Bacterial antisense RNAs are mainly the product of transcriptional noise.
Lloréns-Rico, Verónica; Cano, Jaime; Kamminga, Tjerko; Gil, Rosario; Latorre, Amparo; Chen, Wei-Hua; Bork, Peer; Glass, John I; Serrano, Luis; Lluch-Senar, Maria
2016-03-01
cis-Encoded antisense RNAs (asRNAs) are widespread along bacterial transcriptomes. However, the role of most of these RNAs remains unknown, and there is an ongoing discussion as to what extent these transcripts are the result of transcriptional noise. We show, by comparative transcriptomics of 20 bacterial species and one chloroplast, that the number of asRNAs is exponentially dependent on the genomic AT content and that expression of asRNA at low levels exerts little impact in terms of energy consumption. A transcription model simulating mRNA and asRNA production indicates that the asRNA regulatory effect is only observed above certain expression thresholds, substantially higher than physiological transcript levels. These predictions were verified experimentally by overexpressing nine different asRNAs in Mycoplasma pneumoniae. Our results suggest that most of the antisense transcripts found in bacteria are the consequence of transcriptional noise, arising at spurious promoters throughout the genome.
Bacterial antisense RNAs are mainly the product of transcriptional noise
Lloréns-Rico, Verónica; Cano, Jaime; Kamminga, Tjerko; Gil, Rosario; Latorre, Amparo; Chen, Wei-Hua; Bork, Peer; Glass, John I.; Serrano, Luis; Lluch-Senar, Maria
2016-01-01
cis-Encoded antisense RNAs (asRNAs) are widespread along bacterial transcriptomes. However, the role of most of these RNAs remains unknown, and there is an ongoing discussion as to what extent these transcripts are the result of transcriptional noise. We show, by comparative transcriptomics of 20 bacterial species and one chloroplast, that the number of asRNAs is exponentially dependent on the genomic AT content and that expression of asRNA at low levels exerts little impact in terms of energy consumption. A transcription model simulating mRNA and asRNA production indicates that the asRNA regulatory effect is only observed above certain expression thresholds, substantially higher than physiological transcript levels. These predictions were verified experimentally by overexpressing nine different asRNAs in Mycoplasma pneumoniae. Our results suggest that most of the antisense transcripts found in bacteria are the consequence of transcriptional noise, arising at spurious promoters throughout the genome. PMID:26973873
Baumbach, Jan; Brinkrolf, Karina; Czaja, Lisa F; Rahmann, Sven; Tauch, Andreas
2006-02-14
The application of DNA microarray technology in post-genomic analysis of bacterial genome sequences has allowed the generation of huge amounts of data related to regulatory networks. This data along with literature-derived knowledge on regulation of gene expression has opened the way for genome-wide reconstruction of transcriptional regulatory networks. These large-scale reconstructions can be converted into in silico models of bacterial cells that allow a systematic analysis of network behavior in response to changing environmental conditions. CoryneRegNet was designed to facilitate the genome-wide reconstruction of transcriptional regulatory networks of corynebacteria relevant in biotechnology and human medicine. During the import and integration process of data derived from experimental studies or literature knowledge CoryneRegNet generates links to genome annotations, to identified transcription factors and to the corresponding cis-regulatory elements. CoryneRegNet is based on a multi-layered, hierarchical and modular concept of transcriptional regulation and was implemented by using the relational database management system MySQL and an ontology-based data structure. Reconstructed regulatory networks can be visualized by using the yFiles JAVA graph library. As an application example of CoryneRegNet, we have reconstructed the global transcriptional regulation of a cellular module involved in SOS and stress response of corynebacteria. CoryneRegNet is an ontology-based data warehouse that allows a pertinent data management of regulatory interactions along with the genome-scale reconstruction of transcriptional regulatory networks. These models can further be combined with metabolic networks to build integrated models of cellular function including both metabolism and its transcriptional regulation.
