Role of the σ 54 Activator Interacting Domain in Bacterial Transcription Initiation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Siegel, Alexander R.; Wemmer, David E.
Bacterial sigma factors are subunits of RNA polymerase that direct the holoenzyme to specific sets of promoters in the genome and are a central element of regulating transcription. Most polymerase holoenzymes open the promoter and initiate transcription rapidly after binding. However, polymerase containing the members of the σ 54 family must be acted on by a transcriptional activator before DNA opening and initiation occur. A key domain in these transcriptional activators forms a hexameric AAA + ATPase that acts through conformational changes brought on by ATP hydrolysis. Contacts between the transcriptional activator and σ 54 are primarily made through anmore » N-terminal σ 54 activator interacting domain (AID). To better understand this mechanism of bacterial transcription initiation, we characterized the σ 54 AID by NMR spectroscopy and other biophysical methods and show that it is an intrinsically disordered domain in σ 54 alone. In this paper, we identified a minimal construct of the Aquifex aeolicus σ 54 AID that consists of two predicted helices and retains native-like binding affinity for the transcriptional activator NtrC1. Using the NtrC1 ATPase domain, bound with the non-hydrolyzable ATP analog ADP-beryllium fluoride, we studied the NtrC1–σ 54 AID complex using NMR spectroscopy. We show that the σ 54 AID becomes structured after associating with the core loops of the transcriptional activators in their ATP state and that the primary site of the interaction is the first predicted helix. Finally, understanding this complex, formed as the first step toward initiation, will help unravel the mechanism of σ 54 bacterial transcription initiation.« less
Naryshkin, Nikolai; Druzhinin, Sergei; Revyakin, Andrei; Kim, Younggyu; Mekler, Vladimir; Ebright, Richard H.
2009-01-01
Static site-specific protein-DNA photocrosslinking permits identification of protein-DNA interactions within multiprotein-DNA complexes. Kinetic site-specific protein-DNA photocrosslinking--involving rapid-quench-flow mixing and pulsed-laser irradiation--permits elucidation of pathways and kinetics of formation of protein-DNA interactions within multiprotein-DNA complexes. We present detailed protocols for application of static and kinetic site-specific protein-DNA photocrosslinking to bacterial transcription initiation complexes. PMID:19378179
Structural Basis of Mitochondrial Transcription Initiation.
Hillen, Hauke S; Morozov, Yaroslav I; Sarfallah, Azadeh; Temiakov, Dmitry; Cramer, Patrick
2017-11-16
Transcription in human mitochondria is driven by a single-subunit, factor-dependent RNA polymerase (mtRNAP). Despite its critical role in both expression and replication of the mitochondrial genome, transcription initiation by mtRNAP remains poorly understood. Here, we report crystal structures of human mitochondrial transcription initiation complexes assembled on both light and heavy strand promoters. The structures reveal how transcription factors TFAM and TFB2M assist mtRNAP to achieve promoter-dependent initiation. TFAM tethers the N-terminal region of mtRNAP to recruit the polymerase to the promoter whereas TFB2M induces structural changes in mtRNAP to enable promoter opening and trapping of the DNA non-template strand. Structural comparisons demonstrate that the initiation mechanism in mitochondria is distinct from that in the well-studied nuclear, bacterial, or bacteriophage transcription systems but that similarities are found on the topological and conceptual level. These results provide a framework for studying the regulation of gene expression and DNA replication in mitochondria. Copyright © 2017 Elsevier Inc. All rights reserved.
Washington, Tracy A; Smith, Janet L; Grossman, Alan D
2017-10-01
DnaA is the widely conserved bacterial AAA+ ATPase that functions as both the replication initiator and a transcription factor. In many organisms, DnaA controls expression of its own gene and likely several others during growth and in response to replication stress. To evaluate the effects of DnaA on gene expression, separate from its role in replication initiation, we analyzed changes in mRNA levels in Bacillus subtilis cells with and without dnaA, using engineered strains in which dnaA is not essential. We found that dnaA was required for many of the changes in gene expression in response to replication stress. We also found that dnaA indirectly affected expression of several regulons during growth, including those controlled by the transcription factors Spo0A, AbrB, PhoP, SinR, RemA, Rok and YvrH. These effects were largely mediated by the effects of DnaA on expression of sda. DnaA activates transcription of sda, and Sda inhibits histidine protein kinases required for activation of the transcription factor Spo0A. We also found that loss of dnaA caused a decrease in the development of genetic competence. Together, our results indicate that DnaA plays an important role in modulating cell physiology, separate from its role in replication initiation. © 2017 John Wiley & Sons Ltd.
CoSMoS Unravels Mysteries of Transcription Initiation
Gourse, Richard L.; Landick, Robert
2013-01-01
Using a fluorescence method called colocalization single-molecule spectroscopy (CoSMoS), Friedman and Gelles dissect the kinetics of transcription initiation at a bacterial promoter. Ultimately, CoSMoS could greatly aid the study of the effects of DNA sequence and transcription factors on both prokaryotic and eukaryotic promoters. PMID:22341438
Duchi, Diego; Gryte, Kristofer; Robb, Nicole C; Morichaud, Zakia; Sheppard, Carol; Wigneshweraraj, Sivaramesh
2018-01-01
Abstract Transcription initiation is a major step in gene regulation for all organisms. In bacteria, the promoter DNA is first recognized by RNA polymerase (RNAP) to yield an initial closed complex. This complex subsequently undergoes conformational changes resulting in DNA strand separation to form a transcription bubble and an RNAP-promoter open complex; however, the series and sequence of conformational changes, and the factors that influence them are unclear. To address the conformational landscape and transitions in transcription initiation, we applied single-molecule Förster resonance energy transfer (smFRET) on immobilized Escherichia coli transcription open complexes. Our results revealed the existence of two stable states within RNAP–DNA complexes in which the promoter DNA appears to adopt closed and partially open conformations, and we observed large-scale transitions in which the transcription bubble fluctuated between open and closed states; these transitions, which occur roughly on the 0.1 s timescale, are distinct from the millisecond-timescale dynamics previously observed within diffusing open complexes. Mutational studies indicated that the σ70 region 3.2 of the RNAP significantly affected the bubble dynamics. Our results have implications for many steps of transcription initiation, and support a bend-load-open model for the sequence of transitions leading to bubble opening during open complex formation. PMID:29177430
CoSMoS unravels mysteries of transcription initiation.
Gourse, Richard L; Landick, Robert
2012-02-17
Using a fluorescence method called colocalization single-molecule spectroscopy (CoSMoS), Friedman and Gelles dissect the kinetics of transcription initiation at a bacterial promoter. Ultimately, CoSMoS could greatly aid the study of the effects of DNA sequence and transcription factors on both prokaryotic and eukaryotic promoters. Copyright © 2012 Elsevier Inc. All rights reserved.
A dual switch controls bacterial enhancer-dependent transcription
Wiesler, Simone C.; Burrows, Patricia C.; Buck, Martin
2012-01-01
Bacterial RNA polymerases (RNAPs) are targets for antibiotics. Myxopyronin binds to the RNAP switch regions to block structural rearrangements needed for formation of open promoter complexes. Bacterial RNAPs containing the major variant σ54 factor are activated by enhancer-binding proteins (bEBPs) and transcribe genes whose products are needed in pathogenicity and stress responses. We show that (i) enhancer-dependent RNAPs help Escherichia coli to survive in the presence of myxopyronin, (ii) enhancer-dependent RNAPs partially resist inhibition by myxopyronin and (iii) ATP hydrolysis catalysed by bEBPs is obligatory for functional interaction of the RNAP switch regions with the transcription start site. We demonstrate that enhancer-dependent promoters contain two barriers to full DNA opening, allowing tight regulation of transcription initiation. bEBPs engage in a dual switch to (i) allow propagation of nucleated DNA melting from an upstream DNA fork junction and (ii) complete the formation of the transcription bubble and downstream DNA fork junction at the RNA synthesis start site, resulting in switch region-dependent RNAP clamp closure and open promoter complex formation. PMID:22965125
Bacterial Transcription as a Target for Antibacterial Drug Development
Ma, Cong; Yang, Xiao
2016-01-01
SUMMARY Transcription, the first step of gene expression, is carried out by the enzyme RNA polymerase (RNAP) and is regulated through interaction with a series of protein transcription factors. RNAP and its associated transcription factors are highly conserved across the bacterial domain and represent excellent targets for broad-spectrum antibacterial agent discovery. Despite the numerous antibiotics on the market, there are only two series currently approved that target transcription. The determination of the three-dimensional structures of RNAP and transcription complexes at high resolution over the last 15 years has led to renewed interest in targeting this essential process for antibiotic development by utilizing rational structure-based approaches. In this review, we describe the inhibition of the bacterial transcription process with respect to structural studies of RNAP, highlight recent progress toward the discovery of novel transcription inhibitors, and suggest additional potential antibacterial targets for rational drug design. PMID:26764017
Barvík, Ivan; Rejman, Dominik; Panova, Natalya; Šanderová, Hana; Krásný, Libor
2017-03-01
RNA polymerase (RNAP) is the central enzyme of transcription of the genetic information from DNA into RNA. RNAP recognizes four main substrates: ATP, CTP, GTP and UTP. Experimental evidence from the past several years suggests that, besides these four NTPs, other molecules can be used to initiate transcription: (i) ribooligonucleotides (nanoRNAs) and (ii) coenzymes such as NAD+, NADH, dephospho-CoA and FAD. The presence of these molecules at the 5΄ ends of RNAs affects the properties of the RNA. Here, we discuss the expanding portfolio of molecules that can initiate transcription, their mechanism of incorporation, effects on RNA and cellular processes, and we present an outlook toward other possible initiation substrates. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Bacterial effectors target the plant cell nucleus to subvert host transcription.
Canonne, Joanne; Rivas, Susana
2012-02-01
In order to promote virulence, Gram-negative bacteria have evolved the ability to inject so-called type III effector proteins into host cells. The plant cell nucleus appears to be a subcellular compartment repeatedly targeted by bacterial effectors. In agreement with this observation, mounting evidence suggests that manipulation of host transcription is a major strategy developed by bacteria to counteract plant defense responses. It has been suggested that bacterial effectors may adopt at least three alternative, although not mutually exclusive, strategies to subvert host transcription. T3Es may (1) act as transcription factors that directly activate transcription in host cells, (2) affect histone packing and chromatin configuration, and/or (3) target host transcription factor activity. Here, we provide an overview on how all these strategies may lead to host transcriptional re-programming and, as a result, to improved bacterial multiplication inside plant cells.
Bacterial antisense RNAs are mainly the product of transcriptional noise.
Lloréns-Rico, Verónica; Cano, Jaime; Kamminga, Tjerko; Gil, Rosario; Latorre, Amparo; Chen, Wei-Hua; Bork, Peer; Glass, John I; Serrano, Luis; Lluch-Senar, Maria
2016-03-01
cis-Encoded antisense RNAs (asRNAs) are widespread along bacterial transcriptomes. However, the role of most of these RNAs remains unknown, and there is an ongoing discussion as to what extent these transcripts are the result of transcriptional noise. We show, by comparative transcriptomics of 20 bacterial species and one chloroplast, that the number of asRNAs is exponentially dependent on the genomic AT content and that expression of asRNA at low levels exerts little impact in terms of energy consumption. A transcription model simulating mRNA and asRNA production indicates that the asRNA regulatory effect is only observed above certain expression thresholds, substantially higher than physiological transcript levels. These predictions were verified experimentally by overexpressing nine different asRNAs in Mycoplasma pneumoniae. Our results suggest that most of the antisense transcripts found in bacteria are the consequence of transcriptional noise, arising at spurious promoters throughout the genome.
Bacterial antisense RNAs are mainly the product of transcriptional noise
Lloréns-Rico, Verónica; Cano, Jaime; Kamminga, Tjerko; Gil, Rosario; Latorre, Amparo; Chen, Wei-Hua; Bork, Peer; Glass, John I.; Serrano, Luis; Lluch-Senar, Maria
2016-01-01
cis-Encoded antisense RNAs (asRNAs) are widespread along bacterial transcriptomes. However, the role of most of these RNAs remains unknown, and there is an ongoing discussion as to what extent these transcripts are the result of transcriptional noise. We show, by comparative transcriptomics of 20 bacterial species and one chloroplast, that the number of asRNAs is exponentially dependent on the genomic AT content and that expression of asRNA at low levels exerts little impact in terms of energy consumption. A transcription model simulating mRNA and asRNA production indicates that the asRNA regulatory effect is only observed above certain expression thresholds, substantially higher than physiological transcript levels. These predictions were verified experimentally by overexpressing nine different asRNAs in Mycoplasma pneumoniae. Our results suggest that most of the antisense transcripts found in bacteria are the consequence of transcriptional noise, arising at spurious promoters throughout the genome. PMID:26973873
DNA replication initiator Cdc6 also regulates ribosomal DNA transcription initiation.
Huang, Shijiao; Xu, Xiaowei; Wang, Guopeng; Lu, Guoliang; Xie, Wenbing; Tao, Wei; Zhang, Hongyin; Jiang, Qing; Zhang, Chuanmao
2016-04-01
RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. However, how this process is initiated during the cell cycle is not fully understood. By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. We further showed that Cdc6 is targeted to the nucleolus during late mitosis and G1 phase in a manner that is dependent on B23 (also known as nucleophosmin, NPM1), and preferentially binds to the rDNA promoter through its ATP-binding domain. Overexpression of Cdc6 increases rDNA transcription, whereas knockdown of Cdc6 results in a decreased association of both RNA polymerase I and the RNA polymerase I transcription factor RRN3 with rDNA, and a reduction of rDNA transcription. Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. © 2016. Published by The Company of Biologists Ltd.
Different types of pausing modes during transcription initiation.
Lerner, Eitan; Ingargiola, Antonino; Lee, Jookyung J; Borukhov, Sergei; Michalet, Xavier; Weiss, Shimon
2017-08-08
In many cases, initiation is rate limiting to transcription. This due in part to the multiple cycles of abortive transcription that delay promoter escape and the transition from initiation to elongation. Pausing of transcription in initiation can further delay promoter escape. The previously hypothesized pausing in initiation was confirmed by two recent studies from Duchi et al. 1 and from Lerner, Chung et al. 2 In both studies, pausing is attributed to a lack of forward translocation of the nascent transcript during initiation. However, the two works report on different pausing mechanisms. Duchi et al. report on pausing that occurs during initiation predominantly on-pathway of transcript synthesis. Lerner, Chung et al. report on pausing during initiation as a result of RNAP backtracking, which is off-pathway to transcript synthesis. Here, we discuss these studies, together with additional experimental results from single-molecule FRET focusing on a specific distance within the transcription bubble. We show that the results of these studies are complementary to each other and are consistent with a model involving two types of pauses in initiation: a short-lived pause that occurs in the translocation of a 6-mer nascent transcript and a long-lived pause that occurs as a result of 1-2 nucleotide backtracking of a 7-mer transcript.
Dulin, David; Bauer, David L V; Malinen, Anssi M; Bakermans, Jacob J W; Kaller, Martin; Morichaud, Zakia; Petushkov, Ivan; Depken, Martin; Brodolin, Konstantin; Kulbachinskiy, Andrey; Kapanidis, Achillefs N
2018-04-16
Transcription in bacteria is controlled by multiple molecular mechanisms that precisely regulate gene expression. It has been recently shown that initial RNA synthesis by the bacterial RNA polymerase (RNAP) is interrupted by pauses; however, the pausing determinants and the relationship of pausing with productive and abortive RNA synthesis remain poorly understood. Using single-molecule FRET and biochemical analysis, here we show that the pause encountered by RNAP after the synthesis of a 6-nt RNA (ITC6) renders the promoter escape strongly dependent on the NTP concentration. Mechanistically, the paused ITC6 acts as a checkpoint that directs RNAP to one of three competing pathways: productive transcription, abortive RNA release, or a new unscrunching/scrunching pathway. The cyclic unscrunching/scrunching of the promoter generates a long-lived, RNA-bound paused state; the abortive RNA release and DNA unscrunching are thus not as tightly linked as previously thought. Finally, our new model couples the pausing with the abortive and productive outcomes of initial transcription.
Schnapp, A; Pfleiderer, C; Rosenbauer, H; Grummt, I
1990-09-01
Control of mouse ribosomal RNA synthesis in response to extracellular signals is mediated by TIF-IA, a regulatory factor whose amount or activity correlates with cell proliferation. Factor TIF-IA interacts with RNA polymerase I (pol I), thus converting it into a transcriptionally active holoenzyme, which is able to initiate specifically at the rDNA promoter in the presence of the other auxiliary transcription initiation factors, designated TIF-IB, TIF-IC and UBF. With regard to several criteria, the growth-dependent factor TIF-IA behaves like a bacterial sigma factor: (i) it associates physically with pol I, (ii) it is required for initiation of transcription, (iii) it is present in limiting amounts and (iv) under certain salt conditions, it is chromatographically separable from the polymerase. In addition, evidence is presented that dephosphorylation of pol I abolishes in vitro transcription initiation from the ribosomal gene promoter without significantly affecting the polymerizing activity of the enzyme at nonspecific templates. The involvement of both a regulatory factor and post-translational modification of the transcribing enzyme provides an efficient and versatile mechanism of rDNA transcription regulation which enables the cell to adapt ribosome synthesis rapidly to a variety of extracellular signals.
Glyde, Robert; Ye, Fuzhou; Darbari, Vidya Chandran; Zhang, Nan; Buck, Martin; Zhang, Xiaodong
2017-07-06
Gene transcription is carried out by RNA polymerases (RNAPs). For transcription to occur, the closed promoter complex (RPc), where DNA is double stranded, must isomerize into an open promoter complex (RPo), where the DNA is melted out into a transcription bubble and the single-stranded template DNA is delivered to the RNAP active site. Using a bacterial RNAP containing the alternative σ 54 factor and cryoelectron microscopy, we determined structures of RPc and the activator-bound intermediate complex en route to RPo at 3.8 and 5.8 Å. Our structures show how RNAP-σ 54 interacts with promoter DNA to initiate the DNA distortions required for transcription bubble formation, and how the activator interacts with RPc, leading to significant conformational changes in RNAP and σ 54 that promote RPo formation. We propose that DNA melting is an active process initiated in RPc and that the RNAP conformations of intermediates are significantly different from that of RPc and RPo. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Huang, Faqing; Shi, Yongliang
2012-07-01
Two new photolabile adenosine-containing transcription initiators with terminal thiol and amino functionalities are chemically synthesized. Transcription in the presence of the transcription initiators under the T7 phi2.5 promoter produces 5' thiol- and amino-functionalized RNA conjugated by a photocleavable (PC) linker. Further RNA functionalization with biotin may be achieved through acyl transfer reactions from either biotinyl AMP to the RNA thiol group or biotin NHS to the RNA amino group. Photocleavage of the PC linker displays relatively fast kinetics with a half-life of 4-5 min. The availability of these transcription initiators makes new photolabile RNA accessible for affinity purification of RNA, in vitro selection of functional RNAs, and functional RNA caging. Copyright © 2012 Elsevier Ltd. All rights reserved.
Bacterial community transcription patterns during a marine phytoplankton bloom.
Rinta-Kanto, Johanna M; Sun, Shulei; Sharma, Shalabh; Kiene, Ronald P; Moran, Mary Ann
2012-01-01
Bacterioplankton consume a large proportion of photosynthetically fixed carbon in the ocean and control its biogeochemical fate. We used an experimental metatranscriptomics approach to compare bacterial activities that route energy and nutrients during a phytoplankton bloom compared with non-bloom conditions. mRNAs were sequenced from duplicate bloom and control microcosms 1 day after a phytoplankton biomass peak, and transcript copies per litre of seawater were calculated using an internal mRNA standard. Transcriptome analysis revealed a potential novel mechanism for enhanced efficiency during carbon-limited growth, mediated through membrane-bound pyrophosphatases [V-type H(+)-translocating; hppA]; bloom bacterioplankton participated less in this metabolic energy scavenging than non-bloom bacterioplankton, with possible implications for differences in growth yields on organic substrates. Bloom bacterioplankton transcribed more copies of genes predicted to increase cell surface adhesiveness, mediated by changes in bacterial signalling molecules related to biofilm formation and motility; these may be important in microbial aggregate formation. Bloom bacterioplankton also transcribed more copies of genes for organic acid utilization, suggesting an increased importance of this compound class in the bioreactive organic matter released during phytoplankton blooms. Transcription patterns were surprisingly faithful within a taxon regardless of treatment, suggesting that phylogeny broadly predicts the ecological roles of bacterial groups across 'boom' and 'bust' environmental backgrounds. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.
Cagliero, Cedric; Zhou, Yan Ning; Jin, Ding Jun
2014-01-01
In a fast-growing Escherichia coli cell, most RNA polymerase (RNAP) is allocated to rRNA synthesis forming transcription foci at clusters of rrn operons or bacterial nucleolus, and each of the several nascent nucleoids contains multiple pairs of replication forks. The composition of transcription foci has not been determined. In addition, how the transcription machinery is three-dimensionally organized to promote cell growth in concord with replication machinery in the nucleoid remains essentially unknown. Here, we determine the spatial and functional landscapes of transcription and replication machineries in fast-growing E. coli cells using super-resolution-structured illumination microscopy. Co-images of RNAP and DNA reveal spatial compartmentation and duplication of the transcription foci at the surface of the bacterial chromosome, encompassing multiple nascent nucleoids. Transcription foci cluster with NusA and NusB, which are the rrn anti-termination system and are associated with nascent rRNAs. However, transcription foci tend to separate from SeqA and SSB foci, which track DNA replication forks and/or the replisomes, demonstrating that transcription machinery and replisome are mostly located in different chromosomal territories to maintain harmony between the two major cellular functions in fast-growing cells. Our study suggests that bacterial chromosomes are spatially and functionally organized, analogous to eukaryotes. PMID:25416798
Means, A L; Farnham, P J
1990-02-01
We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).
Transcription initiation complex structures elucidate DNA opening.
Plaschka, C; Hantsche, M; Dienemann, C; Burzinski, C; Plitzko, J; Cramer, P
2016-05-19
Transcription of eukaryotic protein-coding genes begins with assembly of the RNA polymerase (Pol) II initiation complex and promoter DNA opening. Here we report cryo-electron microscopy (cryo-EM) structures of yeast initiation complexes containing closed and open DNA at resolutions of 8.8 Å and 3.6 Å, respectively. DNA is positioned and retained over the Pol II cleft by a network of interactions between the TATA-box-binding protein TBP and transcription factors TFIIA, TFIIB, TFIIE, and TFIIF. DNA opening occurs around the tip of the Pol II clamp and the TFIIE 'extended winged helix' domain, and can occur in the absence of TFIIH. Loading of the DNA template strand into the active centre may be facilitated by movements of obstructing protein elements triggered by allosteric binding of the TFIIE 'E-ribbon' domain. The results suggest a unified model for transcription initiation with a key event, the trapping of open promoter DNA by extended protein-protein and protein-DNA contacts.
Naville, Magali; Gautheret, Daniel
2010-01-01
Bacterial transcription attenuation occurs through a variety of cis-regulatory elements that control gene expression in response to a wide range of signals. The signal-sensing structures in attenuators are so diverse and rapidly evolving that only a small fraction have been properly annotated and characterized to date. Here we apply a broad-spectrum detection tool in order to achieve a more complete view of the transcriptional attenuation complement of key bacterial species. Our protocol seeks gene families with an unusual frequency of 5' terminators found across multiple species. Many of the detected attenuators are part of annotated elements, such as riboswitches or T-boxes, which often operate through transcriptional attenuation. However, a significant fraction of candidates were not previously characterized in spite of their unmistakable footprint. We further characterized some of these new elements using sequence and secondary structure analysis. We also present elements that may control the expression of several non-homologous genes, suggesting co-transcription and response to common signals. An important class of such elements, which we called mobile attenuators, is provided by 3' terminators of insertion sequences or prophages that may be exapted as 5' regulators when inserted directly upstream of a cellular gene. We show here that attenuators involve a complex landscape of signal-detection structures spanning the entire bacterial domain. We discuss possible scenarios through which these diverse 5' regulatory structures may arise or evolve.
Schlesinger, Orr; Chemla, Yonatan; Heltberg, Mathias; Ozer, Eden; Marshall, Ryan; Noireaux, Vincent; Jensen, Mogens Høgh; Alfonta, Lital
2017-06-16
Protein synthesis in cells has been thoroughly investigated and characterized over the past 60 years. However, some fundamental issues remain unresolved, including the reasons for genetic code redundancy and codon bias. In this study, we changed the kinetics of the Eschrichia coli transcription and translation processes by mutating the promoter and ribosome binding domains and by using genetic code expansion. The results expose a counterintuitive phenomenon, whereby an increase in the initiation rates of transcription and translation lead to a decrease in protein expression. This effect can be rescued by introducing slow translating codons into the beginning of the gene, by shortening gene length or by reducing initiation rates. On the basis of the results, we developed a biophysical model, which suggests that the density of co-transcriptional-translation plays a role in bacterial protein synthesis. These findings indicate how cells use codon bias to tune translation speed and protein synthesis.
Distinct Mechanisms of Transcription Initiation by RNA Polymerases I and II.
Engel, Christoph; Neyer, Simon; Cramer, Patrick
2018-05-20
RNA polymerases I and II (Pol I and Pol II) are the eukaryotic enzymes that catalyze DNA-dependent synthesis of ribosomal RNA and messenger RNA, respectively. Recent work shows that the transcribing forms of both enzymes are similar and the fundamental mechanisms of RNA chain elongation are conserved. However, the mechanisms of transcription initiation and its regulation differ between Pol I and Pol II. Recent structural studies of Pol I complexes with transcription initiation factors provided insights into how the polymerase recognizes its specific promoter DNA, how it may open DNA, and how initiation may be regulated. Comparison with the well-studied Pol II initiation system reveals a distinct architecture of the initiation complex and visualizes promoter- and gene-class-specific aspects of transcription initiation. On the basis of new structural studies, we derive a model of the Pol I transcription cycle and provide a molecular movie of Pol I transcription that can be used for teaching.
Thach, Oscar; Mielczarek, Marcin; Ma, Cong; Kutty, Samuel K; Yang, Xiao; Black, David StC; Griffith, Renate; Lewis, Peter J; Kumar, Naresh
2016-03-15
The search for small molecules capable of inhibiting transcription initiation in bacteria has resulted in the synthesis of N,N'-disubstituted hydrazines and imine-carbohydrazides comprised of indole, pyridine, pyrrole, furan and thiophene using the respective trichloroacetyl derivatives, carbohydrazides and aldehydes. Replacement of the indole moiety by smaller heterocycles linked by CONHNC linkers afforded a broad variety of compounds efficiently targeting the RNA polymerase-σ(70)/σ(A) interaction as determined by ELISA and exhibiting increased inhibition of the growth of Escherichia coli compared to Bacillus subtilis in culture. The structural features of the synthesized transcription initiation inhibitors needed for antibacterial activity were identified employing molecular modelling and structure-activity relationship (SAR) studies. Copyright © 2016 Elsevier Ltd. All rights reserved.
Shailes, Hannah; Eleftherohorinou, Hariklia; Hoggart, Clive J; Cebey-Lopez, Miriam; Carter, Michael J; Janes, Victoria A; Gormley, Stuart; Shimizu, Chisato; Tremoulet, Adriana H; Barendregt, Anouk M; Salas, Antonio; Kanegaye, John; Pollard, Andrew J; Faust, Saul N; Patel, Sanjay; Kuijpers, Taco; Martinon-Torres, Federico; Burns, Jane C; Coin, Lachlan JM; Levin, Michael
2018-01-01
Importance As clinical features do not reliably distinguish bacterial from viral infection, many children worldwide receive unnecessary antibiotic treatment whilst bacterial infection is missed in others. Objective To identify a blood RNA expression signature that distinguishes bacterial from viral infection in febrile children. Design Febrile children presenting to participating hospitals in UK, Spain, Netherlands and USA between 2009-2013 were prospectively recruited, comprising a discovery group and validation group. Each group was classified after microbiological investigation into definite bacterial, definite viral infection or indeterminate infection. RNA expression signatures distinguishing definite bacterial from viral infection were identified in the discovery group and diagnostic performance assessed in the validation group. Additional validation was undertaken in separate studies of children with meningococcal disease (n=24) inflammatory diseases (n=48), and on published gene expression datasets. Exposures A 2-transcript RNA expression signature distinguishing bacterial infection from viral infection was evaluated against clinical and microbiological diagnosis. Main Outcomes Definite Bacterial and viral infection was confirmed by culture or molecular detection of the pathogens. Performance of the RNA signature was evaluated in the definite bacterial and viral group, and the indeterminate group. Results The discovery cohort of 240 children (median age 19 months, 62% males) included 52 with definite bacterial infection of whom 36 (69%) required intensive care; and 92 with definite viral infection of whom 32 (35%) required intensive care. 96 children had indeterminate infection. Bioinformatic analysis of RNA expression data identified a 38-transcript signature distinguishing bacterial from viral infection. A smaller (2-transcript) signature (FAM89A and IFI44L) was identified by removing highly correlated transcripts. When this 2-transcript signature was
INITIATION AND REGULATION OF PARAMYXOVIRUS TRANSCRIPTION AND REPLICATION
Noton, Sarah L.; Fearns, Rachel
2015-01-01
The paramyxovirus family has a genome consisting of a single strand of negative sense RNA. This genome acts as a template for two distinct processes: transcription to generate subgenomic, capped and polyadenylated mRNAs, and genome replication. These viruses only encode one polymerase. Thus, an intriguing question is, how does the viral polymerase initiate and become committed to either transcription or replication? By answering this we can begin to understand how these two processes are regulated. In this review article, we present recent findings from studies on the paramyxovirus, respiratory syncytial virus, which show how its polymerase is able to initiate transcription and replication from a single promoter. We discuss how these findings apply to other paramyxoviruses. Then, we examine how trans-acting proteins and promoter secondary structure might serve to regulate transcription and replication during different phases of the paramyxovirus replication cycle. PMID:25683441
Initiation and regulation of paramyxovirus transcription and replication.
Noton, Sarah L; Fearns, Rachel
2015-05-01
The paramyxovirus family has a genome consisting of a single strand of negative sense RNA. This genome acts as a template for two distinct processes: transcription to generate subgenomic, capped and polyadenylated mRNAs, and genome replication. These viruses only encode one polymerase. Thus, an intriguing question is, how does the viral polymerase initiate and become committed to either transcription or replication? By answering this we can begin to understand how these two processes are regulated. In this review article, we present recent findings from studies on the paramyxovirus, respiratory syncytial virus, which show how its polymerase is able to initiate transcription and replication from a single promoter. We discuss how these findings apply to other paramyxoviruses. Then, we examine how trans-acting proteins and promoter secondary structure might serve to regulate transcription and replication during different phases of the paramyxovirus replication cycle. Copyright © 2015 Elsevier Inc. All rights reserved.
Intragenic DNA methylation prevents spurious transcription initiation.
Neri, Francesco; Rapelli, Stefania; Krepelova, Anna; Incarnato, Danny; Parlato, Caterina; Basile, Giulia; Maldotti, Mara; Anselmi, Francesca; Oliviero, Salvatore
2017-03-02
In mammals, DNA methylation occurs mainly at CpG dinucleotides. Methylation of the promoter suppresses gene expression, but the functional role of gene-body DNA methylation in highly expressed genes has yet to be clarified. Here we show that, in mouse embryonic stem cells, Dnmt3b-dependent intragenic DNA methylation protects the gene body from spurious RNA polymerase II entry and cryptic transcription initiation. Using different genome-wide approaches, we demonstrate that this Dnmt3b function is dependent on its enzymatic activity and recruitment to the gene body by H3K36me3. Furthermore, the spurious transcripts can either be degraded by the RNA exosome complex or capped, polyadenylated, and delivered to the ribosome to produce aberrant proteins. Elongating RNA polymerase II therefore triggers an epigenetic crosstalk mechanism that involves SetD2, H3K36me3, Dnmt3b and DNA methylation to ensure the fidelity of gene transcription initiation, with implications for intragenic hypomethylation in cancer.
Liu, Wen; Yan, Yu; Zeng, Hongqiu; Li, Xiaolin; Wei, Yunxie; Liu, Guoyin; He, Chaozu; Shi, Haitao
2018-05-19
Cassava is a major food crop in tropical areas, but its productivity and quality are seriously limited by cassava bacterial blight. So far, the key factors regulating cassava immune response remain elusive. In this study, we identified three cassava Whirly genes (MeWHYs) in cassava variety of South China 124 (SC124), and explored the possible roles and utilization of MeWHYs in cassava disease resistance. Gene expression analysis revealed that the transcripts of three MeWHYs were commonly regulated by the highly conserved N-terminal epitope of f lagellin (flg22) and Xanthomonas axonopodis pv. manihotis Hainan (Xam HN) treatments. Overexpression of MeWHYs improved plant disease resistance against X. axonopodis pv. manihotis, while MeWHYs-silenced cassava plants by virus-induced gene silencing exhibited decreased disease resistance. Notably, MeWRKY75 physically interacted with three MeWHYs in yeast and in planta, and served as a transcriptional activator of MeWHY3. Moreover, the physical interaction between MeWHYs and MeWRKY75 promoted the transcriptional activities of each other. Consistently, MeWRKY75 also positively regulated disease resistance against cassava bacterial blight. Taken together, our observations suggested that MeWRKY75 and MeWHYs confer improved disease resistance against cassava bacterial blight through forming an interacting complex of MeWRKY75-MeWHY1/2/3 and transcriptional module of MeWRKY75-MeWHY3. This study facilitates our understanding of the positive effect of the MeWRKY75-MeWHY3 transcriptional module in plant disease resistance.
Kurose, Kouichi; Koyano, Satoru; Ikeda, Shinobu; Tohkin, Masahiro; Hasegawa, Ryuichi; Sawada, Jun-Ichi
2005-05-01
The human pregnane X receptor (PXR) is a crucial regulator of the genes encoding several major cytochrome P450 enzymes and transporters, such as CYP3A4 and MDR1, but its own transcriptional regulation remains unclear. To elucidate the transcriptional mechanisms of human PXR gene, we first endeavored to identify the transcription initiation site of human PXR using 5'-RACE. Five types of 5'-variable transcripts (a, b, c, d, and e) with common exon 2 sequence were found, and comparison of these sequences with the genomic sequence suggested that their 5' diversity is derived from initiation by alternative promoters and alternative splicing. None of the exons found in our study contain any new in-frame coding regions. Newly identified introns IVS-a and IVS-b were found to have CT-AC splice sites that do not follow the GT-AG rule of conventional donor and acceptor splice sites. Of the five types of 5' variable transcripts identified, RT-PCR showed that type-a was the major transcript type. Four transcription initiation sites (A-D) for type-a transcript were identified by 5'-RACE using GeneRacer RACE Ready cDNA (human liver) constructed by the oligo-capping method. Putative TATA boxes were located approximately 30 bp upstream from the transcriptional start sites of the major transcript (C) and the longest minor transcript (A) expressed in the human liver. These results indicate that the initiation of transcription of human PXR is more complex than previously reported.
Global analysis of bacterial transcription factors to predict cellular target processes.
Doerks, Tobias; Andrade, Miguel A; Lathe, Warren; von Mering, Christian; Bork, Peer
2004-03-01
Whole-genome sequences are now available for >100 bacterial species, giving unprecedented power to comparative genomics approaches. We have applied genome-context methods to predict target processes that are regulated by transcription factors (TFs). Of 128 orthologous groups of proteins annotated as TFs, to date, 36 are functionally uncharacterized; in our analysis we predict a probable cellular target process or biochemical pathway for half of these functionally uncharacterized TFs.
Posse, Viktor; Gustafsson, Claes M
2017-02-17
The mitochondrial transcription initiation machinery in humans consists of three proteins: the RNA polymerase (POLRMT) and two accessory factors, transcription factors A and B2 (TFAM and TFB2M, respectively). This machinery is required for the expression of mitochondrial DNA and the biogenesis of the oxidative phosphorylation system. Previous experiments suggested that TFB2M is required for promoter melting, but conclusive experimental proof for this effect has not been presented. Moreover, the role of TFB2M in promoter unwinding has not been discriminated from that of TFAM. Here we used potassium permanganate footprinting, DNase I footprinting, and in vitro transcription from the mitochondrial light-strand promoter to study the role of TFB2M in transcription initiation. We demonstrate that a complex composed of TFAM and POLRMT was readily formed at the promoter but alone was insufficient for promoter melting, which only occurred when TFB2M joined the complex. We also show that mismatch bubble templates could circumvent the requirement of TFB2M, but TFAM was still required for efficient initiation. Our findings support a model in which TFAM first recruits POLRMT to the promoter, followed by TFB2M binding and induction of promoter melting. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Real-time observation of the initiation of RNA polymerase II transcription.
Fazal, Furqan M; Meng, Cong A; Murakami, Kenji; Kornberg, Roger D; Block, Steven M
2015-09-10
Biochemical and structural studies have shown that the initiation of RNA polymerase II transcription proceeds in the following stages: assembly of the polymerase with general transcription factors and promoter DNA in a 'closed' preinitiation complex (PIC); unwinding of about 15 base pairs of the promoter DNA to form an 'open' complex; scanning downstream to a transcription start site; synthesis of a short transcript, thought to be about 10 nucleotides long; and promoter escape. Here we have assembled a 32-protein, 1.5-megadalton PIC derived from Saccharomyces cerevisiae, and observe subsequent initiation processes in real time with optical tweezers. Contrary to expectation, scanning driven by the transcription factor IIH involved the rapid opening of an extended transcription bubble, averaging 85 base pairs, accompanied by the synthesis of a transcript up to the entire length of the extended bubble, followed by promoter escape. PICs that failed to achieve promoter escape nevertheless formed open complexes and extended bubbles, which collapsed back to closed or open complexes, resulting in repeated futile scanning.
Differentiation Driven Changes in the Dynamic Organization of Basal Transcription Initiation
Giglia-Mari, Giuseppina; Mourgues, Sophie; Nonnekens, Julie; Andrieux, Lise O.; de Wit, Jan; Miquel, Catherine; Wijgers, Nils; Maas, Alex; Fousteri, Maria; Hoeijmakers, Jan H. J.; Vermeulen, Wim
2009-01-01
Studies based on cell-free systems and on in vitro–cultured living cells support the concept that many cellular processes, such as transcription initiation, are highly dynamic: individual proteins stochastically bind to their substrates and disassemble after reaction completion. This dynamic nature allows quick adaptation of transcription to changing conditions. However, it is unknown to what extent this dynamic transcription organization holds for postmitotic cells embedded in mammalian tissue. To allow analysis of transcription initiation dynamics directly into living mammalian tissues, we created a knock-in mouse model expressing fluorescently tagged TFIIH. Surprisingly and in contrast to what has been observed in cultured and proliferating cells, postmitotic murine cells embedded in their tissue exhibit a strong and long-lasting transcription-dependent immobilization of TFIIH. This immobilization is both differentiation driven and development dependent. Furthermore, although very statically bound, TFIIH can be remobilized to respond to new transcriptional needs. This divergent spatiotemporal transcriptional organization in different cells of the soma revisits the generally accepted highly dynamic concept of the kinetic framework of transcription and shows how basic processes, such as transcription, can be organized in a fundamentally different fashion in intact organisms as previously deduced from in vitro studies. PMID:19841728
Redundancy of primary RNA-binding functions of the bacterial transcription terminator Rho
Shashni, Rajesh; Qayyum, M. Zuhaib; Vishalini, V.; Dey, Debashish; Sen, Ranjan
2014-01-01
The bacterial transcription terminator, Rho, terminates transcription at half of the operons. According to the classical model derived from in vitro assays on a few terminators, Rho is recruited to the transcription elongation complex (EC) by recognizing specific sites (rut) on the nascent RNA. Here, we explored the mode of in vivo recruitment process of Rho. We show that sequence specific recognition of the rut site, in majority of the Rho-dependent terminators, can be compromised to a great extent without seriously affecting the genome-wide termination function as well as the viability of Escherichia coli. These terminators function optimally only through a NusG-assisted recruitment and activation of Rho. Our data also indicate that at these terminators, Rho-EC-bound NusG interaction facilitates the isomerization of Rho into a translocase-competent form by stabilizing the interactions of mRNA with the secondary RNA binding site, thereby overcoming the defects of the primary RNA binding functions. PMID:25081210
Bai, Fang; Ho Lim, Chae; Jia, Jingyue; Santostefano, Katherine; Simmons, Chelsey; Kasahara, Hideko; Wu, Weihui; Terada, Naohiro; Jin, Shouguang
2015-10-09
Forced expression of defined transcriptional factors has been well documented as an effective method for cellular reprogramming or directed differentiation. However, transgene expression is not amenable for therapeutic application due to potential insertional mutagenesis. Here, we have developed a bacterial type III secretion system (T3SS)-based protein delivery tool and shown its application in directing pluripotent stem cell differentiation by a controlled delivery of transcription factors relevant to early heart development. By fusing to an N-terminal secretion sequence for T3SS-dependent injection, three transcriptional factors, namely Gata4, Mef2c, and Tbx5 (abbreviated as GMT), were translocated into murine embryonic stem cells (ESCs), where the proteins are effectively targeted to the nucleus with an average intracellular half-life of 5.5 hours. Exogenous GMT protein injection activated the cardiac program, and multiple rounds of GMT protein delivery significantly improved the efficiency of ESC differentiation into cardiomyocytes. Combination of T3SS-mediated GMT delivery and Activin A treatment showed an additive effect, resulting in on average 60% of the ESCs differentiated into cardiomyocytes. ESC derived cardiomyocytes displayed spontaneous rhythmic contractile movement as well as normal hormonal responses. This work serves as a foundation for the bacterial delivery of multiple transcription factors to direct cell fate without jeopardizing genomic integrity.
Bai, Fang; Ho Lim, Chae; Jia, Jingyue; Santostefano, Katherine; Simmons, Chelsey; Kasahara, Hideko; Wu, Weihui; Terada, Naohiro; Jin, Shouguang
2015-01-01
Forced expression of defined transcriptional factors has been well documented as an effective method for cellular reprogramming or directed differentiation. However, transgene expression is not amenable for therapeutic application due to potential insertional mutagenesis. Here, we have developed a bacterial type III secretion system (T3SS)-based protein delivery tool and shown its application in directing pluripotent stem cell differentiation by a controlled delivery of transcription factors relevant to early heart development. By fusing to an N-terminal secretion sequence for T3SS-dependent injection, three transcriptional factors, namely Gata4, Mef2c, and Tbx5 (abbreviated as GMT), were translocated into murine embryonic stem cells (ESCs), where the proteins are effectively targeted to the nucleus with an average intracellular half-life of 5.5 hours. Exogenous GMT protein injection activated the cardiac program, and multiple rounds of GMT protein delivery significantly improved the efficiency of ESC differentiation into cardiomyocytes. Combination of T3SS-mediated GMT delivery and Activin A treatment showed an additive effect, resulting in on average 60% of the ESCs differentiated into cardiomyocytes. ESC derived cardiomyocytes displayed spontaneous rhythmic contractile movement as well as normal hormonal responses. This work serves as a foundation for the bacterial delivery of multiple transcription factors to direct cell fate without jeopardizing genomic integrity. PMID:26449528
2012-01-01
Summary: Bacterial enhancer binding proteins (bEBPs) are transcriptional activators that assemble as hexameric rings in their active forms and utilize ATP hydrolysis to remodel the conformation of RNA polymerase containing the alternative sigma factor σ54. We present a comprehensive and detailed summary of recent advances in our understanding of how these specialized molecular machines function. The review is structured by introducing each of the three domains in turn: the central catalytic domain, the N-terminal regulatory domain, and the C-terminal DNA binding domain. The role of the central catalytic domain is presented with particular reference to (i) oligomerization, (ii) ATP hydrolysis, and (iii) the key GAFTGA motif that contacts σ54 for remodeling. Each of these functions forms a potential target of the signal-sensing N-terminal regulatory domain, which can act either positively or negatively to control the activation of σ54-dependent transcription. Finally, we focus on the DNA binding function of the C-terminal domain and the enhancer sites to which it binds. Particular attention is paid to the importance of σ54 to the bacterial cell and its unique role in regulating transcription. PMID:22933558
Hummel, Aaron W; Doyle, Erin L; Bogdanove, Adam J
2012-09-01
Xanthomonas transcription activator-like (TAL) effectors promote disease in plants by binding to and activating host susceptibility genes. Plants counter with TAL effector-activated executor resistance genes, which cause host cell death and block disease progression. We asked whether the functional specificity of an executor gene could be broadened by adding different TAL effector binding elements (EBEs) to it. We added six EBEs to the rice Xa27 gene, which confers resistance to strains of the bacterial blight pathogen Xanthomonas oryzae pv. oryzae (Xoo) that deliver the TAL effector AvrXa27. The EBEs correspond to three other effectors from Xoo strain PXO99(A) and three from strain BLS256 of the bacterial leaf streak pathogen Xanthomonas oryzae pv. oryzicola (Xoc). Stable integration into rice produced healthy lines exhibiting gene activation by each TAL effector, and resistance to PXO99(A) , a PXO99(A) derivative lacking AvrXa27, and BLS256, as well as two other Xoo and 10 Xoc strains virulent toward wildtype Xa27 plants. Transcripts initiated primarily at a common site. Sequences in the EBEs were found to occur nonrandomly in rice promoters, suggesting an overlap with endogenous regulatory sequences. Thus, executor gene specificity can be broadened by adding EBEs, but caution is warranted because of the possible coincident introduction of endogenous regulatory elements. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.
Wright, David P; Ulijasz, Andrew T
2014-01-01
Bacterial eukaryotic-like serine threonine kinases (eSTKs) and serine threonine phosphatases (eSTPs) have emerged as important signaling elements that are indispensable for pathogenesis. Differing considerably from their histidine kinase counterparts, few eSTK genes are encoded within the average bacterial genome, and their targets are pleiotropic in nature instead of exclusive. The growing list of important eSTK/P substrates includes proteins involved in translation, cell division, peptidoglycan synthesis, antibiotic tolerance, resistance to innate immunity and control of virulence factors. Recently it has come to light that eSTK/Ps also directly modulate transcriptional machinery in many microbial pathogens. This novel form of regulation is now emerging as an additional means by which bacteria can alter their transcriptomes in response to host-specific environmental stimuli. Here we focus on the ability of eSTKs and eSTPs in Gram-positive bacterial pathogens to directly modulate transcription, the known mechanistic outcomes of these modifications, and their roles as an added layer of complexity in controlling targeted RNA synthesis to enhance virulence potential. PMID:25603430
Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R
1996-03-01
In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.
Faithful transcription initiation from a mitochondrial promoter in transgenic plastids
Bohne, Alexandra-Viola; Ruf, Stephanie; Börner, Thomas; Bock, Ralph
2007-01-01
The transcriptional machineries of plastids and mitochondria in higher plants exhibit striking similarities. All mitochondrial genes and part of the plastid genes are transcribed by related phage-type RNA polymerases. Furthermore, the majority of mitochondrial promoters and a subset of plastid promoters show a similar structural organization. We show here that the plant mitochondrial atpA promoter is recognized by plastid RNA polymerases in vitro and in vivo. The Arabidopsis phage-type RNA polymerase RpoTp, an enzyme localized exclusively to plastids, was found to recognize the mitochondrial atpA promoter in in vitro assays suggesting the possibility that mitochondrial promoters might function as well in plastids. We have, therefore, generated transplastomic tobacco plants harboring in their chloroplast genome the atpA promoter fused to the coding region of the bacterial nptII gene. The chimeric nptII gene was found to be efficiently transcribed in chloroplasts. Mapping of the 5′ ends of the nptII transcripts revealed accurate recognition of the atpA promoter by the chloroplast transcription machinery. We show further that the 5′ untranslated region (UTR) of the mitochondrial atpA transcript is capable of mediating translation in chloroplasts. The functional and evolutionary implications of these findings as well as possible applications in chloroplast genome engineering are discussed. PMID:17959651
TIF-IC, a factor involved in both transcription initiation and elongation of RNA polymerase I.
Schnapp, G; Schnapp, A; Rosenbauer, H; Grummt, I
1994-09-01
We have characterized a transcription factor from Ehrlich ascites cells that is required for ribosomal gene transcription by RNA polymerase I (Pol I). This factor, termed TIF-IC, has a native molecular mass of 65 kDa, associates with Pol I, and is required both for the assembly of Sarkosyl-resistant initiation complexes and for the formation of the first internucleotide bonds. In addition to its function in transcription initiation, TIF-IC also plays a role in elongation of nascent RNA chains. At suboptimal levels of TIF-IC, transcripts with heterogeneous 3' ends are formed which are chased into full-length transcripts by the addition of more TIF-IC. Moreover, on a tailed template, which allows initiation in the absence of auxiliary factors, TIF-IC was found to stimulate the overall rate of transcription elongation and suppress pausing of Pol I. Thus TIF-IC appears to serve a function similar to the Pol II-specific factor TFIIF which is required for Pol II transcription initiation and elongation.
D-amino acids inhibit initial bacterial adhesion: thermodynamic evidence.
Xing, Su-Fang; Sun, Xue-Fei; Taylor, Alicia A; Walker, Sharon L; Wang, Yi-Fu; Wang, Shu-Guang
2015-04-01
Bacterial biofilms are structured communities of cells enclosed in a self-produced hydrated polymeric matrix that can adhere to inert or living surfaces. D-Amino acids were previously identified as self-produced compounds that mediate biofilm disassembly by causing the release of the protein component of the polymeric matrix. However, whether exogenous D-amino acids could inhibit initial bacterial adhesion is still unknown. Here, the effect of the exogenous amino acid D-tyrosine on initial bacterial adhesion was determined by combined use of chemical analysis, force spectroscopic measurement, and theoretical predictions. The surface thermodynamic theory demonstrated that the total interaction energy increased with more D-tyrosine, and the contribution of Lewis acid-base interactions relative to the change in the total interaction energy was much greater than the overall nonspecific interactions. Finally, atomic force microscopy analysis implied that the hydrogen bond numbers and adhesion forces decreased with the increase in D-tyrosine concentrations. D-Tyrosine contributed to the repulsive nature of the cell and ultimately led to the inhibition of bacterial adhesion. This study provides a new way to regulate biofilm formation by manipulating the contents of D-amino acids in natural or engineered systems. © 2014 Wiley Periodicals, Inc.
Berger, Michael; Farcas, Anca; Geertz, Marcel; Zhelyazkova, Petya; Brix, Klaudia; Travers, Andrew; Muskhelishvili, Georgi
2010-01-01
The histone-like protein HU is a highly abundant DNA architectural protein that is involved in compacting the DNA of the bacterial nucleoid and in regulating the main DNA transactions, including gene transcription. However, the coordination of the genomic structure and function by HU is poorly understood. Here, we address this question by comparing transcript patterns and spatial distributions of RNA polymerase in Escherichia coli wild-type and hupA/B mutant cells. We demonstrate that, in mutant cells, upregulated genes are preferentially clustered in a large chromosomal domain comprising the ribosomal RNA operons organized on both sides of OriC. Furthermore, we show that, in parallel to this transcription asymmetry, mutant cells are also impaired in forming the transcription foci—spatially confined aggregations of RNA polymerase molecules transcribing strong ribosomal RNA operons. Our data thus implicate HU in coordinating the global genomic structure and function by regulating the spatial distribution of RNA polymerase in the nucleoid. PMID:20010798
Redundancy of primary RNA-binding functions of the bacterial transcription terminator Rho.
Shashni, Rajesh; Qayyum, M Zuhaib; Vishalini, V; Dey, Debashish; Sen, Ranjan
2014-09-01
The bacterial transcription terminator, Rho, terminates transcription at half of the operons. According to the classical model derived from in vitro assays on a few terminators, Rho is recruited to the transcription elongation complex (EC) by recognizing specific sites (rut) on the nascent RNA. Here, we explored the mode of in vivo recruitment process of Rho. We show that sequence specific recognition of the rut site, in majority of the Rho-dependent terminators, can be compromised to a great extent without seriously affecting the genome-wide termination function as well as the viability of Escherichia coli. These terminators function optimally only through a NusG-assisted recruitment and activation of Rho. Our data also indicate that at these terminators, Rho-EC-bound NusG interaction facilitates the isomerization of Rho into a translocase-competent form by stabilizing the interactions of mRNA with the secondary RNA binding site, thereby overcoming the defects of the primary RNA binding functions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
The structural changes of T7 RNA polymerase from transcription initiation to elongation
Steitz, Thomas A
2010-01-01
Summary The structures of T7 RNA polymerase (T7 RNAP) captured in the initiation and elongation phases of transcription, as well as an intermediate stage provide insights into how this RNA polymerase protein can initiate RNA synthesis and synthesize 7 to 10 nucleotides of RNA while remaining bound to the DNA promoter site. Recently, the structures of T7 RNAP bound to it promoter DNA along with either a 7 nucleotide or 8 nucleotide transcript show an elongated product site resulting from a 40° or 45° rotation of the promoter and domain that binds it. The different functional properties of the initiation and elongation phases of transcription are illuminated from structures of the initiation and elongation complexes. Structural insights into the translocation of the product transcript of RNAP, its separation of the downstream duplex DNA and its removal of the transcript from the heteroduplex are provided by the structures of several states of nucleotide incorporation. A conformational change in the “fingers” domain that results from the binding or dissociation of incoming NTP or PPi appears to be associated with the state of translocation of T7 RNAP. PMID:19811903
Grohmann, Dina; Nagy, Julia; Chakraborty, Anirban; Klose, Daniel; Fielden, Daniel; Ebright, Richard H.; Michaelis, Jens; Werner, Finn
2011-01-01
Summary TFIIE and the archaeal homolog TFE enhance DNA strand separation of eukaryotic RNAPII and the archaeal RNAP during transcription initiation by an unknown mechanism. We have developed a fluorescently labeled recombinant M. jannaschii RNAP system to probe the archaeal transcription initiation complex, consisting of promoter DNA, TBP, TFB, TFE, and RNAP. We have localized the position of the TFE winged helix (WH) and Zinc ribbon (ZR) domains on the RNAP using single-molecule FRET. The interaction sites of the TFE WH domain and the transcription elongation factor Spt4/5 overlap, and both factors compete for RNAP binding. Binding of Spt4/5 to RNAP represses promoter-directed transcription in the absence of TFE, which alleviates this effect by displacing Spt4/5 from RNAP. During elongation, Spt4/5 can displace TFE from the RNAP elongation complex and stimulate processivity. Our results identify the RNAP “clamp” region as a regulatory hot spot for both transcription initiation and transcription elongation. PMID:21777815
TIF-IC, a factor involved in both transcription initiation and elongation of RNA polymerase I.
Schnapp, G; Schnapp, A; Rosenbauer, H; Grummt, I
1994-01-01
We have characterized a transcription factor from Ehrlich ascites cells that is required for ribosomal gene transcription by RNA polymerase I (Pol I). This factor, termed TIF-IC, has a native molecular mass of 65 kDa, associates with Pol I, and is required both for the assembly of Sarkosyl-resistant initiation complexes and for the formation of the first internucleotide bonds. In addition to its function in transcription initiation, TIF-IC also plays a role in elongation of nascent RNA chains. At suboptimal levels of TIF-IC, transcripts with heterogeneous 3' ends are formed which are chased into full-length transcripts by the addition of more TIF-IC. Moreover, on a tailed template, which allows initiation in the absence of auxiliary factors, TIF-IC was found to stimulate the overall rate of transcription elongation and suppress pausing of Pol I. Thus TIF-IC appears to serve a function similar to the Pol II-specific factor TFIIF which is required for Pol II transcription initiation and elongation. Images PMID:8076598
Posse, Viktor; Hoberg, Emily; Dierckx, Anke; Shahzad, Saba; Koolmeister, Camilla; Larsson, Nils-Göran; Wilhelmsson, L. Marcus; Hällberg, B. Martin; Gustafsson, Claes M.
2014-01-01
Mammalian mitochondrial transcription is executed by a single subunit mitochondrial RNA polymerase (Polrmt) and its two accessory factors, mitochondrial transcription factors A and B2 (Tfam and Tfb2m). Polrmt is structurally related to single-subunit phage RNA polymerases, but it also contains a unique N-terminal extension (NTE) of unknown function. We here demonstrate that the NTE functions together with Tfam to ensure promoter-specific transcription. When the NTE is deleted, Polrmt can initiate transcription in the absence of Tfam, both from promoters and non-specific DNA sequences. Additionally, when in presence of Tfam and a mitochondrial promoter, the NTE-deleted mutant has an even higher transcription activity than wild-type polymerase, indicating that the NTE functions as an inhibitory domain. Our studies lead to a model according to which Tfam specifically recruits wild-type Polrmt to promoter sequences, relieving the inhibitory effect of the NTE, as a first step in transcription initiation. In the second step, Tfb2m is recruited into the complex and transcription is initiated. PMID:24445803
Crystal Structures of the E. coli Transcription Initiation Complexes with a Complete Bubble
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zuo, Yuhong; Steitz, Thomas A.
2015-05-01
During transcription initiation, RNA polymerase binds to promoter DNA to form an initiation complex containing a DNA bubble and enters into abortive cycles of RNA synthesis before escaping the promoter to transit into the elongation phase for processive RNA synthesis. Here we present the crystal structures of E. coli transcription initiation complexes containing a complete transcription bubble and de novo synthesized RNA oligonucleotides at about 6-Å resolution. The structures show how RNA polymerase recognizes DNA promoters that contain spacers of different lengths and reveal a bridging interaction between the 5'-triphosphate of the nascent RNA and the σ factor that maymore » function to stabilize the short RNA-DNA hybrids during the early stage of transcription initiation. The conformation of the RNA oligonucleotides and the paths of the DNA strands in the complete initiation complexes provide insights into the mechanism that controls both the abortive and productive RNA synthesis.« less
Schnapp, A; Schnapp, G; Erny, B; Grummt, I
1993-11-01
Alterations in the rate of cell proliferation are accompanied by changes in the transcription of rRNA genes. In mammals, this growth-dependent regulation of transcription of genes coding for rRNA (rDNA) is due to reduction of the amount or activity of an essential transcription factor, called TIF-IA. Extracts prepared from quiescent cells lack this factor activity and, therefore, are transcriptionally inactive. We have purified TIF-IA from exponentially growing cells and have shown that it is a polypeptide with a molecular mass of 75 kDa which exists as a monomer in solution. Using a reconstituted transcription system consisting of purified transcription factors, we demonstrate that TIF-IA is a bona fide transcription initiation factor which interacts with RNA polymerase I. Preinitiation complexes can be assembled in the absence of TIF-IA, but formation of the first phosphodiester bonds of nascent rRNA is precluded. After initiation, TIF-IA is liberated from the initiation complex and facilitates transcription from templates bearing preinitiation complexes which lack TIF-IA. Despite the pronounced species specificity of class I gene transcription, this growth-dependent factor has been identified not only in mouse but also in human cells. Murine TIF-IA complements extracts from both growth-inhibited mouse and human cells. The analogous human activity appears to be similar or identical to that of TIF-IA. Therefore, despite the fact that the RNA polymerase transcription system has evolved sufficiently rapidly that an rDNA promoter from one species will not function in another species, the basic mechanisms that adapt ribosome synthesis to cell proliferation have been conserved.
Vorobyeva, Nadezhda E.; Soshnikova, Nataliya V.; Nikolenko, Julia V.; Kuzmina, Julia L.; Nabirochkina, Elena N.; Georgieva, Sofia G.; Shidlovskii, Yulii V.
2009-01-01
Transcription activation by RNA polymerase II is a complicated process driven by combined, precisely coordinated action of a wide array of coactivator complexes, which carry out chromatin-directed activities and nucleate the assembly of the preinitiation complex on the promoter. Using various techniques, we have shown the existence of a stable coactivator supercomplex consisting of the chromatin-remodeling factor Brahma (SWI/SNF) and the transcription initiation factor TFIID, named BTFly (Brahma and TFIID in one assembly). The coupling of Brahma and TFIID is mediated by the SAYP factor, whose evolutionarily conserved activation domain SAY can directly bind to both BAP170 subunit of Brahma and TAF5 subunit of TFIID. The integrity of BTFly is crucial for its ability to activate transcription. BTFly is distributed genome-wide and appears to be a means of effective transcription activation. PMID:19541607
Structures of transcription pre-initiation complex with TFIIH and Mediator.
Schilbach, S; Hantsche, M; Tegunov, D; Dienemann, C; Wigge, C; Urlaub, H; Cramer, P
2017-11-09
For the initiation of transcription, RNA polymerase II (Pol II) assembles with general transcription factors on promoter DNA to form the pre-initiation complex (PIC). Here we report cryo-electron microscopy structures of the Saccharomyces cerevisiae PIC and PIC-core Mediator complex at nominal resolutions of 4.7 Å and 5.8 Å, respectively. The structures reveal transcription factor IIH (TFIIH), and suggest how the core and kinase TFIIH modules function in the opening of promoter DNA and the phosphorylation of Pol II, respectively. The TFIIH core subunit Ssl2 (a homologue of human XPB) is positioned on downstream DNA by the 'E-bridge' helix in TFIIE, consistent with TFIIE-stimulated DNA opening. The TFIIH kinase module subunit Tfb3 (MAT1 in human) anchors the kinase Kin28 (CDK7), which is mobile in the PIC but preferentially located between the Mediator hook and shoulder in the PIC-core Mediator complex. Open spaces between the Mediator head and middle modules may allow access of the kinase to its substrate, the C-terminal domain of Pol II.
Eukaryotic Initiation Factor 4H Is under Transcriptional Control of p65/NF-κB
Fiume, Giuseppe; Rossi, Annalisa; de Laurentiis, Annamaria; Falcone, Cristina; Pisano, Antonio; Vecchio, Eleonora; Pontoriero, Marilena; Scala, Iris; Scialdone, Annarita; Masci, Francesca Fasanella; Mimmi, Selena; Palmieri, Camillo; Scala, Giuseppe; Quinto, Ileana
2013-01-01
Protein synthesis is mainly regulated at the initiation step, allowing the fast, reversible and spatial control of gene expression. Initiation of protein synthesis requires at least 13 translation initiation factors to assemble the 80S ribosomal initiation complex. Loss of translation control may result in cell malignant transformation. Here, we asked whether translational initiation factors could be regulated by NF-κB transcription factor, a major regulator of genes involved in cell proliferation, survival, and inflammatory response. We show that the p65 subunit of NF-κB activates the transcription of eIF4H gene, which is the regulatory subunit of eIF4A, the most relevant RNA helicase in translation initiation. The p65-dependent transcriptional activation of eIF4H increased the eIF4H protein content augmenting the rate of global protein synthesis. In this context, our results provide novel insights into protein synthesis regulation in response to NF-κB activation signalling, suggesting a transcription-translation coupled mechanism of control. PMID:23776612
Wei, Yunxie; Chang, Yanli; Zeng, Hongqiu; Liu, Guoyin; He, Chaozu; Shi, Haitao
2018-01-01
With 1 AP2 domain and 1 B3 domain, 7 MeRAVs in apetala2/ethylene response factor (AP2/ERF) gene family have been identified in cassava. However, the in vivo roles of these remain unknown. Gene expression assays showed that the transcripts of MeRAVs were commonly regulated after Xanthomonas axonopodis pv manihotis (Xam) and MeRAVs were specifically located in plant cell nuclei. Through virus-induced gene silencing (VIGS) in cassava, we found that MeRAV1 and MeRAV2 are essential for plant disease resistance against cassava bacterial blight, as shown by the bacterial propagation of Xam in plant leaves. Through VIGS in cassava leaves and overexpression in cassava leave protoplasts, we found that MeRAV1 and MeRAV2 positively regulated melatonin biosynthesis genes and the endogenous melatonin level. Further investigation showed that MeRAV1 and MeRAV2 are direct transcriptional activators of 3 melatonin biosynthesis genes in cassava, as evidenced by chromatin immunoprecipitation-PCR in cassava leaf protoplasts and electrophoretic mobility shift assay. Moreover, cassava melatonin biosynthesis genes also positively regulated plant disease resistance. Taken together, this study identified MeRAV1 and MeRAV2 as common and upstream transcription factors of melatonin synthesis genes in cassava and revealed a model of MeRAV1 and MeRAV2-melatonin biosynthesis genes-melatonin level in plant disease resistance against cassava bacterial blight. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Helicase promotes replication re-initiation from an RNA transcript.
Sun, Bo; Singh, Anupam; Sultana, Shemaila; Inman, James T; Patel, Smita S; Wang, Michelle D
2018-06-13
To ensure accurate DNA replication, a replisome must effectively overcome numerous obstacles on its DNA substrate. After encountering an obstacle, a progressing replisome often aborts DNA synthesis but continues to unwind. However, little is known about how DNA synthesis is resumed downstream of an obstacle. Here, we examine the consequences of a non-replicating replisome collision with a co-directional RNA polymerase (RNAP). Using single-molecule and ensemble methods, we find that T7 helicase interacts strongly with a non-replicating T7 DNA polymerase (DNAP) at a replication fork. As the helicase advances, the associated DNAP also moves forward. The presence of the DNAP increases both helicase's processivity and unwinding rate. We show that such a DNAP, together with its helicase, is indeed able to actively disrupt a stalled transcription elongation complex, and then initiates replication using the RNA transcript as a primer. These observations exhibit T7 helicase's novel role in replication re-initiation.
Damienikan, Aliaksandr U.
2016-01-01
The majority of bacterial genome annotations are currently automated and based on a ‘gene by gene’ approach. Regulatory signals and operon structures are rarely taken into account which often results in incomplete and even incorrect gene function assignments. Here we present SigmoID, a cross-platform (OS X, Linux and Windows) open-source application aiming at simplifying the identification of transcription regulatory sites (promoters, transcription factor binding sites and terminators) in bacterial genomes and providing assistance in correcting annotations in accordance with regulatory information. SigmoID combines a user-friendly graphical interface to well known command line tools with a genome browser for visualising regulatory elements in genomic context. Integrated access to online databases with regulatory information (RegPrecise and RegulonDB) and web-based search engines speeds up genome analysis and simplifies correction of genome annotation. We demonstrate some features of SigmoID by constructing a series of regulatory protein binding site profiles for two groups of bacteria: Soft Rot Enterobacteriaceae (Pectobacterium and Dickeya spp.) and Pseudomonas spp. Furthermore, we inferred over 900 transcription factor binding sites and alternative sigma factor promoters in the annotated genome of Pectobacterium atrosepticum. These regulatory signals control putative transcription units covering about 40% of the P. atrosepticum chromosome. Reviewing the annotation in cases where it didn’t fit with regulatory information allowed us to correct product and gene names for over 300 loci. PMID:27257541
Lee, Sooncheol; Nguyen, Huong Minh; Kang, Changwon
2010-10-01
No biological function has been identified for tiny RNA transcripts that are abortively and repetitiously released from initiation complexes of RNA polymerase in vitro and in vivo to date. In this study, we show that abortive initiation affects termination in transcription of bacteriophage T7 gene 10. Specifically, abortive transcripts produced from promoter phi 10 exert trans-acting antitermination activity on terminator T phi both in vitro and in vivo. Following abortive initiation cycling of T7 RNA polymerase at phi 10, short G-rich and oligo(G) RNAs were produced and both specifically sequestered 5- and 6-nt C + U stretch sequences, consequently interfering with terminator hairpin formation. This antitermination activity depended on sequence-specific hybridization of abortive transcripts with the 5' but not 3' half of T phi RNA. Antitermination was abolished when T phi was mutated to lack a C + U stretch, but restored when abortive transcript sequence was additionally modified to complement the mutation in T phi, both in vitro and in vivo. Antitermination was enhanced in vivo when the abortive transcript concentration was increased via overproduction of RNA polymerase or ribonuclease deficiency. Accordingly, antitermination activity exerted on T phi by abortive transcripts should facilitate expression of T phi-downstream promoter-less genes 11 and 12 in T7 infection of Escherichia coli.
Wang, Yejun; MacKenzie, Keith D; White, Aaron P
2015-05-07
As sequencing costs are being lowered continuously, RNA-seq has gradually been adopted as the first choice for comparative transcriptome studies with bacteria. Unlike microarrays, RNA-seq can directly detect cDNA derived from mRNA transcripts at a single nucleotide resolution. Not only does this allow researchers to determine the absolute expression level of genes, but it also conveys information about transcript structure. Few automatic software tools have yet been established to investigate large-scale RNA-seq data for bacterial transcript structure analysis. In this study, 54 directional RNA-seq libraries from Salmonella serovar Typhimurium (S. Typhimurium) 14028s were examined for potential relationships between read mapping patterns and transcript structure. We developed an empirical method, combined with statistical tests, to automatically detect key transcript features, including transcriptional start sites (TSSs), transcriptional termination sites (TTSs) and operon organization. Using our method, we obtained 2,764 TSSs and 1,467 TTSs for 1331 and 844 different genes, respectively. Identification of TSSs facilitated further discrimination of 215 putative sigma 38 regulons and 863 potential sigma 70 regulons. Combining the TSSs and TTSs with intergenic distance and co-expression information, we comprehensively annotated the operon organization in S. Typhimurium 14028s. Our results show that directional RNA-seq can be used to detect transcriptional borders at an acceptable resolution of ±10-20 nucleotides. Technical limitations of the RNA-seq procedure may prevent single nucleotide resolution. The automatic transcript border detection methods, statistical models and operon organization pipeline that we have described could be widely applied to RNA-seq studies in other bacteria. Furthermore, the TSSs, TTSs, operons, promoters and unstranslated regions that we have defined for S. Typhimurium 14028s may constitute valuable resources that can be used for
Archaeal RNA polymerase and transcription regulation
Jun, Sung-Hoon; Reichlen, Matthew J.; Tajiri, Momoko; Murakami, Katsuhiko S.
2010-01-01
To elucidate the mechanism of transcription by cellular RNA polymerases (RNAPs), high resolution X-ray crystal structures together with structure-guided biochemical, biophysical and genetics studies are essential. The recently-solved X-ray crystal structures of archaeal RNA polymerase (RNAP) allow a structural comparison of the transcription machinery among all three domains of life. The archaea were once thought of closely related to bacteria, but they are now considered to be more closely related to the eukaryote at the molecular level than bacteria. According to these structures, the archaeal transcription apparatus, which includes RNAP and general transcription factors, is similar to the eukaryotic transcription machinery. Yet, the transcription regulators, activators and repressors, encoded by archaeal genomes are closely related to bacterial factors. Therefore, archaeal transcription appears to possess an intriguing hybrid of eukaryotic-type transcription apparatus and bacterial-like regulatory mechanisms. Elucidating the transcription mechanism in archaea, which possesses a combination of bacterial and eukaryotic transcription mechanisms that are commonly regarded as separate and mutually exclusive, can provide data that will bring basic transcription mechanisms across all three domains of life. PMID:21250781
Structural Basis for Eukaryotic Transcription-Coupled DNA Repair Initiation
Xu, Jun; Lahiri, Indrajit; Wang, Wei; Wier, Adam; Cianfrocco, Michael A.; Chong, Jenny; Hare, Alissa A.; Dervan, Peter B.; DiMaio, Frank; Leschziner, Andres E.; Wang, Dong
2017-01-01
Eukaryotic transcription-coupled repair (TCR), or transcription-coupled nucleotide excision repair (TC-NER), is an important and well-conserved sub-pathway of nucleotide excision repair (NER) that preferentially removes DNA lesions from the template strand blocking RNA polymerase II (Pol II) translocation1,2. Cockayne syndrome group B protein in humans (CSB, or ERCC6), or its yeast orthologs (Rad26 in Saccharomyces cerevisiae and Rhp26 in Schizosaccharomyces pombe), is among the first proteins to be recruited to the lesion-arrested Pol II during initiation of eukaryotic TCR1,3–10. Mutations in CSB are associated with Cockayne syndrome, an autosomal-recessive neurologic disorder characterized by progeriod features, growth failure, and photosensitivity1. The molecular mechanism of eukaryotic TCR initiation remains elusive, with several long-standing questions unanswered: How do cells distinguish DNA lesion-arrested Pol II from other forms of arrested Pol II? How does CSB interact with the arrested Pol II complex? What is the role of CSB in TCR initiation? The lack of structures of CSB or the Pol II-CSB complex have hindered our ability to answer those questions. Here we report the first structure of S. cerevisiae Pol II-Rad26 complex solved by cryo-electron microscopy (cryo-EM). The structure reveals that Rad26 binds to the DNA upstream of Pol II where it dramatically alters its path. Our structural and functional data suggest that the conserved Swi2/Snf2-family core ATPase domain promotes forward movement of Pol II and elucidate key roles for Rad26/CSB in both TCR and transcription elongation. PMID:29168508
Lamacchia, Marina; Dyrka, Witold; Breton, Annick; Saupe, Sven J.; Paoletti, Mathieu
2016-01-01
Recognition and response to non self is essential to development and survival of all organisms. It can occur between individuals of the same species or between different organisms. Fungi are established models for conspecific non self recognition in the form of vegetative incompatibility (VI), a genetically controlled process initiating a programmed cell death (PCD) leading to the rejection of a fusion cell between genetically different isolates of the same species. In Podospora anserina VI is controlled by members of the hnwd gene family encoding for proteins analogous to NOD Like Receptors (NLR) immune receptors in eukaryotes. It was hypothesized that the hnwd controlled VI reaction was derived from the fungal innate immune response. Here we analyze the P. anserina transcriptional responses to two bacterial species, Serratia fonticola to which P. anserina survives and S. marcescens to which P. anserina succumbs, and compare these to the transcriptional response induced under VI conditions. Transcriptional responses to both bacteria largely overlap, however the number of genes regulated and magnitude of regulation is more important when P. anserina survives. Transcriptional responses to bacteria also overlap with the VI reaction for both up or down regulated gene sets. Genes up regulated tend to be clustered in the genome, and display limited phylogenetic distribution. In all three responses we observed genes related to autophagy to be up-regulated. Autophagy contributes to the fungal survival in all three conditions. Genes encoding for secondary metabolites and histidine kinase signaling are also up regulated in all three conditions. Transcriptional responses also display differences. Genes involved in response to oxidative stress, or encoding small secreted proteins are essentially expressed in response to bacteria, while genes encoding NLR proteins are expressed during VI. Most functions encoded in response to bacteria favor survival of the fungus while most
Crawford, Matthew A.; Tapscott, Timothy; Fitzsimmons, Liam F.; Liu, Lin; Reyes, Aníbal M.; Libby, Stephen J.; Trujillo, Madia; Fang, Ferric C.; Radi, Rafael
2016-01-01
ABSTRACT The four-cysteine zinc finger motif of the bacterial RNA polymerase regulator DksA is essential for protein structure, canonical control of the stringent response to nutritional limitation, and thiol-based sensing of oxidative and nitrosative stress. This interdependent relationship has limited our understanding of DksA-mediated functions in bacterial pathogenesis. Here, we have addressed this challenge by complementing ΔdksA Salmonella with Pseudomonas aeruginosa dksA paralogues that encode proteins differing in cysteine and zinc content. We find that four-cysteine, zinc-bound (C4) and two-cysteine, zinc-free (C2) DksA proteins are able to mediate appropriate stringent control in Salmonella and that thiol-based sensing of reactive species is conserved among C2 and C4 orthologues. However, variations in cysteine and zinc content determine the threshold at which individual DksA proteins sense and respond to reactive species. In particular, zinc acts as an antioxidant, dampening cysteine reactivity and raising the threshold of posttranslational thiol modification with reactive species. Consequently, C2 DksA triggers transcriptional responses in Salmonella at levels of oxidative or nitrosative stress normally tolerated by Salmonella expressing C4 orthologues. Inappropriate transcriptional regulation by C2 DksA increases the susceptibility of Salmonella to the antimicrobial effects of hydrogen peroxide and nitric oxide, and attenuates virulence in macrophages and mice. Our findings suggest that the redox-active sensory function of DksA proteins is finely tuned to optimize bacterial fitness according to the levels of oxidative and nitrosative stress encountered by bacterial species in their natural and host environments. PMID:27094335
Transcription termination factor Rho and microbial phenotypic heterogeneity.
Bidnenko, Elena; Bidnenko, Vladimir
2018-06-01
Populations of genetically identical microorganisms exhibit high degree of cell-to-cell phenotypic diversity even when grown in uniform environmental conditions. Heterogeneity is a genetically determined trait, which ensures bacterial adaptation and survival in the ever changing environmental conditions. Fluctuations in gene expression (noise) at the level of transcription initiation largely contribute to cell-to-cell variability within population. Not surprisingly, the analyses of the mechanisms driving phenotypic heterogeneity are mainly focused on the activity of promoters and transcriptional factors. Less attention is currently given to a role of intrinsic and factor-dependent transcription terminators. Here, we discuss recent advances in understanding the regulatory role of the multi-functional transcription termination factor Rho, the major inhibitor of pervasive transcription in bacteria and the emerging global regulator of gene expression. We propose that termination activity of Rho might be among the mechanisms by which cells manage the intensity of transcriptional noise, thus affecting population heterogeneity.
