating that this putative glycosyltransferase, which is required for capsule synthesis, is also involved in LPS synthesis in strain W83. We discuss our finding in the context of how DNABII proteins, an antisense RNA molecule, and the 77bpIR element may modulate expression of surface polysaccharides in P. gingivalis. IMPORTANCE The periodontal pathogen Porphyromonas gingivalis displays at least three different types of cell surface glycans: O-LPS, A-LPS, and K-antigen capsule. We have shown using Northern analysis that the K-antigen capsule locus encodes a large transcript (∼19.4 kb
Aparicio, Frederic; Pallás, Vicente
2002-01-01
The nucleotide sequences of the RNA 3 of fifteen isolates of Prunus necrotic ringspot virus (PNRSV) varying in the symptomatology they cause in six different Prunus spp. were determined. Analysis of the molecular variability has allowed, in addition to study the phylogenetic relationships among them, to evaluate the minimal requirements for the synthesis of the subgenomic RNA in Ilarvirus genus and their comparison to other members of the Bromoviridae family. Computer assisted comparisons led recently to Jaspars (Virus Genes 17, 233-242, 1998) to propose that a hairpin structure in viral minus strand RNA is required for subgenomic promoter activity of viruses from at least two, and possibly all five, genera in the family of Bromoviridae. For PNRSV and Apple mosaic virus two stable hairpins were proposed whereas for the rest of Ilarviruses and the other four genera of the Bromoviridae family only one stable hairpin was predicted. Comparative analysis of this region among the fifteen PNRSV isolates characterized in this study revealed that two of them showed a 12-nt deletion that led to the disappearance of the most proximal hairpin to the initiation site. Interestingly, the only hairpin found in these two isolates is very similar in primary and secondary structure to the one previously shown in Brome mosaic virus to be required for the synthesis of the subgenomic RNA. In this hairpin, the molecular diversity was concentrated mostly at the loop whereas compensatory mutations were observed at the base of the stem strongly suggesting its functional relevance. The evolutionary implications of these observations are discussed.
Wang, Zuo; Elekwachi, Chijioke; Jiao, Jinzhen; Wang, Min; Tang, Shaoxun; Zhou, Chuanshe; Tan, Zhiliang; Forster, Robert J
2017-01-01
The objective of this present study was to explore the initial establishment of metabolically active bacteria and subsequent evolution in four fractions: rumen solid-phase (RS), liquid-phase (RL), protozoa-associated (RP), and epithelium-associated (RE) through early weaning and supplementing rhubarb root powder in 7 different age groups (1, 10, 20, 38, 41, 50, and 60 d) during rumen development. Results of the 16S rRNA sequencing based on RNA isolated from the four fractions revealed that the potentially active bacterial microbiota in four fractions were dominated by the phyla Proteobacteria, Firmicutes , and Bacteroidetes regardless of different ages. An age-dependent increment of Chao 1 richness was observed in the fractions of RL and RE. The principal coordinate analysis (PCoA) indicated that samples in four fractions all clustered based on different age groups, and the structure of the bacterial community in RE was distinct from those in other three fractions. The abundances of Proteobacteria decreased significantly ( P < 0.05) with age, while increases in the abundances of Firmicutes and Bacteroidetes were noted. At the genus level, the abundance of the predominant genus Mannheimia in the Proteobacteria phylum decreased significantly ( P < 0.05) after 1 d, while the genera Quinella, Prevotella, Fretibacterium, Ruminococcus, Lachnospiraceae NK3A20 group , and Atopobium underwent different manners of increases and dominated the bacterial microbiota across four fractions. Variations of the distributions of some specific bacterial genera across fractions were observed, and supplementation of rhubarb affected the relative abundance of various genera of bacteria.
Wang, Zuo; Elekwachi, Chijioke; Jiao, Jinzhen; Wang, Min; Tang, Shaoxun; Zhou, Chuanshe; Tan, Zhiliang; Forster, Robert J.
2017-01-01
The objective of this present study was to explore the initial establishment of metabolically active bacteria and subsequent evolution in four fractions: rumen solid-phase (RS), liquid-phase (RL), protozoa-associated (RP), and epithelium-associated (RE) through early weaning and supplementing rhubarb root powder in 7 different age groups (1, 10, 20, 38, 41, 50, and 60 d) during rumen development. Results of the 16S rRNA sequencing based on RNA isolated from the four fractions revealed that the potentially active bacterial microbiota in four fractions were dominated by the phyla Proteobacteria, Firmicutes, and Bacteroidetes regardless of different ages. An age-dependent increment of Chao 1 richness was observed in the fractions of RL and RE. The principal coordinate analysis (PCoA) indicated that samples in four fractions all clustered based on different age groups, and the structure of the bacterial community in RE was distinct from those in other three fractions. The abundances of Proteobacteria decreased significantly (P < 0.05) with age, while increases in the abundances of Firmicutes and Bacteroidetes were noted. At the genus level, the abundance of the predominant genus Mannheimia in the Proteobacteria phylum decreased significantly (P < 0.05) after 1 d, while the genera Quinella, Prevotella, Fretibacterium, Ruminococcus, Lachnospiraceae NK3A20 group, and Atopobium underwent different manners of increases and dominated the bacterial microbiota across four fractions. Variations of the distributions of some specific bacterial genera across fractions were observed, and supplementation of rhubarb affected the relative abundance of various genera of bacteria. PMID:28223972
ERIC Educational Resources Information Center
Duvarci, Sevil; Nader, Karim; LeDoux, Joseph E.
2008-01-01
Memory consolidation is the process by which newly learned information is stabilized into long-term memory (LTM). Considerable evidence indicates that retrieval of a consolidated memory returns it to a labile state that requires it to be restabilized. Consolidation of new fear memories has been shown to require de novo RNA and protein synthesis in…
Darzynkiewicz, Zbigniew; Traganos, Frank; Zhao, Hong; Halicka, H. Dorota; Li, Jiangwei
2011-01-01
This review covers progress in the development of cytometric methodologies designed to assess DNA replication and RNA synthesis. The early approaches utilizing autoradiography to detect incorporation of 3H- or 14C-labeled thymidine were able to identify the four fundamental phases of the cell cycle G1, S, G2, and M, and by analysis of the fraction of labeled mitosis (FLM), to precisely define the kinetics of cell progression through these phases. Analysis of 3H-uridine incorporation and RNA content provided the means to distinguish quiescent G0 from cycling G1 cells. Subsequent progress in analysis of DNA replication was based on the use of BrdU as a DNA precursor and its detection by the quenching of the fluorescence intensity of DNA-bound fluorochromes such as Hoechst 33358 or acridine orange as measured by flow cytometry. Several variants of this methodology have been designed and used in studies to detect anticancer drug-induced perturbations of cell cycle kinetics. The next phase of method development, which was particularly useful in studies of the cell cycle in vivo, including clinical applications, relied on immunocytochemical detection of incorporated halogenated DNA or RNA precursors. This approach however was hampered by the need for DNA denaturation, which made it difficult to concurrently detect other cell constituents for multiparametric analysis. The recently introduced “click chemistry” approach has no such limitation and is the method of choice for analysis of DNA replication and RNA synthesis. This method is based on the use of 5-ethynyl-2′deoxyuridine (EdU) as a DNA precursor or 5-ethynyluridine (EU) as an RNA precursor and their detection with fluorochrome-tagged azides utilizing a copper (I) catalyzed [3+2] cycloaddition. Several examples are presented that illustrate incorporation of EdU or EU in cells subjected to DNA damage detected as histone H2AX phosphorylation that have been analyzed by flow or laser scanning cytometry. PMID
Base modifications affecting RNA polymerase and reverse transcriptase fidelity.
Potapov, Vladimir; Fu, Xiaoqing; Dai, Nan; Corrêa, Ivan R; Tanner, Nathan A; Ong, Jennifer L
2018-06-20
Ribonucleic acid (RNA) is capable of hosting a variety of chemically diverse modifications, in both naturally-occurring post-transcriptional modifications and artificial chemical modifications used to expand the functionality of RNA. However, few studies have addressed how base modifications affect RNA polymerase and reverse transcriptase activity and fidelity. Here, we describe the fidelity of RNA synthesis and reverse transcription of modified ribonucleotides using an assay based on Pacific Biosciences Single Molecule Real-Time sequencing. Several modified bases, including methylated (m6A, m5C and m5U), hydroxymethylated (hm5U) and isomeric bases (pseudouridine), were examined. By comparing each modified base to the equivalent unmodified RNA base, we can determine how the modification affected cumulative RNA polymerase and reverse transcriptase fidelity. 5-hydroxymethyluridine and N6-methyladenosine both increased the combined error rate of T7 RNA polymerase and reverse transcriptases, while pseudouridine specifically increased the error rate of RNA synthesis by T7 RNA polymerase. In addition, we examined the frequency, mutational spectrum and sequence context of reverse transcription errors on DNA templates from an analysis of second strand DNA synthesis.
Bacterial DNA detected on pathologically changed heart valves using 16S rRNA gene amplification.
Chalupova, Miroslava; Skalova, Anna; Hajek, Tomas; Geigerova, Lenka; Kralova, Dana; Liska, Pavel; Hecova, Hana; Molacek, Jiri; Hrabak, Jaroslav
2018-05-22
Nowadays, dental diseases are one of the most common illnesses in the world. Some of them can lead to translocation of oral bacteria to the bloodstream causing intermittent bacteraemia. Therefore, a potential association between oral infection and cardiovascular diseases has been discussed in recent years as a result of adhesion of oral microbes to the heart valves. The aim of this study was to detect oral bacteria on pathologically changed heart valves not caused by infective endocarditis. In the study, patients with pathologically changed heart valves were involved. Samples of heart valves removed during heart valve replacement surgery were cut into two parts. One aliquot was cultivated aerobically and anaerobically. Bacterial DNA was extracted using Ultra-Deep Microbiome Prep (Molzym GmbH, Bremen, Germany) followed by a 16S rRNA gene PCR amplification using Mastermix 16S Complete kit (Molzym GmbH, Bremen, Germany). Positive PCR products were sequenced and the sequences were analyzed using BLAST database ( http://www.ncbi.nlm.nih/BLAST ). During the study period, 41 samples were processed. Bacterial DNA of the following bacteria was detected in 21 samples: Cutibacterium acnes (formerly Propionibacterium acnes) (n = 11; 52.38% of patients with positive bacterial DNA detection), Staphylococcus sp. (n = 9; 42.86%), Streptococcus sp. (n = 1; 4.76%), Streptococcus sanguinis (n = 4; 19.05%), Streptococcus oralis (n = 1; 4.76%), Carnobacterium sp. (n = 1; 4.76%), Bacillus sp. (n = 2; 9.52%), and Bergeyella sp. (n = 1; 4.76%). In nine samples, multiple bacteria were found. Our results showed significant appearance of bacteria on pathologically changed heart valves in patients with no symptoms of infective endocarditis.
Initial insights into bacterial succession during human decomposition.
Hyde, Embriette R; Haarmann, Daniel P; Petrosino, Joseph F; Lynne, Aaron M; Bucheli, Sibyl R
2015-05-01
Decomposition is a dynamic ecological process dependent upon many factors such as environment, climate, and bacterial, insect, and vertebrate activity in addition to intrinsic properties inherent to individual cadavers. Although largely attributed to microbial metabolism, very little is known about the bacterial basis of human decomposition. To assess the change in bacterial community structure through time, bacterial samples were collected from several sites across two cadavers placed outdoors to decompose and analyzed through 454 pyrosequencing and analysis of variable regions 3-5 of the bacterial 16S ribosomal RNA (16S rRNA) gene. Each cadaver was characterized by a change in bacterial community structure for all sites sampled as time, and decomposition, progressed. Bacteria community structure is variable at placement and before purge for all body sites. At bloat and purge and until tissues began to dehydrate or were removed, bacteria associated with flies, such as Ignatzschineria and Wohlfahrtimonas, were common. After dehydration and skeletonization, bacteria associated with soil, such as Acinetobacter, were common at most body sites sampled. However, more cadavers sampled through multiple seasons are necessary to assess major trends in bacterial succession.
Childress, Catherine; Feuerbacher, Leigh A.; Phillips, Linda; Burgum, Alex
2013-01-01
Aggregatibacter actinomycetemcomitans, a periodontal pathogen, synthesizes leukotoxin (LtxA), a protein that helps the bacterium evade the host immune response. Transcription of the ltxA operon is induced during anaerobic growth. The cyclic AMP (cAMP) receptor protein (CRP) indirectly increases ltxA expression, but the intermediary regulator is unknown. Integration host factor (IHF) binds to and represses the leukotoxin promoter, but neither CRP nor IHF is responsible for the anaerobic induction of ltxA RNA synthesis. Thus, we have undertaken studies to identify other regulators of leukotoxin transcription and to demonstrate how these proteins work together to modulate leukotoxin synthesis. First, analyses of ltxA RNA expression from defined leukotoxin promoter mutations in the chromosome identify positions −69 to −35 as the key control region and indicate that an activator protein modulates leukotoxin transcription. We show that Mlc, which is a repressor in Escherichia coli, functions as a direct transcriptional activator in A. actinomycetemcomitans; an mlc deletion mutant reduces leukotoxin RNA synthesis, and recombinant Mlc protein binds specifically at the −68 to −40 region of the leukotoxin promoter. Furthermore, we show that CRP activates ltxA expression indirectly by increasing the levels of Mlc. Analyses of Δmlc, Δihf, and Δihf Δmlc strains demonstrate that Mlc can increase RNA polymerase (RNAP) activity directly and that IHF represses ltxA RNA synthesis mainly by blocking Mlc binding. Finally, a Δihf Δmlc mutant still induces ltxA during anaerobic growth, indicating that there are additional factors involved in leukotoxin transcriptional regulation. A model for the coordinated regulation of leukotoxin transcription is presented. PMID:23475968
Mayer, Christine; Zhao, Jian; Yuan, Xuejun; Grummt, Ingrid
2004-02-15
In cycling cells, transcription of ribosomal RNA genes by RNA polymerase I (Pol I) is tightly coordinated with cell growth. Here, we show that the mammalian target of rapamycin (mTOR) regulates Pol I transcription by modulating the activity of TIF-IA, a regulatory factor that senses nutrient and growth-factor availability. Inhibition of mTOR signaling by rapamycin inactivates TIF-IA and impairs transcription-initiation complex formation. Moreover, rapamycin treatment leads to translocation of TIF-IA into the cytoplasm. Rapamycin-mediated inactivation of TIF-IA is caused by hypophosphorylation of Se 44 (S44) and hyperphosphorylation of Se 199 (S199). Phosphorylation at these sites affects TIF-IA activity in opposite ways, for example, phosphorylation of S44 activates and S199 inactivates TIF-IA. The results identify a new target formTOR-signaling pathways and elucidate the molecular mechanism underlying mTOR-dependent regulation of RNA synthesis.
Francis, Andrew J; Resendiz, Marino J E
2017-07-28
Solid-phase synthesis has been used to obtain canonical and modified polymers of nucleic acids, specifically of DNA or RNA, which has made it a popular methodology for applications in various fields and for different research purposes. The procedure described herein focuses on the synthesis, purification, and characterization of dodecamers of RNA 5'-[CUA CGG AAU CAU]-3' containing zero, one, or two modifications located at the C2'-O-position. The probes are based on 2-thiophenylmethyl groups, incorporated into RNA nucleotides via standard organic synthesis and introduced into the corresponding oligonucleotides via their respective phosphoramidites. This report makes use of phosphoramidite chemistry via the four canonical nucleobases (Uridine (U), Cytosine (C), Guanosine (G), Adenosine (A)), as well as 2-thiophenylmethyl functionalized nucleotides modified at the 2'-O-position; however, the methodology is amenable for a large variety of modifications that have been developed over the years. The oligonucleotides were synthesized on a controlled-pore glass (CPG) support followed by cleavage from the resin and deprotection under standard conditions, i.e., a mixture of ammonia and methylamine (AMA) followed by hydrogen fluoride/triethylamine/N-methylpyrrolidinone. The corresponding oligonucleotides were purified via polyacrylamide electrophoresis (20% denaturing) followed by elution, desalting, and isolation via reversed-phase chromatography (Sep-pak, C18-column). Quantification and structural parameters were assessed via ultraviolet-visible (UV-vis) and circular dichroism (CD) photometric analysis, respectively. This report aims to serve as a resource and guide for beginner and expert researchers interested in embarking in this field. It is expected to serve as a work-in-progress as new technologies and methodologies are developed. The description of the methodologies and techniques within this document correspond to a DNA/RNA synthesizer (refurbished and purchased in
Choi, Sun Young; Park, Byeonghyeok; Choi, In-Geol; Sim, Sang Jun; Lee, Sun-Mi; Um, Youngsoon; Woo, Han Min
2016-01-01
The development of high-throughput technology using RNA-seq has allowed understanding of cellular mechanisms and regulations of bacterial transcription. In addition, transcriptome analysis with RNA-seq has been used to accelerate strain improvement through systems metabolic engineering. Synechococcus elongatus PCC 7942, a photosynthetic bacterium, has remarkable potential for biochemical and biofuel production due to photoautotrophic cell growth and direct CO2 conversion. Here, we performed a transcriptome analysis of S. elongatus PCC 7942 using RNA-seq to understand the changes of cellular metabolism and regulation for nitrogen starvation responses. As a result, differentially expressed genes (DEGs) were identified and functionally categorized. With mapping onto metabolic pathways, we probed transcriptional perturbation and regulation of carbon and nitrogen metabolisms relating to nitrogen starvation responses. Experimental evidence such as chlorophyll a and phycobilisome content and the measurement of CO2 uptake rate validated the transcriptome analysis. The analysis suggests that S. elongatus PCC 7942 reacts to nitrogen starvation by not only rearranging the cellular transport capacity involved in carbon and nitrogen assimilation pathways but also by reducing protein synthesis and photosynthesis activities. PMID:27488818
Bacterial and cellular RNAs at work during Listeria infection.
Sesto, Nina; Koutero, Mikael; Cossart, Pascale
2014-01-01
Listeria monocytogenes is an intracellular pathogen that can enter and invade host cells. In the course of its infection, RNA-mediated regulatory mechanisms provide a fast and versatile response for both the bacterium and the host. They regulate a variety of processes, such as environment sensing and virulence in pathogenic bacteria, as well as development, cellular differentiation, metabolism and immune responses in eukaryotic cells. The aim of this article is to summarize first the RNA-mediated regulatory mechanisms that play a role in the Listeria lifestyle and in its virulence, and then the host miRNA responses to Listeria infection. Finally, we discuss the potential cross-talk between bacterial RNAs and host RNA regulatory mechanisms as new mechanisms of bacterial virulence.
Ray-Soni, Ananya; Mooney, Rachel A; Landick, Robert
2017-10-31
In bacteria, intrinsic termination signals cause disassembly of the highly stable elongating transcription complex (EC) over windows of two to three nucleotides after kilobases of RNA synthesis. Intrinsic termination is caused by the formation of a nascent RNA hairpin adjacent to a weak RNA-DNA hybrid within RNA polymerase (RNAP). Although the contributions of RNA and DNA sequences to termination are largely understood, the roles of conformational changes in RNAP are less well described. The polymorphous trigger loop (TL), which folds into the trigger helices to promote nucleotide addition, also is proposed to drive termination by folding into the trigger helices and contacting the terminator hairpin after invasion of the hairpin in the RNAP main cleft [Epshtein V, Cardinale CJ, Ruckenstein AE, Borukhov S, Nudler E (2007) Mol Cell 28:991-1001]. To investigate the contribution of the TL to intrinsic termination, we developed a kinetic assay that distinguishes effects of TL alterations on the rate at which ECs terminate from effects of the TL on the nucleotide addition rate that indirectly affect termination efficiency by altering the time window in which termination can occur. We confirmed that the TL stimulates termination rate, but found that stabilizing either the folded or unfolded TL conformation decreased termination rate. We propose that conformational fluctuations of the TL (TL dynamics), not TL-hairpin contact, aid termination by increasing EC conformational diversity and thus access to favorable termination pathways. We also report that the TL and the TL sequence insertion (SI3) increase overall termination efficiency by stimulating pausing, which increases the flux of ECs into the termination pathway. Published under the PNAS license.
Bacterial diversity in permanently cold and alkaline ikaite columns from Greenland.
Schmidt, Mariane; Priemé, Anders; Stougaard, Peter
2006-12-01
Bacterial diversity in alkaline (pH 10.4) and permanently cold (4 degrees C) ikaite tufa columns from the Ikka Fjord, SW Greenland, was investigated using growth characterization of cultured bacterial isolates with Terminal-restriction fragment length polymorphism (T-RFLP) and sequence analysis of bacterial 16S rRNA gene fragments. More than 200 bacterial isolates were characterized with respect to pH and temperature tolerance, and it was shown that the majority were cold-active alkaliphiles. T-RFLP analysis revealed distinct bacterial communities in different fractions of three ikaite columns, and, along with sequence analysis, it showed the presence of rich and diverse bacterial communities. Rarefaction analysis showed that the 109 sequenced clones in the 16S rRNA gene library represented between 25 and 65% of the predicted species richness in the three ikaite columns investigated. Phylogenetic analysis of the 16S rRNA gene sequences revealed many sequences with similarity to alkaliphilic or psychrophilic bacteria, and showed that 33% of the cloned sequences and 33% of the cultured bacteria showed less than 97% sequence identity to known sequences in databases, and may therefore represent yet unknown species.