Baumbach, Jan; Brinkrolf, Karina; Czaja, Lisa F; Rahmann, Sven; Tauch, Andreas
2006-01-01
Background The application of DNA microarray technology in post-genomic analysis of bacterial genome sequences has allowed the generation of huge amounts of data related to regulatory networks. This data along with literature-derived knowledge on regulation of gene expression has opened the way for genome-wide reconstruction of transcriptional regulatory networks. These large-scale reconstructions can be converted into in silico models of bacterial cells that allow a systematic analysis of network behavior in response to changing environmental conditions. Description CoryneRegNet was designed to facilitate the genome-wide reconstruction of transcriptional regulatory networks of corynebacteria relevant in biotechnology and human medicine. During the import and integration process of data derived from experimental studies or literature knowledge CoryneRegNet generates links to genome annotations, to identified transcription factors and to the corresponding cis-regulatory elements. CoryneRegNet is based on a multi-layered, hierarchical and modular concept of transcriptional regulation and was implemented by using the relational database management system MySQL and an ontology-based data structure. Reconstructed regulatory networks can be visualized by using the yFiles JAVA graph library. As an application example of CoryneRegNet, we have reconstructed the global transcriptional regulation of a cellular module involved in SOS and stress response of corynebacteria. Conclusion CoryneRegNet is an ontology-based data warehouse that allows a pertinent data management of regulatory interactions along with the genome-scale reconstruction of transcriptional regulatory networks. These models can further be combined with metabolic networks to build integrated models of cellular function including both metabolism and its transcriptional regulation. PMID:16478536
SATRAT: Staphylococcus aureus transcript regulatory network analysis tool.
Gopal, Tamilselvi; Nagarajan, Vijayaraj; Elasri, Mohamed O
2015-01-01
Staphylococcus aureus is a commensal organism that primarily colonizes the nose of healthy individuals. S. aureus causes a spectrum of infections that range from skin and soft-tissue infections to fatal invasive diseases. S. aureus uses a large number of virulence factors that are regulated in a coordinated fashion. The complex regulatory mechanisms have been investigated in numerous high-throughput experiments. Access to this data is critical to studying this pathogen. Previously, we developed a compilation of microarray experimental data to enable researchers to search, browse, compare, and contrast transcript profiles. We have substantially updated this database and have built a novel exploratory tool-SATRAT-the S. aureus transcript regulatory network analysis tool, based on the updated database. This tool is capable of performing deep searches using a query and generating an interactive regulatory network based on associations among the regulators of any query gene. We believe this integrated regulatory network analysis tool would help researchers explore the missing links and identify novel pathways that regulate virulence in S. aureus. Also, the data model and the network generation code used to build this resource is open sourced, enabling researchers to build similar resources for other bacterial systems.
Damienikan, Aliaksandr U.
2016-01-01
The majority of bacterial genome annotations are currently automated and based on a ‘gene by gene’ approach. Regulatory signals and operon structures are rarely taken into account which often results in incomplete and even incorrect gene function assignments. Here we present SigmoID, a cross-platform (OS X, Linux and Windows) open-source application aiming at simplifying the identification of transcription regulatory sites (promoters, transcription factor binding sites and terminators) in bacterial genomes and providing assistance in correcting annotations in accordance with regulatory information. SigmoID combines a user-friendly graphical interface to well known command line tools with a genome browser for visualising regulatory elements in genomic context. Integrated access to online databases with regulatory information (RegPrecise and RegulonDB) and web-based search engines speeds up genome analysis and simplifies correction of genome annotation. We demonstrate some features of SigmoID by constructing a series of regulatory protein binding site profiles for two groups of bacteria: Soft Rot Enterobacteriaceae (Pectobacterium and Dickeya spp.) and Pseudomonas spp. Furthermore, we inferred over 900 transcription factor binding sites and alternative sigma factor promoters in the annotated genome of Pectobacterium atrosepticum. These regulatory signals control putative transcription units covering about 40% of the P. atrosepticum chromosome. Reviewing the annotation in cases where it didn’t fit with regulatory information allowed us to correct product and gene names for over 300 loci. PMID:27257541
Naville, Magali; Gautheret, Daniel
2010-01-01
Bacterial transcription attenuation occurs through a variety of cis-regulatory elements that control gene expression in response to a wide range of signals. The signal-sensing structures in attenuators are so diverse and rapidly evolving that only a small fraction have been properly annotated and characterized to date. Here we apply a broad-spectrum detection tool in order to achieve a more complete view of the transcriptional attenuation complement of key bacterial species. Our protocol seeks gene families with an unusual frequency of 5' terminators found across multiple species. Many of the detected attenuators are part of annotated elements, such as riboswitches or T-boxes, which often operate through transcriptional attenuation. However, a significant fraction of candidates were not previously characterized in spite of their unmistakable footprint. We further characterized some of these new elements using sequence and secondary structure analysis. We also present elements that may control the expression of several non-homologous genes, suggesting co-transcription and response to common signals. An important class of such elements, which we called mobile attenuators, is provided by 3' terminators of insertion sequences or prophages that may be exapted as 5' regulators when inserted directly upstream of a cellular gene. We show here that attenuators involve a complex landscape of signal-detection structures spanning the entire bacterial domain. We discuss possible scenarios through which these diverse 5' regulatory structures may arise or evolve.