SeqTU: A web server for identification of bacterial transcription units
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Xin; Chou, Wen -Chi; Ma, Qin
A transcription unit (TU) consists of K ≥ 1 consecutive genes on the same strand of a bacterial genome that are transcribed into a single mRNA molecule under certain conditions. Their identification is an essential step in elucidation of transcriptional regulatory networks. We have recently developed a machine-learning method to accurately identify TUs from RNA-seq data, based on two features of the assembled RNA reads: the continuity and stability of RNA-seq coverage across a genomic region. While good performance was achieved by the method on Escherichia coli and Clostridium thermocellum, substantial work is needed to make the program generally applicablemore » to all bacteria, knowing that the program requires organism specific information. A web server, named SeqTU, was developed to automatically identify TUs with given RNA-seq data of any bacterium using a machine-learning approach. The server consists of a number of utility tools, in addition to TU identification, such as data preparation, data quality check and RNA-read mapping. SeqTU provides a user-friendly interface and automated prediction of TUs from given RNA-seq data. Furthermore, the predicted TUs are displayed intuitively using HTML format along with a graphic visualization of the prediction.« less
SeqTU: A web server for identification of bacterial transcription units
Chen, Xin; Chou, Wen -Chi; Ma, Qin; ...
2017-03-07
A transcription unit (TU) consists of K ≥ 1 consecutive genes on the same strand of a bacterial genome that are transcribed into a single mRNA molecule under certain conditions. Their identification is an essential step in elucidation of transcriptional regulatory networks. We have recently developed a machine-learning method to accurately identify TUs from RNA-seq data, based on two features of the assembled RNA reads: the continuity and stability of RNA-seq coverage across a genomic region. While good performance was achieved by the method on Escherichia coli and Clostridium thermocellum, substantial work is needed to make the program generally applicablemore » to all bacteria, knowing that the program requires organism specific information. A web server, named SeqTU, was developed to automatically identify TUs with given RNA-seq data of any bacterium using a machine-learning approach. The server consists of a number of utility tools, in addition to TU identification, such as data preparation, data quality check and RNA-read mapping. SeqTU provides a user-friendly interface and automated prediction of TUs from given RNA-seq data. Furthermore, the predicted TUs are displayed intuitively using HTML format along with a graphic visualization of the prediction.« less
Elucidating the role of transcription in shaping the 3D structure of the bacterial genome
NASA Astrophysics Data System (ADS)
Brandao, Hugo B.; Wang, Xindan; Rudner, David Z.; Mirny, Leonid
Active transcription has been linked to several genome conformation changes in bacteria, including the recruitment of chromosomal DNA to the cell membrane and formation of nucleoid clusters. Using genomic and imaging data as input into mathematical models and polymer simulations, we sought to explore the extent to which bacterial 3D genome structure could be explained by 1D transcription tracks. Using B. subtilis as a model organism, we investigated via polymer simulations the role of loop extrusion and DNA super-coiling on the formation of interaction domains and other fine-scale features that are visible in chromosome conformation capture (Hi-C) data. We then explored the role of the condensin structural maintenance of chromosome complex on the alignment of chromosomal arms. A parameter-free transcription traffic model demonstrated that mean chromosomal arm alignment can be quantitatively explained, and the effects on arm alignment in genomically rearranged strains of B. subtilis were accurately predicted. H.B. acknowledges support from the Natural Sciences and Engineering Research Council of Canada for a PGS-D fellowship.
Convergent Transcription At Intragenic Super-Enhancers Targets AID-initiated Genomic Instability
Meng, Fei-Long; Du, Zhou; Federation, Alexander; Hu, Jiazhi; Wang, Qiao; Kieffer-Kwon, Kyong-Rim; Meyers, Robin M.; Amor, Corina; Wasserman, Caitlyn R.; Neuberg, Donna; Casellas, Rafael; Nussenzweig, Michel C.; Bradner, James E.; Liu, X. Shirley; Alt, Frederick W.
2015-01-01
Summary Activation-induced cytidine deaminase (AID) initiates both somatic hypermutation (SHM) for antibody affinity maturation and DNA breakage for antibody class switch recombination (CSR) via transcription-dependent cytidine deamination of single stranded DNA targets. While largely specific for immunoglobulin genes, AID also acts on a limited set of off-targets, generating oncogenic translocations and mutations that contribute to B cell lymphoma. How AID is recruited to off-targets has been a long-standing mystery. Based on deep GRO-Seq studies of mouse and human B lineage cells activated for CSR or SHM, we report that most robust AID off-target translocations occur within highly focal regions of target genes in which sense and antisense transcription converge. Moreover, we found that such AID-targeting “convergent” transcription arises from antisense transcription that emanates from Super-Enhancers within sense transcribed gene bodies. Our findings provide an explanation for AID off-targeting to a small subset of mostly lineage-specific genes in activated B cells. PMID:25483776
Yao, Yongpeng; Li, Shanshan; Cao, Jiaqian; Liu, Weiwei; Fan, Keqiang; Xiang, Wensheng; Yang, Keqian; Kong, Deming; Wang, Weishan
2018-05-08
Here, we demonstrate an easy-to-implement and general biosensing strategy by coupling the small-molecule recognition of the bacterial allosteric transcription factor (aTF) with isothermal strand displacement amplification (SDA) in vitro. Based on this strategy, we developed two biosensors for the detection of an antiseptic, p-hydroxybenzoic acid, and a disease marker, uric acid, using bacterial aTF HosA and HucR, respectively, highlighting the great potential of this strategy for the development of small-molecule biosensors.
Pu, Jiarui; Mei, Hong; Zhao, Jun; Huang, Kai; Zeng, Fuqing; Tong, Qiangsong
2012-01-01
Heparanase (HPA), an endo-h-D-glucuronidase that cleaves the heparan sulfate chain of heparan sulfate proteoglycans, is overexpressed in majority of human cancers. Recent evidence suggests that small interfering RNA (siRNA) induces transcriptional gene silencing (TGS) in human cells. In this study, transfection of siRNA against −9/+10 bp (siH3), but not −174/−155 bp (siH1) or −134/−115 bp (siH2) region relative to transcription start site (TSS) locating at 101 bp upstream of the translation start site, resulted in TGS of heparanase in human prostate cancer, bladder cancer, and gastric cancer cells in a sequence-specific manner. Methylation-specific PCR and bisulfite sequencing revealed no DNA methylation of CpG islands within heparanase promoter in siH3-transfected cells. The TGS of heparanase did not involve changes of epigenetic markers histone H3 lysine 9 dimethylation (H3K9me2), histone H3 lysine 27 trimethylation (H3K27me3) or active chromatin marker acetylated histone H3 (AcH3). The regulation of alternative splicing was not involved in siH3-mediated TGS. Instead, siH3 interfered with transcription initiation via decreasing the binding of both RNA polymerase II and transcription factor II B (TFIIB), but not the binding of transcription factors Sp1 or early growth response 1, on the heparanase promoter. Moreover, Argonaute 1 and Argonaute 2 facilitated the decreased binding of RNA polymerase II and TFIIB on heparanase promoter, and were necessary in siH3-induced TGS of heparanase. Stable transfection of the short hairpin RNA construct targeting heparanase TSS (−9/+10 bp) into cancer cells, resulted in decreased proliferation, invasion, metastasis and angiogenesis of cancer cells in vitro and in athymic mice models. These results suggest that small RNAs targeting TSS can induce TGS of heparanase via interference with transcription initiation, and significantly suppress the tumor growth, invasion, metastasis and angiogenesis of cancer cells. PMID
Conservation of Transcription Start Sites within Genes across a Bacterial Genus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shao, Wenjun; Price, Morgan N.; Deutschbauer, Adam M.
Transcription start sites (TSSs) lying inside annotated genes, on the same or opposite strand, have been observed in diverse bacteria, but the function of these unexpected transcripts is unclear. Here, we use the metal-reducing bacterium Shewanella oneidensis MR-1 and its relatives to study the evolutionary conservation of unexpected TSSs. Using high-resolution tiling microarrays and 5'-end RNA sequencing, we identified 2,531 TSSs in S. oneidensis MR-1, of which 18% were located inside coding sequences (CDSs). Comparative transcriptome analysis with seven additional Shewanella species revealed that the majority (76%) of the TSSs within the upstream regions of annotated genes (gTSSs) were conserved.more » Thirty percent of the TSSs that were inside genes and on the sense strand (iTSSs) were also conserved. Sequence analysis around these iTSSs showed conserved promoter motifs, suggesting that many iTSS are under purifying selection. Furthermore, conserved iTSSs are enriched for regulatory motifs, suggesting that they are regulated, and they tend to eliminate polar effects, which confirms that they are functional. In contrast, the transcription of antisense TSSs located inside CDSs (aTSSs) was significantly less likely to be conserved (22%). However, aTSSs whose transcription was conserved often have conserved promoter motifs and drive the expression of nearby genes. Overall, our findings demonstrate that some internal TSSs are conserved and drive protein expression despite their unusual locations, but the majority are not conserved and may reflect noisy initiation of transcription rather than a biological function.« less
Structure of the initiation-competent RNA polymerase I and its implication for transcription
NASA Astrophysics Data System (ADS)
Pilsl, Michael; Crucifix, Corinne; Papai, Gabor; Krupp, Ferdinand; Steinbauer, Robert; Griesenbeck, Joachim; Milkereit, Philipp; Tschochner, Herbert; Schultz, Patrick
2016-07-01
Eukaryotic RNA polymerase I (Pol I) is specialized in rRNA gene transcription synthesizing up to 60% of cellular RNA. High level rRNA production relies on efficient binding of initiation factors to the rRNA gene promoter and recruitment of Pol I complexes containing initiation factor Rrn3. Here, we determine the cryo-EM structure of the Pol I-Rrn3 complex at 7.5 Å resolution, and compare it with Rrn3-free monomeric and dimeric Pol I. We observe that Rrn3 contacts the Pol I A43/A14 stalk and subunits A190 and AC40, that association re-organizes the Rrn3 interaction interface, thereby preventing Pol I dimerization; and Rrn3-bound and monomeric Pol I differ from the dimeric enzyme in cleft opening, and localization of the A12.2 C-terminus in the active centre. Our findings thus support a dual role for Rrn3 in transcription initiation to stabilize a monomeric initiation competent Pol I and to drive pre-initiation complex formation.
Brown, Tanya; Bourne, David; Rodriguez-Lanetty, Mauricio
2013-01-01
The impact of disease outbreaks on coral physiology represents an increasing concern for the fitness and resilience of reef ecosystems. Predicting the tolerance of corals to disease relies on an understanding of the coral immune response to pathogenic interactions. This study explored the transcriptional response of two putative immune genes (c3 and c-type lectin) and one stress response gene (hsp70) in the reef building coral, Acropora millepora challenged for 48 hours with bacterial strains, Vibrio coralliilyticus and Alteromonas sp. at concentrations of 106 cells ml-1. Coral fragments challenged with V. coralliilyticus appeared healthy while fragments challenged with Alteromonas sp. showed signs of tissue lesions after 48 hr. Coral-associated bacterial community profiles assessed using denaturing gradient gel electrophoresis changed after challenge by both bacterial strains with the Alteromonas sp. treatment demonstrating the greatest community shift. Transcriptional profiles of c3 and hsp70 increased at 24 hours and correlated with disease signs in the Alteromonas sp. treatment. The expression of hsp70 also showed a significant increase in V. coralliilyticus inoculated corals at 24 h suggesting that even in the absence of disease signs, the microbial inoculum activated a stress response in the coral. C-type lectin did not show a response to any of the bacterial treatments. Increase in gene expression of c3 and hsp70 in corals showing signs of disease indicates their potential involvement in immune and stress response to microbial challenges. PMID:23861754
A model for genesis of transcription systems.
Burton, Zachary F; Opron, Kristopher; Wei, Guowei; Geiger, James H
2016-01-01
Repeating sequences generated from RNA gene fusions/ligations dominate ancient life, indicating central importance of building structural complexity in evolving biological systems. A simple and coherent story of life on earth is told from tracking repeating motifs that generate α/β proteins, 2-double-Ψ-β-barrel (DPBB) type RNA polymerases (RNAPs), general transcription factors (GTFs), and promoters. A general rule that emerges is that biological complexity that arises through generation of repeats is often bounded by solubility and closure (i.e., to form a pseudo-dimer or a barrel). Because the first DNA genomes were replicated by DNA template-dependent RNA synthesis followed by RNA template-dependent DNA synthesis via reverse transcriptase, the first DNA replication origins were initially 2-DPBB type RNAP promoters. A simplifying model for evolution of promoters/replication origins via repetition of core promoter elements is proposed. The model can explain why Pribnow boxes in bacterial transcription (i.e., (-12)TATAATG(-6)) so closely resemble TATA boxes (i.e., (-31)TATAAAAG(-24)) in archaeal/eukaryotic transcription. The evolution of anchor DNA sequences in bacterial (i.e., (-35)TTGACA(-30)) and archaeal (BRE(up); BRE for TFB recognition element) promoters is potentially explained. The evolution of BRE(down) elements of archaeal promoters is potentially explained.
Doidy, Joan; Li, Ying; Neymotin, Benjamin; Edwards, Molly B; Varala, Kranthi; Gresham, David; Coruzzi, Gloria M
2016-02-03
Dynamic transcriptional regulation is critical for an organism's response to environmental signals and yet remains elusive to capture. Such transcriptional regulation is mediated by master transcription factors (TF) that control large gene regulatory networks. Recently, we described a dynamic mode of TF regulation named "hit-and-run". This model proposes that master TF can interact transiently with a set of targets, but the transcription of these transient targets continues after the TF dissociation from the target promoter. However, experimental evidence validating active transcription of the transient TF-targets is still lacking. Here, we show that active transcription continues after transient TF-target interactions by tracking de novo synthesis of RNAs made in response to TF nuclear import. To do this, we introduced an affinity-labeled 4-thiouracil (4tU) nucleobase to specifically isolate newly synthesized transcripts following conditional TF nuclear import. Thus, we extended the TARGET system (Transient Assay Reporting Genome-wide Effects of Transcription factors) to include 4tU-labeling and named this new technology TARGET-tU. Our proof-of-principle example is the master TF Basic Leucine Zipper 1 (bZIP1), a central integrator of metabolic signaling in plants. Using TARGET-tU, we captured newly synthesized mRNAs made in response to bZIP1 nuclear import at a time when bZIP1 is no longer detectably bound to its target. Thus, the analysis of de novo transcripomics demonstrates that bZIP1 may act as a catalyst TF to initiate a transcriptional complex ("hit"), after which active transcription by RNA polymerase continues without the TF being bound to the gene promoter ("run"). Our findings provide experimental proof for active transcription of transient TF-targets supporting a "hit-and-run" mode of action. This dynamic regulatory model allows a master TF to catalytically propagate rapid and broad transcriptional responses to changes in environment. Thus, the
Buttgereit, D; Pflugfelder, G; Grummt, I
1985-11-25
Mouse RNA polymerase I requires at least two chromatographically distinct transcription factors (designated TIF-IA and TIF-IB) to initiate transcription accurately and efficiently in vitro. In this paper we describe the partial purification of TIF-IA by a four-step fractionation procedure. The amount or activity of TIF-IA fluctuates in response to the physiological state of the cells. Extracts from quiescent cells are incapable of specific transcription and do not contain detectable levels of TIF-IA. Transcriptionally inactive extracts can be restored by the addition of TIF-IA preparations that have been highly purified from exponentially growing cells. During the fractionating procedure TIF-IA co-purifies with RNA polymerase I, suggesting that it is functionally associated with the transcribing enzyme. We suggest that only those enzyme molecules that are associated with TIF-IA are capable to interact with TIF-IB and to initiate transcription.
Monitoring transcription initiation activities in rat and dog.
Lizio, Marina; Mukarram, Abdul Kadir; Ohno, Mizuho; Watanabe, Shoko; Itoh, Masayoshi; Hasegawa, Akira; Lassmann, Timo; Severin, Jessica; Harshbarger, Jayson; Abugessaisa, Imad; Kasukawa, Takeya; Hon, Chung Chau; Carninci, Piero; Hayashizaki, Yoshihide; Forrest, Alistair R R; Kawaji, Hideya
2017-11-28
The promoter landscape of several non-human model organisms is far from complete. As a part of FANTOM5 data collection, we generated 13 profiles of transcription initiation activities in dog and rat aortic smooth muscle cells, mesenchymal stem cells and hepatocytes by employing CAGE (Cap Analysis of Gene Expression) technology combined with single molecule sequencing. Our analyses show that the CAGE profiles recapitulate known transcription start sites (TSSs) consistently, in addition to uncover novel TSSs. Our dataset can be thus used with high confidence to support gene annotation in dog and rat species. We identified 28,497 and 23,147 CAGE peaks, or promoter regions, for rat and dog respectively, and associated them to known genes. This approach could be seen as a standard method for improvement of existing gene models, as well as discovery of novel genes. Given that the FANTOM5 data collection includes dog and rat matched cell types in human and mouse as well, this data would also be useful for cross-species studies.
Anti-Biofilm Performance of Three Natural Products against Initial Bacterial Attachment
Salta, Maria; Wharton, Julian A.; Dennington, Simon P.; Stoodley, Paul; Stokes, Keith R.
2013-01-01
Marine bacteria contribute significantly towards the fouling consortium, both directly (modern foul release coatings fail to prevent “slime” attachment) and indirectly (biofilms often excrete chemical cues that attract macrofouling settlement). This study assessed the natural product anti-biofilm performance of an extract of the seaweed, Chondrus crispus, and two isolated compounds from terrestrial sources, (+)-usnic acid and juglone, against two marine biofilm forming bacteria, Cobetia marina and Marinobacter hydrocarbonoclasticus. Bioassays were developed using quantitative imaging and fluorescent labelling to test the natural products over a range of concentrations against initial bacterial attachment. All natural products affected bacterial attachment; however, juglone demonstrated the best anti-biofilm performance against both bacterial species at a concentration range between 5–20 ppm. In addition, for the first time, a dose-dependent inhibition (hormetic) response was observed for natural products against marine biofilm forming bacteria. PMID:24192819
Cerveau, Nicolas; Gilbert, Clément; Liu, Chao; Garrett, Roger A; Grève, Pierre; Bouchon, Didier; Cordaux, Richard
2015-06-10
Transposable elements (TEs) are DNA pieces that are present in almost all the living world at variable genomic density. Due to their mobility and density, TEs are involved in a large array of genomic modifications. In eukaryotes, TE expression has been studied in detail in several species. In prokaryotes, studies of IS expression are generally linked to particular copies that induce a modification of neighboring gene expression. Here we investigated global patterns of IS transcription in the Alphaproteobacterial endosymbiont Wolbachia wVulC, using both RT-PCR and bioinformatic analyses. We detected several transcriptional promoters in all IS groups. Nevertheless, only one of the potentially functional IS groups possesses a promoter located upstream of the transposase gene, that could lead up to the production of a functional protein. We found that the majority of IS groups are expressed whatever their functional status. RT-PCR analyses indicate that the transcription of two IS groups lacking internal promoters upstream of the transposase start codon may be driven by the genomic environment. We confirmed this observation with the transcription analysis of individual copies of one IS group. These results suggest that the genomic environment is important for IS expression and it could explain, at least partly, copy number variability of the various IS groups present in the wVulC genome and, more generally, in bacterial genomes. Copyright © 2015 Elsevier B.V. All rights reserved.
Raindlová, Veronika; Janoušková, Martina; Slavíčková, Michaela; Perlíková, Pavla; Boháčová, Soňa; Milisavljevič, Nemanja; Šanderová, Hana; Benda, Martin; Barvík, Ivan; Krásný, Libor; Hocek, Michal
2016-01-01
DNA templates containing a set of base modifications in the major groove (5-substituted pyrimidines or 7-substituted 7-deazapurines bearing H, methyl, vinyl, ethynyl or phenyl groups) were prepared by PCR using the corresponding base-modified 2′-deoxyribonucleoside triphosphates (dNTPs). The modified templates were used in an in vitro transcription assay using RNA polymerase from Bacillus subtilis and Escherichia coli. Some modified nucleobases bearing smaller modifications (H, Me in 7-deazapurines) were perfectly tolerated by both enzymes, whereas bulky modifications (Ph at any nucleobase) and, surprisingly, uracil blocked transcription. Some middle-sized modifications (vinyl or ethynyl) were partly tolerated mostly by the E. coli enzyme. In all cases where the transcription proceeded, full length RNA product with correct sequence was obtained indicating that the modifications of the template are not mutagenic and the inhibition is probably at the stage of initiation. The results are promising for the development of bioorthogonal reactions for artificial chemical switching of the transcription. PMID:27001521
Bacterial community initial development in proglacial soils of Larsemann hill, East Antarctica
NASA Astrophysics Data System (ADS)
Ma, H.; Yan, W.; Shi, G.; Sun, B.; Zhang, Y.; Xiao, X.
2016-12-01
Glacial forefields are considered ideal places to explore how microbial communities will response to climate-driven environmental changes. Our knowledge of how the bacterial community activities and structure was influenced by changing environment due to glacier retreat is still very limited, especially at the initial stage of glacier retreat. The short gradient soil samples including the ice free and ice covered sites were sampled in the forehead of East Antarctica ice sheet, in Larsemann Hills. By employing the Miseq sequencing methods, 1.8 x104 high-quality sequences were gotten for each sample and the bacterial diversity including abundant bacteria and rare bacteria were studied and compared between the gradient samples. Even though in such an extreme stress condition, the bacterial diversity was high. The coefficient of variance between the five sites of abundant group was 0.886 which was higher than that of the top 20 rare group (0.159) significantly (unpaired t test, p-value<0.0001) suggesting that the abundant bacterial communities were more sensitive to the ice sheet change in the initial stage than rare bacteria did. And the abundant bacteria contributed the community structure more than the rare bacteria did. The rare group acted more like seed bank to keep the community functionality in the forehead of sheet. And the ice thickness was the major factor to affect the abundant bacterial community. Given the fact that Antarctica environment was more sensitive to the global warming, the study about abundant and rare bacteria response to condition change will be helpful to precisely predict community response to climate change in polar region. This finding will improve the understanding about the relationship between community structure and environment condition in extreme stress condition.
Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M
1980-01-01
Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156
Changes in rhizosphere bacterial gene expression following glyphosate treatment.
Newman, Molli M; Lorenz, Nicola; Hoilett, Nigel; Lee, Nathan R; Dick, Richard P; Liles, Mark R; Ramsier, Cliff; Kloepper, Joseph W
2016-05-15
In commercial agriculture, populations and interactions of rhizosphere microflora are potentially affected by the use of specific agrichemicals, possibly by affecting gene expression in these organisms. To investigate this, we examined changes in bacterial gene expression within the rhizosphere of glyphosate-tolerant corn (Zea mays) and soybean (Glycine max) in response to long-term glyphosate (PowerMAX™, Monsanto Company, MO, USA) treatment. A long-term glyphosate application study was carried out using rhizoboxes under greenhouse conditions with soil previously having no history of glyphosate exposure. Rhizosphere soil was collected from the rhizoboxes after four growing periods. Soil microbial community composition was analyzed using microbial phospholipid fatty acid (PLFA) analysis. Total RNA was extracted from rhizosphere soil, and samples were analyzed using RNA-Seq analysis. A total of 20-28 million bacterial sequences were obtained for each sample. Transcript abundance was compared between control and glyphosate-treated samples using edgeR. Overall rhizosphere bacterial metatranscriptomes were dominated by transcripts related to RNA and carbohydrate metabolism. We identified 67 differentially expressed bacterial transcripts from the rhizosphere. Transcripts downregulated following glyphosate treatment involved carbohydrate and amino acid metabolism, and upregulated transcripts involved protein metabolism and respiration. Additionally, bacterial transcripts involving nutrients, including iron, nitrogen, phosphorus, and potassium, were also affected by long-term glyphosate application. Overall, most bacterial and all fungal PLFA biomarkers decreased after glyphosate treatment compared to the control. These results demonstrate that long-term glyphosate use can affect rhizosphere bacterial activities and potentially shift bacterial community composition favoring more glyphosate-tolerant bacteria. Copyright © 2016 The Authors. Published by Elsevier B.V. All
Koh, Hye Ran; Roy, Rahul; Sorokina, Maria; Tang, Guo-Qing; Nandakumar, Divya; Patel, Smita S; Ha, Taekjip
2018-05-17
We provide a comprehensive analysis of transcription in real time by T7 RNA Polymerase (RNAP) using single-molecule fluorescence resonance energy transfer by monitoring the entire life history of transcription initiation, including stepwise RNA synthesis with near base-pair resolution, abortive cycling, and transition into elongation. Kinetically branching pathways were observed for abortive initiation with an RNAP either recycling on the same promoter or exchanging with another RNAP from solution. We detected fast and slow populations of RNAP in their transition into elongation, consistent with the efficient and delayed promoter release, respectively, observed in ensemble studies. Real-time monitoring of abortive cycling using three-probe analysis showed that the initiation events are stochastically branched into productive and failed transcription. The abortive products are generated primarily from initiation events that fail to progress to elongation, and a majority of the productive events transit to elongation without making abortive products. Copyright © 2018 Elsevier Inc. All rights reserved.
Nashimoto, M; Mishima, Y
1988-01-01
Based on recent experimental data about transcription initiation and termination, a model for regulation of mammalian ribosomal DNA transcription is developed using a simple kinetic scheme. In this model, the existence of the transition pathway from the terminator to the promoter increases the rate of ribosomal RNA precursor synthesis. In addition to this 'non-transcribed spacer' traverse of RNA polymerase I, the co-ordination of initiation and termination allows a rapid on/off switch transition from the minimum to the maximum rate of ribosomal RNA precursor synthesis. Furthermore, taking account of the participation of two factors in the termination event, we propose a plausible molecular mechanism for the co-ordination of initiation and termination. This co-ordination is emphasized by repetition of the terminator unit. PMID:3223915
Raindlová, Veronika; Janoušková, Martina; Slavíčková, Michaela; Perlíková, Pavla; Boháčová, Soňa; Milisavljevič, Nemanja; Šanderová, Hana; Benda, Martin; Barvík, Ivan; Krásný, Libor; Hocek, Michal
2016-04-20
DNA templates containing a set of base modifications in the major groove (5-substituted pyrimidines or 7-substituted 7-deazapurines bearing H, methyl, vinyl, ethynyl or phenyl groups) were prepared by PCR using the corresponding base-modified 2'-deoxyribonucleoside triphosphates (dNTPs). The modified templates were used in an in vitro transcription assay using RNA polymerase from Bacillus subtilis and Escherichia coli Some modified nucleobases bearing smaller modifications (H, Me in 7-deazapurines) were perfectly tolerated by both enzymes, whereas bulky modifications (Ph at any nucleobase) and, surprisingly, uracil blocked transcription. Some middle-sized modifications (vinyl or ethynyl) were partly tolerated mostly by the E. colienzyme. In all cases where the transcription proceeded, full length RNA product with correct sequence was obtained indicating that the modifications of the template are not mutagenic and the inhibition is probably at the stage of initiation. The results are promising for the development of bioorthogonal reactions for artificial chemical switching of the transcription. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Zhao, Jian; Yuan, Xuejun; Frödin, Morten; Grummt, Ingrid
2003-02-01
Phosphorylation of transcription factors by mitogen-activated protein kinase (MAPK) cascades links cell signaling with the control of gene expression. Here we show that growth factors induce rRNA synthesis by activating MAPK-dependent signaling cascades that target the RNA polymerase I-specific transcription initiation factor TIF-IA. Activation of TIF-IA and ribosomal gene transcription is sensitive to PD98059, indicating that TIF-IA is targeted by MAPK in vivo. Phosphopeptide mapping and mutational analysis reveals two serine residues (S633 and S649) that are phosphorylated by ERK and RSK kinases. Replacement of S649 by alanine inactivates TIF-IA, inhibits pre-rRNA synthesis, and retards cell growth. The results provide a link between growth factor signaling, ribosome production, and cell growth, and may have a major impact on the mechanism of cell transformation.
Mishima, Y; Financsek, I; Kominami, R; Muramatsu, M
1982-01-01
Mouse and human cell extracts (S100) can support an accurate and efficient transcription initiation on homologous ribosomal RNA gene (rDNA) templates. The cell extracts were fractionated with the aid of a phosphocellulose column into four fractions (termed A, B, C and D), including one containing a major part of the RNA polymerase I activity. Various reconstitution experiments indicate that fraction D is an absolute requirement for the correct and efficient transcription initiation by RNA polymerase I on both mouse and human genes. Fraction B effectively suppresses random initiation on these templates. Fraction A appears to further enhance the transcription which takes place with fractions C and D. Although fractions A, B and C are interchangeable between mouse and human extracts, fraction D is not; i.e. initiation of transcription required the presence of a homologous fraction D for both templates. The factor(s) in fraction D, however, is not literally species-specific, since mouse D fraction is capable of supporting accurate transcription initiation on a rat rDNA template in the presence of all the other fractions from human cell extract under the conditions where human D fraction is unable to support it. We conclude from these experiments that a species-dependent factor in fraction D plays an important role in the initiation of rDNA transcription in each animal species. Images PMID:7177852
Kamke, Janine; Soni, Priya; Li, Yang; Ganesh, Siva; Kelly, William J; Leahy, Sinead C; Shi, Weibing; Froula, Jeff; Rubin, Edward M; Attwood, Graeme T
2017-08-08
Ruminants are important contributors to global methane emissions via microbial fermentation in their reticulo-rumens. This study is part of a larger program, characterising the rumen microbiomes of sheep which vary naturally in methane yield (g CH 4 /kg DM/day) and aims to define differences in microbial communities, and in gene and transcript abundances that can explain the animal methane phenotype. Rumen microbiome metagenomic and metatranscriptomic data were analysed by Gene Set Enrichment, sparse partial least squares regression and the Wilcoxon Rank Sum test to estimate correlations between specific KEGG bacterial pathways/genes and high methane yield in sheep. KEGG genes enriched in high methane yield sheep were reassembled from raw reads and existing contigs and analysed by MEGAN to predict their phylogenetic origin. Protein coding sequences from Succinivibrio dextrinosolvens strains were analysed using Effective DB to predict bacterial type III secreted proteins. The effect of S. dextrinosolvens strain H5 growth on methane formation by rumen methanogens was explored using co-cultures. Detailed analysis of the rumen microbiomes of high methane yield sheep shows that gene and transcript abundances of bacterial type III secretion system genes are positively correlated with methane yield in sheep. Most of the bacterial type III secretion system genes could not be assigned to a particular bacterial group, but several genes were affiliated with the genus Succinivibrio, and searches of bacterial genome sequences found that strains of S. dextrinosolvens were part of a small group of rumen bacteria that encode this type of secretion system. In co-culture experiments, S. dextrinosolvens strain H5 showed a growth-enhancing effect on a methanogen belonging to the order Methanomassiliicoccales, and inhibition of a representative of the Methanobrevibacter gottschalkii clade. This is the first report of bacterial type III secretion system genes being associated with high
RBPJ maintains brain tumor–initiating cells through CDK9-mediated transcriptional elongation
Xie, Qi; Wu, Qiulian; Kim, Leo; Miller, Tyler E.; Liau, Brian B.; Mack, Stephen C.; Yang, Kailin; Factor, Daniel C.; Fang, Xiaoguang; Huang, Zhi; Zhou, Wenchao; Alazem, Kareem; Wang, Xiuxing; Bernstein, Bradley E.; Bao, Shideng; Rich, Jeremy N.
2016-01-01
Glioblastomas co-opt stem cell regulatory pathways to maintain brain tumor–initiating cells (BTICs), also known as cancer stem cells. NOTCH signaling has been a molecular target in BTICs, but NOTCH antagonists have demonstrated limited efficacy in clinical trials. Recombining binding protein suppressor of hairless (RBPJ) is considered a central transcriptional mediator of NOTCH activity. Here, we report that pharmacologic NOTCH inhibitors were less effective than targeting RBPJ in suppressing tumor growth. While NOTCH inhibitors decreased canonical NOTCH gene expression, RBPJ regulated a distinct profile of genes critical to BTIC stemness and cell cycle progression. RBPJ was preferentially expressed by BTICs and required for BTIC self-renewal and tumor growth. MYC, a key BTIC regulator, bound the RBPJ promoter and treatment with a bromodomain and extraterminal domain (BET) family bromodomain inhibitor decreased MYC and RBPJ expression. Proteomic studies demonstrated that RBPJ binds CDK9, a component of positive transcription elongation factor b (P-TEFb), to target gene promoters, enhancing transcriptional elongation. Collectively, RBPJ links MYC and transcriptional control through CDK9, providing potential nodes of fragility for therapeutic intervention, potentially distinct from NOTCH. PMID:27322055
Efficacy of a mouthrinse based on hydroxyapatite to reduce initial bacterial colonisation in situ.
Kensche, A; Holder, C; Basche, S; Tahan, N; Hannig, C; Hannig, M
2017-08-01
The present in situ - investigation aimed to specify the impact of pure hydroxyapatite microclusters on initial bioadhesion and bacterial colonization at the tooth surface. Pellicle formation was carried out in situ on bovine enamel slabs (9 subjects). After 1min of pellicle formation rinses with 8ml of hydroxyapatite (HA) microclusters (5%) in bidestilled water or chlorhexidine 0.2% were performed. As negative control no rinse was adopted. In situ biofilm formation was promoted by the intraoral slab exposure for 8h overnight. Afterwards initial bacterial adhesion was quantified by DAPI staining and bacterial viability was determined in vivo/in vitro by live/dead-staining (BacLight). SEM analysis evaluated the efficacy of the mouthrinse to accumulate hydroxyapatite microclusters at the specimens' surface and spit-out samples of the testsolution were investigated by TEM. Compared to the control (2.36×10 6 ±2.01×10 6 bacteria/cm 2 ), significantly reduced amounts of adherent bacteria were detected on specimens rinsed with chlorhexidine 0.2% (8.73×10 4 ±1.37×10 5 bacteria/cm 2 ) and likewise after rinses with the hydroxyapatite testsolution (2.08×10 5 ±2.85×10 5 bacteria/cm 2 , p<0.001). No demonstrable effect of HA-particles on Streptococcus mutans viability could be shown. SEM analysis confirmed the temporary adsorption of hydroxyapatite microclusters at the tooth surface. Adhesive interactions of HA-particles with oral bacteria were shown by TEM. Hydroxyapatite microclusters reduced initial bacterial adhesion to enamel in situ considerably and could therefore sensibly supplement current approaches in dental prophylaxis. Copyright © 2017 Elsevier Ltd. All rights reserved.
Ramírez-Prado, Jorge Humberto; Martínez-Márquez, Eva Isabel; Olmedo-Alvarez, Gabriela
2006-07-01
We analyzed the influence of the 5' and 3' untranslated regions of the Bacillus thuringiensis cry1Aa on its mRNA stability. Although the cry1Aa gene has a stable transcript (8 min), its 5' UTR did not provide stability to the reporter gene uidA. Stability of cry1Aa could be increased to 40 min by addition of an SP82 stability element at the 5' UTR, suggesting that once the 5' and 3' ends were protected initiation of decay could be effectively blocked. We generated mutations in the transcription terminator and found that changes that reduced the stability of the stem, a larger loop, or elimination of the U-trail sharply decreased the half-life of the transcript. Therefore, unlike some stable bacterial transcripts, cry1Aa lacks special features at the end 5' to prevent decay, but its terminator is the main determinant of its stability.
Yamada, Shintaro; Okamura, Mika; Oda, Arisa; Murakami, Hiroshi; Ohta, Kunihiro; Yamada, Takatomi
2017-06-01
Meiotic homologous recombination, a critical event for ensuring faithful chromosome segregation and creating genetic diversity, is initiated by programmed DNA double-strand breaks (DSBs) formed at recombination hotspots. Meiotic DSB formation is likely to be influenced by other DNA-templated processes including transcription, but how DSB formation and transcription interact with each other has not been understood well. In this study, we used fission yeast to investigate a possible interplay of these two events. A group of hotspots in fission yeast are associated with sequences similar to the cyclic AMP response element and activated by the ATF/CREB family transcription factor dimer Atf1-Pcr1. We first focused on one of those hotspots, ade6-3049 , and Atf1. Our results showed that multiple transcripts, shorter than the ade6 full-length messenger RNA, emanate from a region surrounding the ade6-3049 hotspot. Interestingly, we found that the previously known recombination-activation region of Atf1 is also a transactivation domain, whose deletion affected DSB formation and short transcript production at ade6-3049 These results point to a possibility that the two events may be related to each other at ade6-3049 In fact, comparison of published maps of meiotic transcripts and hotspots suggested that hotspots are very often located close to meiotically transcribed regions. These observations therefore propose that meiotic DSB formation in fission yeast may be connected to transcription of surrounding regions. Copyright © 2017 by the Genetics Society of America.
Bloyet, Louis-Marie; Brunel, Joanna; Dosnon, Marion; Hamon, Véronique; Erales, Jenny; Gruet, Antoine; Lazert, Carine; Bignon, Christophe; Roche, Philippe; Longhi, Sonia; Gerlier, Denis
2016-12-01
Measles virus (MeV) and all Paramyxoviridae members rely on a complex polymerase machinery to ensure viral transcription and replication. Their polymerase associates the phosphoprotein (P) and the L protein that is endowed with all necessary enzymatic activities. To be processive, the polymerase uses as template a nucleocapsid made of genomic RNA entirely wrapped into a continuous oligomer of the nucleoprotein (N). The polymerase enters the nucleocapsid at the 3'end of the genome where are located the promoters for transcription and replication. Transcription of the six genes occurs sequentially. This implies ending and re-initiating mRNA synthesis at each intergenic region (IGR). We explored here to which extent the binding of the X domain of P (XD) to the C-terminal region of the N protein (NTAIL) is involved in maintaining the P/L complex anchored to the nucleocapsid template during the sequential transcription. Amino acid substitutions introduced in the XD-binding site on NTAIL resulted in a wide range of binding affinities as determined by combining protein complementation assays in E. coli and human cells and isothermal titration calorimetry. Molecular dynamics simulations revealed that XD binding to NTAIL involves a complex network of hydrogen bonds, the disruption of which by two individual amino acid substitutions markedly reduced the binding affinity. Using a newly designed, highly sensitive dual-luciferase reporter minigenome assay, the efficiency of re-initiation through the five measles virus IGRs was found to correlate with NTAIL/XD KD. Correlatively, P transcript accumulation rate and F/N transcript ratios from recombinant viruses expressing N variants were also found to correlate with the NTAIL to XD binding strength. Altogether, our data support a key role for XD binding to NTAIL in maintaining proper anchor of the P/L complex thereby ensuring transcription re-initiation at each intergenic region.
Hamon, Véronique; Erales, Jenny; Bignon, Christophe; Roche, Philippe
2016-01-01
Measles virus (MeV) and all Paramyxoviridae members rely on a complex polymerase machinery to ensure viral transcription and replication. Their polymerase associates the phosphoprotein (P) and the L protein that is endowed with all necessary enzymatic activities. To be processive, the polymerase uses as template a nucleocapsid made of genomic RNA entirely wrapped into a continuous oligomer of the nucleoprotein (N). The polymerase enters the nucleocapsid at the 3’end of the genome where are located the promoters for transcription and replication. Transcription of the six genes occurs sequentially. This implies ending and re-initiating mRNA synthesis at each intergenic region (IGR). We explored here to which extent the binding of the X domain of P (XD) to the C-terminal region of the N protein (NTAIL) is involved in maintaining the P/L complex anchored to the nucleocapsid template during the sequential transcription. Amino acid substitutions introduced in the XD-binding site on NTAIL resulted in a wide range of binding affinities as determined by combining protein complementation assays in E. coli and human cells and isothermal titration calorimetry. Molecular dynamics simulations revealed that XD binding to NTAIL involves a complex network of hydrogen bonds, the disruption of which by two individual amino acid substitutions markedly reduced the binding affinity. Using a newly designed, highly sensitive dual-luciferase reporter minigenome assay, the efficiency of re-initiation through the five measles virus IGRs was found to correlate with NTAIL/XD KD. Correlatively, P transcript accumulation rate and F/N transcript ratios from recombinant viruses expressing N variants were also found to correlate with the NTAIL to XD binding strength. Altogether, our data support a key role for XD binding to NTAIL in maintaining proper anchor of the P/L complex thereby ensuring transcription re-initiation at each intergenic region. PMID:27936158
Symbiosis initiation in the bacterially luminous sea urchin cardinalfish Siphamia versicolor.
Dunlap, P V; Gould, A L; Wittenrich, M L; Nakamura, M
2012-09-01
To determine how each new generation of the sea urchin cardinalfish Siphamia versicolor acquires the symbiotic luminous bacterium Photobacterium mandapamensis, and when in its development the S. versicolor initiates the symbiosis, procedures were established for rearing S. versicolor larvae in an aposymbiotic state. Under the conditions provided, larvae survived and developed for 28 days after their release from the mouths of males. Notochord flexion began at 8 days post release (dpr). By 28 dpr, squamation was evident and the caudal complex was complete. The light organ remained free of bacteria but increased in size and complexity during development of the larvae. Thus, aposymbiotic larvae of the fish can survive and develop for extended periods, major components of the luminescence system develop in the absence of the bacteria and the bacteria are not acquired directly from a parent, via the egg or during mouth brooding. Presentation of the symbiotic bacteria to aposymbiotic larvae at 8-10 dpr, but not earlier, led to initiation of the symbiosis. Upon colonization of the light organ, the bacterial population increased rapidly and cells forming the light-organ chambers exhibited a differentiated appearance. Therefore, the light organ apparently first becomes receptive to colonization after 1 week post-release development, the symbiosis is initiated by bacteria acquired from the environment and bacterial colonization induces morphological changes in the nascent light organ. The abilities to culture larvae of S. versicolor for extended periods and to initiate the symbiosis in aposymbiotic larvae are key steps in establishing the experimental tractability of this highly specific vertebrate and microbe mutualism. © 2012 The Authors. Journal of Fish Biology © 2012 The Fisheries Society of the British Isles.
Yang, Ji; Hocking, Dianna M.; Cheng, Catherine; Dogovski, Con; Perugini, Matthew A.; Holien, Jessica K.; Parker, Michael W.; Hartland, Elizabeth L.; Tauschek, Marija; Robins-Browne, Roy M.
2013-01-01
The misuse of antibiotics during past decades has led to pervasive antibiotic resistance in bacteria. Hence, there is an urgent need for the development of new and alternative approaches to combat bacterial infections. In most bacterial pathogens the expression of virulence is tightly regulated at the transcriptional level. Therefore, targeting pathogens with drugs that interfere with virulence gene expression offers an effective alternative to conventional antimicrobial chemotherapy. Many Gram-negative intestinal pathogens produce AraC-like proteins that control the expression of genes required for infection. In this study we investigated the prototypical AraC-like virulence regulator, RegA, from the mouse attaching and effacing pathogen, Citrobacter rodentium, as a potential drug target. By screening a small molecule chemical library and chemical optimization, we identified two compounds that specifically inhibited the ability of RegA to activate its target promoters and thus reduced expression of a number of proteins required for virulence. Biophysical, biochemical, genetic, and computational analyses indicated that the more potent of these two compounds, which we named regacin, disrupts the DNA binding capacity of RegA by interacting with amino acid residues within a conserved region of the DNA binding domain. Oral administration of regacin to mice, commencing 15 min before or 12 h after oral inoculation with C. rodentium, caused highly significant attenuation of intestinal colonization by the mouse pathogen comparable to that of an isogenic regA-deletion mutant. These findings demonstrate that chemical inhibition of the DNA binding domains of transcriptional regulators is a viable strategy for the development of antimicrobial agents that target bacterial pathogens. PMID:24019519
Transcriptional Response of Nitrifying Communities to Wetting of Dry Soil
Firestone, Mary K.
2013-01-01
The first rainfall following a severe dry period provides an abrupt water potential change that is both an acute physiological stress and a defined stimulus for the reawakening of soil microbial communities. We followed the responses of indigenous communities of ammonia-oxidizing bacteria, ammonia-oxidizing archaea, and nitrite-oxidizing bacteria to the addition of water to laboratory incubations of soils taken from two California annual grasslands following a typically dry Mediterranean summer. By quantifying transcripts for a subunit of bacterial and archaeal ammonia monooxygenases (amoA) and a bacterial nitrite oxidoreductase (nxrA) in soil from 15 min to 72 h after water addition, we identified transcriptional response patterns for each of these three groups of nitrifiers. An increase in quantity of bacterial amoA transcripts was detectable within 1 h of wet-up and continued until the size of the ammonium pool began to decrease, reflecting a possible role of transcription in upregulation of nitrification after drought-induced stasis. In one soil, the pulse of amoA transcription lasted for less than 24 h, demonstrating the transience of transcriptional pools and the tight coupling of transcription to the local soil environment. Analysis of 16S rRNA using a high-density microarray suggested that nitrite-oxidizing Nitrobacter spp. respond in tandem with ammonia-oxidizing bacteria while nitrite-oxidizing Nitrospina spp. and Nitrospira bacteria may not. Archaeal ammonia oxidizers may respond slightly later than bacterial ammonia oxidizers but may maintain elevated transcription longer. Despite months of desiccation-induced inactivation, we found rapid transcriptional response by all three groups of soil nitrifiers. PMID:23524666
DOE Office of Scientific and Technical Information (OSTI.GOV)
Henderson, S.L.; Ryan, K.; Sollner-Webb, B.
1989-02-01
We have examined the mechanism by which transcriptional initiation at the mouse rDNA promoter is augmented by the RNA polymerase I terminator element that resides just upstream of it. Using templates in which terminator elements are instead positioned at the opposite side of the plasmid rather than proximal to the promoter, or conditions where transcription is terminated elsewhere in the plasmid by UV-induced lesions, we show that the terminator's stimulatory effect is not position dependent. Mouse terminator elements therefore do not stimulate via the previously postulated 'read-through enhancement' model in which terminated polymerases are handed off to an adjacent promotermore » in a concerted reaction. The position independence and orientation dependence of the terminator also makes it unlikely that the terminator functions as a promoter element or as an enhancer. Instead, terminators serve to augment initiation by preventing polymerases from reading completely around the plasmid and through the promoter from upstream, an event which we show interferes with subsequent rounds of initiation. Notably, this transcriptional interference arises because polymerase passage across a promoter disrupts the otherwise stable transcription complex, specifically releasing the bound transcription factor D. These liberated D molecules can then bind to other templates and activate their expression. The rDNA transcriptional interference is not due to a steric impediment to the binding of new polymerase molecules, and it does not similarly liberate the initiation-competent polymerase (factor C). These studies have also convincingly demonstrated that multiple rounds of transcription are obtained from rDNA template molecules in vitro.« less
Structural basis for the initiation of eukaryotic transcription-coupled DNA repair.
Xu, Jun; Lahiri, Indrajit; Wang, Wei; Wier, Adam; Cianfrocco, Michael A; Chong, Jenny; Hare, Alissa A; Dervan, Peter B; DiMaio, Frank; Leschziner, Andres E; Wang, Dong
2017-11-30
Eukaryotic transcription-coupled repair (TCR) is an important and well-conserved sub-pathway of nucleotide excision repair that preferentially removes DNA lesions from the template strand that block translocation of RNA polymerase II (Pol II). Cockayne syndrome group B (CSB, also known as ERCC6) protein in humans (or its yeast orthologues, Rad26 in Saccharomyces cerevisiae and Rhp26 in Schizosaccharomyces pombe) is among the first proteins to be recruited to the lesion-arrested Pol II during the initiation of eukaryotic TCR. Mutations in CSB are associated with the autosomal-recessive neurological disorder Cockayne syndrome, which is characterized by progeriod features, growth failure and photosensitivity. The molecular mechanism of eukaryotic TCR initiation remains unclear, with several long-standing unanswered questions. How cells distinguish DNA lesion-arrested Pol II from other forms of arrested Pol II, the role of CSB in TCR initiation, and how CSB interacts with the arrested Pol II complex are all unknown. The lack of structures of CSB or the Pol II-CSB complex has hindered our ability to address these questions. Here we report the structure of the S. cerevisiae Pol II-Rad26 complex solved by cryo-electron microscopy. The structure reveals that Rad26 binds to the DNA upstream of Pol II, where it markedly alters its path. Our structural and functional data suggest that the conserved Swi2/Snf2-family core ATPase domain promotes the forward movement of Pol II, and elucidate key roles for Rad26 in both TCR and transcription elongation.
A Critical, Nonlinear Threshold Dictates Bacterial Invasion and Initial Kinetics During Influenza
NASA Astrophysics Data System (ADS)
Smith, Amber M.; Smith, Amanda P.
2016-12-01
Secondary bacterial infections increase morbidity and mortality of influenza A virus (IAV) infections. Bacteria are able to invade due to virus-induced depletion of alveolar macrophages (AMs), but this is not the only contributing factor. By analyzing a kinetic model, we uncovered a nonlinear initial dose threshold that is dependent on the amount of virus-induced AM depletion. The threshold separates the growth and clearance phenotypes such that bacteria decline for dose-AM depletion combinations below the threshold, stay constant near the threshold, and increase above the threshold. In addition, the distance from the threshold correlates to the growth rate. Because AM depletion changes throughout an IAV infection, the dose requirement for bacterial invasion also changes accordingly. Using the threshold, we found that the dose requirement drops dramatically during the first 7d of IAV infection. We then validated these analytical predictions by infecting mice with doses below or above the predicted threshold over the course of IAV infection. These results identify the nonlinear way in which two independent factors work together to support successful post-influenza bacterial invasion. They provide insight into coinfection timing, the heterogeneity in outcome, the probability of acquiring a coinfection, and the use of new therapeutic strategies to combat viral-bacterial coinfections.
A Critical, Nonlinear Threshold Dictates Bacterial Invasion and Initial Kinetics During Influenza.
Smith, Amber M; Smith, Amanda P
2016-12-15
Secondary bacterial infections increase morbidity and mortality of influenza A virus (IAV) infections. Bacteria are able to invade due to virus-induced depletion of alveolar macrophages (AMs), but this is not the only contributing factor. By analyzing a kinetic model, we uncovered a nonlinear initial dose threshold that is dependent on the amount of virus-induced AM depletion. The threshold separates the growth and clearance phenotypes such that bacteria decline for dose-AM depletion combinations below the threshold, stay constant near the threshold, and increase above the threshold. In addition, the distance from the threshold correlates to the growth rate. Because AM depletion changes throughout an IAV infection, the dose requirement for bacterial invasion also changes accordingly. Using the threshold, we found that the dose requirement drops dramatically during the first 7d of IAV infection. We then validated these analytical predictions by infecting mice with doses below or above the predicted threshold over the course of IAV infection. These results identify the nonlinear way in which two independent factors work together to support successful post-influenza bacterial invasion. They provide insight into coinfection timing, the heterogeneity in outcome, the probability of acquiring a coinfection, and the use of new therapeutic strategies to combat viral-bacterial coinfections.
Transcription Regulation in Archaea
Gehring, Alexandra M.; Walker, Julie E.
2016-01-01
The known diversity of metabolic strategies and physiological adaptations of archaeal species to extreme environments is extraordinary. Accurate and responsive mechanisms to ensure that gene expression patterns match the needs of the cell necessitate regulatory strategies that control the activities and output of the archaeal transcription apparatus. Archaea are reliant on a single RNA polymerase for all transcription, and many of the known regulatory mechanisms employed for archaeal transcription mimic strategies also employed for eukaryotic and bacterial species. Novel mechanisms of transcription regulation have become apparent by increasingly sophisticated in vivo and in vitro investigations of archaeal species. This review emphasizes recent progress in understanding archaeal transcription regulatory mechanisms and highlights insights gained from studies of the influence of archaeal chromatin on transcription. PMID:27137495
Zhang, Zhengjian; Boskovic, Zarko; Hussain, Mahmud M; Hu, Wenxin; Inouye, Carla; Kim, Han-Je; Abole, A Katherine; Doud, Mary K; Lewis, Timothy A; Koehler, Angela N; Schreiber, Stuart L; Tjian, Robert
2015-01-01
Intrinsically disordered proteins/regions (IDPs/IDRs) are proteins or peptide segments that fail to form stable 3-dimensional structures in the absence of partner proteins. They are abundant in eukaryotic proteomes and are often associated with human diseases, but their biological functions have been elusive to study. In this study, we report the identification of a tin(IV) oxochloride-derived cluster that binds an evolutionarily conserved IDR within the metazoan TFIID transcription complex. Binding arrests an isomerization of promoter-bound TFIID that is required for the engagement of Pol II during the first (de novo) round of transcription initiation. However, the specific chemical probe does not affect reinitiation, which requires the re-entry of Pol II, thus, mechanistically distinguishing these two modes of transcription initiation. This work also suggests a new avenue for targeting the elusive IDRs by harnessing certain features of metal-based complexes for mechanistic studies, and for the development of novel pharmaceutical interventions. DOI: http://dx.doi.org/10.7554/eLife.07777.001 PMID:26314865
Initial insights into bacterial succession during human decomposition.
Hyde, Embriette R; Haarmann, Daniel P; Petrosino, Joseph F; Lynne, Aaron M; Bucheli, Sibyl R
2015-05-01
Decomposition is a dynamic ecological process dependent upon many factors such as environment, climate, and bacterial, insect, and vertebrate activity in addition to intrinsic properties inherent to individual cadavers. Although largely attributed to microbial metabolism, very little is known about the bacterial basis of human decomposition. To assess the change in bacterial community structure through time, bacterial samples were collected from several sites across two cadavers placed outdoors to decompose and analyzed through 454 pyrosequencing and analysis of variable regions 3-5 of the bacterial 16S ribosomal RNA (16S rRNA) gene. Each cadaver was characterized by a change in bacterial community structure for all sites sampled as time, and decomposition, progressed. Bacteria community structure is variable at placement and before purge for all body sites. At bloat and purge and until tissues began to dehydrate or were removed, bacteria associated with flies, such as Ignatzschineria and Wohlfahrtimonas, were common. After dehydration and skeletonization, bacteria associated with soil, such as Acinetobacter, were common at most body sites sampled. However, more cadavers sampled through multiple seasons are necessary to assess major trends in bacterial succession.
Skinner, Gary M; Baumann, Christoph G; Quinn, Diana M; Molloy, Justin E; Hoggett, James G
2004-01-30
A single-molecule transcription assay has been developed that allows, for the first time, the direct observation of promoter binding, initiation, and elongation by a single RNA polymerase (RNAP) molecule in real-time. To promote DNA binding and transcription initiation, a DNA molecule tethered between two optically trapped beads was held near a third immobile surface bead sparsely coated with RNAP. By driving the optical trap holding the upstream bead with a triangular oscillation while measuring the position of both trapped beads, we observed the onset of promoter binding, promoter escape (productive initiation), and processive elongation by individual RNAP molecules. After DNA template release, transcription re-initiation on the same DNA template is possible; thus, multiple enzymatic turnovers by an individual RNAP molecule can be observed. Using bacteriophage T7 RNAP, a commonly used RNAP paradigm, we observed the association and dissociation (k(off)= 2.9 s(-1)) of T7 RNAP and promoter DNA, the transition to the elongation mode (k(for) = 0.36 s(-1)), and the processive synthesis (k(pol) = 43 nt s(-1)) and release of a gene-length RNA transcript ( approximately 1200 nt). The transition from initiation to elongation is much longer than the mean lifetime of the binary T7 RNAP-promoter DNA complex (k(off) > k(for)), identifying a rate-limiting step between promoter DNA binding and promoter escape.
DOE Office of Scientific and Technical Information (OSTI.GOV)
M Gleghorn; E Davydova; R Basu
2011-12-31
We have determined the X-ray crystal structures of the pre- and postcatalytic forms of the initiation complex of bacteriophage N4 RNA polymerase that provide the complete set of atomic images depicting the process of transcript initiation by a single-subunit RNA polymerase. As observed during T7 RNA polymerase transcript elongation, substrate loading for the initiation process also drives a conformational change of the O helix, but only the correct base pairing between the +2 substrate and DNA base is able to complete the O-helix conformational transition. Substrate binding also facilitates catalytic metal binding that leads to alignment of the reactive groupsmore » of substrates for the nucleotidyl transfer reaction. Although all nucleic acid polymerases use two divalent metals for catalysis, they differ in the requirements and the timing of binding of each metal. In the case of bacteriophage RNA polymerase, we propose that catalytic metal binding is the last step before the nucleotidyl transfer reaction.« less
Tiengwe, Calvin; Marcello, Lucio; Farr, Helen; Dickens, Nicholas; Kelly, Steven; Swiderski, Michal; Vaughan, Diane; Gull, Keith; Barry, J. David; Bell, Stephen D.; McCulloch, Richard
2012-01-01
Summary Identification of replication initiation sites, termed origins, is a crucial step in understanding genome transmission in any organism. Transcription of the Trypanosoma brucei genome is highly unusual, with each chromosome comprising a few discrete transcription units. To understand how DNA replication occurs in the context of such organization, we have performed genome-wide mapping of the binding sites of the replication initiator ORC1/CDC6 and have identified replication origins, revealing that both localize to the boundaries of the transcription units. A remarkably small number of active origins is seen, whose spacing is greater than in any other eukaryote. We show that replication and transcription in T. brucei have a profound functional overlap, as reducing ORC1/CDC6 levels leads to genome-wide increases in mRNA levels arising from the boundaries of the transcription units. In addition, ORC1/CDC6 loss causes derepression of silent Variant Surface Glycoprotein genes, which are critical for host immune evasion. PMID:22840408
Straub, Cécile; Castellote, Jessie; Onesime, Djamila; Bonnarme, Pascal; Irlinger, Françoise
2013-01-01
The cheese microbiota contributes to a large extent to the development of the typical color, flavor, and texture of the final product. Its composition is not well defined in most cases and varies from one cheese to another. The aim of the present study was to establish procedures for gene transcript quantification in cheeses by reverse transcription-quantitative PCR. Total RNA was extracted from five smear-ripened cheeses purchased on the retail market, using a method that does not involve prior separation of microbial cells. 16S rRNA and malate:quinone oxidoreductase gene transcripts of Corynebacterium casei, Brevibacterium aurantiacum, and Arthrobacter arilaitensis and 26S rRNA and beta tubulin gene transcripts of Geotrichum candidum and Debaryomyces hansenii could be detected and quantified in most of the samples. Three types of normalization were applied: against total RNA, against the amount of cheese, and against a reference gene. For the first two types of normalization, differences of reverse transcription efficiencies from one sample to another were taken into account by analysis of exogenous control mRNA. No good correlation was found between the abundances of target mRNA or rRNA transcripts and the viable cell concentration of the corresponding species. However, in most cases, no mRNA transcripts were detected for species that did not belong to the dominant species. The applications of gene expression measurement in cheeses containing an undefined microbiota, as well as issues concerning the strategy of normalization and the assessment of amplification specificity, are discussed. PMID:23124230
Riboregulation of the bacterial actin-homolog MreB by DsrA small noncoding RNA.
Cayrol, Bastien; Fortas, Emilie; Martret, Claire; Cech, Grzegorz; Kloska, Anna; Caulet, Stephane; Barbet, Marion; Trépout, Sylvain; Marco, Sergio; Taghbalout, Aziz; Busi, Florent; Wegrzyn, Grzegorz; Arluison, Véronique
2015-01-01
The bacterial actin-homolog MreB is a key player in bacterial cell-wall biosynthesis and is required for the maintenance of the rod-like morphology of Escherichia coli. However, how MreB cellular levels are adjusted to growth conditions is poorly understood. Here, we show that DsrA, an E. coli small noncoding RNA (sRNA), is involved in the post-transcriptional regulation of mreB. DsrA is required for the downregulation of MreB cellular concentration during environmentally induced slow growth-rates, mainly growth at low temperature and during the stationary phase. DsrA interacts in an Hfq-dependent manner with the 5' region of mreB mRNA, which contains signals for translation initiation and thereby affects mreB translation and stability. Moreover, as DsrA is also involved in the regulation of two transcriptional regulators, σ(S) and the nucleoid associated protein H-NS, which negatively regulate mreB transcription, it also indirectly contributes to mreB transcriptional down-regulation. By using quantitative analyses, our results evidence the complexity of this regulation and the tangled interplay between transcriptional and post-transcriptional control. As transcription factors and sRNA-mediated post-transcriptional regulators use different timescales, we propose that the sRNA pathway helps to adapt to changes in temperature, but also indirectly mediates long-term regulation of MreB concentration. The tight regulation and fine-tuning of mreB gene expression in response to cellular stresses is discussed in regard to the effect of the MreB protein on cell elongation.
R-loops in bacterial transcription: their causes and consequences.
Gowrishankar, J; Leela, J Krishna; Anupama, K
2013-01-01
Nascent untranslated transcripts in bacteria are prone to generating RNA-DNA hybrids (R-loops); Rho-dependent transcription termination acts to reduce their prevalence. Here we discuss the mechanisms of R-loop formation and growth inhibition in bacteria.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hubin, Elizabeth A.; Fay, Allison; Xu, Catherine
RbpA and CarD are essential transcription regulators in mycobacteria. Mechanistic analyses of promoter open complex (RPo) formation establish that RbpA and CarD cooperatively stimulate formation of an intermediate (RP2) leading to RPo; formation of RP2 is likely a bottleneck step at the majority of mycobacterial promoters. Once RPo forms, CarD also disfavors its isomerization back to RP2. We determined a 2.76 Å-resolution crystal structure of a mycobacterial transcription initiation complex (TIC) with RbpA as well as a CarD/RbpA/TIC model. Both CarD and RbpA bind near the upstream edge of the -10 element where they likely facilitate DNA bending and impedemore » transcription bubble collapse. In vivo studies demonstrate the essential role of RbpA, show the effects of RbpA truncations on transcription and cell physiology, and indicate additional functions for RbpA not evident in vitro. This work provides a framework to understand the control of mycobacterial transcription by RbpA and CarD.« less
Nakagawa, Takeya; Kajitani, Takuya; Togo, Shinji; Masuko, Norio; Ohdan, Hideki; Hishikawa, Yoshitaka; Koji, Takehiko; Matsuyama, Toshifumi; Ikura, Tsuyoshi; Muramatsu, Masami; Ito, Takashi
2008-01-01
Transcriptional initiation is a key step in the control of mRNA synthesis and is intimately related to chromatin structure and histone modification. Here, we show that the ubiquitylation of H2A (ubH2A) correlates with silent chromatin and regulates transcriptional initiation. The levels of ubH2A vary during hepatocyte regeneration, and based on microarray expression data from regenerating liver, we identified USP21, a ubiquitin-specific protease that catalyzes the hydrolysis of ubH2A. When chromatin is assembled in vitro, ubH2A, but not H2A, specifically represses the di- and trimethylation of H3K4. USP21 relieves this ubH2A-specific repression. In addition, in vitro transcription analysis revealed that ubH2A represses transcriptional initiation, but not transcriptional elongation, by inhibiting H3K4 methylation. Notably, ubH2A-mediated repression was not observed when H3 Lys 4 was changed to arginine. Furthermore, overexpression of USP21 in the liver up-regulates a gene that is normally down-regulated during hepatocyte regeneration. Our studies revealed a novel mode of trans-histone cross-talk, in which H2A ubiquitylation controls the di- and trimethylation of H3K4, resulting in regulation of transcriptional initiation. PMID:18172164
Prithika, Udayakumar; Vikneswari, Ramaraj; Balamurugan, Krishnaswamy
2017-04-01
One of the key issues pertaining to the control of memory is to respond to a consistently changing environment or microbial niche present in it. Human cyclic AMP response element binding protein (CREB) transcription factor which plays a crucial role in memory has a homolog in C. elegans, crh-1. crh-1 appears to influence memory processes to certain extent by habituation of the host to a particular environment. The discrimination between the pathogen and a non-pathogen is essential for C. elegans in a microbial niche which determines its survival. Training the nematodes in the presence of a virulent pathogen (S. aureus) and an opportunistic pathogen (P. mirabilis) separately exhibits a different behavioural paradigm. This appears to be dependent on the CREB transcription factor. Here we show that C. elegans homolog crh-1 helps in memory response for a short term against the interacting pathogens. Following conditioning of the nematodes to S. aureus and P. mirabilis, the wild type nematodes exhibited a positive response towards the respective pathogens which diminished slowly after 2h. By contrast, the crh-1 deficient nematodes had a defective memory post conditioning. The molecular data reinforces the importance of crh-1 gene in retaining the memory of nematode. Our results also suggest that involvement of neurotransmitters play a crucial role in modulating the memory of the nematode with the assistance of CREB. Therefore, we elucidate that CREB is responsible for the short term memory response in C. elegans against bacterial pathogens. Copyright © 2016 Elsevier GmbH. All rights reserved.
Hubin, Elizabeth A; Fay, Allison; Xu, Catherine; Bean, James M; Saecker, Ruth M; Glickman, Michael S; Darst, Seth A; Campbell, Elizabeth A
2017-01-01
RbpA and CarD are essential transcription regulators in mycobacteria. Mechanistic analyses of promoter open complex (RPo) formation establish that RbpA and CarD cooperatively stimulate formation of an intermediate (RP2) leading to RPo; formation of RP2 is likely a bottleneck step at the majority of mycobacterial promoters. Once RPo forms, CarD also disfavors its isomerization back to RP2. We determined a 2.76 Å-resolution crystal structure of a mycobacterial transcription initiation complex (TIC) with RbpA as well as a CarD/RbpA/TIC model. Both CarD and RbpA bind near the upstream edge of the −10 element where they likely facilitate DNA bending and impede transcription bubble collapse. In vivo studies demonstrate the essential role of RbpA, show the effects of RbpA truncations on transcription and cell physiology, and indicate additional functions for RbpA not evident in vitro. This work provides a framework to understand the control of mycobacterial transcription by RbpA and CarD. DOI: http://dx.doi.org/10.7554/eLife.22520.001 PMID:28067618
Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M
1982-01-01
The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460
Ghosh, Gairika; Reddy, Jayavardhana; Sambhare, Susmit; Sen, Ranjan
2018-01-01
Rho is a hexameric molecular motor that functions as a conserved transcription terminator in the majority of bacterial species and is a potential drug target. Psu is a bacteriophage P4 capsid protein that inhibits Escherichia coli Rho by obstructing its ATPase and translocase activities. In this study, we explored the anti-Rho activity of Psu for Rho proteins from different pathogens. Sequence alignment and homology modeling of Rho proteins from pathogenic bacteria revealed the conserved nature of the Psu-interacting regions in all these proteins. We chose Rho proteins from various pathogens, including Mycobacterium smegmatis , Mycobacterium bovis , Mycobacterium tuberculosis , Xanthomonas campestris , Xanthomonas oryzae , Corynebacterium glutamicum , Vibrio cholerae , Salmonella enterica , and Pseudomonas syringae The purified recombinant Rho proteins of these organisms showed variable rates of ATP hydrolysis on poly(rC) as the substrate and were capable of releasing RNA from the E. coli transcription elongation complexes. Psu was capable of inhibiting these two functions of all these Rho proteins. In vivo pulldown assays revealed direct binding of Psu with many of these Rho proteins. In vivo expression of psu induced killing of M. smegmatis , M. bovis , X. campestris , and E. coli expressing S. enterica Rho indicating Psu-induced inhibition of Rho proteins of these strains under physiological conditions. We propose that the "universal" inhibitory function of the Psu protein against the Rho proteins from both Gram-negative and Gram-positive bacteria could be useful for designing peptides with antimicrobial functions and that these peptides could contribute to synergistic antibiotic treatment of the pathogens by compromising the Rho functions. IMPORTANCE Bacteriophage-derived protein factors modulating different bacterial processes could be converted into unique antimicrobial agents. Bacteriophage P4 capsid protein Psu is an inhibitor of the E. coli transcription
Bratkowski, Matthew; Unarta, Ilona Christy; Zhu, Lizhe; Shubbar, Murtada; Huang, Xuhui; Liu, Xin
2018-02-02
Functional cross-talk between the promoter and terminator of a gene has long been noted. Promoters and terminators are juxtaposed to form gene loops in several organisms, and gene looping is thought to be involved in transcriptional regulation. The general transcription factor IIB (TFIIB) and the C-terminal domain phosphatase Ssu72, essential factors of the transcription preinitiation complex and the mRNA processing and polyadenylation complex, respectively, are important for gene loop formation. TFIIB and Ssu72 interact both genetically and physically, but the molecular basis of this interaction is not known. Here we present a crystal structure of the core domain of TFIIB in two new conformations that differ in the relative distance and orientation of the two cyclin-like domains. The observed extraordinary conformational plasticity may underlie the binding of TFIIB to multiple transcription factors and promoter DNAs that occurs in distinct stages of transcription, including initiation, reinitiation, and gene looping. We mapped the binding interface of the TFIIB-Ssu72 complex using a series of systematic, structure-guided in vitro binding and site-specific photocross-linking assays. Our results indicate that Ssu72 competes with acidic activators for TFIIB binding and that Ssu72 disrupts an intramolecular TFIIB complex known to impede transcription initiation. We also show that the TFIIB-binding site on Ssu72 overlaps with the binding site of symplekin, a component of the mRNA processing and polyadenylation complex. We propose a hand-off model in which Ssu72 mediates a conformational transition in TFIIB, accounting for the role of Ssu72 in transcription reinitiation, gene looping, and promoter-terminator cross-talk. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Srivastava, Ankita; Bhattacharya, Alok; Bhattacharya, Sudha; Jhingan, Gagan Deep
2016-03-01
Initiation of rDNA transcription requires the assembly of a specific multi-protein complex at the rDNA promoter containing the RNA Pol I with auxiliary factors. One of these factors is known as Rrn3P in yeast and Transcription Initiation Factor IA (TIF-IA) in mammals. Rrn3p/TIF-IA serves as a bridge between RNA Pol I and the pre-initiation complex at the promoter. It is phosphorylated at multiple sites and is involved in regulation of rDNA transcription in a growth-dependent manner. In the early branching parasitic protist Entamoeba histolytica, the rRNA genes are present exclusively on circular extra chromosomal plasmids. The protein factors involved in regulation of rDNA transcription in E. histolytica are not known. We have identified the E. histolytica equivalent of TIF-1A (EhTIF-IA) by homology search within the database and was further cloned and expressed. Immuno-localization studies showed that EhTIF-IA co-localized partially with fibrillarin in the peripherally localized nucleolus. EhTIF-IA was shown to interact with the RNA Pol I-specific subunit RPA12 both in vivo and in vitro. Mass spectroscopy data identified RNA Pol I-specific subunits and other nucleolar proteins to be the interacting partners of EhTIF-IA. Our study demonstrates for the first time a conserved putative RNA Pol I transcription factor TIF-IA in E. histolytica.
Chen, X B; Velicer, L F
1991-01-01
Marek's disease is an oncogenic disease of chickens caused by a herpesvirus, Marek's disease virus (MDV). Serial in vitro passage of pathogenic MDV results in amplification of a 132-bp direct repeat in the MDV genome's TRL and IRL repeat regions and loss of tumorigenicity. This led to the hypothesis that upon such expansion, one or more tumor-inducing genes fail to be expressed. In this report a group of cDNAs mapping in the expanded regions were isolated from a pathogenic MDV strain in which the 132-bp direct repeat number was found to range between one and seven. Partial cDNA sequencing and S1 nuclease protection analysis revealed that the corresponding transcripts are either initiated or terminated within or near the expanded regions at multiple sites in both rightward and leftward directions. Furthermore, each 132-bp repeat contains one TATA box and two polyadenylation consensus sequences in each direction. These RNAs contain a partial copy or one or more full copies of the 132-bp direct repeat at either their 5' or 3' end. Northern (RNA) blot analysis showed that the majority of transcripts are 1.8 kb in size, while the minor species range in size from 0.67 to 3.1 kb. Together, these data raise the possibility that the 132-bp direct repeat, and indirectly its copy number, may be involved in the regulation of transcriptional initiation and termination and therefore in the generation of four groups of transcripts from the TRL and IRL, although this remains to be demonstrated. Images PMID:1850022
Bacterial Sigma Factors and Anti-Sigma Factors: Structure, Function and Distribution
Paget, Mark S.
2015-01-01
Sigma factors are multi-domain subunits of bacterial RNA polymerase (RNAP) that play critical roles in transcription initiation, including the recognition and opening of promoters as well as the initial steps in RNA synthesis. This review focuses on the structure and function of the major sigma-70 class that includes the housekeeping sigma factor (Group 1) that directs the bulk of transcription during active growth, and structurally-related alternative sigma factors (Groups 2–4) that control a wide variety of adaptive responses such as morphological development and the management of stress. A recurring theme in sigma factor control is their sequestration by anti-sigma factors that occlude their RNAP-binding determinants. Sigma factors are then released through a wide variety of mechanisms, often involving branched signal transduction pathways that allow the integration of distinct signals. Three major strategies for sigma release are discussed: regulated proteolysis, partner-switching, and direct sensing by the anti-sigma factor. PMID:26131973
Core Mediator structure at 3.4 Å extends model of transcription initiation complex.
Nozawa, Kayo; Schneider, Thomas R; Cramer, Patrick
2017-05-11
Mediator is a multiprotein co-activator that binds the transcription pre-initiation complex (PIC) and regulates RNA polymerase (Pol) II. The Mediator head and middle modules form the essential core Mediator (cMed), whereas the tail and kinase modules play regulatory roles. The architecture of Mediator and its position on the PIC are known, but atomic details are limited to Mediator subcomplexes. Here we report the crystal structure of the 15-subunit cMed from Schizosaccharomyces pombe at 3.4 Å resolution. The structure shows an unaltered head module, and reveals the intricate middle module, which we show is globally required for transcription. Sites of known Mediator mutations cluster at the interface between the head and middle modules, and in terminal regions of the head subunits Med6 (ref. 16) and Med17 (ref. 17) that tether the middle module. The structure led to a model for Saccharomyces cerevisiae cMed that could be combined with the 3.6 Å cryo-electron microscopy structure of the core PIC (cPIC). The resulting atomic model of the cPIC-cMed complex informs on interactions of the submodules forming the middle module, called beam, knob, plank, connector, and hook. The hook is flexibly linked to Mediator by a conserved hinge and contacts the transcription initiation factor IIH (TFIIH) kinase that phosphorylates the carboxy (C)-terminal domain (CTD) of Pol II and was recently positioned on the PIC. The hook also contains residues that crosslink to the CTD and reside in a previously described cradle. These results provide a framework for understanding Mediator function, including its role in stimulating CTD phosphorylation by TFIIH.
Karygianni, Lamprini; Jähnig, Andrea; Schienle, Stefanie; Bernsmann, Falk; Adolfsson, Erik; Kohal, Ralf J.; Chevalier, Jérôme; Hellwig, Elmar; Al-Ahmad, Ali
2013-01-01
Bacterial adhesion to implant biomaterials constitutes a virulence factor leading to biofilm formation, infection and treatment failure. The aim of this study was to examine the initial bacterial adhesion on different implant materials in vitro. Four implant biomaterials were incubated with Enterococcus faecalis, Staphylococcus aureus and Candida albicans for 2 h: 3 mol % yttria-stabilized tetragonal zirconia polycrystal surface (B1a), B1a with zirconium oxide (ZrO2) coating (B2a), B1a with zirconia-based composite coating (B1b) and B1a with zirconia-based composite and ZrO2 coatings (B2b). Bovine enamel slabs (BES) served as control. The adherent microorganisms were quantified and visualized using scanning electron microscopy (SEM); DAPI and live/dead staining. The lowest bacterial count of E. faecalis was detected on BES and the highest on B1a. The fewest vital C. albicans strains (42.22%) were detected on B2a surfaces, while most E. faecalis and S. aureus strains (approximately 80%) were vital overall. Compared to BES; coated and uncoated zirconia substrata exhibited no anti-adhesive properties. Further improvement of the material surface characteristics is essential. PMID:28788415
Karygianni, Lamprini; Jähnig, Andrea; Schienle, Stefanie; Bernsmann, Falk; Adolfsson, Erik; Kohal, Ralf J; Chevalier, Jérôme; Hellwig, Elmar; Al-Ahmad, Ali
2013-12-04
Bacterial adhesion to implant biomaterials constitutes a virulence factor leading to biofilm formation, infection and treatment failure. The aim of this study was to examine the initial bacterial adhesion on different implant materials in vitro . Four implant biomaterials were incubated with Enterococcus faecalis , Staphylococcus aureus and Candida albicans for 2 h: 3 mol % yttria-stabilized tetragonal zirconia polycrystal surface (B1a), B1a with zirconium oxide (ZrO₂) coating (B2a), B1a with zirconia-based composite coating (B1b) and B1a with zirconia-based composite and ZrO₂ coatings (B2b). Bovine enamel slabs (BES) served as control. The adherent microorganisms were quantified and visualized using scanning electron microscopy (SEM); DAPI and live/dead staining. The lowest bacterial count of E. faecalis was detected on BES and the highest on B1a. The fewest vital C. albicans strains (42.22%) were detected on B2a surfaces, while most E. faecalis and S. aureus strains (approximately 80%) were vital overall. Compared to BES; coated and uncoated zirconia substrata exhibited no anti-adhesive properties. Further improvement of the material surface characteristics is essential.
