Regulation of transcription by eukaryotic-like serine-threonine kinases and phosphatases in Gram-positive bacterial pathogens

PubMed Central

Wright, David P; Ulijasz, Andrew T

2014-01-01

Bacterial eukaryotic-like serine threonine kinases (eSTKs) and serine threonine phosphatases (eSTPs) have emerged as important signaling elements that are indispensable for pathogenesis. Differing considerably from their histidine kinase counterparts, few eSTK genes are encoded within the average bacterial genome, and their targets are pleiotropic in nature instead of exclusive. The growing list of important eSTK/P substrates includes proteins involved in translation, cell division, peptidoglycan synthesis, antibiotic tolerance, resistance to innate immunity and control of virulence factors. Recently it has come to light that eSTK/Ps also directly modulate transcriptional machinery in many microbial pathogens. This novel form of regulation is now emerging as an additional means by which bacteria can alter their transcriptomes in response to host-specific environmental stimuli. Here we focus on the ability of eSTKs and eSTPs in Gram-positive bacterial pathogens to directly modulate transcription, the known mechanistic outcomes of these modifications, and their roles as an added layer of complexity in controlling targeted RNA synthesis to enhance virulence potential. PMID:25603430

Coordination of genomic structure and transcription by the main bacterial nucleoid-associated protein HU

PubMed Central

Berger, Michael; Farcas, Anca; Geertz, Marcel; Zhelyazkova, Petya; Brix, Klaudia; Travers, Andrew; Muskhelishvili, Georgi

2010-01-01

The histone-like protein HU is a highly abundant DNA architectural protein that is involved in compacting the DNA of the bacterial nucleoid and in regulating the main DNA transactions, including gene transcription. However, the coordination of the genomic structure and function by HU is poorly understood. Here, we address this question by comparing transcript patterns and spatial distributions of RNA polymerase in Escherichia coli wild-type and hupA/B mutant cells. We demonstrate that, in mutant cells, upregulated genes are preferentially clustered in a large chromosomal domain comprising the ribosomal RNA operons organized on both sides of OriC. Furthermore, we show that, in parallel to this transcription asymmetry, mutant cells are also impaired in forming the transcription foci—spatially confined aggregations of RNA polymerase molecules transcribing strong ribosomal RNA operons. Our data thus implicate HU in coordinating the global genomic structure and function by regulating the spatial distribution of RNA polymerase in the nucleoid. PMID:20010798

Redundancy of primary RNA-binding functions of the bacterial transcription terminator Rho.

PubMed

Shashni, Rajesh; Qayyum, M Zuhaib; Vishalini, V; Dey, Debashish; Sen, Ranjan

2014-09-01

The bacterial transcription terminator, Rho, terminates transcription at half of the operons. According to the classical model derived from in vitro assays on a few terminators, Rho is recruited to the transcription elongation complex (EC) by recognizing specific sites (rut) on the nascent RNA. Here, we explored the mode of in vivo recruitment process of Rho. We show that sequence specific recognition of the rut site, in majority of the Rho-dependent terminators, can be compromised to a great extent without seriously affecting the genome-wide termination function as well as the viability of Escherichia coli. These terminators function optimally only through a NusG-assisted recruitment and activation of Rho. Our data also indicate that at these terminators, Rho-EC-bound NusG interaction facilitates the isomerization of Rho into a translocase-competent form by stabilizing the interactions of mRNA with the secondary RNA binding site, thereby overcoming the defects of the primary RNA binding functions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

STATIC AND KINETIC SITE-SPECIFIC PROTEIN-DNA PHOTOCROSSLINKING: ANALYSIS OF BACTERIAL TRANSCRIPTION INITIATION COMPLEXES

PubMed Central

Naryshkin, Nikolai; Druzhinin, Sergei; Revyakin, Andrei; Kim, Younggyu; Mekler, Vladimir; Ebright, Richard H.

2009-01-01

Static site-specific protein-DNA photocrosslinking permits identification of protein-DNA interactions within multiprotein-DNA complexes. Kinetic site-specific protein-DNA photocrosslinking--involving rapid-quench-flow mixing and pulsed-laser irradiation--permits elucidation of pathways and kinetics of formation of protein-DNA interactions within multiprotein-DNA complexes. We present detailed protocols for application of static and kinetic site-specific protein-DNA photocrosslinking to bacterial transcription initiation complexes. PMID:19378179

RAV transcription factors are essential for disease resistance against cassava bacterial blight via activation of melatonin biosynthesis genes.

PubMed

Wei, Yunxie; Chang, Yanli; Zeng, Hongqiu; Liu, Guoyin; He, Chaozu; Shi, Haitao

2018-01-01

With 1 AP2 domain and 1 B3 domain, 7 MeRAVs in apetala2/ethylene response factor (AP2/ERF) gene family have been identified in cassava. However, the in vivo roles of these remain unknown. Gene expression assays showed that the transcripts of MeRAVs were commonly regulated after Xanthomonas axonopodis pv manihotis (Xam) and MeRAVs were specifically located in plant cell nuclei. Through virus-induced gene silencing (VIGS) in cassava, we found that MeRAV1 and MeRAV2 are essential for plant disease resistance against cassava bacterial blight, as shown by the bacterial propagation of Xam in plant leaves. Through VIGS in cassava leaves and overexpression in cassava leave protoplasts, we found that MeRAV1 and MeRAV2 positively regulated melatonin biosynthesis genes and the endogenous melatonin level. Further investigation showed that MeRAV1 and MeRAV2 are direct transcriptional activators of 3 melatonin biosynthesis genes in cassava, as evidenced by chromatin immunoprecipitation-PCR in cassava leaf protoplasts and electrophoretic mobility shift assay. Moreover, cassava melatonin biosynthesis genes also positively regulated plant disease resistance. Taken together, this study identified MeRAV1 and MeRAV2 as common and upstream transcription factors of melatonin synthesis genes in cassava and revealed a model of MeRAV1 and MeRAV2-melatonin biosynthesis genes-melatonin level in plant disease resistance against cassava bacterial blight. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

SigmoID: a user-friendly tool for improving bacterial genome annotation through analysis of transcription control signals

PubMed Central

Damienikan, Aliaksandr U.

2016-01-01

The majority of bacterial genome annotations are currently automated and based on a ‘gene by gene’ approach. Regulatory signals and operon structures are rarely taken into account which often results in incomplete and even incorrect gene function assignments. Here we present SigmoID, a cross-platform (OS X, Linux and Windows) open-source application aiming at simplifying the identification of transcription regulatory sites (promoters, transcription factor binding sites and terminators) in bacterial genomes and providing assistance in correcting annotations in accordance with regulatory information. SigmoID combines a user-friendly graphical interface to well known command line tools with a genome browser for visualising regulatory elements in genomic context. Integrated access to online databases with regulatory information (RegPrecise and RegulonDB) and web-based search engines speeds up genome analysis and simplifies correction of genome annotation. We demonstrate some features of SigmoID by constructing a series of regulatory protein binding site profiles for two groups of bacteria: Soft Rot Enterobacteriaceae (Pectobacterium and Dickeya spp.) and Pseudomonas spp. Furthermore, we inferred over 900 transcription factor binding sites and alternative sigma factor promoters in the annotated genome of Pectobacterium atrosepticum. These regulatory signals control putative transcription units covering about 40% of the P. atrosepticum chromosome. Reviewing the annotation in cases where it didn’t fit with regulatory information allowed us to correct product and gene names for over 300 loci. PMID:27257541

An empirical strategy to detect bacterial transcript structure from directional RNA-seq transcriptome data.

PubMed

Wang, Yejun; MacKenzie, Keith D; White, Aaron P

2015-05-07

As sequencing costs are being lowered continuously, RNA-seq has gradually been adopted as the first choice for comparative transcriptome studies with bacteria. Unlike microarrays, RNA-seq can directly detect cDNA derived from mRNA transcripts at a single nucleotide resolution. Not only does this allow researchers to determine the absolute expression level of genes, but it also conveys information about transcript structure. Few automatic software tools have yet been established to investigate large-scale RNA-seq data for bacterial transcript structure analysis. In this study, 54 directional RNA-seq libraries from Salmonella serovar Typhimurium (S. Typhimurium) 14028s were examined for potential relationships between read mapping patterns and transcript structure. We developed an empirical method, combined with statistical tests, to automatically detect key transcript features, including transcriptional start sites (TSSs), transcriptional termination sites (TTSs) and operon organization. Using our method, we obtained 2,764 TSSs and 1,467 TTSs for 1331 and 844 different genes, respectively. Identification of TSSs facilitated further discrimination of 215 putative sigma 38 regulons and 863 potential sigma 70 regulons. Combining the TSSs and TTSs with intergenic distance and co-expression information, we comprehensively annotated the operon organization in S. Typhimurium 14028s. Our results show that directional RNA-seq can be used to detect transcriptional borders at an acceptable resolution of ±10-20 nucleotides. Technical limitations of the RNA-seq procedure may prevent single nucleotide resolution. The automatic transcript border detection methods, statistical models and operon organization pipeline that we have described could be widely applied to RNA-seq studies in other bacteria. Furthermore, the TSSs, TTSs, operons, promoters and unstranslated regions that we have defined for S. Typhimurium 14028s may constitute valuable resources that can be used for

Archaeal RNA polymerase and transcription regulation

PubMed Central

Jun, Sung-Hoon; Reichlen, Matthew J.; Tajiri, Momoko; Murakami, Katsuhiko S.

2010-01-01

To elucidate the mechanism of transcription by cellular RNA polymerases (RNAPs), high resolution X-ray crystal structures together with structure-guided biochemical, biophysical and genetics studies are essential. The recently-solved X-ray crystal structures of archaeal RNA polymerase (RNAP) allow a structural comparison of the transcription machinery among all three domains of life. The archaea were once thought of closely related to bacteria, but they are now considered to be more closely related to the eukaryote at the molecular level than bacteria. According to these structures, the archaeal transcription apparatus, which includes RNAP and general transcription factors, is similar to the eukaryotic transcription machinery. Yet, the transcription regulators, activators and repressors, encoded by archaeal genomes are closely related to bacterial factors. Therefore, archaeal transcription appears to possess an intriguing hybrid of eukaryotic-type transcription apparatus and bacterial-like regulatory mechanisms. Elucidating the transcription mechanism in archaea, which possesses a combination of bacterial and eukaryotic transcription mechanisms that are commonly regarded as separate and mutually exclusive, can provide data that will bring basic transcription mechanisms across all three domains of life. PMID:21250781

Redox-Active Sensing by Bacterial DksA Transcription Factors Is Determined by Cysteine and Zinc Content

PubMed Central

Crawford, Matthew A.; Tapscott, Timothy; Fitzsimmons, Liam F.; Liu, Lin; Reyes, Aníbal M.; Libby, Stephen J.; Trujillo, Madia; Fang, Ferric C.; Radi, Rafael

2016-01-01

ABSTRACT The four-cysteine zinc finger motif of the bacterial RNA polymerase regulator DksA is essential for protein structure, canonical control of the stringent response to nutritional limitation, and thiol-based sensing of oxidative and nitrosative stress. This interdependent relationship has limited our understanding of DksA-mediated functions in bacterial pathogenesis. Here, we have addressed this challenge by complementing ΔdksA Salmonella with Pseudomonas aeruginosa dksA paralogues that encode proteins differing in cysteine and zinc content. We find that four-cysteine, zinc-bound (C4) and two-cysteine, zinc-free (C2) DksA proteins are able to mediate appropriate stringent control in Salmonella and that thiol-based sensing of reactive species is conserved among C2 and C4 orthologues. However, variations in cysteine and zinc content determine the threshold at which individual DksA proteins sense and respond to reactive species. In particular, zinc acts as an antioxidant, dampening cysteine reactivity and raising the threshold of posttranslational thiol modification with reactive species. Consequently, C2 DksA triggers transcriptional responses in Salmonella at levels of oxidative or nitrosative stress normally tolerated by Salmonella expressing C4 orthologues. Inappropriate transcriptional regulation by C2 DksA increases the susceptibility of Salmonella to the antimicrobial effects of hydrogen peroxide and nitric oxide, and attenuates virulence in macrophages and mice. Our findings suggest that the redox-active sensory function of DksA proteins is finely tuned to optimize bacterial fitness according to the levels of oxidative and nitrosative stress encountered by bacterial species in their natural and host environments. PMID:27094335

Simulation of Graphene Field-Effect Transistor Biosensors for Bacterial Detection.

PubMed

Wu, Guangfu; Meyyappan, Meyya; Lai, King Wai Chiu

2018-05-25

Foodborne illness is correlated with the existence of infectious pathogens such as bacteria in food and drinking water. Probe-modified graphene field effect transistors (G-FETs) have been shown to be suitable for Escherichia coli ( E. coli ) detection. Here, the G-FETs for bacterial detection are modeled and simulated with COMSOL Multiphysics to understand the operation of the biosensors. The motion of E. coli cells in electrolyte and the surface charge of graphene induced by E. coli are systematically investigated. The comparison between the simulation and experimental data proves the sensing probe size to be a key parameter affecting the surface charge of graphene induced by bacteria. Finally, the relationship among the change in source-drain current (∆ I ds ), graphene-bacteria distance and bacterial concentration is established. The shorter graphene-bacteria distance and higher bacterial concentration give rise to better sensing performance (larger ∆ I ds ) of the G-FETs biosensors. The simulation here could serve as a guideline for the design and optimization of G-FET biosensors for various applications.

SeqTU: A web server for identification of bacterial transcription units

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Xin; Chou, Wen -Chi; Ma, Qin

A transcription unit (TU) consists of K ≥ 1 consecutive genes on the same strand of a bacterial genome that are transcribed into a single mRNA molecule under certain conditions. Their identification is an essential step in elucidation of transcriptional regulatory networks. We have recently developed a machine-learning method to accurately identify TUs from RNA-seq data, based on two features of the assembled RNA reads: the continuity and stability of RNA-seq coverage across a genomic region. While good performance was achieved by the method on Escherichia coli and Clostridium thermocellum, substantial work is needed to make the program generally applicablemore » to all bacteria, knowing that the program requires organism specific information. A web server, named SeqTU, was developed to automatically identify TUs with given RNA-seq data of any bacterium using a machine-learning approach. The server consists of a number of utility tools, in addition to TU identification, such as data preparation, data quality check and RNA-read mapping. SeqTU provides a user-friendly interface and automated prediction of TUs from given RNA-seq data. Furthermore, the predicted TUs are displayed intuitively using HTML format along with a graphic visualization of the prediction.« less

SeqTU: A web server for identification of bacterial transcription units

DOE PAGES

Chen, Xin; Chou, Wen -Chi; Ma, Qin; ...

2017-03-07

A transcription unit (TU) consists of K ≥ 1 consecutive genes on the same strand of a bacterial genome that are transcribed into a single mRNA molecule under certain conditions. Their identification is an essential step in elucidation of transcriptional regulatory networks. We have recently developed a machine-learning method to accurately identify TUs from RNA-seq data, based on two features of the assembled RNA reads: the continuity and stability of RNA-seq coverage across a genomic region. While good performance was achieved by the method on Escherichia coli and Clostridium thermocellum, substantial work is needed to make the program generally applicablemore » to all bacteria, knowing that the program requires organism specific information. A web server, named SeqTU, was developed to automatically identify TUs with given RNA-seq data of any bacterium using a machine-learning approach. The server consists of a number of utility tools, in addition to TU identification, such as data preparation, data quality check and RNA-read mapping. SeqTU provides a user-friendly interface and automated prediction of TUs from given RNA-seq data. Furthermore, the predicted TUs are displayed intuitively using HTML format along with a graphic visualization of the prediction.« less

Supplemental oxygen attenuates the increase in wound bacterial growth during simulated aeromedical evacuation in goats.

PubMed

Earnest, Ryan E; Sonnier, Dennis I; Makley, Amy T; Campion, Eric M; Wenke, Joseph C; Bailey, Stephanie R; Dorlac, Warren C; Lentsch, Alex B; Pritts, Timothy A

2012-07-01

Bacterial growth in soft tissue and open fractures is a known risk factor for tissue loss and complications in contaminated musculoskeletal wounds. Current care for battlefield casualties with soft tissue and musculoskeletal wounds includes tactical and strategic aeromedical evacuation (AE). This exposes patients to a hypobaric, hypoxic environment. In this study, we sought to determine whether exposure to AE alters bacterial growth in contaminated complex musculoskeletal wounds and whether supplemental oxygen had any effect on wound infections during simulated AE. A caprine model of a contaminated complex musculoskeletal wound was used. Complex musculoskeletal wounds were created and inoculated with bioluminescent Pseudomonas aeruginosa. Goats were divided into three experimental groups: ground control, simulated AE, and simulated AE with supplemental oxygen. Simulated AE was induced in a hypobaric chamber pressurized to 8,800 feet for 7 hours. Bacterial luminescence was measured using a photon counting camera at three time points: preflight (20 hours postsurgery), postflight (7 hours from preflight and 27 hours postsurgery), and necropsy (24 hours from preflight and 44 hours postsurgery). There was a significant increase in bacterial growth in the AE group compared with the ground control group measured postflight and at necropsy. Simulated AE induced hypoxia with oxygen saturation less than 93%. Supplemental oxygen corrected the hypoxia and significantly reduced bacterial growth in wounds at necropsy. Hypoxia induced during simulated AE enhances bacterial growth in complex musculoskeletal wounds which can be prevented with the application of supplemental oxygen to the host.

Development of small molecule biosensors by coupling the recognition of the bacterial allosteric transcription factor with isothermal strand displacement amplification.

PubMed

Yao, Yongpeng; Li, Shanshan; Cao, Jiaqian; Liu, Weiwei; Fan, Keqiang; Xiang, Wensheng; Yang, Keqian; Kong, Deming; Wang, Weishan

2018-05-08

Here, we demonstrate an easy-to-implement and general biosensing strategy by coupling the small-molecule recognition of the bacterial allosteric transcription factor (aTF) with isothermal strand displacement amplification (SDA) in vitro. Based on this strategy, we developed two biosensors for the detection of an antiseptic, p-hydroxybenzoic acid, and a disease marker, uric acid, using bacterial aTF HosA and HucR, respectively, highlighting the great potential of this strategy for the development of small-molecule biosensors.

Transcriptional Activation of c3 and hsp70 as Part of the Immune Response of Acropora millepora to Bacterial Challenges

PubMed Central

Brown, Tanya; Bourne, David; Rodriguez-Lanetty, Mauricio

2013-01-01

The impact of disease outbreaks on coral physiology represents an increasing concern for the fitness and resilience of reef ecosystems. Predicting the tolerance of corals to disease relies on an understanding of the coral immune response to pathogenic interactions. This study explored the transcriptional response of two putative immune genes (c3 and c-type lectin) and one stress response gene (hsp70) in the reef building coral, Acropora millepora challenged for 48 hours with bacterial strains, Vibrio coralliilyticus and Alteromonas sp. at concentrations of 106 cells ml-1. Coral fragments challenged with V. coralliilyticus appeared healthy while fragments challenged with Alteromonas sp. showed signs of tissue lesions after 48 hr. Coral-associated bacterial community profiles assessed using denaturing gradient gel electrophoresis changed after challenge by both bacterial strains with the Alteromonas sp. treatment demonstrating the greatest community shift. Transcriptional profiles of c3 and hsp70 increased at 24 hours and correlated with disease signs in the Alteromonas sp. treatment. The expression of hsp70 also showed a significant increase in V. coralliilyticus inoculated corals at 24 h suggesting that even in the absence of disease signs, the microbial inoculum activated a stress response in the coral. C-type lectin did not show a response to any of the bacterial treatments. Increase in gene expression of c3 and hsp70 in corals showing signs of disease indicates their potential involvement in immune and stress response to microbial challenges. PMID:23861754

Genomic context drives transcription of insertion sequences in the bacterial endosymbiont Wolbachia wVulC.

PubMed

Cerveau, Nicolas; Gilbert, Clément; Liu, Chao; Garrett, Roger A; Grève, Pierre; Bouchon, Didier; Cordaux, Richard

2015-06-10

Transposable elements (TEs) are DNA pieces that are present in almost all the living world at variable genomic density. Due to their mobility and density, TEs are involved in a large array of genomic modifications. In eukaryotes, TE expression has been studied in detail in several species. In prokaryotes, studies of IS expression are generally linked to particular copies that induce a modification of neighboring gene expression. Here we investigated global patterns of IS transcription in the Alphaproteobacterial endosymbiont Wolbachia wVulC, using both RT-PCR and bioinformatic analyses. We detected several transcriptional promoters in all IS groups. Nevertheless, only one of the potentially functional IS groups possesses a promoter located upstream of the transposase gene, that could lead up to the production of a functional protein. We found that the majority of IS groups are expressed whatever their functional status. RT-PCR analyses indicate that the transcription of two IS groups lacking internal promoters upstream of the transposase start codon may be driven by the genomic environment. We confirmed this observation with the transcription analysis of individual copies of one IS group. These results suggest that the genomic environment is important for IS expression and it could explain, at least partly, copy number variability of the various IS groups present in the wVulC genome and, more generally, in bacterial genomes. Copyright © 2015 Elsevier B.V. All rights reserved.

Genetic networks controlled by the bacterial replication initiator and transcription factor DnaA in Bacillus subtilis.

PubMed

Washington, Tracy A; Smith, Janet L; Grossman, Alan D

2017-10-01

DnaA is the widely conserved bacterial AAA+ ATPase that functions as both the replication initiator and a transcription factor. In many organisms, DnaA controls expression of its own gene and likely several others during growth and in response to replication stress. To evaluate the effects of DnaA on gene expression, separate from its role in replication initiation, we analyzed changes in mRNA levels in Bacillus subtilis cells with and without dnaA, using engineered strains in which dnaA is not essential. We found that dnaA was required for many of the changes in gene expression in response to replication stress. We also found that dnaA indirectly affected expression of several regulons during growth, including those controlled by the transcription factors Spo0A, AbrB, PhoP, SinR, RemA, Rok and YvrH. These effects were largely mediated by the effects of DnaA on expression of sda. DnaA activates transcription of sda, and Sda inhibits histidine protein kinases required for activation of the transcription factor Spo0A. We also found that loss of dnaA caused a decrease in the development of genetic competence. Together, our results indicate that DnaA plays an important role in modulating cell physiology, separate from its role in replication initiation. © 2017 John Wiley & Sons Ltd.

Changes in rhizosphere bacterial gene expression following glyphosate treatment.

PubMed

Newman, Molli M; Lorenz, Nicola; Hoilett, Nigel; Lee, Nathan R; Dick, Richard P; Liles, Mark R; Ramsier, Cliff; Kloepper, Joseph W

2016-05-15

In commercial agriculture, populations and interactions of rhizosphere microflora are potentially affected by the use of specific agrichemicals, possibly by affecting gene expression in these organisms. To investigate this, we examined changes in bacterial gene expression within the rhizosphere of glyphosate-tolerant corn (Zea mays) and soybean (Glycine max) in response to long-term glyphosate (PowerMAX™, Monsanto Company, MO, USA) treatment. A long-term glyphosate application study was carried out using rhizoboxes under greenhouse conditions with soil previously having no history of glyphosate exposure. Rhizosphere soil was collected from the rhizoboxes after four growing periods. Soil microbial community composition was analyzed using microbial phospholipid fatty acid (PLFA) analysis. Total RNA was extracted from rhizosphere soil, and samples were analyzed using RNA-Seq analysis. A total of 20-28 million bacterial sequences were obtained for each sample. Transcript abundance was compared between control and glyphosate-treated samples using edgeR. Overall rhizosphere bacterial metatranscriptomes were dominated by transcripts related to RNA and carbohydrate metabolism. We identified 67 differentially expressed bacterial transcripts from the rhizosphere. Transcripts downregulated following glyphosate treatment involved carbohydrate and amino acid metabolism, and upregulated transcripts involved protein metabolism and respiration. Additionally, bacterial transcripts involving nutrients, including iron, nitrogen, phosphorus, and potassium, were also affected by long-term glyphosate application. Overall, most bacterial and all fungal PLFA biomarkers decreased after glyphosate treatment compared to the control. These results demonstrate that long-term glyphosate use can affect rhizosphere bacterial activities and potentially shift bacterial community composition favoring more glyphosate-tolerant bacteria. Copyright © 2016 The Authors. Published by Elsevier B.V. All

Bacterial content in runoff from simulated rainfall applied to plots amended with poultry litter

USDA-ARS?s Scientific Manuscript database

To evaluate potential bacterial runoff from poultry litter, litter was applied to test plots and exposed to simulated rainfall 1, 8 or 15 d after litter application. Runoff samples were tested for Salmonella and Campylobacter, two bacterial pathogens commonly associated with poultry, as well as com...

Simulation-Based Validation of the p53 Transcriptional Activity with Hybrid Functional Petri Net.

PubMed

Doi, Atsushi; Nagasaki, Masao; Matsuno, Hiroshi; Miyano, Satoru

2011-01-01

MDM2 and p19ARF are essential proteins in cancer pathways forming a complex with protein p53 to control the transcriptional activity of protein p53. It is confirmed that protein p53 loses its transcriptional activity by forming the functional dimer with protein MDM2. However, it is still unclear that protein p53 keeps its transcriptional activity when it forms the trimer with proteins MDM2 and p19ARF. We have observed mutual behaviors among genes p53, MDM2, p19ARF and their products on a computational model with hybrid functional Petri net (HFPN) which is constructed based on information described in the literature. The simulation results suggested that protein p53 should have the transcriptional activity in the forms of the trimer of proteins p53, MDM2, and p19ARF. This paper also discusses the advantages of HFPN based modeling method in terms of pathway description for simulations.

Gene and transcript abundances of bacterial type III secretion systems from the rumen microbiome are correlated with methane yield in sheep.

PubMed

Kamke, Janine; Soni, Priya; Li, Yang; Ganesh, Siva; Kelly, William J; Leahy, Sinead C; Shi, Weibing; Froula, Jeff; Rubin, Edward M; Attwood, Graeme T

2017-08-08

Ruminants are important contributors to global methane emissions via microbial fermentation in their reticulo-rumens. This study is part of a larger program, characterising the rumen microbiomes of sheep which vary naturally in methane yield (g CH 4 /kg DM/day) and aims to define differences in microbial communities, and in gene and transcript abundances that can explain the animal methane phenotype. Rumen microbiome metagenomic and metatranscriptomic data were analysed by Gene Set Enrichment, sparse partial least squares regression and the Wilcoxon Rank Sum test to estimate correlations between specific KEGG bacterial pathways/genes and high methane yield in sheep. KEGG genes enriched in high methane yield sheep were reassembled from raw reads and existing contigs and analysed by MEGAN to predict their phylogenetic origin. Protein coding sequences from Succinivibrio dextrinosolvens strains were analysed using Effective DB to predict bacterial type III secreted proteins. The effect of S. dextrinosolvens strain H5 growth on methane formation by rumen methanogens was explored using co-cultures. Detailed analysis of the rumen microbiomes of high methane yield sheep shows that gene and transcript abundances of bacterial type III secretion system genes are positively correlated with methane yield in sheep. Most of the bacterial type III secretion system genes could not be assigned to a particular bacterial group, but several genes were affiliated with the genus Succinivibrio, and searches of bacterial genome sequences found that strains of S. dextrinosolvens were part of a small group of rumen bacteria that encode this type of secretion system. In co-culture experiments, S. dextrinosolvens strain H5 showed a growth-enhancing effect on a methanogen belonging to the order Methanomassiliicoccales, and inhibition of a representative of the Methanobrevibacter gottschalkii clade. This is the first report of bacterial type III secretion system genes being associated with high

Activity and stability of a complex bacterial soil community under simulated Martian conditions

NASA Astrophysics Data System (ADS)

Hansen, Aviaja Anna; Merrison, Jonathan; Nørnberg, Per; Aagaard Lomstein, Bente; Finster, Kai

2005-04-01

A simulation experiment with a complex bacterial soil community in a Mars simulation chamber was performed to determine the effect of Martian conditions on community activity, stability and survival. At three different depths in the soil core short-term effects of Martian conditions with and without ultraviolet (UV) exposure corresponding to 8 Martian Sol were compared. Community metabolic activities and functional diversity, measured as glucose respiration and versatility in substrate utilization, respectively, decreased after UV exposure, whereas they remained unaffected by Martian conditions without UV exposure. In contrast, the numbers of culturable bacteria and the genetic diversity were unaffected by the simulated Martian conditions both with and without UV exposure. The genetic diversity of the soil community and of the colonies grown on agar plates were evaluated by denaturant gradient gel electrophoresis (DGGE) on DNA extracts. Desiccation of the soil prior to experimentation affected the functional diversity by decreasing the versatility in substrate utilization. The natural dominance of endospores and Gram-positive bacteria in the investigated Mars-analogue soil may explain the limited effect of the Mars incubations on the survival and community structure. Our results suggest that UV radiation and desiccation are major selecting factors on bacterial functional diversity in terrestrial bacterial communities incubated under simulated Martian conditions. Furthermore, these results suggest that forward contamination of Mars is a matter of great concern in future space missions.

Iodine-impregnated incision drape and bacterial recolonization in simulated total knee arthroplasty.

PubMed

Milandt, Nikolaj; Nymark, Tine; Jørn Kolmos, Hans; Emmeluth, Claus; Overgaard, Søren

2016-08-01

Background and purpose - Iodine-impregnated incision drapes (IIIDs) are used to prevent surgical site infection (SSI). However, there is some evidence to suggest a potential increase in SSI risk as a result of IIID use, possibly from promotion of skin recolonization. A greater number of viable bacteria in the surgical field of an arthroplasty, and surgery in general, may increase the infection risk. We investigated whether IIID use increases bacterial recolonization compared to no drape use under conditions of simulated total knee arthroplasty (TKA). Methods - 20 patients scheduled for TKA were recruited. Each patient had 1 knee randomized for draping with IIID, while the contralateral knee was left bare. The patients thus served as their own control. The operating room conditions and perioperative procedures of a TKA were simulated. Cylinder samples were collected from the skin of each knee prior to disinfection, and again on 2 occasions after skin preparation-75 min apart. Quantities of bacteria were estimated using a spread plate technique under aerobic conditions. Results - We found similar quantities of bacteria on the intervention and control knees immediately after skin disinfection and after 75 min of simulated surgery. These quantities had not increased at the end of surgery when compared to baseline, so no recolonization was detected on the draped knees or on the bare knees. Interpretation - The use of IIIDs did not increase bacterial recolonization in simulated TKA. This study does not support the hypothesis that IIIDs promote bacterial recolonization and postoperative infection risk.

Iodine-impregnated incision drape and bacterial recolonization in simulated total knee arthroplasty

PubMed Central

Milandt, Nikolaj; Nymark, Tine; Jørn Kolmos, Hans; Emmeluth, Claus; Overgaard, Søren

2016-01-01

Background and purpose Iodine-impregnated incision drapes (IIIDs) are used to prevent surgical site infection (SSI). However, there is some evidence to suggest a potential increase in SSI risk as a result of IIID use, possibly from promotion of skin recolonization. A greater number of viable bacteria in the surgical field of an arthroplasty, and surgery in general, may increase the infection risk. We investigated whether IIID use increases bacterial recolonization compared to no drape use under conditions of simulated total knee arthroplasty (TKA). Methods 20 patients scheduled for TKA were recruited. Each patient had 1 knee randomized for draping with IIID, while the contralateral knee was left bare. The patients thus served as their own control. The operating room conditions and perioperative procedures of a TKA were simulated. Cylinder samples were collected from the skin of each knee prior to disinfection, and again on 2 occasions after skin preparation—75 min apart. Quantities of bacteria were estimated using a spread plate technique under aerobic conditions. Results We found similar quantities of bacteria on the intervention and control knees immediately after skin disinfection and after 75 min of simulated surgery. These quantities had not increased at the end of surgery when compared to baseline, so no recolonization was detected on the draped knees or on the bare knees. Interpretation The use of IIIDs did not increase bacterial recolonization in simulated TKA. This study does not support the hypothesis that IIIDs promote bacterial recolonization and postoperative infection risk. PMID:27168308

Effect of simulated acid rain on fluorine mobility and the bacterial community of phosphogypsum.

PubMed

Wang, Mei; Tang, Ya; Anderson, Christopher W N; Jeyakumar, Paramsothy; Yang, Jinyan

2018-06-01

Contamination of soil and water with fluorine (F) leached from phosphogypsum (PG) stacks is a global environmental issue. Millions of tons of PG is produced each year as a by-product of fertilizer manufacture, and in China, weathering is exacerbated by acid rain. In this work, column leaching experiments using simulated acid rain were run to evaluate the mobility of F and the impact of weathering on native bacterial community composition in PG. After a simulated summer rainfall, 2.42-3.05 wt% of the total F content of PG was leached and the F concentration in leachate was above the quality standard for surface water and groundwater in China. Acid rain had no significant effect on the movement of F in PG. A higher concentration of F was observed at the bottom than the top section of PG columns suggesting mobility and reprecipitation of F. Throughout the simulation, the PG was environmentally safe according the TCLP testing. The dominant bacteria in PG were from the Enterococcus and Bacillus genus. Bacterial community composition in PG leached by simulated acid rain (pH 3.03) was more abundant than at pH 6.88. Information on F mobility and bacterial community in PG under conditions of simulated rain is relevant to management of environmental risk in stockpiled PG waste.

Disarming Bacterial Virulence through Chemical Inhibition of the DNA Binding Domain of an AraC-like Transcriptional Activator Protein*

PubMed Central

Yang, Ji; Hocking, Dianna M.; Cheng, Catherine; Dogovski, Con; Perugini, Matthew A.; Holien, Jessica K.; Parker, Michael W.; Hartland, Elizabeth L.; Tauschek, Marija; Robins-Browne, Roy M.

2013-01-01

The misuse of antibiotics during past decades has led to pervasive antibiotic resistance in bacteria. Hence, there is an urgent need for the development of new and alternative approaches to combat bacterial infections. In most bacterial pathogens the expression of virulence is tightly regulated at the transcriptional level. Therefore, targeting pathogens with drugs that interfere with virulence gene expression offers an effective alternative to conventional antimicrobial chemotherapy. Many Gram-negative intestinal pathogens produce AraC-like proteins that control the expression of genes required for infection. In this study we investigated the prototypical AraC-like virulence regulator, RegA, from the mouse attaching and effacing pathogen, Citrobacter rodentium, as a potential drug target. By screening a small molecule chemical library and chemical optimization, we identified two compounds that specifically inhibited the ability of RegA to activate its target promoters and thus reduced expression of a number of proteins required for virulence. Biophysical, biochemical, genetic, and computational analyses indicated that the more potent of these two compounds, which we named regacin, disrupts the DNA binding capacity of RegA by interacting with amino acid residues within a conserved region of the DNA binding domain. Oral administration of regacin to mice, commencing 15 min before or 12 h after oral inoculation with C. rodentium, caused highly significant attenuation of intestinal colonization by the mouse pathogen comparable to that of an isogenic regA-deletion mutant. These findings demonstrate that chemical inhibition of the DNA binding domains of transcriptional regulators is a viable strategy for the development of antimicrobial agents that target bacterial pathogens. PMID:24019519

Transcriptional Response of Nitrifying Communities to Wetting of Dry Soil

PubMed Central

Firestone, Mary K.

2013-01-01

The first rainfall following a severe dry period provides an abrupt water potential change that is both an acute physiological stress and a defined stimulus for the reawakening of soil microbial communities. We followed the responses of indigenous communities of ammonia-oxidizing bacteria, ammonia-oxidizing archaea, and nitrite-oxidizing bacteria to the addition of water to laboratory incubations of soils taken from two California annual grasslands following a typically dry Mediterranean summer. By quantifying transcripts for a subunit of bacterial and archaeal ammonia monooxygenases (amoA) and a bacterial nitrite oxidoreductase (nxrA) in soil from 15 min to 72 h after water addition, we identified transcriptional response patterns for each of these three groups of nitrifiers. An increase in quantity of bacterial amoA transcripts was detectable within 1 h of wet-up and continued until the size of the ammonium pool began to decrease, reflecting a possible role of transcription in upregulation of nitrification after drought-induced stasis. In one soil, the pulse of amoA transcription lasted for less than 24 h, demonstrating the transience of transcriptional pools and the tight coupling of transcription to the local soil environment. Analysis of 16S rRNA using a high-density microarray suggested that nitrite-oxidizing Nitrobacter spp. respond in tandem with ammonia-oxidizing bacteria while nitrite-oxidizing Nitrospina spp. and Nitrospira bacteria may not. Archaeal ammonia oxidizers may respond slightly later than bacterial ammonia oxidizers but may maintain elevated transcription longer. Despite months of desiccation-induced inactivation, we found rapid transcriptional response by all three groups of soil nitrifiers. PMID:23524666

[Auricular sporotrichosis. Atypical case report simulating bacterial cellulitis].

PubMed

Ochoa-Reyes, Juan; Ramos-Martínez, Ernesto; Treviño-Rangel, Rogelio; González, Gloria M; Bonifaz, Alexandro

Sporotrichosis is the most common subcutaneous or implantation mycosis in Mexico. The case of a preauricular cutaneous-fixed sporotrichosis simulating atypical bacterial cellulitis is reported in an elderly patient with no history of trauma. The biopsy showed a suppurative granuloma with scarce yeast. Sporothrix schenckii was identified in the culture and confirmed by molecular biology. She was treated with itraconazole and a clinical and mycological cure was obtained. The case of atypical presentation is presented, coming from a semi-arid zone with extreme weather.

Transcription Regulation in Archaea

PubMed Central

Gehring, Alexandra M.; Walker, Julie E.

2016-01-01

The known diversity of metabolic strategies and physiological adaptations of archaeal species to extreme environments is extraordinary. Accurate and responsive mechanisms to ensure that gene expression patterns match the needs of the cell necessitate regulatory strategies that control the activities and output of the archaeal transcription apparatus. Archaea are reliant on a single RNA polymerase for all transcription, and many of the known regulatory mechanisms employed for archaeal transcription mimic strategies also employed for eukaryotic and bacterial species. Novel mechanisms of transcription regulation have become apparent by increasingly sophisticated in vivo and in vitro investigations of archaeal species. This review emphasizes recent progress in understanding archaeal transcription regulatory mechanisms and highlights insights gained from studies of the influence of archaeal chromatin on transcription. PMID:27137495

Addition of transcription activator-like effector binding sites to a pathogen strain-specific rice bacterial blight resistance gene makes it effective against additional strains and against bacterial leaf streak.

PubMed

Hummel, Aaron W; Doyle, Erin L; Bogdanove, Adam J

2012-09-01

Xanthomonas transcription activator-like (TAL) effectors promote disease in plants by binding to and activating host susceptibility genes. Plants counter with TAL effector-activated executor resistance genes, which cause host cell death and block disease progression. We asked whether the functional specificity of an executor gene could be broadened by adding different TAL effector binding elements (EBEs) to it. We added six EBEs to the rice Xa27 gene, which confers resistance to strains of the bacterial blight pathogen Xanthomonas oryzae pv. oryzae (Xoo) that deliver the TAL effector AvrXa27. The EBEs correspond to three other effectors from Xoo strain PXO99(A) and three from strain BLS256 of the bacterial leaf streak pathogen Xanthomonas oryzae pv. oryzicola (Xoc). Stable integration into rice produced healthy lines exhibiting gene activation by each TAL effector, and resistance to PXO99(A) , a PXO99(A) derivative lacking AvrXa27, and BLS256, as well as two other Xoo and 10 Xoc strains virulent toward wildtype Xa27 plants. Transcripts initiated primarily at a common site. Sequences in the EBEs were found to occur nonrandomly in rice promoters, suggesting an overlap with endogenous regulatory sequences. Thus, executor gene specificity can be broadened by adding EBEs, but caution is warranted because of the possible coincident introduction of endogenous regulatory elements. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

SIMULATION OF SUMMER-TIME DIURNAL BACTERIAL DYNAMICS IN THE ATMOSPHERIC SURFACE LAYER

EPA Science Inventory

A model was prepared to simulate the observed concentration dynamics of culturable bacteria in the diurnal summer atmosphere at a Willamette River Valley, Oregon location. The meteorological and bacterial mechanisms included in a dynamic null-dimensional model with one-second tim...

Quantification of Yeast and Bacterial Gene Transcripts in Retail Cheeses by Reverse Transcription-Quantitative PCR

PubMed Central

Straub, Cécile; Castellote, Jessie; Onesime, Djamila; Bonnarme, Pascal; Irlinger, Françoise

2013-01-01

The cheese microbiota contributes to a large extent to the development of the typical color, flavor, and texture of the final product. Its composition is not well defined in most cases and varies from one cheese to another. The aim of the present study was to establish procedures for gene transcript quantification in cheeses by reverse transcription-quantitative PCR. Total RNA was extracted from five smear-ripened cheeses purchased on the retail market, using a method that does not involve prior separation of microbial cells. 16S rRNA and malate:quinone oxidoreductase gene transcripts of Corynebacterium casei, Brevibacterium aurantiacum, and Arthrobacter arilaitensis and 26S rRNA and beta tubulin gene transcripts of Geotrichum candidum and Debaryomyces hansenii could be detected and quantified in most of the samples. Three types of normalization were applied: against total RNA, against the amount of cheese, and against a reference gene. For the first two types of normalization, differences of reverse transcription efficiencies from one sample to another were taken into account by analysis of exogenous control mRNA. No good correlation was found between the abundances of target mRNA or rRNA transcripts and the viable cell concentration of the corresponding species. However, in most cases, no mRNA transcripts were detected for species that did not belong to the dominant species. The applications of gene expression measurement in cheeses containing an undefined microbiota, as well as issues concerning the strategy of normalization and the assessment of amplification specificity, are discussed. PMID:23124230

R-loops in bacterial transcription: their causes and consequences.

PubMed

Gowrishankar, J; Leela, J Krishna; Anupama, K

2013-01-01

Nascent untranslated transcripts in bacteria are prone to generating RNA-DNA hybrids (R-loops); Rho-dependent transcription termination acts to reduce their prevalence. Here we discuss the mechanisms of R-loop formation and growth inhibition in bacteria.

A Two-State Model for the Dynamics of the Pyrophosphate Ion Release in Bacterial RNA Polymerase

PubMed Central

Da, Lin-Tai; Pardo Avila, Fátima; Wang, Dong; Huang, Xuhui

2013-01-01

The dynamics of the PPi release during the transcription elongation of bacterial RNA polymerase and its effects on the Trigger Loop (TL) opening motion are still elusive. Here, we built a Markov State Model (MSM) from extensive all-atom molecular dynamics (MD) simulations to investigate the mechanism of the PPi release. Our MSM has identified a simple two-state mechanism for the PPi release instead of a more complex four-state mechanism observed in RNA polymerase II (Pol II). We observed that the PPi release in bacterial RNA polymerase occurs at sub-microsecond timescale, which is ∼3-fold faster than that in Pol II. After escaping from the active site, the (Mg-PPi)2− group passes through a single elongated metastable region where several positively charged residues on the secondary channel provide favorable interactions. Surprisingly, we found that the PPi release is not coupled with the TL unfolding but correlates tightly with the side-chain rotation of the TL residue R1239. Our work sheds light on the dynamics underlying the transcription elongation of the bacterial RNA polymerase. PMID:23592966

Short term memory of Caenorhabditis elegans against bacterial pathogens involves CREB transcription factor.

PubMed

Prithika, Udayakumar; Vikneswari, Ramaraj; Balamurugan, Krishnaswamy

2017-04-01

One of the key issues pertaining to the control of memory is to respond to a consistently changing environment or microbial niche present in it. Human cyclic AMP response element binding protein (CREB) transcription factor which plays a crucial role in memory has a homolog in C. elegans, crh-1. crh-1 appears to influence memory processes to certain extent by habituation of the host to a particular environment. The discrimination between the pathogen and a non-pathogen is essential for C. elegans in a microbial niche which determines its survival. Training the nematodes in the presence of a virulent pathogen (S. aureus) and an opportunistic pathogen (P. mirabilis) separately exhibits a different behavioural paradigm. This appears to be dependent on the CREB transcription factor. Here we show that C. elegans homolog crh-1 helps in memory response for a short term against the interacting pathogens. Following conditioning of the nematodes to S. aureus and P. mirabilis, the wild type nematodes exhibited a positive response towards the respective pathogens which diminished slowly after 2h. By contrast, the crh-1 deficient nematodes had a defective memory post conditioning. The molecular data reinforces the importance of crh-1 gene in retaining the memory of nematode. Our results also suggest that involvement of neurotransmitters play a crucial role in modulating the memory of the nematode with the assistance of CREB. Therefore, we elucidate that CREB is responsible for the short term memory response in C. elegans against bacterial pathogens. Copyright © 2016 Elsevier GmbH. All rights reserved.

A Bacteriophage Capsid Protein Is an Inhibitor of a Conserved Transcription Terminator of Various Bacterial Pathogens.

PubMed

Ghosh, Gairika; Reddy, Jayavardhana; Sambhare, Susmit; Sen, Ranjan

2018-01-01

Rho is a hexameric molecular motor that functions as a conserved transcription terminator in the majority of bacterial species and is a potential drug target. Psu is a bacteriophage P4 capsid protein that inhibits Escherichia coli Rho by obstructing its ATPase and translocase activities. In this study, we explored the anti-Rho activity of Psu for Rho proteins from different pathogens. Sequence alignment and homology modeling of Rho proteins from pathogenic bacteria revealed the conserved nature of the Psu-interacting regions in all these proteins. We chose Rho proteins from various pathogens, including Mycobacterium smegmatis , Mycobacterium bovis , Mycobacterium tuberculosis , Xanthomonas campestris , Xanthomonas oryzae , Corynebacterium glutamicum , Vibrio cholerae , Salmonella enterica , and Pseudomonas syringae The purified recombinant Rho proteins of these organisms showed variable rates of ATP hydrolysis on poly(rC) as the substrate and were capable of releasing RNA from the E. coli transcription elongation complexes. Psu was capable of inhibiting these two functions of all these Rho proteins. In vivo pulldown assays revealed direct binding of Psu with many of these Rho proteins. In vivo expression of psu induced killing of M. smegmatis , M. bovis , X. campestris , and E. coli expressing S. enterica Rho indicating Psu-induced inhibition of Rho proteins of these strains under physiological conditions. We propose that the "universal" inhibitory function of the Psu protein against the Rho proteins from both Gram-negative and Gram-positive bacteria could be useful for designing peptides with antimicrobial functions and that these peptides could contribute to synergistic antibiotic treatment of the pathogens by compromising the Rho functions. IMPORTANCE Bacteriophage-derived protein factors modulating different bacterial processes could be converted into unique antimicrobial agents. Bacteriophage P4 capsid protein Psu is an inhibitor of the E. coli transcription

Overlapping Podospora anserina Transcriptional Responses to Bacterial and Fungal Non Self Indicate a Multilayered Innate Immune Response

PubMed Central

Lamacchia, Marina; Dyrka, Witold; Breton, Annick; Saupe, Sven J.; Paoletti, Mathieu

2016-01-01

Recognition and response to non self is essential to development and survival of all organisms. It can occur between individuals of the same species or between different organisms. Fungi are established models for conspecific non self recognition in the form of vegetative incompatibility (VI), a genetically controlled process initiating a programmed cell death (PCD) leading to the rejection of a fusion cell between genetically different isolates of the same species. In Podospora anserina VI is controlled by members of the hnwd gene family encoding for proteins analogous to NOD Like Receptors (NLR) immune receptors in eukaryotes. It was hypothesized that the hnwd controlled VI reaction was derived from the fungal innate immune response. Here we analyze the P. anserina transcriptional responses to two bacterial species, Serratia fonticola to which P. anserina survives and S. marcescens to which P. anserina succumbs, and compare these to the transcriptional response induced under VI conditions. Transcriptional responses to both bacteria largely overlap, however the number of genes regulated and magnitude of regulation is more important when P. anserina survives. Transcriptional responses to bacteria also overlap with the VI reaction for both up or down regulated gene sets. Genes up regulated tend to be clustered in the genome, and display limited phylogenetic distribution. In all three responses we observed genes related to autophagy to be up-regulated. Autophagy contributes to the fungal survival in all three conditions. Genes encoding for secondary metabolites and histidine kinase signaling are also up regulated in all three conditions. Transcriptional responses also display differences. Genes involved in response to oxidative stress, or encoding small secreted proteins are essentially expressed in response to bacteria, while genes encoding NLR proteins are expressed during VI. Most functions encoded in response to bacteria favor survival of the fungus while most

Two Cassava Basic Leucine Zipper (bZIP) Transcription Factors (MebZIP3 and MebZIP5) Confer Disease Resistance against Cassava Bacterial Blight.

PubMed

Li, Xiaolin; Fan, Shuhong; Hu, Wei; Liu, Guoyin; Wei, Yunxie; He, Chaozu; Shi, Haitao

2017-01-01

Basic domain-leucine zipper (bZIP) transcription factor, one type of conserved gene family, plays an important role in plant development and stress responses. Although 77 MebZIPs have been genome-wide identified in cassava, their in vivo roles remain unknown. In this study, we analyzed the expression pattern and the function of two MebZIPs ( MebZIP3 and MebZIP5 ) in response to pathogen infection. Gene expression analysis indicated that MebZIP3 and MebZIP5 were commonly regulated by flg22, Xanthomonas axonopodis pv. manihotis ( Xam ), salicylic acid (SA), and hydrogen peroxide (H 2 O 2 ). Subcellular localization analysis showed that MebZIP3 and MebZIP5 are specifically located in cell nucleus. Through overexpression in tobacco, we found that MebZIP3 and MebZIP5 conferred improved disease resistance against cassava bacterial blight, with more callose depositions. On the contrary, MebZIP3- and MebZIP5 -silenced plants by virus-induced gene silencing (VIGS) showed disease sensitive phenotype, lower transcript levels of defense-related genes and less callose depositions. Taken together, this study highlights the positive role of MebZIP3 and MebZIP5 in disease resistance against cassava bacterial blight for further utilization in genetic improvement of cassava disease resistance.

Molecular recognition of avirulence protein (avrxa5) by eukaryotic transcription factor xa5 of rice (Oryza sativa L.): insights from molecular dynamics simulations.

PubMed

Dehury, Budheswar; Maharana, Jitendra; Sahoo, Bikash Ranjan; Sahu, Jagajjit; Sen, Priyabrata; Modi, Mahendra Kumar; Barooah, Madhumita

2015-04-01

The avirulence gene avrxa5 of bacterial blight pathogen Xanthomonas oryzae pv. oryzae (Xoo) recognized by the resistant rice lines having corresponding resistance (xa5) gene in a gene-for-gene manner. We used a combinatorial approach involving protein-protein docking, molecular dynamics (MD) simulations and binding free energy calculations to gain novel insights into the gene-for-gene mechanism that governs the direct interaction of R-Avr protein. From the best three binding poses predicted by molecular docking, MD simulations were performed to explore the dynamic binding mechanism of xa5 and avrxa5. Molecular Mechanics/Poisson Boltzmann Surface Area (MM/PBSA) techniques were employed to calculate the binding free energy and to uncover the thriving force behind the molecular recognition of avrxa5 by eukaryotic transcription factor xa5. Binding free energy analysis revealed van der Waals term as the most constructive component that favors the xa5 and avrxa5 interaction. In addition, hydrogen bonds (H-bonds) and essential electrostatic interactions analysis highlighted amino acid residues Lys54/Asp870, Lys56/Ala868, Lys56/Ala866, Lys56/Glu871, Ile59/His862, Gly61/Phe858, His62/Arg841, His62/Leu856, Ser101/Ala872 and Ser105/Asp870 plays pivotal role for the energetically stability of the R-Avr complex. Insights gained from the present study are expected to unveil the molecular mechanisms that define the transcriptional activator mediated transcriptome modification in host plants. Copyright © 2015 Elsevier Inc. All rights reserved.

CoSMoS Unravels Mysteries of Transcription Initiation

PubMed Central

Gourse, Richard L.; Landick, Robert

2013-01-01

Using a fluorescence method called colocalization single-molecule spectroscopy (CoSMoS), Friedman and Gelles dissect the kinetics of transcription initiation at a bacterial promoter. Ultimately, CoSMoS could greatly aid the study of the effects of DNA sequence and transcription factors on both prokaryotic and eukaryotic promoters. PMID:22341438

Conformational heterogeneity and bubble dynamics in single bacterial transcription initiation complexes

PubMed Central

Duchi, Diego; Gryte, Kristofer; Robb, Nicole C; Morichaud, Zakia; Sheppard, Carol; Wigneshweraraj, Sivaramesh

2018-01-01

Abstract Transcription initiation is a major step in gene regulation for all organisms. In bacteria, the promoter DNA is first recognized by RNA polymerase (RNAP) to yield an initial closed complex. This complex subsequently undergoes conformational changes resulting in DNA strand separation to form a transcription bubble and an RNAP-promoter open complex; however, the series and sequence of conformational changes, and the factors that influence them are unclear. To address the conformational landscape and transitions in transcription initiation, we applied single-molecule Förster resonance energy transfer (smFRET) on immobilized Escherichia coli transcription open complexes. Our results revealed the existence of two stable states within RNAP–DNA complexes in which the promoter DNA appears to adopt closed and partially open conformations, and we observed large-scale transitions in which the transcription bubble fluctuated between open and closed states; these transitions, which occur roughly on the 0.1 s timescale, are distinct from the millisecond-timescale dynamics previously observed within diffusing open complexes. Mutational studies indicated that the σ70 region 3.2 of the RNAP significantly affected the bubble dynamics. Our results have implications for many steps of transcription initiation, and support a bend-load-open model for the sequence of transitions leading to bubble opening during open complex formation. PMID:29177430

A Transcriptional Regulatory Mechanism Finely Tunes the Firing of Type VI Secretion System in Response to Bacterial Enemies.

PubMed

Lazzaro, Martina; Feldman, Mario F; García Véscovi, Eleonora

2017-08-22

The ability to detect and measure danger from an environmental signal is paramount for bacteria to respond accordingly, deploying strategies that halt or counteract potential cellular injury and maximize survival chances. Type VI secretion systems (T6SSs) are complex bacterial contractile nanomachines able to target toxic effectors into neighboring bacteria competing for the same colonization niche. Previous studies support the concept that either T6SSs are constitutively active or they fire effectors in response to various stimuli, such as high bacterial density, cell-cell contact, nutrient depletion, or components from dead sibling cells. For Serratia marcescens , it has been proposed that its T6SS is stochastically expressed, with no distinction between harmless or aggressive competitors. In contrast, we demonstrate that the Rcs regulatory system is responsible for finely tuning Serratia T6SS expression levels, behaving as a transcriptional rheostat. When confronted with harmless bacteria, basal T6SS expression levels suffice for Serratia to eliminate the competitor. A moderate T6SS upregulation is triggered when, according to the aggressor-prey ratio, an unbalanced interplay between homologous and heterologous effectors and immunity proteins takes place. Higher T6SS expression levels are achieved when Serratia is challenged by a contender like Acinetobacter , which indiscriminately fires heterologous effectors able to exert lethal cellular harm, threatening the survival of the Serratia population. We also demonstrate that Serratia 's RcsB-dependent T6SS regulatory mechanism responds not to general stress signals but to the action of specific effectors from competitors, displaying an exquisite strategy to weigh risks and keep the balance between energy expenditure and fitness costs. IMPORTANCE Serratia marcescens is among the health-threatening pathogens categorized by the WHO as research priorities to develop alternative antimicrobial strategies, and it was

Code-assisted discovery of TAL effector targets in bacterial leaf streak of rice reveals contrast with bacterial blight and a novel susceptibility gene

USDA-ARS?s Scientific Manuscript database

Transcription activator-like (TAL) effectors found in Xanthomonas spp. promote bacterial growth and plant susceptibility by binding specific DNA sequences or, effector-binding elements (EBEs), and inducing host gene expression. In this study, we have found substantially different transcriptional pro...

Transcript of the Joint FAA/Industry Symposium on Level B Airplane simulator aeromodel validation requirements

DOT National Transportation Integrated Search

1996-03-13

"This is the transcript of the Joint FAA/Industry Symposium on Level B Airplane Simulator Aeromodel Validation Requirements held on March 13-14, 1996, at the Washington Dulles Airport Hilton. The purpose of the meeting was to discuss the aeromodeling...

CoSMoS unravels mysteries of transcription initiation.

PubMed

Gourse, Richard L; Landick, Robert

2012-02-17

Using a fluorescence method called colocalization single-molecule spectroscopy (CoSMoS), Friedman and Gelles dissect the kinetics of transcription initiation at a bacterial promoter. Ultimately, CoSMoS could greatly aid the study of the effects of DNA sequence and transcription factors on both prokaryotic and eukaryotic promoters. Copyright © 2012 Elsevier Inc. All rights reserved.

New insights in the bacterial spore resistance to extreme terrestrial and extraterrestrial factors

NASA Astrophysics Data System (ADS)

Moeller, Ralf; Horneck, Gerda; Reitz, Guenther

Based on their unique resistance to various space parameters, Bacillus endospores are one of the model systems used for astrobiological studies. The extremely high resistance of bacterial endospores to environmental stress factors has intrigued researchers since long time and many characteristic spore features, especially those involved in the protection of spore DNA, have already been uncovered. The disclosure of the complete genomic sequence of Bacillus subtilis 168, one of the often used astrobiological model system, and the rapid development of tran-scriptional microarray techniques have opened new opportunities of gaining further insights in the enigma of spore resistance. Spores of B. subtilis were exposed to various extreme ter-restrial and extraterrestrial stressors to reach a better understanding of the DNA protection and repair strategies, which them to cope with the induced DNA damage. Following physical stress factors of environmental importance -either on Earth or in space -were selected for this thesis: (i) mono-and polychromatic UV radiation, (ii) ionizing radiation, (iii) exposure to ultrahigh vacuum; and (iv) high shock pressures simulating meteorite impacts. To reach a most comprehensive understanding of spore resistance to those harsh terrestrial or simulated extraterrestrial conditions, a standardized experimental protocol of the preparation and ana-lyzing methods was established including the determination of the following spore responses: (i) survival, (ii) induced mutations, (iii) DNA damage, (iv) role of different repair pathways by use of a set of repair deficient mutants, and (v) transcriptional responses during spore germi-nation by use of genome-wide transcriptome analyses and confirmation by RT-PCR. From this comprehensive set of data on spore resistance to a variety of environmental stress parameters a model of a "built-in" transcriptional program of bacterial spores in response to DNA damaging treatments to ensure DNA restoration

Molecular dynamics simulations on interaction between bacterial proteins: Implication on pathogenic activities.

PubMed

Mondal, Manas; Chakrabarti, Jaydeb; Ghosh, Mahua

2018-03-01

We perform molecular dynamics simulation studies on interaction between bacterial proteins: an outer-membrane protein STY3179 and a yfdX protein STY3178 of Salmonella Typhi. STY3179 has been found to be involved in bacterial adhesion and invasion. STY3178 is recently biophysically characterized. It is a soluble protein having antibiotic binding and chaperon activity capabilities. These two proteins co-occur and are from neighboring gene in Salmonella Typhi-occurrence of homologs of both STY3178 and STY3179 are identified in many Gram-negative bacteria. We show using homology modeling, docking followed by molecular dynamics simulation that they can form a stable complex. STY3178 belongs to aqueous phase, while the beta barrel portion of STY3179 remains buried in DPPC bilayer with extra-cellular loops exposed to water. To understand the molecular basis of interaction between STY3178 and STY3179, we compute the conformational thermodynamics which indicate that these two proteins interact through polar and acidic residues belonging to their interfacial region. Conformational thermodynamics results further reveal instability of certain residues in extra-cellular loops of STY3179 upon complexation with STY3178 which is an indication for binding with host cell protein laminin. © 2017 Wiley Periodicals, Inc.

The Transcription Terminator Rho: A First Bacterial Prion.

PubMed

Pallarès, Irantzu; Ventura, Salvador

2017-06-01

Traditionally associated with neurodegenerative diseases, prions are increasingly recognized for their potential to confer beneficial traits on eukaryotic organisms. The discovery of the first bacterial prion suggests that the sustained mechanism of prion assembly is an ancient molecular tool aimed at providing fast and persistent adaptation to changing environments. Copyright © 2017 Elsevier Ltd. All rights reserved.

A cysteine protease (cathepsin Z) from disk abalone, Haliotis discus discus: Genomic characterization and transcriptional profiling during bacterial infections.

PubMed

Godahewa, G I; Perera, N C N; Lee, Sukkyoung; Kim, Myoung-Jin; Lee, Jehee

2017-09-05

Cathepsin Z (CTSZ) is lysosomal cysteine protease of the papain superfamily. It participates in the host immune defense via phagocytosis, signal transduction, cell-cell communication, proliferation, and migration of immune cells such as monocytes, macrophages, and dendritic cells. Hence, CTSZ is also acknowledged as an acute-phase protein in host immunity. In this study, we sought to identify the CTSZ homolog from disk abalone (AbCTSZ) and characterize it at the molecular, genomic, and transcriptional levels. AbCTSZ encodes a protein with 318 amino acids and a molecular mass of 36kDa. The structure of AbCTSZ reveals amino acid sequences that are characteristic of the signal sequence, pro-peptide, peptidase-C1 papain family cysteine protease domain, mini-loop, HIP motif, N-linked glycosylation sites, active sites, and conserved Cys residues. A pairwise comparison revealed that AbCTSZ shared the highest amino acid homology with its molluscan counterpart from Crassostrea gigas. A multiple alignment analysis revealed the conservation of functionally crucial elements of AbCTSZ, and a phylogenetic study further confirmed a proximal evolutionary relationship with its invertebrate counterparts. Further, an analysis of AbCTSZ genomic structure revealed seven exons separated by six introns, which differs from that of its vertebrate counterparts. Quantitative real time PCR (qPCR) detected the transcripts of AbCTSZ in early developmental stages and in eight different tissues. Higher levels of AbCTSZ transcripts were found in trochophore, gill, and hemocytes, highlighting its importance in the early development and immunity of disk abalone. In addition, we found that viable bacteria (Vibrio parahaemolyticus and Listeria monocytogenes) and bacterial lipopolysaccharides significantly modulated AbCTSZ transcription. Collectively, these lines of evidences suggest that AbCTSZ plays an indispensable role in the innate immunity of disk abalone. Copyright © 2017. Published by Elsevier

Dual transcriptional profiling of a bacterial/fungal confrontation: Collimonas fungivorans versus Aspergillus niger

PubMed Central

Mela, Francesca; Fritsche, Kathrin; de Boer, Wietse; van Veen, Johannes A; de Graaff, Leo H; van den Berg, Marlies; Leveau, Johan H J

2011-01-01

Interactions between bacteria and fungi cover a wide range of incentives, mechanisms and outcomes. The genus Collimonas consists of soil bacteria that are known for their antifungal activity and ability to grow at the expense of living fungi. In non-contact confrontation assays with the fungus Aspergillus niger, Collimonas fungivorans showed accumulation of biomass concomitant with inhibition of hyphal spread. Through microarray analysis of bacterial and fungal mRNA from the confrontation arena, we gained new insights into the mechanisms underlying the fungistatic effect and mycophagous phenotype of collimonads. Collimonas responded to the fungus by activating genes for the utilization of fungal-derived compounds and for production of a putative antifungal compound. In A. niger, differentially expressed genes included those involved in lipid and cell wall metabolism and cell defense, which correlated well with the hyphal deformations that were observed microscopically. Transcriptional profiles revealed distress in both partners: downregulation of ribosomal proteins and upregulation of mobile genetic elements in the bacteria and expression of endoplasmic reticulum stress and conidia-related genes in the fungus. Both partners experienced nitrogen shortage in each other's presence. Overall, our results indicate that the Collimonas/Aspergillus interaction is a complex interplay between trophism, antibiosis and competition for nutrients. PMID:21614084

Antisense transcription is pervasive but rarely conserved in enteric bacteria.

PubMed

Raghavan, Rahul; Sloan, Daniel B; Ochman, Howard

2012-01-01

Noncoding RNAs, including antisense RNAs (asRNAs) that originate from the complementary strand of protein-coding genes, are involved in the regulation of gene expression in all domains of life. Recent application of deep-sequencing technologies has revealed that the transcription of asRNAs occurs genome-wide in bacteria. Although the role of the vast majority of asRNAs remains unknown, it is often assumed that their presence implies important regulatory functions, similar to those of other noncoding RNAs. Alternatively, many antisense transcripts may be produced by chance transcription events from promoter-like sequences that result from the degenerate nature of bacterial transcription factor binding sites. To investigate the biological relevance of antisense transcripts, we compared genome-wide patterns of asRNA expression in closely related enteric bacteria, Escherichia coli and Salmonella enterica serovar Typhimurium, by performing strand-specific transcriptome sequencing. Although antisense transcripts are abundant in both species, less than 3% of asRNAs are expressed at high levels in both species, and only about 14% appear to be conserved among species. And unlike the promoters of protein-coding genes, asRNA promoters show no evidence of sequence conservation between, or even within, species. Our findings suggest that many or even most bacterial asRNAs are nonadaptive by-products of the cell's transcription machinery. IMPORTANCE Application of high-throughput methods has revealed the expression throughout bacterial genomes of transcripts encoded on the strand complementary to protein-coding genes. Because transcription is costly, it is usually assumed that these transcripts, termed antisense RNAs (asRNAs), serve some function; however, the role of most asRNAs is unclear, raising questions about their relevance in cellular processes. Because natural selection conserves functional elements, comparisons between related species provide a method for assessing

Antisense Transcription Is Pervasive but Rarely Conserved in Enteric Bacteria

PubMed Central

Raghavan, Rahul; Sloan, Daniel B.; Ochman, Howard

2012-01-01

ABSTRACT Noncoding RNAs, including antisense RNAs (asRNAs) that originate from the complementary strand of protein-coding genes, are involved in the regulation of gene expression in all domains of life. Recent application of deep-sequencing technologies has revealed that the transcription of asRNAs occurs genome-wide in bacteria. Although the role of the vast majority of asRNAs remains unknown, it is often assumed that their presence implies important regulatory functions, similar to those of other noncoding RNAs. Alternatively, many antisense transcripts may be produced by chance transcription events from promoter-like sequences that result from the degenerate nature of bacterial transcription factor binding sites. To investigate the biological relevance of antisense transcripts, we compared genome-wide patterns of asRNA expression in closely related enteric bacteria, Escherichia coli and Salmonella enterica serovar Typhimurium, by performing strand-specific transcriptome sequencing. Although antisense transcripts are abundant in both species, less than 3% of asRNAs are expressed at high levels in both species, and only about 14% appear to be conserved among species. And unlike the promoters of protein-coding genes, asRNA promoters show no evidence of sequence conservation between, or even within, species. Our findings suggest that many or even most bacterial asRNAs are nonadaptive by-products of the cell’s transcription machinery. PMID:22872780

Conservation of Transcription Start Sites within Genes across a Bacterial Genus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shao, Wenjun; Price, Morgan N.; Deutschbauer, Adam M.

Transcription start sites (TSSs) lying inside annotated genes, on the same or opposite strand, have been observed in diverse bacteria, but the function of these unexpected transcripts is unclear. Here, we use the metal-reducing bacterium Shewanella oneidensis MR-1 and its relatives to study the evolutionary conservation of unexpected TSSs. Using high-resolution tiling microarrays and 5'-end RNA sequencing, we identified 2,531 TSSs in S. oneidensis MR-1, of which 18% were located inside coding sequences (CDSs). Comparative transcriptome analysis with seven additional Shewanella species revealed that the majority (76%) of the TSSs within the upstream regions of annotated genes (gTSSs) were conserved.more » Thirty percent of the TSSs that were inside genes and on the sense strand (iTSSs) were also conserved. Sequence analysis around these iTSSs showed conserved promoter motifs, suggesting that many iTSS are under purifying selection. Furthermore, conserved iTSSs are enriched for regulatory motifs, suggesting that they are regulated, and they tend to eliminate polar effects, which confirms that they are functional. In contrast, the transcription of antisense TSSs located inside CDSs (aTSSs) was significantly less likely to be conserved (22%). However, aTSSs whose transcription was conserved often have conserved promoter motifs and drive the expression of nearby genes. Overall, our findings demonstrate that some internal TSSs are conserved and drive protein expression despite their unusual locations, but the majority are not conserved and may reflect noisy initiation of transcription rather than a biological function.« less

Modeling the integration of bacterial rRNA fragments into the human cancer genome.

PubMed

Sieber, Karsten B; Gajer, Pawel; Dunning Hotopp, Julie C

2016-03-21

Cancer is a disease driven by the accumulation of genomic alterations, including the integration of exogenous DNA into the human somatic genome. We previously identified in silico evidence of DNA fragments from a Pseudomonas-like bacteria integrating into the 5'-UTR of four proto-oncogenes in stomach cancer sequencing data. The functional and biological consequences of these bacterial DNA integrations remain unknown. Modeling of these integrations suggests that the previously identified sequences cover most of the sequence flanking the junction between the bacterial and human DNA. Further examination of these reads reveals that these integrations are rich in guanine nucleotides and the integrated bacterial DNA may have complex transcript secondary structures. The models presented here lay the foundation for future experiments to test if bacterial DNA integrations alter the transcription of the human genes.

Fungal Innate Immunity Induced by Bacterial Microbe-Associated Molecular Patterns (MAMPs)

PubMed Central

Ipcho, Simon; Sundelin, Thomas; Erbs, Gitte; Kistler, H. Corby; Newman, Mari-Anne; Olsson, Stefan

2016-01-01

Plants and animals detect bacterial presence through Microbe-Associated Molecular Patterns (MAMPs) which induce an innate immune response. The field of fungal–bacterial interaction at the molecular level is still in its infancy and little is known about MAMPs and their detection by fungi. Exposing Fusarium graminearum to bacterial MAMPs led to increased fungal membrane hyperpolarization, a putative defense response, and a range of transcriptional responses. The fungus reacted with a different transcript profile to each of the three tested MAMPs, although a core set of genes related to energy generation, transport, amino acid production, secondary metabolism, and especially iron uptake were detected for all three. Half of the genes related to iron uptake were predicted MirA type transporters that potentially take up bacterial siderophores. These quick responses can be viewed as a preparation for further interactions with beneficial or pathogenic bacteria, and constitute a fungal innate immune response with similarities to those of plants and animals. PMID:27172188

A Novel WRKY transcription factor is required for induction of PR-1a gene expression by salicylic acid and bacterial elicitors.

PubMed

van Verk, Marcel C; Pappaioannou, Dimitri; Neeleman, Lyda; Bol, John F; Linthorst, Huub J M

2008-04-01

PR-1a is a salicylic acid-inducible defense gene of tobacco (Nicotiana tabacum). One-hybrid screens identified a novel tobacco WRKY transcription factor (NtWRKY12) with specific binding sites in the PR-1a promoter at positions -564 (box WK(1)) and -859 (box WK(2)). NtWRKY12 belongs to the class of transcription factors in which the WRKY sequence is followed by a GKK rather than a GQK sequence. The binding sequence of NtWRKY12 (WK box TTTTCCAC) deviated significantly from the consensus sequence (W box TTGAC[C/T]) shown to be recognized by WRKY factors with the GQK sequence. Mutation of the GKK sequence in NtWRKY12 into GQK or GEK abolished binding to the WK box. The WK(1) box is in close proximity to binding sites in the PR-1a promoter for transcription factors TGA1a (as-1 box) and Myb1 (MBSII box). Expression studies with PR-1a promoterbeta-glucuronidase (GUS) genes in stably and transiently transformed tobacco indicated that NtWRKY12 and TGA1a act synergistically in PR-1a expression induced by salicylic acid and bacterial elicitors. Cotransfection of Arabidopsis thaliana protoplasts with 35SNtWRKY12 and PR-1aGUS promoter fusions showed that overexpression of NtWRKY12 resulted in a strong increase in GUS expression, which required functional WK boxes in the PR-1a promoter.