Andersen, Niels Møller; Poehlsgaard, Jacob; Warrass, Ralf
2012-01-01
Tildipirosin is a 16-membered-ring macrolide developed to treat bacterial pathogens, including Mannheimia haemolytica and Pasteurella multocida, that cause respiratory tract infections in cattle and swine. Here we evaluated the efficacy of tildipirosin at inhibiting protein synthesis on the ribosome (50% inhibitory concentration [IC50], 0.23 ± 0.01 μM) and compared it with the established veterinary macrolides tylosin, tilmicosin, and tulathromycin. Mutation and methylation at key rRNA nucleotides revealed differences in the interactions of these macrolides within their common ribosomal binding site. PMID:22926570
Romero, J; García-Varela, M; Laclette, J P; Espejo, R T
2002-11-01
To explore the bacterial microbiota in Chilean oyster (Tiostrea chilensis), a molecular approach that permits detection of different bacteria, independently of their capacity to grow in culture media, was used. Bacterial diversity was assessed by analysis of both the 16S rDNA and the 16S-23S intergenic region, obtained by PCR amplifications of DNA extracted from depurated oysters. RFLP of the PCR amplified 16S rDNA showed a prevailing pattern in most of the individuals analyzed, indicating that a few bacterial species were relatively abundant and common in oysters. Cloning and sequencing of the 16S rDNA with the prevailing RFLP pattern indicated that this rRNA was most closely related to Arcobacter spp. However, analysis by the size of the amplified 16S-23S rRNA intergenic regions revealed not Arcobacter spp. but Staphylococcus spp. related bacteria as a major and common component in oyster. These different results may be caused by the absence of target for one of the primers employed for amplification of the intergenic region. Neither of the two bacteria species found in large abundance was recovered after culturing under aerobic, anaerobic, or microaerophilic conditions. This result, however, is expected because the number of bacteria recovered after cultivation was less than 0.01% of the total. All together, these observations suggest that Arcobacter-related strains are probably abundant and common in the Chilean oyster bacterial microbiota.
2004-01-01
The oxidation of polyamines induced by antitumour polyamine analogues has been associated with tumour response to specific agents. The human spermine oxidase, SMO(PAOh1), is one enzyme that may play a direct role in the cellular response to the antitumour polyamine analogues. In the present study, the induction of SMO(PAOh1) enzyme activity by CPENSpm [N1-ethyl-N11-(cyclopropyl)methyl-4,8,diazaundecane] is demonstrated to be a result of newly synthesized mRNA and protein. Inhibition of new RNA synthesis by actinomycin D inhibits both the appearance of SMO(PAOh1) mRNA and enzyme activity. Similarly, inhibition of newly synthesized protein with cycloheximide prevents analogue-induced enzyme activity. Half-life determinations indicate that stabilization of SMO(PAOh1) protein does not play a significant role in analogue-induced activity. However, half-life experiments using actinomycin D indicate that CPENSpm treatment not only increases mRNA expression, but also leads to a significant increase in mRNA half-life (17.1 and 8.8 h for CPENSpm-treated cells and control respectively). Using reporter constructs encompassing the SMO(PAOh1) promoter region, a 30–90% increase in transcription is observed after exposure to CPENSpm. The present results are consistent with the hypothesis that analogue-induced expression of SMO(PAOh1) is a result of increased transcription and stabilization of SMO(PAOh1) mRNA, leading to increased protein production and enzyme activity. These data indicate that the major level of control of SMO(PAOh1) expression in response to polyamine analogues exposure is at the level of mRNA. PMID:15496143
Parulekar, Niranjan Nitin; Kolekar, Pandurang; Jenkins, Andrew; Kleiven, Synne; Utkilen, Hans; Johansen, Anette; Sawant, Sangeeta; Kulkarni-Kale, Urmila; Kale, Mohan; Sæbø, Mona
2017-01-01
Interactions between different phytoplankton taxa and heterotrophic bacterial communities within aquatic environments can differentially support growth of various heterotrophic bacterial species. In this study, phytoplankton diversity was studied using traditional microscopic techniques and the bacterial communities associated with phytoplankton bloom were studied using High Throughput Sequencing (HTS) analysis of 16S rRNA gene amplicons from the V1-V3 and V3-V4 hypervariable regions. Samples were collected from Lake Akersvannet, a eutrophic lake in South Norway, during the growth season from June to August 2013. Microscopic examination revealed that the phytoplankton community was mostly represented by Cyanobacteria and the dinoflagellate Ceratium hirundinella. The HTS results revealed that Proteobacteria (Alpha, Beta, and Gamma), Bacteriodetes, Cyanobacteria, Actinobacteria and Verrucomicrobia dominated the bacterial community, with varying relative abundances throughout the sampling season. Species level identification of Cyanobacteria showed a mixed population of Aphanizomenon flos-aquae, Microcystis aeruginosa and Woronichinia naegeliana. A significant proportion of the microbial community was composed of unclassified taxa which might represent locally adapted freshwater bacterial groups. Comparison of cyanobacterial species composition from HTS and microscopy revealed quantitative discrepancies, indicating a need for cross validation of results. To our knowledge, this is the first study that uses HTS methods for studying the bacterial community associated with phytoplankton blooms in a Norwegian lake. The study demonstrates the value of considering results from multiple methods when studying bacterial communities.
Control of rRNA and tRNA syntheses in Escherichia coli by guanosine tetraphosphate.
Ryals, J; Little, R; Bremer, H
1982-01-01
The expression of stable RNA (rRNA and tRNA) genes and the concentration of guanosine tetraphosphate (ppGpp) were measured in an isogenic pair of relA+ and relA derivatives of Escherichia coli B/r. The cells were either growing exponentially at different rates or subject to amino acid starvation when they were measured. The specific stable RNA gene activity (rs/rt, the rate of rRNA and tRNA synthesis relative to the total instantaneous rate of RNA synthesis) was found to decrease from 1.0 at a ppGpp concentration of 0 (extrapolated value) to 0.24 at saturating concentrations of ppGpp (above 100 pmoles per optical density at 460 nm unit of cell mass). The same relationship between the rs/rt ratio and ppGpp concentration was obtained independent of the physiological state of the bacteria (i.e., independent of the growth rate or of amino acid starvation) and independent of the relA allele. It can be concluded that ppGpp is an effector for stable RNA gene control and that stable RNA genes are not controlled by factors other than the ppGpp-mediated system. The results were shown to be qualitatively and quantitatively consistent with data on in vitro rRNA gene control by ppGpp, and they were interpreted in the light of reported ideas derived from those in vitro experiments. PMID:6179924
Gill, Aman S; Lee, Angela; McGuire, Krista L
2017-08-15
New York City (NYC) is pioneering green infrastructure with the use of bioswales and other engineered soil-based habitats to provide stormwater infiltration and other ecosystem functions. In addition to avoiding the environmental and financial costs of expanding traditional built infrastructure, green infrastructure is thought to generate cobenefits in the form of diverse ecological processes performed by its plant and microbial communities. Yet, although plant communities in these habitats are closely managed, we lack basic knowledge about how engineered ecosystems impact the distribution and functioning of soil bacteria. We sequenced amplicons of the 16S ribosomal subunit, as well as seven genes associated with functional pathways, generated from both total (DNA-based) and expressed (RNA) soil communities in the Bronx, NYC, NY, in order to test whether bioswale soils host characteristic bacterial communities with evidence for enriched microbial functioning, compared to nonengineered soils in park lawns and tree pits. Bioswales had distinct, phylogenetically diverse bacterial communities, including taxa associated with nutrient cycling and metabolism of hydrocarbons and other pollutants. Bioswale soils also had a significantly greater diversity of genes involved in several functional pathways, including carbon fixation ( cbbL-R [ cbbL gene, red-like subunit] and apsA ), nitrogen cycling ( noxZ and amoA ), and contaminant degradation ( bphA ); conversely, no functional genes were significantly more abundant in nonengineered soils. These results provide preliminary evidence that urban land management can shape the diversity and activity of soil communities, with positive consequences for genetic resources underlying valuable ecological functions, including biogeochemical cycling and degradation of common urban pollutants. IMPORTANCE Management of urban soil biodiversity by favoring taxa associated with decontamination or other microbial metabolic processes is a
Lee, Angela; McGuire, Krista L.
2017-01-01
ABSTRACT New York City (NYC) is pioneering green infrastructure with the use of bioswales and other engineered soil-based habitats to provide stormwater infiltration and other ecosystem functions. In addition to avoiding the environmental and financial costs of expanding traditional built infrastructure, green infrastructure is thought to generate cobenefits in the form of diverse ecological processes performed by its plant and microbial communities. Yet, although plant communities in these habitats are closely managed, we lack basic knowledge about how engineered ecosystems impact the distribution and functioning of soil bacteria. We sequenced amplicons of the 16S ribosomal subunit, as well as seven genes associated with functional pathways, generated from both total (DNA-based) and expressed (RNA) soil communities in the Bronx, NYC, NY, in order to test whether bioswale soils host characteristic bacterial communities with evidence for enriched microbial functioning, compared to nonengineered soils in park lawns and tree pits. Bioswales had distinct, phylogenetically diverse bacterial communities, including taxa associated with nutrient cycling and metabolism of hydrocarbons and other pollutants. Bioswale soils also had a significantly greater diversity of genes involved in several functional pathways, including carbon fixation (cbbL-R [cbbL gene, red-like subunit] and apsA), nitrogen cycling (noxZ and amoA), and contaminant degradation (bphA); conversely, no functional genes were significantly more abundant in nonengineered soils. These results provide preliminary evidence that urban land management can shape the diversity and activity of soil communities, with positive consequences for genetic resources underlying valuable ecological functions, including biogeochemical cycling and degradation of common urban pollutants. IMPORTANCE Management of urban soil biodiversity by favoring taxa associated with decontamination or other microbial metabolic processes is a
Nielsen, Lene Nørby; Roager, Henrik M; Casas, Mònica Escolà; Frandsen, Henrik L; Gosewinkel, Ulrich; Bester, Kai; Licht, Tine Rask; Hendriksen, Niels Bohse; Bahl, Martin Iain
2018-02-01
Recently, concerns have been raised that residues of glyphosate-based herbicides may interfere with the homeostasis of the intestinal bacterial community and thereby affect the health of humans or animals. The biochemical pathway for aromatic amino acid synthesis (Shikimate pathway), which is specifically inhibited by glyphosate, is shared by plants and numerous bacterial species. Several in vitro studies have shown that various groups of intestinal bacteria may be differently affected by glyphosate. Here, we present results from an animal exposure trial combining deep 16S rRNA gene sequencing of the bacterial community with liquid chromatography mass spectrometry (LC-MS) based metabolic profiling of aromatic amino acids and their downstream metabolites. We found that glyphosate as well as the commercial formulation Glyfonova ® 450 PLUS administered at up to fifty times the established European Acceptable Daily Intake (ADI = 0.5 mg/kg body weight) had very limited effects on bacterial community composition in Sprague Dawley rats during a two-week exposure trial. The effect of glyphosate on prototrophic bacterial growth was highly dependent on the availability of aromatic amino acids, suggesting that the observed limited effect on bacterial composition was due to the presence of sufficient amounts of aromatic amino acids in the intestinal environment. A strong correlation was observed between intestinal concentrations of glyphosate and intestinal pH, which may partly be explained by an observed reduction in acetic acid produced by the gut bacteria. We conclude that sufficient intestinal levels of aromatic amino acids provided by the diet alleviates the need for bacterial synthesis of aromatic amino acids and thus prevents an antimicrobial effect of glyphosate in vivo. It is however possible that the situation is different in cases of human malnutrition or in production animals. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Mayer, Christine; Zhao, Jian; Yuan, Xuejun; Grummt, Ingrid
2004-01-01
In cycling cells, transcription of ribosomal RNA genes by RNA polymerase I (Pol I) is tightly coordinated with cell growth. Here, we show that the mammalian target of rapamycin (mTOR) regulates Pol I transcription by modulating the activity of TIF-IA, a regulatory factor that senses nutrient and growth-factor availability. Inhibition of mTOR signaling by rapamycin inactivates TIF-IA and impairs transcription-initiation complex formation. Moreover, rapamycin treatment leads to translocation of TIF-IA into the cytoplasm. Rapamycin-mediated inactivation of TIF-IA is caused by hypophosphorylation of Ser 44 (S44) and hyperphosphorylation of Ser 199 (S199). Phosphorylation at these sites affects TIF-IA activity in opposite ways, for example, phosphorylation of S44 activates and S199 inactivates TIF-IA. The results identify a new target for mTOR-signaling pathways and elucidate the molecular mechanism underlying mTOR-dependent regulation of rRNA synthesis. PMID:15004009
Control of rRNA transcription in Escherichia coli.
Condon, C; Squires, C; Squires, C L
1995-01-01
The control of rRNA synthesis in response to both extra- and intracellular signals has been a subject of interest to microbial physiologists for nearly four decades, beginning with the observations that Salmonella typhimurium cells grown on rich medium are larger and contain more RNA than those grown on poor medium. This was followed shortly by the discovery of the stringent response in Escherichia coli, which has continued to be the organism of choice for the study of rRNA synthesis. In this review, we summarize four general areas of E. coli rRNA transcription control: stringent control, growth rate regulation, upstream activation, and anti-termination. We also cite similar mechanisms in other bacteria and eukaryotes. The separation of growth rate-dependent control of rRNA synthesis from stringent control continues to be a subject of controversy. One model holds that the nucleotide ppGpp is the key effector for both mechanisms, while another school holds that it is unlikely that ppGpp or any other single effector is solely responsible for growth rate-dependent control. Recent studies on activation of rRNA synthesis by cis-acting upstream sequences has led to the discovery of a new class of promoters that make contact with RNA polymerase at a third position, called the UP element, in addition to the well-known -10 and -35 regions. Lastly, clues as to the role of antitermination in rRNA operons have begun to appear. Transcription complexes modified at the antiterminator site appear to elongate faster and are resistant to the inhibitory effects of ppGpp during the stringent response. PMID:8531889
Changes in rhizosphere bacterial gene expression following glyphosate treatment.
Newman, Molli M; Lorenz, Nicola; Hoilett, Nigel; Lee, Nathan R; Dick, Richard P; Liles, Mark R; Ramsier, Cliff; Kloepper, Joseph W
2016-05-15
In commercial agriculture, populations and interactions of rhizosphere microflora are potentially affected by the use of specific agrichemicals, possibly by affecting gene expression in these organisms. To investigate this, we examined changes in bacterial gene expression within the rhizosphere of glyphosate-tolerant corn (Zea mays) and soybean (Glycine max) in response to long-term glyphosate (PowerMAX™, Monsanto Company, MO, USA) treatment. A long-term glyphosate application study was carried out using rhizoboxes under greenhouse conditions with soil previously having no history of glyphosate exposure. Rhizosphere soil was collected from the rhizoboxes after four growing periods. Soil microbial community composition was analyzed using microbial phospholipid fatty acid (PLFA) analysis. Total RNA was extracted from rhizosphere soil, and samples were analyzed using RNA-Seq analysis. A total of 20-28 million bacterial sequences were obtained for each sample. Transcript abundance was compared between control and glyphosate-treated samples using edgeR. Overall rhizosphere bacterial metatranscriptomes were dominated by transcripts related to RNA and carbohydrate metabolism. We identified 67 differentially expressed bacterial transcripts from the rhizosphere. Transcripts downregulated following glyphosate treatment involved carbohydrate and amino acid metabolism, and upregulated transcripts involved protein metabolism and respiration. Additionally, bacterial transcripts involving nutrients, including iron, nitrogen, phosphorus, and potassium, were also affected by long-term glyphosate application. Overall, most bacterial and all fungal PLFA biomarkers decreased after glyphosate treatment compared to the control. These results demonstrate that long-term glyphosate use can affect rhizosphere bacterial activities and potentially shift bacterial community composition favoring more glyphosate-tolerant bacteria. Copyright © 2016 The Authors. Published by Elsevier B.V. All
The origin of polynucleotide-directed protein synthesis
NASA Technical Reports Server (NTRS)
Orgel, Leslie E.
1989-01-01
If protein synthesis evolved in an RNA world it was probably preceded by simpler processes by means of which interaction with amino acids conferred selective advantage on replicating RNA molecules. It is suggested that at first the simple attachment of amino acids to the 2'(3') termini of RNA templates favored initiation of replication at the end of the template rather than at internal positions. The second stage in the evolution of protein synthesis would probably have been the association of pairs of charged RNA adaptors in such a way as to favor noncoded formation of peptides. Only after this process had become efficient could coded synthesis have begun.
From "Cellular" RNA to "Smart" RNA: Multiple Roles of RNA in Genome Stability and Beyond.
Michelini, Flavia; Jalihal, Ameya P; Francia, Sofia; Meers, Chance; Neeb, Zachary T; Rossiello, Francesca; Gioia, Ubaldo; Aguado, Julio; Jones-Weinert, Corey; Luke, Brian; Biamonti, Giuseppe; Nowacki, Mariusz; Storici, Francesca; Carninci, Piero; Walter, Nils G; Fagagna, Fabrizio d'Adda di
2018-04-25
Coding for proteins has been considered the main function of RNA since the "central dogma" of biology was proposed. The discovery of noncoding transcripts shed light on additional roles of RNA, ranging from the support of polypeptide synthesis, to the assembly of subnuclear structures, to gene expression modulation. Cellular RNA has therefore been recognized as a central player in often unanticipated biological processes, including genomic stability. This ever-expanding list of functions inspired us to think of RNA as a "smart" phone, which has replaced the older obsolete "cellular" phone. In this review, we summarize the last two decades of advances in research on the interface between RNA biology and genome stability. We start with an account of the emergence of noncoding RNA, and then we discuss the involvement of RNA in DNA damage signaling and repair, telomere maintenance, and genomic rearrangements. We continue with the depiction of single-molecule RNA detection techniques, and we conclude by illustrating the possibilities of RNA modulation in hopes of creating or improving new therapies. The widespread biological functions of RNA have made this molecule a reoccurring theme in basic and translational research, warranting it the transcendence from classically studied "cellular" RNA to "smart" RNA.
Stazic, Damir; Lindell, Debbie; Steglich, Claudia
2011-06-01
The ecologically important cyanobacterium Prochlorococcus possesses the smallest genome among oxyphototrophs, with a reduced suite of protein regulators and a disproportionately high number of regulatory RNAs. Many of these are asRNAs, raising the question whether they modulate gene expression through the protection of mRNA from RNase E degradation. To address this question, we produced recombinant RNase E from Prochlorococcus sp. MED4, which functions optimally at 12 mM Mg(2+), pH 9 and 35°C. RNase E cleavage assays were performed with this recombinant protein to assess enzyme activity in the presence of single- or double-stranded RNA substrates. We found that extraordinarily long asRNAs of 3.5 and 7 kb protect a set of mRNAs from RNase E degradation that accumulate during phage infection. These asRNA-mRNA duplex formations mask single-stranded recognition sites of RNase E, leading to increased stability of the mRNAs. Such interactions directly modulate RNA stability and provide an explanation for enhanced transcript abundance of certain mRNAs during phage infection. Protection from RNase E-triggered RNA decay may constitute a hitherto unknown regulatory function of bacterial cis-asRNAs, impacting gene expression.
Seth, Punit P; Yu, Jinghua; Jazayeri, Ali; Pallan, Pradeep S; Allerson, Charles R; Østergaard, Michael E; Liu, Fengwu; Herdewijn, Piet; Egli, Martin; Swayze, Eric E
2012-06-01
We report the design and synthesis of 2'-fluoro cyclohexenyl nucleic acid (F-CeNA) pyrimidine phosphoramidites and the synthesis and biophysical, structural, and biological evaluation of modified oligonucleotides. The synthesis of the nucleoside phosphoramidites was accomplished in multigram quantities starting from commercially available methyl-D-mannose pyranoside. Installation of the fluorine atom was accomplished using nonafluorobutanesulfonyl fluoride, and the cyclohexenyl ring system was assembled by means of a palladium-catalyzed Ferrier rearrangement. Installation of the nucleobase was carried out under Mitsunobu conditions followed by standard protecting group manipulations to provide the desired pyrimidine phosphoramidites. Biophysical evaluation indicated that F-CeNA shows behavior similar to that of a 2'-modified nucleotide, and duplexes with RNA showed slightly lower duplex thermostability as compared to that of the more rigid 3'-fluoro hexitol nucleic acid (FHNA). However, F-CeNA modified oligonucleotides were significantly more stable against digestion by snake venom phosphodiesterases (SVPD) as compared to unmodified DNA, 2'-fluoro RNA (FRNA), 2'-methoxyethyl RNA (MOE), and FHNA modified oligonucleotides. Examination of crystal structures of a modified DNA heptamer duplex d(GCG)-T*-d(GCG):d(CGCACGC) by X-ray crystallography indicated that the cyclohexenyl ring system exhibits both the (3)H(2) and (2)H(3) conformations, similar to the C3'-endo/C2'-endo conformation equilibrium seen in natural furanose nucleosides. In the (2)H(3) conformation, the equatorial fluorine engages in a relatively close contact with C8 (2.94 Å) of the 3'-adjacent dG nucleotide that may represent a pseudo hydrogen bond. In contrast, the cyclohexenyl ring of F-CeNA was found to exist exclusively in the (3)H(2) (C3'-endo like) conformation in the crystal structure of the modified A-form DNA decamer duplex [d(GCGTA)-T*-d(ACGC)](2.) In an animal experiment, a 16-mer F
Bringing RNA Interference (RNAi) into the High School Classroom
ERIC Educational Resources Information Center
Sengupta, Sibani
2013-01-01
RNA interference (abbreviated RNAi) is a relatively new discovery in the field of mechanisms that serve to regulate gene expression (a.k.a. protein synthesis). Gene expression can be regulated at the transcriptional level (mRNA production, processing, or stability) and at the translational level (protein synthesis). RNAi acts in a gene-specific…
CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening.