Hu, J C; Gross, C A
1985-01-01
The sigma subunits of bacterial RNA polymerases are required for the selective initiation of transcription. We have isolated and characterized mutations in rpoD, the gene which encodes the major form of sigma in E. coli, which affect the selectivity of transcription. These mutations increase the expression of araBAD up to 12-fold in the absence of CAP-cAMP. Expression of lac is unaffected, while expression of malT-activated operons is decreased. We determined the DNA sequence of 17 independently isolated mutations, and found that they consist of three different changes in a single CGC arginine codon at position 596 in the sigma polypeptide.
Heckenberg, Sebastiaan G B; Brouwer, Matthijs C; van de Beek, Diederik
2014-01-01
Bacterial meningitis is a neurologic emergency. Vaccination against common pathogens has decreased the burden of disease. Early diagnosis and rapid initiation of empiric antimicrobial and adjunctive therapy are vital. Therapy should be initiated as soon as blood cultures have been obtained, preceding any imaging studies. Clinical signs suggestive of bacterial meningitis include fever, headache, meningismus, and an altered level of consciousness but signs may be scarce in children, in the elderly, and in meningococcal disease. Host genetic factors are major determinants of susceptibility to meningococcal and pneumococcal disease. Dexamethasone therapy has been implemented as adjunctive treatment of adults with pneumococcal meningitis. Adequate and prompt treatment of bacterial meningitis is critical to outcome. In this chapter we review the epidemiology, pathophysiology, and management of bacterial meningitis. © 2014 Elsevier B.V. All rights reserved.
Li, Xiaolin; Fan, Shuhong; Hu, Wei; Liu, Guoyin; Wei, Yunxie; He, Chaozu; Shi, Haitao
2017-01-01
Basic domain-leucine zipper (bZIP) transcription factor, one type of conserved gene family, plays an important role in plant development and stress responses. Although 77 MebZIPs have been genome-wide identified in cassava, their in vivo roles remain unknown. In this study, we analyzed the expression pattern and the function of two MebZIPs ( MebZIP3 and MebZIP5 ) in response to pathogen infection. Gene expression analysis indicated that MebZIP3 and MebZIP5 were commonly regulated by flg22, Xanthomonas axonopodis pv. manihotis ( Xam ), salicylic acid (SA), and hydrogen peroxide (H 2 O 2 ). Subcellular localization analysis showed that MebZIP3 and MebZIP5 are specifically located in cell nucleus. Through overexpression in tobacco, we found that MebZIP3 and MebZIP5 conferred improved disease resistance against cassava bacterial blight, with more callose depositions. On the contrary, MebZIP3- and MebZIP5 -silenced plants by virus-induced gene silencing (VIGS) showed disease sensitive phenotype, lower transcript levels of defense-related genes and less callose depositions. Taken together, this study highlights the positive role of MebZIP3 and MebZIP5 in disease resistance against cassava bacterial blight for further utilization in genetic improvement of cassava disease resistance.
Scieglinska, D; Widłak, W; Konopka, W; Poutanen, M; Rahman, N; Huhtaniemi, I; Krawczyk, Z
2001-01-01
The rat Hst70 gene and its mouse counterpart Hsp70.2 belong to the family of Hsp70 heat shock genes and are specifically expressed in male germ cells. Previous studies regarding the structure of the 5' region of the transcription unit of these genes as well as localization of the 'cis' elements conferring their testis-specific expression gave contradictory results [Widlak, Markkula, Krawczyk, Kananen and Huhtaniemi (1995) Biochim. Biophys. Acta 1264, 191-200; Dix, Rosario-Herrle, Gotoh, Mori, Goulding, Barret and Eddy (1996) Dev. Biol. 174, 310-321]. In the present paper we solve these controversies and show that the 5' untranslated region (UTR) of the Hst70 gene contains an intron which is localized similar to that of the mouse Hsp70.2 gene. Reverse transcriptase-mediated PCR, Northern blotting and RNase protection analysis revealed that the transcription initiation of both genes starts at two main distant sites, and one of them is localized within the intron. As a result two populations of Hst70 gene transcripts with similar sizes but different 5' UTR structures can be detected in total testicular RNA. Functional analysis of the Hst70 gene promoter in transgenic mice and transient transfection assays proved that the DNA fragment of approx. 360 bp localized upstream of the ATG transcription start codon is the minimal promoter required for testis-specific expression of the HST70/chloramphenicol acetyltransferase transgene. These experiments also suggest that the expression of the gene may depend on 'cis' regulatory elements localized within exon 1 and the intron sequences. PMID:11563976
García-López, M. Carmen; Pelechano, Vicent; Mirón-García, M. Carmen; Garrido-Godino, Ana I.; García, Alicia; Calvo, Olga; Werner, Michel; Pérez-Ortín, José E.; Navarro, Francisco
2011-01-01
RNA polymerase (pol) II establishes many protein–protein interactions with transcriptional regulators to coordinate different steps of transcription. Although some of these interactions have been well described, little is known about the existence of RNA pol II regions involved in contact with transcriptional regulators. We hypothesize that conserved regions on the surface of RNA pol II contact transcriptional regulators. We identified such an RNA pol II conserved region that includes the majority of the “foot” domain and identified interactions of this region with Mvp1, a protein required for sorting proteins to the vacuole, and Spo14, a phospholipase D. Deletion of MVP1 and SPO14 affects the transcription of their target genes and increases phosphorylation of Ser5 in the carboxy-terminal domain (CTD). Genetic, phenotypic, and functional analyses point to a role for these proteins in transcriptional initiation and/or early elongation, consistent with their genetic interactions with CEG1, a guanylyltransferase subunit of the Saccharomyces cerevisiae capping enzyme. PMID:21954159
The Mediator Complex and Transcription Elongation
Conaway, Ronald C.; Conaway, Joan Weliky
2013-01-01
Background Mediator is an evolutionarily conserved multisubunit RNA polymerase II (Pol II) coregulatory complex. Although Mediator was initially found to play a critical role in regulation of the initiation of Pol II transcription, recent studies have brought to light an expanded role for Mediator at post-initiation stages of transcription. Scope of review We provide a brief description of the structure of Mediator and its function in the regulation of Pol II transcription initiation, and we summarize recent findings implicating Mediator in the regulation of various stages of Pol II transcription elongation. Major conclusions Emerging evidence is revealing new roles for Mediator in nearly all stages of Pol II transcription, including initiation, promoter escape, elongation, pre-mRNA processing, and termination. General significance Mediator plays a central role in the regulation of gene expression by impacting nearly all stages of mRNA synthesis. PMID:22983086
Lazzaro, Martina; Feldman, Mario F; García Véscovi, Eleonora
2017-08-22
The ability to detect and measure danger from an environmental signal is paramount for bacteria to respond accordingly, deploying strategies that halt or counteract potential cellular injury and maximize survival chances. Type VI secretion systems (T6SSs) are complex bacterial contractile nanomachines able to target toxic effectors into neighboring bacteria competing for the same colonization niche. Previous studies support the concept that either T6SSs are constitutively active or they fire effectors in response to various stimuli, such as high bacterial density, cell-cell contact, nutrient depletion, or components from dead sibling cells. For Serratia marcescens , it has been proposed that its T6SS is stochastically expressed, with no distinction between harmless or aggressive competitors. In contrast, we demonstrate that the Rcs regulatory system is responsible for finely tuning Serratia T6SS expression levels, behaving as a transcriptional rheostat. When confronted with harmless bacteria, basal T6SS expression levels suffice for Serratia to eliminate the competitor. A moderate T6SS upregulation is triggered when, according to the aggressor-prey ratio, an unbalanced interplay between homologous and heterologous effectors and immunity proteins takes place. Higher T6SS expression levels are achieved when Serratia is challenged by a contender like Acinetobacter , which indiscriminately fires heterologous effectors able to exert lethal cellular harm, threatening the survival of the Serratia population. We also demonstrate that Serratia 's RcsB-dependent T6SS regulatory mechanism responds not to general stress signals but to the action of specific effectors from competitors, displaying an exquisite strategy to weigh risks and keep the balance between energy expenditure and fitness costs. IMPORTANCE Serratia marcescens is among the health-threatening pathogens categorized by the WHO as research priorities to develop alternative antimicrobial strategies, and it was
Wada, C; Imai, M; Yura, T
1987-01-01
Replication of F factor or mini-F plasmid is strongly inhibited in the rpoH (htpR) mutants of Escherichia coli deficient in the sigma factor (sigma 32) known to be required for heat shock gene expression. Transcription of the mini-F repE gene encoding a replication initiator protein (E protein) was examined by operon fusion and by direct determination of repE mRNA. The synthesis rate and the level of repE mRNA were found to increase transiently upon temperature upshift (30 degrees C to 42 degrees C) in wild-type cells but to decrease rapidly in the rpoH mutants. Thus sigma 32 appeared to be directly involved in transcription of repE whose product, E protein, in turn activates DNA replication from the mini-F ori2 region. This scheme of host-controlled plasmid replication is further supported by the analysis of transcription in vitro: RNA synthesis can be initiated from the repE promoter by a minor form of RNA polymerase containing sigma 32 but not by the major polymerase containing the normal sigma factor sigma 70. The sigma 32-mediated transcription from the repE promoter is strongly inhibited by the E protein. We conclude that transcription of the mini-F repE gene is mediated by the host transcription factor sigma 32 and is negatively controlled by its own product. Images PMID:2447584
USDA-ARS?s Scientific Manuscript database
Transcription activator-like (TAL) effectors found in Xanthomonas spp. promote bacterial growth and plant susceptibility by binding specific DNA sequences or, effector-binding elements (EBEs), and inducing host gene expression. In this study, we have found substantially different transcriptional pro...
DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus
Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...
2014-08-23
Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less
Lee, Bomi; Wu, Cheng-Ying; Lin, Yi-Wei; Park, Sung Wook; Wei, Li-Na
2016-01-01
All-trans Retinoic acid (RA) and its derivatives are potent therapeutics for immunological functions including wound repair. However, the molecular mechanism of RA modulation in innate immunity is poorly understood, especially in macrophages. We found that topical application of RA significantly improves wound healing and that RA and IL-4 synergistically activate Arg1, a critical gene for tissue repair, in M2 polarized macrophages. This involves feed forward regulation of Raldh2, a rate-limiting enzyme for RA biosynthesis, and requires Med25 to coordinate RAR, STAT6 and chromatin remodeler, Brg1 to remodel the +1 nucleosome of Arg1 for transcription initiation. By recruiting elongation factor TFIIS, Med25 also facilitates transcriptional initiation-elongation coupling. This study uncovers synergistic activation of Arg1 by RA and IL-4 in M2 macrophages that involves feed forward regulation of RA synthesis and dual functions of Med25 in nucleosome remodeling and transcription initiation-elongation coupling that underlies robust modulatory activity of RA in innate immunity. PMID:27166374
Wu, Yi-Hsuan; Taggart, Janet; Song, Pamela Xiyao; MacDiarmid, Colin; Eide, David J.
2016-01-01
The Msc2 and Zrg17 proteins of Saccharomyces cerevisiae form a complex to transport zinc into the endoplasmic reticulum. ZRG17 is transcriptionally induced in zinc-limited cells by the Zap1 transcription factor. In this report, we show that MSC2 mRNA also increases (~1.5 fold) in zinc-limited cells. The MSC2 gene has two in-frame ATG codons at its 5’ end, ATG1 and ATG2; ATG2 is the predicted initiation codon. When the MSC2 promoter was fused at ATG2 to the lacZ gene, we found that unlike the chromosomal gene this reporter showed a 4-fold decrease in lacZ mRNA in zinc-limited cells. Surprisingly, β-galactosidase activity generated by this fusion gene increased ~7 fold during zinc deficiency suggesting the influence of post-transcriptional factors. Transcription of MSC2ATG2-lacZ was found to start upstream of ATG1 in zinc-replete cells. In zinc-limited cells, transcription initiation shifted to sites just upstream of ATG2. From the results of mutational and polysome profile analyses, we propose the following explanation for these effects. In zinc-replete cells, MSC2ATG2-lacZ mRNA with long 5’ UTRs fold into secondary structures that inhibit translation. In zinc-limited cells, transcripts with shorter unstructured 5’ UTRs are generated that are more efficiently translated. Surprisingly, chromosomal MSC2 did not show start site shifts in response to zinc status and only shorter 5’ UTRs were observed. However, the shifts that occur in the MSC2ATG2-lacZ construct led us to identify significant transcription start site changes affecting the expression of ~3% of all genes. Therefore, zinc status can profoundly alter transcription initiation across the yeast genome. PMID:27657924
Koppstein, David; Ashour, Joseph; Bartel, David P.
2015-01-01
The influenza polymerase cleaves host RNAs ∼10–13 nucleotides downstream of their 5′ ends and uses this capped fragment to prime viral mRNA synthesis. To better understand this process of cap snatching, we used high-throughput sequencing to determine the 5′ ends of A/WSN/33 (H1N1) influenza mRNAs. The sequences provided clear evidence for nascent-chain realignment during transcription initiation and revealed a strong influence of the viral template on the frequency of realignment. After accounting for the extra nucleotides inserted through realignment, analysis of the capped fragments indicated that the different viral mRNAs were each prepended with a common set of sequences and that the polymerase often cleaved host RNAs after a purine and often primed transcription on a single base pair to either the terminal or penultimate residue of the viral template. We also developed a bioinformatic approach to identify the targeted host transcripts despite limited information content within snatched fragments and found that small nuclear RNAs and small nucleolar RNAs contributed the most abundant capped leaders. These results provide insight into the mechanism of viral transcription initiation and reveal the diversity of the cap-snatched repertoire, showing that noncoding transcripts as well as mRNAs are used to make influenza mRNAs. PMID:25901029
Transcription Factor Interplay between LEAFY and APETALA1/CAULIFLOWER during Floral Initiation.
Goslin, Kevin; Zheng, Beibei; Serrano-Mislata, Antonio; Rae, Liina; Ryan, Patrick T; Kwaśniewska, Kamila; Thomson, Bennett; Ó'Maoiléidigh, Diarmuid S; Madueño, Francisco; Wellmer, Frank; Graciet, Emmanuelle
2017-06-01
The transcription factors LEAFY (LFY) and APETALA1 (AP1), together with the AP1 paralog CAULIFLOWER (CAL), control the onset of flower development in a partially redundant manner. This redundancy is thought to be mediated, at least in part, through the regulation of a shared set of target genes. However, whether these genes are independently or cooperatively regulated by LFY and AP1/CAL is currently unknown. To better understand the regulatory relationship between LFY and AP1/CAL and to obtain deeper insights into the control of floral initiation, we monitored the activity of LFY in the absence of AP1/CAL function. We found that the regulation of several known LFY target genes is unaffected by AP1/CAL perturbation, while others appear to require AP1/CAL activity. Furthermore, we obtained evidence that LFY and AP1/CAL control the expression of some genes in an antagonistic manner. Notably, these include key regulators of floral initiation such as TERMINAL FLOWER1 ( TFL1 ), which had been previously reported to be directly repressed by both LFY and AP1. We show here that TFL1 expression is suppressed by AP1 but promoted by LFY. We further demonstrate that LFY has an inhibitory effect on flower formation in the absence of AP1/CAL activity. We propose that LFY and AP1/CAL act as part of an incoherent feed-forward loop, a network motif where two interconnected pathways or transcription factors act in opposite directions on a target gene, to control the establishment of a stable developmental program for the formation of flowers. © 2017 American Society of Plant Biologists. All Rights Reserved.
Verrier, C S; Roodi, N; Yee, C J; Bailey, L R; Jensen, R A; Bustin, M; Parl, F F
1997-07-01
The estrogen receptor (ER) belongs to a family of ligand-inducible nuclear receptors that exert their effects by binding to cis-acting DNA elements in the regulatory region of target genes. The detailed mechanisms by which ER interacts with the estrogen response element (ERE) and affects transcription still remain to be elucidated. To study the ER-ERE interaction and transcription initiation, we employed purified recombinant ER expressed in both the baculovirus-Sf9 and his-tagged bacterial systems. The effect of high-mobility group (HMG) protein HMG-1 and purified recombinant TATA-binding protein-associated factor TAF(II)30 on ER-ERE binding and transcription initiation were assessed by electrophoretic mobility shift assay and in vitro transcription from an ERE-containing template (pERE2LovTATA), respectively. We find that purified, recombinant ER fails to bind to ERE in spite of high ligand-binding activity and electrophoretic and immunological properties identical to ER in MCF-7 breast cancer cells. HMG-1 interacts with ER and promotes ER-ERE binding in a concentration- and time-dependent manner. The effectiveness of HMG-1 to stimulate ER-ERE binding in the electrophoretic mobility shift assay depends on the sequence flanking the ERE consensus as well as the position of the latter in the oligonucleotide. We find that TAF(II)30 has no effect on ER-ERE binding either alone or in combination with ER and HMG-1. Although HMG-1 promotes ER-ERE binding, it fails to stimulate transcription initiation either in the presence or absence of hormone. In contrast, TAF(II)30, while not affecting ER-ERE binding, stimulates transcription initiation 20-fold in the presence of HMG-1. These results indicate that HMG-1 and TAF(II)30 act in sequence, the former acting to promote ER-ERE binding followed by the latter to stimulate transcription initiation.
The Transcription Terminator Rho: A First Bacterial Prion.
Pallarès, Irantzu; Ventura, Salvador
2017-06-01
Traditionally associated with neurodegenerative diseases, prions are increasingly recognized for their potential to confer beneficial traits on eukaryotic organisms. The discovery of the first bacterial prion suggests that the sustained mechanism of prion assembly is an ancient molecular tool aimed at providing fast and persistent adaptation to changing environments. Copyright © 2017 Elsevier Ltd. All rights reserved.
Godahewa, G I; Perera, N C N; Lee, Sukkyoung; Kim, Myoung-Jin; Lee, Jehee
2017-09-05
Cathepsin Z (CTSZ) is lysosomal cysteine protease of the papain superfamily. It participates in the host immune defense via phagocytosis, signal transduction, cell-cell communication, proliferation, and migration of immune cells such as monocytes, macrophages, and dendritic cells. Hence, CTSZ is also acknowledged as an acute-phase protein in host immunity. In this study, we sought to identify the CTSZ homolog from disk abalone (AbCTSZ) and characterize it at the molecular, genomic, and transcriptional levels. AbCTSZ encodes a protein with 318 amino acids and a molecular mass of 36kDa. The structure of AbCTSZ reveals amino acid sequences that are characteristic of the signal sequence, pro-peptide, peptidase-C1 papain family cysteine protease domain, mini-loop, HIP motif, N-linked glycosylation sites, active sites, and conserved Cys residues. A pairwise comparison revealed that AbCTSZ shared the highest amino acid homology with its molluscan counterpart from Crassostrea gigas. A multiple alignment analysis revealed the conservation of functionally crucial elements of AbCTSZ, and a phylogenetic study further confirmed a proximal evolutionary relationship with its invertebrate counterparts. Further, an analysis of AbCTSZ genomic structure revealed seven exons separated by six introns, which differs from that of its vertebrate counterparts. Quantitative real time PCR (qPCR) detected the transcripts of AbCTSZ in early developmental stages and in eight different tissues. Higher levels of AbCTSZ transcripts were found in trochophore, gill, and hemocytes, highlighting its importance in the early development and immunity of disk abalone. In addition, we found that viable bacteria (Vibrio parahaemolyticus and Listeria monocytogenes) and bacterial lipopolysaccharides significantly modulated AbCTSZ transcription. Collectively, these lines of evidences suggest that AbCTSZ plays an indispensable role in the innate immunity of disk abalone. Copyright © 2017. Published by Elsevier
Mela, Francesca; Fritsche, Kathrin; de Boer, Wietse; van Veen, Johannes A; de Graaff, Leo H; van den Berg, Marlies; Leveau, Johan H J
2011-01-01
Interactions between bacteria and fungi cover a wide range of incentives, mechanisms and outcomes. The genus Collimonas consists of soil bacteria that are known for their antifungal activity and ability to grow at the expense of living fungi. In non-contact confrontation assays with the fungus Aspergillus niger, Collimonas fungivorans showed accumulation of biomass concomitant with inhibition of hyphal spread. Through microarray analysis of bacterial and fungal mRNA from the confrontation arena, we gained new insights into the mechanisms underlying the fungistatic effect and mycophagous phenotype of collimonads. Collimonas responded to the fungus by activating genes for the utilization of fungal-derived compounds and for production of a putative antifungal compound. In A. niger, differentially expressed genes included those involved in lipid and cell wall metabolism and cell defense, which correlated well with the hyphal deformations that were observed microscopically. Transcriptional profiles revealed distress in both partners: downregulation of ribosomal proteins and upregulation of mobile genetic elements in the bacteria and expression of endoplasmic reticulum stress and conidia-related genes in the fungus. Both partners experienced nitrogen shortage in each other's presence. Overall, our results indicate that the Collimonas/Aspergillus interaction is a complex interplay between trophism, antibiosis and competition for nutrients. PMID:21614084
Antisense transcription is pervasive but rarely conserved in enteric bacteria.
Raghavan, Rahul; Sloan, Daniel B; Ochman, Howard
2012-01-01
Noncoding RNAs, including antisense RNAs (asRNAs) that originate from the complementary strand of protein-coding genes, are involved in the regulation of gene expression in all domains of life. Recent application of deep-sequencing technologies has revealed that the transcription of asRNAs occurs genome-wide in bacteria. Although the role of the vast majority of asRNAs remains unknown, it is often assumed that their presence implies important regulatory functions, similar to those of other noncoding RNAs. Alternatively, many antisense transcripts may be produced by chance transcription events from promoter-like sequences that result from the degenerate nature of bacterial transcription factor binding sites. To investigate the biological relevance of antisense transcripts, we compared genome-wide patterns of asRNA expression in closely related enteric bacteria, Escherichia coli and Salmonella enterica serovar Typhimurium, by performing strand-specific transcriptome sequencing. Although antisense transcripts are abundant in both species, less than 3% of asRNAs are expressed at high levels in both species, and only about 14% appear to be conserved among species. And unlike the promoters of protein-coding genes, asRNA promoters show no evidence of sequence conservation between, or even within, species. Our findings suggest that many or even most bacterial asRNAs are nonadaptive by-products of the cell's transcription machinery. IMPORTANCE Application of high-throughput methods has revealed the expression throughout bacterial genomes of transcripts encoded on the strand complementary to protein-coding genes. Because transcription is costly, it is usually assumed that these transcripts, termed antisense RNAs (asRNAs), serve some function; however, the role of most asRNAs is unclear, raising questions about their relevance in cellular processes. Because natural selection conserves functional elements, comparisons between related species provide a method for assessing
A new paradigm for transcription factor TFIIB functionality
Gelev, Vladimir; Zabolotny, Janice M.; Lange, Martin; Hiromura, Makoto; Yoo, Sang Wook; Orlando, Joseph S.; Kushnir, Anna; Horikoshi, Nobuo; Paquet, Eric; Bachvarov, Dimcho; Schaffer, Priscilla A.; Usheva, Anny
2014-01-01
Experimental and bioinformatic studies of transcription initiation by RNA polymerase II (RNAP2) have revealed a mechanism of RNAP2 transcription initiation less uniform across gene promoters than initially thought. However, the general transcription factor TFIIB is presumed to be universally required for RNAP2 transcription initiation. Based on bioinformatic analysis of data and effects of TFIIB knockdown in primary and transformed cell lines on cellular functionality and global gene expression, we report that TFIIB is dispensable for transcription of many human promoters, but is essential for herpes simplex virus-1 (HSV-1) gene transcription and replication. We report a novel cell cycle TFIIB regulation and localization of the acetylated TFIIB variant on the transcriptionally silent mitotic chromatids. Taken together, these results establish a new paradigm for TFIIB functionality in human gene expression, which when downregulated has potent anti-viral effects. PMID:24441171
Rodrigues, Raquel; Grosso, Ana Rita; Moita, Luís
2013-01-01
The immune system relies on the plasticity of its components to produce appropriate responses to frequent environmental challenges. Dendritic cells (DCs) are critical initiators of innate immunity and orchestrate the later and more specific adaptive immunity. The generation of diversity in transcriptional programs is central for effective immune responses. Alternative splicing is widely considered a key generator of transcriptional and proteomic complexity, but its role has been rarely addressed systematically in immune cells. Here we used splicing-sensitive arrays to assess genome-wide gene- and exon-level expression profiles in human DCs in response to a bacterial challenge. We find widespread alternative splicing events and splicing factor transcriptional signatures induced by an E. coli challenge to human DCs. Alternative splicing acts in concert with transcriptional modulation, but these two mechanisms of gene regulation affect primarily distinct functional gene groups. Alternative splicing is likely to have an important role in DC immunobiology because it affects genes known to be involved in DC development, endocytosis, antigen presentation and cell cycle arrest.
Reading of the non-template DNA by transcription elongation factors.
Svetlov, Vladimir; Nudler, Evgeny
2018-05-14
Unlike transcription initiation and termination, which have easily discernable signals such as promoters and terminators, elongation is regulated through a dynamic network involving RNA/DNA pause signals and states- rather than sequence-specific protein interactions. A report by Nedialkov et al. (in press) provides experimental evidence for sequence-specific recruitment of elongation factor RfaH to transcribing RNA polymerase (RNAP) and outlines the mechanism of gene expression regulation by restraint ("locking") of the DNA non-template strand. According to this model, the elongation complex pauses at the so called "operon polarity sequence" (found in some long bacterial operons coding for virulence genes), when the usually flexible non-template DNA strand adopts a distinct hairpin-loop conformation on the surface of transcribing RNAP. Sequence-specific binding of RfaH to this DNA segment facilitates conversion of RfaH from its inactive closed to its active open conformation. The interaction network formed between RfaH, non-template DNA, and RNAP locks DNA in a conformation that renders the elongation complex resistant to pausing and termination. The effects of such locking on transcript elongation can be mimicked by restraint of the non-template strand due to its shortening. This work advances our understanding of regulation of transcript elongation and has important implications for the action of general transcription factors, such as NusG, which lack apparent sequence-specificity, as well as for the mechanisms of other processes linked to transcription such as transcription-coupled DNA repair. This article is protected by copyright. All rights reserved. © 2018 John Wiley & Sons Ltd.
Inhibition of master transcription factors in pluripotent cells induces early stage differentiation
De, Debojyoti; Jeong, Myong-Ho; Leem, Young-Eun; Svergun, Dmitri I.; Wemmer, David E.; Kang, Jong-Sun; Kim, Kyeong Kyu; Kim, Sung-Hou
2014-01-01
The potential for pluripotent cells to differentiate into diverse specialized cell types has given much hope to the field of regenerative medicine. Nevertheless, the low efficiency of cell commitment has been a major bottleneck in this field. Here we provide a strategy to enhance the efficiency of early differentiation of pluripotent cells. We hypothesized that the initial phase of differentiation can be enhanced if the transcriptional activity of master regulators of stemness is suppressed, blocking the formation of functional transcriptomes. However, an obstacle is the lack of an efficient strategy to block protein–protein interactions. In this work, we take advantage of the biochemical property of seventeen kilodalton protein (Skp), a bacterial molecular chaperone that binds directly to sex determining region Y-box 2 (Sox2). The small angle X-ray scattering analyses provided a low resolution model of the complex and suggested that the transactivation domain of Sox2 is probably wrapped in a cleft on Skp trimer. Upon the transduction of Skp into pluripotent cells, the transcriptional activity of Sox2 was inhibited and the expression of Sox2 and octamer-binding transcription factor 4 was reduced, which resulted in the expression of early differentiation markers and appearance of early neuronal and cardiac progenitors. These results suggest that the initial stage of differentiation can be accelerated by inhibiting master transcription factors of stemness. This strategy can possibly be applied to increase the efficiency of stem cell differentiation into various cell types and also provides a clue to understanding the mechanism of early differentiation. PMID:24434556
Uprety, Bhawana; Sen, Rwik
2015-01-01
NuA4 (nucleosome acetyltransferase of H4) promotes transcriptional initiation of TFIID (a complex of TBP and TBP-associated factors [TAFs])-dependent ribosomal protein genes involved in ribosome biogenesis. However, it is not clearly understood how NuA4 regulates the transcription of ribosomal protein genes. Here, we show that NuA4 is recruited to the promoters of ribosomal protein genes, such as RPS5, RPL2B, and RPS11B, for TFIID recruitment to initiate transcription, and the recruitment of NuA4 to these promoters is impaired in the absence of its Eaf1p component. Intriguingly, impaired NuA4 recruitment in a Δeaf1 strain depletes recruitment of TFIID (a TAF-dependent form of TBP) but not the TAF-independent form of TBP to the promoters of ribosomal protein genes. However, in the absence of NuA4, SAGA (Spt-Ada-Gcn5-acetyltransferase) is involved in targeting the TAF-independent form of TBP to the promoters of ribosomal protein genes for transcriptional initiation. Thus, NuA4 plays an important role in targeting TFIID to the promoters of ribosomal protein genes for transcriptional initiation in vivo. Such a function is mediated via its targeted histone acetyltransferase activity. In the absence of NuA4, ribosomal protein genes lose TFIID dependency and become SAGA dependent for transcriptional initiation. Collectively, these results provide significant insights into the regulation of ribosomal protein gene expression and, hence, ribosome biogenesis and functions. PMID:26100014
Lim, Vivian; Naim, Ahmad Nazri Mohamed; Bifani, Pablo; Boshoff, Helena I. M.; Sambandamurthy, Vasan K.; Dick, Thomas; Hibberd, Martin L.; Schreiber, Mark; Rao, Srinivasa P. S.
2013-01-01
Most candidate anti-bacterials are identified on the basis of their whole cell anti-bacterial activity. A critical bottleneck in the early discovery of novel anti-bacterials is tracking the structure activity relationship (SAR) of the novel compounds synthesized during the hit to lead and lead optimization stage. It is often very difficult for medicinal chemists to visualize if the novel compounds synthesized for understanding SAR of a particular scaffold have similar molecular mechanism of action (MoA) as that of the initial hit. The elucidation of the molecular MoA of bioactive inhibitors is critical. Here, a new strategy and routine assay for MoA de-convolution, using a microfluidic platform for transcriptional profiling of bacterial response to inhibitors with whole cell activity has been presented. First a reference transcriptome compendium of Mycobacterial response to various clinical and investigational drugs was built. Using feature reduction, it was demonstrated that subsets of biomarker genes representative of the whole genome are sufficient for MoA classification and deconvolution in a medium-throughput microfluidic format ultimately leading to a cost effective and rapid tool for routine antibacterial drug-discovery programs. PMID:23935951
Chang, D D; Clayton, D A
1986-01-01
Transcription of the heavy strand of mouse mitochondrial DNA starts from two closely spaced, distinct sites located in the displacement loop region of the genome. We report here an analysis of regulatory sequences required for faithful transcription from these two sites. Data obtained from in vitro assays demonstrated that a 51-base-pair region, encompassing nucleotides -40 to +11 of the downstream start site, contains sufficient information for accurate transcription from both start sites. Deletion of the 3' flanking sequences, including one or both start sites to -17, resulted in the initiation of transcription by the mitochondrial RNA polymerase from alternative sites within vector DNA sequences. This feature places the mouse heavy-strand promoter uniquely among other known mitochondrial promoters, all of which absolutely require cognate start sites for transcription. Comparison of the heavy-strand promoter with those of other vertebrate mitochondrial DNAs revealed a remarkably high rate of sequence divergence among species. Images PMID:3785226
Antisense Transcription Is Pervasive but Rarely Conserved in Enteric Bacteria
Raghavan, Rahul; Sloan, Daniel B.; Ochman, Howard
2012-01-01
ABSTRACT Noncoding RNAs, including antisense RNAs (asRNAs) that originate from the complementary strand of protein-coding genes, are involved in the regulation of gene expression in all domains of life. Recent application of deep-sequencing technologies has revealed that the transcription of asRNAs occurs genome-wide in bacteria. Although the role of the vast majority of asRNAs remains unknown, it is often assumed that their presence implies important regulatory functions, similar to those of other noncoding RNAs. Alternatively, many antisense transcripts may be produced by chance transcription events from promoter-like sequences that result from the degenerate nature of bacterial transcription factor binding sites. To investigate the biological relevance of antisense transcripts, we compared genome-wide patterns of asRNA expression in closely related enteric bacteria, Escherichia coli and Salmonella enterica serovar Typhimurium, by performing strand-specific transcriptome sequencing. Although antisense transcripts are abundant in both species, less than 3% of asRNAs are expressed at high levels in both species, and only about 14% appear to be conserved among species. And unlike the promoters of protein-coding genes, asRNA promoters show no evidence of sequence conservation between, or even within, species. Our findings suggest that many or even most bacterial asRNAs are nonadaptive by-products of the cell’s transcription machinery. PMID:22872780
The Role of Multiple Transcription Factors In Archaeal Gene Expression
DOE Office of Scientific and Technical Information (OSTI.GOV)
Charles J. Daniels
2008-09-23
Since the inception of this research program, the project has focused on two central questions: What is the relationship between the 'eukaryal-like' transcription machinery of archaeal cells and its counterparts in eukaryal cells? And, how does the archaeal cell control gene expression using its mosaic of eukaryal core transcription machinery and its bacterial-like transcription regulatory proteins? During the grant period we have addressed these questions using a variety of in vivo approaches and have sought to specifically define the roles of the multiple TATA binding protein (TBP) and TFIIB-like (TFB) proteins in controlling gene expression in Haloferax volcanii. H. volcaniimore » was initially chosen as a model for the Archaea based on the availability of suitable genetic tools; however, later studies showed that all haloarchaea possessed multiple tbp and tfb genes, which led to the proposal that multiple TBP and TFB proteins may function in a manner similar to alternative sigma factors in bacterial cells. In vivo transcription and promoter analysis established a clear relationship between the promoter requirements of haloarchaeal genes and those of the eukaryal RNA polymerase II promoter. Studies on heat shock gene promoters, and the demonstration that specific tfb genes were induced by heat shock, provided the first indication that TFB proteins may direct expression of specific gene families. The construction of strains lacking tbp or tfb genes, coupled with the finding that many of these genes are differentially expressed under varying growth conditions, provided further support for this model. Genetic tools were also developed that led to the construction of insertion and deletion mutants, and a novel gene expression scheme was designed that allowed the controlled expression of these genes in vivo. More recent studies have used a whole genome array to examine the expression of these genes and we have established a linkage between the expression of
2013-01-01
Background Sequencing of the genome of Propionibacterium acnes produced a catalogue of genes many of which enable this organism to colonise skin and survive exposure to the elements. Despite this platform, there was little understanding of the gene regulation that gives rise to an organism that has a major impact on human health and wellbeing and causes infections beyond the skin. To address this situation, we have undertaken a genome–wide study of gene regulation using a combination of improved differential and global RNA-sequencing and an analytical approach that takes into account the inherent noise within the data. Results We have produced nucleotide-resolution transcriptome maps that identify and differentiate sites of transcription initiation from sites of stable RNA processing and mRNA cleavage. Moreover, analysis of these maps provides strong evidence for ‘pervasive’ transcription and shows that contrary to initial indications it is not biased towards the production of antisense RNAs. In addition, the maps reveal an extensive array of riboswitches, leaderless mRNAs and small non-protein-coding RNAs alongside vegetative promoters and post-transcriptional events, which includes unusual tRNA processing. The identification of such features will inform models of complex gene regulation, as illustrated here for ribonucleotide reductases and a potential quorum-sensing, two-component system. Conclusions The approach described here, which is transferable to any bacterial species, has produced a step increase in whole-cell knowledge of gene regulation in P. acnes. Continued expansion of our maps to include transcription associated with different growth conditions and genetic backgrounds will provide a new platform from which to computationally model the gene expression that determines the physiology of P. acnes and its role in human disease. PMID:24034785
Houtz, Philip; Bonfini, Alessandro; Liu, Xi; Revah, Jonathan; Guillou, Aurélien; Poidevin, Mickael; Hens, Korneel; Huang, Hsin-Yi; Deplancke, Bart; Tsai, Yu-Chen; Buchon, Nicolas
2017-11-01
Cytokine signaling is responsible for coordinating conserved epithelial regeneration and immune responses in the digestive tract. In the Drosophila midgut, Upd3 is a major cytokine, which is induced in enterocytes (EC) and enteroblasts (EB) upon oral infection, and initiates intestinal stem cell (ISC) dependent tissue repair. To date, the genetic network directing upd3 transcription remains largely uncharacterized. Here, we have identified the key infection-responsive enhancers of the upd3 gene and show that distinct enhancers respond to various stresses. Furthermore, through functional genetic screening, bioinformatic analyses and yeast one-hybrid screening, we determined that the transcription factors Scalloped (Sd), Mothers against dpp (Mad), and D-Fos are principal regulators of upd3 expression. Our study demonstrates that upd3 transcription in the gut is regulated by the activation of multiple pathways, including the Hippo, TGF-β/Dpp, and Src, as well as p38-dependent MAPK pathways. Thus, these essential pathways, which are known to control ISC proliferation cell-autonomously, are also activated in ECs to promote tissue turnover the regulation of upd3 transcription.
Wen, Zhensong; Sertil, Odeniel; Cheng, Yongxin; Zhang, Shanshan; Liu, Xue; Wang, Wen-Ching
2015-01-01
Streptococcus pneumoniae is a major bacterial pathogen in humans. Its polysaccharide capsule is a key virulence factor that promotes bacterial evasion of human phagocytic killing. While S. pneumoniae produces at least 94 antigenically different types of capsule, the genes for biosynthesis of almost all capsular types are arranged in the same locus. The transcription of the capsular polysaccharide (cps) locus is not well understood. This study determined the transcriptional features of the cps locus in the type 2 virulent strain D39. The initial analysis revealed that the cps genes are cotranscribed from a major transcription start site at the −25 nucleotide (G) upstream of cps2A, the first gene in the locus. Using unmarked chromosomal truncations and a luciferase-based transcriptional reporter, we showed that the full transcription of the cps genes not only depends on the core promoter immediately upstream of cps2A, but also requires additional elements upstream of the core promoter, particularly a 59-bp sequence immediately upstream of the core promoter. Unmarked deletions of these promoter elements in the D39 genome also led to significant reduction in CPS production and virulence in mice. Lastly, common cps gene (cps2ABCD) mutants did not show significant abnormality in cps transcription, although they produced significantly less CPS, indicating that the CpsABCD proteins are involved in the encapsulation of S. pneumoniae in a posttranscriptional manner. This study has yielded important information on the transcriptional characteristics of the cps locus in S. pneumoniae. PMID:25733517
Cecocentral scotoma as the initial manifestation of subacute bacterial endocarditis
Strauss, Danielle Savitsky; Baharestani, Samuel; Nemiroff, Julia; Amesur, Kiran; Howard, David
2011-01-01
Introduction: We report a case of a 67-year-old male who presented with a cecocentral scotoma caused by a septic embolus from subacute bacterial endocarditis (SBE). Methods: A 67-year-old man presented with sudden, painless decreased vision in the left eye. A dilated fundoscopic exam, Humphrey visual field test, transthoracic echocardiogram, abdominal computed tomography (CT), and blood cultures were all performed. Results: A dilated fundoscopic exam revealed temporal segmental optic disc pallor on the left, and Humphrey visual field testing demonstrated a dense left cecocentral scotoma. When the patient developed fever (103. 9°F) and palpitations, transthoracic echocardiogram revealed valvular vegetations, and contrast CT of the abdomen revealed an abscess in the dome of the liver likely due to an infectious thrombus. Blood cultures grew viridians group streptococci in three separate peripheral collections. Conclusion: This case illustrates that a sudden cecocentral scotoma may be the initial manifestation of SBE. PMID:21468335
Transcription Factor Interplay between LEAFY and APETALA1/CAULIFLOWER during Floral Initiation1
Zheng, Beibei; Kwaśniewska, Kamila; Thomson, Bennett
2017-01-01
The transcription factors LEAFY (LFY) and APETALA1 (AP1), together with the AP1 paralog CAULIFLOWER (CAL), control the onset of flower development in a partially redundant manner. This redundancy is thought to be mediated, at least in part, through the regulation of a shared set of target genes. However, whether these genes are independently or cooperatively regulated by LFY and AP1/CAL is currently unknown. To better understand the regulatory relationship between LFY and AP1/CAL and to obtain deeper insights into the control of floral initiation, we monitored the activity of LFY in the absence of AP1/CAL function. We found that the regulation of several known LFY target genes is unaffected by AP1/CAL perturbation, while others appear to require AP1/CAL activity. Furthermore, we obtained evidence that LFY and AP1/CAL control the expression of some genes in an antagonistic manner. Notably, these include key regulators of floral initiation such as TERMINAL FLOWER1 (TFL1), which had been previously reported to be directly repressed by both LFY and AP1. We show here that TFL1 expression is suppressed by AP1 but promoted by LFY. We further demonstrate that LFY has an inhibitory effect on flower formation in the absence of AP1/CAL activity. We propose that LFY and AP1/CAL act as part of an incoherent feed-forward loop, a network motif where two interconnected pathways or transcription factors act in opposite directions on a target gene, to control the establishment of a stable developmental program for the formation of flowers. PMID:28385730
Modeling the integration of bacterial rRNA fragments into the human cancer genome.
Sieber, Karsten B; Gajer, Pawel; Dunning Hotopp, Julie C
2016-03-21
Cancer is a disease driven by the accumulation of genomic alterations, including the integration of exogenous DNA into the human somatic genome. We previously identified in silico evidence of DNA fragments from a Pseudomonas-like bacteria integrating into the 5'-UTR of four proto-oncogenes in stomach cancer sequencing data. The functional and biological consequences of these bacterial DNA integrations remain unknown. Modeling of these integrations suggests that the previously identified sequences cover most of the sequence flanking the junction between the bacterial and human DNA. Further examination of these reads reveals that these integrations are rich in guanine nucleotides and the integrated bacterial DNA may have complex transcript secondary structures. The models presented here lay the foundation for future experiments to test if bacterial DNA integrations alter the transcription of the human genes.
Fungal Innate Immunity Induced by Bacterial Microbe-Associated Molecular Patterns (MAMPs)
Ipcho, Simon; Sundelin, Thomas; Erbs, Gitte; Kistler, H. Corby; Newman, Mari-Anne; Olsson, Stefan
2016-01-01
Plants and animals detect bacterial presence through Microbe-Associated Molecular Patterns (MAMPs) which induce an innate immune response. The field of fungal–bacterial interaction at the molecular level is still in its infancy and little is known about MAMPs and their detection by fungi. Exposing Fusarium graminearum to bacterial MAMPs led to increased fungal membrane hyperpolarization, a putative defense response, and a range of transcriptional responses. The fungus reacted with a different transcript profile to each of the three tested MAMPs, although a core set of genes related to energy generation, transport, amino acid production, secondary metabolism, and especially iron uptake were detected for all three. Half of the genes related to iron uptake were predicted MirA type transporters that potentially take up bacterial siderophores. These quick responses can be viewed as a preparation for further interactions with beneficial or pathogenic bacteria, and constitute a fungal innate immune response with similarities to those of plants and animals. PMID:27172188
Zhang, Baixia; Li, Yanwen; Zhang, Yanling; Li, Zhiyong; Bi, Tian; He, Yusu; Song, Kuokui; Wang, Yun
2016-01-01
Identification of bioactive components is an important area of research in traditional Chinese medicine (TCM) formula. The reported identification methods only consider the interaction between the components and the target proteins, which is not sufficient to explain the influence of TCM on the gene expression. Here, we propose the Initial Transcription Process-based Identification (ITPI) method for the discovery of bioactive components that influence transcription factors (TFs). In this method, genome-wide chip detection technology was used to identify differentially expressed genes (DEGs). The TFs of DEGs were derived from GeneCards. The components influencing the TFs were derived from STITCH. The bioactive components in the formula were identified by evaluating the molecular similarity between the components in formula and the components that influence the TF of DEGs. Using the formula of Tian-Zhu-San (TZS) as an example, the reliability and limitation of ITPI were examined and 16 bioactive components that influence TFs were identified. PMID:27034696
Hubin, Elizabeth A.; Lilic, Mirjana; Darst, Seth A.; ...
2017-07-13
The mycobacteria RNA polymerase (RNAP) is a target for antimicrobials against tuberculosis, motivating structure/function studies. Here we report a 3.2 Å-resolution crystal structure of a Mycobacterium smegmatis (Msm) open promoter complex (RPo), along with structural analysis of the Msm RPo and a previously reported 2.76 Å-resolution crystal structure of an Msm transcription initiation complex with a promoter DNA fragment. We observe the interaction of the Msm RNAP α-subunit C-terminal domain (αCTD) with DNA, and we provide evidence that the a CTD may play a role in Mtb transcription regulation. Here, our results reveal the structure of an Actinobacteria-unique insert ofmore » the RNAP β' subunit. Finally, our analysis reveals the disposition of the N-terminal segment of Msm σ A, which may comprise an intrinsically disordered protein domain unique to mycobacteria. The clade-specific features of the mycobacteria RNAP provide clues to the profound instability of mycobacteria RPo compared with E. coli.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hubin, Elizabeth A.; Lilic, Mirjana; Darst, Seth A.
The mycobacteria RNA polymerase (RNAP) is a target for antimicrobials against tuberculosis, motivating structure/function studies. Here we report a 3.2 Å-resolution crystal structure of a Mycobacterium smegmatis (Msm) open promoter complex (RPo), along with structural analysis of the Msm RPo and a previously reported 2.76 Å-resolution crystal structure of an Msm transcription initiation complex with a promoter DNA fragment. We observe the interaction of the Msm RNAP α-subunit C-terminal domain (αCTD) with DNA, and we provide evidence that the αCTD may play a role in Mtb transcription regulation. Our results reveal the structure of an Actinobacteria-unique insert of the RNAPmore » β' subunit. Finally, our analysis reveals the disposition of the N-terminal segment of Msm σA, which may comprise an intrinsically disordered protein domain unique to mycobacteria. The clade-specific features of the mycobacteria RNAP provide clues to the profound instability of mycobacteria RPo compared with E. coli.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hubin, Elizabeth A.; Lilic, Mirjana; Darst, Seth A.
The mycobacteria RNA polymerase (RNAP) is a target for antimicrobials against tuberculosis, motivating structure/function studies. Here we report a 3.2 Å-resolution crystal structure of a Mycobacterium smegmatis (Msm) open promoter complex (RPo), along with structural analysis of the Msm RPo and a previously reported 2.76 Å-resolution crystal structure of an Msm transcription initiation complex with a promoter DNA fragment. We observe the interaction of the Msm RNAP α-subunit C-terminal domain (αCTD) with DNA, and we provide evidence that the a CTD may play a role in Mtb transcription regulation. Here, our results reveal the structure of an Actinobacteria-unique insert ofmore » the RNAP β' subunit. Finally, our analysis reveals the disposition of the N-terminal segment of Msm σ A, which may comprise an intrinsically disordered protein domain unique to mycobacteria. The clade-specific features of the mycobacteria RNAP provide clues to the profound instability of mycobacteria RPo compared with E. coli.« less
van Verk, Marcel C; Pappaioannou, Dimitri; Neeleman, Lyda; Bol, John F; Linthorst, Huub J M
2008-04-01
PR-1a is a salicylic acid-inducible defense gene of tobacco (Nicotiana tabacum). One-hybrid screens identified a novel tobacco WRKY transcription factor (NtWRKY12) with specific binding sites in the PR-1a promoter at positions -564 (box WK(1)) and -859 (box WK(2)). NtWRKY12 belongs to the class of transcription factors in which the WRKY sequence is followed by a GKK rather than a GQK sequence. The binding sequence of NtWRKY12 (WK box TTTTCCAC) deviated significantly from the consensus sequence (W box TTGAC[C/T]) shown to be recognized by WRKY factors with the GQK sequence. Mutation of the GKK sequence in NtWRKY12 into GQK or GEK abolished binding to the WK box. The WK(1) box is in close proximity to binding sites in the PR-1a promoter for transcription factors TGA1a (as-1 box) and Myb1 (MBSII box). Expression studies with PR-1a promoterbeta-glucuronidase (GUS) genes in stably and transiently transformed tobacco indicated that NtWRKY12 and TGA1a act synergistically in PR-1a expression induced by salicylic acid and bacterial elicitors. Cotransfection of Arabidopsis thaliana protoplasts with 35SNtWRKY12 and PR-1aGUS promoter fusions showed that overexpression of NtWRKY12 resulted in a strong increase in GUS expression, which required functional WK boxes in the PR-1a promoter.
Hahn, Steven; Young, Elton T.
2011-01-01
Here we review recent advances in understanding the regulation of mRNA synthesis in Saccharomyces cerevisiae. Many fundamental gene regulatory mechanisms have been conserved in all eukaryotes, and budding yeast has been at the forefront in the discovery and dissection of these conserved mechanisms. Topics covered include upstream activation sequence and promoter structure, transcription factor classification, and examples of regulated transcription factor activity. We also examine advances in understanding the RNA polymerase II transcription machinery, conserved coactivator complexes, transcription activation domains, and the cooperation of these factors in gene regulatory mechanisms. PMID:22084422
Li, Xin Zhiguo; Roy, Christian K.; Dong, Xianjun; Bolcun-Filas, Ewelina; Wang, Jie; Han, Bo W.; Xu, Jia; Moore, Melissa J.; Schimenti, John C.; Weng, Zhiping; Zamore, Phillip D.
2013-01-01
SUMMARY Animal germ cells produce PIWI-interacting RNAs (piRNAs), small silencing RNAs that suppress transposons and enable gamete maturation. Mammalian transposon-silencing piRNAs accumulate early in spermatogenesis, whereas pachytene piRNAs are produced later during post-natal spermatogenesis and account for >95% of all piRNAs in the adult mouse testis. Mutants defective for pachytene piRNA pathway proteins fail to produce mature sperm, but neither the piRNA precursor transcripts nor the trigger for pachytene piRNA production is known. Here, we show that the transcription factor A-MYB initiates pachytene piRNA production. A-MYB drives transcription of both pachytene piRNA precursor RNAs and the mRNAs for core piRNA biogenesis factors, including MIWI, the protein through which pachytene piRNAs function. A-MYB regulation of piRNA pathway proteins and piRNA genes creates a coherent feed-forward loop that ensures the robust accumulation of pachytene piRNAs. This regulatory circuit, which can be detected in rooster testes, likely predates the divergence of birds and mammals. PMID:23523368
Elucidation of Small RNAs that Activate Transcription in Bacteria
2012-03-01
bacterial sRNAs that activate transcription of a target gene in E. coli to varying degrees. Mutation of the strongest activator modified its...identified RNA- based transcriptional activators in yeast (Buskirk et al., 2003) although the underlying mechanism was not elucidated. We show that the...previous yeast two-hybrid (Buskirk et al., 2003) and three-hybrid studies (Bernstein et al., 2002). Colonies were observed from co-transformations of pBT
Withman, Benjamin; Gunasekera, Thusitha S.; Beesetty, Pavani; Agans, Richard
2013-01-01
Uropathogenic Escherichia coli (UPEC) is the most common causative agent of urinary tract infections in humans. The majority of urinary infections develop via ascending route through the urethra, where bacterial cells come in contact with human urine prior to reaching the bladder or kidneys. Since urine contains significant amounts of inorganic ions and urea, it imposes osmotic and denaturing stresses on bacterial cells. In this study, we determined the transcriptional adaptive responses of UPEC strain CFT073 to the presence of 0.3 M NaCl or 0.6 M urea in the growth medium. The cell responses to these two osmolytes were drastically different. Although most of the genes of the osmotically inducible regulon were overexpressed in medium with salt, urea failed to stimulate osmotic stress response. At the same time, UPEC colonization genes encoding type 1 and F1C fimbriae and capsule biosynthesis were transcriptionally induced in the presence of urea but did not respond to increased salt concentration. We speculate that urea can potentially be sensed by uropathogenic bacteria to initiate infection program. In addition, several molecular chaperone genes were overexpressed in the presence of urea, whereas adding NaCl to the medium led to an upregulation of a number of anaerobic metabolism pathways. PMID:23090957
Withman, Benjamin; Gunasekera, Thusitha S; Beesetty, Pavani; Agans, Richard; Paliy, Oleg
2013-01-01
Uropathogenic Escherichia coli (UPEC) is the most common causative agent of urinary tract infections in humans. The majority of urinary infections develop via ascending route through the urethra, where bacterial cells come in contact with human urine prior to reaching the bladder or kidneys. Since urine contains significant amounts of inorganic ions and urea, it imposes osmotic and denaturing stresses on bacterial cells. In this study, we determined the transcriptional adaptive responses of UPEC strain CFT073 to the presence of 0.3 M NaCl or 0.6 M urea in the growth medium. The cell responses to these two osmolytes were drastically different. Although most of the genes of the osmotically inducible regulon were overexpressed in medium with salt, urea failed to stimulate osmotic stress response. At the same time, UPEC colonization genes encoding type 1 and F1C fimbriae and capsule biosynthesis were transcriptionally induced in the presence of urea but did not respond to increased salt concentration. We speculate that urea can potentially be sensed by uropathogenic bacteria to initiate infection program. In addition, several molecular chaperone genes were overexpressed in the presence of urea, whereas adding NaCl to the medium led to an upregulation of a number of anaerobic metabolism pathways.
Yan, Yurong; Ding, Shijia; Zhao, Dan; Yuan, Rui; Zhang, Yuhong; Cheng, Wei
2016-01-01
Sensitive and specific methodologies for detection of pathogenic gene at the point-of-care are still urgent demands in rapid diagnosis of infectious diseases. This work develops a simple and pragmatic electrochemical biosensing strategy for ultrasensitive and specific detection of pathogenic nucleic acids directly by integrating homogeneous target-initiated transcription amplification (HTITA) with interfacial sensing process in single analysis system. The homogeneous recognition and specific binding of target DNA with the designed hairpin probe triggered circular primer extension reaction to form DNA double-strands which contained T7 RNA polymerase promoter and served as templates for in vitro transcription amplification. The HTITA protocol resulted in numerous single-stranded RNA products which could synchronously hybridized with the detection probes and immobilized capture probes for enzyme-amplified electrochemical detection on the biosensor surface. The proposed electrochemical biosensing strategy showed very high sensitivity and selectivity for target DNA with a dynamic response range from 1 fM to 100 pM. Using salmonella as a model, the established strategy was successfully applied to directly detect invA gene from genomic DNA extract. This proposed strategy presented a simple, pragmatic platform toward ultrasensitive nucleic acids detection and would become a versatile and powerful tool for point-of-care pathogen identification. PMID:26729209
NASA Astrophysics Data System (ADS)
Yan, Yurong; Ding, Shijia; Zhao, Dan; Yuan, Rui; Zhang, Yuhong; Cheng, Wei
2016-01-01
Sensitive and specific methodologies for detection of pathogenic gene at the point-of-care are still urgent demands in rapid diagnosis of infectious diseases. This work develops a simple and pragmatic electrochemical biosensing strategy for ultrasensitive and specific detection of pathogenic nucleic acids directly by integrating homogeneous target-initiated transcription amplification (HTITA) with interfacial sensing process in single analysis system. The homogeneous recognition and specific binding of target DNA with the designed hairpin probe triggered circular primer extension reaction to form DNA double-strands which contained T7 RNA polymerase promoter and served as templates for in vitro transcription amplification. The HTITA protocol resulted in numerous single-stranded RNA products which could synchronously hybridized with the detection probes and immobilized capture probes for enzyme-amplified electrochemical detection on the biosensor surface. The proposed electrochemical biosensing strategy showed very high sensitivity and selectivity for target DNA with a dynamic response range from 1 fM to 100 pM. Using salmonella as a model, the established strategy was successfully applied to directly detect invA gene from genomic DNA extract. This proposed strategy presented a simple, pragmatic platform toward ultrasensitive nucleic acids detection and would become a versatile and powerful tool for point-of-care pathogen identification.
Yan, Yurong; Ding, Shijia; Zhao, Dan; Yuan, Rui; Zhang, Yuhong; Cheng, Wei
2016-01-05
Sensitive and specific methodologies for detection of pathogenic gene at the point-of-care are still urgent demands in rapid diagnosis of infectious diseases. This work develops a simple and pragmatic electrochemical biosensing strategy for ultrasensitive and specific detection of pathogenic nucleic acids directly by integrating homogeneous target-initiated transcription amplification (HTITA) with interfacial sensing process in single analysis system. The homogeneous recognition and specific binding of target DNA with the designed hairpin probe triggered circular primer extension reaction to form DNA double-strands which contained T7 RNA polymerase promoter and served as templates for in vitro transcription amplification. The HTITA protocol resulted in numerous single-stranded RNA products which could synchronously hybridized with the detection probes and immobilized capture probes for enzyme-amplified electrochemical detection on the biosensor surface. The proposed electrochemical biosensing strategy showed very high sensitivity and selectivity for target DNA with a dynamic response range from 1 fM to 100 pM. Using salmonella as a model, the established strategy was successfully applied to directly detect invA gene from genomic DNA extract. This proposed strategy presented a simple, pragmatic platform toward ultrasensitive nucleic acids detection and would become a versatile and powerful tool for point-of-care pathogen identification.
Nucleosome displacement in transcription.
Workman, Jerry L
2006-08-01
Recent reports reinforce the notion that nucleosomes are highly dynamic in response to the process of transcription. Nucleosomes are displaced at promoters during gene activation in a process that involves histone modification, ATP-dependent nucleosome remodeling complexes, histone chaperones and perhaps histone variants. During transcription elongation nucleosomes are acetylated and transferred behind RNA polymerase II where they are required to suppress spurious transcription initiation within the body of the gene. It is becoming increasingly clear that the eukaryotic transcriptional machinery is adapted to exploit the presence of nucleosomes in very sophisticated ways.
Shi, Hui; Zhong, Shangwei; Mo, Xiaorong; Liu, Na; Nezames, Cynthia D.; Deng, Xing Wang
2013-01-01
Seed germination is the first step for seed plants to initiate a new life cycle. Light plays a predominant role in promoting seed germination, where the initial phase is mediated by photoreceptor phytochrome B (phyB). Previous studies showed that PHYTOCHROME-INTERACTING FACTOR1 (PIF1) represses seed germination downstream of phyB. Here, we identify a positive regulator of phyB-dependent seed germination, LONG HYPOCOTYL IN FAR-RED1 (HFR1). HFR1 blocks PIF1 transcriptional activity by forming a heterodimer with PIF1 that prevents PIF1 from binding to DNA. Our whole-genomic analysis shows that HFR1 and PIF1 oppositely mediate the light-regulated transcriptome in imbibed seeds. Through the HFR1–PIF1 module, light regulates expression of numerous genes involved in cell wall loosening, cell division, and hormone pathways to initiate seed germination. The functionally antagonistic HFR1–PIF1 pair constructs a fail-safe mechanism for fine-tuning seed germination during low-level illumination, ensuring a rapid response to favorable environmental changes. This study identifies the HFR1–PIF1 pair as a central module directing the whole genomic transcriptional network to rapidly initiate light-induced seed germination. PMID:24179122
Transcriptional response of Musca domestica larvae to bacterial infection.
Tang, Ting; Li, Xiang; Yang, Xue; Yu, Xue; Wang, Jianhui; Liu, Fengsong; Huang, Dawei
2014-01-01
The house fly Musca domestica, a cosmopolitan dipteran insect, is a significant vector for human and animal bacterial pathogens, but little is known about its immune response to these pathogens. To address this issue, we inoculated the larvae with a mixture of Escherichia coli and Staphylococcus aureus and profiled the transcriptome 6, 24, and 48 h thereafter. Many genes known to controlling innate immunity in insects were induced following infection, including genes encoding pattern recognition proteins (PGRPs), various components of the Toll and IMD signaling pathways and of the proPO-activating and redox systems, and multiple antimicrobial peptides. Interestingly, we also uncovered a large set of novel immune response genes including two broad-spectrum antimicrobial peptides (muscin and domesticin), which might have evolved to adapt to house-fly's unique ecological environments. Finally, genes mediating oxidative phosphorylation were repressed at 48 h post-infection, suggesting disruption of energy homeostasis and mitochondrial function at the late stages of infection. Collectively, our data reveal dynamic changes in gene expression following bacterial infection in the house fly, paving the way for future in-depth analysis of M. domestica's immune system.
Landini, P; Bown, J A; Volkert, M R; Busby, S J
1998-05-22
The methylated form of the Ada protein (meAda) binds the ada and aidB promoters between 60 and 40 base pairs upstream from the transcription start and activates transcription of the Escherichia coli ada and aidB genes. This region is also a binding site for the alpha subunit of RNA polymerase and resembles the rrnB P1 UP element in A/T content and location relative to the core promoter. In this report, we show that deletion of the C-terminal domain of the alpha subunit severely decreases meAda-independent binding of RNA polymerase to ada and aidB, affecting transcription initiation at these promoters. We provide evidence that meAda activates transcription by direct interaction with the C-terminal domain of RNA polymerase sigma70 subunit (amino acids 574-613). Several negatively charged residues in the sigma70 C-terminal domain are important for transcription activation by meAda; in particular, a glutamic acid to valine substitution at position 575 has a dramatic effect on meAda-dependent transcription. Based on these observations, we propose that the role of the alpha subunit at ada and aidB is to allow initial binding of RNA polymerase to the promoters. However, transcription initiation is dependent on meAda-sigma70 interaction.
Sensing new chemicals with bacterial transcription factors.
Libis, Vincent; Delépine, Baudoin; Faulon, Jean-Loup
2016-10-01
Bacteria rely on allosteric transcription factors (aTFs) to sense a wide range of chemicals. The variety of effectors has contributed in making aTFs the most used input system in synthetic biological circuits. Considering their enabling role in biotechnology, an important question concerns the size of the chemical space that can potentially be detected by these biosensors. From digging into the ever changing repertoire of natural regulatory circuits, to advances in aTF engineering, we review here different strategies that are pushing the boundaries of this chemical space. We also review natural and synthetic cases of indirect sensing, where aTFs work in combination with metabolism to enable detection of new molecules. Copyright © 2016 Elsevier Ltd. All rights reserved.
SPARTA: Simple Program for Automated reference-based bacterial RNA-seq Transcriptome Analysis.
Johnson, Benjamin K; Scholz, Matthew B; Teal, Tracy K; Abramovitch, Robert B
2016-02-04
Many tools exist in the analysis of bacterial RNA sequencing (RNA-seq) transcriptional profiling experiments to identify differentially expressed genes between experimental conditions. Generally, the workflow includes quality control of reads, mapping to a reference, counting transcript abundance, and statistical tests for differentially expressed genes. In spite of the numerous tools developed for each component of an RNA-seq analysis workflow, easy-to-use bacterially oriented workflow applications to combine multiple tools and automate the process are lacking. With many tools to choose from for each step, the task of identifying a specific tool, adapting the input/output options to the specific use-case, and integrating the tools into a coherent analysis pipeline is not a trivial endeavor, particularly for microbiologists with limited bioinformatics experience. To make bacterial RNA-seq data analysis more accessible, we developed a Simple Program for Automated reference-based bacterial RNA-seq Transcriptome Analysis (SPARTA). SPARTA is a reference-based bacterial RNA-seq analysis workflow application for single-end Illumina reads. SPARTA is turnkey software that simplifies the process of analyzing RNA-seq data sets, making bacterial RNA-seq analysis a routine process that can be undertaken on a personal computer or in the classroom. The easy-to-install, complete workflow processes whole transcriptome shotgun sequencing data files by trimming reads and removing adapters, mapping reads to a reference, counting gene features, calculating differential gene expression, and, importantly, checking for potential batch effects within the data set. SPARTA outputs quality analysis reports, gene feature counts and differential gene expression tables and scatterplots. SPARTA provides an easy-to-use bacterial RNA-seq transcriptional profiling workflow to identify differentially expressed genes between experimental conditions. This software will enable microbiologists with
Brandt, Stephanie L.; Ke, Wujian; Reid, Tara B.; Molini, Barbara J.; Iverson-Cabral, Stefanie; Ciccarese, Giulia; Drago, Francesco; Lukehart, Sheila A.; Centurion-Lara, Arturo
2015-01-01
An effective mechanism for introduction of phenotypic diversity within a bacterial population exploits changes in the length of repetitive DNA elements located within gene promoters. This phenomenon, known as phase variation, causes rapid activation or silencing of gene expression and fosters bacterial adaptation to new or changing environments. Phase variation often occurs in surface-exposed proteins, and in Treponema pallidum subsp. pallidum, the syphilis agent, it was reported to affect transcription of three putative outer membrane protein (OMP)-encoding genes. When the T. pallidum subsp. pallidum Nichols strain genome was initially annotated, the TP0126 open reading frame was predicted to include a poly(G) tract and did not appear to have a predicted signal sequence that might suggest the possibility of its being an OMP. Here we show that the initial annotation was incorrect, that this poly(G) is instead located within the TP0126 promoter, and that it varies in length in vivo during experimental syphilis. Additionally, we show that TP0126 transcription is affected by changes in the poly(G) length consistent with regulation by phase variation. In silico analysis of the TP0126 open reading frame based on the experimentally identified transcriptional start site shortens this hypothetical protein by 69 amino acids, reveals a predicted cleavable signal peptide, and suggests structural homology with the OmpW family of porins. Circular dichroism of recombinant TP0126 supports structural homology to OmpW. Together with the evidence that TP0126 is fully conserved among T. pallidum subspecies and strains, these data suggest an important role for TP0126 in T. pallidum biology and syphilis pathogenesis. PMID:25802057
Ribonuclease E modulation of the bacterial SOS response.
Manasherob, Robert; Miller, Christine; Kim, Kwang-sun; Cohen, Stanley N
2012-01-01
Plants, animals, bacteria, and Archaea all have evolved mechanisms to cope with environmental or cellular stress. Bacterial cells respond to the stress of DNA damage by activation of the SOS response, the canonical RecA/LexA-dependent signal transduction pathway that transcriptionally derepresses a multiplicity of genes-leading to transient arrest of cell division and initiation of DNA repair. Here we report the previously unsuspected role of E. coli endoribonuclease RNase E in regulation of the SOS response. We show that RNase E deletion or inactivation of temperature-sensitive RNase E protein precludes normal initiation of SOS. The ability of RNase E to regulate SOS is dynamic, as down regulation of RNase E following DNA damage by mitomycin C resulted in SOS termination and restoration of RNase E function leads to resumption of a previously aborted response. Overexpression of the RraA protein, which binds to the C-terminal region of RNase E and modulates the actions of degradosomes, recapitulated the effects of RNase E deficiency. Possible mechanisms for RNase E effects on SOS are discussed.
Ribonuclease E Modulation of the Bacterial SOS Response
Manasherob, Robert; Miller, Christine; Kim, Kwang-sun; Cohen, Stanley N.
2012-01-01
Plants, animals, bacteria, and Archaea all have evolved mechanisms to cope with environmental or cellular stress. Bacterial cells respond to the stress of DNA damage by activation of the SOS response, the canonical RecA/LexA-dependent signal transduction pathway that transcriptionally derepresses a multiplicity of genes–leading to transient arrest of cell division and initiation of DNA repair. Here we report the previously unsuspected role of E. coli endoribonuclease RNase E in regulation of the SOS response. We show that RNase E deletion or inactivation of temperature-sensitive RNase E protein precludes normal initiation of SOS. The ability of RNase E to regulate SOS is dynamic, as down regulation of RNase E following DNA damage by mitomycin C resulted in SOS termination and restoration of RNase E function leads to resumption of a previously aborted response. Overexpression of the RraA protein, which binds to the C-terminal region of RNase E and modulates the actions of degradosomes, recapitulated the effects of RNase E deficiency. Possible mechanisms for RNase E effects on SOS are discussed. PMID:22719885
Feld, Louise; Hjelmsø, Mathis Hjort; Nielsen, Morten Schostag; Jacobsen, Anne Dorthe; Rønn, Regin; Ekelund, Flemming; Krogh, Paul Henning; Strobel, Bjarne Westergaard; Jacobsen, Carsten Suhr
2015-01-01
Background and Methods Assessing the effects of pesticide hazards on microbiological processes in the soil is currently based on analyses that provide limited insight into the ongoing processes. This study proposes a more comprehensive approach. The side effects of pesticides may appear as changes in the expression of specific microbial genes or as changes in diversity. To assess the impact of pesticides on gene expression, we focused on the amoA gene, which is involved in ammonia oxidation. We prepared soil microcosms and exposed them to dazomet, mancozeb or no pesticide. We hypothesized that the amount of amoA transcript decreases upon pesticide application, and to test this hypothesis, we used reverse-transcription qPCR. We also hypothesized that bacterial diversity is affected by pesticides. This hypothesis was investigated via 454 sequencing and diversity analysis of the 16S ribosomal RNA and RNA genes, representing the active and total soil bacterial communities, respectively. Results and Conclusion Treatment with dazomet reduced both the bacterial and archaeal amoA transcript numbers by more than two log units and produced long-term effects for more than 28 days. Mancozeb also inhibited the numbers of amoA transcripts, but only transiently. The bacterial and archaeal amoA transcripts were both sensitive bioindicators of pesticide side effects. Additionally, the numbers of bacterial amoA transcripts correlated with nitrate production in N-amended microcosms. Dazomet reduced the total bacterial numbers by one log unit, but the population size was restored after twelve days. The diversity of the active soil bacteria also seemed to be re-established after twelve days. However, the total bacterial diversity as reflected in the 16S ribosomal RNA gene sequences was largely dominated by Firmicutes and Proteobacteria at day twelve, likely reflecting a halt in the growth of early opportunists and the re-establishment of a more diverse population. We observed no
Radebaugh, C A; Matthews, J L; Geiss, G K; Liu, F; Wong, J M; Bateman, E; Camier, S; Sentenac, A; Paule, M R
1994-01-01
The role of the Acanthamoeba castellanii TATA-binding protein (TBP) in transcription was examined. Specific antibodies against the nonconserved N-terminal domain of TBP were used to verify the presence of TBP in the fundamental transcription initiation factor for RNA polymerase I, TIF-IB, and to demonstrate that TBP is part of the committed initiation complex on the rRNA promoter. The same antibodies inhibit transcription in all three polymerase systems, but they do so differentially. Oligonucleotide competitors were used to evaluate the accessibility of the TATA-binding site in TIF-IB, TFIID, and TFIIIB. The results suggest that insertion of TBP into the polymerase II and III factors is more similar than insertion into the polymerase I factor.
Land use type significantly affects microbial gene transcription in soil.
Nacke, Heiko; Fischer, Christiane; Thürmer, Andrea; Meinicke, Peter; Daniel, Rolf
2014-05-01
Soil microorganisms play an essential role in sustaining biogeochemical processes and cycling of nutrients across different land use types. To gain insights into microbial gene transcription in forest and grassland soil, we isolated mRNA from 32 sampling sites. After sequencing of generated complementary DNA (cDNA), a total of 5,824,229 sequences could be further analyzed. We were able to assign nonribosomal cDNA sequences to all three domains of life. A dominance of bacterial sequences, which were affiliated to 25 different phyla, was found. Bacterial groups capable of aromatic compound degradation such as Phenylobacterium and Burkholderia were detected in significantly higher relative abundance in forest soil than in grassland soil. Accordingly, KEGG pathway categories related to degradation of aromatic ring-containing molecules (e.g., benzoate degradation) were identified in high abundance within forest soil-derived metatranscriptomic datasets. The impact of land use type forest on community composition and activity is evidently to a high degree caused by the presence of wood breakdown products. Correspondingly, bacterial groups known to be involved in lignin degradation and containing ligninolytic genes such as Burkholderia, Bradyrhizobium, and Azospirillum exhibited increased transcriptional activity in forest soil. Higher solar radiation in grassland presumably induced increased transcription of photosynthesis-related genes within this land use type. This is in accordance with high abundance of photosynthetic organisms and plant-infecting viruses in grassland.
Nikolakakis, K; Lehnert, E; McFall-Ngai, M J; Ruby, E G
2015-07-01
The establishment of a productive symbiosis between Euprymna scolopes, the Hawaiian bobtail squid, and its luminous bacterial symbiont, Vibrio fischeri, is mediated by transcriptional changes in both partners. A key challenge to unraveling the steps required to successfully initiate this and many other symbiotic associations is characterization of the timing and location of these changes. We report on the adaptation of hybridization chain reaction-fluorescent in situ hybridization (HCR-FISH) to simultaneously probe the spatiotemporal regulation of targeted genes in both E. scolopes and V. fischeri. This method revealed localized, transcriptionally coregulated epithelial cells within the light organ that responded directly to the presence of bacterial cells while, at the same time, provided a sensitive means to directly show regulated gene expression within the symbiont population. Thus, HCR-FISH provides a new approach for characterizing habitat transition in bacteria and for discovering host tissue responses to colonization. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Chibazakura, T; Kawamura, F; Takahashi, H
1991-04-01
We have shown by S1 nuclease mapping with in vivo transcripts that the differential expression of a sporulation-regulatory gene, spo0A, is regulated by switching of two discrete promoters during the initiation of sporulation in Bacillus subtilis; vegetative mRNA was transcribed from an upstream promoter (Pv, vegetative promoter), and sporulation-specific mRNA was transcribed from the other promoter (Ps, sporulation-specific promoter) about 150 bp downstream of the Pv promoter. Transcription from the Pv promoter was at a low level and shut off at T0.5. On the other hand, transcription from the Ps promoter was strongly induced at T0.5 and increased until T2.5. In the presence of 2% glucose, Pv-directed transcription was not shut off and was observed even at T1.5, whereas the induction of Ps-directed transcription was completely repressed. A mutant in which the spo0A gene was transcribed only from the Ps promoter could sporulate normally in the presence of 0.1% glucose but could not sporulate at all in the presence of 2% glucose. In a catabolite-resistant sporulation mutant carrying crsA47 (sigA47), a mutation within the gene encoding sigma A, normal promoter switching from Pv to Ps was observed in the presence of 2% glucose.
Mueller, R F; Characklis, W G; Jones, W L; Sears, J T
1992-05-01
The processes leading to bacterial colonization on solid-water interfaces are adsorption, desorption, growth, and erosion. These processes have been measured individually in situ in a flowing system in real time using image analysis. Four different substrata (copper, silicon, 316 stainless-steel and glass) and 2 different bacterial species (Pseudomonas aeruginosa and Pseudomonas fluorescens) were used in the experiments. The flow was laminar (Re = 1.4) and the shear stress was kept constant during all experiments at 0.75 N m(-2). The surface roughness varied among the substrata from 0.002 microm (for silicon) to 0.015 microm (for copper). Surface free energies varied from 25.1 dynes cm(-1) for silicon to 31.2 dynes cm(-1) for copper. Cell curface hydrophobicity, reported as hydrocarbon partitioning values, ranged from 0.67 for Ps. fluorescens to 0.97 for Ps. aeruginosa.The adsorption rate coefficient varied by as much as a factor of 10 among the combinations of bacterial strain and substratum material, and was positively correlated with surface free energy, the surface roughness of the substratum, and the hydrophobicity of the cells. The probability of desorption decreased with increasing surface free energy and surface roughness of the substratum. Cell growth was inhibited on copper, but replication of cells overlying an initial cell layer was observed with increased exposure time to the cell-containing bulk water. A mathematical model describing cell accumulation on a substratum is presented.
2010-01-01
Over 50 years of biological research with bacteriophage T4 includes notable discoveries in post-transcriptional control, including the genetic code, mRNA, and tRNA; the very foundations of molecular biology. In this review we compile the past 10 - 15 year literature on RNA-protein interactions with T4 and some of its related phages, with particular focus on advances in mRNA decay and processing, and on translational repression. Binding of T4 proteins RegB, RegA, gp32 and gp43 to their cognate target RNAs has been characterized. For several of these, further study is needed for an atomic-level perspective, where resolved structures of RNA-protein complexes are awaiting investigation. Other features of post-transcriptional control are also summarized. These include: RNA structure at translation initiation regions that either inhibit or promote translation initiation; programmed translational bypassing, where T4 orchestrates ribosome bypass of a 50 nucleotide mRNA sequence; phage exclusion systems that involve T4-mediated activation of a latent endoribonuclease (PrrC) and cofactor-assisted activation of EF-Tu proteolysis (Gol-Lit); and potentially important findings on ADP-ribosylation (by Alt and Mod enzymes) of ribosome-associated proteins that might broadly impact protein synthesis in the infected cell. Many of these problems can continue to be addressed with T4, whereas the growing database of T4-related phage genome sequences provides new resources and potentially new phage-host systems to extend the work into a broader biological, evolutionary context. PMID:21129205
Crystal structure of enterococcus faecalis sly A-like transcriptional factor.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, R.; Zhang, R.; Zagnitko, O.