Elucidation of Small RNAs that Activate Transcription in Bacteria

DTIC Science & Technology

2012-03-01

bacterial sRNAs that activate transcription of a target gene in E. coli to varying degrees. Mutation of the strongest activator modified its...identified RNA- based transcriptional activators in yeast (Buskirk et al., 2003) although the underlying mechanism was not elucidated. We show that the...previous yeast two-hybrid (Buskirk et al., 2003) and three-hybrid studies (Bernstein et al., 2002). Colonies were observed from co-transformations of pBT

Spaceflight and Simulated Microgravity Increases Virulence of the Known Bacterial Pathogen S. Marcescens

NASA Technical Reports Server (NTRS)

Clemens-Grisham, Rachel Andrea; Bhattacharya, Sharmila; Wade, William

2016-01-01

After spaceflight, the number of immune cells is reduced in humans. In other research models, including Drosophila, not only is there a reduction in the number of plasmatocytes, but expression of immune-related genes is also changed after spaceflight. These observations suggest that the immune system is compromised after exposure to microgravity. It has also been reported that there is a change in virulence of some bacterial pathogens after spaceflight. We recently observed that samples of gram-negative S. marcescens retrieved from spaceflight is more virulent than ground controls, as determined by reduced survival and increased bacterial growth in the host. We were able to repeat this finding of increased virulence after exposure to simulated microgravity using the rotating wall vessel, a ground based analog to microgravity. With the ground and spaceflight samples, we looked at involvement of the Toll and Imd pathways in the Drosophila host in fighting infection by ground and spaceflight samples. We observed that Imd-pathway mutants were more susceptible to infection by the ground bacterial samples, which aligns with the known role of this pathway in fighting infections by gram-negative bacteria. When the Imd-pathway mutants were infected with the spaceflight sample, however, they exhibited the same susceptibility as seen with the ground control bacteria. Interestingly, all mutant flies show the same susceptibility to the spaceflight bacterial sample as do wild type flies. This suggests that neither humoral immunity pathway is effectively able to counter the increased pathogenicity of the space-flown S. marcescens bacteria.

Structural Basis of Mitochondrial Transcription Initiation.

PubMed

Hillen, Hauke S; Morozov, Yaroslav I; Sarfallah, Azadeh; Temiakov, Dmitry; Cramer, Patrick

2017-11-16

Transcription in human mitochondria is driven by a single-subunit, factor-dependent RNA polymerase (mtRNAP). Despite its critical role in both expression and replication of the mitochondrial genome, transcription initiation by mtRNAP remains poorly understood. Here, we report crystal structures of human mitochondrial transcription initiation complexes assembled on both light and heavy strand promoters. The structures reveal how transcription factors TFAM and TFB2M assist mtRNAP to achieve promoter-dependent initiation. TFAM tethers the N-terminal region of mtRNAP to recruit the polymerase to the promoter whereas TFB2M induces structural changes in mtRNAP to enable promoter opening and trapping of the DNA non-template strand. Structural comparisons demonstrate that the initiation mechanism in mitochondria is distinct from that in the well-studied nuclear, bacterial, or bacteriophage transcription systems but that similarities are found on the topological and conceptual level. These results provide a framework for studying the regulation of gene expression and DNA replication in mitochondria. Copyright © 2017 Elsevier Inc. All rights reserved.

Transcriptional and metabolic response of recombinant Escherichia coli to spatial dissolved oxygen tension gradients simulated in a scale-down system.

PubMed

Lara, Alvaro R; Leal, Lidia; Flores, Noemí; Gosset, Guillermo; Bolívar, Francisco; Ramírez, Octavio T

2006-02-05

Escherichia coli, expressing recombinant green fluorescent protein (GFP), was subjected to dissolved oxygen tension (DOT) oscillations in a two-compartment system for simulating gradients that can occur in large-scale bioreactors. Cells were continuously circulated between the anaerobic (0% DOT) and aerobic (10% DOT) vessels of the scale-down system to mimic an overall circulation time of 50 s, and a mean residence time in the anaerobic and aerobic compartments of 33 and 17 s, respectively. Transcription levels of mixed acid fermentation genes (ldhA, poxB, frdD, ackA, adhE, pflD, and fdhF), measured by quantitative RT-PCR, increased between 1.5- to over 6-fold under oscillatory DOT compared to aerobic cultures (constant 10% DOT). In addition, the transcription level of fumB increased whereas it decreased for sucA and sucB, suggesting that the tricarboxylic acid cycle was functioning as two open branches. Gene transcription levels revealed that cytrochrome bd, which has higher affinity to oxygen but lower energy efficiency, was preferred over cytochrome bO3 in oscillatory DOT cultures. Post-transcriptional processing limited heterologous protein production in the scale-down system, as inferred from similar gfp transcription but 19% lower GFP concentration compared to aerobic cultures. Simulated DOT gradients also affected the transcription of genes of the glyoxylate shunt (aceA), of global regulators of aerobic and anaerobic metabolism (fnr, arcA, and arcB), and other relevant genes (luxS, sodA, fumA, and sdhB). Transcriptional changes explained the observed alterations in overall stoichiometric and kinetic parameters, and production of ethanol and organic acids. Differences in transcription levels between aerobic and anaerobic compartments were also observed, indicating that E. coli can respond very fast to intermittent DOT conditions. The transcriptional responses of E. coli to DOT gradients reported here are useful for establishing rational scale-up criteria and

Do bacterial cell numbers follow a theoretical Poisson distribution? Comparison of experimentally obtained numbers of single cells with random number generation via computer simulation.

PubMed

Koyama, Kento; Hokunan, Hidekazu; Hasegawa, Mayumi; Kawamura, Shuso; Koseki, Shigenobu

2016-12-01

We investigated a bacterial sample preparation procedure for single-cell studies. In the present study, we examined whether single bacterial cells obtained via 10-fold dilution followed a theoretical Poisson distribution. Four serotypes of Salmonella enterica, three serotypes of enterohaemorrhagic Escherichia coli and one serotype of Listeria monocytogenes were used as sample bacteria. An inoculum of each serotype was prepared via a 10-fold dilution series to obtain bacterial cell counts with mean values of one or two. To determine whether the experimentally obtained bacterial cell counts follow a theoretical Poisson distribution, a likelihood ratio test between the experimentally obtained cell counts and Poisson distribution which parameter estimated by maximum likelihood estimation (MLE) was conducted. The bacterial cell counts of each serotype sufficiently followed a Poisson distribution. Furthermore, to examine the validity of the parameters of Poisson distribution from experimentally obtained bacterial cell counts, we compared these with the parameters of a Poisson distribution that were estimated using random number generation via computer simulation. The Poisson distribution parameters experimentally obtained from bacterial cell counts were within the range of the parameters estimated using a computer simulation. These results demonstrate that the bacterial cell counts of each serotype obtained via 10-fold dilution followed a Poisson distribution. The fact that the frequency of bacterial cell counts follows a Poisson distribution at low number would be applied to some single-cell studies with a few bacterial cells. In particular, the procedure presented in this study enables us to develop an inactivation model at the single-cell level that can estimate the variability of survival bacterial numbers during the bacterial death process. Copyright © 2016 Elsevier Ltd. All rights reserved.

Transcription termination factor Rho and microbial phenotypic heterogeneity.

PubMed

Bidnenko, Elena; Bidnenko, Vladimir

2018-06-01

Populations of genetically identical microorganisms exhibit high degree of cell-to-cell phenotypic diversity even when grown in uniform environmental conditions. Heterogeneity is a genetically determined trait, which ensures bacterial adaptation and survival in the ever changing environmental conditions. Fluctuations in gene expression (noise) at the level of transcription initiation largely contribute to cell-to-cell variability within population. Not surprisingly, the analyses of the mechanisms driving phenotypic heterogeneity are mainly focused on the activity of promoters and transcriptional factors. Less attention is currently given to a role of intrinsic and factor-dependent transcription terminators. Here, we discuss recent advances in understanding the regulatory role of the multi-functional transcription termination factor Rho, the major inhibitor of pervasive transcription in bacteria and the emerging global regulator of gene expression. We propose that termination activity of Rho might be among the mechanisms by which cells manage the intensity of transcriptional noise, thus affecting population heterogeneity.

Transcriptional response of Musca domestica larvae to bacterial infection.

PubMed

Tang, Ting; Li, Xiang; Yang, Xue; Yu, Xue; Wang, Jianhui; Liu, Fengsong; Huang, Dawei

2014-01-01

The house fly Musca domestica, a cosmopolitan dipteran insect, is a significant vector for human and animal bacterial pathogens, but little is known about its immune response to these pathogens. To address this issue, we inoculated the larvae with a mixture of Escherichia coli and Staphylococcus aureus and profiled the transcriptome 6, 24, and 48 h thereafter. Many genes known to controlling innate immunity in insects were induced following infection, including genes encoding pattern recognition proteins (PGRPs), various components of the Toll and IMD signaling pathways and of the proPO-activating and redox systems, and multiple antimicrobial peptides. Interestingly, we also uncovered a large set of novel immune response genes including two broad-spectrum antimicrobial peptides (muscin and domesticin), which might have evolved to adapt to house-fly's unique ecological environments. Finally, genes mediating oxidative phosphorylation were repressed at 48 h post-infection, suggesting disruption of energy homeostasis and mitochondrial function at the late stages of infection. Collectively, our data reveal dynamic changes in gene expression following bacterial infection in the house fly, paving the way for future in-depth analysis of M. domestica's immune system.

A model for genesis of transcription systems.

PubMed

Burton, Zachary F; Opron, Kristopher; Wei, Guowei; Geiger, James H

2016-01-01

Repeating sequences generated from RNA gene fusions/ligations dominate ancient life, indicating central importance of building structural complexity in evolving biological systems. A simple and coherent story of life on earth is told from tracking repeating motifs that generate α/β proteins, 2-double-Ψ-β-barrel (DPBB) type RNA polymerases (RNAPs), general transcription factors (GTFs), and promoters. A general rule that emerges is that biological complexity that arises through generation of repeats is often bounded by solubility and closure (i.e., to form a pseudo-dimer or a barrel). Because the first DNA genomes were replicated by DNA template-dependent RNA synthesis followed by RNA template-dependent DNA synthesis via reverse transcriptase, the first DNA replication origins were initially 2-DPBB type RNAP promoters. A simplifying model for evolution of promoters/replication origins via repetition of core promoter elements is proposed. The model can explain why Pribnow boxes in bacterial transcription (i.e., (-12)TATAATG(-6)) so closely resemble TATA boxes (i.e., (-31)TATAAAAG(-24)) in archaeal/eukaryotic transcription. The evolution of anchor DNA sequences in bacterial (i.e., (-35)TTGACA(-30)) and archaeal (BRE(up); BRE for TFB recognition element) promoters is potentially explained. The evolution of BRE(down) elements of archaeal promoters is potentially explained.

Sensing new chemicals with bacterial transcription factors.

PubMed

Libis, Vincent; Delépine, Baudoin; Faulon, Jean-Loup

2016-10-01

Bacteria rely on allosteric transcription factors (aTFs) to sense a wide range of chemicals. The variety of effectors has contributed in making aTFs the most used input system in synthetic biological circuits. Considering their enabling role in biotechnology, an important question concerns the size of the chemical space that can potentially be detected by these biosensors. From digging into the ever changing repertoire of natural regulatory circuits, to advances in aTF engineering, we review here different strategies that are pushing the boundaries of this chemical space. We also review natural and synthetic cases of indirect sensing, where aTFs work in combination with metabolism to enable detection of new molecules. Copyright © 2016 Elsevier Ltd. All rights reserved.

SPARTA: Simple Program for Automated reference-based bacterial RNA-seq Transcriptome Analysis.

PubMed

Johnson, Benjamin K; Scholz, Matthew B; Teal, Tracy K; Abramovitch, Robert B

2016-02-04

Many tools exist in the analysis of bacterial RNA sequencing (RNA-seq) transcriptional profiling experiments to identify differentially expressed genes between experimental conditions. Generally, the workflow includes quality control of reads, mapping to a reference, counting transcript abundance, and statistical tests for differentially expressed genes. In spite of the numerous tools developed for each component of an RNA-seq analysis workflow, easy-to-use bacterially oriented workflow applications to combine multiple tools and automate the process are lacking. With many tools to choose from for each step, the task of identifying a specific tool, adapting the input/output options to the specific use-case, and integrating the tools into a coherent analysis pipeline is not a trivial endeavor, particularly for microbiologists with limited bioinformatics experience. To make bacterial RNA-seq data analysis more accessible, we developed a Simple Program for Automated reference-based bacterial RNA-seq Transcriptome Analysis (SPARTA). SPARTA is a reference-based bacterial RNA-seq analysis workflow application for single-end Illumina reads. SPARTA is turnkey software that simplifies the process of analyzing RNA-seq data sets, making bacterial RNA-seq analysis a routine process that can be undertaken on a personal computer or in the classroom. The easy-to-install, complete workflow processes whole transcriptome shotgun sequencing data files by trimming reads and removing adapters, mapping reads to a reference, counting gene features, calculating differential gene expression, and, importantly, checking for potential batch effects within the data set. SPARTA outputs quality analysis reports, gene feature counts and differential gene expression tables and scatterplots. SPARTA provides an easy-to-use bacterial RNA-seq transcriptional profiling workflow to identify differentially expressed genes between experimental conditions. This software will enable microbiologists with

Pesticide Side Effects in an Agricultural Soil Ecosystem as Measured by amoA Expression Quantification and Bacterial Diversity Changes

PubMed Central

Feld, Louise; Hjelmsø, Mathis Hjort; Nielsen, Morten Schostag; Jacobsen, Anne Dorthe; Rønn, Regin; Ekelund, Flemming; Krogh, Paul Henning; Strobel, Bjarne Westergaard; Jacobsen, Carsten Suhr

2015-01-01

Background and Methods Assessing the effects of pesticide hazards on microbiological processes in the soil is currently based on analyses that provide limited insight into the ongoing processes. This study proposes a more comprehensive approach. The side effects of pesticides may appear as changes in the expression of specific microbial genes or as changes in diversity. To assess the impact of pesticides on gene expression, we focused on the amoA gene, which is involved in ammonia oxidation. We prepared soil microcosms and exposed them to dazomet, mancozeb or no pesticide. We hypothesized that the amount of amoA transcript decreases upon pesticide application, and to test this hypothesis, we used reverse-transcription qPCR. We also hypothesized that bacterial diversity is affected by pesticides. This hypothesis was investigated via 454 sequencing and diversity analysis of the 16S ribosomal RNA and RNA genes, representing the active and total soil bacterial communities, respectively. Results and Conclusion Treatment with dazomet reduced both the bacterial and archaeal amoA transcript numbers by more than two log units and produced long-term effects for more than 28 days. Mancozeb also inhibited the numbers of amoA transcripts, but only transiently. The bacterial and archaeal amoA transcripts were both sensitive bioindicators of pesticide side effects. Additionally, the numbers of bacterial amoA transcripts correlated with nitrate production in N-amended microcosms. Dazomet reduced the total bacterial numbers by one log unit, but the population size was restored after twelve days. The diversity of the active soil bacteria also seemed to be re-established after twelve days. However, the total bacterial diversity as reflected in the 16S ribosomal RNA gene sequences was largely dominated by Firmicutes and Proteobacteria at day twelve, likely reflecting a halt in the growth of early opportunists and the re-establishment of a more diverse population. We observed no

Land use type significantly affects microbial gene transcription in soil.

PubMed

Nacke, Heiko; Fischer, Christiane; Thürmer, Andrea; Meinicke, Peter; Daniel, Rolf

2014-05-01

Soil microorganisms play an essential role in sustaining biogeochemical processes and cycling of nutrients across different land use types. To gain insights into microbial gene transcription in forest and grassland soil, we isolated mRNA from 32 sampling sites. After sequencing of generated complementary DNA (cDNA), a total of 5,824,229 sequences could be further analyzed. We were able to assign nonribosomal cDNA sequences to all three domains of life. A dominance of bacterial sequences, which were affiliated to 25 different phyla, was found. Bacterial groups capable of aromatic compound degradation such as Phenylobacterium and Burkholderia were detected in significantly higher relative abundance in forest soil than in grassland soil. Accordingly, KEGG pathway categories related to degradation of aromatic ring-containing molecules (e.g., benzoate degradation) were identified in high abundance within forest soil-derived metatranscriptomic datasets. The impact of land use type forest on community composition and activity is evidently to a high degree caused by the presence of wood breakdown products. Correspondingly, bacterial groups known to be involved in lignin degradation and containing ligninolytic genes such as Burkholderia, Bradyrhizobium, and Azospirillum exhibited increased transcriptional activity in forest soil. Higher solar radiation in grassland presumably induced increased transcription of photosynthesis-related genes within this land use type. This is in accordance with high abundance of photosynthetic organisms and plant-infecting viruses in grassland.

A New Improved and Extended Version of the Multicell Bacterial Simulator gro.

PubMed

Gutiérrez, Martín; Gregorio-Godoy, Paula; Pérez Del Pulgar, Guillermo; Muñoz, Luis E; Sáez, Sandra; Rodríguez-Patón, Alfonso

2017-08-18

gro is a cell programming language developed in Klavins Lab for simulating colony growth and cell-cell communication. It is used as a synthetic biology prototyping tool for simulating multicellular biocircuits and microbial consortia. In this work, we present several extensions made to gro that improve the performance of the simulator, make it easier to use, and provide new functionalities. The new version of gro is between 1 and 2 orders of magnitude faster than the original version. It is able to grow microbial colonies with up to 10 5 cells in less than 10 min. A new library, CellEngine, accelerates the resolution of spatial physical interactions between growing and dividing cells by implementing a new shoving algorithm. A genetic library, CellPro, based on Probabilistic Timed Automata, simulates gene expression dynamics using simplified and easy to compute digital proteins. We also propose a more convenient language specification layer, ProSpec, based on the idea that proteins drive cell behavior. CellNutrient, another library, implements Monod-based growth and nutrient uptake functionalities. The intercellular signaling management was improved and extended in a library called CellSignals. Finally, bacterial conjugation, another local cell-cell communication process, was added to the simulator. To show the versatility and potential outreach of this version of gro, we provide studies and novel examples ranging from synthetic biology to evolutionary microbiology. We believe that the upgrades implemented for gro have made it into a powerful and fast prototyping tool capable of simulating a large variety of systems and synthetic biology designs.

Modeling trophic dependencies and exchanges among insects' bacterial symbionts in a host-simulated environment.

PubMed

Opatovsky, Itai; Santos-Garcia, Diego; Ruan, Zhepu; Lahav, Tamar; Ofaim, Shany; Mouton, Laurence; Barbe, Valérie; Jiang, Jiandong; Zchori-Fein, Einat; Freilich, Shiri

2018-05-25

Individual organisms are linked to their communities and ecosystems via metabolic activities. Metabolic exchanges and co-dependencies have long been suggested to have a pivotal role in determining community structure. In phloem-feeding insects such metabolic interactions with bacteria enable complementation of their deprived nutrition. The phloem-feeding whitefly Bemisia tabaci (Hemiptera: Aleyrodidae) harbors an obligatory symbiotic bacterium, as well as varying combinations of facultative symbionts. This well-defined bacterial community in B. tabaci serves here as a case study for a comprehensive and systematic survey of metabolic interactions within the bacterial community and their associations with documented occurrences of bacterial combinations. We first reconstructed the metabolic networks of five common B. tabaci symbionts genera (Portiera, Rickettsia, Hamiltonella, Cardinium and Wolbachia), and then used network analysis approaches to predict: (1) species-specific metabolic capacities in a simulated bacteriocyte-like environment; (2) metabolic capacities of the corresponding species' combinations, and (3) dependencies of each species on different media components. The predictions for metabolic capacities of the symbionts in the host environment were in general agreement with previously reported genome analyses, each focused on the single-species level. The analysis suggests several previously un-reported routes for complementary interactions and estimated the dependency of each symbiont in specific host metabolites. No clear association was detected between metabolic co-dependencies and co-occurrence patterns. The analysis generated predictions for testable hypotheses of metabolic exchanges and co-dependencies in bacterial communities and by crossing them with co-occurrence profiles, contextualized interaction patterns into a wider ecological perspective.

A Transcriptional Regulatory Mechanism Finely Tunes the Firing of Type VI Secretion System in Response to Bacterial Enemies

PubMed Central

Lazzaro, Martina; Feldman, Mario F.

2017-01-01

ABSTRACT The ability to detect and measure danger from an environmental signal is paramount for bacteria to respond accordingly, deploying strategies that halt or counteract potential cellular injury and maximize survival chances. Type VI secretion systems (T6SSs) are complex bacterial contractile nanomachines able to target toxic effectors into neighboring bacteria competing for the same colonization niche. Previous studies support the concept that either T6SSs are constitutively active or they fire effectors in response to various stimuli, such as high bacterial density, cell-cell contact, nutrient depletion, or components from dead sibling cells. For Serratia marcescens, it has been proposed that its T6SS is stochastically expressed, with no distinction between harmless or aggressive competitors. In contrast, we demonstrate that the Rcs regulatory system is responsible for finely tuning Serratia T6SS expression levels, behaving as a transcriptional rheostat. When confronted with harmless bacteria, basal T6SS expression levels suffice for Serratia to eliminate the competitor. A moderate T6SS upregulation is triggered when, according to the aggressor-prey ratio, an unbalanced interplay between homologous and heterologous effectors and immunity proteins takes place. Higher T6SS expression levels are achieved when Serratia is challenged by a contender like Acinetobacter, which indiscriminately fires heterologous effectors able to exert lethal cellular harm, threatening the survival of the Serratia population. We also demonstrate that Serratia’s RcsB-dependent T6SS regulatory mechanism responds not to general stress signals but to the action of specific effectors from competitors, displaying an exquisite strategy to weigh risks and keep the balance between energy expenditure and fitness costs. PMID:28830939

Molecular dynamics simulation study of the "stay or leave" problem for two magnesium ions in gene transcription.

PubMed

Wu, Shaogui

2017-06-01

Two magnesium ions play important roles in nucleotide addition cycle (NAC) of gene transcription. However, at the end of each NAC, why does one ion stay in the active site while the other ion leaves with product pyrophosphate (PP i )? This problem still remains obscure. In this work, we studied the problem using all-atom molecular dynamics simulation combined with steered molecular dynamics and umbrella sampling simulation methods. Our simulations reveal that although both ions are located in the active site after chemistry, their detailed positions are not symmetrical, leading to their different forces from surrounding groups. One ion makes weaker contacts with PP i than the whole protein. Hence, PP i release is less likely to take it away. The other one forms tighter contacts with PP i relative to the protein. The formed (Mg 2+ -PP i ) 2- complex is found to break the contacts with surrounding protein residues one by one so as to dissociate from the active site. This effectively avoids the coexistence of two ions in the active site after PP i release and guarantees a reasonable Mg 2+ ion number in the active site for the next NAC. The observations from this work can provide valuable information for comprehensively understanding the molecular mechanism of transcription. Proteins 2017; 85:1002-1007. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Bacterially-Associated Transcriptional Remodelling in a Distinct Genomic Subtype of Colorectal Cancer Provides a Plausible Molecular Basis for Disease Development

PubMed Central

Goosen, Ryan W.

2016-01-01

The relevance of specific microbial colonisation to colorectal cancer (CRC) disease pathogenesis is increasingly recognised, but our understanding of possible underlying molecular mechanisms that may link colonisation to disease in vivo remains limited. Here, we investigate the relationships between the most commonly studied CRC-associated bacteria (Enterotoxigenic Bacteroides fragilis, pks+ Escherichia coli, Fusobacterium spp., afaC+ E. coli, Enterococcus faecalis & Enteropathogenic E. coli) and altered transcriptomic and methylation profiles of CRC patients, in order to gain insight into the potential contribution of these bacteria in the aetiopathogenesis of CRC. We show that colonisation by E. faecalis and high levels of Fusobacterium is associated with a specific transcriptomic subtype of CRC that is characterised by CpG island methylation, microsatellite instability and a significant increase in inflammatory and DNA damage pathways. Analysis of the significant, bacterially-associated changes in host gene expression, both at the level of individual genes as well as pathways, revealed a transcriptional remodeling that provides a plausible mechanistic link between specific bacterial colonisation and colorectal cancer disease development and progression in this subtype; these included upregulation of REG3A, REG1A and REG1P in the case of high-level colonization by Fusobacterium, and CXCL10 and BMI1 in the case of colonisation by E. faecalis. The enrichment of both E. faecalis and Fusobacterium in this CRC subtype suggests that polymicrobial colonisation of the colonic epithelium may well be an important aspect of colonic tumourigenesis. PMID:27846243

Thermal Unfolding Simulations of Bacterial Flagellin: Insight into its Refolding Before Assembly

PubMed Central

Chng, Choon-Peng; Kitao, Akio

2008-01-01

Flagellin is the subunit of the bacterial filament, the micrometer-long propeller of a bacterial flagellum. The protein is believed to undergo unfolding for transport through the channel of the filament and to refold in a chamber at the end of the channel before being assembled into the growing filament. We report a thermal unfolding simulation study of S. typhimurium flagellin in aqueous solution as an attempt to gain atomic-level insight into the refolding process. Each molecule comprises two filament-core domains {D0, D1} and two hypervariable-region domains {D2, D3}. D2 can be separated into subdomains D2a and D2b. We observed a similar unfolding order of the domains as reported in experimental thermal denaturation. D2a and D3 exhibited high thermal stability and contained persistent three-stranded β-sheets in the denatured state which could serve as folding cores to guide refolding. A recent mutagenesis study on flagellin stability seems to suggest the importance of the folding cores. Using crude size estimates, our data suggests that the chamber might be large enough for either denatured hypervariable-region domains or filament-core domains, but not whole flagellin; this implicates a two-staged refolding process. PMID:18263660

The Campylobacter jejuni MarR-like transcriptional regulators RrpA and RrpB both influence bacterial responses to oxidative and aerobic stresses.

PubMed

Gundogdu, Ozan; da Silva, Daiani T; Mohammad, Banaz; Elmi, Abdi; Mills, Dominic C; Wren, Brendan W; Dorrell, Nick

2015-01-01

The ability of the human intestinal pathogen Campylobacter jejuni to respond to oxidative stress is central to bacterial survival both in vivo during infection and in the environment. Re-annotation of the C. jejuni NCTC11168 genome revealed the presence of two MarR-type transcriptional regulators Cj1546 and Cj1556, originally annotated as hypothetical proteins, which we have designated RrpA and RrpB (regulator of response to peroxide) respectively. Previously we demonstrated a role for RrpB in both oxidative and aerobic (O2) stress and that RrpB was a DNA binding protein with auto-regulatory activity, typical of MarR-type transcriptional regulators. In this study, we show that RrpA is also a DNA binding protein and that a rrpA mutant in strain 11168H exhibits increased sensitivity to hydrogen peroxide oxidative stress. Mutation of either rrpA or rrpB reduces catalase (KatA) expression. However, a rrpAB double mutant exhibits higher levels of resistance to hydrogen peroxide oxidative stress, with levels of KatA expression similar to the wild-type strain. Mutation of either rrpA or rrpB also results in a reduction in the level of katA expression, but this reduction was not observed in the rrpAB double mutant. Neither the rrpA nor rrpB mutant exhibits any significant difference in sensitivity to either cumene hydroperoxide or menadione oxidative stresses, but both mutants exhibit a reduced ability to survive aerobic (O2) stress, enhanced biofilm formation and reduced virulence in the Galleria mellonella infection model. The rrpAB double mutant exhibits wild-type levels of biofilm formation and wild-type levels of virulence in the G mellonella infection model. Together these data indicate a role for both RrpA and RrpB in the C. jejuni peroxide oxidative and aerobic (O2) stress responses, enhancing bacterial survival in vivo and in the environment.

Functional role of pyruvate kinase from Lactobacillus bulgaricus in acid tolerance and identification of its transcription factor by bacterial one-hybrid

PubMed Central

Zhai, Zhengyuan; An, Haoran; Wang, Guohong; Luo, Yunbo; Hao, Yanling

2015-01-01

Lactobacillus delbrueckii subsp. bulgaricus develops acid tolerance response when subjected to acid stress conditions, such as the induction of enzymes associated with carbohydrate metabolism. In this study, pyk gene encoding pyruvate kinase was over-expressed in heterologous host Lactococcus lactis NZ9000, and SDS-PAGE analysis revealed the successful expression of this gene in NZ9000. The survival rate of Pyk-overproducing strain was 45-fold higher than the control under acid stress condition (pH 4.0). In order to determine the transcription factor (TF) which regulates the expression of pyk by bacterial one-hybrid, we constructed a TF library including 65 TFs of L. bulgaricus. Western blotting indicated that TFs in this library could be successfully expressed in host strains. Subsequently, the promoter of pfk-pyk operon in L. bulgaricus was identified by 5′-RACE PCR. The bait plasmid pH3U3-p01 carrying the deletion fragment of pfk-pyk promoter captured catabolite control protein A (CcpA) which could regulate the expression of pyk by binding to a putative catabolite-responsive element (5′-TGTAAGCCCTAACA-3′) upstream the -35 region. Real-time qPCR analysis revealed the transcription of pyk was positively regulated by CcpA. This is the first report about identifying the TF of pyk in L. bulgaricus, which will provide new insight into the regulatory network. PMID:26581248

Using in-cell SHAPE-Seq and simulations to probe structure–function design principles of RNA transcriptional regulators

PubMed Central

Takahashi, Melissa K.; Watters, Kyle E.; Gasper, Paul M.; Abbott, Timothy R.; Carlson, Paul D.; Chen, Alan A.

2016-01-01

Antisense RNA-mediated transcriptional regulators are powerful tools for controlling gene expression and creating synthetic gene networks. RNA transcriptional repressors derived from natural mechanisms called attenuators are particularly versatile, though their mechanistic complexity has made them difficult to engineer. Here we identify a new structure–function design principle for attenuators that enables the forward engineering of new RNA transcriptional repressors. Using in-cell SHAPE-Seq to characterize the structures of attenuator variants within Escherichia coli, we show that attenuator hairpins that facilitate interaction with antisense RNAs require interior loops for proper function. Molecular dynamics simulations of these attenuator variants suggest these interior loops impart structural flexibility. We further observe hairpin flexibility in the cellular structures of natural RNA mechanisms that use antisense RNA interactions to repress translation, confirming earlier results from in vitro studies. Finally, we design new transcriptional attenuators in silico using an interior loop as a structural requirement and show that they function as desired in vivo. This work establishes interior loops as an important structural element for designing synthetic RNA gene regulators. We anticipate that the coupling of experimental measurement of cellular RNA structure and function with computational modeling will enable rapid discovery of structure–function design principles for a diverse array of natural and synthetic RNA regulators. PMID:27103533

Transcription upregulation via force-induced direct stretching of chromatin

NASA Astrophysics Data System (ADS)

Tajik, Arash; Zhang, Yuejin; Wei, Fuxiang; Sun, Jian; Jia, Qiong; Zhou, Wenwen; Singh, Rishi; Khanna, Nimish; Belmont, Andrew S.; Wang, Ning

2016-12-01

Mechanical forces play critical roles in the function of living cells. However, the underlying mechanisms of how forces influence nuclear events remain elusive. Here, we show that chromatin deformation as well as force-induced transcription of a green fluorescent protein (GFP)-tagged bacterial-chromosome dihydrofolate reductase (DHFR) transgene can be visualized in a living cell by using three-dimensional magnetic twisting cytometry to apply local stresses on the cell surface via an Arg-Gly-Asp-coated magnetic bead. Chromatin stretching depended on loading direction. DHFR transcription upregulation was sensitive to load direction and proportional to the magnitude of chromatin stretching. Disrupting filamentous actin or inhibiting actomyosin contraction abrogated or attenuated force-induced DHFR transcription, whereas activating endogenous contraction upregulated force-induced DHFR transcription. Our findings suggest that local stresses applied to integrins propagate from the tensed actin cytoskeleton to the LINC complex and then through lamina-chromatin interactions to directly stretch chromatin and upregulate transcription.

Activation of nuclear transcription factor-kappaB in mouse brain induced by a simulated microgravity environment

NASA Technical Reports Server (NTRS)

Wise, Kimberly C.; Manna, Sunil K.; Yamauchi, Keiko; Ramesh, Vani; Wilson, Bobby L.; Thomas, Renard L.; Sarkar, Shubhashish; Kulkarni, Anil D.; Pellis, Neil R.; Ramesh, Govindarajan T.

2005-01-01

Microgravity induces inflammatory responses and modulates immune functions that may increase oxidative stress. Exposure to a microgravity environment induces adverse neurological effects; however, there is little research exploring the etiology of these effects resulting from exposure to such an environment. It is also known that spaceflight is associated with increase in oxidative stress; however, this phenomenon has not been reproduced in land-based simulated microgravity models. In this study, an attempt has been made to show the induction of reactive oxygen species (ROS) in mice brain, using ground-based microgravity simulator. Increased ROS was observed in brain stem and frontal cortex with concomitant decrease in glutathione, on exposing mice to simulated microgravity for 7 d. Oxidative stress-induced activation of nuclear factor-kappaB was observed in all the regions of the brain. Moreover, mitogen-activated protein kinase kinase was phosphorylated equally in all regions of the brain exposed to simulated microgravity. These results suggest that exposure of brain to simulated microgravity can induce expression of certain transcription factors, and these have been earlier argued to be oxidative stress dependent.

Direct modulation of T-box riboswitch-controlled transcription by protein synthesis inhibitors

PubMed Central

Stamatopoulou, Vassiliki; Apostolidi, Maria; Li, Shuang; Lamprinou, Katerina; Papakyriakou, Athanasios

2017-01-01

Abstract Recently, it was discovered that exposure to mainstream antibiotics activate numerous bacterial riboregulators that control antibiotic resistance genes including metabolite-binding riboswitches and other transcription attenuators. However, the effects of commonly used antibiotics, many of which exhibit RNA-binding properties, on the widespread T-box riboswitches, remain unknown. In Staphylococcus aureus, a species-specific glyS T-box controls the supply of glycine for both ribosomal translation and cell wall synthesis, making it a promising target for next-generation antimicrobials. Here, we report that specific protein synthesis inhibitors could either significantly increase T-box-mediated transcription antitermination, while other compounds could suppress it, both in vitro and in vivo. In-line probing of the full-length T-box combined with molecular modelling and docking analyses suggest that the antibiotics that promote transcription antitermination stabilize the T-box:tRNA complex through binding specific positions on stem I and the Staphylococcal-specific stem Sa. By contrast, the antibiotics that attenuate T-box transcription bind to other positions on stem I and do not interact with stem Sa. Taken together, our results reveal that the transcription of essential genes controlled by T-box riboswitches can be directly modulated by commonly used protein synthesis inhibitors. These findings accentuate the regulatory complexities of bacterial response to antimicrobials that involve multiple riboregulators. PMID:28973457

Genes on a Wire: The Nucleoid-Associated Protein HU Insulates Transcription Units in Escherichia coli

PubMed Central

Berger, Michael; Gerganova, Veneta; Berger, Petya; Rapiteanu, Radu; Lisicovas, Viktoras; Dobrindt, Ulrich

2016-01-01

The extent to which chromosomal gene position in prokaryotes affects local gene expression remains an open question. Several studies have shown that chromosomal re-positioning of bacterial transcription units does not alter their expression pattern, except for a general decrease in gene expression levels from chromosomal origin to terminus proximal positions, which is believed to result from gene dosage effects. Surprisingly, the question as to whether this chromosomal context independence is a cis encoded property of a bacterial transcription unit, or if position independence is a property conferred by factors acting in trans, has not been addressed so far. For this purpose, we established a genetic test system assessing the chromosomal positioning effects by means of identical promoter-fluorescent reporter gene fusions inserted equidistantly from OriC into both chromosomal replichores of Escherichia coli K-12. Our investigations of the reporter activities in mutant cells lacking the conserved nucleoid associated protein HU uncovered various drastic chromosomal positional effects on gene transcription. In addition we present evidence that these positional effects are caused by transcriptional activity nearby the insertion site of our reporter modules. We therefore suggest that the nucleoid-associated protein HU is functionally insulating transcription units, most likely by constraining transcription induced DNA supercoiling. PMID:27545593

RNA-Seq-Based Transcript Structure Analysis with TrBorderExt.

PubMed

Wang, Yejun; Sun, Ming-An; White, Aaron P

2018-01-01

RNA-Seq has become a routine strategy for genome-wide gene expression comparisons in bacteria. Despite lower resolution in transcript border parsing compared with dRNA-Seq, TSS-EMOTE, Cappable-seq, Term-seq, and others, directional RNA-Seq still illustrates its advantages: low cost, quantification and transcript border analysis with a medium resolution (±10-20 nt). To facilitate mining of directional RNA-Seq datasets especially with respect to transcript structure analysis, we developed a tool, TrBorderExt, which can parse transcript start sites and termination sites accurately in bacteria. A detailed protocol is described in this chapter for how to use the software package step by step to identify bacterial transcript borders from raw RNA-Seq data. The package was developed with Perl and R programming languages, and is accessible freely through the website: http://www.szu-bioinf.org/TrBorderExt .

Influence of major-groove chemical modifications of DNA on transcription by bacterial RNA polymerases

PubMed Central

Raindlová, Veronika; Janoušková, Martina; Slavíčková, Michaela; Perlíková, Pavla; Boháčová, Soňa; Milisavljevič, Nemanja; Šanderová, Hana; Benda, Martin; Barvík, Ivan; Krásný, Libor; Hocek, Michal

2016-01-01

DNA templates containing a set of base modifications in the major groove (5-substituted pyrimidines or 7-substituted 7-deazapurines bearing H, methyl, vinyl, ethynyl or phenyl groups) were prepared by PCR using the corresponding base-modified 2′-deoxyribonucleoside triphosphates (dNTPs). The modified templates were used in an in vitro transcription assay using RNA polymerase from Bacillus subtilis and Escherichia coli. Some modified nucleobases bearing smaller modifications (H, Me in 7-deazapurines) were perfectly tolerated by both enzymes, whereas bulky modifications (Ph at any nucleobase) and, surprisingly, uracil blocked transcription. Some middle-sized modifications (vinyl or ethynyl) were partly tolerated mostly by the E. coli enzyme. In all cases where the transcription proceeded, full length RNA product with correct sequence was obtained indicating that the modifications of the template are not mutagenic and the inhibition is probably at the stage of initiation. The results are promising for the development of bioorthogonal reactions for artificial chemical switching of the transcription. PMID:27001521

Suppression of Factor-Dependent Transcription Termination by Antiterminator RNA

PubMed Central

King, Rodney A.; Weisberg, Robert A.

2003-01-01

Nascent transcripts of the phage HK022 put sites modify the transcription elongation complex so that it terminates less efficiently at intrinsic transcription terminators and accelerates through pause sites. We show here that the modification also suppresses termination in vivo at two factor-dependent terminators, one that depends on the bacterial Rho protein and a second that depends on the HK022-encoded Nun protein. Suppression was efficient when the termination factors were present at physiological levels, but an increase in the intracellular concentration of Nun increased termination both in the presence and absence of put. put-mediated antitermination thus shows no apparent terminator specificity, suggesting that put inhibits a step that is common to termination at the different types of terminator. PMID:14645267

New evidence for hybrid acrylic/TiO2 films inducing bacterial inactivation under low intensity simulated sunlight.

PubMed

Bonnefond, Audrey; González, Edurne; Asua, Jose María; Leiza, Jose Ramon; Kiwi, John; Pulgarin, Cesar; Rtimi, Sami

2015-11-01

This study addresses the preparation and characterization of hybrid films prepared from Titanium dioxide (TiO2) Pickering stabilized acrylic polymeric dispersion as well as their bacterial inactivation efficiency under sunlight irradiation. Complete bacterial inactivation under low intensity simulated solar light irradiation (55 mW/cm(2)) was observed within 240 min for the films containing 10 weight based on monomers (wbm) % of TiO2, whereas 360 min were needed for the films containing 20 wbm% of TiO2. The hybrid films showed repetitive Escherichia coli (E. coli) inactivation under light irradiation. TiO2 released from the films surfaces was measured by inductively coupled plasma mass spectrometry (IPC-MS), obtaining values of ∼ 0.5 and 1 ppb/cm(2) for the films containing 10 wbm% and 20 wbm% of TiO2, respectively, far below the allowed cytotoxicity level for TiO2 (200 ppb). Transmission electron microscopy (TEM) of the hybrid films showed that TiO2 nanoparticles (NPs) were located at the polymer particle's surface forming a continuous inorganic network inside the film matrix. Atomic force microscopy (AFM) images showed differences in the TiO2 dispersion between the air-film and film-substrate interfaces. Films containing 10 wbm% of TiO2 had higher roughness (Rg) at both interfaces than the one containing 20 wbm% of TiO2 inducing an increase in the bacterial adhesion as well as the bacterial inactivation kinetics. The highly oxidative OH-radicals participating in the bacterial inactivation were determined by fluorescence. Copyright © 2015 Elsevier B.V. All rights reserved.

A host basal transcription factor is a key component for infection of rice by TALE-carrying bacteria.

PubMed

Yuan, Meng; Ke, Yinggen; Huang, Renyan; Ma, Ling; Yang, Zeyu; Chu, Zhaohui; Xiao, Jinghua; Li, Xianghua; Wang, Shiping

2016-07-29

Transcription activator-like effectors (TALEs) are sequence-specific DNA binding proteins found in a range of plant pathogenic bacteria, where they play important roles in host-pathogen interactions. However, it has been unclear how TALEs, after they have been injected into the host cells, activate transcription of host genes required for infection success. Here, we show that the basal transcription factor IIA gamma subunit TFIIAγ5 from rice is a key component for infection by the TALE-carrying bacterium Xanthomonas oryzae pv. oryzae, the causal agent for bacterial blight. Direct interaction of several TALEs with TFIIAγ5 is required for activation of disease susceptibility genes. Conversely, reduced expression of the TFIIAγ5 host gene limits the induction of susceptibility genes and thus decreases bacterial blight symptoms. Suppression or mutation of TFIIAγ5 can also reduce bacterial streak, another devastating disease of rice caused by TALE-carrying X. oryzae pv. oryzicola. These results have important implications for formulating a widely applicable strategy with which to improve resistance of plants to TALE-carrying pathogens.

Transcriptional Response of Honey Bee Larvae Infected with the Bacterial Pathogen Paenibacillus larvae

PubMed Central

Cornman, Robert Scott; Lopez, Dawn; Evans, Jay D.

2013-01-01

American foulbrood disease of honey bees is caused by the bacterium Paenibacillus larvae. Infection occurs per os in larvae and systemic infection requires a breaching of the host peritrophic matrix and midgut epithelium. Genetic variation exists for both bacterial virulence and host resistance, and a general immunity is achieved by larvae as they age, the basis of which has not been identified. To quickly identify a pool of candidate genes responsive to P. larvae infection, we sequenced transcripts from larvae inoculated with P. larvae at 12 hours post-emergence and incubated for 72 hours, and compared expression levels to a control cohort. We identified 75 genes with significantly higher expression and six genes with significantly lower expression. In addition to several antimicrobial peptides, two genes encoding peritrophic-matrix domains were also up-regulated. Extracellular matrix proteins, proteases/protease inhibitors, and members of the Osiris gene family were prevalent among differentially regulated genes. However, analysis of Drosophila homologs of differentially expressed genes revealed spatial and temporal patterns consistent with developmental asynchrony as a likely confounder of our results. We therefore used qPCR to measure the consistency of gene expression changes for a subset of differentially expressed genes. A replicate experiment sampled at both 48 and 72 hours post infection allowed further discrimination of genes likely to be involved in host response. The consistently responsive genes in our test set included a hymenopteran-specific protein tyrosine kinase, a hymenopteran specific serine endopeptidase, a cytochrome P450 (CYP9Q1), and a homolog of trynity, a zona pellucida domain protein. Of the known honey bee antimicrobial peptides, apidaecin was responsive at both time-points studied whereas hymenoptaecin was more consistent in its level of change between biological replicates and had the greatest increase in expression by RNA-seq analysis

Transcriptional response of honey bee larvae infected with the bacterial pathogen Paenibacillus larvae.

PubMed

Cornman, Robert Scott; Lopez, Dawn; Evans, Jay D

2013-01-01

American foulbrood disease of honey bees is caused by the bacterium Paenibacillus larvae. Infection occurs per os in larvae and systemic infection requires a breaching of the host peritrophic matrix and midgut epithelium. Genetic variation exists for both bacterial virulence and host resistance, and a general immunity is achieved by larvae as they age, the basis of which has not been identified. To quickly identify a pool of candidate genes responsive to P. larvae infection, we sequenced transcripts from larvae inoculated with P. larvae at 12 hours post-emergence and incubated for 72 hours, and compared expression levels to a control cohort. We identified 75 genes with significantly higher expression and six genes with significantly lower expression. In addition to several antimicrobial peptides, two genes encoding peritrophic-matrix domains were also up-regulated. Extracellular matrix proteins, proteases/protease inhibitors, and members of the Osiris gene family were prevalent among differentially regulated genes. However, analysis of Drosophila homologs of differentially expressed genes revealed spatial and temporal patterns consistent with developmental asynchrony as a likely confounder of our results. We therefore used qPCR to measure the consistency of gene expression changes for a subset of differentially expressed genes. A replicate experiment sampled at both 48 and 72 hours post infection allowed further discrimination of genes likely to be involved in host response. The consistently responsive genes in our test set included a hymenopteran-specific protein tyrosine kinase, a hymenopteran specific serine endopeptidase, a cytochrome P450 (CYP9Q1), and a homolog of trynity, a zona pellucida domain protein. Of the known honey bee antimicrobial peptides, apidaecin was responsive at both time-points studied whereas hymenoptaecin was more consistent in its level of change between biological replicates and had the greatest increase in expression by RNA-seq analysis.

Immunomodulators targeting MARCO expression improve resistance to postinfluenza bacterial pneumonia.

PubMed

Wu, Muzo; Gibbons, John G; DeLoid, Glen M; Bedugnis, Alice S; Thimmulappa, Rajesh K; Biswal, Shyam; Kobzik, Lester

2017-07-01

Downregulation of the alveolar macrophage (AM) receptor with collagenous structure (MARCO) leads to susceptibility to postinfluenza bacterial pneumonia, a major cause of morbidity and mortality. We sought to determine whether immunomodulation of MARCO could improve host defense and resistance to secondary bacterial pneumonia. RNAseq analysis identified a striking increase in MARCO expression between days 9 and 11 after influenza infection and indicated important roles for Akt and Nrf2 in MARCO recovery. In vitro, primary human AM-like monocyte-derived macrophages (AM-MDMs) and THP-1 macrophages were treated with IFNγ to model influenza effects. Activators of Nrf2 (sulforaphane) or Akt (SC79) caused increased MARCO expression and a MARCO-dependent improvement in phagocytosis in IFNγ-treated cells and improved survival in mice with postinfluenza pneumococcal pneumonia. Transcription factor analysis also indicated a role for transcription factor E-box (TFEB) in MARCO recovery. Overexpression of TFEB in THP-1 cells led to marked increases in MARCO. The ability of Akt activation to increase MARCO expression in IFNγ-treated AM-MDMs was abrogated in TFEB-knockdown cells, indicating Akt increases MARCO expression through TFEB. Increasing MARCO expression by targeting Nrf2 signaling or the Akt-TFEB-MARCO pathway are promising strategies to improve bacterial clearance and survival in postinfluenza bacterial pneumonia. Copyright © 2017 the American Physiological Society.

Simulated binding of transcription factors to active and inactive regions folds human chromosomes into loops, rosettes and topological domains

PubMed Central

Brackley, Chris A.; Johnson, James; Kelly, Steven; Cook, Peter R.; Marenduzzo, Davide

2016-01-01

Biophysicists are modeling conformations of interphase chromosomes, often basing the strengths of interactions between segments distant on the genetic map on contact frequencies determined experimentally. Here, instead, we develop a fitting-free, minimal model: bivalent or multivalent red and green ‘transcription factors’ bind to cognate sites in strings of beads (‘chromatin’) to form molecular bridges stabilizing loops. In the absence of additional explicit forces, molecular dynamic simulations reveal that bound factors spontaneously cluster—red with red, green with green, but rarely red with green—to give structures reminiscent of transcription factories. Binding of just two transcription factors (or proteins) to active and inactive regions of human chromosomes yields rosettes, topological domains and contact maps much like those seen experimentally. This emergent ‘bridging-induced attraction’ proves to be a robust, simple and generic force able to organize interphase chromosomes at all scales. PMID:27060145

Using in-cell SHAPE-Seq and simulations to probe structure-function design principles of RNA transcriptional regulators.

PubMed

Takahashi, Melissa K; Watters, Kyle E; Gasper, Paul M; Abbott, Timothy R; Carlson, Paul D; Chen, Alan A; Lucks, Julius B

2016-06-01

Antisense RNA-mediated transcriptional regulators are powerful tools for controlling gene expression and creating synthetic gene networks. RNA transcriptional repressors derived from natural mechanisms called attenuators are particularly versatile, though their mechanistic complexity has made them difficult to engineer. Here we identify a new structure-function design principle for attenuators that enables the forward engineering of new RNA transcriptional repressors. Using in-cell SHAPE-Seq to characterize the structures of attenuator variants within Escherichia coli, we show that attenuator hairpins that facilitate interaction with antisense RNAs require interior loops for proper function. Molecular dynamics simulations of these attenuator variants suggest these interior loops impart structural flexibility. We further observe hairpin flexibility in the cellular structures of natural RNA mechanisms that use antisense RNA interactions to repress translation, confirming earlier results from in vitro studies. Finally, we design new transcriptional attenuators in silico using an interior loop as a structural requirement and show that they function as desired in vivo. This work establishes interior loops as an important structural element for designing synthetic RNA gene regulators. We anticipate that the coupling of experimental measurement of cellular RNA structure and function with computational modeling will enable rapid discovery of structure-function design principles for a diverse array of natural and synthetic RNA regulators. © 2016 Takahashi et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Structure and Orientation of Bovine Lactoferrampin in the Mimetic Bacterial Membrane as Revealed by Solid-State NMR and Molecular Dynamics Simulation

PubMed Central

Tsutsumi, Atsushi; Javkhlantugs, Namsrai; Kira, Atsushi; Umeyama, Masako; Kawamura, Izuru; Nishimura, Katsuyuki; Ueda, Kazuyoshi; Naito, Akira

2012-01-01

Bovine lactoferrampin (LFampinB) is a newly discovered antimicrobial peptide found in the N1-domain of bovine lactoferrin (268–284), and consists of 17 amino-acid residues. It is important to determine the orientation and structure of LFampinB in bacterial membranes to reveal the antimicrobial mechanism. We therefore performed 13C and 31P NMR, 13C-31P rotational echo double resonance (REDOR), potassium ion-selective electrode, and quartz-crystal microbalance measurements for LFampinB with mimetic bacterial membrane and molecular-dynamics simulation in acidic membrane. 31P NMR results indicated that LFampinB caused a defect in mimetic bacterial membranes. Ion-selective electrode measurements showed that ion leakage occurred for the mimetic bacterial membrane containing cardiolipin. Quartz-crystal microbalance measurements revealed that LFampinB had greater affinity to acidic phospholipids than that to neutral phospholipids. 13C DD-MAS and static NMR spectra showed that LFampinB formed an α-helix in the N-terminus region and tilted 45° to the bilayer normal. REDOR dephasing patterns between carbonyl carbon nucleus in LFampinB and phosphorus nuclei in lipid phosphate groups were measured by 13C-31P REDOR and the results revealed that LFampinB is located in the interfacial region of the membrane. Molecular-dynamics simulation showed the tilt angle to be 42° and the rotation angle to be 92.5° for Leu3, which are in excellent agreement with the experimental values. PMID:23083717

The Global Regulatory Architecture of Transcription during the Caulobacter Cell Cycle

PubMed Central

Zhou, Bo; Schrader, Jared M.; Kalogeraki, Virginia S.; Abeliuk, Eduardo; Dinh, Cong B.; Pham, James Q.; Cui, Zhongying Z.; Dill, David L.; McAdams, Harley H.; Shapiro, Lucy

2015-01-01

Each Caulobacter cell cycle involves differentiation and an asymmetric cell division driven by a cyclical regulatory circuit comprised of four transcription factors (TFs) and a DNA methyltransferase. Using a modified global 5′ RACE protocol, we globally mapped transcription start sites (TSSs) at base-pair resolution, measured their transcription levels at multiple times in the cell cycle, and identified their transcription factor binding sites. Out of 2726 TSSs, 586 were shown to be cell cycle-regulated and we identified 529 binding sites for the cell cycle master regulators. Twenty-three percent of the cell cycle-regulated promoters were found to be under the combinatorial control of two or more of the global regulators. Previously unknown features of the core cell cycle circuit were identified, including 107 antisense TSSs which exhibit cell cycle-control, and 241 genes with multiple TSSs whose transcription levels often exhibited different cell cycle timing. Cumulatively, this study uncovered novel new layers of transcriptional regulation mediating the bacterial cell cycle. PMID:25569173

The global regulatory architecture of transcription during the Caulobacter cell cycle.

PubMed

Zhou, Bo; Schrader, Jared M; Kalogeraki, Virginia S; Abeliuk, Eduardo; Dinh, Cong B; Pham, James Q; Cui, Zhongying Z; Dill, David L; McAdams, Harley H; Shapiro, Lucy

2015-01-01

Each Caulobacter cell cycle involves differentiation and an asymmetric cell division driven by a cyclical regulatory circuit comprised of four transcription factors (TFs) and a DNA methyltransferase. Using a modified global 5' RACE protocol, we globally mapped transcription start sites (TSSs) at base-pair resolution, measured their transcription levels at multiple times in the cell cycle, and identified their transcription factor binding sites. Out of 2726 TSSs, 586 were shown to be cell cycle-regulated and we identified 529 binding sites for the cell cycle master regulators. Twenty-three percent of the cell cycle-regulated promoters were found to be under the combinatorial control of two or more of the global regulators. Previously unknown features of the core cell cycle circuit were identified, including 107 antisense TSSs which exhibit cell cycle-control, and 241 genes with multiple TSSs whose transcription levels often exhibited different cell cycle timing. Cumulatively, this study uncovered novel new layers of transcriptional regulation mediating the bacterial cell cycle.

Influence of major-groove chemical modifications of DNA on transcription by bacterial RNA polymerases.

PubMed

Raindlová, Veronika; Janoušková, Martina; Slavíčková, Michaela; Perlíková, Pavla; Boháčová, Soňa; Milisavljevič, Nemanja; Šanderová, Hana; Benda, Martin; Barvík, Ivan; Krásný, Libor; Hocek, Michal

2016-04-20

DNA templates containing a set of base modifications in the major groove (5-substituted pyrimidines or 7-substituted 7-deazapurines bearing H, methyl, vinyl, ethynyl or phenyl groups) were prepared by PCR using the corresponding base-modified 2'-deoxyribonucleoside triphosphates (dNTPs). The modified templates were used in an in vitro transcription assay using RNA polymerase from Bacillus subtilis and Escherichia coli Some modified nucleobases bearing smaller modifications (H, Me in 7-deazapurines) were perfectly tolerated by both enzymes, whereas bulky modifications (Ph at any nucleobase) and, surprisingly, uracil blocked transcription. Some middle-sized modifications (vinyl or ethynyl) were partly tolerated mostly by the E. colienzyme. In all cases where the transcription proceeded, full length RNA product with correct sequence was obtained indicating that the modifications of the template are not mutagenic and the inhibition is probably at the stage of initiation. The results are promising for the development of bioorthogonal reactions for artificial chemical switching of the transcription. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

An RNA motif advances transcription by preventing Rho-dependent termination

PubMed Central

Sevostyanova, Anastasia; Groisman, Eduardo A.

2015-01-01

The transcription termination factor Rho associates with most nascent bacterial RNAs as they emerge from RNA polymerase. However, pharmacological inhibition of Rho derepresses only a small fraction of these transcripts. What, then, determines the specificity of Rho-dependent transcription termination? We now report the identification of a Rho-antagonizing RNA element (RARE) that hinders Rho-dependent transcription termination. We establish that RARE traps Rho in an inactive complex but does not prevent Rho binding to its recruitment sites. Although translating ribosomes normally block Rho access to an mRNA, inefficient translation of an open reading frame in the leader region of the Salmonella mgtCBR operon actually enables transcription of its associated coding region by favoring an RNA conformation that sequesters RARE. The discovery of an RNA element that inactivates Rho signifies that the specificity of nucleic-acid binding proteins is defined not only by the sequences that recruit these proteins but also by sequences that antagonize their activity. PMID:26630006

Direct modulation of T-box riboswitch-controlled transcription by protein synthesis inhibitors.

PubMed

Stamatopoulou, Vassiliki; Apostolidi, Maria; Li, Shuang; Lamprinou, Katerina; Papakyriakou, Athanasios; Zhang, Jinwei; Stathopoulos, Constantinos

2017-09-29

Recently, it was discovered that exposure to mainstream antibiotics activate numerous bacterial riboregulators that control antibiotic resistance genes including metabolite-binding riboswitches and other transcription attenuators. However, the effects of commonly used antibiotics, many of which exhibit RNA-binding properties, on the widespread T-box riboswitches, remain unknown. In Staphylococcus aureus, a species-specific glyS T-box controls the supply of glycine for both ribosomal translation and cell wall synthesis, making it a promising target for next-generation antimicrobials. Here, we report that specific protein synthesis inhibitors could either significantly increase T-box-mediated transcription antitermination, while other compounds could suppress it, both in vitro and in vivo. In-line probing of the full-length T-box combined with molecular modelling and docking analyses suggest that the antibiotics that promote transcription antitermination stabilize the T-box:tRNA complex through binding specific positions on stem I and the Staphylococcal-specific stem Sa. By contrast, the antibiotics that attenuate T-box transcription bind to other positions on stem I and do not interact with stem Sa. Taken together, our results reveal that the transcription of essential genes controlled by T-box riboswitches can be directly modulated by commonly used protein synthesis inhibitors. These findings accentuate the regulatory complexities of bacterial response to antimicrobials that involve multiple riboregulators. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

RNA transcriptional biosignature analysis for identifying febrile infants with serious bacterial infections in the emergency department: a feasibility study.

PubMed

Mahajan, Prashant; Kuppermann, Nathan; Suarez, Nicolas; Mejias, Asuncion; Casper, Charlie; Dean, J Michael; Ramilo, Octavio

2015-01-01

To develop the infrastructure and demonstrate the feasibility of conducting microarray-based RNA transcriptional profile analyses for the diagnosis of serious bacterial infections in febrile infants 60 days and younger in a multicenter pediatric emergency research network. We designed a prospective multicenter cohort study with the aim of enrolling more than 4000 febrile infants 60 days and younger. To ensure success of conducting complex genomic studies in emergency department (ED) settings, we established an infrastructure within the Pediatric Emergency Care Applied Research Network, including 21 sites, to evaluate RNA transcriptional profiles in young febrile infants. We developed a comprehensive manual of operations and trained site investigators to obtain and process blood samples for RNA extraction and genomic analyses. We created standard operating procedures for blood sample collection, processing, storage, shipping, and analyses. We planned to prospectively identify, enroll, and collect 1 mL blood samples for genomic analyses from eligible patients to identify logistical issues with study procedures. Finally, we planned to batch blood samples and determined RNA quantity and quality at the central microarray laboratory and organized data analysis with the Pediatric Emergency Care Applied Research Network data coordinating center. Below we report on establishment of the infrastructure and the feasibility success in the first year based on the enrollment of a limited number of patients. We successfully established the infrastructure at 21 EDs. Over the first 5 months we enrolled 79% (74 of 94) of eligible febrile infants. We were able to obtain and ship 1 mL of blood from 74% (55 of 74) of enrolled participants, with at least 1 sample per participating ED. The 55 samples were shipped and evaluated at the microarray laboratory, and 95% (52 of 55) of blood samples were of adequate quality and contained sufficient RNA for expression analysis. It is possible to

The Effects of Simulated Weightlessness on Susceptibility to Viral and Bacterial Infections Using a Murine Model

NASA Technical Reports Server (NTRS)

Gould, C. L.

1985-01-01

Certain immunological responses may be compromised as a result of changes in environmental conditions, such as the physiological adaptation to and from the weightlessness which occurs during space flight and recovery. A murine antiorthostatic model was developed to simulate weightlessness. Using this model, the proposed study will determine if differences in susceptibility to viral and bacterial infections exist among mice suspended in an antiorthostatic orientation to simulate weightlessness, mice suspended in an orthostatic orientation to provide a stressful situation without the condition of weightlessness simulation, and non-suspended control mice. Inbred mouse strains which are resistant to the diabetogenic effects of the D variant of encephalomyocarditis virus (EMC-D) and the lethal effects of Salmonella typhimurium will be evaluated. Glucose tolerance tests will be performed on all EMC-D-infected and non-infected control groups. The incidence of EMC-D-induced diabetes and the percentage survival of S. typhimurium-infected animals will be determined in each group. An additional study will determine the effects of simulated weightlessness on murine responses to exogenous interferon.

Riboregulation of the bacterial actin-homolog MreB by DsrA small noncoding RNA.

PubMed

Cayrol, Bastien; Fortas, Emilie; Martret, Claire; Cech, Grzegorz; Kloska, Anna; Caulet, Stephane; Barbet, Marion; Trépout, Sylvain; Marco, Sergio; Taghbalout, Aziz; Busi, Florent; Wegrzyn, Grzegorz; Arluison, Véronique

2015-01-01

The bacterial actin-homolog MreB is a key player in bacterial cell-wall biosynthesis and is required for the maintenance of the rod-like morphology of Escherichia coli. However, how MreB cellular levels are adjusted to growth conditions is poorly understood. Here, we show that DsrA, an E. coli small noncoding RNA (sRNA), is involved in the post-transcriptional regulation of mreB. DsrA is required for the downregulation of MreB cellular concentration during environmentally induced slow growth-rates, mainly growth at low temperature and during the stationary phase. DsrA interacts in an Hfq-dependent manner with the 5' region of mreB mRNA, which contains signals for translation initiation and thereby affects mreB translation and stability. Moreover, as DsrA is also involved in the regulation of two transcriptional regulators, σ(S) and the nucleoid associated protein H-NS, which negatively regulate mreB transcription, it also indirectly contributes to mreB transcriptional down-regulation. By using quantitative analyses, our results evidence the complexity of this regulation and the tangled interplay between transcriptional and post-transcriptional control. As transcription factors and sRNA-mediated post-transcriptional regulators use different timescales, we propose that the sRNA pathway helps to adapt to changes in temperature, but also indirectly mediates long-term regulation of MreB concentration. The tight regulation and fine-tuning of mreB gene expression in response to cellular stresses is discussed in regard to the effect of the MreB protein on cell elongation.

Transcriptional Control of the Lateral-Flagellar Genes of Bradyrhizobium diazoefficiens.

PubMed

Mongiardini, Elías J; Quelas, J Ignacio; Dardis, Carolina; Althabegoiti, M Julia; Lodeiro, Aníbal R

2017-08-01

Bradyrhizobium diazoefficiens , a soybean N 2 -fixing symbiont, possesses a dual flagellar system comprising a constitutive subpolar flagellum and inducible lateral flagella. Here, we analyzed the genomic organization and biosynthetic regulation of the lateral-flagellar genes. We found that these genes are located in a single genomic cluster, organized in two monocistronic transcriptional units and three operons, one possibly containing an internal transcription start site. Among the monocistronic units is blr6846, homologous to the class IB master regulators of flagellum synthesis in Brucella melitensis and Ensifer meliloti and required for the expression of all the lateral-flagellar genes except lafA2 , whose locus encodes a single lateral flagellin. We therefore named blr6846 lafR ( la teral- f lagellar r egulator). Despite its similarity to two-component response regulators and its possession of a phosphorylatable Asp residue, lafR behaved as an orphan response regulator by not requiring phosphorylation at this site. Among the genes induced by lafR is flbT L , a class III regulator. We observed different requirements for FlbT L in the synthesis of each flagellin subunit. Although the accumulation of lafA1 , but not lafA2 , transcripts required FlbT L , the production of both flagellin polypeptides required FlbT L Moreover, the regulation cascade of this lateral-flagellar regulon appeared to be not as strictly ordered as those found in other bacterial species. IMPORTANCE Bacterial motility seems essential for the free-living style in the environment, and therefore these microorganisms allocate a great deal of their energetic resources to the biosynthesis and functioning of flagella. Despite energetic costs, some bacterial species possess dual flagellar systems, one of which is a primary system normally polar or subpolar, and the other is a secondary, lateral system that is produced only under special circumstances. Bradyrhizobium diazoefficiens , an N 2 -fixing

Transcription Factors Involved in Plant Resistance to Pathogens.

PubMed

Amorim, Lidiane L B; da Fonseca Dos Santos, Romulo; Neto, Joao Pacífico Bezerra; Guida-Santos, Mauro; Crovella, Sergio; Benko-Iseppon, Ana Maria

2017-01-01

Phytopathogenic microorganisms have a significant influence on survival and productivity of several crop plants. Transcription factors (TFs) are important players in the response to biotic stresses, as insect attack and pathogen infection. In face of such adversities many TFs families have been previously reported as differentially expressed in plants as a reaction to bacterial, fungal and viral infection. This review highlights recent progresses in understanding the structure, function, signal regulation and interaction of transcription factors with other proteins in response to pathogens. Hence, we focus on three families of transcription factors: ERF, bZIP and WRKY, due to their abundance, importance and the availability of functionally well-characterized members in response to pathogen attack. Their roles and the possibilities related to the use of this knowledge for engineering pathogen resistance in crop plants are also discussed. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

PRODORIC2: the bacterial gene regulation database in 2018

PubMed Central

Dudek, Christian-Alexander; Hartlich, Juliane; Brötje, David; Jahn, Dieter

2018-01-01

Abstract Bacteria adapt to changes in their environment via differential gene expression mediated by DNA binding transcriptional regulators. The PRODORIC2 database hosts one of the largest collections of DNA binding sites for prokaryotic transcription factors. It is the result of the thoroughly redesigned PRODORIC database. PRODORIC2 is more intuitive and user-friendly. Besides significant technical improvements, the new update offers more than 1000 new transcription factor binding sites and 110 new position weight matrices for genome-wide pattern searches with the Virtual Footprint tool. Moreover, binding sites deduced from high-throughput experiments were included. Data for 6 new bacterial species including bacteria of the Rhodobacteraceae family were added. Finally, a comprehensive collection of sigma- and transcription factor data for the nosocomial pathogen Clostridium difficile is now part of the database. PRODORIC2 is publicly available at http://www.prodoric2.de. PMID:29136200

A host basal transcription factor is a key component for infection of rice by TALE-carrying bacteria

PubMed Central

Yuan, Meng; Ke, Yinggen; Huang, Renyan; Ma, Ling; Yang, Zeyu; Chu, Zhaohui; Xiao, Jinghua; Li, Xianghua; Wang, Shiping

2016-01-01

Transcription activator-like effectors (TALEs) are sequence-specific DNA binding proteins found in a range of plant pathogenic bacteria, where they play important roles in host-pathogen interactions. However, it has been unclear how TALEs, after they have been injected into the host cells, activate transcription of host genes required for infection success. Here, we show that the basal transcription factor IIA gamma subunit TFIIAγ5 from rice is a key component for infection by the TALE-carrying bacterium Xanthomonas oryzae pv. oryzae, the causal agent for bacterial blight. Direct interaction of several TALEs with TFIIAγ5 is required for activation of disease susceptibility genes. Conversely, reduced expression of the TFIIAγ5 host gene limits the induction of susceptibility genes and thus decreases bacterial blight symptoms. Suppression or mutation of TFIIAγ5 can also reduce bacterial streak, another devastating disease of rice caused by TALE-carrying X. oryzae pv. oryzicola. These results have important implications for formulating a widely applicable strategy with which to improve resistance of plants to TALE-carrying pathogens. DOI: http://dx.doi.org/10.7554/eLife.19605.001 PMID:27472897

Interaction of multiple biomimetic antimicrobial polymers with model bacterial membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baul, Upayan, E-mail: upayanb@imsc.res.in; Vemparala, Satyavani, E-mail: vani@imsc.res.in; Kuroda, Kenichi, E-mail: kkuroda@umich.edu

Using atomistic molecular dynamics simulations, interaction of multiple synthetic random copolymers based on methacrylates on prototypical bacterial membranes is investigated. The simulations show that the cationic polymers form a micellar aggregate in water phase and the aggregate, when interacting with the bacterial membrane, induces clustering of oppositely charged anionic lipid molecules to form clusters and enhances ordering of lipid chains. The model bacterial membrane, consequently, develops lateral inhomogeneity in membrane thickness profile compared to polymer-free system. The individual polymers in the aggregate are released into the bacterial membrane in a phased manner and the simulations suggest that the most probablemore » location of the partitioned polymers is near the 1-palmitoyl-2-oleoyl-phosphatidylglycerol (POPG) clusters. The partitioned polymers preferentially adopt facially amphiphilic conformations at lipid-water interface, despite lacking intrinsic secondary structures such as α-helix or β-sheet found in naturally occurring antimicrobial peptides.« less

cry1Aa lacks stability elements at its 5'-UTR but integrity of its transcription terminator is critical to prevent decay of its transcript.

PubMed

Ramírez-Prado, Jorge Humberto; Martínez-Márquez, Eva Isabel; Olmedo-Alvarez, Gabriela

2006-07-01

We analyzed the influence of the 5' and 3' untranslated regions of the Bacillus thuringiensis cry1Aa on its mRNA stability. Although the cry1Aa gene has a stable transcript (8 min), its 5' UTR did not provide stability to the reporter gene uidA. Stability of cry1Aa could be increased to 40 min by addition of an SP82 stability element at the 5' UTR, suggesting that once the 5' and 3' ends were protected initiation of decay could be effectively blocked. We generated mutations in the transcription terminator and found that changes that reduced the stability of the stem, a larger loop, or elimination of the U-trail sharply decreased the half-life of the transcript. Therefore, unlike some stable bacterial transcripts, cry1Aa lacks special features at the end 5' to prevent decay, but its terminator is the main determinant of its stability.

Structure of Thermotoga maritima TM0439: implications for the mechanism of bacterial GntR transcription regulators with Zn2+-binding FCD domains

PubMed Central

Zheng, Meiying; Cooper, David R.; Grossoehme, Nickolas E.; Yu, Minmin; Hung, Li-Wei; Cieslik, Marcin; Derewenda, Urszula; Lesley, Scott A.; Wilson, Ian A.; Giedroc, David P.; Derewenda, Zygmunt S.