Köferle, Anna; Worf, Karolina; Breunig, Christopher; Baumann, Valentin; Herrero, Javier; Wiesbeck, Maximilian; Hutter, Lukas H; Götz, Magdalena; Fuchs, Christiane; Beck, Stephan; Stricker, Stefan H
2016-11-14
The bacterial CRISPR system is fast becoming the most popular genetic and epigenetic engineering tool due to its universal applicability and adaptability. The desire to deploy CRISPR-based methods in a large variety of species and contexts has created an urgent need for the development of easy, time- and cost-effective methods enabling large-scale screening approaches. Here we describe CORALINA (comprehensive gRNA library generation through controlled nuclease activity), a method for the generation of comprehensive gRNA libraries for CRISPR-based screens. CORALINA gRNA libraries can be derived from any source of DNA without the need of complex oligonucleotide synthesis. We show the utility of CORALINA for human and mouse genomic DNA, its reproducibility in covering the most relevant genomic features including regulatory, coding and non-coding sequences and confirm the functionality of CORALINA generated gRNAs. The simplicity and cost-effectiveness make CORALINA suitable for any experimental system. The unprecedented sequence complexities obtainable with CORALINA libraries are a necessary pre-requisite for less biased large scale genomic and epigenomic screens.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stanek, Kimberly A.; Patterson-West, Jennifer; Randolph, Peter S.
The host factor Hfq, as the bacterial branch of the Sm family, is an RNA-binding protein involved in the post-transcriptional regulation of mRNA expression and turnover. Hfq facilitates pairing between small regulatory RNAs (sRNAs) and their corresponding mRNA targets by binding both RNAs and bringing them into close proximity. Hfq homologs self-assemble into homo-hexameric rings with at least two distinct surfaces that bind RNA. Recently, another binding site, dubbed the `lateral rim', has been implicated in sRNA·mRNA annealing; the RNA-binding properties of this site appear to be rather subtle, and its degree of evolutionary conservation is unknown. An Hfq homologmore » has been identified in the phylogenetically deep-branching thermophileAquifex aeolicus(Aae), but little is known about the structure and function of Hfq from basal bacterial lineages such as the Aquificae. Therefore,AaeHfq was cloned, overexpressed, purified, crystallized and biochemically characterized. Structures ofAaeHfq were determined in space groupsP1 andP6, both to 1.5 Å resolution, and nanomolar-scale binding affinities for uridine- and adenosine-rich RNAs were discovered. Co-crystallization with U 6RNA reveals that the outer rim of theAaeHfq hexamer features a well defined binding pocket that is selective for uracil. ThisAaeHfq structure, combined with biochemical and biophysical characterization of the homolog, reveals deep evolutionary conservation of the lateral RNA-binding mode, and lays a foundation for further studies of Hfq-associated RNA biology in ancient bacterial phyla.« less
Wessman, Maria; Thorsteinsson, Kristina; Jensen, Jørgen S; Storgaard, Merete; Rönsholt, Frederikke F; Johansen, Isik S; Pedersen, Gitte; Nørregård Nielsen, Lars; Bonde, Jesper; Katzenstein, Terese L; Weis, Nina; Lebech, Anne-Mette
2017-05-31
Bacterial vaginosis (BV) has been found to be associated with HIV acquisition and transmission. This is suggested to be due to higher HIV RNA levels in cervicovaginal fluids in women living with HIV (WLWH) with BV, as bacteria associated with BV may induce viral replication and shedding in the genital tract despite undetectable HIV RNA plasma viral load. We examined the prevalence and diagnostic predictors of BV and HIV-1 RNA vaginal shedding in women living with HIV (WLWH) in Denmark, taking into account the presence of human papillomavirus (HPV) and herpes viridae. WLWH between 18-51 years were recruited from six Departments of Infectious Diseases in Denmark during enrolment in the SHADE cohort; a prospective cohort study of WLWH attending regular outpatient care. BV was diagnosed by microscopy of vaginal swabs and PCR was used for detection of BV-associated bacteria, HPV, herpes viridae, and vaginal HIV viral load. Median age of the 150 included women was 41 years; ethnicity was predominantly White (35%) or Black (47%). The majority (96%) was on ART and had undetectable (85%) plasma HIV RNA (<40 copies/mL). BV was diagnosed in 32%. Overall, 11% had detectable vaginal HIV RNA. Both before and after adjustment for BV, age, ethnicity, plasma HIV RNA, CD4 cell count, herpes viridae and HPV, we found no significant predictors of HIV RNA vaginal shedding. In well-treated WLWH, BV, herpes viridae or HPV do not predict vaginal HIV RNA shedding. This implies that HIV shedding does not seem to be increased by BV.
Stracy, Mathew; Lesterlin, Christian; Garza de Leon, Federico; Uphoff, Stephan; Zawadzki, Pawel; Kapanidis, Achillefs N.
2015-01-01
Despite the fundamental importance of transcription, a comprehensive analysis of RNA polymerase (RNAP) behavior and its role in the nucleoid organization in vivo is lacking. Here, we used superresolution microscopy to study the localization and dynamics of the transcription machinery and DNA in live bacterial cells, at both the single-molecule and the population level. We used photoactivated single-molecule tracking to discriminate between mobile RNAPs and RNAPs specifically bound to DNA, either on promoters or transcribed genes. Mobile RNAPs can explore the whole nucleoid while searching for promoters, and spend 85% of their search time in nonspecific interactions with DNA. On the other hand, the distribution of specifically bound RNAPs shows that low levels of transcription can occur throughout the nucleoid. Further, clustering analysis and 3D structured illumination microscopy (SIM) show that dense clusters of transcribing RNAPs form almost exclusively at the nucleoid periphery. Treatment with rifampicin shows that active transcription is necessary for maintaining this spatial organization. In faster growth conditions, the fraction of transcribing RNAPs increases, as well as their clustering. Under these conditions, we observed dramatic phase separation between the densest clusters of RNAPs and the densest regions of the nucleoid. These findings show that transcription can cause spatial reorganization of the nucleoid, with movement of gene loci out of the bulk of DNA as levels of transcription increase. This work provides a global view of the organization of RNA polymerase and transcription in living cells. PMID:26224838
NASA Astrophysics Data System (ADS)
MacGregor, B. J.; Mendlovitz, H.; Albert, D.; Teske, A. P.
2012-12-01
Small-subunit ribosomal RNA (SSU rRNA) is a phylogenetically informative molecule found in all species. Because it is poorly preserved in most environments, it is a useful marker for active microbial populations. We are using the natural-abundance stable carbon isotopic composition of specific microbial groups to help identify the carbon substrates contributing to microbial biomass in a variety of marine environments. At Guaymas Basin, hydrothermal fluids interact with abundant sedimentary organic carbon to produce natural gas and petroleum. Where this reaches the sediment surface, it can support dense patches of seafloor life, including Beggiatoa mats. We report here on the stable carbon isotopic composition of SSU rRNA from a Beggiatoa mat transect, a cold background site, a warm site with high oil concentration, and a second Beggiatoa mat. The central part of the transect mat overlay the steepest temperature gradient, and was visually dominated by orange Beggiatoa. This was fringed by white Beggiatoa mat and bare, but still warm, sediment. Methane concentrations were saturating beneath the orange and white mats and at the oily site, lower beneath bare sediment, and below detection at the background site. Our initial hypotheses were that rRNA isotopic composition would be strongly influenced by methane supply, and that archaeal rRNA might be lighter than bacterial due to contributions from methanogens and anaerobic methane oxidizers. We used biotin-labeled oligonucleotides to capture Bacterial and Archaeal SSU rRNA for isotopic determination. Background-site rRNA was isotopically heaviest, and bacterial RNA from below 2 cm at the oily site was lightest, consistent with control by methane. Within the transect mat, however, the pattern was more complicated; at some sediment depths, rRNA from the mat periphery was isotopically lightest. Part of this may be due to the spatially and temporally variable paths followed by hydrothermal fluid, which can include horizontal
Krasheninina, Olga A; Novopashina, Darya S; Lomzov, Alexander A; Venyaminova, Alya G
2014-09-05
The synthesis and properties two series of new 2'-O-methyl RNA probes, each containing a single insertion of a 2'-bispyrenylmethylphosphorodiamidate derivative of a nucleotide (U, C, A, and G), are described. As demonstrated by UV melting studies, the probes form stable complexes with model RNAs and DNAs. Significant increases (up to 21-fold) in pyrene excimer fluorescence intensity were observed upon binding of most of the probes with complementary RNAs, but not with DNAs. The fluorescence spectra are independent of the nature of the modified nucleotides. The nucleotides on the 5'-side of the modified nucleotide have no effect on the fluorescence spectra, whereas the natures of the two nucleotides on the 3'-side are important: CC, CG, and UC dinucleotide units on the 3'-side of the modified nucleotide provide the maximum increases in excimer fluorescence intensity. This study suggests that these 2'-bispyrene-labeled 2'-O-methyl RNA probes might be useful tools for detection of RNAs. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Genetic Validation of Aminoacyl-tRNA Synthetases as Drug Targets in Trypanosoma brucei
Kalidas, Savitha; Cestari, Igor; Monnerat, Severine; Li, Qiong; Regmi, Sandesh; Hasle, Nicholas; Labaied, Mehdi; Parsons, Marilyn; Stuart, Kenneth
2014-01-01
Human African trypanosomiasis (HAT) is an important public health threat in sub-Saharan Africa. Current drugs are unsatisfactory, and new drugs are being sought. Few validated enzyme targets are available to support drug discovery efforts, so our goal was to obtain essentiality data on genes with proven utility as drug targets. Aminoacyl-tRNA synthetases (aaRSs) are known drug targets for bacterial and fungal pathogens and are required for protein synthesis. Here we survey the essentiality of eight Trypanosoma brucei aaRSs by RNA interference (RNAi) gene expression knockdown, covering an enzyme from each major aaRS class: valyl-tRNA synthetase (ValRS) (class Ia), tryptophanyl-tRNA synthetase (TrpRS-1) (class Ib), arginyl-tRNA synthetase (ArgRS) (class Ic), glutamyl-tRNA synthetase (GluRS) (class 1c), threonyl-tRNA synthetase (ThrRS) (class IIa), asparaginyl-tRNA synthetase (AsnRS) (class IIb), and phenylalanyl-tRNA synthetase (α and β) (PheRS) (class IIc). Knockdown of mRNA encoding these enzymes in T. brucei mammalian stage parasites showed that all were essential for parasite growth and survival in vitro. The reduced expression resulted in growth, morphological, cell cycle, and DNA content abnormalities. ThrRS was characterized in greater detail, showing that the purified recombinant enzyme displayed ThrRS activity and that the protein localized to both the cytosol and mitochondrion. Borrelidin, a known inhibitor of ThrRS, was an inhibitor of T. brucei ThrRS and showed antitrypanosomal activity. The data show that aaRSs are essential for T. brucei survival and are likely to be excellent targets for drug discovery efforts. PMID:24562907
Nanson, Jeffrey D; Forwood, Jade K
2015-01-01
Ketoacyl-acyl carrier protein reductases (FabG) are ubiquitously expressed enzymes that catalyse the reduction of acyl carrier protein (ACP) linked thioesters within the bacterial type II fatty acid synthesis (FASII) pathway. The products of these enzymes, saturated and unsaturated fatty acids, are essential components of the bacterial cell envelope. The FASII reductase enoyl-ACP reductase (FabI) has been the focus of numerous drug discovery efforts, some of which have led to clinical trials, yet few studies have focused on FabG. Like FabI, FabG appears to be essential for survival in many bacteria, similarly indicating the potential of this enzyme as a drug target. FabG enzymes are members of the short-chain alcohol dehydrogenase/reductase (SDR) family, and like other SDRs, exhibit highly conserved secondary and tertiary structures, and contain a number of conserved sequence motifs. Here we describe the crystal structures of FabG from Yersinia pestis (YpFabG), the causative agent of bubonic, pneumonic, and septicaemic plague, and three human pandemics. Y. pestis remains endemic in many parts of North America, South America, Southeast Asia, and Africa, and a threat to human health. YpFabG shares a high degree of structural similarity with bacterial homologues, and the ketoreductase domain of the mammalian fatty acid synthase from both Homo sapiens and Sus scrofa. Structural characterisation of YpFabG, and comparison with other bacterial FabGs and the mammalian fatty acid synthase, provides a strong platform for virtual screening of potential inhibitors, rational drug design, and the development of new antimicrobial agents to combat Y. pestis infections.
Template switching between PNA and RNA oligonucleotides
NASA Technical Reports Server (NTRS)
Bohler, C.; Nielsen, P. E.; Orgel, L. E.; Miller, S. L. (Principal Investigator)
1995-01-01
The origin of the RNA world is not easily understood, as effective prebiotic syntheses of the components of RNA, the beta-ribofuranoside-5'-phosphates, are hard to envisage. Recognition of this difficulty has led to the proposal that other genetic systems, the components of which are more easily formed, may have preceded RNA. This raises the question of how transitions between one genetic system and another could occur. Peptide nucleic acid (PNA) resembles RNA in its ability to form double-helical complexes stabilized by Watson-Crick hydrogen bonding between adenine and thymine and between cytosine and guanine, but has a backbone that is held together by amide rather than by phosphodiester bonds. Oligonucleotides bases on RNA are known to act as templates that catalyse the non-enzymatic synthesis of their complements from activated mononucleotides, we now show that RNA oligonucleotides facilitate the synthesis of complementary PNA strands and vice versa. This suggests that a transition between different genetic systems can occur without loss of information.
Recoding aminoacyl-tRNA synthetases for synthetic biology by rational protein-RNA engineering.
Hadd, Andrew; Perona, John J
2014-12-19
We have taken a rational approach to redesigning the amino acid binding and aminoacyl-tRNA pairing specificities of bacterial glutaminyl-tRNA synthetase. The four-stage engineering incorporates generalizable design principles and improves the pairing efficiency of noncognate glutamate with tRNA(Gln) by over 10(5)-fold compared to the wild-type enzyme. Better optimized designs of the protein-RNA complex include substantial reengineering of the globular core region of the tRNA, demonstrating a role for specific tRNA nucleotides in specifying the identity of the genetically encoded amino acid. Principles emerging from this engineering effort open new prospects for combining rational and genetic selection approaches to design novel aminoacyl-tRNA synthetases that ligate noncanonical amino acids onto tRNAs. This will facilitate reconstruction of the cellular translation apparatus for applications in synthetic biology.
Synthesis and Labeling of RNA In Vitro
Huang, Chao; Yu, Yi-Tao
2013-01-01
This unit discusses several methods for generating large amounts of uniformly labeled, end-labeled, and site-specifically labeled RNAs in vitro. The methods involve a number of experimental procedures, including RNA transcription, 5′ dephosphorylation and rephosphorylation, 3′ terminal nucleotide addition (via ligation), site-specific RNase H cleavage directed by 2′-O-methyl RNA-DNA chimeras, and 2-piece splint ligation. The applications of these RNA radiolabeling approaches are also discussed. PMID:23547015
Recognition of the bacterial alarmone ZMP through long-distance association of two RNA subdomains
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jones, Christopher P.; Ferré-D'Amaré, Adrian R.
The bacterial alarmone 5-aminoimidazole-4-carboxamide riboside 5'-triphosphate (AICAR triphosphate or ZTP), derived from the monophosphorylated purine precursor ZMP, accumulates during folate starvation. ZTP regulates genes involved in purine and folate metabolism through a cognate riboswitch. The linker connecting this riboswitch's two subdomains varies in length by over 100 nucleotides. In this paper, we report the cocrystal structure of the Fusobacterium ulcerans riboswitch bound to ZMP, which spans the two subdomains whose interface also comprises a pseudoknot and ribose zipper. The riboswitch recognizes the carboxamide oxygen of ZMP through an unprecedented inner-sphere coordination with a Mg 2+ ion. We show that themore » affinity of the riboswitch for ZMP is modulated by the linker length. Notably, ZMP can simultaneously bind to the two subdomains even when they are synthesized as separate RNAs. Finally, the ZTP riboswitch demonstrates how specific small-molecule binding can drive association of distant noncoding-RNA domains to regulate gene expression.« less
Recognition of the bacterial alarmone ZMP through long-distance association of two RNA subdomains
Jones, Christopher P.; Ferré-D'Amaré, Adrian R.
2015-08-17
The bacterial alarmone 5-aminoimidazole-4-carboxamide riboside 5'-triphosphate (AICAR triphosphate or ZTP), derived from the monophosphorylated purine precursor ZMP, accumulates during folate starvation. ZTP regulates genes involved in purine and folate metabolism through a cognate riboswitch. The linker connecting this riboswitch's two subdomains varies in length by over 100 nucleotides. In this paper, we report the cocrystal structure of the Fusobacterium ulcerans riboswitch bound to ZMP, which spans the two subdomains whose interface also comprises a pseudoknot and ribose zipper. The riboswitch recognizes the carboxamide oxygen of ZMP through an unprecedented inner-sphere coordination with a Mg 2+ ion. We show that themore » affinity of the riboswitch for ZMP is modulated by the linker length. Notably, ZMP can simultaneously bind to the two subdomains even when they are synthesized as separate RNAs. Finally, the ZTP riboswitch demonstrates how specific small-molecule binding can drive association of distant noncoding-RNA domains to regulate gene expression.« less
Mardirossian, Mario; Grzela, Renata; Giglione, Carmela; Meinnel, Thierry; Gennaro, Renato; Mergaert, Peter; Scocchi, Marco
2014-12-18
Antimicrobial peptides (AMPs) are molecules from innate immunity with high potential as novel anti-infective agents. Most of them inactivate bacteria through pore formation or membrane barrier disruption, but others cross the membrane without damages and act inside the cells, affecting vital processes. However, little is known about their intracellular bacterial targets. Here we report that Bac71-35, a proline-rich AMP belonging to the cathelicidin family, can reach high concentrations (up to 340 μM) inside the E. coli cytoplasm. The peptide specifically and completely inhibits in vitro translation in the micromolar concentration range. Experiments of incorporation of radioactive precursors in macromolecules with E. coli cells confirmed that Bac71-35 affects specifically protein synthesis. Ribosome coprecipitation and crosslinking assays showed that the peptide interacts with ribosomes, binding to a limited subset of ribosomal proteins. Overall, these results indicate that the killing mechanism of Bac71-35 is based on a specific block of protein synthesis. Copyright © 2014 Elsevier Ltd. All rights reserved.
Saito-Tarashima, Noriko; Ota, Masashi; Minakawa, Noriaki
2017-09-18
Herein is described a detailed protocol for the synthesis of 4'-selenoribonucleoside derivatives that involves the use of a hypervalent iodine species. These derivatives are versatile units for the preparation of 4'-selenoRNA. Large-scale synthesis of a 4-selenosugar starting from D-ribose is achieved in eight steps, including a final chromatographic purification. The resulting 4-selenosugar is then subjected to the one-pot Pummerer-like reaction using hypervalent iodine in the presence of silylated nucleobases. The reaction with silylated uracil affords the desired 4'-selenouridine derivatives with excellent β-selectivity and in good yield. Conversely, when purine nucleobases are used in the Pummerer-like reaction, N7 4'-selenoribonucleoside isomers are obtained alongside the desired N9 isomers. However, the undesired N7 isomers can be converted to the desired N9 ones under acidic conditions. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
A Simple and Rapid Method for Preparing a Cell-Free Bacterial Lysate for Protein Synthesis
Kaduri, Maya; Shainsky-Roitman, Janna; Goldfeder, Mor; Ivanir, Eran; Benhar, Itai; Shoham, Yuval; Schroeder, Avi
2016-01-01
Cell-free protein synthesis (CFPS) systems are important laboratory tools that are used for various synthetic biology applications. Here, we present a simple and inexpensive laboratory-scale method for preparing a CFPS system from E. coli. The procedure uses basic lab equipment, a minimal set of reagents, and requires less than one hour to process the bacterial cell mass into a functional S30-T7 extract. BL21(DE3) and MRE600 E. coli strains were used to prepare the S30-T7 extract. The CFPS system was used to produce a set of fluorescent and therapeutic proteins of different molecular weights (up to 66 kDa). This system was able to produce 40–150 μg-protein/ml, with variations depending on the plasmid type, expressed protein and E. coli strain. Interestingly, the BL21-based CFPS exhibited stability and increased activity at 40 and 45°C. To the best of our knowledge, this is the most rapid and affordable lab-scale protocol for preparing a cell-free protein synthesis system, with high thermal stability and efficacy in producing therapeutic proteins. PMID:27768741
Spontaneous reverse movement of mRNA-bound tRNA through the ribosome.