2003-05-30
The crystal structure of a SlyA transcriptional regulator at 1.6 {angstrom} resolution is presented, and structural relationships between members of the MarR/SlyA family are discussed. The SlyA family, which includes SlyA, Rap, Hor, and RovA proteins, is widely distributed in bacterial and archaeal genomes. Current evidence suggests that SlyA-like factors act as repressors, activators, and modulators of gene transcription. These proteins have been shown to up-regulate the expression of molecular chaperones, acid-resistance proteins, and cytolysin, and down-regulate several biosynthetic enzymes. The structure of SlyA from Enterococcus faecalis, determined as a part of an ongoing structural genomics initiative (www.mcsg.anl.gov), revealed themore » same winged helix DNA-binding motif that was recently found in the MarR repressor from Escherichia coli and the MexR repressor from Pseudomonas aeruginosa, a sequence homologue of MarR. Phylogenetic analysis of the MarR/SlyA family suggests that Sly is placed between the SlyA and MarR subfamilies and shows significant sequence similarity to members of both subfamilies.« less
Near-atomic resolution visualization of human transcription promoter opening
He, Yuan; Yan, Chunli; Fang, Jie; Inouye, Carla; Tjian, Robert; Ivanov, Ivaylo; Nogales, Eva
2016-01-01
In eukaryotic transcription initiation, a large multi-subunit pre-initiation complex (PIC) that assembles at the core promoter is required for the opening of the duplex DNA and identification of the start site for transcription by RNA polymerase II. Here we use cryo-electron microscropy (cryo-EM) to determine near-atomic resolution structures of the human PIC in a closed state (engaged with duplex DNA), an open state (engaged with a transcription bubble), and an initially transcribing complex (containing six base pairs of DNA–RNA hybrid). Our studies provide structures for previously uncharacterized components of the PIC, such as TFIIE and TFIIH, and segments of TFIIA, TFIIB and TFIIF. Comparison of the different structures reveals the sequential conformational changes that accompany the transition from each state to the next throughout the transcription initiation process. This analysis illustrates the key role of TFIIB in transcription bubble stabilization and provides strong structural support for a translocase activity of XPB. PMID:27193682
Transcription regulation by the Mediator complex.
Soutourina, Julie
2018-04-01
Alterations in the regulation of gene expression are frequently associated with developmental diseases or cancer. Transcription activation is a key phenomenon in the regulation of gene expression. In all eukaryotes, mediator of RNA polymerase II transcription (Mediator), a large complex with modular organization, is generally required for transcription by RNA polymerase II, and it regulates various steps of this process. The main function of Mediator is to transduce signals from the transcription activators bound to enhancer regions to the transcription machinery, which is assembled at promoters as the preinitiation complex (PIC) to control transcription initiation. Recent functional studies of Mediator with the use of structural biology approaches and functional genomics have revealed new insights into Mediator activity and its regulation during transcription initiation, including how Mediator is recruited to transcription regulatory regions and how it interacts and cooperates with PIC components to assist in PIC assembly. Novel roles of Mediator in the control of gene expression have also been revealed by showing its connection to the nuclear pore and linking Mediator to the regulation of gene positioning in the nuclear space. Clear links between Mediator subunits and disease have also encouraged studies to explore targeting of this complex as a potential therapeutic approach in cancer and fungal infections.
Shabalina, Svetlana A.; Ogurtsov, Aleksey Y.; Spiridonov, Nikolay A.; Koonin, Eugene V.
2014-01-01
Alternative splicing (AS), alternative transcription initiation (ATI) and alternative transcription termination (ATT) create the extraordinary complexity of transcriptomes and make key contributions to the structural and functional diversity of mammalian proteomes. Analysis of mammalian genomic and transcriptomic data shows that contrary to the traditional view, the joint contribution of ATI and ATT to the transcriptome and proteome diversity is quantitatively greater than the contribution of AS. Although the mean numbers of protein-coding constitutive and alternative nucleotides in gene loci are nearly identical, their distribution along the transcripts is highly non-uniform. On average, coding exons in the variable 5′ and 3′ transcript ends that are created by ATI and ATT contain approximately four times more alternative nucleotides than core protein-coding regions that diversify exclusively via AS. Short upstream exons that encompass alternative 5′-untranslated regions and N-termini of proteins evolve under strong nucleotide-level selection whereas in 3′-terminal exons that encode protein C-termini, protein-level selection is significantly stronger. The groups of genes that are subject to ATI and ATT show major differences in biological roles, expression and selection patterns. PMID:24792168
Bacterial reference genes for gene expression studies by RT-qPCR: survey and analysis.
Rocha, Danilo J P; Santos, Carolina S; Pacheco, Luis G C
2015-09-01
The appropriate choice of reference genes is essential for accurate normalization of gene expression data obtained by the method of reverse transcription quantitative real-time PCR (RT-qPCR). In 2009, a guideline called the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) highlighted the importance of the selection and validation of more than one suitable reference gene for obtaining reliable RT-qPCR results. Herein, we searched the recent literature in order to identify the bacterial reference genes that have been most commonly validated in gene expression studies by RT-qPCR (in the first 5 years following publication of the MIQE guidelines). Through a combination of different search parameters with the text mining tool MedlineRanker, we identified 145 unique bacterial genes that were recently tested as candidate reference genes. Of these, 45 genes were experimentally validated and, in most of the cases, their expression stabilities were verified using the software tools geNorm and NormFinder. It is noteworthy that only 10 of these reference genes had been validated in two or more of the studies evaluated. An enrichment analysis using Gene Ontology classifications demonstrated that genes belonging to the functional categories of DNA Replication (GO: 0006260) and Transcription (GO: 0006351) rendered a proportionally higher number of validated reference genes. Three genes in the former functional class were also among the top five most stable genes identified through an analysis of gene expression data obtained from the Pathosystems Resource Integration Center. These results may provide a guideline for the initial selection of candidate reference genes for RT-qPCR studies in several different bacterial species.
Al-Khouri, Anna Maria; Paule, Marvin R.
2002-01-01
In the small, free-living amoeba Acanthamoeba castellanii, rRNA transcription requires, in addition to RNA polymerase I, a single DNA-binding factor, transcription initiation factor IB (TIF-IB). TIF-IB is a multimeric protein that contains TATA-binding protein (TBP) and four TBP-associated factors that are specific for polymerase I transcription. TIF-IB is required for accurate and promoter-specific initiation of rRNA transcription, recruiting and positioning the polymerase on the start site by protein-protein interaction. In A. castellanii, partially purified TIF-IB can form a persistent complex with the ribosomal DNA (rDNA) promoter while homogeneous TIF-IB cannot. An additional factor, TIF-IE, is required along with homogeneous TIF-IB for the formation of a stable complex on the rDNA core promoter. We show that TIF-IE by itself, however, does not bind to the rDNA promoter and thus differs in its mechanism from the upstream binding factor and upstream activating factor, which carry out similar complex-stabilizing functions in vertebrates and yeast, respectively. In addition to its presence in impure TIF-IB, TIF-IE is found in highly purified fractions of polymerase I, with which it associates. Renaturation of polypeptides excised from sodium dodecyl sulfate-polyacrylamide gels showed that a 141-kDa polypeptide possesses all the known activities of TIF-IE. PMID:11784852
Al-Khouri, Anna Maria; Paule, Marvin R
2002-02-01
In the small, free-living amoeba Acanthamoeba castellanii, rRNA transcription requires, in addition to RNA polymerase I, a single DNA-binding factor, transcription initiation factor IB (TIF-IB). TIF-IB is a multimeric protein that contains TATA-binding protein (TBP) and four TBP-associated factors that are specific for polymerase I transcription. TIF-IB is required for accurate and promoter-specific initiation of rRNA transcription, recruiting and positioning the polymerase on the start site by protein-protein interaction. In A. castellanii, partially purified TIF-IB can form a persistent complex with the ribosomal DNA (rDNA) promoter while homogeneous TIF-IB cannot. An additional factor, TIF-IE, is required along with homogeneous TIF-IB for the formation of a stable complex on the rDNA core promoter. We show that TIF-IE by itself, however, does not bind to the rDNA promoter and thus differs in its mechanism from the upstream binding factor and upstream activating factor, which carry out similar complex-stabilizing functions in vertebrates and yeast, respectively. In addition to its presence in impure TIF-IB, TIF-IE is found in highly purified fractions of polymerase I, with which it associates. Renaturation of polypeptides excised from sodium dodecyl sulfate-polyacrylamide gels showed that a 141-kDa polypeptide possesses all the known activities of TIF-IE.
Lazzaro, Martina; Feldman, Mario F.
2017-01-01
ABSTRACT The ability to detect and measure danger from an environmental signal is paramount for bacteria to respond accordingly, deploying strategies that halt or counteract potential cellular injury and maximize survival chances. Type VI secretion systems (T6SSs) are complex bacterial contractile nanomachines able to target toxic effectors into neighboring bacteria competing for the same colonization niche. Previous studies support the concept that either T6SSs are constitutively active or they fire effectors in response to various stimuli, such as high bacterial density, cell-cell contact, nutrient depletion, or components from dead sibling cells. For Serratia marcescens, it has been proposed that its T6SS is stochastically expressed, with no distinction between harmless or aggressive competitors. In contrast, we demonstrate that the Rcs regulatory system is responsible for finely tuning Serratia T6SS expression levels, behaving as a transcriptional rheostat. When confronted with harmless bacteria, basal T6SS expression levels suffice for Serratia to eliminate the competitor. A moderate T6SS upregulation is triggered when, according to the aggressor-prey ratio, an unbalanced interplay between homologous and heterologous effectors and immunity proteins takes place. Higher T6SS expression levels are achieved when Serratia is challenged by a contender like Acinetobacter, which indiscriminately fires heterologous effectors able to exert lethal cellular harm, threatening the survival of the Serratia population. We also demonstrate that Serratia’s RcsB-dependent T6SS regulatory mechanism responds not to general stress signals but to the action of specific effectors from competitors, displaying an exquisite strategy to weigh risks and keep the balance between energy expenditure and fitness costs. PMID:28830939
Proulx, Alexandre; Hume, Daniel Z; Drobatz, Kenneth J; Reineke, Erica L
2014-01-01
To determine the proportion of airway bacterial isolates resistant to both empirically selected and recently administered antimicrobials, and to assess the impact of inappropriate initial empiric antimicrobials selection on length of hospital stay and survival to discharge in dogs with bacterial pneumonia. Retrospective study. University veterinary teaching hospital. One hundred and eleven dogs with a clinical diagnosis of bacterial pneumonia that had aerobic bacterial culture and susceptibility testing performed from a tracheal wash sample. None. Overall, 26% (29/111) of the dogs had at least 1 bacterial isolate that was resistant to empirically selected antimicrobials. In dogs with a history of antimicrobial administration within the preceding 4 weeks, a high incidence (57.4%, 31/54) of in vitro bacterial resistance to those antimicrobials was found: 64.7% (11/17) in the community-acquired pneumonia group, 55.2% (16/29) in the aspiration pneumonia group, and 50.0% (4/8) in the other causes of bacterial pneumonia group. No statistically significant association was found between bacterial isolate resistance to empirically selected antimicrobials and length of hospital stay or mortality. The high proportion of in vitro airway bacterial resistance to empiric antimicrobials would suggest that airway sampling for bacterial culture and susceptibility testing may be helpful in guiding antimicrobial therapy and recently administered antimicrobials should be avoided when empirically selecting antimicrobials. Although no relationship was found between inappropriate initial empiric antimicrobial selection and length of hospital stay or mortality, future prospective studies using standardized airway-sampling techniques, treatment modalities, and stratification of disease severity based on objective values, such as arterial blood gas analysis in all dogs with pneumonia, would be needed to determine if a clinical effect of in vitro bacterial resistance to empirically
Goosen, Ryan W.
2016-01-01
The relevance of specific microbial colonisation to colorectal cancer (CRC) disease pathogenesis is increasingly recognised, but our understanding of possible underlying molecular mechanisms that may link colonisation to disease in vivo remains limited. Here, we investigate the relationships between the most commonly studied CRC-associated bacteria (Enterotoxigenic Bacteroides fragilis, pks+ Escherichia coli, Fusobacterium spp., afaC+ E. coli, Enterococcus faecalis & Enteropathogenic E. coli) and altered transcriptomic and methylation profiles of CRC patients, in order to gain insight into the potential contribution of these bacteria in the aetiopathogenesis of CRC. We show that colonisation by E. faecalis and high levels of Fusobacterium is associated with a specific transcriptomic subtype of CRC that is characterised by CpG island methylation, microsatellite instability and a significant increase in inflammatory and DNA damage pathways. Analysis of the significant, bacterially-associated changes in host gene expression, both at the level of individual genes as well as pathways, revealed a transcriptional remodeling that provides a plausible mechanistic link between specific bacterial colonisation and colorectal cancer disease development and progression in this subtype; these included upregulation of REG3A, REG1A and REG1P in the case of high-level colonization by Fusobacterium, and CXCL10 and BMI1 in the case of colonisation by E. faecalis. The enrichment of both E. faecalis and Fusobacterium in this CRC subtype suggests that polymicrobial colonisation of the colonic epithelium may well be an important aspect of colonic tumourigenesis. PMID:27846243
Prajapati, Ranjit Kumar; Sengupta, Shreya; Rudra, Paulami; Mukhopadhyay, Jayanta
2016-01-15
Most bacterial RNA polymerases (RNAP) contain five conserved subunits, viz. 2α, β, β', and ω. However, in many Gram-positive bacteria, especially in fermicutes, RNAP is associated with an additional factor, called δ. For over three decades since its identification, it had been thought that δ functioned as a subunit of RNAP to enhance the level of transcripts by recycling RNAP. In support of the previous observations, we also find that δ is involved in recycling of RNAP by releasing the RNA from the ternary complex. We further show that δ binds to RNA and is able to recycle RNAP when the length of the nascent RNA reaches a critical length. However, in this work we decipher a new function of δ. Performing biochemical and mutational analysis, we show that Bacillus subtilis δ binds to DNA immediately upstream of the promoter element at A-rich sequences on the abrB and rrnB1 promoters and facilitates open complex formation. As a result, δ facilitates RNAP to initiate transcription in the second scale, compared with minute scale in the absence of δ. Using transcription assay, we show that δ-mediated recycling of RNAP cannot be the sole reason for the enhancement of transcript yield. Our observation that δ does not bind to RNAP holo enzyme but is required to bind to DNA upstream of the -35 promoter element for transcription activation suggests that δ functions as a transcriptional regulator. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Gundogdu, Ozan; da Silva, Daiani T; Mohammad, Banaz; Elmi, Abdi; Mills, Dominic C; Wren, Brendan W; Dorrell, Nick
2015-01-01
The ability of the human intestinal pathogen Campylobacter jejuni to respond to oxidative stress is central to bacterial survival both in vivo during infection and in the environment. Re-annotation of the C. jejuni NCTC11168 genome revealed the presence of two MarR-type transcriptional regulators Cj1546 and Cj1556, originally annotated as hypothetical proteins, which we have designated RrpA and RrpB (regulator of response to peroxide) respectively. Previously we demonstrated a role for RrpB in both oxidative and aerobic (O2) stress and that RrpB was a DNA binding protein with auto-regulatory activity, typical of MarR-type transcriptional regulators. In this study, we show that RrpA is also a DNA binding protein and that a rrpA mutant in strain 11168H exhibits increased sensitivity to hydrogen peroxide oxidative stress. Mutation of either rrpA or rrpB reduces catalase (KatA) expression. However, a rrpAB double mutant exhibits higher levels of resistance to hydrogen peroxide oxidative stress, with levels of KatA expression similar to the wild-type strain. Mutation of either rrpA or rrpB also results in a reduction in the level of katA expression, but this reduction was not observed in the rrpAB double mutant. Neither the rrpA nor rrpB mutant exhibits any significant difference in sensitivity to either cumene hydroperoxide or menadione oxidative stresses, but both mutants exhibit a reduced ability to survive aerobic (O2) stress, enhanced biofilm formation and reduced virulence in the Galleria mellonella infection model. The rrpAB double mutant exhibits wild-type levels of biofilm formation and wild-type levels of virulence in the G mellonella infection model. Together these data indicate a role for both RrpA and RrpB in the C. jejuni peroxide oxidative and aerobic (O2) stress responses, enhancing bacterial survival in vivo and in the environment.
Structural characterization of human general transcription factor TFIIF in solution
Akashi, Satoko; Nagakura, Shinjiro; Yamamoto, Seiji; Okuda, Masahiko; Ohkuma, Yoshiaki; Nishimura, Yoshifumi
2008-01-01
Human general transcription factor IIF (TFIIF), a component of the transcription pre-initiation complex (PIC) associated with RNA polymerase II (Pol II), was characterized by size-exclusion chromatography (SEC), electrospray ionization mass spectrometry (ESI-MS), and chemical cross-linking. Recombinant TFIIF, composed of an equimolar ratio of α and β subunits, was bacterially expressed, purified to homogeneity, and found to have a transcription activity similar to a natural one in the human in vitro transcription system. SEC of purified TFIIF, as previously reported, suggested that this protein has a size >200 kDa. In contrast, ESI-MS of the purified sample gave a molecular size of 87 kDa, indicating that TFIIF is an αβ heterodimer, which was confirmed by matrix-assisted laser desorption/ionization (MALDI) MS of the cross-linked TFIIF components. Recent electron microscopy (EM) and photo-cross-linking studies showed that the yeast TFIIF homolog containing Tfg1 and Tfg2, corresponding to the human α and β subunits, exists as a heterodimer in the PIC, so the human TFIIF is also likely to exist as a heterodimer even in the PIC. In the yeast PIC, EM and photo-cross-linking studies showed different results for the mutual location of TFIIE and TFIIF along DNA. We have examined the direct interaction between human TFIIF and TFIIE by ESI-MS, SEC, and chemical cross-linking; however, no direct interaction was observed, at least in solution. This is consistent with the previous photo-cross-linking observation that TFIIF and TFIIE flank DNA separately on both sides of the Pol II central cleft in the yeast PIC. PMID:18218714
Pervasive transcription: detecting functional RNAs in bacteria.
Lybecker, Meghan; Bilusic, Ivana; Raghavan, Rahul
2014-01-01
Pervasive, or genome-wide, transcription has been reported in all domains of life. In bacteria, most pervasive transcription occurs antisense to protein-coding transcripts, although recently a new class of pervasive RNAs was identified that originates from within annotated genes. Initially considered to be non-functional transcriptional noise, pervasive transcription is increasingly being recognized as important in regulating gene expression. The function of pervasive transcription is an extensively debated question in the field of transcriptomics and regulatory RNA biology. Here, we highlight the most recent contributions addressing the purpose of pervasive transcription in bacteria and discuss their implications.
Zhai, Zhengyuan; An, Haoran; Wang, Guohong; Luo, Yunbo; Hao, Yanling
2015-01-01
Lactobacillus delbrueckii subsp. bulgaricus develops acid tolerance response when subjected to acid stress conditions, such as the induction of enzymes associated with carbohydrate metabolism. In this study, pyk gene encoding pyruvate kinase was over-expressed in heterologous host Lactococcus lactis NZ9000, and SDS-PAGE analysis revealed the successful expression of this gene in NZ9000. The survival rate of Pyk-overproducing strain was 45-fold higher than the control under acid stress condition (pH 4.0). In order to determine the transcription factor (TF) which regulates the expression of pyk by bacterial one-hybrid, we constructed a TF library including 65 TFs of L. bulgaricus. Western blotting indicated that TFs in this library could be successfully expressed in host strains. Subsequently, the promoter of pfk-pyk operon in L. bulgaricus was identified by 5′-RACE PCR. The bait plasmid pH3U3-p01 carrying the deletion fragment of pfk-pyk promoter captured catabolite control protein A (CcpA) which could regulate the expression of pyk by binding to a putative catabolite-responsive element (5′-TGTAAGCCCTAACA-3′) upstream the -35 region. Real-time qPCR analysis revealed the transcription of pyk was positively regulated by CcpA. This is the first report about identifying the TF of pyk in L. bulgaricus, which will provide new insight into the regulatory network. PMID:26581248
Transcription upregulation via force-induced direct stretching of chromatin
NASA Astrophysics Data System (ADS)
Tajik, Arash; Zhang, Yuejin; Wei, Fuxiang; Sun, Jian; Jia, Qiong; Zhou, Wenwen; Singh, Rishi; Khanna, Nimish; Belmont, Andrew S.; Wang, Ning
2016-12-01
Mechanical forces play critical roles in the function of living cells. However, the underlying mechanisms of how forces influence nuclear events remain elusive. Here, we show that chromatin deformation as well as force-induced transcription of a green fluorescent protein (GFP)-tagged bacterial-chromosome dihydrofolate reductase (DHFR) transgene can be visualized in a living cell by using three-dimensional magnetic twisting cytometry to apply local stresses on the cell surface via an Arg-Gly-Asp-coated magnetic bead. Chromatin stretching depended on loading direction. DHFR transcription upregulation was sensitive to load direction and proportional to the magnitude of chromatin stretching. Disrupting filamentous actin or inhibiting actomyosin contraction abrogated or attenuated force-induced DHFR transcription, whereas activating endogenous contraction upregulated force-induced DHFR transcription. Our findings suggest that local stresses applied to integrins propagate from the tensed actin cytoskeleton to the LINC complex and then through lamina-chromatin interactions to directly stretch chromatin and upregulate transcription.
Direct modulation of T-box riboswitch-controlled transcription by protein synthesis inhibitors
Stamatopoulou, Vassiliki; Apostolidi, Maria; Li, Shuang; Lamprinou, Katerina; Papakyriakou, Athanasios
2017-01-01
Abstract Recently, it was discovered that exposure to mainstream antibiotics activate numerous bacterial riboregulators that control antibiotic resistance genes including metabolite-binding riboswitches and other transcription attenuators. However, the effects of commonly used antibiotics, many of which exhibit RNA-binding properties, on the widespread T-box riboswitches, remain unknown. In Staphylococcus aureus, a species-specific glyS T-box controls the supply of glycine for both ribosomal translation and cell wall synthesis, making it a promising target for next-generation antimicrobials. Here, we report that specific protein synthesis inhibitors could either significantly increase T-box-mediated transcription antitermination, while other compounds could suppress it, both in vitro and in vivo. In-line probing of the full-length T-box combined with molecular modelling and docking analyses suggest that the antibiotics that promote transcription antitermination stabilize the T-box:tRNA complex through binding specific positions on stem I and the Staphylococcal-specific stem Sa. By contrast, the antibiotics that attenuate T-box transcription bind to other positions on stem I and do not interact with stem Sa. Taken together, our results reveal that the transcription of essential genes controlled by T-box riboswitches can be directly modulated by commonly used protein synthesis inhibitors. These findings accentuate the regulatory complexities of bacterial response to antimicrobials that involve multiple riboregulators. PMID:28973457
Nordén, Rickard; Martner, Anna; Samuelsson, Ebba; Hynsjö, Lars; Wold, Agnes E.
2017-01-01
ABSTRACT A peculiar trait of pneumococci (Streptococcus pneumoniae) is their propensity to undergo spontaneous lysis during stationary growth due to activation of the enzyme autolysin (LytA), which fragments the peptidoglycan cell wall. The fragments that are generated upon autolysis impair phagocytosis and reduce production of interleukin-12 (IL-12) and gamma interferon (IFN-γ) by human leukocytes in response to intact pneumococci, thereby impeding crucial host defenses. The objective was to identify additional monocyte genes whose transcription is induced by intact pneumococci and subverted by autolyzed bacteria. Monocytes were isolated from healthy blood donors and stimulated for 3 h with UV-inactivated S. pneumoniae (Rx1PLY− LytA+ strain), which is capable of autolyzing, its LytA− isogenic autolysin-deficient mutant, or a mixture of the two (containing twice the initial bacterial concentration). Gene expression was assessed by Illumina microarray, and selected findings were confirmed by reverse transcription-quantitative real-time PCR (RT-qPCR), enzyme-linked immunosorbent assay (ELISA), and flow cytometry. In all, we identified 121 genes that were upregulated to a significantly higher degree by intact than autolyzed pneumococci. These included IFNB1 and a large set of interferon-induced genes, such as IFIT3, RSAD2, CFCL1, and CXCL10 genes, as well as IL12B and CD40 genes. RT-qPCR revealed that transcription of these genes in response to intact pneumococci diminished when autolyzed pneumococci were admixed and that this pattern was independent of pneumolysin. Thus, transcription of interferon-related genes is triggered by intact pneumococci and subverted by fragments generated by spontaneous bacterial autolysis. We suggest that interferon-related pathways are important for elimination of pneumococci and that autolysis contributes to virulence by extinguishing these pathways. PMID:28223347
Berger, Michael; Gerganova, Veneta; Berger, Petya; Rapiteanu, Radu; Lisicovas, Viktoras; Dobrindt, Ulrich
2016-01-01
The extent to which chromosomal gene position in prokaryotes affects local gene expression remains an open question. Several studies have shown that chromosomal re-positioning of bacterial transcription units does not alter their expression pattern, except for a general decrease in gene expression levels from chromosomal origin to terminus proximal positions, which is believed to result from gene dosage effects. Surprisingly, the question as to whether this chromosomal context independence is a cis encoded property of a bacterial transcription unit, or if position independence is a property conferred by factors acting in trans, has not been addressed so far. For this purpose, we established a genetic test system assessing the chromosomal positioning effects by means of identical promoter-fluorescent reporter gene fusions inserted equidistantly from OriC into both chromosomal replichores of Escherichia coli K-12. Our investigations of the reporter activities in mutant cells lacking the conserved nucleoid associated protein HU uncovered various drastic chromosomal positional effects on gene transcription. In addition we present evidence that these positional effects are caused by transcriptional activity nearby the insertion site of our reporter modules. We therefore suggest that the nucleoid-associated protein HU is functionally insulating transcription units, most likely by constraining transcription induced DNA supercoiling. PMID:27545593
RNA-Seq-Based Transcript Structure Analysis with TrBorderExt.
Wang, Yejun; Sun, Ming-An; White, Aaron P
2018-01-01
RNA-Seq has become a routine strategy for genome-wide gene expression comparisons in bacteria. Despite lower resolution in transcript border parsing compared with dRNA-Seq, TSS-EMOTE, Cappable-seq, Term-seq, and others, directional RNA-Seq still illustrates its advantages: low cost, quantification and transcript border analysis with a medium resolution (±10-20 nt). To facilitate mining of directional RNA-Seq datasets especially with respect to transcript structure analysis, we developed a tool, TrBorderExt, which can parse transcript start sites and termination sites accurately in bacteria. A detailed protocol is described in this chapter for how to use the software package step by step to identify bacterial transcript borders from raw RNA-Seq data. The package was developed with Perl and R programming languages, and is accessible freely through the website: http://www.szu-bioinf.org/TrBorderExt .
Suppression of Factor-Dependent Transcription Termination by Antiterminator RNA
King, Rodney A.; Weisberg, Robert A.
2003-01-01
Nascent transcripts of the phage HK022 put sites modify the transcription elongation complex so that it terminates less efficiently at intrinsic transcription terminators and accelerates through pause sites. We show here that the modification also suppresses termination in vivo at two factor-dependent terminators, one that depends on the bacterial Rho protein and a second that depends on the HK022-encoded Nun protein. Suppression was efficient when the termination factors were present at physiological levels, but an increase in the intracellular concentration of Nun increased termination both in the presence and absence of put. put-mediated antitermination thus shows no apparent terminator specificity, suggesting that put inhibits a step that is common to termination at the different types of terminator. PMID:14645267
Wilson, Clyde; Zeng, Linghe; Ismail, Abdelbagi M.; Condamine, Pascal; Close, Timothy J.
2006-01-01
Rice yield is most sensitive to salinity stress imposed during the panicle initiation (PI) stage. In this study, we have focused on physiological and transcriptional responses of four rice genotypes exposed to salinity stress during PI. The genotypes selected included a pair of indicas (IR63731 and IR29) and a pair of japonica (Agami and M103) rice subspecies with contrasting salt tolerance. Physiological characterization showed that tolerant genotypes maintained a much lower shoot Na+ concentration relative to sensitive genotypes under salinity stress. Global gene expression analysis revealed a strikingly large number of genes which are induced by salinity stress in sensitive genotypes, IR29 and M103 relative to tolerant lines. We found 19 probe sets to be commonly induced in all four genotypes. We found several salinity modulated, ion homeostasis related genes from our analysis. We also studied the expression of SKC1, a cation transporter reported by others as a major source of variation in salt tolerance in rice. The transcript abundance of SKC1 did not change in response to salinity stress at PI stage in the shoot tissue of all four genotypes. However, we found the transcript abundance of SKC1 to be significantly higher in tolerant japonica Agami relative to sensitive japonica M103 under control and stressed conditions during PI stage. Electronic supplementary material Supplementary material is available in the online version of this article at http://dx.doi.org/10.1007/s11103-006-9112-0 and is accessible for authorized users. PMID:17160619
Yuan, Meng; Ke, Yinggen; Huang, Renyan; Ma, Ling; Yang, Zeyu; Chu, Zhaohui; Xiao, Jinghua; Li, Xianghua; Wang, Shiping
2016-07-29
Transcription activator-like effectors (TALEs) are sequence-specific DNA binding proteins found in a range of plant pathogenic bacteria, where they play important roles in host-pathogen interactions. However, it has been unclear how TALEs, after they have been injected into the host cells, activate transcription of host genes required for infection success. Here, we show that the basal transcription factor IIA gamma subunit TFIIAγ5 from rice is a key component for infection by the TALE-carrying bacterium Xanthomonas oryzae pv. oryzae, the causal agent for bacterial blight. Direct interaction of several TALEs with TFIIAγ5 is required for activation of disease susceptibility genes. Conversely, reduced expression of the TFIIAγ5 host gene limits the induction of susceptibility genes and thus decreases bacterial blight symptoms. Suppression or mutation of TFIIAγ5 can also reduce bacterial streak, another devastating disease of rice caused by TALE-carrying X. oryzae pv. oryzicola. These results have important implications for formulating a widely applicable strategy with which to improve resistance of plants to TALE-carrying pathogens.
Cornman, Robert Scott; Lopez, Dawn; Evans, Jay D.
2013-01-01
American foulbrood disease of honey bees is caused by the bacterium Paenibacillus larvae. Infection occurs per os in larvae and systemic infection requires a breaching of the host peritrophic matrix and midgut epithelium. Genetic variation exists for both bacterial virulence and host resistance, and a general immunity is achieved by larvae as they age, the basis of which has not been identified. To quickly identify a pool of candidate genes responsive to P. larvae infection, we sequenced transcripts from larvae inoculated with P. larvae at 12 hours post-emergence and incubated for 72 hours, and compared expression levels to a control cohort. We identified 75 genes with significantly higher expression and six genes with significantly lower expression. In addition to several antimicrobial peptides, two genes encoding peritrophic-matrix domains were also up-regulated. Extracellular matrix proteins, proteases/protease inhibitors, and members of the Osiris gene family were prevalent among differentially regulated genes. However, analysis of Drosophila homologs of differentially expressed genes revealed spatial and temporal patterns consistent with developmental asynchrony as a likely confounder of our results. We therefore used qPCR to measure the consistency of gene expression changes for a subset of differentially expressed genes. A replicate experiment sampled at both 48 and 72 hours post infection allowed further discrimination of genes likely to be involved in host response. The consistently responsive genes in our test set included a hymenopteran-specific protein tyrosine kinase, a hymenopteran specific serine endopeptidase, a cytochrome P450 (CYP9Q1), and a homolog of trynity, a zona pellucida domain protein. Of the known honey bee antimicrobial peptides, apidaecin was responsive at both time-points studied whereas hymenoptaecin was more consistent in its level of change between biological replicates and had the greatest increase in expression by RNA-seq analysis
Cornman, Robert Scott; Lopez, Dawn; Evans, Jay D
2013-01-01
American foulbrood disease of honey bees is caused by the bacterium Paenibacillus larvae. Infection occurs per os in larvae and systemic infection requires a breaching of the host peritrophic matrix and midgut epithelium. Genetic variation exists for both bacterial virulence and host resistance, and a general immunity is achieved by larvae as they age, the basis of which has not been identified. To quickly identify a pool of candidate genes responsive to P. larvae infection, we sequenced transcripts from larvae inoculated with P. larvae at 12 hours post-emergence and incubated for 72 hours, and compared expression levels to a control cohort. We identified 75 genes with significantly higher expression and six genes with significantly lower expression. In addition to several antimicrobial peptides, two genes encoding peritrophic-matrix domains were also up-regulated. Extracellular matrix proteins, proteases/protease inhibitors, and members of the Osiris gene family were prevalent among differentially regulated genes. However, analysis of Drosophila homologs of differentially expressed genes revealed spatial and temporal patterns consistent with developmental asynchrony as a likely confounder of our results. We therefore used qPCR to measure the consistency of gene expression changes for a subset of differentially expressed genes. A replicate experiment sampled at both 48 and 72 hours post infection allowed further discrimination of genes likely to be involved in host response. The consistently responsive genes in our test set included a hymenopteran-specific protein tyrosine kinase, a hymenopteran specific serine endopeptidase, a cytochrome P450 (CYP9Q1), and a homolog of trynity, a zona pellucida domain protein. Of the known honey bee antimicrobial peptides, apidaecin was responsive at both time-points studied whereas hymenoptaecin was more consistent in its level of change between biological replicates and had the greatest increase in expression by RNA-seq analysis.
Immunomodulators targeting MARCO expression improve resistance to postinfluenza bacterial pneumonia.
Wu, Muzo; Gibbons, John G; DeLoid, Glen M; Bedugnis, Alice S; Thimmulappa, Rajesh K; Biswal, Shyam; Kobzik, Lester
2017-07-01
Downregulation of the alveolar macrophage (AM) receptor with collagenous structure (MARCO) leads to susceptibility to postinfluenza bacterial pneumonia, a major cause of morbidity and mortality. We sought to determine whether immunomodulation of MARCO could improve host defense and resistance to secondary bacterial pneumonia. RNAseq analysis identified a striking increase in MARCO expression between days 9 and 11 after influenza infection and indicated important roles for Akt and Nrf2 in MARCO recovery. In vitro, primary human AM-like monocyte-derived macrophages (AM-MDMs) and THP-1 macrophages were treated with IFNγ to model influenza effects. Activators of Nrf2 (sulforaphane) or Akt (SC79) caused increased MARCO expression and a MARCO-dependent improvement in phagocytosis in IFNγ-treated cells and improved survival in mice with postinfluenza pneumococcal pneumonia. Transcription factor analysis also indicated a role for transcription factor E-box (TFEB) in MARCO recovery. Overexpression of TFEB in THP-1 cells led to marked increases in MARCO. The ability of Akt activation to increase MARCO expression in IFNγ-treated AM-MDMs was abrogated in TFEB-knockdown cells, indicating Akt increases MARCO expression through TFEB. Increasing MARCO expression by targeting Nrf2 signaling or the Akt-TFEB-MARCO pathway are promising strategies to improve bacterial clearance and survival in postinfluenza bacterial pneumonia. Copyright © 2017 the American Physiological Society.
El-Mayet, Fouad S; Sawant, Laximan; Thunuguntla, Prasanth; Jones, Clinton
2017-11-01
respiratory disease and suppresses immune responses in cattle; consequently, life-threatening bacterial pneumonia can occur. Following acute infection, BoHV-1 establishes lifelong latency in sensory neurons. Reactivation from latency is initiated by the synthetic corticosteroid dexamethasone. Dexamethasone stimulates lytic cycle viral gene expression in sensory neurons of calves latently infected with BoHV-1, culminating in virus shedding and transmission. Two stress-induced cellular transcription factors, Krüppel-like transcription factor 15 (KLF15) and the glucocorticoid receptor (GR), cooperate to stimulate productive infection and viral transcription. Additional studies demonstrated that KLF15 and the GR form a stable complex and that these stress-induced transcription factors bind to viral DNA sequences, which correlates with transcriptional activation. The ability of the GR and KLF15 to synergistically stimulate viral gene expression and productive infection may be critical for the ability of BoHV-1 to reactivate from latency following stressful stimuli. Copyright © 2017 American Society for Microbiology.
El-mayet, Fouad S.; Sawant, Laximan; Thunuguntla, Prasanth
2017-01-01
causes respiratory disease and suppresses immune responses in cattle; consequently, life-threatening bacterial pneumonia can occur. Following acute infection, BoHV-1 establishes lifelong latency in sensory neurons. Reactivation from latency is initiated by the synthetic corticosteroid dexamethasone. Dexamethasone stimulates lytic cycle viral gene expression in sensory neurons of calves latently infected with BoHV-1, culminating in virus shedding and transmission. Two stress-induced cellular transcription factors, Krüppel-like transcription factor 15 (KLF15) and the glucocorticoid receptor (GR), cooperate to stimulate productive infection and viral transcription. Additional studies demonstrated that KLF15 and the GR form a stable complex and that these stress-induced transcription factors bind to viral DNA sequences, which correlates with transcriptional activation. The ability of the GR and KLF15 to synergistically stimulate viral gene expression and productive infection may be critical for the ability of BoHV-1 to reactivate from latency following stressful stimuli. PMID:28794031
Epigenetic Regulation of Transcription in Trypanosomatid Protozoa.
Martínez-Calvillo, Santiago; Romero-Meza, Gabriela; Vizuet-de-Rueda, Juan C; Florencio-Martínez, Luis E; Manning-Cela, Rebeca; Nepomuceno-Mejía, Tomás
2018-02-01
The Trypanosomatid family includes flagellated parasites that cause fatal human diseases. Remarkably, protein-coding genes in these organisms are positioned in long tandem arrays that are transcribed polycistronically. However, the knowledge about regulation of transcription initiation and termination in trypanosomatids is scarce. The importance of epigenetic regulation in these processes has become evident in the last years, as distinctive histone modifications and histone variants have been found in transcription initiation and termination regions. Moreover, multiple chromatin-related proteins have been identified and characterized in trypanosomatids, including histone-modifying enzymes, effector complexes, chromatin-remodelling enzymes and histone chaperones. Notably, base J, a modified thymine residue present in the nuclear DNA of trypanosomatids, has been implicated in transcriptional regulation. Here we review the current knowledge on epigenetic control of transcription by all three RNA polymerases in this group of early-diverged eukaryotes.
The Global Regulatory Architecture of Transcription during the Caulobacter Cell Cycle
Zhou, Bo; Schrader, Jared M.; Kalogeraki, Virginia S.; Abeliuk, Eduardo; Dinh, Cong B.; Pham, James Q.; Cui, Zhongying Z.; Dill, David L.; McAdams, Harley H.; Shapiro, Lucy
2015-01-01
Each Caulobacter cell cycle involves differentiation and an asymmetric cell division driven by a cyclical regulatory circuit comprised of four transcription factors (TFs) and a DNA methyltransferase. Using a modified global 5′ RACE protocol, we globally mapped transcription start sites (TSSs) at base-pair resolution, measured their transcription levels at multiple times in the cell cycle, and identified their transcription factor binding sites. Out of 2726 TSSs, 586 were shown to be cell cycle-regulated and we identified 529 binding sites for the cell cycle master regulators. Twenty-three percent of the cell cycle-regulated promoters were found to be under the combinatorial control of two or more of the global regulators. Previously unknown features of the core cell cycle circuit were identified, including 107 antisense TSSs which exhibit cell cycle-control, and 241 genes with multiple TSSs whose transcription levels often exhibited different cell cycle timing. Cumulatively, this study uncovered novel new layers of transcriptional regulation mediating the bacterial cell cycle. PMID:25569173
The global regulatory architecture of transcription during the Caulobacter cell cycle.
Zhou, Bo; Schrader, Jared M; Kalogeraki, Virginia S; Abeliuk, Eduardo; Dinh, Cong B; Pham, James Q; Cui, Zhongying Z; Dill, David L; McAdams, Harley H; Shapiro, Lucy
2015-01-01
Each Caulobacter cell cycle involves differentiation and an asymmetric cell division driven by a cyclical regulatory circuit comprised of four transcription factors (TFs) and a DNA methyltransferase. Using a modified global 5' RACE protocol, we globally mapped transcription start sites (TSSs) at base-pair resolution, measured their transcription levels at multiple times in the cell cycle, and identified their transcription factor binding sites. Out of 2726 TSSs, 586 were shown to be cell cycle-regulated and we identified 529 binding sites for the cell cycle master regulators. Twenty-three percent of the cell cycle-regulated promoters were found to be under the combinatorial control of two or more of the global regulators. Previously unknown features of the core cell cycle circuit were identified, including 107 antisense TSSs which exhibit cell cycle-control, and 241 genes with multiple TSSs whose transcription levels often exhibited different cell cycle timing. Cumulatively, this study uncovered novel new layers of transcriptional regulation mediating the bacterial cell cycle.
Ubiquitin and Proteasomes in Transcription
Geng, Fuqiang; Wenzel, Sabine; Tansey, William P.
2013-01-01
Regulation of gene transcription is vitally important for the maintenance of normal cellular homeostasis. Failure to correctly regulate gene expression, or to deal with problems that arise during the transcription process, can lead to cellular catastrophe and disease. One of the ways cells cope with the challenges of transcription is by making extensive use of the proteolytic and nonproteolytic activities of the ubiquitin-proteasome system (UPS). Here, we review recent evidence showing deep mechanistic connections between the transcription and ubiquitin-proteasome systems. Our goal is to leave the reader with a sense that just about every step in transcription—from transcription initiation through to export of mRNA from the nucleus—is influenced by the UPS and that all major arms of the system—from the first step in ubiquitin (Ub) conjugation through to the proteasome—are recruited into transcriptional processes to provide regulation, directionality, and deconstructive power. PMID:22404630
An RNA motif advances transcription by preventing Rho-dependent termination
Sevostyanova, Anastasia; Groisman, Eduardo A.
2015-01-01
The transcription termination factor Rho associates with most nascent bacterial RNAs as they emerge from RNA polymerase. However, pharmacological inhibition of Rho derepresses only a small fraction of these transcripts. What, then, determines the specificity of Rho-dependent transcription termination? We now report the identification of a Rho-antagonizing RNA element (RARE) that hinders Rho-dependent transcription termination. We establish that RARE traps Rho in an inactive complex but does not prevent Rho binding to its recruitment sites. Although translating ribosomes normally block Rho access to an mRNA, inefficient translation of an open reading frame in the leader region of the Salmonella mgtCBR operon actually enables transcription of its associated coding region by favoring an RNA conformation that sequesters RARE. The discovery of an RNA element that inactivates Rho signifies that the specificity of nucleic-acid binding proteins is defined not only by the sequences that recruit these proteins but also by sequences that antagonize their activity. PMID:26630006
Direct modulation of T-box riboswitch-controlled transcription by protein synthesis inhibitors.
Stamatopoulou, Vassiliki; Apostolidi, Maria; Li, Shuang; Lamprinou, Katerina; Papakyriakou, Athanasios; Zhang, Jinwei; Stathopoulos, Constantinos
2017-09-29
Recently, it was discovered that exposure to mainstream antibiotics activate numerous bacterial riboregulators that control antibiotic resistance genes including metabolite-binding riboswitches and other transcription attenuators. However, the effects of commonly used antibiotics, many of which exhibit RNA-binding properties, on the widespread T-box riboswitches, remain unknown. In Staphylococcus aureus, a species-specific glyS T-box controls the supply of glycine for both ribosomal translation and cell wall synthesis, making it a promising target for next-generation antimicrobials. Here, we report that specific protein synthesis inhibitors could either significantly increase T-box-mediated transcription antitermination, while other compounds could suppress it, both in vitro and in vivo. In-line probing of the full-length T-box combined with molecular modelling and docking analyses suggest that the antibiotics that promote transcription antitermination stabilize the T-box:tRNA complex through binding specific positions on stem I and the Staphylococcal-specific stem Sa. By contrast, the antibiotics that attenuate T-box transcription bind to other positions on stem I and do not interact with stem Sa. Taken together, our results reveal that the transcription of essential genes controlled by T-box riboswitches can be directly modulated by commonly used protein synthesis inhibitors. These findings accentuate the regulatory complexities of bacterial response to antimicrobials that involve multiple riboregulators. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Chun, Carlene K; Troll, Joshua V; Koroleva, Irina; Brown, Bartley; Manzella, Liliana; Snir, Einat; Almabrazi, Hakeem; Scheetz, Todd E; Bonaldo, Maria de Fatima; Casavant, Thomas L; Soares, M Bento; Ruby, Edward G; McFall-Ngai, Margaret J
2008-08-12
The light-organ symbiosis between the squid Euprymna scolopes and the luminous bacterium Vibrio fischeri offers the opportunity to decipher the hour-by-hour events that occur during the natural colonization of an animal's epithelial surface by its microbial partners. To determine the genetic basis of these events, a glass-slide microarray was used to characterize the light-organ transcriptome of juvenile squid in response to the initiation of symbiosis. Patterns of gene expression were compared between animals not exposed to the symbiont, exposed to the wild-type symbiont, or exposed to a mutant symbiont defective in either of two key characters of this association: bacterial luminescence or autoinducer (AI) production. Hundreds of genes were differentially regulated as a result of symbiosis initiation, and a hierarchy existed in the magnitude of the host's response to three symbiont features: bacterial presence > luminescence > AI production. Putative host receptors for bacterial surface molecules known to induce squid development are up-regulated by symbiont light production, suggesting that bioluminescence plays a key role in preparing the host for bacteria-induced development. Further, because the transcriptional response of tissues exposed to AI in the natural context (i.e., with the symbionts) differed from that to AI alone, the presence of the bacteria potentiates the role of quorum signals in symbiosis. Comparison of these microarray data with those from other symbioses, such as germ-free/conventionalized mice and zebrafish, revealed a set of shared genes that may represent a core set of ancient host responses conserved throughout animal evolution.
Chun, Carlene K.; Troll, Joshua V.; Koroleva, Irina; Brown, Bartley; Manzella, Liliana; Snir, Einat; Almabrazi, Hakeem; Scheetz, Todd E.; de Fatima Bonaldo, Maria; Casavant, Thomas L.; Soares, M. Bento; Ruby, Edward G.; McFall-Ngai, Margaret J.
2008-01-01
The light–organ symbiosis between the squid Euprymna scolopes and the luminous bacterium Vibrio fischeri offers the opportunity to decipher the hour-by-hour events that occur during the natural colonization of an animal's epithelial surface by its microbial partners. To determine the genetic basis of these events, a glass-slide microarray was used to characterize the light-organ transcriptome of juvenile squid in response to the initiation of symbiosis. Patterns of gene expression were compared between animals not exposed to the symbiont, exposed to the wild-type symbiont, or exposed to a mutant symbiont defective in either of two key characters of this association: bacterial luminescence or autoinducer (AI) production. Hundreds of genes were differentially regulated as a result of symbiosis initiation, and a hierarchy existed in the magnitude of the host's response to three symbiont features: bacterial presence > luminescence > AI production. Putative host receptors for bacterial surface molecules known to induce squid development are up-regulated by symbiont light production, suggesting that bioluminescence plays a key role in preparing the host for bacteria-induced development. Further, because the transcriptional response of tissues exposed to AI in the natural context (i.e., with the symbionts) differed from that to AI alone, the presence of the bacteria potentiates the role of quorum signals in symbiosis. Comparison of these microarray data with those from other symbioses, such as germ-free/conventionalized mice and zebrafish, revealed a set of shared genes that may represent a core set of ancient host responses conserved throughout animal evolution. PMID:18682555
Mahajan, Prashant; Kuppermann, Nathan; Suarez, Nicolas; Mejias, Asuncion; Casper, Charlie; Dean, J Michael; Ramilo, Octavio
2015-01-01
To develop the infrastructure and demonstrate the feasibility of conducting microarray-based RNA transcriptional profile analyses for the diagnosis of serious bacterial infections in febrile infants 60 days and younger in a multicenter pediatric emergency research network. We designed a prospective multicenter cohort study with the aim of enrolling more than 4000 febrile infants 60 days and younger. To ensure success of conducting complex genomic studies in emergency department (ED) settings, we established an infrastructure within the Pediatric Emergency Care Applied Research Network, including 21 sites, to evaluate RNA transcriptional profiles in young febrile infants. We developed a comprehensive manual of operations and trained site investigators to obtain and process blood samples for RNA extraction and genomic analyses. We created standard operating procedures for blood sample collection, processing, storage, shipping, and analyses. We planned to prospectively identify, enroll, and collect 1 mL blood samples for genomic analyses from eligible patients to identify logistical issues with study procedures. Finally, we planned to batch blood samples and determined RNA quantity and quality at the central microarray laboratory and organized data analysis with the Pediatric Emergency Care Applied Research Network data coordinating center. Below we report on establishment of the infrastructure and the feasibility success in the first year based on the enrollment of a limited number of patients. We successfully established the infrastructure at 21 EDs. Over the first 5 months we enrolled 79% (74 of 94) of eligible febrile infants. We were able to obtain and ship 1 mL of blood from 74% (55 of 74) of enrolled participants, with at least 1 sample per participating ED. The 55 samples were shipped and evaluated at the microarray laboratory, and 95% (52 of 55) of blood samples were of adequate quality and contained sufficient RNA for expression analysis. It is possible to
Design of a Temperature-Responsive Transcription Terminator.
Roßmanith, Johanna; Weskamp, Mareen; Narberhaus, Franz
2018-02-16
RNA structures regulate various steps in gene expression. Transcription in bacteria is typically terminated by stable hairpin structures. Translation initiation can be modulated by metabolite- or temperature-sensitive RNA structures, called riboswitches or RNA thermometers (RNATs), respectively. RNATs control translation initiation by occlusion of the ribosome binding site at low temperatures. Increasing temperatures destabilize the RNA structure and facilitate ribosome access. In this study, we exploited temperature-responsive RNAT structures to design regulatory elements that control transcription termination instead of translation initiation in Escherichia coli. In order to mimic the structure of factor-independent intrinsic terminators, naturally occurring RNAT hairpins were genetically engineered to be followed by a U-stretch. Functional temperature-responsive terminators (thermoterms) prevented mRNA synthesis at low temperatures but resumed transcription after a temperature upshift. The successful design of temperature-controlled terminators highlights the potential of RNA structures as versatile gene expression control elements.
Disease notes - Bacterial root rot
USDA-ARS?s Scientific Manuscript database
Bacterial root rot initiated by lactic acid bacteria, particularly Leuconostoc, occurs every year in Idaho sugarbeet fields. Hot fall weather seems to make the problem worse. Although Leuconostoc initiates the rot, other bacteria and yeast frequently invade the tissue as well. The acetic acid bac...
Transcription regulation by distal enhancers
Stadhouders, Ralph; van den Heuvel, Anita; Kolovos, Petros; Jorna, Ruud; Leslie, Kris; Grosveld, Frank; Soler, Eric
2012-01-01
Genome-wide chromatin profiling efforts have shown that enhancers are often located at large distances from gene promoters within the noncoding genome. Whereas enhancers can stimulate transcription initiation by communicating with promoters via chromatin looping mechanisms, we propose that enhancers may also stimulate transcription elongation by physical interactions with intronic elements. We review here recent findings derived from the study of the hematopoietic system. PMID:22771987
Bacterial meningitis - principles of antimicrobial treatment.
Jawień, Miroslaw; Garlicki, Aleksander M
2013-01-01
Bacterial meningitis is associated with significant morbidity and mortality despite the availability of effective antimicrobial therapy. The management approach to patients with suspected or proven bacterial meningitis includes emergent cerebrospinal fluid analysis and initiation of appropriate antimicrobial and adjunctive therapies. The choice of empirical antimicrobial therapy is based on the patient's age and underlying disease status; once the infecting pathogen is isolated, antimicrobial therapy can be modified for optimal treatment. Successful treatment of bacterial meningitis requires the knowledge on epidemiology including prevalence of antimicrobial resistant pathogens, pathogenesis of meningitis, pharmacokinetics and pharmacodynamics of antimicrobial agents. The emergence of antibiotic-resistant bacterial strains in recent years has necessitated the development of new strategies for empiric antimicrobial therapy for bacterial meningitis.
TAF(II)250: a transcription toolbox.
Wassarman, D A; Sauer, F
2001-08-01
Activation of RNA-polymerase-II-dependent transcription involves conversion of signals provided by gene-specific activator proteins into the synthesis of messenger RNA. This conversion requires dynamic structural changes in chromatin and assembly of general transcription factors (GTFs) and RNA polymerase II at core promoter sequence elements surrounding the transcription start site of genes. One hallmark of transcriptional activation is the interaction of DNA-bound activators with coactivators such as the TATA-box binding protein (TBP)-associated factors (TAF(II)s) within the GTF TFIID. TAF(II)250 possesses a variety of activities that are likely to contribute to the initial steps of RNA polymerase II transcription. TAF(II)250 is a scaffold for assembly of other TAF(II)s and TBP into TFIID, TAF(II)250 binds activators to recruit TFIID to particular promoters, TAF(II)250 regulates binding of TBP to DNA, TAF(II)250 binds core promoter initiator elements, TAF(II)250 binds acetylated lysine residues in core histones, and TAF(II)250 possesses protein kinase, ubiquitin-activating/conjugating and acetylase activities that modify histones and GTFs. We speculate that these activities achieve two goals--(1) they aid in positioning and stabilizing TFIID at particular promoters, and (2) they alter chromatin structure at the promoter to allow assembly of GTFs--and we propose a model for how TAF(II)250 converts activation signals into active transcription.
Transcriptional Control of the Lateral-Flagellar Genes of Bradyrhizobium diazoefficiens.
Mongiardini, Elías J; Quelas, J Ignacio; Dardis, Carolina; Althabegoiti, M Julia; Lodeiro, Aníbal R
2017-08-01
Bradyrhizobium diazoefficiens , a soybean N 2 -fixing symbiont, possesses a dual flagellar system comprising a constitutive subpolar flagellum and inducible lateral flagella. Here, we analyzed the genomic organization and biosynthetic regulation of the lateral-flagellar genes. We found that these genes are located in a single genomic cluster, organized in two monocistronic transcriptional units and three operons, one possibly containing an internal transcription start site. Among the monocistronic units is blr6846, homologous to the class IB master regulators of flagellum synthesis in Brucella melitensis and Ensifer meliloti and required for the expression of all the lateral-flagellar genes except lafA2 , whose locus encodes a single lateral flagellin. We therefore named blr6846 lafR ( la teral- f lagellar r egulator). Despite its similarity to two-component response regulators and its possession of a phosphorylatable Asp residue, lafR behaved as an orphan response regulator by not requiring phosphorylation at this site. Among the genes induced by lafR is flbT L , a class III regulator. We observed different requirements for FlbT L in the synthesis of each flagellin subunit. Although the accumulation of lafA1 , but not lafA2 , transcripts required FlbT L , the production of both flagellin polypeptides required FlbT L Moreover, the regulation cascade of this lateral-flagellar regulon appeared to be not as strictly ordered as those found in other bacterial species. IMPORTANCE Bacterial motility seems essential for the free-living style in the environment, and therefore these microorganisms allocate a great deal of their energetic resources to the biosynthesis and functioning of flagella. Despite energetic costs, some bacterial species possess dual flagellar systems, one of which is a primary system normally polar or subpolar, and the other is a secondary, lateral system that is produced only under special circumstances. Bradyrhizobium diazoefficiens , an N 2 -fixing
Bequette, Carlton J.; Fu, Zheng Qing; Loraine, Ann E.
2016-01-01
AINTEGUMENTA (ANT) and AINTEGUMENTA-LIKE6 (AIL6) are two related transcription factors in Arabidopsis (Arabidopsis thaliana) that have partially overlapping roles in several aspects of flower development, including floral organ initiation, identity specification, growth, and patterning. To better understand the biological processes regulated by these two transcription factors, we performed RNA sequencing (RNA-Seq) on ant ail6 double mutants. We identified thousands of genes that are differentially expressed in the double mutant compared with the wild type. Analyses of these genes suggest that ANT and AIL6 regulate floral organ initiation and growth through modifications to the cell wall polysaccharide pectin. We found reduced levels of demethylesterified homogalacturonan and altered patterns of auxin accumulation in early stages of ant ail6 flower development. The RNA-Seq experiment also revealed cross-regulation of AIL gene expression at the transcriptional level. The presence of a number of overrepresented Gene Ontology terms related to plant defense in the set of genes differentially expressed in ant ail6 suggest that ANT and AIL6 also regulate plant defense pathways. Furthermore, we found that ant ail6 plants have elevated levels of two defense hormones: salicylic acid and jasmonic acid, and show increased resistance to the bacterial pathogen Pseudomonas syringae. These results suggest that ANT and AIL6 regulate biological pathways that are critical for both development and defense. PMID:27208279
Transcription Factors Involved in Plant Resistance to Pathogens.
Amorim, Lidiane L B; da Fonseca Dos Santos, Romulo; Neto, Joao Pacífico Bezerra; Guida-Santos, Mauro; Crovella, Sergio; Benko-Iseppon, Ana Maria
2017-01-01
Phytopathogenic microorganisms have a significant influence on survival and productivity of several crop plants. Transcription factors (TFs) are important players in the response to biotic stresses, as insect attack and pathogen infection. In face of such adversities many TFs families have been previously reported as differentially expressed in plants as a reaction to bacterial, fungal and viral infection. This review highlights recent progresses in understanding the structure, function, signal regulation and interaction of transcription factors with other proteins in response to pathogens. Hence, we focus on three families of transcription factors: ERF, bZIP and WRKY, due to their abundance, importance and the availability of functionally well-characterized members in response to pathogen attack. Their roles and the possibilities related to the use of this knowledge for engineering pathogen resistance in crop plants are also discussed. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
PRODORIC2: the bacterial gene regulation database in 2018
Dudek, Christian-Alexander; Hartlich, Juliane; Brötje, David; Jahn, Dieter
2018-01-01
Abstract Bacteria adapt to changes in their environment via differential gene expression mediated by DNA binding transcriptional regulators. The PRODORIC2 database hosts one of the largest collections of DNA binding sites for prokaryotic transcription factors. It is the result of the thoroughly redesigned PRODORIC database. PRODORIC2 is more intuitive and user-friendly. Besides significant technical improvements, the new update offers more than 1000 new transcription factor binding sites and 110 new position weight matrices for genome-wide pattern searches with the Virtual Footprint tool. Moreover, binding sites deduced from high-throughput experiments were included. Data for 6 new bacterial species including bacteria of the Rhodobacteraceae family were added. Finally, a comprehensive collection of sigma- and transcription factor data for the nosocomial pathogen Clostridium difficile is now part of the database. PRODORIC2 is publicly available at http://www.prodoric2.de. PMID:29136200
Guo, Dongshu; Zhang, Jinzhe; Wang, Xinlei; Han, Xiang; Wei, Baoye; Yu, Hao; Huang, Qingpei
2015-01-01
Plant shoot branching is pivotal for developmental plasticity and crop yield. The formation of branch meristems is regulated by several key transcription factors including REGULATOR OF AXILLARY MERISTEMS1 (RAX1), RAX2, and RAX3. However, the regulatory network of shoot branching is still largely unknown. Here, we report the identification of EXCESSIVE BRANCHES1 (EXB1), which affects axillary meristem (AM) initiation and bud activity. Overexpression of EXB1 in the gain-of-function mutant exb1-D leads to severe bushy and dwarf phenotypes, which result from excessive AM initiation and elevated bud activities. EXB1 encodes the WRKY transcription factor WRKY71, which has demonstrated transactivation activities. Disruption of WRKY71/EXB1 by chimeric repressor silencing technology leads to fewer branches, indicating that EXB1 plays important roles in the control of shoot branching. We demonstrate that EXB1 controls AM initiation by positively regulating the transcription of RAX1, RAX2, and RAX3. Disruption of the RAX genes partially rescues the branching phenotype caused by EXB1 overexpression. We further show that EXB1 also regulates auxin homeostasis in control of shoot branching. Our data demonstrate that EXB1 plays pivotal roles in shoot branching by regulating both transcription of RAX genes and auxin pathways. PMID:26578700
A host basal transcription factor is a key component for infection of rice by TALE-carrying bacteria
Yuan, Meng; Ke, Yinggen; Huang, Renyan; Ma, Ling; Yang, Zeyu; Chu, Zhaohui; Xiao, Jinghua; Li, Xianghua; Wang, Shiping
2016-01-01
Transcription activator-like effectors (TALEs) are sequence-specific DNA binding proteins found in a range of plant pathogenic bacteria, where they play important roles in host-pathogen interactions. However, it has been unclear how TALEs, after they have been injected into the host cells, activate transcription of host genes required for infection success. Here, we show that the basal transcription factor IIA gamma subunit TFIIAγ5 from rice is a key component for infection by the TALE-carrying bacterium Xanthomonas oryzae pv. oryzae, the causal agent for bacterial blight. Direct interaction of several TALEs with TFIIAγ5 is required for activation of disease susceptibility genes. Conversely, reduced expression of the TFIIAγ5 host gene limits the induction of susceptibility genes and thus decreases bacterial blight symptoms. Suppression or mutation of TFIIAγ5 can also reduce bacterial streak, another devastating disease of rice caused by TALE-carrying X. oryzae pv. oryzicola. These results have important implications for formulating a widely applicable strategy with which to improve resistance of plants to TALE-carrying pathogens. DOI: http://dx.doi.org/10.7554/eLife.19605.001 PMID:27472897
Impact of wall shear stress on initial bacterial adhesion in rotating annular reactor
Saur, Thibaut; Morin, Emilie; Habouzit, Frédéric; Bernet, Nicolas
2017-01-01
The objective of this study was to investigate the bacterial adhesion under different wall shear stresses in turbulent flow and using a diverse bacterial consortium. A better understanding of the mechanisms governing microbial adhesion can be useful in diverse domains such as industrial processes, medical fields or environmental biotechnologies. The impact of wall shear stress—four values ranging from 0.09 to 7.3 Pa on polypropylene (PP) and polyvinyl chloride (PVC)—was carried out in rotating annular reactors to evaluate the adhesion in terms of morphological and microbiological structures. A diverse inoculum consisting of activated sludge was used. Epifluorescence microscopy was used to quantitatively and qualitatively characterize the adhesion. Attached bacterial communities were assessed by molecular fingerprinting profiles (CE-SSCP). It has been demonstrated that wall shear stress had a strong impact on both quantitative and qualitative aspects of the bacterial adhesion. ANOVA tests also demonstrated the significant impact of wall shear stress on all three tested morphological parameters (surface coverage, number of objects and size of objects) (p-values < 2.10−16). High wall shear stresses increased the quantity of attached bacteria but also altered their spatial distribution on the substratum surface. As the shear increased, aggregates or clusters appeared and their size grew when increasing the shears. Concerning the microbiological composition, the adhered bacterial communities changed gradually with the applied shear. PMID:28207869
Functional Architecture of T7 RNA Polymerase Transcription Complexes
Nayak, Dhananjaya; Guo, Qing; Sousa, Rui
2007-01-01
Summary T7 RNA polymerase is the best-characterized member of a widespread family of single-subunit RNA polymerases. Crystal structures of T7 RNA polymerase initiation and elongation complexes have provided a wealth of detailed information on RNA polymerase interactions with the promoter and transcription bubble, but the absence of DNA downstream of the melted region of the template in the initiation complex structure, and the absence of DNA upstream of the transcription bubble in the elongation complex structure means that our picture of the functional architecture of T7 RNA polymerase transcription complexes remains incomplete. Here we use the site-specifically tethered chemical nucleases and functional characterization of directed T7 RNAP mutants to both reveal the architecture of the duplex DNA that flanks the transcription bubble in the T7 RNAP initiation and elongation complexes, and to define the function of the interactions made by these duplex elements. We find that downstream duplex interactions made with a cluster of lysines (K711/K713/K714) are present during both elongation and initiation where they contribute to stabilizing a bend in the downstream DNA that is important for promoter opening. The upstream DNA in the elongation complex is also found to be sharply bent at the upstream edge of the transcription bubble, thereby allowing formation of upstream duplex:polymerase interactions that contribute to elongation complex stability. PMID:17580086
Zheng, Meiying; Cooper, David R.; Grossoehme, Nickolas E.; Yu, Minmin; Hung, Li-Wei; Cieslik, Marcin; Derewenda, Urszula; Lesley, Scott A.; Wilson, Ian A.; Giedroc, David P.; Derewenda, Zygmunt S.
2009-01-01
The GntR superfamily of dimeric transcription factors, with more than 6200 members encoded in bacterial genomes, are characterized by N-terminal winged-helix DNA-binding domains and diverse C-terminal regulatory domains which provide a basis for the classification of the constituent families. The largest of these families, FadR, contains nearly 3000 proteins with all-α-helical regulatory domains classified into two related Pfam families: FadR_C and FCD. Only two crystal structures of FadR-family members, those of Escherichia coli FadR protein and LldR from Corynebacterium glutamicum, have been described to date in the literature. Here, the crystal structure of TM0439, a GntR regulator with an FCD domain found in the Thermotoga maritima genome, is described. The FCD domain is similar to that of the LldR regulator and contains a buried metal-binding site. Using atomic absorption spectroscopy and Trp fluorescence, it is shown that the recombinant protein contains bound Ni2+ ions but that it is able to bind Zn2+ with K d < 70 nM. It is concluded that Zn2+ is the likely physiological metal and that it may perform either structural or regulatory roles or both. Finally, the TM0439 structure is compared with two other FadR-family structures recently deposited by structural genomics consortia. The results call for a revision in the classification of the FadR family of transcription factors. PMID:19307717
Baumbach, Jan; Brinkrolf, Karina; Czaja, Lisa F; Rahmann, Sven; Tauch, Andreas
2006-02-14
The application of DNA microarray technology in post-genomic analysis of bacterial genome sequences has allowed the generation of huge amounts of data related to regulatory networks. This data along with literature-derived knowledge on regulation of gene expression has opened the way for genome-wide reconstruction of transcriptional regulatory networks. These large-scale reconstructions can be converted into in silico models of bacterial cells that allow a systematic analysis of network behavior in response to changing environmental conditions. CoryneRegNet was designed to facilitate the genome-wide reconstruction of transcriptional regulatory networks of corynebacteria relevant in biotechnology and human medicine. During the import and integration process of data derived from experimental studies or literature knowledge CoryneRegNet generates links to genome annotations, to identified transcription factors and to the corresponding cis-regulatory elements. CoryneRegNet is based on a multi-layered, hierarchical and modular concept of transcriptional regulation and was implemented by using the relational database management system MySQL and an ontology-based data structure. Reconstructed regulatory networks can be visualized by using the yFiles JAVA graph library. As an application example of CoryneRegNet, we have reconstructed the global transcriptional regulation of a cellular module involved in SOS and stress response of corynebacteria. CoryneRegNet is an ontology-based data warehouse that allows a pertinent data management of regulatory interactions along with the genome-scale reconstruction of transcriptional regulatory networks. These models can further be combined with metabolic networks to build integrated models of cellular function including both metabolism and its transcriptional regulation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fradkin, L.G.; Yoshinaga, S.K.; Berk, A.J.
1987-11-01
The inhibition of transcription by RNA polymerase III in poliovirus-infected cells was studied. Experiments utilizing two different cell lines showed that the initiation step of transcription by RNA polymerase III was impaired by infection of these cells with the virus. The observed inhibition of transcription was not due to shut-off of host cell protein synthesis by poliovirus. Among four distinct components required for accurate transcription in vitro from cloned DNA templates, activities of RNA polymerase III and transcription factor TFIIIA were not significantly affected by virus infection. The activity of transcription factor TFIIIC, the limiting component required for transcription ofmore » RNA polymerase III genes, was severely inhibited in infected cells, whereas that of transcription factor TFIIIB was inhibited to a lesser extent. The sequence-specific DNA-binding of TFIIIC to the adenovirus VA1 gene internal promoted, however, was not altered by infection of cells with the virus. The authors conclude that (i) at least two transcription factors, TFIIIB and TFIIIC, are inhibited by infection of cells with poliovirtus, (ii) inactivation of TFIIIC does not involve destruction of its DNA-binding domain, and (iii) sequence-specific DNA binding by TFIIIC may be necessary but is not sufficient for the formation of productive transcription complexes.« less
A multivariate prediction model for Rho-dependent termination of transcription.
Nadiras, Cédric; Eveno, Eric; Schwartz, Annie; Figueroa-Bossi, Nara; Boudvillain, Marc
2018-06-21
Bacterial transcription termination proceeds via two main mechanisms triggered either by simple, well-conserved (intrinsic) nucleic acid motifs or by the motor protein Rho. Although bacterial genomes can harbor hundreds of termination signals of either type, only intrinsic terminators are reliably predicted. Computational tools to detect the more complex and diversiform Rho-dependent terminators are lacking. To tackle this issue, we devised a prediction method based on Orthogonal Projections to Latent Structures Discriminant Analysis [OPLS-DA] of a large set of in vitro termination data. Using previously uncharacterized genomic sequences for biochemical evaluation and OPLS-DA, we identified new Rho-dependent signals and quantitative sequence descriptors with significant predictive value. Most relevant descriptors specify features of transcript C>G skewness, secondary structure, and richness in regularly-spaced 5'CC/UC dinucleotides that are consistent with known principles for Rho-RNA interaction. Descriptors collectively warrant OPLS-DA predictions of Rho-dependent termination with a ∼85% success rate. Scanning of the Escherichia coli genome with the OPLS-DA model identifies significantly more termination-competent regions than anticipated from transcriptomics and predicts that regions intrinsically refractory to Rho are primarily located in open reading frames. Altogether, this work delineates features important for Rho activity and describes the first method able to predict Rho-dependent terminators in bacterial genomes.
Ziveri, Jason; Tros, Fabiola; Guerrera, Ida Chiara; Chhuon, Cerina; Audry, Mathilde; Dupuis, Marion; Barel, Monique; Korniotis, Sarantis; Fillatreau, Simon; Gales, Lara; Cahoreau, Edern; Charbit, Alain
2017-10-11
The enzyme fructose-bisphosphate aldolase occupies a central position in glycolysis and gluconeogenesis pathways. Beyond its housekeeping role in metabolism, fructose-bisphosphate aldolase has been involved in additional functions and is considered as a potential target for drug development against pathogenic bacteria. Here, we address the role of fructose-bisphosphate aldolase in the bacterial pathogen Francisella novicida. We demonstrate that fructose-bisphosphate aldolase is important for bacterial multiplication in macrophages in the presence of gluconeogenic substrates. In addition, we unravel a direct role of this metabolic enzyme in transcription regulation of genes katG and rpoA, encoding catalase and an RNA polymerase subunit, respectively. We propose a model in which fructose-bisphosphate aldolase participates in the control of host redox homeostasis and the inflammatory immune response.The enzyme fructose-bisphosphate aldolase (FBA) plays central roles in glycolysis and gluconeogenesis. Here, Ziveri et al. show that FBA of the pathogen Francisella novicida acts, in addition, as a transcriptional regulator and is important for bacterial multiplication in macrophages.
Top-level dynamics and the regulated gene response of feed-forward loop transcriptional motifs.
Mayo, Michael; Abdelzaher, Ahmed; Perkins, Edward J; Ghosh, Preetam
2014-09-01
Feed-forward loops are hierarchical three-node transcriptional subnetworks, wherein a top-level protein regulates the activity of a target gene via two paths: a direct-regulatory path, and an indirect route, whereby the top-level proteins act implicitly through an intermediate transcription factor. Using a transcriptional network of the model bacterium Escherichia coli, we confirmed that nearly all types of feed-forward loop were significantly overrepresented in the bacterial network. We then used mathematical modeling to study their dynamics by manipulating the rise times of the top-level protein concentration, termed the induction time, through alteration of the protein destruction rates. Rise times of the regulated proteins exhibited two qualitatively different regimes, depending on whether top-level inductions were "fast" or "slow." In the fast regime, rise times were nearly independent of rapid top-level inductions, indicative of biological robustness, and occurred when RNA production rate-limits the protein yield. Alternatively, the protein rise times were dependent upon slower top-level inductions, greater than approximately one bacterial cell cycle. An equation is given for this crossover, which depends upon three parameters of the direct-regulatory path: transcriptional cooperation at the DNA-binding site, a protein-DNA dissociation constant, and the relative magnitude of the top-level protien concentration.
Pulkkinen, P; Saranen, M; Kaaja, R
1993-01-01
In a double-blind trial comprising 66 patients we assessed the effect of metronidazole-nystatin vagitories on the prevention of bacterial vaginosis (BV) in women using IUD as a contraceptive method after an initial oral single dose of 2.0 g metronidazole and 7 days of intravaginal metronidazole-nystatin or placebo treatment. The prophylactic treatment consisted of metronidazole-nystatin or placebo vagitories applied at bedtime for 3 days after menstruation over 6 consecutive menstrual periods. The patients were randomized in two study groups: a treatment group of 32 patients (group A) and a placebo group of 34 patients (group B). The overall objective cure rate after the initial treatment was 97% in group A and 91% in group B. After 6 months of follow-up, the overall cumulative objective cure rate in group A was 100%, and 76% in group B. The single-dose oral treatment was well tolerated and no notable side effects were recorded.
Initiating head development in mouse embryos: integrating signalling and transcriptional activity.
Arkell, Ruth M; Tam, Patrick P L
2012-03-01
The generation of an embryonic body plan is the outcome of inductive interactions between the progenitor tissues that underpin their specification, regionalization and morphogenesis. The intercellular signalling activity driving these processes is deployed in a time- and site-specific manner, and the signal strength must be precisely controlled. Receptor and ligand functions are modulated by secreted antagonists to impose a dynamic pattern of globally controlled and locally graded signals onto the tissues of early post-implantation mouse embryo. In response to the WNT, Nodal and Bone Morphogenetic Protein (BMP) signalling cascades, the embryo acquires its body plan, which manifests as differences in the developmental fate of cells located at different positions in the anterior-posterior body axis. The initial formation of the anterior (head) structures in the mouse embryo is critically dependent on the morphogenetic activity emanating from two signalling centres that are juxtaposed with the progenitor tissues of the head. A common property of these centres is that they are the source of antagonistic factors and the hub of transcriptional activities that negatively modulate the function of WNT, Nodal and BMP signalling cascades. These events generate the scaffold of the embryonic head by the early-somite stage of development. Beyond this, additional tissue interactions continue to support the growth, regionalization, differentiation and morphogenesis required for the elaboration of the structure recognizable as the embryonic head.
Gyenis, Ákos; Umlauf, David; Újfaludi, Zsuzsanna; Boros, Imre; Ye, Tao; Tora, Làszlò
2014-01-01
Faithful transcription of DNA is constantly threatened by different endogenous and environmental genotoxic effects. Transcription coupled repair (TCR) has been described to stop transcription and quickly remove DNA lesions from the transcribed strand of active genes, permitting rapid resumption of blocked transcription. This repair mechanism has been well characterized in the past using individual target genes. Moreover, numerous efforts investigated the fate of blocked RNA polymerase II (Pol II) during DNA repair mechanisms and suggested that stopped Pol II complexes can either backtrack, be removed and degraded or bypass the lesions to allow TCR. We investigated the effect of a non-lethal dose of UVB on global DNA-bound Pol II distribution in human cells. We found that the used UVB dose did not induce Pol II degradation however surprisingly at about 93% of the promoters of all expressed genes Pol II occupancy was seriously reduced 2–4 hours following UVB irradiation. The presence of Pol II at these cleared promoters was restored 5–6 hours after irradiation, indicating that the negative regulation is very dynamic. We also identified a small set of genes (including several p53 regulated genes), where the UVB-induced Pol II clearing did not operate. Interestingly, at promoters, where Pol II promoter clearance occurs, TFIIH, but not TBP, follows the behavior of Pol II, suggesting that at these genes upon UVB treatment TFIIH is sequestered for DNA repair by the TCR machinery. In agreement, in cells where the TCR factor, the Cockayne Syndrome B protein, was depleted UVB did not induce Pol II and TFIIH clearance at promoters. Thus, our study reveals a UVB induced negative regulatory mechanism that targets Pol II transcription initiation on the large majority of transcribed gene promoters, and a small subset of genes, where Pol II escapes this negative regulation. PMID:25058334
Guo, Dongshu; Zhang, Jinzhe; Wang, Xinlei; Han, Xiang; Wei, Baoye; Wang, Jianqiao; Li, Boxun; Yu, Hao; Huang, Qingpei; Gu, Hongya; Qu, Li-Jia; Qin, Genji
2015-11-01
Plant shoot branching is pivotal for developmental plasticity and crop yield. The formation of branch meristems is regulated by several key transcription factors including REGULATOR OF AXILLARY MERISTEMS1 (RAX1), RAX2, and RAX3. However, the regulatory network of shoot branching is still largely unknown. Here, we report the identification of EXCESSIVE BRANCHES1 (EXB1), which affects axillary meristem (AM) initiation and bud activity. Overexpression of EXB1 in the gain-of-function mutant exb1-D leads to severe bushy and dwarf phenotypes, which result from excessive AM initiation and elevated bud activities. EXB1 encodes the WRKY transcription factor WRKY71, which has demonstrated transactivation activities. Disruption of WRKY71/EXB1 by chimeric repressor silencing technology leads to fewer branches, indicating that EXB1 plays important roles in the control of shoot branching. We demonstrate that EXB1 controls AM initiation by positively regulating the transcription of RAX1, RAX2, and RAX3. Disruption of the RAX genes partially rescues the branching phenotype caused by EXB1 overexpression. We further show that EXB1 also regulates auxin homeostasis in control of shoot branching. Our data demonstrate that EXB1 plays pivotal roles in shoot branching by regulating both transcription of RAX genes and auxin pathways. © 2015 American Society of Plant Biologists. All rights reserved.