2009-01-01

The GntR superfamily of dimeric transcription factors, with more than 6200 members encoded in bacterial genomes, are characterized by N-terminal winged-helix DNA-binding domains and diverse C-terminal regulatory domains which provide a basis for the classification of the constituent families. The largest of these families, FadR, contains nearly 3000 proteins with all-α-helical regulatory domains classified into two related Pfam families: FadR_C and FCD. Only two crystal structures of FadR-family members, those of Escherichia coli FadR protein and LldR from Corynebacterium glutamicum, have been described to date in the literature. Here, the crystal structure of TM0439, a GntR regulator with an FCD domain found in the Thermotoga maritima genome, is described. The FCD domain is similar to that of the LldR regulator and contains a buried metal-binding site. Using atomic absorption spectroscopy and Trp fluorescence, it is shown that the recombinant protein contains bound Ni2+ ions but that it is able to bind Zn2+ with K d < 70 nM. It is concluded that Zn2+ is the likely physiological metal and that it may perform either structural or regulatory roles or both. Finally, the TM0439 structure is compared with two other FadR-family structures recently deposited by structural genomics consortia. The results call for a revision in the classification of the FadR family of transcription factors. PMID:19307717

CoryneRegNet: an ontology-based data warehouse of corynebacterial transcription factors and regulatory networks.

PubMed

Baumbach, Jan; Brinkrolf, Karina; Czaja, Lisa F; Rahmann, Sven; Tauch, Andreas

2006-02-14

The application of DNA microarray technology in post-genomic analysis of bacterial genome sequences has allowed the generation of huge amounts of data related to regulatory networks. This data along with literature-derived knowledge on regulation of gene expression has opened the way for genome-wide reconstruction of transcriptional regulatory networks. These large-scale reconstructions can be converted into in silico models of bacterial cells that allow a systematic analysis of network behavior in response to changing environmental conditions. CoryneRegNet was designed to facilitate the genome-wide reconstruction of transcriptional regulatory networks of corynebacteria relevant in biotechnology and human medicine. During the import and integration process of data derived from experimental studies or literature knowledge CoryneRegNet generates links to genome annotations, to identified transcription factors and to the corresponding cis-regulatory elements. CoryneRegNet is based on a multi-layered, hierarchical and modular concept of transcriptional regulation and was implemented by using the relational database management system MySQL and an ontology-based data structure. Reconstructed regulatory networks can be visualized by using the yFiles JAVA graph library. As an application example of CoryneRegNet, we have reconstructed the global transcriptional regulation of a cellular module involved in SOS and stress response of corynebacteria. CoryneRegNet is an ontology-based data warehouse that allows a pertinent data management of regulatory interactions along with the genome-scale reconstruction of transcriptional regulatory networks. These models can further be combined with metabolic networks to build integrated models of cellular function including both metabolism and its transcriptional regulation.

Computer simulation of the processes of inactivation of bacterial cells by dynamic low-coherent speckles

NASA Astrophysics Data System (ADS)

Ulianova, Onega V.; Ulyanov, Sergey S.; Sazanova, Elena V.; Zhihong, Zhang; Sibo, Zhou; Luo, Qingming; Zudina, Irina; Bednov, Andrey

2006-05-01

Biochemical, biophysical and optical aspects of interaction of low-coherent light with bacterial cells have been discussed. Influence of low-coherent speckles on the colonies grows is investigated. It has been demonstrated that effects of light on the inhibition of cells (Francisella Tularensis) are connected with speckle dynamics. The regimes of illumination of cell suspension with purpose of devitalization of hazard bacteria, caused very dangerous infections, such as tularemia, are found. Mathematical model of interaction of low-coherent laser radiation with bacteria suspension has been proposed. Computer simulations of the processes of laser-cells interaction have been carried out.

A multivariate prediction model for Rho-dependent termination of transcription.

PubMed

Nadiras, Cédric; Eveno, Eric; Schwartz, Annie; Figueroa-Bossi, Nara; Boudvillain, Marc

2018-06-21

Bacterial transcription termination proceeds via two main mechanisms triggered either by simple, well-conserved (intrinsic) nucleic acid motifs or by the motor protein Rho. Although bacterial genomes can harbor hundreds of termination signals of either type, only intrinsic terminators are reliably predicted. Computational tools to detect the more complex and diversiform Rho-dependent terminators are lacking. To tackle this issue, we devised a prediction method based on Orthogonal Projections to Latent Structures Discriminant Analysis [OPLS-DA] of a large set of in vitro termination data. Using previously uncharacterized genomic sequences for biochemical evaluation and OPLS-DA, we identified new Rho-dependent signals and quantitative sequence descriptors with significant predictive value. Most relevant descriptors specify features of transcript C>G skewness, secondary structure, and richness in regularly-spaced 5'CC/UC dinucleotides that are consistent with known principles for Rho-RNA interaction. Descriptors collectively warrant OPLS-DA predictions of Rho-dependent termination with a ∼85% success rate. Scanning of the Escherichia coli genome with the OPLS-DA model identifies significantly more termination-competent regions than anticipated from transcriptomics and predicts that regions intrinsically refractory to Rho are primarily located in open reading frames. Altogether, this work delineates features important for Rho activity and describes the first method able to predict Rho-dependent terminators in bacterial genomes.

The Transcriptional Response of Diverse Saccharomyces cerevisiae Strains to Simulated Microgravity

NASA Technical Reports Server (NTRS)

Neff, Lilly S.; Fleury, Samantha T.; Galazka, Jonathan M.

2018-01-01

Spaceflight imposes multiple stresses on biological systems resulting in genome-scale adaptations. Understanding these adaptations and their underlying molecular mechanisms is important to clarifying and reducing the risks associated with spaceflight. One such risk is infection by microbes present in spacecraft and their associated systems and inhabitants. This risk is compounded by results suggesting that some microbes may exhibit increased virulence after exposure to spaceflight conditions. The yeast, S. cerevisiae, is a powerful microbial model system, and it's response to spaceflight has been studied for decades. However, to date, these studies have utilized common lab strains. Yet studies on trait variation in S. cerevisiae demonstrate that these lab strains are not representative of wild yeast and instead respond to environmental stimuli in an a typical manner. Thus, it is not clear how transferable these results are to the wild S. cerevisiae strains likely to be encountered during spaceflight. To determine if diverse S. cerevisiae strains exhibit a conserved response to simulated microgravity, we will utilize a collection of 100 S. cerevisiae strains isolated from clinical, environmental and industrial settings. We will place selected S. cerevisiae strains in simulated microgravity using a high-aspect rotating vessel (HARV) and document their transcriptional response by RNA-sequencing and quantify similarities and differences between strains. Our research will have a strong impact on the understanding of how genetic diversity of microorganisms effects their response to spaceflight, and will serve as a platform for further studies.

The Transcriptional Response of Diverse Saccharomyces Cerevisiae Strains to Simulated Microgravity

NASA Technical Reports Server (NTRS)

Neff, Lily S.; Fleury, Samantha T.; Galazka, Jonathan M.

2017-01-01

Spaceflight imposes multiple stresses on biological systems resulting in genome-scale adaptations. Understanding these adaptations and their underlying molecular mechanisms is important to clarifying and reducing the risks associated with spaceflight. One such risk is infection by microbes present in spacecraft and their associated systems and inhabitants. This risk is compounded by results suggesting that some microbes may exhibit increased virulence after exposure to spaceflight conditions. The yeast, S. cerevisiae, is a powerful microbial model system, and its response to spaceflight has been studied for decades. However, to date, these studies have utilized common lab strains. Yet studies on trait variation in S. cerevisiae demonstrate that these lab strains are not representative of wild yeast and instead respond to environmental stimuli in an atypical manner. Thus, it is not clear how transferable these results are to the wild S. cerevisiae strains likely to be encountered during spaceflight. To determine if diverse S. cerevisiae strains exhibit a conserved response to simulated microgravity, we will utilize a collection of 100 S. cerevisiae strains isolated from clinical, environmental and industrial settings. We will place selected S. cerevisiae strains in simulated microgravity using a high-aspect rotating vessel (HARV) and document their transcriptional response by RNA-sequencing and quantify similarities and differences between strains. Our research will have a strong impact on the understanding of how genetic diversity of microorganisms effects their response to spaceflight, and will serve as a platform for further studies.

The Transcriptional Response of Diverse Saccharomyces Cerevisiae Strains to Simulated Microgravity

NASA Technical Reports Server (NTRS)

Neff, Lily S.; Fleury, Samantha T.; Galazka, Jonathan M.

2017-01-01

Spaceflight imposes multiple stresses on biological systems resulting in genome-scale adaptations. Understanding these adaptations and their underlying molecular mechanisms is important to clarifying and reducing the risks associated with spaceflight. One such risk is infection by microbes present in spacecraft and their associated systems and inhabitants. This risk is compounded by results suggesting that some microbes may exhibit increased virulence after exposure to spaceflight conditions. The yeast, S. cerevisiae, is a powerful microbial model system, and it's response to spaceflight has been studied for decades. However, to date, these studies have utilized common lab strains. Yet studies on trait variation in S. cerevisiae demonstrate that these lab strains are not representative of wild yeast and instead respond to environmental stimuli in an atypical manner. Thus, it is not clear how transferable these results are to the wild S. cerevisiae strains likely to be encountered during spaceflight. To determine if diverse S. cerevisiae strains exhibit a conserved response to simulated microgravity, we will utilize a collection of 100 S. cerevisiae strains isolated from clinical, environmental and industrial settings. We will place selected S. cerevisiae strains in simulated microgravity using a high-aspect rotating vessel (HARV) and document their transcriptional response by RNA-sequencing and quantify similarities and differences between strains. Our research will have a strong impact on the understanding of how genetic diversity of microorganisms effects their response to spaceflight, and will serve as a platform for further studies.

The Transcriptional Response of Diverse Saccharomyces cerevisiae Strains to Simulated Microgravity

NASA Technical Reports Server (NTRS)

Neff, Lily S.; Fleury, Samantha T.; Galazka, Jonathan M.

2018-01-01

Spaceflight imposes multiple stresses on biological systems resulting in genome-scale adaptations. Understanding these adaptations and their underlying molecular mechanisms is important to clarifying and reducing the risks associated with spaceflight. One such risk is infection by microbes present in spacecraft and their associated systems and inhabitants. This risk is compounded by results suggesting that some microbes may exhibit increased virulence after exposure to spaceflight conditions. The yeast, S. cerevisiae, is a powerful microbial model system, and its response to spaceflight has been studied for decades. However, to date, these studies have utilized common lab strains. Yet studies on trait variation in S. cerevisiae demonstrate that these lab strains are not representative of wild yeast and instead respond to environmental stimuli in an atypical manner. Thus, it is not clear how transferable these results are to the wild S. cerevisiae strains likely to be encountered during spaceflight. To determine if diverse S. cerevisiae strains exhibit a conserved response to simulated microgravity, we will utilize a collection of 100 S. cerevisiae strains isolated from clinical, environmental and industrial settings. We will place selected S. cerevisiae strains in simulated microgravity using a high-aspect rotating vessel (HARV) and document their transcriptional response by RNA-sequencing and quantify similarities and differences between strains. Our research will have a strong impact on the understanding of how genetic diversity of microorganisms effects their response to spaceflight, and will serve as a platform for further studies.

Molecular Mechanism of Uptake of Cationic Photoantimicrobial Phthalocyanine across Bacterial Membranes Revealed by Molecular Dynamics Simulations.

PubMed

Orekhov, Philipp S; Kholina, Ekaterina G; Bozdaganyan, Marine E; Nesterenko, Alexey M; Kovalenko, Ilya B; Strakhovskaya, Marina G

2018-04-12

the type of counterions, which stabilize it. Thus, the results of our simulations provide a detailed molecular view of ZnPcChol 8+ "self-promoted uptake", the pathway previously proposed for some small molecules crossing the outer bacterial membrane.

Exogenous indirect photoinactivation of bacterial pathogens and indicators in water with natural and synthetic photosensitizers in simulated sunlight with reduced UVB.

PubMed

Maraccini, P A; Wenk, J; Boehm, A B

2016-08-01

To investigate the UVB-independent and exogenous indirect photoinactivation of eight human health-relevant bacterial species in the presence of photosensitizers. Eight bacterial species were exposed to simulated sunlight with greatly reduced UVB light intensity in the presence of three synthetic photosensitizers and two natural photosensitizers. Inactivation curves were fit with shoulder log-linear or first-order kinetic models, from which the presence of a shoulder and magnitude of inactivation rate constants were compared. Eighty-four percent reduction in the UVB light intensity roughly matched a 72-95% reduction in the overall bacterial photoinactivation rate constants in sensitizer-free water. With the UVB light mostly reduced, the exogenous indirect mechanism contribution was evident for most bacteria and photosensitizers tested, although most prominently with the Gram-positive bacteria. Results confirm the importance of UVB light in bacterial photoinactivation and, with the reduction of the UVB light intensity, that the Gram-positive bacteria are more vulnerable to the exogenous indirect mechanism than Gram-negative bacteria. UVB is the most important range of the sunlight spectrum for bacterial photoinactivation. In aquatic environments where photosensitizers are present and there is high UVB light attenuation, UVA and visible wavelengths can contribute to exogenous indirect photoinactivation. © 2016 The Society for Applied Microbiology.

The metabolic enzyme fructose-1,6-bisphosphate aldolase acts as a transcriptional regulator in pathogenic Francisella.

PubMed

Ziveri, Jason; Tros, Fabiola; Guerrera, Ida Chiara; Chhuon, Cerina; Audry, Mathilde; Dupuis, Marion; Barel, Monique; Korniotis, Sarantis; Fillatreau, Simon; Gales, Lara; Cahoreau, Edern; Charbit, Alain

2017-10-11

The enzyme fructose-bisphosphate aldolase occupies a central position in glycolysis and gluconeogenesis pathways. Beyond its housekeeping role in metabolism, fructose-bisphosphate aldolase has been involved in additional functions and is considered as a potential target for drug development against pathogenic bacteria. Here, we address the role of fructose-bisphosphate aldolase in the bacterial pathogen Francisella novicida. We demonstrate that fructose-bisphosphate aldolase is important for bacterial multiplication in macrophages in the presence of gluconeogenic substrates. In addition, we unravel a direct role of this metabolic enzyme in transcription regulation of genes katG and rpoA, encoding catalase and an RNA polymerase subunit, respectively. We propose a model in which fructose-bisphosphate aldolase participates in the control of host redox homeostasis and the inflammatory immune response.The enzyme fructose-bisphosphate aldolase (FBA) plays central roles in glycolysis and gluconeogenesis. Here, Ziveri et al. show that FBA of the pathogen Francisella novicida acts, in addition, as a transcriptional regulator and is important for bacterial multiplication in macrophages.

Top-level dynamics and the regulated gene response of feed-forward loop transcriptional motifs.

PubMed

Mayo, Michael; Abdelzaher, Ahmed; Perkins, Edward J; Ghosh, Preetam

2014-09-01

Feed-forward loops are hierarchical three-node transcriptional subnetworks, wherein a top-level protein regulates the activity of a target gene via two paths: a direct-regulatory path, and an indirect route, whereby the top-level proteins act implicitly through an intermediate transcription factor. Using a transcriptional network of the model bacterium Escherichia coli, we confirmed that nearly all types of feed-forward loop were significantly overrepresented in the bacterial network. We then used mathematical modeling to study their dynamics by manipulating the rise times of the top-level protein concentration, termed the induction time, through alteration of the protein destruction rates. Rise times of the regulated proteins exhibited two qualitatively different regimes, depending on whether top-level inductions were "fast" or "slow." In the fast regime, rise times were nearly independent of rapid top-level inductions, indicative of biological robustness, and occurred when RNA production rate-limits the protein yield. Alternatively, the protein rise times were dependent upon slower top-level inductions, greater than approximately one bacterial cell cycle. An equation is given for this crossover, which depends upon three parameters of the direct-regulatory path: transcriptional cooperation at the DNA-binding site, a protein-DNA dissociation constant, and the relative magnitude of the top-level protien concentration.

Biomimicry of quorum sensing using bacterial lifecycle model.

PubMed

Niu, Ben; Wang, Hong; Duan, Qiqi; Li, Li

2013-01-01

Recent microbiologic studies have shown that quorum sensing mechanisms, which serve as one of the fundamental requirements for bacterial survival, exist widely in bacterial intra- and inter-species cell-cell communication. Many simulation models, inspired by the social behavior of natural organisms, are presented to provide new approaches for solving realistic optimization problems. Most of these simulation models follow population-based modelling approaches, where all the individuals are updated according to the same rules. Therefore, it is difficult to maintain the diversity of the population. In this paper, we present a computational model termed LCM-QS, which simulates the bacterial quorum-sensing (QS) mechanism using an individual-based modelling approach under the framework of Agent-Environment-Rule (AER) scheme, i.e. bacterial lifecycle model (LCM). LCM-QS model can be classified into three main sub-models: chemotaxis with QS sub-model, reproduction and elimination sub-model and migration sub-model. The proposed model is used to not only imitate the bacterial evolution process at the single-cell level, but also concentrate on the study of bacterial macroscopic behaviour. Comparative experiments under four different scenarios have been conducted in an artificial 3-D environment with nutrients and noxious distribution. Detailed study on bacterial chemotatic processes with quorum sensing and without quorum sensing are compared. By using quorum sensing mechanisms, artificial bacteria working together can find the nutrient concentration (or global optimum) quickly in the artificial environment. Biomimicry of quorum sensing mechanisms using the lifecycle model allows the artificial bacteria endowed with the communication abilities, which are essential to obtain more valuable information to guide their search cooperatively towards the preferred nutrient concentrations. It can also provide an inspiration for designing new swarm intelligence optimization algorithms

Biomimicry of quorum sensing using bacterial lifecycle model

PubMed Central

2013-01-01

Background Recent microbiologic studies have shown that quorum sensing mechanisms, which serve as one of the fundamental requirements for bacterial survival, exist widely in bacterial intra- and inter-species cell-cell communication. Many simulation models, inspired by the social behavior of natural organisms, are presented to provide new approaches for solving realistic optimization problems. Most of these simulation models follow population-based modelling approaches, where all the individuals are updated according to the same rules. Therefore, it is difficult to maintain the diversity of the population. Results In this paper, we present a computational model termed LCM-QS, which simulates the bacterial quorum-sensing (QS) mechanism using an individual-based modelling approach under the framework of Agent-Environment-Rule (AER) scheme, i.e. bacterial lifecycle model (LCM). LCM-QS model can be classified into three main sub-models: chemotaxis with QS sub-model, reproduction and elimination sub-model and migration sub-model. The proposed model is used to not only imitate the bacterial evolution process at the single-cell level, but also concentrate on the study of bacterial macroscopic behaviour. Comparative experiments under four different scenarios have been conducted in an artificial 3-D environment with nutrients and noxious distribution. Detailed study on bacterial chemotatic processes with quorum sensing and without quorum sensing are compared. By using quorum sensing mechanisms, artificial bacteria working together can find the nutrient concentration (or global optimum) quickly in the artificial environment. Conclusions Biomimicry of quorum sensing mechanisms using the lifecycle model allows the artificial bacteria endowed with the communication abilities, which are essential to obtain more valuable information to guide their search cooperatively towards the preferred nutrient concentrations. It can also provide an inspiration for designing new swarm

Limitations to estimating bacterial cross-speciestransmission using genetic and genomic markers: inferencesfrom simulation modeling

USGS Publications Warehouse

Julio Andre, Benavides; Cross, Paul C.; Luikart, Gordon; Scott, Creel

2014-01-01

Cross-species transmission (CST) of bacterial pathogens has major implications for human health, livestock, and wildlife management because it determines whether control actions in one species may have subsequent effects on other potential host species. The study of bacterial transmission has benefitted from methods measuring two types of genetic variation: variable number of tandem repeats (VNTRs) and single nucleotide polymorphisms (SNPs). However, it is unclear whether these data can distinguish between different epidemiological scenarios. We used a simulation model with two host species and known transmission rates (within and between species) to evaluate the utility of these markers for inferring CST. We found that CST estimates are biased for a wide range of parameters when based on VNTRs and a most parsimonious reconstructed phylogeny. However, estimations of CST rates lower than 5% can be achieved with relatively low bias using as low as 250 SNPs. CST estimates are sensitive to several parameters, including the number of mutations accumulated since introduction, stochasticity, the genetic difference of strains introduced, and the sampling effort. Our results suggest that, even with whole-genome sequences, unbiased estimates of CST will be difficult when sampling is limited, mutation rates are low, or for pathogens that were recently introduced.

A combinatorial approach to synthetic transcription factor-promoter combinations for yeast strain engineering

DOE PAGES

Dossani, Zain Y.; Reider Apel, Amanda; Szmidt-Middleton, Heather; ...

2017-10-30

Despite the need for inducible promoters in strain development efforts, the majority of engineering in Saccharomyces cerevisiae continues to rely on a few constitutively active or inducible promoters. Building on advances that use the modular nature of both transcription factors and promoter regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein. Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domainmore » of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes, and the hybrid promoters can be induced using estradiol, a compound with no detectable impact on S. cerevisiae physiology. Using combinations of one, two or three operator sequence repeats and a set of native S. cerevisiae promoters, we obtained a series of hybrid promoters that can be induced to different levels, using the same synthetic TF and a given estradiol. Finally, this set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain.« less

A combinatorial approach to synthetic transcription factor‐promoter combinations for yeast strain engineering

PubMed Central

Dossani, Zain Y.; Reider Apel, Amanda; Szmidt‐Middleton, Heather; Hillson, Nathan J.; Deutsch, Samuel; Keasling, Jay D.

2017-01-01

Abstract Despite the need for inducible promoters in strain development efforts, the majority of engineering in Saccharomyces cerevisiae continues to rely on a few constitutively active or inducible promoters. Building on advances that use the modular nature of both transcription factors and promoter regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein. Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domain of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes, and the hybrid promoters can be induced using estradiol, a compound with no detectable impact on S. cerevisiae physiology. Using combinations of one, two or three operator sequence repeats and a set of native S. cerevisiae promoters, we obtained a series of hybrid promoters that can be induced to different levels, using the same synthetic TF and a given estradiol. This set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain. PMID:29084380

A combinatorial approach to synthetic transcription factor-promoter combinations for yeast strain engineering

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dossani, Zain Y.; Reider Apel, Amanda; Szmidt-Middleton, Heather

Despite the need for inducible promoters in strain development efforts, the majority of engineering in Saccharomyces cerevisiae continues to rely on a few constitutively active or inducible promoters. Building on advances that use the modular nature of both transcription factors and promoter regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein. Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domainmore » of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes, and the hybrid promoters can be induced using estradiol, a compound with no detectable impact on S. cerevisiae physiology. Using combinations of one, two or three operator sequence repeats and a set of native S. cerevisiae promoters, we obtained a series of hybrid promoters that can be induced to different levels, using the same synthetic TF and a given estradiol. Finally, this set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain.« less

Host Biomarkers for Distinguishing Bacterial from Non-Bacterial Causes of Acute Febrile Illness: A Comprehensive Review

PubMed Central

Kapasi, Anokhi J.; Dittrich, Sabine; González, Iveth J.; Rodwell, Timothy C.

2016-01-01

Background In resource limited settings acute febrile illnesses are often treated empirically due to a lack of reliable, rapid point-of-care diagnostics. This contributes to the indiscriminate use of antimicrobial drugs and poor treatment outcomes. The aim of this comprehensive review was to summarize the diagnostic performance of host biomarkers capable of differentiating bacterial from non-bacterial infections to guide the use of antibiotics. Methods Online databases of published literature were searched from January 2010 through April 2015. English language studies that evaluated the performance of one or more host biomarker in differentiating bacterial from non-bacterial infection in patients were included. Key information extracted included author information, study methods, population, pathogens, clinical information, and biomarker performance data. Study quality was assessed using a combination of validated criteria from the QUADAS and Lijmer checklists. Biomarkers were categorized as hematologic factors, inflammatory molecules, cytokines, cell surface or metabolic markers, other host biomarkers, host transcripts, clinical biometrics, and combinations of markers. Findings Of the 193 citations identified, 59 studies that evaluated over 112 host biomarkers were selected. Most studies involved patient populations from high-income countries, while 19% involved populations from low- and middle-income countries. The most frequently evaluated host biomarkers were C-reactive protein (61%), white blood cell count (44%) and procalcitonin (34%). Study quality scores ranged from 23.1% to 92.3%. There were 9 high performance host biomarkers or combinations, with sensitivity and specificity of ≥85% or either sensitivity or specificity was reported to be 100%. Five host biomarkers were considered weak markers as they lacked statistically significant performance in discriminating between bacterial and non-bacterial infections. Discussion This manuscript provides a summary

CoryneRegNet: An ontology-based data warehouse of corynebacterial transcription factors and regulatory networks

PubMed Central

Baumbach, Jan; Brinkrolf, Karina; Czaja, Lisa F; Rahmann, Sven; Tauch, Andreas

2006-01-01

Background The application of DNA microarray technology in post-genomic analysis of bacterial genome sequences has allowed the generation of huge amounts of data related to regulatory networks. This data along with literature-derived knowledge on regulation of gene expression has opened the way for genome-wide reconstruction of transcriptional regulatory networks. These large-scale reconstructions can be converted into in silico models of bacterial cells that allow a systematic analysis of network behavior in response to changing environmental conditions. Description CoryneRegNet was designed to facilitate the genome-wide reconstruction of transcriptional regulatory networks of corynebacteria relevant in biotechnology and human medicine. During the import and integration process of data derived from experimental studies or literature knowledge CoryneRegNet generates links to genome annotations, to identified transcription factors and to the corresponding cis-regulatory elements. CoryneRegNet is based on a multi-layered, hierarchical and modular concept of transcriptional regulation and was implemented by using the relational database management system MySQL and an ontology-based data structure. Reconstructed regulatory networks can be visualized by using the yFiles JAVA graph library. As an application example of CoryneRegNet, we have reconstructed the global transcriptional regulation of a cellular module involved in SOS and stress response of corynebacteria. Conclusion CoryneRegNet is an ontology-based data warehouse that allows a pertinent data management of regulatory interactions along with the genome-scale reconstruction of transcriptional regulatory networks. These models can further be combined with metabolic networks to build integrated models of cellular function including both metabolism and its transcriptional regulation. PMID:16478536

Mixed response in bacterial and biochemical variables to simulated sand mining in placer-rich beach sediments, Ratnagiri, West coast of India.

PubMed

Fernandes, Christabelle E G; Das, Anindita; Nath, B N; Faria, Daphne G; Loka Bharathi, P A

2012-05-01

We investigated the influence on bacterial community and biochemical variables through mechanical disturbance of sediment-akin to small-scale mining in Kalbadevi beach, Ratnagiri, a placer-rich beach ecosystem which is a potential mining site. Changes were investigated by comparing three periods, namely phase I before disturbance, phase II just after disturbance, and phase III 24 h after disturbance as the bacterial generation time is ≤7 h. Cores from dune, berm, high-, mid-, and low-tide were examined for changes in distribution of total bacterial abundance, total direct viability (counts under aerobic and anaerobic conditions), culturability and biochemical parameters up to 40 cm depth. Results showed that bacterial abundance decreased by an order from 10(6) cells g(-1) sediment, while, viability reduced marginally. Culturability on different-strength nutrient broth increased by 155% during phase II. Changes in sedimentary proteins, carbohydrates, and lipids were marked at berm and dune and masked at other levels by tidal influence. Sedimentary ATP reduced drastically. During phase III, Pearson's correlation between these variables evolved from non-significant to significant level. Thus, simulated disturbance had a mixed effect on bacterial and biochemical variables of the sediments. It had a negative impact on bacterial abundance, viability and ATP but positive impact on culturability. Viability, culturability, and ATP could act as important indicators reflecting the disturbance in the system at short time intervals. Culturability, which improved by an order, could perhaps be a fraction that contributes to restoration of the system at bacterial level. This baseline information about the potential mining site could help in developing rational approach towards sustainable harnessing of resources with minimum damage to the ecosystem.

The chemical structure of DNA sequence signals for RNA transcription

NASA Technical Reports Server (NTRS)

George, D. G.; Dayhoff, M. O.

1982-01-01

The proposed recognition sites for RNA transcription for E. coli NRA polymerase, bacteriophage T7 RNA polymerase, and eukaryotic RNA polymerase Pol II are evaluated in the light of the requirements for efficient recognition. It is shown that although there is good experimental evidence that specific nucleic acid sequence patterns are involved in transcriptional regulation in bacteria and bacterial viruses, among the sequences now available, only in the case of the promoters recognized by bacteriophage T7 polymerase does it seem likely that the pattern is sufficient. It is concluded that the eukaryotic pattern that is investigated is not restrictive enough to serve as a recognition site.

Riboregulation of bacterial and archaeal transposition.

PubMed

Ellis, Michael J; Haniford, David B

2016-05-01

The coexistence of transposons with their hosts depends largely on transposition levels being tightly regulated to limit the mutagenic burden associated with frequent transposition. For 'DNA-based' (class II) bacterial transposons there is growing evidence that regulation through small noncoding RNAs and/or the RNA-binding protein Hfq are prominent mechanisms of defense against transposition. Recent transcriptomics analyses have identified many new cases of antisense RNAs (asRNA) that potentially could regulate the expression of transposon-encoded genes giving the impression that asRNA regulation of DNA-based transposons is much more frequent than previously thought. Hfq is a highly conserved bacterial protein that plays a central role in posttranscriptional gene regulation and stress response pathways in many bacteria. Three different mechanisms for Hfq-directed control of bacterial transposons have been identified to date highlighting the versatility of this protein as a regulator of bacterial transposons. There is also evidence emerging that some DNA-based transposons encode RNAs that could regulate expression of host genes. In the case of IS200, which appears to have lost its ability to transpose, contributing a regulatory RNA to its host could account for the persistence of this mobile element in a wide range of bacterial species. It remains to be seen how prevalent these transposon-encoded RNA regulators are, but given the relatively large amount of intragenic transcription in bacterial genomes, it would not be surprising if new examples are forthcoming. WIREs RNA 2016, 7:382-398. doi: 10.1002/wrna.1341 For further resources related to this article, please visit the WIREs website. © 2016 Wiley Periodicals, Inc.

The transcription factor relish controls anaplasma marginale infection in the bovine tick rhipicephalus microplus

USDA-ARS?s Scientific Manuscript database

Rhipicephalus microplus is an important biological vector of Anaplasma marginale, the etiological agent of bovine anaplasmosis. The knowledge of tick immune responses to control bacterial infections remains limited. In this study, we demonstrate that transcription factor Relish from the Imd signalin...

Identification of regulatory targets for the bacterial Nus factor complex.

PubMed

Baniulyte, Gabriele; Singh, Navjot; Benoit, Courtney; Johnson, Richard; Ferguson, Robert; Paramo, Mauricio; Stringer, Anne M; Scott, Ashley; Lapierre, Pascal; Wade, Joseph T

2017-12-11

Nus factors are broadly conserved across bacterial species, and are often essential for viability. A complex of five Nus factors (NusB, NusE, NusA, NusG and SuhB) is considered to be a dedicated regulator of ribosomal RNA folding, and has been shown to prevent Rho-dependent transcription termination. Here, we identify an additional cellular function for the Nus factor complex in Escherichia coli: repression of the Nus factor-encoding gene, suhB. This repression occurs primarily by translation inhibition, followed by Rho-dependent transcription termination. Thus, the Nus factor complex can prevent or promote Rho activity depending on the gene context. Conservation of putative NusB/E binding sites upstream of Nus factor genes suggests that Nus factor autoregulation occurs in many bacterial species. Additionally, many putative NusB/E binding sites are also found upstream of other genes in diverse species, and we demonstrate Nus factor regulation of one such gene in Citrobacter koseri. We conclude that Nus factors have an evolutionarily widespread regulatory function beyond ribosomal RNA, and that they are often autoregulatory.

The physical size of transcription factors is key to transcriptional regulation in chromatin domains

NASA Astrophysics Data System (ADS)

Maeshima, Kazuhiro; Kaizu, Kazunari; Tamura, Sachiko; Nozaki, Tadasu; Kokubo, Tetsuro; Takahashi, Koichi

2015-02-01

Genetic information, which is stored in the long strand of genomic DNA as chromatin, must be scanned and read out by various transcription factors. First, gene-specific transcription factors, which are relatively small (˜50 kDa), scan the genome and bind regulatory elements. Such factors then recruit general transcription factors, Mediators, RNA polymerases, nucleosome remodellers, and histone modifiers, most of which are large protein complexes of 1-3 MDa in size. Here, we propose a new model for the functional significance of the size of transcription factors (or complexes) for gene regulation of chromatin domains. Recent findings suggest that chromatin consists of irregularly folded nucleosome fibres (10 nm fibres) and forms numerous condensed domains (e.g., topologically associating domains). Although the flexibility and dynamics of chromatin allow repositioning of genes within the condensed domains, the size exclusion effect of the domain may limit accessibility of DNA sequences by transcription factors. We used Monte Carlo computer simulations to determine the physical size limit of transcription factors that can enter condensed chromatin domains. Small gene-specific transcription factors can penetrate into the chromatin domains and search their target sequences, whereas large transcription complexes cannot enter the domain. Due to this property, once a large complex binds its target site via gene-specific factors it can act as a ‘buoy’ to keep the target region on the surface of the condensed domain and maintain transcriptional competency. This size-dependent specialization of target-scanning and surface-tethering functions could provide novel insight into the mechanisms of various DNA transactions, such as DNA replication and repair/recombination.

NrdR Transcription Regulation: Global Proteome Analysis and Its Role in Escherichia coli Viability and Virulence

PubMed Central

Naveen, Vankadari; Hsiao, Chwan-Deng

2016-01-01

Bacterial ribonucleotide reductases (RNRs) play an important role in the synthesis of dNTPs and their expression is regulated by the transcription factors, NrdR and Fur. Recent transcriptomic studies using deletion mutants have indicated a role for NrdR in bacterial chemotaxis and in the maintenance of topoisomerase levels. However, NrdR deletion alone has no effect on bacterial growth or virulence in infected flies or in human blood cells. Furthermore, transcriptomic studies are limited to the deletion strain alone, and so are inadequate for drawing biological implications when the NrdR repressor is active or abundant. Therefore, further examination is warranted of changes in the cellular proteome in response to both NrdR overexpression, as well as deletion, to better understand its functional relevance as a bacterial transcription repressor. Here, we profile bacterial fate under conditions of overexpression and deletion of NrdR in E. coli. Biochemical assays show auxiliary zinc enhances the DNA binding activity of NrdR. We also demonstrate at the physiological level that increased nrdR expression causes a significant reduction in bacterial growth and fitness even at normal temperatures, and causes lethality at elevated temperatures. Corroborating these direct effects, global proteome analysis following NrdR overexpression showed a significant decrease in global protein expression. In parallel, studies on complementary expression of downregulated essential genes polA, eno and thiL showed partial rescue of the fitness defect caused by NrdR overexpression. Deletion of downregulated non-essential genes ygfK and trxA upon NrdR overexpression resulted in diminished bacterial growth and fitness suggesting an additional role for NrdR in regulating other genes. Moreover, in comparison with NrdR deletion, E. coli cells overexpressing NrdR showed significantly diminished adherence to human epithelial cells, reflecting decreased bacterial virulence. These results suggest

Bombyx mori Transcription Factors: Genome-Wide Identification, Expression Profiles and Response to Pathogens by Microarray Analysis

PubMed Central

Huang, Lulin; Cheng, Tingcai; Xu, Pingzhen; Fang, Ting; Xia, Qingyou

2012-01-01

Transcription factors are present in all living organisms, and play vital roles in a wide range of biological processes. Studies of transcription factors will help reveal the complex regulation mechanism of organisms. So far, hundreds of domains have been identified that show transcription factor activity. Here, 281 reported transcription factor domains were used as seeds to search the transcription factors in genomes of Bombyx mori L. (Lepidoptera: Bombycidae) and four other model insects. Overall, 666 transcription factors including 36 basal factors and 630 other factors were identified in B. mori genome, which accounted for 4.56% of its genome. The silkworm transcription factors' expression profiles were investigated in relation to multiple tissues, developmental stages, sexual dimorphism, and responses to oral infection by pathogens and direct bacterial injection. These all provided rich clues for revealing the transcriptional regulation mechanism of silkworm organ differentiation, growth and development, sexual dimorphism, and response to pathogen infection. PMID:22943524

Transcriptional response of honey bee larvae infected with the bacterial pathogen Paenibacillus larvae

USDA-ARS?s Scientific Manuscript database

American foulbrood disease of honey bees is caused by the bacterium Paenibacillus larvae. Infection occurs per os in larvae and systemic infection requires a breaching of the host peritrophic matrix and midgut epithelium. Genetic variation exists for both bacterial virulence and host resistance, and...

Distinct summer and winter bacterial communities in the active layer of Svalbard permafrost revealed by DNA- and RNA-based analyses

DOE PAGES

Schostag, Morten; Stibal, Marek; Jacobsen, Carsten S.; ...

2015-04-30

The active layer of soil overlaying permafrost in the Arctic is subjected to dramatic annual changes in temperature and soil chemistry, which likely affect bacterial activity and community structure. We studied seasonal variations in the bacterial community of active layer soil from Svalbard (78°N) by co-extracting DNA and RNA from 12 soil cores collected monthly over a year. PCR amplicons of 16S rRNA genes (DNA) and reverse transcribed transcripts (cDNA) were quantified and sequenced to test for the effect of low winter temperature and seasonal variation in concentration of easily degradable organic matter on the bacterial communities. The copy numbermore » of 16S rRNA genes and transcripts revealed no distinct seasonal changes indicating potential bacterial activity during winter despite soil temperatures well below -10°C. Multivariate statistical analysis of the bacterial diversity data (DNA and cDNA libraries) revealed a season-based clustering of the samples, and, e.g., the relative abundance of potentially active Cyanobacteria peaked in June and Alphaproteobacteria increased over the summer and then declined from October to November. The structure of the bulk (DNA-based) community was significantly correlated with pH and dissolved organic carbon, while the potentially active (RNA-based) community structure was not significantly correlated with any of the measured soil parameters. A large fraction of the 16S rRNA transcripts was assigned to nitrogen-fixing bacteria (up to 24% in June) and phototrophic organisms (up to 48% in June) illustrating the potential importance of nitrogen fixation in otherwise nitrogen poor Arctic ecosystems and of phototrophic bacterial activity on the soil surface.« less

Distinct summer and winter bacterial communities in the active layer of Svalbard permafrost revealed by DNA- and RNA-based analyses

PubMed Central

Schostag, Morten; Stibal, Marek; Jacobsen, Carsten S.; Bælum, Jacob; Taş, Neslihan; Elberling, Bo; Jansson, Janet K.; Semenchuk, Philipp; Priemé, Anders

2015-01-01

The active layer of soil overlaying permafrost in the Arctic is subjected to dramatic annual changes in temperature and soil chemistry, which likely affect bacterial activity and community structure. We studied seasonal variations in the bacterial community of active layer soil from Svalbard (78°N) by co-extracting DNA and RNA from 12 soil cores collected monthly over a year. PCR amplicons of 16S rRNA genes (DNA) and reverse transcribed transcripts (cDNA) were quantified and sequenced to test for the effect of low winter temperature and seasonal variation in concentration of easily degradable organic matter on the bacterial communities. The copy number of 16S rRNA genes and transcripts revealed no distinct seasonal changes indicating potential bacterial activity during winter despite soil temperatures well below −10°C. Multivariate statistical analysis of the bacterial diversity data (DNA and cDNA libraries) revealed a season-based clustering of the samples, and, e.g., the relative abundance of potentially active Cyanobacteria peaked in June and Alphaproteobacteria increased over the summer and then declined from October to November. The structure of the bulk (DNA-based) community was significantly correlated with pH and dissolved organic carbon, while the potentially active (RNA-based) community structure was not significantly correlated with any of the measured soil parameters. A large fraction of the 16S rRNA transcripts was assigned to nitrogen-fixing bacteria (up to 24% in June) and phototrophic organisms (up to 48% in June) illustrating the potential importance of nitrogen fixation in otherwise nitrogen poor Arctic ecosystems and of phototrophic bacterial activity on the soil surface. PMID:25983731

Transcriptional analysis of exopolysaccharides biosynthesis gene clusters in Lactobacillus plantarum.

PubMed

Vastano, Valeria; Perrone, Filomena; Marasco, Rosangela; Sacco, Margherita; Muscariello, Lidia

2016-04-01

Exopolysaccharides (EPS) from lactic acid bacteria contribute to specific rheology and texture of fermented milk products and find applications also in non-dairy foods and in therapeutics. Recently, four clusters of genes (cps) associated with surface polysaccharide production have been identified in Lactobacillus plantarum WCFS1, a probiotic and food-associated lactobacillus. These clusters are involved in cell surface architecture and probably in release and/or exposure of immunomodulating bacterial molecules. Here we show a transcriptional analysis of these clusters. Indeed, RT-PCR experiments revealed that the cps loci are organized in five operons. Moreover, by reverse transcription-qPCR analysis performed on L. plantarum WCFS1 (wild type) and WCFS1-2 (ΔccpA), we demonstrated that expression of three cps clusters is under the control of the global regulator CcpA. These results, together with the identification of putative CcpA target sequences (catabolite responsive element CRE) in the regulatory region of four out of five transcriptional units, strongly suggest for the first time a role of the master regulator CcpA in EPS gene transcription among lactobacilli.

RegPrecise 3.0--a resource for genome-scale exploration of transcriptional regulation in bacteria.

PubMed

Novichkov, Pavel S; Kazakov, Alexey E; Ravcheev, Dmitry A; Leyn, Semen A; Kovaleva, Galina Y; Sutormin, Roman A; Kazanov, Marat D; Riehl, William; Arkin, Adam P; Dubchak, Inna; Rodionov, Dmitry A

2013-11-01

Genome-scale prediction of gene regulation and reconstruction of transcriptional regulatory networks in prokaryotes is one of the critical tasks of modern genomics. Bacteria from different taxonomic groups, whose lifestyles and natural environments are substantially different, possess highly diverged transcriptional regulatory networks. The comparative genomics approaches are useful for in silico reconstruction of bacterial regulons and networks operated by both transcription factors (TFs) and RNA regulatory elements (riboswitches). RegPrecise (http://regprecise.lbl.gov) is a web resource for collection, visualization and analysis of transcriptional regulons reconstructed by comparative genomics. We significantly expanded a reference collection of manually curated regulons we introduced earlier. RegPrecise 3.0 provides access to inferred regulatory interactions organized by phylogenetic, structural and functional properties. Taxonomy-specific collections include 781 TF regulogs inferred in more than 160 genomes representing 14 taxonomic groups of Bacteria. TF-specific collections include regulogs for a selected subset of 40 TFs reconstructed across more than 30 taxonomic lineages. Novel collections of regulons operated by RNA regulatory elements (riboswitches) include near 400 regulogs inferred in 24 bacterial lineages. RegPrecise 3.0 provides four classifications of the reference regulons implemented as controlled vocabularies: 55 TF protein families; 43 RNA motif families; ~150 biological processes or metabolic pathways; and ~200 effectors or environmental signals. Genome-wide visualization of regulatory networks and metabolic pathways covered by the reference regulons are available for all studied genomes. A separate section of RegPrecise 3.0 contains draft regulatory networks in 640 genomes obtained by an conservative propagation of the reference regulons to closely related genomes. RegPrecise 3.0 gives access to the transcriptional regulons reconstructed in

Biochar amendment decreases soil microbial biomass and increases bacterial diversity in Moso bamboo (Phyllostachys edulis) plantations under simulated nitrogen deposition

NASA Astrophysics Data System (ADS)

Li, Quan; Lei, Zhaofeng; Song, Xinzhang; Zhang, Zhiting; Ying, Yeqing; Peng, Changhui

2018-04-01

Biochar amendment has been proposed as a strategy to improve acidic soils after overuse of nitrogen fertilizers. However, little is known of the role of biochar in soil microbial biomass carbon (MBC) and bacterial community structure and diversity after soil acidification induced by nitrogen (N) deposition. Using high-throughput sequencing of the 16S rRNA gene, we determined the effects of biochar amendment (BC0, 0 t bamboo biochar ha‑1 BC20, 20 t bamboo biochar ha‑1 and BC40, 40 t bamboo biochar ha‑1) on the soil bacterial community structure and diversity in Moso bamboo plantations that had received simulated N deposition (N30, 30 kg N ha‑1 yr‑1 N60, 60 kg N ha‑1 yr‑1 N90, 90 kg N ha‑1 yr‑1 and N-free) for 21 months. After treatment of N-free plots, BC20 significantly increased soil MBC and bacterial diversity, while BC40 significantly decreased soil MBC but increased bacterial diversity. When used to amend N30 and N60 plots, biochar significantly decreased soil MBC and the reducing effect increased with biochar amendment amount. However, these significant effects were not observed in N90 plots. Under N deposition, biochar amendment largely increased soil bacterial diversity, and these effects depended on the rates of N deposition and biochar amendment. Soil bacterial diversity was significantly related to the soil C/N ratio, pH, and soil organic carbon content. These findings suggest an optimal approach for using biochar to offset the effects of N deposition in plantation soils and provide a new perspective for understanding the potential role of biochar amendments in plantation soil.

Interplay of DNA repair with transcription: from structures to mechanisms.

PubMed

Deaconescu, Alexandra M; Artsimovitch, Irina; Grigorieff, Nikolaus

2012-12-01

Many DNA transactions are crucial for maintaining genomic integrity and faithful transfer of genetic information but remain poorly understood. An example is the interplay between nucleotide excision repair (NER) and transcription, also known as transcription-coupled DNA repair (TCR). Discovered decades ago, the mechanisms for TCR have remained elusive, not in small part due to the scarcity of structural studies of key players. Here we summarize recent structural information on NER/TCR factors, focusing on bacterial systems, and integrate it with existing genetic, biochemical, and biophysical data to delineate the mechanisms at play. We also review emerging, alternative modalities for recruitment of NER proteins to DNA lesions. Copyright © 2012 Elsevier Ltd. All rights reserved.

The 11S Proteasome Subunit PSME3 Is a Positive Feedforward Regulator of NF-κB and Important for Host Defense against Bacterial Pathogens.

PubMed

Sun, Jinxia; Luan, Yi; Xiang, Dong; Tan, Xiao; Chen, Hui; Deng, Qi; Zhang, Jiaojiao; Chen, Minghui; Huang, Hongjun; Wang, Weichao; Niu, Tingting; Li, Wenjie; Peng, Hu; Li, Shuangxi; Li, Lei; Tang, Wenwen; Li, Xiaotao; Wu, Dianqing; Wang, Ping

2016-02-02

The NF-κB pathway plays important roles in immune responses. Although its regulation has been extensively studied, here, we report an unknown feedforward mechanism for the regulation of this pathway by Toll-like receptor (TLR) ligands in macrophages. During bacterial infections, TLR ligands upregulate the expression of the 11S proteasome subunit PSME3 via NF-κB-mediated transcription in macrophages. PSME3, in turn, enhances the transcriptional activity of NF-κB by directly binding to and destabilizing KLF2, a negative regulator of NF-κB transcriptional activity. Consistent with this positive role of PSME3 in NF-κB regulation and importance of the NF-κB pathway in host defense against bacterial infections, the lack of PSME3 in hematopoietic cells renders the hosts more susceptible to bacterial infections, accompanied by increased bacterial burdens in host tissues. Thus, this study identifies a substrate for PSME3 and elucidates a proteolysis-dependent, but ubiquitin-independent, mechanism for NF-κB regulation that is important for host defense and innate immunity. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Overexpression of miR169o, an Overlapping microRNA in Response to Both Nitrogen Limitation and Bacterial Infection, Promotes Nitrogen Use Efficiency and Susceptibility to Bacterial Blight in Rice.

PubMed

Chao, Yu; Chen, Yutong; Cao, Yaqian; Chen, Huamin; Wang, Jichun; Bi, Yong-Mei; Tian, Fang; Yang, Fenghuan; Rothstein, Steven J; Zhou, Xueping; He, Chenyang

2018-03-15

Limiting nitrogen (N) supply contributes to improved resistance to bacterial blight (BB) caused by Xanthomonas oryzae pv. oryzae (Xoo) in susceptible rice (Oryza sativa). To understand the regulatory roles of microRNAs in this phenomenon, sixty-three differentially-expressed overlapping miRNAs in response to Xoo infection and N-limitation stress in rice were identified through deep RNA-sequence and stem loop qRT-PCR. Among these, miR169o was further assessed as a typical overlapping miRNA through the overexpression of the miR169o primary gene. Osa-miR169o-OX plants were taller, and had more biomass accumulation with significantly increased nitrate and total amino acid contents in roots than wild type (WT). Transcript level assays showed that under different N supply conditions miR169o opposite regulated NRT2 which is reduced under normal N supply condition but remarkably induced under N limiting stress. On the other hand, osa-miR169o-OX plants also displayed increased disease lesion lengths and reduced transcriptional levels of defense gene (PR1b, PR10a, PR10b and PAL) compared with WT after inoculation with Xoo. In addition, miR169o impeded Xoo-mediated NRT transcription. Therefore, the overlapping miR169o contributes to increase N use efficiency and negatively regulates the resistance to bacterial blight in rice. Consistently, transient expression of NF-YAs in rice protoplast promoted the transcripts of PR genes and NRT2 genes, while reduced the transcripts of NRT1 genes. Our results provide novel and additional insights into the coordinated regulatory mechanisms of crosstalk between Xoo infection and N-deficiency responses in rice.

Immune subversion by chromatin manipulation: a 'new face' of host-bacterial pathogen interaction.

PubMed

Arbibe, Laurence

2008-08-01

Bacterial pathogens have evolved various strategies to avoid immune surveillance, depending of their in vivo'lifestyle'. The identification of few bacterial effectors capable to enter the nucleus and modifying chromatin structure in host raises the fascinating questions of how pathogens modulate chromatin structure and why. Chromatin is a dynamic structure that maintains the stability and accessibility of the host DNA genome to the transcription machinery. This review describes the various strategies used by pathogens to interface with host chromatin. In some cases, chromatin injury can be a strategy to take control of major cellular functions, such as the cell cycle. In other cases, manipulation of chromatin structure at specific genomic locations by modulating epigenetic information provides a way for the pathogen to impose its own transcriptional signature onto host cells. This emerging field should strongly influence our understanding of chromatin regulation at interphase nucleus and may provide invaluable openings to the control of immune gene expression in inflammatory and infectious diseases.

A transcription activator-like effector induction system mediated by proteolysis

PubMed Central

Copeland, Matthew F.; Politz, Mark C.; Johnson, Charles B.; Markley, Andrew L.; Pfleger, Brian F.

2016-01-01

Simple and predictable trans-acting regulatory tools are needed in the fields of synthetic biology and metabolic engineering to build complex genetic circuits and optimize the levels of native and heterologous gene products. Transcription activator-like effectors (TALEs) are bacterial virulence factors that have recently gained traction in biotechnology applications due to their customizable DNA binding specificity. In this work we expand the versatility of these transcription factors to create an inducible TALE system by inserting tobacco-etch virus (TEV) protease recognition sites into the TALE backbone. The resulting engineered TALEs maintain transcriptional repression of their target genes in Escherichia coli, but are degraded following the induction of the TEV protease, thereby promoting expression of the previously repressed target gene of interest. This TALE-TEV technology enables both repression and induction of plasmid or chromosomal target genes in a manner analogous to traditional repressor proteins but with the added flexibility of being operator agnostic. PMID:26854666

Arsenic uptake in bacterial calcite

NASA Astrophysics Data System (ADS)

Catelani, Tiziano; Perito, Brunella; Bellucci, Francesco; Lee, Sang Soo; Fenter, Paul; Newville, Matthew; Rimondi, Valentina; Pratesi, Giovanni; Costagliola, Pilario

2018-02-01

Bio-mediated processes for arsenic (As) uptake in calcite were investigated by means of X-ray Diffraction (XRD) and X-ray Absorption Spectroscopy (XAS) coupled with X-ray Fluorescence measurements. The environmental bacterial strain Bacillus licheniformis BD5, sampled at the Bullicame Hot Springs (Viterbo, Central Italy), was used to synthesize calcite from As-enriched growth media. Both liquid and solid cultures were applied to simulate planktonic and biofilm community environments, respectively. Bacterial calcite samples cultured in liquid media had an As enrichment factor (Kd) 50 times higher than that from solid media. The XRD analysis revealed an elongation of the crystal lattice along the c axis (by 0.03 Å) for biogenic calcite, which likely resulted from the substitution of larger arsenate for carbonate in the crystal. The XAS data also showed a clear difference in the oxidation state of sorbed As between bacterial and abiotic calcite. Abiotic chemical processes yielded predominantly As(V) uptake whereas bacterial precipitation processes led to the uptake of both As(III) and As(V). The presence of As(III) in bacterial calcite is proposed to result from subsequent reduction of arsenate to arsenite by bacterial activities. To the best of our knowledge, this is the first experimental observation of the incorporation of As(III) in the calcite crystal lattice, revealing a critical role of biochemical processes for the As cycling in nature.

The C2H2 transcription factor regulator of symbiosome differentiation represses transcription of the secretory pathway gene VAMP721a and promotes symbiosome development in Medicago truncatula.

PubMed

Sinharoy, Senjuti; Torres-Jerez, Ivone; Bandyopadhyay, Kaustav; Kereszt, Attila; Pislariu, Catalina I; Nakashima, Jin; Benedito, Vagner A; Kondorosi, Eva; Udvardi, Michael K

2013-09-01

Transcription factors (TFs) are thought to regulate many aspects of nodule and symbiosis development in legumes, although few TFs have been characterized functionally. Here, we describe regulator of symbiosome differentiation (RSD) of Medicago truncatula, a member of the Cysteine-2/Histidine-2 (C2H2) family of plant TFs that is required for normal symbiosome differentiation during nodule development. RSD is expressed in a nodule-specific manner, with maximal transcript levels in the bacterial invasion zone. A tobacco (Nicotiana tabacum) retrotransposon (Tnt1) insertion rsd mutant produced nodules that were unable to fix nitrogen and that contained incompletely differentiated symbiosomes and bacteroids. RSD protein was localized to the nucleus, consistent with a role of the protein in transcriptional regulation. RSD acted as a transcriptional repressor in a heterologous yeast assay. Transcriptome analysis of an rsd mutant identified 11 genes as potential targets of RSD repression. RSD interacted physically with the promoter of one of these genes, VAMP721a, which encodes vesicle-associated membrane protein 721a. Thus, RSD may influence symbiosome development in part by repressing transcription of VAMP721a and modifying vesicle trafficking in nodule cells. This establishes RSD as a TF implicated directly in symbiosome and bacteroid differentiation and a transcriptional regulator of secretory pathway genes in plants.

Assessing the Robustness of Complete Bacterial Genome Segmentations

NASA Astrophysics Data System (ADS)

Devillers, Hugo; Chiapello, Hélène; Schbath, Sophie; El Karoui, Meriem

Comparison of closely related bacterial genomes has revealed the presence of highly conserved sequences forming a "backbone" that is interrupted by numerous, less conserved, DNA fragments. Segmentation of bacterial genomes into backbone and variable regions is particularly useful to investigate bacterial genome evolution. Several software tools have been designed to compare complete bacterial chromosomes and a few online databases store pre-computed genome comparisons. However, very few statistical methods are available to evaluate the reliability of these software tools and to compare the results obtained with them. To fill this gap, we have developed two local scores to measure the robustness of bacterial genome segmentations. Our method uses a simulation procedure based on random perturbations of the compared genomes. The scores presented in this paper are simple to implement and our results show that they allow to discriminate easily between robust and non-robust bacterial genome segmentations when using aligners such as MAUVE and MGA.

Limitations to estimating bacterial cross-species transmission using genetic and genomic markers: inferences from simulation modeling

PubMed Central

Benavides, Julio A; Cross, Paul C; Luikart, Gordon; Creel, Scott

2014-01-01

Cross-species transmission (CST) of bacterial pathogens has major implications for human health, livestock, and wildlife management because it determines whether control actions in one species may have subsequent effects on other potential host species. The study of bacterial transmission has benefitted from methods measuring two types of genetic variation: variable number of tandem repeats (VNTRs) and single nucleotide polymorphisms (SNPs). However, it is unclear whether these data can distinguish between different epidemiological scenarios. We used a simulation model with two host species and known transmission rates (within and between species) to evaluate the utility of these markers for inferring CST. We found that CST estimates are biased for a wide range of parameters when based on VNTRs and a most parsimonious reconstructed phylogeny. However, estimations of CST rates lower than 5% can be achieved with relatively low bias using as low as 250 SNPs. CST estimates are sensitive to several parameters, including the number of mutations accumulated since introduction, stochasticity, the genetic difference of strains introduced, and the sampling effort. Our results suggest that, even with whole-genome sequences, unbiased estimates of CST will be difficult when sampling is limited, mutation rates are low, or for pathogens that were recently introduced. PMID:25469159

[Characterization and transcriptional analysis of a new CC chemokine associated with innate imimune response in cobia (Rachycentron canadum)].

PubMed

Su, Y; Feng, J; Sun, X; Guo, Z; Xu, L; Jiang, J

2013-01-01

Chemokines are small, secreted cytokine peptides, known principally for their ability to induce migration and activation of leukocyte populations under both pathological and physiological conditions. On the basis of previously constructed express sequence tags (ESTs) of the head kidney and spleen cDNA library of the perciform marine fish Rachycentron canadum (common name cobia). We used bi-directional rapid amplification of cDNA ends (RACE) and obtained a full-length cDNA of a new CC chemokine gene (designated RcCC3). The RcCC3 putative peptide exhibits sequence similarity to the group of CCL19/21/25 CC chemokines. The reverse transcription quantitative polymerase chain reaction (RT-qPCR) was used in transcript expression studies of RcCC3. We examined the constitutive expression of the transcripts in 12 tissues of non-stressed cobia; RcCC3 transcripts were detected in all tissues examined, with the highest expression in gill and liver, following by head kidney, kidney, spleen, skin, intestine, muscle, stomach, heart, blood and brain. Transcript expression of RcCC3 was examined in immune-related organs, including head kidney, spleen and liver, following intraperitoneal injection of phosphate-buffered saline control, polyriboinosinic polyribocytidylic acid (poly(I:C)) and formalin-killed Vibrio carchariae (bacterial vaccine). The transcripts in these tissues were quickly up-regulated by the injection of poly(I:C) and bacterial vaccine at early time points, although with different expression profiles. These results indicate RcCC3 represents an important component of innate immunity in cobia.

Structure of Thermotoga maritima TM0439: implications for the mechanism of bacterial GntR transcription regulators with Zn{sup 2+}-binding FCD domains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zheng, Meiying; Cooper, David R.; Grossoehme, Nickolas E.

2009-04-01

Here, the crystal structure of TM0439, a GntR regulator with an FCD domain found in the Thermotoga maritima genome, is described. The GntR superfamily of dimeric transcription factors, with more than 6200 members encoded in bacterial genomes, are characterized by N-terminal winged-helix DNA-binding domains and diverse C-terminal regulatory domains which provide a basis for the classification of the constituent families. The largest of these families, FadR, contains nearly 3000 proteins with all-α-helical regulatory domains classified into two related Pfam families: FadR-C and FCD. Only two crystal structures of FadR-family members, those of Escherichia coli FadR protein and LldR from Corynebacteriummore » glutamicum, have been described to date in the literature. Here, the crystal structure of TM0439, a GntR regulator with an FCD domain found in the Thermotoga maritima genome, is described. The FCD domain is similar to that of the LldR regulator and contains a buried metal-binding site. Using atomic absorption spectroscopy and Trp fluorescence, it is shown that the recombinant protein contains bound Ni{sup 2+} ions but that it is able to bind Zn{sup 2+} with K{sub d} < 70 nM. It is concluded that Zn{sup 2+} is the likely physiological metal and that it may perform either structural or regulatory roles or both. Finally, the TM0439 structure is compared with two other FadR-family structures recently deposited by structural genomics consortia. The results call for a revision in the classification of the FadR family of transcription factors.« less

Regulation of host-pathogen interactions via the post-transcriptional Csr/Rsm system.

PubMed

Kusmierek, Maria; Dersch, Petra

2018-02-01

A successful colonization of specific hosts requires a rapid and efficient adaptation of the virulence-relevant gene expression program by bacterial pathogens. An important element in this endeavor is the Csr/Rsm system. This multi-component, post-transcriptional control system forms a central hub within complex regulatory networks and coordinately adjusts virulence properties with metabolic and physiological attributes of the pathogen. A key function is elicited by the RNA-binding protein CsrA/RsmA. CsrA/RsmA interacts with numerous target mRNAs, many of which encode crucial virulence factors, and alters their translation, stability or elongation of transcription. Recent studies highlighted that important colonization factors, toxins, and bacterial secretion systems are under CsrA/RsmA control. CsrA/RsmA deficiency impairs host colonization and attenuates virulence, making this post-transcriptional regulator a suitable drug target. The CsrA/RsmA protein can be inactivated through sequestration by non-coding RNAs, or via binding to specific highly abundant mRNAs and interacting proteins. The wide range of interaction partners and RNA targets, as well as the overarching, interlinked genetic control circuits illustrate the complexity of this regulatory system in the different pathogens. Future work addressing spatio-temporal changes of Csr/Rsm-mediated control during the course of an infection will help us to understand how bacteria reprogram their expression profile to cope with continuous changes experienced in colonized niches. Copyright © 2017 Elsevier Ltd. All rights reserved.

Defining the microbial transcriptional response to colitis through integrated host and microbiome profiling

PubMed Central

Ilott, Nicholas Edward; Bollrath, Julia; Danne, Camille; Schiering, Chris; Shale, Matthew; Adelmann, Krista; Krausgruber, Thomas; Heger, Andreas; Sims, David; Powrie, Fiona

2016-01-01

The gut microbiome is significantly altered in inflammatory bowel diseases, but the basis of these changes is not well understood. We have combined metagenomic and metatranscriptomic profiling of the gut microbiome to assess modifications to both bacterial community structure and transcriptional activity in a mouse model of colitis. By using transcriptomic analysis of colonic tissue and luminal RNA derived from the host, we have also characterised how host transcription relates to the microbial transcriptional response in inflammation. In colitis, increased abundance and transcription of diverse microbial gene families involved in responses to nutrient deprivation, antimicrobial peptide production and oxidative stress support an adaptation of multiple commensal genera to withstand a diverse set of environmental stressors in the inflammatory environment. These data are supported by a transcriptional signature of activated macrophages and granulocytes in the gut lumen during colitis, a signature that includes the transcription of the key antimicrobial genes S100a8 and S100a9 (calprotectin). Genes involved in microbial resistance to oxidative stress, including Dps/ferritin, Fe-dependent peroxidase and glutathione S-transferase were identified as changing to a greater extent at the level of transcription than would be predicted by DNA abundance changes, implicating a role for increased oxygen tension and/or host-derived reactive oxygen species in driving transcriptional changes in commensal microbes. PMID:27003245

Arsenic uptake in bacterial calcite

DOE Office of Scientific and Technical Information (OSTI.GOV)

Catelani, Tiziano; Perito, Brunella; Bellucci, Francesco

Bio-mediated processes for arsenic (As) uptake in calcite were investigated by means of X-ray Diffraction (XRD) and Xray Absorption Spectroscopy (XAS) coupled with X-ray Fluorescence measurements. The environmental bacterial strain Bacillus licheniformis BD5, sampled at the Bullicame Hot Springs (Viterbo, Central Italy), was used to synthesize calcite from As-enriched growth media. Both liquid and solid cultures were applied to simulate planktonic and biofilm community environments, respectively. Bacterial calcite samples cultured in liquid media had an As enrichment factor (Kd) 50 times higher than that from solid media. The XRD analysis revealed an elongation of the crystal lattice along the cmore » axis (by 0.03Å) for biogenic calcite, which likely resulted from the substitution of larger arsenate for carbonate in the crystal. The XAS data also showed a clear difference in the oxidation state of sorbed As between bacterial and abiotic calcite. Abiotic chemical processes yielded predominantly As(V) uptake whereas bacterial precipitation processes led to the uptake of both As(III) and As(V). The presence of As(III) in bacterial calcite is proposed to result from subsequent reduction of arsenate to arsenite by bacterial activities. To the best of our knowledge, this is the first experimental observation of the incorporation of As(III) in the calcite crystal lattice, revealing a critical role of biochemical processes for the As cycling in nature.« less

Evolvable social agents for bacterial systems modeling.

PubMed

Paton, Ray; Gregory, Richard; Vlachos, Costas; Saunders, Jon; Wu, Henry

2004-09-01

We present two approaches to the individual-based modeling (IbM) of bacterial ecologies and evolution using computational tools. The IbM approach is introduced, and its important complementary role to biosystems modeling is discussed. A fine-grained model of bacterial evolution is then presented that is based on networks of interactivity between computational objects representing genes and proteins. This is followed by a coarser grained agent-based model, which is designed to explore the evolvability of adaptive behavioral strategies in artificial bacteria represented by learning classifier systems. The structure and implementation of the two proposed individual-based bacterial models are discussed, and some results from simulation experiments are presented, illustrating their adaptive properties.

Secreted bacterial effectors that inhibit host protein synthesis are critical for induction of the innate immune response to virulent Legionella pneumophila.

PubMed

Fontana, Mary F; Banga, Simran; Barry, Kevin C; Shen, Xihui; Tan, Yunhao; Luo, Zhao-Qing; Vance, Russell E

2011-02-01

The intracellular bacterial pathogen Legionella pneumophila causes an inflammatory pneumonia called Legionnaires' Disease. For virulence, L. pneumophila requires a Dot/Icm type IV secretion system that translocates bacterial effectors to the host cytosol. L. pneumophila lacking the Dot/Icm system is recognized by Toll-like receptors (TLRs), leading to a canonical NF-κB-dependent transcriptional response. In addition, L. pneumophila expressing a functional Dot/Icm system potently induces unique transcriptional targets, including proinflammatory genes such as Il23a and Csf2. Here we demonstrate that this Dot/Icm-dependent response, which we term the effector-triggered response (ETR), requires five translocated bacterial effectors that inhibit host protein synthesis. Upon infection of macrophages with virulent L. pneumophila, these five effectors caused a global decrease in host translation, thereby preventing synthesis of IκB, an inhibitor of the NF-κB transcription factor. Thus, macrophages infected with wildtype L. pneumophila exhibited prolonged activation of NF-κB, which was associated with transcription of ETR target genes such as Il23a and Csf2. L. pneumophila mutants lacking the five effectors still activated TLRs and NF-κB, but because the mutants permitted normal IκB synthesis, NF-κB activation was more transient and was not sufficient to fully induce the ETR. L. pneumophila mutants expressing enzymatically inactive effectors were also unable to fully induce the ETR, whereas multiple compounds or bacterial toxins that inhibit host protein synthesis via distinct mechanisms recapitulated the ETR when administered with TLR ligands. Previous studies have demonstrated that the host response to bacterial infection is induced primarily by specific microbial molecules that activate TLRs or cytosolic pattern recognition receptors. Our results add to this model by providing a striking illustration of how the host immune response to a virulent pathogen can also

HLH-30/TFEB-mediated autophagy functions in a cell-autonomous manner for epithelium intrinsic cellular defense against bacterial pore-forming toxin in C. elegans.

PubMed

Chen, Huan-Da; Kao, Cheng-Yuan; Liu, Bang-Yu; Huang, Shin-Whei; Kuo, Cheng-Ju; Ruan, Jhen-Wei; Lin, Yen-Hung; Huang, Cheng-Rung; Chen, Yu-Hung; Wang, Horng-Dar; Aroian, Raffi V; Chen, Chang-Shi

2017-02-01

Autophagy is an evolutionarily conserved intracellular system that maintains cellular homeostasis by degrading and recycling damaged cellular components. The transcription factor HLH-30/TFEB-mediated autophagy has been reported to regulate tolerance to bacterial infection, but less is known about the bona fide bacterial effector that activates HLH-30 and autophagy. Here, we reveal that bacterial membrane pore-forming toxin (PFT) induces autophagy in an HLH-30-dependent manner in Caenorhabditis elegans. Moreover, autophagy controls the susceptibility of animals to PFT toxicity through xenophagic degradation of PFT and repair of membrane-pore cell-autonomously in the PFT-targeted intestinal cells in C. elegans. These results demonstrate that autophagic pathways and autophagy are induced partly at the transcriptional level through HLH-30 activation and are required to protect metazoan upon PFT intoxication. Together, our data show a new and powerful connection between HLH-30-mediated autophagy and epithelium intrinsic cellular defense against the single most common mode of bacterial attack in vivo.

A Rapid Spin Column-Based Method to Enrich Pathogen Transcripts from Eukaryotic Host Cells Prior to Sequencing

DOE PAGES

Bent, Zachary W.; Poorey, Kunal; LaBauve, Annette E.; ...

2016-12-21

When analyzing pathogen transcriptomes during the infection of host cells, the signal-to-background (pathogen-to-host) ratio of nucleic acids (NA) in infected samples is very small. Despite the advancements in next-generation sequencing, the minute amount of pathogen NA makes standard RNA-seq library preps inadequate for effective gene-level analysis of the pathogen in cases with low bacterial loads. In order to provide a more complete picture of the pathogen transcriptome during an infection, we developed a novel pathogen enrichment technique, which can enrich for transcripts from any cultivable bacteria or virus, using common, readily available laboratory equipment and reagents. To evenly enrich formore » pathogen transcripts, we generate biotinylated pathogen-targeted capture probes in an enzymatic process using the entire genome of the pathogen as a template. The capture probes are hybridized to a strand-specific cDNA library generated from an RNA sample. The biotinylated probes are captured on a monomeric avidin resin in a miniature spin column, and enriched pathogen-specific cDNA is eluted following a series of washes. To test this method, we performed an in vitro time-course infection using Klebsiella pneumoniae to infect murine macrophage cells. K. pneumoniae transcript enrichment efficiency was evaluated using RNA-seq. Bacterial transcripts were enriched up to ~400-fold, and allowed the recovery of transcripts from ~2000–3600 genes not observed in untreated control samples. These additional transcripts revealed interesting aspects of K. pneumoniae biology including the expression of putative virulence factors and the expression of several genes responsible for antibiotic resistance even in the absence of drugs.« less

A Rapid Spin Column-Based Method to Enrich Pathogen Transcripts from Eukaryotic Host Cells Prior to Sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bent, Zachary W.; Poorey, Kunal; LaBauve, Annette E.