Konevega, Andrey L; Fischer, Niels; Semenkov, Yuri P; Stark, Holger; Wintermeyer, Wolfgang; Rodnina, Marina V
2007-04-01
During the translocation step of protein synthesis, a complex of two transfer RNAs bound to messenger RNA (tRNA-mRNA) moves through the ribosome. The reaction is promoted by an elongation factor, called EF-G in bacteria, which, powered by GTP hydrolysis, induces an open, unlocked conformation of the ribosome that allows for spontaneous tRNA-mRNA movement. Here we show that, in the absence of EF-G, there is spontaneous backward movement, or retrotranslocation, of two tRNAs bound to mRNA. Retrotranslocation is driven by the gain in affinity when a cognate E-site tRNA moves into the P site, which compensates the affinity loss accompanying the movement of peptidyl-tRNA from the P to the A site. These results lend support to the diffusion model of tRNA movement during translocation. In the cell, tRNA movement is biased in the forward direction by EF-G, which acts as a Brownian ratchet and prevents backward movement.
Benthic bacterial diversity in submerged sinkhole ecosystems.
Nold, Stephen C; Pangborn, Joseph B; Zajack, Heidi A; Kendall, Scott T; Rediske, Richard R; Biddanda, Bopaiah A
2010-01-01
Physicochemical characterization, automated ribosomal intergenic spacer analysis (ARISA) community profiling, and 16S rRNA gene sequencing approaches were used to study bacterial communities inhabiting submerged Lake Huron sinkholes inundated with hypoxic, sulfate-rich groundwater. Photosynthetic cyanobacterial mats on the sediment surface were dominated by Phormidium autumnale, while deeper, organically rich sediments contained diverse and active bacterial communities.
tRNA wobble modifications and protein homeostasis
Ranjan, Namit; Rodnina, Marina V.
2016-01-01
Abstract tRNA is a central component of the protein synthesis machinery in the cell. In living cells, tRNAs undergo numerous post-transcriptional modifications. In particular, modifications at the anticodon loop play an important role in ensuring efficient protein synthesis, maintaining protein homeostasis, and helping cell adaptation and survival. Hypo-modification of the wobble position of the tRNA anticodon loop is of particular relevance for translation regulation and is implicated in various human diseases. In this review we summarize recent evidence of how methyl and thiol modifications in eukaryotic tRNA at position 34 affect cellular fitness and modulate regulatory circuits at normal conditions and under stress. PMID:27335723
Watanabe, Hikaru; Takaya, Tomohiro; Shimoi, Toshinobu; Ogawa, Hiroto; Kitamura, Yoshiichiro; Oka, Kotaro
2005-03-01
We investigated the process of memory consolidation following classical conditioning of earthworms. Earthworms were conditioned in paired trials by a weak vibration as a conditioned stimulus (CS), and by light as an unconditioned stimulus (US). The occurrence of a shrinking response upon exposure to the CS increased steadily with the number of paired training trials. When the training procedure was changed by increasing the intertrial interval (ITI), it was found that only those worms trained with a 68 s ITI exhibited long-term memory retention for at least 24 h. The influence of mRNA synthesis inhibition by actinomycin-D or of protein synthesis by anisomycin on memory consolidation was also examined. Induction of the long-term memory was blocked when either of these two compounds was injected into the body cavity of the worm within 25 min of conditioning with the 68 s ITI. These results demonstrate that the long-term memory is dependent upon protein synthesis in response to the upregulation of new transcription messengers.
Glycerol as an additional carbon source for bacterial cellulose synthesis
NASA Astrophysics Data System (ADS)
Agustin, Y. E.; Padmawijaya, K. S.; Rixwari, H. F.; Yuniharto, V. A. S.
2018-03-01
Bacterial cellulose, the fermentation result of Acetobacter xylinus can be produced when glycerol was used as an additional carbon source. In this research, bacterial cellulose produced in two different fermentation medium, Hestrin and Scharmm (HS) medium and HS medium with additional MgSO4. Concentration of glycerol that used in this research were 0%; 5%; 10%; and 15% (v/v). The optimum conditions of bacterial cellulose production on each experiment variations determined by characterization of the mechanical properties, including thickness, tensile strength and elongation. Fourier Transform Infra Red Spectroscopy (FTIR) revealed the characterization of bacterial cellulose. Results showed that the growth rate of bacterial cellulose in HS-MgSO4-glycerol medium was faster than in HS-glycerol medium. Increasing concentrations of glycerol will lower the value of tensile strength and elongation. Elongation test showed that the elongation bacterial cellulose (BC) with the addition of 4.95% (v/v) glycerol in the HS-MgSO4 medium is the highest elongation value. The optimum bacterial cellulose production was achieved when 4.95% (v/v) of glycerol added into HS-MgSO4 medium with stress at break of 116.885 MPa and 4.214% elongation.
Almalki, Abdulraheem; Alston, Charlotte L; Parker, Alasdair; Simonic, Ingrid; Mehta, Sarju G; He, Langping; Reza, Mojgan; Oliveira, Jorge M A; Lightowlers, Robert N; McFarland, Robert; Taylor, Robert W; Chrzanowska-Lightowlers, Zofia M A
2014-01-01
Mitochondrial aminoacyl-tRNA synthetases (aaRSs) are essential enzymes in protein synthesis since they charge tRNAs with their cognate amino acids. Mutations in the genes encoding mitochondrial aaRSs have been associated with a wide spectrum of human mitochondrial diseases. Here we report the identification of pathogenic mutations (a partial genomic deletion and a highly conserved p. Asp325Tyr missense variant) in FARS2, the gene encoding mitochondrial phenylalanyl-tRNA synthetase, in a patient with early-onset epilepsy and isolated complex IV deficiency in muscle. The biochemical defect was expressed in myoblasts but not in fibroblasts and associated with decreased steady state levels of COXI and COXII protein and reduced steady state levels of the mt-tRNA(Phe) transcript. Functional analysis of the recombinant mutant p. Asp325Tyr FARS2 protein showed an inability to bind ATP and consequently undetectable aminoacylation activity using either bacterial tRNA or human mt-tRNA(Phe) as substrates. Lentiviral transduction of cells with wildtype FARS2 restored complex IV protein levels, confirming that the p.Asp325Tyr mutation is pathogenic, causing respiratory chain deficiency and neurological deficits on account of defective aminoacylation of mt-tRNA(Phe). © 2013. Published by Elsevier B.V. All rights reserved.
Sinkala, Edford; Zyambo, Kanekwa; Besa, Ellen; Kaonga, Patrick; Nsokolo, Bright; Kayamba, Violet; Vinikoor, Michael; Zulu, Rabison; Bwalya, Martin; Foster, Graham R; Kelly, Paul
2018-04-01
Cirrhosis is the dominant cause of portal hypertension globally but may be overshadowed by hepatosplenic schistosomiasis (HSS) in the tropics. In Zambia, schistosomiasis seroprevalence can reach 88% in endemic areas. Bacterial translocation (BT) drives portal hypertension in cirrhosis contributing to mortality but remains unexplored in HSS. Rifaximin, a non-absorbable antibiotic may reduce BT. We aimed to explore the influence of rifaximin on BT, inflammation, and fibrosis in HSS. In this phase II open-label trial (ISRCTN67590499), 186 patients with HSS in Zambia were evaluated and 85 were randomized to standard care with or without rifaximin for 42 days. Changes in markers of inflammation, BT, and fibrosis were the primary outcomes. BT was measured using plasma 16S rRNA, lipopolysaccharide-binding protein, and lipopolysaccharide, whereas hyaluronan was used to measure fibrosis. Tumor necrosis factor receptor 1 (TNFR1) and soluble cluster of differentiation 14 (sCD14) assessed inflammation. 16S rRNA reduced from baseline (median 146 copies/µL, interquartile range [IQR] 9, 537) to day 42 in the rifaximin group (median 63 copies/µL, IQR 12, 196), P < 0.01. The rise in sCD14 was lower ( P < 0.01) in the rifaximin group (median rise 122 ng/mL, IQR-184, 783) than in the non-rifaximin group (median rise 832 ng/mL, IQR 530, 967). TNFR1 decreased ( P < 0.01) in the rifaximin group (median -39 ng/mL IQR-306, 563) but increased in the non-rifaximin group (median 166 ng/mL, IQR 3, 337). Other markers remained unaffected. Rifaximin led to a reduction of inflammatory markers and bacterial 16S rRNA which may implicate BT in the inflammation in HSS.
Sinkala, Edford; Zyambo, Kanekwa; Besa, Ellen; Kaonga, Patrick; Nsokolo, Bright; Kayamba, Violet; Vinikoor, Michael; Zulu, Rabison; Bwalya, Martin; Foster, Graham R.; Kelly, Paul
2018-01-01
Abstract. Cirrhosis is the dominant cause of portal hypertension globally but may be overshadowed by hepatosplenic schistosomiasis (HSS) in the tropics. In Zambia, schistosomiasis seroprevalence can reach 88% in endemic areas. Bacterial translocation (BT) drives portal hypertension in cirrhosis contributing to mortality but remains unexplored in HSS. Rifaximin, a non-absorbable antibiotic may reduce BT. We aimed to explore the influence of rifaximin on BT, inflammation, and fibrosis in HSS. In this phase II open-label trial (ISRCTN67590499), 186 patients with HSS in Zambia were evaluated and 85 were randomized to standard care with or without rifaximin for 42 days. Changes in markers of inflammation, BT, and fibrosis were the primary outcomes. BT was measured using plasma 16S rRNA, lipopolysaccharide-binding protein, and lipopolysaccharide, whereas hyaluronan was used to measure fibrosis. Tumor necrosis factor receptor 1 (TNFR1) and soluble cluster of differentiation 14 (sCD14) assessed inflammation. 16S rRNA reduced from baseline (median 146 copies/µL, interquartile range [IQR] 9, 537) to day 42 in the rifaximin group (median 63 copies/µL, IQR 12, 196), P < 0.01. The rise in sCD14 was lower (P < 0.01) in the rifaximin group (median rise 122 ng/mL, IQR-184, 783) than in the non-rifaximin group (median rise 832 ng/mL, IQR 530, 967). TNFR1 decreased (P < 0.01) in the rifaximin group (median -39 ng/mL IQR-306, 563) but increased in the non-rifaximin group (median 166 ng/mL, IQR 3, 337). Other markers remained unaffected. Rifaximin led to a reduction of inflammatory markers and bacterial 16S rRNA which may implicate BT in the inflammation in HSS. PMID:29436337
Kitamura, Masaru
2002-02-15
Clostridium botulinum type E toxin was isolated in the form of a complex with RNA(s) from bacterial cells. Characterization of the complexed RNA remains to be elucidated. The RNA is identified here as ribosomal RNA (rRNA) having 23S and 16S components. The RNA-toxin complexes were found to be made up of three types with different molecular sizes. The three types of RNA-toxin complex are toxin bound to both the 23S and 16S rRNA, toxin bound to the 16S rRNA and a small amount of 23S rRNA, and toxin bound only to the 16S rRNA. ©2002 Elsevier Science (USA).
Essentiality of threonylcarbamoyladenosine (t6A), a universal tRNA modification, in bacteria
Thiaville, Patrick C.; Yacoubi, Basma El; Köhrer, Caroline; Thiaville, Jennifer J.; Deutsch, Chris; Iwata-Reuyl, Dirk; Bacusmo, Jo Marie; Armengaud, Jean; Bessho, Yoshitaka; Wetzel, Collin; Cao, Xiaoyu; Limbach, Patrick A.; RajBhandary, Uttam L.; de Crécy-Lagard, Valérie
2016-01-01
Threonylcarbamoyladenosine (t6A) is a modified nucleoside universally conserved in tRNAs in all three kingdoms of life. The recently discovered genes for t6A synthesis, including tsaC and tsaD, are essential in model prokaryotes but not essential in yeast. These genes had been identified as antibacterial targets even before their functions were known. However, the molecular basis for this prokaryotic-specific essentiality has remained a mystery. Here, we show that t6A is a strong positive determinant for aminoacylation of tRNA by bacterial-type but not by eukaryotic-type isoleucyl-tRNA synthetases and might also be a determinant for the essential enzyme tRNAIle-lysidine synthetase. We confirm that t6A is essential in Escherichia coli and a survey of genome-wide essentiality studies shows that genes for t6A synthesis are essential in most prokaryotes. This essentiality phenotype is not universal in Bacteria as t6A is dispensable in Deinococcus radiodurans, Thermus thermophilus, Synechocystis PCC6803 and Streptococcus mutans. Proteomic analysis of t6A- D. radiodurans strains revealed an induction of the proteotoxic stress response and identified genes whose translation is most affected by the absence of t6A in tRNAs. Thus, although t6A is universally conserved in tRNAs, its role in translation might vary greatly between organisms. PMID:26337258
Synthesis of 4'-C-aminoalkyl-2'-O-methyl modified RNA and their biological properties.
Koizumi, Kana; Maeda, Yusuke; Kano, Toshifumi; Yoshida, Hisae; Sakamoto, Taiichi; Yamagishi, Kenji; Ueno, Yoshihito
2018-05-17
In this paper, we describe the synthesis of 4'-C-aminoalkyl-2'-O-methylnucleosides and the properties of RNAs containing these analogs. Phosphoramidites of 4'-C-aminoethyl and 4'-C-aminopropyl-2'-O-methyluridines were prepared using glucose as starting material, and RNAs containing the analogs were synthesized using the phosphoramidites. Thermal denaturation studies revealed that these nucleoside analogs decreased the thermal stabilities of double-stranded RNAs (dsRNAs). Results of NMR, molecular modeling, and CD spectra measurements suggested that 4'-C-aminoalkyl-2'-O-methyluridine adopts an C2'-endo sugar puckering in dsRNA. The 4'-C-aminoalkyl modifications in the passenger strand and the guide strand outside the seed region were well tolerated for RNAi activity of siRNAs. Single-stranded RNAs (ssRNAs) and siRNAs containing the 4'-C-aminoethyl and 4'-C-aminopropyl analogs showed high stability in buffer containing bovine serum. Thus, siRNAs containing the 4'-C-aminoethyl and 4'-C-aminopropyl analogs are good candidates for the development of therapeutic siRNA molecules. Copyright © 2018 Elsevier Ltd. All rights reserved.
Characterization of Halophilic Bacterial Communities in Turda Salt Mine (Romania)
NASA Astrophysics Data System (ADS)
Carpa, Rahela; Keul, Anca; Muntean, Vasile; Dobrotă, Cristina
2014-09-01
Halophilic organisms are having adaptations to extreme salinity, the majority of them being Archaean, which have the ability to grow at extremely high salt concentrations, (from 3 % to 35 %). Level of salinity causes natural fluctuations in the halophilic populations that inhabit this particular habitat, raising problems in maintaining homeostasis of the osmotic pressure. Samples such as salt and water taken from Turda Salt Mine were analyzed in order to identify the eco-physiological bacterial groups. Considering the number of bacteria of each eco-physiological group, the bacterial indicators of salt quality (BISQ) were calculated and studied for each sample. The phosphatase, catalase and dehydrogenases enzymatic activities were quantitatively determined and the enzymatic indicators of salt quality (EISQ) were calculated. Bacterial isolates were analyzed using 16S rRNA gene sequence analysis. Universal bacterial primers, targeting the consensus region of the bacterial 16S rRNA gene were used. Analysis of a large fragment, of 1499 bp was performed to improve discrimination at the species level.
Bacterial communities in soil samples from the Mingyong Glacier of southwestern China.
Li, Haoyu; Taj, Muhammad Kamran; Ji, Xiuling; Zhang, Qi; Lin, Liangbing; Zhou, Zhimei; Wei, Yunlin
2017-05-01
The present study was an effort to determine the bacterial diversity of soils in Mingyong Glacier located at the Meili Snow Mountains of southwestern China. Mingyong Glacier has different climatic zones within a very narrow area, and bacterial community diversity in this low temperature area remains largely unknown. In this study, soil samples were collected from four different climatic zones: M11A (dry warm valley), M14 (forest), M15 (grass land), and M16 (glacier zones). Phylogenetic analysis based on 16S rRNA gene V6 hypervariable region showed high bacterial abundance in the glacier. The number of Operational Taxonomic Units ranged from 2.24×10 3 to 5.56×10 3 in soil samples. Statistical analysis of 16S rRNA gene clone libraries results showed that bacterial diversity in zones M11A,M14 and M16 are higher than in zone M15. The bacterial community structures are clearly distinguishable, and phylogenetic analysis showed that the predominant phyla were Proteobacteria, Deinococcus-Thermus, Firmicutes, Actinobacteria, and Nitrospirae in Mingyong Glacier. Seventy-nine different orders from four zones have been isolated. Bacterial diversity and distribution of bacterial communities related to the anthropogenic perturbations in zone (M15) were confirmed by diversity index analysis, and the diversity index of other three zones was satisfactory through this analysis software. The results suggest that bacterial diversity and distribution analyses using bacterial 16S rRNA gene V6 hypervariable region were successful, and bacterial communities in this area not only had the same bacterial phyla compared to other glaciers but also had their own rare species.
Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav
2002-12-01
The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.
Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav
2002-01-01
The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit. PMID:12515387
Nair, Nilendra; Raff, Hannah; Islam, Mohammed Tarek; Feen, Melanie; Garofalo, Denise M; Sheppard, Kelly
2016-02-13
Synthesis of asparaginyl-tRNA (Asn-tRNA(Asn)) in bacteria can be formed either by directly ligating Asn to tRNA(Asn) using an asparaginyl-tRNA synthetase (AsnRS) or by synthesizing Asn on the tRNA. In the latter two-step indirect pathway, a non-discriminating aspartyl-tRNA synthetase (ND-AspRS) attaches Asp to tRNA(Asn) and the amidotransferase GatCAB transamidates the Asp to Asn on the tRNA. GatCAB can be similarly used for Gln-tRNA(Gln) formation. Most bacteria are predicted to use only one route for Asn-tRNA(Asn) formation. Given that Bacillus halodurans and Bacillus subtilis encode AsnRS for Asn-tRNA(Asn) formation and Asn synthetases to synthesize Asn and GatCAB for Gln-tRNA(Gln) synthesis, their AspRS enzymes were thought to be specific for tRNA(Asp). However, we demonstrate that the AspRSs are non-discriminating and can be used with GatCAB to synthesize Asn. The results explain why B. subtilis with its Asn synthetase genes knocked out is still an Asn prototroph. Our phylogenetic analysis suggests that this may be common among Firmicutes and 30% of all bacteria. In addition, the phylogeny revealed that discrimination toward tRNA(Asp) by AspRS has evolved independently multiple times. The retention of the indirect pathway in B. subtilis and B. halodurans likely reflects the ancient link between Asn biosynthesis and its use in translation that enabled Asn to be added to the genetic code. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
Comprehensive Identification of RNA-Binding Proteins by RNA Interactome Capture.
Castello, Alfredo; Horos, Rastislav; Strein, Claudia; Fischer, Bernd; Eichelbaum, Katrin; Steinmetz, Lars M; Krijgsveld, Jeroen; Hentze, Matthias W
2016-01-01
RNA associates with RNA-binding proteins (RBPs) from synthesis to decay, forming dynamic ribonucleoproteins (RNPs). In spite of the preeminent role of RBPs regulating RNA fate, the scope of cellular RBPs has remained largely unknown. We have recently developed a novel and comprehensive method to identify the repertoire of active RBPs of cultured cells, called RNA interactome capture. Using in vivo UV cross-linking on cultured cells, proteins are covalently bound to RNA if the contact between the two is direct ("zero distance"). Protein-RNA complexes are purified by poly(A) tail-dependent oligo(dT) capture and analyzed by quantitative mass spectrometry. Because UV irradiation is applied to living cells and purification is performed using highly stringent washes, RNA interactome capture identifies physiologic and direct protein-RNA interactions. Applied to HeLa cells, this protocol revealed the near-complete repertoire of RBPs, including hundreds of novel RNA binders. Apart from its RBP discovery capacity, quantitative and comparative RNA interactome capture can also be used to study the responses of the RBP repertoire to different physiological cues and processes, including metabolic stress, differentiation, development, or the response to drugs.
Sprockett, Daniel D.; Ammons, Christine G.; Tuttle, Marie S.