The Global Regulatory Architecture of Transcription during the Caulobacter Cell Cycle
Zhou, Bo; Schrader, Jared M.; Kalogeraki, Virginia S.; Abeliuk, Eduardo; Dinh, Cong B.; Pham, James Q.; Cui, Zhongying Z.; Dill, David L.; McAdams, Harley H.; Shapiro, Lucy
2015-01-01
Each Caulobacter cell cycle involves differentiation and an asymmetric cell division driven by a cyclical regulatory circuit comprised of four transcription factors (TFs) and a DNA methyltransferase. Using a modified global 5′ RACE protocol, we globally mapped transcription start sites (TSSs) at base-pair resolution, measured their transcription levels at multiple times in the cell cycle, and identified their transcription factor binding sites. Out of 2726 TSSs, 586 were shown to be cell cycle-regulated and we identified 529 binding sites for the cell cycle master regulators. Twenty-three percent of the cell cycle-regulated promoters were found to be under the combinatorial control of two or more of the global regulators. Previously unknown features of the core cell cycle circuit were identified, including 107 antisense TSSs which exhibit cell cycle-control, and 241 genes with multiple TSSs whose transcription levels often exhibited different cell cycle timing. Cumulatively, this study uncovered novel new layers of transcriptional regulation mediating the bacterial cell cycle. PMID:25569173
The global regulatory architecture of transcription during the Caulobacter cell cycle.
Zhou, Bo; Schrader, Jared M; Kalogeraki, Virginia S; Abeliuk, Eduardo; Dinh, Cong B; Pham, James Q; Cui, Zhongying Z; Dill, David L; McAdams, Harley H; Shapiro, Lucy
2015-01-01
Each Caulobacter cell cycle involves differentiation and an asymmetric cell division driven by a cyclical regulatory circuit comprised of four transcription factors (TFs) and a DNA methyltransferase. Using a modified global 5' RACE protocol, we globally mapped transcription start sites (TSSs) at base-pair resolution, measured their transcription levels at multiple times in the cell cycle, and identified their transcription factor binding sites. Out of 2726 TSSs, 586 were shown to be cell cycle-regulated and we identified 529 binding sites for the cell cycle master regulators. Twenty-three percent of the cell cycle-regulated promoters were found to be under the combinatorial control of two or more of the global regulators. Previously unknown features of the core cell cycle circuit were identified, including 107 antisense TSSs which exhibit cell cycle-control, and 241 genes with multiple TSSs whose transcription levels often exhibited different cell cycle timing. Cumulatively, this study uncovered novel new layers of transcriptional regulation mediating the bacterial cell cycle.
Transcriptional regulatory proteins as biosensing tools.
Turner, Kendrick; Joel, Smita; Feliciano, Jessika; Feltus, Agatha; Pasini, Patrizia; Wynn, Daniel; Dau, Peter; Dikici, Emre; Deo, Sapna K; Daunert, Sylvia
2017-06-22
We have developed sensing systems employing different classes of transcriptional regulatory proteins genetically and chemically modified to incorporate a fluorescent reporter molecule for detection of arsenic, hydroxylated polychlorinated biphenyls (OH-PCBs), and cyclic AMP (cAMP). These are the first examples of optical sensing systems based on transcriptional regulatory proteins.