Dossani, Zain Y.; Reider Apel, Amanda; Szmidt-Middleton, Heather; ...
2017-10-30
Despite the need for inducible promoters in strain development efforts, the majority of engineering in Saccharomyces cerevisiae continues to rely on a few constitutively active or inducible promoters. Building on advances that use the modular nature of both transcription factors and promoter regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein. Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domainmore » of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes, and the hybrid promoters can be induced using estradiol, a compound with no detectable impact on S. cerevisiae physiology. Using combinations of one, two or three operator sequence repeats and a set of native S. cerevisiae promoters, we obtained a series of hybrid promoters that can be induced to different levels, using the same synthetic TF and a given estradiol. Finally, this set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain.« less
Dossani, Zain Y.; Reider Apel, Amanda; Szmidt‐Middleton, Heather; Hillson, Nathan J.; Deutsch, Samuel; Keasling, Jay D.
2017-01-01
Abstract Despite the need for inducible promoters in strain development efforts, the majority of engineering in Saccharomyces cerevisiae continues to rely on a few constitutively active or inducible promoters. Building on advances that use the modular nature of both transcription factors and promoter regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein. Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domain of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes, and the hybrid promoters can be induced using estradiol, a compound with no detectable impact on S. cerevisiae physiology. Using combinations of one, two or three operator sequence repeats and a set of native S. cerevisiae promoters, we obtained a series of hybrid promoters that can be induced to different levels, using the same synthetic TF and a given estradiol. This set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain. PMID:29084380
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dossani, Zain Y.; Reider Apel, Amanda; Szmidt-Middleton, Heather
Despite the need for inducible promoters in strain development efforts, the majority of engineering in Saccharomyces cerevisiae continues to rely on a few constitutively active or inducible promoters. Building on advances that use the modular nature of both transcription factors and promoter regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein. Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domainmore » of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes, and the hybrid promoters can be induced using estradiol, a compound with no detectable impact on S. cerevisiae physiology. Using combinations of one, two or three operator sequence repeats and a set of native S. cerevisiae promoters, we obtained a series of hybrid promoters that can be induced to different levels, using the same synthetic TF and a given estradiol. Finally, this set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain.« less
Epigenetics regulates transcription and pathogenesis in the parasite Trichomonas vaginalis.
Pachano, Tomas; Nievas, Yesica R; Lizarraga, Ayelen; Johnson, Patricia J; Strobl-Mazzulla, Pablo H; de Miguel, Natalia
2017-06-01
Trichomonas vaginalis is a common sexually transmitted parasite that colonizes the human urogenital tract. Infections range from asymptomatic to highly inflammatory, depending on the host and the parasite strain. Different T. vaginalis strains vary greatly in their adherence and cytolytic capacities. These phenotypic differences might be attributed to differentially expressed genes as a consequence of extra-genetic variation, such as epigenetic modifications. In this study, we explored the role of histone acetylation in regulating gene transcription and pathogenesis in T. vaginalis. Here, we show that histone 3 lysine acetylation (H3KAc) is enriched in nucleosomes positioned around the transcription start site of active genes (BAP1 and BAP2) in a highly adherent parasite strain; compared with the low acetylation abundance in contrast to that observed in a less-adherent strain that expresses these genes at low levels. Additionally, exposition of less-adherent strain with a specific histone deacetylases inhibitor, trichostatin A, upregulated the transcription of BAP1 and BAP2 genes in concomitance with an increase in H3KAc abundance and chromatin accessibility around their transcription start sites. Moreover, we demonstrated that the binding of initiator binding protein, the transcription factor responsible for the initiation of transcription of ~75% of known T. vaginalis genes, depends on the histone acetylation state around the metazoan-like initiator to which initiator binding protein binds. Finally, we found that trichostatin A treatment increased parasite aggregation and adherence to host cells. Our data demonstrated for the first time that H3KAc is a permissive histone modification that functions to mediate both transcription and pathogenesis of the parasite T. vaginalis. © 2017 John Wiley & Sons Ltd.
Transcriptional requirements of the distal heavy-strand promoter of mtDNA
Zollo, Ornella; Tiranti, Valeria; Sondheimer, Neal
2012-01-01
The heavy strand of mtDNA contains two promoters with nonoverlapping functions. The role of the minor heavy-strand promoter (HSP2) is controversial, because the promoter has been difficult to activate in an in vitro system. We have isolated HSP2 by excluding its interaction with the more powerful HSP1 promoter, and we find that it is transcribed efficiently by recombinant mtRNA polymerase and mitochondrial transcription factor B2. The mitochondrial transcription factor A is not required for initiation, but it has the ability to alternatively activate and repress the HSP2 transcriptional unit depending on the ratio between mitochondrial transcription factor A and other transcription factors. The positioning of transcriptional initiation agrees with our current understanding of HSP2 activity in vivo. Serial deletion of HSP2 shows that only proximal sequences are required. Several mutations, including the disruption of a polycytosine track upstream of the HSP2 initiation site, influence transcriptional activity. Transcription from HSP2 is also observed when HeLa cell mitochondrial extract is used as the source of mitochondrial polymerase, and this transcription is maintained when HSP2 is provided in proper spacing and context to the HSP1 promoter. Studies of the linked heavy-strand promoters show that they are differentially regulated by ATP dosage. We conclude that HSP2 is transcribed and has features that allow it to regulate mitochondrial mRNA synthesis. PMID:22454497
A continuum model of transcriptional bursting
Corrigan, Adam M; Tunnacliffe, Edward; Cannon, Danielle; Chubb, Jonathan R
2016-01-01
Transcription occurs in stochastic bursts. Early models based upon RNA hybridisation studies suggest bursting dynamics arise from alternating inactive and permissive states. Here we investigate bursting mechanism in live cells by quantitative imaging of actin gene transcription, combined with molecular genetics, stochastic simulation and probabilistic modelling. In contrast to early models, our data indicate a continuum of transcriptional states, with a slowly fluctuating initiation rate converting the gene between different levels of activity, interspersed with extended periods of inactivity. We place an upper limit of 40 s on the lifetime of fluctuations in elongation rate, with initiation rate variations persisting an order of magnitude longer. TATA mutations reduce the accessibility of high activity states, leaving the lifetime of on- and off-states unchanged. A continuum or spectrum of gene states potentially enables a wide dynamic range for cell responses to stimuli. DOI: http://dx.doi.org/10.7554/eLife.13051.001 PMID:26896676
Quantitative PCR Method for Diagnosis of Citrus Bacterial Canker†
Cubero, J.; Graham, J. H.; Gottwald, T. R.
2001-01-01
For diagnosis of citrus bacterial canker by PCR, an internal standard is employed to ensure the quality of the DNA extraction and that proper requisites exist for the amplification reaction. The ratio of PCR products from the internal standard and bacterial target is used to estimate the initial bacterial concentration in citrus tissues with lesions. PMID:11375206
Morphodynamics of growing bacterial colony
NASA Astrophysics Data System (ADS)
Ghosh, Pushpita; Perlekar, Prasad; Rana, Navdeep
Self-organization into multicellular communities is a natural trend of most of the bacteria. Mutual interactions and competition among the bacterial cells in such multicellular organization play essential role in governing the spatiotemporal dynamics. We here present the spatiotemporal dynamics of growing bacterial colony using theory and a particle-based or individual-based simulation model of nonmotile cells growing utilizing a diffusing nutrient/food on a semi-solid surface by their growth and division forces and by pushing each-other through sliding motility. We show how the resource competition over a fixed amount of food, the diffusion coefficient of the nutrient and the random genetic noise govern the morphodynamics of a single species and a well-mixed two-species bacterial colonies. Our results show that for a very low initial food concentrations, colony develops fingering pattern at the front, while for intermediate values of initial food sources, the colony undergoes transitions to branched structures at the periphery and for very high values of food colony develops smoother fronts.
Kapasi, Anokhi J.; Dittrich, Sabine; González, Iveth J.; Rodwell, Timothy C.
2016-01-01
Background In resource limited settings acute febrile illnesses are often treated empirically due to a lack of reliable, rapid point-of-care diagnostics. This contributes to the indiscriminate use of antimicrobial drugs and poor treatment outcomes. The aim of this comprehensive review was to summarize the diagnostic performance of host biomarkers capable of differentiating bacterial from non-bacterial infections to guide the use of antibiotics. Methods Online databases of published literature were searched from January 2010 through April 2015. English language studies that evaluated the performance of one or more host biomarker in differentiating bacterial from non-bacterial infection in patients were included. Key information extracted included author information, study methods, population, pathogens, clinical information, and biomarker performance data. Study quality was assessed using a combination of validated criteria from the QUADAS and Lijmer checklists. Biomarkers were categorized as hematologic factors, inflammatory molecules, cytokines, cell surface or metabolic markers, other host biomarkers, host transcripts, clinical biometrics, and combinations of markers. Findings Of the 193 citations identified, 59 studies that evaluated over 112 host biomarkers were selected. Most studies involved patient populations from high-income countries, while 19% involved populations from low- and middle-income countries. The most frequently evaluated host biomarkers were C-reactive protein (61%), white blood cell count (44%) and procalcitonin (34%). Study quality scores ranged from 23.1% to 92.3%. There were 9 high performance host biomarkers or combinations, with sensitivity and specificity of ≥85% or either sensitivity or specificity was reported to be 100%. Five host biomarkers were considered weak markers as they lacked statistically significant performance in discriminating between bacterial and non-bacterial infections. Discussion This manuscript provides a summary
Liu, Danya; Li, Chunsheng; Chen, Yiliu; Burnett, Christie; Liu, Xue Yan; Downs, Sheila; Collins, Robert D; Hawiger, Jacek
2004-11-12
Stimulation of macrophages with lipopolysaccharide (LPS) leads to the production of cytokines that elicit massive liver apoptosis. We investigated the in vivo role of stress-responsive transcription factors (SRTFs) in this process focusing on the precipitating events that are sensitive to a cell-permeant peptide inhibitor of SRTF nuclear import (cSN50). In the absence of cSN50, mice challenged with LPS displayed very early bursts of inflammatory cytokines/chemokines, tumor necrosis factor alpha (1 h), interleukin 6 (2 h), interleukin 1 beta (2 h), and monocyte chemoattractant protein 1 (2 h). Activation of both initiator caspases 8 and 9 and effector caspase 3 was noted 4 h later when full-blown DNA fragmentation and chromatin condensation were first observed (6 h). At this time an increase of pro-apoptotic Bax gene expression was observed. It was preceded by a decrease of anti-apoptotic Bcl2 and BclX(L) gene transcripts. Massive apoptosis was accompanied by microvascular injury manifested by hemorrhagic necrosis and a precipitous drop in blood platelets observed at 6 h. An increase in fibrinogen/fibrin degradation products and a rise in plasminogen activator inhibitor 1 occurred between 4 and 6 h. Inhibition of SRTFs nuclear import with the cSN50 peptide abrogated all these changes and increased survival from 7 to 71%. Thus, the nuclear import of SRTFs induced by LPS is a prerequisite for activation of the genetic program that governs cytokines/chemokines production, liver apoptosis, microvascular injury, and death. These results should facilitate the rational design of drugs that protect the liver from inflammation-driven apoptosis.
Baumbach, Jan; Brinkrolf, Karina; Czaja, Lisa F; Rahmann, Sven; Tauch, Andreas
2006-01-01
Background The application of DNA microarray technology in post-genomic analysis of bacterial genome sequences has allowed the generation of huge amounts of data related to regulatory networks. This data along with literature-derived knowledge on regulation of gene expression has opened the way for genome-wide reconstruction of transcriptional regulatory networks. These large-scale reconstructions can be converted into in silico models of bacterial cells that allow a systematic analysis of network behavior in response to changing environmental conditions. Description CoryneRegNet was designed to facilitate the genome-wide reconstruction of transcriptional regulatory networks of corynebacteria relevant in biotechnology and human medicine. During the import and integration process of data derived from experimental studies or literature knowledge CoryneRegNet generates links to genome annotations, to identified transcription factors and to the corresponding cis-regulatory elements. CoryneRegNet is based on a multi-layered, hierarchical and modular concept of transcriptional regulation and was implemented by using the relational database management system MySQL and an ontology-based data structure. Reconstructed regulatory networks can be visualized by using the yFiles JAVA graph library. As an application example of CoryneRegNet, we have reconstructed the global transcriptional regulation of a cellular module involved in SOS and stress response of corynebacteria. Conclusion CoryneRegNet is an ontology-based data warehouse that allows a pertinent data management of regulatory interactions along with the genome-scale reconstruction of transcriptional regulatory networks. These models can further be combined with metabolic networks to build integrated models of cellular function including both metabolism and its transcriptional regulation. PMID:16478536
The chemical structure of DNA sequence signals for RNA transcription
NASA Technical Reports Server (NTRS)
George, D. G.; Dayhoff, M. O.
1982-01-01
The proposed recognition sites for RNA transcription for E. coli NRA polymerase, bacteriophage T7 RNA polymerase, and eukaryotic RNA polymerase Pol II are evaluated in the light of the requirements for efficient recognition. It is shown that although there is good experimental evidence that specific nucleic acid sequence patterns are involved in transcriptional regulation in bacteria and bacterial viruses, among the sequences now available, only in the case of the promoters recognized by bacteriophage T7 polymerase does it seem likely that the pattern is sufficient. It is concluded that the eukaryotic pattern that is investigated is not restrictive enough to serve as a recognition site.
Murthy, S C; Bhat, G P; Thimmappaya, B
1985-01-01
A molecular dissection of the adenovirus EIIA early (E) promoter was undertaken to study the sequence elements required for transcription and to examine the nucleotide sequences, if any, specific for its trans-activation by the viral pre-early EIA gene product. A chimeric gene in which the EIIA-E promoter region fused to the coding sequences of the bacterial chloramphenicol acetyltransferase (CAT) gene was used in transient assays to identify the transcriptional control regions. Deletion mapping studies revealed that the upstream DNA sequences up to -86 were sufficient for the optimal basal level transcription in HeLa cells and also for the EIA-induced transcription. A series of linker-scanning (LS) mutants were constructed to precisely identify the nucleotide sequences that control transcription. Analysis of these LS mutants allowed us to identify two regions of the promoter that are critical for the EIIA-E transcription. These regions are located between -29 and -21 (region I) and between -82 and -66 (region II). Mutations in region I affected initiation and appeared functionally similar to the "TATA" sequence of the commonly studied promoters. To examine whether or not the EIIA-E promoter contained DNA sequences specific for the trans-activation by the EIA, the LS mutants were analyzed in a cotransfection assay containing a plasmid carrying the EIA gene. CAT activity of all of the LS mutants was induced by the EIA gene in this assay, suggesting that the induction of transcription of the EIIA-E promoter by the EIA gene is not sequence-specific. Images PMID:3857577
Riboregulation of bacterial and archaeal transposition.
Ellis, Michael J; Haniford, David B
2016-05-01
The coexistence of transposons with their hosts depends largely on transposition levels being tightly regulated to limit the mutagenic burden associated with frequent transposition. For 'DNA-based' (class II) bacterial transposons there is growing evidence that regulation through small noncoding RNAs and/or the RNA-binding protein Hfq are prominent mechanisms of defense against transposition. Recent transcriptomics analyses have identified many new cases of antisense RNAs (asRNA) that potentially could regulate the expression of transposon-encoded genes giving the impression that asRNA regulation of DNA-based transposons is much more frequent than previously thought. Hfq is a highly conserved bacterial protein that plays a central role in posttranscriptional gene regulation and stress response pathways in many bacteria. Three different mechanisms for Hfq-directed control of bacterial transposons have been identified to date highlighting the versatility of this protein as a regulator of bacterial transposons. There is also evidence emerging that some DNA-based transposons encode RNAs that could regulate expression of host genes. In the case of IS200, which appears to have lost its ability to transpose, contributing a regulatory RNA to its host could account for the persistence of this mobile element in a wide range of bacterial species. It remains to be seen how prevalent these transposon-encoded RNA regulators are, but given the relatively large amount of intragenic transcription in bacterial genomes, it would not be surprising if new examples are forthcoming. WIREs RNA 2016, 7:382-398. doi: 10.1002/wrna.1341 For further resources related to this article, please visit the WIREs website. © 2016 Wiley Periodicals, Inc.
Treatment of bacterial meningitis: an update.
Shin, Seon Hee; Kim, Kwang Sik
2012-10-01
The introduction of protein conjugate vaccines for Haemophilus influenzae type b (Hib), Streptococcus pneumoniae (S. pneumoniae) and Neisseria meningitidis (N. menigitidis) has changed the epidemiology of bacterial meningitis. Bacterial meningitis continues to be an important cause of mortality and morbidity, and our incomplete knowledge of its pathogenesis and emergence of antimicrobial resistant bacteria contribute to such mortality and morbidity. An early empiric antibiotic treatment is critical for the management of patients with bacterial meningitis. This article gives an overview on optimal treatment strategies of bacterial meningitis, along with considerations of new insights on epidemiology, clinical and laboratory findings supportive of bacterial meningitis, chemoprophylaxis, selection of initial antimicrobial agents for suspected bacterial meningitis, antimicrobial resistance and utility of new antibiotics, status on anti-inflammatory agents and adjunctive therapy, and pathogenesis of bacterial meningitis. Prompt treatment of bacterial meningitis with an appropriate antibiotic is essential. Optimal antimicrobial treatment of bacterial meningitis requires bactericidal agents able to penetrate the blood-brain barrier (BBB), with efficacy in cerebrospinal fluid (CSF). Several new antibiotics have been introduced for the treatment of meningitis caused by resistant bacteria, but their use in human studies has been limited. More complete understanding of the microbial and host interactions that are involved in the pathogenesis of bacterial meningitis and associated neurologic sequelae is likely to help in developing new strategies for the prevention and therapy of bacterial meningitis.
USDA-ARS?s Scientific Manuscript database
Rhipicephalus microplus is an important biological vector of Anaplasma marginale, the etiological agent of bovine anaplasmosis. The knowledge of tick immune responses to control bacterial infections remains limited. In this study, we demonstrate that transcription factor Relish from the Imd signalin...
Identification of regulatory targets for the bacterial Nus factor complex.
Baniulyte, Gabriele; Singh, Navjot; Benoit, Courtney; Johnson, Richard; Ferguson, Robert; Paramo, Mauricio; Stringer, Anne M; Scott, Ashley; Lapierre, Pascal; Wade, Joseph T
2017-12-11
Nus factors are broadly conserved across bacterial species, and are often essential for viability. A complex of five Nus factors (NusB, NusE, NusA, NusG and SuhB) is considered to be a dedicated regulator of ribosomal RNA folding, and has been shown to prevent Rho-dependent transcription termination. Here, we identify an additional cellular function for the Nus factor complex in Escherichia coli: repression of the Nus factor-encoding gene, suhB. This repression occurs primarily by translation inhibition, followed by Rho-dependent transcription termination. Thus, the Nus factor complex can prevent or promote Rho activity depending on the gene context. Conservation of putative NusB/E binding sites upstream of Nus factor genes suggests that Nus factor autoregulation occurs in many bacterial species. Additionally, many putative NusB/E binding sites are also found upstream of other genes in diverse species, and we demonstrate Nus factor regulation of one such gene in Citrobacter koseri. We conclude that Nus factors have an evolutionarily widespread regulatory function beyond ribosomal RNA, and that they are often autoregulatory.
Genome-wide uniformity of human ‘open’ pre-initiation complexes
Lai, William K.M.; Pugh, B. Franklin
2017-01-01
Transcription of protein-coding and noncoding DNA occurs pervasively throughout the mammalian genome. Their sites of initiation are generally inferred from transcript 5′ ends and are thought to be either locally dispersed or focused. How these two modes of initiation relate is unclear. Here, we apply permanganate treatment and chromatin immunoprecipitation (PIP-seq) of initiation factors to identify the precise location of melted DNA separately associated with the preinitiation complex (PIC) and the adjacent paused complex (PC). This approach revealed the two known modes of transcription initiation. However, in contrast to prevailing views, they co-occurred within the same promoter region: initiation originating from a focused PIC, and broad nucleosome-linked initiation. PIP-seq allowed transcriptional orientation of Pol II to be determined, which may be useful near promoters where sufficient sense/anti-sense transcript mapping information is lacking. PIP-seq detected divergently oriented Pol II at both coding and noncoding promoters, as well as at enhancers. Their occupancy levels were not necessarily coupled in the two orientations. DNA sequence and shape analysis of initiation complex sites suggest that both sequence and shape contribute to specificity, but in a context-restricted manner. That is, initiation sites have the locally “best” initiator (INR) sequence and/or shape. These findings reveal a common core to pervasive Pol II initiation throughout the human genome. PMID:27927716
Naveen, Vankadari; Hsiao, Chwan-Deng
2016-01-01
Bacterial ribonucleotide reductases (RNRs) play an important role in the synthesis of dNTPs and their expression is regulated by the transcription factors, NrdR and Fur. Recent transcriptomic studies using deletion mutants have indicated a role for NrdR in bacterial chemotaxis and in the maintenance of topoisomerase levels. However, NrdR deletion alone has no effect on bacterial growth or virulence in infected flies or in human blood cells. Furthermore, transcriptomic studies are limited to the deletion strain alone, and so are inadequate for drawing biological implications when the NrdR repressor is active or abundant. Therefore, further examination is warranted of changes in the cellular proteome in response to both NrdR overexpression, as well as deletion, to better understand its functional relevance as a bacterial transcription repressor. Here, we profile bacterial fate under conditions of overexpression and deletion of NrdR in E. coli. Biochemical assays show auxiliary zinc enhances the DNA binding activity of NrdR. We also demonstrate at the physiological level that increased nrdR expression causes a significant reduction in bacterial growth and fitness even at normal temperatures, and causes lethality at elevated temperatures. Corroborating these direct effects, global proteome analysis following NrdR overexpression showed a significant decrease in global protein expression. In parallel, studies on complementary expression of downregulated essential genes polA, eno and thiL showed partial rescue of the fitness defect caused by NrdR overexpression. Deletion of downregulated non-essential genes ygfK and trxA upon NrdR overexpression resulted in diminished bacterial growth and fitness suggesting an additional role for NrdR in regulating other genes. Moreover, in comparison with NrdR deletion, E. coli cells overexpressing NrdR showed significantly diminished adherence to human epithelial cells, reflecting decreased bacterial virulence. These results suggest
Streubel, Jana; Baum, Heidi; Grau, Jan; Stuttman, Johannes; Boch, Jens
2017-01-01
Plant-pathogenic Xanthomonas bacteria inject transcription activator-like effector proteins (TALEs) into host cells to specifically induce transcription of plant genes and enhance susceptibility. Although the DNA-binding mode is well-understood it is still ambiguous how TALEs initiate transcription and whether additional promoter elements are needed to support this. To systematically dissect prerequisites for transcriptional initiation the activity of one TALE was compared on different synthetic Bs4 promoter fragments. In addition, a large collection of artificial TALEs spanning the OsSWEET14 promoter was compared. We show that the presence of a TALE alone is not sufficient to initiate transcription suggesting the requirement of additional supporting promoter elements. At the OsSWEET14 promoter TALEs can initiate transcription from various positions, in a synergistic manner of multiple TALEs binding in parallel to the promoter, and even by binding in reverse orientation. TALEs are known to shift the transcriptional start site, but our data show that this shift depends on the individual position of a TALE within a promoter context. Our results implicate that TALEs function like classical enhancer-binding proteins and initiate transcription in both orientations which has consequences for in planta target gene prediction and design of artificial activators. PMID:28301511
Streubel, Jana; Baum, Heidi; Grau, Jan; Stuttman, Johannes; Boch, Jens
2017-01-01
Plant-pathogenic Xanthomonas bacteria inject transcription activator-like effector proteins (TALEs) into host cells to specifically induce transcription of plant genes and enhance susceptibility. Although the DNA-binding mode is well-understood it is still ambiguous how TALEs initiate transcription and whether additional promoter elements are needed to support this. To systematically dissect prerequisites for transcriptional initiation the activity of one TALE was compared on different synthetic Bs4 promoter fragments. In addition, a large collection of artificial TALEs spanning the OsSWEET14 promoter was compared. We show that the presence of a TALE alone is not sufficient to initiate transcription suggesting the requirement of additional supporting promoter elements. At the OsSWEET14 promoter TALEs can initiate transcription from various positions, in a synergistic manner of multiple TALEs binding in parallel to the promoter, and even by binding in reverse orientation. TALEs are known to shift the transcriptional start site, but our data show that this shift depends on the individual position of a TALE within a promoter context. Our results implicate that TALEs function like classical enhancer-binding proteins and initiate transcription in both orientations which has consequences for in planta target gene prediction and design of artificial activators.
Huang, Lulin; Cheng, Tingcai; Xu, Pingzhen; Fang, Ting; Xia, Qingyou
2012-01-01
Transcription factors are present in all living organisms, and play vital roles in a wide range of biological processes. Studies of transcription factors will help reveal the complex regulation mechanism of organisms. So far, hundreds of domains have been identified that show transcription factor activity. Here, 281 reported transcription factor domains were used as seeds to search the transcription factors in genomes of Bombyx mori L. (Lepidoptera: Bombycidae) and four other model insects. Overall, 666 transcription factors including 36 basal factors and 630 other factors were identified in B. mori genome, which accounted for 4.56% of its genome. The silkworm transcription factors' expression profiles were investigated in relation to multiple tissues, developmental stages, sexual dimorphism, and responses to oral infection by pathogens and direct bacterial injection. These all provided rich clues for revealing the transcriptional regulation mechanism of silkworm organ differentiation, growth and development, sexual dimorphism, and response to pathogen infection. PMID:22943524
USDA-ARS?s Scientific Manuscript database
American foulbrood disease of honey bees is caused by the bacterium Paenibacillus larvae. Infection occurs per os in larvae and systemic infection requires a breaching of the host peritrophic matrix and midgut epithelium. Genetic variation exists for both bacterial virulence and host resistance, and...
Structure of a bacterial RNA polymerase holoenzyme open promoter complex
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bae, Brian; Feklistov, Andrey; Lass-Napiorkowska, Agnieszka
2015-09-08
Initiation of transcription is a primary means for controlling gene expression. In bacteria, the RNA polymerase (RNAP) holoenzyme binds and unwinds promoter DNA, forming the transcription bubble of the open promoter complex (RPo). We have determined crystal structures, refined to 4.14 Å-resolution, of RPo containing Thermus aquaticus RNAP holoenzyme and promoter DNA that includes the full transcription bubble. The structures, combined with biochemical analyses, reveal key features supporting the formation and maintenance of the double-strand/single-strand DNA junction at the upstream edge of the -10 element where bubble formation initiates. The results also reveal RNAP interactions with duplex DNA just upstreammore » of the -10 element and potential protein/DNA interactions that direct the DNA template strand into the RNAP active site. Addition of an RNA primer to yield a 4 base-pair post-translocated RNA:DNA hybrid mimics an initially transcribing complex at the point where steric clash initiates abortive initiation and σA dissociation.« less
Structure of a bacterial RNA polymerase holoenzyme open promoter complex
Bae, Brian; Feklistov, Andrey; Lass-Napiorkowska, Agnieszka; ...
2015-09-08
Initiation of transcription is a primary means for controlling gene expression. In bacteria, the RNA polymerase (RNAP) holoenzyme binds and unwinds promoter DNA, forming the transcription bubble of the open promoter complex (RPo). We have determined crystal structures, refined to 4.14 Å-resolution, of RPo containing Thermus aquaticus RNAP holoenzyme and promoter DNA that includes the full transcription bubble. The structures, combined with biochemical analyses, reveal key features supporting the formation and maintenance of the double-strand/single-strand DNA junction at the upstream edge of the -10 element where bubble formation initiates. The results also reveal RNAP interactions with duplex DNA just upstreammore » of the -10 element and potential protein/DNA interactions that direct the DNA template strand into the RNAP active site. Additionally a RNA primer to yield a 4 base-pair post-translocated RNA:DNA hybrid mimics an initially transcribing complex at the point where steric clash initiates abortive initiation and σ A dissociation.« less
Schostag, Morten; Stibal, Marek; Jacobsen, Carsten S.; ...
2015-04-30
The active layer of soil overlaying permafrost in the Arctic is subjected to dramatic annual changes in temperature and soil chemistry, which likely affect bacterial activity and community structure. We studied seasonal variations in the bacterial community of active layer soil from Svalbard (78°N) by co-extracting DNA and RNA from 12 soil cores collected monthly over a year. PCR amplicons of 16S rRNA genes (DNA) and reverse transcribed transcripts (cDNA) were quantified and sequenced to test for the effect of low winter temperature and seasonal variation in concentration of easily degradable organic matter on the bacterial communities. The copy numbermore » of 16S rRNA genes and transcripts revealed no distinct seasonal changes indicating potential bacterial activity during winter despite soil temperatures well below -10°C. Multivariate statistical analysis of the bacterial diversity data (DNA and cDNA libraries) revealed a season-based clustering of the samples, and, e.g., the relative abundance of potentially active Cyanobacteria peaked in June and Alphaproteobacteria increased over the summer and then declined from October to November. The structure of the bulk (DNA-based) community was significantly correlated with pH and dissolved organic carbon, while the potentially active (RNA-based) community structure was not significantly correlated with any of the measured soil parameters. A large fraction of the 16S rRNA transcripts was assigned to nitrogen-fixing bacteria (up to 24% in June) and phototrophic organisms (up to 48% in June) illustrating the potential importance of nitrogen fixation in otherwise nitrogen poor Arctic ecosystems and of phototrophic bacterial activity on the soil surface.« less
Schostag, Morten; Stibal, Marek; Jacobsen, Carsten S.; Bælum, Jacob; Taş, Neslihan; Elberling, Bo; Jansson, Janet K.; Semenchuk, Philipp; Priemé, Anders
2015-01-01
The active layer of soil overlaying permafrost in the Arctic is subjected to dramatic annual changes in temperature and soil chemistry, which likely affect bacterial activity and community structure. We studied seasonal variations in the bacterial community of active layer soil from Svalbard (78°N) by co-extracting DNA and RNA from 12 soil cores collected monthly over a year. PCR amplicons of 16S rRNA genes (DNA) and reverse transcribed transcripts (cDNA) were quantified and sequenced to test for the effect of low winter temperature and seasonal variation in concentration of easily degradable organic matter on the bacterial communities. The copy number of 16S rRNA genes and transcripts revealed no distinct seasonal changes indicating potential bacterial activity during winter despite soil temperatures well below −10°C. Multivariate statistical analysis of the bacterial diversity data (DNA and cDNA libraries) revealed a season-based clustering of the samples, and, e.g., the relative abundance of potentially active Cyanobacteria peaked in June and Alphaproteobacteria increased over the summer and then declined from October to November. The structure of the bulk (DNA-based) community was significantly correlated with pH and dissolved organic carbon, while the potentially active (RNA-based) community structure was not significantly correlated with any of the measured soil parameters. A large fraction of the 16S rRNA transcripts was assigned to nitrogen-fixing bacteria (up to 24% in June) and phototrophic organisms (up to 48% in June) illustrating the potential importance of nitrogen fixation in otherwise nitrogen poor Arctic ecosystems and of phototrophic bacterial activity on the soil surface. PMID:25983731
Vastano, Valeria; Perrone, Filomena; Marasco, Rosangela; Sacco, Margherita; Muscariello, Lidia
2016-04-01
Exopolysaccharides (EPS) from lactic acid bacteria contribute to specific rheology and texture of fermented milk products and find applications also in non-dairy foods and in therapeutics. Recently, four clusters of genes (cps) associated with surface polysaccharide production have been identified in Lactobacillus plantarum WCFS1, a probiotic and food-associated lactobacillus. These clusters are involved in cell surface architecture and probably in release and/or exposure of immunomodulating bacterial molecules. Here we show a transcriptional analysis of these clusters. Indeed, RT-PCR experiments revealed that the cps loci are organized in five operons. Moreover, by reverse transcription-qPCR analysis performed on L. plantarum WCFS1 (wild type) and WCFS1-2 (ΔccpA), we demonstrated that expression of three cps clusters is under the control of the global regulator CcpA. These results, together with the identification of putative CcpA target sequences (catabolite responsive element CRE) in the regulatory region of four out of five transcriptional units, strongly suggest for the first time a role of the master regulator CcpA in EPS gene transcription among lactobacilli.
RegPrecise 3.0--a resource for genome-scale exploration of transcriptional regulation in bacteria.
Novichkov, Pavel S; Kazakov, Alexey E; Ravcheev, Dmitry A; Leyn, Semen A; Kovaleva, Galina Y; Sutormin, Roman A; Kazanov, Marat D; Riehl, William; Arkin, Adam P; Dubchak, Inna; Rodionov, Dmitry A
2013-11-01
Genome-scale prediction of gene regulation and reconstruction of transcriptional regulatory networks in prokaryotes is one of the critical tasks of modern genomics. Bacteria from different taxonomic groups, whose lifestyles and natural environments are substantially different, possess highly diverged transcriptional regulatory networks. The comparative genomics approaches are useful for in silico reconstruction of bacterial regulons and networks operated by both transcription factors (TFs) and RNA regulatory elements (riboswitches). RegPrecise (http://regprecise.lbl.gov) is a web resource for collection, visualization and analysis of transcriptional regulons reconstructed by comparative genomics. We significantly expanded a reference collection of manually curated regulons we introduced earlier. RegPrecise 3.0 provides access to inferred regulatory interactions organized by phylogenetic, structural and functional properties. Taxonomy-specific collections include 781 TF regulogs inferred in more than 160 genomes representing 14 taxonomic groups of Bacteria. TF-specific collections include regulogs for a selected subset of 40 TFs reconstructed across more than 30 taxonomic lineages. Novel collections of regulons operated by RNA regulatory elements (riboswitches) include near 400 regulogs inferred in 24 bacterial lineages. RegPrecise 3.0 provides four classifications of the reference regulons implemented as controlled vocabularies: 55 TF protein families; 43 RNA motif families; ~150 biological processes or metabolic pathways; and ~200 effectors or environmental signals. Genome-wide visualization of regulatory networks and metabolic pathways covered by the reference regulons are available for all studied genomes. A separate section of RegPrecise 3.0 contains draft regulatory networks in 640 genomes obtained by an conservative propagation of the reference regulons to closely related genomes. RegPrecise 3.0 gives access to the transcriptional regulons reconstructed in
Ching, Yick-Pang; Chun, Abel CS; Chin, King-Tung; Zhang, Zhi-Qing; Jeang, Kuan-Teh; Jin, Dong-Yan
2004-01-01
Background Human T-cell leukemia virus type I (HTLV-I) Tax protein is a transcriptional regulator of viral and cellular genes. In this study we have examined in detail the determinants for Tax-mediated transcriptional activation. Results Whereas previously the LTR enhancer elements were thought to be the sole Tax-targets, herein, we find that the core HTLV-I TATAA motif also provides specific responsiveness not seen with either the SV40 or the E1b TATAA boxes. When enhancer elements which can mediate Tax-responsiveness were compared, the authentic HTLV-I 21-bp repeats were found to be the most effective. Related bZIP factors such as CREB, ATF4, c-Jun and LZIP are often thought to recognize the 21-bp repeats equivalently. However, amongst bZIP factors, we found that CREB, by far, is preferred by Tax for activation. When LTR transcription was reconstituted by substituting either κB or serum response elements in place of the 21-bp repeats, Tax activated these surrogate motifs using surfaces which are different from that utilized for CREB interaction. Finally, we employed artificial recruitment of TATA-binding protein to the HTLV-I promoter in "bypass" experiments to show for the first time that Tax has transcriptional activity subsequent to the assembly of an initiation complex at the promoter. Conclusions Optimal activation of the HTLV-I LTR by Tax specifically requires the core HTLV-I TATAA promoter, CREB and the 21-bp repeats. In addition, we also provide the first evidence for transcriptional activity of Tax after the recruitment of TATA-binding protein to the promoter. PMID:15285791
Topical Corticosteroids in the Management of Bacterial Keratitis.
Tuli, Sonal S
2013-12-01
Bacterial keratitis can cause significant morbidity from ulceration of the cornea and the resultant scarring. The use of steroids to decrease these complications is controversial with arguments for and against their use. The SCUT (Steroids for Corneal Ulcers Trial) was initiated in 2006 to definitively determine whether steroids in bacterial keratitis were beneficial or harmful. While the SCUT showed no benefit or harm overall, subgroup analyses showed that larger, more central ulcers with very poor initial visual acuity may benefit. On the other hand, Nocardia ulcers that were treated with steroids had worse outcomes. The study did have some limitations as the patient population was not typical for bacterial keratitis in the United States, and there were some criticisms of the therapeutic approach so the question is still not definitively answered.
Def1 interacts with TFIIH and modulates RNA polymerase II transcription.
Damodaren, Nivedita; Van Eeuwen, Trevor; Zamel, Joanna; Lin-Shiao, Enrique; Kalisman, Nir; Murakami, Kenji
2017-12-12
The DNA damage response is an essential process for the survival of living cells. In a subset of stress-responsive genes in humans, Elongin controls transcription in response to multiple stimuli, such as DNA damage, oxidative stress, and heat shock. Yeast Elongin (Ela1-Elc1), along with Def1, is known to facilitate ubiquitylation and degradation of RNA polymerase II (pol II) in response to multiple stimuli, yet transcription activity has not been examined. We have found that Def1 copurifies from yeast whole-cell extract with TFIIH, the largest general transcription factor required for transcription initiation and nucleotide excision repair. The addition of recombinant Def1 and Ela1-Elc1 enhanced transcription initiation in an in vitro reconstituted system including pol II, the general transcription factors, and TFIIS. Def1 also enhanced transcription restart from TFIIS-induced cleavage in a pol II transcribing complex. In the Δdef1 strain, heat shock genes were misregulated, indicating that Def1 is required for induction of some stress-responsive genes in yeast. Taken together, our results extend the understanding of the molecular mechanism of transcription regulation on cellular stress and reveal functional similarities to the mammalian system.
Interplay of DNA repair with transcription: from structures to mechanisms.
Deaconescu, Alexandra M; Artsimovitch, Irina; Grigorieff, Nikolaus
2012-12-01
Many DNA transactions are crucial for maintaining genomic integrity and faithful transfer of genetic information but remain poorly understood. An example is the interplay between nucleotide excision repair (NER) and transcription, also known as transcription-coupled DNA repair (TCR). Discovered decades ago, the mechanisms for TCR have remained elusive, not in small part due to the scarcity of structural studies of key players. Here we summarize recent structural information on NER/TCR factors, focusing on bacterial systems, and integrate it with existing genetic, biochemical, and biophysical data to delineate the mechanisms at play. We also review emerging, alternative modalities for recruitment of NER proteins to DNA lesions. Copyright © 2012 Elsevier Ltd. All rights reserved.
Sun, Jinxia; Luan, Yi; Xiang, Dong; Tan, Xiao; Chen, Hui; Deng, Qi; Zhang, Jiaojiao; Chen, Minghui; Huang, Hongjun; Wang, Weichao; Niu, Tingting; Li, Wenjie; Peng, Hu; Li, Shuangxi; Li, Lei; Tang, Wenwen; Li, Xiaotao; Wu, Dianqing; Wang, Ping
2016-02-02
The NF-κB pathway plays important roles in immune responses. Although its regulation has been extensively studied, here, we report an unknown feedforward mechanism for the regulation of this pathway by Toll-like receptor (TLR) ligands in macrophages. During bacterial infections, TLR ligands upregulate the expression of the 11S proteasome subunit PSME3 via NF-κB-mediated transcription in macrophages. PSME3, in turn, enhances the transcriptional activity of NF-κB by directly binding to and destabilizing KLF2, a negative regulator of NF-κB transcriptional activity. Consistent with this positive role of PSME3 in NF-κB regulation and importance of the NF-κB pathway in host defense against bacterial infections, the lack of PSME3 in hematopoietic cells renders the hosts more susceptible to bacterial infections, accompanied by increased bacterial burdens in host tissues. Thus, this study identifies a substrate for PSME3 and elucidates a proteolysis-dependent, but ubiquitin-independent, mechanism for NF-κB regulation that is important for host defense and innate immunity. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Hoffman, David J.; Niyogi, Salil K.
1973-01-01
The effects of dinucleoside monophosphates on the transcription of phage T4 DNA by E. coli RNA polymerase have been examined at various concentrations of the sigma subunit and extremely low concentration of ribonucleoside triphosphate. The following conclusions were reached: (i) Labeled specific dinucleoside monophosphates are incorporated as chain initiators. (ii) When the ratio of sigma factor to core enzyme is small, there is a general stimulation by most 5′-guanosyl dinucleoside monophosphates. (iii) When the ratio is increased or holoenzyme is present, ApU, CpA, UpA, and GpU are the most effective stimulators. (iv) At high concentrations of sigma factor, only certain adenosine-containing dinucleoside monophosphates (ApU, CpA, UpA, and ApA) stimulate the reaction. (v) Competition hybridization studies indicate that the RNAs stimulated by dinucleoside monophosphates (ApU, CpA, UpA, and GpU) are of the T4 “early” type. (vi) Studies involving both combinations of stimulatory dinucleoside monophosphates and competitive effects of these compounds on chain initiation by ATP and GTP suggest that the stimulatory dinucleoside monophosphates act as chain initiators and may recognize part of a continuous sequence in a promoter region. Studies based on the incorporation of 3H-labeled stimulatory dinucleoside monophosphates support the above conclusions. PMID:4568732
Problem-Solving Test: Attenuation--A Mechanism to Regulate Bacterial Tryptophan Biosynthesis
ERIC Educational Resources Information Center
Szeberenyi, Jozsef
2010-01-01
Terms to be familiar with before you start to solve the test: tryptophan, transcription unit, operon, "trp" repressor, corepressor, operator, promoter, palindrome, initiation, elongation, and termination of transcription, open reading frame, coupled transcription/translation, chromosome-polysome complex. (Contains 2 figures and 1 footnote.)
Schlager, S; Speck, S H; Woisetschläger, M
1996-06-01
The purpose of this study was to gain insights into the regulation of Epstein-Barr virus (EBV) gene transcription during the establishment of viral latency in B cells. During the early stages of EBV infection in B lymphocytes, transcription of six viral nuclear antigens (EBNAs) is initiated from an early promoter (Wp). This is followed by a switch of promoter usage to an upstream promoter, Cp, whose activity is autoregulated by both EBNA1 and EBNA2. Previously it was demonstrated that infection of primary B cells with EBNA2-negative (EBNA2-) EBNA4-mutant (EBNA4mut) virus resulted only in the expression of mutant EBNA4 protein and failure to express the other EBNA gene products (C. Rooney H. G. Howe, S. H. Speck, and G. Miller, J. Virol. 63:1531-1539, 1989). We extended this research to demonstrate that Wp-to-Cp switching did not occur upon infection of primary B cells with an EBNA2- EBNA4mut virus (M. Woisetschlaeger, X. W. Jin, C. N. Yandara, L. A. Furmanski, J. L. Strominger, and S. H. Speck, Proc. Natl. Acad. Sci. USA 88:3942-3946, 1991). Further characterization of this phenomenon led to the identification of an EBNA2-dependent enhancer upstream of Cp. On the basis of these data, a model was proposed in which initial transcription from Wp gives rise to the expression of EBNA2 and EBNA4, and then transcription is upregulated from Cp via the EBNA2- dependent enhancer (Woisetschlaeger et al., as noted above). Implicit in this model is that transcription of the EBNA1 and EBNA3a to -3c genes is dependent on the switch from Wp to Cp, since primary cells infected with EBNA2- EBNA4mut virus fail to switch and also fail to express these viral antigens. Here we critically evaluate this model and demonstrate, in contrast to the predictions of the model, that transcription of both the EBNA1 and EBNA2 genes precedes activation of Cp. Furthermore, the level of EBNA1 gene transcription was strongly reduced in primary B cells infected with EBNA2- EBNA4mut virus compared with
CHD chromatin remodelers and the transcription cycle
Murawska, Magdalena
2011-01-01
It is well established that ATP-dependent chromatin remodelers modulate DNA access of transcription factors and RNA polymerases by “opening” or “closing” chromatin structure. However, this view is far too simplistic. Recent findings have demonstrated that these enzymes not only set the stage for the transcription machinery to act but also are actively involved at every step of the transcription process. As a consequence, they affect initiation, elongation, termination and RNA processing. In this review we will use the CHD family as a paradigm to illustrate the progress that has been made in revealing these new concepts. PMID:22223048
Methylation of an intragenic alternative promoter regulates transcription of GARP.
Haupt, Sonja; Söntgerath, Viktoria Sophie Apollonia; Leipe, Jan; Schulze-Koops, Hendrik; Skapenko, Alla
2016-02-01
Alternative promoter usage has been proposed as a mechanism regulating transcriptional and translational diversity in highly elaborated systems like the immune system in humans. Here, we report that transcription of human glycoprotein A repetitions predominant (GARP) in regulatory CD4 T cells (Tregs) is tightly regulated by two alternative promoters. An intragenic promoter contains several CpGs and acts as a weak promoter that is demethylated and initiates transcription Treg-specifically. The strong up-stream promoter containing a CpG-island is, in contrast, fully demethylated throughout tissues. Transcriptional activity of the strong promoter was surprisingly down-regulated upon demethylation of the weak promoter. This demethylation-induced transcriptional attenuation regulated the magnitude of GARP expression and correlated with disease activity in rheumatoid arthritis. Treg-specific GARP transcription was initiated by synergistic interaction of forkhead box protein 3 (Foxp3) with nuclear factor of activated T cells (NFAT) and was underpinned by permissive chromatin remodeling caused by release of the H3K4 demethylase, PLU-1. Our findings describe a novel function of alternative promoters in regulating the extent of transcription. Moreover, since GARP functions as a transporter of transforming growth factor β (TGFβ), a cytokine with broad pleiotropic traits, GARP transcriptional attenuation by alternative promoters might provide a mechanism regulating peripheral TGFβ to avoid unwanted harmful effects. Copyright © 2015 Elsevier B.V. All rights reserved.
Chao, Yu; Chen, Yutong; Cao, Yaqian; Chen, Huamin; Wang, Jichun; Bi, Yong-Mei; Tian, Fang; Yang, Fenghuan; Rothstein, Steven J; Zhou, Xueping; He, Chenyang
2018-03-15
Limiting nitrogen (N) supply contributes to improved resistance to bacterial blight (BB) caused by Xanthomonas oryzae pv. oryzae (Xoo) in susceptible rice (Oryza sativa). To understand the regulatory roles of microRNAs in this phenomenon, sixty-three differentially-expressed overlapping miRNAs in response to Xoo infection and N-limitation stress in rice were identified through deep RNA-sequence and stem loop qRT-PCR. Among these, miR169o was further assessed as a typical overlapping miRNA through the overexpression of the miR169o primary gene. Osa-miR169o-OX plants were taller, and had more biomass accumulation with significantly increased nitrate and total amino acid contents in roots than wild type (WT). Transcript level assays showed that under different N supply conditions miR169o opposite regulated NRT2 which is reduced under normal N supply condition but remarkably induced under N limiting stress. On the other hand, osa-miR169o-OX plants also displayed increased disease lesion lengths and reduced transcriptional levels of defense gene (PR1b, PR10a, PR10b and PAL) compared with WT after inoculation with Xoo. In addition, miR169o impeded Xoo-mediated NRT transcription. Therefore, the overlapping miR169o contributes to increase N use efficiency and negatively regulates the resistance to bacterial blight in rice. Consistently, transient expression of NF-YAs in rice protoplast promoted the transcripts of PR genes and NRT2 genes, while reduced the transcripts of NRT1 genes. Our results provide novel and additional insights into the coordinated regulatory mechanisms of crosstalk between Xoo infection and N-deficiency responses in rice.
Burkhalter, Rebecca J.; Westfall, Suzanne D.; Liu, Yueying; Stack, M. Sharon
2015-01-01
During tumor progression, epithelial ovarian cancer (EOC) cells undergo epithelial-to-mesenchymal transition (EMT), which influences metastatic success. Mutation-dependent activation of Wnt/β-catenin signaling has been implicated in gain of mesenchymal phenotype and loss of differentiation in several solid tumors; however, similar mutations are rare in most EOC histotypes. Nevertheless, evidence for activated Wnt/β-catenin signaling in EOC has been reported, and immunohistochemical analysis of human EOC tumors demonstrates nuclear staining in all histotypes. This study addresses the hypothesis that the bioactive lipid lysophosphatidic acid (LPA), prevalent in the EOC microenvironment, functions to regulate EMT in EOC. Our results demonstrate that LPA induces loss of junctional β-catenin, stimulates clustering of β1 integrins, and enhances the conformationally active population of surface β1 integrins. Furthermore, LPA treatment initiates nuclear translocation of β-catenin and transcriptional activation of Wnt/β-catenin target genes resulting in gain of mesenchymal marker expression. Together these data suggest that LPA initiates EMT in ovarian tumors through β1-integrin-dependent activation of Wnt/β-catenin signaling, providing a novel mechanism for mutation-independent activation of this pathway in EOC progression. PMID:26175151
Bueno, Clara; Lemke, Caitlin D; Criado, Gabriel; Baroja, Miren L; Ferguson, Stephen S G; Rahman, A K M Nur-Ur; Tsoukas, Constantine D; McCormick, John K; Madrenas, Joaquin
2006-07-01
The paradigm to explain antigen-dependent T cell receptor (TCR) signaling is based on the activation of the CD4 or CD8 coreceptor-associated kinase Lck. It is widely assumed that this paradigm is also applicable to signaling by bacterial superantigens. However, these bacterial toxins can activate human T cells lacking Lck, suggesting the existence of an additional pathway of TCR signaling. Here we showed that this alternative pathway operates in the absence of Lck-dependent tyrosine-phosphorylation events and was initiated by the TCR-dependent activation of raft-enriched heterotrimeric Galpha11 proteins. This event, in turn, activated a phospholipase C-beta and protein kinase C-mediated cascade that turned on the mitogen-activated protein kinases ERK-1 and ERK-2, triggered Ca(2+) influx, and translocated the transcription factors NF-AT and NF-kappaB to the nucleus, ultimately inducing the production of interleukin-2 in Lck-deficient T cells. The triggering of this alternative pathway by superantigens suggests that these toxins use a G protein-coupled receptor as a coreceptor on T cells.
A Two-State Model for the Dynamics of the Pyrophosphate Ion Release in Bacterial RNA Polymerase
Da, Lin-Tai; Pardo Avila, Fátima; Wang, Dong; Huang, Xuhui
2013-01-01
The dynamics of the PPi release during the transcription elongation of bacterial RNA polymerase and its effects on the Trigger Loop (TL) opening motion are still elusive. Here, we built a Markov State Model (MSM) from extensive all-atom molecular dynamics (MD) simulations to investigate the mechanism of the PPi release. Our MSM has identified a simple two-state mechanism for the PPi release instead of a more complex four-state mechanism observed in RNA polymerase II (Pol II). We observed that the PPi release in bacterial RNA polymerase occurs at sub-microsecond timescale, which is ∼3-fold faster than that in Pol II. After escaping from the active site, the (Mg-PPi)2− group passes through a single elongated metastable region where several positively charged residues on the secondary channel provide favorable interactions. Surprisingly, we found that the PPi release is not coupled with the TL unfolding but correlates tightly with the side-chain rotation of the TL residue R1239. Our work sheds light on the dynamics underlying the transcription elongation of the bacterial RNA polymerase. PMID:23592966
Immune subversion by chromatin manipulation: a 'new face' of host-bacterial pathogen interaction.
Arbibe, Laurence
2008-08-01
Bacterial pathogens have evolved various strategies to avoid immune surveillance, depending of their in vivo'lifestyle'. The identification of few bacterial effectors capable to enter the nucleus and modifying chromatin structure in host raises the fascinating questions of how pathogens modulate chromatin structure and why. Chromatin is a dynamic structure that maintains the stability and accessibility of the host DNA genome to the transcription machinery. This review describes the various strategies used by pathogens to interface with host chromatin. In some cases, chromatin injury can be a strategy to take control of major cellular functions, such as the cell cycle. In other cases, manipulation of chromatin structure at specific genomic locations by modulating epigenetic information provides a way for the pathogen to impose its own transcriptional signature onto host cells. This emerging field should strongly influence our understanding of chromatin regulation at interphase nucleus and may provide invaluable openings to the control of immune gene expression in inflammatory and infectious diseases.
A transcription activator-like effector induction system mediated by proteolysis
Copeland, Matthew F.; Politz, Mark C.; Johnson, Charles B.; Markley, Andrew L.; Pfleger, Brian F.
2016-01-01
Simple and predictable trans-acting regulatory tools are needed in the fields of synthetic biology and metabolic engineering to build complex genetic circuits and optimize the levels of native and heterologous gene products. Transcription activator-like effectors (TALEs) are bacterial virulence factors that have recently gained traction in biotechnology applications due to their customizable DNA binding specificity. In this work we expand the versatility of these transcription factors to create an inducible TALE system by inserting tobacco-etch virus (TEV) protease recognition sites into the TALE backbone. The resulting engineered TALEs maintain transcriptional repression of their target genes in Escherichia coli, but are degraded following the induction of the TEV protease, thereby promoting expression of the previously repressed target gene of interest. This TALE-TEV technology enables both repression and induction of plasmid or chromosomal target genes in a manner analogous to traditional repressor proteins but with the added flexibility of being operator agnostic. PMID:26854666
Modelling reveals kinetic advantages of co-transcriptional splicing.
Aitken, Stuart; Alexander, Ross D; Beggs, Jean D
2011-10-01
Messenger RNA splicing is an essential and complex process for the removal of intron sequences. Whereas the composition of the splicing machinery is mostly known, the kinetics of splicing, the catalytic activity of splicing factors and the interdependency of transcription, splicing and mRNA 3' end formation are less well understood. We propose a stochastic model of splicing kinetics that explains data obtained from high-resolution kinetic analyses of transcription, splicing and 3' end formation during induction of an intron-containing reporter gene in budding yeast. Modelling reveals co-transcriptional splicing to be the most probable and most efficient splicing pathway for the reporter transcripts, due in part to a positive feedback mechanism for co-transcriptional second step splicing. Model comparison is used to assess the alternative representations of reactions. Modelling also indicates the functional coupling of transcription and splicing, because both the rate of initiation of transcription and the probability that step one of splicing occurs co-transcriptionally are reduced, when the second step of splicing is abolished in a mutant reporter.
High density growth of T7 expression strains with auto-induction option
Studier, F William [Stony Brook, NY
2009-07-14
Disclosed is a method for promoting auto-induction of transcription of cloned DNA in cultures of bacterial cells grown batchwise, the transcription being under the control of a promoter whose activity can be induced by an exogenous inducer whose ability to induce said promoter is dependent on the metabolic state of said bacterial cells. Initially, a culture media is provided which includes: i) an inducer that causes induction of transcription from said promoter in said bacterial cells; and ii) a metabolite that prevents induction by said inducer, the concentration of said metabolite being adjusted so as to substantially preclude induction by said inducer in the early stages of growth of the bacterial culture, but such that said metabolite is depleted to a level that allows induction by said inducer at a later stage of growth. The culture medium is inoculated with a bacterial inoculum, the inoculum comprising bacterial cells containing cloned DNA, the transcription of which is induced by said inducer. The culture is then incubated under conditions appropriate for growth of the bacterial cells.
Fujita, Yasutaro; Ogura, Mitsuo; Nii, Satomi; Hirooka, Kazutake
2017-01-01
It is known that transcription of kinB encoding a trigger for Bacillus subtilis sporulation is under repression by SinR, a master repressor of biofilm formation, and under positive stringent transcription control depending on the adenine species at the transcription initiation nucleotide (nt). Deletion and base substitution analyses of the kinB promoter (P kinB ) region using lacZ fusions indicated that either a 5-nt deletion (Δ5, nt -61/-57, +1 is the transcription initiation nt) or the substitution of G at nt -45 with A (G-45A) relieved kinB repression. Thus, we found a pair of SinR-binding consensus sequences (GTTCTYT; Y is T or C) in an inverted orientation (SinR-1) between nt -57/-42, which is most likely a SinR-binding site for kinB repression. This relief from SinR repression likely requires SinI, an antagonist of SinR. Surprisingly, we found that SinR is essential for positive stringent transcription control of P kinB . Electrophoretic mobility shift assay (EMSA) analysis indicated that SinR bound not only to SinR-1 but also to SinR-2 (nt -29/-8) consisting of another pair of SinR consensus sequences in a tandem repeat arrangement; the two sequences partially overlap the '-35' and '-10' regions of P kinB . Introduction of base substitutions (T-27C C-26T) in the upstream consensus sequence of SinR-2 affected positive stringent transcription control of P kinB , suggesting that SinR binding to SinR-2 likely causes this positive control. EMSA also implied that RNA polymerase and SinR are possibly bound together to SinR-2 to form a transcription initiation complex for kinB transcription. Thus, it was suggested in this work that derepression of kinB from SinR repression by SinI induced by Spo0A∼P and occurrence of SinR-dependent positive stringent transcription control of kinB might induce effective sporulation cooperatively, implying an intimate interplay by stringent response, sporulation, and biofilm formation.
Sinharoy, Senjuti; Torres-Jerez, Ivone; Bandyopadhyay, Kaustav; Kereszt, Attila; Pislariu, Catalina I; Nakashima, Jin; Benedito, Vagner A; Kondorosi, Eva; Udvardi, Michael K
2013-09-01
Transcription factors (TFs) are thought to regulate many aspects of nodule and symbiosis development in legumes, although few TFs have been characterized functionally. Here, we describe regulator of symbiosome differentiation (RSD) of Medicago truncatula, a member of the Cysteine-2/Histidine-2 (C2H2) family of plant TFs that is required for normal symbiosome differentiation during nodule development. RSD is expressed in a nodule-specific manner, with maximal transcript levels in the bacterial invasion zone. A tobacco (Nicotiana tabacum) retrotransposon (Tnt1) insertion rsd mutant produced nodules that were unable to fix nitrogen and that contained incompletely differentiated symbiosomes and bacteroids. RSD protein was localized to the nucleus, consistent with a role of the protein in transcriptional regulation. RSD acted as a transcriptional repressor in a heterologous yeast assay. Transcriptome analysis of an rsd mutant identified 11 genes as potential targets of RSD repression. RSD interacted physically with the promoter of one of these genes, VAMP721a, which encodes vesicle-associated membrane protein 721a. Thus, RSD may influence symbiosome development in part by repressing transcription of VAMP721a and modifying vesicle trafficking in nodule cells. This establishes RSD as a TF implicated directly in symbiosome and bacteroid differentiation and a transcriptional regulator of secretory pathway genes in plants.
Formation and dissolution of bacterial colonies.
Weber, Christoph A; Lin, Yen Ting; Biais, Nicolas; Zaburdaev, Vasily
2015-09-01
Many organisms form colonies for a transient period of time to withstand environmental pressure. Bacterial biofilms are a prototypical example of such behavior. Despite significant interest across disciplines, physical mechanisms governing the formation and dissolution of bacterial colonies are still poorly understood. Starting from a kinetic description of motile and interacting cells we derive a hydrodynamic equation for their density on a surface, where most of the kinetic coefficients are estimated from experimental data for N. gonorrhoeae bacteria. We use it to describe the formation of multiple colonies with sizes consistent with experimental observations. Finally, we show how the changes in the cell-to-cell interactions lead to the dissolution of the bacterial colonies. The successful application of kinetic theory to a complex far from equilibrium system such as formation and dissolution of living bacterial colonies potentially paves the way for the physical quantification of the initial stages of biofilm formation.
Barry, Kevin C; Ingolia, Nicholas T; Vance, Russell E
2017-01-01
The inducible innate immune response to infection requires a concerted process of gene expression that is regulated at multiple levels. Most global analyses of the innate immune response have focused on transcription induced by defined immunostimulatory ligands, such as lipopolysaccharide. However, the response to pathogens involves additional complexity, as pathogens interfere with virtually every step of gene expression. How cells respond to pathogen-mediated disruption of gene expression to nevertheless initiate protective responses remains unclear. We previously discovered that a pathogen-mediated blockade of host protein synthesis provokes the production of specific pro-inflammatory cytokines. It remains unclear how these cytokines are produced despite the global pathogen-induced block of translation. We addressed this question by using parallel RNAseq and ribosome profiling to characterize the response of macrophages to infection with the intracellular bacterial pathogen Legionella pneumophila. Our results reveal that mRNA superinduction is required for the inducible immune response to a bacterial pathogen. DOI: http://dx.doi.org/10.7554/eLife.22707.001 PMID:28383283
Teichmann, Martin; Dumay-Odelot, Hélène; Fribourg, Sébastien
2012-01-01
The winged helix (WH) domain is found in core components of transcription systems in eukaryotes and prokaryotes. It represents a sub-class of the helix-turn-helix motif. The WH domain participates in establishing protein-DNA and protein-protein-interactions. Here, we discuss possible explanations for the enrichment of this motif in transcription systems.
Nascent RNA kinetics: Transient and steady state behavior of models of transcription
NASA Astrophysics Data System (ADS)
Choubey, Sandeep
2018-02-01
Regulation of transcription is a vital process in cells, but mechanistic details of this regulation still remain elusive. The dominant approach to unravel the dynamics of transcriptional regulation is to first develop mathematical models of transcription and then experimentally test the predictions these models make for the distribution of mRNA and protein molecules at the individual cell level. However, these measurements are affected by a multitude of downstream processes which make it difficult to interpret the measurements. Recent experimental advancements allow for counting the nascent mRNA number of a gene as a function of time at the single-inglr cell level. These measurements closely reflect the dynamics of transcription. In this paper, we consider a general mechanism of transcription with stochastic initiation and deterministic elongation and probe its impact on the temporal behavior of nascent RNA levels. Using techniques from queueing theory, we derive exact analytical expressions for the mean and variance of the nascent RNA distribution as functions of time. We apply these analytical results to obtain the mean and variance of nascent RNA distribution for specific models of transcription. These models of initiation exhibit qualitatively distinct transient behaviors for both the mean and variance which further allows us to discriminate between them. Stochastic simulations confirm these results. Overall the analytical results presented here provide the necessary tools to connect mechanisms of transcription initiation to single-cell measurements of nascent RNA.
Bacterial Community Succession in Pine-Wood Decomposition.
Kielak, Anna M; Scheublin, Tanja R; Mendes, Lucas W; van Veen, Johannes A; Kuramae, Eiko E
2016-01-01
Though bacteria and fungi are common inhabitants of decaying wood, little is known about the relationship between bacterial and fungal community dynamics during natural wood decay. Based on previous studies involving inoculated wood blocks, strong fungal selection on bacteria abundance and community composition was expected to occur during natural wood decay. Here, we focused on bacterial and fungal community compositions in pine wood samples collected from dead trees in different stages of decomposition. We showed that bacterial communities undergo less drastic changes than fungal communities during wood decay. Furthermore, we found that bacterial community assembly was a stochastic process at initial stage of wood decay and became more deterministic in later stages, likely due to environmental factors. Moreover, composition of bacterial communities did not respond to the changes in the major fungal species present in the wood but rather to the stage of decay reflected by the wood density. We concluded that the shifts in the bacterial communities were a result of the changes in wood properties during decomposition and largely independent of the composition of the wood-decaying fungal communities.
Bacterial Community Succession in Pine-Wood Decomposition
Kielak, Anna M.; Scheublin, Tanja R.; Mendes, Lucas W.; van Veen, Johannes A.; Kuramae, Eiko E.
2016-01-01
Though bacteria and fungi are common inhabitants of decaying wood, little is known about the relationship between bacterial and fungal community dynamics during natural wood decay. Based on previous studies involving inoculated wood blocks, strong fungal selection on bacteria abundance and community composition was expected to occur during natural wood decay. Here, we focused on bacterial and fungal community compositions in pine wood samples collected from dead trees in different stages of decomposition. We showed that bacterial communities undergo less drastic changes than fungal communities during wood decay. Furthermore, we found that bacterial community assembly was a stochastic process at initial stage of wood decay and became more deterministic in later stages, likely due to environmental factors. Moreover, composition of bacterial communities did not respond to the changes in the major fungal species present in the wood but rather to the stage of decay reflected by the wood density. We concluded that the shifts in the bacterial communities were a result of the changes in wood properties during decomposition and largely independent of the composition of the wood-decaying fungal communities. PMID:26973611
Su, Y; Feng, J; Sun, X; Guo, Z; Xu, L; Jiang, J
2013-01-01
Chemokines are small, secreted cytokine peptides, known principally for their ability to induce migration and activation of leukocyte populations under both pathological and physiological conditions. On the basis of previously constructed express sequence tags (ESTs) of the head kidney and spleen cDNA library of the perciform marine fish Rachycentron canadum (common name cobia). We used bi-directional rapid amplification of cDNA ends (RACE) and obtained a full-length cDNA of a new CC chemokine gene (designated RcCC3). The RcCC3 putative peptide exhibits sequence similarity to the group of CCL19/21/25 CC chemokines. The reverse transcription quantitative polymerase chain reaction (RT-qPCR) was used in transcript expression studies of RcCC3. We examined the constitutive expression of the transcripts in 12 tissues of non-stressed cobia; RcCC3 transcripts were detected in all tissues examined, with the highest expression in gill and liver, following by head kidney, kidney, spleen, skin, intestine, muscle, stomach, heart, blood and brain. Transcript expression of RcCC3 was examined in immune-related organs, including head kidney, spleen and liver, following intraperitoneal injection of phosphate-buffered saline control, polyriboinosinic polyribocytidylic acid (poly(I:C)) and formalin-killed Vibrio carchariae (bacterial vaccine). The transcripts in these tissues were quickly up-regulated by the injection of poly(I:C) and bacterial vaccine at early time points, although with different expression profiles. These results indicate RcCC3 represents an important component of innate immunity in cobia.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zheng, Meiying; Cooper, David R.; Grossoehme, Nickolas E.
2009-04-01
Here, the crystal structure of TM0439, a GntR regulator with an FCD domain found in the Thermotoga maritima genome, is described. The GntR superfamily of dimeric transcription factors, with more than 6200 members encoded in bacterial genomes, are characterized by N-terminal winged-helix DNA-binding domains and diverse C-terminal regulatory domains which provide a basis for the classification of the constituent families. The largest of these families, FadR, contains nearly 3000 proteins with all-α-helical regulatory domains classified into two related Pfam families: FadR-C and FCD. Only two crystal structures of FadR-family members, those of Escherichia coli FadR protein and LldR from Corynebacteriummore » glutamicum, have been described to date in the literature. Here, the crystal structure of TM0439, a GntR regulator with an FCD domain found in the Thermotoga maritima genome, is described. The FCD domain is similar to that of the LldR regulator and contains a buried metal-binding site. Using atomic absorption spectroscopy and Trp fluorescence, it is shown that the recombinant protein contains bound Ni{sup 2+} ions but that it is able to bind Zn{sup 2+} with K{sub d} < 70 nM. It is concluded that Zn{sup 2+} is the likely physiological metal and that it may perform either structural or regulatory roles or both. Finally, the TM0439 structure is compared with two other FadR-family structures recently deposited by structural genomics consortia. The results call for a revision in the classification of the FadR family of transcription factors.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sahu, Geetaram; Farley, Kalamo; El-Hage, Nazira
Cocaine accelerates human immunodeficiency virus (HIV-1) replication by altering specific cell-signaling and epigenetic pathways. We have elucidated the underlying molecular mechanisms through which cocaine exerts its effect in myeloid cells, a major target of HIV-1 in central nervous system (CNS). We demonstrate that cocaine treatment promotes HIV-1 gene expression by activating both nuclear factor-kappa B (NF-ĸB) and mitogen- and stress-activated kinase 1 (MSK1). MSK1 subsequently catalyzes the phosphorylation of histone H3 at serine 10, and p65 subunit of NF-ĸB at 276th serine residue. These modifications enhance the interaction of NF-ĸB with P300 and promote the recruitment of the positive transcriptionmore » elongation factor b (P-TEFb) to the HIV-1 LTR, supporting the development of an open/relaxed chromatin configuration, and facilitating the initiation and elongation phases of HIV-1 transcription. Results are also confirmed in primary monocyte derived macrophages (MDM). Overall, our study provides detailed insights into cocaine-driven HIV-1 transcription and replication. - Highlights: • Cocaine induces the initiation phase of HIV transcription by activating NF-ĸB. • Cocaine induced NF-ĸB phosphorylation promotes its interaction with P300. • Cocaine enhances the elongation phase of HIV transcription by stimulating MSK1. • Cocaine activated MSK1 catalyzes the phosphorylation of histone H3 at its Ser10. • Cocaine induced H3S10 phosphorylation facilitates the recruitment of P-TEFb at LTR.« less
Regulation of host-pathogen interactions via the post-transcriptional Csr/Rsm system.
Kusmierek, Maria; Dersch, Petra
2018-02-01
A successful colonization of specific hosts requires a rapid and efficient adaptation of the virulence-relevant gene expression program by bacterial pathogens. An important element in this endeavor is the Csr/Rsm system. This multi-component, post-transcriptional control system forms a central hub within complex regulatory networks and coordinately adjusts virulence properties with metabolic and physiological attributes of the pathogen. A key function is elicited by the RNA-binding protein CsrA/RsmA. CsrA/RsmA interacts with numerous target mRNAs, many of which encode crucial virulence factors, and alters their translation, stability or elongation of transcription. Recent studies highlighted that important colonization factors, toxins, and bacterial secretion systems are under CsrA/RsmA control. CsrA/RsmA deficiency impairs host colonization and attenuates virulence, making this post-transcriptional regulator a suitable drug target. The CsrA/RsmA protein can be inactivated through sequestration by non-coding RNAs, or via binding to specific highly abundant mRNAs and interacting proteins. The wide range of interaction partners and RNA targets, as well as the overarching, interlinked genetic control circuits illustrate the complexity of this regulatory system in the different pathogens. Future work addressing spatio-temporal changes of Csr/Rsm-mediated control during the course of an infection will help us to understand how bacteria reprogram their expression profile to cope with continuous changes experienced in colonized niches. Copyright © 2017 Elsevier Ltd. All rights reserved.
Ilott, Nicholas Edward; Bollrath, Julia; Danne, Camille; Schiering, Chris; Shale, Matthew; Adelmann, Krista; Krausgruber, Thomas; Heger, Andreas; Sims, David; Powrie, Fiona
2016-01-01
The gut microbiome is significantly altered in inflammatory bowel diseases, but the basis of these changes is not well understood. We have combined metagenomic and metatranscriptomic profiling of the gut microbiome to assess modifications to both bacterial community structure and transcriptional activity in a mouse model of colitis. By using transcriptomic analysis of colonic tissue and luminal RNA derived from the host, we have also characterised how host transcription relates to the microbial transcriptional response in inflammation. In colitis, increased abundance and transcription of diverse microbial gene families involved in responses to nutrient deprivation, antimicrobial peptide production and oxidative stress support an adaptation of multiple commensal genera to withstand a diverse set of environmental stressors in the inflammatory environment. These data are supported by a transcriptional signature of activated macrophages and granulocytes in the gut lumen during colitis, a signature that includes the transcription of the key antimicrobial genes S100a8 and S100a9 (calprotectin). Genes involved in microbial resistance to oxidative stress, including Dps/ferritin, Fe-dependent peroxidase and glutathione S-transferase were identified as changing to a greater extent at the level of transcription than would be predicted by DNA abundance changes, implicating a role for increased oxygen tension and/or host-derived reactive oxygen species in driving transcriptional changes in commensal microbes. PMID:27003245
Fontana, Mary F; Banga, Simran; Barry, Kevin C; Shen, Xihui; Tan, Yunhao; Luo, Zhao-Qing; Vance, Russell E
2011-02-01
The intracellular bacterial pathogen Legionella pneumophila causes an inflammatory pneumonia called Legionnaires' Disease. For virulence, L. pneumophila requires a Dot/Icm type IV secretion system that translocates bacterial effectors to the host cytosol. L. pneumophila lacking the Dot/Icm system is recognized by Toll-like receptors (TLRs), leading to a canonical NF-κB-dependent transcriptional response. In addition, L. pneumophila expressing a functional Dot/Icm system potently induces unique transcriptional targets, including proinflammatory genes such as Il23a and Csf2. Here we demonstrate that this Dot/Icm-dependent response, which we term the effector-triggered response (ETR), requires five translocated bacterial effectors that inhibit host protein synthesis. Upon infection of macrophages with virulent L. pneumophila, these five effectors caused a global decrease in host translation, thereby preventing synthesis of IκB, an inhibitor of the NF-κB transcription factor. Thus, macrophages infected with wildtype L. pneumophila exhibited prolonged activation of NF-κB, which was associated with transcription of ETR target genes such as Il23a and Csf2. L. pneumophila mutants lacking the five effectors still activated TLRs and NF-κB, but because the mutants permitted normal IκB synthesis, NF-κB activation was more transient and was not sufficient to fully induce the ETR. L. pneumophila mutants expressing enzymatically inactive effectors were also unable to fully induce the ETR, whereas multiple compounds or bacterial toxins that inhibit host protein synthesis via distinct mechanisms recapitulated the ETR when administered with TLR ligands. Previous studies have demonstrated that the host response to bacterial infection is induced primarily by specific microbial molecules that activate TLRs or cytosolic pattern recognition receptors. Our results add to this model by providing a striking illustration of how the host immune response to a virulent pathogen can also
Chen, Huan-Da; Kao, Cheng-Yuan; Liu, Bang-Yu; Huang, Shin-Whei; Kuo, Cheng-Ju; Ruan, Jhen-Wei; Lin, Yen-Hung; Huang, Cheng-Rung; Chen, Yu-Hung; Wang, Horng-Dar; Aroian, Raffi V; Chen, Chang-Shi
2017-02-01
Autophagy is an evolutionarily conserved intracellular system that maintains cellular homeostasis by degrading and recycling damaged cellular components. The transcription factor HLH-30/TFEB-mediated autophagy has been reported to regulate tolerance to bacterial infection, but less is known about the bona fide bacterial effector that activates HLH-30 and autophagy. Here, we reveal that bacterial membrane pore-forming toxin (PFT) induces autophagy in an HLH-30-dependent manner in Caenorhabditis elegans. Moreover, autophagy controls the susceptibility of animals to PFT toxicity through xenophagic degradation of PFT and repair of membrane-pore cell-autonomously in the PFT-targeted intestinal cells in C. elegans. These results demonstrate that autophagic pathways and autophagy are induced partly at the transcriptional level through HLH-30 activation and are required to protect metazoan upon PFT intoxication. Together, our data show a new and powerful connection between HLH-30-mediated autophagy and epithelium intrinsic cellular defense against the single most common mode of bacterial attack in vivo.
Bent, Zachary W.; Poorey, Kunal; LaBauve, Annette E.; ...
2016-12-21
When analyzing pathogen transcriptomes during the infection of host cells, the signal-to-background (pathogen-to-host) ratio of nucleic acids (NA) in infected samples is very small. Despite the advancements in next-generation sequencing, the minute amount of pathogen NA makes standard RNA-seq library preps inadequate for effective gene-level analysis of the pathogen in cases with low bacterial loads. In order to provide a more complete picture of the pathogen transcriptome during an infection, we developed a novel pathogen enrichment technique, which can enrich for transcripts from any cultivable bacteria or virus, using common, readily available laboratory equipment and reagents. To evenly enrich formore » pathogen transcripts, we generate biotinylated pathogen-targeted capture probes in an enzymatic process using the entire genome of the pathogen as a template. The capture probes are hybridized to a strand-specific cDNA library generated from an RNA sample. The biotinylated probes are captured on a monomeric avidin resin in a miniature spin column, and enriched pathogen-specific cDNA is eluted following a series of washes. To test this method, we performed an in vitro time-course infection using Klebsiella pneumoniae to infect murine macrophage cells. K. pneumoniae transcript enrichment efficiency was evaluated using RNA-seq. Bacterial transcripts were enriched up to ~400-fold, and allowed the recovery of transcripts from ~2000–3600 genes not observed in untreated control samples. These additional transcripts revealed interesting aspects of K. pneumoniae biology including the expression of putative virulence factors and the expression of several genes responsible for antibiotic resistance even in the absence of drugs.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bent, Zachary W.; Poorey, Kunal; LaBauve, Annette E.