2016-01-01
Clinical diagnosis of infection in chronic wounds is currently limited to subjective clinical signs and culture-based methods that underestimate the complexity of wound microbial bioburden as revealed by DNA-based microbial identification methods. Here, we use 16S rRNA next generation sequencing and quantitative polymerase chain reaction to characterize weekly changes in bacterial load, community structure, and diversity associated with a chronic venous leg ulcer over the 15-week course of treatment and healing. Our DNA-based methods and detailed sampling scheme reveal that the bacterial bioburden of the wound is unexpectedly dynamic, including changes in the bacterial load and community structure that correlate with wound expansion, antibiotic therapy, and healing. We demonstrate that these multidimensional changes in bacterial bioburden can be summarized using swabs taken prior to debridement, and therefore, can be more easily collected serially than debridement or biopsy samples. Overall, this case illustrates the importance of detailed clinical indicators and longitudinal sampling to determine the pathogenic significance of chronic wound microbial dynamics and guide best use of antimicrobials for improvement of healing outcomes. PMID:25902876
RNA interference of tubulin genes has lethal effects in Mythimna separate.
Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji
2018-05-23
RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.
Ray-Soni, Ananya; Mooney, Rachel A.; Landick, Robert
2017-01-01
In bacteria, intrinsic termination signals cause disassembly of the highly stable elongating transcription complex (EC) over windows of two to three nucleotides after kilobases of RNA synthesis. Intrinsic termination is caused by the formation of a nascent RNA hairpin adjacent to a weak RNA−DNA hybrid within RNA polymerase (RNAP). Although the contributions of RNA and DNA sequences to termination are largely understood, the roles of conformational changes in RNAP are less well described. The polymorphous trigger loop (TL), which folds into the trigger helices to promote nucleotide addition, also is proposed to drive termination by folding into the trigger helices and contacting the terminator hairpin after invasion of the hairpin in the RNAP main cleft [Epshtein V, Cardinale CJ, Ruckenstein AE, Borukhov S, Nudler E (2007) Mol Cell 28:991–1001]. To investigate the contribution of the TL to intrinsic termination, we developed a kinetic assay that distinguishes effects of TL alterations on the rate at which ECs terminate from effects of the TL on the nucleotide addition rate that indirectly affect termination efficiency by altering the time window in which termination can occur. We confirmed that the TL stimulates termination rate, but found that stabilizing either the folded or unfolded TL conformation decreased termination rate. We propose that conformational fluctuations of the TL (TL dynamics), not TL-hairpin contact, aid termination by increasing EC conformational diversity and thus access to favorable termination pathways. We also report that the TL and the TL sequence insertion (SI3) increase overall termination efficiency by stimulating pausing, which increases the flux of ECs into the termination pathway. PMID:29078293
Harpen, Mary; Barik, Tiasha; Musiyenko, Alla; Barik, Sailen
2009-11-01
As obligatory parasites, viruses co-opt a variety of cellular functions for robust replication. The expression of the nonsegmented negative-strand RNA genome of respiratory syncytial virus (RSV), a significant pediatric pathogen, absolutely requires actin and is stimulated by the actin-regulatory protein profilin. As actin is a major contractile protein, it was important to determine whether the known functional domains of actin and profilin were important for their ability to activate RSV transcription. Analyses of recombinant mutants in a reconstituted RSV transcription system suggested that the divalent-cation-binding domain of actin is critically needed for binding to the RSV genome template and for the activation of viral RNA synthesis. In contrast, the nucleotide-binding domain and the N-terminal acidic domain were needed neither for template binding nor for transcription. Specific surface residues of actin, required for actin-actin contact during filamentation, were also nonessential for viral transcription. Unlike actin, profilin did not directly bind to the viral template but was recruited by actin. Mutation of the interactive residues of actin or profilin, resulting in the loss of actin-profilin binding, also abolished profilin's ability to stimulate viral transcription. Together, these results suggest that actin acts as a classical transcription factor for the virus by divalent-cation-dependent binding to the viral template and that profilin acts as a transcriptional cofactor, in part by associating with actin. This essential viral role of actin is independent of its contractile cellular role.
Muir, Peter; Fox, Robin; Wu, Qiang; Baker, Theresa A; Zitzer, Nina C; Hudson, Alan P; Manley, Paul A; Schaefer, Susan L; Hao, Zhengling
2010-02-24
An underappreciated cause and effect relationship between environmental bacteria and arthritis may exist. Previously, we found that stifle arthritis in dogs was associated with the presence of environmental bacteria within synovium. Cranial cruciate ligament rupture (CCLR) is often associated with stifle arthritis in dogs. We now wished to determine whether seasonal variation in detection of bacterial material may exist in affected dogs, and to also conduct analyses of both synovium and synovial fluid. We also wished to analyze a larger clone library of the 16S rRNA gene to further understanding of the microbial population in the canine stifle. Synovial biopsies were obtained from 117 affected dogs from January to December 2006. Using PCR, synovium and synovial fluid were tested for Borrelia burgdorferi and Stenotrophomonas maltophilia DNA. Broad-ranging 16S rRNA primers were also used and PCR products were cloned and sequenced for bacterial identification. Overall, 41% of arthritic canine stifle joints contained bacterial DNA. Detection of bacterial DNA in synovial fluid samples was increased, when compared with synovium (p<0.01). Detection rates were highest in the winter and spring and lowest in the summer period, suggesting environmental factors influence the risk of translocation to the stifle. Organisms detected were predominately Gram's negative Proteobacteria, particularly the orders Rhizobiales (32.8% of clones) and Burkholderiales (20.0% of clones), usually as part of a polymicrobial population. PCR-positivity was inversely correlated with severity of arthritis assessed radiographically and with dog age. Bacterial translocation to the canine stifle may be associated with changes to the indoor environment. Copyright 2009 Elsevier B.V. All rights reserved.
Determination of in vivo RNA kinetics using RATE-seq.
Neymotin, Benjamin; Athanasiadou, Rodoniki; Gresham, David
2014-10-01
The abundance of a transcript is determined by its rate of synthesis and its rate of degradation; however, global methods for quantifying RNA abundance cannot distinguish variation in these two processes. Here, we introduce RNA approach to equilibrium sequencing (RATE-seq), which uses in vivo metabolic labeling of RNA and approach to equilibrium kinetics, to determine absolute RNA degradation and synthesis rates. RATE-seq does not disturb cellular physiology, uses straightforward normalization with exogenous spike-ins, and can be readily adapted for studies in most organisms. We demonstrate the use of RATE-seq to estimate genome-wide kinetic parameters for coding and noncoding transcripts in Saccharomyces cerevisiae. © 2014 Neymotin et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Extraordinary Structured Noncoding RNAs Revealed by Bacterial Metagenome Analysis
Weinberg, Zasha; Perreault, Jonathan; Meyer, Michelle M.; Breaker, Ronald R.
2012-01-01
Estimates of the total number of bacterial species1-3 suggest that existing DNA sequence databases carry only a tiny fraction of the total amount of DNA sequence space represented by this division of life. Indeed, environmental DNA samples have been shown to encode many previously unknown classes of proteins4 and RNAs5. Bioinformatics searches6-10 of genomic DNA from bacteria commonly identify novel noncoding RNAs (ncRNAs)10-12 such as riboswitches13,14. In rare instances, RNAs that exhibit more extensive sequence and structural conservation across a wide range of bacteria are encountered15,16. Given that large structured RNAs are known to carry out complex biochemical functions such as protein synthesis and RNA processing reactions, identifying more RNAs of great size and intricate structure is likely to reveal additional biochemical functions that can be achieved by RNA. We applied an updated computational pipeline17 to discover ncRNAs that rival the known large ribozymes in size and structural complexity or that are among the most abundant RNAs in bacteria that encode them. These RNAs would have been difficult or impossible to detect without examining environmental DNA sequences, suggesting that numerous RNAs with extraordinary size, structural complexity, or other exceptional characteristics remain to be discovered in unexplored sequence space. PMID:19956260
Messing with Bacterial Quorum Sensing
González, Juan E.; Keshavan, Neela D.
2006-01-01
Quorum sensing is widely recognized as an efficient mechanism to regulate expression of specific genes responsible for communal behavior in bacteria. Several bacterial phenotypes essential for the successful establishment of symbiotic, pathogenic, or commensal relationships with eukaryotic hosts, including motility, exopolysaccharide production, biofilm formation, and toxin production, are often regulated by quorum sensing. Interestingly, eukaryotes produce quorum-sensing-interfering (QSI) compounds that have a positive or negative influence on the bacterial signaling network. This eukaryotic interference could result in further fine-tuning of bacterial quorum sensing. Furthermore, recent work involving the synthesis of structural homologs to the various quorum-sensing signal molecules has resulted in the development of additional QSI compounds that could be used to control pathogenic bacteria. The creation of transgenic plants that express bacterial quorum-sensing genes is yet another strategy to interfere with bacterial behavior. Further investigation on the manipulation of quorum-sensing systems could provide us with powerful tools against harmful bacteria. PMID:17158701
Reverse transcription of phage RNA and its fragment directed by synthetic heteropolymeric primers
Frolova, L. Yu.; Metelyev, V. G.; Ratmanova, K. I.; Smirnov, V. D.; Shabarova, Z. A.; Prokofyev, M. A.; Berzin, V. M.; Jansone, I. V.; Gren, E. J.; Kisselev, L. L.
1977-01-01
DNA synthesis catalysed by RNA-directed DNA-polymerase (reverse transcriptase) was found to proceed on the RNA template of an MS2 phage in the presence of heteropolymeric synthetic octa- and nonadeoxyribonucleotide primers complementary to the intercistronic region (coat protein binding site) and the region of the coat protein cistron, respectively. The product of synthesis consists of discrete DNA fractions of different length, including transcripts longer than 1,000 nucleotides. The coat protein inhibits DNA synthesis if it is initiated at its binding site, but has no effect on DNA synthesis initiated at the coat protein cistron. It has been suggested that, in this system, the initiation of DNA synthesis by synthetic primers is topographically specific. The MS2 coat protein binding site (an RNA fragment of 59 nucleotides) serves as a template for polydeoxyribonucleotide synthesis in the presence of octanucleotide primer and reverse transcriptase. The product of synthesis is homogenous and its length corresponds to the length of the template. The effective and complete copying of the fragment having a distinct secondary structure proves that the secondary structure does not interfere, in principle, with RNA being a template in the system of reverse transcription. PMID:71713
Switch from translation to RNA replication in a positive-stranded RNA virus
Gamarnik, Andrea V.; Andino, Raul
1998-01-01
In positive-stranded viruses, the genomic RNA serves as a template for both translation and RNA replication. Using poliovirus as a model, we examined the interaction between these two processes. We show that the RNA polymerase is unable to replicate RNA templates undergoing translation. We discovered that an RNA structure at the 5′ end of the viral genome, next to the internal ribosomal entry site, carries signals that control both viral translation and RNA synthesis. The interaction of this RNA structure with the cellular factor PCBP up-regulates viral translation, while the binding of the viral protein 3CD represses translation and promotes negative-strand RNA synthesis. We propose that the interaction of 3CD with this RNA structure controls whether the genomic RNA is used for translation or RNA replication. PMID:9694795
Functional RNA elements in the dengue virus genome.
Gebhard, Leopoldo G; Filomatori, Claudia V; Gamarnik, Andrea V
2011-09-01
Dengue virus (DENV) genome amplification is a process that involves the viral RNA, cellular and viral proteins, and a complex architecture of cellular membranes. The viral RNA is not a passive template during this process; it plays an active role providing RNA signals that act as promoters, enhancers and/or silencers of the replication process. RNA elements that modulate RNA replication were found at the 5' and 3' UTRs and within the viral coding sequence. The promoter for DENV RNA synthesis is a large stem loop structure located at the 5' end of the genome. This structure specifically interacts with the viral polymerase NS5 and promotes RNA synthesis at the 3' end of a circularized genome. The circular conformation of the viral genome is mediated by long range RNA-RNA interactions that span thousands of nucleotides. Recent studies have provided new information about the requirement of alternative, mutually exclusive, structures in the viral RNA, highlighting the idea that the viral genome is flexible and exists in different conformations. In this article, we describe elements in the promoter SLA and other RNA signals involved in NS5 polymerase binding and activity, and provide new ideas of how dynamic secondary and tertiary structures of the viral RNA participate in the viral life cycle.
The control of paramyxovirus genome hexamer length and mRNA editing.
Matsumoto, Yusuke; Ohta, Keisuke; Kolakofsky, Daniel; Nishio, Machiko
2018-04-01
The unusual ability of a human parainfluenza virus type 2 (hPIV2) nucleoprotein point mutation (NP Q202A ) to strongly enhance minigenome replication was found to depend on the absence of a functional, internal element of the bipartite replication promoter (CRII). This point mutation allows relatively robust CRII-minus minigenome replication in a CRII-independent manner, under conditions in which NP wt is essentially inactive. The nature of the amino acid at position 202 apparently controls whether viral RNA-dependent RNA polymerase (vRdRp) can, or cannot, initiate RNA synthesis in a CRII-independent manner. By repressing genome synthesis when vRdRp cannot correctly interact with CRII, gln 202 of N, the only residue of the RNA-binding groove that contacts a nucleotide base in the N-RNA, acts as a gatekeeper for wild-type (CRII-dependent) RNA synthesis. This ensures that only hexamer-length genomes are replicated, and that the critical hexamer phase of the cis -acting mRNA editing sequence is maintained. © 2018 Matsumoto et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Dotiwala, Farokh; Sen Santara, Sumit; Binker-Cosen, Andres Ariel; Li, Bo; Chandrasekaran, Sriram; Lieberman, Judy
2017-11-16
Human cytotoxic lymphocytes kill intracellular microbes. The cytotoxic granule granzyme proteases released by cytotoxic lymphocytes trigger oxidative bacterial death by disrupting electron transport, generating superoxide anion and inactivating bacterial oxidative defenses. However, they also cause non-oxidative cell death because anaerobic bacteria are also killed. Here, we use differential proteomics to identify granzyme B substrates in three unrelated bacteria: Escherichia coli, Listeria monocytogenes, and Mycobacteria tuberculosis. Granzyme B cleaves a highly conserved set of proteins in all three bacteria, which function in vital biosynthetic and metabolic pathways that are critical for bacterial survival under diverse environmental conditions. Key proteins required for protein synthesis, folding, and degradation are also substrates, including multiple aminoacyl tRNA synthetases, ribosomal proteins, protein chaperones, and the Clp system. Because killer cells use a multipronged strategy to target vital pathways, bacteria may not easily become resistant to killer cell attack. Copyright © 2017 Elsevier Inc. All rights reserved.
Kimer, Nina; Pedersen, Julie S; Tavenier, Juliette; Christensen, Jeffrey E; Busk, Troels M; Hobolth, Lise; Krag, Aleksander; Al-Soud, Waleed Abu; Mortensen, Martin S; Sørensen, Søren J; Møller, Søren; Bendtsen, Flemming
2018-01-01
Decompensated cirrhosis is characterized by disturbed hemodynamics, immune dysfunction, and high risk of infections. Translocation of viable bacteria and bacterial products from the gut to the blood is considered a key driver in this process. Intestinal decontamination with rifaximin may reduce bacterial translocation (BT) and decrease inflammation. A randomized, placebo-controlled trial investigated the effects of rifaximin on inflammation and BT in decompensated cirrhosis. Fifty-four out-patients with cirrhosis and ascites were randomized, mean age 56 years (± 8.4), and model for end-stage liver disease score 12 (± 3.9). Patients received rifaximin 550-mg BD (n = 36) or placebo BD (n = 18). Blood and fecal (n = 15) sampling were conducted at baseline and after 4 weeks. Bacterial DNA in blood was determined by real-time qPCR 16S rRNA gene quantification. Bacterial composition in feces was analyzed by 16S rRNA gene sequencing. Circulating markers of inflammation, including tumor necrosis factor alpha, interleukins 6, 10, and 18, stromal cell-derived factor 1-α, transforming growth factor β-1, and high sensitivity C-reactive protein, were unaltered by rifaximin treatment. Rifaximin altered abundance of bacterial taxa in blood marginally, only a decrease in Pseudomonadales was observed. In feces, rifaximin decreased bacterial richness, but effect on particular species was not observed. Subgroup analyses on patients with severely disturbed hemodynamics (n = 34) or activated lipopolysaccharide binding protein (n = 37) revealed no effect of rifaximin. Four weeks of treatment with rifaximin had no impact on the inflammatory state and only minor effects on BT and intestinal bacterial composition in stable, decompensated cirrhosis (NCT01769040). © 2017 Journal of Gastroenterology and Hepatology Foundation and John Wiley & Sons Australia, Ltd.
Temperature requirements for initiation of RNA-dependent RNA polymerization.
Yang, Hongyan; Gottlieb, Paul; Wei, Hui; Bamford, Dennis H; Makeyev, Eugene V
2003-09-30
To continue the molecular characterization of RNA-dependent RNA polymerases of dsRNA bacteriophages (Cystoviridae), we purified and biochemically characterized the wild-type (wt) and a temperature-sensitive (ts) point mutant of the polymerase subunit (Pol) from bacteriophage phi12. Interestingly, initiation by both wt and the ts phi12 Pol was notably more sensitive to increased temperatures than the elongation step, the absolute value of the nonpermissive temperature being lower for the ts enzyme. Experiments with the Pol subunit of related cystovirus phi6 revealed a similar differential sensitivity of the initiation and elongation steps. This is consistent with the previous result showing that de novo initiation by RdRp from dengue virus is inhibited at elevated temperatures, whereas the elongation phase is relatively thermostable. Overall, these data suggest that de novo RNA-dependent RNA synthesis in many viral systems includes a specialized thermolabile state of the RdRp initiation complex.
Will, Christiane; Thürmer, Andrea; Wollherr, Antje; Nacke, Heiko; Herold, Nadine; Schrumpf, Marion; Gutknecht, Jessica; Wubet, Tesfaye; Buscot, François; Daniel, Rolf
2010-01-01
The diversity of bacteria in soil is enormous, and soil bacterial communities can vary greatly in structure. Here, we employed a pyrosequencing-based analysis of the V2-V3 16S rRNA gene region to characterize the overall and horizon-specific (A and B horizons) bacterial community compositions in nine grassland soils, which covered three different land use types. The entire data set comprised 752,838 sequences, 600,544 of which could be classified below the domain level. The average number of sequences per horizon was 41,824. The dominant taxonomic groups present in all samples and horizons were the Acidobacteria, Betaproteobacteria, Actinobacteria, Gammaproteobacteria, Alphaproteobacteria, Deltaproteobacteria, Chloroflexi, Firmicutes, and Bacteroidetes. Despite these overarching dominant taxa, the abundance, diversity, and composition of bacterial communities were horizon specific. In almost all cases, the estimated bacterial diversity (H′) was higher in the A horizons than in the corresponding B horizons. In addition, the H′ was positively correlated with the organic carbon content, the total nitrogen content, and the C-to-N ratio, which decreased with soil depth. It appeared that lower land use intensity results in higher bacterial diversity. The majority of sequences affiliated with the Actinobacteria, Bacteroidetes, Cyanobacteria, Fibrobacteres, Firmicutes, Spirochaetes, Verrucomicrobia, Alphaproteobacteria, Betaproteobacteria, and Gammaproteobacteria were derived from A horizons, whereas the majority of the sequences related to Acidobacteria, Chloroflexi, Gemmatimonadetes, Nitrospira, TM7, and WS3 originated from B horizons. The distribution of some bacterial phylogenetic groups and subgroups in the different horizons correlated with soil properties such as organic carbon content, total nitrogen content, or microbial biomass. PMID:20729324
mRNA Cap Methyltransferase, RNMT-RAM, Promotes RNA Pol II-Dependent Transcription.
Varshney, Dhaval; Lombardi, Olivia; Schweikert, Gabriele; Dunn, Sianadh; Suska, Olga; Cowling, Victoria H
2018-05-01
mRNA cap addition occurs early during RNA Pol II-dependent transcription, facilitating pre-mRNA processing and translation. We report that the mammalian mRNA cap methyltransferase, RNMT-RAM, promotes RNA Pol II transcription independent of mRNA capping and translation. In cells, sublethal suppression of RNMT-RAM reduces RNA Pol II occupancy, net mRNA synthesis, and pre-mRNA levels. Conversely, expression of RNMT-RAM increases transcription independent of cap methyltransferase activity. In isolated nuclei, recombinant RNMT-RAM stimulates transcriptional output; this requires the RAM RNA binding domain. RNMT-RAM interacts with nascent transcripts along their entire length and with transcription-associated factors including the RNA Pol II subunits SPT4, SPT6, and PAFc. Suppression of RNMT-RAM inhibits transcriptional markers including histone H2BK120 ubiquitination, H3K4 and H3K36 methylation, RNA Pol II CTD S5 and S2 phosphorylation, and PAFc recruitment. These findings suggest that multiple interactions among RNMT-RAM, RNA Pol II factors, and RNA along the transcription unit stimulate transcription. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Neuenfeldt, Anne; Lorber, Bernard; Ennifar, Eric; Gaudry, Agnès; Sauter, Claude; Sissler, Marie; Florentz, Catherine
2013-02-01
In the mammalian mitochondrial translation apparatus, the proteins and their partner RNAs are coded by two genomes. The proteins are nuclear-encoded and resemble their homologs, whereas the RNAs coming from the rapidly evolving mitochondrial genome have lost critical structural information. This raises the question of molecular adaptation of these proteins to their peculiar partner RNAs. The crystal structure of the homodimeric bacterial-type human mitochondrial aspartyl-tRNA synthetase (DRS) confirmed a 3D architecture close to that of Escherichia coli DRS. However, the mitochondrial enzyme distinguishes by an enlarged catalytic groove, a more electropositive surface potential and an alternate interaction network at the subunits interface. It also presented a thermal stability reduced by as much as 12°C. Isothermal titration calorimetry analyses revealed that the affinity of the mitochondrial enzyme for cognate and non-cognate tRNAs is one order of magnitude higher, but with different enthalpy and entropy contributions. They further indicated that both enzymes bind an adenylate analog by a cooperative allosteric mechanism with different thermodynamic contributions. The larger flexibility of the mitochondrial synthetase with respect to the bacterial enzyme, in combination with a preserved architecture, may represent an evolutionary process, allowing nuclear-encoded proteins to cooperate with degenerated organelle RNAs.