When analyzing pathogen transcriptomes during the infection of host cells, the signal-to-background (pathogen-to-host) ratio of nucleic acids (NA) in infected samples is very small. Despite the advancements in next-generation sequencing, the minute amount of pathogen NA makes standard RNA-seq library preps inadequate for effective gene-level analysis of the pathogen in cases with low bacterial loads. In order to provide a more complete picture of the pathogen transcriptome during an infection, we developed a novel pathogen enrichment technique, which can enrich for transcripts from any cultivable bacteria or virus, using common, readily available laboratory equipment and reagents. To evenly enrich formore » pathogen transcripts, we generate biotinylated pathogen-targeted capture probes in an enzymatic process using the entire genome of the pathogen as a template. The capture probes are hybridized to a strand-specific cDNA library generated from an RNA sample. The biotinylated probes are captured on a monomeric avidin resin in a miniature spin column, and enriched pathogen-specific cDNA is eluted following a series of washes. To test this method, we performed an in vitro time-course infection using Klebsiella pneumoniae to infect murine macrophage cells. K. pneumoniae transcript enrichment efficiency was evaluated using RNA-seq. Bacterial transcripts were enriched up to ~400-fold, and allowed the recovery of transcripts from ~2000–3600 genes not observed in untreated control samples. These additional transcripts revealed interesting aspects of K. pneumoniae biology including the expression of putative virulence factors and the expression of several genes responsible for antibiotic resistance even in the absence of drugs.« less

Physical constraints determine the logic of bacterial promoter architectures

PubMed Central

Ezer, Daphne; Zabet, Nicolae Radu; Adryan, Boris

2014-01-01

Site-specific transcription factors (TFs) bind to their target sites on the DNA, where they regulate the rate at which genes are transcribed. Bacterial TFs undergo facilitated diffusion (a combination of 3D diffusion around and 1D random walk on the DNA) when searching for their target sites. Using computer simulations of this search process, we show that the organization of the binding sites, in conjunction with TF copy number and binding site affinity, plays an important role in determining not only the steady state of promoter occupancy, but also the order at which TFs bind. These effects can be captured by facilitated diffusion-based models, but not by standard thermodynamics. We show that the spacing of binding sites encodes complex logic, which can be derived from combinations of three basic building blocks: switches, barriers and clusters, whose response alone and in higher orders of organization we characterize in detail. Effective promoter organizations are commonly found in the E. coli genome and are highly conserved between strains. This will allow studies of gene regulation at a previously unprecedented level of detail, where our framework can create testable hypothesis of promoter logic. PMID:24476912

A transcription activator-like effector (TALE) induction system mediated by proteolysis.

PubMed

Copeland, Matthew F; Politz, Mark C; Johnson, Charles B; Markley, Andrew L; Pfleger, Brian F

2016-04-01

Simple and predictable trans-acting regulatory tools are needed in the fields of synthetic biology and metabolic engineering to build complex genetic circuits and optimize the levels of native and heterologous gene products. Transcription activator-like effectors (TALEs) are bacterial virulence factors that have recently gained traction in biotechnology applications owing to their customizable DNA-binding specificity. In this work we expanded the versatility of these transcription factors to create an inducible TALE system by inserting tobacco-etch virus (TEV) protease recognition sites into the TALE backbone. The resulting engineered TALEs maintain transcriptional repression of their target genes in Escherichia coli, but are degraded after induction of the TEV protease, thereby promoting expression of the previously repressed target gene of interest. This TALE-TEV technology enables both repression and induction of plasmid or chromosomal target genes in a manner analogous to traditional repressor proteins but with the added flexibility of being operator-agnostic.

ATP-dependent RecG Helicase Is Required for the Transcriptional Regulator OxyR Function in Pseudomonas species*

PubMed Central

Yeom, Jinki; Lee, Yunho; Park, Woojun

2012-01-01

The oxyR gene appears to reside in an operon with the recG helicase gene in many bacteria, including pathogenic Pseudomonas aeruginosa and Pseudomonas putida. Analysis of P. putida transcriptomes shows that many OxyR-controlled genes are regulated by the ATP-dependent RecG helicase and that RecG alone modulates the expression of many genes. We found that purified RecG binds to the promoters of many OxyR-controlled genes and that expression of these genes was not induced under conditions of oxidative stress in recG mutants of P. aeruginosa, P. putida, and Escherichia coli. In vitro data revealed that promoters containing palindromic sequences are essential for RecG binding and that single-strand binding proteins and ATP are also needed for RecG to promote transcription, whereas a magnesium ion has the opposite effect. The OxyR tetramer preferentially binds to promoters after RecG has generated linear DNA in the presence of ATP; otherwise, the OxyR dimer has higher affinity. This study provides new insights into the mechanism of bacterial transcription by demonstrating that RecG might be required for the induction of the OxyR regulon by unwinding palindromic DNA for transcription. This work describes a novel bacterial transcriptional function by RecG helicase with OxyR and may provide new targets for controlling Pseudomonas species pathogen. PMID:22621928

Bacterial vaginosis-associated microflora isolated from the female genital tract activates HIV-1 expression.

PubMed

Al-Harthi, L; Roebuck, K A; Olinger, G G; Landay, A; Sha, B E; Hashemi, F B; Spear, G T

1999-07-01

Alteration of cervicovaginal microbial flora can lead to vaginosis, which is associated with an increased risk of HIV-1 transmission. We recently characterized a soluble HIV-inducing factor (HIF) from the cervicovaginal lavage (CVL) samples of women. The goals of this study were to determine the effect of cervicovaginal microflora on HIV-1 expression and to elucidate the relationship between HIF activity and microflora. Physiologically relevant microorganisms, Mycoplasma, diphtheroid-like bacteria, Gardnerella vaginalis, Streptococcus agalactiae, and Streptococcus constellatus, cultured from the CVL of a representative woman with a clinical condition of bacterial vaginosis and possessing HIF activity, induced HIV-1 expression. The magnitude of virus induction varied widely with the greatest stimulation induced by diphtheroid-like bacteria and Mycoplasma. The transcriptional induction by Mycoplasma was mediated by activation of the KB enhancer, an activation mechanism shared with HIF. Also as with HIF, Mycoplasma induced AP-1 dependent transcription. Polymerase chain reaction (PCR)-based speciation showed that the isolate was M. hominis. Our data indicate that bacterial vaginosis-associated microflora can enhance HIV-1 transcription and replication and identify M. hominis as a potential source for HIF activity. The virus-enhancing activities associated with the microflora and HIF may increase genital tract viral load, potentially contributing to HIV transmission.

The Role of Multiple Transcription Factors In Archaeal Gene Expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Charles J. Daniels

2008-09-23

Since the inception of this research program, the project has focused on two central questions: What is the relationship between the 'eukaryal-like' transcription machinery of archaeal cells and its counterparts in eukaryal cells? And, how does the archaeal cell control gene expression using its mosaic of eukaryal core transcription machinery and its bacterial-like transcription regulatory proteins? During the grant period we have addressed these questions using a variety of in vivo approaches and have sought to specifically define the roles of the multiple TATA binding protein (TBP) and TFIIB-like (TFB) proteins in controlling gene expression in Haloferax volcanii. H. volcaniimore » was initially chosen as a model for the Archaea based on the availability of suitable genetic tools; however, later studies showed that all haloarchaea possessed multiple tbp and tfb genes, which led to the proposal that multiple TBP and TFB proteins may function in a manner similar to alternative sigma factors in bacterial cells. In vivo transcription and promoter analysis established a clear relationship between the promoter requirements of haloarchaeal genes and those of the eukaryal RNA polymerase II promoter. Studies on heat shock gene promoters, and the demonstration that specific tfb genes were induced by heat shock, provided the first indication that TFB proteins may direct expression of specific gene families. The construction of strains lacking tbp or tfb genes, coupled with the finding that many of these genes are differentially expressed under varying growth conditions, provided further support for this model. Genetic tools were also developed that led to the construction of insertion and deletion mutants, and a novel gene expression scheme was designed that allowed the controlled expression of these genes in vivo. More recent studies have used a whole genome array to examine the expression of these genes and we have established a linkage between the expression of

VirF-Independent Regulation of Shigella virB Transcription is Mediated by the Small RNA RyhB

PubMed Central

Broach, William H.; Egan, Nicholas; Wing, Helen J.; Payne, Shelley M.; Murphy, Erin R.

2012-01-01

Infection of the human host by Shigella species requires the coordinated production of specific Shigella virulence factors, a process mediated largely by the VirF/VirB regulatory cascade. VirF promotes the transcription of virB, a gene encoding the transcriptional activator of several virulence-associated genes. This study reveals that transcription of virB is also regulated by the small RNA RyhB, and importantly, that this regulation is not achieved indirectly via modulation of VirF activity. These data are the first to demonstrate that the regulation of virB transcription can be uncoupled from the master regulator VirF. It is also established that efficient RyhB-dependent regulation of transcription is facilitated by specific nucleic acid sequences within virB. This study not only reveals RyhB-dependent regulation of virB transcription as a novel point of control in the central regulatory circuit modulating Shigella virulence, but also highlights the versatility of RyhB in controlling bacterial gene expression. PMID:22701677

TAL effector driven induction of a SWEET gene confers susceptibility to bacterial blight of cotton

USDA-ARS?s Scientific Manuscript database

Bacterial blight of cotton (BBC), caused by Xanthomonas citri subsp. malvacearum (Xcm), is among the most destructive diseases in cotton (Gossypium spp.). Transcription activator-like (TAL) effectors from Xcm are essential for BBC disease progression. Here, we carried out whole-genome PacBio-seque...

The C2H2 Transcription Factor REGULATOR OF SYMBIOSOME DIFFERENTIATION Represses Transcription of the Secretory Pathway Gene VAMP721a and Promotes Symbiosome Development in Medicago truncatula[W][OPEN

PubMed Central

Sinharoy, Senjuti; Torres-Jerez, Ivone; Bandyopadhyay, Kaustav; Kereszt, Attila; Pislariu, Catalina I.; Nakashima, Jin; Benedito, Vagner A.; Kondorosi, Eva; Udvardi, Michael K.

2013-01-01

Transcription factors (TFs) are thought to regulate many aspects of nodule and symbiosis development in legumes, although few TFs have been characterized functionally. Here, we describe REGULATOR OF SYMBIOSOME DIFFERENTIATION (RSD) of Medicago truncatula, a member of the Cysteine-2/Histidine-2 (C2H2) family of plant TFs that is required for normal symbiosome differentiation during nodule development. RSD is expressed in a nodule-specific manner, with maximal transcript levels in the bacterial invasion zone. A tobacco (Nicotiana tabacum) retrotransposon (Tnt1) insertion rsd mutant produced nodules that were unable to fix nitrogen and that contained incompletely differentiated symbiosomes and bacteroids. RSD protein was localized to the nucleus, consistent with a role of the protein in transcriptional regulation. RSD acted as a transcriptional repressor in a heterologous yeast assay. Transcriptome analysis of an rsd mutant identified 11 genes as potential targets of RSD repression. RSD interacted physically with the promoter of one of these genes, VAMP721a, which encodes vesicle-associated membrane protein 721a. Thus, RSD may influence symbiosome development in part by repressing transcription of VAMP721a and modifying vesicle trafficking in nodule cells. This establishes RSD as a TF implicated directly in symbiosome and bacteroid differentiation and a transcriptional regulator of secretory pathway genes in plants. PMID:24082011

Bacterial RNA Biology on a Genome Scale.

PubMed

Hör, Jens; Gorski, Stanislaw A; Vogel, Jörg

2018-06-07

Bacteria are an exceedingly diverse group of organisms whose molecular exploration is experiencing a renaissance. While the classical view of bacterial gene expression was relatively simple, the emerging view is more complex, encompassing extensive post-transcriptional control involving riboswitches, RNA thermometers, and regulatory small RNAs (sRNAs) associated with the RNA-binding proteins CsrA, Hfq, and ProQ, as well as CRISPR/Cas systems that are programmed by RNAs. Moreover, increasing interest in members of the human microbiota and environmental microbial communities has highlighted the importance of understudied bacterial species with largely unknown transcriptome structures and RNA-based control mechanisms. Collectively, this creates a need for global RNA biology approaches that can rapidly and comprehensively analyze the RNA composition of a bacterium of interest. We review such approaches with a focus on RNA-seq as a versatile tool to investigate the different layers of gene expression in which RNA is made, processed, regulated, modified, translated, and turned over. Copyright © 2017 Elsevier Inc. All rights reserved.

K+ Block Is the Mechanism of Functional Asymmetry in Bacterial Nav Channels

PubMed Central

Ngo, Van; Wang, Yibo; Haas, Stephan; Noskov, Sergei Y.; Farley, Robert A.

2016-01-01

Crystal structures of several bacterial Nav channels have been recently published and molecular dynamics simulations of ion permeation through these channels are consistent with many electrophysiological properties of eukaryotic channels. Bacterial Nav channels have been characterized as functionally asymmetric, and the mechanism of this asymmetry has not been clearly understood. To address this question, we combined non-equilibrium simulation data with two-dimensional equilibrium unperturbed landscapes generated by umbrella sampling and Weighted Histogram Analysis Methods for multiple ions traversing the selectivity filter of bacterial NavAb channel. This approach provided new insight into the mechanism of selective ion permeation in bacterial Nav channels. The non-equilibrium simulations indicate that two or three extracellular K+ ions can block the entrance to the selectivity filter of NavAb in the presence of applied forces in the inward direction, but not in the outward direction. The block state occurs in an unstable local minimum of the equilibrium unperturbed free-energy landscape of two K+ ions that can be ‘locked’ in place by modest applied forces. In contrast to K+, three Na+ ions move favorably through the selectivity filter together as a unit in a loose “knock-on” mechanism of permeation in both inward and outward directions, and there is no similar local minimum in the two-dimensional free-energy landscape of two Na+ ions for a block state. The useful work predicted by the non-equilibrium simulations that is required to break the K+ block is equivalent to large applied potentials experimentally measured for two bacterial Nav channels to induce inward currents of K+ ions. These results illustrate how inclusion of non-equilibrium factors in the simulations can provide detailed information about mechanisms of ion selectivity that is missing from mechanisms derived from either crystal structures or equilibrium unperturbed free-energy landscapes

The RclR Protein Is a Reactive Chlorine-specific Transcription Factor in Escherichia coli *

PubMed Central

Parker, Benjamin W.; Schwessinger, Emily A.; Jakob, Ursula; Gray, Michael J.

2013-01-01

Reactive chlorine species (RCS) such as hypochlorous acid are powerful antimicrobial oxidants. Used extensively for disinfection in household and industrial settings (i.e. as bleach), RCS are also naturally generated in high quantities during the innate immune response. Bacterial responses to RCS are complex and differ substantially from the well characterized responses to other physiologically relevant oxidants, like peroxide or superoxide. Several RCS-sensitive transcription factors have been identified in bacteria, but most of them respond to multiple stressors whose damaging effects overlap with those of RCS, including reactive oxygen species and electrophiles. We have now used in vivo genetic and in vitro biochemical methods to identify and demonstrate that Escherichia coli RclR (formerly YkgD) is a redox-regulated transcriptional activator of the AraC family, whose highly conserved cysteine residues are specifically sensitive to oxidation by RCS. Oxidation of these cysteines leads to strong, highly specific activation of expression of genes required for survival of RCS stress. These results demonstrate the existence of a widely conserved bacterial regulon devoted specifically to RCS resistance. PMID:24078635

The RclR protein is a reactive chlorine-specific transcription factor in Escherichia coli.

PubMed

Parker, Benjamin W; Schwessinger, Emily A; Jakob, Ursula; Gray, Michael J

2013-11-08

Reactive chlorine species (RCS) such as hypochlorous acid are powerful antimicrobial oxidants. Used extensively for disinfection in household and industrial settings (i.e. as bleach), RCS are also naturally generated in high quantities during the innate immune response. Bacterial responses to RCS are complex and differ substantially from the well characterized responses to other physiologically relevant oxidants, like peroxide or superoxide. Several RCS-sensitive transcription factors have been identified in bacteria, but most of them respond to multiple stressors whose damaging effects overlap with those of RCS, including reactive oxygen species and electrophiles. We have now used in vivo genetic and in vitro biochemical methods to identify and demonstrate that Escherichia coli RclR (formerly YkgD) is a redox-regulated transcriptional activator of the AraC family, whose highly conserved cysteine residues are specifically sensitive to oxidation by RCS. Oxidation of these cysteines leads to strong, highly specific activation of expression of genes required for survival of RCS stress. These results demonstrate the existence of a widely conserved bacterial regulon devoted specifically to RCS resistance.

Transcription factors and stress response gene alterations in human keratinocytes following Solar Simulated Ultra Violet Radiation.

PubMed

Marais, Thomas L Des; Kluz, Thomas; Xu, Dazhong; Zhang, Xiaoru; Gesumaria, Lisa; Matsui, Mary S; Costa, Max; Sun, Hong

2017-10-19

Ultraviolet radiation (UVR) from sunlight is the major effector for skin aging and carcinogenesis. However, genes and pathways altered by solar-simulated UVR (ssUVR), a mixture of UVA and UVB, are not well characterized. Here we report global changes in gene expression as well as associated pathways and upstream transcription factors in human keratinocytes exposed to ssUVR. Human HaCaT keratinocytes were exposed to either a single dose or 5 repetitive doses of ssUVR. Comprehensive analyses of gene expression profiles as well as functional annotation were performed at 24 hours post irradiation. Our results revealed that ssUVR modulated genes with diverse cellular functions changed in a dose-dependent manner. Gene expression in cells exposed to a single dose of ssUVR differed significantly from those that underwent repetitive exposures. While single ssUVR caused a significant inhibition in genes involved in cell cycle progression, especially G2/M checkpoint and mitotic regulation, repetitive ssUVR led to extensive changes in genes related to cell signaling and metabolism. We have also identified a panel of ssUVR target genes that exhibited persistent changes in gene expression even at 1 week after irradiation. These results revealed a complex network of transcriptional regulators and pathways that orchestrate the cellular response to ssUVR.

Gut-derived commensal bacterial products inhibit liver dendritic cell maturation by stimulating hepatic interleukin-6/signal transducer and activator of transcription 3 activity.

PubMed

Lunz, John G; Specht, Susan M; Murase, Noriko; Isse, Kumiko; Demetris, Anthony J

2007-12-01

Intraorgan dendritic cells (DCs) monitor the environment and help translate triggers of innate immunity into adaptive immune responses. Liver-based DCs are continually exposed, via gut-derived portal venous blood, to potential antigens and bacterial products that can trigger innate immunity. However, somehow the liver avoids a state of perpetual inflammation and protects central immune organs from overstimulation. In this study, we tested the hypothesis that hepatic interleukin-6 (IL-6)/signal transducer and activator of transcription 3 (STAT3) activity increases the activation/maturation threshold of hepatic DCs toward innate immune signals. The results show that the liver nuclear STAT3 activity is significantly higher than that of other organs and is IL-6-dependent. Hepatic DCs in normal IL-6 wild-type (IL-6(+/+)) mice are phenotypically and functionally less mature than DCs from IL-6-deficient (IL-6(-/-)) or STAT3-inhibited IL-6(+/+) mice, as determined by surface marker expression, proinflammatory cytokine secretion, and allogeneic T-cell stimulation. IL-6(+/+) liver DCs produce IL-6 in response to exposure to lipopolysaccharide (LPS) and cytidine phosphate guanosine oligonucleotides (CpG) but are resistant to maturation compared with IL-6(-/-) liver DCs. Conversely, exogenous IL-6 inhibits LPS-induced IL-6(-/-) liver DC maturation. IL-6/STAT3 signaling influences the liver DC expression of toll-like receptor 9 and IL-1 receptor associated kinase-M. The depletion of gut commensal bacteria in IL-6(+/+) mice with oral antibiotics decreased portal blood endotoxin levels, lowered the expression of IL-6 and phospho-STAT3, and significantly increased liver DC maturation. Gut-derived bacterial products, by stimulating hepatic IL-6/STAT3 signaling, inhibit hepatic DC activation/maturation and thereby elevate the threshold needed for translating triggers of innate immunity into adaptive immune responses. Manipulating gut bacteria may therefore be an effective strategy

Faithful transcription initiation from a mitochondrial promoter in transgenic plastids

PubMed Central

Bohne, Alexandra-Viola; Ruf, Stephanie; Börner, Thomas; Bock, Ralph

2007-01-01

The transcriptional machineries of plastids and mitochondria in higher plants exhibit striking similarities. All mitochondrial genes and part of the plastid genes are transcribed by related phage-type RNA polymerases. Furthermore, the majority of mitochondrial promoters and a subset of plastid promoters show a similar structural organization. We show here that the plant mitochondrial atpA promoter is recognized by plastid RNA polymerases in vitro and in vivo. The Arabidopsis phage-type RNA polymerase RpoTp, an enzyme localized exclusively to plastids, was found to recognize the mitochondrial atpA promoter in in vitro assays suggesting the possibility that mitochondrial promoters might function as well in plastids. We have, therefore, generated transplastomic tobacco plants harboring in their chloroplast genome the atpA promoter fused to the coding region of the bacterial nptII gene. The chimeric nptII gene was found to be efficiently transcribed in chloroplasts. Mapping of the 5′ ends of the nptII transcripts revealed accurate recognition of the atpA promoter by the chloroplast transcription machinery. We show further that the 5′ untranslated region (UTR) of the mitochondrial atpA transcript is capable of mediating translation in chloroplasts. The functional and evolutionary implications of these findings as well as possible applications in chloroplast genome engineering are discussed. PMID:17959651

Gene Expression Profiling of Transcription Factors of Helicobacter pylori under Different Environmental Conditions.

PubMed

De la Cruz, Miguel A; Ares, Miguel A; von Bargen, Kristine; Panunzi, Leonardo G; Martínez-Cruz, Jessica; Valdez-Salazar, Hilda A; Jiménez-Galicia, César; Torres, Javier

2017-01-01

Helicobacter pylori is a Gram-negative bacterium that colonizes the human gastric mucosa and causes peptic ulcers and gastric carcinoma. H. pylori strain 26695 has a small genome (1.67 Mb), which codes for few known transcriptional regulators that control bacterial metabolism and virulence. We analyzed by qRT-PCR the expression of 16 transcriptional regulators in H. pylori 26695, including the three sigma factors under different environmental conditions. When bacteria were exposed to acidic pH, urea, nickel, or iron, the sigma factors were differentially expressed with a particularly strong induction of fliA . The regulatory genes hrcA, hup , and crdR were highly induced in the presence of urea, nickel, and iron. In terms of biofilm formation fliA, flgR, hp1021, fur, nikR , and crdR were induced in sessile bacteria. Transcriptional expression levels of rpoD, flgR, hspR, hp1043 , and cheY were increased in contact with AGS epithelial cells. Kanamycin, chloramphenicol, and tetracycline increased or decreased expression of regulatory genes, showing that these antibiotics affect the transcription of H. pylori . Our data indicate that environmental cues which may be present in the human stomach modulate H. pylori transcription.

Molecular Dynamics Simulations of the Bacterial UraA H+-Uracil Symporter in Lipid Bilayers Reveal a Closed State and a Selective Interaction with Cardiolipin

PubMed Central

Kalli, Antreas C.; Sansom, Mark S. P.; Reithmeier, Reinhart A. F.

2015-01-01

The Escherichia coli UraA H+-uracil symporter is a member of the nucleobase/ascorbate transporter (NAT) family of proteins, and is responsible for the proton-driven uptake of uracil. Multiscale molecular dynamics simulations of the UraA symporter in phospholipid bilayers consisting of: 1) 1-palmitoyl 2-oleoyl-phosphatidylcholine (POPC); 2) 1-palmitoyl 2-oleoyl-phosphatidylethanolamine (POPE); and 3) a mixture of 75% POPE, 20% 1-palmitoyl 2-oleoyl-phosphatidylglycerol (POPG); and 5% 1-palmitoyl 2-oleoyl-diphosphatidylglycerol/cardiolipin (CL) to mimic the lipid composition of the bacterial inner membrane, were performed using the MARTINI coarse-grained force field to self-assemble lipids around the crystal structure of this membrane transport protein, followed by atomistic simulations. The overall fold of the protein in lipid bilayers remained similar to the crystal structure in detergent on the timescale of our simulations. Simulations were performed in the absence of uracil, and resulted in a closed state of the transporter, due to relative movement of the gate and core domains. Anionic lipids, including POPG and especially CL, were found to associate with UraA, involving interactions between specific basic residues in loop regions and phosphate oxygens of the CL head group. In particular, three CL binding sites were identified on UraA: two in the inner leaflet and a single site in the outer leaflet. Mutation of basic residues in the binding sites resulted in the loss of CL binding in the simulations. CL may play a role as a “proton trap” that channels protons to and from this transporter within CL-enriched areas of the inner bacterial membrane. PMID:25729859

Reading of the non-template DNA by transcription elongation factors.

PubMed

Svetlov, Vladimir; Nudler, Evgeny

2018-05-14

Unlike transcription initiation and termination, which have easily discernable signals such as promoters and terminators, elongation is regulated through a dynamic network involving RNA/DNA pause signals and states- rather than sequence-specific protein interactions. A report by Nedialkov et al. (in press) provides experimental evidence for sequence-specific recruitment of elongation factor RfaH to transcribing RNA polymerase (RNAP) and outlines the mechanism of gene expression regulation by restraint ("locking") of the DNA non-template strand. According to this model, the elongation complex pauses at the so called "operon polarity sequence" (found in some long bacterial operons coding for virulence genes), when the usually flexible non-template DNA strand adopts a distinct hairpin-loop conformation on the surface of transcribing RNAP. Sequence-specific binding of RfaH to this DNA segment facilitates conversion of RfaH from its inactive closed to its active open conformation. The interaction network formed between RfaH, non-template DNA, and RNAP locks DNA in a conformation that renders the elongation complex resistant to pausing and termination. The effects of such locking on transcript elongation can be mimicked by restraint of the non-template strand due to its shortening. This work advances our understanding of regulation of transcript elongation and has important implications for the action of general transcription factors, such as NusG, which lack apparent sequence-specificity, as well as for the mechanisms of other processes linked to transcription such as transcription-coupled DNA repair. This article is protected by copyright. All rights reserved. © 2018 John Wiley & Sons Ltd.

Multi-fractal characterization of bacterial swimming dynamics: a case study on real and simulated Serratia marcescens

PubMed Central

Bogdan, Paul; Wei, Guopeng; Marculescu, Radu; Zhuang, Jiang; Carlsen, Rika Wright; Sitti, Metin

2017-01-01

To add to the current state of knowledge about bacterial swimming dynamics, in this paper, we study the fractal swimming dynamics of populations of Serratia marcescens bacteria both in vitro and in silico, while accounting for realistic conditions like volume exclusion, chemical interactions, obstacles and distribution of chemoattractant in the environment. While previous research has shown that bacterial motion is non-ergodic, we demonstrate that, besides the non-ergodicity, the bacterial swimming dynamics is multi-fractal in nature. Finally, we demonstrate that the multi-fractal characteristic of bacterial dynamics is strongly affected by bacterial density and chemoattractant concentration. PMID:28804259

Transcriptional and posttranscriptional regulation of cyanobacterial photosynthesis.

PubMed

Wilde, Annegret; Hihara, Yukako

2016-03-01

Cyanobacteria are well established model organisms for the study of oxygenic photosynthesis, nitrogen metabolism, toxin biosynthesis, and salt acclimation. However, in comparison to other model bacteria little is known about regulatory networks, which allow cyanobacteria to acclimate to changing environmental conditions. The current work has begun to illuminate how transcription factors modulate expression of different photosynthetic regulons. During the past few years, the research on other regulatory principles like RNA-based regulation showed the importance of non-protein regulators for bacterial lifestyle. Investigations on modulation of photosynthetic components should elucidate the contributions of all factors within the context of a larger regulatory network. Here, we focus on regulation of photosynthetic processes including transcriptional and posttranscriptional mechanisms, citing examples from a limited number of cyanobacterial species. Though, the general idea holds true for most species, important differences exist between various organisms, illustrating diversity of acclimation strategies in the very heterogeneous cyanobacterial clade. This article is part of a Special Issue entitled Organization and dynamics of bioenergetic systems in bacteria, edited by Prof Conrad Mullineaux. Copyright © 2015 Elsevier B.V. All rights reserved.

Morphomechanics of bacterial biofilms undergoing anisotropic differential growth

NASA Astrophysics Data System (ADS)

Zhang, Cheng; Li, Bo; Huang, Xiao; Ni, Yong; Feng, Xi-Qiao

2016-10-01

Growing bacterial biofilms exhibit a number of surface morphologies, e.g., concentric wrinkles, radial ridges, and labyrinthine networks, depending on their physiological status and nutrient access. We explore the mechanisms underlying the emergence of these greatly different morphologies. Ginzburg-Landau kinetic method and Fourier spectral method are integrated to simulate the morphological evolution of bacterial biofilms. It is shown that the morphological instability of biofilms is triggered by the stresses induced by anisotropic and heterogeneous bacterial expansion, and involves the competition between membrane energy and bending energy. Local interfacial delamination further enriches the morphologies of biofilms. Phase diagrams are established to reveal how the anisotropy and spatial heterogeneity of growth modulate the surface patterns. The mechanics of three-dimensional microbial morphogenesis may also underpin self-organization in other development systems and provide a potential strategy for engineering microscopic structures from bacterial aggregates.

Rainfall simulation in greenhouse microcosms to assess bacterial-associated runoff from land-applied poultry litter.

PubMed

Brooks, John P; Adeli, Ardeshir; Read, John J; McLaughlin, Michael R

2009-01-01

Runoff water following a rain event is one possible source of environmental contamination after a manure application. This greenhouse study used a rainfall simulator to determine bacterial-associated runoff from troughs of common bermudagrass [Cynodon dactylon (L.) Pers.] that were treated with P-based, N-based, and N plus lime rates of poultry (Gallus gallus) litter, recommended inorganic fertilizer, and control. Total heterotrophic plate count (HPC) bacteria, total and thermotolerant coliforms, enterococci, staphylococci, Clostridium perfringens, Salmonella, and Campylobacter, as well as antibiotic resistance profiles for the staphylococci and enterococci isolates were all monitored in runoff waters. Analysis following five rainfall events indicated that staphylococci, enterococci, and clostridia levels were related to manure application rate. Runoff release of staphylococci, enterococci, and C. perfringens were approximately 3 to 6 log10 greater in litter vs. control treatment. In addition, traditional indicators such as thermotolerant and total coliforms performed poorly as fecal indicators. Some isolated enterococci demonstrated increased antibiotic resistance to polymixin b and/or select aminoglyocosides, while many staphylococci were susceptible to most antimicrobials tested. Results indicated poultry litter application can lead to microbial runoff following simulated rain events. Future studies should focus on the use of staphylococci, enterococci, and C. perfringens as indicators.

Inter-replicon Gene Flow Contributes to Transcriptional Integration in the Sinorhizobium meliloti Multipartite Genome.

PubMed

diCenzo, George C; Wellappili, Deelaka; Golding, G Brian; Finan, Turlough M

2018-05-04

Integration of newly acquired genes into existing regulatory networks is necessary for successful horizontal gene transfer (HGT). Ten percent of bacterial species contain at least two DNA replicons over 300 kilobases in size, with the secondary replicons derived predominately through HGT. The Sinorhizobium meliloti genome is split between a 3.7 Mb chromosome, a 1.7 Mb chromid consisting largely of genes acquired through ancient HGT, and a 1.4 Mb megaplasmid consisting primarily of recently acquired genes. Here, RNA-sequencing is used to examine the transcriptional consequences of massive, synthetic genome reduction produced through the removal of the megaplasmid and/or the chromid. Removal of the pSymA megaplasmid influenced the transcription of only six genes. In contrast, removal of the chromid influenced expression of ∼8% of chromosomal genes and ∼4% of megaplasmid genes. This was mediated in part by the loss of the ETR DNA region whose presence on pSymB is due to a translocation from the chromosome. No obvious functional bias among the up-regulated genes was detected, although genes with putative homologs on the chromid were enriched. Down-regulated genes were enriched in motility and sensory transduction pathways. Four transcripts were examined further, and in each case the transcriptional change could be traced to loss of specific pSymB regions. In particularly, a chromosomal transporter was induced due to deletion of bdhA likely mediated through 3-hydroxybutyrate accumulation. These data provide new insights into the evolution of the multipartite bacterial genome, and more generally into the integration of horizontally acquired genes into the transcriptome. Copyright © 2018 diCenzo, et al.

Transcriptional dynamics with time-dependent reaction rates

NASA Astrophysics Data System (ADS)

Nandi, Shubhendu; Ghosh, Anandamohan

2015-02-01

Transcription is the first step in the process of gene regulation that controls cell response to varying environmental conditions. Transcription is a stochastic process, involving synthesis and degradation of mRNAs, that can be modeled as a birth-death process. We consider a generic stochastic model, where the fluctuating environment is encoded in the time-dependent reaction rates. We obtain an exact analytical expression for the mRNA probability distribution and are able to analyze the response for arbitrary time-dependent protocols. Our analytical results and stochastic simulations confirm that the transcriptional machinery primarily act as a low-pass filter. We also show that depending on the system parameters, the mRNA levels in a cell population can show synchronous/asynchronous fluctuations and can deviate from Poisson statistics.

Deep sequencing approaches for the analysis of prokaryotic transcriptional boundaries and dynamics.

PubMed

James, Katherine; Cockell, Simon J; Zenkin, Nikolay

2017-05-01

The identification of the protein-coding regions of a genome is straightforward due to the universality of start and stop codons. However, the boundaries of the transcribed regions, conditional operon structures, non-coding RNAs and the dynamics of transcription, such as pausing of elongation, are non-trivial to identify, even in the comparatively simple genomes of prokaryotes. Traditional methods for the study of these areas, such as tiling arrays, are noisy, labour-intensive and lack the resolution required for densely-packed bacterial genomes. Recently, deep sequencing has become increasingly popular for the study of the transcriptome due to its lower costs, higher accuracy and single nucleotide resolution. These methods have revolutionised our understanding of prokaryotic transcriptional dynamics. Here, we review the deep sequencing and data analysis techniques that are available for the study of transcription in prokaryotes, and discuss the bioinformatic considerations of these analyses. Copyright © 2017 Elsevier Inc. All rights reserved.

In-vitro analysis of APA microcapsules for oral delivery of live bacterial cells.

PubMed

Chen, H; Ouyang, W; Jones, M; Haque, T; Lawuyi, B; Prakash, S

2005-08-01

Oral administration of microcapsules containing live bacterial cells has potential as an alternative therapy for several diseases. This article evaluates the suitability of the alginate-poly-L-lysine-alginate (APA) microcapsules for oral delivery of live bacterial cells, in-vitro, using a dynamic simulated human gastro-intestinal (GI) model. Results showed that the APA microcapsules were morphologically stable in the simulated stomach conditions, but did not retain their structural integrity after a 3-day exposure in simulated human GI media. The microbial populations of the tested bacterial cells and the activities of the tested enzymes in the simulated human GI suspension were not substantially altered by the presence of the APA microcapsules, suggesting that there were no significant adverse effects of oral administration of the APA microcapsules on the flora of the human gastrointestinal tract. When the APA microcapsules containing Lactobacillus plantarum 80 (LP80) were challenged in the simulated gastric medium (pH = 2.0), 80.0% of the encapsulated cells remained viable after a 5-min incubation; however, the viability decreased considerably (8.3%) after 15 min and dropped to 2.6% after 30 min and lower than 0.2% after 60 min, indicating the limitations of the currently obtainable APA membrane for oral delivery of live bacteria. Further in-vivo studies are required before conclusions can be made concerning the inadequacy of APA microcapsules for oral delivery of live bacterial cells.

UGT-29 protein expression and localization during bacterial infection in Caenorhabditis elegans

NASA Astrophysics Data System (ADS)

Wong, Rui-Rui; Lee, Song-Hua; Nathan, Sheila

2014-09-01

The nematode Caenorhabditis elegans is routinely used as an animal model to delineate complex molecular mechanisms involved in the host response to pathogen infection. Following up on an earlier study on host-pathogen interaction, we constructed a ugt-29::GFP transcriptional fusion transgenic worm strain to examine UGT-29 protein expression and localization upon bacterial infection. UGT-29 orthologs can be found in higher organisms including humans and is proposed as a member of the UDP-Glucoronosyl Transferase family of proteins which are involved in phase II detoxification of compounds detrimental to the host organism. Under uninfected conditions, UGT-29::GFP fusion protein was highly expressed in the C. elegans anterior pharynx and intestine, two major organs involved in detoxification. We further evaluated the localization of the enzyme in worms infected with the bacterial pathogen, Burkholderia pseudomallei. The infected ugt-29::GFP transgenic strain exhibited increased fluorescence in the pharynx and intestine with pronounced fluorescence also extending to body wall muscle. This transcriptional fusion GFP transgenic worm is a convenient and direct tool to provide information on UGT detoxification enzyme gene expression and could be a useful tool for a number of diverse applications.

Effect Of Simulated Microgravity On Activated T Cell Gene Transcription

NASA Technical Reports Server (NTRS)

Morrow, Maureen A.

2003-01-01

Studies of T lymphocytes under the shear stress environment of clinorotation have demonstrated an inhibition of activation in response to TCR mediated signaling. These results mimic those observed during space flight. This work investigates the molecular signaling events of T lymphocyte activation with clinorotation. Purified human T lymphocytes and the T cell clone Jurkat exhibit an uncoupling of signaling as mediated through the TCR. Activation of the transcription factor AP-1 is inhibited while activation of NFAT occurs. NFAT dephosphorylation and activation is dependent on sustained Ca(++) influx. Alternatively, AP-1, which consists of two transcription factors, jun and fos, is activated by PKC and Ras mediated pathways. TCR signaling is known to be dependent on cytoskeletal rearrangements, in particular, raft aggregation is critical. Raft aggregation, as mediated through GM, crosslinking, overcomes the inhibition of T lymphocyte activation with clinorotation, indicating that the block is occurring upstream of raft aggregation. Clinorotation is shown to have an effect similar to a weak TCR signal.

Impact of ionic liquids in aqueous solution on bacterial plasma membranes studied with molecular dynamics simulations.

PubMed

Lim, Geraldine S; Zidar, Jernej; Cheong, Daniel W; Jaenicke, Stephan; Klähn, Marco

2014-09-04

The impact of five different imidazolium-based ionic liquids (ILs) diluted in water on the properties of a bacterial plasma membrane is investigated using molecular dynamics (MD) simulations. Cations considered are 1-octyl-3-methylimidazolium (OMIM), 1-octyloxymethyl-3-methylimidazolium (OXMIM), and 1-tetradecyl-3-methylimidazolium (TDMIM), as well as the anions chloride and lactate. The atomistic model of the membrane bilayer is designed to reproduce the lipid composition of the plasma membrane of Gram-negative Escherichia coli. Spontaneous insertion of cations into the membrane is observed in all ILs. Substantially more insertions of OMIM than of OXMIM occur and the presence of chloride reduces cation insertions compared to lactate. In contrast, anions do not adsorb onto the membrane surface nor diffuse into the bilayer. Once inserted, cations are oriented in parallel to membrane lipids with cation alkyl tails embedded into the hydrophobic membrane core, while the imidazolium-ring remains mostly exposed to the solvent. Such inserted cations are strongly associated with one to two phospholipids in the membrane. The overall order of lipids decreased after OMIM and OXMIM insertions, while on the contrary the order of lipids in the vicinity of TDMIM increased. The short alkyl tails of OMIM and OXMIM generate voids in the bilayer that are filled by curling lipids. This cation induced lipid disorder also reduces the average membrane thickness. This effect is not observed after TDMIM insertions due to the similar length of cation alkyl chain and the fatty acids of the lipids. This lipid-mimicking behavior of inserted TDMIM indicates a high membrane affinity of this cation that could lead to an enhanced accumulation of cations in the membrane over time. Overall, the simulations reveal how cations are inserted into the bacterial membrane and how such insertions change its properties. Moreover, the different roles of cations and anions are highlighted and the fundamental

Shrimp alpha-2-macroglobulin prevents the bacterial escape by inhibiting fibrinolysis of blood clots.

PubMed

Chaikeeratisak, Vorrapon; Somboonwiwat, Kunlaya; Tassanakajon, Anchalee

2012-01-01

Proteomic analysis of the hemocytic proteins of Penaeus monodon (Pm) has previously shown that alpha-2-macroglobulin (A2M) was among the proteins that showed substantially altered expression levels upon Vibrio harveyi infection. Therefore, in this study its potentially important role in the response of shrimp to bacterial infection was further characterized. The yeast two-hybrid system revealed that the receptor binding domain of PmA2M interacted with the carboxyl-terminus of one or both of the transglutaminase type II isoforms, which are key enzymes involved in the shrimp clotting system. In accord with this, PmA2M was found to be localized on the extracellular blood clots and to colocalize with clottable proteins. RNA interference (RNAi)-mediated knockdown of A2M transcript levels reduced the PmA2M transcript levels (∼94%) and significantly reduced the bacterial seizing ability of the clotting system, resulting in an up to 3.3-fold higher number of V. harveyi that systemically disseminated into the circulatory system at 5 min post-infection before subsequent clearance by the immune system. Furthermore, an appearance of PmA2M depleted clots in the presence of V. harveyi strikingly demonstrated fibrinolysis zones surrounding the bacteria. This study provides the first evidence of the vital role of PmA2M in enhancing bacterial sequestration by protecting blood clots against fibrinolysis.

Cellulose Nanofibrils and Mechanism of their Mineralization in Biomimetic Synthesis of Hydroxyapatite/Native Bacterial Cellulose Nanocomposites: Molecular Dynamics Simulations.

PubMed

Lukasheva, N V; Tolmachev, D A

2016-01-12

Molecular dynamics (MD) simulation of a nanofibril of native bacterial cellulose (BC) in solutions of mineral ions is presented. The supersaturated calcium-phosphate (CP) solution with the ionic composition of hydroxyapatite and CaCl2 solutions with the concentrations below, equal to, and above the solubility limits are simulated. The influence of solvation models (TIP3P and TIP4P-ew water models) on structural characteristics of the simulated nanofibril and on the crystal nucleation process is assessed. The structural characteristics of cellulose nanofibrils (in particular, of the surface layer) are found to be nearly independent of the solvation models used in the simulation and on the presence of ions in the solutions. It is shown that ionic clusters are formed in the solution rather than on the fibril surface. The cluster sizes are slightly different for the two water models. The effect of the ion-ion interaction parameters on the results is discussed. The main conclusion is that the activity of hydroxyl groups on the BC fibril surface is not high enough to cause adsorption of Ca(2+) ions from the solution. Therefore, the nucleation of CP crystals takes place initially in solution, and then the crystallites formed can be adsorbed on BC nanofibril surfaces.

K + block is the mechanism of functional asymmetry in bacterial Na v channels

DOE PAGES

Ngo, Van; Wang, Yibo; Haas, Stephan; ...

2016-01-04

Crystal structures of several bacterial Na v channels have been recently published and molecular dynamics simulations of ion permeation through these channels are consistent with many electrophysiological properties of eukaryotic channels. Bacterial Na v channels have been characterized as functionally asymmetric, and the mechanism of this asymmetry has not been clearly understood. To address this question, we combined non-equilibrium simulation data with two-dimensional equilibrium unperturbed landscapes generated by umbrella sampling and Weighted Histogram Analysis Methods for multiple ions traversing the selectivity filter of bacterial Na vAb channel. This approach provided new insight into the mechanism of selective ion permeation inmore » bacterial Nav channels. The non-equilibrium simulations indicate that two or three extracellular K + ions can block the entrance to the selectivity filter of Na vAb in the presence of applied forces in the inward direction, but not in the outward direction. The block state occurs in an unstable local minimum of the equilibrium unperturbed free-energy landscape of two K+ ions that can be ‘locked’ in place bymodest applied forces. In contrast to K +, three Na + ions move favorably through the selectivity filter together as a unit in a loose “knock-on” mechanism of permeation in both inward and outward directions, and there is no similar local minimum in the two-dimensional free-energy landscape of two Na + ions for a block state. The useful work predicted by the non-equilibrium simulations that is required to break the K + block is equivalent to large applied potentials experimentally measured for two bacterial Na v channels to induce inward currents of K + ions. Here, these results illustrate how inclusion of non-equilibrium factors in the simulations can provide detailed information about mechanisms of ion selectivity that is missing from mechanisms derived from either crystal structures or equilibrium unperturbed

Active bacterial community structure along vertical redox gradients in Baltic Sea sediment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jansson, Janet; Edlund, Anna; Hardeman, Fredrik

Community structures of active bacterial populations were investigated along a vertical redox profile in coastal Baltic Sea sediments by terminal-restriction fragment length polymorphism (T-RFLP) and clone library analysis. According to correspondence analysis of T-RFLP results and sequencing of cloned 16S rRNA genes, the microbial community structures at three redox depths (179 mV, -64 mV and -337 mV) differed significantly. The bacterial communities in the community DNA differed from those in bromodeoxyuridine (BrdU)-labeled DNA, indicating that the growing members of the community that incorporated BrdU were not necessarily the most dominant members. The structures of the actively growing bacterial communities weremore » most strongly correlated to organic carbon followed by total nitrogen and redox potentials. Bacterial identification by sequencing of 16S rRNA genes from clones of BrdU-labeled DNA and DNA from reverse transcription PCR (rt-PCR) showed that bacterial taxa involved in nitrogen and sulfur cycling were metabolically active along the redox profiles. Several sequences had low similarities to previously detected sequences indicating that novel lineages of bacteria are present in Baltic Sea sediments. Also, a high number of different 16S rRNA gene sequences representing different phyla were detected at all sampling depths.« less

A continuum model of transcriptional bursting

PubMed Central

Corrigan, Adam M; Tunnacliffe, Edward; Cannon, Danielle; Chubb, Jonathan R

2016-01-01

Transcription occurs in stochastic bursts. Early models based upon RNA hybridisation studies suggest bursting dynamics arise from alternating inactive and permissive states. Here we investigate bursting mechanism in live cells by quantitative imaging of actin gene transcription, combined with molecular genetics, stochastic simulation and probabilistic modelling. In contrast to early models, our data indicate a continuum of transcriptional states, with a slowly fluctuating initiation rate converting the gene between different levels of activity, interspersed with extended periods of inactivity. We place an upper limit of 40 s on the lifetime of fluctuations in elongation rate, with initiation rate variations persisting an order of magnitude longer. TATA mutations reduce the accessibility of high activity states, leaving the lifetime of on- and off-states unchanged. A continuum or spectrum of gene states potentially enables a wide dynamic range for cell responses to stimuli. DOI: http://dx.doi.org/10.7554/eLife.13051.001 PMID:26896676

Sequence Elements Upstream of the Core Promoter Are Necessary for Full Transcription of the Capsule Gene Operon in Streptococcus pneumoniae Strain D39

PubMed Central

Wen, Zhensong; Sertil, Odeniel; Cheng, Yongxin; Zhang, Shanshan; Liu, Xue; Wang, Wen-Ching

2015-01-01

Streptococcus pneumoniae is a major bacterial pathogen in humans. Its polysaccharide capsule is a key virulence factor that promotes bacterial evasion of human phagocytic killing. While S. pneumoniae produces at least 94 antigenically different types of capsule, the genes for biosynthesis of almost all capsular types are arranged in the same locus. The transcription of the capsular polysaccharide (cps) locus is not well understood. This study determined the transcriptional features of the cps locus in the type 2 virulent strain D39. The initial analysis revealed that the cps genes are cotranscribed from a major transcription start site at the −25 nucleotide (G) upstream of cps2A, the first gene in the locus. Using unmarked chromosomal truncations and a luciferase-based transcriptional reporter, we showed that the full transcription of the cps genes not only depends on the core promoter immediately upstream of cps2A, but also requires additional elements upstream of the core promoter, particularly a 59-bp sequence immediately upstream of the core promoter. Unmarked deletions of these promoter elements in the D39 genome also led to significant reduction in CPS production and virulence in mice. Lastly, common cps gene (cps2ABCD) mutants did not show significant abnormality in cps transcription, although they produced significantly less CPS, indicating that the CpsABCD proteins are involved in the encapsulation of S. pneumoniae in a posttranscriptional manner. This study has yielded important information on the transcriptional characteristics of the cps locus in S. pneumoniae. PMID:25733517

Morphodynamics of growing bacterial colony

NASA Astrophysics Data System (ADS)

Ghosh, Pushpita; Perlekar, Prasad; Rana, Navdeep

Self-organization into multicellular communities is a natural trend of most of the bacteria. Mutual interactions and competition among the bacterial cells in such multicellular organization play essential role in governing the spatiotemporal dynamics. We here present the spatiotemporal dynamics of growing bacterial colony using theory and a particle-based or individual-based simulation model of nonmotile cells growing utilizing a diffusing nutrient/food on a semi-solid surface by their growth and division forces and by pushing each-other through sliding motility. We show how the resource competition over a fixed amount of food, the diffusion coefficient of the nutrient and the random genetic noise govern the morphodynamics of a single species and a well-mixed two-species bacterial colonies. Our results show that for a very low initial food concentrations, colony develops fingering pattern at the front, while for intermediate values of initial food sources, the colony undergoes transitions to branched structures at the periphery and for very high values of food colony develops smoother fronts.

Evidence for Transcript Networks Composed of Chimeric RNAs in Human Cells

PubMed Central

Borel, Christelle; Mudge, Jonathan M.; Howald, Cédric; Foissac, Sylvain; Ucla, Catherine; Chrast, Jacqueline; Ribeca, Paolo; Martin, David; Murray, Ryan R.; Yang, Xinping; Ghamsari, Lila; Lin, Chenwei; Bell, Ian; Dumais, Erica; Drenkow, Jorg; Tress, Michael L.; Gelpí, Josep Lluís; Orozco, Modesto; Valencia, Alfonso; van Berkum, Nynke L.; Lajoie, Bryan R.; Vidal, Marc; Stamatoyannopoulos, John; Batut, Philippe; Dobin, Alex; Harrow, Jennifer; Hubbard, Tim; Dekker, Job; Frankish, Adam; Salehi-Ashtiani, Kourosh; Reymond, Alexandre; Antonarakis, Stylianos E.; Guigó, Roderic; Gingeras, Thomas R.

2012-01-01

The classic organization of a gene structure has followed the Jacob and Monod bacterial gene model proposed more than 50 years ago. Since then, empirical determinations of the complexity of the transcriptomes found in yeast to human has blurred the definition and physical boundaries of genes. Using multiple analysis approaches we have characterized individual gene boundaries mapping on human chromosomes 21 and 22. Analyses of the locations of the 5′ and 3′ transcriptional termini of 492 protein coding genes revealed that for 85% of these genes the boundaries extend beyond the current annotated termini, most often connecting with exons of transcripts from other well annotated genes. The biological and evolutionary importance of these chimeric transcripts is underscored by (1) the non-random interconnections of genes involved, (2) the greater phylogenetic depth of the genes involved in many chimeric interactions, (3) the coordination of the expression of connected genes and (4) the close in vivo and three dimensional proximity of the genomic regions being transcribed and contributing to parts of the chimeric RNAs. The non-random nature of the connection of the genes involved suggest that chimeric transcripts should not be studied in isolation, but together, as an RNA network. PMID:22238572

Shikimate Induced Transcriptional Activation of Protocatechuate Biosynthesis Genes by QuiR, a LysR-Type Transcriptional Regulator, in Listeria monocytogenes.

PubMed

Prezioso, Stephanie M; Xue, Kevin; Leung, Nelly; Gray-Owen, Scott D; Christendat, Dinesh

2018-04-27

Listeria monocytogenes is a common foodborne bacterial pathogen that contaminates plant and animal consumable products. The persistent nature of L. monocytogenes is associated with millions of dollars in food recalls annually. Here, we describe the role of shikimate in directly modulating the expression of genes encoding enzymes for the conversion of quinate and shikimate metabolites to protocatechuate. In L. monocytogenes, these genes are found within two operons, named qui1 and qui2. In addition, a gene named quiR, encoding a LysR-Type Transcriptional Regulator (QuiR), is located immediately upstream of the qui1 operon. Transcriptional lacZ-promoter fusion experiments show that QuiR induces gene expression of both qui1 and qui2 operons in the presence of shikimate. Furthermore, co-crystallization of the QuiR effector binding domain in complex with shikimate provides insights into the mechanism of activation of this regulator. Together these data show that upon shikimate accumulation, QuiR activates the transcription of genes encoding enzymes involved in shikimate and quinate utilization for the production of protocatechuate. Furthermore, the accumulation of protocatechuate leads to the inhibition of Listeria growth. Since protocatechuate is not known to be utilized by Listeria, its role is distinct from those established in other bacteria. Copyright © 2018 Elsevier Ltd. All rights reserved.

Genome engineering and gene expression control for bacterial strain development.

PubMed

Song, Chan Woo; Lee, Joungmin; Lee, Sang Yup

2015-01-01

In recent years, a number of techniques and tools have been developed for genome engineering and gene expression control to achieve desired phenotypes of various bacteria. Here we review and discuss the recent advances in bacterial genome manipulation and gene expression control techniques, and their actual uses with accompanying examples. Genome engineering has been commonly performed based on homologous recombination. During such genome manipulation, the counterselection systems employing SacB or nucleases have mainly been used for the efficient selection of desired engineered strains. The recombineering technology enables simple and more rapid manipulation of the bacterial genome. The group II intron-mediated genome engineering technology is another option for some bacteria that are difficult to be engineered by homologous recombination. Due to the increasing demands on high-throughput screening of bacterial strains having the desired phenotypes, several multiplex genome engineering techniques have recently been developed and validated in some bacteria. Another approach to achieve desired bacterial phenotypes is the repression of target gene expression without the modification of genome sequences. This can be performed by expressing antisense RNA, small regulatory RNA, or CRISPR RNA to repress target gene expression at the transcriptional or translational level. All of these techniques allow efficient and rapid development and screening of bacterial strains having desired phenotypes, and more advanced techniques are expected to be seen. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

GlpR is a direct transcriptional repressor of fructose metabolic genes in Haloferax volcanii.

PubMed

Martin, Jonathan H; Rawls, Katie Sherwood; Chan, Jou Chin; Hwang, Sungmin; Martinez-Pastor, Mar; McMillan, Lana J; Prunetti, Laurence; Schmid, Amy K; Maupin-Furlow, Julie A

2018-06-18

DeoR-type helix-turn-helix (HTH) domain proteins are transcriptional regulators of sugar and nucleoside metabolism in diverse bacteria and occur in select archaea. In the model archaeon Haloferax volcanii , previous work implicated GlpR, a DeoR-type transcriptional regulator, in transcriptional repression of glpR and the gene encoding the fructose-specific phosphofructokinase ( pfkB ) during growth on glycerol. However, the global regulon governed by GlpR remained unclear. Here we compared transcriptomes of wild type and Δ glpR mutant strains grown on glycerol and glucose to detect significant transcript level differences for nearly 50 new genes regulated by GlpR. By coupling computational prediction of GlpR binding sequences with in vivo and in vitro DNA binding experiments, we determined that GlpR directly controls genes encoding enzymes in fructose degradation, including fructose bisphosphate aldolase, a central control point in glycolysis. GlpR also directly controls other transcription factors. In contrast, other metabolic pathways appear to be under indirect influence of GlpR. In vitro experiments demonstrated that GlpR purifies as a tetramer that binds the effector molecule fructose-1-phosphate (F1P). These results suggest that Hfx. volcanii GlpR functions as a direct negative regulator of fructose degradation during growth on carbon sources other than fructose, such as glucose and glycerol, and that GlpR bears striking functional similarity to bacterial DeoR-type regulators. IMPORTANCE Many archaea are extremophiles, able to thrive in habitats of extreme salinity, pH and temperature. These biological properties are ideal for applications in biotechnology. However, limited knowledge of archaeal metabolism is a bottleneck that prevents broad use of archaea as microbial factories for industrial products. Here we characterize how sugar uptake and use is regulated in a species that lives in high salinity. We demonstrate that a key sugar regulatory protein in

Influence of simulated acidic rain on bacterial speck of tomato. [Lycopersicon esculentum Mill var. 'Chico III', Pseudomonas tomato

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bisessar, S.; Palmer, K.T.; Kuja, A.L.

Ambient rain in southern Ontario has a volume-weighted average pH of approximately 4.2. Tomato (Lycopersicon esculentum Mill var. 'Chico III') seedlings were exposed to simulated acidic rain in specially designed chambers. The inoculum of Pseudomonas tomato (Okabe) Alstatt, causal agent of bacterial speck, was sprayed on plants before or after exposure to acidic rain of pH 2.5, 3.5, and 4.5, as well as on plants not exposed to the simulated acidic rain. Speck symptoms (small, dark, brown spots with yellow halos) were found on all inoculated plants. Exposure of plants to simulted acidic rain inhibited speck development, but the inhibitionmore » was greater on plants exposed to acidic rain after inoculation. Spot necrosis, a typical response to acid rain, occurred on up to 15 to 20% of the leaf area on all tomato plants treated with acidic rain at pH 2.5. Plants alos showed a decrease in growth (height and fresh and dry weights) with an increase in rain acidity. Leaves injured by simulated acidic rain and examined histopathologically displayed cellular malformations including hyperplasia and hypertrophy. Pseudomonas tomato failed to grow on acidified King B medium or Difco nutrient broth adjusted to pH 3.5 or lower.« less

Spatial organization shapes the turnover of a bacterial transcriptome

PubMed Central

Moffitt, Jeffrey R; Pandey, Shristi; Boettiger, Alistair N; Wang, Siyuan; Zhuang, Xiaowei

2016-01-01

Spatial organization of the transcriptome has emerged as a powerful means for regulating the post-transcriptional fate of RNA in eukaryotes; however, whether prokaryotes use RNA spatial organization as a mechanism for post-transcriptional regulation remains unclear. Here we used super-resolution microscopy to image the E. coli transcriptome and observed a genome-wide spatial organization of RNA: mRNAs encoding inner-membrane proteins are enriched at the membrane, whereas mRNAs encoding outer-membrane, cytoplasmic and periplasmic proteins are distributed throughout the cytoplasm. Membrane enrichment is caused by co-translational insertion of signal peptides recognized by the signal-recognition particle. Time-resolved RNA-sequencing revealed that degradation rates of inner-membrane-protein mRNAs are on average greater that those of the other mRNAs and that this selective destabilization of inner-membrane-protein mRNAs is abolished by dissociating the RNA degradosome from the membrane. Together, these results demonstrate that the bacterial transcriptome is spatially organized and suggest that this organization shapes the post-transcriptional dynamics of mRNAs. DOI: http://dx.doi.org/10.7554/eLife.13065.001 PMID:27198188

Community structure of the metabolically active rumen bacterial and archaeal communities of dairy cows over the transition period

PubMed Central

Zhu, Zhigang; Noel, Samantha Joan; Difford, Gareth Frank; Al-Soud, Waleed Abu; Brejnrod, Asker; Sørensen, Søren Johannes; Lassen, Jan; Løvendahl, Peter; Højberg, Ole

2017-01-01

Dairy cows experience dramatic changes in host physiology from gestation to lactation period and dietary switch from high-forage prepartum diet to high-concentrate postpartum diet over the transition period (parturition +/- three weeks). Understanding the community structure and activity of the rumen microbiota and its associative patterns over the transition period may provide insight for e.g. improving animal health and production. In the present study, rumen samples from ten primiparous Holstein dairy cows were collected over seven weeks spanning the transition period. Total RNA was extracted from the rumen samples and cDNA thereof was subsequently used for characterizing the metabolically active bacterial (16S rRNA transcript amplicon sequencing) and archaeal (qPCR, T-RFLP and mcrA and 16S rRNA transcript amplicon sequencing) communities. The metabolically active bacterial community was dominated by three phyla, showing significant changes in relative abundance range over the transition period: Firmicutes (from prepartum 57% to postpartum 35%), Bacteroidetes (from prepartum 22% to postpartum 18%) and Proteobacteria (from prepartum 7% to postpartum 32%). For the archaea, qPCR analysis of 16S rRNA transcript number, revealed a significant prepartum to postpartum increase in Methanobacteriales, in accordance with an observed increase (from prepartum 80% to postpartum 89%) in relative abundance of 16S rRNA transcript amplicons allocated to this order. On the other hand, a significant prepartum to postpartum decrease (from 15% to 2%) was observed in relative abundance of Methanomassiliicoccales 16S rRNA transcripts. In contrast to qPCR analysis of the 16S rRNA transcripts, quantification of mcrA transcripts revealed no change in total abundance of metabolically active methanogens over the transition period. According to T-RFLP analysis of the mcrA transcripts, two Methanobacteriales genera, Methanobrevibacter and Methanosphaera (represented by the T-RFs 39 and 267

Characterization of Bacterial Community Dynamics during the Decomposition of Pig Carcasses in Simulated Soil Burial and Composting Systems.

PubMed

Ki, Bo-Min; Kim, Yu Mi; Jeon, Jun Min; Ryu, Hee Wook; Cho, Kyung-Suk

2017-12-28

Soil burial is the most widely used disposal method for infected pig carcasses, but composting has gained attention as an alternative disposal method because pig carcasses can be decomposed rapidly and safely by composting. To understand the pig carcass decomposition process in soil burial and by composting, pilot-scale test systems that simulated soil burial and composting were designed and constructed in the field. The envelope material samples were collected using special sampling devices without disturbance, and bacterial community dynamics were analyzed by high-throughput pyrosequencing for 340 days. Based on the odor gas intensity profiles, it was estimated that the active and advanced decay stages were reached earlier by composting than by soil burial. The dominant bacterial communities in the soil were aerobic and/or facultatively anaerobic gram-negative bacteria such as Pseudomonas, Gelidibacter, Mucilaginibacter , and Brevundimonas . However, the dominant bacteria in the composting system were anaerobic, thermophilic, endospore-forming, and/or halophilic gram-positive bacteria such as Pelotomaculum, Lentibacillus, Clostridium , and Caldicoprobacter . Different dominant bacteria played important roles in the decomposition of pig carcasses in the soil and compost. This study provides useful comparative date for the degradation of pig carcasses in the soil burial and composting systems.

RNA search engines empower the bacterial intranet.

PubMed

Dendooven, Tom; Luisi, Ben F

2017-08-15

RNA acts not only as an information bearer in the biogenesis of proteins from genes, but also as a regulator that participates in the control of gene expression. In bacteria, small RNA molecules (sRNAs) play controlling roles in numerous processes and help to orchestrate complex regulatory networks. Such processes include cell growth and development, response to stress and metabolic change, transcription termination, cell-to-cell communication, and the launching of programmes for host invasion. All these processes require recognition of target messenger RNAs by the sRNAs. This review summarizes recent results that have provided insights into how bacterial sRNAs are recruited into effector ribonucleoprotein complexes that can seek out and act upon target transcripts. The results hint at how sRNAs and their protein partners act as pattern-matching search engines that efficaciously regulate gene expression, by performing with specificity and speed while avoiding off-target effects. The requirements for efficient searches of RNA patterns appear to be common to all domains of life. © 2017 The Author(s).

RNA search engines empower the bacterial intranet

PubMed Central

Dendooven, Tom

2017-01-01

RNA acts not only as an information bearer in the biogenesis of proteins from genes, but also as a regulator that participates in the control of gene expression. In bacteria, small RNA molecules (sRNAs) play controlling roles in numerous processes and help to orchestrate complex regulatory networks. Such processes include cell growth and development, response to stress and metabolic change, transcription termination, cell-to-cell communication, and the launching of programmes for host invasion. All these processes require recognition of target messenger RNAs by the sRNAs. This review summarizes recent results that have provided insights into how bacterial sRNAs are recruited into effector ribonucleoprotein complexes that can seek out and act upon target transcripts. The results hint at how sRNAs and their protein partners act as pattern-matching search engines that efficaciously regulate gene expression, by performing with specificity and speed while avoiding off-target effects. The requirements for efficient searches of RNA patterns appear to be common to all domains of life. PMID:28710287

Dissimilatory Metabolism of Nitrogen Oxides in Bacteria:Comparative Reconstruction of Transcriptional Networks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rodionov, Dmitry A.; Dubchak, Inna L.; Arkin, Adam P.

2005-09-01

Bacterial response to nitric oxide (NO) is of major importance since NO is an obligatory intermediate of the nitrogen cycle. Transcriptional regulation of the dissimilatory nitric oxides metabolism in bacteria is diverse and involves FNR-like transcription factors HcpR, DNR and NnrR, two-component systems NarXL and NarQP, NO-responsive activator NorR, and nitrite sensitive repressor NsrR. Using comparative genomics approaches we predict DNA-binding signals for these transcriptional factors and describe corresponding regulons in available bacterial genomes. Within the FNR family of regulators, we observed a correlation of two specificity-determining amino acids and contacting bases in corresponding DNA signal. Highly conserved regulon HcpRmore » for the hybrid cluster protein and some other redox enzymes is present in diverse anaerobic bacteria including Clostridia, Thermotogales and delta-proteobacteria. NnrR and DNR control denitrification in alpha- and beta-proteobacteria, respectively. Sigma-54-dependent NorR regulon found in some gamma- and beta-proteobacteria contains various enzymes involved in the NO detoxification. Repressor NsrR, which was previously known to control only nitrite reductase operon in Nitrosomonas spp., appears to be the master regulator of the nitric oxides metabolism not only in most gamma- and beta-proteobacteria (including well-studied species like Escherichia coli), but also in Gram-positive Bacillus and Streptomyces species. Positional analysis and comparison of regulatory regions of NO detoxification genes allows us to propose the candidate NsrR-binding signal. The most conserved member of the predicted NsrR regulon is the NO-detoxifying flavohemoglobin Hmp. In enterobacteria, the regulon includes also two nitrite-responsive loci, nipAB (hcp-hcr) and nipC(dnrN), thus confirming the identity of the effector, i.e., nitrite. The proposed NsrR regulons in Neisseria and some other species are extended to include denitrification genes. As

Numerical studies of bacterial-carpet microflows

NASA Astrophysics Data System (ADS)

Huber, Greg; Tillberg, Dan; Powers, Thomas R.

2004-03-01

Bacterial carpets are arrays of motile bacteria attached to two-dimensional surfaces. Improved understanding of carpet flows is important in the design of microfluidic devices and transport systems powered by bacterial flagellar motion. In recent experiments by the group of Howard Berg, cells of swarming S. marcescens are stuck to the surface, with most of their flagella free to rotate in the fluid. These studies show modified transport and greatly enhanced diffusion near the active carpet surface. We present theoretical models of the flagella-driven flow, bridging the nano- to the macro-scale, simulate the diffusion and advection of passive tracers, and compare the numerical results with the tracking data of Berg et al.

A network-based approach for resistance transmission in bacterial populations.

PubMed

Gehring, Ronette; Schumm, Phillip; Youssef, Mina; Scoglio, Caterina

2010-01-07

Horizontal transfer of mobile genetic elements (conjugation) is an important mechanism whereby resistance is spread through bacterial populations. The aim of our work is to develop a mathematical model that quantitatively describes this process, and to use this model to optimize antimicrobial dosage regimens to minimize resistance development. The bacterial population is conceptualized as a compartmental mathematical model to describe changes in susceptible, resistant, and transconjugant bacteria over time. This model is combined with a compartmental pharmacokinetic model to explore the effect of different plasma drug concentration profiles. An agent-based simulation tool is used to account for resistance transfer occurring when two bacteria are adjacent or in close proximity. In addition, a non-linear programming optimal control problem is introduced to minimize bacterial populations as well as the drug dose. Simulation and optimization results suggest that the rapid death of susceptible individuals in the population is pivotal in minimizing the number of transconjugants in a population. This supports the use of potent antimicrobials that rapidly kill susceptible individuals and development of dosage regimens that maintain effective antimicrobial drug concentrations for as long as needed to kill off the susceptible population. Suggestions are made for experiments to test the hypotheses generated by these simulations.

Transcriptome of American oysters, Crassostrea virginica, in response to bacterial challenge: insights into potential mechanisms of disease resistance.

PubMed

McDowell, Ian C; Nikapitiya, Chamilani; Aguiar, Derek; Lane, Christopher E; Istrail, Sorin; Gomez-Chiarri, Marta

2014-01-01

The American oyster Crassostrea virginica, an ecologically and economically important estuarine organism, can suffer high mortalities in areas in the Northeast United States due to Roseovarius Oyster Disease (ROD), caused by the gram-negative bacterial pathogen Roseovarius crassostreae. The goals of this research were to provide insights into: 1) the responses of American oysters to R. crassostreae, and 2) potential mechanisms of resistance or susceptibility to ROD. The responses of oysters to bacterial challenge were characterized by exposing oysters from ROD-resistant and susceptible families to R. crassostreae, followed by high-throughput sequencing of cDNA samples from various timepoints after disease challenge. Sequence data was assembled into a reference transcriptome and analyzed through differential gene expression and functional enrichment to uncover genes and processes potentially involved in responses to ROD in the American oyster. While susceptible oysters experienced constant levels of mortality when challenged with R. crassostreae, resistant oysters showed levels of mortality similar to non-challenged oysters. Oysters exposed to R. crassostreae showed differential expression of transcripts involved in immune recognition, signaling, protease inhibition, detoxification, and apoptosis. Transcripts involved in metabolism were enriched in susceptible oysters, suggesting that bacterial infection places a large metabolic demand on these oysters. Transcripts differentially expressed in resistant oysters in response to infection included the immune modulators IL-17 and arginase, as well as several genes involved in extracellular matrix remodeling. The identification of potential genes and processes responsible for defense against R. crassostreae in the American oyster provides insights into potential mechanisms of disease resistance.

Transcriptome of American Oysters, Crassostrea virginica, in Response to Bacterial Challenge: Insights into Potential Mechanisms of Disease Resistance

PubMed Central

McDowell, Ian C.; Nikapitiya, Chamilani; Aguiar, Derek; Lane, Christopher E.; Istrail, Sorin; Gomez-Chiarri, Marta

2014-01-01

The American oyster Crassostrea virginica, an ecologically and economically important estuarine organism, can suffer high mortalities in areas in the Northeast United States due to Roseovarius Oyster Disease (ROD), caused by the gram-negative bacterial pathogen Roseovarius crassostreae. The goals of this research were to provide insights into: 1) the responses of American oysters to R. crassostreae, and 2) potential mechanisms of resistance or susceptibility to ROD. The responses of oysters to bacterial challenge were characterized by exposing oysters from ROD-resistant and susceptible families to R. crassostreae, followed by high-throughput sequencing of cDNA samples from various timepoints after disease challenge. Sequence data was assembled into a reference transcriptome and analyzed through differential gene expression and functional enrichment to uncover genes and processes potentially involved in responses to ROD in the American oyster. While susceptible oysters experienced constant levels of mortality when challenged with R. crassostreae, resistant oysters showed levels of mortality similar to non-challenged oysters. Oysters exposed to R. crassostreae showed differential expression of transcripts involved in immune recognition, signaling, protease inhibition, detoxification, and apoptosis. Transcripts involved in metabolism were enriched in susceptible oysters, suggesting that bacterial infection places a large metabolic demand on these oysters. Transcripts differentially expressed in resistant oysters in response to infection included the immune modulators IL-17 and arginase, as well as several genes involved in extracellular matrix remodeling. The identification of potential genes and processes responsible for defense against R. crassostreae in the American oyster provides insights into potential mechanisms of disease resistance. PMID:25122115

Divergent transcription is associated with promoters of transcriptional regulators

PubMed Central

2013-01-01

Background Divergent transcription is a wide-spread phenomenon in mammals. For instance, short bidirectional transcripts are a hallmark of active promoters, while longer transcripts can be detected antisense from active genes in conditions where the RNA degradation machinery is inhibited. Moreover, many described long non-coding RNAs (lncRNAs) are transcribed antisense from coding gene promoters. However, the general significance of divergent lncRNA/mRNA gene pair transcription is still poorly understood. Here, we used strand-specific RNA-seq with high sequencing depth to thoroughly identify antisense transcripts from coding gene promoters in primary mouse tissues. Results We found that a substantial fraction of coding-gene promoters sustain divergent transcription of long non-coding RNA (lncRNA)/mRNA gene pairs. Strikingly, upstream antisense transcription is significantly associated with genes related to transcriptional regulation and development. Their promoters share several characteristics with those of transcriptional developmental genes, including very large CpG islands, high degree of conservation and epigenetic regulation in ES cells. In-depth analysis revealed a unique GC skew profile at these promoter regions, while the associated coding genes were found to have large first exons, two genomic features that might enforce bidirectional transcription. Finally, genes associated with antisense transcription harbor specific H3K79me2 epigenetic marking and RNA polymerase II enrichment profiles linked to an intensified rate of early transcriptional elongation. Conclusions We concluded that promoters of a class of transcription regulators are characterized by a specialized transcriptional control mechanism, which is directly coupled to relaxed bidirectional transcription. PMID:24365181

Computational design of RNA parts, devices, and transcripts with kinetic folding algorithms implemented on multiprocessor clusters.