When analyzing pathogen transcriptomes during the infection of host cells, the signal-to-background (pathogen-to-host) ratio of nucleic acids (NA) in infected samples is very small. Despite the advancements in next-generation sequencing, the minute amount of pathogen NA makes standard RNA-seq library preps inadequate for effective gene-level analysis of the pathogen in cases with low bacterial loads. In order to provide a more complete picture of the pathogen transcriptome during an infection, we developed a novel pathogen enrichment technique, which can enrich for transcripts from any cultivable bacteria or virus, using common, readily available laboratory equipment and reagents. To evenly enrich formore » pathogen transcripts, we generate biotinylated pathogen-targeted capture probes in an enzymatic process using the entire genome of the pathogen as a template. The capture probes are hybridized to a strand-specific cDNA library generated from an RNA sample. The biotinylated probes are captured on a monomeric avidin resin in a miniature spin column, and enriched pathogen-specific cDNA is eluted following a series of washes. To test this method, we performed an in vitro time-course infection using Klebsiella pneumoniae to infect murine macrophage cells. K. pneumoniae transcript enrichment efficiency was evaluated using RNA-seq. Bacterial transcripts were enriched up to ~400-fold, and allowed the recovery of transcripts from ~2000–3600 genes not observed in untreated control samples. These additional transcripts revealed interesting aspects of K. pneumoniae biology including the expression of putative virulence factors and the expression of several genes responsible for antibiotic resistance even in the absence of drugs.« less
Bacterial adherence in the pathogenesis of urinary tract infection: a review.
Reid, G; Sobel, J D
1987-01-01
Bacterial adherence to the uroepithelium is recognized as an important mechanism in the initiation and pathogenesis of urinary tract infections (UTI). The uropathogens originate predominantly in the intestinal tract and initially colonize the periurethral region and ascend into the bladder, resulting in symptomatic or asymptomatic bacteriuria. Thereafter, depending on host factors and bacterial virulence factors, the organisms may further ascend and give rise to pyelonephritis. Uropathogens are selected by the presence of virulence characteristics that enable them to resist the normally efficient host defense mechanisms. Considerable progress has been made in identifying bacterial adhesins and in demonstrating bacterial receptor sites on uroepithelial surfaces. Recent studies have identified natural anti-adherence mechanisms in humans as well as possible increased susceptibility to UTI when these mechanisms are defective and when receptor density on uroepithelial cells is altered. Knowledge of bacterial adherence mechanisms may permit alternative methods of prevention and management of urinary infection, including the use of subinhibitory concentrations of antibiotics, vaccine development, nonimmune inhibition of bacterial adhesins and receptor sites, and the use of autochthonous flora, such as lactobacilli, to exclude uropathogens from colonizing the urinary tract.
The histone modifications governing TFF1 transcription mediated by estrogen receptor.
Li, Yanyan; Sun, Luyang; Zhang, Yu; Wang, Dandan; Wang, Feng; Liang, Jing; Gui, Bin; Shang, Yongfeng
2011-04-22
Transcription regulation by histone modifications is a major contributing factor to the structural and functional diversity in biology. These modifications are encrypted as histone codes or histone languages and function to establish and maintain heritable epigenetic codes that define the identity and the fate of the cell. Despite recent advances revealing numerous histone modifications associated with transcription regulation, how such modifications dictate the process of transcription is not fully understood. Here we describe spatial and temporal analyses of the histone modifications that are introduced during estrogen receptor α (ERα)-activated transcription. We demonstrated that aborting RNA polymerase II caused a disruption of the histone modifications that are associated with transcription elongation but had a minimal effect on modifications deposited during transcription initiation. We also found that the histone H3S10 phosphorylation mark is catalyzed by mitogen- and stress-activated protein kinase 1 (MSK1) and is recognized by a 14-3-3ζ/14-3-3ε heterodimer through its interaction with H3K4 trimethyltransferase SMYD3 and the p52 subunit of TFIIH. We showed that H3S10 phosphorylation is a prerequisite for H3K4 trimethylation. In addition, we demonstrated that SET8/PR-Set7/KMT5A is required for ERα-regulated transcription and its catalyzed H4K20 monomethylation is implicated in both transcription initiation and elongation. Our experiments provide a relatively comprehensive analysis of histone modifications associated with ERα-regulated transcription and define the biological meaning of several key components of the histone code that governs ERα-regulated transcription.
A transcription activator-like effector (TALE) induction system mediated by proteolysis.
Copeland, Matthew F; Politz, Mark C; Johnson, Charles B; Markley, Andrew L; Pfleger, Brian F
2016-04-01
Simple and predictable trans-acting regulatory tools are needed in the fields of synthetic biology and metabolic engineering to build complex genetic circuits and optimize the levels of native and heterologous gene products. Transcription activator-like effectors (TALEs) are bacterial virulence factors that have recently gained traction in biotechnology applications owing to their customizable DNA-binding specificity. In this work we expanded the versatility of these transcription factors to create an inducible TALE system by inserting tobacco-etch virus (TEV) protease recognition sites into the TALE backbone. The resulting engineered TALEs maintain transcriptional repression of their target genes in Escherichia coli, but are degraded after induction of the TEV protease, thereby promoting expression of the previously repressed target gene of interest. This TALE-TEV technology enables both repression and induction of plasmid or chromosomal target genes in a manner analogous to traditional repressor proteins but with the added flexibility of being operator-agnostic.
Moon, Kyung; Six, David A.; Lee, Hyun-Jung; Raetz, Christian R.H.; Gottesman, Susan
2013-01-01
Summary The PhoQ/PhoP two-component system activates many genes for lipopolysaccharide (LPS) modification when cells are grown at low Mg2+ concentrations. An additional target of PhoQ and PhoP is MgrR, an Hfq-dependent small RNA that negatively regulates expression of eptB, also encoding a protein that carries out LPS modification. Examination of LPS confirmed that MgrR effectively silences EptB; the phosphoethanolamine modification associated with EptB is found in ΔmgrR::kan but not mgrR+ cells. Sigma E has been reported to positively regulate eptB, although the eptB promoter does not have the expected Sigma E recognition motifs. The effects of Sigma E and deletion of mgrR on levels of eptB mRNA were independent, and the same 5′ end was found in both cases. In vitro transcription and the behavior of transcriptional and translational fusions demonstrate that Sigma E acts directly at the level of transcription initiation for eptB, from the same start point as Sigma 70. The results suggest that when Sigma E is active, synthesis of eptB transcript outstrips MgrR-dependent degradation; presumably the modification of LPS is important under these conditions. Adding to the complexity of eptB regulation is a second sRNA, ArcZ, which also directly and negatively regulates eptB. PMID:23659637
Yeom, Jinki; Lee, Yunho; Park, Woojun
2012-01-01
The oxyR gene appears to reside in an operon with the recG helicase gene in many bacteria, including pathogenic Pseudomonas aeruginosa and Pseudomonas putida. Analysis of P. putida transcriptomes shows that many OxyR-controlled genes are regulated by the ATP-dependent RecG helicase and that RecG alone modulates the expression of many genes. We found that purified RecG binds to the promoters of many OxyR-controlled genes and that expression of these genes was not induced under conditions of oxidative stress in recG mutants of P. aeruginosa, P. putida, and Escherichia coli. In vitro data revealed that promoters containing palindromic sequences are essential for RecG binding and that single-strand binding proteins and ATP are also needed for RecG to promote transcription, whereas a magnesium ion has the opposite effect. The OxyR tetramer preferentially binds to promoters after RecG has generated linear DNA in the presence of ATP; otherwise, the OxyR dimer has higher affinity. This study provides new insights into the mechanism of bacterial transcription by demonstrating that RecG might be required for the induction of the OxyR regulon by unwinding palindromic DNA for transcription. This work describes a novel bacterial transcriptional function by RecG helicase with OxyR and may provide new targets for controlling Pseudomonas species pathogen. PMID:22621928
Al-Harthi, L; Roebuck, K A; Olinger, G G; Landay, A; Sha, B E; Hashemi, F B; Spear, G T
1999-07-01
Alteration of cervicovaginal microbial flora can lead to vaginosis, which is associated with an increased risk of HIV-1 transmission. We recently characterized a soluble HIV-inducing factor (HIF) from the cervicovaginal lavage (CVL) samples of women. The goals of this study were to determine the effect of cervicovaginal microflora on HIV-1 expression and to elucidate the relationship between HIF activity and microflora. Physiologically relevant microorganisms, Mycoplasma, diphtheroid-like bacteria, Gardnerella vaginalis, Streptococcus agalactiae, and Streptococcus constellatus, cultured from the CVL of a representative woman with a clinical condition of bacterial vaginosis and possessing HIF activity, induced HIV-1 expression. The magnitude of virus induction varied widely with the greatest stimulation induced by diphtheroid-like bacteria and Mycoplasma. The transcriptional induction by Mycoplasma was mediated by activation of the KB enhancer, an activation mechanism shared with HIF. Also as with HIF, Mycoplasma induced AP-1 dependent transcription. Polymerase chain reaction (PCR)-based speciation showed that the isolate was M. hominis. Our data indicate that bacterial vaginosis-associated microflora can enhance HIV-1 transcription and replication and identify M. hominis as a potential source for HIF activity. The virus-enhancing activities associated with the microflora and HIF may increase genital tract viral load, potentially contributing to HIV transmission.
VirF-Independent Regulation of Shigella virB Transcription is Mediated by the Small RNA RyhB
Broach, William H.; Egan, Nicholas; Wing, Helen J.; Payne, Shelley M.; Murphy, Erin R.
2012-01-01
Infection of the human host by Shigella species requires the coordinated production of specific Shigella virulence factors, a process mediated largely by the VirF/VirB regulatory cascade. VirF promotes the transcription of virB, a gene encoding the transcriptional activator of several virulence-associated genes. This study reveals that transcription of virB is also regulated by the small RNA RyhB, and importantly, that this regulation is not achieved indirectly via modulation of VirF activity. These data are the first to demonstrate that the regulation of virB transcription can be uncoupled from the master regulator VirF. It is also established that efficient RyhB-dependent regulation of transcription is facilitated by specific nucleic acid sequences within virB. This study not only reveals RyhB-dependent regulation of virB transcription as a novel point of control in the central regulatory circuit modulating Shigella virulence, but also highlights the versatility of RyhB in controlling bacterial gene expression. PMID:22701677
TAL effector driven induction of a SWEET gene confers susceptibility to bacterial blight of cotton
USDA-ARS?s Scientific Manuscript database
Bacterial blight of cotton (BBC), caused by Xanthomonas citri subsp. malvacearum (Xcm), is among the most destructive diseases in cotton (Gossypium spp.). Transcription activator-like (TAL) effectors from Xcm are essential for BBC disease progression. Here, we carried out whole-genome PacBio-seque...
The effect of myotonic dystrophy transcript levels and location on muscle differentiation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mastroyiannopoulos, Nikolaos P.; Chrysanthou, Elina; Kyriakides, Tassos C.
2008-12-12
In myotonic dystrophy type I (DM1), nuclear retention of mutant DMPK transcripts compromises muscle cell differentiation. Although several reports have identified molecular defects in myogenesis, it remains still unclear how exactly the retention of the mutant transcripts induces this defect. We have recently created a novel cellular model in which the mutant DMPK 3' UTR transcripts were released to the cytoplasm of myoblasts by using the WPRE genetic element. As a result, muscle cell differentiation was repaired. In this paper, this cellular model was further exploited to investigate the effect of the levels and location of the mutant transcripts onmore » muscle differentiation. Results show that the levels of these transcripts were proportional to the inhibition of both the initial fusion of myoblasts and the maturity of myotubes. Moreover, the cytoplasmic export of the mutant RNAs to the cytoplasm caused less inhibition only in the initial fusion of myoblasts.« less
[Revised Japanese guidelines for the clinical management of bacterial meningitis].
Ishikawa, Harumi; Kamei, Satoshi
2014-01-01
Improvement of outcomes represents the most important problem in the treatment of bacterial meningitis. To achieve such improvement, revision of the guidelines for the clinical management of bacterial meningitis in Japan has been carried out, and these revised Japanese guidelines will soon be published. The choice of specific antimicrobial agents for initial treatment in bacterial meningitis is influenced by a number of factors, including patient age, systemic symptoms, and local patterns of bacterial resistance. In the revised Japanese guidelines, antimicrobial agents based on current knowledge of the epidemiology in Japan are recommended. Bacterial meningitis is a medical emergency, and patients with this disease require immediate medical assessment and appropriate treatment. Rapid diagnosis and treatment of bacterial meningitis reduces mortality and neurological sequelae. We describe the revised Japanese guidelines for the clinical management of bacterial meningitis 2014, with a focus on adults.
Sinharoy, Senjuti; Torres-Jerez, Ivone; Bandyopadhyay, Kaustav; Kereszt, Attila; Pislariu, Catalina I.; Nakashima, Jin; Benedito, Vagner A.; Kondorosi, Eva; Udvardi, Michael K.
2013-01-01
Transcription factors (TFs) are thought to regulate many aspects of nodule and symbiosis development in legumes, although few TFs have been characterized functionally. Here, we describe REGULATOR OF SYMBIOSOME DIFFERENTIATION (RSD) of Medicago truncatula, a member of the Cysteine-2/Histidine-2 (C2H2) family of plant TFs that is required for normal symbiosome differentiation during nodule development. RSD is expressed in a nodule-specific manner, with maximal transcript levels in the bacterial invasion zone. A tobacco (Nicotiana tabacum) retrotransposon (Tnt1) insertion rsd mutant produced nodules that were unable to fix nitrogen and that contained incompletely differentiated symbiosomes and bacteroids. RSD protein was localized to the nucleus, consistent with a role of the protein in transcriptional regulation. RSD acted as a transcriptional repressor in a heterologous yeast assay. Transcriptome analysis of an rsd mutant identified 11 genes as potential targets of RSD repression. RSD interacted physically with the promoter of one of these genes, VAMP721a, which encodes vesicle-associated membrane protein 721a. Thus, RSD may influence symbiosome development in part by repressing transcription of VAMP721a and modifying vesicle trafficking in nodule cells. This establishes RSD as a TF implicated directly in symbiosome and bacteroid differentiation and a transcriptional regulator of secretory pathway genes in plants. PMID:24082011
Bacterial RNA Biology on a Genome Scale.
Hör, Jens; Gorski, Stanislaw A; Vogel, Jörg
2018-06-07
Bacteria are an exceedingly diverse group of organisms whose molecular exploration is experiencing a renaissance. While the classical view of bacterial gene expression was relatively simple, the emerging view is more complex, encompassing extensive post-transcriptional control involving riboswitches, RNA thermometers, and regulatory small RNAs (sRNAs) associated with the RNA-binding proteins CsrA, Hfq, and ProQ, as well as CRISPR/Cas systems that are programmed by RNAs. Moreover, increasing interest in members of the human microbiota and environmental microbial communities has highlighted the importance of understudied bacterial species with largely unknown transcriptome structures and RNA-based control mechanisms. Collectively, this creates a need for global RNA biology approaches that can rapidly and comprehensively analyze the RNA composition of a bacterium of interest. We review such approaches with a focus on RNA-seq as a versatile tool to investigate the different layers of gene expression in which RNA is made, processed, regulated, modified, translated, and turned over. Copyright © 2017 Elsevier Inc. All rights reserved.
The effects of cocaine on HIV transcription.
Tyagi, Mudit; Weber, Jaime; Bukrinsky, Michael; Simon, Gary L
2016-06-01
Illicit drug users are a high-risk population for infection with the human immunodeficiency virus (HIV). A strong correlation exists between prohibited drug use and an increased rate of HIV transmission. Cocaine stands out as one of the most frequently abused illicit drugs, and its use is correlated with HIV infection and disease progression. The central nervous system (CNS) is a common target for both drugs of abuse and HIV, and cocaine intake further accelerates neuronal injury in HIV patients. Although the high incidence of HIV infection in illicit drug abusers is primarily due to high-risk activities such as needle sharing and unprotected sex, several studies have demonstrated that cocaine enhances the rate of HIV gene expression and replication by activating various signal transduction pathways and downstream transcription factors. In order to generate mature HIV genomic transcript, HIV gene expression has to pass through both the initiation and elongation phases of transcription, which requires discrete transcription factors. In this review, we will provide a detailed analysis of the molecular mechanisms that regulate HIV transcription and discuss how cocaine modulates those mechanisms to upregulate HIV transcription and eventually HIV replication.
Auray, Gaël; Lachance, Claude; Wang, Yingchao; Gagnon, Carl A.; Segura, Mariela; Gottschalk, Marcelo
2016-01-01
The porcine reproductive and respiratory syndrome virus (PRRSV) is one of the most important swine pathogens and often serves as an entry door for other viral or bacterial pathogens, of which Streptococcus suis is one of the most common. Pre-infection with PRRSV leads to exacerbated disease caused by S. suis infection. Very few studies have assessed the immunological mechanisms underlying this higher susceptibility. Since antigen presenting cells play a major role in the initiation of the immune response, the in vitro transcriptional response of bone marrow-derived dendritic cells (BMDCs) and monocytes in the context of PRRSV and S. suis co-infection was investigated. BMDCs were found to be more permissive than monocytes to PRRSV infection; S. suis phagocytosis by PRRSV-infected BMDCs was found to be impaired, whereas no effect was found on bacterial intracellular survival. Transcription profile analysis, with a major focus on inflammatory genes, following S. suis infection, with and without pre-infection with PRRSV, was then performed. While PRRSV pre-infection had little effect on monocytes response to S. suis infection, a significant expression of several pro-inflammatory molecules was observed in BMDCs pre-infected with PRRSV after a subsequent infection with S. suis. While an additive effect could be observed for CCL4, CCL14, CCL20, and IL-15, a distinct synergistic up-regulatory effect was observed for IL-6, CCL5 and TNF-α after co-infection. This increased pro-inflammatory response by DCs could participate in the exacerbation of the disease observed during PRRSV and S. suis co-infection. PMID:27213692
NASA Technical Reports Server (NTRS)
Kyrpides, N. C.; Woese, C. R.
1998-01-01
As the amount of available sequence data increases, it becomes apparent that our understanding of translation initiation is far from comprehensive and that prior conclusions concerning the origin of the process are wrong. Contrary to earlier conclusions, key elements of translation initiation originated at the Universal Ancestor stage, for homologous counterparts exist in all three primary taxa. Herein, we explore the evolutionary relationships among the components of bacterial initiation factor 2 (IF-2) and eukaryotic IF-2 (eIF-2)/eIF-2B, i.e., the initiation factors involved in introducing the initiator tRNA into the translation mechanism and performing the first step in the peptide chain elongation cycle. All Archaea appear to posses a fully functional eIF-2 molecule, but they lack the associated GTP recycling function, eIF-2B (a five-subunit molecule). Yet, the Archaea do posses members of the gene family defined by the (related) eIF-2B subunits alpha, beta, and delta, although these are not specifically related to any of the three eukaryotic subunits. Additional members of this family also occur in some (but by no means all) Bacteria and even in some eukaryotes. The functional significance of the other members of this family is unclear and requires experimental resolution. Similarly, the occurrence of bacterial IF-2-like molecules in all Archaea and in some eukaryotes further complicates the picture of translation initiation. Overall, these data lend further support to the suggestion that the rudiments of translation initiation were present at the Universal Ancestor stage.
The RclR Protein Is a Reactive Chlorine-specific Transcription Factor in Escherichia coli *
Parker, Benjamin W.; Schwessinger, Emily A.; Jakob, Ursula; Gray, Michael J.
2013-01-01
Reactive chlorine species (RCS) such as hypochlorous acid are powerful antimicrobial oxidants. Used extensively for disinfection in household and industrial settings (i.e. as bleach), RCS are also naturally generated in high quantities during the innate immune response. Bacterial responses to RCS are complex and differ substantially from the well characterized responses to other physiologically relevant oxidants, like peroxide or superoxide. Several RCS-sensitive transcription factors have been identified in bacteria, but most of them respond to multiple stressors whose damaging effects overlap with those of RCS, including reactive oxygen species and electrophiles. We have now used in vivo genetic and in vitro biochemical methods to identify and demonstrate that Escherichia coli RclR (formerly YkgD) is a redox-regulated transcriptional activator of the AraC family, whose highly conserved cysteine residues are specifically sensitive to oxidation by RCS. Oxidation of these cysteines leads to strong, highly specific activation of expression of genes required for survival of RCS stress. These results demonstrate the existence of a widely conserved bacterial regulon devoted specifically to RCS resistance. PMID:24078635
The RclR protein is a reactive chlorine-specific transcription factor in Escherichia coli.
Parker, Benjamin W; Schwessinger, Emily A; Jakob, Ursula; Gray, Michael J
2013-11-08
Reactive chlorine species (RCS) such as hypochlorous acid are powerful antimicrobial oxidants. Used extensively for disinfection in household and industrial settings (i.e. as bleach), RCS are also naturally generated in high quantities during the innate immune response. Bacterial responses to RCS are complex and differ substantially from the well characterized responses to other physiologically relevant oxidants, like peroxide or superoxide. Several RCS-sensitive transcription factors have been identified in bacteria, but most of them respond to multiple stressors whose damaging effects overlap with those of RCS, including reactive oxygen species and electrophiles. We have now used in vivo genetic and in vitro biochemical methods to identify and demonstrate that Escherichia coli RclR (formerly YkgD) is a redox-regulated transcriptional activator of the AraC family, whose highly conserved cysteine residues are specifically sensitive to oxidation by RCS. Oxidation of these cysteines leads to strong, highly specific activation of expression of genes required for survival of RCS stress. These results demonstrate the existence of a widely conserved bacterial regulon devoted specifically to RCS resistance.
Lough, Denver; Dai, Hui; Yang, Mei; Reichensperger, Joel; Cox, Lisa; Harrison, Carrie; Neumeister, Michael W
2013-11-01
Discovery of leucine-rich repeat-containing G-protein-coupled receptors 5 and 6 (LGR5 and LGR6) as markers of adult epithelial stem cells of the skin and intestine permits researchers to draw on the intrinsic cellular fundamentals of wound healing and proliferation dynamics of epithelial surfaces. In this study, the authors use the intestine-derived human alpha defensin 5 to stimulate epithelial proliferation, bacterial reduction, and hair production in burn wound beds to provide the field with initial insight on augmenting wound healing in tissues devoid of adnexal stem cells. Murine third-degree burn wound beds were treated with (1) intestine-derived human alpha defensin 5, (2) skin-derived human beta defensin 1, and (3) sulfadiazine to determine their roles in wound healing, bacterial reduction, and hair growth. The human alpha defensin 5 peptide significantly enhanced wound healing and reduced basal bacterial load compared with human beta defensin 1 and sulfadiazine. Human alpha defensin 5 was the only therapy to induce LGR stem cell migration into the wound bed. In addition, gene heat mapping showed significant mRNA up-regulation of key wound healing and Wnt pathway transcripts such as Wnt1 and Wisp1. Ex vivo studies showed enhanced cell migration in human alpha defensin 5-treated wounds compared with controls. Application of human alpha defensin 5 increases LGR stem cell migration into wound beds, leading to enhanced healing, bacterial reduction, and hair production through the augmentation of key Wnt and wound healing transcripts. These findings can be used to derive gut protein-based therapeutics in wound healing.
Lunz, John G; Specht, Susan M; Murase, Noriko; Isse, Kumiko; Demetris, Anthony J
2007-12-01
Intraorgan dendritic cells (DCs) monitor the environment and help translate triggers of innate immunity into adaptive immune responses. Liver-based DCs are continually exposed, via gut-derived portal venous blood, to potential antigens and bacterial products that can trigger innate immunity. However, somehow the liver avoids a state of perpetual inflammation and protects central immune organs from overstimulation. In this study, we tested the hypothesis that hepatic interleukin-6 (IL-6)/signal transducer and activator of transcription 3 (STAT3) activity increases the activation/maturation threshold of hepatic DCs toward innate immune signals. The results show that the liver nuclear STAT3 activity is significantly higher than that of other organs and is IL-6-dependent. Hepatic DCs in normal IL-6 wild-type (IL-6(+/+)) mice are phenotypically and functionally less mature than DCs from IL-6-deficient (IL-6(-/-)) or STAT3-inhibited IL-6(+/+) mice, as determined by surface marker expression, proinflammatory cytokine secretion, and allogeneic T-cell stimulation. IL-6(+/+) liver DCs produce IL-6 in response to exposure to lipopolysaccharide (LPS) and cytidine phosphate guanosine oligonucleotides (CpG) but are resistant to maturation compared with IL-6(-/-) liver DCs. Conversely, exogenous IL-6 inhibits LPS-induced IL-6(-/-) liver DC maturation. IL-6/STAT3 signaling influences the liver DC expression of toll-like receptor 9 and IL-1 receptor associated kinase-M. The depletion of gut commensal bacteria in IL-6(+/+) mice with oral antibiotics decreased portal blood endotoxin levels, lowered the expression of IL-6 and phospho-STAT3, and significantly increased liver DC maturation. Gut-derived bacterial products, by stimulating hepatic IL-6/STAT3 signaling, inhibit hepatic DC activation/maturation and thereby elevate the threshold needed for translating triggers of innate immunity into adaptive immune responses. Manipulating gut bacteria may therefore be an effective strategy
Radebaugh, C A; Kubaska, W M; Hoffman, L H; Stiffler, K; Paule, M R
1998-10-16
The fundamental transcription initiation factor (TIF) for ribosomal RNA expression by eukaryotic RNA polymerase I, TIF-IB, has been purified to near homogeneity from Acanthamoeba castellanii using standard techniques. The purified factor consists of the TATA-binding protein and four TATA-binding protein-associated factors with relative molecular weights of 145,000, 99,000, 96,000, and 91,000. This yields a calculated native molecular weight of 460, 000, which compares well with its mass determined by scanning transmission electron microscopy (493,000) and its sedimentation rate, which is close to RNA polymerase I (515,000). Both impure and nearly homogeneous TIF-IB exhibit an apparent equilibrium dissociation constant of 56 +/- 3 pM. However, although impure TIF-IB can form a promoter-DNA complex resistant to challenge by other promoter-containing DNAs, near homogeneous TIF-IB cannot do so. An additional transcription factor, dubbed TIF-IE, restores the ability of near homogeneous TIF-IB to sequester DNA into a committed complex.
Regulation of the Hippo Pathway Transcription Factor TEAD.
Lin, Kimberly C; Park, Hyun Woo; Guan, Kun-Liang
2017-11-01
The TEAD transcription factor family is best known for transcriptional output of the Hippo signaling pathway and has been implicated in processes such as development, cell growth and proliferation, tissue homeostasis, and regeneration. Our understanding of the functional importance of TEADs has increased dramatically since its initial discovery three decades ago. The majority of our knowledge of TEADs is in the context of Hippo signaling as nuclear DNA-binding proteins passively activated by Yes-associated protein (YAP) and transcriptional activator with PDZ-binding domain (TAZ), transcription coactivators downstream of the Hippo pathway. However, recent studies suggest that TEAD itself is actively regulated. Here, we highlight evidence demonstrating Hippo-independent regulation of TEADs and the potential impacts these studies may have on new cancer therapeutics. Copyright © 2017 Elsevier Ltd. All rights reserved.
De la Cruz, Miguel A; Ares, Miguel A; von Bargen, Kristine; Panunzi, Leonardo G; Martínez-Cruz, Jessica; Valdez-Salazar, Hilda A; Jiménez-Galicia, César; Torres, Javier
2017-01-01
Helicobacter pylori is a Gram-negative bacterium that colonizes the human gastric mucosa and causes peptic ulcers and gastric carcinoma. H. pylori strain 26695 has a small genome (1.67 Mb), which codes for few known transcriptional regulators that control bacterial metabolism and virulence. We analyzed by qRT-PCR the expression of 16 transcriptional regulators in H. pylori 26695, including the three sigma factors under different environmental conditions. When bacteria were exposed to acidic pH, urea, nickel, or iron, the sigma factors were differentially expressed with a particularly strong induction of fliA . The regulatory genes hrcA, hup , and crdR were highly induced in the presence of urea, nickel, and iron. In terms of biofilm formation fliA, flgR, hp1021, fur, nikR , and crdR were induced in sessile bacteria. Transcriptional expression levels of rpoD, flgR, hspR, hp1043 , and cheY were increased in contact with AGS epithelial cells. Kanamycin, chloramphenicol, and tetracycline increased or decreased expression of regulatory genes, showing that these antibiotics affect the transcription of H. pylori . Our data indicate that environmental cues which may be present in the human stomach modulate H. pylori transcription.
El-Robh, Mohamed Samir; Busby, Stephen J W
2002-01-01
We report the first detailed quantitative study of divergent promoters dependent on the Escherichia coli cAMP receptor protein (CRP), a factor known to activate transcription initiation at target promoters by making direct interactions with the RNA polymerase holoenzyme. In this work, we show that CRP bound at a single target site is able to activate transcription at two divergently organized promoters. Experiments using promoter probe plasmids, designed to study divergent promoters in vivo and in vitro, show that the divergent promoters function independently. Further in vitro experiments show that two holo RNA polymerase molecules cannot be accommodated simultaneously at the divergent promoters. PMID:12350222
[Bacterial meningitis in adults in emergency and rescue services].
Klein, M; Pfister, H-W
2016-10-01
The cardinal symptoms of bacterial meningitis are headache, fever, impaired consciousness and nuchal stiffness (meningism); however, the diagnosis of acute bacterial meningitis can only be confirmed or ruled out by investigation of cerebrospinal fluid. The recommended empirical antibiotic regimen for community-acquired acute bacterial meningitis in adults in Germany is a combination of ceftriaxone and ampicillin plus adjuvant dexamethasone. An important influenceable factor for treatment success of acute bacterial meningitis is a rapid induction of antibiotic therapy, which must be initiated directly after lumbar puncture. When this is delayed for any reason, e. g. because of the necessity of cerebral computed tomography imaging before lumbar puncture, antibiotics should be started even before acquisition of cerebrospinal fluid.
In vitro transcription of adenovirus.
Fire, A; Baker, C C; Manley, J L; Ziff, E B; Sharp, P A
1981-01-01
A series of recombinants of adenovirus DNA fragments and pBR322 was used to test the transcriptional activity of the nine known adenovirus promoters in a cell-free extract. Specific initiation was seen at all five early promoters as well as at the major late promotor and at the intermediate promoter for polypeptide IX. The system failed to recognize the two other adenovirus promoters, which were prominent in vivo only at intermediate and late stages in infection. Microheterogeneity of 5' termini at several adenovirus promoters, previously shown in vivo, was reproduced in the in vitro reaction and indeed appeared to result from heterogeneous initiation rather than 5' processing. To test for the presence of soluble factors involved in regulation of nRNA synthesis, the activity of extracts prepared from early and late stages of infection was compared on an assortment of viral promoter sites. Although mock and early extracts showed identical transcription patterns, extracts prepared from late stages gave 5- to 10-fold relative enhancement of the late and polypeptide IX promoters as compared with early promoters. Images PMID:7321101
Transcription-dependent induction of G1 phase during the zebra fish midblastula transition.
Zamir, E; Kam, Z; Yarden, A
1997-02-01
The early development of the zebra fish (Danio rerio) embryo is characterized by a series of rapid and synchronous cell cycles with no detectable transcription. This period is followed by the midblastula transition (MBT), during which the cell cycle gradually lengthens, cell synchrony is lost, and zygotic transcription is initially detected. In this work, we examined the changes in the pattern of the cell cycle during MBT in zebra fish and whether these changes are dependent on the initiation of zygotic transcription. To characterize the pattern of the early zebra fish cell cycles, the embryonic DNA content was determined by flow cytometric analysis. We found that G1 phase is below detection levels during the first 10 cleavages and can be initially detected at the onset of MBT. Inhibition of zygotic transcription, by microinjection of actinomycin D, abolished the appearance of G1 phase at MBT. Premature activation of zygotic transcription, by microinjection of nonspecific DNA, induced G1 phase before the onset of MBT, while coinjection of actinomycin D and nonspecific DNA abolished this early appearance of G1 phase. We therefore suggest that during the early development of the zebra fish embryo, G1 phase appears at the onset of MBT and that the activation of transcription at MBT is essential and sufficient for the G1-phase induction.
Hydrodynamics of bacterial colonies: Phase diagrams
NASA Astrophysics Data System (ADS)
Lega, J.; Passot, T.
2004-09-01
We present numerical simulations of a recent hydrodynamic model describing the growth of bacterial colonies on agar plates. We show that this model is able to qualitatively reproduce experimentally observed phase diagrams, which relate a colony shape to the initial quantity of nutrients on the plate and the initial wetness of the agar. We also discuss the principal features resulting from the interplay between hydrodynamic motions and colony growth, as described by our model.
Oncogenes Activate an Autonomous Transcriptional Regulatory Circuit That Drives Glioblastoma.
Singh, Dinesh K; Kollipara, Rahul K; Vemireddy, Vamsidara; Yang, Xiao-Li; Sun, Yuxiao; Regmi, Nanda; Klingler, Stefan; Hatanpaa, Kimmo J; Raisanen, Jack; Cho, Steve K; Sirasanagandla, Shyam; Nannepaga, Suraj; Piccirillo, Sara; Mashimo, Tomoyuki; Wang, Shan; Humphries, Caroline G; Mickey, Bruce; Maher, Elizabeth A; Zheng, Hongwu; Kim, Ryung S; Kittler, Ralf; Bachoo, Robert M
2017-01-24
Efforts to identify and target glioblastoma (GBM) drivers have primarily focused on receptor tyrosine kinases (RTKs). Clinical benefits, however, have been elusive. Here, we identify an SRY-related box 2 (SOX2) transcriptional regulatory network that is independent of upstream RTKs and capable of driving glioma-initiating cells. We identified oligodendrocyte lineage transcription factor 2 (OLIG2) and zinc-finger E-box binding homeobox 1 (ZEB1), which are frequently co-expressed irrespective of driver mutations, as potential SOX2 targets. In murine glioma models, we show that different combinations of tumor suppressor and oncogene mutations can activate Sox2, Olig2, and Zeb1 expression. We demonstrate that ectopic co-expression of the three transcription factors can transform tumor-suppressor-deficient astrocytes into glioma-initiating cells in the absence of an upstream RTK oncogene. Finally, we demonstrate that the transcriptional inhibitor mithramycin downregulates SOX2 and its target genes, resulting in markedly reduced proliferation of GBM cells in vivo. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Individual based simulations of bacterial growth on agar plates
NASA Astrophysics Data System (ADS)
Ginovart, M.; López, D.; Valls, J.; Silbert, M.
2002-03-01
The individual based simulator, INDividual DIScrete SIMulations (INDISIM) has been used to study the behaviour of the growth of bacterial colonies on a finite dish. The simulations reproduce the qualitative trends of pattern formation that appear during the growth of Bacillus subtilis on an agar plate under different initial conditions of nutrient peptone concentration, the amount of agar on the plate, and the temperature. The simulations are carried out by imposing closed boundary conditions on a square lattice divided into square spatial cells. The simulator studies the temporal evolution of the bacterial population possible by setting rules of behaviour for each bacterium, such as its uptake, metabolism and reproduction, as well as rules for the medium in which the bacterial cells grow, such as concentration of nutrient particles and their diffusion. The determining factors that characterize the structure of the bacterial colony patterns in the presents simulations, are the initial concentrations of nutrient particles, that mimic the amount of peptone in the experiments, and the set of values for the microscopic diffusion parameter related, in the experiments, to the amount of the agar medium.
Transcriptional and posttranscriptional regulation of cyanobacterial photosynthesis.
Wilde, Annegret; Hihara, Yukako
2016-03-01
Cyanobacteria are well established model organisms for the study of oxygenic photosynthesis, nitrogen metabolism, toxin biosynthesis, and salt acclimation. However, in comparison to other model bacteria little is known about regulatory networks, which allow cyanobacteria to acclimate to changing environmental conditions. The current work has begun to illuminate how transcription factors modulate expression of different photosynthetic regulons. During the past few years, the research on other regulatory principles like RNA-based regulation showed the importance of non-protein regulators for bacterial lifestyle. Investigations on modulation of photosynthetic components should elucidate the contributions of all factors within the context of a larger regulatory network. Here, we focus on regulation of photosynthetic processes including transcriptional and posttranscriptional mechanisms, citing examples from a limited number of cyanobacterial species. Though, the general idea holds true for most species, important differences exist between various organisms, illustrating diversity of acclimation strategies in the very heterogeneous cyanobacterial clade. This article is part of a Special Issue entitled Organization and dynamics of bioenergetic systems in bacteria, edited by Prof Conrad Mullineaux. Copyright © 2015 Elsevier B.V. All rights reserved.
Dissecting transcription-coupled and global genomic repair in the chromatin of yeast GAL1-10 genes.
Li, Shisheng; Smerdon, Michael J
2004-04-02
Transcription-coupled repair (TCR) and global genomic repair (GGR) of UV-induced cyclobutane pyrimidine dimers were investigated in the yeast GAL1-10 genes. Both Rpb9- and Rad26-mediated TCR are confined to the transcribed strands, initiating at upstream sites approximately 100 nucleotides from the upstream activating sequence shared by the two genes. However, TCR initiation sites do not correlate with either transcription start sites or TATA boxes. Rad16-mediated GGR tightly correlates with nucleosome positioning when the genes are repressed and are slow in the nucleosome core and fast in linker DNA. Induction of transcription enhanced GGR in nucleosome core DNA, especially in the nucleosomes around and upstream of the transcription start sites. Furthermore, when the genes were induced, GGR was slower in the transcribed regions than in the upstream regions. Finally, simultaneous deletion of RAD16, RAD26, and RPB9 resulted in no detectable repair in all sites along the region analyzed. Our results suggest that (a). TCR may be initiated by a transcription activator, presumably through the loading of RNA polymerase II, rather than by transcription initiation or elongation per se; (b). TCR and nucleosome disruption-enhanced GGR are the major causes of rapid repair in regions around and upstream of transcription start sites; (c). transcription machinery may hinder access of NER factors to a DNA lesion in the absence of a transcription-repair coupling factor; and (d). other than GGR mediated by Rad16 and TCR mediated by Rad26 and Rpb9, no other nucleotide excision repair pathway exists in these RNA polymerase II-transcribed genes.
Transcription regulation by distal enhancers: who's in the loop?
Stadhouders, Ralph; van den Heuvel, Anita; Kolovos, Petros; Jorna, Ruud; Leslie, Kris; Grosveld, Frank; Soler, Eric
2012-01-01
Genome-wide chromatin profiling efforts have shown that enhancers are often located at large distances from gene promoters within the noncoding genome. Whereas enhancers can stimulate transcription initiation by communicating with promoters via chromatin looping mechanisms, we propose that enhancers may also stimulate transcription elongation by physical interactions with intronic elements. We review here recent findings derived from the study of the hematopoietic system.
Effect of oral bacterial lysates on serum immunoglobulins.
Palma-Carlos, A G; Palma-Carlos, M L
1989-11-01
The level of serum immunoglobulins IgG, IgA, IgM and IgE has been studied before and after oral immunotherapy with a bacterial lysate in 88 patients with bronchial asthma, repeated respiratory infection and 12 cases of IgA deficiency. A significant increase in IgA has been observed in 9 patients presenting initially a decreased IgA serum level. In 3 patients without response to the standard treatment an increase in IgA was achieved increasing the dosage of oral bacterial lysate. Oral bacterial lysates could be an useful immunomodulating agent in repeated respiratory infections associated or not with IgA deficiency.
Silver nanoparticle-doped zirconia capillaries for enhanced bacterial filtration.
Wehling, Julia; Köser, Jan; Lindner, Patrick; Lüder, Christian; Beutel, Sascha; Kroll, Stephen; Rezwan, Kurosch
2015-03-01
Membrane clogging and biofilm formation are the most serious problems during water filtration. Silver nanoparticle (Agnano) coatings on filtration membranes can prevent bacterial adhesion and the initiation of biofilm formation. In this study, Agnano are immobilized via direct reduction on porous zirconia capillary membranes to generate a nanocomposite material combining the advantages of ceramics being chemically, thermally and mechanically stable with nanosilver, an efficient broadband bactericide for water decontamination. The filtration of bacterial suspensions of the fecal contaminant Escherichia coli reveals highly efficient bacterial retention capacities of the capillaries of 8 log reduction values, fulfilling the requirements on safe drinking water according to the U.S. Environmental Protection Agency. Maximum bacterial loading capacities of the capillary membranes are determined to be 3×10(9)bacterialcells/750mm(2) capillary surface until back flushing is recommendable. The immobilized Agnano remain accessible and exhibit strong bactericidal properties by killing retained bacteria up to maximum bacterial loads of 6×10(8)bacterialcells/750mm(2) capillary surface and the regenerated membranes regain filtration efficiencies of 95-100%. Silver release is moderate as only 0.8% of the initial silver loading is leached during a three-day filtration experiment leading to average silver contaminant levels of 100μg/L. Copyright © 2014 Elsevier B.V. All rights reserved.
Miroshnichenko, O I; Borisenko, A S; Ponomareva, T I; Tikhonenko, T I
1990-03-01
The E1A region of the adenoviral genome, important for initiation of virus infection and activation of other viral genes, was chosen as a target for engineering antisense RNA (asRNA) to inhibit adenovirus 5 (Ad5) replication in COS-1 cell culture in vitro. The hsp70 promoter, taken from the appropriate heat-shock-protein gene of Drosophila melanogaster, and the VA-1 RNA promoter, derived from the Ad5 gene coding for low-molecular-mass VA-1 RNA and recognized by RNA polymerase III were used as regulatory elements of transcription. The two types of recombinant constructs contained E1A fragments of 710 bp (hsp70 constructs) or 380 or 740 bp (VA-1 RNA constructs) in reverse orientation relative to the promoter position, as well as a transcription termination signal, the SV40 ori, and the gene controlling Geneticin (antibiotic G418) resistance (G418R). After selection of transfected COS-1 cells in the presence of G418, a number of stable G418R cell lines were raised which expressed engineered asRNAs. Plating of Ad5 suspensions of known titre on monolayers of transfected COS-1 cells clearly showed strong inhibition of adenovirus replication by asRNAs: 75% with the hsp70 promoter and 90% with the VA-1 RNA promoter.
Impact of contraceptive initiation on vaginal microbiota.
Achilles, Sharon L; Austin, Michele N; Meyn, Leslie A; Mhlanga, Felix; Chirenje, Zvavahera M; Hillier, Sharon L
2018-06-01
Data evaluating the impact of contraceptives on the vaginal microbiome are limited and inconsistent. We hypothesized that women initiating copper intrauterine device use would have increased bacterial vaginosis and bacterial vaginosis-associated microbes with use compared to women initiating and using hormonal contraceptive methods. Vaginal swabs (N = 1047 from 266 participants seeking contraception) for Nugent score determination of bacterial vaginosis and quantitative polymerase chain reaction analyses for assessment of specific microbiota were collected from asymptomatic, healthy women aged 18-35 years in Harare, Zimbabwe, who were confirmed to be free of nonstudy hormones by mass spectrometry at each visit. Contraception was initiated with an injectable (depot medroxyprogesterone acetate [n = 41], norethisterone enanthate [n = 44], or medroxyprogesterone acetate and ethinyl estradiol [n = 40]), implant (levonorgestrel [n = 45] or etonogestrel [n = 48]), or copper intrauterine device (n = 48) and repeat vaginal swabs were collected after 30, 90, and 180 days of continuous use. Self-reported condom use was similar across all arms at baseline. Quantitative polymerase chain reaction was used to detect Lactobacillus crispatus, L jensenii, L gasseri/johnsonii group, L vaginalis, L iners, Gardnerella vaginalis, Atopobium vaginae, and Megasphaera-like bacterium phylotype I from swabs. Modified Poisson regression and mixed effects linear models were used to compare marginal prevalence and mean difference in quantity (expressed as gene copies/swab) prior to and during contraceptive use. Bacterial vaginosis prevalence increased in women initiating copper intrauterine devices from 27% at baseline, 35% at 30 days, 40% at 90 days, and 49% at 180 days (P = .005 compared to marginal prevalence at enrollment). Women initiating hormonal methods had no change in bacterial vaginosis prevalence over 180 days. The mean increase in Nugent score was 1.2 (95% confidence
diCenzo, George C; Wellappili, Deelaka; Golding, G Brian; Finan, Turlough M
2018-05-04
Integration of newly acquired genes into existing regulatory networks is necessary for successful horizontal gene transfer (HGT). Ten percent of bacterial species contain at least two DNA replicons over 300 kilobases in size, with the secondary replicons derived predominately through HGT. The Sinorhizobium meliloti genome is split between a 3.7 Mb chromosome, a 1.7 Mb chromid consisting largely of genes acquired through ancient HGT, and a 1.4 Mb megaplasmid consisting primarily of recently acquired genes. Here, RNA-sequencing is used to examine the transcriptional consequences of massive, synthetic genome reduction produced through the removal of the megaplasmid and/or the chromid. Removal of the pSymA megaplasmid influenced the transcription of only six genes. In contrast, removal of the chromid influenced expression of ∼8% of chromosomal genes and ∼4% of megaplasmid genes. This was mediated in part by the loss of the ETR DNA region whose presence on pSymB is due to a translocation from the chromosome. No obvious functional bias among the up-regulated genes was detected, although genes with putative homologs on the chromid were enriched. Down-regulated genes were enriched in motility and sensory transduction pathways. Four transcripts were examined further, and in each case the transcriptional change could be traced to loss of specific pSymB regions. In particularly, a chromosomal transporter was induced due to deletion of bdhA likely mediated through 3-hydroxybutyrate accumulation. These data provide new insights into the evolution of the multipartite bacterial genome, and more generally into the integration of horizontally acquired genes into the transcriptome. Copyright © 2018 diCenzo, et al.
In vitro transcription in E. coli crude lysates prepared on cellophane discs.
Valla, S; Lindqvist, B H
1978-01-01
An in vitro RNA-synthesizing system consisting of gently lysed E. coli cells on cellophane discs is described. The system has been optimalized with respect to total RNA synthesis. Under certain standard conditions DNA dependent RNA polymerase (EC 2.7.7.6) is responsible for the majority of the RNA synthesis. The extensive rifampicin sensitivity of the synthesis indicates that most of the transcripts are initiated in vitro. The RNA synthesizing system described here has been developed with the aim of studying phage transcription in vitro. We show here that lysates of a P4 infected P2 lysogen support initiation and propagation of transcription from the P2 prophage. PMID:27767
Frieman, M; Chen, Z J; Saez-Vasquez, J; Shen, L A; Pikaard, C S
1999-01-01
In interspecific hybrids or allopolyploids, often one parental set of ribosomal RNA genes is transcribed and the other is silent, an epigenetic phenomenon known as nucleolar dominance. Silencing is enforced by cytosine methylation and histone deacetylation, but the initial discrimination mechanism is unknown. One hypothesis is that a species-specific transcription factor is inactivated, thereby silencing one set of rRNA genes. Another is that dominant rRNA genes have higher binding affinities for limiting transcription factors. A third suggests that selective methylation of underdominant rRNA genes blocks transcription factor binding. We tested these hypotheses using Brassica napus (canola), an allotetraploid derived from B. rapa and B. oleracea in which only B. rapa rRNA genes are transcribed. B. oleracea and B. rapa rRNA genes were active when transfected into protoplasts of the other species, which argues against the species-specific transcription factor model. B. oleracea and B. rapa rRNA genes also competed equally for the pol I transcription machinery in vitro and in vivo. Cytosine methylation had no effect on rRNA gene transcription in vitro, which suggests that transcription factor binding was unimpaired. These data are inconsistent with the prevailing models and point to discrimination mechanisms that are likely to act at a chromosomal level. PMID:10224274
Deep sequencing approaches for the analysis of prokaryotic transcriptional boundaries and dynamics.
James, Katherine; Cockell, Simon J; Zenkin, Nikolay
2017-05-01
The identification of the protein-coding regions of a genome is straightforward due to the universality of start and stop codons. However, the boundaries of the transcribed regions, conditional operon structures, non-coding RNAs and the dynamics of transcription, such as pausing of elongation, are non-trivial to identify, even in the comparatively simple genomes of prokaryotes. Traditional methods for the study of these areas, such as tiling arrays, are noisy, labour-intensive and lack the resolution required for densely-packed bacterial genomes. Recently, deep sequencing has become increasingly popular for the study of the transcriptome due to its lower costs, higher accuracy and single nucleotide resolution. These methods have revolutionised our understanding of prokaryotic transcriptional dynamics. Here, we review the deep sequencing and data analysis techniques that are available for the study of transcription in prokaryotes, and discuss the bioinformatic considerations of these analyses. Copyright © 2017 Elsevier Inc. All rights reserved.
UGT-29 protein expression and localization during bacterial infection in Caenorhabditis elegans
NASA Astrophysics Data System (ADS)
Wong, Rui-Rui; Lee, Song-Hua; Nathan, Sheila
2014-09-01
The nematode Caenorhabditis elegans is routinely used as an animal model to delineate complex molecular mechanisms involved in the host response to pathogen infection. Following up on an earlier study on host-pathogen interaction, we constructed a ugt-29::GFP transcriptional fusion transgenic worm strain to examine UGT-29 protein expression and localization upon bacterial infection. UGT-29 orthologs can be found in higher organisms including humans and is proposed as a member of the UDP-Glucoronosyl Transferase family of proteins which are involved in phase II detoxification of compounds detrimental to the host organism. Under uninfected conditions, UGT-29::GFP fusion protein was highly expressed in the C. elegans anterior pharynx and intestine, two major organs involved in detoxification. We further evaluated the localization of the enzyme in worms infected with the bacterial pathogen, Burkholderia pseudomallei. The infected ugt-29::GFP transgenic strain exhibited increased fluorescence in the pharynx and intestine with pronounced fluorescence also extending to body wall muscle. This transcriptional fusion GFP transgenic worm is a convenient and direct tool to provide information on UGT detoxification enzyme gene expression and could be a useful tool for a number of diverse applications.
Chaikeeratisak, Vorrapon; Somboonwiwat, Kunlaya; Tassanakajon, Anchalee
2012-01-01
Proteomic analysis of the hemocytic proteins of Penaeus monodon (Pm) has previously shown that alpha-2-macroglobulin (A2M) was among the proteins that showed substantially altered expression levels upon Vibrio harveyi infection. Therefore, in this study its potentially important role in the response of shrimp to bacterial infection was further characterized. The yeast two-hybrid system revealed that the receptor binding domain of PmA2M interacted with the carboxyl-terminus of one or both of the transglutaminase type II isoforms, which are key enzymes involved in the shrimp clotting system. In accord with this, PmA2M was found to be localized on the extracellular blood clots and to colocalize with clottable proteins. RNA interference (RNAi)-mediated knockdown of A2M transcript levels reduced the PmA2M transcript levels (∼94%) and significantly reduced the bacterial seizing ability of the clotting system, resulting in an up to 3.3-fold higher number of V. harveyi that systemically disseminated into the circulatory system at 5 min post-infection before subsequent clearance by the immune system. Furthermore, an appearance of PmA2M depleted clots in the presence of V. harveyi strikingly demonstrated fibrinolysis zones surrounding the bacteria. This study provides the first evidence of the vital role of PmA2M in enhancing bacterial sequestration by protecting blood clots against fibrinolysis.
RNA polymerase gate loop guides the nontemplate DNA strand in transcription complexes.
NandyMazumdar, Monali; Nedialkov, Yuri; Svetlov, Dmitri; Sevostyanova, Anastasia; Belogurov, Georgiy A; Artsimovitch, Irina
2016-12-27
Upon RNA polymerase (RNAP) binding to a promoter, the σ factor initiates DNA strand separation and captures the melted nontemplate DNA, whereas the core enzyme establishes interactions with the duplex DNA in front of the active site that stabilize initiation complexes and persist throughout elongation. Among many core RNAP elements that participate in these interactions, the β' clamp domain plays the most prominent role. In this work, we investigate the role of the β gate loop, a conserved and essential structural element that lies across the DNA channel from the clamp, in transcription regulation. The gate loop was proposed to control DNA loading during initiation and to interact with NusG-like proteins to lock RNAP in a closed, processive state during elongation. We show that the removal of the gate loop has large effects on promoter complexes, trapping an unstable intermediate in which the RNAP contacts with the nontemplate strand discriminator region and the downstream duplex DNA are not yet fully established. We find that although RNAP lacking the gate loop displays moderate defects in pausing, transcript cleavage, and termination, it is fully responsive to the transcription elongation factor NusG. Together with the structural data, our results support a model in which the gate loop, acting in concert with initiation or elongation factors, guides the nontemplate DNA in transcription complexes, thereby modulating their regulatory properties.
A Laboratory Assessment of Factors That Affect Bacterial Adhesion to Contact Lenses
Dutta, Debarun; Willcox, Mark DP
2013-01-01
Adhesion of pathogenic microbes, particularly bacteria, to contact lenses is implicated in contact lens related microbial adverse events. Various in vitro conditions such as type of bacteria, the size of initial inoculum, contact lens material, nutritional content of media, and incubation period can influence bacterial adhesion to contact lenses and the current study investigated the effect of these conditions on bacterial adhesion to contact lenses. There was no significant difference in numbers of bacteria that adhered to hydrogel etafilcon A or silicone hydrogel senofilcon A contact lenses. Pseudomonas aeruginosa adhered in higher numbers compared to Staphylococcus aureus. Within a genera/species, adhesion of different bacterial strains did not differ appreciably. The size of initial inoculum, nutritional content of media, and incubation period played significant roles in bacterial adhesion to lenses. A set of in vitro assay conditions to help standardize adhesion between studies have been recommended. PMID:24833224
Ke, N; Gao, X; Keeney, J B; Boeke, J D; Voytas, D F
1999-01-01
Retrotransposons and retroviruses replicate by reverse transcription of an mRNA intermediate. Most retroelements initiate reverse transcription from a host-encoded tRNA primer. DNA synthesis typically extends from the 3'-OH of the acceptor stem, which is complementary to sequences on the retroelement mRNA (the primer binding site, PBS). However, for some retrotransposons, including the yeast Ty5 elements, sequences in the anticodon stem-loop of the initiator methionine tRNA (IMT) are complementary to the PBS. We took advantage of the genetic tractability of the yeast system to investigate the mechanism of Ty5 priming. We found that transposition frequencies decreased at least 800-fold for mutations in the Ty5 PBS that disrupt complementarity with the IMT. Similarly, transposition was reduced at least 200-fold for IMT mutations in the anticodon stem-loop. Base pairing between the Ty5 PBS and IMT is essential for transposition, as compensatory changes that restored base pairing between the two mutant RNAs restored transposition significantly. An analysis of 12 imt mutants with base changes outside of the region of complementarity failed to identify other tRNA residues important for transposition. In addition, assays carried out with heterologous IMTs from Schizosaccharomyces pombe and Arabidopsis thaliana indicated that residues outside of the anticodon stem-loop have at most a fivefold effect on transposition. Our genetic system should make it possible to further define the components required for priming and to understand the mechanism by which Ty5's novel primer is generated. PMID:10411136
Geiss, G K; Radebaugh, C A; Paule, M R
1997-11-14
Acanthamoeba castellanii transcription initiation factor-IB (TIF-IB) is the TATA-binding protein-containing transcription factor that binds the rRNA promoter to form the committed complex. Minor groove-specific drugs inhibit TIF-IB binding, with higher concentrations needed to disrupt preformed complexes because of drug exclusion by bound TIF-IB. TIF-IB/DNA interactions were mapped by hydroxyl radical and uranyl nitrate footprinting. TIF-IB contacts four minor grooves in its binding site. TIF-IB and DNA wrap around each other in a right-handed superhelix of high pitch, so the upstream and downstream contacts are on opposite faces of the helix. Dimethyl sulfate protection assays revealed limited contact with a few guanines in the major groove. This detailed analysis suggests significant DNA conformation dependence of the interaction.
Ortmann, Alice C; Lu, YueHan
2015-01-15
Bioremediation of seawater by natural bacterial communities is one potential response to coastal oil spills, but the success of the approach may vary, depending on geographical location, oil composition and the timing of spill. The short term response of coastal bacteria to dispersant, oil and dispersed oil was characterized using 16S rRNA gene tags in two mesocosm experiments conducted two months apart. Despite differences in the amount of oil-derived alkanes across the treatments and experiments, increases in the contributions of hydrocarbon degrading taxa and decreases in common estuarine bacteria were observed in response to dispersant and/or oil. Between the two experiments, the direction and rates of changes in particulate alkane concentrations differed, as did the magnitude of the bacterial response to oil and/or dispersant. Together, our data underscore large variability in bacterial responses to hydrocarbon pollutants, implying that bioremediation success varies with starting biological and environmental conditions. Copyright © 2014 Elsevier Ltd. All rights reserved.
Active bacterial community structure along vertical redox gradients in Baltic Sea sediment
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jansson, Janet; Edlund, Anna; Hardeman, Fredrik
Community structures of active bacterial populations were investigated along a vertical redox profile in coastal Baltic Sea sediments by terminal-restriction fragment length polymorphism (T-RFLP) and clone library analysis. According to correspondence analysis of T-RFLP results and sequencing of cloned 16S rRNA genes, the microbial community structures at three redox depths (179 mV, -64 mV and -337 mV) differed significantly. The bacterial communities in the community DNA differed from those in bromodeoxyuridine (BrdU)-labeled DNA, indicating that the growing members of the community that incorporated BrdU were not necessarily the most dominant members. The structures of the actively growing bacterial communities weremore » most strongly correlated to organic carbon followed by total nitrogen and redox potentials. Bacterial identification by sequencing of 16S rRNA genes from clones of BrdU-labeled DNA and DNA from reverse transcription PCR (rt-PCR) showed that bacterial taxa involved in nitrogen and sulfur cycling were metabolically active along the redox profiles. Several sequences had low similarities to previously detected sequences indicating that novel lineages of bacteria are present in Baltic Sea sediments. Also, a high number of different 16S rRNA gene sequences representing different phyla were detected at all sampling depths.« less
Molecular signatures in Arabidopsis thaliana in response to insect attack and bacterial infection.
Barah, Pankaj; Winge, Per; Kusnierczyk, Anna; Tran, Diem Hong; Bones, Atle M
2013-01-01
Under the threat of global climatic change and food shortages, it is essential to take the initiative to obtain a comprehensive understanding of common and specific defence mechanisms existing in plant systems for protection against different types of biotic invaders. We have implemented an integrated approach to analyse the overall transcriptomic reprogramming and systems-level defence responses in the model plant species Arabidopsis thaliana (A. thaliana henceforth) during insect Brevicoryne brassicae (B. brassicae henceforth) and bacterial Pseudomonas syringae pv. tomato strain DC3000 (P. syringae henceforth) attacks. The main aim of this study was to identify the attacker-specific and general defence response signatures in A. thaliana when attacked by phloem-feeding aphids or pathogenic bacteria. The obtained annotated networks of differentially expressed transcripts indicated that members of transcription factor families, such as WRKY, MYB, ERF, BHLH and bZIP, could be crucial for stress-specific defence regulation in Arabidopsis during aphid and P. syringae attack. The defence response pathways, signalling pathways and metabolic processes associated with aphid attack and P. syringae infection partially overlapped. Components of several important biosynthesis and signalling pathways, such as salicylic acid (SA), jasmonic acid (JA), ethylene (ET) and glucosinolates, were differentially affected during the two the treatments. Several stress-regulated transcription factors were known to be associated with stress-inducible microRNAs. The differentially regulated gene sets included many signature transcription factors, and our co-expression analysis showed that they were also strongly co-expressed during 69 other biotic stress experiments. Defence responses and functional networks that were unique and specific to aphid or P. syringae stresses were identified. Furthermore, our analysis revealed a probable link between biotic stress and microRNAs in Arabidopsis and
Aseptic and Bacterial Meningitis: Evaluation, Treatment, and Prevention.
Mount, Hillary R; Boyle, Sean D
2017-09-01
The etiologies of meningitis range in severity from benign and self-limited to life-threatening with potentially severe morbidity. Bacterial meningitis is a medical emergency that requires prompt recognition and treatment. Mortality remains high despite the introduction of vaccinations for common pathogens that have reduced the incidence of meningitis worldwide. Aseptic meningitis is the most common form of meningitis with an annual incidence of 7.6 per 100,000 adults. Most cases of aseptic meningitis are viral and require supportive care. Viral meningitis is generally self-limited with a good prognosis. Examination maneuvers such as Kernig sign or Brudzinski sign may not be useful to differentiate bacterial from aseptic meningitis because of variable sensitivity and specificity. Because clinical findings are also unreliable, the diagnosis relies on the examination of cerebrospinal fluid obtained from lumbar puncture. Delayed initiation of antibiotics can worsen mortality. Treatment should be started promptly in cases where transfer, imaging, or lumbar puncture may slow a definitive diagnosis. Empiric antibiotics should be directed toward the most likely pathogens and should be adjusted by patient age and risk factors. Dexamethasone should be administered to children and adults with suspected bacterial meningitis before or at the time of initiation of antibiotics. Vaccination against the most common pathogens that cause bacterial meningitis is recommended. Chemoprophylaxis of close contacts is helpful in preventing additional infections.
Evidence for Transcript Networks Composed of Chimeric RNAs in Human Cells
Borel, Christelle; Mudge, Jonathan M.; Howald, Cédric; Foissac, Sylvain; Ucla, Catherine; Chrast, Jacqueline; Ribeca, Paolo; Martin, David; Murray, Ryan R.; Yang, Xinping; Ghamsari, Lila; Lin, Chenwei; Bell, Ian; Dumais, Erica; Drenkow, Jorg; Tress, Michael L.; Gelpí, Josep Lluís; Orozco, Modesto; Valencia, Alfonso; van Berkum, Nynke L.; Lajoie, Bryan R.; Vidal, Marc; Stamatoyannopoulos, John; Batut, Philippe; Dobin, Alex; Harrow, Jennifer; Hubbard, Tim; Dekker, Job; Frankish, Adam; Salehi-Ashtiani, Kourosh; Reymond, Alexandre; Antonarakis, Stylianos E.; Guigó, Roderic; Gingeras, Thomas R.
2012-01-01
The classic organization of a gene structure has followed the Jacob and Monod bacterial gene model proposed more than 50 years ago. Since then, empirical determinations of the complexity of the transcriptomes found in yeast to human has blurred the definition and physical boundaries of genes. Using multiple analysis approaches we have characterized individual gene boundaries mapping on human chromosomes 21 and 22. Analyses of the locations of the 5′ and 3′ transcriptional termini of 492 protein coding genes revealed that for 85% of these genes the boundaries extend beyond the current annotated termini, most often connecting with exons of transcripts from other well annotated genes. The biological and evolutionary importance of these chimeric transcripts is underscored by (1) the non-random interconnections of genes involved, (2) the greater phylogenetic depth of the genes involved in many chimeric interactions, (3) the coordination of the expression of connected genes and (4) the close in vivo and three dimensional proximity of the genomic regions being transcribed and contributing to parts of the chimeric RNAs. The non-random nature of the connection of the genes involved suggest that chimeric transcripts should not be studied in isolation, but together, as an RNA network. PMID:22238572
Prezioso, Stephanie M; Xue, Kevin; Leung, Nelly; Gray-Owen, Scott D; Christendat, Dinesh
2018-04-27
Listeria monocytogenes is a common foodborne bacterial pathogen that contaminates plant and animal consumable products. The persistent nature of L. monocytogenes is associated with millions of dollars in food recalls annually. Here, we describe the role of shikimate in directly modulating the expression of genes encoding enzymes for the conversion of quinate and shikimate metabolites to protocatechuate. In L. monocytogenes, these genes are found within two operons, named qui1 and qui2. In addition, a gene named quiR, encoding a LysR-Type Transcriptional Regulator (QuiR), is located immediately upstream of the qui1 operon. Transcriptional lacZ-promoter fusion experiments show that QuiR induces gene expression of both qui1 and qui2 operons in the presence of shikimate. Furthermore, co-crystallization of the QuiR effector binding domain in complex with shikimate provides insights into the mechanism of activation of this regulator. Together these data show that upon shikimate accumulation, QuiR activates the transcription of genes encoding enzymes involved in shikimate and quinate utilization for the production of protocatechuate. Furthermore, the accumulation of protocatechuate leads to the inhibition of Listeria growth. Since protocatechuate is not known to be utilized by Listeria, its role is distinct from those established in other bacteria. Copyright © 2018 Elsevier Ltd. All rights reserved.
Genome engineering and gene expression control for bacterial strain development.
Song, Chan Woo; Lee, Joungmin; Lee, Sang Yup
2015-01-01
In recent years, a number of techniques and tools have been developed for genome engineering and gene expression control to achieve desired phenotypes of various bacteria. Here we review and discuss the recent advances in bacterial genome manipulation and gene expression control techniques, and their actual uses with accompanying examples. Genome engineering has been commonly performed based on homologous recombination. During such genome manipulation, the counterselection systems employing SacB or nucleases have mainly been used for the efficient selection of desired engineered strains. The recombineering technology enables simple and more rapid manipulation of the bacterial genome. The group II intron-mediated genome engineering technology is another option for some bacteria that are difficult to be engineered by homologous recombination. Due to the increasing demands on high-throughput screening of bacterial strains having the desired phenotypes, several multiplex genome engineering techniques have recently been developed and validated in some bacteria. Another approach to achieve desired bacterial phenotypes is the repression of target gene expression without the modification of genome sequences. This can be performed by expressing antisense RNA, small regulatory RNA, or CRISPR RNA to repress target gene expression at the transcriptional or translational level. All of these techniques allow efficient and rapid development and screening of bacterial strains having desired phenotypes, and more advanced techniques are expected to be seen. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A Transcription and Translation Protocol for Sensitive Cross-Cultural Team Research.
Clark, Lauren; Birkhead, Ana Sanchez; Fernandez, Cecilia; Egger, Marlene J
2017-10-01
Assurance of transcript accuracy and quality in interview-based qualitative research is foundational for data accuracy and study validity. Based on our experience in a cross-cultural ethnographic study of women's pelvic organ prolapse, we provide practical guidance to set up step-by-step interview transcription and translation protocols for team-based research on sensitive topics. Beginning with team decisions about level of detail in transcription, completeness, and accuracy, we operationalize the process of securing vendors to deliver the required quality of transcription and translation. We also share rubrics for assessing transcript quality and the team protocol for managing transcripts (assuring consistency of format, insertion of metadata, anonymization, and file labeling conventions) and procuring an acceptable initial translation of Spanish-language interviews. Accurate, complete, and systematically constructed transcripts in both source and target languages respond to the call for more transparency and reproducibility of scientific methods.
NASA Astrophysics Data System (ADS)
Senavirathne, Gayan; Bertram, Jeffrey G.; Jaszczur, Malgorzata; Chaurasiya, Kathy R.; Pham, Phuong; Mak, Chi H.; Goodman, Myron F.; Rueda, David
2015-12-01
Activation-induced deoxycytidine deaminase (AID) generates antibody diversity in B cells by initiating somatic hypermutation (SHM) and class-switch recombination (CSR) during transcription of immunoglobulin variable (IgV) and switch region (IgS) DNA. Using single-molecule FRET, we show that AID binds to transcribed dsDNA and translocates unidirectionally in concert with RNA polymerase (RNAP) on moving transcription bubbles, while increasing the fraction of stalled bubbles. AID scans randomly when constrained in an 8 nt model bubble. When unconstrained on single-stranded (ss) DNA, AID moves in random bidirectional short slides/hops over the entire molecule while remaining bound for ~5 min. Our analysis distinguishes dynamic scanning from static ssDNA creasing. That AID alone can track along with RNAP during transcription and scan within stalled transcription bubbles suggests a mechanism by which AID can initiate SHM and CSR when properly regulated, yet when unregulated can access non-Ig genes and cause cancer.
Senavirathne, Gayan; Bertram, Jeffrey G.; Jaszczur, Malgorzata; Chaurasiya, Kathy R.; Pham, Phuong; Mak, Chi H.; Goodman, Myron F.; Rueda, David
2015-01-01
Activation-induced deoxycytidine deaminase (AID) generates antibody diversity in B cells by initiating somatic hypermutation (SHM) and class-switch recombination (CSR) during transcription of immunoglobulin variable (IgV) and switch region (IgS) DNA. Using single-molecule FRET, we show that AID binds to transcribed dsDNA and translocates unidirectionally in concert with RNA polymerase (RNAP) on moving transcription bubbles, while increasing the fraction of stalled bubbles. AID scans randomly when constrained in an 8 nt model bubble. When unconstrained on single-stranded (ss) DNA, AID moves in random bidirectional short slides/hops over the entire molecule while remaining bound for ∼5 min. Our analysis distinguishes dynamic scanning from static ssDNA creasing. That AID alone can track along with RNAP during transcription and scan within stalled transcription bubbles suggests a mechanism by which AID can initiate SHM and CSR when properly regulated, yet when unregulated can access non-Ig genes and cause cancer. PMID:26681117
GlpR is a direct transcriptional repressor of fructose metabolic genes in Haloferax volcanii.
Martin, Jonathan H; Rawls, Katie Sherwood; Chan, Jou Chin; Hwang, Sungmin; Martinez-Pastor, Mar; McMillan, Lana J; Prunetti, Laurence; Schmid, Amy K; Maupin-Furlow, Julie A
2018-06-18
DeoR-type helix-turn-helix (HTH) domain proteins are transcriptional regulators of sugar and nucleoside metabolism in diverse bacteria and occur in select archaea. In the model archaeon Haloferax volcanii , previous work implicated GlpR, a DeoR-type transcriptional regulator, in transcriptional repression of glpR and the gene encoding the fructose-specific phosphofructokinase ( pfkB ) during growth on glycerol. However, the global regulon governed by GlpR remained unclear. Here we compared transcriptomes of wild type and Δ glpR mutant strains grown on glycerol and glucose to detect significant transcript level differences for nearly 50 new genes regulated by GlpR. By coupling computational prediction of GlpR binding sequences with in vivo and in vitro DNA binding experiments, we determined that GlpR directly controls genes encoding enzymes in fructose degradation, including fructose bisphosphate aldolase, a central control point in glycolysis. GlpR also directly controls other transcription factors. In contrast, other metabolic pathways appear to be under indirect influence of GlpR. In vitro experiments demonstrated that GlpR purifies as a tetramer that binds the effector molecule fructose-1-phosphate (F1P). These results suggest that Hfx. volcanii GlpR functions as a direct negative regulator of fructose degradation during growth on carbon sources other than fructose, such as glucose and glycerol, and that GlpR bears striking functional similarity to bacterial DeoR-type regulators. IMPORTANCE Many archaea are extremophiles, able to thrive in habitats of extreme salinity, pH and temperature. These biological properties are ideal for applications in biotechnology. However, limited knowledge of archaeal metabolism is a bottleneck that prevents broad use of archaea as microbial factories for industrial products. Here we characterize how sugar uptake and use is regulated in a species that lives in high salinity. We demonstrate that a key sugar regulatory protein in
Lapierre, Pascal; Mir, Mushtaq; Chase, Michael R.; Pyle, Margaret M.; Gawande, Richa; Ahmad, Rushdy; Sarracino, David A.; Ioerger, Thomas R.; Fortune, Sarah M.; Derbyshire, Keith M.; Wade, Joseph T.; Gray, Todd A.
2015-01-01
RNA-seq technologies have provided significant insight into the transcription networks of mycobacteria. However, such studies provide no definitive information on the translational landscape. Here, we use a combination of high-throughput transcriptome and proteome-profiling approaches to more rigorously understand protein expression in two mycobacterial species. RNA-seq and ribosome profiling in Mycobacterium smegmatis, and transcription start site (TSS) mapping and N-terminal peptide mass spectrometry in Mycobacterium tuberculosis, provide complementary, empirical datasets to examine the congruence of transcription and translation in the Mycobacterium genus. We find that nearly one-quarter of mycobacterial transcripts are leaderless, lacking a 5’ untranslated region (UTR) and Shine-Dalgarno ribosome-binding site. Our data indicate that leaderless translation is a major feature of mycobacterial genomes and is comparably robust to leadered initiation. Using translational reporters to systematically probe the cis-sequence requirements of leaderless translation initiation in mycobacteria, we find that an ATG or GTG at the mRNA 5’ end is both necessary and sufficient. This criterion, together with our ribosome occupancy data, suggests that mycobacteria encode hundreds of small, unannotated proteins at the 5’ ends of transcripts. The conservation of small proteins in both mycobacterial species tested suggests that some play important roles in mycobacterial physiology. Our translational-reporter system further indicates that mycobacterial leadered translation initiation requires a Shine Dalgarno site in the 5’ UTR and that ATG, GTG, TTG, and ATT codons can robustly initiate translation. Our combined approaches provide the first comprehensive view of mycobacterial gene structures and their non-canonical mechanisms of protein expression. PMID:26536359
Shell, Scarlet S; Wang, Jing; Lapierre, Pascal; Mir, Mushtaq; Chase, Michael R; Pyle, Margaret M; Gawande, Richa; Ahmad, Rushdy; Sarracino, David A; Ioerger, Thomas R; Fortune, Sarah M; Derbyshire, Keith M; Wade, Joseph T; Gray, Todd A
2015-11-01
RNA-seq technologies have provided significant insight into the transcription networks of mycobacteria. However, such studies provide no definitive information on the translational landscape. Here, we use a combination of high-throughput transcriptome and proteome-profiling approaches to more rigorously understand protein expression in two mycobacterial species. RNA-seq and ribosome profiling in Mycobacterium smegmatis, and transcription start site (TSS) mapping and N-terminal peptide mass spectrometry in Mycobacterium tuberculosis, provide complementary, empirical datasets to examine the congruence of transcription and translation in the Mycobacterium genus. We find that nearly one-quarter of mycobacterial transcripts are leaderless, lacking a 5' untranslated region (UTR) and Shine-Dalgarno ribosome-binding site. Our data indicate that leaderless translation is a major feature of mycobacterial genomes and is comparably robust to leadered initiation. Using translational reporters to systematically probe the cis-sequence requirements of leaderless translation initiation in mycobacteria, we find that an ATG or GTG at the mRNA 5' end is both necessary and sufficient. This criterion, together with our ribosome occupancy data, suggests that mycobacteria encode hundreds of small, unannotated proteins at the 5' ends of transcripts. The conservation of small proteins in both mycobacterial species tested suggests that some play important roles in mycobacterial physiology. Our translational-reporter system further indicates that mycobacterial leadered translation initiation requires a Shine Dalgarno site in the 5' UTR and that ATG, GTG, TTG, and ATT codons can robustly initiate translation. Our combined approaches provide the first comprehensive view of mycobacterial gene structures and their non-canonical mechanisms of protein expression.
Archaeal RNA polymerase arrests transcription at DNA lesions.
Gehring, Alexandra M; Santangelo, Thomas J
2017-01-01
Transcription elongation is not uniform and transcription is often hindered by protein-bound factors or DNA lesions that limit translocation and impair catalysis. Despite the high degree of sequence and structural homology of the multi-subunit RNA polymerases (RNAP), substantial differences in response to DNA lesions have been reported. Archaea encode only a single RNAP with striking structural conservation with eukaryotic RNAP II (Pol II). Here, we demonstrate that the archaeal RNAP from Thermococcus kodakarensis is sensitive to a variety of DNA lesions that pause and arrest RNAP at or adjacent to the site of DNA damage. DNA damage only halts elongation when present in the template strand, and the damage often results in RNAP arresting such that the lesion would be encapsulated with the transcription elongation complex. The strand-specific halt to archaeal transcription elongation on modified templates is supportive of RNAP recognizing DNA damage and potentially initiating DNA repair through a process akin to the well-described transcription-coupled DNA repair (TCR) pathways in Bacteria and Eukarya.
Spatial organization shapes the turnover of a bacterial transcriptome
Moffitt, Jeffrey R; Pandey, Shristi; Boettiger, Alistair N; Wang, Siyuan; Zhuang, Xiaowei
2016-01-01
Spatial organization of the transcriptome has emerged as a powerful means for regulating the post-transcriptional fate of RNA in eukaryotes; however, whether prokaryotes use RNA spatial organization as a mechanism for post-transcriptional regulation remains unclear. Here we used super-resolution microscopy to image the E. coli transcriptome and observed a genome-wide spatial organization of RNA: mRNAs encoding inner-membrane proteins are enriched at the membrane, whereas mRNAs encoding outer-membrane, cytoplasmic and periplasmic proteins are distributed throughout the cytoplasm. Membrane enrichment is caused by co-translational insertion of signal peptides recognized by the signal-recognition particle. Time-resolved RNA-sequencing revealed that degradation rates of inner-membrane-protein mRNAs are on average greater that those of the other mRNAs and that this selective destabilization of inner-membrane-protein mRNAs is abolished by dissociating the RNA degradosome from the membrane. Together, these results demonstrate that the bacterial transcriptome is spatially organized and suggest that this organization shapes the post-transcriptional dynamics of mRNAs. DOI: http://dx.doi.org/10.7554/eLife.13065.001 PMID:27198188
Non-Equilibrium Thermodynamics of Transcriptional Bursts
NASA Astrophysics Data System (ADS)
Hernández-Lemus, Enrique
Gene transcription or Gene Expression (GE) is the process which transforms the information encoded in DNA into a functional RNA message. It is known that GE can occur in bursts or pulses. Transcription is irregular, with strong periods of activity, interspersed by long periods of inactivity. If we consider the average behavior over millions of cells, this process appears to be continuous. But at the individual cell level, there is considerable variability, and for most genes, very little activity at any one time. Some have claimed that GE bursting can account for the high variability in gene expression occurring between cells in isogenic populations. This variability has a big impact on cell behavior and thus on phenotypic conditions and disease. In view of these facts, the development of a thermodynamic framework to study gene expression and transcriptional regulation to integrate the vast amount of molecular biophysical GE data is appealing. Application of such thermodynamic formalism is useful to observe various dissipative phenomena in GE regulatory dynamics. In this chapter we will examine at some detail the complex phenomena of transcriptional bursts (specially of a certain class of anomalous bursts) in the context of a non-equilibrium thermodynamics formalism and will make some initial comments on the relevance of some irreversible processes that may be connected to anomalous transcriptional bursts.