Lazzaro, Martina; Feldman, Mario F; García Véscovi, Eleonora
2017-08-22
The ability to detect and measure danger from an environmental signal is paramount for bacteria to respond accordingly, deploying strategies that halt or counteract potential cellular injury and maximize survival chances. Type VI secretion systems (T6SSs) are complex bacterial contractile nanomachines able to target toxic effectors into neighboring bacteria competing for the same colonization niche. Previous studies support the concept that either T6SSs are constitutively active or they fire effectors in response to various stimuli, such as high bacterial density, cell-cell contact, nutrient depletion, or components from dead sibling cells. For Serratia marcescens , it has been proposed that its T6SS is stochastically expressed, with no distinction between harmless or aggressive competitors. In contrast, we demonstrate that the Rcs regulatory system is responsible for finely tuning Serratia T6SS expression levels, behaving as a transcriptional rheostat. When confronted with harmless bacteria, basal T6SS expression levels suffice for Serratia to eliminate the competitor. A moderate T6SS upregulation is triggered when, according to the aggressor-prey ratio, an unbalanced interplay between homologous and heterologous effectors and immunity proteins takes place. Higher T6SS expression levels are achieved when Serratia is challenged by a contender like Acinetobacter , which indiscriminately fires heterologous effectors able to exert lethal cellular harm, threatening the survival of the Serratia population. We also demonstrate that Serratia 's RcsB-dependent T6SS regulatory mechanism responds not to general stress signals but to the action of specific effectors from competitors, displaying an exquisite strategy to weigh risks and keep the balance between energy expenditure and fitness costs. IMPORTANCE Serratia marcescens is among the health-threatening pathogens categorized by the WHO as research priorities to develop alternative antimicrobial strategies, and it was
2012-01-01
Summary: Bacterial enhancer binding proteins (bEBPs) are transcriptional activators that assemble as hexameric rings in their active forms and utilize ATP hydrolysis to remodel the conformation of RNA polymerase containing the alternative sigma factor σ54. We present a comprehensive and detailed summary of recent advances in our understanding of how these specialized molecular machines function. The review is structured by introducing each of the three domains in turn: the central catalytic domain, the N-terminal regulatory domain, and the C-terminal DNA binding domain. The role of the central catalytic domain is presented with particular reference to (i) oligomerization, (ii) ATP hydrolysis, and (iii) the key GAFTGA motif that contacts σ54 for remodeling. Each of these functions forms a potential target of the signal-sensing N-terminal regulatory domain, which can act either positively or negatively to control the activation of σ54-dependent transcription. Finally, we focus on the DNA binding function of the C-terminal domain and the enhancer sites to which it binds. Particular attention is paid to the importance of σ54 to the bacterial cell and its unique role in regulating transcription. PMID:22933558
Lazzaro, Martina; Feldman, Mario F.
2017-01-01
ABSTRACT The ability to detect and measure danger from an environmental signal is paramount for bacteria to respond accordingly, deploying strategies that halt or counteract potential cellular injury and maximize survival chances. Type VI secretion systems (T6SSs) are complex bacterial contractile nanomachines able to target toxic effectors into neighboring bacteria competing for the same colonization niche. Previous studies support the concept that either T6SSs are constitutively active or they fire effectors in response to various stimuli, such as high bacterial density, cell-cell contact, nutrient depletion, or components from dead sibling cells. For Serratia marcescens, it has been proposed that its T6SS is stochastically expressed, with no distinction between harmless or aggressive competitors. In contrast, we demonstrate that the Rcs regulatory system is responsible for finely tuning Serratia T6SS expression levels, behaving as a transcriptional rheostat. When confronted with harmless bacteria, basal T6SS expression levels suffice for Serratia to eliminate the competitor. A moderate T6SS upregulation is triggered when, according to the aggressor-prey ratio, an unbalanced interplay between homologous and heterologous effectors and immunity proteins takes place. Higher T6SS expression levels are achieved when Serratia is challenged by a contender like Acinetobacter, which indiscriminately fires heterologous effectors able to exert lethal cellular harm, threatening the survival of the Serratia population. We also demonstrate that Serratia’s RcsB-dependent T6SS regulatory mechanism responds not to general stress signals but to the action of specific effectors from competitors, displaying an exquisite strategy to weigh risks and keep the balance between energy expenditure and fitness costs. PMID:28830939
Identification of regulatory targets for the bacterial Nus factor complex.