PubMed

Thimmaiah, Tim; Voje, William E; Carothers, James M

2015-01-01

With progress toward inexpensive, large-scale DNA assembly, the demand for simulation tools that allow the rapid construction of synthetic biological devices with predictable behaviors continues to increase. By combining engineered transcript components, such as ribosome binding sites, transcriptional terminators, ligand-binding aptamers, catalytic ribozymes, and aptamer-controlled ribozymes (aptazymes), gene expression in bacteria can be fine-tuned, with many corollaries and applications in yeast and mammalian cells. The successful design of genetic constructs that implement these kinds of RNA-based control mechanisms requires modeling and analyzing kinetically determined co-transcriptional folding pathways. Transcript design methods using stochastic kinetic folding simulations to search spacer sequence libraries for motifs enabling the assembly of RNA component parts into static ribozyme- and dynamic aptazyme-regulated expression devices with quantitatively predictable functions (rREDs and aREDs, respectively) have been described (Carothers et al., Science 334:1716-1719, 2011). Here, we provide a detailed practical procedure for computational transcript design by illustrating a high throughput, multiprocessor approach for evaluating spacer sequences and generating functional rREDs. This chapter is written as a tutorial, complete with pseudo-code and step-by-step instructions for setting up a computational cluster with an Amazon, Inc. web server and performing the large numbers of kinefold-based stochastic kinetic co-transcriptional folding simulations needed to design functional rREDs and aREDs. The method described here should be broadly applicable for designing and analyzing a variety of synthetic RNA parts, devices and transcripts.

The α-Glucan Phosphorylase MalP of Corynebacterium glutamicum Is Subject to Transcriptional Regulation and Competitive Inhibition by ADP-Glucose

PubMed Central

Clermont, Lina; Macha, Arthur; Müller, Laura M.; Derya, Sami M.; von Zaluskowski, Philipp; Eck, Alexander; Eikmanns, Bernhard J.

2015-01-01

ABSTRACT α-Glucan phosphorylases contribute to degradation of glycogen and maltodextrins formed in the course of maltose metabolism in bacteria. Accordingly, bacterial α-glucan phosphorylases are classified as either glycogen or maltodextrin phosphorylase, GlgP or MalP, respectively. GlgP and MalP enzymes follow the same catalytic mechanism, and thus their substrate spectra overlap; however, they differ in their regulation: GlgP genes are constitutively expressed and the enzymes are controlled on the activity level, whereas expression of MalP genes are transcriptionally controlled in response to the carbon source used for cultivation. We characterize here the modes of control of the α-glucan phosphorylase MalP of the Gram-positive Corynebacterium glutamicum. In accordance to the proposed function of the malP gene product as MalP, we found transcription of malP to be regulated in response to the carbon source. Moreover, malP transcription is shown to depend on the growth phase and to occur independently of the cell glycogen content. Surprisingly, we also found MalP activity to be tightly regulated competitively by the presence of ADP-glucose, an intermediate of glycogen synthesis. Since the latter is considered a typical feature of GlgPs, we propose that C. glutamicum MalP acts as both maltodextrin and glycogen phosphorylase and, based on these findings, we question the current system for classification of bacterial α-glucan phosphorylases. IMPORTANCE Bacterial α-glucan phosphorylases have been classified conferring to their purpose as either glycogen or maltodextrin phosphorylases. We found transcription of malP in C. glutamicum to be regulated in response to the carbon source, which is recognized as typical for maltodextrin phosphorylases. Surprisingly, we also found MalP activity to be tightly regulated competitively by the presence of ADP-glucose, an intermediate of glycogen synthesis. The latter is considered a typical feature of GlgPs. These findings

Effects of long-term simulated martian conditions on a freeze-dried and homogenized bacterial permafrost community.

PubMed

Hansen, Aviaja A; Jensen, Lars L; Kristoffersen, Tommy; Mikkelsen, Karina; Merrison, Jonathan; Finster, Kai W; Lomstein, Bente Aa

2009-03-01

Indigenous bacteria and biomolecules (DNA and proteins) in a freeze-dried and homogenized Arctic permafrost were exposed to simulated martian conditions that correspond to about 80 days on the surface of Mars with respect to the accumulated UV dose. The simulation conditions included UV radiation, freeze-thaw cycles, the atmospheric gas composition, and pressure. The homogenized permafrost cores were subjected to repeated cycles of UV radiation for 3 h followed by 27 h without irradiation. The effects of the simulation conditions on the concentrations of biomolecules; numbers of viable, dead, and cultured bacteria; as well as the community structure were determined. Simulated martian conditions resulted in a significant reduction of the concentrations of DNA and amino acids in the uppermost 1.5 mm of the soil core. The total number of bacterial cells was reduced in the upper 9 mm of the soil core, while the number of viable cells was reduced in the upper 15 mm. The number of cultured aerobic bacteria was reduced in the upper 6 mm of the soil core, whereas the community structure of cultured anaerobic bacteria was relatively unaffected by the exposure conditions. As explanations for the observed changes, we propose three causes that might have been working on the biological material either individually or synergistically: (i) UV radiation, (ii) UV-generated reactive oxygen species, and (iii) freeze-thaw cycles. Currently, the production and action of reactive gases is only hypothetical and will be a central subject in future investigations. Overall, we conclude that in a stable environment (no wind-/pressure-induced mixing) biological material is efficiently shielded by a 2 cm thick layer of dust, while it is relatively rapidly destroyed in the surface layer, and that biomolecules like proteins and polynucleotides are more resistant to destruction than living biota.

Effects of Long-Term Simulated Martian Conditions on a Freeze-Dried and Homogenized Bacterial Permafrost Community

NASA Astrophysics Data System (ADS)

Hansen, Aviaja A.; Jenson, Lars L.; Kristoffersen, Tommy; Mikkelsen, Karina; Merrison, Jonathan; Finster, Kai W.; Lomstein, Bente Aa.

2009-03-01

Indigenous bacteria and biomolecules (DNA and proteins) in a freeze-dried and homogenized Arctic permafrost were exposed to simulated martian conditions that correspond to about 80 days on the surface of Mars with respect to the accumulated UV dose. The simulation conditions included UV radiation, freeze-thaw cycles, the atmospheric gas composition, and pressure. The homogenized permafrost cores were subjected to repeated cycles of UV radiation for 3 h followed by 27 h without irradiation. The effects of the simulation conditions on the concentrations of biomolecules; numbers of viable, dead, and cultured bacteria; as well as the community structure were determined. Simulated martian conditions resulted in a significant reduction of the concentrations of DNA and amino acids in the uppermost 1.5 mm of the soil core. The total number of bacterial cells was reduced in the upper 9 mm of the soil core, while the number of viable cells was reduced in the upper 15 mm. The number of cultured aerobic bacteria was reduced in the upper 6 mm of the soil core, whereas the community structure of cultured anaerobic bacteria was relatively unaffected by the exposure conditions. As explanations for the observed changes, we propose three causes that might have been working on the biological material either individually or synergistically: (i) UV radiation, (ii) UV-generated reactive oxygen species, and (iii) freeze-thaw cycles. Currently, the production and action of reactive gases is only hypothetical and will be a central subject in future investigations. Overall, we conclude that in a stable environment (no wind-/pressure-induced mixing) biological material is efficiently shielded by a 2 cm thick layer of dust, while it is relatively rapidly destroyed in the surface layer, and that biomolecules like proteins and polynucleotides are more resistant to destruction than living biota.

Inactivation of Transcriptional Regulators during Within-Household Evolution of Escherichia coli.

PubMed

Kisiela, Dagmara I; Radey, Matthew; Paul, Sandip; Porter, Stephen; Polukhina, Kseniya; Tchesnokova, Veronika; Shevchenko, Sofiya; Chan, Diana; Aziz, Maliha; Johnson, Timothy J; Price, Lance B; Johnson, James R; Sokurenko, Evgeni V

2017-07-01

We analyzed the within-household evolution of two household-associated Escherichia coli strains from pandemic clonal group ST131- H 30, using isolates recovered from five individuals within two families, each of which had a distinct strain. Family 1's strain was represented by a urine isolate from the index patient (older sister) with recurrent cystitis and a blood isolate from her younger sister with fatal urosepsis. Family 2's strain was represented by a urine isolate from the index patient (father) with pyelonephritis and renal abscesses, blood and kidney drainage isolates from the daughter with emphysematous pyelonephritis, and urine and fecal isolates from the mother with cystitis. Collectively, the several variants of each family's strain had accumulated a total of 8 (family 1) and 39 (family 2) point mutations; no two isolates were identical. Of the 47 total mutations, 36 resulted in amino acid changes or truncation of coded proteins. Fourteen such mutations (39%) targeted genes encoding transcriptional regulators, and 9 (25%) involved DNA-binding transcription factors (TFs), which significantly exceeded the relative contribution of TF genes to the isolates' genomes (∼6%). At least one-half of the transcriptional regulator mutations were inactivating, based on phenotypic and/or transcriptional analysis. In particular, inactivating mutations in the global regulator LrhA (repressor of type 1 fimbriae and flagella) occurred in the blood isolates from both households and increased the virulence of E. coli strains in a murine sepsis model. The results indicate that E. coli undergoes adaptive evolution between and/or within hosts, generating subpopulations with distinctive phenotypes and virulence potential. IMPORTANCE The clonal evolution of bacterial strains associated with interhost transmission is poorly understood. We characterized the genome sequences of clonal descendants of two Escherichia coli strains, recovered at different time points from multiple

Shrimp Alpha-2-Macroglobulin Prevents the Bacterial Escape by Inhibiting Fibrinolysis of Blood Clots

PubMed Central

Chaikeeratisak, Vorrapon; Somboonwiwat, Kunlaya; Tassanakajon, Anchalee

2012-01-01

Proteomic analysis of the hemocytic proteins of Penaeus monodon (Pm) has previously shown that alpha-2-macroglobulin (A2M) was among the proteins that showed substantially altered expression levels upon Vibrio harveyi infection. Therefore, in this study its potentially important role in the response of shrimp to bacterial infection was further characterized. The yeast two-hybrid system revealed that the receptor binding domain of PmA2M interacted with the carboxyl-terminus of one or both of the transglutaminase type II isoforms, which are key enzymes involved in the shrimp clotting system. In accord with this, PmA2M was found to be localized on the extracellular blood clots and to colocalize with clottable proteins. RNA interference (RNAi)-mediated knockdown of A2M transcript levels reduced the PmA2M transcript levels (∼94%) and significantly reduced the bacterial seizing ability of the clotting system, resulting in an up to 3.3-fold higher number of V. harveyi that systemically disseminated into the circulatory system at 5 min post-infection before subsequent clearance by the immune system. Furthermore, an appearance of PmA2M depleted clots in the presence of V. harveyi strikingly demonstrated fibrinolysis zones surrounding the bacteria. This study provides the first evidence of the vital role of PmA2M in enhancing bacterial sequestration by protecting blood clots against fibrinolysis. PMID:23082160

Selective recognition of N4-methylcytosine in DNA by engineered transcription-activator-like effectors.

PubMed

Rathi, Preeti; Maurer, Sara; Summerer, Daniel

2018-06-05

The epigenetic DNA nucleobases 5-methylcytosine (5mC) and N 4-methylcytosine (4mC) coexist in bacterial genomes and have important functions in host defence and transcription regulation. To better understand the individual biological roles of both methylated nucleobases, analytical strategies for distinguishing unmodified cytosine (C) from 4mC and 5mC are required. Transcription-activator-like effectors (TALEs) are programmable DNA-binding repeat proteins, which can be re-engineered for the direct detection of epigenetic nucleobases in user-defined DNA sequences. We here report the natural, cytosine-binding TALE repeat to not strongly differentiate between 5mC and 4mC. To engineer repeats with selectivity in the context of C, 5mC and 4mC, we developed a homogeneous fluorescence assay and screened a library of size-reduced TALE repeats for binding to all three nucleobases. This provided insights into the requirements of size-reduced TALE repeats for 4mC binding and revealed a single mutant repeat as a selective binder of 4mC. Employment of a TALE with this repeat in affinity enrichment enabled the isolation of a user-defined DNA sequence containing a single 4mC but not C or 5mC from the background of a bacterial genome. Comparative enrichments with TALEs bearing this or the natural C-binding repeat provides an approach for the complete, programmable decoding of all cytosine nucleobases found in bacterial genomes.This article is part of a discussion meeting issue 'Frontiers in epigenetic chemical biology'. © 2018 The Author(s).

TSSer: an automated method to identify transcription start sites in prokaryotic genomes from differential RNA sequencing data.

PubMed

Jorjani, Hadi; Zavolan, Mihaela

2014-04-01

Accurate identification of transcription start sites (TSSs) is an essential step in the analysis of transcription regulatory networks. In higher eukaryotes, the capped analysis of gene expression technology enabled comprehensive annotation of TSSs in genomes such as those of mice and humans. In bacteria, an equivalent approach, termed differential RNA sequencing (dRNA-seq), has recently been proposed, but the application of this approach to a large number of genomes is hindered by the paucity of computational analysis methods. With few exceptions, when the method has been used, annotation of TSSs has been largely done manually. In this work, we present a computational method called 'TSSer' that enables the automatic inference of TSSs from dRNA-seq data. The method rests on a probabilistic framework for identifying both genomic positions that are preferentially enriched in the dRNA-seq data as well as preferentially captured relative to neighboring genomic regions. Evaluating our approach for TSS calling on several publicly available datasets, we find that TSSer achieves high consistency with the curated lists of annotated TSSs, but identifies many additional TSSs. Therefore, TSSer can accelerate genome-wide identification of TSSs in bacterial genomes and can aid in further characterization of bacterial transcription regulatory networks. TSSer is freely available under GPL license at http://www.clipz.unibas.ch/TSSer/index.php

Mutations in the sigma subunit of E. coli RNA polymerase which affect positive control of transcription.

PubMed

Hu, J C; Gross, C A

1985-01-01

The sigma subunits of bacterial RNA polymerases are required for the selective initiation of transcription. We have isolated and characterized mutations in rpoD, the gene which encodes the major form of sigma in E. coli, which affect the selectivity of transcription. These mutations increase the expression of araBAD up to 12-fold in the absence of CAP-cAMP. Expression of lac is unaffected, while expression of malT-activated operons is decreased. We determined the DNA sequence of 17 independently isolated mutations, and found that they consist of three different changes in a single CGC arginine codon at position 596 in the sigma polypeptide.

Pausing controls branching between productive and non-productive pathways during initial transcription in bacteria.

PubMed

Dulin, David; Bauer, David L V; Malinen, Anssi M; Bakermans, Jacob J W; Kaller, Martin; Morichaud, Zakia; Petushkov, Ivan; Depken, Martin; Brodolin, Konstantin; Kulbachinskiy, Andrey; Kapanidis, Achillefs N

2018-04-16

Transcription in bacteria is controlled by multiple molecular mechanisms that precisely regulate gene expression. It has been recently shown that initial RNA synthesis by the bacterial RNA polymerase (RNAP) is interrupted by pauses; however, the pausing determinants and the relationship of pausing with productive and abortive RNA synthesis remain poorly understood. Using single-molecule FRET and biochemical analysis, here we show that the pause encountered by RNAP after the synthesis of a 6-nt RNA (ITC6) renders the promoter escape strongly dependent on the NTP concentration. Mechanistically, the paused ITC6 acts as a checkpoint that directs RNAP to one of three competing pathways: productive transcription, abortive RNA release, or a new unscrunching/scrunching pathway. The cyclic unscrunching/scrunching of the promoter generates a long-lived, RNA-bound paused state; the abortive RNA release and DNA unscrunching are thus not as tightly linked as previously thought. Finally, our new model couples the pausing with the abortive and productive outcomes of initial transcription.

Genome-wide analysis of alternative splicing during dendritic cell response to a bacterial challenge.

PubMed

Rodrigues, Raquel; Grosso, Ana Rita; Moita, Luís

2013-01-01

The immune system relies on the plasticity of its components to produce appropriate responses to frequent environmental challenges. Dendritic cells (DCs) are critical initiators of innate immunity and orchestrate the later and more specific adaptive immunity. The generation of diversity in transcriptional programs is central for effective immune responses. Alternative splicing is widely considered a key generator of transcriptional and proteomic complexity, but its role has been rarely addressed systematically in immune cells. Here we used splicing-sensitive arrays to assess genome-wide gene- and exon-level expression profiles in human DCs in response to a bacterial challenge. We find widespread alternative splicing events and splicing factor transcriptional signatures induced by an E. coli challenge to human DCs. Alternative splicing acts in concert with transcriptional modulation, but these two mechanisms of gene regulation affect primarily distinct functional gene groups. Alternative splicing is likely to have an important role in DC immunobiology because it affects genes known to be involved in DC development, endocytosis, antigen presentation and cell cycle arrest.

Exploring the Mode of Action of Bioactive Compounds by Microfluidic Transcriptional Profiling in Mycobacteria

PubMed Central

Lim, Vivian; Naim, Ahmad Nazri Mohamed; Bifani, Pablo; Boshoff, Helena I. M.; Sambandamurthy, Vasan K.; Dick, Thomas; Hibberd, Martin L.; Schreiber, Mark; Rao, Srinivasa P. S.

2013-01-01

Most candidate anti-bacterials are identified on the basis of their whole cell anti-bacterial activity. A critical bottleneck in the early discovery of novel anti-bacterials is tracking the structure activity relationship (SAR) of the novel compounds synthesized during the hit to lead and lead optimization stage. It is often very difficult for medicinal chemists to visualize if the novel compounds synthesized for understanding SAR of a particular scaffold have similar molecular mechanism of action (MoA) as that of the initial hit. The elucidation of the molecular MoA of bioactive inhibitors is critical. Here, a new strategy and routine assay for MoA de-convolution, using a microfluidic platform for transcriptional profiling of bacterial response to inhibitors with whole cell activity has been presented. First a reference transcriptome compendium of Mycobacterial response to various clinical and investigational drugs was built. Using feature reduction, it was demonstrated that subsets of biomarker genes representative of the whole genome are sufficient for MoA classification and deconvolution in a medium-throughput microfluidic format ultimately leading to a cost effective and rapid tool for routine antibacterial drug-discovery programs. PMID:23935951

Atypical archaeal tRNA pyrrolysine transcript behaves towards EF-Tu as a typical elongator tRNA

PubMed Central

Théobald-Dietrich, Anne; Frugier, Magali; Giegé, Richard; Rudinger-Thirion, Joëlle

2004-01-01

The newly discovered tRNAPyl is involved in specific incorporation of pyrrolysine in the active site of methylamine methyltransferases in the archaeon Methanosarcina barkeri. In solution probing experiments, a transcript derived from tRNAPyl displays a secondary fold slightly different from the canonical cloverleaf and interestingly similar to that of bovine mitochondrial tRNASer(uga). Aminoacylation of tRNAPyl transcript by a typical class II synthetase, LysRS from yeast, was possible when its amber anticodon CUA was mutated into a lysine UUU anticodon. Hydrolysis protection assays show that lysylated tRNAPyl can be recognized by bacterial elongation factor. This indicates that no antideterminant sequence is present in the body of the tRNAPyl transcript to prevent it from interacting with EF-Tu, in contrast with the otherwise functionally similar tRNASec that mediates selenocysteine incorporation. PMID:14872064

Comparative genomics of transcriptional regulation of methionine metabolism in proteobacteria

DOE PAGES

Leyn, Semen A.; Suvorova, Inna A.; Kholina, Tatiana D.; ...

2014-11-20

Methionine metabolism and uptake genes in Proteobacteria are controlled by a variety of RNA and DNA regulatory systems. We have applied comparative genomics to reconstruct regulons for three known transcription factors, MetJ, MetR, and SahR, and three known riboswitch motifs, SAH, SAM-SAH, and SAM_alpha, in ~200 genomes from 22 taxonomic groups of Proteobacteria. We also identified two novel regulons: a SahR-like transcription factor SamR controlling various methionine biosynthesis genes in the Xanthomonadales group, and a potential RNA regulatory element with terminator-antiterminator mechanism controlling the metX or metZ genes in beta-proteobacteria. For each analyzed regulator we identified the core, taxon-specific andmore » genome-specific regulon members. By analyzing the distribution of these regulators in bacterial genomes and by comparing their regulon contents we elucidated possible evolutionary scenarios for the regulation of the methionine metabolism genes in Proteobacteria.« less

Bacterial virulence effectors and their activities.

PubMed

Hann, Dagmar R; Gimenez-Ibanez, Selena; Rathjen, John P

2010-08-01

The major virulence strategy for plant pathogenic bacteria is deployment of effector molecules within the host cytoplasm. Each bacterial strain possesses a set of 20-30 effectors which have overlapping activities, are functionally interchangeable, and diverge in composition between strains. Effectors target host molecules to suppress immunity. Two main strategies are apparent. Effectors that target host proteins seem to attack conserved structural domains but otherwise lack specificity. On the other hand, those that influence host gene transcription directly do so with extreme specificity. In both cases, examples are known where the host has exploited effector-target affinities to establish immune recognition of effectors. The molecular activity of each effector links virulence and immune outcomes. Copyright 2010 Elsevier Ltd. All rights reserved.

The simulated silicification of bacteria--new clues to the modes and timing of bacterial preservation and implications for the search for extraterrestrial microfossils.

PubMed

Toporski, Jan K W; Steele, Andrew; Westall, Frances; Thomas-Keprta, Kathie L; McKay, David S

2002-01-01

Evidence of microbial life on Earth has been found in siliceous rock formations throughout the geological and fossil record. To understand the mechanisms of silicification and thus improve our search patterns for evidence of fossil microbial life in rocks, a series of controlled laboratory experiments were designed to simulate the silicification of microorganisms. The bacterial strains Pseudomonas fluorescens and Desulphovibrio indonensis were exposed to silicifying media. The experiments were designed to determine how exposure time to silicifying solutions and to silicifying solutions of different Si concentration affect the fossilization of microbial biofilms. The silicified biofilms were analyzed using transmission electron microscopy (TEM) in combination with energy-dispersive spectroscopy. Both bacterial species showed evidence of silicification after 24 h in 1,000 ppm silica solution, although D. indonensis was less prone to silicification. The degree of silicification of individual cells of the same sample varied, though such variations decreased with increasing exposure time. High Si concentration resulted in better preservation of cellular detail; the Si concentration was more important than the duration in Si solution. Even though no evidence of amorphous silica precipitation was observed, bacterial cells became permineralized. High-resolution TEM analysis revealed nanometer-sized crystallites characterized by lattice fringe-spacings that match the (10-11) d-spacing of quartz formed within bacterial cell walls after 1 week in 5,000 ppm silica solution. The mechanisms of silicification under controlled laboratory conditions and the implication for silicification in natural environments are discussed, along with the relevance of our findings in the search for early life on Earth and extraterrestrial life.

A new regulatory mechanism for bacterial lipoic acid synthesis

PubMed Central

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-01

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

A new regulatory mechanism for bacterial lipoic acid synthesis.

PubMed

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-22

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

The Csr system regulates genome-wide mRNA stability and transcription and thus gene expression in Escherichia coli.

PubMed

Esquerré, Thomas; Bouvier, Marie; Turlan, Catherine; Carpousis, Agamemnon J; Girbal, Laurence; Cocaign-Bousquet, Muriel

2016-04-26

Bacterial adaptation requires large-scale regulation of gene expression. We have performed a genome-wide analysis of the Csr system, which regulates many important cellular functions. The Csr system is involved in post-transcriptional regulation, but a role in transcriptional regulation has also been suggested. Two proteins, an RNA-binding protein CsrA and an atypical signaling protein CsrD, participate in the Csr system. Genome-wide transcript stabilities and levels were compared in wildtype E. coli (MG1655) and isogenic mutant strains deficient in CsrA or CsrD activity demonstrating for the first time that CsrA and CsrD are global negative and positive regulators of transcription, respectively. The role of CsrA in transcription regulation may be indirect due to the 4.6-fold increase in csrD mRNA concentration in the CsrA deficient strain. Transcriptional action of CsrA and CsrD on a few genes was validated by transcriptional fusions. In addition to an effect on transcription, CsrA stabilizes thousands of mRNAs. This is the first demonstration that CsrA is a global positive regulator of mRNA stability. For one hundred genes, we predict that direct control of mRNA stability by CsrA might contribute to metabolic adaptation by regulating expression of genes involved in carbon metabolism and transport independently of transcriptional regulation.

Accurate RNA consensus sequencing for high-fidelity detection of transcriptional mutagenesis-induced epimutations.

PubMed

Reid-Bayliss, Kate S; Loeb, Lawrence A

2017-08-29

Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.

Competition for space during bacterial colonization of a surface.

PubMed

Lloyd, Diarmuid P; Allen, Rosalind J

2015-09-06

Competition for space is ubiquitous in the ecology of both microorganisms and macro-organisms. We introduce a bacterial model system in which the factors influencing competition for space during colonization of an initially empty habitat can be tracked directly. Using fluorescence microscopy, we follow the fate of individual Escherichia coli bacterial cell lineages as they undergo expansion competition (the race to be the first to colonize a previously empty territory), and as they later compete at boundaries between clonal territories. Our experiments are complemented by computer simulations of a lattice-based model. We find that both expansion competition, manifested as differences in individual cell lag times, and boundary competition, manifested as effects of neighbour cell geometry, can play a role in colonization success, particularly when lineages expand exponentially. This work provides a baseline for investigating how ecological interactions affect colonization of space by bacterial populations, and highlights the potential of bacterial model systems for the testing and development of ecological theory. © 2015 The Authors.

Competition for space during bacterial colonization of a surface

PubMed Central

Lloyd, Diarmuid P.; Allen, Rosalind J.

2015-01-01

Competition for space is ubiquitous in the ecology of both microorganisms and macro-organisms. We introduce a bacterial model system in which the factors influencing competition for space during colonization of an initially empty habitat can be tracked directly. Using fluorescence microscopy, we follow the fate of individual Escherichia coli bacterial cell lineages as they undergo expansion competition (the race to be the first to colonize a previously empty territory), and as they later compete at boundaries between clonal territories. Our experiments are complemented by computer simulations of a lattice-based model. We find that both expansion competition, manifested as differences in individual cell lag times, and boundary competition, manifested as effects of neighbour cell geometry, can play a role in colonization success, particularly when lineages expand exponentially. This work provides a baseline for investigating how ecological interactions affect colonization of space by bacterial populations, and highlights the potential of bacterial model systems for the testing and development of ecological theory. PMID:26333814

Exposure to West Nile Virus Increases Bacterial Diversity and Immune Gene Expression in Culex pipiens.

PubMed

Zink, Steven D; Van Slyke, Greta A; Palumbo, Michael J; Kramer, Laura D; Ciota, Alexander T

2015-10-27

Complex interactions between microbial residents of mosquitoes and arboviruses are likely to influence many aspects of vectorial capacity and could potentially have profound effects on patterns of arbovirus transmission. Such interactions have not been well studied for West Nile virus (WNV; Flaviviridae, Flavivirus) and Culex spp. mosquitoes. We utilized next-generation sequencing of 16S ribosomal RNA bacterial genes derived from Culex pipiens Linnaeus following WNV exposure and/or infection and compared bacterial populations and broad immune responses to unexposed mosquitoes. Our results demonstrate that WNV infection increases the diversity of bacterial populations and is associated with up-regulation of classical invertebrate immune pathways including RNA interference (RNAi), Toll, and Jak-STAT (Janus kinase-Signal Transducer and Activator of Transcription). In addition, WNV exposure alone, without the establishment of infection, results in similar alterations to microbial and immune signatures, although to a lesser extent. Multiple bacterial genera were found in greater abundance inWNV-exposed and/or infected mosquitoes, yet the most consistent and notable was the genus Serratia.

Combinatorial Effects of the Glucocorticoid Receptor and Krüppel-Like Transcription Factor 15 on Bovine Herpesvirus 1 Transcription and Productive Infection.

PubMed

El-Mayet, Fouad S; Sawant, Laximan; Thunuguntla, Prasanth; Jones, Clinton

2017-11-01

respiratory disease and suppresses immune responses in cattle; consequently, life-threatening bacterial pneumonia can occur. Following acute infection, BoHV-1 establishes lifelong latency in sensory neurons. Reactivation from latency is initiated by the synthetic corticosteroid dexamethasone. Dexamethasone stimulates lytic cycle viral gene expression in sensory neurons of calves latently infected with BoHV-1, culminating in virus shedding and transmission. Two stress-induced cellular transcription factors, Krüppel-like transcription factor 15 (KLF15) and the glucocorticoid receptor (GR), cooperate to stimulate productive infection and viral transcription. Additional studies demonstrated that KLF15 and the GR form a stable complex and that these stress-induced transcription factors bind to viral DNA sequences, which correlates with transcriptional activation. The ability of the GR and KLF15 to synergistically stimulate viral gene expression and productive infection may be critical for the ability of BoHV-1 to reactivate from latency following stressful stimuli. Copyright © 2017 American Society for Microbiology.

Combinatorial Effects of the Glucocorticoid Receptor and Krüppel-Like Transcription Factor 15 on Bovine Herpesvirus 1 Transcription and Productive Infection

PubMed Central

El-mayet, Fouad S.; Sawant, Laximan; Thunuguntla, Prasanth

2017-01-01

causes respiratory disease and suppresses immune responses in cattle; consequently, life-threatening bacterial pneumonia can occur. Following acute infection, BoHV-1 establishes lifelong latency in sensory neurons. Reactivation from latency is initiated by the synthetic corticosteroid dexamethasone. Dexamethasone stimulates lytic cycle viral gene expression in sensory neurons of calves latently infected with BoHV-1, culminating in virus shedding and transmission. Two stress-induced cellular transcription factors, Krüppel-like transcription factor 15 (KLF15) and the glucocorticoid receptor (GR), cooperate to stimulate productive infection and viral transcription. Additional studies demonstrated that KLF15 and the GR form a stable complex and that these stress-induced transcription factors bind to viral DNA sequences, which correlates with transcriptional activation. The ability of the GR and KLF15 to synergistically stimulate viral gene expression and productive infection may be critical for the ability of BoHV-1 to reactivate from latency following stressful stimuli. PMID:28794031

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

PubMed

Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

2011-10-07

Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

Rapid and Sensitive Salmonella Typhi Detection in Blood and Fecal Samples Using Reverse Transcription Loop-Mediated Isothermal Amplification.

PubMed

Fan, Fenxia; Yan, Meiying; Du, Pengcheng; Chen, Chen; Kan, Biao

2015-09-01

Typhoid fever caused by Salmonella enterica serovar Typhi remains a significant public health problem in developing countries. Although the main method for diagnosing typhoid fever is blood culture, the test is time consuming and not always able to detect infections. Thus, it is very difficult to distinguish typhoid from other infections in patients with nonspecific symptoms. A simple and sensitive laboratory detection method remains necessary. The purpose of this study is to establish and evaluate a rapid and sensitive reverse transcription-based loop-mediated isothermal amplification (RT-LAMP) method to detect Salmonella Typhi infection. In this study, a new specific gene marker, STY1607, was selected to develop a STY1607-RT-LAMP assay; this is the first report of specific RT-LAMP detection assay for typhoid. Human-simulated and clinical blood/stool samples were used to evaluate the performance of STY1607-RT-LAMP for RNA detection; this method was compared with STY1607-LAMP, reverse transcription real-time polymerase chain reaction (rRT-PCR), and bacterial culture methods for Salmonella Typhi detection. Using mRNA as the template, STY1607-RT-LAMP exhibited 50-fold greater sensitivity than STY1607-LAMP for DNA detection. The STY1607-RT-LAMP detection limit is 3 colony-forming units (CFU)/mL for both the pure Salmonella Typhi samples and Salmonella Typhi-simulated blood samples and was 30 CFU/g for the simulated stool samples, all of which were 10-fold more sensitive than the rRT-PCR method. RT-LAMP exhibited improved Salmonella Typhi detection sensitivity compared to culture methods and to rRT-PCR of clinical blood and stool specimens from suspected typhoid fever patients. Because it can be performed without sophisticated equipment or skilled personnel, RT-LAMP is a valuable tool for clinical laboratories in developing countries. This method can be applied in the clinical diagnosis and care of typhoid fever patients as well as for a quick public health response.

Phosphorylation of Trihelix Transcriptional Repressor ASR3 by MAP KINASE4 Negatively Regulates Arabidopsis Immunity

PubMed Central

Li, Bo; Jiang, Shan; Yu, Xiao; Cheng, Cheng; Chen, Sixue; Cheng, Yanbing; Yuan, Joshua S.; Jiang, Daohong; He, Ping; Shan, Libo

2015-01-01

Proper control of immune-related gene expression is crucial for the host to launch an effective defense response. Perception of microbe-associated molecular patterns (MAMPs) induces rapid and profound transcriptional reprogramming via unclear mechanisms. Here, we show that ASR3 (ARABIDOPSIS SH4-RELATED3) functions as a transcriptional repressor and plays a negative role in regulating pattern-triggered immunity (PTI) in Arabidopsis thaliana. ASR3 belongs to a plant-specific trihelix transcription factor family for which functional studies are lacking. MAMP treatments induce rapid phosphorylation of ASR3 at threonine 189 via MPK4, a mitogen-activated protein kinase that negatively regulates PTI responses downstream of multiple MAMP receptors. ASR3 possesses transcriptional repressor activity via its ERF-associated amphiphilic repression motifs and negatively regulates a large subset of flg22-induced genes. Phosphorylation of ASR3 by MPK4 enhances its DNA binding activity to suppress gene expression. Importantly, the asr3 mutant shows enhanced disease resistance to virulent bacterial pathogen infection, whereas transgenic plants overexpressing the wild-type or phospho-mimetic form of ASR3 exhibit compromised PTI responses. Our studies reveal a function of the trihelix transcription factors in plant innate immunity and provide evidence that ASR3 functions as a transcriptional repressor regulated by MAMP-activated MPK4 to fine-tune plant immune gene expression. PMID:25770109

Live-cell superresolution microscopy reveals the organization of RNA polymerase in the bacterial nucleoid

PubMed Central

Stracy, Mathew; Lesterlin, Christian; Garza de Leon, Federico; Uphoff, Stephan; Zawadzki, Pawel; Kapanidis, Achillefs N.

2015-01-01

Despite the fundamental importance of transcription, a comprehensive analysis of RNA polymerase (RNAP) behavior and its role in the nucleoid organization in vivo is lacking. Here, we used superresolution microscopy to study the localization and dynamics of the transcription machinery and DNA in live bacterial cells, at both the single-molecule and the population level. We used photoactivated single-molecule tracking to discriminate between mobile RNAPs and RNAPs specifically bound to DNA, either on promoters or transcribed genes. Mobile RNAPs can explore the whole nucleoid while searching for promoters, and spend 85% of their search time in nonspecific interactions with DNA. On the other hand, the distribution of specifically bound RNAPs shows that low levels of transcription can occur throughout the nucleoid. Further, clustering analysis and 3D structured illumination microscopy (SIM) show that dense clusters of transcribing RNAPs form almost exclusively at the nucleoid periphery. Treatment with rifampicin shows that active transcription is necessary for maintaining this spatial organization. In faster growth conditions, the fraction of transcribing RNAPs increases, as well as their clustering. Under these conditions, we observed dramatic phase separation between the densest clusters of RNAPs and the densest regions of the nucleoid. These findings show that transcription can cause spatial reorganization of the nucleoid, with movement of gene loci out of the bulk of DNA as levels of transcription increase. This work provides a global view of the organization of RNA polymerase and transcription in living cells. PMID:26224838

Structures of RNA Polymerase Closed and Intermediate Complexes Reveal Mechanisms of DNA Opening and Transcription Initiation.

PubMed

Glyde, Robert; Ye, Fuzhou; Darbari, Vidya Chandran; Zhang, Nan; Buck, Martin; Zhang, Xiaodong

2017-07-06

Gene transcription is carried out by RNA polymerases (RNAPs). For transcription to occur, the closed promoter complex (RPc), where DNA is double stranded, must isomerize into an open promoter complex (RPo), where the DNA is melted out into a transcription bubble and the single-stranded template DNA is delivered to the RNAP active site. Using a bacterial RNAP containing the alternative σ 54 factor and cryoelectron microscopy, we determined structures of RPc and the activator-bound intermediate complex en route to RPo at 3.8 and 5.8 Å. Our structures show how RNAP-σ 54 interacts with promoter DNA to initiate the DNA distortions required for transcription bubble formation, and how the activator interacts with RPc, leading to significant conformational changes in RNAP and σ 54 that promote RPo formation. We propose that DNA melting is an active process initiated in RPc and that the RNAP conformations of intermediates are significantly different from that of RPc and RPo. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Molecular cloning, transcriptional profiling, and subcellular localization of signal transducer and activator of transcription 2 (STAT2) ortholog from rock bream, Oplegnathus fasciatus.

PubMed

Bathige, S D N K; Umasuthan, Navaneethaiyer; Priyathilaka, Thanthrige Thiunuwan; Thulasitha, William Shanthakumar; Jayasinghe, J D H E; Wan, Qiang; Nam, Bo-Hye; Lee, Jehee

2017-08-30

Signal transducer and activator of transcription 2 (STAT2) is a key element that transduces signals from the cell membrane to the nucleus via the type I interferon-signaling pathway. Although the structural and functional aspects of STAT proteins are well studied in mammals, information on teleostean STATs is very limited. In this study, a STAT paralog, which is highly homologous to the STAT2 members, was identified from a commercially important fish species called rock bream and designated as RbSTAT2. The RbSTAT2 gene was characterized at complementary DNA (cDNA) and genomic sequence levels, and was found to possess structural features common with its mammalian counterparts. The complete cDNA sequence was distributed into 24 exons in the genomic sequence. The promoter proximal region was analyzed and found to contain potential transcription factor binding sites to regulate the transcription of RbSTAT2. Phylogenetic studies and comparative genomic structure organization revealed the distinguishable evolution for fish and other vertebrate STAT2 orthologs. Transcriptional quantification was performed by SYBR Green quantitative real-time PCR (qPCR) and the ubiquitous expression of RbSTAT2 transcripts was observed in all tissues analyzed from healthy fish, with a remarkably high expression in blood cells. Significantly (P<0.05) altered transcription of RbSTAT2 was detected after immune challenge experiments with viral (rock bream irido virus; RBIV), bacterial (Edwardsiella tarda and Streptococcus iniae), and immune stimulants (poly I:C and LPS). Antiviral potential was further confirmed by WST-1 assay, by measuring the viability of rock bream heart cells treated with RBIV. In addition, results of an in vitro challenge experiment signified the influence of rock bream interleukin-10 (RbIL-10) on transcription of RbSTAT2. Subcellular localization studies by transfection of pEGFP-N1/RbSTAT2 into rock bream heart cells revealed that the RbSTAT2 was usually located in the

Acute Sleep Deprivation Enhances Post-Infection Sleep and Promotes Survival during Bacterial Infection in Drosophila

PubMed Central

Kuo, Tzu-Hsing; Williams, Julie A.

2014-01-01

Study Objectives: Sleep is known to increase as an acute response to infection. However, the function of this behavioral response in host defense is not well understood. To address this problem, we evaluated the effect of acute sleep deprivation on post-infection sleep and immune function in Drosophila. Setting: Laboratory. Participants: Drosophila melanogaster. Methods and Results: Flies were subjected to sleep deprivation before (early DEP) or after (late DEP) bacterial infection. Relative to a non-deprived control, flies subjected to early DEP had enhanced sleep after infection as well as increased bacterial clearance and survival outcome. Flies subjected to late DEP experienced enhanced sleep following the deprivation period, and showed a modest improvement in survival outcome. Continuous DEP (early and late DEP) throughout infection also enhanced sleep later during infection and improved survival. However, improved survival in flies subjected to late or continuous DEP did not occur until after flies had experienced sleep. During infection, both early and late DEP enhanced NFκB transcriptional activity as measured by a luciferase reporter (κB-luc) in living flies. Early DEP also increased NFκB activity prior to infection. Flies that were deficient in expression of either the Relish or Dif NFκB transcription factors showed normal responses to early DEP. However, the effect of early DEP on post-infection sleep and survival was abolished in double mutants, which indicates that Relish and Dif have redundant roles in this process. Conclusions: Acute sleep deprivation elevated NFκB-dependent activity, increased post-infection sleep, and improved survival during bacterial infection. Citation: Kuo TH, Williams JA. Acute sleep deprivation enhances post-infection sleep and promotes survival during bacterial infection in Drosophila. SLEEP 2014;37(5):859-869. PMID:24790264

Global Transcriptional Responses to Osmotic, Oxidative, and Imipenem Stress Conditions in Pseudomonas putida.

PubMed

Bojanovič, Klara; D'Arrigo, Isotta; Long, Katherine S

2017-04-01

Bacteria cope with and adapt to stress by modulating gene expression in response to specific environmental cues. In this study, the transcriptional response of Pseudomonas putida KT2440 to osmotic, oxidative, and imipenem stress conditions at two time points was investigated via identification of differentially expressed mRNAs and small RNAs (sRNAs). A total of 440 sRNA transcripts were detected, of which 10% correspond to previously annotated sRNAs, 40% to novel intergenic transcripts, and 50% to novel transcripts antisense to annotated genes. Each stress elicits a unique response as far as the extent and dynamics of the transcriptional changes. Nearly 200 protein-encoding genes exhibited significant changes in all stress types, implicating their participation in a general stress response. Almost half of the sRNA transcripts were differentially expressed under at least one condition, suggesting possible functional roles in the cellular response to stress conditions. The data show a larger fraction of differentially expressed sRNAs than of mRNAs with >5-fold expression changes. The work provides detailed insights into the mechanisms through which P. putida responds to different stress conditions and increases understanding of bacterial adaptation in natural and industrial settings. IMPORTANCE This study maps the complete transcriptional response of P. putida KT2440 to osmotic, oxidative, and imipenem stress conditions at short and long exposure times. Over 400 sRNA transcripts, consisting of both intergenic and antisense transcripts, were detected, increasing the number of identified sRNA transcripts in the strain by a factor of 10. Unique responses to each type of stress are documented, including both the extent and dynamics of the gene expression changes. The work adds rich detail to previous knowledge of stress response mechanisms due to the depth of the RNA sequencing data. Almost half of the sRNAs exhibit significant expression changes under at least one

Global Transcriptional Responses to Osmotic, Oxidative, and Imipenem Stress Conditions in Pseudomonas putida

PubMed Central

Bojanovič, Klara; D'Arrigo, Isotta

2017-01-01

ABSTRACT Bacteria cope with and adapt to stress by modulating gene expression in response to specific environmental cues. In this study, the transcriptional response of Pseudomonas putida KT2440 to osmotic, oxidative, and imipenem stress conditions at two time points was investigated via identification of differentially expressed mRNAs and small RNAs (sRNAs). A total of 440 sRNA transcripts were detected, of which 10% correspond to previously annotated sRNAs, 40% to novel intergenic transcripts, and 50% to novel transcripts antisense to annotated genes. Each stress elicits a unique response as far as the extent and dynamics of the transcriptional changes. Nearly 200 protein-encoding genes exhibited significant changes in all stress types, implicating their participation in a general stress response. Almost half of the sRNA transcripts were differentially expressed under at least one condition, suggesting possible functional roles in the cellular response to stress conditions. The data show a larger fraction of differentially expressed sRNAs than of mRNAs with >5-fold expression changes. The work provides detailed insights into the mechanisms through which P. putida responds to different stress conditions and increases understanding of bacterial adaptation in natural and industrial settings. IMPORTANCE This study maps the complete transcriptional response of P. putida KT2440 to osmotic, oxidative, and imipenem stress conditions at short and long exposure times. Over 400 sRNA transcripts, consisting of both intergenic and antisense transcripts, were detected, increasing the number of identified sRNA transcripts in the strain by a factor of 10. Unique responses to each type of stress are documented, including both the extent and dynamics of the gene expression changes. The work adds rich detail to previous knowledge of stress response mechanisms due to the depth of the RNA sequencing data. Almost half of the sRNAs exhibit significant expression changes under at least

Thermal resistance of naturally occurring airborne bacterial spores. [Viking spacecraft dry heat decontamination simulation

NASA Technical Reports Server (NTRS)

Puleo, J. R.; Bergstrom, S. L.; Peeler, J. T.; Oxborrow, G. S.

1978-01-01

Simulation of a heat process used in the terminal dry-heat decontamination of the Viking spacecraft is reported. Naturally occurring airborne bacterial spores were collected on Teflon ribbons in selected spacecraft assembly areas and subsequently subjected to dry heat. Thermal inactivation experiments were conducted at 105, 111.7, 120, 125, 130, and 135 C with a moisture level of 1.2 mg of water per liter. Heat survivors were recovered at temperatures of 135 C when a 30-h heating cycle was employed. Survivors were recovered from all cycles studied and randomly selected for identification. The naturally occurring spore population was reduced an average of 2.2 to 4.4 log cycles from 105 to 135 C. Heating cycles of 5 and 15 h at temperature were compared with the standard 30-h cycle at 111.7, 120, and 125 C. No significant differences in inactivation (alpha = 0.05) were observed between 111.7 and 120 C. The 30-h cycle differs from the 5- and 15-h cycles at 125 C. Thus, the heating cycle can be reduced if a small fraction (about 0.001 to 0.0001) of very resistant spores can be tolerated.

Hippo, TGF-β, and Src-MAPK pathways regulate transcription of the upd3 cytokine in Drosophila enterocytes upon bacterial infection.

PubMed

Houtz, Philip; Bonfini, Alessandro; Liu, Xi; Revah, Jonathan; Guillou, Aurélien; Poidevin, Mickael; Hens, Korneel; Huang, Hsin-Yi; Deplancke, Bart; Tsai, Yu-Chen; Buchon, Nicolas

2017-11-01

Cytokine signaling is responsible for coordinating conserved epithelial regeneration and immune responses in the digestive tract. In the Drosophila midgut, Upd3 is a major cytokine, which is induced in enterocytes (EC) and enteroblasts (EB) upon oral infection, and initiates intestinal stem cell (ISC) dependent tissue repair. To date, the genetic network directing upd3 transcription remains largely uncharacterized. Here, we have identified the key infection-responsive enhancers of the upd3 gene and show that distinct enhancers respond to various stresses. Furthermore, through functional genetic screening, bioinformatic analyses and yeast one-hybrid screening, we determined that the transcription factors Scalloped (Sd), Mothers against dpp (Mad), and D-Fos are principal regulators of upd3 expression. Our study demonstrates that upd3 transcription in the gut is regulated by the activation of multiple pathways, including the Hippo, TGF-β/Dpp, and Src, as well as p38-dependent MAPK pathways. Thus, these essential pathways, which are known to control ISC proliferation cell-autonomously, are also activated in ECs to promote tissue turnover the regulation of upd3 transcription.

SATRAT: Staphylococcus aureus transcript regulatory network analysis tool.

PubMed

Gopal, Tamilselvi; Nagarajan, Vijayaraj; Elasri, Mohamed O

2015-01-01

Staphylococcus aureus is a commensal organism that primarily colonizes the nose of healthy individuals. S. aureus causes a spectrum of infections that range from skin and soft-tissue infections to fatal invasive diseases. S. aureus uses a large number of virulence factors that are regulated in a coordinated fashion. The complex regulatory mechanisms have been investigated in numerous high-throughput experiments. Access to this data is critical to studying this pathogen. Previously, we developed a compilation of microarray experimental data to enable researchers to search, browse, compare, and contrast transcript profiles. We have substantially updated this database and have built a novel exploratory tool-SATRAT-the S. aureus transcript regulatory network analysis tool, based on the updated database. This tool is capable of performing deep searches using a query and generating an interactive regulatory network based on associations among the regulators of any query gene. We believe this integrated regulatory network analysis tool would help researchers explore the missing links and identify novel pathways that regulate virulence in S. aureus. Also, the data model and the network generation code used to build this resource is open sourced, enabling researchers to build similar resources for other bacterial systems.

Simulated sugar factory wastewater remediation kinetics using algal-bacterial raceway reactor promoted by polyacrylate polyalcohol.

PubMed

Memon, Abdul Rehman; Andresen, John; Habib, Muddasar; Jaffar, Muhammad

2014-04-01

The remediation kinetics of simulated sugar factory wastewater (SFW) using an algal-bacterial culture (ABC) of Chlorella vulgaris in association with Pseudomonas putida in a raceway reactor was found to be enhanced by 89% with the addition of 80ppm of copolymer Polyacrylate polyalcohol (PAPA). This was achieved by efficient suspension of the ABC throughout the water body maintaining optimum pH and dissolved oxygen that led to rapid COD removal and improved algal biomass production. The suspension of the ABC using the co-polymer PAPA maintained a DO of 8-10mgl(-1) compared to 2-3mgl(-1) when not suspended. As a result, the non-suspended ABC only achieved a 50% reduction in COD after 96h compared to a 89% COD removal using 80ppm PAPA suspension. In addition, the algae biomass increased from 0.4gl(-1)d(-1) for the non-suspended ABC to 1.1gl(-1)d(-1) when suspended using 80ppm PAPA. Copyright © 2014 Elsevier Ltd. All rights reserved.

Elucidating the impact of micro-scale heterogeneous bacterial distribution on biodegradation

NASA Astrophysics Data System (ADS)

Schmidt, Susanne I.; Kreft, Jan-Ulrich; Mackay, Rae; Picioreanu, Cristian; Thullner, Martin

2018-06-01

Groundwater microorganisms hardly ever cover the solid matrix uniformly-instead they form micro-scale colonies. To which extent such colony formation limits the bioavailability and biodegradation of a substrate is poorly understood. We used a high-resolution numerical model of a single pore channel inhabited by bacterial colonies to simulate the transport and biodegradation of organic substrates. These high-resolution 2D simulation results were compared to 1D simulations that were based on effective rate laws for bioavailability-limited biodegradation. We (i) quantified the observed bioavailability limitations and (ii) evaluated the applicability of previously established effective rate concepts if microorganisms are heterogeneously distributed. Effective bioavailability reductions of up to more than one order of magnitude were observed, showing that the micro-scale aggregation of bacterial cells into colonies can severely restrict the bioavailability of a substrate and reduce in situ degradation rates. Effective rate laws proved applicable for upscaling when using the introduced effective colony sizes.

Interaction of two photoreceptors in the regulation of bacterial photosynthesis genes

PubMed Central

Metz, Sebastian; Haberzettl, Kerstin; Frühwirth, Sebastian; Teich, Kristin; Hasewinkel, Christian; Klug, Gabriele

2012-01-01

The expression of photosynthesis genes in the facultatively photosynthetic bacterium Rhodobacter sphaeroides is controlled by the oxygen tension and by light quantity. Two photoreceptor proteins, AppA and CryB, have been identified in the past, which are involved in this regulation. AppA senses light by its N-terminal BLUF domain, its C-terminal part binds heme and is redox-responsive. Through its interaction to the transcriptional repressor PpsR the AppA photoreceptor controls expression of photosynthesis genes. The cryptochrome-like protein CryB was shown to affect regulation of photosynthesis genes, but the underlying signal chain remained unknown. Here we show that CryB interacts with the C-terminal domain of AppA and modulates the binding of AppA to the transcriptional repressor PpsR in a light-dependent manner. Consequently, binding of the transcription factor PpsR to its DNA target is affected by CryB. In agreement with this, all genes of the PpsR regulon showed altered expression levels in a CryB deletion strain after blue-light illumination. These results elucidate for the first time how a bacterial cryptochrome affects gene expression. PMID:22434878

Interaction of two photoreceptors in the regulation of bacterial photosynthesis genes.

PubMed

Metz, Sebastian; Haberzettl, Kerstin; Frühwirth, Sebastian; Teich, Kristin; Hasewinkel, Christian; Klug, Gabriele

2012-07-01

The expression of photosynthesis genes in the facultatively photosynthetic bacterium Rhodobacter sphaeroides is controlled by the oxygen tension and by light quantity. Two photoreceptor proteins, AppA and CryB, have been identified in the past, which are involved in this regulation. AppA senses light by its N-terminal BLUF domain, its C-terminal part binds heme and is redox-responsive. Through its interaction to the transcriptional repressor PpsR the AppA photoreceptor controls expression of photosynthesis genes. The cryptochrome-like protein CryB was shown to affect regulation of photosynthesis genes, but the underlying signal chain remained unknown. Here we show that CryB interacts with the C-terminal domain of AppA and modulates the binding of AppA to the transcriptional repressor PpsR in a light-dependent manner. Consequently, binding of the transcription factor PpsR to its DNA target is affected by CryB. In agreement with this, all genes of the PpsR regulon showed altered expression levels in a CryB deletion strain after blue-light illumination. These results elucidate for the first time how a bacterial cryptochrome affects gene expression.

Overexpression of CaWRKY27, a subgroup IIe WRKY transcription factor of Capsicum annuum, positively regulates tobacco resistance to Ralstonia solanacearum infection.

PubMed

Dang, Fengfeng; Wang, Yuna; She, Jianju; Lei, Yufen; Liu, Zhiqin; Eulgem, Thomas; Lai, Yan; Lin, Jing; Yu, Lu; Lei, Dan; Guan, Deyi; Li, Xia; Yuan, Qian; He, Shuilin

2014-03-01

WRKY proteins are encoded by a large gene family and are linked to many biological processes across a range of plant species. The functions and underlying mechanisms of WRKY proteins have been investigated primarily in model plants such as Arabidopsis and rice. The roles of these transcription factors in non-model plants, including pepper and other Solanaceae, are poorly understood. Here, we characterize the expression and function of a subgroup IIe WRKY protein from pepper (Capsicum annuum), denoted as CaWRKY27. The protein localized to nuclei and activated the transcription of a reporter GUS gene construct driven by the 35S promoter that contained two copies of the W-box in its proximal upstream region. Inoculation of pepper cultivars with Ralstonia solanacearum induced the expression of CaWRKY27 transcript in 76a, a bacterial wilt-resistant pepper cultivar, whereas it downregulated the expression of CaWRKY27 transcript in Gui-1-3, a bacterial wilt-susceptible pepper cultivar. CaWRKY27 transcript levels were also increased by treatments with salicylic acid (SA), methyl jasmonate (MeJA) and ethephon (ETH). Transgenic tobacco plants overexpressing CaWRKY27 exhibited resistance to R. solanacearum infection compared to that of wild-type plants. This resistance was coupled with increased transcript levels in a number of marker genes, including hypersensitive response genes, and SA-, JA- and ET-associated genes. By contrast, virus-induced gene silencing (VIGS) of CaWRKY27 increased the susceptibility of pepper plants to R. solanacearum infection. These results suggest that CaWRKY27 acts as a positive regulator in tobacco resistance responses to R. solanacearum infection through modulation of SA-, JA- and ET-mediated signaling pathways. © 2013 Scandinavian Plant Physiology Society.

A New Experimental Design for Bacterial Microleakage Investigation at the Implant-Abutment Interface: An In Vitro Study.

PubMed

Zipprich, Holger; Miatke, Sven; Hmaidouch, Rim; Lauer, Hans-Christoph

2016-01-01

This study aimed to test bacterial microleakage at the implant-abutment interface (IAI) before and after dynamic loading using a new chewing simulation. Fourteen implant systems (n = 5 samples of each) were divided into two groups: (1) systems with conical implant-abutment connections (IACs), and (2) systems with flat IACs. For collecting samples without abutment disconnection, channels (Ø = 0.3 mm) were drilled into implants perpendicularly to their axes, and stainless-steel cannulas were adhesively glued inside these channels to allow a sterilized rinsing solution to enter the implant interior and to exit with potential contaminants for testing. Implants were embedded in epoxy resin matrices, which were supported by titanium cylinders with lateral openings for inward and outward cannulas. Abutments were tightened and then provided with vertically adjustable, threaded titanium balls, which were cemented using composite cement. Specimens were immersed in a bacterial liquid and after a contact time of 15 minutes, the implant interior was rinsed prior to chewing simulation (0 N ≘ static seal testing). Specimens were exposed to a Frankfurt chewing simulator. Two hundred twenty force cycles per power level (110 in ± X-axis) were applied to simulate a daily masticatory load of 660 chewing cycles (equivalent to 1,200,000 cycles/5 years). The applied load was gradually increased from 0 N to a maximum load of 200 N in 25-N increments. The implant interior was rinsed to obtain samples before each new power level. All samples were tested using fluorescence microscopy; invading microorganisms could be counted and evaluated. No bacterial contamination was detected under static loading conditions in both groups. After loading, bacterial contamination was detected in one sample from one specimen in group 1 and in two samples from two specimens in group 2. Controlled dynamic loading applied in this study simulated a clinical situation and enabled time-dependent analysis

Molecular dynamics simulation unveils the conformational flexibility of the interdomain linker in the bacterial transcriptional regulator GabR from Bacillus subtilis bound to pyridoxal 5’-phosphate

PubMed Central

Narzi, Daniele; Guidoni, Leonardo

2017-01-01

GabR from Bacillus subtilis is a transcriptional regulator belonging to the MocR subfamily of the GntR regulators. The structure of the MocR regulators is characterized by the presence of two domains: i) a N-terminal domain, about 60 residue long, possessing the winged-Helix-Turn-Helix (wHTH) architecture with DNA recognition and binding capability; ii) a C-terminal domain (about 350 residue) folded as the pyridoxal 5’-phosphate (PLP) dependent aspartate aminotransferase (AAT) with dimerization and effector binding functions. The two domains are linked to each other by a peptide bridge. Although structural and functional characterization of MocRs is proceeding at a fast pace, virtually nothing is know about the molecular changes induced by the effector binding and on how these modifications influence the properties of the regulator. An extensive molecular dynamics simulation on the crystallographic structure of the homodimeric B. subtilis GabR has been undertaken with the aim to envisage the role and the importance of conformational flexibility in the action of GabR. Molecular dynamics has been calculated for the apo (without PLP) and holo (with PLP bound) forms of the GabR. A comparison between the molecular dynamics trajectories calculated for the two GabR forms suggested that one of the wHTH domain detaches from the AAT-like domain in the GabR PLP-bound form. The most evident conformational change in the holo PLP-bound form is represented by the rotation and the subsequent detachment from the subunit surface of one of the wHTH domains. The movement is mediated by a rearrangement of the linker connecting the AAT domain possibly triggered by the presence of the negative charge of the PLP cofactor. This is the second most significant conformational modification. The C-terminal section of the linker docks into the “active site” pocket and establish stabilizing contacts consisting of hydrogen-bonds, salt-bridges and hydrophobic interactions. PMID:29253008

Control of transcription elongation by GreA determines rate of gene expression in Streptococcus pneumoniae.

PubMed

Yuzenkova, Yulia; Gamba, Pamela; Herber, Martijn; Attaiech, Laetitia; Shafeeq, Sulman; Kuipers, Oscar P; Klumpp, Stefan; Zenkin, Nikolay; Veening, Jan-Willem

2014-01-01

Transcription by RNA polymerase may be interrupted by pauses caused by backtracking or misincorporation that can be resolved by the conserved bacterial Gre-factors. However, the consequences of such pausing in the living cell remain obscure. Here, we developed molecular biology and transcriptome sequencing tools in the human pathogen Streptococcus pneumoniae and provide evidence that transcription elongation is rate-limiting on highly expressed genes. Our results suggest that transcription elongation may be a highly regulated step of gene expression in S. pneumoniae. Regulation is accomplished via long-living elongation pauses and their resolution by elongation factor GreA. Interestingly, mathematical modeling indicates that long-living pauses cause queuing of RNA polymerases, which results in 'transcription traffic jams' on the gene and thus blocks its expression. Together, our results suggest that long-living pauses and RNA polymerase queues caused by them are a major problem on highly expressed genes and are detrimental for cell viability. The major and possibly sole function of GreA in S. pneumoniae is to prevent formation of backtracked elongation complexes. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Shedding light on cell compartmentation in the candidate phylum Poribacteria by high resolution visualisation and transcriptional profiling

NASA Astrophysics Data System (ADS)

Jahn, Martin T.; Markert, Sebastian M.; Ryu, Taewoo; Ravasi, Timothy; Stigloher, Christian; Hentschel, Ute; Moitinho-Silva, Lucas

2016-10-01

Assigning functions to uncultivated environmental microorganisms continues to be a challenging endeavour. Here, we present a new microscopy protocol for fluorescence in situ hybridisation-correlative light and electron microscopy (FISH-CLEM) that enabled, to our knowledge for the first time, the identification of single cells within their complex microenvironment at electron microscopy resolution. Members of the candidate phylum Poribacteria, common and uncultivated symbionts of marine sponges, were used towards this goal. Cellular 3D reconstructions revealed bipolar, spherical granules of low electron density, which likely represent carbon reserves. Poribacterial activity profiles were retrieved from prokaryotic enriched sponge metatranscriptomes using simulation-based optimised mapping. We observed high transcriptional activity for proteins related to bacterial microcompartments (BMC) and we resolved their subcellular localisation by combining FISH-CLEM with immunohistochemistry (IHC) on ultra-thin sponge tissue sections. In terms of functional relevance, we propose that the BMC-A region may be involved in 1,2-propanediol degradation. The FISH-IHC-CLEM approach was proven an effective toolkit to combine -omics approaches with functional studies and it should be widely applicable in environmental microbiology.

Transcriptional Responses of Uropathogenic Escherichia coli to Increased Environmental Osmolality Caused by Salt or Urea

PubMed Central

Withman, Benjamin; Gunasekera, Thusitha S.; Beesetty, Pavani; Agans, Richard

2013-01-01

Uropathogenic Escherichia coli (UPEC) is the most common causative agent of urinary tract infections in humans. The majority of urinary infections develop via ascending route through the urethra, where bacterial cells come in contact with human urine prior to reaching the bladder or kidneys. Since urine contains significant amounts of inorganic ions and urea, it imposes osmotic and denaturing stresses on bacterial cells. In this study, we determined the transcriptional adaptive responses of UPEC strain CFT073 to the presence of 0.3 M NaCl or 0.6 M urea in the growth medium. The cell responses to these two osmolytes were drastically different. Although most of the genes of the osmotically inducible regulon were overexpressed in medium with salt, urea failed to stimulate osmotic stress response. At the same time, UPEC colonization genes encoding type 1 and F1C fimbriae and capsule biosynthesis were transcriptionally induced in the presence of urea but did not respond to increased salt concentration. We speculate that urea can potentially be sensed by uropathogenic bacteria to initiate infection program. In addition, several molecular chaperone genes were overexpressed in the presence of urea, whereas adding NaCl to the medium led to an upregulation of a number of anaerobic metabolism pathways. PMID:23090957

Transcriptional responses of uropathogenic Escherichia coli to increased environmental osmolality caused by salt or urea.

PubMed

Withman, Benjamin; Gunasekera, Thusitha S; Beesetty, Pavani; Agans, Richard; Paliy, Oleg

2013-01-01

Uropathogenic Escherichia coli (UPEC) is the most common causative agent of urinary tract infections in humans. The majority of urinary infections develop via ascending route through the urethra, where bacterial cells come in contact with human urine prior to reaching the bladder or kidneys. Since urine contains significant amounts of inorganic ions and urea, it imposes osmotic and denaturing stresses on bacterial cells. In this study, we determined the transcriptional adaptive responses of UPEC strain CFT073 to the presence of 0.3 M NaCl or 0.6 M urea in the growth medium. The cell responses to these two osmolytes were drastically different. Although most of the genes of the osmotically inducible regulon were overexpressed in medium with salt, urea failed to stimulate osmotic stress response. At the same time, UPEC colonization genes encoding type 1 and F1C fimbriae and capsule biosynthesis were transcriptionally induced in the presence of urea but did not respond to increased salt concentration. We speculate that urea can potentially be sensed by uropathogenic bacteria to initiate infection program. In addition, several molecular chaperone genes were overexpressed in the presence of urea, whereas adding NaCl to the medium led to an upregulation of a number of anaerobic metabolism pathways.

Universality in Bacterial Colonies

NASA Astrophysics Data System (ADS)

Bonachela, Juan A.; Nadell, Carey D.; Xavier, João B.; Levin, Simon A.

2011-07-01

The emergent spatial patterns generated by growing bacterial colonies have been the focus of intense study in physics during the last twenty years. Both experimental and theoretical investigations have made possible a clear qualitative picture of the different structures that such colonies can exhibit, depending on the medium on which they are growing. However, there are relatively few quantitative descriptions of these patterns. In this paper, we use a mechanistically detailed simulation framework to measure the scaling exponents associated with the advancing fronts of bacterial colonies on hard agar substrata, aiming to discern the universality class to which the system belongs. We show that the universal behavior exhibited by the colonies can be much richer than previously reported, and we propose the possibility of up to four different sub-phases within the medium-to-high nutrient concentration regime. We hypothesize that the quenched disorder that characterizes one of these sub-phases is an emergent property of the growth and division of bacteria competing for limited space and nutrients.

Regulation of RB Transcription In Vivo by RB Family Members▿ ‡

PubMed Central

Burkhart, Deborah L.; Ngai, Lynn K.; Roake, Caitlin M.; Viatour, Patrick; Thangavel, Chellappagounder; Ho, Victoria M.; Knudsen, Erik S.; Sage, Julien

2010-01-01

In cancer cells, the retinoblastoma tumor suppressor RB is directly inactivated by mutation in the RB gene or functionally inhibited by abnormal activation of cyclin-dependent kinase activity. While variations in RB levels may also provide an important means of controlling RB function in both normal and cancer cells, little is known about the mechanisms regulating RB transcription. Here we show that members of the RB and E2F families bind directly to the RB promoter. To investigate how the RB/E2F pathway may regulate Rb transcription, we generated reporter mice carrying an eGFP transgene inserted into a bacterial artificial chromosome containing most of the Rb gene. Expression of eGFP largely parallels that of Rb in transgenic embryos and adult mice. Using these reporter mice and mutant alleles for Rb, p107, and p130, we found that RB family members modulate Rb transcription in specific cell populations in vivo and in culture. Interestingly, while Rb is a target of the RB/E2F pathway in mouse and human cells, Rb expression does not strictly correlate with the cell cycle status of these cells. These experiments identify novel regulatory feedback mechanisms within the RB pathway in mammalian cells. PMID:20100864

Chromatin potentiates transcription

PubMed Central

Nagai, Shigeki; Davis, Ralph E.; Mattei, Pierre Jean; Eagen, Kyle Patrick; Kornberg, Roger D.

2017-01-01

Chromatin isolated from the chromosomal locus of the PHO5 gene of yeast in a transcriptionally repressed state was transcribed with 12 pure proteins (80 polypeptides): RNA polymerase II, six general transcription factors, TFIIS, the Pho4 gene activator protein, and the SAGA, SWI/SNF, and Mediator complexes. Contrary to expectation, a nucleosome occluding the TATA box and transcription start sites did not impede transcription but rather, enhanced it: the level of chromatin transcription was at least sevenfold greater than that of naked DNA, and chromatin gave patterns of transcription start sites closely similar to those occurring in vivo, whereas naked DNA gave many aberrant transcripts. Both histone acetylation and trimethylation of H3K4 (H3K4me3) were important for chromatin transcription. The nucleosome, long known to serve as a general gene repressor, thus also performs an important positive role in transcription. PMID:28137832

Characterizing highly dynamic conformational states: The transcription bubble in RNAP-promoter open complex as an example

NASA Astrophysics Data System (ADS)

Lerner, Eitan; Ingargiola, Antonino; Weiss, Shimon

2018-03-01

Bio-macromolecules carry out complicated functions through structural changes. To understand their mechanism of action, the structure of each step has to be characterized. While classical structural biology techniques allow the characterization of a few "structural snapshots" along the enzymatic cycle (usually of stable conformations), they do not cover all (and often fast interconverting) structures in the ensemble, where each may play an important functional role. Recently, several groups have demonstrated that structures of different conformations in solution could be solved by measuring multiple distances between different pairs of residues using single-molecule Förster resonance energy transfer (smFRET) and using them as constrains for hybrid/integrative structural modeling. However, this approach is limited in cases where the conformational dynamics is faster than the technique's temporal resolution. In this study, we combine existing tools that elucidate sub-millisecond conformational dynamics together with hybrid/integrative structural modeling to study the conformational states of the transcription bubble in the bacterial RNA polymerase-promoter open complex (RPo). We measured microsecond alternating laser excitation-smFRET of differently labeled lacCONS promoter dsDNA constructs. We used a combination of burst variance analysis, photon-by-photon hidden Markov modeling, and the FRET-restrained positioning and screening approach to identify two conformational states for RPo. The experimentally derived distances of one conformational state match the known crystal structure of bacterial RPo. The experimentally derived distances of the other conformational state have characteristics of a scrunched RPo. These findings support the hypothesis that sub-millisecond dynamics in the transcription bubble are responsible for transcription start site selection.

Near-infrared light-controlled systems for gene transcription regulation, protein targeting and spectral multiplexing.

PubMed

Redchuk, Taras A; Kaberniuk, Andrii A; Verkhusha, Vladislav V

2018-05-01

Near-infrared (NIR, 740-780 nm) optogenetic systems are well-suited to spectral multiplexing with blue-light-controlled tools. Here, we present two protocols, one for regulation of gene transcription and another for control of protein localization, that use a NIR-responsive bacterial phytochrome BphP1-QPAS1 optogenetic pair. In the first protocol, cells are transfected with the optogenetic constructs for independently controlling gene transcription by NIR (BphP1-QPAS1) and blue (LightOn) light. The NIR and blue-light-controlled gene transcription systems show minimal spectral crosstalk and induce a 35- to 40-fold increase in reporter gene expression. In the second protocol, the BphP1-QPAS1 pair is combined with a light-oxygen-voltage-sensing (LOV) domain-based construct into a single optogenetic tool, termed iRIS. This dual-light-controllable protein localization tool allows tridirectional protein translocation among the cytoplasm, nucleus and plasma membrane. Both procedures can be performed within 3-5 d. Use of NIR light-controlled optogenetic systems should advance basic and biomedical research.

Acute sleep deprivation enhances post-infection sleep and promotes survival during bacterial infection in Drosophila.