Zhu, Zhigang; Noel, Samantha Joan; Difford, Gareth Frank; Al-Soud, Waleed Abu; Brejnrod, Asker; Sørensen, Søren Johannes; Lassen, Jan; Løvendahl, Peter; Højberg, Ole
2017-01-01
Dairy cows experience dramatic changes in host physiology from gestation to lactation period and dietary switch from high-forage prepartum diet to high-concentrate postpartum diet over the transition period (parturition +/- three weeks). Understanding the community structure and activity of the rumen microbiota and its associative patterns over the transition period may provide insight for e.g. improving animal health and production. In the present study, rumen samples from ten primiparous Holstein dairy cows were collected over seven weeks spanning the transition period. Total RNA was extracted from the rumen samples and cDNA thereof was subsequently used for characterizing the metabolically active bacterial (16S rRNA transcript amplicon sequencing) and archaeal (qPCR, T-RFLP and mcrA and 16S rRNA transcript amplicon sequencing) communities. The metabolically active bacterial community was dominated by three phyla, showing significant changes in relative abundance range over the transition period: Firmicutes (from prepartum 57% to postpartum 35%), Bacteroidetes (from prepartum 22% to postpartum 18%) and Proteobacteria (from prepartum 7% to postpartum 32%). For the archaea, qPCR analysis of 16S rRNA transcript number, revealed a significant prepartum to postpartum increase in Methanobacteriales, in accordance with an observed increase (from prepartum 80% to postpartum 89%) in relative abundance of 16S rRNA transcript amplicons allocated to this order. On the other hand, a significant prepartum to postpartum decrease (from 15% to 2%) was observed in relative abundance of Methanomassiliicoccales 16S rRNA transcripts. In contrast to qPCR analysis of the 16S rRNA transcripts, quantification of mcrA transcripts revealed no change in total abundance of metabolically active methanogens over the transition period. According to T-RFLP analysis of the mcrA transcripts, two Methanobacteriales genera, Methanobrevibacter and Methanosphaera (represented by the T-RFs 39 and 267
A critical role for topoisomerase IIb and DNA double strand breaks in transcription
Calderwood, Stuart K.
2016-01-01
ABSTRACT Recent studies have indicated a novel role for topoisomerase IIb in transcription. Transcription of heat shock genes, serum-induced immediate early genes and nuclear receptor-activated genes, each required DNA double strands generated by topoisomerase IIb. Such strand breaks seemed both necessary and sufficient for transcriptional activation. In addition, such transcription was associated with initiation of the DNA damage response pathways, including the activation of the enzymes: ataxia-telangiectasia mutated (ATM), DNA-dependent protein kinase and poly (ADP ribose) polymerase 1. DNA damage response signaling was involved both in transcription and in repair of DNA breaks generated by topoisomerase IIb. PMID:27100743
A critical role for topoisomerase IIb and DNA double strand breaks in transcription.
Calderwood, Stuart K
2016-05-26
Recent studies have indicated a novel role for topoisomerase IIb in transcription. Transcription of heat shock genes, serum-induced immediate early genes and nuclear receptor-activated genes, each required DNA double strands generated by topoisomerase IIb. Such strand breaks seemed both necessary and sufficient for transcriptional activation. In addition, such transcription was associated with initiation of the DNA damage response pathways, including the activation of the enzymes: ataxia-telangiectasia mutated (ATM), DNA-dependent protein kinase and poly (ADP ribose) polymerase 1. DNA damage response signaling was involved both in transcription and in repair of DNA breaks generated by topoisomerase IIb.
RNA search engines empower the bacterial intranet.
Dendooven, Tom; Luisi, Ben F
2017-08-15
RNA acts not only as an information bearer in the biogenesis of proteins from genes, but also as a regulator that participates in the control of gene expression. In bacteria, small RNA molecules (sRNAs) play controlling roles in numerous processes and help to orchestrate complex regulatory networks. Such processes include cell growth and development, response to stress and metabolic change, transcription termination, cell-to-cell communication, and the launching of programmes for host invasion. All these processes require recognition of target messenger RNAs by the sRNAs. This review summarizes recent results that have provided insights into how bacterial sRNAs are recruited into effector ribonucleoprotein complexes that can seek out and act upon target transcripts. The results hint at how sRNAs and their protein partners act as pattern-matching search engines that efficaciously regulate gene expression, by performing with specificity and speed while avoiding off-target effects. The requirements for efficient searches of RNA patterns appear to be common to all domains of life. © 2017 The Author(s).
RNA search engines empower the bacterial intranet
Dendooven, Tom
2017-01-01
RNA acts not only as an information bearer in the biogenesis of proteins from genes, but also as a regulator that participates in the control of gene expression. In bacteria, small RNA molecules (sRNAs) play controlling roles in numerous processes and help to orchestrate complex regulatory networks. Such processes include cell growth and development, response to stress and metabolic change, transcription termination, cell-to-cell communication, and the launching of programmes for host invasion. All these processes require recognition of target messenger RNAs by the sRNAs. This review summarizes recent results that have provided insights into how bacterial sRNAs are recruited into effector ribonucleoprotein complexes that can seek out and act upon target transcripts. The results hint at how sRNAs and their protein partners act as pattern-matching search engines that efficaciously regulate gene expression, by performing with specificity and speed while avoiding off-target effects. The requirements for efficient searches of RNA patterns appear to be common to all domains of life. PMID:28710287
Prevalence of transcription promoters within archaeal operons and coding sequences
Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S
2009-01-01
Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of ∼64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein–DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3′ ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes—events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements. PMID:19536208
Prevalence of transcription promoters within archaeal operons and coding sequences.
Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S
2009-01-01
Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rodionov, Dmitry A.; Dubchak, Inna L.; Arkin, Adam P.
2005-09-01
Bacterial response to nitric oxide (NO) is of major importance since NO is an obligatory intermediate of the nitrogen cycle. Transcriptional regulation of the dissimilatory nitric oxides metabolism in bacteria is diverse and involves FNR-like transcription factors HcpR, DNR and NnrR, two-component systems NarXL and NarQP, NO-responsive activator NorR, and nitrite sensitive repressor NsrR. Using comparative genomics approaches we predict DNA-binding signals for these transcriptional factors and describe corresponding regulons in available bacterial genomes. Within the FNR family of regulators, we observed a correlation of two specificity-determining amino acids and contacting bases in corresponding DNA signal. Highly conserved regulon HcpRmore » for the hybrid cluster protein and some other redox enzymes is present in diverse anaerobic bacteria including Clostridia, Thermotogales and delta-proteobacteria. NnrR and DNR control denitrification in alpha- and beta-proteobacteria, respectively. Sigma-54-dependent NorR regulon found in some gamma- and beta-proteobacteria contains various enzymes involved in the NO detoxification. Repressor NsrR, which was previously known to control only nitrite reductase operon in Nitrosomonas spp., appears to be the master regulator of the nitric oxides metabolism not only in most gamma- and beta-proteobacteria (including well-studied species like Escherichia coli), but also in Gram-positive Bacillus and Streptomyces species. Positional analysis and comparison of regulatory regions of NO detoxification genes allows us to propose the candidate NsrR-binding signal. The most conserved member of the predicted NsrR regulon is the NO-detoxifying flavohemoglobin Hmp. In enterobacteria, the regulon includes also two nitrite-responsive loci, nipAB (hcp-hcr) and nipC(dnrN), thus confirming the identity of the effector, i.e., nitrite. The proposed NsrR regulons in Neisseria and some other species are extended to include denitrification genes. As
McDowell, Ian C; Nikapitiya, Chamilani; Aguiar, Derek; Lane, Christopher E; Istrail, Sorin; Gomez-Chiarri, Marta
2014-01-01
The American oyster Crassostrea virginica, an ecologically and economically important estuarine organism, can suffer high mortalities in areas in the Northeast United States due to Roseovarius Oyster Disease (ROD), caused by the gram-negative bacterial pathogen Roseovarius crassostreae. The goals of this research were to provide insights into: 1) the responses of American oysters to R. crassostreae, and 2) potential mechanisms of resistance or susceptibility to ROD. The responses of oysters to bacterial challenge were characterized by exposing oysters from ROD-resistant and susceptible families to R. crassostreae, followed by high-throughput sequencing of cDNA samples from various timepoints after disease challenge. Sequence data was assembled into a reference transcriptome and analyzed through differential gene expression and functional enrichment to uncover genes and processes potentially involved in responses to ROD in the American oyster. While susceptible oysters experienced constant levels of mortality when challenged with R. crassostreae, resistant oysters showed levels of mortality similar to non-challenged oysters. Oysters exposed to R. crassostreae showed differential expression of transcripts involved in immune recognition, signaling, protease inhibition, detoxification, and apoptosis. Transcripts involved in metabolism were enriched in susceptible oysters, suggesting that bacterial infection places a large metabolic demand on these oysters. Transcripts differentially expressed in resistant oysters in response to infection included the immune modulators IL-17 and arginase, as well as several genes involved in extracellular matrix remodeling. The identification of potential genes and processes responsible for defense against R. crassostreae in the American oyster provides insights into potential mechanisms of disease resistance.
McDowell, Ian C.; Nikapitiya, Chamilani; Aguiar, Derek; Lane, Christopher E.; Istrail, Sorin; Gomez-Chiarri, Marta
2014-01-01
The American oyster Crassostrea virginica, an ecologically and economically important estuarine organism, can suffer high mortalities in areas in the Northeast United States due to Roseovarius Oyster Disease (ROD), caused by the gram-negative bacterial pathogen Roseovarius crassostreae. The goals of this research were to provide insights into: 1) the responses of American oysters to R. crassostreae, and 2) potential mechanisms of resistance or susceptibility to ROD. The responses of oysters to bacterial challenge were characterized by exposing oysters from ROD-resistant and susceptible families to R. crassostreae, followed by high-throughput sequencing of cDNA samples from various timepoints after disease challenge. Sequence data was assembled into a reference transcriptome and analyzed through differential gene expression and functional enrichment to uncover genes and processes potentially involved in responses to ROD in the American oyster. While susceptible oysters experienced constant levels of mortality when challenged with R. crassostreae, resistant oysters showed levels of mortality similar to non-challenged oysters. Oysters exposed to R. crassostreae showed differential expression of transcripts involved in immune recognition, signaling, protease inhibition, detoxification, and apoptosis. Transcripts involved in metabolism were enriched in susceptible oysters, suggesting that bacterial infection places a large metabolic demand on these oysters. Transcripts differentially expressed in resistant oysters in response to infection included the immune modulators IL-17 and arginase, as well as several genes involved in extracellular matrix remodeling. The identification of potential genes and processes responsible for defense against R. crassostreae in the American oyster provides insights into potential mechanisms of disease resistance. PMID:25122115
Bacterial community changes in response to oil contamination and perennial crop cultivation.
Yan, Lijuan; Penttinen, Petri; Mikkonen, Anu; Lindström, Kristina
2018-05-01
We investigated bacterial community dynamics in response to used motor oil contamination and perennial crop cultivation by 16S rRNA gene amplicon sequencing in a 4-year field study. Actinobacteria, Proteobacteria, Chloroflexi, Acidobacteria, and Gemmatimonadetes were the major bacterial phyla, and Rhodococcus was the most abundant genus. Initially, oil contamination decreased the overall bacterial diversity. Actinobacteria, Betaproteobacteria, and Gammaproteobacteria were sensitive to oil contamination, exhibiting clear succession with time. However, bacterial communities changed over time, regardless of oil contamination and crop cultivation. The abundance difference of most OTUs between oil-contaminated and non-contaminated plots remained the same in later sampling years after the initial abundance difference induced by oil spike. The abundances of three oil-favored actinobacteria (Lysinimonas, Microbacteriaceae, and Marmoricola) and one betaproteobacterium (Aquabacterium) changed in different manner over time in oil-contaminated and non-contaminated soil. We propose that these taxa are potential bio-indicators for monitoring recovery from motor oil contamination in boreal soil. The effect of crop cultivation on bacterial communities became significant only after the crops achieved stable growth, likely associated with plant material decomposition by Bacteroidetes, Armatimonadetes and Fibrobacteres.
Gu, Tao; Zhou, Chaoyang; Sørensen, Sebastian R.; Zhang, Ji; He, Jian; Yu, Peiwen; Li, Shunpeng
2013-01-01
The environmental fate of phenylurea herbicides has received considerable attention in recent decades. The microbial metabolism of N,N-dimethyl-substituted phenylurea herbicides can generally be initiated by mono-N-demethylation. In this study, the molecular basis for this process was revealed. The pdmAB genes in Sphingobium sp. strain YBL2 were shown to be responsible for the initial mono-N-demethylation of commonly used N,N-dimethyl-substituted phenylurea herbicides. PdmAB is the oxygenase component of a bacterial Rieske non-heme iron oxygenase (RO) system. The genes pdmAB, encoding the α subunit PdmA and the β subunit PdmB, are organized in a transposable element flanked by two direct repeats of an insertion element resembling ISRh1. Furthermore, this transposable element is highly conserved among phenylurea herbicide-degrading sphingomonads originating from different areas of the world. However, there was no evidence of a gene for an electron carrier (a ferredoxin or a reductase) located in the immediate vicinity of pdmAB. Without its cognate electron transport components, expression of PdmAB in Escherichia coli, Pseudomonas putida, and other sphingomonads resulted in a functional enzyme. Moreover, coexpression of a putative [3Fe-4S]-type ferredoxin from Sphingomonas sp. strain RW1 greatly enhanced the catalytic activity of PdmAB in E. coli. These data suggested that PdmAB has a low specificity for electron transport components and that its optimal ferredoxin may be the [3Fe-4S] type. PdmA exhibited low homology to the α subunits of previously characterized ROs (less than 37% identity) and did not cluster with the RO group involved in O- or N-demethylation reactions, indicating that PdmAB is a distinct bacterial RO N-demethylase. PMID:24123738
Temperate bacterial viruses as double-edged swords in bacterial warfare.
Gama, João Alves; Reis, Ana Maria; Domingues, Iolanda; Mendes-Soares, Helena; Matos, Ana Margarida; Dionisio, Francisco
2013-01-01
It has been argued that bacterial cells may use their temperate viruses as biological weapons. For instance, a few bacterial cells among a population of lysogenic cells could release the virus and kill susceptible non-lysogenic competitors, while their clone mates would be immune. Because viruses replicate inside their victims upon infection, this process would amplify their number in the arena. Sometimes, however, temperate viruses spare recipient cells from death by establishing themselves in a dormant state inside cells. This phenomenon is called lysogenization and, for some viruses such as the λ virus, the probability of lysogenization increases with the multiplicity of infection. Therefore, the amplification of viruses leads to conflicting predictions about the efficacy of temperate viruses as biological weapons: amplification can increase the relative advantage of clone mates of lysogens but also the likelihood of saving susceptible cells from death, because the probability of lysogenization is higher. To test the usefulness of viruses as biological weapons, we performed competition experiments between lysogenic Escherichia coli cells carrying the λ virus and susceptible λ-free E. coli cells, either in a structured or unstructured habitat. In structured and sometimes in unstructured habitats, the λ virus qualitatively behaved as a "replicating toxin". However, such toxic effect of λ viruses ceased after a few days of competition. This was due to the fact that many of initially susceptible cells became lysogenic. Massive lysogenization of susceptible cells occurred precisely under the conditions where the amplification of the virus was substantial. From then on, these cells and their descendants became immune to the λ virus. In conclusion, if at short term bacterial cells may use temperate viruses as biological weapons, after a few days only the classical view of temperate bacterial viruses as parasitic agents prevails.
Temperate Bacterial Viruses as Double-Edged Swords in Bacterial Warfare
Gama, João Alves; Reis, Ana Maria; Domingues, Iolanda; Mendes-Soares, Helena; Matos, Ana Margarida; Dionisio, Francisco
2013-01-01
It has been argued that bacterial cells may use their temperate viruses as biological weapons. For instance, a few bacterial cells among a population of lysogenic cells could release the virus and kill susceptible non-lysogenic competitors, while their clone mates would be immune. Because viruses replicate inside their victims upon infection, this process would amplify their number in the arena. Sometimes, however, temperate viruses spare recipient cells from death by establishing themselves in a dormant state inside cells. This phenomenon is called lysogenization and, for some viruses such as the λ virus, the probability of lysogenization increases with the multiplicity of infection. Therefore, the amplification of viruses leads to conflicting predictions about the efficacy of temperate viruses as biological weapons: amplification can increase the relative advantage of clone mates of lysogens but also the likelihood of saving susceptible cells from death, because the probability of lysogenization is higher. To test the usefulness of viruses as biological weapons, we performed competition experiments between lysogenic Escherichia coli cells carrying the λ virus and susceptible λ-free E. coli cells, either in a structured or unstructured habitat. In structured and sometimes in unstructured habitats, the λ virus qualitatively behaved as a “replicating toxin”. However, such toxic effect of λ viruses ceased after a few days of competition. This was due to the fact that many of initially susceptible cells became lysogenic. Massive lysogenization of susceptible cells occurred precisely under the conditions where the amplification of the virus was substantial. From then on, these cells and their descendants became immune to the λ virus. In conclusion, if at short term bacterial cells may use temperate viruses as biological weapons, after a few days only the classical view of temperate bacterial viruses as parasitic agents prevails. PMID:23536852
Divergent transcription is associated with promoters of transcriptional regulators
2013-01-01
Background Divergent transcription is a wide-spread phenomenon in mammals. For instance, short bidirectional transcripts are a hallmark of active promoters, while longer transcripts can be detected antisense from active genes in conditions where the RNA degradation machinery is inhibited. Moreover, many described long non-coding RNAs (lncRNAs) are transcribed antisense from coding gene promoters. However, the general significance of divergent lncRNA/mRNA gene pair transcription is still poorly understood. Here, we used strand-specific RNA-seq with high sequencing depth to thoroughly identify antisense transcripts from coding gene promoters in primary mouse tissues. Results We found that a substantial fraction of coding-gene promoters sustain divergent transcription of long non-coding RNA (lncRNA)/mRNA gene pairs. Strikingly, upstream antisense transcription is significantly associated with genes related to transcriptional regulation and development. Their promoters share several characteristics with those of transcriptional developmental genes, including very large CpG islands, high degree of conservation and epigenetic regulation in ES cells. In-depth analysis revealed a unique GC skew profile at these promoter regions, while the associated coding genes were found to have large first exons, two genomic features that might enforce bidirectional transcription. Finally, genes associated with antisense transcription harbor specific H3K79me2 epigenetic marking and RNA polymerase II enrichment profiles linked to an intensified rate of early transcriptional elongation. Conclusions We concluded that promoters of a class of transcription regulators are characterized by a specialized transcriptional control mechanism, which is directly coupled to relaxed bidirectional transcription. PMID:24365181
Clermont, Lina; Macha, Arthur; Müller, Laura M.; Derya, Sami M.; von Zaluskowski, Philipp; Eck, Alexander; Eikmanns, Bernhard J.
2015-01-01
ABSTRACT α-Glucan phosphorylases contribute to degradation of glycogen and maltodextrins formed in the course of maltose metabolism in bacteria. Accordingly, bacterial α-glucan phosphorylases are classified as either glycogen or maltodextrin phosphorylase, GlgP or MalP, respectively. GlgP and MalP enzymes follow the same catalytic mechanism, and thus their substrate spectra overlap; however, they differ in their regulation: GlgP genes are constitutively expressed and the enzymes are controlled on the activity level, whereas expression of MalP genes are transcriptionally controlled in response to the carbon source used for cultivation. We characterize here the modes of control of the α-glucan phosphorylase MalP of the Gram-positive Corynebacterium glutamicum. In accordance to the proposed function of the malP gene product as MalP, we found transcription of malP to be regulated in response to the carbon source. Moreover, malP transcription is shown to depend on the growth phase and to occur independently of the cell glycogen content. Surprisingly, we also found MalP activity to be tightly regulated competitively by the presence of ADP-glucose, an intermediate of glycogen synthesis. Since the latter is considered a typical feature of GlgPs, we propose that C. glutamicum MalP acts as both maltodextrin and glycogen phosphorylase and, based on these findings, we question the current system for classification of bacterial α-glucan phosphorylases. IMPORTANCE Bacterial α-glucan phosphorylases have been classified conferring to their purpose as either glycogen or maltodextrin phosphorylases. We found transcription of malP in C. glutamicum to be regulated in response to the carbon source, which is recognized as typical for maltodextrin phosphorylases. Surprisingly, we also found MalP activity to be tightly regulated competitively by the presence of ADP-glucose, an intermediate of glycogen synthesis. The latter is considered a typical feature of GlgPs. These findings
The Mediator complex and transcription regulation
Poss, Zachary C.; Ebmeier, Christopher C.
2013-01-01
The Mediator complex is a multi-subunit assembly that appears to be required for regulating expression of most RNA polymerase II (pol II) transcripts, which include protein-coding and most non-coding RNA genes. Mediator and pol II function within the pre-initiation complex (PIC), which consists of Mediator, pol II, TFIIA, TFIIB, TFIID, TFIIE, TFIIF and TFIIH and is approximately 4.0 MDa in size. Mediator serves as a central scaffold within the PIC and helps regulate pol II activity in ways that remain poorly understood. Mediator is also generally targeted by sequence-specific, DNA-binding transcription factors (TFs) that work to control gene expression programs in response to developmental or environmental cues. At a basic level, Mediator functions by relaying signals from TFs directly to the pol II enzyme, thereby facilitating TF-dependent regulation of gene expression. Thus, Mediator is essential for converting biological inputs (communicated by TFs) to physiological responses (via changes in gene expression). In this review, we summarize an expansive body of research on the Mediator complex, with an emphasis on yeast and mammalian complexes. We focus on the basics that underlie Mediator function, such as its structure and subunit composition, and describe its broad regulatory influence on gene expression, ranging from chromatin architecture to transcription initiation and elongation, to mRNA processing. We also describe factors that influence Mediator structure and activity, including TFs, non-coding RNAs and the CDK8 module. PMID:24088064
Inactivation of Transcriptional Regulators during Within-Household Evolution of Escherichia coli.
Kisiela, Dagmara I; Radey, Matthew; Paul, Sandip; Porter, Stephen; Polukhina, Kseniya; Tchesnokova, Veronika; Shevchenko, Sofiya; Chan, Diana; Aziz, Maliha; Johnson, Timothy J; Price, Lance B; Johnson, James R; Sokurenko, Evgeni V
2017-07-01
We analyzed the within-household evolution of two household-associated Escherichia coli strains from pandemic clonal group ST131- H 30, using isolates recovered from five individuals within two families, each of which had a distinct strain. Family 1's strain was represented by a urine isolate from the index patient (older sister) with recurrent cystitis and a blood isolate from her younger sister with fatal urosepsis. Family 2's strain was represented by a urine isolate from the index patient (father) with pyelonephritis and renal abscesses, blood and kidney drainage isolates from the daughter with emphysematous pyelonephritis, and urine and fecal isolates from the mother with cystitis. Collectively, the several variants of each family's strain had accumulated a total of 8 (family 1) and 39 (family 2) point mutations; no two isolates were identical. Of the 47 total mutations, 36 resulted in amino acid changes or truncation of coded proteins. Fourteen such mutations (39%) targeted genes encoding transcriptional regulators, and 9 (25%) involved DNA-binding transcription factors (TFs), which significantly exceeded the relative contribution of TF genes to the isolates' genomes (∼6%). At least one-half of the transcriptional regulator mutations were inactivating, based on phenotypic and/or transcriptional analysis. In particular, inactivating mutations in the global regulator LrhA (repressor of type 1 fimbriae and flagella) occurred in the blood isolates from both households and increased the virulence of E. coli strains in a murine sepsis model. The results indicate that E. coli undergoes adaptive evolution between and/or within hosts, generating subpopulations with distinctive phenotypes and virulence potential. IMPORTANCE The clonal evolution of bacterial strains associated with interhost transmission is poorly understood. We characterized the genome sequences of clonal descendants of two Escherichia coli strains, recovered at different time points from multiple
Schneider, T D
2001-12-01
The sequence logo for DNA binding sites of the bacteriophage P1 replication protein RepA shows unusually high sequence conservation ( approximately 2 bits) at a minor groove that faces RepA. However, B-form DNA can support only 1 bit of sequence conservation via contacts into the minor groove. The high conservation in RepA sites therefore implies a distorted DNA helix with direct or indirect contacts to the protein. Here I show that a high minor groove conservation signature also appears in sequence logos of sites for other replication origin binding proteins (Rts1, DnaA, P4 alpha, EBNA1, ORC) and promoter binding proteins (sigma(70), sigma(D) factors). This finding implies that DNA binding proteins generally use non-B-form DNA distortion such as base flipping to initiate replication and transcription.
Characterization of Herpes Simplex Virus 2 Primary MicroRNA Transcript Regulation
Bosch-Marce, Marta; Patel, Amita; Margolis, Todd P.
2015-01-01
ABSTRACT In order to understand factors that may influence latency-associated transcription and latency-associated transcript (LAT) phenotypes, we studied the expression of the herpes simplex virus 2 (HSV-2) LAT-associated microRNAs (miRNAs). We mapped the transcription initiation sites of all three primary miRNA transcripts and identified the ICP4-binding sequences at the transcription initiation sites of both HSV-2 LAT (pri-miRNA for miR-I and miR-II, which target ICP34.5, and miR-III, which targets ICP0) and L/ST (a pri-miRNA for miR-I and miR-II) but not at that of the primary miR-H6 (for which the target is unknown). We confirmed activity of the putative HSV-2 L/ST promoter and found that ICP4 trans-activates the L/ST promoter when the ICP4-binding site at its transcription initiation site is mutated, suggesting that ICP4 may play a dual role in regulating transcription of L/ST and, consequently, of miR-I and miR-II. LAT exon 1 (containing LAT enhancer sequences), together with the LAT promoter region, comprises a bidirectional promoter required for the expression of both LAT-encoded miRNAs and miR-H6 in latently infected mouse ganglia. The ability of ICP4 to suppress ICP34.5-targeting miRNAs and to activate lytic viral genes suggests that ICP4 could play a key role in the switch between latency and reactivation. IMPORTANCE The HSV-2 LAT and viral miRNAs expressed in the LAT region are the most abundant viral transcripts during HSV latency. The balance between the expression of LAT and LAT-associated miRNAs and the expression of lytic viral transcripts from the opposite strand appears to influence whether individual HSV-infected neurons will be latently or productively infected. The outcome of neuronal infection may thus depend on regulation of gene expression of the corresponding primary miRNAs. In the present study, we characterize promoter sequences responsible for miRNA expression, including identification of the primary miRNA 5′ ends and evaluation of
Hwang, Shin-Rong; Garza, Christina Z; Wegrzyn, Jill; Hook, Vivian Y H
2004-08-16
This study demonstrates utilization of the novel GTG initiation codon for translation of a human mRNA transcript that encodes the serpin endopin 2B, a protease inhibitor. Molecular cloning revealed the nucleotide sequence of the human endopin 2B cDNA. Its deduced primary sequence shows high homology to bovine endopin 2A that possesses cross-class protease inhibition of elastase and papain. Notably, the human endopin 2B cDNA sequence revealed GTG as the predicted translation initiation codon; the predicted translation product of 46 kDa endopin 2B was produced by in vitro translation of 35S-endopin 2B with mammalian (rabbit) protein translation components. Importantly, bioinformatic studies demonstrated the presence of the entire human endopin 2B cDNA sequence with GTG as initiation codon within the human genome on chromosome 14. Further evidence for GTG as a functional initiation codon was illustrated by GTG-mediated in vitro translation of the heterologous protein EGFP, and by GTG-mediated expression of EGFP in mammalian PC12 cells. Mutagenesis of GTG to GTC resulted in the absence of EGFP expression in PC12 cells, indicating the function of GTG as an initiation codon. In addition, it was apparent that the GTG initiation codon produces lower levels of translated protein compared to ATG as initiation codon. Significantly, GTG-mediated translation of endopin 2B demonstrates a functional human gene product not previously predicted from initial analyses of the human genome. Further analyses based on GTG as an alternative initiation codon may predict new candidate genes of the human genome.
Shrimp Alpha-2-Macroglobulin Prevents the Bacterial Escape by Inhibiting Fibrinolysis of Blood Clots
Chaikeeratisak, Vorrapon; Somboonwiwat, Kunlaya; Tassanakajon, Anchalee
2012-01-01
Proteomic analysis of the hemocytic proteins of Penaeus monodon (Pm) has previously shown that alpha-2-macroglobulin (A2M) was among the proteins that showed substantially altered expression levels upon Vibrio harveyi infection. Therefore, in this study its potentially important role in the response of shrimp to bacterial infection was further characterized. The yeast two-hybrid system revealed that the receptor binding domain of PmA2M interacted with the carboxyl-terminus of one or both of the transglutaminase type II isoforms, which are key enzymes involved in the shrimp clotting system. In accord with this, PmA2M was found to be localized on the extracellular blood clots and to colocalize with clottable proteins. RNA interference (RNAi)-mediated knockdown of A2M transcript levels reduced the PmA2M transcript levels (∼94%) and significantly reduced the bacterial seizing ability of the clotting system, resulting in an up to 3.3-fold higher number of V. harveyi that systemically disseminated into the circulatory system at 5 min post-infection before subsequent clearance by the immune system. Furthermore, an appearance of PmA2M depleted clots in the presence of V. harveyi strikingly demonstrated fibrinolysis zones surrounding the bacteria. This study provides the first evidence of the vital role of PmA2M in enhancing bacterial sequestration by protecting blood clots against fibrinolysis. PMID:23082160
Sahu, Geetaram; Farley, Kalamo; El-Hage, Nazira; Aiamkitsumrit, Benjamas; Fassnacht, Ryan; Kashanchi, Fatah; Ochem, Alex; Simon, Gary L; Karn, Jonathan; Hauser, Kurt F; Tyagi, Mudit
2015-09-01
Cocaine accelerates human immunodeficiency virus (HIV-1) replication by altering specific cell-signaling and epigenetic pathways. We have elucidated the underlying molecular mechanisms through which cocaine exerts its effect in myeloid cells, a major target of HIV-1 in central nervous system (CNS). We demonstrate that cocaine treatment promotes HIV-1 gene expression by activating both nuclear factor-kappa B (NF-ĸB) and mitogen- and stress-activated kinase 1 (MSK1). MSK1 subsequently catalyzes the phosphorylation of histone H3 at serine 10, and p65 subunit of NF-ĸB at 276th serine residue. These modifications enhance the interaction of NF-ĸB with P300 and promote the recruitment of the positive transcription elongation factor b (P-TEFb) to the HIV-1 LTR, supporting the development of an open/relaxed chromatin configuration, and facilitating the initiation and elongation phases of HIV-1 transcription. Results are also confirmed in primary monocyte derived macrophages (MDM). Overall, our study provides detailed insights into cocaine-driven HIV-1 transcription and replication. Copyright © 2015 Elsevier Inc. All rights reserved.
Sahu, Geetaram; Farley, Kalamo; El-Hage, Nazira; Aiamkitsumrit, Benjamas; Fassnacht, Ryan; Kashanchi, Fatah; Ochem, Alex; Simon, Gary L.; Karn, Jonathan; Hauser, Kurt F.; Tyagi, Mudit
2015-01-01
Cocaine accelerates human immunodeficiency virus (HIV-1) replication by altering specific cell-signaling and epigenetic pathways. We have elucidated the underlying molecular mechanisms through which cocaine exerts its effect in myeloid cells, a major target of HIV-1 in central nervous system (CNS). We demonstrate that cocaine treatment promotes HIV-1 gene expression by activating both nuclear factor-kappa B (NF-κB) and mitogen- and stress-activated kinase 1 (MSK1). MSK1 subsequently catalyzes the phosphorylation of histone H3 at serine 10, and p65 subunit of NF-κB at 276th serine residue. These modifications enhance the interaction of NF-κB with P300 and promote the recruitment of the positive transcription elongation factor b (P-TEFb) to the HIV-1 LTR, supporting the development of an open/relaxed chromatin configuration, and facilitating the initiation and elongation phases of HIV-1 transcription. Results are also confirmed in primary monocyte derived macrophages (MDM). Overall, our study provides detailed insights into cocaine-driven HIV-1 transcription and replication. PMID:25980739
7SK-BAF axis controls pervasive transcription at enhancers
Flynn, Ryan A.; Do, Brian T.; Rubin, Adam J.; Calo, Eliezer; Lee, Byron; Kuchelmeister, Hannes; Rale, Michael; Chu, Ci; Kool, Eric T.; Wysocka, Joanna; Khavari, Paul A.
2016-01-01
RNA functions at enhancers remain mysterious. Here we show that the 7SK small nuclear RNA (snRNA) inhibits enhancer transcription by modulating nucleosome position. 7SK occupies enhancers and super enhancers genome-wide in mouse and human cells, and 7SK is required to limit eRNA initiation and synthesis in a manner distinct from promoter pausing. Clustered elements at super enhancers uniquely require 7SK to prevent convergent transcription and DNA damage signaling. 7SK physically interacts with the BAF chromatin remodeling complex, recruit BAF to enhancers, and inhibits enhancer transcription by modulating chromatin structure. In turn, 7SK occupancy at enhancers coincides with Brd4 and is exquisitely sensitive to the bromodomain inhibitor JQ1. Thus, 7SK employs distinct mechanisms to counteract diverse consequences of pervasive transcription that distinguish super enhancers, enhancers, and promoters. PMID:26878240
Tran, Huy; Ferraro, Teresa; Lucas, Tanguy; Guillou, Aurelien; Coppey, Mathieu; Dostatni, Nathalie
2016-01-01
The simultaneous expression of the hunchback gene in the numerous nuclei of the developing fly embryo gives us a unique opportunity to study how transcription is regulated in living organisms. A recently developed MS2-MCP technique for imaging nascent messenger RNA in living Drosophila embryos allows us to quantify the dynamics of the developmental transcription process. The initial measurement of the morphogens by the hunchback promoter takes place during very short cell cycles, not only giving each nucleus little time for a precise readout, but also resulting in short time traces of transcription. Additionally, the relationship between the measured signal and the promoter state depends on the molecular design of the reporting probe. We develop an analysis approach based on tailor made autocorrelation functions that overcomes the short trace problems and quantifies the dynamics of transcription initiation. Based on live imaging data, we identify signatures of bursty transcription initiation from the hunchback promoter. We show that the precision of the expression of the hunchback gene to measure its position along the anterior-posterior axis is low both at the boundary and in the anterior even at cycle 13, suggesting additional post-transcriptional averaging mechanisms to provide the precision observed in fixed embryos. PMID:27942043
Palladium-bacterial cellulose membranes for fuel cells.
Evans, Barbara R; O'Neill, Hugh M; Malyvanh, Valerie P; Lee, Ida; Woodward, Jonathan
2003-07-01
Bacterial cellulose is a versatile renewable biomaterial that can be used as a hydrophilic matrix for the incorporation of metals into thin, flexible, thermally stable membranes. In contrast to plant cellulose, we found it catalyzed the deposition of metals within its structure to generate a finely divided homogeneous catalyst layer. Experimental data suggested that bacterial cellulose possessed reducing groups capable of initiating the precipitation of palladium, gold, and silver from aqueous solution. Since the bacterial cellulose contained water equivalent to at least 200 times the dry weight of the cellulose, it was dried to a thin membranous structure suitable for the construction of membrane electrode assemblies (MEAs). Results of our study with palladium-cellulose showed that it was capable of catalyzing the generation of hydrogen when incubated with sodium dithionite and generated an electrical current from hydrogen in an MEA containing native cellulose as the polyelectrolyte membrane (PEM). Advantages of using native and metallized bacterial cellulose membranes in an MEA over other PEMs such as Nafion 117 include its higher thermal stability to 130 degrees C and lower gas crossover.
Oya, Eriko; Kato, Hiroaki; Chikashige, Yuji; Tsutsumi, Chihiro; Hiraoka, Yasushi; Murakami, Yota
2013-01-01
Heterochromatin at the pericentromeric repeats in fission yeast is assembled and spread by an RNAi-dependent mechanism, which is coupled with the transcription of non-coding RNA from the repeats by RNA polymerase II. In addition, Rrp6, a component of the nuclear exosome, also contributes to heterochromatin assembly and is coupled with non-coding RNA transcription. The multi-subunit complex Mediator, which directs initiation of RNA polymerase II-dependent transcription, has recently been suggested to function after initiation in processes such as elongation of transcription and splicing. However, the role of Mediator in the regulation of chromatin structure is not well understood. We investigated the role of Mediator in pericentromeric heterochromatin formation and found that deletion of specific subunits of the head domain of Mediator compromised heterochromatin structure. The Mediator head domain was required for Rrp6-dependent heterochromatin nucleation at the pericentromere and for RNAi-dependent spreading of heterochromatin into the neighboring region. In the latter process, Mediator appeared to contribute to efficient processing of siRNA from transcribed non-coding RNA, which was required for efficient spreading of heterochromatin. Furthermore, the head domain directed efficient transcription in heterochromatin. These results reveal a pivotal role for Mediator in multiple steps of transcription-coupled formation of pericentromeric heterochromatin. This observation further extends the role of Mediator to co-transcriptional chromatin regulation.
Rathi, Preeti; Maurer, Sara; Summerer, Daniel
2018-06-05
The epigenetic DNA nucleobases 5-methylcytosine (5mC) and N 4-methylcytosine (4mC) coexist in bacterial genomes and have important functions in host defence and transcription regulation. To better understand the individual biological roles of both methylated nucleobases, analytical strategies for distinguishing unmodified cytosine (C) from 4mC and 5mC are required. Transcription-activator-like effectors (TALEs) are programmable DNA-binding repeat proteins, which can be re-engineered for the direct detection of epigenetic nucleobases in user-defined DNA sequences. We here report the natural, cytosine-binding TALE repeat to not strongly differentiate between 5mC and 4mC. To engineer repeats with selectivity in the context of C, 5mC and 4mC, we developed a homogeneous fluorescence assay and screened a library of size-reduced TALE repeats for binding to all three nucleobases. This provided insights into the requirements of size-reduced TALE repeats for 4mC binding and revealed a single mutant repeat as a selective binder of 4mC. Employment of a TALE with this repeat in affinity enrichment enabled the isolation of a user-defined DNA sequence containing a single 4mC but not C or 5mC from the background of a bacterial genome. Comparative enrichments with TALEs bearing this or the natural C-binding repeat provides an approach for the complete, programmable decoding of all cytosine nucleobases found in bacterial genomes.This article is part of a discussion meeting issue 'Frontiers in epigenetic chemical biology'. © 2018 The Author(s).
The specificity and flexibility of l1 reverse transcription priming at imperfect T-tracts.
Monot, Clément; Kuciak, Monika; Viollet, Sébastien; Mir, Ashfaq Ali; Gabus, Caroline; Darlix, Jean-Luc; Cristofari, Gaël
2013-05-01
L1 retrotransposons have a prominent role in reshaping mammalian genomes. To replicate, the L1 ribonucleoprotein particle (RNP) first uses its endonuclease (EN) to nick the genomic DNA. The newly generated DNA end is subsequently used as a primer to initiate reverse transcription within the L1 RNA poly(A) tail, a process known as target-primed reverse transcription (TPRT). Prior studies demonstrated that most L1 insertions occur into sequences related to the L1 EN consensus sequence (degenerate 5'-TTTT/A-3' sites) and frequently preceded by imperfect T-tracts. However, it is currently unclear whether--and to which degree--the liberated 3'-hydroxyl extremity on the genomic DNA needs to be accessible and complementary to the poly(A) tail of the L1 RNA for efficient priming of reverse transcription. Here, we employed a direct assay for the initiation of L1 reverse transcription to define the molecular rules that guide this process. First, efficient priming is detected with as few as 4 matching nucleotides at the primer 3' end. Second, L1 RNP can tolerate terminal mismatches if they are compensated within the 10 last bases of the primer by an increased number of matching nucleotides. All terminal mismatches are not equally detrimental to DNA extension, a C being extended at higher levels than an A or a G. Third, efficient priming in the context of duplex DNA requires a 3' overhang. This suggests the possible existence of additional DNA processing steps, which generate a single-stranded 3' end to allow L1 reverse transcription. Based on these data we propose that the specificity of L1 reverse transcription initiation contributes, together with the specificity of the initial EN cleavage, to the distribution of new L1 insertions within the human genome.
The Specificity and Flexibility of L1 Reverse Transcription Priming at Imperfect T-Tracts
Viollet, Sébastien; Mir, Ashfaq Ali; Gabus, Caroline; Darlix, Jean-Luc; Cristofari, Gaël
2013-01-01
L1 retrotransposons have a prominent role in reshaping mammalian genomes. To replicate, the L1 ribonucleoprotein particle (RNP) first uses its endonuclease (EN) to nick the genomic DNA. The newly generated DNA end is subsequently used as a primer to initiate reverse transcription within the L1 RNA poly(A) tail, a process known as target-primed reverse transcription (TPRT). Prior studies demonstrated that most L1 insertions occur into sequences related to the L1 EN consensus sequence (degenerate 5′-TTTT/A-3′ sites) and frequently preceded by imperfect T-tracts. However, it is currently unclear whether—and to which degree—the liberated 3′-hydroxyl extremity on the genomic DNA needs to be accessible and complementary to the poly(A) tail of the L1 RNA for efficient priming of reverse transcription. Here, we employed a direct assay for the initiation of L1 reverse transcription to define the molecular rules that guide this process. First, efficient priming is detected with as few as 4 matching nucleotides at the primer 3′ end. Second, L1 RNP can tolerate terminal mismatches if they are compensated within the 10 last bases of the primer by an increased number of matching nucleotides. All terminal mismatches are not equally detrimental to DNA extension, a C being extended at higher levels than an A or a G. Third, efficient priming in the context of duplex DNA requires a 3′ overhang. This suggests the possible existence of additional DNA processing steps, which generate a single-stranded 3′ end to allow L1 reverse transcription. Based on these data we propose that the specificity of L1 reverse transcription initiation contributes, together with the specificity of the initial EN cleavage, to the distribution of new L1 insertions within the human genome. PMID:23675310
ERIC Educational Resources Information Center
Adelman, Clifford
This addendum describes the nature, rationale, and results of the second cleaning and revision of the National Longitudinal Study of 1972 (NLS-72) Postsecondary Education Transcript Files (PETS). This project, conducted for nearly 3 years, followed an initial cleaning and reduction in 1987, which came about as a reaction to the idiosyncratic…
Jorjani, Hadi; Zavolan, Mihaela
2014-04-01
Accurate identification of transcription start sites (TSSs) is an essential step in the analysis of transcription regulatory networks. In higher eukaryotes, the capped analysis of gene expression technology enabled comprehensive annotation of TSSs in genomes such as those of mice and humans. In bacteria, an equivalent approach, termed differential RNA sequencing (dRNA-seq), has recently been proposed, but the application of this approach to a large number of genomes is hindered by the paucity of computational analysis methods. With few exceptions, when the method has been used, annotation of TSSs has been largely done manually. In this work, we present a computational method called 'TSSer' that enables the automatic inference of TSSs from dRNA-seq data. The method rests on a probabilistic framework for identifying both genomic positions that are preferentially enriched in the dRNA-seq data as well as preferentially captured relative to neighboring genomic regions. Evaluating our approach for TSS calling on several publicly available datasets, we find that TSSer achieves high consistency with the curated lists of annotated TSSs, but identifies many additional TSSs. Therefore, TSSer can accelerate genome-wide identification of TSSs in bacterial genomes and can aid in further characterization of bacterial transcription regulatory networks. TSSer is freely available under GPL license at http://www.clipz.unibas.ch/TSSer/index.php
The logic of communication: roles for mobile transcription factors in plants.
Long, Yuchen; Scheres, Ben; Blilou, Ikram
2015-02-01
Mobile transcription factors play many roles in plant development. Here, we compare the use of mobile transcription factors as signals with some canonical signal transduction processes in prokaryotes and eukaryotes. After an initial survey, we focus on the SHORT-ROOT pathway in Arabidopsis roots to show that, despite the simplicity of the concept of mobile transcription factor signalling, many lines of evidence reveal a surprising complexity in control mechanisms linked to this process. We argue that these controls bestow precision, robustness, and versatility on mobile transcription factor signalling. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
The cryo-electron microscopy structure of human transcription factor IIH
Greber, Basil J.; Nguyen, Thi Hoang Duong; Fang, Jie; ...
2017-09-13
We report human transcription factor IIH (TFIIH) is part of the general transcriptional machinery required by RNA polymerase II for the initiation of eukaryotic gene transcription. Composed of ten subunits that add up to a molecular mass of about 500 kDa, TFIIH is also essential for nucleotide excision repair. The seven-subunit TFIIH core complex formed by XPB, XPD, p62, p52, p44, p34, and p8 is competent for DNA repair, while the CDK-activating kinase subcomplex, which includes the kinase activity of CDK7 as well as the cyclin H and MAT1 subunits, is additionally required for transcription initiation. Mutations in the TFIIHmore » subunits XPB, XPD, and p8 lead to severe premature ageing and cancer propensity in the genetic diseases xeroderma pigmentosum, Cockayne syndrome, and trichothiodystrophy, highlighting the importance of TFIIH for cellular physiology. Here we present the cryo-electron microscopy structure of human TFIIH at 4.4 Å resolution. The structure reveals the molecular architecture of the TFIIH core complex, the detailed structures of its constituent XPB and XPD ATPases, and how the core and kinase subcomplexes of TFIIH are connected. Also, our structure provides insight into the conformational dynamics of TFIIH and the regulation of its activity.« less
The cryo-electron microscopy structure of human transcription factor IIH
DOE Office of Scientific and Technical Information (OSTI.GOV)
Greber, Basil J.; Nguyen, Thi Hoang Duong; Fang, Jie
We report human transcription factor IIH (TFIIH) is part of the general transcriptional machinery required by RNA polymerase II for the initiation of eukaryotic gene transcription. Composed of ten subunits that add up to a molecular mass of about 500 kDa, TFIIH is also essential for nucleotide excision repair. The seven-subunit TFIIH core complex formed by XPB, XPD, p62, p52, p44, p34, and p8 is competent for DNA repair, while the CDK-activating kinase subcomplex, which includes the kinase activity of CDK7 as well as the cyclin H and MAT1 subunits, is additionally required for transcription initiation. Mutations in the TFIIHmore » subunits XPB, XPD, and p8 lead to severe premature ageing and cancer propensity in the genetic diseases xeroderma pigmentosum, Cockayne syndrome, and trichothiodystrophy, highlighting the importance of TFIIH for cellular physiology. Here we present the cryo-electron microscopy structure of human TFIIH at 4.4 Å resolution. The structure reveals the molecular architecture of the TFIIH core complex, the detailed structures of its constituent XPB and XPD ATPases, and how the core and kinase subcomplexes of TFIIH are connected. Also, our structure provides insight into the conformational dynamics of TFIIH and the regulation of its activity.« less
Transcriptional Networks in Epithelial-Mesenchymal Transition
Venkov, Christo; Plieth, David; Ni, Terri; Karmaker, Amitava; Bian, Aihua; George, Alfred L.; Neilson, Eric G.
2011-01-01
Backround Epithelial-mesenchymal transition (EMT) changes polarized epithelial cells into migratory phenotypes associated with loss of cell-cell adhesion molecules and cytoskeletal rearrangements. This form of plasticity is seen in mesodermal development, fibroblast formation, and cancer metastasis. Methods and Findings Here we identify prominent transcriptional networks active during three time points of this transitional process, as epithelial cells become fibroblasts. DNA microarray in cultured epithelia undergoing EMT, validated in vivo, were used to detect various patterns of gene expression. In particular, the promoter sequences of differentially expressed genes and their transcription factors were analyzed to identify potential binding sites and partners. The four most frequent cis-regulatory elements (CREs) in up-regulated genes were SRY, FTS-1, Evi-1, and GC-Box, and RNA inhibition of the four transcription factors, Atf2, Klf10, Sox11, and SP1, most frequently binding these CREs, establish their importance in the initiation and propagation of EMT. Oligonucleotides that block the most frequent CREs restrain EMT at early and intermediate stages through apoptosis of the cells. Conclusions Our results identify new transcriptional interactions with high frequency CREs that modulate the stability of cellular plasticity, and may serve as targets for modulating these transitional states in fibroblasts. PMID:21980432
Atypical archaeal tRNA pyrrolysine transcript behaves towards EF-Tu as a typical elongator tRNA
Théobald-Dietrich, Anne; Frugier, Magali; Giegé, Richard; Rudinger-Thirion, Joëlle
2004-01-01
The newly discovered tRNAPyl is involved in specific incorporation of pyrrolysine in the active site of methylamine methyltransferases in the archaeon Methanosarcina barkeri. In solution probing experiments, a transcript derived from tRNAPyl displays a secondary fold slightly different from the canonical cloverleaf and interestingly similar to that of bovine mitochondrial tRNASer(uga). Aminoacylation of tRNAPyl transcript by a typical class II synthetase, LysRS from yeast, was possible when its amber anticodon CUA was mutated into a lysine UUU anticodon. Hydrolysis protection assays show that lysylated tRNAPyl can be recognized by bacterial elongation factor. This indicates that no antideterminant sequence is present in the body of the tRNAPyl transcript to prevent it from interacting with EF-Tu, in contrast with the otherwise functionally similar tRNASec that mediates selenocysteine incorporation. PMID:14872064
Comparative genomics of transcriptional regulation of methionine metabolism in proteobacteria
Leyn, Semen A.; Suvorova, Inna A.; Kholina, Tatiana D.; ...
2014-11-20
Methionine metabolism and uptake genes in Proteobacteria are controlled by a variety of RNA and DNA regulatory systems. We have applied comparative genomics to reconstruct regulons for three known transcription factors, MetJ, MetR, and SahR, and three known riboswitch motifs, SAH, SAM-SAH, and SAM_alpha, in ~200 genomes from 22 taxonomic groups of Proteobacteria. We also identified two novel regulons: a SahR-like transcription factor SamR controlling various methionine biosynthesis genes in the Xanthomonadales group, and a potential RNA regulatory element with terminator-antiterminator mechanism controlling the metX or metZ genes in beta-proteobacteria. For each analyzed regulator we identified the core, taxon-specific andmore » genome-specific regulon members. By analyzing the distribution of these regulators in bacterial genomes and by comparing their regulon contents we elucidated possible evolutionary scenarios for the regulation of the methionine metabolism genes in Proteobacteria.« less
Sense transcription through the S region is essential for immunoglobulin class switch recombination
Haddad, Dania; Oruc, Zéliha; Puget, Nadine; Laviolette-Malirat, Nathalie; Philippe, Magali; Carrion, Claire; Le Bert, Marc; Khamlichi, Ahmed Amine
2011-01-01
Class switch recombination (CSR) occurs between highly repetitive sequences called switch (S) regions and is initiated by activation-induced cytidine deaminase (AID). CSR is preceded by a bidirectional transcription of S regions but the relative importance of sense and antisense transcription for CSR in vivo is unknown. We generated three mouse lines in which we attempted a premature termination of transcriptional elongation by inserting bidirectional transcription terminators upstream of Sμ, upstream of Sγ3 or downstream of Sγ3 sequences. The data show, at least for Sγ3, that sense transcriptional elongation across S region is absolutely required for CSR whereas its antisense counterpart is largely dispensable, strongly suggesting that sense transcription is sufficient for AID targeting to both DNA strands. PMID:21378751
Amino acid-dependent signaling via S6K1 and MYC is essential for regulation of rDNA transcription
Kang, Jian; Kusnadi, Eric P.; Ogden, Allison J.; Hicks, Rodney J.; Bammert, Lukas; Kutay, Ulrike; Hung, Sandy; Sanij, Elaine; Hannan, Ross D.; Hannan, Katherine M.; Pearson, Richard B.
2016-01-01
Dysregulation of RNA polymerase I (Pol I)-dependent ribosomal DNA (rDNA) transcription is a consistent feature of malignant transformation that can be targeted to treat cancer. Understanding how rDNA transcription is coupled to the availability of growth factors and nutrients will provide insight into how ribosome biogenesis is maintained in a tumour environment characterised by limiting nutrients. We demonstrate that modulation of rDNA transcription initiation, elongation and rRNA processing is an immediate, co-regulated response to altered amino acid abundance, dependent on both mTORC1 activation of S6K1 and MYC activity. Growth factors regulate rDNA transcription initiation while amino acids modulate growth factor-dependent rDNA transcription by primarily regulating S6K1-dependent rDNA transcription elongation and processing. Thus, we show for the first time amino acids regulate rRNA synthesis by a distinct, post-initiation mechanism, providing a novel model for integrated control of ribosome biogenesis that has implications for understanding how this process is dysregulated in cancer. PMID:27385002
Bacterial virulence effectors and their activities.
Hann, Dagmar R; Gimenez-Ibanez, Selena; Rathjen, John P
2010-08-01
The major virulence strategy for plant pathogenic bacteria is deployment of effector molecules within the host cytoplasm. Each bacterial strain possesses a set of 20-30 effectors which have overlapping activities, are functionally interchangeable, and diverge in composition between strains. Effectors target host molecules to suppress immunity. Two main strategies are apparent. Effectors that target host proteins seem to attack conserved structural domains but otherwise lack specificity. On the other hand, those that influence host gene transcription directly do so with extreme specificity. In both cases, examples are known where the host has exploited effector-target affinities to establish immune recognition of effectors. The molecular activity of each effector links virulence and immune outcomes. Copyright 2010 Elsevier Ltd. All rights reserved.
Spontaneous bacterial peritonitis
Koulaouzidis, Anastasios; Bhat, Shivaram; Saeed, Athar A
2009-01-01
Since its initial description in 1964, research has transformed spontaneous bacterial peritonitis (SBP) from a feared disease (with reported mortality of 90%) to a treatable complication of decompensated cirrhosis, albeit with steady prevalence and a high recurrence rate. Bacterial translocation, the key mechanism in the pathogenesis of SBP, is only possible because of the concurrent failure of defensive mechanisms in cirrhosis. Variants of SBP should be treated. Leucocyte esterase reagent strips have managed to shorten the ‘tap-to-shot’ time, while future studies should look into their combined use with ascitic fluid pH. Third generation cephalosporins are the antibiotic of choice because they have a number of advantages. Renal dysfunction has been shown to be an independent predictor of mortality in patients with SBP. Albumin is felt to reduce the risk of renal impairment by improving effective intravascular volume, and by helping to bind pro-inflammatory molecules. Following a single episode of SBP, patients should have long-term antibiotic prophylaxis and be considered for liver transplantation. PMID:19266595
A new regulatory mechanism for bacterial lipoic acid synthesis
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-01
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID
A new regulatory mechanism for bacterial lipoic acid synthesis.
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-22
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015
Ribeiro, Marta; Monteiro, Fernando J.; Ferraz, Maria P.
2012-01-01
Staphylococcus comprises up to two-thirds of all pathogens in orthopedic implant infections and they are the principal causative agents of two major types of infection affecting bone: septic arthritis and osteomyelitis, which involve the inflammatory destruction of joint and bone. Bacterial adhesion is the first and most important step in implant infection. It is a complex process influenced by environmental factors, bacterial properties, material surface properties and by the presence of serum or tissue proteins. Properties of the substrate, such as chemical composition of the material, surface charge, hydrophobicity, surface roughness and the presence of specific proteins at the surface, are all thought to be important in the initial cell attachment process. The biofilm mode of growth of infecting bacteria on an implant surface protects the organisms from the host immune system and antibiotic therapy. The research for novel therapeutic strategies is incited by the emergence of antibiotic-resistant bacteria. This work will provide an overview of the mechanisms and factors involved in bacterial adhesion, the techniques that are currently being used studying bacterial-material interactions as well as provide insight into future directions in the field. PMID:23507884
Baba, Ryuko; Asakawa, Susumu; Watanabe, Takeshi
2016-09-29
The transcription patterns of [FeFe]-hydrogenase genes (hydA), which encode the enzymes responsible for H2 production, were investigated during rice straw decomposition in paddy soil using molecular biological techniques. Paddy soil amended with and without rice straw was incubated under anoxic conditions. RNA was extracted from the soil, and three clone libraries of hydA were constructed using RNAs obtained from samples in the initial phase of rice straw decomposition (day 1 with rice straw), methanogenic phase of rice straw decomposition (day 14 with rice straw), and under a non-amended condition (day 14 without rice straw). hydA genes related to Proteobacteria, Firmicutes, Bacteroidetes, Chloroflexi, and Thermotogae were mainly transcribed in paddy soil samples; however, their proportions markedly differed among the libraries. Deltaproteobacteria-related hydA genes were predominantly transcribed on day 1 with rice straw, while various types of hydA genes related to several phyla were transcribed on day 14 with rice straw. Although the diversity of transcribed hydA was significantly higher in the library on day 14 with rice straw than the other two libraries, the composition of hydA transcripts in the library was similar to that in the library on day 14 without rice straw. These results indicate that the composition of active H2 producers and/or H2 metabolic patterns dynamically change during rice straw decomposition in paddy soil.
Nascent Transcription Affected by RNA Polymerase IV in Zea mays
Erhard, Karl F.; Talbot, Joy-El R. B.; Deans, Natalie C.; McClish, Allison E.; Hollick, Jay B.
2015-01-01
All eukaryotes use three DNA-dependent RNA polymerases (RNAPs) to create cellular RNAs from DNA templates. Plants have additional RNAPs related to Pol II, but their evolutionary role(s) remain largely unknown. Zea mays (maize) RNA polymerase D1 (RPD1), the largest subunit of RNA polymerase IV (Pol IV), is required for normal plant development, paramutation, transcriptional repression of certain transposable elements (TEs), and transcriptional regulation of specific alleles. Here, we define the nascent transcriptomes of rpd1 mutant and wild-type (WT) seedlings using global run-on sequencing (GRO-seq) to identify the broader targets of RPD1-based regulation. Comparisons of WT and rpd1 mutant GRO-seq profiles indicate that Pol IV globally affects transcription at both transcriptional start sites and immediately downstream of polyadenylation addition sites. We found no evidence of divergent transcription from gene promoters as seen in mammalian GRO-seq profiles. Statistical comparisons identify genes and TEs whose transcription is affected by RPD1. Most examples of significant increases in genic antisense transcription appear to be initiated by 3ʹ-proximal long terminal repeat retrotransposons. These results indicate that maize Pol IV specifies Pol II-based transcriptional regulation for specific regions of the maize genome including genes having developmental significance. PMID:25653306
Bacterial Sepsis in Patients with Visceral Leishmaniasis in Northwest Ethiopia
Takele, Yegnasew; Woldeyohannes, Desalegn; Tiruneh, Moges; Mohammed, Rezika; Lynen, Lutgarde; van Griensven, Johan
2014-01-01
Background and Objectives. Visceral leishmaniasis (VL) is one of the neglected diseases affecting the poorest segment of world populations. Sepsis is one of the predictors for death of patients with VL. This study aimed to assess the prevalence and factors associated with bacterial sepsis, causative agents, and their antimicrobial susceptibility patterns among patients with VL. Methods. A cross-sectional study was conducted among parasitologically confirmed VL patients suspected of sepsis admitted to the University of Gondar Hospital, Northwest Ethiopia, from February 2012 to May 2012. Blood cultures and other clinical samples were collected and cultured following the standard procedures. Results. Among 83 sepsis suspected VL patients 16 (19.3%) had culture confirmed bacterial sepsis. The most frequently isolated organism was Staphylococcus aureus (68.8%; 11/16), including two methicillin-resistant isolates (MRSA). Patients with focal bacterial infection were more likely to have bacterial sepsis (P < 0.001). Conclusions. The prevalence of culture confirmed bacterial sepsis was high, predominantly due to S. aureus. Concurrent focal bacterial infection was associated with bacterial sepsis, suggesting that focal infections could serve as sources for bacterial sepsis among VL patients. Careful clinical evaluation for focal infections and prompt initiation of empiric antibiotic treatment appears warranted in VL patients. PMID:24895569
Esquerré, Thomas; Bouvier, Marie; Turlan, Catherine; Carpousis, Agamemnon J; Girbal, Laurence; Cocaign-Bousquet, Muriel
2016-04-26
Bacterial adaptation requires large-scale regulation of gene expression. We have performed a genome-wide analysis of the Csr system, which regulates many important cellular functions. The Csr system is involved in post-transcriptional regulation, but a role in transcriptional regulation has also been suggested. Two proteins, an RNA-binding protein CsrA and an atypical signaling protein CsrD, participate in the Csr system. Genome-wide transcript stabilities and levels were compared in wildtype E. coli (MG1655) and isogenic mutant strains deficient in CsrA or CsrD activity demonstrating for the first time that CsrA and CsrD are global negative and positive regulators of transcription, respectively. The role of CsrA in transcription regulation may be indirect due to the 4.6-fold increase in csrD mRNA concentration in the CsrA deficient strain. Transcriptional action of CsrA and CsrD on a few genes was validated by transcriptional fusions. In addition to an effect on transcription, CsrA stabilizes thousands of mRNAs. This is the first demonstration that CsrA is a global positive regulator of mRNA stability. For one hundred genes, we predict that direct control of mRNA stability by CsrA might contribute to metabolic adaptation by regulating expression of genes involved in carbon metabolism and transport independently of transcriptional regulation.
Reid-Bayliss, Kate S; Loeb, Lawrence A
2017-08-29
Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.
Polyphenol Compound as a Transcription Factor Inhibitor.
Park, Seyeon
2015-10-30
A target-based approach has been used to develop novel drugs in many therapeutic fields. In the final stage of intracellular signaling, transcription factor-DNA interactions are central to most biological processes and therefore represent a large and important class of targets for human therapeutics. Thus, we focused on the idea that the disruption of protein dimers and cognate DNA complexes could impair the transcriptional activation and cell transformation regulated by these proteins. Historically, natural products have been regarded as providing the primary leading compounds capable of modulating protein-protein or protein-DNA interactions. Although their mechanism of action is not fully defined, polyphenols including flavonoids were found to act mostly as site-directed small molecule inhibitors on signaling. There are many reports in the literature of screening initiatives suggesting improved drugs that can modulate the transcription factor interactions responsible for disease. In this review, we focus on polyphenol compound inhibitors against dimeric forms of transcription factor components of intracellular signaling pathways (for instance, c-jun/c-fos (Activator Protein-1; AP-1), c-myc/max, Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and β-catenin/T cell factor (Tcf)).
Zink, Steven D; Van Slyke, Greta A; Palumbo, Michael J; Kramer, Laura D; Ciota, Alexander T
2015-10-27
Complex interactions between microbial residents of mosquitoes and arboviruses are likely to influence many aspects of vectorial capacity and could potentially have profound effects on patterns of arbovirus transmission. Such interactions have not been well studied for West Nile virus (WNV; Flaviviridae, Flavivirus) and Culex spp. mosquitoes. We utilized next-generation sequencing of 16S ribosomal RNA bacterial genes derived from Culex pipiens Linnaeus following WNV exposure and/or infection and compared bacterial populations and broad immune responses to unexposed mosquitoes. Our results demonstrate that WNV infection increases the diversity of bacterial populations and is associated with up-regulation of classical invertebrate immune pathways including RNA interference (RNAi), Toll, and Jak-STAT (Janus kinase-Signal Transducer and Activator of Transcription). In addition, WNV exposure alone, without the establishment of infection, results in similar alterations to microbial and immune signatures, although to a lesser extent. Multiple bacterial genera were found in greater abundance inWNV-exposed and/or infected mosquitoes, yet the most consistent and notable was the genus Serratia.
Fefelova, E A; Stolyarenko, A D; Yakushev, E Y; Gvozdev, V A; Klenov, M S
2017-01-01
Proteins of the Piwi family and short Piwi-interacting RNAs (piRNAs) ensure the protection of the genome from transposable elements. We have previously shown that nuclear Piwi protein tends to concentrate in the nucleoli of the cells of Drosophila melanogaster ovaries. It could be hypothesized that the function of Piwi in the nucleolus is associated with the repression of R1 and R2 retrotransposons inserted into the rDNA cluster. Here, we show that Piwi participates in recruiting Udd protein to nucleoli. Udd is a component of the conserved Selectivity Factor I-like (SL1-like) complex, which is required for transcription initiation by RNA polymerase I. We found that Udd localization depends on Piwi in germline cells, but not in somatic cells of the ovaries. In contrast, knockdowns of the SL1-like components (Udd or TAF1b) do not disrupt Piwi localization. We also observed that the absence of Udd or TAF1b in germline cells, as well as the impairment of Piwi nuclear localization lead to the accumulation of late stage egg chambers in the ovaries, which could be explained by reduced rRNA transcription. These results allow us to propose for the first time a role for Piwi in the nucleolus that is not directly associated with transposable element repression.
Bierhoff, Holger; Dundr, Miroslav; Michels, Annemieke A; Grummt, Ingrid
2008-08-01
The protein kinase casein kinase 2 (CK2) phosphorylates different components of the RNA polymerase I (Pol I) transcription machinery and exerts a positive effect on rRNA gene (rDNA) transcription. Here we show that CK2 phosphorylates the transcription initiation factor TIF-IA at serines 170 and 172 (Ser170/172), and this phosphorylation triggers the release of TIF-IA from Pol I after transcription initiation. Inhibition of Ser170/172 phosphorylation or covalent tethering of TIF-IA to the RPA43 subunit of Pol I inhibits rDNA transcription, leading to perturbation of nucleolar structure and cell cycle arrest. Fluorescence recovery after photobleaching and chromatin immunoprecipitation experiments demonstrate that dissociation of TIF-IA from Pol I is a prerequisite for proper transcription elongation. In support of phosphorylation of TIF-IA switching from the initiation into the elongation phase, dephosphorylation of Ser170/172 by FCP1 facilitates the reassociation of TIF-IA with Pol I, allowing a new round of rDNA transcription. The results reveal a mechanism by which the functional interplay between CK2 and FCP1 sustains multiple rounds of Pol I transcription.
Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie
2011-10-07
Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Li, Bo; Jiang, Shan; Yu, Xiao; Cheng, Cheng; Chen, Sixue; Cheng, Yanbing; Yuan, Joshua S.; Jiang, Daohong; He, Ping; Shan, Libo
2015-01-01
Proper control of immune-related gene expression is crucial for the host to launch an effective defense response. Perception of microbe-associated molecular patterns (MAMPs) induces rapid and profound transcriptional reprogramming via unclear mechanisms. Here, we show that ASR3 (ARABIDOPSIS SH4-RELATED3) functions as a transcriptional repressor and plays a negative role in regulating pattern-triggered immunity (PTI) in Arabidopsis thaliana. ASR3 belongs to a plant-specific trihelix transcription factor family for which functional studies are lacking. MAMP treatments induce rapid phosphorylation of ASR3 at threonine 189 via MPK4, a mitogen-activated protein kinase that negatively regulates PTI responses downstream of multiple MAMP receptors. ASR3 possesses transcriptional repressor activity via its ERF-associated amphiphilic repression motifs and negatively regulates a large subset of flg22-induced genes. Phosphorylation of ASR3 by MPK4 enhances its DNA binding activity to suppress gene expression. Importantly, the asr3 mutant shows enhanced disease resistance to virulent bacterial pathogen infection, whereas transgenic plants overexpressing the wild-type or phospho-mimetic form of ASR3 exhibit compromised PTI responses. Our studies reveal a function of the trihelix transcription factors in plant innate immunity and provide evidence that ASR3 functions as a transcriptional repressor regulated by MAMP-activated MPK4 to fine-tune plant immune gene expression. PMID:25770109
Neuroprotective action of bacterial melanin in rats after corticospinal tract lesions.
Petrosyan, Tigran R; Gevorkyan, Olga V; Meliksetyan, Irina B; Hovsepyan, Anna S; Manvelyan, Levon R
2012-04-01
Experiments were performed on 48 albino rats. Part of the experimental animals were initially trained to a balancing instrumental conditioned reflex (ICR). Unilateral bulbar pyramidotomy performed in all rats caused contralateral hemiparesis. On the next day following the operation 24 rats were injected intramuscularly with bacterial melanin solution. 12 of these rats were initially trained to ICR. Recovery periods of ICR and paralyzed hindlimb movements were registered for melanin injected rats (n=24) and for operated rats, not treated with melanin (n=24). In rats injected with bacterial melanin the posttraumatic recovery is shorter than in animals not treated with melanin. The fastest and complete recovery was registered in rats initially trained to ICR and injected after the operation with bacterial melanin. Electrophysiological experiments were performed in transected animals treated with melanin, transected animals without melanin treatment and intact animals. Spiking activity of motoneurons was registered in lumbar motoneurons of rats in response to high frequency stimulation above the corticospinal tract transection. Spiking activity was very similar in motoneurons of melanin injected and intact or non operated animals. In animals, not dosed with bacterial melanin after the operation, areactivity or no change in firing rate was registered in response to stimulus. Stimulation of the corticospinal tract of melanin injected rats produced potentiation of the motoneuronal firing rate and is an evidence of regeneration in corticospinal tract. Similarity in spiking activity of intact and melanin injected rats shows the recovery of conductance in pyramidal tract. Morphohistochemical examination was carried out to confirm the results of behavioral and electrophysiological experiments. Medulla slices were prepared to trace the regeneration of nerve fibers. Examination of transection area revealed that bacterial melanin increases vascularization, dilates the
Characterization of herpes simplex virus 2 primary microRNA Transcript regulation.
Tang, Shuang; Bosch-Marce, Marta; Patel, Amita; Margolis, Todd P; Krause, Philip R
2015-05-01
In order to understand factors that may influence latency-associated transcription and latency-associated transcript (LAT) phenotypes, we studied the expression of the herpes simplex virus 2 (HSV-2) LAT-associated microRNAs (miRNAs). We mapped the transcription initiation sites of all three primary miRNA transcripts and identified the ICP4-binding sequences at the transcription initiation sites of both HSV-2 LAT (pri-miRNA for miR-I and miR-II, which target ICP34.5, and miR-III, which targets ICP0) and L/ST (a pri-miRNA for miR-I and miR-II) but not at that of the primary miR-H6 (for which the target is unknown). We confirmed activity of the putative HSV-2 L/ST promoter and found that ICP4 trans-activates the L/ST promoter when the ICP4-binding site at its transcription initiation site is mutated, suggesting that ICP4 may play a dual role in regulating transcription of L/ST and, consequently, of miR-I and miR-II. LAT exon 1 (containing LAT enhancer sequences), together with the LAT promoter region, comprises a bidirectional promoter required for the expression of both LAT-encoded miRNAs and miR-H6 in latently infected mouse ganglia. The ability of ICP4 to suppress ICP34.5-targeting miRNAs and to activate lytic viral genes suggests that ICP4 could play a key role in the switch between latency and reactivation. The HSV-2 LAT and viral miRNAs expressed in the LAT region are the most abundant viral transcripts during HSV latency. The balance between the expression of LAT and LAT-associated miRNAs and the expression of lytic viral transcripts from the opposite strand appears to influence whether individual HSV-infected neurons will be latently or productively infected. The outcome of neuronal infection may thus depend on regulation of gene expression of the corresponding primary miRNAs. In the present study, we characterize promoter sequences responsible for miRNA expression, including identification of the primary miRNA 5' ends and evaluation of ICP4 response. These
The mechanism of RNA 5' capping with NAD +, NADH and desphospho-CoA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bird, Jeremy G.; Zhang, Yu; Tian, Yuan
The chemical nature of the 5' end of RNA is a key determinant of RNA stability, processing, localization and translation efficiency and has been proposed to provide a layer of ‘epitranscriptomic’ gene regulation. Recently it has been shown that some bacterial RNA species carry a 5'-end structure reminiscent of the 5' 7-methylguanylate ‘cap’ in eukaryotic RNA. In particular, RNA species containing a 5'-end nicotinamide adenine dinucleotide (NAD+) or 3'-desphospho-coenzyme A (dpCoA) have been identified in both Gram-negative and Gram-positive bacteria. It has been proposed that NAD+, reduced NAD+ (NADH) and dpCoA caps are added to RNA after transcription initiation, inmore » a manner analogous to the addition of 7-methylguanylate caps. Here we show instead that NAD+, NADH and dpCoA are incorporated into RNA during transcription initiation, by serving as non-canonical initiating nucleotides (NCINs) for de novo transcription initiation by cellular RNA polymerase (RNAP). We further show that both bacterial RNAP and eukaryotic RNAP II incorporate NCIN caps, that promoter DNA sequences at and upstream of the transcription start site determine the efficiency of NCIN capping, that NCIN capping occurs in vivo, and that NCIN capping has functional consequences. We report crystal structures of transcription initiation complexes containing NCIN-capped RNA products. Our results define the mechanism and structural basis of NCIN capping, and suggest that NCIN-mediated ‘ab initio capping’ may occur in all organisms.« less
[Biofilm: set-up and organization of a bacterial community].
Filloux, Alain; Vallet, Isabelle
2003-01-01
Bacterial attachment on various surfaces mostly takes place in the form of specialised bacterial communities, referred to as biofilm. The biofilm is formed through series of interactions between cells and adherence to surface, resulting in an organised structure. In this review we have been using Pseudomonas aeruginosa as a model microorganism to describe the series of events that occurred during this developmental process. P. aeruginosa is an opportunistic pathogen that has a wide variety of hosts and infectious sites. In addition to biofilm formation in certain tissues, inert surfaces, such as catheters, are also target for bacterial biofilm development. The use of convenient genetic screens has made possible the identification of numerous biofilm-defective mutants, which have been characterised further. These studies have allowed the proposal for a global model, in which key events are described for the different stages of biofilm formation. Briefly, flagellar mobility is crucial for approaching the surface, whereas type IV pili motility is preponderant for surface colonisation and microcolonies formation. These microcolonies are finally packed together and buried in an exopolysaccharide matrix to form the differentiated bio-film. It is obvious that the different stages of biofilm formation also involved perception of environmental stimuli. These stimuli, and their associated complex regulatory networks, have still to be fully characterised to understand the bacterial strategy, which initiates biofilm formation. One such regulatory system, called Quorum sensing, is one of the key player in the initial differentiation of biofilm. Finally, a better understanding, at the molecular level, of biofilm establishment and persistence should help for the design of antimicrobials that prevent bacterial infections.
Stracy, Mathew; Lesterlin, Christian; Garza de Leon, Federico; Uphoff, Stephan; Zawadzki, Pawel; Kapanidis, Achillefs N.
2015-01-01
Despite the fundamental importance of transcription, a comprehensive analysis of RNA polymerase (RNAP) behavior and its role in the nucleoid organization in vivo is lacking. Here, we used superresolution microscopy to study the localization and dynamics of the transcription machinery and DNA in live bacterial cells, at both the single-molecule and the population level. We used photoactivated single-molecule tracking to discriminate between mobile RNAPs and RNAPs specifically bound to DNA, either on promoters or transcribed genes. Mobile RNAPs can explore the whole nucleoid while searching for promoters, and spend 85% of their search time in nonspecific interactions with DNA. On the other hand, the distribution of specifically bound RNAPs shows that low levels of transcription can occur throughout the nucleoid. Further, clustering analysis and 3D structured illumination microscopy (SIM) show that dense clusters of transcribing RNAPs form almost exclusively at the nucleoid periphery. Treatment with rifampicin shows that active transcription is necessary for maintaining this spatial organization. In faster growth conditions, the fraction of transcribing RNAPs increases, as well as their clustering. Under these conditions, we observed dramatic phase separation between the densest clusters of RNAPs and the densest regions of the nucleoid. These findings show that transcription can cause spatial reorganization of the nucleoid, with movement of gene loci out of the bulk of DNA as levels of transcription increase. This work provides a global view of the organization of RNA polymerase and transcription in living cells. PMID:26224838
Cheng, Benson Yee Hin; Zhi, Jizu; Santana, Alexis; Khan, Sohail; Salinas, Eduardo; Forrest, J. Craig; Zheng, Yueting; Jaggi, Shirin; Leatherwood, Janet
2012-01-01
We applied a custom tiled microarray to examine murine gammaherpesvirus 68 (MHV68) polyadenylated transcript expression in a time course of de novo infection of fibroblast cells and following phorbol ester-mediated reactivation from a latently infected B cell line. During de novo infection, all open reading frames (ORFs) were transcribed and clustered into four major temporal groups that were overlapping yet distinct from clusters based on the phorbol ester-stimulated B cell reactivation time course. High-density transcript analysis at 2-h intervals during de novo infection mapped gene boundaries with a 20-nucleotide resolution, including a previously undefined ORF73 transcript and the MHV68 ORF63 homolog of Kaposi's sarcoma-associated herpesvirus vNLRP1. ORF6 transcript initiation was mapped by tiled array and confirmed by 5′ rapid amplification of cDNA ends. The ∼1.3-kb region upstream of ORF6 was responsive to lytic infection and MHV68 RTA, identifying a novel RTA-responsive promoter. Transcription in intergenic regions consistent with the previously defined expressed genomic regions was detected during both types of productive infection. We conclude that the MHV68 transcriptome is dynamic and distinct during de novo fibroblast infection and upon phorbol ester-stimulated B cell reactivation, highlighting the need to evaluate further transcript structure and the context-dependent molecular events that govern viral gene expression during chronic infection. PMID:22318145
Transcriptional regulation of the human mitochondrial peptide deformylase (PDF).