[Congenital skull base defect causing recurrent bacterial meningitis].
Berliner, Elihay; Bar Meir, Maskit; Megged, Orli
2012-08-01
Bacterial meningitis is a life threatening disease. Most patients will experience only one episode throughout life. Children who experience bacterial meningitis more than once, require further immunologic or anatomic evaluation. We report a 9 year old child with five episodes of bacterial meningitis due to a congenital defect of the skull base. A two and a half year old boy first presented to our medical center with pneumococcal meningitis. He was treated with antibiotics and fully recovered. Two months later he presented again with a similar clinical picture. Streptococcus pneumoniae grew in cerebrospinal fluid (CSF) culture. CT scan and later MRI of the brain revealed a defect in the anterior middle fossa floor, with protrusion of brain tissue into the sphenoidal sinus. Corrective surgery was recommended but the parents refused. Three months later, a third episode of pneumococcal meningitis occurred. The child again recovered with antibiotics and this time corrective surgery was performed. Five years later, the boy presented once again with clinical signs and symptoms consistent with bacterial meningitis. CSF culture was positive, but the final identification of the bacteria was conducted by broad spectrum 16S ribosomal RNA PCR (16S rRNA PCR) which revealed a sequence of Neisseria lactamica. CT and MRI showed recurrence of the skull base defect with encephalocele in the sphenoid sinus. The parents again refused neurosurgical intervention. A year later the patient presented with bacterial meningitis. CSF culture obtained after initiation of antibiotics was negative, but actinobacillus was identified in the CSF by 16S rRNA PCR. The patient is scheduled for neurosurgical intervention. In patients with recurrent bacterial meningitis caused by organisms colonizing the oropharynx or nasopharynx, an anatomical defect should be carefully sought and surgically repaired.
BLM helicase facilitates RNA polymerase I-mediated ribosomal RNA transcription
Grierson, Patrick M.; Lillard, Kate; Behbehani, Gregory K.; Combs, Kelly A.; Bhattacharyya, Saumitri; Acharya, Samir; Groden, Joanna
2012-01-01
Bloom's syndrome (BS) is an autosomal recessive disorder that is invariably characterized by severe growth retardation and cancer predisposition. The Bloom's syndrome helicase (BLM), mutations of which lead to BS, localizes to promyelocytic leukemia protein bodies and to the nucleolus of the cell, the site of RNA polymerase I-mediated ribosomal RNA (rRNA) transcription. rRNA transcription is fundamental for ribosome biogenesis and therefore protein synthesis, cellular growth and proliferation; its inhibition limits cellular growth and proliferation as well as bodily growth. We report that nucleolar BLM facilitates RNA polymerase I-mediated rRNA transcription. Immunofluorescence studies demonstrate the dependance of BLM nucleolar localization upon ongoing RNA polymerase I-mediated rRNA transcription. In vivo protein co-immunoprecipitation demonstrates that BLM interacts with RPA194, a subunit of RNA polymerase I. 3H-uridine pulse-chase assays demonstrate that BLM expression is required for efficient rRNA transcription. In vitro helicase assays demonstrate that BLM unwinds GC-rich rDNA-like substrates that form in the nucleolus and normally inhibit progression of the RNA polymerase I transcription complex. These studies suggest that nucleolar BLM modulates rDNA structures in association with RNA polymerase I to facilitate RNA polymerase I-mediated rRNA transcription. Given the intricate relationship between rDNA metabolism and growth, our data may help in understanding the etiology of proportional dwarfism in BS. PMID:22106380
BLM helicase facilitates RNA polymerase I-mediated ribosomal RNA transcription.
Grierson, Patrick M; Lillard, Kate; Behbehani, Gregory K; Combs, Kelly A; Bhattacharyya, Saumitri; Acharya, Samir; Groden, Joanna
2012-03-01
Bloom's syndrome (BS) is an autosomal recessive disorder that is invariably characterized by severe growth retardation and cancer predisposition. The Bloom's syndrome helicase (BLM), mutations of which lead to BS, localizes to promyelocytic leukemia protein bodies and to the nucleolus of the cell, the site of RNA polymerase I-mediated ribosomal RNA (rRNA) transcription. rRNA transcription is fundamental for ribosome biogenesis and therefore protein synthesis, cellular growth and proliferation; its inhibition limits cellular growth and proliferation as well as bodily growth. We report that nucleolar BLM facilitates RNA polymerase I-mediated rRNA transcription. Immunofluorescence studies demonstrate the dependance of BLM nucleolar localization upon ongoing RNA polymerase I-mediated rRNA transcription. In vivo protein co-immunoprecipitation demonstrates that BLM interacts with RPA194, a subunit of RNA polymerase I. (3)H-uridine pulse-chase assays demonstrate that BLM expression is required for efficient rRNA transcription. In vitro helicase assays demonstrate that BLM unwinds GC-rich rDNA-like substrates that form in the nucleolus and normally inhibit progression of the RNA polymerase I transcription complex. These studies suggest that nucleolar BLM modulates rDNA structures in association with RNA polymerase I to facilitate RNA polymerase I-mediated rRNA transcription. Given the intricate relationship between rDNA metabolism and growth, our data may help in understanding the etiology of proportional dwarfism in BS.
Role of RNase MRP in viral RNA degradation and RNA recombination.
Jaag, Hannah M; Lu, Qiasheng; Schmitt, Mark E; Nagy, Peter D
2011-01-01
RNA degradation, together with RNA synthesis, controls the steady-state level of viral RNAs in infected cells. The endoribonucleolytic cleavage of viral RNA is important not only for viral RNA degradation but for RNA recombination as well, due to the participation of some RNA degradation products in the RNA recombination process. To identify host endoribonucleases involved in degradation of Tomato bushy stunt virus (TBSV) in a Saccharomyces cerevisiae model host, we tested eight known endoribonucleases. Here we report that downregulation of SNM1, encoding a component of the RNase MRP, and a temperature-sensitive mutation in the NME1 gene, coding for the RNA component of RNase MRP, lead to reduced production of the endoribonucleolytically cleaved TBSV RNA in yeast. We also show that the highly purified yeast RNase MRP cleaves the TBSV RNA in vitro, resulting in TBSV RNA degradation products similar in size to those observed in yeast cells. Knocking down the NME1 homolog in Nicotiana benthamiana also led to decreased production of the cleaved TBSV RNA, suggesting that in plants, RNase MRP is involved in TBSV RNA degradation. Altogether, this work suggests a role for the host endoribonuclease RNase MRP in viral RNA degradation and recombination.
Ortiz-Martínez, Sebastían; Silva, Andrea X.; Lavandero, Blas
2018-01-01
Bacterial endosymbionts that produce important phenotypic effects on their hosts are common among plant sap-sucking insects. Aphids have become a model system of insect-symbiont interactions. However, endosymbiont research has focused on a few aphid species, making it necessary to make greater efforts to other aphid species through different regions, in order to have a better understanding of the role of endosymbionts in aphids as a group. Aphid endosymbionts have frequently been studied by PCR-based techniques, using species-specific primers, nevertheless this approach may omit other non-target bacteria cohabiting a particular host species. Advances in high-throughput sequencing technologies are complementing our knowledge of microbial communities by allowing us the study of whole microbiome of different organisms. We used a 16S rRNA amplicon sequencing approach to study the microbiome of aphids in order to describe the bacterial community diversity in introduced populations of the cereal aphids, Sitobion avenae and Rhopalosiphum padi in Chile (South America). An absence of secondary endosymbionts and two common secondary endosymbionts of aphids were found in the aphids R. padi and S. avenae, respectively. Of those endosymbionts, Regiella insecticola was the dominant secondary endosymbiont among the aphid samples. In addition, the presence of a previously unidentified bacterial species closely related to a phytopathogenic Pseudomonad species was detected. We discuss these results in relation to the bacterial endosymbiont diversity found in other regions of the native and introduced range of S. avenae and R. padi. A similar endosymbiont diversity has been reported for both aphid species in their native range. However, variation in the secondary endosymbiont infection could be observed among the introduced and native populations of the aphid S. avenae, indicating that aphid-endosymbiont associations can vary across the geographic range of an aphid species. In
Campbell, Barbara J; Kirchman, David L
2013-01-01
Very little is known about growth rates of individual bacterial taxa and how they respond to environmental flux. Here, we characterized bacterial community diversity, structure and the relative abundance of 16S rRNA and 16S rRNA genes (rDNA) using pyrosequencing along the salinity gradient in the Delaware Bay. Indices of diversity, evenness, structure and growth rates of the surface bacterial community significantly varied along the transect, reflecting active mixing between the freshwater and marine ends of the estuary. There was no positive correlation between relative abundances of 16S rRNA and rDNA for the entire bacterial community, suggesting that abundance of bacteria does not necessarily reflect potential growth rate or activity. However, for almost half of the individual taxa, 16S rRNA positively correlated with rDNA, suggesting that activity did follow abundance in these cases. The positive relationship between 16S rRNA and rDNA was less in the whole water community than for free-living taxa, indicating that the two communities differed in activity. The 16S rRNA:rDNA ratios of some typically marine taxa reflected differences in light, nutrient concentrations and other environmental factors along the estuarine gradient. The ratios of individual freshwater taxa declined as salinity increased, whereas the 16S rRNA:rDNA ratios of only some typical marine bacteria increased as salinity increased. These data suggest that physical and other bottom-up factors differentially affect growth rates, but not necessarily abundance of individual taxa in this highly variable environment. PMID:22895159
Kalogianni, Despina P; Goura, Sophia; Aletras, Alexios J; Christopoulos, Theodore K; Chanos, Michalis G; Christofidou, Myrto; Skoutelis, Athanasios; Ioannou, Penelope C; Panagiotopoulos, Elias
2007-02-15
Periprosthetic joint infections present a challenging problem in orthopaedics. Conventional methods for detection of arthroplasty infections rely on bacterial culture of synovial fluid aspirates. During recent years, however, molecular tests that are based on DNA amplification by the polymerase chain reaction (PCR), followed by electrophoretic analysis of the products, have been introduced. We report a simple and inexpensive assay that allows visual detection and confirmation of the PCR-amplified sequences by hybridization within minutes. The assay is performed in a dry reagent dipstick format (strip) and does not require special instrumentation. Universal primers are used for PCR of the 23S ribosomal RNA (rRNA) gene. The biotinylated amplification product is hybridized with dA-tailed probes that are specific for six pathogens commonly involved in periprosthetic joint infections. The mixture is applied to the strip, which is then immersed in the appropriate buffer. The buffer migrates along the strip by capillary action and rehydrates gold nanoparticles with oligo(dT) strands attached to their surface. The nanoparticles bind to the target DNA through hybridization, and the hybrids are captured by immobilized streptavidin at the test zone of the strip, producing a characteristic red line. Unbound nanoparticles are captured by immobilized oligo(dT) strands at the control zone of the strip, generating a second line. The dipstick test was applied to the detection of Escherichia coli, Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus pneumoniae, Enterococcus faesium, and Haemophilus influenza. Twelve samples of synovial fluids from patients were analyzed for the detection and identification of the infection caused by the six pathogens. The results were compared with bacterial cultures.
Different bacterial communities in ectomycorrhizae and surrounding soil
Vik, Unni; Logares, Ramiro; Blaalid, Rakel; Halvorsen, Rune; Carlsen, Tor; Bakke, Ingrid; Kolstø, Anne-Brit; Økstad, Ole Andreas; Kauserud, Håvard
2013-01-01
Several eukaryotic symbioses have shown to host a rich diversity of prokaryotes that interact with their hosts. Here, we study bacterial communities associated with ectomycorrhizal root systems of Bistorta vivipara compared to bacterial communities in bulk soil using pyrosequencing of 16S rRNA amplicons. A high richness of Operational Taxonomic Units (OTUs) was found in plant roots (3,571 OTUs) and surrounding soil (3,476 OTUs). The community composition differed markedly between these two environments. Actinobacteria, Armatimonadetes, Chloroflexi and OTUs unclassified at phylum level were significantly more abundant in plant roots than in soil. A large proportion of the OTUs, especially those in plant roots, presented low similarity to Sanger 16S rRNA reference sequences, suggesting novel bacterial diversity in ectomycorrhizae. Furthermore, the bacterial communities of the plant roots were spatially structured up to a distance of 60 cm, which may be explained by bacteria using fungal hyphae as a transport vector. The analyzed ectomycorrhizae presents a distinct microbiome, which likely influence the functioning of the plant-fungus symbiosis. PMID:24326907
Murphy, Edwin C.; Wills, Norma; Arlinghaus, Ralph B.
1980-01-01
The effect of suppressor tRNA's on the cell-free translation of several leukemia and sarcoma virus RNAs was examined. Yeast amber suppressor tRNA (amber tRNA) enhanced the synthesis of the Rauscher murine leukemia virus and clone 1 Moloney murine leukemia virus Pr200gag-pol polypeptides by 10- to 45-fold, but at the same time depressed the synthesis of Rauscher murine leukemia virus Pr65gag and Moloney murine leukemia virus Pr63gag. Under suppressor-minus conditions, Moloney murine leukemia virus Pr70gag was present as a closely spaced doublet. Amber tRNA stimulated the synthesis of the “upper” Moloney murine leukemia virus Pr70gag polypeptide. Yeast ochre suppressor tRNA appeared to be ineffective. Quantitative analyses of the kinetics of viral precursor polypeptide accumulation in the presence of amber tRNA showed that during linear protein synthesis, the increase in accumulated Moloney murine leukemia virus Pr200gag-pol coincided closely with the molar loss of Pr63gag. Enhancement of Pr200gag-pol and Pr70gag by amber tRNA persisted in the presence of pactamycin, a drug which blocks the initiation of protein synthesis, thus arguing for the addition of amino acids to the C terminus of Pr63gag as the mechanism behind the amber tRNA effect. Moloney murine sarcoma virus 124 30S RNA was translated into four major polypeptides, Pr63gag, P42, P38, and P23. In the presence of amber tRNA, a new polypeptide, Pr67gag, appeared, whereas Pr63gag synthesis was decreased. Quantitative estimates indicated that for every 1 mol of Pr67gag which appeared, 1 mol of Pr63gag was lost. Images PMID:7373716
Office space bacterial abundance and diversity in three metropolitan areas.
Hewitt, Krissi M; Gerba, Charles P; Maxwell, Sheri L; Kelley, Scott T
2012-01-01
People in developed countries spend approximately 90% of their lives indoors, yet we know little about the source and diversity of microbes in built environments. In this study, we combined culture-based cell counting and multiplexed pyrosequencing of environmental ribosomal RNA (rRNA) gene sequences to investigate office space bacterial diversity in three metropolitan areas. Five surfaces common to all offices were sampled using sterile double-tipped swabs, one tip for culturing and one for DNA extraction, in 30 different offices per city (90 offices, 450 total samples). 16S rRNA gene sequences were PCR amplified using bar-coded "universal" bacterial primers from 54 of the surfaces (18 per city) and pooled for pyrosequencing. A three-factorial Analysis of Variance (ANOVA) found significant differences in viable bacterial abundance between offices inhabited by men or women, among the various surface types, and among cities. Multiplex pyrosequencing identified more than 500 bacterial genera from 20 different bacterial divisions. The most abundant of these genera tended to be common inhabitants of human skin, nasal, oral or intestinal cavities. Other commonly occurring genera appeared to have environmental origins (e.g., soils). There were no significant differences in the bacterial diversity between offices inhabited by men or women or among surfaces, but the bacterial community diversity of the Tucson samples was clearly distinguishable from that of New York and San Francisco, which were indistinguishable. Overall, our comprehensive molecular analysis of office building microbial diversity shows the potential of these methods for studying patterns and origins of indoor bacterial contamination. "[H]umans move through a sea of microbial life that is seldom perceived except in the context of potential disease and decay." - Feazel et al. (2009).
RNA Futile Cycling in Model Persisters Derived from MazF Accumulation
Mok, Wendy W. K.; Park, Junyoung O.; Rabinowitz, Joshua D.
2015-01-01
ABSTRACT Metabolism plays an important role in the persister phenotype, as evidenced by the number of strategies that perturb metabolism to sabotage this troublesome subpopulation. However, the absence of techniques to isolate high-purity populations of native persisters has precluded direct measurement of persister metabolism. To address this technical challenge, we studied Escherichia coli populations whose growth had been inhibited by the accumulation of the MazF toxin, which catalyzes RNA cleavage, as a model system for persistence. Using chromosomally integrated, orthogonally inducible promoters to express MazF and its antitoxin MazE, bacterial populations that were almost entirely tolerant to fluoroquinolone and β-lactam antibiotics were obtained upon MazF accumulation, and these were subjected to direct metabolic measurements. While MazF model persisters were nonreplicative, they maintained substantial oxygen and glucose consumption. Metabolomic analysis revealed accumulation of all four ribonucleotide monophosphates (NMPs). These results are consistent with a MazF-catalyzed RNA futile cycle, where the energy derived from catabolism is dissipated through continuous transcription and MazF-mediated RNA degradation. When transcription was inhibited, oxygen consumption and glucose uptake decreased, and nucleotide triphosphates (NTPs) and NTP/NMP ratios increased. Interestingly, the MazF-inhibited cells were sensitive to aminoglycosides, and this sensitivity was blocked by inhibition of transcription. Thus, in MazF model persisters, futile cycles of RNA synthesis and degradation result in both significant metabolic demands and aminoglycoside sensitivity. PMID:26578677
Functional expansion of human tRNA synthetases achieved by structural inventions
Guo, Min; Schimmel, Paul; Yang, Xiang-Lei
2010-01-01
Known as an essential component of the translational apparatus, the aminoacyl-tRNA synthetase family catalyzes the first step reaction in protein synthesis, that is, to specifically attach each amino acid to its cognate tRNA. While preserving this essential role, tRNA synthetases developed other roles during evolution. Human tRNA synthetases, in particular, have diverse functions in different pathways involving angiogenesis, inflammation and apoptosis. The functional diversity is further illustrated in the association with various diseases through genetic mutations that do not affect aminoacylation or protein synthesis. Here we review the accumulated knowledge on how human tRNA synthetases used structural inventions to achieve functional expansions. PMID:19932696
Hernández-Ocaña, Betania; Pozos-Parra, Ma. Del Pilar; Mezura-Montes, Efrén; Portilla-Flores, Edgar Alfredo; Vega-Alvarado, Eduardo; Calva-Yáñez, Maria Bárbara
2016-01-01
This paper presents two-swim operators to be added to the chemotaxis process of the modified bacterial foraging optimization algorithm to solve three instances of the synthesis of four-bar planar mechanisms. One swim favors exploration while the second one promotes fine movements in the neighborhood of each bacterium. The combined effect of the new operators looks to increase the production of better solutions during the search. As a consequence, the ability of the algorithm to escape from local optimum solutions is enhanced. The algorithm is tested through four experiments and its results are compared against two BFOA-based algorithms and also against a differential evolution algorithm designed for mechanical design problems. The overall results indicate that the proposed algorithm outperforms other BFOA-based approaches and finds highly competitive mechanisms, with a single set of parameter values and with less evaluations in the first synthesis problem, with respect to those mechanisms obtained by the differential evolution algorithm, which needed a parameter fine-tuning process for each optimization problem. PMID:27057156
Hernández-Ocaña, Betania; Pozos-Parra, Ma Del Pilar; Mezura-Montes, Efrén; Portilla-Flores, Edgar Alfredo; Vega-Alvarado, Eduardo; Calva-Yáñez, Maria Bárbara
2016-01-01
This paper presents two-swim operators to be added to the chemotaxis process of the modified bacterial foraging optimization algorithm to solve three instances of the synthesis of four-bar planar mechanisms. One swim favors exploration while the second one promotes fine movements in the neighborhood of each bacterium. The combined effect of the new operators looks to increase the production of better solutions during the search. As a consequence, the ability of the algorithm to escape from local optimum solutions is enhanced. The algorithm is tested through four experiments and its results are compared against two BFOA-based algorithms and also against a differential evolution algorithm designed for mechanical design problems. The overall results indicate that the proposed algorithm outperforms other BFOA-based approaches and finds highly competitive mechanisms, with a single set of parameter values and with less evaluations in the first synthesis problem, with respect to those mechanisms obtained by the differential evolution algorithm, which needed a parameter fine-tuning process for each optimization problem.