PubMed

Kuo, Tzu-Hsing; Williams, Julie A

2014-05-01

Sleep is known to increase as an acute response to infection. However, the function of this behavioral response in host defense is not well understood. To address this problem, we evaluated the effect of acute sleep deprivation on post-infection sleep and immune function in Drosophila. Laboratory. Drosophila melanogaster. Flies were subjected to sleep deprivation before (early DEP) or after (late DEP) bacterial infection. Relative to a non-deprived control, flies subjected to early DEP had enhanced sleep after infection as well as increased bacterial clearance and survival outcome. Flies subjected to late DEP experienced enhanced sleep following the deprivation period, and showed a modest improvement in survival outcome. Continuous DEP (early and late DEP) throughout infection also enhanced sleep later during infection and improved survival. However, improved survival in flies subjected to late or continuous DEP did not occur until after flies had experienced sleep. During infection, both early and late DEP enhanced NFκB transcriptional activity as measured by a luciferase reporter (κB-luc) in living flies. Early DEP also increased NFκB activity prior to infection. Flies that were deficient in expression of either the Relish or Dif NFκB transcription factors showed normal responses to early DEP. However, the effect of early DEP on post-infection sleep and survival was abolished in double mutants, which indicates that Relish and Dif have redundant roles in this process. Acute sleep deprivation elevated NFκB-dependent activity, increased post-infection sleep, and improved survival during bacterial infection.

Stable Host Gene Expression in the Gut of Adult Drosophila melanogaster with Different Bacterial Mono-Associations

PubMed Central

Zhang, Vivian; Ludington, William B.; Eisen, Michael B.

2016-01-01

There is growing evidence that the microbes found in the digestive tracts of animals influence host biology, but we still do not understand how they accomplish this. Here, we evaluated how different microbial species commonly associated with laboratory-reared Drosophila melanogaster impact host biology at the level of gene expression in the dissected adult gut and in the entire adult organism. We observed that guts from animals associated from the embryonic stage with either zero, one or three bacterial species demonstrated indistinguishable transcriptional profiles. Additionally, we found that the gut transcriptional profiles of animals reared in the presence of the yeast Saccharomyces cerevisiae alone or in combination with bacteria could recapitulate those of conventionally-reared animals. In contrast, we found whole body transcriptional profiles of conventionally-reared animals were distinct from all of the treatments tested. Our data suggest that adult flies are insensitive to the ingestion of the bacteria found in their gut, but that prior to adulthood, different microbes impact the host in ways that lead to global transcriptional differences observable across the whole adult body. PMID:27898741

Bacterial streamers in curved microchannels

NASA Astrophysics Data System (ADS)

Rusconi, Roberto; Lecuyer, Sigolene; Guglielmini, Laura; Stone, Howard

2009-11-01

Biofilms, generally identified as microbial communities embedded in a self-produced matrix of extracellular polymeric substances, are involved in a wide variety of health-related problems ranging from implant-associated infections to disease transmissions and dental plaque. The usual picture of these bacterial films is that they grow and develop on surfaces. However, suspended biofilm structures, or streamers, have been found in natural environments (e.g., rivers, acid mines, hydrothermal hot springs) and are always suggested to stem from a turbulent flow. We report the formation of bacterial streamers in curved microfluidic channels. By using confocal laser microscopy we are able to directly image and characterize the spatial and temporal evolution of these filamentous structures. Such streamers, which always connect the inner corners of opposite sides of the channel, are always located in the middle plane. Numerical simulations of the flow provide evidences for an underlying hydrodynamic mechanism behind the formation of the streamers.

Hydrodynamics of bacterial colonies: A model

NASA Astrophysics Data System (ADS)

Lega, J.; Passot, T.

2003-03-01

We propose a hydrodynamic model for the evolution of bacterial colonies growing on soft agar plates. This model consists of reaction-diffusion equations for the concentrations of nutrients, water, and bacteria, coupled to a single hydrodynamic equation for the velocity field of the bacteria-water mixture. It captures the dynamics inside the colony as well as on its boundary and allows us to identify a mechanism for collective motion towards fresh nutrients, which, in its modeling aspects, is similar to classical chemotaxis. As shown in numerical simulations, our model reproduces both usual colony shapes and typical hydrodynamic motions, such as the whirls and jets recently observed in wet colonies of Bacillus subtilis. The approach presented here could be extended to different experimental situations and provides a general framework for the use of advection-reaction-diffusion equations in modeling bacterial colonies.

Phase transition of traveling waves in bacterial colony pattern

NASA Astrophysics Data System (ADS)

Wakano, Joe Yuichiro; Komoto, Atsushi; Yamaguchi, Yukio

2004-05-01

Depending on the growth condition, bacterial colonies can exhibit different morphologies. Many previous studies have used reaction diffusion equations to reproduce spatial patterns. They have revealed that nonlinear reaction term can produce diverse patterns as well as nonlinear diffusion coefficient. Typical reaction term consists of nutrient consumption, bacterial reproduction, and sporulation. Among them, the functional form of sporulation rate has not been biologically investigated. Here we report experimentally measured sporulation rate. Then, based on the result, a reaction diffusion model is proposed. One-dimensional simulation showed the existence of traveling wave solution. We study the wave form as a function of the initial nutrient concentration and find two distinct types of solution. Moreover, transition between them is very sharp, which is analogous to phase transition. The velocity of traveling wave also shows sharp transition in nonlinear diffusion model, which is consistent with the previous experimental result. The phenomenon can be explained by separatrix in reaction term dynamics. Results of two-dimensional simulation are also shown and discussed.

Bacterial prostatitis.

PubMed

Gill, Bradley C; Shoskes, Daniel A

2016-02-01

The review provides the infectious disease community with a urologic perspective on bacterial prostatitis. Specifically, the article briefly reviews the categorization of prostatitis by type and provides a distillation of new findings published on bacterial prostatitis over the past year. It also highlights key points from the established literature. Cross-sectional prostate imaging is becoming more common and may lead to more incidental diagnoses of acute bacterial prostatitis. As drug resistance remains problematic in this condition, the reemergence of older antibiotics such as fosfomycin, has proven beneficial. With regard to chronic bacterial prostatitis, no clear clinical risk factors emerged in a large epidemiological study. However, bacterial biofilm formation has been associated with more severe cases. Surgery has a limited role in bacterial prostatitis and should be reserved for draining of a prostatic abscess or the removal of infected prostatic stones. Prostatitis remains a common and bothersome clinical condition. Antibiotic therapy remains the basis of treatment for both acute and chronic bacterial prostatitis. Further research into improving prostatitis treatment is indicated.

Bacterial Sialidase

NASA Technical Reports Server (NTRS)

2004-01-01

Data shows that elevated sialidase in bacterial vaginosis patients correlates to premature births in women. Bacterial sialidase also plays a significant role in the unusual colonization of Pseudomonas aeruginosa in cystic fibrosis patients. Crystals of Salmonella sialidase have been reproduced and are used for studying the inhibitor-enzyme complexes. These inhibitors may also be used to inhibit a trans-sialidase of Trypanosome cruzi, a very similar enzyme to bacterial sialidase, therefore preventing T. cruzi infection, the causitive agent of Chagas' disease. The Center for Macromolecular Crystallography suggests that inhibitors of bacterial sialidases can be used as prophylactic drugs to prevent bacterial infections in these critical cases.

A growth-dependent transcription initiation factor (TIF-IA) interacting with RNA polymerase I regulates mouse ribosomal RNA synthesis.

PubMed

Schnapp, A; Pfleiderer, C; Rosenbauer, H; Grummt, I

1990-09-01

Control of mouse ribosomal RNA synthesis in response to extracellular signals is mediated by TIF-IA, a regulatory factor whose amount or activity correlates with cell proliferation. Factor TIF-IA interacts with RNA polymerase I (pol I), thus converting it into a transcriptionally active holoenzyme, which is able to initiate specifically at the rDNA promoter in the presence of the other auxiliary transcription initiation factors, designated TIF-IB, TIF-IC and UBF. With regard to several criteria, the growth-dependent factor TIF-IA behaves like a bacterial sigma factor: (i) it associates physically with pol I, (ii) it is required for initiation of transcription, (iii) it is present in limiting amounts and (iv) under certain salt conditions, it is chromatographically separable from the polymerase. In addition, evidence is presented that dephosphorylation of pol I abolishes in vitro transcription initiation from the ribosomal gene promoter without significantly affecting the polymerizing activity of the enzyme at nonspecific templates. The involvement of both a regulatory factor and post-translational modification of the transcribing enzyme provides an efficient and versatile mechanism of rDNA transcription regulation which enables the cell to adapt ribosome synthesis rapidly to a variety of extracellular signals.

Hydrodynamics of bacterial colonies: Phase diagrams

NASA Astrophysics Data System (ADS)

Lega, J.; Passot, T.

2004-09-01

We present numerical simulations of a recent hydrodynamic model describing the growth of bacterial colonies on agar plates. We show that this model is able to qualitatively reproduce experimentally observed phase diagrams, which relate a colony shape to the initial quantity of nutrients on the plate and the initial wetness of the agar. We also discuss the principal features resulting from the interplay between hydrodynamic motions and colony growth, as described by our model.

Bacterial reference genes for gene expression studies by RT-qPCR: survey and analysis.

PubMed

Rocha, Danilo J P; Santos, Carolina S; Pacheco, Luis G C

2015-09-01

The appropriate choice of reference genes is essential for accurate normalization of gene expression data obtained by the method of reverse transcription quantitative real-time PCR (RT-qPCR). In 2009, a guideline called the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) highlighted the importance of the selection and validation of more than one suitable reference gene for obtaining reliable RT-qPCR results. Herein, we searched the recent literature in order to identify the bacterial reference genes that have been most commonly validated in gene expression studies by RT-qPCR (in the first 5 years following publication of the MIQE guidelines). Through a combination of different search parameters with the text mining tool MedlineRanker, we identified 145 unique bacterial genes that were recently tested as candidate reference genes. Of these, 45 genes were experimentally validated and, in most of the cases, their expression stabilities were verified using the software tools geNorm and NormFinder. It is noteworthy that only 10 of these reference genes had been validated in two or more of the studies evaluated. An enrichment analysis using Gene Ontology classifications demonstrated that genes belonging to the functional categories of DNA Replication (GO: 0006260) and Transcription (GO: 0006351) rendered a proportionally higher number of validated reference genes. Three genes in the former functional class were also among the top five most stable genes identified through an analysis of gene expression data obtained from the Pathosystems Resource Integration Center. These results may provide a guideline for the initial selection of candidate reference genes for RT-qPCR studies in several different bacterial species.

Mobile Bacterial Group II Introns at the Crux of Eukaryotic Evolution

PubMed Central

Lambowitz, Alan M.; Belfort, Marlene

2015-01-01

SUMMARY This review focuses on recent developments in our understanding of group II intron function, the relationships of these introns to retrotransposons and spliceosomes, and how their common features have informed thinking about bacterial group II introns as key elements in eukaryotic evolution. Reverse transcriptase-mediated and host factor-aided intron retrohoming pathways are considered along with retrotransposition mechanisms to novel sites in bacteria, where group II introns are thought to have originated. DNA target recognition and movement by target-primed reverse transcription infer an evolutionary relationship among group II introns, non-LTR retrotransposons, such as LINE elements, and telomerase. Additionally, group II introns are almost certainly the progenitors of spliceosomal introns. Their profound similarities include splicing chemistry extending to RNA catalysis, reaction stereochemistry, and the position of two divalent metals that perform catalysis at the RNA active site. There are also sequence and structural similarities between group II introns and the spliceosome’s small nuclear RNAs (snRNAs) and between a highly conserved core spliceosomal protein Prp8 and a group II intron-like reverse transcriptase. It has been proposed that group II introns entered eukaryotes during bacterial endosymbiosis or bacterial-archaeal fusion, proliferated within the nuclear genome, necessitating evolution of the nuclear envelope, and fragmented giving rise to spliceosomal introns. Thus, these bacterial self-splicing mobile elements have fundamentally impacted the composition of extant eukaryotic genomes, including the human genome, most of which is derived from close relatives of mobile group II introns. PMID:25878921

Locomotion of bacteria in liquid flow and the boundary layer effect on bacterial attachment.

PubMed

Zhang, Chao; Liao, Qiang; Chen, Rong; Zhu, Xun

2015-06-12

The formation of biofilm greatly affects the performance of biological reactors, which highly depends on bacterial swimming and attachment that usually takes place in liquid flow. Therefore, bacterial swimming and attachment on flat and circular surfaces with the consideration of flow was studied experimentally. Besides, a mathematical model comprehensively combining bacterial swimming and motion with flow is proposed for the simulation of bacterial locomotion and attachment in flow. Both experimental and theoretical results revealed that attached bacteria density increases with decreasing boundary layer thickness on both flat and circular surfaces, the consequence of which is inherently related to the competition between bacterial swimming and the non-slip motion with flow evaluated by the Péclet number. In the boundary layer, where the Péclet number is relatively higher, bacterial locomotion mainly depends on bacterial swimming. Thinner boundary layer promotes bacterial swimming towards the surface, leading to higher attachment density. To enhance the performance of biofilm reactors, it is effective to reduce the boundary layer thickness on desired surfaces. Copyright © 2015 Elsevier Inc. All rights reserved.

Effect of lag time distribution on the lag phase of bacterial growth - a Monte Carlo analysis

USDA-ARS?s Scientific Manuscript database

The objective of this study is to use Monte Carlo simulation to evaluate the effect of lag time distribution of individual bacterial cells incubated under isothermal conditions on the development of lag phase. The growth of bacterial cells of the same initial concentration and mean lag phase durati...

Clavibacter michiganensis ssp. michiganensis: bacterial canker of tomato, molecular interactions and disease management.

PubMed

Nandi, Munmun; Macdonald, Jacqueline; Liu, Peng; Weselowski, Brian; Yuan, Ze-Chun

2018-03-12

Bacterial canker disease is considered to be one of the most destructive diseases of tomato (Solanum lycopersicum), and is caused by the seed-borne Gram-positive bacterium Clavibacter michiganensis ssp. michiganensis (Cmm). This vascular pathogen generally invades and proliferates in the xylem through natural openings or wounds, causing wilt and canker symptoms. The incidence of symptomless latent infections and the invasion of tomato seeds by Cmm are widespread. Pathogenicity is mediated by virulence factors and transcriptional regulators encoded by the chromosome and two natural plasmids. The virulence factors include serine proteases, cell wall-degrading enzymes (cellulases, xylanases, pectinases) and others. Mutational analyses of these genes and gene expression profiling (via quantitative reverse transcription-polymerase chain reaction, transcriptomics and proteomics) have begun to shed light on their roles in colonization and virulence, whereas the expression of tomato genes in response to Cmm infection suggests plant factors involved in the defence response. These findings may aid in the generation of target-specific bactericides or new resistant varieties of tomato. Meanwhile, various chemical and biological controls have been researched to control Cmm. This review presents a detailed investigation regarding the pathogen Cmm, bacterial canker infection, molecular interactions between Cmm and tomato, and current perspectives on improved disease management. © 2018 AGRICULTURE AND AGRI-FOOD CANADA. MOLECULAR PLANT PATHOLOGY © 2018 JOHN WILEY & SONS LTD.

Polyester: simulating RNA-seq datasets with differential transcript expression.

PubMed

Frazee, Alyssa C; Jaffe, Andrew E; Langmead, Ben; Leek, Jeffrey T

2015-09-01

Statistical methods development for differential expression analysis of RNA sequencing (RNA-seq) requires software tools to assess accuracy and error rate control. Since true differential expression status is often unknown in experimental datasets, artificially constructed datasets must be utilized, either by generating costly spike-in experiments or by simulating RNA-seq data. Polyester is an R package designed to simulate RNA-seq data, beginning with an experimental design and ending with collections of RNA-seq reads. Its main advantage is the ability to simulate reads indicating isoform-level differential expression across biological replicates for a variety of experimental designs. Data generated by Polyester is a reasonable approximation to real RNA-seq data and standard differential expression workflows can recover differential expression set in the simulation by the user. Polyester is freely available from Bioconductor (http://bioconductor.org/). jtleek@gmail.com Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Comparative evaluation of rRNA depletion procedures for the improved analysis of bacterial biofilm and mixed pathogen culture transcriptomes

PubMed Central

Petrova, Olga E.; Garcia-Alcalde, Fernando; Zampaloni, Claudia; Sauer, Karin

2017-01-01

Global transcriptomic analysis via RNA-seq is often hampered by the high abundance of ribosomal (r)RNA in bacterial cells. To remove rRNA and enrich coding sequences, subtractive hybridization procedures have become the approach of choice prior to RNA-seq, with their efficiency varying in a manner dependent on sample type and composition. Yet, despite an increasing number of RNA-seq studies, comparative evaluation of bacterial rRNA depletion methods has remained limited. Moreover, no such study has utilized RNA derived from bacterial biofilms, which have potentially higher rRNA:mRNA ratios and higher rRNA carryover during RNA-seq analysis. Presently, we evaluated the efficiency of three subtractive hybridization-based kits in depleting rRNA from samples derived from biofilm, as well as planktonic cells of the opportunistic human pathogen Pseudomonas aeruginosa. Our results indicated different rRNA removal efficiency for the three procedures, with the Ribo-Zero kit yielding the highest degree of rRNA depletion, which translated into enhanced enrichment of non-rRNA transcripts and increased depth of RNA-seq coverage. The results indicated that, in addition to improving RNA-seq sensitivity, efficient rRNA removal enhanced detection of low abundance transcripts via qPCR. Finally, we demonstrate that the Ribo-Zero kit also exhibited the highest efficiency when P. aeruginosa/Staphylococcus aureus co-culture RNA samples were tested. PMID:28117413

Interaction of Arabidopsis Trihelix-Domain Transcription Factors VFP3 and VFP5 with Agrobacterium Virulence Protein VirF

PubMed Central

García-Cano, Elena; Magori, Shimpei; Sun, Qi; Ding, Zehong; Lazarowitz, Sondra G.; Citovsky, Vitaly

2015-01-01

Agrobacterium is a natural genetic engineer of plants that exports several virulence proteins into host cells in order to take advantage of the cell machinery to facilitate transformation and support bacterial growth. One of these effectors is the F-box protein VirF, which presumably uses the host ubiquitin/proteasome system (UPS) to uncoat the packaging proteins from the invading bacterial T-DNA. By analogy to several other bacterial effectors, VirF most likely has several functions in the host cell and, therefore, several interacting partners among host proteins. Here we identify one such interactor, an Arabidopsis trihelix-domain transcription factor VFP3, and further show that its very close homolog VFP5 also interacted with VirF. Interestingly, interactions of VirF with either VFP3 or VFP5 did not activate the host UPS, suggesting that VirF might play other UPS-independent roles in bacterial infection. To better understand the potential scope of VFP3 function, we used RNAi to reduce expression of the VFP3 gene. Transcriptome profiling of these VFP3-silenced plants using high-throughput cDNA sequencing (RNA-seq) revealed that VFP3 substantially affected plant gene expression; specifically, 1,118 genes representing approximately 5% of all expressed genes were significantly either up- or down-regulated in the VFP3 RNAi line compared to wild-type Col-0 plants. Among the 507 up-regulated genes were genes implicated in the regulation of transcription, protein degradation, calcium signaling, and hormone metabolism, whereas the 611 down-regulated genes included those involved in redox regulation, light reactions of photosynthesis, and metabolism of lipids, amino acids, and cell wall. Overall, this pattern of changes in gene expression is characteristic of plants under stress. Thus, VFP3 likely plays an important role in controlling plant homeostasis. PMID:26571494

Effect of exposure to sunlight and phosphorus-limitation on bacterial degradation of coloured dissolved organic matter (CDOM) in freshwater.

PubMed

Kragh, Theis; Søndergaard, Morten; Tranvik, Lars

2008-05-01

This study reports on the interacting effect of photochemical conditioning of dissolved organic matter and inorganic phosphorus on the metabolic activity of bacteria in freshwater. Batch cultures with lake-water bacteria and dissolved organic carbon (DOC) extracted from a humic boreal river were arranged in an experimental matrix of three levels of exposure to simulated sunlight and three levels of phosphorus concentration. We measured an increase in bacterial biomass, a decrease in DOC and bacterial respiration as CO(2) production and O(2) consumption over 450 h. These measurements were used to calculate bacterial growth efficiency (BGE). Bacterial degradation of DOC increased with increasing exposure to simulated sunlight and availability of phosphorus and no detectable growth occurred on DOC that was not pre-exposed to simulated sunlight. The outcome of photochemical degradation of DOC changed with increasing availability of phosphorus, resulting in an increase in BGE from about 5% to 30%. Thus, the availability of phosphorus has major implications for the quantitative transfer of carbon in microbial food webs.

Expression of transcription factors after short-term exposure of Arabidopsis thaliana cell cultures to hyper-g, and to simulated and sounding rocket micro-g

NASA Astrophysics Data System (ADS)

Hampp, R.; Babbick, M.

Previous microarray studies with cell cultures of Arabidopsis thaliana cv Columbia have shown responses in gene expression which were partly specific to exposure to microgravity sounding rocket experiment TEXUS In order to get access to early responses upon changes in gravitational fields we used exposure times as short as 2 min For this purpose we selected a range of genes which code for different groups of transcription factors WRKY ERF MYB MADS Samples were taken in 5-min clinorotation 2- and 3-dimensional hypergravity 8g and 2-min intervals sounding rocket experiment Amounts of transcripts were determined by quantitative RT PCR Most transcripts showed a significant transient change in content within a time frame of up to 30 min after changing the external gravitational field strength They could be grouped into 1 basic stress responses which occurred under all conditions 2 clinorotation-related effects which were either identical or opposite between 2D 60 rpm 4x10 -2 g and 3D clinorotation random positioning machine and 3 alterations specific to the microgravity exposure under sounding rocket conditions MAXUS The data are discussed in relation to gravitation-dependent signalling chains and with regard to the simulation of microgravity by means of clinorotation Supported by a grant from the Deutsches Zentrum f u r Luft- und Raumfahrt e V grant no 50 WB 0143

Assessing the hodgepodge of non-mapped reads in bacterial transcriptomes: real or artifactual RNA chimeras?

PubMed

Lloréns-Rico, Verónica; Serrano, Luis; Lluch-Senar, Maria

2014-07-29

RNA sequencing methods have already altered our view of the extent and complexity of bacterial and eukaryotic transcriptomes, revealing rare transcript isoforms (circular RNAs, RNA chimeras) that could play an important role in their biology. We performed an analysis of chimera formation by four different computational approaches, including a custom designed pipeline, to study the transcriptomes of M. pneumoniae and P. aeruginosa, as well as mixtures of both. We found that rare transcript isoforms detected by conventional pipelines of analysis could be artifacts of the experimental procedure used in the library preparation, and that they are protocol-dependent. By using a customized pipeline we show that optimal library preparation protocol and the pipeline to analyze the results are crucial to identify real chimeric RNAs.

A C-Type Cytochrome and a Transcriptional Regulator Responsible for Enhanced Extracellular Electron Transfer in Geobacter Sulfurreducens Revealed by Adaptive Evolution

DTIC Science & Technology

2010-01-01

dance of pgcA transcripts, consistent with increased expression of pgcA in the adapted strains. One of the mutations doubled the rate of Fe(III) oxide...sequenced bacterial genomes. BMC Genomics 8: 274. Herring, C.D., Raghunathan, A., Honisch, C., Patel, T., Apple- bee , M.K., Joyce, A.R., et al. (2006

Bacterial Sigma Factors and Anti-Sigma Factors: Structure, Function and Distribution

PubMed Central

Paget, Mark S.

2015-01-01

Sigma factors are multi-domain subunits of bacterial RNA polymerase (RNAP) that play critical roles in transcription initiation, including the recognition and opening of promoters as well as the initial steps in RNA synthesis. This review focuses on the structure and function of the major sigma-70 class that includes the housekeeping sigma factor (Group 1) that directs the bulk of transcription during active growth, and structurally-related alternative sigma factors (Groups 2–4) that control a wide variety of adaptive responses such as morphological development and the management of stress. A recurring theme in sigma factor control is their sequestration by anti-sigma factors that occlude their RNAP-binding determinants. Sigma factors are then released through a wide variety of mechanisms, often involving branched signal transduction pathways that allow the integration of distinct signals. Three major strategies for sigma release are discussed: regulated proteolysis, partner-switching, and direct sensing by the anti-sigma factor. PMID:26131973

Antimicrobial Nanoplexes meet Model Bacterial Membranes: the key role of Cardiolipin

NASA Astrophysics Data System (ADS)

Marín-Menéndez, Alejandro; Montis, Costanza; Díaz-Calvo, Teresa; Carta, Davide; Hatzixanthis, Kostas; Morris, Christopher J.; McArthur, Michael; Berti, Debora

2017-01-01

Antimicrobial resistance to traditional antibiotics is a crucial challenge of medical research. Oligonucleotide therapeutics, such as antisense or Transcription Factor Decoys (TFDs), have the potential to circumvent current resistance mechanisms by acting on novel targets. However, their full translation into clinical application requires efficient delivery strategies and fundamental comprehension of their interaction with target bacterial cells. To address these points, we employed a novel cationic bolaamphiphile that binds TFDs with high affinity to form self-assembled complexes (nanoplexes). Confocal microscopy revealed that nanoplexes efficiently transfect bacterial cells, consistently with biological efficacy on animal models. To understand the factors affecting the delivery process, liposomes with varying compositions, taken as model synthetic bilayers, were challenged with nanoplexes and investigated with Scattering and Fluorescence techniques. Thanks to the combination of results on bacteria and synthetic membrane models we demonstrate for the first time that the prokaryotic-enriched anionic lipid Cardiolipin (CL) plays a key-role in the TFDs delivery to bacteria. Moreover, we can hypothesize an overall TFD delivery mechanism, where bacterial membrane reorganization with permeability increase and release of the TFD from the nanoplexes are the main factors. These results will be of great benefit to boost the development of oligonucleotides-based antimicrobials of superior efficacy.

Themes and Variations: Regulation of RpoN-Dependent Flagellar Genes across Diverse Bacterial Species

PubMed Central

Tsang, Jennifer; Hoover, Timothy R.

2014-01-01

Flagellar biogenesis in bacteria is a complex process in which the transcription of dozens of structural and regulatory genes is coordinated with the assembly of the flagellum. Although the overall process of flagellar biogenesis is conserved among bacteria, the mechanisms used to regulate flagellar gene expression vary greatly among different bacterial species. Many bacteria use the alternative sigma factor σ 54 (also known as RpoN) to transcribe specific sets of flagellar genes. These bacteria include members of the Epsilonproteobacteria (e.g., Helicobacter pylori and Campylobacter jejuni), Gammaproteobacteria (e.g., Vibrio and Pseudomonas species), and Alphaproteobacteria (e.g., Caulobacter crescentus). This review characterizes the flagellar transcriptional hierarchies in these bacteria and examines what is known about how flagellar gene regulation is linked with other processes including growth phase, quorum sensing, and host colonization. PMID:24672734

Intact Pneumococci Trigger Transcription of Interferon-Related Genes in Human Monocytes, while Fragmented, Autolyzed Bacteria Subvert This Response

PubMed Central

Nordén, Rickard; Martner, Anna; Samuelsson, Ebba; Hynsjö, Lars; Wold, Agnes E.

2017-01-01

ABSTRACT A peculiar trait of pneumococci (Streptococcus pneumoniae) is their propensity to undergo spontaneous lysis during stationary growth due to activation of the enzyme autolysin (LytA), which fragments the peptidoglycan cell wall. The fragments that are generated upon autolysis impair phagocytosis and reduce production of interleukin-12 (IL-12) and gamma interferon (IFN-γ) by human leukocytes in response to intact pneumococci, thereby impeding crucial host defenses. The objective was to identify additional monocyte genes whose transcription is induced by intact pneumococci and subverted by autolyzed bacteria. Monocytes were isolated from healthy blood donors and stimulated for 3 h with UV-inactivated S. pneumoniae (Rx1PLY− LytA+ strain), which is capable of autolyzing, its LytA− isogenic autolysin-deficient mutant, or a mixture of the two (containing twice the initial bacterial concentration). Gene expression was assessed by Illumina microarray, and selected findings were confirmed by reverse transcription-quantitative real-time PCR (RT-qPCR), enzyme-linked immunosorbent assay (ELISA), and flow cytometry. In all, we identified 121 genes that were upregulated to a significantly higher degree by intact than autolyzed pneumococci. These included IFNB1 and a large set of interferon-induced genes, such as IFIT3, RSAD2, CFCL1, and CXCL10 genes, as well as IL12B and CD40 genes. RT-qPCR revealed that transcription of these genes in response to intact pneumococci diminished when autolyzed pneumococci were admixed and that this pattern was independent of pneumolysin. Thus, transcription of interferon-related genes is triggered by intact pneumococci and subverted by fragments generated by spontaneous bacterial autolysis. We suggest that interferon-related pathways are important for elimination of pneumococci and that autolysis contributes to virulence by extinguishing these pathways. PMID:28223347

Structural characterization of human general transcription factor TFIIF in solution

PubMed Central

Akashi, Satoko; Nagakura, Shinjiro; Yamamoto, Seiji; Okuda, Masahiko; Ohkuma, Yoshiaki; Nishimura, Yoshifumi

2008-01-01

Human general transcription factor IIF (TFIIF), a component of the transcription pre-initiation complex (PIC) associated with RNA polymerase II (Pol II), was characterized by size-exclusion chromatography (SEC), electrospray ionization mass spectrometry (ESI-MS), and chemical cross-linking. Recombinant TFIIF, composed of an equimolar ratio of α and β subunits, was bacterially expressed, purified to homogeneity, and found to have a transcription activity similar to a natural one in the human in vitro transcription system. SEC of purified TFIIF, as previously reported, suggested that this protein has a size >200 kDa. In contrast, ESI-MS of the purified sample gave a molecular size of 87 kDa, indicating that TFIIF is an αβ heterodimer, which was confirmed by matrix-assisted laser desorption/ionization (MALDI) MS of the cross-linked TFIIF components. Recent electron microscopy (EM) and photo-cross-linking studies showed that the yeast TFIIF homolog containing Tfg1 and Tfg2, corresponding to the human α and β subunits, exists as a heterodimer in the PIC, so the human TFIIF is also likely to exist as a heterodimer even in the PIC. In the yeast PIC, EM and photo-cross-linking studies showed different results for the mutual location of TFIIE and TFIIF along DNA. We have examined the direct interaction between human TFIIF and TFIIE by ESI-MS, SEC, and chemical cross-linking; however, no direct interaction was observed, at least in solution. This is consistent with the previous photo-cross-linking observation that TFIIF and TFIIE flank DNA separately on both sides of the Pol II central cleft in the yeast PIC. PMID:18218714

Activation of endothelial-leukocyte adhesion molecule 1 (ELAM-1) gene transcription

DOE Office of Scientific and Technical Information (OSTI.GOV)

Montgomery, K.F.; Tarr, P.I.; Bomsztyk, K.

1991-08-01

Leukocyte adherence to endothelium is in part mediated by the transient expression of endothelial-leukocyte adhesion molecule 1 (ELAM-1) on endothelial surfaces stimulated by tumor necrosis factor {alpha} (TNF), interleukin (IL) 1, or bacterial lipopolysaccharide (LPS). The intracellular factors controlling induction of ELAM-1 mRNA and protein are unknown. In nuclear runoff experiments with cultured human umbilical vein endothelial cells (HUVEC), the authors demonstrate that transcriptional activation of the ELAM-1 gene occurs following stimulation with TNF. Sequence analysis of the 5{prime} flanking region of the ELAM-1 gene reveals consensus DNA-binding sequences for two known transcription factors, NF-{kappa}B and AP-1. Gel mobility shiftmore » assays demonstrate that TNF, IL-1, or LPS induces activation of NF-{kappa}B-like DNA binding activity in HUVEC. Phorbol 12-myristate 13-acetate, a known activator of protein kinase C (PKC), weakly induces NF-{kappa}B-like activity, ELAM-1 mRNA, and ELAM-1 surface expression in HUVEC. However, TNF, IL-1, and LPS do not activate PKC in HUVEC at doses that strongly induce NF-{kappa}B-like protein activation and ELAM-1 gene expression. PKC blockade with H7 does not inhibit activation of these NF-kB-like proteins but does inhibit ELAM-1 gene transcription. They conclude that PKC-independent activation of NF-{kappa}B in HUVEC with TNF, IL-1, or LPS is associated with, but not sufficient for, activation of ELAM-1 gene transcription.« less

The transcriptional stress response of Candida albicans to weak organic acids.

PubMed

Cottier, Fabien; Tan, Alrina Shin Min; Chen, Jinmiao; Lum, Josephine; Zolezzi, Francesca; Poidinger, Michael; Pavelka, Norman

2015-01-29

Candida albicans is the most important fungal pathogen of humans, causing severe infections, especially in nosocomial and immunocompromised settings. However, it is also the most prevalent fungus of the normal human microbiome, where it shares its habitat with hundreds of trillions of other microbial cells. Despite weak organic acids (WOAs) being among the most abundant metabolites produced by bacterial microbiota, little is known about their effect on C. albicans. Here we used a sequencing-based profiling strategy to systematically investigate the transcriptional stress response of C. albicans to lactic, acetic, propionic, and butyric acid at several time points after treatment. Our data reveal a complex transcriptional response, with individual WOAs triggering unique gene expression profiles and with important differences between acute and chronic exposure. Despite these dissimilarities, we found significant overlaps between the gene expression changes induced by each WOA, which led us to uncover a core transcriptional response that was largely unrelated to other previously published C. albicans transcriptional stress responses. Genes commonly up-regulated by WOAs were enriched in several iron transporters, which was associated with an overall decrease in intracellular iron concentrations. Moreover, chronic exposure to any WOA lead to down-regulation of RNA synthesis and ribosome biogenesis genes, which resulted in significant reduction of total RNA levels and of ribosomal RNA in particular. In conclusion, this study suggests that gastrointestinal microbiota might directly influence C. albicans physiology via production of WOAs, with possible implications of how this fungus interacts with its host in both health and disease. Copyright © 2015 Cottier et al.

The Transcriptional Stress Response of Candida albicans to Weak Organic Acids

PubMed Central

Cottier, Fabien; Tan, Alrina Shin Min; Chen, Jinmiao; Lum, Josephine; Zolezzi, Francesca; Poidinger, Michael; Pavelka, Norman

2015-01-01

Candida albicans is the most important fungal pathogen of humans, causing severe infections, especially in nosocomial and immunocompromised settings. However, it is also the most prevalent fungus of the normal human microbiome, where it shares its habitat with hundreds of trillions of other microbial cells. Despite weak organic acids (WOAs) being among the most abundant metabolites produced by bacterial microbiota, little is known about their effect on C. albicans. Here we used a sequencing-based profiling strategy to systematically investigate the transcriptional stress response of C. albicans to lactic, acetic, propionic, and butyric acid at several time points after treatment. Our data reveal a complex transcriptional response, with individual WOAs triggering unique gene expression profiles and with important differences between acute and chronic exposure. Despite these dissimilarities, we found significant overlaps between the gene expression changes induced by each WOA, which led us to uncover a core transcriptional response that was largely unrelated to other previously published C. albicans transcriptional stress responses. Genes commonly up-regulated by WOAs were enriched in several iron transporters, which was associated with an overall decrease in intracellular iron concentrations. Moreover, chronic exposure to any WOA lead to down-regulation of RNA synthesis and ribosome biogenesis genes, which resulted in significant reduction of total RNA levels and of ribosomal RNA in particular. In conclusion, this study suggests that gastrointestinal microbiota might directly influence C. albicans physiology via production of WOAs, with possible implications of how this fungus interacts with its host in both health and disease. PMID:25636313

Locomotion of bacteria in liquid flow and the boundary layer effect on bacterial attachment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Chao, E-mail: zhangchao@cqu.edu.cn; Institute of Engineering Thermophysics, Chongqing University, Chongqing 400030; Liao, Qiang, E-mail: lqzx@cqu.edu.cn

The formation of biofilm greatly affects the performance of biological reactors, which highly depends on bacterial swimming and attachment that usually takes place in liquid flow. Therefore, bacterial swimming and attachment on flat and circular surfaces with the consideration of flow was studied experimentally. Besides, a mathematical model comprehensively combining bacterial swimming and motion with flow is proposed for the simulation of bacterial locomotion and attachment in flow. Both experimental and theoretical results revealed that attached bacteria density increases with decreasing boundary layer thickness on both flat and circular surfaces, the consequence of which is inherently related to the competitionmore » between bacterial swimming and the non-slip motion with flow evaluated by the Péclet number. In the boundary layer, where the Péclet number is relatively higher, bacterial locomotion mainly depends on bacterial swimming. Thinner boundary layer promotes bacterial swimming towards the surface, leading to higher attachment density. To enhance the performance of biofilm reactors, it is effective to reduce the boundary layer thickness on desired surfaces. - Highlights: • Study of bacterial locomotion in flow as an early stage in biofilm formation. • Mathematical model combining bacterial swimming and the motion with flow. • Boundary layer plays a key role in bacterial attachment under flow condition. • The competition between bacterial swimming and the motion with flow is evaluated.« less

Hydrodebridement of wounds: effectiveness in reducing wound bacterial contamination and potential for air bacterial contamination.

PubMed

Bowling, Frank L; Stickings, Daryl S; Edwards-Jones, Valerie; Armstrong, David G; Boulton, Andrew Jm

2009-05-08

The purpose of this study was to assess the level of air contamination with bacteria after surgical hydrodebridement and to determine the effectiveness of hydro surgery on bacterial reduction of a simulated infected wound. Four porcine samples were scored then infected with a broth culture containing a variety of organisms and incubated at 37 degrees C for 24 hours. The infected samples were then debrided with the hydro surgery tool (Versajet, Smith and Nephew, Largo, Florida, USA). Samples were taken for microbiology, histology and scanning electron microscopy pre-infection, post infection and post debridement. Air bacterial contamination was evaluated before, during and after debridement by using active and passive methods; for active sampling the SAS-Super 90 air sampler was used, for passive sampling settle plates were located at set distances around the clinic room. There was no statistically significant reduction in bacterial contamination of the porcine samples post hydrodebridement. Analysis of the passive sampling showed a significant (p < 0.001) increase in microbial counts post hydrodebridement. Levels ranging from 950 colony forming units per meter cubed (CFUs/m3) to 16780 CFUs/m3 were observed with active sampling of the air whilst using hydro surgery equipment compared with a basal count of 582 CFUs/m3. During removal of the wound dressing, a significant increase was observed relative to basal counts (p < 0.05). Microbial load of the air samples was still significantly raised 1 hour post-therapy. The results suggest a significant increase in bacterial air contamination both by active sampling and passive sampling. We believe that action might be taken to mitigate fallout in the settings in which this technique is used.

Targeting bacterial secretion systems: benefits of disarmament in the microcosm.

PubMed

Baron, Christian; Coombes, Brian

2007-03-01

Secretion systems are used by many bacterial pathogens for the delivery of virulence factors to the extracellular space or directly into host cells. They are attractive targets for the development of novel anti-virulence drugs as their inactivation would lead to pathogen attenuation or avirulence, followed by clearance of the bacteria by the immune system. This review will present the state of knowledge on the assembly and function of type II, type III and type IV secretion systems in Gram-negative bacteria focusing on insights provided by structural analyses of several key components. The suitability of transcription factors regulating the expression of secretion system components and of ATPases, lytic transglycosylases and protein assembly factors as drug targets will be discussed. Recent progress using innovative in vivo as well as in vitro screening strategies led to a first set of secretion system inhibitors with potential for further development as anti-infectives. The discovery of such inhibitors offers exciting and innovative opportunities to further develop these anti-virulence drugs into monotherapy or in combination with classical antibiotics. Bacterial growth per se would not be inhibited by such drugs so that the selection for mutations causing resistance could be reduced. Secretion system inhibitors may therefore avoid many of the problems associated with classical antibiotics and may constitute a valuable addition to our arsenal for the treatment of bacterial infections.

Modeling number of bacteria per food unit in comparison to bacterial concentration in quantitative risk assessment: impact on risk estimates.

PubMed

Pouillot, Régis; Chen, Yuhuan; Hoelzer, Karin

2015-02-01

When developing quantitative risk assessment models, a fundamental consideration for risk assessors is to decide whether to evaluate changes in bacterial levels in terms of concentrations or in terms of bacterial numbers. Although modeling bacteria in terms of integer numbers may be regarded as a more intuitive and rigorous choice, modeling bacterial concentrations is more popular as it is generally less mathematically complex. We tested three different modeling approaches in a simulation study. The first approach considered bacterial concentrations; the second considered the number of bacteria in contaminated units, and the third considered the expected number of bacteria in contaminated units. Simulation results indicate that modeling concentrations tends to overestimate risk compared to modeling the number of bacteria. A sensitivity analysis using a regression tree suggests that processes which include drastic scenarios consisting of combinations of large bacterial inactivation followed by large bacterial growth frequently lead to a >10-fold overestimation of the average risk when modeling concentrations as opposed to bacterial numbers. Alternatively, the approach of modeling the expected number of bacteria in positive units generates results similar to the second method and is easier to use, thus potentially representing a promising compromise. Published by Elsevier Ltd.

Nanoindentation of Pseudomonas aeruginosa bacterial biofilm using atomic force microscopy

NASA Astrophysics Data System (ADS)

Baniasadi, Mahmoud; Xu, Zhe; Gandee, Leah; Du, Yingjie; Lu, Hongbing; Zimmern, Philippe; Minary-Jolandan, Majid

2014-12-01

Bacterial biofilms are a source of many chronic infections. Biofilms and their inherent resistance to antibiotics are attributable to a range of health issues including affecting prosthetic implants, hospital-acquired infections, and wound infection. Mechanical properties of biofilm, in particular, at micro- and nano-scales, are governed by microstructures and porosity of the biofilm, which in turn may contribute to their inherent antibiotic resistance. We utilize atomic force microscopy (AFM)-based nanoindentation and finite element simulation to investigate the nanoscale mechanical properties of Pseudomonas aeruginosa bacterial biofilm. This biofilm was derived from human samples and represents a medically relevant model.

Measurement and modeling of intrinsic transcription terminators

PubMed Central

Cambray, Guillaume; Guimaraes, Joao C.; Mutalik, Vivek K.; Lam, Colin; Mai, Quynh-Anh; Thimmaiah, Tim; Carothers, James M.; Arkin, Adam P.; Endy, Drew

2013-01-01

The reliable forward engineering of genetic systems remains limited by the ad hoc reuse of many types of basic genetic elements. Although a few intrinsic prokaryotic transcription terminators are used routinely, termination efficiencies have not been studied systematically. Here, we developed and validated a genetic architecture that enables reliable measurement of termination efficiencies. We then assembled a collection of 61 natural and synthetic terminators that collectively encode termination efficiencies across an ∼800-fold dynamic range within Escherichia coli. We simulated co-transcriptional RNA folding dynamics to identify competing secondary structures that might interfere with terminator folding kinetics or impact termination activity. We found that structures extending beyond the core terminator stem are likely to increase terminator activity. By excluding terminators encoding such context-confounding elements, we were able to develop a linear sequence-function model that can be used to estimate termination efficiencies (r = 0.9, n = 31) better than models trained on all terminators (r = 0.67, n = 54). The resulting systematically measured collection of terminators should improve the engineering of synthetic genetic systems and also advance quantitative modeling of transcription termination. PMID:23511967

Eye-specification genes in the bacterial light organ of the bobtail squid Euprymna scolopes, and their expression in response to symbiont cues.

PubMed

Peyer, Suzanne M; Pankey, M Sabrina; Oakley, Todd H; McFall-Ngai, Margaret J

2014-02-01

The squid Euprymna scolopes has evolved independent sets of tissues capable of light detection, including a complex eye and a photophore or 'light organ', which houses the luminous bacterial symbiont Vibrio fischeri. As the eye and light organ originate from different embryonic tissues, we examined whether the eye-specification genes, pax6, eya, six, and dac, are shared by these two organs, and if so, whether they are regulated in the light organ by symbiosis. We obtained sequences of the four genes with PCR, confirmed orthology with phylogenetic analysis, and determined that each was expressed in the eye and light organ. With in situ hybridization (ISH), we localized the gene transcripts in developing embryos, comparing the patterns of expression in the two organs. The four transcripts localized to similar tissues, including those associated with the visual system ∼1/4 into embryogenesis (Naef stage 18) and the light organ ∼3/4 into embryogenesis (Naef stage 26). We used ISH and quantitative real-time PCR to examine transcript expression and differential regulation in postembryonic light organs in response to the following colonization conditions: wild-type, luminescent V. fischeri; a mutant strain defective in light production; and as a control, no symbiont. In ISH experiments light organs showed down regulation of the pax6, eya, and six transcripts in response to wild-type V. fischeri. Mutant strains also induced down regulation of the pax6 and eya transcripts, but not of the six transcript. Thus, luminescence was required for down regulation of the six transcript. We discuss these results in the context of symbiont-induced light-organ development. Our study indicates that the eye-specification genes are expressed in light-interacting tissues independent of their embryonic origin and are capable of responding to bacterial cues. These results offer evidence for evolutionary tinkering or the recruitment of eye development genes for use in a light

Eye-specification genes in the bacterial light organ of the bobtail squid Euprymna scolopes, and their expression in response to symbiont cues

PubMed Central

Peyer, Suzanne M.; Pankey, M. Sabrina; Oakley, Todd H.; McFall-Ngai, Margaret J.

2014-01-01

The squid Euprymna scolopes has evolved independent sets of tissues capable of light detection, including a complex eye and a photophore or ‘light organ’, which houses the luminous bacterial symbiont Vibrio fischeri. As the eye and light organ originate from different embryonic tissues, we examined whether the eye-specification genes, pax6, eya, six, and dac, are shared by these two organs, and if so, whether they are regulated in the light organ by symbiosis. We obtained sequences of the four genes with PCR, confirmed orthology with phylogenetic analysis, and determined that each was expressed in the eye and light organ. With in situ hybridization (ISH), we localized the gene transcripts in developing embryos, comparing the patterns of expression in the two organs. The four transcripts localized to similar tissues, including those associated with the visual system ~1/4 into embryogenesis (Naef stage 18) and the light organ ~3/4 into embryogenesis (Naef stage 26). We used ISH and quantitative real-time PCR to examine transcript expression and differential regulation in postembryonic light organs in response to the following colonization conditions: wild-type, luminescent V. fischeri; a mutant strain defective in light production; and as a control, no symbiont. In ISH experiments light organs showed down regulation of the pax6, eya, and six transcripts in response to wild-type V. fischeri. Mutant strains also induced down regulation of the pax6 and eya transcripts, but not of the six transcript. Thus, luminescence was required for down regulation of the six transcript. We discuss these results in the context of symbiont-induced light-organ development. Our study indicates that the eye-specification genes are expressed in light-interacting tissues independent of their embryonic origin and are capable of responding to bacterial cues. These results offer evidence for evolutionary tinkering or the recruitment of eye development genes for use in a light

Klebsiella pneumoniae Siderophores Induce Inflammation, Bacterial Dissemination, and HIF-1α Stabilization during Pneumonia.

PubMed

Holden, Victoria I; Breen, Paul; Houle, Sébastien; Dozois, Charles M; Bachman, Michael A

2016-09-13

Klebsiella pneumoniae is a Gram-negative pathogen responsible for a wide range of infections, including pneumonia and bacteremia, and is rapidly acquiring antibiotic resistance. K. pneumoniae requires secretion of siderophores, low-molecular-weight, high-affinity iron chelators, for bacterial replication and full virulence. The specific combination of siderophores secreted by K. pneumoniae during infection can impact tissue localization, systemic dissemination, and host survival. However, the effect of these potent iron chelators on the host during infection is unknown. In vitro, siderophores deplete epithelial cell iron, induce cytokine secretion, and activate the master transcription factor hypoxia inducible factor-1α (HIF-1α) protein that controls vascular permeability and inflammatory gene expression. Therefore, we hypothesized that siderophore secretion by K. pneumoniae directly contributes to inflammation and bacterial dissemination during pneumonia. To examine the effects of siderophore secretion independently of bacterial growth, we performed infections with tonB mutants that persist in vivo but are deficient in siderophore import. Using a murine model of pneumonia, we found that siderophore secretion by K. pneumoniae induces the secretion of interleukin-6 (IL-6), CXCL1, and CXCL2, as well as bacterial dissemination to the spleen, compared to siderophore-negative mutants at an equivalent bacterial number. Furthermore, we determined that siderophore-secreting K. pneumoniae stabilized HIF-1α in vivo and that bacterial dissemination to the spleen required alveolar epithelial HIF-1α. Our results indicate that siderophores act directly on the host to induce inflammatory cytokines and bacterial dissemination and that HIF-1α is a susceptibility factor for bacterial invasion during pneumonia. Klebsiella pneumoniae causes a wide range of bacterial diseases, including pneumonia, urinary tract infections, and sepsis. To cause infection, K. pneumoniae steals

Bacillus subtilis δ Factor Functions as a Transcriptional Regulator by Facilitating the Open Complex Formation.

PubMed

Prajapati, Ranjit Kumar; Sengupta, Shreya; Rudra, Paulami; Mukhopadhyay, Jayanta

2016-01-15

Most bacterial RNA polymerases (RNAP) contain five conserved subunits, viz. 2α, β, β', and ω. However, in many Gram-positive bacteria, especially in fermicutes, RNAP is associated with an additional factor, called δ. For over three decades since its identification, it had been thought that δ functioned as a subunit of RNAP to enhance the level of transcripts by recycling RNAP. In support of the previous observations, we also find that δ is involved in recycling of RNAP by releasing the RNA from the ternary complex. We further show that δ binds to RNA and is able to recycle RNAP when the length of the nascent RNA reaches a critical length. However, in this work we decipher a new function of δ. Performing biochemical and mutational analysis, we show that Bacillus subtilis δ binds to DNA immediately upstream of the promoter element at A-rich sequences on the abrB and rrnB1 promoters and facilitates open complex formation. As a result, δ facilitates RNAP to initiate transcription in the second scale, compared with minute scale in the absence of δ. Using transcription assay, we show that δ-mediated recycling of RNAP cannot be the sole reason for the enhancement of transcript yield. Our observation that δ does not bind to RNAP holo enzyme but is required to bind to DNA upstream of the -35 promoter element for transcription activation suggests that δ functions as a transcriptional regulator. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

NemR Is a Bleach-sensing Transcription Factor*

PubMed Central

Gray, Michael J.; Wholey, Wei-Yun; Parker, Benjamin W.; Kim, Minwook; Jakob, Ursula

2013-01-01

Hypochlorous acid (HOCl), the active component of household bleach, also functions as a powerful antimicrobial during the innate immune response. Despite its widespread use, surprisingly little is known about how cells sense or respond to HOCl. We now demonstrate that Escherichia coli NemR is a redox-regulated transcriptional repressor, which uses the oxidation status of HOCl-sensitive cysteine residues to respond to bleach and related reactive chlorine species. NemR controls bleach-mediated expression of two enzymes required for detoxification of reactive electrophiles: glyoxalase I and N-ethylmaleimide reductase. Both enzymes contribute to bacterial bleach survival. These results provide evidence that bleach resistance relies on the capacity of organisms to specifically sense reactive chlorine species and respond with the up-regulation of enzymes dedicated to detoxification of methylglyoxal and other reactive electrophiles. PMID:23536188

RsaM: a transcriptional regulator of Burkholderia spp. with novel fold

DOE Office of Scientific and Technical Information (OSTI.GOV)

Michalska, Karolina; Chhor, Gekleng; Clancy, Shonda

2014-07-04

Burkholderia cepacia complex (Bcc) is a set of closely related bacterial species that are notorious pathogens of cystic fibrosis patients, responsible for life-threatening lung infections. Expression of several virulence factors of Bcc is controlled by a mechanism known as quorum sensing (QS). QS is a means of bacterial communication used to coordinate gene expression in a cell-density-dependent manner. The system involves the production of diffusible signaling molecules (N-acyl-L-homoserine lactones, AHLs), that bind to cognate transcriptional regulators and influence their ability to regulate gene expression. One such system that is highly conserved in Bcc consists of CepI and CepR. CepI ismore » AHL synthase, while CepR is an AHL-dependent transcription factor. In most members of the Bcc group, the cepI and cepR genes are divergently transcribed and separated by additional genes. One of them, bcam1869, encodes the BcRsaM protein, which was recently postulated to modulate the abundance or activity of CepI or CepR. Here we show the crystal structure of BcRsaM from B. cenocepacia J2315. It is a single-domain protein with unique topology and presents a novel fold. The protein is a dimer in the crystal and in solution. This regulator has no known DNA binding motifs and direct binding of BcRsaM to the cepI promoter could not be detected in in vitro assays. Therefore, we propose that the modulatory action of RsaM might result from interactions with other components of the QS machinery rather than from direct association with the DNA promoter.« less

Bench-to-bedside review: Quorum sensing and the role of cell-to-cell communication during invasive bacterial infection

PubMed Central

Asad, Shadaba; Opal, Steven M

2008-01-01

Bacteria communicate extensively with each other and employ a communal approach to facilitate survival in hostile environments. A hierarchy of cell-to-cell signaling pathways regulates bacterial growth, metabolism, biofilm formation, virulence expression, and a myriad of other essential functions in bacterial populations. The notion that bacteria can signal each other and coordinate their assault patterns against susceptible hosts is now well established. These signaling networks represent a previously unrecognized survival strategy by which bacterial pathogens evade antimicrobial defenses and overwhelm the host. These quorum sensing communication signals can transgress species barriers and even kingdom barriers. Quorum sensing molecules can regulate human transcriptional programs to the advantage of the pathogen. Human stress hormones and cytokines can be detected by bacterial quorum sensing systems. By this mechanism, the pathogen can detect the physiologically stressed host, providing an opportunity to invade when the patient is most vulnerable. These rather sophisticated, microbial communication systems may prove to be a liability to pathogens as they make convenient targets for therapeutic intervention in our continuing struggle to control microbial pathogens. PMID:19040778

3' rapid amplification of cDNA ends (RACE) walking for rapid structural analysis of large transcripts.

PubMed

Ozawa, Tatsuhiko; Kondo, Masato; Isobe, Masaharu

2004-01-01

The 3' rapid amplification of cDNA ends (3' RACE) is widely used to isolate the cDNA of unknown 3' flanking sequences. However, the conventional 3' RACE often fails to amplify cDNA from a large transcript if there is a long distance between the 5' gene-specific primer and poly(A) stretch, since the conventional 3' RACE utilizes 3' oligo-dT-containing primer complementary to the poly(A) tail of mRNA at the first strand cDNA synthesis. To overcome this problem, we have developed an improved 3' RACE method suitable for the isolation of cDNA derived from very large transcripts. By using the oligonucleotide-containing random 9mer together with the GC-rich sequence for the suppression PCR technology at the first strand of cDNA synthesis, we have been able to amplify the cDNA from a very large transcript, such as the microtubule-actin crosslinking factor 1 (MACF1) gene, which codes a transcript of 20 kb in size. When there is no splicing variant, our highly specific amplification allows us to perform the direct sequencing of 3' RACE products without requiring cloning in bacterial hosts. Thus, this stepwise 3' RACE walking will help rapid characterization of the 3' structure of a gene, even when it encodes a very large transcript.

Antiviral activity and specific modes of action of bacterial prodigiosin against Bombyx mori nucleopolyhedrovirus in vitro.

PubMed

Zhou, Wei; Zeng, Cheng; Liu, RenHua; Chen, Jie; Li, Ru; Wang, XinYan; Bai, WenWen; Liu, XiaoYuan; Xiang, TingTing; Zhang, Lin; Wan, YongJi

2016-05-01

Prodigiosin, the tripyrrole red pigment, is a bacterial secondary metabolite with multiple bioactivities; however, the antiviral activity has not been reported yet. In the present study, we found the antiviral activity of bacterial prodigiosin on Bombyx mori nucleopolyhedrovirus (BmNPV)-infected cells in vitro, with specific modes of action. Prodigiosin at nontoxic concentrations selectively killed virus-infected cells, inhibited viral gene transcription, especially viral early gene ie-1, and prevented virus-mediated membrane fusion. Under prodigiosin treatment, both progeny virus production and viral DNA replication were significantly inhibited. Fluorescent assays showed that prodigiosin predominantly located in cytoplasm which suggested it might interact with cytoplasm factors to inhibit virus replication. In conclusion, the present study clearly indicates that prodigiosin possesses significant antiviral activity against BmNPV.

DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus

DOE PAGES

Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...

2014-08-23

Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less

Antagonistic interactions are sufficient to explain self-assemblage of bacterial communities in a homogeneous environment: a computational modeling approach

PubMed Central

Zapién-Campos, Román; Olmedo-Álvarez, Gabriela; Santillán, Moisés

2015-01-01

Most of the studies in Ecology have been devoted to analyzing the effects the environment has on individuals, populations, and communities, thus neglecting the effects of biotic interactions on the system dynamics. In the present work we study the structure of bacterial communities in the oligotrophic shallow water system of Churince, Cuatro Cienegas, Mexico. Since the physicochemical conditions of this water system are homogeneous and quite stable in time, it is an excellent candidate to study how biotic factors influence the structure of bacterial communities. In a previous study, the binary antagonistic interactions of 78 bacterial strains, isolated from Churince, were experimentally determined. We employ these data to develop a computer algorithm to simulate growth experiments in a cellular grid representing the pond. Remarkably, in our model, the dynamics of all the simulated bacterial populations is determined solely by antagonistic interactions. Our results indicate that all bacterial strains (even those that are antagonized by many other bacteria) survive in the long term, and that the underlying mechanism is the formation of bacterial community patches. Patches corresponding to less antagonistic and highly susceptible strains are consistently isolated from the highly-antagonistic bacterial colonies by patches of neutral strains. These results concur with the observed features of the bacterial community structure previously reported. Finally, we study how our findings depend on factors like initial population size, differential population growth rates, homogeneous population death rates, and enhanced bacterial diffusion. PMID:26052318

Microprocessor mediates transcriptional termination of long noncoding RNA transcripts hosting microRNAs.

PubMed

Dhir, Ashish; Dhir, Somdutta; Proudfoot, Nick J; Jopling, Catherine L

2015-04-01

MicroRNAs (miRNAs) play a major part in the post-transcriptional regulation of gene expression. Mammalian miRNA biogenesis begins with cotranscriptional cleavage of RNA polymerase II (Pol II) transcripts by the Microprocessor complex. Although most miRNAs are located within introns of protein-coding transcripts, a substantial minority of miRNAs originate from long noncoding (lnc) RNAs, for which transcript processing is largely uncharacterized. We show, by detailed characterization of liver-specific lnc-pri-miR-122 and genome-wide analysis in human cell lines, that most lncRNA transcripts containing miRNAs (lnc-pri-miRNAs) do not use the canonical cleavage-and-polyadenylation pathway but instead use Microprocessor cleavage to terminate transcription. Microprocessor inactivation leads to extensive transcriptional readthrough of lnc-pri-miRNA and transcriptional interference with downstream genes. Consequently we define a new RNase III-mediated, polyadenylation-independent mechanism of Pol II transcription termination in mammalian cells.

Co-expression of heat shock protein (HSP) 40 and HSP70 in Pinctada martensii response to thermal, low salinity and bacterial challenges.

PubMed

Li, Jun; Zhang, Yuehuan; Liu, Ying; Zhang, Yang; Xiao, Shu; Yu, Ziniu

2016-01-01

Heat shock protein (HSP) 40 proteins are a family of molecular chaperones that bind to HSP70 through their J-domain and regulate the function of HSP70 by stimulating its adenosine triphosphatase activity. In the present study, a HSP40 homolog named PmHSP40 was cloned from the hemocytes of pearl oyster Pinctada martensii using EST and rapid amplification of cDNA ends (RACE) techniques. The full-length cDNA of PmHSP40 was 1251 bp in length, which included a 5' untranslated region (UTR) of 75 bp, an open reading frame (ORF) of a 663 bp, and a 3' UTR of 513 bp. The deduced amino acid sequence of PmHSP40 contains a J domain in the N-terminus. In response to thermal and low salinity stress challenges, the expression of PmHSP40 in hemocytes and the gill were inducible in a time-dependent manner. After bacterial challenge, PmHSP40 transcripts in hemocytes increased and peaked at 6 h post injection. In the gill, PmHSP40 expression increased, similar to expression in hemocytes; however, transcript expression of PmHSP40 was significantly up-regulated at 12 h post injection. Furthermore, the transcripts of PmHSP70 showed similar kinetics as that of PmHSP40, with highest induction during thermal, low salinity stress and bacterial challenges. Altogether these results demonstrate that PmHSP40 is an inducible protein under thermal, low salinity and bacterial challenges, suggesting its involvement in both environmental and biological stresses, and in the innate immunity of the pearl oyster. Copyright © 2015 Elsevier Ltd. All rights reserved.

[Bacterial meningitis].

PubMed

Brouwer, M C; van de Beek, D

2012-05-01

Bacterial meningitis is a severe disease which affects 35.000 Europeans each year and has a mortality rate of about 20%. During the past 25 years the epidemiology of bacterial meningitis has changed significantly due to the implementation of vaccination against Haemophilus influenzae, Neisseria meningtidis group C and Streptococcus pneumoniae. Due to these vaccines, meningitis is now predominantly a disease occurring in adults, caused especially by Streptococcus pneumoniae, while it was formerly a child disease which was largely caused by Haemophilus influenzae. Bacterial meningitis is often difficult to recognize since the classical presentation with neck stiffness, reduced awareness and fever occurs in less than half of the patients. The only way to diagnose or exclude bacterial meningitis is by performing low-threshold cerebrospinal fluid examination with a suspicion of bacterial meningitis. The treatment consists of the prescription of antibiotics and dexamethasone.

WRKY transcription factors.

PubMed

Rushton, Paul J; Somssich, Imre E; Ringler, Patricia; Shen, Qingxi J

2010-05-01

WRKY transcription factors are one of the largest families of transcriptional regulators in plants and form integral parts of signalling webs that modulate many plant processes. Here, we review recent significant progress in WRKY transcription factor research. New findings illustrate that WRKY proteins often act as repressors as well as activators, and that members of the family play roles in both the repression and de-repression of important plant processes. Furthermore, it is becoming clear that a single WRKY transcription factor might be involved in regulating several seemingly disparate processes. Mechanisms of signalling and transcriptional regulation are being dissected, uncovering WRKY protein functions via interactions with a diverse array of protein partners, including MAP kinases, MAP kinase kinases, 14-3-3 proteins, calmodulin, histone deacetylases, resistance proteins and other WRKY transcription factors. WRKY genes exhibit extensive autoregulation and cross-regulation that facilitates transcriptional reprogramming in a dynamic web with built-in redundancy. 2010 Elsevier Ltd. All rights reserved.

Hindered bacterial mobility in porous media flow enhances dispersion

NASA Astrophysics Data System (ADS)

Dehkharghani, Amin; Waisbord, Nicolas; Dunkel, Jörn; Guasto, Jeffrey

2017-11-01

Swimming bacteria live in porous environments characterized by dynamic fluid flows, where they play a crucial role in processes ranging from the bioremediation to the spread of infections. We study bacterial transport in a quasi-two-dimensional porous microfluidic device, which is complemented by Langevin simulations. The cell trajectories reveal filamentous patterns of high cell concentration, which result from the accumulation of bacteria in the high-shear regions of the flow and their subsequent advection. Moreover, the effective diffusion coefficient of the motile bacteria is severely hindered in the transverse direction to the flow due to decorrelation of the cells' persistent random walk by shear-induced rotation. The hindered lateral diffusion has the surprising consequence of strongly enhancing the longitudinal bacterial transport through a dispersion effect. These results demonstrate the significant role of the flow and geometry in bacterial transport through porous media with potential implications for understanding ecosystem dynamics and engineering bioreactors. NSF CBET-1511340, NSF CAREER-1554095.

Transcriptional Responses to Sucrose Mimic the Plant-Associated Life Style of the Plant Growth Promoting Endophyte Enterobacter sp. 638

DOE PAGES

Taghavi, Safiyh; Wu, Xiao; Ouyang, Liming; ...

2015-01-21

Growth in sucrose medium was previously found to trigger the expression of functions involved in the plant associated life style of the endophytic bacterium Enterobacter sp. 638. Therefore, comparative transcriptome analysis between cultures grown in sucrose or lactate medium was used to gain insights in the expression levels of bacterial functions involved in the endophytic life style of strain 638. Growth on sucrose as a carbon source resulted in major changes in cell physiology, including a shift from a planktonic life style to the formation of bacterial aggregates. This shift was accompanied by a decrease in transcription of genes involvedmore » in motility (e.g. flagella biosynthesis) and an increase in the transcription of genes involved in colonization, adhesion and biofilm formation. The transcription levels of functions previously suggested as being involved in endophytic behavior and functions responsible for plant growth promoting properties, including the synthesis of indole-acetic acid, acetoin and 2,3-butanediol, also increased significantly for cultures grown in sucrose medium. Interestingly, despite an abundance of essential nutrients transcription levels of functions related to uptake and processing of nitrogen and iron became increased for cultures grown on sucrose as sole carbon source. Transcriptome data were also used to analyze putative regulatory relationships. In addition to the small RNA csrABCD regulon, which seems to play a role in the physiological adaptation and possibly the shift between free-living and plant-associated endophytic life style of Enterobacter sp. 638, our results also pointed to the involvement of rcsAB in controlling responses by Enterobacter sp. 638 to a plant-associated life style. Lastly, targeted mutagenesis was used to confirm this role and showed that compared to wild-type Enterobacter sp. 638 a ΔrcsB mutant was affected in its plant growth promoting ability.« less

Transcriptional Responses to Sucrose Mimic the Plant-Associated Life Style of the Plant Growth Promoting Endophyte Enterobacter sp. 638

PubMed Central

Taghavi, Safiyh; Wu, Xiao; Ouyang, Liming; Stadler, Andrea; McCorkle, Sean; Zhu, Wei; Maslov, Sergei; van der Lelie, Daniel

2015-01-01

Growth in sucrose medium was previously found to trigger the expression of functions involved in the plant associated life style of the endophytic bacterium Enterobacter sp. 638. Therefore, comparative transcriptome analysis between cultures grown in sucrose or lactate medium was used to gain insights in the expression levels of bacterial functions involved in the endophytic life style of strain 638. Growth on sucrose as a carbon source resulted in major changes in cell physiology, including a shift from a planktonic life style to the formation of bacterial aggregates. This shift was accompanied by a decrease in transcription of genes involved in motility (e.g. flagella biosynthesis) and an increase in the transcription of genes involved in colonization, adhesion and biofilm formation. The transcription levels of functions previously suggested as being involved in endophytic behavior and functions responsible for plant growth promoting properties, including the synthesis of indole-acetic acid, acetoin and 2,3-butanediol, also increased significantly for cultures grown in sucrose medium. Interestingly, despite an abundance of essential nutrients transcription levels of functions related to uptake and processing of nitrogen and iron became increased for cultures grown on sucrose as sole carbon source. Transcriptome data were also used to analyze putative regulatory relationships. In addition to the small RNA csrABCD regulon, which seems to play a role in the physiological adaptation and possibly the shift between free-living and plant-associated endophytic life style of Enterobacter sp. 638, our results also pointed to the involvement of rcsAB in controlling responses by Enterobacter sp. 638 to a plant-associated life style. Targeted mutagenesis was used to confirm this role and showed that compared to wild-type Enterobacter sp. 638 a ΔrcsB mutant was affected in its plant growth promoting ability. PMID:25607953

Transcriptional responses to sucrose mimic the plant-associated life style of the plant growth promoting endophyte Enterobacter sp. 638.

PubMed

Taghavi, Safiyh; Wu, Xiao; Ouyang, Liming; Zhang, Yian Biao; Stadler, Andrea; McCorkle, Sean; Zhu, Wei; Maslov, Sergei; van der Lelie, Daniel

2015-01-01

Growth in sucrose medium was previously found to trigger the expression of functions involved in the plant associated life style of the endophytic bacterium Enterobacter sp. 638. Therefore, comparative transcriptome analysis between cultures grown in sucrose or lactate medium was used to gain insights in the expression levels of bacterial functions involved in the endophytic life style of strain 638. Growth on sucrose as a carbon source resulted in major changes in cell physiology, including a shift from a planktonic life style to the formation of bacterial aggregates. This shift was accompanied by a decrease in transcription of genes involved in motility (e.g., flagella biosynthesis) and an increase in the transcription of genes involved in colonization, adhesion and biofilm formation. The transcription levels of functions previously suggested as being involved in endophytic behavior and functions responsible for plant growth promoting properties, including the synthesis of indole-acetic acid, acetoin and 2,3-butanediol, also increased significantly for cultures grown in sucrose medium. Interestingly, despite an abundance of essential nutrients transcription levels of functions related to uptake and processing of nitrogen and iron became increased for cultures grown on sucrose as sole carbon source. Transcriptome data were also used to analyze putative regulatory relationships. In addition to the small RNA csrABCD regulon, which seems to play a role in the physiological adaptation and possibly the shift between free-living and plant-associated endophytic life style of Enterobacter sp. 638, our results also pointed to the involvement of rcsAB in controlling responses by Enterobacter sp. 638 to a plant-associated life style. Targeted mutagenesis was used to confirm this role and showed that compared to wild-type Enterobacter sp. 638 a ΔrcsB mutant was affected in its plant growth promoting ability.

Transcriptional Responses to Sucrose Mimic the Plant-Associated Life Style of the Plant Growth Promoting Endophyte Enterobacter sp. 638

DOE Office of Scientific and Technical Information (OSTI.GOV)

Taghavi, Safiyh; Wu, Xiao; Ouyang, Liming

Growth in sucrose medium was previously found to trigger the expression of functions involved in the plant associated life style of the endophytic bacterium Enterobacter sp. 638. Therefore, comparative transcriptome analysis between cultures grown in sucrose or lactate medium was used to gain insights in the expression levels of bacterial functions involved in the endophytic life style of strain 638. Growth on sucrose as a carbon source resulted in major changes in cell physiology, including a shift from a planktonic life style to the formation of bacterial aggregates. This shift was accompanied by a decrease in transcription of genes involvedmore » in motility (e.g. flagella biosynthesis) and an increase in the transcription of genes involved in colonization, adhesion and biofilm formation. The transcription levels of functions previously suggested as being involved in endophytic behavior and functions responsible for plant growth promoting properties, including the synthesis of indole-acetic acid, acetoin and 2,3-butanediol, also increased significantly for cultures grown in sucrose medium. Interestingly, despite an abundance of essential nutrients transcription levels of functions related to uptake and processing of nitrogen and iron became increased for cultures grown on sucrose as sole carbon source. Transcriptome data were also used to analyze putative regulatory relationships. In addition to the small RNA csrABCD regulon, which seems to play a role in the physiological adaptation and possibly the shift between free-living and plant-associated endophytic life style of Enterobacter sp. 638, our results also pointed to the involvement of rcsAB in controlling responses by Enterobacter sp. 638 to a plant-associated life style. Lastly, targeted mutagenesis was used to confirm this role and showed that compared to wild-type Enterobacter sp. 638 a ΔrcsB mutant was affected in its plant growth promoting ability.« less

Genome-Wide Spectra of Transcription Insertions and Deletions Reveal That Slippage Depends on RNA:DNA Hybrid Complementarity.

PubMed

Traverse, Charles C; Ochman, Howard

2017-08-29

. Knowledge of the full extent of sequences subject to transcription indels supports a new model of bacterial transcription slippage, one that relies on the number of complementary bases between the transcript and the DNA template to which it slipped. Copyright © 2017 Traverse and Ochman.