Baniulyte, Gabriele; Singh, Navjot; Benoit, Courtney; Johnson, Richard; Ferguson, Robert; Paramo, Mauricio; Stringer, Anne M; Scott, Ashley; Lapierre, Pascal; Wade, Joseph T
2017-12-11
Nus factors are broadly conserved across bacterial species, and are often essential for viability. A complex of five Nus factors (NusB, NusE, NusA, NusG and SuhB) is considered to be a dedicated regulator of ribosomal RNA folding, and has been shown to prevent Rho-dependent transcription termination. Here, we identify an additional cellular function for the Nus factor complex in Escherichia coli: repression of the Nus factor-encoding gene, suhB. This repression occurs primarily by translation inhibition, followed by Rho-dependent transcription termination. Thus, the Nus factor complex can prevent or promote Rho activity depending on the gene context. Conservation of putative NusB/E binding sites upstream of Nus factor genes suggests that Nus factor autoregulation occurs in many bacterial species. Additionally, many putative NusB/E binding sites are also found upstream of other genes in diverse species, and we demonstrate Nus factor regulation of one such gene in Citrobacter koseri. We conclude that Nus factors have an evolutionarily widespread regulatory function beyond ribosomal RNA, and that they are often autoregulatory.
Liu, Zhi-Ping; Wu, Canglin; Miao, Hongyu; Wu, Hulin
2015-01-01
Transcriptional and post-transcriptional regulation of gene expression is of fundamental importance to numerous biological processes. Nowadays, an increasing amount of gene regulatory relationships have been documented in various databases and literature. However, to more efficiently exploit such knowledge for biomedical research and applications, it is necessary to construct a genome-wide regulatory network database to integrate the information on gene regulatory relationships that are widely scattered in many different places. Therefore, in this work, we build a knowledge-based database, named ‘RegNetwork’, of gene regulatory networks for human and mouse by collecting and integrating the documented regulatory interactions among transcription factors (TFs), microRNAs (miRNAs) and target genes from 25 selected databases. Moreover, we also inferred and incorporated potential regulatory relationships based on transcription factor binding site (TFBS) motifs into RegNetwork. As a result, RegNetwork contains a comprehensive set of experimentally observed or predicted transcriptional and post-transcriptional regulatory relationships, and the database framework is flexibly designed for potential extensions to include gene regulatory networks for other organisms in the future. Based on RegNetwork, we characterized the statistical and topological properties of genome-wide regulatory networks for human and mouse, we also extracted and interpreted simple yet important network motifs that involve the interplays between TF-miRNA and their targets. In summary, RegNetwork provides an integrated resource on the prior information for gene regulatory relationships, and it enables us to further investigate context-specific transcriptional and post-transcriptional regulatory interactions based on domain-specific experimental data. Database URL: http://www.regnetworkweb.org PMID:26424082
Transcription factor trapping by RNA in gene regulatory elements.
Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A
2015-11-20
Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.
Transcription Regulation in Archaea
Gehring, Alexandra M.; Walker, Julie E.
2016-01-01
The known diversity of metabolic strategies and physiological adaptations of archaeal species to extreme environments is extraordinary. Accurate and responsive mechanisms to ensure that gene expression patterns match the needs of the cell necessitate regulatory strategies that control the activities and output of the archaeal transcription apparatus. Archaea are reliant on a single RNA polymerase for all transcription, and many of the known regulatory mechanisms employed for archaeal transcription mimic strategies also employed for eukaryotic and bacterial species. Novel mechanisms of transcription regulation have become apparent by increasingly sophisticated in vivo and in vitro investigations of archaeal species. This review emphasizes recent progress in understanding archaeal transcription regulatory mechanisms and highlights insights gained from studies of the influence of archaeal chromatin on transcription. PMID:27137495
Hijacking Complement Regulatory Proteins for Bacterial Immune Evasion.
Hovingh, Elise S; van den Broek, Bryan; Jongerius, Ilse
2016-01-01
The human complement system plays an important role in the defense against invading pathogens, inflammation and homeostasis. Invading microbes, such as bacteria, directly activate the complement system resulting in the formation of chemoattractants and in effective labeling of the bacteria for phagocytosis. In addition, formation of the membrane attack complex is responsible for direct killing of Gram-negative bacteria. In turn, bacteria have evolved several ways to evade complement activation on their surface in order to be able to colonize and invade the human host. One important mechanism of bacterial escape is attraction of complement regulatory proteins to the microbial surface. These molecules are present in the human body for tight regulation of the complement system to prevent damage to host self-surfaces. Therefore, recruitment of complement regulatory proteins to the bacterial surface results in decreased complement activation on the microbial surface which favors bacterial survival. This review will discuss recent advances in understanding the binding of complement regulatory proteins to the bacterial surface at the molecular level. This includes, new insights that have become available concerning specific conserved motives on complement regulatory proteins that are favorable for microbial binding. Finally, complement evasion molecules are of high importance for vaccine development due to their dominant role in bacterial survival, high immunogenicity and homology as well as their presence on the bacterial surface. Here, the use of complement evasion molecules for vaccine development will be discussed.