Duthoit, Frédérique; Godon, Jean-Jacques; Montel, Marie-Christine
2003-01-01
Microbial dynamics during processing and ripening of traditional cheeses such as registered designation of origin Salers cheese, an artisanal cheese produced in France, play an important role in the elaboration of sensory qualities. The aim of the present study was to obtain a picture of the dynamics of the microbial ecosystem of RDO Salers cheese by using culture-independent methods. This included DNA extraction, PCR, and single-strand conformation polymorphism (SSCP) analysis. Bacterial and high-GC% gram-positive bacterial primers were used to amplify V2 or V3 regions of the 16S rRNA gene. SSCP patterns revealed changes during the manufacturing of the cheese. Patterns of the ecosystems of cheeses that were provided by three farmers were also quite different. Cloning and sequencing of the 16S rRNA gene revealed sequences related to lactic acid bacteria (Lactococcus lactis, Streptococcus thermophilus, Enterococcus faecium, Leuconostoc mesenteroides, Leuconostoc pseudomesenteroides, Lactobacillus plantarum, and Lactobacillus pentosus), which were predominant during manufacturing and ripening. Bacteria belonging to the high-GC% gram-positive group (essentially corynebacteria) were found by using specific primers. The present molecular approach can effectively describe the ecosystem of artisanal dairy products. PMID:12839752
Devireddy, Laxminarayana R.; Hart, Daniel O.; Goetz, David; Green, Michael R.
2010-01-01
SUMMARY Intracellular iron homeostasis is critical for survival and proliferation. Lipocalin 24p3 is an iron trafficking protein that binds iron through association with a bacterial siderophore, such as enterobactin, or a postulated mammalian siderophore. Here we show that the iron-binding moiety of the 24p3-associated mammalian siderophore is 2,5-dihydroxybenzoic acid (2,5-DHBA), which is similar to 2,3-DHBA, the iron-binding component of enterobactin. We find that the murine enzyme responsible for 2,5-DHBA synthesis is the homologue of bacterial EntA, which catalyzes 2,3-DHBA production during enterobactin biosynthesis. RNA interference-mediated knockdown of the murine homologue of EntA results in siderophore depletion. Mammalian cells lacking the siderophore accumulate abnormally high amounts of cytoplasmic iron, resulting in elevated levels of reactive oxygen species, whereas the mitochondria are iron deficient. Siderophore-depleted mammalian cells and zebrafish embryos fail to synthesize heme, an iron-dependent mitochondrial process. Our results reveal features of intracellular iron homeostasis that are conserved from bacteria through humans. PMID:20550936
Trans-acting small interfering RNA4: key to nutraceutical synthesis in grape development?
Rock, Christopher D
2013-11-01
The facility and versatility of microRNAs (miRNAs) to evolve and change likely underlies how they have become dominant constituents of eukaryotic genomes. In this opinion article I propose that trans-acting small interfering RNA gene 4 (TAS4) evolution may be important for biosynthesis of polyphenolics, arbuscular symbiosis, and bacterial pathogen etiologies. Expression-based and phylogenetic evidence shows that TAS4 targets two novel grape (Vitis vinifera L.) MYB transcription factors (VvMYBA6, VvMYBA7) that spawn phased small interfering RNAs (siRNAs) which probably function in nutraceutical bioflavonoid biosynthesis and fruit development. Characterization of the molecular mechanisms of TAS4 control of plant development and integration into biotic and abiotic stress- and nutrient-signaling regulatory networks has applicability to molecular breeding and the development of strategies for engineering healthier foods. Copyright © 2013 Elsevier Ltd. All rights reserved.
High-Resolution Melt Analysis for Rapid Comparison of Bacterial Community Compositions
Hjelmsø, Mathis Hjort; Hansen, Lars Hestbjerg; Bælum, Jacob; Feld, Louise; Holben, William E.
2014-01-01
In the study of bacterial community composition, 16S rRNA gene amplicon sequencing is today among the preferred methods of analysis. The cost of nucleotide sequence analysis, including requisite computational and bioinformatic steps, however, takes up a large part of many research budgets. High-resolution melt (HRM) analysis is the study of the melt behavior of specific PCR products. Here we describe a novel high-throughput approach in which we used HRM analysis targeting the 16S rRNA gene to rapidly screen multiple complex samples for differences in bacterial community composition. We hypothesized that HRM analysis of amplified 16S rRNA genes from a soil ecosystem could be used as a screening tool to identify changes in bacterial community structure. This hypothesis was tested using a soil microcosm setup exposed to a total of six treatments representing different combinations of pesticide and fertilization treatments. The HRM analysis identified a shift in the bacterial community composition in two of the treatments, both including the soil fumigant Basamid GR. These results were confirmed with both denaturing gradient gel electrophoresis (DGGE) analysis and 454-based 16S rRNA gene amplicon sequencing. HRM analysis was shown to be a fast, high-throughput technique that can serve as an effective alternative to gel-based screening methods to monitor microbial community composition. PMID:24610853
Chao, Yu; Chen, Yutong; Cao, Yaqian; Chen, Huamin; Wang, Jichun; Bi, Yong-Mei; Tian, Fang; Yang, Fenghuan; Rothstein, Steven J; Zhou, Xueping; He, Chenyang
2018-03-15
Limiting nitrogen (N) supply contributes to improved resistance to bacterial blight (BB) caused by Xanthomonas oryzae pv. oryzae (Xoo) in susceptible rice (Oryza sativa). To understand the regulatory roles of microRNAs in this phenomenon, sixty-three differentially-expressed overlapping miRNAs in response to Xoo infection and N-limitation stress in rice were identified through deep RNA-sequence and stem loop qRT-PCR. Among these, miR169o was further assessed as a typical overlapping miRNA through the overexpression of the miR169o primary gene. Osa-miR169o-OX plants were taller, and had more biomass accumulation with significantly increased nitrate and total amino acid contents in roots than wild type (WT). Transcript level assays showed that under different N supply conditions miR169o opposite regulated NRT2 which is reduced under normal N supply condition but remarkably induced under N limiting stress. On the other hand, osa-miR169o-OX plants also displayed increased disease lesion lengths and reduced transcriptional levels of defense gene (PR1b, PR10a, PR10b and PAL) compared with WT after inoculation with Xoo. In addition, miR169o impeded Xoo-mediated NRT transcription. Therefore, the overlapping miR169o contributes to increase N use efficiency and negatively regulates the resistance to bacterial blight in rice. Consistently, transient expression of NF-YAs in rice protoplast promoted the transcripts of PR genes and NRT2 genes, while reduced the transcripts of NRT1 genes. Our results provide novel and additional insights into the coordinated regulatory mechanisms of crosstalk between Xoo infection and N-deficiency responses in rice.
Beilby, J P
1983-05-01
The incorporation of isotopically labelled precursors, [1-14C]leucine, [2-14C]uracil and [1-14C]acetate, by germinating spores of the vesicular-arbuscular mycorrhizal fungus Glomus caledonium was investigated after prior incubation with several metabolic inhibitors. Inhibition of isotope incorporation was greatest with ethidium bromide and cycloheximide and least with chloramphenicol and actinomycin D. The incorporation of [1-14C]leucine into protein was reduced by 92% within 60 min of incubation in either ethidium bromide at 5 micrograms/mL or cycloheximide at 100 micrograms/mL. For these studies time zero was coincident with dry quiescent spores being first wet. Lipid synthesis during germination of the spores was detected at 120 min by following the incorporation of [1-14C]acetate. At 51 h, incorporation was greater in the triacylglycerides and diacylglycerides than in the free sterols, phospholipids, or free fatty acid. Spores exposed to cycloheximide for 60 min after imbibition showed very little phospholipid synthesis and no free fatty acid synthesis. The synthesis of RNA after spore imbibition is also discussed.
Strand-specific transcriptome profiling with directly labeled RNA on genomic tiling microarrays
2011-01-01
Background With lower manufacturing cost, high spot density, and flexible probe design, genomic tiling microarrays are ideal for comprehensive transcriptome studies. Typically, transcriptome profiling using microarrays involves reverse transcription, which converts RNA to cDNA. The cDNA is then labeled and hybridized to the probes on the arrays, thus the RNA signals are detected indirectly. Reverse transcription is known to generate artifactual cDNA, in particular the synthesis of second-strand cDNA, leading to false discovery of antisense RNA. To address this issue, we have developed an effective method using RNA that is directly labeled, thus by-passing the cDNA generation. This paper describes this method and its application to the mapping of transcriptome profiles. Results RNA extracted from laboratory cultures of Porphyromonas gingivalis was fluorescently labeled with an alkylation reagent and hybridized directly to probes on genomic tiling microarrays specifically designed for this periodontal pathogen. The generated transcriptome profile was strand-specific and produced signals close to background level in most antisense regions of the genome. In contrast, high levels of signal were detected in the antisense regions when the hybridization was done with cDNA. Five antisense areas were tested with independent strand-specific RT-PCR and none to negligible amplification was detected, indicating that the strong antisense cDNA signals were experimental artifacts. Conclusions An efficient method was developed for mapping transcriptome profiles specific to both coding strands of a bacterial genome. This method chemically labels and uses extracted RNA directly in microarray hybridization. The generated transcriptome profile was free of cDNA artifactual signals. In addition, this method requires fewer processing steps and is potentially more sensitive in detecting small amount of RNA compared to conventional end-labeling methods due to the incorporation of more
Witek, Marta A; Conn, Graeme L
2014-09-01
The global dissemination, potential activity in diverse species and broad resistance spectrum conferred by the aminoglycoside-resistance ribosomal RNA methyltransferases make them a significant potential new threat to the efficacy of aminoglycoside antibiotics in the treatment of serious bacterial infections. The N1 methylation of adenosine 1408 (m(1)A1408) confers resistance to structurally diverse aminoglycosides, including kanamycin, neomycin and apramycin. The limited analyses to date of the enzymes responsible have identified common features but also potential differences in their molecular details of action. Therefore, with the goal of expanding the known 16S rRNA (m(1)A1408) methyltransferase family as a platform for developing a more complete mechanistic understanding, we report here the cloning, expression and functional analyses of four hypothetical aminoglycoside-resistance rRNA methyltransferases from recent genome sequences of diverse bacterial species. Each of the genes produced a soluble, folded protein with a secondary structure, as determined from circular dichroism (CD) spectra, consistent with enzymes for which high-resolution structures are available. For each enzyme, antibiotic minimum inhibitory concentration (MIC) assays revealed a resistance spectrum characteristic of the known 16S rRNA (m(1)A1408) methyltransferases and the modified nucleotide was confirmed by reverse transcription as A1408. In common with other family members, higher binding affinity for the methylation reaction by-product S-adenosylhomocysteine (SAH) than the cosubstrate S-adenosyl-L-methionine (SAM) was observed for three methyltransferases, while one unexpectedly showed no measurable affinity for SAH. Collectively, these results confirm that each hypothetical enzyme is a functional 16S rRNA (m(1)A1408) methyltransferase but also point to further potential mechanistic variation within this enzyme family. Copyright © 2014 Elsevier B.V. All rights reserved.
The effect of ethionine on ribonucleic acid synthesis in rat liver.
Swann, P F
1975-01-01
1. By 1h after administration of ethionine to the female rat the appearance of newly synthesized 18SrRNA in the cytoplasm is completely inhibited. This is not caused by inhibition of RNA synthesis, for the synthesis of the large ribosomal precursor RNA (45S) and of tRNA continues. Cleavage of 45S RNA to 32S RNA also occurs, but there was no evidence for the accumulation of mature or immature rRNA in the nucleus. 2. The effect of ethionine on the maturation of rRNA was not mimicked by an inhibitor of protein synthesis (cycloheximide) or an inhibitor of polyamine synthesis [methylglyoxal bis(guanylhydrazone)]. 3. Unlike the ethionine-induced inhibition of protein synthesis, this effect was not prevented by concurrent administration of inosine. A similar effect could be induced in HeLa cells by incubation for 1h in a medium lacking methionine. The ATP concentration in these cells was normal. From these two observations it was concluded that the effect of etionine on rRNA maturation is not caused by an ethionine-induced lack of ATP. It is suggested that ethionine, by lowering the hepatic concentration of S-adenosylmethionine, prevents methylation of the ribosomal precursor. The methylation is essential for the correct maturation of the molecule; without methylation complete degradation occurs. PMID:1212195
The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...
We examined the bacterial composition of chlorinated drinking water using 16S rRNA gene clone libraries derived from RNA and DNA extracted from twelve water samples collected in three different months (June, August, and September of 2007). Phylogenetic analysis of 1234 and 1117 ...
Kamphuis, Monique B; Bonvin, Alexandre M J J; Monti, Maria Chiara; Lemonnier, Marc; Muñoz-Gómez, Ana; van den Heuvel, Robert H H; Díaz-Orejas, Ramón; Boelens, Rolf
2006-03-17
The toxin Kid and antitoxin Kis are encoded by the parD operon of Escherichia coli plasmid R1. Kid and its chromosomal homologues MazF and ChpBK have been shown to inhibit protein synthesis in cell extracts and to act as ribosome-independent endoribonucleases in vitro. Kid cleaves RNA preferentially at the 5' side of the A residue in the nucleotide sequence 5'-UA(A/C)-3' of single-stranded regions. Here, we show that RNA cleavage by Kid yields two fragments with a 2':3'-cyclic phosphate group and a free 5'-OH group, respectively. The cleavage mechanism is similar to that of RNases A and T1, involving the uracil 2'-OH group. Via NMR titration studies with an uncleavable RNA mimic, we demonstrate that residues of both monomers of the Kid dimer together form a concatenated RNA-binding surface. Docking calculations based on the NMR chemical shifts, the cleavage mechanism and previously reported mutagenesis data provide a detailed picture of the position of the AUACA fragment within the binding pocket. We propose that residues D75, R73 and H17 form the active site of the Kid toxin, where D75 and R73 are the catalytic base and acid, respectively. The RNA sequence specificity is defined by residues T46, S47, A55, F57, T69, V71 and R73. Our data show the importance of these residues for Kid function, and the implications of our results for related toxins, such as MazF, CcdB and RelE, are discussed.
Sierant, Malgorzata; Leszczynska, Grazyna; Sadowska, Klaudia; Dziergowska, Agnieszka; Rozanski, Michal; Sochacka, Elzbieta; Nawrot, Barbara
2016-01-01
Recently, highly lipophilic S-geranylated derivatives of 5-methylaminomethyl-2-thiouridine (mnm5geS2U) and 5-carboxymethylaminomethyl-2-thiouridine (cmnm5geS2U) were found at the first (wobble) anticodon position in bacterial tRNAs specific for Lys, Glu and Gln. The function and cellular biogenesis of these unique tRNAs remain poorly understood. Here, we present one direct and two post-synthetic chemical routes for preparing model geS2U-RNAs. Our experimental data demonstrate that geS2U-RNAs are more lipophilic than their parent S2U-RNAs as well as non-modified U-RNAs. Thermodynamic studies revealed that the S-geranyl-2-thiouridine-containing RNA has higher affinity toward complementary RNA strand with G opposite the modified unit than with A. Recombinant tRNA selenouridine synthase (SelU) exhibits sulfur-specific geranylation activity toward model S2U-RNA, which is composed of the anticodon-stem-loop (ASL) from the human tRNALys3 sequence. In addition, the presence of magnesium ions is required to achieve appreciable geranylation efficiencies. PMID:27566149
Restructuring of the Aquatic Bacterial Community by Hydric Dynamics Associated with Superstorm Sandy
Ulrich, Nikea; Rosenberger, Abigail; Brislawn, Colin; Wright, Justin; Kessler, Collin; Toole, David; Solomon, Caroline; Strutt, Steven; McClure, Erin
2016-01-01
ABSTRACT Bacterial community composition and longitudinal fluctuations were monitored in a riverine system during and after Superstorm Sandy to better characterize inter- and intracommunity responses associated with the disturbance associated with a 100-year storm event. High-throughput sequencing of the 16S rRNA gene was used to assess microbial community structure within water samples from Muddy Creek Run, a second-order stream in Huntingdon, PA, at 12 different time points during the storm event (29 October to 3 November 2012) and under seasonally matched baseline conditions. High-throughput sequencing of the 16S rRNA gene was used to track changes in bacterial community structure and divergence during and after Superstorm Sandy. Bacterial community dynamics were correlated to measured physicochemical parameters and fecal indicator bacteria (FIB) concentrations. Bioinformatics analyses of 2.1 million 16S rRNA gene sequences revealed a significant increase in bacterial diversity in samples taken during peak discharge of the storm. Beta-diversity analyses revealed longitudinal shifts in the bacterial community structure. Successional changes were observed, in which Betaproteobacteria and Gammaproteobacteria decreased in 16S rRNA gene relative abundance, while the relative abundance of members of the Firmicutes increased. Furthermore, 16S rRNA gene sequences matching pathogenic bacteria, including strains of Legionella, Campylobacter, Arcobacter, and Helicobacter, as well as bacteria of fecal origin (e.g., Bacteroides), exhibited an increase in abundance after peak discharge of the storm. This study revealed a significant restructuring of in-stream bacterial community structure associated with hydric dynamics of a storm event. IMPORTANCE In order to better understand the microbial risks associated with freshwater environments during a storm event, a more comprehensive understanding of the variations in aquatic bacterial diversity is warranted. This study
Ogram, Sushma A; Boone, Christopher D; McKenna, Robert; Flanegan, James B
2014-09-01
The mechanism of amiloride inhibition of Coxsackievirus B3 (CVB3) and poliovirus type 1 (PV1) RNA replication was investigated using membrane-associated RNA replication complexes. Amiloride was shown to inhibit viral RNA replication and VPgpUpU synthesis. However, the drug had no effect on polymerase elongation activity during either (-) strand or (+) strand synthesis. These findings indicated that amiloride inhibited the initiation of RNA synthesis by inhibiting VPg uridylylation. In addition, in silico binding studies showed that amiloride docks in the VPg binding site on the back of the viral RNA polymerase, 3D(pol). Since VPg binding at this site on PV1 3D(pol) was previously shown to be required for VPg uridylylation, our results suggest that amiloride inhibits VPg binding to 3D(pol). In summary, our findings are consistent with a model in which amiloride inhibits VPgpUpU synthesis and viral RNA replication by competing with VPg for binding to 3D(pol). Copyright © 2014 Elsevier Inc. All rights reserved.
Choudhury, Nila Roy; Michlewski, Gracjan
2018-06-08
RNA-binding proteins mediate and control gene expression. As some examples, they regulate pre-mRNA synthesis and processing; mRNA localisation, translation and decay; and microRNA (miRNA) biogenesis and function. Here, we present a detailed protocol for RNA pull-down coupled to stable isotope labelling by amino acids in cell culture (SILAC) mass spectrometry (RP-SMS) that enables quantitative, fast and specific detection of RNA-binding proteins that regulate miRNA biogenesis. In general, this method allows for the identification of RNA-protein complexes formed using in vitro or chemically synthesized RNAs and protein extracts derived from cultured cells. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Alternative bases in the RNA world: the prebiotic synthesis of urazole and its ribosides
NASA Technical Reports Server (NTRS)
Kolb, V. M.; Dworkin, J. P.; Miller, S. L.
1994-01-01
Urazole is a five-membered heterocyclic compound which is isosteric with uracil's hydrogen-bonding segment. Urazole reacts spontaneoulsy with ribose (and other aldoses) to give a mixture of four ribosides: alpha and beta pyranosides and furanosides. This reaction occurs in aqueous solution at mild temperatures. Thermodynamic and kinetic parameters for the reaction of urazole with ribose were determined. In contrast, uracil is completely unreactive with ribose under these conditions. Urazole's unusual reactivity is ascribed to the hydrazine portion of the molecule. Urazole can be synthesized from biuret and hydrazine under prebiotic conditions. The prebiotic synthesis of guanazole, which is isosteric in part to diaminopyrimidine and cytosine, is accomplished from dicyandiamide and hydrazine. Kinetic parameters for both prebiotic reactions were measured. Urazole and guanazole are transparent in the UV, which would be a favorable property in the absence of an ozone layer on the early Earth. Urazole makes hydrogen bonds with adenine in DMSO similar to those of uracil, as established by H NMR. All of these properties make urazole an attractive potential precursor to uracil and guanazole a potential precursor to cytosine in the RNA or pre-RNA world.