Analysis of bacterial diversity in two oil blocks from two low-permeability reservoirs with high salinities.

PubMed

Xiao, Meng; Sun, Shan-Shan; Zhang, Zhong-Zhi; Wang, Jun-Ming; Qiu, Long-Wei; Sun, Hua-Yang; Song, Zhao-Zheng; Zhang, Bei-Yu; Gao, De-Li; Zhang, Guang-Qing; Wu, Wei-Min

2016-01-20

The community diversities of two oil reservoirs with low permeability of 1.81 × 10(-3) and 2.29 × 10(-3) μm(2) in Changqing, China, were investigated using a high throughput sequencing technique to analyze the influence of biostimulation with a nutrient activator on the bacterial communities. These two blocks differed significantly in salinity (average 17,500 vs 40,900 mg/L). A core simulation test was used to evaluate the effectiveness of indigenous microbial-enhanced oil recovery (MEOR). The results indicated that in the two high salinity oil reservoirs, one reservoir having relatively lower salinity level and a narrow salinity range had higher bacterial and phylogenetic diversity. The addition of the nutrient activator increased the diversity of the bacterial community structure and the diversity differences between the two blocks. The results of the core simulation test showed that the bacterial community in the reservoir with a salinity level of 17,500 mg/L did not show significant higher MEOR efficiency compared with the reservoir with 40,900 mg/L i.e. MEOR efficiency of 8.12% vs 6.56% (test p = 0.291 > 0.05). Therefore, salinity levels affected the bacterial diversities in the two low permeability oil blocks remarkably. But the influence of salinity for the MEOR recovery was slightly.

Estimates of Soil Bacterial Ribosome Content and Diversity Are Significantly Affected by the Nucleic Acid Extraction Method Employed

PubMed Central

Wüst, Pia K.; Nacke, Heiko; Kaiser, Kristin; Marhan, Sven; Sikorski, Johannes; Kandeler, Ellen; Daniel, Rolf

2016-01-01

Modern sequencing technologies allow high-resolution analyses of total and potentially active soil microbial communities based on their DNA and RNA, respectively. In the present study, quantitative PCR and 454 pyrosequencing were used to evaluate the effects of different extraction methods on the abundance and diversity of 16S rRNA genes and transcripts recovered from three different types of soils (leptosol, stagnosol, and gleysol). The quality and yield of nucleic acids varied considerably with respect to both the applied extraction method and the analyzed type of soil. The bacterial ribosome content (calculated as the ratio of 16S rRNA transcripts to 16S rRNA genes) can serve as an indicator of the potential activity of bacterial cells and differed by 2 orders of magnitude between nucleic acid extracts obtained by the various extraction methods. Depending on the extraction method, the relative abundances of dominant soil taxa, in particular Actinobacteria and Proteobacteria, varied by a factor of up to 10. Through this systematic approach, the present study allows guidelines to be deduced for the selection of the appropriate extraction protocol according to the specific soil properties, the nucleic acid of interest, and the target organisms. PMID:26896137

Rational design of chemical genetic probes of RNA function and lead therapeutics targeting repeating transcripts.

PubMed

Disney, Matthew D

2013-12-01

RNA is an important yet vastly underexploited target for small molecule chemical probes or lead therapeutics. Small molecules have been used successfully to modulate the function of the bacterial ribosome, viral RNAs and riboswitches. These RNAs are either highly expressed or can be targeted using substrate mimicry, a mainstay in the design of enzyme inhibitors. However, most cellular RNAs are neither highly expressed nor have a lead small molecule inhibitor, a significant challenge for drug discovery efforts. Herein, I describe the design of small molecules targeting expanded repeating transcripts that cause myotonic muscular dystrophy (DM). These test cases illustrate the challenges of designing small molecules that target RNA and the advantages of targeting repeating transcripts. Lastly, I discuss how small molecules might be more advantageous than oligonucleotides for targeting RNA. Copyright © 2013 Elsevier Ltd. All rights reserved.

Structural, Functional, and Genetic Analysis of Sorangicin Inhibition of Bacterial RNA Polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Campbell,E.; Pavlova, O.; Zenkin, N.

2005-01-01

A combined structural, functional, and genetic approach was used to investigate inhibition of bacterial RNA polymerase (RNAP) by sorangicin (Sor), a macrolide polyether antibiotic. Sor lacks chemical and structural similarity to the ansamycin rifampicin (Rif), an RNAP inhibitor widely used to treat tuberculosis. Nevertheless, structural analysis revealed Sor binds in the same RNAP {beta} subunit pocket as Rif, with almost complete overlap of RNAP binding determinants, and functional analysis revealed that both antibiotics inhibit transcription by directly blocking the path of the elongating transcript at a length of 2-3 nucleotides. Genetic analysis indicates that Rif binding is extremely sensitive tomore » mutations expected to change the shape of the antibiotic binding pocket, while Sor is not. We suggest that conformational flexibility of Sor, in contrast to the rigid conformation of Rif, allows Sor to adapt to changes in the binding pocket. This has important implications for drug design against rapidly mutating targets.« less

The Yersinia pestis Rcs phosphorelay inhibits biofilm formation by repressing transcription of the diguanylate cyclase gene hmsT.

PubMed

Sun, Yi-Cheng; Guo, Xiao-Peng; Hinnebusch, B Joseph; Darby, Creg

2012-04-01

Yersinia pestis, which causes bubonic plague, forms biofilms in fleas, its insect vectors, as a means to enhance transmission. Biofilm development is positively regulated by hmsT, encoding a diguanylate cyclase that synthesizes the bacterial second messenger cyclic-di-GMP. Biofilm development is negatively regulated by the Rcs phosphorelay signal transduction system. In this study, we show that Rcs-negative regulation is accomplished by repressing transcription of hmsT.

Simulated Microgravity Regulates Gene Transcript Profiles of 2T3 Preosteoblasts: Comparison of the Random Positioning Machine and the Rotating Wall Vessel Bioreactor

NASA Technical Reports Server (NTRS)

Patel, Mamta J.; Liu, Wenbin; Sykes, Michelle C.; Ward, Nancy E.; Risin, Semyon A.; Risin, Diana; Hanjoong, Jo

2007-01-01

Microgravity of spaceflight induces bone loss due in part to decreased bone formation by osteoblasts. We have previously examined the microgravity-induced changes in gene expression profiles in 2T3 preosteoblasts using the Random Positioning Machine (RPM) to simulate microgravity conditions. Here, we hypothesized that exposure of preosteoblasts to an independent microgravity simulator, the Rotating Wall Vessel (RWV), induces similar changes in differentiation and gene transcript profiles, resulting in a more confined list of gravi-sensitive genes that may play a role in bone formation. In comparison to static 1g controls, exposure of 2T3 cells to RWV for 3 days inhibited alkaline phosphatase activity, a marker of differentiation, and downregulated 61 genes and upregulated 45 genes by more than two-fold as shown by microarray analysis. The microarray results were confirmed with real time PCR for downregulated genes osteomodulin, bone morphogenic protein 4 (BMP4), runx2, and parathyroid hormone receptor 1. Western blot analysis validated the expression of three downregulated genes, BMP4, peroxiredoxin IV, and osteoglycin, and one upregulated gene peroxiredoxin I. Comparison of the microarrays from the RPM and the RWV studies identified 14 gravi-sensitive genes that changed in the same direction in both systems. Further comparison of our results to a published database showing gene transcript profiles of mechanically loaded mouse tibiae revealed 16 genes upregulated by the loading that were shown to be downregulated by RWV and RPM. These mechanosensitive genes identified by the comparative studies may provide novel insights into understanding the mechanisms regulating bone formation and potential targets of countermeasure against decreased bone formation both in astronauts and in general patients with musculoskeletal disorders.

Production of Phloroglucinol, a Platform Chemical, in Arabidopsis using a Bacterial Gene.

PubMed

Abdel-Ghany, Salah E; Day, Irene; Heuberger, Adam L; Broeckling, Corey D; Reddy, Anireddy S N

2016-12-07

Phloroglucinol (1,3,5-trihydroxybenzene; PG) and its derivatives are phenolic compounds that are used for various industrial applications. Current methods to synthesize PG are not sustainable due to the requirement for carbon-based precursors and co-production of toxic byproducts. Here, we describe a more sustainable production of PG using plants expressing a native bacterial or a codon-optimized synthetic PhlD targeted to either the cytosol or chloroplasts. Transgenic lines were analyzed for the production of PG using gas and liquid chromatography coupled to mass spectroscopy. Phloroglucinol was produced in all transgenic lines and the line with the highest PhlD transcript level showed the most accumulation of PG. Over 80% of the produced PG was glycosylated to phlorin. Arabidopsis leaves have the machinery to glycosylate PG to form phlorin, which can be hydrolyzed enzymatically to produce PG. Furthermore, the metabolic profile of plants with PhlD in either the cytosol or chloroplasts was altered. Our results provide evidence that plants can be engineered to produce PG using a bacterial gene. Phytoproduction of PG using a bacterial gene paves the way for further genetic manipulations to enhance the level of PG with implications for the commercial production of this important platform chemical in plants.

Crystal structure of enterococcus faecalis sly A-like transcriptional factor.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, R.; Zhang, R.; Zagnitko, O.

2003-05-30

The crystal structure of a SlyA transcriptional regulator at 1.6 {angstrom} resolution is presented, and structural relationships between members of the MarR/SlyA family are discussed. The SlyA family, which includes SlyA, Rap, Hor, and RovA proteins, is widely distributed in bacterial and archaeal genomes. Current evidence suggests that SlyA-like factors act as repressors, activators, and modulators of gene transcription. These proteins have been shown to up-regulate the expression of molecular chaperones, acid-resistance proteins, and cytolysin, and down-regulate several biosynthetic enzymes. The structure of SlyA from Enterococcus faecalis, determined as a part of an ongoing structural genomics initiative (www.mcsg.anl.gov), revealed themore » same winged helix DNA-binding motif that was recently found in the MarR repressor from Escherichia coli and the MexR repressor from Pseudomonas aeruginosa, a sequence homologue of MarR. Phylogenetic analysis of the MarR/SlyA family suggests that Sly is placed between the SlyA and MarR subfamilies and shows significant sequence similarity to members of both subfamilies.« less

CpsR, a GntR family regulator, transcriptionally regulates capsular polysaccharide biosynthesis and governs bacterial virulence in Streptococcus pneumoniae.

PubMed

Wu, Kaifeng; Xu, Hongmei; Zheng, Yuqiang; Wang, Libin; Zhang, Xuemei; Yin, Yibing

2016-07-08

Transcriptional regulation of capsule expression is critical for pneumococcal transition from carriage to infection, yet the underlying mechanism remains incompletely understood. Here, we describe the regulation of capsular polysaccharide, one of the most important pneumococcal virulence factor by a GntR family regulator, CpsR. Electrophoretic mobility-shift assays have shown the direct interaction between CpsR and the cps promoter (cpsp), and their interaction could be competitively interfered by glucose. DNase I footprinting assays localized the binding site to a region -146 to -114 base pairs relative to the transcriptional start site of the cps locus in S. pneumoniae D39. We found that CpsR negatively controlled the transcription of the cps locus and hence CPS production, which was confirmed by fine-tuning expression of CpsR in a ΔcpsR complemented strain. Increased expression of CpsR in complemented strain led to a decreased resistance to the whole-blood-mediated killing, suggesting a protective role for CpsR-cpsp interaction in the establishment of invasive infection. Finally, animal experiments showed that CpsR-cpsp interaction was necessary for both pneumococcal colonization and invasive infection. Taken together, our results provide a thorough insight into the regulation of capsule production mediated by CpsR and its important roles in pneumococcal pathogenesis.

Leveraging transcript quantification for fast computation of alternative splicing profiles.

PubMed

Alamancos, Gael P; Pagès, Amadís; Trincado, Juan L; Bellora, Nicolás; Eyras, Eduardo

2015-09-01

Alternative splicing plays an essential role in many cellular processes and bears major relevance in the understanding of multiple diseases, including cancer. High-throughput RNA sequencing allows genome-wide analyses of splicing across multiple conditions. However, the increasing number of available data sets represents a major challenge in terms of computation time and storage requirements. We describe SUPPA, a computational tool to calculate relative inclusion values of alternative splicing events, exploiting fast transcript quantification. SUPPA accuracy is comparable and sometimes superior to standard methods using simulated as well as real RNA-sequencing data compared with experimentally validated events. We assess the variability in terms of the choice of annotation and provide evidence that using complete transcripts rather than more transcripts per gene provides better estimates. Moreover, SUPPA coupled with de novo transcript reconstruction methods does not achieve accuracies as high as using quantification of known transcripts, but remains comparable to existing methods. Finally, we show that SUPPA is more than 1000 times faster than standard methods. Coupled with fast transcript quantification, SUPPA provides inclusion values at a much higher speed than existing methods without compromising accuracy, thereby facilitating the systematic splicing analysis of large data sets with limited computational resources. The software is implemented in Python 2.7 and is available under the MIT license at https://bitbucket.org/regulatorygenomicsupf/suppa. © 2015 Alamancos et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Inhibition of master transcription factors in pluripotent cells induces early stage differentiation

PubMed Central

De, Debojyoti; Jeong, Myong-Ho; Leem, Young-Eun; Svergun, Dmitri I.; Wemmer, David E.; Kang, Jong-Sun; Kim, Kyeong Kyu; Kim, Sung-Hou

2014-01-01

The potential for pluripotent cells to differentiate into diverse specialized cell types has given much hope to the field of regenerative medicine. Nevertheless, the low efficiency of cell commitment has been a major bottleneck in this field. Here we provide a strategy to enhance the efficiency of early differentiation of pluripotent cells. We hypothesized that the initial phase of differentiation can be enhanced if the transcriptional activity of master regulators of stemness is suppressed, blocking the formation of functional transcriptomes. However, an obstacle is the lack of an efficient strategy to block protein–protein interactions. In this work, we take advantage of the biochemical property of seventeen kilodalton protein (Skp), a bacterial molecular chaperone that binds directly to sex determining region Y-box 2 (Sox2). The small angle X-ray scattering analyses provided a low resolution model of the complex and suggested that the transactivation domain of Sox2 is probably wrapped in a cleft on Skp trimer. Upon the transduction of Skp into pluripotent cells, the transcriptional activity of Sox2 was inhibited and the expression of Sox2 and octamer-binding transcription factor 4 was reduced, which resulted in the expression of early differentiation markers and appearance of early neuronal and cardiac progenitors. These results suggest that the initial stage of differentiation can be accelerated by inhibiting master transcription factors of stemness. This strategy can possibly be applied to increase the efficiency of stem cell differentiation into various cell types and also provides a clue to understanding the mechanism of early differentiation. PMID:24434556

Cross-species transcriptional network analysis reveals conservation and variation in response to metal stress in cyanobacteria

PubMed Central

2013-01-01

Background As one of the most dominant bacterial groups on Earth, cyanobacteria play a pivotal role in the global carbon cycling and the Earth atmosphere composition. Understanding their molecular responses to environmental perturbations has important scientific and environmental values. Since important biological processes or networks are often evolutionarily conserved, the cross-species transcriptional network analysis offers a useful strategy to decipher conserved and species-specific transcriptional mechanisms that cells utilize to deal with various biotic and abiotic disturbances, and it will eventually lead to a better understanding of associated adaptation and regulatory networks. Results In this study, the Weighted Gene Co-expression Network Analysis (WGCNA) approach was used to establish transcriptional networks for four important cyanobacteria species under metal stress, including iron depletion and high copper conditions. Cross-species network comparison led to discovery of several core response modules and genes possibly essential to metal stress, as well as species-specific hub genes for metal stresses in different cyanobacteria species, shedding light on survival strategies of cyanobacteria responding to different environmental perturbations. Conclusions The WGCNA analysis demonstrated that the application of cross-species transcriptional network analysis will lead to novel insights to molecular response to environmental changes which will otherwise not be achieved by analyzing data from a single species. PMID:23421563

Dissecting the protein architecture of DNA-binding transcription factors in bacteria and archaea.

PubMed

Rivera-Gómez, Nancy; Martínez-Núñez, Mario Alberto; Pastor, Nina; Rodriguez-Vazquez, Katya; Perez-Rueda, Ernesto

2017-08-01

Gene regulation at the transcriptional level is a central process in all organisms where DNA-binding transcription factors play a fundamental role. This class of proteins binds specifically at DNA sequences, activating or repressing gene expression as a function of the cell's metabolic status, operator context and ligand-binding status, among other factors, through the DNA-binding domain (DBD). In addition, TFs may contain partner domains (PaDos), which are involved in ligand binding and protein-protein interactions. In this work, we systematically evaluated the distribution, abundance and domain organization of DNA-binding TFs in 799 non-redundant bacterial and archaeal genomes. We found that the distributions of the DBDs and their corresponding PaDos correlated with the size of the genome. We also identified specific combinations between the DBDs and their corresponding PaDos. Within each class of DBDs there are differences in the actual angle formed at the dimerization interface, responding to the presence/absence of ligands and/or crystallization conditions, setting the orientation of the resulting helices and wings facing the DNA. Our results highlight the importance of PaDos as central elements that enhance the diversity of regulatory functions in all bacterial and archaeal organisms, and our results also demonstrate the role of PaDos in sensing diverse signal compounds. The highly specific interactions between DBDs and PaDos observed in this work, together with our structural analysis highlighting the difficulty in predicting both inter-domain geometry and quaternary structure, suggest that these systems appeared once and evolved with diverse duplication events in all the analysed organisms.

Dynamics of Immune System Gene Expression upon Bacterial Challenge and Wounding in a Social Insect (Bombus terrestris)

PubMed Central

Erler, Silvio; Popp, Mario; Lattorff, H. Michael G.

2011-01-01

The innate immune system which helps individuals to combat pathogens comprises a set of genes representing four immune system pathways (Toll, Imd, JNK and JAK/STAT). There is a lack of immune genes in social insects (e.g. honeybees) when compared to Diptera. Potentially, this might be compensated by an advanced system of social immunity (synergistic action of several individuals). The bumble bee, Bombus terrestris, is a primitively eusocial species with an annual life cycle and colonies headed by a single queen. We used this key pollinator to study the temporal dynamics of immune system gene expression in response to wounding and bacterial challenge. Antimicrobial peptides (AMP) (abaecin, defensin 1, hymenoptaecin) were strongly up-regulated by wounding and bacterial challenge, the latter showing a higher impact on the gene expression level. Sterile wounding down-regulated TEP A, an effector gene of the JAK/STAT pathway, and bacterial infection influenced genes of the Imd (relish) and JNK pathway (basket). Relish was up-regulated within the first hour after bacterial challenge, but decreased strongly afterwards. AMP expression following wounding and bacterial challenge correlates with the expression pattern of relish whereas correlated expression with dorsal was absent. Although expression of AMPs was high, continuous bacterial growth was observed throughout the experiment. Here we demonstrate for the first time the temporal dynamics of immune system gene expression in a social insect. Wounding and bacterial challenge affected the innate immune system significantly. Induction of AMP expression due to wounding might comprise a pre-adaptation to accompanying bacterial infections. Compared with solitary species this social insect exhibits reduced immune system efficiency, as bacterial growth could not be inhibited. A negative feedback loop regulating the Imd-pathway is suggested. AMPs, the end product of the Imd-pathway, inhibited the up-regulation of the

MITIE: Simultaneous RNA-Seq-based transcript identification and quantification in multiple samples.

PubMed

Behr, Jonas; Kahles, André; Zhong, Yi; Sreedharan, Vipin T; Drewe, Philipp; Rätsch, Gunnar

2013-10-15

High-throughput sequencing of mRNA (RNA-Seq) has led to tremendous improvements in the detection of expressed genes and reconstruction of RNA transcripts. However, the extensive dynamic range of gene expression, technical limitations and biases, as well as the observed complexity of the transcriptional landscape, pose profound computational challenges for transcriptome reconstruction. We present the novel framework MITIE (Mixed Integer Transcript IdEntification) for simultaneous transcript reconstruction and quantification. We define a likelihood function based on the negative binomial distribution, use a regularization approach to select a few transcripts collectively explaining the observed read data and show how to find the optimal solution using Mixed Integer Programming. MITIE can (i) take advantage of known transcripts, (ii) reconstruct and quantify transcripts simultaneously in multiple samples, and (iii) resolve the location of multi-mapping reads. It is designed for genome- and assembly-based transcriptome reconstruction. We present an extensive study based on realistic simulated RNA-Seq data. When compared with state-of-the-art approaches, MITIE proves to be significantly more sensitive and overall more accurate. Moreover, MITIE yields substantial performance gains when used with multiple samples. We applied our system to 38 Drosophila melanogaster modENCODE RNA-Seq libraries and estimated the sensitivity of reconstructing omitted transcript annotations and the specificity with respect to annotated transcripts. Our results corroborate that a well-motivated objective paired with appropriate optimization techniques lead to significant improvements over the state-of-the-art in transcriptome reconstruction. MITIE is implemented in C++ and is available from http://bioweb.me/mitie under the GPL license.

One-step affinity tag purification of full-length recombinant human AP-1 complexes from bacterial inclusion bodies using a polycistronic expression system

PubMed Central

Wang, Wei-Ming; Lee, A-Young; Chiang, Cheng-Ming

2008-01-01

The AP-1 transcription factor is a dimeric protein complex formed primarily between Jun (c-Jun, JunB, JunD) and Fos (c-Fos, FosB, Fra-1, Fra-2) family members. These distinct AP-1 complexes are expressed in many cell types and modulate target gene expression implicated in cell proliferation, differentiation, and stress responses. Although the importance of AP-1 has long been recognized, the biochemical characterization of AP-1 remains limited in part due to the difficulty in purifying full-length, reconstituted dimers with active DNA-binding and transcriptional activity. Using a combination of bacterial coexpression and epitope-tagging methods, we successfully purified all 12 heterodimers (3 Jun × 4 Fos) of full-length human AP-1 complexes as well as c-Jun/c-Jun, JunD/JunD, and c-Jun/JunD dimers from bacterial inclusion bodies using one-step nickel-NTA affinity tag purification following denaturation and renaturation of coexpressed AP-1 subunits. Coexpression of two constitutive components in a dimeric AP-1 complex helps stabilize the proteins when compared with individual protein expression in bacteria. Purified dimeric AP-1 complexes are functional in sequence-specific DNA binding, as illustrated by electrophoretic mobility shift assays and DNase I footprinting, and are also active in transcription with in vitro-reconstituted human papillomavirus (HPV) chromatin containing AP-1-binding sites in the native configuration of HPV nucleosomes. The availability of these recombinant full-length human AP-1 complexes has greatly facilitated mechanistic studies of AP-1-regulated gene transcription in many biological systems. PMID:18329890

Directing traffic on DNA-How transcription factors relieve or induce transcriptional interference.

PubMed

Hao, Nan; Palmer, Adam C; Dodd, Ian B; Shearwin, Keith E

2017-03-15

Transcriptional interference (TI) is increasingly recognized as a widespread mechanism of gene control, particularly given the pervasive nature of transcription, both sense and antisense, across all kingdoms of life. Here, we discuss how transcription factor binding kinetics strongly influence the ability of a transcription factor to relieve or induce TI.

An Iterative Time Windowed Signature Algorithm for Time Dependent Transcription Module Discovery

PubMed Central

Meng, Jia; Gao, Shou-Jiang; Huang, Yufei

2010-01-01

An algorithm for the discovery of time varying modules using genome-wide expression data is present here. When applied to large-scale time serious data, our method is designed to discover not only the transcription modules but also their timing information, which is rarely annotated by the existing approaches. Rather than assuming commonly defined time constant transcription modules, a module is depicted as a set of genes that are co-regulated during a specific period of time, i.e., a time dependent transcription module (TDTM). A rigorous mathematical definition of TDTM is provided, which is serve as an objective function for retrieving modules. Based on the definition, an effective signature algorithm is proposed that iteratively searches the transcription modules from the time series data. The proposed method was tested on the simulated systems and applied to the human time series microarray data during Kaposi's sarcoma-associated herpesvirus (KSHV) infection. The result has been verified by Expression Analysis Systematic Explorer. PMID:21552463

Strontium Incorporation Into Calcite Generated by Bacterial Ureolysis

NASA Astrophysics Data System (ADS)

Fujita, Y.; Ingram, J. A.; Cortez, M. M.; Redden, G. D.; Smith, R. W.

2002-12-01

Strontium incorporation into calcite generated by bacterial ureolytic activity was investigated as part of a larger effort to evaluate the use of in situ urea hydrolysis for accelerating co-precipitation of trace metals and radionuclides in contaminated aquifers. 90Sr, a uranium fission product with a half-life of 29 years, is a significant subsurface contaminant at several Department of Energy facilities and could be immobilized using this remediation strategy. Experiments were conducted in a medium designed to simulate the groundwater of the Snake River Plain Aquifer in eastern Idaho, amended with strontium. Initially the solution was undersaturated with respect to calcite. As a model ureolytic organism, we used Bacillus pasteurii, a well-characterized bacterium known for high urease activity and previously shown to induce calcite precipitation in urea-amended medium. To gain information on the effect of the bacterial surfaces, we also looked at precipitation in the presence of a bacterial species that did not hydrolyze urea, as well as in the absence of bacteria. In the absence of bacterial ureolysis, carbonate precipitation was induced by addition of ammonium carbonate. All products were identified as calcite by X-ray diffraction. Strontium uptake was observed in all cases, but was greatest in the system including bacterial ureolysis. Sputter depth element profiling by time-of-flight secondary ion mass spectrometry (TOF-SIMS) confirmed this finding, showing highest Sr:Ca ratios in the bacterially generated calcite throughout the depth (~350 nm) investigated. Environmental Scanning Electron Microscopy (ESEM) of the solids revealed regular crystals containing the outlines of embedded or entombed bacterial cells, suggesting that calcite precipitated directly on the cell surfaces when present. Analysis by X-ray Absorption Near Edge Spectroscopy (XANES) indicated that in both the biotically and abiotically generated calcites the Sr was incorporated into the calcite

Computing algebraic transfer entropy and coupling directions via transcripts

NASA Astrophysics Data System (ADS)

Amigó, José M.; Monetti, Roberto; Graff, Beata; Graff, Grzegorz

2016-11-01

Most random processes studied in nonlinear time series analysis take values on sets endowed with a group structure, e.g., the real and rational numbers, and the integers. This fact allows to associate with each pair of group elements a third element, called their transcript, which is defined as the product of the second element in the pair times the first one. The transfer entropy of two such processes is called algebraic transfer entropy. It measures the information transferred between two coupled processes whose values belong to a group. In this paper, we show that, subject to one constraint, the algebraic transfer entropy matches the (in general, conditional) mutual information of certain transcripts with one variable less. This property has interesting practical applications, especially to the analysis of short time series. We also derive weak conditions for the 3-dimensional algebraic transfer entropy to yield the same coupling direction as the corresponding mutual information of transcripts. A related issue concerns the use of mutual information of transcripts to determine coupling directions in cases where the conditions just mentioned are not fulfilled. We checked the latter possibility in the lowest dimensional case with numerical simulations and cardiovascular data, and obtained positive results.

The transcription factor Mlc promotes Vibrio cholerae biofilm formation through repression of phosphotransferase system components.

PubMed

Pickering, Bradley S; Lopilato, Jane E; Smith, Daniel R; Watnick, Paula I

2014-07-01

The phosphoenol phosphotransferase system (PTS) is a multicomponent signal transduction cascade that regulates diverse aspects of bacterial cellular physiology in response to the availability of high-energy sugars in the environment. Many PTS components are repressed at the transcriptional level when the substrates they transport are not available. In Escherichia coli, the transcription factor Mlc (for makes large colonies) represses transcription of the genes encoding enzyme I (EI), histidine protein (HPr), and the glucose-specific enzyme IIBC (EIIBC(Glc)) in defined media that lack PTS substrates. When glucose is present, the unphosphorylated form of EIIBC(Glc) sequesters Mlc to the cell membrane, preventing its interaction with DNA. Very little is known about Vibrio cholerae Mlc. We found that V. cholerae Mlc activates biofilm formation in LB broth but not in defined medium supplemented with either pyruvate or glucose. Therefore, we questioned whether V. cholerae Mlc functions differently than E. coli Mlc. Here we have shown that, like E. coli Mlc, V. cholerae Mlc represses transcription of PTS components in both defined medium and LB broth and that E. coli Mlc is able to rescue the biofilm defect of a V. cholerae Δmlc mutant. Furthermore, we provide evidence that Mlc indirectly activates transcription of the vps genes by repressing expression of EI. Because activation of the vps genes by Mlc occurs under only a subset of the conditions in which repression of PTS components is observed, we conclude that additional inputs present in LB broth are required for activation of vps gene transcription by Mlc. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

A Plant Immune Receptor Detects Pathogen Effectors that Target WRKY Transcription Factors.

PubMed

Sarris, Panagiotis F; Duxbury, Zane; Huh, Sung Un; Ma, Yan; Segonzac, Cécile; Sklenar, Jan; Derbyshire, Paul; Cevik, Volkan; Rallapalli, Ghanasyam; Saucet, Simon B; Wirthmueller, Lennart; Menke, Frank L H; Sohn, Kee Hoon; Jones, Jonathan D G

2015-05-21

Defense against pathogens in multicellular eukaryotes depends on intracellular immune receptors, yet surveillance by these receptors is poorly understood. Several plant nucleotide-binding, leucine-rich repeat (NB-LRR) immune receptors carry fusions with other protein domains. The Arabidopsis RRS1-R NB-LRR protein carries a C-terminal WRKY DNA binding domain and forms a receptor complex with RPS4, another NB-LRR protein. This complex detects the bacterial effectors AvrRps4 or PopP2 and then activates defense. Both bacterial proteins interact with the RRS1 WRKY domain, and PopP2 acetylates lysines to block DNA binding. PopP2 and AvrRps4 interact with other WRKY domain-containing proteins, suggesting these effectors interfere with WRKY transcription factor-dependent defense, and RPS4/RRS1 has integrated a "decoy" domain that enables detection of effectors that target WRKY proteins. We propose that NB-LRR receptor pairs, one member of which carries an additional protein domain, enable perception of pathogen effectors whose function is to target that domain. Copyright © 2015 Elsevier Inc. All rights reserved.

Carbohydrate hydrogels with stabilized phage particles for bacterial biosensing: bacterium diffusion studies.

PubMed

Balcão, Victor M; Barreira, Sérgio V P; Nunes, Thiago M; Chaud, Marco V; Tubino, Matthieu; Vila, Marta M D C

2014-02-01

Bacteriophage particles have been reported as potentially useful in the development of diagnosis tools for pathogenic bacteria as they specifically recognize and lyse bacterial isolates thus confirming the presence of viable cells. One of the most representative microorganisms associated with health care services is the bacterium Pseudomonas aeruginosa, which alone is responsible for nearly 15% of all nosocomial infections. In this context, structural and functional stabilization of phage particles within biopolymeric hydrogels, aiming at producing cheap (chromogenic) bacterial biosensing devices, has been the goal of a previous research effort. For this, a detailed knowledge of the bacterial diffusion profile into the hydrogel core, where the phage particles lie, is of utmost importance. In the present research effort, the bacterial diffusion process into the biopolymeric hydrogel core was mathematically described and the theoretical simulations duly compared with experimental results, allowing determination of the effective diffusion coefficients of P. aeruginosa in the agar and calcium alginate hydrogels tested.

Single transcriptional and translational preQ1 riboswitches adopt similar pre-folded ensembles that follow distinct folding pathways into the same ligand-bound structure

PubMed Central

Suddala, Krishna C.; Rinaldi, Arlie J.; Feng, Jun; Mustoe, Anthony M.; Eichhorn, Catherine D.; Liberman, Joseph A.; Wedekind, Joseph E.; Al-Hashimi, Hashim M.; Brooks, Charles L.; Walter, Nils G.

2013-01-01

Riboswitches are structural elements in the 5′ untranslated regions of many bacterial messenger RNAs that regulate gene expression in response to changing metabolite concentrations by inhibition of either transcription or translation initiation. The preQ1 (7-aminomethyl-7-deazaguanine) riboswitch family comprises some of the smallest metabolite sensing RNAs found in nature. Once ligand-bound, the transcriptional Bacillus subtilis and translational Thermoanaerobacter tengcongensis preQ1 riboswitch aptamers are structurally similar RNA pseudoknots; yet, prior structural studies have characterized their ligand-free conformations as largely unfolded and folded, respectively. In contrast, through single molecule observation, we now show that, at near-physiological Mg2+ concentration and pH, both ligand-free aptamers adopt similar pre-folded state ensembles that differ in their ligand-mediated folding. Structure-based Gō-model simulations of the two aptamers suggest that the ligand binds late (Bacillus subtilis) and early (Thermoanaerobacter tengcongensis) relative to pseudoknot folding, leading to the proposal that the principal distinction between the two riboswitches lies in their relative tendencies to fold via mechanisms of conformational selection and induced fit, respectively. These mechanistic insights are put to the test by rationally designing a single nucleotide swap distal from the ligand binding pocket that we find to predictably control the aptamers′ pre-folded states and their ligand binding affinities. PMID:24003028

How gene order is influenced by the biophysics of transcription regulation

PubMed Central

Kolesov, Grigory; Wunderlich, Zeba; Laikova, Olga N.; Gelfand, Mikhail S.; Mirny, Leonid A.

2007-01-01

What are the forces that shape the structure of prokaryotic genomes: the order of genes, their proximity, and their orientation? Coregulation and coordinated horizontal gene transfer are believed to promote the proximity of functionally related genes and the formation of operons. However, forces that influence the structure of the genome beyond the level of a single operon remain unknown. Here, we show that the biophysical mechanism by which regulatory proteins search for their sites on DNA can impose constraints on genome structure. Using simulations, we demonstrate that rapid and reliable gene regulation requires that the transcription factor (TF) gene be close to the site on DNA the TF has to bind, thus promoting the colocalization of TF genes and their targets on the genome. We use parameters that have been measured in recent experiments to estimate the relevant length and times scales of this process and demonstrate that the search for a cognate site may be prohibitively slow if a TF has a low copy number and is not colocalized. We also analyze TFs and their sites in a number of bacterial genomes, confirm that they are colocalized significantly more often than expected, and show that this observation cannot be attributed to the pressure for coregulation or formation of selfish gene clusters, thus supporting the role of the biophysical constraint in shaping the structure of prokaryotic genomes. Our results demonstrate how spatial organization can influence timing and noise in gene expression. PMID:17709750

Shared and distinct mechanisms of iron acquisition by bacterial and fungal pathogens of humans

PubMed Central

Caza, Mélissa; Kronstad, James W.

2013-01-01

Iron is the most abundant transition metal in the human body and its bioavailability is stringently controlled. In particular, iron is tightly bound to host proteins such as transferrin to maintain homeostasis, to limit potential damage caused by iron toxicity under physiological conditions and to restrict access by pathogens. Therefore, iron acquisition during infection of a human host is a challenge that must be surmounted by every successful pathogenic microorganism. Iron is essential for bacterial and fungal physiological processes such as DNA replication, transcription, metabolism, and energy generation via respiration. Hence, pathogenic bacteria and fungi have developed sophisticated strategies to gain access to iron from host sources. Indeed, siderophore production and transport, iron acquisition from heme and host iron-containing proteins such as hemoglobin and transferrin, and reduction of ferric to ferrous iron with subsequent transport are all strategies found in bacterial and fungal pathogens of humans. This review focuses on a comparison of these strategies between bacterial and fungal pathogens in the context of virulence and the iron limitation that occurs in the human body as a mechanism of innate nutritional defense. PMID:24312900

A human transcription factor in search mode.

PubMed

Hauser, Kevin; Essuman, Bernard; He, Yiqing; Coutsias, Evangelos; Garcia-Diaz, Miguel; Simmerling, Carlos

2016-01-08

Transcription factors (TF) can change shape to bind and recognize DNA, shifting the energy landscape from a weak binding, rapid search mode to a higher affinity recognition mode. However, the mechanism(s) driving this conformational change remains unresolved and in most cases high-resolution structures of the non-specific complexes are unavailable. Here, we investigate the conformational switch of the human mitochondrial transcription termination factor MTERF1, which has a modular, superhelical topology complementary to DNA. Our goal was to characterize the details of the non-specific search mode to complement the crystal structure of the specific binding complex, providing a basis for understanding the recognition mechanism. In the specific complex, MTERF1 binds a significantly distorted and unwound DNA structure, exhibiting a protein conformation incompatible with binding to B-form DNA. In contrast, our simulations of apo MTERF1 revealed significant flexibility, sampling structures with superhelical pitch and radius complementary to the major groove of B-DNA. Docking these structures to B-DNA followed by unrestrained MD simulations led to a stable complex in which MTERF1 was observed to undergo spontaneous diffusion on the DNA. Overall, the data support an MTERF1-DNA binding and recognition mechanism driven by intrinsic dynamics of the MTERF1 superhelical topology. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Tuning of Recombinant Protein Expression in Escherichia coli by Manipulating Transcription, Translation Initiation Rates, and Incorporation of Noncanonical Amino Acids.

PubMed

Schlesinger, Orr; Chemla, Yonatan; Heltberg, Mathias; Ozer, Eden; Marshall, Ryan; Noireaux, Vincent; Jensen, Mogens Høgh; Alfonta, Lital

2017-06-16

Protein synthesis in cells has been thoroughly investigated and characterized over the past 60 years. However, some fundamental issues remain unresolved, including the reasons for genetic code redundancy and codon bias. In this study, we changed the kinetics of the Eschrichia coli transcription and translation processes by mutating the promoter and ribosome binding domains and by using genetic code expansion. The results expose a counterintuitive phenomenon, whereby an increase in the initiation rates of transcription and translation lead to a decrease in protein expression. This effect can be rescued by introducing slow translating codons into the beginning of the gene, by shortening gene length or by reducing initiation rates. On the basis of the results, we developed a biophysical model, which suggests that the density of co-transcriptional-translation plays a role in bacterial protein synthesis. These findings indicate how cells use codon bias to tune translation speed and protein synthesis.

Bayesian estimation of differential transcript usage from RNA-seq data.

PubMed

Papastamoulis, Panagiotis; Rattray, Magnus

2017-11-27

Next generation sequencing allows the identification of genes consisting of differentially expressed transcripts, a term which usually refers to changes in the overall expression level. A specific type of differential expression is differential transcript usage (DTU) and targets changes in the relative within gene expression of a transcript. The contribution of this paper is to: (a) extend the use of cjBitSeq to the DTU context, a previously introduced Bayesian model which is originally designed for identifying changes in overall expression levels and (b) propose a Bayesian version of DRIMSeq, a frequentist model for inferring DTU. cjBitSeq is a read based model and performs fully Bayesian inference by MCMC sampling on the space of latent state of each transcript per gene. BayesDRIMSeq is a count based model and estimates the Bayes Factor of a DTU model against a null model using Laplace's approximation. The proposed models are benchmarked against the existing ones using a recent independent simulation study as well as a real RNA-seq dataset. Our results suggest that the Bayesian methods exhibit similar performance with DRIMSeq in terms of precision/recall but offer better calibration of False Discovery Rate.

Strawberry: Fast and accurate genome-guided transcript reconstruction and quantification from RNA-Seq.

PubMed

Liu, Ruolin; Dickerson, Julie

2017-11-01

We propose a novel method and software tool, Strawberry, for transcript reconstruction and quantification from RNA-Seq data under the guidance of genome alignment and independent of gene annotation. Strawberry consists of two modules: assembly and quantification. The novelty of Strawberry is that the two modules use different optimization frameworks but utilize the same data graph structure, which allows a highly efficient, expandable and accurate algorithm for dealing large data. The assembly module parses aligned reads into splicing graphs, and uses network flow algorithms to select the most likely transcripts. The quantification module uses a latent class model to assign read counts from the nodes of splicing graphs to transcripts. Strawberry simultaneously estimates the transcript abundances and corrects for sequencing bias through an EM algorithm. Based on simulations, Strawberry outperforms Cufflinks and StringTie in terms of both assembly and quantification accuracies. Under the evaluation of a real data set, the estimated transcript expression by Strawberry has the highest correlation with Nanostring probe counts, an independent experiment measure for transcript expression. Strawberry is written in C++14, and is available as open source software at https://github.com/ruolin/strawberry under the MIT license.

The transcriptional response of Escherichia coli to recombinant protein insolubility.

PubMed

Smith, Harold E

2007-03-01

Bacterial production of recombinant proteins offers several advantages over alternative expression methods and remains the system of choice for many structural genomics projects. However, a large percentage of targets accumulate as insoluble inclusion bodies rather than soluble protein, creating a significant bottleneck in the protein production pipeline. Numerous strategies have been reported that can improve in vivo protein solubility, but most do not scale easily for high-throughput expression screening. To understand better the host cell response to the accumulation of insoluble protein, we determined genome-wide changes in bacterial gene expression upon induction of either soluble or insoluble target proteins. By comparing transcriptional profiles for multiple examples from the soluble or insoluble class, we identified a pattern of gene expression that correlates strongly with protein solubility. Direct targets of the sigma32 heat shock sigma factor, which includes genes involved in protein folding and degradation, were highly expressed in response to induction of insoluble protein. This same group of genes was also upregulated by insoluble protein accumulation under a different growth regime, indicating that sigma32-mediated gene expression is a general response to protein insolubility. This knowledge provides a starting point for the rational design of growth parameters and host strains with improved protein solubility characteristics. Summary Problems with protein solubility are frequently encountered when recombinant proteins are expressed in E. coli. The bacterial host responds to this problem by increasing expression of the protein folding machinery via the heat shock sigma factor sigma32. Manipulation of the sigma32 regulon might provide a general mechanism for improving recombinant protein solubility.

Bacterial Adaptation of Respiration from Oxic to Microoxic and Anoxic Conditions: Redox Control

PubMed Central

Bueno, Emilio; Mesa, Socorro; Bedmar, Eulogio J.; Richardson, David J.

2012-01-01

Abstract Under a shortage of oxygen, bacterial growth can be faced mainly by two ATP-generating mechanisms: (i) by synthesis of specific high-affinity terminal oxidases that allow bacteria to use traces of oxygen or (ii) by utilizing other substrates as final electron acceptors such as nitrate, which can be reduced to dinitrogen gas through denitrification or to ammonium. This bacterial respiratory shift from oxic to microoxic and anoxic conditions requires a regulatory strategy which ensures that cells can sense and respond to changes in oxygen tension and to the availability of other electron acceptors. Bacteria can sense oxygen by direct interaction of this molecule with a membrane protein receptor (e.g., FixL) or by interaction with a cytoplasmic transcriptional factor (e.g., Fnr). A third type of oxygen perception is based on sensing changes in redox state of molecules within the cell. Redox-responsive regulatory systems (e.g., ArcBA, RegBA/PrrBA, RoxSR, RegSR, ActSR, ResDE, and Rex) integrate the response to multiple signals (e.g., ubiquinone, menaquinone, redox active cysteine, electron transport to terminal oxidases, and NAD/NADH) and activate or repress target genes to coordinate the adaptation of bacterial respiration from oxic to anoxic conditions. Here, we provide a compilation of the current knowledge about proteins and regulatory networks involved in the redox control of the respiratory adaptation of different bacterial species to microxic and anoxic environments. Antioxid. Redox Signal. 16, 819–852. PMID:22098259

Biophysics and bioinformatics of transcription regulation in bacteria and bacteriophages

NASA Astrophysics Data System (ADS)

Djordjevic, Marko

2005-11-01

Due to rapid accumulation of biological data, bioinformatics has become a very important branch of biological research. In this thesis, we develop novel bioinformatic approaches and aid design of biological experiments by using ideas and methods from statistical physics. Identification of transcription factor binding sites within the regulatory segments of genomic DNA is an important step towards understanding of the regulatory circuits that control expression of genes. We propose a novel, biophysics based algorithm, for the supervised detection of transcription factor (TF) binding sites. The method classifies potential binding sites by explicitly estimating the sequence-specific binding energy and the chemical potential of a given TF. In contrast with the widely used information theory based weight matrix method, our approach correctly incorporates saturation in the transcription factor/DNA binding probability. This results in a significant reduction in the number of expected false positives, and in the explicit appearance---and determination---of a binding threshold. The new method was used to identify likely genomic binding sites for the Escherichia coli TFs, and to examine the relationship between TF binding specificity and degree of pleiotropy (number of regulatory targets). We next address how parameters of protein-DNA interactions can be obtained from data on protein binding to random oligos under controlled conditions (SELEX experiment data). We show that 'robust' generation of an appropriate data set is achieved by a suitable modification of the standard SELEX procedure, and propose a novel bioinformatic algorithm for analysis of such data. Finally, we use quantitative data analysis, bioinformatic methods and kinetic modeling to analyze gene expression strategies of bacterial viruses. We study bacteriophage Xp10 that infects rice pathogen Xanthomonas oryzae. Xp10 is an unusual bacteriophage, which has morphology and genome organization that most closely

Lack of conservation of bacterial type promoters in plastids of Streptophyta

PubMed Central

2010-01-01

We demonstrate the scarcity of conserved bacterial-type promoters in plastids of Streptophyta and report widely conserved promoters only for genes psaA, psbA, psbB, psbE, rbcL. Among the reasonable explanations are: evolutionary changes of sigma subunit paralogs and phage-type RNA polymerases possibly entailing the loss of corresponding nuclear genes, de novo emergence of the promoters, their loss together with plastome genes; functional substitution of the promoter boxes by transcription activation factor binding sites. Reviewers This article was reviewed by Dr. Arcady Mushegian, and by Dr. Alexander Bolshoy and Dr. Yuri Wolf (both nominated by Dr. Purificación López-García). PMID:20459727

Analysis of bacterial diversity in two oil blocks from two low-permeability reservoirs with high salinities

PubMed Central

Xiao, Meng; Sun, Shan-Shan; Zhang, Zhong-Zhi; Wang, Jun-Ming; Qiu, Long-Wei; Sun, Hua-Yang; Song, Zhao-Zheng; Zhang, Bei-Yu; Gao, De-Li; Zhang, Guang-Qing; Wu, Wei-Min

2016-01-01

The community diversities of two oil reservoirs with low permeability of 1.81 × 10−3 and 2.29 × 10−3 μm2 in Changqing, China, were investigated using a high throughput sequencing technique to analyze the influence of biostimulation with a nutrient activator on the bacterial communities. These two blocks differed significantly in salinity (average 17,500 vs 40,900 mg/L). A core simulation test was used to evaluate the effectiveness of indigenous microbial-enhanced oil recovery (MEOR). The results indicated that in the two high salinity oil reservoirs, one reservoir having relatively lower salinity level and a narrow salinity range had higher bacterial and phylogenetic diversity. The addition of the nutrient activator increased the diversity of the bacterial community structure and the diversity differences between the two blocks. The results of the core simulation test showed that the bacterial community in the reservoir with a salinity level of 17,500 mg/L did not show significant higher MEOR efficiency compared with the reservoir with 40,900 mg/L i.e. MEOR efficiency of 8.12% vs 6.56% (test p = 0.291 > 0.05). Therefore, salinity levels affected the bacterial diversities in the two low permeability oil blocks remarkably. But the influence of salinity for the MEOR recovery was slightly. PMID:26786765

Illegitimate transcription: transcription of any gene in any cell type.

PubMed Central

Chelly, J; Concordet, J P; Kaplan, J C; Kahn, A

1989-01-01

Using in vitro amplification of cDNA by the polymerase chain reaction, we have detected spliced transcripts of various tissue-specific genes (genes for anti-Müllerian hormone, beta-globin, aldolase A, and factor VIIIc) in human nonspecific cells, such as fibroblasts, hepatoma cells, and lymphoblasts. In rats, erythroid- and liver-type pyruvate kinase transcripts were also detected in brain, lung, and muscle. The abundance of these "illegitimate" transcripts is very low; yet, their existence and the possibility of amplifying them by the cDNA polymerase chain reaction provide a powerful tool to analyze pathological transcripts of any tissue-specific gene by using any accessible cell. Images PMID:2495532

Population PK Modeling and Target Attainment Simulations to Support Dosing of Ceftaroline Fosamil in Pediatric Patients With Acute Bacterial Skin and Skin Structure Infections and Community-Acquired Bacterial Pneumonia.

PubMed

Riccobene, Todd A; Khariton, Tatiana; Knebel, William; Das, Shampa; Li, James; Jandourek, Alena; Carrothers, Timothy J; Bradley, John S

2017-03-01

Ceftaroline, the active form of the prodrug ceftaroline fosamil, is approved for use in adults with community-acquired bacterial pneumonia (CABP) or acute bacterial skin and skin structure infections (ABSSSI) in the United States and for similar indications in Europe. Pharmacokinetic (PK) data from 5 pediatric (birth to <18 years) studies of ceftaroline fosamil were combined with PK data from adults to update a population PK model for ceftaroline and ceftaroline fosamil. This model, based on a data set including 305 children, was used to conduct simulations to estimate ceftaroline exposures and percentage of time that free drug concentrations were above the minimum inhibitory concentration (%fT>MIC) for pediatric dose regimens. With dose regimens of 8 mg/kg every 8 hours (q8h) in children aged 2 months to <2 years and 12 mg/kg (up to a maximum of 400 mg) q8h in children aged 2 years to <18 years or 600 mg q12h in children aged 12 to <18 years, >90% of children were predicted to achieve a target of 36% fT>MIC at an MIC of 2 mg/L, and >97% were predicted to achieve 44% fT>MIC at an MIC of 1 mg/L. Thus, high PK/pharmacodynamic target attainment would be maintained in children for targets associated with 1-log kill of Staphylococcus aureus and Streptococcus pneumoniae. The predicted ceftaroline exposures for these dose regimens were similar to those in adults given 600 mg q12h ceftaroline fosamil. This work contributed to the approval of dose regimens for children aged 2 months to <18 years by the FDA and EMA, which are presented. © 2016, The American College of Clinical Pharmacology.

Recent Developments in Copper and Zinc Homeostasis in Bacterial Pathogens

PubMed Central

Braymer, Joseph J.; Giedroc, David P.

2014-01-01

Copper and zinc homeostasis systems in pathogenic bacteria are required to resist host efforts to manipulate the availability and toxicity of these metal ions. Central to this microbial adaptive response is the involvement of metal-trafficking and -sensing proteins that ultimately exercise control of metal speciation in the cell. Cu- and Zn-specific metalloregulatory proteins regulate the transcription of metal-responsive genes while metallochaperones and related proteins ensure that these metals are appropriately buffered by the intracellular milieu and delivered to correct intracellular targets. In this review, we summarize recent findings on how bacterial pathogens mount a metal-specific response to derail host efforts to win the “fight over metals.” PMID:24463765

Contributions of in vitro transcription to the understanding of human RNA polymerase III transcription

PubMed Central

Dumay-Odelot, Hélène; Durrieu-Gaillard, Stéphanie; El Ayoubi, Leyla; Parrot, Camila; Teichmann, Martin

2014-01-01

Human RNA polymerase III transcribes small untranslated RNAs that contribute to the regulation of essential cellular processes, including transcription, RNA processing and translation. Analysis of this transcription system by in vitro transcription techniques has largely contributed to the discovery of its transcription factors and to the understanding of the regulation of human RNA polymerase III transcription. Here we review some of the key steps that led to the identification of transcription factors and to the definition of minimal promoter sequences for human RNA polymerase III transcription. PMID:25764111

Splicing and transcription touch base: co-transcriptional spliceosome assembly and function

PubMed Central

Herzel, Lydia; Ottoz, Diana S. M.; Alpert, Tara; Neugebauer, Karla M.

2018-01-01

Several macromolecular machines collaborate to produce eukaryotic messenger RNA. RNA polymerase II (Pol II) translocates along genes that are up to millions of base pairs in length and generates a flexible RNA copy of the DNA template. This nascent RNA harbours introns that are removed by the spliceosome, which is a megadalton ribonucleoprotein complex that positions the distant ends of the intron into its catalytic centre. Emerging evidence that the catalytic spliceosome is physically close to Pol II in vivo implies that transcription and splicing occur on similar timescales and that the transcription and splicing machineries may be spatially constrained. In this Review, we discuss aspects of spliceosome assembly, transcription elongation and other co-transcriptional events that allow the temporal coordination of co-transcriptional splicing. PMID:28792005

Modeling bacterial contamination of fuel ethanol fermentation.

PubMed

Bischoff, Kenneth M; Liu, Siqing; Leathers, Timothy D; Worthington, Ronald E; Rich, Joseph O

2009-05-01

The emergence of antibiotic-resistant bacteria may limit the effectiveness of antibiotics to treat bacterial contamination in fuel ethanol plants, and therefore, new antibacterial intervention methods and tools to test their application are needed. Using shake-flask cultures of Saccharomyces cerevisiae grown on saccharified corn mash and strains of lactic acid bacteria isolated from a dry-grind ethanol facility, a simple model to simulate bacterial contamination and infection was developed. Challenging the model with 10(8) CFU/mL Lactobacillus fermentum decreased ethanol yield by 27% and increased residual glucose from 6.2 to 45.5 g/L. The magnitude of the effect was proportional to the initial bacterial load, with 10(5) CFU/mL L. fermentum still producing an 8% decrease in ethanol and a 3.2-fold increase in residual glucose. Infection was also dependent on the bacterial species used to challenge the fermentation, as neither L. delbrueckii ATCC 4797 nor L. amylovorus 0315-7B produced a significant decrease in ethanol when inoculated at a density of 10(8) CFU/mL. In the shake-flask model, treatment with 2 microg/mL virginiamycin mitigated the infection when challenged with a susceptible strain of L. fermentum (MIC for virginiamycin < or =2 ppm), but treatment was ineffective at treating infection by a resistant strain of L. fermentum (MIC = 16 ppm). The model may find application in developing new antibacterial agents and management practices for use in controlling contamination in the fuel ethanol industry. Copyright 2008 Wiley Periodicals, Inc.

Bacterial meningitis.

PubMed

Heckenberg, Sebastiaan G B; Brouwer, Matthijs C; van de Beek, Diederik

2014-01-01

Bacterial meningitis is a neurologic emergency. Vaccination against common pathogens has decreased the burden of disease. Early diagnosis and rapid initiation of empiric antimicrobial and adjunctive therapy are vital. Therapy should be initiated as soon as blood cultures have been obtained, preceding any imaging studies. Clinical signs suggestive of bacterial meningitis include fever, headache, meningismus, and an altered level of consciousness but signs may be scarce in children, in the elderly, and in meningococcal disease. Host genetic factors are major determinants of susceptibility to meningococcal and pneumococcal disease. Dexamethasone therapy has been implemented as adjunctive treatment of adults with pneumococcal meningitis. Adequate and prompt treatment of bacterial meningitis is critical to outcome. In this chapter we review the epidemiology, pathophysiology, and management of bacterial meningitis. © 2014 Elsevier B.V. All rights reserved.

Facilitated dissociation of transcription factors from single DNA binding sites

PubMed Central

Kamar, Ramsey I.; Banigan, Edward J.; Erbas, Aykut; Giuntoli, Rebecca D.; Olvera de la Cruz, Monica; Johnson, Reid C.; Marko, John F.

2017-01-01

The binding of transcription factors (TFs) to DNA controls most aspects of cellular function, making the understanding of their binding kinetics imperative. The standard description of bimolecular interactions posits that TF off rates are independent of TF concentration in solution. However, recent observations have revealed that proteins in solution can accelerate the dissociation of DNA-bound proteins. To study the molecular basis of facilitated dissociation (FD), we have used single-molecule imaging to measure dissociation kinetics of Fis, a key Escherichia coli TF and major bacterial nucleoid protein, from single dsDNA binding sites. We observe a strong FD effect characterized by an exchange rate ∼1×104 M−1s−1, establishing that FD of Fis occurs at the single-binding site level, and we find that the off rate saturates at large Fis concentrations in solution. Although spontaneous (i.e., competitor-free) dissociation shows a strong salt dependence, we find that FD depends only weakly on salt. These results are quantitatively explained by a model in which partially dissociated bound proteins are susceptible to invasion by competitor proteins in solution. We also report FD of NHP6A, a yeast TF with structure that differs significantly from Fis. We further perform molecular dynamics simulations, which indicate that FD can occur for molecules that interact far more weakly than those that we have studied. Taken together, our results indicate that FD is a general mechanism assisting in the local removal of TFs from their binding sites and does not necessarily require cooperativity, clustering, or binding site overlap. PMID:28364020

Analytic model for ring pattern formation by bacterial swarmers

NASA Astrophysics Data System (ADS)

Arouh, Scott

2001-03-01

We analyze a model proposed by Medvedev, Kaper, and Kopell (the MKK model) for ring formation in two-dimensional bacterial colonies of Proteus mirabilis. We correct the model to formally include a feature crucial of the ring generation mechanism: a bacterial density threshold to the nonlinear diffusivity of the MKK model. We numerically integrate the model equations, and observe the logarithmic profiles of the bacterial densities near the front. These lead us to define a consolidation front distinct from the colony radius. We find that this consolidation front propagates outward toward the colony radius with a nearly constant velocity. We then implement the corrected MKK equations in two dimensions and compare our results with biological experiment. Our numerical results indicate that the two-dimensional corrected MKK model yields smooth (rather than branched) rings, and that colliding colonies merge if grown in phase but not if grown out of phase. We also introduce a model, based on coupling the MKK model to a nutrient field, for simulating experimentally observed branched rings.

G =  MAT: linking transcription factor expression and DNA binding data.

PubMed

Tretyakov, Konstantin; Laur, Sven; Vilo, Jaak

2011-01-31

Transcription factors are proteins that bind to motifs on the DNA and thus affect gene expression regulation. The qualitative description of the corresponding processes is therefore important for a better understanding of essential biological mechanisms. However, wet lab experiments targeted at the discovery of the regulatory interplay between transcription factors and binding sites are expensive. We propose a new, purely computational method for finding putative associations between transcription factors and motifs. This method is based on a linear model that combines sequence information with expression data. We present various methods for model parameter estimation and show, via experiments on simulated data, that these methods are reliable. Finally, we examine the performance of this model on biological data and conclude that it can indeed be used to discover meaningful associations. The developed software is available as a web tool and Scilab source code at http://biit.cs.ut.ee/gmat/.

G = MAT: Linking Transcription Factor Expression and DNA Binding Data

PubMed Central

Tretyakov, Konstantin; Laur, Sven; Vilo, Jaak

2011-01-01

Transcription factors are proteins that bind to motifs on the DNA and thus affect gene expression regulation. The qualitative description of the corresponding processes is therefore important for a better understanding of essential biological mechanisms. However, wet lab experiments targeted at the discovery of the regulatory interplay between transcription factors and binding sites are expensive. We propose a new, purely computational method for finding putative associations between transcription factors and motifs. This method is based on a linear model that combines sequence information with expression data. We present various methods for model parameter estimation and show, via experiments on simulated data, that these methods are reliable. Finally, we examine the performance of this model on biological data and conclude that it can indeed be used to discover meaningful associations. The developed software is available as a web tool and Scilab source code at http://biit.cs.ut.ee/gmat/. PMID:21297945

Nascent RNA kinetics: Transient and steady state behavior of models of transcription

NASA Astrophysics Data System (ADS)

Choubey, Sandeep

2018-02-01

Regulation of transcription is a vital process in cells, but mechanistic details of this regulation still remain elusive. The dominant approach to unravel the dynamics of transcriptional regulation is to first develop mathematical models of transcription and then experimentally test the predictions these models make for the distribution of mRNA and protein molecules at the individual cell level. However, these measurements are affected by a multitude of downstream processes which make it difficult to interpret the measurements. Recent experimental advancements allow for counting the nascent mRNA number of a gene as a function of time at the single-inglr cell level. These measurements closely reflect the dynamics of transcription. In this paper, we consider a general mechanism of transcription with stochastic initiation and deterministic elongation and probe its impact on the temporal behavior of nascent RNA levels. Using techniques from queueing theory, we derive exact analytical expressions for the mean and variance of the nascent RNA distribution as functions of time. We apply these analytical results to obtain the mean and variance of nascent RNA distribution for specific models of transcription. These models of initiation exhibit qualitatively distinct transient behaviors for both the mean and variance which further allows us to discriminate between them. Stochastic simulations confirm these results. Overall the analytical results presented here provide the necessary tools to connect mechanisms of transcription initiation to single-cell measurements of nascent RNA.

WRKY transcription factors

PubMed Central

Bakshi, Madhunita; Oelmüller, Ralf

2014-01-01

WRKY transcription factors are one of the largest families of transcriptional regulators found exclusively in plants. They have diverse biological functions in plant disease resistance, abiotic stress responses, nutrient deprivation, senescence, seed and trichome development, embryogenesis, as well as additional developmental and hormone-controlled processes. WRKYs can act as transcriptional activators or repressors, in various homo- and heterodimer combinations. Here we review recent progress on the function of WRKY transcription factors in Arabidopsis and other plant species such as rice, potato, and parsley, with a special focus on abiotic, developmental, and hormone-regulated processes. PMID:24492469

A Genetic Selection For Neurospora crassa Mutants Altered in Their Light Regulation of Transcription

PubMed Central

Navarro-Sampedro, Laura; Yanofsky, Charles; Corrochano, Luis M.

2008-01-01

Transcription of the Neurospora crassa gene con-10 is induced during conidiation and following exposure of vegetative mycelia to light, but light activation is transient due to photoadaptation. We describe mutational analyses of photoadaptation using a N. crassa strain bearing a translational fusion of con-10, including its regulatory region, to a selectable bacterial gene conferring hygromycin resistance (hph). Growth of this strain was sensitive to hygromycin, upon continuous culture in the light. Five mutants were isolated that were resistant to hygromycin when cultured under constant light. Three mutant strains displayed elevated, sustained accumulation of con-10∷hph mRNA during continued light exposure, suggesting that they bear mutations that reduce or eliminate the presumed light-dependent repression mechanism that blocks con-10 transcription upon prolonged illumination. These mutations altered photoadaptation for only a specific group of genes (con-10 and con-6), suggesting that regulation of photoadaptation is relatively gene specific. The mutations increased light-dependent mRNA accumulation for genes al-1, al-2, and al-3, each required for carotenoid biosynthesis, resulting in a threefold increase in carotenoid accumulation following continuous light exposure. Identification of the altered gene or genes in these mutants may reveal novel proteins that participate in light regulation of gene transcription in fungi. PMID:18202366

Investigating Microbial Activity in Diazotrophic Methane Seep Sediment via Transcript Analysis and Single-Cell FISH-NanoSIMS

NASA Astrophysics Data System (ADS)

Dekas, A. E.; Connon, S. A.; Chadwick, G.; Orphan, V. J.

2012-12-01

Methane seep microbial ecosystems are phylogenetically diverse and physiologically complex, and require culture-independent techniques to accurately investigate metabolic activity. In the present study we combine an RNA analysis of four key microbial genes with FISH-NanoSIMS analysis of single cells to determine the diversity of nitrogen fixing microorganisms (diazotrophs) present at a deep-sea methane-seeping site, as well as investigate the methane-dependency of a variety of community members. Recently, methane-dependent nitrogen fixation was observed in Mound 12 Costa Rica sediments, and was spatially correlated with the abundance of aggregates of anaerobic methanotrophic archaea (ANME) and sulfate reducing bacterial symbionts (SRB). Combined with the detection of 15N uptake from 15N2 in these aggregates, this suggested that the ANME-SRB aggregates are the primary diazotrophs in seep sediment. However, the diversity of dinitrogenase reductase (nifH) sequences recovered from several deep-sea locales, including Mound 12, suggests a greater diversity of diazotrophs in marine sediment. To investigate the activity of these potential diazotrophs in Mound 12 sediment, we investigated a suite of RNA transcripts in 15N2 incubations in both the presence and absence of methane: nifH, bacterial 16S rRNA, methyl coenzyme M reductase A (mcrA), and adenosine-5'-phosposulfate reductase alpha subunit (aprA). No nifH transcripts were recovered in incubations without methane, consistent with previous measurements lacking 15N2 uptake in the same sediments. The activity of the bacterial community in general, assessed by variable transcription, was also greatly affected by the presence or absence of methane. Single-cell fluorescence in situ hybridization coupled to nanoscale secondary ion mass spectrometry (FISH-NanoSIMS) was employed to confirm diazotrophic activity (15N2 uptake) and protein synthesis (15NH4+ uptake) of particular species implicated as ecologically important by the

Widespread anti-sense transcription in apple is correlated with siRNA production and indicates a large potential for transcriptional and/or post-transcriptional control.

PubMed

Celton, Jean-Marc; Gaillard, Sylvain; Bruneau, Maryline; Pelletier, Sandra; Aubourg, Sébastien; Martin-Magniette, Marie-Laure; Navarro, Lionel; Laurens, François; Renou, Jean-Pierre

2014-07-01

Characterizing the transcriptome of eukaryotic organisms is essential for studying gene regulation and its impact on phenotype. The realization that anti-sense (AS) and noncoding RNA transcription is pervasive in many genomes has emphasized our limited understanding of gene transcription and post-transcriptional regulation. Numerous mechanisms including convergent transcription, anti-correlated expression of sense and AS transcripts, and RNAi remain ill-defined. Here, we have combined microarray analysis and high-throughput sequencing of small RNAs (sRNAs) to unravel the complexity of transcriptional and potential post-transcriptional regulation in eight organs of apple (Malus × domestica). The percentage of AS transcript expression is higher than that identified in annual plants such as rice and Arabidopsis thaliana. Furthermore, we show that a majority of AS transcripts are transcribed beyond 3'UTR regions, and may cover a significant portion of the predicted sense transcripts. Finally we demonstrate at a genome-wide scale that anti-sense transcript expression is correlated with the presence of both short (21-23 nt) and long (> 30 nt) siRNAs, and that the sRNA coverage depth varies with the level of AS transcript expression. Our study provides a new insight on the functional role of anti-sense transcripts at the genome-wide level, and a new basis for the understanding of sRNA biogenesis in plants. © 2014 INRA. New Phytologist © 2014 New Phytologist Trust.

Teaching Microbial Growth by Simulation.

ERIC Educational Resources Information Center

Ruiz, A. Fernandez; And Others

1989-01-01

Presented is a simulation program for Apple II computer which assays the effects of a series of variables on bacterial growth and interactions between microbial populations. Results of evaluation of the program with students are summarized. (CW)

Synergistic effects of UVR and simulated stratification on commensalistic algal-bacterial relationship in two optically contrasting oligotrophic Mediterranean lakes

NASA Astrophysics Data System (ADS)

Carrillo, P.; Medina-Sánchez, J. M.; Durán, C.; Herrera, G.; Villafañe, V. E.; Helbling, E. W.

2014-08-01

An indirect effect of global warming is the shallowing epilimnion, causing organisms to be exposed to higher levels of ultraviolet (UVR, 280-400 nm) and photosynthetically active radiation (PAR, 400-700 nm), which could affect primary and bacterial production as well as the commensalistic algal-bacterial relationship. The combined effects of UVR and reduction in the depth of the upper mixed layer (UML) were assessed on variables related to the metabolism of algae and bacteria, during in situ experiments performed with natural microplanktonic communities from two oligotrophic lakes with contrasting UVR-transparency (clear vs. opaque) of southern Spain. The negative UVR effects on epilimnetic primary production (PP) and on heterotrophic bacterial production (HBP), intensified by high mean irradiances, were higher in the UVR-opaque than in the UVR-clear lake, and stronger on the algae than on the heterotrophic bacterial communities. Under UVR and high mean irradiance, the algal-bacterial relationship was strengthened in the UVR-clear lake, where excreted organic carbon (EOC) rates exceeded the bacterial carbon demand (BCD). This did not occur in the UVR-opaque lake. The greater UVR damage to algae and bacteria and the weakening of their commensalistic interaction found in the UVR-opaque lake indicates that these ecosystems would be especially vulnerable to stressors related to global change. Thus, our findings may have important implications for the carbon cycle in oligotrophic lakes of the Mediterranean region.

Forest floor community metatranscriptomes identify fungal and bacterial responses to N deposition in two maple forests

DOE PAGES

Hesse, Cedar N.; Mueller, Rebecca C.; Vuyisich, Momchilo; ...

2015-04-23

Anthropogenic N deposition alters patterns of C and N cycling in temperate forests, where forest floor litter decomposition is a key process mediated by a diverse community of bacteria and fungi. To track forest floor decomposer activity we generated metatranscriptomes that simultaneously surveyed the actively expressed bacterial and eukaryote genes in the forest floor, to compare the impact of N deposition on the decomposers in two natural maple forests in Michigan, USA, where replicate field plots had been amended with N for 16 years. Site and N amendment responses were compared using about 74,000 carbohydrate active enzyme transcript sequences (CAZymes)more » in each metatranscriptome. Parallel ribosomal RNA (rRNA) surveys of bacterial and fungal biomass and taxonomic composition showed no significant differences in either biomass or OTU richness between the two sites or in response to N. Site and N amendment were not significant variables defining bacterial taxonomic composition, but they were significant for fungal community composition, explaining 17 and 14% of the variability, respectively. The relative abundance of expressed bacterial and fungal CAZymes changed significantly with N amendment in one of the forests, and N-response trends were also identified in the second forest. Although the two ambient forests were similar in community biomass, taxonomic structure and active CAZyme profile, the shifts in active CAZyme profiles in response to N-amendment differed between the sites. One site responded with an over-expression of bacterial CAZymes, and the other site responded with an over-expression of both fungal and different bacterial CAZymes. Both sites showed reduced representation of fungal lignocellulose degrading enzymes in N-amendment plots. The metatranscriptome approach provided a holistic assessment of eukaryote and bacterial gene expression and is applicable to other systems where eukaryotes and bacteria interact.« less

Bacterial Trapping in Porous Media Flows

NASA Astrophysics Data System (ADS)

Dehkharghani, Amin; Waisbord, Nicolas; Dunkel, Jörn; Guasto, Jeffrey

2016-11-01

Swimming bacteria inhabit heterogeneous, microstructured environments that are often characterized by complex, ambient flows. Understanding the physical mechanisms underlying cell transport in these systems is key to controlling important processes such as bioremediation in porous soils and infections in human tissues. We study the transport of swimming bacteria (Bacillus subtilis) in quasi-two-dimensional porous microfluidic channels with a range of periodic microstructures and flow strengths. Measured cell trajectories and the local cell number density reveal the formation of filamentous cell concentration patterns within the porous structures. The local cell densification is maximized at shear rates in the range 1-10 s-1, but widely varies with pore geometry and flow topology. Experimental observations are complemented by Langevin simulations to demonstrate that the filamentous patterns result from a coupling of bacterial motility to the complex flow fields via Jeffery orbits, which effectively 'trap' the bacteria on streamlines. The resulting microscopic heterogeneity observed here suppresses bacterial transport and likely has implications for both mixing and cell nutrient uptake in porous media flows. NSF CBET-1511340.

Modeling physiological resistance in bacterial biofilms.