Pereira-Castro, Isabel; Costa, Luís Teixeira da; Amorim, António; Azevedo, Luisa
2012-05-18
The last years of research have been particularly dynamic in establishing the importance of peptide deformylase (PDF), a protein of the N-terminal methionine excision (NME) pathway that removes formyl-methionine from mitochondrial-encoded proteins. The genomic sequence of the human PDF gene is shared with the COG8 gene, which encodes a component of the oligomeric golgi complex, a very unusual case in Eukaryotic genomes. Since PDF is crucial in maintaining mitochondrial function and given the atypical short distance between the end of COG8 coding sequence and the PDF initiation codon, we investigated whether the regulation of the human PDF is affected by the COG8 overlapping partner. Our data reveals that PDF has several transcription start sites, the most important of which only 18 bp from the initiation codon. Furthermore, luciferase-activation assays using differently-sized fragments defined a 97 bp minimal promoter region for human PDF, which is capable of very strong transcriptional activity. This fragment contains a potential Sp1 binding site highly conserved in mammalian species. We show that this binding site, whose mutation significantly reduces transcription activation, is a target for the Sp1 transcription factor, and possibly of other members of the Sp family. Importantly, the entire minimal promoter region is located after the end of COG8's coding region, strongly suggesting that the human PDF preserves an independent regulation from its overlapping partner. Copyright © 2012 Elsevier Inc. All rights reserved.
Bathige, S D N K; Umasuthan, Navaneethaiyer; Priyathilaka, Thanthrige Thiunuwan; Thulasitha, William Shanthakumar; Jayasinghe, J D H E; Wan, Qiang; Nam, Bo-Hye; Lee, Jehee
2017-08-30
Signal transducer and activator of transcription 2 (STAT2) is a key element that transduces signals from the cell membrane to the nucleus via the type I interferon-signaling pathway. Although the structural and functional aspects of STAT proteins are well studied in mammals, information on teleostean STATs is very limited. In this study, a STAT paralog, which is highly homologous to the STAT2 members, was identified from a commercially important fish species called rock bream and designated as RbSTAT2. The RbSTAT2 gene was characterized at complementary DNA (cDNA) and genomic sequence levels, and was found to possess structural features common with its mammalian counterparts. The complete cDNA sequence was distributed into 24 exons in the genomic sequence. The promoter proximal region was analyzed and found to contain potential transcription factor binding sites to regulate the transcription of RbSTAT2. Phylogenetic studies and comparative genomic structure organization revealed the distinguishable evolution for fish and other vertebrate STAT2 orthologs. Transcriptional quantification was performed by SYBR Green quantitative real-time PCR (qPCR) and the ubiquitous expression of RbSTAT2 transcripts was observed in all tissues analyzed from healthy fish, with a remarkably high expression in blood cells. Significantly (P<0.05) altered transcription of RbSTAT2 was detected after immune challenge experiments with viral (rock bream irido virus; RBIV), bacterial (Edwardsiella tarda and Streptococcus iniae), and immune stimulants (poly I:C and LPS). Antiviral potential was further confirmed by WST-1 assay, by measuring the viability of rock bream heart cells treated with RBIV. In addition, results of an in vitro challenge experiment signified the influence of rock bream interleukin-10 (RbIL-10) on transcription of RbSTAT2. Subcellular localization studies by transfection of pEGFP-N1/RbSTAT2 into rock bream heart cells revealed that the RbSTAT2 was usually located in the
Tian, Tian; Salis, Howard M.
2015-01-01
Natural and engineered genetic systems require the coordinated expression of proteins. In bacteria, translational coupling provides a genetically encoded mechanism to control expression level ratios within multi-cistronic operons. We have developed a sequence-to-function biophysical model of translational coupling to predict expression level ratios in natural operons and to design synthetic operons with desired expression level ratios. To quantitatively measure ribosome re-initiation rates, we designed and characterized 22 bi-cistronic operon variants with systematically modified intergenic distances and upstream translation rates. We then derived a thermodynamic free energy model to calculate de novo initiation rates as a result of ribosome-assisted unfolding of intergenic RNA structures. The complete biophysical model has only five free parameters, but was able to accurately predict downstream translation rates for 120 synthetic bi-cistronic and tri-cistronic operons with rationally designed intergenic regions and systematically increased upstream translation rates. The biophysical model also accurately predicted the translation rates of the nine protein atp operon, compared to ribosome profiling measurements. Altogether, the biophysical model quantitatively predicts how translational coupling controls protein expression levels in synthetic and natural bacterial operons, providing a deeper understanding of an important post-transcriptional regulatory mechanism and offering the ability to rationally engineer operons with desired behaviors. PMID:26117546
Kuo, Tzu-Hsing; Williams, Julie A.
2014-01-01
Study Objectives: Sleep is known to increase as an acute response to infection. However, the function of this behavioral response in host defense is not well understood. To address this problem, we evaluated the effect of acute sleep deprivation on post-infection sleep and immune function in Drosophila. Setting: Laboratory. Participants: Drosophila melanogaster. Methods and Results: Flies were subjected to sleep deprivation before (early DEP) or after (late DEP) bacterial infection. Relative to a non-deprived control, flies subjected to early DEP had enhanced sleep after infection as well as increased bacterial clearance and survival outcome. Flies subjected to late DEP experienced enhanced sleep following the deprivation period, and showed a modest improvement in survival outcome. Continuous DEP (early and late DEP) throughout infection also enhanced sleep later during infection and improved survival. However, improved survival in flies subjected to late or continuous DEP did not occur until after flies had experienced sleep. During infection, both early and late DEP enhanced NFκB transcriptional activity as measured by a luciferase reporter (κB-luc) in living flies. Early DEP also increased NFκB activity prior to infection. Flies that were deficient in expression of either the Relish or Dif NFκB transcription factors showed normal responses to early DEP. However, the effect of early DEP on post-infection sleep and survival was abolished in double mutants, which indicates that Relish and Dif have redundant roles in this process. Conclusions: Acute sleep deprivation elevated NFκB-dependent activity, increased post-infection sleep, and improved survival during bacterial infection. Citation: Kuo TH, Williams JA. Acute sleep deprivation enhances post-infection sleep and promotes survival during bacterial infection in Drosophila. SLEEP 2014;37(5):859-869. PMID:24790264
Bojanovič, Klara; D'Arrigo, Isotta; Long, Katherine S
2017-04-01
Bacteria cope with and adapt to stress by modulating gene expression in response to specific environmental cues. In this study, the transcriptional response of Pseudomonas putida KT2440 to osmotic, oxidative, and imipenem stress conditions at two time points was investigated via identification of differentially expressed mRNAs and small RNAs (sRNAs). A total of 440 sRNA transcripts were detected, of which 10% correspond to previously annotated sRNAs, 40% to novel intergenic transcripts, and 50% to novel transcripts antisense to annotated genes. Each stress elicits a unique response as far as the extent and dynamics of the transcriptional changes. Nearly 200 protein-encoding genes exhibited significant changes in all stress types, implicating their participation in a general stress response. Almost half of the sRNA transcripts were differentially expressed under at least one condition, suggesting possible functional roles in the cellular response to stress conditions. The data show a larger fraction of differentially expressed sRNAs than of mRNAs with >5-fold expression changes. The work provides detailed insights into the mechanisms through which P. putida responds to different stress conditions and increases understanding of bacterial adaptation in natural and industrial settings. IMPORTANCE This study maps the complete transcriptional response of P. putida KT2440 to osmotic, oxidative, and imipenem stress conditions at short and long exposure times. Over 400 sRNA transcripts, consisting of both intergenic and antisense transcripts, were detected, increasing the number of identified sRNA transcripts in the strain by a factor of 10. Unique responses to each type of stress are documented, including both the extent and dynamics of the gene expression changes. The work adds rich detail to previous knowledge of stress response mechanisms due to the depth of the RNA sequencing data. Almost half of the sRNAs exhibit significant expression changes under at least one
Bojanovič, Klara; D'Arrigo, Isotta
2017-01-01
ABSTRACT Bacteria cope with and adapt to stress by modulating gene expression in response to specific environmental cues. In this study, the transcriptional response of Pseudomonas putida KT2440 to osmotic, oxidative, and imipenem stress conditions at two time points was investigated via identification of differentially expressed mRNAs and small RNAs (sRNAs). A total of 440 sRNA transcripts were detected, of which 10% correspond to previously annotated sRNAs, 40% to novel intergenic transcripts, and 50% to novel transcripts antisense to annotated genes. Each stress elicits a unique response as far as the extent and dynamics of the transcriptional changes. Nearly 200 protein-encoding genes exhibited significant changes in all stress types, implicating their participation in a general stress response. Almost half of the sRNA transcripts were differentially expressed under at least one condition, suggesting possible functional roles in the cellular response to stress conditions. The data show a larger fraction of differentially expressed sRNAs than of mRNAs with >5-fold expression changes. The work provides detailed insights into the mechanisms through which P. putida responds to different stress conditions and increases understanding of bacterial adaptation in natural and industrial settings. IMPORTANCE This study maps the complete transcriptional response of P. putida KT2440 to osmotic, oxidative, and imipenem stress conditions at short and long exposure times. Over 400 sRNA transcripts, consisting of both intergenic and antisense transcripts, were detected, increasing the number of identified sRNA transcripts in the strain by a factor of 10. Unique responses to each type of stress are documented, including both the extent and dynamics of the gene expression changes. The work adds rich detail to previous knowledge of stress response mechanisms due to the depth of the RNA sequencing data. Almost half of the sRNAs exhibit significant expression changes under at least
The Mediator complex: a central integrator of transcription
Allen, Benjamin L.; Taatjes, Dylan J.
2016-01-01
The RNA polymerase II (pol II) enzyme transcribes all protein-coding and most non-coding RNA genes and is globally regulated by Mediator, a large, conformationally flexible protein complex with variable subunit composition (for example, a four-subunit CDK8 module can reversibly associate). These biochemical characteristics are fundamentally important for Mediator's ability to control various processes important for transcription, including organization of chromatin architecture and regulation of pol II pre-initiation, initiation, re-initiation, pausing, and elongation. Although Mediator exists in all eukaryotes, a variety of Mediator functions appear to be specific to metazoans, indicative of more diverse regulatory requirements. PMID:25693131
Medrano, A I; DiRita, V J; Castillo, G; Sanchez, J
1999-05-01
Vibrio cholerae El Tor require special in vitro culture conditions, consisting of an initial static growth period followed by shift to shaking (AKI conditions), for expression of cholera toxin (CT) and toxin coregulated pili (TCP). ToxT, a regulator whose initial transcription depends on the ToxR regulator, positively modulates expression of CT and TCP. To help understand control of CT and TCP in El Tor vibrios, we monitored ctxAB and ToxR-dependent toxT transcription by time course primer extension assays. AKI conditions stimulated CT synthesis with an absence of ctxAB transcription during static growth followed by induction upon shaking. ToxR-dependent toxT transcription was induced at the end of the static growth period but was transient, stopping shortly after shaking was initiated but, interestingly, also if the static phase was prolonged. Immunoblot assays showed that ToxR protein levels were not coincidentally transient, implying a protein on/off switch mechanism for ToxR. Despite the transient activation by ToxR, transcription of ctxAB was maintained during shaking. This finding suggested continued toxT expression, possibly through relay transcription from another promoter. The 12.6-kb distant upstream tcpA promoter responsible for expression of the TCP operon has been proposed to provide an alternate toxT message by readthrough transcription. Activation of the tcpA promoter is supported by increased expression of TcpA protein during the shaking phase of the culture. Readthrough transcription of toxT from tcpA would be compatible with reverse transcription-PCR evidence for a toxT mRNA at times when ToxR-dependent transcription was no longer detectable by primer extension.
SATRAT: Staphylococcus aureus transcript regulatory network analysis tool.
Gopal, Tamilselvi; Nagarajan, Vijayaraj; Elasri, Mohamed O
2015-01-01
Staphylococcus aureus is a commensal organism that primarily colonizes the nose of healthy individuals. S. aureus causes a spectrum of infections that range from skin and soft-tissue infections to fatal invasive diseases. S. aureus uses a large number of virulence factors that are regulated in a coordinated fashion. The complex regulatory mechanisms have been investigated in numerous high-throughput experiments. Access to this data is critical to studying this pathogen. Previously, we developed a compilation of microarray experimental data to enable researchers to search, browse, compare, and contrast transcript profiles. We have substantially updated this database and have built a novel exploratory tool-SATRAT-the S. aureus transcript regulatory network analysis tool, based on the updated database. This tool is capable of performing deep searches using a query and generating an interactive regulatory network based on associations among the regulators of any query gene. We believe this integrated regulatory network analysis tool would help researchers explore the missing links and identify novel pathways that regulate virulence in S. aureus. Also, the data model and the network generation code used to build this resource is open sourced, enabling researchers to build similar resources for other bacterial systems.
Qiao, Huan; May, James M.
2012-01-01
Transcription of the ascorbate transporter, SVCT2, is driven by two distinct promoters in exon 1 of the transporter sequence. The exon 1a promoter lacks a classical transcription start site and little is known about regulation of promoter activity in the transcription start site core (TSSC) region. Here we present evidence that the TSSC binds the multifunctional initiator-binding protein YY1. Electrophoresis shift assays using YY1 antibody showed that YY1 is present as one of two major complexes that specifically bind to the TSSC. The other complex contains the transcription factor NF-Y. Mutations in the TSSC that decreased YY1 binding also impaired the exon 1a promoter activity despite the presence of an upstream activating NF-Y/USF complex, suggesting that YY1 is involved in the regulation of the exon 1a transcription. Furthermore, YY1 interaction with NF-Y and/or USF synergistically enhanced the exon 1a promoter activity in transient transfections and co-activator p300 enhanced their synergistic activation. We propose that the TSSC plays a vital role in the exon 1a transcription and that this function is partially carried out by the transcription factor YY1. Moreover, co-activator p300 might be able to synergistically enhance the TSSC function via a “bridge” mechanism with upstream sequences. PMID:22532872
NASA Astrophysics Data System (ADS)
Sala, Adrien; Shoaib, Muhammad; Anufrieva, Olga; Mutharasu, Gnanavel; Jahan Hoque, Rawnak; Yli-Harja, Olli; Kandhavelu, Meenakshisundaram
2015-05-01
In E. coli, promoter closed and open complexes are key steps in transcription initiation, where magnesium-dependent RNA polymerase catalyzes RNA synthesis. However, the exact mechanism of initiation remains to be fully elucidated. Here, using single mRNA detection and dual reporter studies, we show that increased intracellular magnesium concentration affects Plac initiation complex formation resulting in a highly dynamic process over the cell growth phases. Mg2+ regulates transcription transition, which modulates bimodality of mRNA distribution in the exponential phase. We reveal that Mg2+ regulates the size and frequency of the mRNA burst by changing the open complex duration. Moreover, increasing magnesium concentration leads to higher intrinsic and extrinsic noise in the exponential phase. RNAP-Mg2+ interaction simulation reveals critical movements creating a shorter contact distance between aspartic acid residues and Nucleotide Triphosphate residues and increasing electrostatic charges in the active site. Our findings provide unique biophysical insights into the balanced mechanism of genetic determinants and magnesium ion in transcription initiation regulation during cell growth.
Bravo, Andrea G; Loizeau, Jean-Luc; Dranguet, Perrine; Makri, Stamatina; Björn, Erik; Ungureanu, Viorel Gh; Slaveykova, Vera I; Cosio, Claudia
2016-06-01
Chlor-alkali plants using mercury (Hg) cell technology are acute point sources of Hg pollution in the aquatic environment. While there have been recent efforts to reduce the use of Hg cells, some of the emitted Hg can be transformed to neurotoxic methylmercury (MeHg). Here, we aimed (i) to study the dispersion of Hg in four reservoirs located downstream of a chlor-alkali plant along the Olt River (Romania) and (ii) to track the activity of bacterial functional genes involved in Hg methylation. Total Hg (THg) concentrations in water and sediments decreased successively from the initial reservoir to downstream reservoirs. Suspended fine size particles and seston appeared to be responsible for the transport of THg into downstream reservoirs, while macrophytes reflected the local bioavailability of Hg. The concentration and proportion of MeHg were correlated with THg, but were not correlated with bacterial activity in sediments, while the abundance of hgcA transcript correlated with organic matter and Cl(-) concentration, indicating the importance of Hg bioavailability in sediments for Hg methylation. Our data clearly highlights the importance of considering Hg contamination as a legacy pollutant since there is a high risk of continued Hg accumulation in food webs long after Hg-cell phase out.
Competition for space during bacterial colonization of a surface.
Lloyd, Diarmuid P; Allen, Rosalind J
2015-09-06
Competition for space is ubiquitous in the ecology of both microorganisms and macro-organisms. We introduce a bacterial model system in which the factors influencing competition for space during colonization of an initially empty habitat can be tracked directly. Using fluorescence microscopy, we follow the fate of individual Escherichia coli bacterial cell lineages as they undergo expansion competition (the race to be the first to colonize a previously empty territory), and as they later compete at boundaries between clonal territories. Our experiments are complemented by computer simulations of a lattice-based model. We find that both expansion competition, manifested as differences in individual cell lag times, and boundary competition, manifested as effects of neighbour cell geometry, can play a role in colonization success, particularly when lineages expand exponentially. This work provides a baseline for investigating how ecological interactions affect colonization of space by bacterial populations, and highlights the potential of bacterial model systems for the testing and development of ecological theory. © 2015 The Authors.
Competition for space during bacterial colonization of a surface
Lloyd, Diarmuid P.; Allen, Rosalind J.
2015-01-01
Competition for space is ubiquitous in the ecology of both microorganisms and macro-organisms. We introduce a bacterial model system in which the factors influencing competition for space during colonization of an initially empty habitat can be tracked directly. Using fluorescence microscopy, we follow the fate of individual Escherichia coli bacterial cell lineages as they undergo expansion competition (the race to be the first to colonize a previously empty territory), and as they later compete at boundaries between clonal territories. Our experiments are complemented by computer simulations of a lattice-based model. We find that both expansion competition, manifested as differences in individual cell lag times, and boundary competition, manifested as effects of neighbour cell geometry, can play a role in colonization success, particularly when lineages expand exponentially. This work provides a baseline for investigating how ecological interactions affect colonization of space by bacterial populations, and highlights the potential of bacterial model systems for the testing and development of ecological theory. PMID:26333814
Transcription through the roadblocks: the role of RNA polymerase cooperation
Epshtein, Vitaly; Toulmé, Francine; Rahmouni, A.Rachid; Borukhov, Sergei; Nudler, Evgeny
2003-01-01
During transcription, cellular RNA polymerases (RNAP) have to deal with numerous potential roadblocks imposed by various DNA binding proteins. Many such proteins partially or completely interrupt a single round of RNA chain elongation in vitro. Here we demonstrate that Escherichia coli RNAP can effectively read through the site-specific DNA-binding proteins in vitro and in vivo if more than one RNAP molecule is allowed to initiate from the same promoter. The anti-roadblock activity of the trailing RNAP does not require transcript cleavage activity but relies on forward translocation of roadblocked complexes. These results support a cooperation model of transcription whereby RNAP molecules behave as ‘partners’ helping one another to traverse intrinsic and extrinsic obstacles. PMID:12970184
Biallelic Germline Transcription at the κ Immunoglobulin Locus
Singh, Nandita; Bergman, Yehudit; Cedar, Howard; Chess, Andrew
2003-01-01
Rearrangement of antigen receptor genes generates a vast array of antigen receptors on lymphocytes. The establishment of allelic exclusion in immunoglobulin genes requires differential treatment of the two sequence identical alleles. In the case of the κ immunoglobulin locus, changes in chromatin structure, methylation, and replication timing of the two alleles are all potentially involved in regulating rearrangement. Additionally, germline transcription of the κ locus which precedes rearrangement has been proposed to reflect an opening of the chromatin structure rendering it available for rearrangement. As the initial restriction of rearrangement to one allele is critical to the establishment of allelic exclusion, a key question is whether or not germline transcription at the κ locus is monoallelic or biallelic. We have used a sensitive reverse transcription-polymerase chain reaction (RT-PCR) assay and an RNA–fluorescence in situ hybridization (FISH) to show that germline transcription of the κ locus is biallelic in wild-type immature B cells and in recombination activating gene (RAG)−/−, μ+ B cells. Therefore, germline transcription is unlikely to dictate which allele will be rearranged first and rather reflects a general opening on both alleles that must be accompanied by a mechanism allowing one of the two alleles to be rearranged first. PMID:12629064
Qu, Jie; Ji, Shaoyi; Wallace, Andrew J.; Wu, Jian; Li, Yi; Gopalan, Venkat; Ding, Biao
2016-01-01
Some DNA-dependent RNA polymerases (DdRPs) possess RNA-dependent RNA polymerase activity, as was first discovered in the replication of Potato spindle tuber viroid (PSTVd) RNA genome in tomato (Solanum lycopersicum). Recent studies revealed that this activity in bacteria and mammals is important for transcriptional and posttranscriptional regulatory mechanisms. Here, we used PSTVd as a model to uncover auxiliary factors essential for RNA-templated transcription by DdRP. PSTVd replication in the nucleoplasm generates (−)-PSTVd intermediates and (+)-PSTVd copies. We found that the Nicotiana benthamiana canonical 9-zinc finger (ZF) Transcription Factor IIIA (TFIIIA-9ZF) as well as its variant TFIIIA-7ZF interacted with (+)-PSTVd, but only TFIIIA-7ZF interacted with (−)-PSTVd. Suppression of TFIIIA-7ZF reduced PSTVd replication, and overexpression of TFIIIA-7ZF enhanced PSTVd replication in planta. Consistent with the locale of PSTVd replication, TFIIIA-7ZF was found in the nucleoplasm and nucleolus, in contrast to the strictly nucleolar localization of TFIIIA-9ZF. Footprinting assays revealed that only TFIIIA-7ZF bound to a region of PSTVd critical for initiating transcription. Furthermore, TFIIIA-7ZF strongly enhanced the in vitro transcription of circular (+)-PSTVd by partially purified Pol II. Together, our results identify TFIIIA-7ZF as a dedicated cellular transcription factor that acts in DdRP-catalyzed RNA-templated transcription, highlighting both the extraordinary evolutionary adaptation of viroids and the potential of DdRPs for a broader role in cellular processes. PMID:27113774
Step-wise loss of bacterial flagellar torsion confers progressive phagocytic evasion.
Lovewell, Rustin R; Collins, Ryan M; Acker, Julie L; O'Toole, George A; Wargo, Matthew J; Berwin, Brent
2011-09-01
Phagocytosis of bacteria by innate immune cells is a primary method of bacterial clearance during infection. However, the mechanisms by which the host cell recognizes bacteria and consequentially initiates phagocytosis are largely unclear. Previous studies of the bacterium Pseudomonas aeruginosa have indicated that bacterial flagella and flagellar motility play an important role in colonization of the host and, importantly, that loss of flagellar motility enables phagocytic evasion. Here we use molecular, cellular, and genetic methods to provide the first formal evidence that phagocytic cells recognize bacterial motility rather than flagella and initiate phagocytosis in response to this motility. We demonstrate that deletion of genes coding for the flagellar stator complex, which results in non-swimming bacteria that retain an initial flagellar structure, confers resistance to phagocytic binding and ingestion in several species of the gamma proteobacterial group of Gram-negative bacteria, indicative of a shared strategy for phagocytic evasion. Furthermore, we show for the first time that susceptibility to phagocytosis in swimming bacteria is proportional to mot gene function and, consequently, flagellar rotation since complementary genetically- and biochemically-modulated incremental decreases in flagellar motility result in corresponding and proportional phagocytic evasion. These findings identify that phagocytic cells respond to flagellar movement, which represents a novel mechanism for non-opsonized phagocytic recognition of pathogenic bacteria.
Cellular microRNAs up-regulate transcription via interaction with promoter TATA-box motifs.
Zhang, Yijun; Fan, Miaomiao; Zhang, Xue; Huang, Feng; Wu, Kang; Zhang, Junsong; Liu, Jun; Huang, Zhuoqiong; Luo, Haihua; Tao, Liang; Zhang, Hui
2014-12-01
The TATA box represents one of the most prevalent core promoters where the pre-initiation complexes (PICs) for gene transcription are assembled. This assembly is crucial for transcription initiation and well regulated. Here we show that some cellular microRNAs (miRNAs) are associated with RNA polymerase II (Pol II) and TATA box-binding protein (TBP) in human peripheral blood mononuclear cells (PBMCs). Among them, let-7i sequence specifically binds to the TATA-box motif of interleukin-2 (IL-2) gene and elevates IL-2 mRNA and protein production in CD4(+) T-lymphocytes in vitro and in vivo. Through direct interaction with the TATA-box motif, let-7i facilitates the PIC assembly and transcription initiation of IL-2 promoter. Several other cellular miRNAs, such as mir-138, mir-92a or mir-181d, also enhance the promoter activities via binding to the TATA-box motifs of insulin, calcitonin or c-myc, respectively. In agreement with the finding that an HIV-1-encoded miRNA could enhance viral replication through targeting the viral promoter TATA-box motif, our data demonstrate that the interaction with core transcription machinery is a novel mechanism for miRNAs to regulate gene expression. © 2014 Zhang et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Moran, M A; Hodson, R E
1989-01-01
Bacterial production at the expense of vascular plant detritus was measured for three emergent plant species (Juncus effusus, Panicum hemitomon, and Typha latifolia) degrading in the littoral zone of a thermally impacted lake. Bacterial secondary production, measured as tritiated thymidine incorporation into DNA, ranged from 0.01 to 0.81 microgram of bacterial C mg of detritus-1 day-1. The three plant species differed with respect to the amount of bacterial productivity they supported per milligram of detritus, in accordance with the predicted biodegradability of the plant material based on initial nitrogen content, lignin content, and C/N ratio. Bacterial production also varied throughout the 22 weeks of in situ decomposition and was positively related to the nitrogen content and lignin content of the remaining detritus, as well as to the temperature of the lake water. Over time, production was negatively related to the C/N ratio and cellulose content of the degrading plant material. Bacterial production on degrading plant material was also calculated on the basis of plant surface area and ranged from 0.17 to 1.98 micrograms of bacterial C cm-2 day-1. Surface area-based calculations did not correlate well with either initial plant composition or changing composition of the remaining detritus during decomposition. The rate of bacterial detritus degradation, calculated from measured production of surface-attached bacteria, was much lower than the actual rate of weight loss of plant material. This discrepancy may be attributable to the importance of nonbacterial organisms in the degradation and loss of plant material from litterbags or to the microbially mediated solubilization of particulate material prior to bacterial utilization, or both. PMID:2802603
Coupled effects of chemotaxis and growth on traveling bacterial waves.
Yan, Zhifeng; Bouwer, Edward J; Hilpert, Markus
2014-08-01
Traveling bacterial waves are capable of improving contaminant remediation in the subsurface. It is fairly well understood how bacterial chemotaxis and growth separately affect the formation and propagation of such waves. However, their interaction is not well understood. We therefore perform a modeling study to investigate the coupled effects of chemotaxis and growth on bacterial migration, and examine their effects on contaminant remediation. We study the waves by using different initial electron acceptor concentrations for different bacteria and substrate systems. Three types of traveling waves can occur: a chemotactic wave due to the biased movement of chemotactic bacteria resulting from metabolism-generated substrate concentration gradients; a growth/decay/motility wave due to a dynamic equilibrium between bacterial growth, decay and random motility; and an integrated wave due to the interaction between bacterial chemotaxis and growth. Chemotaxis hardly enhances the bacterial propagation if it is too weak to form a chemotactic wave or its wave speed is less than half of the growth/decay/motility wave speed. However, chemotaxis significantly accelerates bacterial propagation once its wave speed exceeds the growth/decay/motility wave speed. When convection occurs, it speeds up the growth/decay/motility wave but slows down or even eliminates the chemotactic wave due to the dispersion. Bacterial survival proves particularly important for bacterial propagation. Therefore we develop a conceptual model to estimate the speed of growth/decay/motility waves. Copyright © 2014 Elsevier B.V. All rights reserved.
Interaction of two photoreceptors in the regulation of bacterial photosynthesis genes
Metz, Sebastian; Haberzettl, Kerstin; Frühwirth, Sebastian; Teich, Kristin; Hasewinkel, Christian; Klug, Gabriele
2012-01-01
The expression of photosynthesis genes in the facultatively photosynthetic bacterium Rhodobacter sphaeroides is controlled by the oxygen tension and by light quantity. Two photoreceptor proteins, AppA and CryB, have been identified in the past, which are involved in this regulation. AppA senses light by its N-terminal BLUF domain, its C-terminal part binds heme and is redox-responsive. Through its interaction to the transcriptional repressor PpsR the AppA photoreceptor controls expression of photosynthesis genes. The cryptochrome-like protein CryB was shown to affect regulation of photosynthesis genes, but the underlying signal chain remained unknown. Here we show that CryB interacts with the C-terminal domain of AppA and modulates the binding of AppA to the transcriptional repressor PpsR in a light-dependent manner. Consequently, binding of the transcription factor PpsR to its DNA target is affected by CryB. In agreement with this, all genes of the PpsR regulon showed altered expression levels in a CryB deletion strain after blue-light illumination. These results elucidate for the first time how a bacterial cryptochrome affects gene expression. PMID:22434878
Interaction of two photoreceptors in the regulation of bacterial photosynthesis genes.
Metz, Sebastian; Haberzettl, Kerstin; Frühwirth, Sebastian; Teich, Kristin; Hasewinkel, Christian; Klug, Gabriele
2012-07-01
The expression of photosynthesis genes in the facultatively photosynthetic bacterium Rhodobacter sphaeroides is controlled by the oxygen tension and by light quantity. Two photoreceptor proteins, AppA and CryB, have been identified in the past, which are involved in this regulation. AppA senses light by its N-terminal BLUF domain, its C-terminal part binds heme and is redox-responsive. Through its interaction to the transcriptional repressor PpsR the AppA photoreceptor controls expression of photosynthesis genes. The cryptochrome-like protein CryB was shown to affect regulation of photosynthesis genes, but the underlying signal chain remained unknown. Here we show that CryB interacts with the C-terminal domain of AppA and modulates the binding of AppA to the transcriptional repressor PpsR in a light-dependent manner. Consequently, binding of the transcription factor PpsR to its DNA target is affected by CryB. In agreement with this, all genes of the PpsR regulon showed altered expression levels in a CryB deletion strain after blue-light illumination. These results elucidate for the first time how a bacterial cryptochrome affects gene expression.
Dang, Fengfeng; Wang, Yuna; She, Jianju; Lei, Yufen; Liu, Zhiqin; Eulgem, Thomas; Lai, Yan; Lin, Jing; Yu, Lu; Lei, Dan; Guan, Deyi; Li, Xia; Yuan, Qian; He, Shuilin
2014-03-01
WRKY proteins are encoded by a large gene family and are linked to many biological processes across a range of plant species. The functions and underlying mechanisms of WRKY proteins have been investigated primarily in model plants such as Arabidopsis and rice. The roles of these transcription factors in non-model plants, including pepper and other Solanaceae, are poorly understood. Here, we characterize the expression and function of a subgroup IIe WRKY protein from pepper (Capsicum annuum), denoted as CaWRKY27. The protein localized to nuclei and activated the transcription of a reporter GUS gene construct driven by the 35S promoter that contained two copies of the W-box in its proximal upstream region. Inoculation of pepper cultivars with Ralstonia solanacearum induced the expression of CaWRKY27 transcript in 76a, a bacterial wilt-resistant pepper cultivar, whereas it downregulated the expression of CaWRKY27 transcript in Gui-1-3, a bacterial wilt-susceptible pepper cultivar. CaWRKY27 transcript levels were also increased by treatments with salicylic acid (SA), methyl jasmonate (MeJA) and ethephon (ETH). Transgenic tobacco plants overexpressing CaWRKY27 exhibited resistance to R. solanacearum infection compared to that of wild-type plants. This resistance was coupled with increased transcript levels in a number of marker genes, including hypersensitive response genes, and SA-, JA- and ET-associated genes. By contrast, virus-induced gene silencing (VIGS) of CaWRKY27 increased the susceptibility of pepper plants to R. solanacearum infection. These results suggest that CaWRKY27 acts as a positive regulator in tobacco resistance responses to R. solanacearum infection through modulation of SA-, JA- and ET-mediated signaling pathways. © 2013 Scandinavian Plant Physiology Society.
USDA-ARS?s Scientific Manuscript database
E. coli DksA is in a class of transcription factors that modify RNA polymerase (RNAP) in all three kingdoms of life. DksA potentiates the effects of the global regulator ppGpp and the initiating NTP, controlling transcription initiation without binding to DNA. Incorporating benzoyl-phenylalanine (Bp...
TEFM is a potent stimulator of mitochondrial transcription elongation in vitro
Posse, Viktor; Shahzad, Saba; Falkenberg, Maria; Hällberg, B. Martin; Gustafsson, Claes M.
2015-01-01
A single-subunit RNA polymerase, POLRMT, transcribes the mitochondrial genome in human cells. Recently, a factor termed as the mitochondrial transcription elongation factor, TEFM, was shown to stimulate transcription elongation in vivo, but its effect in vitro was relatively modest. In the current work, we have isolated active TEFM in recombinant form and used a reconstituted in vitro transcription system to characterize its activities. We show that TEFM strongly promotes POLRMT processivity as it dramatically stimulates the formation of longer transcripts. TEFM also abolishes premature transcription termination at conserved sequence block II, an event that has been linked to primer formation during initiation of mtDNA synthesis. We show that POLRMT pauses at a wide range of sites in a given DNA sequence. In the absence of TEFM, this leads to termination; however, the presence of TEFM abolishes this effect and aids POLRMT in continuation of transcription. Further, we show that TEFM substantially increases the POLRMT affinity to an elongation-like DNA:RNA template. In combination with previously published in vivo observations, our data establish TEFM as an essential component of the mitochondrial transcription machinery. PMID:25690892
Yuzenkova, Yulia; Gamba, Pamela; Herber, Martijn; Attaiech, Laetitia; Shafeeq, Sulman; Kuipers, Oscar P; Klumpp, Stefan; Zenkin, Nikolay; Veening, Jan-Willem
2014-01-01
Transcription by RNA polymerase may be interrupted by pauses caused by backtracking or misincorporation that can be resolved by the conserved bacterial Gre-factors. However, the consequences of such pausing in the living cell remain obscure. Here, we developed molecular biology and transcriptome sequencing tools in the human pathogen Streptococcus pneumoniae and provide evidence that transcription elongation is rate-limiting on highly expressed genes. Our results suggest that transcription elongation may be a highly regulated step of gene expression in S. pneumoniae. Regulation is accomplished via long-living elongation pauses and their resolution by elongation factor GreA. Interestingly, mathematical modeling indicates that long-living pauses cause queuing of RNA polymerases, which results in 'transcription traffic jams' on the gene and thus blocks its expression. Together, our results suggest that long-living pauses and RNA polymerase queues caused by them are a major problem on highly expressed genes and are detrimental for cell viability. The major and possibly sole function of GreA in S. pneumoniae is to prevent formation of backtracked elongation complexes. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Bacterial communities in the fruit bodies of ground basidiomycetes
NASA Astrophysics Data System (ADS)
Zagryadskaya, Yu. A.; Lysak, L. V.; Chernov, I. Yu.
2015-06-01
Fruit bodies of basidiomycetes at different stages of decomposition serve as specific habitats in forest biocenoses for bacteria and differ significantly with respect to the total bacterial population and abundance of particular bacterial genera. A significant increase in the total bacterial population estimated by the direct microscopic method with acridine orange staining and in the population of saprotrophic bacteria (inoculation of glucose peptone yeast agar) in fruit bodies of basidiomycetes Armillaria mellea and Coprinus comatus was recorded at the final stage of their decomposition in comparison with the initial stage. Gramnegative bacteria predominated in the tissues of fruit bodies at all the stages of decomposition and were represented at the final stage by the Aeromonas, Vibrio, and Pseudomonas genera (for fruit bodies of A. mellea) the Pseudomonas genus (for fruit bodies of C. comatus). The potential influence of bacterial communities in the fruit bodies of soil basidiomycetes on the formation of bacterial communities in the upper soil horizons in forest biocenoses is discussed. The loci connected with the development and decomposition of fruit bodies of basidiomycetes on the soil surface are promising for targeted search of Gram-negative bacteria, the important objects of biotechnology.
Kim, Kihoon; Kim, AeRi
2010-09-01
Chromatin structure is modulated during transcriptional activation. The changes include the association of transcriptional activators, formation of hypersensitive sites and covalent modifications of histones. To understand the order of the various changes accompanying transcriptional activation, we analyzed the mouse beta globin gene, which is transcriptionally inducible in erythroid MEL cells over a time course of HMBA treatment. Transcription of the globin genes requires the locus control region (LCR) consisting of several hypersensitive sites (HSs). Erythroid specific transcriptional activators such as NF-E2, GATA-1, TAL1 and EKLF were associated with the LCR in the uninduced state before transcriptional activation. The HSs of the LCR were formed in this state as revealed by high sensitivity to DNase I and MNase attack. However the binding of transcriptional activators and the depletion of histones were observed in the promoter of the beta globin gene only after transcriptional activation. In addition, various covalent histone modifications were sequentially detected in lysine residues of histone H3 during the activation. Acetylation of K9, K36 and K27 was notable in both LCR HSs and gene after induction but before transcriptional initiation. Inactive histone marks such as K9me2, K36me2 and K27me2 were removed coincident with transcriptional initiation in the gene region. Taken together, these results indicate that LCR has a substantially active structure in the uninduced state while transcriptional activation serially adds active marks, including histone modifications, and removes inactive marks in the target gene of the LCR. Copyright (c) 2010 Elsevier Ltd. All rights reserved.
Rieger, Tomáš; Neubauer, Zdeněk; Blahůšková, Anna; Cvrčková, Fatima
2008-01-01
The bacterium Serratia marcescens produces a plethora of multicellular shapes of different colorations on solid substrates, allowing immediate visual detection of varieties. Such a plasticity allows studies on multicellular community scale spanning two extremes, from well-elaborated individual colonies to undifferentiated cell mass. For a single strain and medium, we obtained a range of different multicellular bodies, depending on the layout of initial plating. Four principal factors affecting the morphogenetic pathways of such bodies can be distinguished: (1) amount, density and distribution pattern of founder cells; (2) the configuration of surrounding free medium; (3) the presence and character of other bacterial bodies sharing the same niche; and (4) self-perception, resulting in delimitation towards other bodies. The last feature results in an ability of well-formed multicellular individuals to maintain their identity upon a close mutual contact, as well as in spontaneous separation of cell masses in experimental chimeras. We propose an “embryo-like” colony model where multicellular bacterial bodies develop along genuine ontogenetic pathways inherent to the given species (clone), while external shaping forces (like nutrient gradients, pH, etc.,) exert not formative, but only regulative roles in the process. PMID:19513204
Transcriptional activation of the tad type IVb pilus operon by PypB in Yersinia enterocolitica.
Schilling, Jennifer; Wagner, Karin; Seekircher, Stephanie; Greune, Lilo; Humberg, Verena; Schmidt, M Alexander; Heusipp, Gerhard
2010-07-01
Type IV pili are virulence factors in various bacteria and mediate, among other functions, the colonization of diverse surfaces. Various subclasses of type IV pili have been identified, but information on pilus expression, biogenesis, and the associated phenotypes is sparse for the genus Yersinia. We recently described the identification of PypB as a transcriptional regulator in Yersinia enterocolitica. Here we show that the pypB gene is associated with the tad locus, a genomic island that is widespread among bacterial and archaeal species. The genetic linkage of pypB with the tad locus is conserved throughout the yersiniae but is not found among other bacteria carrying the tad locus. We show that the genes of the tad locus form an operon in Y. enterocolitica that is controlled by PypB and that pypB is part of this operon. The tad genes encode functions necessary for the biogenesis of the Flp subfamily of type IVb pili initially described for Aggregatibacter actinomycetemcomitans to mediate a tight-adherence phenotype. In Y. enterocolitica, the Flp pilin protein shows some peculiarities in its amino acid sequence that imply similarities as well as differences compared to typical motifs found in the Flp subtype of type IVb pili. Flp is expressed and processed after PypB overproduction, resulting in microcolony formation but not in increased adherence to biotic or abiotic surfaces. Our data describe the transcriptional regulation of the tad type IVb pilus operon by PypB in Y. enterocolitica but fail to show most previously described phenotypes associated with this type of pilus in other bacteria.
Bernbom, Nete; Ng, Yoke Yin; Olsen, Stefan Møller
2013-01-01
The purpose of the present study was to determine if the monoculture antifouling effect of several pigmented pseudoalteromonads was retained in in vitro mesocosm systems using natural coastal seawater and when the bacteria were embedded in paint used on surfaces submerged in coastal waters. Pseudoalteromonas piscicida survived on a steel surface and retained antifouling activity for at least 53 days in sterile seawater, whereas P. tunicata survived and had antifouling activity for only 1 week. However, during the first week, all Pseudoalteromonas strains facilitated rather than prevented bacterial attachment when used to coat stainless steel surfaces and submerged in mesocosms with natural seawater. The bacterial density on surfaces coated with sterile growth medium was 105 cells/cm2 after 7 days, whereas counts on surfaces precoated with Pseudoalteromonas were significantly higher, at 106 to 108 cells/cm2. However, after 53 days, seven of eight Pseudoalteromonas strains had reduced total bacterial adhesion compared to the control. P. piscicida, P. antarctica, and P. ulvae remained on the surface, at levels similar to those in the initial coating, whereas P. tunicata could not be detected. Larger fouling organisms were observed on all plates precoated with Pseudoalteromonas; however, plates coated only with sterile growth medium were dominated by a bacterial biofilm. Suspensions of a P. piscicida strain and a P. tunicata strain were incorporated into ship paints (Hempasil x3 87500 and Hempasil 77500) used on plates that were placed at the Hempel A/S test site in Jyllinge Harbor. For the first 4 months, no differences were observed between control plates and treated plates, but after 5 to 6 months, the control plates were more fouled than the plates with pseudoalteromonad-based paint. Our study demonstrates that no single laboratory assay can predict antifouling effects and that a combination of laboratory and real-life methods must be used to determine the
Regulation of RB Transcription In Vivo by RB Family Members▿ ‡
Burkhart, Deborah L.; Ngai, Lynn K.; Roake, Caitlin M.; Viatour, Patrick; Thangavel, Chellappagounder; Ho, Victoria M.; Knudsen, Erik S.; Sage, Julien
2010-01-01
In cancer cells, the retinoblastoma tumor suppressor RB is directly inactivated by mutation in the RB gene or functionally inhibited by abnormal activation of cyclin-dependent kinase activity. While variations in RB levels may also provide an important means of controlling RB function in both normal and cancer cells, little is known about the mechanisms regulating RB transcription. Here we show that members of the RB and E2F families bind directly to the RB promoter. To investigate how the RB/E2F pathway may regulate Rb transcription, we generated reporter mice carrying an eGFP transgene inserted into a bacterial artificial chromosome containing most of the Rb gene. Expression of eGFP largely parallels that of Rb in transgenic embryos and adult mice. Using these reporter mice and mutant alleles for Rb, p107, and p130, we found that RB family members modulate Rb transcription in specific cell populations in vivo and in culture. Interestingly, while Rb is a target of the RB/E2F pathway in mouse and human cells, Rb expression does not strictly correlate with the cell cycle status of these cells. These experiments identify novel regulatory feedback mechanisms within the RB pathway in mammalian cells. PMID:20100864
Chromatin potentiates transcription
Nagai, Shigeki; Davis, Ralph E.; Mattei, Pierre Jean; Eagen, Kyle Patrick; Kornberg, Roger D.
2017-01-01
Chromatin isolated from the chromosomal locus of the PHO5 gene of yeast in a transcriptionally repressed state was transcribed with 12 pure proteins (80 polypeptides): RNA polymerase II, six general transcription factors, TFIIS, the Pho4 gene activator protein, and the SAGA, SWI/SNF, and Mediator complexes. Contrary to expectation, a nucleosome occluding the TATA box and transcription start sites did not impede transcription but rather, enhanced it: the level of chromatin transcription was at least sevenfold greater than that of naked DNA, and chromatin gave patterns of transcription start sites closely similar to those occurring in vivo, whereas naked DNA gave many aberrant transcripts. Both histone acetylation and trimethylation of H3K4 (H3K4me3) were important for chromatin transcription. The nucleosome, long known to serve as a general gene repressor, thus also performs an important positive role in transcription. PMID:28137832
NASA Astrophysics Data System (ADS)
Lerner, Eitan; Ingargiola, Antonino; Weiss, Shimon
2018-03-01
Bio-macromolecules carry out complicated functions through structural changes. To understand their mechanism of action, the structure of each step has to be characterized. While classical structural biology techniques allow the characterization of a few "structural snapshots" along the enzymatic cycle (usually of stable conformations), they do not cover all (and often fast interconverting) structures in the ensemble, where each may play an important functional role. Recently, several groups have demonstrated that structures of different conformations in solution could be solved by measuring multiple distances between different pairs of residues using single-molecule Förster resonance energy transfer (smFRET) and using them as constrains for hybrid/integrative structural modeling. However, this approach is limited in cases where the conformational dynamics is faster than the technique's temporal resolution. In this study, we combine existing tools that elucidate sub-millisecond conformational dynamics together with hybrid/integrative structural modeling to study the conformational states of the transcription bubble in the bacterial RNA polymerase-promoter open complex (RPo). We measured microsecond alternating laser excitation-smFRET of differently labeled lacCONS promoter dsDNA constructs. We used a combination of burst variance analysis, photon-by-photon hidden Markov modeling, and the FRET-restrained positioning and screening approach to identify two conformational states for RPo. The experimentally derived distances of one conformational state match the known crystal structure of bacterial RPo. The experimentally derived distances of the other conformational state have characteristics of a scrunched RPo. These findings support the hypothesis that sub-millisecond dynamics in the transcription bubble are responsible for transcription start site selection.
Redchuk, Taras A; Kaberniuk, Andrii A; Verkhusha, Vladislav V
2018-05-01
Near-infrared (NIR, 740-780 nm) optogenetic systems are well-suited to spectral multiplexing with blue-light-controlled tools. Here, we present two protocols, one for regulation of gene transcription and another for control of protein localization, that use a NIR-responsive bacterial phytochrome BphP1-QPAS1 optogenetic pair. In the first protocol, cells are transfected with the optogenetic constructs for independently controlling gene transcription by NIR (BphP1-QPAS1) and blue (LightOn) light. The NIR and blue-light-controlled gene transcription systems show minimal spectral crosstalk and induce a 35- to 40-fold increase in reporter gene expression. In the second protocol, the BphP1-QPAS1 pair is combined with a light-oxygen-voltage-sensing (LOV) domain-based construct into a single optogenetic tool, termed iRIS. This dual-light-controllable protein localization tool allows tridirectional protein translocation among the cytoplasm, nucleus and plasma membrane. Both procedures can be performed within 3-5 d. Use of NIR light-controlled optogenetic systems should advance basic and biomedical research.
Kuo, Tzu-Hsing; Williams, Julie A
2014-05-01
Sleep is known to increase as an acute response to infection. However, the function of this behavioral response in host defense is not well understood. To address this problem, we evaluated the effect of acute sleep deprivation on post-infection sleep and immune function in Drosophila. Laboratory. Drosophila melanogaster. Flies were subjected to sleep deprivation before (early DEP) or after (late DEP) bacterial infection. Relative to a non-deprived control, flies subjected to early DEP had enhanced sleep after infection as well as increased bacterial clearance and survival outcome. Flies subjected to late DEP experienced enhanced sleep following the deprivation period, and showed a modest improvement in survival outcome. Continuous DEP (early and late DEP) throughout infection also enhanced sleep later during infection and improved survival. However, improved survival in flies subjected to late or continuous DEP did not occur until after flies had experienced sleep. During infection, both early and late DEP enhanced NFκB transcriptional activity as measured by a luciferase reporter (κB-luc) in living flies. Early DEP also increased NFκB activity prior to infection. Flies that were deficient in expression of either the Relish or Dif NFκB transcription factors showed normal responses to early DEP. However, the effect of early DEP on post-infection sleep and survival was abolished in double mutants, which indicates that Relish and Dif have redundant roles in this process. Acute sleep deprivation elevated NFκB-dependent activity, increased post-infection sleep, and improved survival during bacterial infection.
Liu, J; Turnbough, C L
1994-01-01
In Escherichia coli, expression of the pyrC gene is regulated primarily by a translational control mechanism based on nucleotide-sensitive selection of transcriptional start sites at the pyrC promoter. When intracellular levels of CTP are high, pyrC transcripts are initiated predominantly with CTP at a site 7 bases downstream of the Pribnow box. These transcripts form a stable hairpin at their 5' ends that blocks ribosome binding. When the CTP level is low and the GTP level is high, conditions found in pyrimidine-limited cells, transcripts are initiated primarily with GTP at a site 9 bases downstream of the Pribnow box. These shorter transcripts are unable to form a hairpin at their 5' ends and are readily translated. In this study, we examined the effects of nucleotide sequence and position on the selection of transcriptional start sites at the pyrC promoter. We characterized promoter mutations that systematically alter the sequence at position 7 or 9 downstream of the Pribnow box or vary the spacing between the Pribnow box and wild-type transcriptional initiation region. The results reveal preferences for particular initiating nucleotides (ATP > or = GTP > UTP >> CTP) and for starting positions downstream of the Pribnow box (7 >> 6 and 8 > 9 > 10). The results indicate that optimal nucleotide-sensitive start site switching at the wild-type pyrC promoter is the result of competition between the preferred start site (position 7) that uses the poorest initiating nucleotide (CTP) and a weak start site (position 9) that uses a good initiating nucleotide (GTP). The sequence of the pyrC promoter also minimizes the synthesis of untranslatable transcripts and provides for maximum stability of the regulatory transcript hairpin. In addition, the results show that the effects of the mutations on pyrC expression and regulation are consistent with the current model for translational control. Possible effects of preferences for initiating nucleotides and start sites on the
A dual promoter system regulating λ DNA replication initiation
Olszewski, Paweł; Szambowska, Anna; Barańska, Sylwia; Narajczyk, Magdalena; Węgrzyn, Grzegorz; Glinkowska, Monika
2014-01-01
Transcription and DNA replication are tightly regulated to ensure coordination of gene expression with growth conditions and faithful transmission of genetic material to progeny. A large body of evidence has accumulated, indicating that encounters between protein machineries carrying out DNA and RNA synthesis occur in vivo and may have important regulatory consequences. This feature may be exacerbated in the case of compact genomes, like the one of bacteriophage λ, used in our study. Transcription that starts at the rightward pR promoter and proceeds through the λ origin of replication and downstream of it was proven to stimulate the initiation of λ DNA replication. Here, we demonstrate that the activity of a convergently oriented pO promoter decreases the efficiency of transcription starting from pR. Our results show, however, that a lack of the functional pO promoter negatively influences λ phage and λ-derived plasmid replication. We present data, suggesting that this effect is evoked by the enhanced level of the pR-driven transcription, occurring in the presence of the defective pO, which may result in the impeded formation of the replication initiation complex. Our data suggest that the cross talk between the two promoters regulates λ DNA replication and coordinates transcription and replication processes. PMID:24500197
Zhang, Vivian; Ludington, William B.; Eisen, Michael B.
2016-01-01
There is growing evidence that the microbes found in the digestive tracts of animals influence host biology, but we still do not understand how they accomplish this. Here, we evaluated how different microbial species commonly associated with laboratory-reared Drosophila melanogaster impact host biology at the level of gene expression in the dissected adult gut and in the entire adult organism. We observed that guts from animals associated from the embryonic stage with either zero, one or three bacterial species demonstrated indistinguishable transcriptional profiles. Additionally, we found that the gut transcriptional profiles of animals reared in the presence of the yeast Saccharomyces cerevisiae alone or in combination with bacteria could recapitulate those of conventionally-reared animals. In contrast, we found whole body transcriptional profiles of conventionally-reared animals were distinct from all of the treatments tested. Our data suggest that adult flies are insensitive to the ingestion of the bacteria found in their gut, but that prior to adulthood, different microbes impact the host in ways that lead to global transcriptional differences observable across the whole adult body. PMID:27898741
Effect of regulatory peptides on gene transcription.
Khavinson, V Kh; Shataeva, L K; Chernova, A A
2003-09-01
Experimental studies of geroprotective activity of synthetic oligopeptides and conformational analysis of the tetrapeptide Epithalon allowed us to hypothesize that regulatory oligopeptides directly initiate transcription of genes for vitally important proteins. Sequences of nucleotide pairs that can serve as binding sites for tetrapeptide Epithalon were identified in the promoter regions of retinal genes F379, telomerase, and RNA polymerase II.
[Acute care of patients with bacterial meningitis].
Stetefeld, H R; Dohmen, C
2016-04-01
Bacterial meningitis is a life-threatening emergency that is still associated with high mortality and poor outcome. The purpose of this article is to provide a review of clinical presentation, diagnostic procedure, therapy, and prognosis in bacterial meningitis. Prognostic factors which could be influenced positively are identified and a focused procedure in the emergency setting and for the treatment of complications are provided. This work is based on a literature search (PubMed, guidelines) and personal experience (standard operating procedures, SOP). Despite improved health care, bacterial meningitis is still associated with high mortality and poor neurological outcome, which has remained largely unaltered during recent decades. Diagnosis and, more importantly, effective therapy of bacterial meningitis are often delayed, having an immediate negative influence on clinical outcome. Neurological and nonneurological complications often necessitate intensive care and may occur rapidly or in the further course of the disease. Immediate initiation of effective therapy is crucial to positively influence mortality and neurological outcome. Antibiotics should be administered within 30 min after admission. To achieve this, a focused and well-organized procedure in the emergency setting is necessary. Because of intra- and extracranial complications, patients need to be treated on intensive care units including neurological expertise and interdisciplinary support.
Reagent-free bacterial identification using multivariate analysis of transmission spectra
NASA Astrophysics Data System (ADS)
Smith, Jennifer M.; Huffman, Debra E.; Acosta, Dayanis; Serebrennikova, Yulia; García-Rubio, Luis; Leparc, German F.
2012-10-01
The identification of bacterial pathogens from culture is critical to the proper administration of antibiotics and patient treatment. Many of the tests currently used in the clinical microbiology laboratory for bacterial identification today can be highly sensitive and specific; however, they have the additional burdens of complexity, cost, and the need for specialized reagents. We present an innovative, reagent-free method for the identification of pathogens from culture. A clinical study has been initiated to evaluate the sensitivity and specificity of this approach. Multiwavelength transmission spectra were generated from a set of clinical isolates including Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Staphylococcus aureus. Spectra of an initial training set of these target organisms were used to create identification models representing the spectral variability of each species using multivariate statistical techniques. Next, the spectra of the blinded isolates of targeted species were identified using the model achieving >94% sensitivity and >98% specificity, with 100% accuracy for P. aeruginosa and S. aureus. The results from this on-going clinical study indicate this approach is a powerful and exciting technique for identification of pathogens. The menu of models is being expanded to include other bacterial genera and species of clinical significance.
2011-01-01
Background Apomixis, asexual seed production in plants, holds great potential for agriculture as a means to fix hybrid vigor. Apospory is a form of apomixis where the embryo develops from an unreduced egg that is derived from a somatic nucellar cell, the aposporous initial, via mitosis. Understanding the molecular mechanism regulating aposporous initial specification will be a critical step toward elucidation of apomixis and also provide insight into developmental regulation and downstream signaling that results in apomixis. To discover candidate transcripts for regulating aposporous initial specification in P. squamulatum, we compared two transcriptomes derived from microdissected ovules at the stage of aposporous initial formation between the apomictic donor parent, P. squamulatum (accession PS26), and an apomictic derived backcross 8 (BC8) line containing only the Apospory-Specific Genomic Region (ASGR)-carrier chromosome from P. squamulatum. Toward this end, two transcriptomes derived from ovules of an apomictic donor parent and its apomictic backcross derivative at the stage of apospory initiation, were sequenced using 454-FLX technology. Results Using 454-FLX technology, we generated 332,567 reads with an average read length of 147 base pairs (bp) for the PS26 ovule transcriptome library and 363,637 reads with an average read length of 142 bp for the BC8 ovule transcriptome library. A total of 33,977 contigs from the PS26 ovule transcriptome library and 26,576 contigs from the BC8 ovule transcriptome library were assembled using the Multifunctional Inertial Reference Assembly program. Using stringent in silico parameters, 61 transcripts were predicted to map to the ASGR-carrier chromosome, of which 49 transcripts were verified as ASGR-carrier chromosome specific. One of the alien expressed genes could be assigned as tightly linked to the ASGR by screening of apomictic and sexual F1s. Only one transcript, which did not map to the ASGR, showed expression
Gill, Bradley C; Shoskes, Daniel A
2016-02-01
The review provides the infectious disease community with a urologic perspective on bacterial prostatitis. Specifically, the article briefly reviews the categorization of prostatitis by type and provides a distillation of new findings published on bacterial prostatitis over the past year. It also highlights key points from the established literature. Cross-sectional prostate imaging is becoming more common and may lead to more incidental diagnoses of acute bacterial prostatitis. As drug resistance remains problematic in this condition, the reemergence of older antibiotics such as fosfomycin, has proven beneficial. With regard to chronic bacterial prostatitis, no clear clinical risk factors emerged in a large epidemiological study. However, bacterial biofilm formation has been associated with more severe cases. Surgery has a limited role in bacterial prostatitis and should be reserved for draining of a prostatic abscess or the removal of infected prostatic stones. Prostatitis remains a common and bothersome clinical condition. Antibiotic therapy remains the basis of treatment for both acute and chronic bacterial prostatitis. Further research into improving prostatitis treatment is indicated.
Traveling Rocky Roads: The Consequences of Transcription-Blocking DNA Lesions on RNA Polymerase II.
Steurer, Barbara; Marteijn, Jurgen A
2017-10-27
The faithful transcription of eukaryotic genes by RNA polymerase II (RNAP2) is crucial for proper cell function and tissue homeostasis. However, transcription-blocking DNA lesions of both endogenous and environmental origin continuously challenge the progression of elongating RNAP2. The stalling of RNAP2 on a transcription-blocking lesion triggers a series of highly regulated events, including RNAP2 processing to make the lesion accessible for DNA repair, R-loop-mediated DNA damage signaling, and the initiation of transcription-coupled DNA repair. The correct execution and coordination of these processes is vital for resuming transcription following the successful repair of transcription-blocking lesions. Here, we outline recent insights into the molecular consequences of RNAP2 stalling on transcription-blocking DNA lesions and how these lesions are resolved to restore mRNA synthesis. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.
CarD uses a minor groove wedge mechanism to stabilize the RNA polymerase open promoter complex.
Bae, Brian; Chen, James; Davis, Elizabeth; Leon, Katherine; Darst, Seth A; Campbell, Elizabeth A
2015-09-08
A key point to regulate gene expression is at transcription initiation, and activators play a major role. CarD, an essential activator in Mycobacterium tuberculosis, is found in many bacteria, including Thermus species, but absent in Escherichia coli. To delineate the molecular mechanism of CarD, we determined crystal structures of Thermus transcription initiation complexes containing CarD. The structures show CarD interacts with the unique DNA topology presented by the upstream double-stranded/single-stranded DNA junction of the transcription bubble. We confirm that our structures correspond to functional activation complexes, and extend our understanding of the role of a conserved CarD Trp residue that serves as a minor groove wedge, preventing collapse of the transcription bubble to stabilize the transcription initiation complex. Unlike E. coli RNAP, many bacterial RNAPs form unstable promoter complexes, explaining the need for CarD.
NASA Technical Reports Server (NTRS)
2004-01-01
Data shows that elevated sialidase in bacterial vaginosis patients correlates to premature births in women. Bacterial sialidase also plays a significant role in the unusual colonization of Pseudomonas aeruginosa in cystic fibrosis patients. Crystals of Salmonella sialidase have been reproduced and are used for studying the inhibitor-enzyme complexes. These inhibitors may also be used to inhibit a trans-sialidase of Trypanosome cruzi, a very similar enzyme to bacterial sialidase, therefore preventing T. cruzi infection, the causitive agent of Chagas' disease. The Center for Macromolecular Crystallography suggests that inhibitors of bacterial sialidases can be used as prophylactic drugs to prevent bacterial infections in these critical cases.
Santiago, André S; Santos, Clelton A; Mendes, Juliano S; Toledo, Marcelo A S; Beloti, Lilian L; Souza, Alessandra A; Souza, Anete P
2015-09-01
The Xylella fastidiosa 9a5c strain is a xylem-limited phytopathogen that is the causal agent of citrus variegated chlorosis (CVC). This bacterium is able to form a biofilm and occlude the xylem vessels of susceptible plants, which leads to significant agricultural and economic losses. Biofilms are associated with bacterial pathogenicity because they are very resistant to antibiotics and other metal-based chemicals that are used in agriculture. The X. fastidiosa YcjZ-like (XfYcjZ-like) protein belongs to the LysR-type transcriptional regulator (LTTR) family and is involved in various cellular functions that range from quorum sensing to bacterial survival. In the present study, we report the cloning, expression and purification of XfYcjZ-like, which was overexpressed in Escherichia coli. The secondary folding of the recombinant and purified protein was assessed by circular dichroism, which revealed that XfYcjZ-like contains a typical α/β fold. An initial hydrodynamic characterization showed that XfYcjZ-like is a globular tetramer in solution. In addition, using a polyclonal antibody against XfYcjZ-like, we assessed the expression profile of this protein during the different developmental phases of X. fastidiosa in in vitro cultivated biofilm cells and demonstrated that XfYcjZ-like is upregulated in planktonic cells in response to a copper shock treatment. Finally, the ability of XfYcjZ-like to interact with its own predicted promoter was confirmed in vitro, which is a typical feature of LysR. Taken together, our findings indicated that the XfYcjZ-like protein is involved in both the organization of the architecture and the maturation of the bacterial biofilm and that it is responsive to oxidative stress. Copyright © 2015 Elsevier Inc. All rights reserved.
Mobile Bacterial Group II Introns at the Crux of Eukaryotic Evolution
Lambowitz, Alan M.; Belfort, Marlene
2015-01-01
SUMMARY This review focuses on recent developments in our understanding of group II intron function, the relationships of these introns to retrotransposons and spliceosomes, and how their common features have informed thinking about bacterial group II introns as key elements in eukaryotic evolution. Reverse transcriptase-mediated and host factor-aided intron retrohoming pathways are considered along with retrotransposition mechanisms to novel sites in bacteria, where group II introns are thought to have originated. DNA target recognition and movement by target-primed reverse transcription infer an evolutionary relationship among group II introns, non-LTR retrotransposons, such as LINE elements, and telomerase. Additionally, group II introns are almost certainly the progenitors of spliceosomal introns. Their profound similarities include splicing chemistry extending to RNA catalysis, reaction stereochemistry, and the position of two divalent metals that perform catalysis at the RNA active site. There are also sequence and structural similarities between group II introns and the spliceosome’s small nuclear RNAs (snRNAs) and between a highly conserved core spliceosomal protein Prp8 and a group II intron-like reverse transcriptase. It has been proposed that group II introns entered eukaryotes during bacterial endosymbiosis or bacterial-archaeal fusion, proliferated within the nuclear genome, necessitating evolution of the nuclear envelope, and fragmented giving rise to spliceosomal introns. Thus, these bacterial self-splicing mobile elements have fundamentally impacted the composition of extant eukaryotic genomes, including the human genome, most of which is derived from close relatives of mobile group II introns. PMID:25878921
Bacterial Cellulose Production from Industrial Waste and by-Product Streams.
Tsouko, Erminda; Kourmentza, Constantina; Ladakis, Dimitrios; Kopsahelis, Nikolaos; Mandala, Ioanna; Papanikolaou, Seraphim; Paloukis, Fotis; Alves, Vitor; Koutinas, Apostolis
2015-07-01
The utilization of fermentation media derived from waste and by-product streams from biodiesel and confectionery industries could lead to highly efficient production of bacterial cellulose. Batch fermentations with the bacterial strain Komagataeibacter sucrofermentans DSM (Deutsche Sammlung von Mikroorganismen) 15973 were initially carried out in synthetic media using commercial sugars and crude glycerol. The highest bacterial cellulose concentration was achieved when crude glycerol (3.2 g/L) and commercial sucrose (4.9 g/L) were used. The combination of crude glycerol and sunflower meal hydrolysates as the sole fermentation media resulted in bacterial cellulose production of 13.3 g/L. Similar results (13 g/L) were obtained when flour-rich hydrolysates produced from confectionery industry waste streams were used. The properties of bacterial celluloses developed when different fermentation media were used showed water holding capacities of 102-138 g · water/g · dry bacterial cellulose, viscosities of 4.7-9.3 dL/g, degree of polymerization of 1889.1-2672.8, stress at break of 72.3-139.5 MPa and Young's modulus of 0.97-1.64 GPa. This study demonstrated that by-product streams from the biodiesel industry and waste streams from confectionery industries could be used as the sole sources of nutrients for the production of bacterial cellulose with similar properties as those produced with commercial sources of nutrients.
Nandi, Munmun; Macdonald, Jacqueline; Liu, Peng; Weselowski, Brian; Yuan, Ze-Chun
2018-03-12
Bacterial canker disease is considered to be one of the most destructive diseases of tomato (Solanum lycopersicum), and is caused by the seed-borne Gram-positive bacterium Clavibacter michiganensis ssp. michiganensis (Cmm). This vascular pathogen generally invades and proliferates in the xylem through natural openings or wounds, causing wilt and canker symptoms. The incidence of symptomless latent infections and the invasion of tomato seeds by Cmm are widespread. Pathogenicity is mediated by virulence factors and transcriptional regulators encoded by the chromosome and two natural plasmids. The virulence factors include serine proteases, cell wall-degrading enzymes (cellulases, xylanases, pectinases) and others. Mutational analyses of these genes and gene expression profiling (via quantitative reverse transcription-polymerase chain reaction, transcriptomics and proteomics) have begun to shed light on their roles in colonization and virulence, whereas the expression of tomato genes in response to Cmm infection suggests plant factors involved in the defence response. These findings may aid in the generation of target-specific bactericides or new resistant varieties of tomato. Meanwhile, various chemical and biological controls have been researched to control Cmm. This review presents a detailed investigation regarding the pathogen Cmm, bacterial canker infection, molecular interactions between Cmm and tomato, and current perspectives on improved disease management. © 2018 AGRICULTURE AND AGRI-FOOD CANADA. MOLECULAR PLANT PATHOLOGY © 2018 JOHN WILEY & SONS LTD.
Dini-Andreote, Francisco; de Cássia Pereira e Silva, Michele; Triadó-Margarit, Xavier; Casamayor, Emilio O; van Elsas, Jan Dirk; Salles, Joana Falcão
2014-10-01
The mechanisms underlying community assembly and promoting temporal succession are often overlooked in microbial ecology. Here, we studied an undisturbed salt marsh chronosequence, spanning over a century of ecosystem development, to understand bacterial succession in soil. We used 16S rRNA gene-based quantitative PCR to determine bacterial abundance and multitag 454 pyrosequencing for community composition and diversity analyses. Despite 10-fold lower 16S rRNA gene abundances, the initial stages of soil development held higher phylogenetic diversities than the soil at late succession. Temporal variations in phylogenetic β-diversity were greater at initial stages of soil development, possibly as a result of the great dynamism imposed by the daily influence of the tide, promoting high immigration rates. Allogenic succession of bacterial communities was mostly driven by shifts in the soil physical structure, as well as variations in pH and salinity, which collectively explained 84.5% of the variation concerning community assemblage. The community assembly data for each successional stage were integrated into a network co-occurrence analysis, revealing higher complexity at initial stages, coinciding with great dynamism in turnover and environmental variability. Contrary to a spatial niche-based perspective of bacterial community assembly, we suggest temporal niche partitioning as the dominant mechanism of assembly (promoting more phylotype co-occurrence) in the initial stages of succession, where continuous environmental change results in the existence of multiple niches over short periods of time.
Dini-Andreote, Francisco; de Cássia Pereira e Silva, Michele; Triadó-Margarit, Xavier; Casamayor, Emilio O; van Elsas, Jan Dirk; Salles, Joana Falcão
2014-01-01
The mechanisms underlying community assembly and promoting temporal succession are often overlooked in microbial ecology. Here, we studied an undisturbed salt marsh chronosequence, spanning over a century of ecosystem development, to understand bacterial succession in soil. We used 16S rRNA gene-based quantitative PCR to determine bacterial abundance and multitag 454 pyrosequencing for community composition and diversity analyses. Despite 10-fold lower 16S rRNA gene abundances, the initial stages of soil development held higher phylogenetic diversities than the soil at late succession. Temporal variations in phylogenetic β-diversity were greater at initial stages of soil development, possibly as a result of the great dynamism imposed by the daily influence of the tide, promoting high immigration rates. Allogenic succession of bacterial communities was mostly driven by shifts in the soil physical structure, as well as variations in pH and salinity, which collectively explained 84.5% of the variation concerning community assemblage. The community assembly data for each successional stage were integrated into a network co-occurrence analysis, revealing higher complexity at initial stages, coinciding with great dynamism in turnover and environmental variability. Contrary to a spatial niche-based perspective of bacterial community assembly, we suggest temporal niche partitioning as the dominant mechanism of assembly (promoting more phylotype co-occurrence) in the initial stages of succession, where continuous environmental change results in the existence of multiple niches over short periods of time. PMID:24739625
Parra-Millán, Raquel; Guerrero-Gómez, David; Ayerbe-Algaba, Rafael; Pachón-Ibáñez, Maria Eugenia; Miranda-Vizuete, Antonio
2018-01-01
ABSTRACT Acinetobacter baumannii is a significant human pathogen associated with hospital-acquired infections. While adhesion, an initial and important step in A. baumannii infection, is well characterized, the intracellular trafficking of this pathogen inside host cells remains poorly studied. Here, we demonstrate that transcription factor EB (TFEB) is activated after A. baumannii infection of human lung epithelial cells (A549). We also show that TFEB is required for the invasion and persistence inside A549 cells. Consequently, lysosomal biogenesis and autophagy activation were observed after TFEB activation which could increase the death of A549 cells. In addition, using the Caenorhabditis elegans infection model by A. baumannii, the TFEB orthologue HLH-30 was required for survival of the nematode to infection, although nuclear translocation of HLH-30 was not required. These results identify TFEB as a conserved key factor in the pathogenesis of A. baumannii. IMPORTANCE Adhesion is an initial and important step in Acinetobacter baumannii infections. However, the mechanism of entrance and persistence inside host cells is unclear and remains to be understood. In this study, we report that, in addition to its known role in host defense against Gram-positive bacterial infection, TFEB also plays an important role in the intracellular trafficking of A. baumannii in host cells. TFEB was activated shortly after A. baumannii infection and is required for its persistence within host cells. Additionally, using the C. elegans infection model by A. baumannii, the TFEB orthologue HLH-30 was required for survival of the nematode to infection, although nuclear translocation of HLH-30 was not required. PMID:29600279
Effect of Weak Magnetic Field on Bacterial Growth
NASA Astrophysics Data System (ADS)
Masood, Samina
Effects of weak magnetic fields are observed on the growth of various bacterial strains. Different sources of a constant magnetic field are used to demonstrate that ion transport in the nutrient broth and bacterial cellular dynamics is perturbed in the presence of weak magnetic field which affects the mobility and absorption of nutrients in cells and hence their doubling rate. The change is obvious after a few hours of exposure and keeps on increasing with time for all the observed species. The growth rate depends on the field strength and the nature of the magnetic field. The field effect varies with the shape and the structure of the bacterial cell wall as well as the concentration of nutrient broth. We closely study the growth of three species Escherichia coli, Pseudomonas aeruginosa and Staphylococcus epidermidis with the same initial concentrations at the same temperature in the same laboratory environment. Our results indicate that the weak static field of a few gauss after a few hours gives a measurable change in the growth rates of all bacterial species. This shows that the same magnetic field has different effects on different species in the same environment.
Petrova, Olga E.; Garcia-Alcalde, Fernando; Zampaloni, Claudia; Sauer, Karin
2017-01-01
Global transcriptomic analysis via RNA-seq is often hampered by the high abundance of ribosomal (r)RNA in bacterial cells. To remove rRNA and enrich coding sequences, subtractive hybridization procedures have become the approach of choice prior to RNA-seq, with their efficiency varying in a manner dependent on sample type and composition. Yet, despite an increasing number of RNA-seq studies, comparative evaluation of bacterial rRNA depletion methods has remained limited. Moreover, no such study has utilized RNA derived from bacterial biofilms, which have potentially higher rRNA:mRNA ratios and higher rRNA carryover during RNA-seq analysis. Presently, we evaluated the efficiency of three subtractive hybridization-based kits in depleting rRNA from samples derived from biofilm, as well as planktonic cells of the opportunistic human pathogen Pseudomonas aeruginosa. Our results indicated different rRNA removal efficiency for the three procedures, with the Ribo-Zero kit yielding the highest degree of rRNA depletion, which translated into enhanced enrichment of non-rRNA transcripts and increased depth of RNA-seq coverage. The results indicated that, in addition to improving RNA-seq sensitivity, efficient rRNA removal enhanced detection of low abundance transcripts via qPCR. Finally, we demonstrate that the Ribo-Zero kit also exhibited the highest efficiency when P. aeruginosa/Staphylococcus aureus co-culture RNA samples were tested. PMID:28117413
Perron, Gabriel G.; Lee, Alexander E. G.; Wang, Yun; Huang, Wei E.; Barraclough, Timothy G.
2012-01-01
Bacterial recombination is believed to be a major factor explaining the prevalence of multi-drug-resistance (MDR) among pathogenic bacteria. Despite extensive evidence for exchange of resistance genes from retrospective sequence analyses, experimental evidence for the evolutionary benefits of bacterial recombination is scarce. We compared the evolution of MDR between populations of Acinetobacter baylyi in which we manipulated both the recombination rate and the initial diversity of strains with resistance to single drugs. In populations lacking recombination, the initial presence of multiple strains resistant to different antibiotics inhibits the evolution of MDR. However, in populations with recombination, the inhibitory effect of standing diversity is alleviated and MDR evolves rapidly. Moreover, only the presence of DNA harbouring resistance genes promotes the evolution of resistance, ruling out other proposed benefits for recombination. Together, these results provide direct evidence for the fitness benefits of bacterial recombination and show that this occurs by mitigation of functional interference between genotypes resistant to single antibiotics. Although analogous to previously described mechanisms of clonal interference among alternative beneficial mutations, our results actually highlight a different mechanism by which interactions among co-occurring strains determine the benefits of recombination for bacterial evolution. PMID:22048956
Isolation and identification of efficient Egyptian malathion-degrading bacterial isolates.
Hamouda, S A; Marzouk, M A; Abbassy, M A; Abd-El-Haleem, D A; Shamseldin, Abdelaal
2015-03-01
Bacterial isolates degrading malathion were isolated from the soil and agricultural waste water due to their ability to grow on minimal salt media amended with malathion as a sole carbon source. Efficiencies of native Egyptian bacterial malathion-degrading isolates were investigated and the study generated nine highly effective malathion-degrading bacterial strains among 40. Strains were identified by partial sequencing of 16S rDNA analysis. Comparative analysis of 16S rDNA sequences revealed that these bacteria are similar with the genus Acinetobacter and Bacillus spp. and RFLP based PCR of 16S rDNA gave four different RFLP patterns among strains with enzyme HinfI while with enzyme HaeI they gave two RFLP profiles. The degradation rate of malathion in liquid culture was estimated using gas chromatography. Bacterial strains could degrade more than 90% of the initial malathion concentration (1000 ppm) within 4 days. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.