Hijacking Complement Regulatory Proteins for Bacterial Immune Evasion
Hovingh, Elise S.; van den Broek, Bryan; Jongerius, Ilse
2016-01-01
The human complement system plays an important role in the defense against invading pathogens, inflammation and homeostasis. Invading microbes, such as bacteria, directly activate the complement system resulting in the formation of chemoattractants and in effective labeling of the bacteria for phagocytosis. In addition, formation of the membrane attack complex is responsible for direct killing of Gram-negative bacteria. In turn, bacteria have evolved several ways to evade complement activation on their surface in order to be able to colonize and invade the human host. One important mechanism of bacterial escape is attraction of complement regulatory proteins to the microbial surface. These molecules are present in the human body for tight regulation of the complement system to prevent damage to host self-surfaces. Therefore, recruitment of complement regulatory proteins to the bacterial surface results in decreased complement activation on the microbial surface which favors bacterial survival. This review will discuss recent advances in understanding the binding of complement regulatory proteins to the bacterial surface at the molecular level. This includes, new insights that have become available concerning specific conserved motives on complement regulatory proteins that are favorable for microbial binding. Finally, complement evasion molecules are of high importance for vaccine development due to their dominant role in bacterial survival, high immunogenicity and homology as well as their presence on the bacterial surface. Here, the use of complement evasion molecules for vaccine development will be discussed. PMID:28066340
Bacterial Transcription as a Target for Antibacterial Drug Development
Ma, Cong; Yang, Xiao
2016-01-01
SUMMARY Transcription, the first step of gene expression, is carried out by the enzyme RNA polymerase (RNAP) and is regulated through interaction with a series of protein transcription factors. RNAP and its associated transcription factors are highly conserved across the bacterial domain and represent excellent targets for broad-spectrum antibacterial agent discovery. Despite the numerous antibiotics on the market, there are only two series currently approved that target transcription. The determination of the three-dimensional structures of RNAP and transcription complexes at high resolution over the last 15 years has led to renewed interest in targeting this essential process for antibiotic development by utilizing rational structure-based approaches. In this review, we describe the inhibition of the bacterial transcription process with respect to structural studies of RNAP, highlight recent progress toward the discovery of novel transcription inhibitors, and suggest additional potential antibacterial targets for rational drug design. PMID:26764017
Transcriptional regulatory elements in the noncoding region of human papillomavirus type 6
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Tzyy-Choou.
1989-01-01
The structure and function of the transcriptional regulatory region of human papillomavirus type 6 (HPV-6) has been investigated. To investigate tissue specific gene expression, a sensitive method to detect and localize HPV-6 viral DNA, mRNA and protein in plastic-embedded tissue sections of genital and respiratory tract papillomata by using in situ hybridization and immunoperoxidase assays has been developed. This method, using ultrathin sections and strand-specific {sup 3}H labeled riboprobes, offers the advantages of superior morphological preservation and detection of viral genomes at low copy number with good resolution, and the modified immunocytochemistry provides better sensitivity. The results suggest that genitalmore » tract epithelium is more permissive for HPV-6 replication than respiratory tract epithelium. To study the tissue tropism of HPV-6 at the level of regulation of viral gene expression, the polymerase chain reaction was used to isolate the noncoding region (NCR) of HPV-6 in independent isolates. Nucleotide sequence analysis of molecularly cloned DNA identified base substitutions, deletions/insertions and tandem duplications. Transcriptional regulatory elements in the NCR were assayed in recombinant plasmids containing the bacterial gene for chloramphenicol acetyl transferase.« less
Han, Kook; Tjaden, Brian; Lory, Stephen
2017-01-01
The first step in the post-transcriptional regulatory function of most bacterial small non-coding RNAs (sRNAs) is base-pairing with partially complementary sequences of targeted transcripts. We present a simple method for identifying sRNA targets in vivo and defining processing sites of the regulated transcripts. The technique (referred to as GRIL-Seq) is based on preferential ligation of sRNAs to ends of base-paired targets in bacteria co-expressing T4 RNA ligase, followed by sequencing to identify the chimeras. In addition to the RNA chaperone Hfq, the GRIL-Seq method depends on the activity of the pyrophosphorylase RppH. Using PrrF1, an iron-regulated sRNA in Pseudomonas aeruginosa, we demonstrate that direct regulatory targets of this sRNA can be readily identified. Therefore, GRIL-Seq represents a powerful tool not only for identifying direct targets of sRNAs in a variety of environments, but can also result in uncovering novel roles for sRNAs and their targets in complex regulatory networks. PMID:28005055
Bacterial effectors target the plant cell nucleus to subvert host transcription.