PubMed

Cogan, N G; Cortez, Ricardo; Fauci, Lisa

2005-07-01

A mathematical model of the action of antimicrobial agents on bacterial biofilms is presented. The model includes the fluid dynamics in and around the biofilm, advective and diffusive transport of two chemical constituents and the mechanism of physiological resistance. Although the mathematical model applies in three dimensions, we present two-dimensional simulations for arbitrary biofilm domains and various dosing strategies. The model allows the prediction of the spatial evolution of bacterial population and chemical constituents as well as different dosing strategies based on the fluid motion. We find that the interaction between the nutrient and the antimicrobial agent can reproduce survival curves which are comparable to other model predictions as well as experimental results. The model predicts that exposing the biofilm to low concentration doses of antimicrobial agent for longer time is more effective than short time dosing with high antimicrobial agent concentration. The effects of flow reversal and the roughness of the fluid/biofilm are also investigated. We find that reversing the flow increases the effectiveness of dosing. In addition, we show that overall survival decreases with increasing surface roughness.

Competition between histone and transcription factor binding regulates the onset of transcription in zebrafish embryos.

PubMed

Joseph, Shai R; Pálfy, Máté; Hilbert, Lennart; Kumar, Mukesh; Karschau, Jens; Zaburdaev, Vasily; Shevchenko, Andrej; Vastenhouw, Nadine L

2017-04-20

Upon fertilization, the genome of animal embryos remains transcriptionally inactive until the maternal-to-zygotic transition. At this time, the embryo takes control of its development and transcription begins. How the onset of zygotic transcription is regulated remains unclear. Here, we show that a dynamic competition for DNA binding between nucleosome-forming histones and transcription factors regulates zebrafish genome activation. Taking a quantitative approach, we found that the concentration of non-DNA-bound core histones sets the time for the onset of transcription. The reduction in nuclear histone concentration that coincides with genome activation does not affect nucleosome density on DNA, but allows transcription factors to compete successfully for DNA binding. In agreement with this, transcription factor binding is sensitive to histone levels and the concentration of transcription factors also affects the time of transcription. Our results demonstrate that the relative levels of histones and transcription factors regulate the onset of transcription in the embryo.

A homolog of teleostean signal transducer and activator of transcription 3 (STAT3) from rock bream, Oplegnathus fasciatus: Structural insights, transcriptional modulation, and subcellular localization.

PubMed

Bathige, S D N K; Thulasitha, William Shanthakumar; Umasuthan, Navaneethaiyer; Jayasinghe, J D H E; Wan, Qiang; Nam, Bo-Hye; Lee, Jehee

2017-04-01

Signal transducer and activator of transcription 3 (STAT3) is one of the crucial transcription factors in the Janus kinase (JAK)/STAT signaling pathway, and it was previously considered as acute phase response factor. A number of interleukins (ILs) such as IL-5, IL-6, IL-9, IL-10, IL-12, and IL-22 are known to be involved in activation of STAT3. In addition, various growth factors and pathogenic or oxidative stresses mediate the activation of a wide range of functions via STAT3. In this study, a STAT3 homolog was identified and functionally characterized from rock bream (RbSTAT3), Oplegnathus fasciatus. In silico characterization revealed that the RbSTAT3 amino acid sequence shares highly conserved common domain architectural features including N-terminal domain, coiled coil domain, DNA binding domain, linker domain, and Src homology 2 (SH2) domains. In addition, a fairly conserved transcriptional activation domain (TAD) was located at the C-terminus. Comparison of RbSTAT3 with other counterparts revealed higher identities (>90%) with fish orthologs. The genomic sequence of RbSTAT3 was obtained from a bacterial artificial chromosome (BAC) library, and was identified as a multi-exonic gene (24 exons), as found in other vertebrates. Genomic structural comparison and phylogenetic studies have showed that the evolutionary routes of teleostean and non-teleostean vertebrates were distinct. Quantitative real time PCR (qPCR) analysis revealed that the spatial distribution of RbSTAT3 mRNA expression was ubiquitous and highly detectable in blood, heart, and liver tissues. Transcriptional modulation of RbSTAT3 was examined in blood and liver tissues after challenges with bacteria (Edwardsiella tarda and Streptococcus iniae), rock bream irido virus (RBIV), and immune stimulants (LPS and poly (I:C)). Significant changes in RbSTAT3 transcription were also observed in response to tissue injury. In addition, the transcriptional up-regulation of RbSTAT3 was detected in rock bream

Swinger RNAs with sharp switches between regular transcription and transcription systematically exchanging ribonucleotides: Case studies.

PubMed

Seligmann, Hervé

2015-09-01

During RNA transcription, DNA nucleotides A,C,G, T are usually matched by ribonucleotides A, C, G and U. However occasionally, this rule does not apply: transcript-DNA homologies are detectable only assuming systematic exchanges between ribonucleotides. Nine symmetric (X ↔ Y, e.g. A ↔ C) and fourteen asymmetric (X ↔ Y ↔ Z, e.g. A ↔ C ↔ G) exchanges exist, called swinger transcriptions. Putatively, polymerases occasionally stabilize in unspecified swinger conformations, possibly similar to transient conformations causing punctual misinsertions. This predicts chimeric transcripts, part regular, part swinger-transformed, reflecting polymerases switching to swinger polymerization conformation(s). Four chimeric Genbank transcripts (three from human mitochondrion and one murine cytosolic) are described here: (a) the 5' and 3' extremities reflect regular polymerization, the intervening sequence exchanges systematically between ribonucleotides (swinger rule G ↔ U, transcript (1), with sharp switches between regular and swinger sequences; (b) the 5' half is 'normal', the 3' half systematically exchanges ribonucleotides (swinger rule C ↔ G, transcript (2), with an intercalated sequence lacking homology; (c) the 3' extremity fits A ↔ G exchanges (10% of transcript length), the 5' half follows regular transcription; the intervening region seems a mix of regular and A ↔ G transcriptions (transcript 3); (d) murine cytosolic transcript 4 switches to A ↔ U + C ↔ G, and is fused with A ↔ U + C ↔ G swinger transformed precursor rRNA. In (c), each concomitant transcript 5' and 3' extremities match opposite genome strands. Transcripts 3 and 4 combine transcript fusions with partial swinger transcriptions. Occasional (usually sharp) switches between regular and swinger transcriptions reveal greater coding potential than detected until now, suggest stable polymerase swinger conformations. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Intrinsic disorder in transcription factors†

PubMed Central

Liu, Jiangang; Perumal, Narayanan B.; Oldfield, Christopher J.; Su, Eric W.; Uversky, Vladimir N.; Dunker, A. Keith

2008-01-01

Intrinsic disorder (ID) is highly abundant in eukaryotes, which reflect the greater need for disorder-associated signaling and transcriptional regulation in nucleated cells. Although several well-characterized examples of intrinsically disordered proteins in transcriptional regulation have been reported, no systematic analysis has been reported so far. To test for a general prevalence of intrinsic disorder in transcriptional regulation, we used the Predictor Of Natural Disorder Regions (PONDR) to analyze the abundance of intrinsic disorder in three transcription factor datasets and two control sets. This analysis revealed that from 94.13% to 82.63% of transcription factors posses extended regions of intrinsic disorder, relative to 54.51% and 18.64% of the proteins in two control datasets, which indicates the significant prevalence of intrinsic disorder in transcription factors. This propensity of transcription factors for intrinsic disorder was confirmed by cumulative distribution function analysis and charge-hydropathy plots. The amino acid composition analysis showed that all three transcription factor datasets were substantially depleted in order-promoting residues, and significantly enriched in disorder-promoting residues. Our analysis of the distribution of disorder within the transcription factor datasets revealed that: (a) The AT-hooks and basic regions of transcription factor DNA-binding domains are highly disordered; (b) The degree of disorder in transcription factor activation regions is much higher than that in DNA-binding domains; (c) The degree of disorder is significantly higher in eukaryotic transcription factors than in prokaryotic transcription factors; (d) The level of α-MoRFs (molecular recognition feature) prediction is much higher in transcription factors. Overall, our data reflected the fact that the eukaryotes with well-developed gene transcription machinery require transcription factor flexibility to be more efficient. PMID:16734424

Regulation of Global Transcription in Escherichia coli by Rsd and 6S RNA

PubMed Central

Lal, Avantika; Krishna, Sandeep; Seshasayee, Aswin Sai Narain

2018-01-01

In Escherichia coli, the sigma factor σ70 directs RNA polymerase to transcribe growth-related genes, while σ38 directs transcription of stress response genes during stationary phase. Two molecules hypothesized to regulate RNA polymerase are the protein Rsd, which binds to σ70, and the non-coding 6S RNA which binds to the RNA polymerase-σ70 holoenzyme. Despite multiple studies, the functions of Rsd and 6S RNA remain controversial. Here we use RNA-Seq in five phases of growth to elucidate their function on a genome-wide scale. We show that Rsd and 6S RNA facilitate σ38 activity throughout bacterial growth, while 6S RNA also regulates widely different genes depending upon growth phase. We discover novel interactions between 6S RNA and Rsd and show widespread expression changes in a strain lacking both regulators. Finally, we present a mathematical model of transcription which highlights the crosstalk between Rsd and 6S RNA as a crucial factor in controlling sigma factor competition and global gene expression. PMID:29686109

Regulation of Global Transcription in Escherichia coli by Rsd and 6S RNA.

PubMed

Lal, Avantika; Krishna, Sandeep; Seshasayee, Aswin Sai Narain

2018-05-31

In Escherichia coli , the sigma factor σ 70 directs RNA polymerase to transcribe growth-related genes, while σ 38 directs transcription of stress response genes during stationary phase. Two molecules hypothesized to regulate RNA polymerase are the protein Rsd, which binds to σ 70 , and the non-coding 6S RNA which binds to the RNA polymerase-σ 70 holoenzyme. Despite multiple studies, the functions of Rsd and 6S RNA remain controversial. Here we use RNA-Seq in five phases of growth to elucidate their function on a genome-wide scale. We show that Rsd and 6S RNA facilitate σ 38 activity throughout bacterial growth, while 6S RNA also regulates widely different genes depending upon growth phase. We discover novel interactions between 6S RNA and Rsd and show widespread expression changes in a strain lacking both regulators. Finally, we present a mathematical model of transcription which highlights the crosstalk between Rsd and 6S RNA as a crucial factor in controlling sigma factor competition and global gene expression. Copyright © 2018 Lal et al.

A novel statistical approach for identification of the master regulator transcription factor.

PubMed

Sikdar, Sinjini; Datta, Susmita

2017-02-02

Transcription factors are known to play key roles in carcinogenesis and therefore, are gaining popularity as potential therapeutic targets in drug development. A 'master regulator' transcription factor often appears to control most of the regulatory activities of the other transcription factors and the associated genes. This 'master regulator' transcription factor is at the top of the hierarchy of the transcriptomic regulation. Therefore, it is important to identify and target the master regulator transcription factor for proper understanding of the associated disease process and identifying the best therapeutic option. We present a novel two-step computational approach for identification of master regulator transcription factor in a genome. At the first step of our method we test whether there exists any master regulator transcription factor in the system. We evaluate the concordance of two ranked lists of transcription factors using a statistical measure. In case the concordance measure is statistically significant, we conclude that there is a master regulator. At the second step, our method identifies the master regulator transcription factor, if there exists one. In the simulation scenario, our method performs reasonably well in validating the existence of a master regulator when the number of subjects in each treatment group is reasonably large. In application to two real datasets, our method ensures the existence of master regulators and identifies biologically meaningful master regulators. An R code for implementing our method in a sample test data can be found in http://www.somnathdatta.org/software . We have developed a screening method of identifying the 'master regulator' transcription factor just using only the gene expression data. Understanding the regulatory structure and finding the master regulator help narrowing the search space for identifying biomarkers for complex diseases such as cancer. In addition to identifying the master regulator our

Competition between histone and transcription factor binding regulates the onset of transcription in zebrafish embryos

PubMed Central

Joseph, Shai R; Pálfy, Máté; Hilbert, Lennart; Kumar, Mukesh; Karschau, Jens; Zaburdaev, Vasily; Shevchenko, Andrej; Vastenhouw, Nadine L

2017-01-01

Upon fertilization, the genome of animal embryos remains transcriptionally inactive until the maternal-to-zygotic transition. At this time, the embryo takes control of its development and transcription begins. How the onset of zygotic transcription is regulated remains unclear. Here, we show that a dynamic competition for DNA binding between nucleosome-forming histones and transcription factors regulates zebrafish genome activation. Taking a quantitative approach, we found that the concentration of non-DNA-bound core histones sets the time for the onset of transcription. The reduction in nuclear histone concentration that coincides with genome activation does not affect nucleosome density on DNA, but allows transcription factors to compete successfully for DNA binding. In agreement with this, transcription factor binding is sensitive to histone levels and the concentration of transcription factors also affects the time of transcription. Our results demonstrate that the relative levels of histones and transcription factors regulate the onset of transcription in the embryo. DOI: http://dx.doi.org/10.7554/eLife.23326.001 PMID:28425915

Increased Sleep Promotes Survival during a Bacterial Infection in Drosophila

PubMed Central

Kuo, Tzu-Hsing; Williams, Julie A.

2014-01-01

Study Objectives: The relationship between sleep and immune function is not well understood at a functional or molecular level. We therefore used a genetic approach in Drosophila to manipulate sleep and evaluated effects on the ability of flies to fight bacterial infection. Setting: Laboratory. Participants: Drosophila melanogaster. Methods and Results: We used a genetic approach to transiently alter neuronal excitability in the mushroom body, a region in the central brain that is known to regulate sleep. Flies with increased sleep for up to two days prior to a bacterial infection showed increased resistance to the infection and improved survival. These flies also had increased expression levels of a subset of anti-microbial peptide mRNA prior to infection, as well as increased NFκB activity during infection as indicated by in vivo luciferase reporter activity. In contrast, flies that experienced reduced sleep for up to two days prior to infection had no effect on survival or on NFκB activity during infection. However, flies with reduced sleep showed an altered defense mechanism, such that resistance to infection was increased, but at the expense of reduced tolerance. This effect was dependent on environmental condition. Conclusions: Increasing sleep enhanced activity of an NFκB transcription factor, increased resistance to infection, and strongly promoted survival. Together, these findings support the hypothesis that sleep is beneficial to the host by maintaining a robust immune system. Citation: Kuo TH, Williams JA. Increased sleep promotes survival during a bacterial infection in Drosophila. SLEEP 2014;37(6):1077-1086. PMID:24882902

Phytoplankton-bacterial interactions mediate micronutrient colimitation at the coastal Antarctic sea ice edge.

PubMed

Bertrand, Erin M; McCrow, John P; Moustafa, Ahmed; Zheng, Hong; McQuaid, Jeffrey B; Delmont, Tom O; Post, Anton F; Sipler, Rachel E; Spackeen, Jenna L; Xu, Kai; Bronk, Deborah A; Hutchins, David A; Allen, Andrew E

2015-08-11

Southern Ocean primary productivity plays a key role in global ocean biogeochemistry and climate. At the Southern Ocean sea ice edge in coastal McMurdo Sound, we observed simultaneous cobalamin and iron limitation of surface water phytoplankton communities in late Austral summer. Cobalamin is produced only by bacteria and archaea, suggesting phytoplankton-bacterial interactions must play a role in this limitation. To characterize these interactions and investigate the molecular basis of multiple nutrient limitation, we examined transitions in global gene expression over short time scales, induced by shifts in micronutrient availability. Diatoms, the dominant primary producers, exhibited transcriptional patterns indicative of co-occurring iron and cobalamin deprivation. The major contributor to cobalamin biosynthesis gene expression was a gammaproteobacterial population, Oceanospirillaceae ASP10-02a. This group also contributed significantly to metagenomic cobalamin biosynthesis gene abundance throughout Southern Ocean surface waters. Oceanospirillaceae ASP10-02a displayed elevated expression of organic matter acquisition and cell surface attachment-related genes, consistent with a mutualistic relationship in which they are dependent on phytoplankton growth to fuel cobalamin production. Separate bacterial groups, including Methylophaga, appeared to rely on phytoplankton for carbon and energy sources, but displayed gene expression patterns consistent with iron and cobalamin deprivation. This suggests they also compete with phytoplankton and are important cobalamin consumers. Expression patterns of siderophore- related genes offer evidence for bacterial influences on iron availability as well. The nature and degree of this episodic colimitation appear to be mediated by a series of phytoplankton-bacterial interactions in both positive and negative feedback loops.

Phytoplankton–bacterial interactions mediate micronutrient colimitation at the coastal Antarctic sea ice edge

PubMed Central

Bertrand, Erin M.; McCrow, John P.; Moustafa, Ahmed; Zheng, Hong; McQuaid, Jeffrey B.; Delmont, Tom O.; Post, Anton F.; Sipler, Rachel E.; Spackeen, Jenna L.; Xu, Kai; Bronk, Deborah A.; Hutchins, David A.; Allen, Andrew E.

2015-01-01

Southern Ocean primary productivity plays a key role in global ocean biogeochemistry and climate. At the Southern Ocean sea ice edge in coastal McMurdo Sound, we observed simultaneous cobalamin and iron limitation of surface water phytoplankton communities in late Austral summer. Cobalamin is produced only by bacteria and archaea, suggesting phytoplankton–bacterial interactions must play a role in this limitation. To characterize these interactions and investigate the molecular basis of multiple nutrient limitation, we examined transitions in global gene expression over short time scales, induced by shifts in micronutrient availability. Diatoms, the dominant primary producers, exhibited transcriptional patterns indicative of co-occurring iron and cobalamin deprivation. The major contributor to cobalamin biosynthesis gene expression was a gammaproteobacterial population, Oceanospirillaceae ASP10-02a. This group also contributed significantly to metagenomic cobalamin biosynthesis gene abundance throughout Southern Ocean surface waters. Oceanospirillaceae ASP10-02a displayed elevated expression of organic matter acquisition and cell surface attachment-related genes, consistent with a mutualistic relationship in which they are dependent on phytoplankton growth to fuel cobalamin production. Separate bacterial groups, including Methylophaga, appeared to rely on phytoplankton for carbon and energy sources, but displayed gene expression patterns consistent with iron and cobalamin deprivation. This suggests they also compete with phytoplankton and are important cobalamin consumers. Expression patterns of siderophore- related genes offer evidence for bacterial influences on iron availability as well. The nature and degree of this episodic colimitation appear to be mediated by a series of phytoplankton–bacterial interactions in both positive and negative feedback loops. PMID:26221022

Compensatory Evolution of Intrinsic Transcription Terminators in Bacillus Cereus

PubMed Central

Safina, Ksenia R.; Mironov, Andrey A.

2017-01-01

Many RNA molecules possess complicated secondary structure critical to their function. Mutations in double-helical regions of RNA may disrupt Watson–Crick (WC) interactions causing structure destabilization or even complete loss of function. Such disruption can be compensated by another mutation restoring base pairing, as has been shown for mRNA, rRNA and tRNA. Here, we investigate the evolution of intrinsic transcription terminators between closely related strains of Bacillus cereus. While the terminator structure is maintained by strong natural selection, as evidenced by the low frequency of disrupting mutations, we observe multiple instances of pairs of disrupting-compensating mutations in RNA structure stems. Such two-step switches between different WC pairs occur very fast, consistent with the low fitness conferred by the intermediate non-WC variant. Still, they are not instantaneous, and probably involve transient fixation of the intermediate variant. The GU wobble pair is the most frequent intermediate, and remains fixed longer than other intermediates, consistent with its less disruptive effect on the RNA structure. Double switches involving non-GU intermediates are more frequent at the ends of RNA stems, probably because they are associated with smaller fitness loss. Together, these results show that the fitness landscape of bacterial transcription terminators is rather rugged, but that the fitness valleys associated with unpaired stem nucleotides are rather shallow, facilitating evolution. PMID:28201729

Diversity of transcripts and transcript processing forms in plastids of the dinoflagellate alga Karenia mikimotoi.

PubMed

Dorrell, Richard G; Hinksman, George A; Howe, Christopher J

2016-02-01

Plastids produce a vast diversity of transcripts. These include mature transcripts containing coding sequences, and their processing precursors, as well as transcripts that lack direct coding functions, such as antisense transcripts. Although plastid transcriptomes have been characterised for many plant species, less is known about the transcripts produced in other plastid lineages. We characterised the transcripts produced in the fucoxanthin-containing plastids of the dinoflagellate alga Karenia mikimotoi. This plastid lineage, acquired through tertiary endosymbiosis, utilises transcript processing pathways that are very different from those found in plants and green algae, including 3' poly(U) tail addition, and extensive substitutional editing of transcript sequences. We have sequenced the plastid transcriptome of K. mikimotoi, and have detected evidence for divergent evolution of fucoxanthin plastid genomes. We have additionally characterised polycistronic and monocistronic transcripts from two plastid loci, psbD-tRNA (Met)-ycf4 and rpl36-rps13-rps11. We find evidence for a range of transcripts produced from each locus that differ in terms of editing state, 5' end cleavage position, and poly(U) tail addition. Finally, we identify antisense transcripts in K. mikimotoi, which appear to undergo different processing events from the corresponding sense transcripts. Overall, our study provides insights into the diversity of transcripts and processing intermediates found in plastid lineages across the eukaryotes.

A Rice CPYC-Type Glutaredoxin OsGRX20 in Protection against Bacterial Blight, Methyl Viologen and Salt Stresses.

PubMed

Ning, Xi; Sun, Yao; Wang, Changchun; Zhang, Weilin; Sun, Meihao; Hu, Haitao; Liu, Jianzhong; Yang, Ling

2018-01-01

Glutaredoxins (GRXs) belong to the antioxidants involved in the cellular stress responses. In spite of the identification 48 GRX genes in rice genomes, the biological functions of most of them remain unknown. Especially, the biological roles of members of GRX family in disease resistance are still lacking. Our proteomic analysis found that OsGRX20 increased by 2.7-fold after infection by bacterial blight. In this study, we isolated and characterized the full-length nucleotide sequences of the rice OsGRX20 gene, which encodes a GRX family protein with CPFC active site of CPYC-type class. OsGRX20 protein was localized in nucleus and cytosol, and its transcripts were expressed predominantly in leaves. Several stress- and hormone-related motifs putatively acting as regulatory elements were found in the OsGRX20 promoter. Real-time quantitative PCR analysis indicated that OsGRX20 was expressed at a significantly higher level in leaves of a resistant or tolerant rice genotype, Yongjing 50A, than in a sensitive genotype, Xiushui 11, exposed to bacterial blight, methyl viologen, heat, and cold. Its expression could be induced by salt, PEG-6000, 2,4-D, salicylic acid, jasmonic acid, and abscisic acid treatments in Yongjing 50A. Overexpression of OsGRX20 in rice Xiushui 11 significantly enhanced its resistance to bacterial blight attack, and tolerance to methyl viologen and salt stresses. In contrast, interference of OsGRX20 in Yongjing 50A led to increased susceptibility to bacterial blight, methyl viologen and salt stresses. OsGRX20 restrained accumulation of superoxide radicals in aerial tissue during methyl viologen treatment. Consistently, alterations in OsGRX20 expression affect the ascorbate/dehydroascorbate ratio and the abundance of transcripts encoding four reactive oxygen species scavenging enzymes after methyl viologen-induced stress. Our results demonstrate that OsGRX20 functioned as a positive regulator in rice tolerance to multiple stresses, which may be of

From indole to pyrrole, furan, thiophene and pyridine: Search for novel small molecule inhibitors of bacterial transcription initiation complex formation.

PubMed

Thach, Oscar; Mielczarek, Marcin; Ma, Cong; Kutty, Samuel K; Yang, Xiao; Black, David StC; Griffith, Renate; Lewis, Peter J; Kumar, Naresh

2016-03-15

The search for small molecules capable of inhibiting transcription initiation in bacteria has resulted in the synthesis of N,N'-disubstituted hydrazines and imine-carbohydrazides comprised of indole, pyridine, pyrrole, furan and thiophene using the respective trichloroacetyl derivatives, carbohydrazides and aldehydes. Replacement of the indole moiety by smaller heterocycles linked by CONHNC linkers afforded a broad variety of compounds efficiently targeting the RNA polymerase-σ(70)/σ(A) interaction as determined by ELISA and exhibiting increased inhibition of the growth of Escherichia coli compared to Bacillus subtilis in culture. The structural features of the synthesized transcription initiation inhibitors needed for antibacterial activity were identified employing molecular modelling and structure-activity relationship (SAR) studies. Copyright © 2016 Elsevier Ltd. All rights reserved.

Dynamics simulations for engineering macromolecular interactions

NASA Astrophysics Data System (ADS)

Robinson-Mosher, Avi; Shinar, Tamar; Silver, Pamela A.; Way, Jeffrey

2013-06-01

The predictable engineering of well-behaved transcriptional circuits is a central goal of synthetic biology. The artificial attachment of promoters to transcription factor genes usually results in noisy or chaotic behaviors, and such systems are unlikely to be useful in practical applications. Natural transcriptional regulation relies extensively on protein-protein interactions to insure tightly controlled behavior, but such tight control has been elusive in engineered systems. To help engineer protein-protein interactions, we have developed a molecular dynamics simulation framework that simplifies features of proteins moving by constrained Brownian motion, with the goal of performing long simulations. The behavior of a simulated protein system is determined by summation of forces that include a Brownian force, a drag force, excluded volume constraints, relative position constraints, and binding constraints that relate to experimentally determined on-rates and off-rates for chosen protein elements in a system. Proteins are abstracted as spheres. Binding surfaces are defined radially within a protein. Peptide linkers are abstracted as small protein-like spheres with rigid connections. To address whether our framework could generate useful predictions, we simulated the behavior of an engineered fusion protein consisting of two 20 000 Da proteins attached by flexible glycine/serine-type linkers. The two protein elements remained closely associated, as if constrained by a random walk in three dimensions of the peptide linker, as opposed to showing a distribution of distances expected if movement were dominated by Brownian motion of the protein domains only. We also simulated the behavior of fluorescent proteins tethered by a linker of varying length, compared the predicted Förster resonance energy transfer with previous experimental observations, and obtained a good correspondence. Finally, we simulated the binding behavior of a fusion of two ligands that could

Dynamics simulations for engineering macromolecular interactions.

PubMed

Robinson-Mosher, Avi; Shinar, Tamar; Silver, Pamela A; Way, Jeffrey

2013-06-01

The predictable engineering of well-behaved transcriptional circuits is a central goal of synthetic biology. The artificial attachment of promoters to transcription factor genes usually results in noisy or chaotic behaviors, and such systems are unlikely to be useful in practical applications. Natural transcriptional regulation relies extensively on protein-protein interactions to insure tightly controlled behavior, but such tight control has been elusive in engineered systems. To help engineer protein-protein interactions, we have developed a molecular dynamics simulation framework that simplifies features of proteins moving by constrained Brownian motion, with the goal of performing long simulations. The behavior of a simulated protein system is determined by summation of forces that include a Brownian force, a drag force, excluded volume constraints, relative position constraints, and binding constraints that relate to experimentally determined on-rates and off-rates for chosen protein elements in a system. Proteins are abstracted as spheres. Binding surfaces are defined radially within a protein. Peptide linkers are abstracted as small protein-like spheres with rigid connections. To address whether our framework could generate useful predictions, we simulated the behavior of an engineered fusion protein consisting of two 20,000 Da proteins attached by flexible glycine/serine-type linkers. The two protein elements remained closely associated, as if constrained by a random walk in three dimensions of the peptide linker, as opposed to showing a distribution of distances expected if movement were dominated by Brownian motion of the protein domains only. We also simulated the behavior of fluorescent proteins tethered by a linker of varying length, compared the predicted Förster resonance energy transfer with previous experimental observations, and obtained a good correspondence. Finally, we simulated the binding behavior of a fusion of two ligands that could

Dynamics simulations for engineering macromolecular interactions

PubMed Central

Robinson-Mosher, Avi; Shinar, Tamar; Silver, Pamela A.; Way, Jeffrey

2013-01-01

The predictable engineering of well-behaved transcriptional circuits is a central goal of synthetic biology. The artificial attachment of promoters to transcription factor genes usually results in noisy or chaotic behaviors, and such systems are unlikely to be useful in practical applications. Natural transcriptional regulation relies extensively on protein-protein interactions to insure tightly controlled behavior, but such tight control has been elusive in engineered systems. To help engineer protein-protein interactions, we have developed a molecular dynamics simulation framework that simplifies features of proteins moving by constrained Brownian motion, with the goal of performing long simulations. The behavior of a simulated protein system is determined by summation of forces that include a Brownian force, a drag force, excluded volume constraints, relative position constraints, and binding constraints that relate to experimentally determined on-rates and off-rates for chosen protein elements in a system. Proteins are abstracted as spheres. Binding surfaces are defined radially within a protein. Peptide linkers are abstracted as small protein-like spheres with rigid connections. To address whether our framework could generate useful predictions, we simulated the behavior of an engineered fusion protein consisting of two 20 000 Da proteins attached by flexible glycine/serine-type linkers. The two protein elements remained closely associated, as if constrained by a random walk in three dimensions of the peptide linker, as opposed to showing a distribution of distances expected if movement were dominated by Brownian motion of the protein domains only. We also simulated the behavior of fluorescent proteins tethered by a linker of varying length, compared the predicted Förster resonance energy transfer with previous experimental observations, and obtained a good correspondence. Finally, we simulated the binding behavior of a fusion of two ligands that could

Resistance, resilience and recovery: aquatic bacterial dynamics after water column disturbance.

PubMed

Shade, Ashley; Read, Jordan S; Welkie, David G; Kratz, Timothy K; Wu, Chin H; McMahon, Katherine D

2011-10-01

For lake microbes, water column mixing acts as a disturbance because it homogenizes thermal and chemical gradients known to define the distributions of microbial taxa. Our first objective was to isolate hypothesized drivers of lake bacterial response to water column mixing. To accomplish this, we designed an enclosure experiment with three treatments to independently test key biogeochemical changes induced by mixing: oxygen addition to the hypolimnion, nutrient addition to the epilimnion, and full water column mixing. We used molecular fingerprinting to observe bacterial community dynamics in the treatment and control enclosures, and in ambient lake water. We found that oxygen and nutrient amendments simulated the physical-chemical water column environment following mixing and resulted in similar bacterial communities to the mixing treatment, affirming that these were important drivers of community change. These results demonstrate that specific environmental changes can replicate broad disturbance effects on microbial communities. Our second objective was to characterize bacterial community stability by quantifying community resistance, recovery and resilience to an episodic disturbance. The communities in the nutrient and oxygen amendments changed quickly (had low resistance), but generally matched the control composition by the 10th day after treatment, exhibiting resilience. These results imply that aquatic bacterial assemblages are generally stable in the face of disturbance. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.

Innate immunity: Bacterial cell-wall muramyl peptide targets the conserved transcription factor YB-1.

PubMed

Laman, A G; Lathe, R; Savinov, G V; Shepelyakovskaya, A O; Boziev, Kh M; Baidakova, L K; Chulin, A N; Brovko, F A; Svirshchevskaya, E V; Kotelevtsev, Y; Eliseeva, I A; Guryanov, S G; Lyabin, D N; Ovchinnikov, L P; Ivanov, V T

2015-07-08

The bacterial cell wall muramyl dipeptides MDP and glucosaminyl-MDP (GMDP) are powerful immunostimulators but their binding target remains controversial. We previously reported expression cloning of GMDP-binding polypeptides and identification of Y-box protein 1 (YB-1) as their sole target. Here we show specific binding of GMDP to recombinant YB-1 protein and subcellular colocalization of YB-1 and GMDP. GMDP binding to YB-1 upregulated gene expression levels of NF-κB2, a mediator of innate immunity. Furthermore, YB-1 knockdown abolished GMDP-induced Nfkb2 expression. GMDP/YB-1 stimulation led to NF-κB2 cleavage, transport of activated NF-κB2 p52 to the nucleus, and upregulation of NF-κB2-dependent chemokine Cxcr4 gene expression. Therefore, our findings identify YB-1 as new target for muramyl peptide signaling. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Viral and bacterial septicaemic infections modulate the expression of PACAP splicing variants and VIP/PACAP receptors in brown trout immune organs.

PubMed

Gorgoglione, Bartolomeo; Carpio, Yamila; Secombes, Christopher J; Taylor, Nick G H; Lugo, Juana María; Estrada, Mario Pablo

2015-12-01

Pituitary Adenylate Cyclase-Activating Polypeptide (PACAP) and PACAP-Related Peptide (PRP) are structurally similar peptides encoded in the same transcripts. Their transcription has been detected not only in the brain but also in a wide range of peripheral tissues, even including organs of the immune system. PACAP exerts pleiotropic activities through G-protein coupled membrane receptors: the PACAP-specific PAC-1 and the VPAC-1 and VPAC-2 receptors that exhibit similar affinities for the Vasoactive Intestinal Peptide (VIP) and PACAP. Recent findings added PACAP and its receptors to the growing list of mediators that allow cross-talk between the nervous, endocrine and immune systems in fish. In this study the expression of genes encoding for PACAP and PRP, as well as VIP/PACAP receptors was studied in laboratory-reared brown trout (Salmo trutta) after septicaemic infections. Respectively Viral Haemorrhagic Septicaemia Virus (VHSV-Ia) or the Gram-negative bacterium Yersinia ruckeri (ser. O1 - biot. 2) were used in infection challenges. Kidney and spleen, the teleost main lymphopoietic organs, were sampled during the first two weeks post-infection. RT-qPCR analysis assessed specific pathogens burden and gene expression levels. PACAP and PRP transcription in each organ was positively correlated to the respective pathogen burden, assessed targeting the VHSV-glycoprotein or Y. ruckeri 16S rRNA. Results showed as the transcription of PACAP splicing variants and VIP/PACAP receptors is modulated in these organs during an acute viral and bacterial septicaemic infections in brown trout. These gene expression results provide clues as to how the PACAP system is modulated in fish, confirming an involvement during active immune responses elicited by both viral and bacterial aetiological agents. However, further experimental evidence is still required to fully elucidate and characterize the role of PACAP and PRP for an efficient immune response against pathogens. Copyright © 2015

Impact of space flight on bacterial virulence and antibiotic susceptibility

PubMed Central

Taylor, Peter William

2015-01-01

Manned space flight induces a reduction in immune competence among crew and is likely to cause deleterious changes to the composition of the gastrointestinal, nasal, and respiratory bacterial flora, leading to an increased risk of infection. The space flight environment may also affect the susceptibility of microorganisms within the spacecraft to antibiotics, key components of flown medical kits, and may modify the virulence characteristics of bacteria and other microorganisms that contaminate the fabric of the International Space Station and other flight platforms. This review will consider the impact of true and simulated microgravity and other characteristics of the space flight environment on bacterial cell behavior in relation to the potential for serious infections that may appear during missions to astronomical objects beyond low Earth orbit. PMID:26251622

Transcriptional response of Atlantic salmon families to Piscirickettsia salmonis infection highlights the relevance of the iron-deprivation defence system.

PubMed

Pulgar, Rodrigo; Hödar, Christian; Travisany, Dante; Zuñiga, Alejandro; Domínguez, Calixto; Maass, Alejandro; González, Mauricio; Cambiazo, Verónica

2015-07-04

Piscirickettsiosis or Salmonid Rickettsial Septicaemia (SRS) is a bacterial disease that has a major economic impact on the Chilean salmon farming industry. Despite the fact that Piscirickettsia salmonis has been recognized as a major fish pathogen for over 20 years, the molecular strategies underlying the fish response to infection and the bacterial mechanisms of pathogenesis are poorly understood. We analysed and compared the head kidney transcriptional response of Atlantic salmon (Salmo salar) families with different levels of susceptibility to P. salmonis infection in order to reveal mechanisms that might confer infection resistance. We ranked forty full-sibling Atlantic salmon families according to accumulated mortality after a challenge with P. salmonis and selected the families with the lowest and highest cumulative mortalities for microarray gene expression analysis. A comparison of the response to P. salmonis infection between low and high susceptibility groups identified biological processes presumably involved in natural resistance to the pathogen. In particular, expression changes of genes linked to cellular iron depletion, as well as low iron content and bacterial load in the head kidney of fish from low susceptibility families, suggest that iron-deprivation is an innate immunity defence mechanism against P. salmonis. To complement these results, we predicted a set of iron acquisition genes from the P. salmonis genome. Identification of putative Fur boxes and expression of the genes under iron-depleted conditions revealed that most of these genes form part of the Fur regulon of P. salmonis. This study revealed, for the first time, differences in the transcriptional response to P. salmonis infection among Atlantic salmon families with varied levels of susceptibility to the infection. These differences correlated with changes in the abundance of transcripts encoding proteins directly and indirectly involved in the immune response; changes that

The significance of alternative transcripts for Caenorhabditis elegans transcription factor genes, based on expression pattern analysis

PubMed Central

2013-01-01

Background Sequence-specific DNA-binding proteins, with their paramount importance in the regulation of expression of the genetic material, are encoded by approximately 5% of the genes in an animal’s genome. But it is unclear to what extent alternative transcripts from these genes may further increase the complexity of the transcription factor complement. Results Of the 938 potential C. elegans transcription factor genes, 197 were annotated in WormBase as encoding at least two distinct isoforms. Evaluation of prior evidence identified, with different levels of confidence, 50 genes with alternative transcript starts, 23 with alternative transcript ends, 35 with alternative splicing and 34 with alternative transcripts generated by a combination of mechanisms, leaving 55 that were discounted. Expression patterns were determined for transcripts for a sample of 29 transcription factor genes, concentrating on those with alternative transcript starts for which the evidence was strongest. Seamless fosmid recombineering was used to generate reporter gene fusions with minimal modification to assay expression of specific transcripts while maintaining the broad genomic DNA context and alternative transcript production. Alternative transcription factor gene transcripts were typically expressed with identical or substantially overlapping distributions rather than in distinct domains. Conclusions Increasingly sensitive sequencing technologies will reveal rare transcripts but many of these are clearly non-productive. The majority of the transcription factor gene alternative transcripts that are productive may represent tolerable noise rather than encoding functionally distinct isoforms. PMID:23586691

Clk post-transcriptional control denoises circadian transcription both temporally and spatially.

PubMed

Lerner, Immanuel; Bartok, Osnat; Wolfson, Victoria; Menet, Jerome S; Weissbein, Uri; Afik, Shaked; Haimovich, Daniel; Gafni, Chen; Friedman, Nir; Rosbash, Michael; Kadener, Sebastian

2015-05-08

The transcription factor CLOCK (CLK) is essential for the development and maintenance of circadian rhythms in Drosophila. However, little is known about how CLK levels are controlled. Here we show that Clk mRNA is strongly regulated post-transcriptionally through its 3' UTR. Flies expressing Clk transgenes without normal 3' UTR exhibit variable CLK-driven transcription and circadian behaviour as well as ectopic expression of CLK-target genes in the brain. In these flies, the number of the key circadian neurons differs stochastically between individuals and within the two hemispheres of the same brain. Moreover, flies carrying Clk transgenes with deletions in the binding sites for the miRNA bantam have stochastic number of pacemaker neurons, suggesting that this miRNA mediates the deterministic expression of CLK. Overall our results demonstrate a key role of Clk post-transcriptional control in stabilizing circadian transcription, which is essential for proper development and maintenance of circadian rhythms in Drosophila.

Bacterial and dye penetration through interim restorations used during endodontic treatment of molar teeth.

PubMed

Chailertvanitkul, Pattama; Abbott, Paul V; Riley, Thomas V; Sooksuntisakoonchai, Namchai

2009-07-01

The purpose of this study was to investigate the association between dye and bacterial penetration through interim restorations used during endodontic treatment. Sixty-four extracted human teeth were used, with 2 teeth each as positive and negative controls. Endodontic access with a mesio-occluso-distal cavity was prepared. Palatal cusps of maxillary molars and buccal cusps of mandibular molars were removed. Cotton was placed over the canals and covered with Cavit. Thirty teeth were restored with Ketac Silver (KS) and 30 with KS reinforced with a stainless steel band (KSSB). Samples were submersed in India ink mixed with brain heart infusion broth containing Streptococcus gordonii. After 3 months of simulated chewing, structural integrity and dye and bacterial penetration were assessed. Positive controls had both dye and bacterial penetration. Negative controls had no dye or bacterial penetration. All KS restorations debonded, whereas 18 KSSB restorations (60%) debonded. KS restorations were 1.67 times more likely to debond than KSSB restorations (Fisher exact test). KS was 1.3 times more likely to have dye penetration than KSSB (Fisher exact test) and 3 times more likely to have bacterial penetration, although not statistically significant (chi(2) test). Overall, 88.3% of specimens had dye penetration, and 20% had bacterial penetration. This 68.3% difference indicated no association between dye and bacterial penetration (exact McNemar test). Stainless steel bands helped maintain structural integrity of KS restorations under masticatory function. Bands helped prevent dye penetration but not bacterial penetration. There was no association between dye and bacterial penetration.

A continuum theoretical model and finite elements simulation of bacterial flagellar filament phase transition.

PubMed

Wang, Xiaoling; Meng, Shuo; Han, Jingshi

2017-10-03

The Bacterial flagellar filament can undergo a polymorphic phase transition in response to both mechanical and chemical variations in vitro and in vivo environments. Under mechanical stimuli, such as viscous flow or forces induced by motor rotation, the filament changes its phase from left-handed normal (N) to right-handed semi-coiled (SC) via phase nucleation and growth. Our detailed mechanical analysis of existing experiments shows that both torque and bending moment contribute to the filament phase transition. In this paper, we establish a non-convex and non-local continuum model based on the Ginzburg-Landau theory to describe main characteristics of the filament phase transition such as new-phase nucleation, growth, propagation and the merging of neighboring interfaces. The finite element method (FEM) is adopted to simulate the phase transition under a displacement-controlled loading condition (rotation angle and bending deflection). We show that new-phase nucleation corresponds to the maximum torque and bending moment at the stuck end of the filament. The hysteresis loop in the loading and unloading curves indicates energy dissipation. When the new phase grows and propagates, torque and bending moment remain static. We also find that there is a drop in load when the two interfaces merge, indicating a concomitant reduction in the interfacial energy. Finally, the interface thickness is governed by the coefficients of the gradient of order parameters in the non-local interface energy. Our continuum theory and the finite element method provide a method to study the mechanical behavior of such biomaterials. Copyright © 2017 Elsevier Ltd. All rights reserved.

Effect of simulated lunar impact on the survival of bacterial spores.

NASA Technical Reports Server (NTRS)

Whitfield, O.; Merek, E. L.; Oyama, V. I.

1973-01-01

In order to test the effect of impact on organisms, the survival of bacterial spores after being propelled at high velocity in Pyrex and plastic beads into crushed basalt was measured. The beads were fired into sterilized canisters by both a conventional powder and a light gas gun. Results indicate that at the minimum (2.4 km/sec) lunar capture velocity, the number of colony forming units (CFUs) decreased by five orders of magnitude, and at 5.5 km/sec, statistically a more probable capture velocity, no CFUs were found. The decrease in CFUs observed with increasing velocity indicates that the spores were most probably killed by the impact.

Transcription termination factor Rho: a hub linking diverse physiological processes in bacteria.

PubMed

Grylak-Mielnicka, Aleksandra; Bidnenko, Vladimir; Bardowski, Jacek; Bidnenko, Elena

2016-03-01

Factor-dependent termination of transcription in bacteria relies on the activity of a specific RNA helicase, the termination factor Rho. Rho is nearly ubiquitous in bacteria, but the extent to which its physiological functions are conserved throughout the different phyla remains unknown. Most of our current knowledge concerning the mechanism of Rho's activity and its physiological roles comes from the model micro-organism Escherichia coli, where Rho is essential and involved in the control of several important biological processes. However, the rather comprehensive knowledge about the general mechanisms of action and activities of Rho based on the E. coli paradigm cannot be directly extrapolated to other bacteria. Recent studies performed in different species favour the view that Rho-dependent termination plays a significant role even in bacteria where Rho is not essential. Here, we summarize the current state of the ever-increasing knowledge about the various aspects of the physiological functions of Rho, such as limitation of deleterious foreign DNA expression, control of gene expression, suppression of pervasive transcription, prevention of R-loops and maintenance of chromosome integrity, focusing on similarities and differences of the activities of Rho in various bacterial species.

Transcriptional regulatory elements in the noncoding region of human papillomavirus type 6

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Tzyy-Choou.

1989-01-01

The structure and function of the transcriptional regulatory region of human papillomavirus type 6 (HPV-6) has been investigated. To investigate tissue specific gene expression, a sensitive method to detect and localize HPV-6 viral DNA, mRNA and protein in plastic-embedded tissue sections of genital and respiratory tract papillomata by using in situ hybridization and immunoperoxidase assays has been developed. This method, using ultrathin sections and strand-specific {sup 3}H labeled riboprobes, offers the advantages of superior morphological preservation and detection of viral genomes at low copy number with good resolution, and the modified immunocytochemistry provides better sensitivity. The results suggest that genitalmore » tract epithelium is more permissive for HPV-6 replication than respiratory tract epithelium. To study the tissue tropism of HPV-6 at the level of regulation of viral gene expression, the polymerase chain reaction was used to isolate the noncoding region (NCR) of HPV-6 in independent isolates. Nucleotide sequence analysis of molecularly cloned DNA identified base substitutions, deletions/insertions and tandem duplications. Transcriptional regulatory elements in the NCR were assayed in recombinant plasmids containing the bacterial gene for chloramphenicol acetyl transferase.« less

Identification and transcriptional profile of multiple genes in the posterior kidney of Nile tilapia at 6h post bacterial infections

USDA-ARS?s Scientific Manuscript database

To understand the molecular mechanisms involved in response of Nile tilapia (Oreochromis niloticus) to bacterial infection, suppression subtractive cDNA hybridization technique was used to identify upregulated genes in the posterior kidney of Nile tilapia at 6h post infection with Aeromonas hydrophi...

Mitotic Transcriptional Activation: Clearance of Actively Engaged Pol II via Transcriptional Elongation Control in Mitosis.

PubMed

Liang, Kaiwei; Woodfin, Ashley R; Slaughter, Brian D; Unruh, Jay R; Box, Andrew C; Rickels, Ryan A; Gao, Xin; Haug, Jeffrey S; Jaspersen, Sue L; Shilatifard, Ali

2015-11-05

Although it is established that some general transcription factors are inactivated at mitosis, many details of mitotic transcription inhibition (MTI) and its underlying mechanisms are largely unknown. We have identified mitotic transcriptional activation (MTA) as a key regulatory step to control transcription in mitosis for genes with transcriptionally engaged RNA polymerase II (Pol II) to activate and transcribe until the end of the gene to clear Pol II from mitotic chromatin, followed by global impairment of transcription reinitiation through MTI. Global nascent RNA sequencing and RNA fluorescence in situ hybridization demonstrate the existence of transcriptionally engaged Pol II in early mitosis. Both genetic and chemical inhibition of P-TEFb in mitosis lead to delays in the progression of cell division. Together, our study reveals a mechanism for MTA and MTI whereby transcriptionally engaged Pol II can progress into productive elongation and finish transcription to allow proper cellular division. Copyright © 2015 Elsevier Inc. All rights reserved.

CpxR-Dependent Thermoregulation of Serratia marcescens PrtA Metalloprotease Expression and Its Contribution to Bacterial Biofilm Formation.

PubMed

Bruna, Roberto E; Molino, María Victoria; Lazzaro, Martina; Mariscotti, Javier F; García Véscovi, Eleonora

2018-04-15

PrtA is the major secreted metalloprotease of Serratia marcescens Previous reports implicate PrtA in the pathogenic capacity of this bacterium. PrtA is also clinically used as a potent analgesic and anti-inflammatory drug, and its catalytic properties attract industrial interest. Comparatively, there is scarce knowledge about the mechanisms that physiologically govern PrtA expression in Serratia In this work, we demonstrate that PrtA production is derepressed when the bacterial growth temperature decreases from 37°C to 30°C. We show that this thermoregulation occurs at the transcriptional level. We determined that upstream of prtA , there is a conserved motif that is directly recognized by the CpxR transcriptional regulator. This feature is found along Serratia strains irrespective of their isolation source, suggesting an evolutionary conservation of CpxR-dependent regulation of PrtA expression. We found that in S. marcescen s, the CpxAR system is more active at 37°C than at 30°C. In good agreement with these results, in a cpxR mutant background, prtA is derepressed at 37°C, while overexpression of the NlpE lipoprotein, a well-known CpxAR-inducing condition, inhibits PrtA expression, suggesting that the levels of the activated form of CpxR are increased at 37°C over those at 30°C. In addition, we establish that PrtA is involved in the ability of S. marcescens to develop biofilm. In accordance, CpxR influences the biofilm phenotype only when bacteria are grown at 37°C. In sum, our findings shed light on regulatory mechanisms that fine-tune PrtA expression and reveal a novel role for PrtA in the lifestyle of S. marcescens IMPORTANCE We demonstrate that S. marcescens metalloprotease PrtA expression is transcriptionally thermoregulated. While strongly activated below 30°C, its expression is downregulated at 37°C. We found that in S. marcescens , the CpxAR signal transduction system, which responds to envelope stress and bacterial surface adhesion, is

Structural differences in the bacterial flagellar motor among bacterial species.

PubMed

Terashima, Hiroyuki; Kawamoto, Akihiro; Morimoto, Yusuke V; Imada, Katsumi; Minamino, Tohru

2017-01-01

The bacterial flagellum is a supramolecular motility machine consisting of the basal body as a rotary motor, the hook as a universal joint, and the filament as a helical propeller. Intact structures of the bacterial flagella have been observed for different bacterial species by electron cryotomography and subtomogram averaging. The core structures of the basal body consisting of the C ring, the MS ring, the rod and the protein export apparatus, and their organization are well conserved, but novel and divergent structures have also been visualized to surround the conserved structure of the basal body. This suggests that the flagellar motors have adapted to function in various environments where bacteria live and survive. In this review, we will summarize our current findings on the divergent structures of the bacterial flagellar motor.

A Herpesviral Immediate Early Protein Promotes Transcription Elongation of Viral Transcripts.

PubMed

Fox, Hannah L; Dembowski, Jill A; DeLuca, Neal A

2017-06-13

Herpes simplex virus 1 (HSV-1) genes are transcribed by cellular RNA polymerase II (RNA Pol II). While four viral immediate early proteins (ICP4, ICP0, ICP27, and ICP22) function in some capacity in viral transcription, the mechanism by which ICP22 functions remains unclear. We observed that the FACT complex (comprised of SSRP1 and Spt16) was relocalized in infected cells as a function of ICP22. ICP22 was also required for the association of FACT and the transcription elongation factors SPT5 and SPT6 with viral genomes. We further demonstrated that the FACT complex interacts with ICP22 throughout infection. We therefore hypothesized that ICP22 recruits cellular transcription elongation factors to viral genomes for efficient transcription elongation of viral genes. We reevaluated the phenotype of an ICP22 mutant virus by determining the abundance of all viral mRNAs throughout infection by transcriptome sequencing (RNA-seq). The accumulation of almost all viral mRNAs late in infection was reduced compared to the wild type, regardless of kinetic class. Using chromatin immunoprecipitation sequencing (ChIP-seq), we mapped the location of RNA Pol II on viral genes and found that RNA Pol II levels on the bodies of viral genes were reduced in the ICP22 mutant compared to wild-type virus. In contrast, the association of RNA Pol II with transcription start sites in the mutant was not reduced. Taken together, our results indicate that ICP22 plays a role in recruiting elongation factors like the FACT complex to the HSV-1 genome to allow for efficient viral transcription elongation late in viral infection and ultimately infectious virion production. IMPORTANCE HSV-1 interacts with many cellular proteins throughout productive infection. Here, we demonstrate the interaction of a viral protein, ICP22, with a subset of cellular proteins known to be involved in transcription elongation. We determined that ICP22 is required to recruit the FACT complex and other transcription

A gene network simulator to assess reverse engineering algorithms.

PubMed

Di Camillo, Barbara; Toffolo, Gianna; Cobelli, Claudio

2009-03-01

In the context of reverse engineering of biological networks, simulators are helpful to test and compare the accuracy of different reverse-engineering approaches in a variety of experimental conditions. A novel gene-network simulator is presented that resembles some of the main features of transcriptional regulatory networks related to topology, interaction among regulators of transcription, and expression dynamics. The simulator generates network topology according to the current knowledge of biological network organization, including scale-free distribution of the connectivity and clustering coefficient independent of the number of nodes in the network. It uses fuzzy logic to represent interactions among the regulators of each gene, integrated with differential equations to generate continuous data, comparable to real data for variety and dynamic complexity. Finally, the simulator accounts for saturation in the response to regulation and transcription activation thresholds and shows robustness to perturbations. It therefore provides a reliable and versatile test bed for reverse engineering algorithms applied to microarray data. Since the simulator describes regulatory interactions and expression dynamics as two distinct, although interconnected aspects of regulation, it can also be used to test reverse engineering approaches that use both microarray and protein-protein interaction data in the process of learning. A first software release is available at http://www.dei.unipd.it/~dicamill/software/netsim as an R programming language package.

Convergence of the transcriptional responses to heat shock and singlet oxygen stresses.

PubMed

Dufour, Yann S; Imam, Saheed; Koo, Byoung-Mo; Green, Heather A; Donohue, Timothy J

2012-09-01

Cells often mount transcriptional responses and activate specific sets of genes in response to stress-inducing signals such as heat or reactive oxygen species. Transcription factors in the RpoH family of bacterial alternative σ factors usually control gene expression during a heat shock response. Interestingly, several α-proteobacteria possess two or more paralogs of RpoH, suggesting some functional distinction. We investigated the target promoters of Rhodobacter sphaeroides RpoH(I) and RpoH(II) using genome-scale data derived from gene expression profiling and the direct interactions of each protein with DNA in vivo. We found that the RpoH(I) and RpoH(II) regulons have both distinct and overlapping gene sets. We predicted DNA sequence elements that dictate promoter recognition specificity by each RpoH paralog. We found that several bases in the highly conserved TTG in the -35 element are important for activity with both RpoH homologs; that the T-9 position, which is over-represented in the RpoH(I) promoter sequence logo, is critical for RpoH(I)-dependent transcription; and that several bases in the predicted -10 element were important for activity with either RpoH(II) or both RpoH homologs. Genes that are transcribed by both RpoH(I) and RpoH(II) are predicted to encode for functions involved in general cell maintenance. The functions specific to the RpoH(I) regulon are associated with a classic heat shock response, while those specific to RpoH(II) are associated with the response to the reactive oxygen species, singlet oxygen. We propose that a gene duplication event followed by changes in promoter recognition by RpoH(I) and RpoH(II) allowed convergence of the transcriptional responses to heat and singlet oxygen stress in R. sphaeroides and possibly other bacteria.

Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization

NASA Astrophysics Data System (ADS)

Igoshin, Oleg

2011-03-01

Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.

The application of rumen simulation technique (RUSITEC) for studying dynamics of the bacterial community and metabolome in rumen fluid and the effects of a challenge with Clostridium perfringens.

PubMed

Wetzels, Stefanie U; Eger, Melanie; Burmester, Marion; Kreienbrock, Lothar; Abdulmawjood, Amir; Pinior, Beate; Wagner, Martin; Breves, Gerhard; Mann, Evelyne

2018-01-01

The rumen simulation technique (RUSITEC) is a well-established semicontinuous in vitro model for investigating ruminal fermentation; however, information on the stability of the ruminal bacterial microbiota and metabolome in the RUSITEC system is rarely available. The availability of high resolution methods, such as high-throughput sequencing and metabolomics improve our knowledge about the rumen microbial ecosystem and its fermentation processes. Thus, we used Illumina MiSeq 16S rRNA amplicon sequencing and a combination of direct injection mass spectrometry with a reverse-phase LC-MS/MS to evaluate the dynamics of the bacterial community and the concentration of several metabolites in a RUSITEC experiment as a function of time and in response to a challenge with a pathogenic Clostridium perfringens (C. perfringens) strain. After four days of equilibration, samples were collected on days 5, 6, 7, 10, 12 and 15 of the steady-state and experimental period. From a total of six fermenters, three non-infected fermenters were used for investigating time-dependent alterations; three fermenters were incubated with C. perfringens and compared with the non-infected vessels at days 10, 12 and 15. Along the time-line, there was no statistically significant change of the overall bacterial community, however, some phylotypes were enriched at certain time points. A decrease in Fibrobacter and Elusimicrobia over time was followed by an increase in Firmicutes and Actinobacteria. In contrast, classical fermentation measurements such as pH, redox potential, NH3-N, short chain fatty acids and the concentrations of metabolites determined by metabolomics (biogenic amines, hexoses and amino acids) remained stable throughout the experiment. In response to C. perfringens addition the concentrations of several amino acids increased. Although the overall bacterial community was not altered here either, some minor changes such as an enrichment of Synergistetes and Bacteroidetes were

Transcription factor clusters regulate genes in eukaryotic cells

PubMed Central

Hedlund, Erik G; Friemann, Rosmarie; Hohmann, Stefan

2017-01-01

Transcription is regulated through binding factors to gene promoters to activate or repress expression, however, the mechanisms by which factors find targets remain unclear. Using single-molecule fluorescence microscopy, we determined in vivo stoichiometry and spatiotemporal dynamics of a GFP tagged repressor, Mig1, from a paradigm signaling pathway of Saccharomyces cerevisiae. We find the repressor operates in clusters, which upon extracellular signal detection, translocate from the cytoplasm, bind to nuclear targets and turnover. Simulations of Mig1 configuration within a 3D yeast genome model combined with a promoter-specific, fluorescent translation reporter confirmed clusters are the functional unit of gene regulation. In vitro and structural analysis on reconstituted Mig1 suggests that clusters are stabilized by depletion forces between intrinsically disordered sequences. We observed similar clusters of a co-regulatory activator from a different pathway, supporting a generalized cluster model for transcription factors that reduces promoter search times through intersegment transfer while stabilizing gene expression. PMID:28841133

A multispecies exclusion model inspired by transcriptional interference

NASA Astrophysics Data System (ADS)

Ghosh, Soumendu; Bameta, Tripti; Ghanti, Dipanwita; Chowdhury, Debashish

2016-12-01

We introduce exclusion models of two distinguishable species of hard rods with their distinct sites of entry and exit under open boundary conditions. In the first model both species of rods move in the same direction whereas in the other two models they move in the opposite direction. These models are motivated by the biological phenomenon known as transcriptional interference. Therefore, the rules for the kinetics of the models, particularly the rules for the outcome of the encounter of the rods, are also formulated to mimic those observed in transcriptional interference. By a combination of mean-field theory and computer simulation of these models we demonstrate how the flux of one species of rods is completely switched off by the other. Exploring the parameter space of the model we also establish the conditions under which switch-like regulation of two fluxes is possible; from the extensive analysis we discover more than one possible mechanism of this phenomenon.

Transcription of TP0126, Treponema pallidum Putative OmpW Homolog, Is Regulated by the Length of a Homopolymeric Guanosine Repeat

PubMed Central

Brandt, Stephanie L.; Ke, Wujian; Reid, Tara B.; Molini, Barbara J.; Iverson-Cabral, Stefanie; Ciccarese, Giulia; Drago, Francesco; Lukehart, Sheila A.; Centurion-Lara, Arturo

2015-01-01

An effective mechanism for introduction of phenotypic diversity within a bacterial population exploits changes in the length of repetitive DNA elements located within gene promoters. This phenomenon, known as phase variation, causes rapid activation or silencing of gene expression and fosters bacterial adaptation to new or changing environments. Phase variation often occurs in surface-exposed proteins, and in Treponema pallidum subsp. pallidum, the syphilis agent, it was reported to affect transcription of three putative outer membrane protein (OMP)-encoding genes. When the T. pallidum subsp. pallidum Nichols strain genome was initially annotated, the TP0126 open reading frame was predicted to include a poly(G) tract and did not appear to have a predicted signal sequence that might suggest the possibility of its being an OMP. Here we show that the initial annotation was incorrect, that this poly(G) is instead located within the TP0126 promoter, and that it varies in length in vivo during experimental syphilis. Additionally, we show that TP0126 transcription is affected by changes in the poly(G) length consistent with regulation by phase variation. In silico analysis of the TP0126 open reading frame based on the experimentally identified transcriptional start site shortens this hypothetical protein by 69 amino acids, reveals a predicted cleavable signal peptide, and suggests structural homology with the OmpW family of porins. Circular dichroism of recombinant TP0126 supports structural homology to OmpW. Together with the evidence that TP0126 is fully conserved among T. pallidum subspecies and strains, these data suggest an important role for TP0126 in T. pallidum biology and syphilis pathogenesis. PMID:25802057

The multidrug ABC transporter BmrC/BmrD of Bacillus subtilis is regulated via a ribosome-mediated transcriptional attenuation mechanism

PubMed Central

Reilman, Ewoud; Mars, Ruben A. T.; van Dijl, Jan Maarten; Denham, Emma L.

2014-01-01

Expression of particular drug transporters in response to antibiotic pressure is a critical element in the development of bacterial multidrug resistance, and represents a serious concern for human health. To obtain a better understanding of underlying regulatory mechanisms, we have dissected the transcriptional activation of the ATP-binding cassette (ABC) transporter BmrC/BmrD of the Gram-positive model bacterium Bacillus subtilis. By using promoter-GFP fusions and live cell array technology, we demonstrate a temporally controlled transcriptional activation of the bmrCD genes in response to antibiotics that target protein synthesis. Intriguingly, bmrCD expression only occurs during the late-exponential and stationary growth stages, irrespective of the timing of the antibiotic challenge. We show that this is due to tight transcriptional control by the transition state regulator AbrB. Moreover, our results show that the bmrCD genes are co-transcribed with bmrB (yheJ), a small open reading frame immediately upstream of bmrC that harbors three alternative stem-loop structures. These stem-loops are apparently crucial for antibiotic-induced bmrCD transcription. Importantly, the antibiotic-induced bmrCD expression requires translation of bmrB, which implies that BmrB serves as a regulatory leader peptide. Altogether, we demonstrate for the first time that a ribosome-mediated transcriptional attenuation mechanism can control the expression of a multidrug ABC transporter. PMID:25217586

The transcriptional regulator pool of the marine bacterium Rhodopirellula baltica SH 1T as revealed by whole genome comparisons.

PubMed

Lombardot, Thierry; Bauer, Margarete; Teeling, Hanno; Amann, Rudolf; Glöckner, Frank Oliver

2005-01-01

Rhodopirellula baltica (strain SH 1T) is a free-living marine representative of the phylogenetically independent and environmentally relevant phylum Planctomycetes. Little is known about the regulatory strategies of free-living bacteria with large (7.15 Mb) genomes. Therefore, a consistent, quantitative and qualitative description was produced by comparing R. baltica's transcriptional regulator pool with that of 123 publicly available bacterial genomes. The overall results are congruous with earlier observations that in Bacteria, the proportion of genes encoding transcriptional regulators generally increases with genome size. However, R. baltica distinctly stands out from this trend with only 2.4% (174) of all genes predicted to encode transcriptional regulators. The qualitative investigation of R. baltica's transcriptional regulators revealed a clear shift towards high numbers of two-component systems (66) as well as high numbers of sigma factors (49), with more than 76% (37) belonging to the extra-cytoplasmic function subfamily of sigma-70. Only one predicted sigma factor showed a relatively close phylogenetic relationship to that of another bacterium, the sigma factor SigZ of Bacillus subtilis. In summary, analysis of the R. baltica genome revealed disparate regulatory mechanisms and a clear bias towards direct environmental sensing. This strategy might provide a selective advantage for organisms living in habitats with frequently changing environmental conditions.

GRIL-Seq, a method for identifying direct targets of bacterial small regulatory RNA by in vivo proximity ligation

PubMed Central

Han, Kook; Tjaden, Brian; Lory, Stephen

2017-01-01

The first step in the post-transcriptional regulatory function of most bacterial small non-coding RNAs (sRNAs) is base-pairing with partially complementary sequences of targeted transcripts. We present a simple method for identifying sRNA targets in vivo and defining processing sites of the regulated transcripts. The technique (referred to as GRIL-Seq) is based on preferential ligation of sRNAs to ends of base-paired targets in bacteria co-expressing T4 RNA ligase, followed by sequencing to identify the chimeras. In addition to the RNA chaperone Hfq, the GRIL-Seq method depends on the activity of the pyrophosphorylase RppH. Using PrrF1, an iron-regulated sRNA in Pseudomonas aeruginosa, we demonstrate that direct regulatory targets of this sRNA can be readily identified. Therefore, GRIL-Seq represents a powerful tool not only for identifying direct targets of sRNAs in a variety of environments, but can also result in uncovering novel roles for sRNAs and their targets in complex regulatory networks. PMID:28005055

Bacterial mycophagy: definition and diagnosis of a unique bacterial-fungal interaction.

PubMed

Leveau, Johan H J; Preston, Gail M

2008-01-01

This review analyses the phenomenon of bacterial mycophagy, which we define as a set of phenotypic behaviours that enable bacteria to obtain nutrients from living fungi and thus allow the conversion of fungal into bacterial biomass. We recognize three types of bacterial strategies to derive nutrition from fungi: necrotrophy, extracellular biotrophy and endocellular biotrophy. Each is characterized by a set of uniquely sequential and differently overlapping interactions with the fungal target. We offer a detailed analysis of the nature of these interactions, as well as a comprehensive overview of methodologies for assessing and quantifying their individual contributions to the mycophagy phenotype. Furthermore, we discuss future prospects for the study and exploitation of bacterial mycophagy, including the need for appropriate tools to detect bacterial mycophagy in situ in order to be able to understand, predict and possibly manipulate the way in which mycophagous bacteria affect fungal activity, turnover, and community structure in soils and other ecosystems.

Mini-review: Strategies for Variation and Evolution of Bacterial Antigens

PubMed Central

Foley, Janet

2015-01-01

Across the eubacteria, antigenic variation has emerged as a strategy to evade host immunity. However, phenotypic variation in some of these antigens also allows the bacteria to exploit variable host niches as well. The specific mechanisms are not shared-derived characters although there is considerable convergent evolution and numerous commonalities reflecting considerations of natural selection and biochemical restraints. Unlike in viruses, mechanisms of antigenic variation in most bacteria involve larger DNA movement such as gene conversion or DNA rearrangement, although some antigens vary due to point mutations or modified transcriptional regulation. The convergent evolution that promotes antigenic variation integrates various evolutionary forces: these include mutations underlying variant production; drift which could remove alleles especially early in infection or during life history phases in arthropod vectors (when the bacterial population size goes through a bottleneck); selection not only for any particular variant but also for the mechanism for the production of variants (i.e., selection for mutability); and overcoming negative selection against variant production. This review highlights the complexities of drivers of antigenic variation, in particular extending evaluation beyond the commonly cited theory of immune evasion. A deeper understanding of the diversity of purpose and mechanisms of antigenic variation in bacteria will contribute to greater insight into bacterial pathogenesis, ecology and coevolution with hosts. PMID:26288700

The transcriptional terminator sequences downstream of the covR gene terminate covR/S operon transcription to generate covR monocistronic transcripts in Streptococcus pyogenes.

PubMed

Chiang-Ni, Chuan; Tsou, Chih-Cheng; Lin, Yee-Shin; Chuang, Woei-Jer; Lin, Ming-T; Liu, Ching-Chuan; Wu, Jiunn-Jong

2008-12-31

CovR/S is an important two component regulatory system, which regulates about 15% of the gene expression in Streptococcus pyogenes. The covR/S locus was identified as an operon generating an RNA transcript around 2.5-kb in size. In this study, we found the covR/S operon produced three RNA transcripts (around 2.5-, 1.0-, and 0.8-kb in size). Using RNA transcriptional terminator sequence prediction and transcriptional terminator analysis, we identified two atypical rho-independent terminator sequences downstream of the covR gene and showed these terminator sequences terminate RNA transcription efficiently. These results indicate that covR/S operon generates covR/S transcript and monocistronic covR transcripts.

Biochemical Roles for Conserved Residues in the Bacterial Fatty Acid-binding Protein Family*

PubMed Central

Broussard, Tyler C.; Miller, Darcie J.; Jackson, Pamela; Nourse, Amanda; White, Stephen W.; Rock, Charles O.

2016-01-01

Fatty acid kinase (Fak) is a ubiquitous Gram-positive bacterial enzyme consisting of an ATP-binding protein (FakA) that phosphorylates the fatty acid bound to FakB. In Staphylococcus aureus, Fak is a global regulator of virulence factor transcription and is essential for the activation of exogenous fatty acids for incorporation into phospholipids. The 1.2-Å x-ray structure of S. aureus FakB2, activity assays, solution studies, site-directed mutagenesis, and in vivo complementation were used to define the functions of the five conserved residues that define the FakB protein family (Pfam02645). The fatty acid tail is buried within the protein, and the exposed carboxyl group is bound by a Ser-93-fatty acid carboxyl-Thr-61-His-266 hydrogen bond network. The guanidinium of the invariant Arg-170 is positioned to potentially interact with a bound acylphosphate. The reduced thermal denaturation temperatures of the T61A, S93A, and H266A FakB2 mutants illustrate the importance of the hydrogen bond network in protein stability. The FakB2 T61A, S93A, and H266A mutants are 1000-fold less active in the Fak assay, and the R170A mutant is completely inactive. All FakB2 mutants form FakA(FakB2)2 complexes except FakB2(R202A), which is deficient in FakA binding. Allelic replacement shows that strains expressing FakB2 mutants are defective in fatty acid incorporation into phospholipids and virulence gene transcription. These conserved residues are likely to perform the same critical functions in all bacterial fatty acid-binding proteins. PMID:26774272

Cellular damage in bacterial meningitis: an interplay of bacterial and host driven toxicity.

PubMed

Weber, Joerg R; Tuomanen, Elaine I

2007-03-01

Bacterial meningitis is still an important infectious disease causing death and disability. Invasive bacterial infections of the CNS generate some of the most powerful inflammatory responses known in medicine. Although the components of bacterial cell surfaces are now chemically defined in exquisite detail and the interaction with several receptor pathways has been discovered, it is only very recently that studies combining these advanced biochemical and cell biological tools have been done. Additional to the immunological response direct bacterial toxicity has been identified as an important contributor to neuronal damage. A detailed understanding of the complex interaction of bacterial toxicity and host response may generate opportunities for innovative and specific neuroprotective therapies.

When transcription goes on Holliday: Double Holliday junctions block RNA polymerase II transcription in vitro.

PubMed

Pipathsouk, Anne; Belotserkovskii, Boris P; Hanawalt, Philip C

2017-02-01

Non-canonical DNA structures can obstruct transcription. This transcription blockage could have various biological consequences, including genomic instability and gratuitous transcription-coupled repair. Among potential structures causing transcription blockage are Holliday junctions (HJs), which can be generated as intermediates in homologous recombination or during processing of stalled replication forks. Of particular interest is the double Holliday junction (DHJ), which contains two HJs. Topological considerations impose the constraint that the total number of helical turns in the DNA duplexes between the junctions cannot be altered as long as the flanking DNA duplexes are intact. Thus, the DHJ structure should strongly resist transient unwinding during transcription; consequently, it is predicted to cause significantly stronger blockage than single HJ structures. The patterns of transcription blockage obtained for RNA polymerase II transcription in HeLa cell nuclear extracts were in accordance with this prediction. However, we did not detect transcription blockage with purified T7 phage RNA polymerase; we discuss a possible explanation for this difference. In general, our findings implicate naturally occurring Holliday junctions in transcription arrest. Copyright © 2016 Elsevier B.V. All rights reserved.