Alvarenga, C A; Winter, C E; Stocker, A J; Pueyo, M T; Lara, F J
1991-01-01
1. Fourth-instar larvae of Rhynchosciara americana were injected with the insect molting hormone, ecdysterone, giving final hemolymph concentrations from 4.46 to 223 microM. 2. Induction of the DNA puff, B2b, in the proximal (S1) region of the salivary glands of Rhynchosciara americana by 22.6 microM ecdysterone, was accompanied by the production of an mRNA and a polypeptide with the same characteristics as B2b products produced during normal development. This mRNA and polypeptide were restricted to the proximal region of the gland, as is the B2b puff. 3. Synthesis of other poly(A)+RNAs was also stimulated in S1 by ecdysterone, and other puffs that appear during normal development were induced. However, rRNA production in S1 goes through a pattern of inhibition, followed by recovery when B2b is puffed, and subsequent inhibition. 4. Low molecular weight RNA, with a peak in the region of 4S, is stimulated after ecdysterone administration.
Synthesizing topological structures containing RNA
NASA Astrophysics Data System (ADS)
Liu, Di; Shao, Yaming; Chen, Gang; Tse-Dinh, Yuk-Ching; Piccirilli, Joseph A.; Weizmann, Yossi
2017-03-01
Though knotting and entanglement have been observed in DNA and proteins, their existence in RNA remains an enigma. Synthetic RNA topological structures are significant for understanding the physical and biological properties pertaining to RNA topology, and these properties in turn could facilitate identifying naturally occurring topologically nontrivial RNA molecules. Here we show that topological structures containing single-stranded RNA (ssRNA) free of strong base pairing interactions can be created either by configuring RNA-DNA hybrid four-way junctions or by template-directed synthesis with a single-stranded DNA (ssDNA) topological structure. By using a constructed ssRNA knot as a highly sensitive topological probe, we find that Escherichia coli DNA topoisomerase I has low RNA topoisomerase activity and that the R173A point mutation abolishes the unknotting activity for ssRNA, but not for ssDNA. Furthermore, we discover the topological inhibition of reverse transcription (RT) and obtain different RT-PCR patterns for an ssRNA knot and circle of the same sequence.
Bieth, E; Gabus, C; Darlix, J L
1990-01-11
The genetic material of all retroviruses examined so far is an RNA dimer where two identical RNA subunits are joined at their 5' ends by a structure named dimer linkage structure (DLS). Since the precise location and structure of the DLS as well as the mechanism and role(s) of RNA dimerization remain unclear, we analysed the dimerization process of Rous sarcoma virus (RSV) RNA. For this purpose we set up an in vitro model for RSV RNA dimerization. Using this model RSV RNA was shown to form dimeric molecules and this dimerization process was greatly activated by nucleocapsid protein (NCp12) of RSV. Furthermore, RSV RNA dimerization was performed in the presence of complementary 5'32P-DNA oligomers in order to probe the monomer and dimer forms of RSV RNA. Data indicated that the DLS of RSV RNA probably maps between positions 544-564 from the 5' end. In an attempt to define sequences needed for the dimerization of RSV RNA, deletion mutageneses were generated in the 5' 600 nt. The results showed that the dimer promoting sequences probably are located within positions 208-270 and 400-600 from the 5' end and hence possibly encompassing the cis-acting elements needed for the specific encapsidation of RSV genomic RNA. Also it is reported that synthesis of the polyprotein precursor Pr76gag is inhibited upon dimerization of RSV RNA. These results suggest that dimerization and encapsidation of genome length RSV RNA might be linked in the course of virion formation since they appear to be under the control of the same cis elements, E and DLS, and the trans-acting factor nucleocapsid protein NCp12.
Bacterial antisense RNAs are mainly the product of transcriptional noise.
Lloréns-Rico, Verónica; Cano, Jaime; Kamminga, Tjerko; Gil, Rosario; Latorre, Amparo; Chen, Wei-Hua; Bork, Peer; Glass, John I; Serrano, Luis; Lluch-Senar, Maria
2016-03-01
cis-Encoded antisense RNAs (asRNAs) are widespread along bacterial transcriptomes. However, the role of most of these RNAs remains unknown, and there is an ongoing discussion as to what extent these transcripts are the result of transcriptional noise. We show, by comparative transcriptomics of 20 bacterial species and one chloroplast, that the number of asRNAs is exponentially dependent on the genomic AT content and that expression of asRNA at low levels exerts little impact in terms of energy consumption. A transcription model simulating mRNA and asRNA production indicates that the asRNA regulatory effect is only observed above certain expression thresholds, substantially higher than physiological transcript levels. These predictions were verified experimentally by overexpressing nine different asRNAs in Mycoplasma pneumoniae. Our results suggest that most of the antisense transcripts found in bacteria are the consequence of transcriptional noise, arising at spurious promoters throughout the genome.
Simmon, Keith; Karaca, Dilek; Langeland, Nina; Wiker, Harald G.
2012-01-01
Broad-range amplification and sequencing of the bacterial 16S rRNA gene directly from clinical specimens are offered as a diagnostic service in many laboratories. One major pitfall is primer cross-reactivity with human DNA which will result in mixed chromatograms. Mixed chromatograms will complicate subsequent sequence analysis and impede identification. In SYBR green real-time PCR assays, it can also affect crossing threshold values and consequently the status of a specimen as positive or negative. We evaluated two conventional primer pairs in common use and a new primer pair based on the dual priming oligonucleotide (DPO) principle. Cross-reactivity was observed when both conventional primer pairs were used, resulting in interpretation difficulties. No cross-reactivity was observed using the DPOs even in specimens with a high ratio of human to bacterial DNA. In addition to reducing cross-reactivity, the DPO principle also offers a high degree of flexibility in the design of primers and should be considered for any PCR assay intended for detection and identification of pathogens directly from human clinical specimens. PMID:22278843
Benthic Bacterial Diversity in Submerged Sinkhole Ecosystems▿ †
Nold, Stephen C.; Pangborn, Joseph B.; Zajack, Heidi A.; Kendall, Scott T.; Rediske, Richard R.; Biddanda, Bopaiah A.
2010-01-01
Physicochemical characterization, automated ribosomal intergenic spacer analysis (ARISA) community profiling, and 16S rRNA gene sequencing approaches were used to study bacterial communities inhabiting submerged Lake Huron sinkholes inundated with hypoxic, sulfate-rich groundwater. Photosynthetic cyanobacterial mats on the sediment surface were dominated by Phormidium autumnale, while deeper, organically rich sediments contained diverse and active bacterial communities. PMID:19880643
Kahlisch, Leila; Henne, Karsten; Gröbe, Lothar; Brettar, Ingrid; Höfle, Manfred G
2012-02-01
The question which bacterial species are present in water and if they are viable is essential for drinking water safety but also of general relevance in aquatic ecology. To approach this question we combined propidium iodide/SYTO9 staining ("live/dead staining" indicating membrane integrity), fluorescence-activated cell sorting (FACS) and community fingerprinting for the analysis of a set of tap water samples. Live/dead staining revealed that about half of the bacteria in the tap water had intact membranes. Molecular analysis using 16S rRNA and 16S rRNA gene-based single-strand conformation polymorphism (SSCP) fingerprints and sequencing of drinking water bacteria before and after FACS sorting revealed: (1) the DNA- and RNA-based overall community structure differed substantially, (2) the community retrieved from RNA and DNA reflected different bacterial species, classified as 53 phylotypes (with only two common phylotypes), (3) the percentage of phylotypes with intact membranes or damaged cells were comparable for RNA- and DNA-based analyses, and (4) the retrieved species were primarily of aquatic origin. The pronounced difference between phylotypes obtained from DNA extracts (dominated by Betaproteobacteria, Bacteroidetes, and Actinobacteria) and from RNA extracts (dominated by Alpha-, Beta-, Gammaproteobacteria, Bacteroidetes, and Cyanobacteria) demonstrate the relevance of concomitant RNA and DNA analyses for drinking water studies. Unexpected was that a comparable fraction (about 21%) of phylotypes with membrane-injured cells was observed for DNA- and RNA-based analyses, contradicting the current understanding that RNA-based analyses represent the actively growing fraction of the bacterial community. Overall, we think that this combined approach provides an interesting tool for a concomitant phylogenetic and viability analysis of bacterial species of drinking water.
Active bacterial community structure along vertical redox gradients in Baltic Sea sediment
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jansson, Janet; Edlund, Anna; Hardeman, Fredrik
Community structures of active bacterial populations were investigated along a vertical redox profile in coastal Baltic Sea sediments by terminal-restriction fragment length polymorphism (T-RFLP) and clone library analysis. According to correspondence analysis of T-RFLP results and sequencing of cloned 16S rRNA genes, the microbial community structures at three redox depths (179 mV, -64 mV and -337 mV) differed significantly. The bacterial communities in the community DNA differed from those in bromodeoxyuridine (BrdU)-labeled DNA, indicating that the growing members of the community that incorporated BrdU were not necessarily the most dominant members. The structures of the actively growing bacterial communities weremore » most strongly correlated to organic carbon followed by total nitrogen and redox potentials. Bacterial identification by sequencing of 16S rRNA genes from clones of BrdU-labeled DNA and DNA from reverse transcription PCR (rt-PCR) showed that bacterial taxa involved in nitrogen and sulfur cycling were metabolically active along the redox profiles. Several sequences had low similarities to previously detected sequences indicating that novel lineages of bacteria are present in Baltic Sea sediments. Also, a high number of different 16S rRNA gene sequences representing different phyla were detected at all sampling depths.« less
Trans-acting small interfering RNA4: key to nutraceutical synthesis in 1 grape development?
Rock, Christopher D.
2013-01-01
The facility and versatility of microRNAs (miRNAs) to evolve and change likely underlies how they have become dominant constituents of eukaryotic genomes. In this opinion article I propose that trans-acting small interfering RNA gene 4 (TAS4) evolution may be important for biosynthesis of polyphenolics, arbuscular symbiosis, and bacterial pathogen etiologies. Expression-based and phylogenetic evidence shows that TAS4 targets two novel grape (Vitis vinifera L.) MYB transcription factors (VvMYBA6, VvMYBA7) that spawn phased siRNAs and likely function in nutraceutical bioflavonoid biosynthesis and fruit development. Characterization of the molecular mechanisms of TAS4 control of plant development and integration into biotic and abiotic stress- and nutrient signaling regulatory networks has applicability to molecular breeding and development of strategies for engineering healthier foods. PMID:23993483
Genome engineering and gene expression control for bacterial strain development.
Song, Chan Woo; Lee, Joungmin; Lee, Sang Yup
2015-01-01
In recent years, a number of techniques and tools have been developed for genome engineering and gene expression control to achieve desired phenotypes of various bacteria. Here we review and discuss the recent advances in bacterial genome manipulation and gene expression control techniques, and their actual uses with accompanying examples. Genome engineering has been commonly performed based on homologous recombination. During such genome manipulation, the counterselection systems employing SacB or nucleases have mainly been used for the efficient selection of desired engineered strains. The recombineering technology enables simple and more rapid manipulation of the bacterial genome. The group II intron-mediated genome engineering technology is another option for some bacteria that are difficult to be engineered by homologous recombination. Due to the increasing demands on high-throughput screening of bacterial strains having the desired phenotypes, several multiplex genome engineering techniques have recently been developed and validated in some bacteria. Another approach to achieve desired bacterial phenotypes is the repression of target gene expression without the modification of genome sequences. This can be performed by expressing antisense RNA, small regulatory RNA, or CRISPR RNA to repress target gene expression at the transcriptional or translational level. All of these techniques allow efficient and rapid development and screening of bacterial strains having desired phenotypes, and more advanced techniques are expected to be seen. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Stamper, David M.; Walch, Marianne; Jacobs, Rachel N.
2003-01-01
The bacterial population of a graywater treatment system was monitored over the course of 100 days, along with several wastewater biochemical parameters. The graywater treatment system employed an 1,800-liter membrane bioreactor (MBR) to process the waste, with essentially 100% recycling of the biomass. Graywater feed consisting of 10% galley water and 90% laundry water, selected to approximate the graywater composition on board U.S. Navy ships, was collected offsite. Five-day biological oxygen demand (BOD5), oils and greases (O/G), nitrogen, and phosphorus were monitored in the feed and were found to vary greatly day to day. Changes in the bacterial population were monitored by PCR amplification of region 332 to 518 (Escherichia coli numbering) of the 16S rRNA gene and denaturing gradient gel electrophoresis (DGGE) analysis of the resultant PCR products. DGGE analysis indicated a diverse and unstable bacterial population throughout the 100-day period, with spikes in feed strength causing significant changes in community structure. Long-term similarity between the communities was 0 to 25%, depending on the method of analysis. In spite of the unstable bacterial population, the MBR system was able to meet effluent quality parameters approximately 90% of the time. PMID:12571004
Stamper, David M; Walch, Marianne; Jacobs, Rachel N
2003-02-01
The bacterial population of a graywater treatment system was monitored over the course of 100 days, along with several wastewater biochemical parameters. The graywater treatment system employed an 1,800-liter membrane bioreactor (MBR) to process the waste, with essentially 100% recycling of the biomass. Graywater feed consisting of 10% galley water and 90% laundry water, selected to approximate the graywater composition on board U.S. Navy ships, was collected offsite. Five-day biological oxygen demand (BOD(5)), oils and greases (O/G), nitrogen, and phosphorus were monitored in the feed and were found to vary greatly day to day. Changes in the bacterial population were monitored by PCR amplification of region 332 to 518 (Escherichia coli numbering) of the 16S rRNA gene and denaturing gradient gel electrophoresis (DGGE) analysis of the resultant PCR products. DGGE analysis indicated a diverse and unstable bacterial population throughout the 100-day period, with spikes in feed strength causing significant changes in community structure. Long-term similarity between the communities was 0 to 25%, depending on the method of analysis. In spite of the unstable bacterial population, the MBR system was able to meet effluent quality parameters approximately 90% of the time.
We examined the bacterial composition of chlorinated drinking water using 16S rRNA gene clone libraries derived from RNA and DNA extracted from twelve water samples collected in three different months (June, August, and September of 2007). Phylogenetic analysis of 1234 and 1117 ...
Greenberg, Jay R.; Perry, Robert P.
1971-01-01
The relationship of the DNA sequences from which polyribosomal messenger RNA (mRNA) and heterogeneous nuclear RNA (NRNA) of mouse L cells are transcribed was investigated by means of hybridization kinetics and thermal denaturation of the hybrids. Hybridization was performed in formamide solutions at DNA excess. Under these conditions most of the hybridizing mRNA and NRNA react at values of Dot (DNA concentration multiplied by time) expected for RNA transcribed from the nonrepeated or rarely repeated fraction of the genome. However, a fraction of both mRNA and NRNA hybridize at values of Dot about 10,000 times lower, and therefore must be transcribed from highly redundant DNA sequences. The fraction of NRNA hybridizing to highly repeated sequences is about 1.7 times greater than the corresponding fraction of mRNA. The hybrids formed by the rapidly reacting fractions of both NRNA and mRNA melt over a narrow temperature range with a midpoint about 11°C below that of native L cell DNA. This indicates that these hybrids consist of partially complementary sequences with approximately 11% mismatching of bases. Hybrids formed by the slowly reacting fraction of NRNA melt within 4°–6°C of native DNA, indicating very little, if any, mismatching of bases. Hybrids of the slowly reacting components of mRNA, formed under conditions of sufficiently low RNA input, have a high thermal stability, similar to that observed for hybrids of the slowly reacting NRNA component. However, when higher inputs of mRNA are used, hybrids are formed which have a strikingly lower thermal stability. This observation can be explained by assuming that there is sufficient similarity among the relatively rare DNA sequences coding for mRNA so that under hybridization conditions, in which these DNA sequences are not truly in excess, reversible hybrids exhibiting a considerable amount of mispairing are formed. The fact that a comparable phenomenon has not been observed for NRNA may mean that there is
Expression of Functional Influenza Virus RNA Polymerase in the Methylotrophic Yeast Pichia pastoris
Hwang, Jung-Shan; Yamada, Kazunori; Honda, Ayae; Nakade, Kohji; Ishihama, Akira
2000-01-01
Influenza virus RNA polymerase with the subunit composition PB1-PB2-PA is a multifunctional enzyme with the activities of both synthesis and cleavage of RNA and is involved in both transcription and replication of the viral genome. In order to produce large amounts of the functional viral RNA polymerase sufficient for analysis of its structure-function relationships, the cDNAs for RNA segments 1, 2, and 3 of influenza virus A/PR/8, each under independent control of the alcohol oxidase gene promoter, were integrated into the chromosome of the methylotrophic yeast Pichia pastoris. Simultaneous expression of all three P proteins in the yeast P. pastoris was achieved by the addition of methanol. To purify the P protein complexes, a sequence coding for a histidine tag was added to the PB2 protein gene at its N terminus. Starting from the induced P. pastoris cell lysate, we partially purified a 3P complex by Ni2+-agarose affinity column chromatography. The 3P complex showed influenza virus model RNA-directed and ApG-primed RNA synthesis in vitro but was virtually inactive without addition of template or primer. The kinetic properties of model template-directed RNA synthesis and the requirements for template sequence were analyzed using the 3P complex. Furthermore, the 3P complex showed capped RNA-primed RNA synthesis. Thus, we conclude that functional influenza virus RNA polymerase with the catalytic properties of a transcriptase is formed in the methylotrophic yeast P. pastoris. PMID:10756019
Estimating Bacterial Diversity for Ecological Studies: Methods, Metrics, and Assumptions
Birtel, Julia; Walser, Jean-Claude; Pichon, Samuel; Bürgmann, Helmut; Matthews, Blake
2015-01-01
Methods to estimate microbial diversity have developed rapidly in an effort to understand the distribution and diversity of microorganisms in natural environments. For bacterial communities, the 16S rRNA gene is the phylogenetic marker gene of choice, but most studies select only a specific region of the 16S rRNA to estimate bacterial diversity. Whereas biases derived from from DNA extraction, primer choice and PCR amplification are well documented, we here address how the choice of variable region can influence a wide range of standard ecological metrics, such as species richness, phylogenetic diversity, β-diversity and rank-abundance distributions. We have used Illumina paired-end sequencing to estimate the bacterial diversity of 20 natural lakes across Switzerland derived from three trimmed variable 16S rRNA regions (V3, V4, V5). Species richness, phylogenetic diversity, community composition, β-diversity, and rank-abundance distributions differed significantly between 16S rRNA regions. Overall, patterns of diversity quantified by the V3 and V5 regions were more similar to one another than those assessed by the V4 region. Similar results were obtained when analyzing the datasets with different sequence similarity thresholds used during sequences clustering and when the same analysis was used on a reference dataset of sequences from the Greengenes database. In addition we also measured species richness from the same lake samples using ARISA Fingerprinting, but did not find a strong relationship between species richness estimated by Illumina and ARISA. We conclude that the selection of 16S rRNA region significantly influences the estimation of bacterial diversity and species distributions and that caution is warranted when comparing data from different variable regions as well as when using different sequencing techniques. PMID:25915756
Vinícius de Melo, Gilberto
2018-01-01
Summary Coffee bean fermentation is a spontaneous, on-farm process involving the action of different microbial groups, including bacteria and fungi. In this study, high-throughput sequencing approach was employed to study the diversity and dynamics of bacteria associated with Brazilian coffee bean fermentation. The total DNA from fermenting coffee samples was extracted at different time points, and the 16S rRNA gene with segments around the V4 variable region was sequenced by Illumina high-throughput platform. Using this approach, the presence of over eighty bacterial genera was determined, many of which have been detected for the first time during coffee bean fermentation, including Fructobacillus, Pseudonocardia, Pedobacter, Sphingomonas and Hymenobacter. The presence of Fructobacillus suggests an influence of these bacteria on fructose metabolism during coffee fermentation. Temporal analysis showed a strong dominance of lactic acid bacteria with over 97% of read sequences at the end of fermentation, mainly represented by the Leuconostoc and Lactococcus. Metabolism of lactic acid bacteria was associated with the high formation of lactic acid during fermentation, as determined by HPLC analysis. The results reported in this study confirm the underestimation of bacterial diversity associated with coffee fermentation. New microbial groups reported in this study may be explored as functional starter cultures for on-farm coffee processing.
Lopes, Ana R; Manaia, Célia M; Nunes, Olga C
2014-03-01
Crop rotation is a practice harmonized with the sustainable rice production. Nevertheless, the implications of this empirical practice are not well characterized, mainly in relation to the bacterial community composition and structure. In this study, the bacterial communities of two adjacent paddy fields in the 3rd and 4th year of the crop rotation cycle and of a nonseeded subplot were characterized before rice seeding and after harvesting, using 454-pyrosequencing of the 16S rRNA gene. Although the phyla Acidobacteria, Proteobacteria, Chloroflexi, Actinobacteria and Bacteroidetes predominated in all the samples, there were variations in relative abundance of these groups. Samples from the 3rd and 4th years of the crop rotation differed on the higher abundance of groups of presumable aerobic bacteria and of presumable anaerobic and acidobacterial groups, respectively. Members of the phylum Nitrospira were more abundant after rice harvest than in the previously sampled period. Rice cropping was positively correlated with the abundance of members of the orders Acidobacteriales and 'Solibacterales' and negatively with lineages such as Chloroflexi 'Ellin6529'. Studies like this contribute to understand variations occurring in the microbial communities in soils under sustainable rice production, based on real-world data. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.