Canonne, Joanne; Rivas, Susana
2012-02-01
In order to promote virulence, Gram-negative bacteria have evolved the ability to inject so-called type III effector proteins into host cells. The plant cell nucleus appears to be a subcellular compartment repeatedly targeted by bacterial effectors. In agreement with this observation, mounting evidence suggests that manipulation of host transcription is a major strategy developed by bacteria to counteract plant defense responses. It has been suggested that bacterial effectors may adopt at least three alternative, although not mutually exclusive, strategies to subvert host transcription. T3Es may (1) act as transcription factors that directly activate transcription in host cells, (2) affect histone packing and chromatin configuration, and/or (3) target host transcription factor activity. Here, we provide an overview on how all these strategies may lead to host transcriptional re-programming and, as a result, to improved bacterial multiplication inside plant cells.
Han, Kook; Tjaden, Brian; Lory, Stephen
2016-12-22
The first step in the post-transcriptional regulatory function of most bacterial small non-coding RNAs (sRNAs) is base pairing with partially complementary sequences of targeted transcripts. We present a simple method for identifying sRNA targets in vivo and defining processing sites of the regulated transcripts. The technique, referred to as global small non-coding RNA target identification by ligation and sequencing (GRIL-seq), is based on preferential ligation of sRNAs to the ends of base-paired targets in bacteria co-expressing T4 RNA ligase, followed by sequencing to identify the chimaeras. In addition to the RNA chaperone Hfq, the GRIL-seq method depends on the activity of the pyrophosphorylase RppH. Using PrrF1, an iron-regulated sRNA in Pseudomonas aeruginosa, we demonstrated that direct regulatory targets of this sRNA can readily be identified. Therefore, GRIL-seq represents a powerful tool not only for identifying direct targets of sRNAs in a variety of environments, but also for uncovering novel roles for sRNAs and their targets in complex regulatory networks.
Transcriptional Regulatory Networks in Saccharomyces cerevisiae
NASA Astrophysics Data System (ADS)
Lee, Tong Ihn; Rinaldi, Nicola J.; Robert, François; Odom, Duncan T.; Bar-Joseph, Ziv; Gerber, Georg K.; Hannett, Nancy M.; Harbison, Christopher T.; Thompson, Craig M.; Simon, Itamar; Zeitlinger, Julia; Jennings, Ezra G.; Murray, Heather L.; Gordon, D. Benjamin; Ren, Bing; Wyrick, John J.; Tagne, Jean-Bosco; Volkert, Thomas L.; Fraenkel, Ernest; Gifford, David K.; Young, Richard A.
2002-10-01
We have determined how most of the transcriptional regulators encoded in the eukaryote Saccharomyces cerevisiae associate with genes across the genome in living cells. Just as maps of metabolic networks describe the potential pathways that may be used by a cell to accomplish metabolic processes, this network of regulator-gene interactions describes potential pathways yeast cells can use to regulate global gene expression programs. We use this information to identify network motifs, the simplest units of network architecture, and demonstrate that an automated process can use motifs to assemble a transcriptional regulatory network structure. Our results reveal that eukaryotic cellular functions are highly connected through networks of transcriptional regulators that regulate other transcriptional regulators.
The G-Box Transcriptional Regulatory Code in Arabidopsis1[OPEN
Shepherd, Samuel J.K.; Brestovitsky, Anna; Dickinson, Patrick; Biswas, Surojit
2017-01-01
Plants have significantly more transcription factor (TF) families than animals and fungi, and plant TF families tend to contain more genes; these expansions are linked to adaptation to environmental stressors. Many TF family members bind to similar or identical sequence motifs, such as G-boxes (CACGTG), so it is difficult to predict regulatory relationships. We determined that the flanking sequences near G-boxes help determine in vitro specificity but that this is insufficient to predict the transcription pattern of genes near G-boxes. Therefore, we constructed a gene regulatory network that identifies the set of bZIPs and bHLHs that are most predictive of the expression of genes downstream of perfect G-boxes. This network accurately predicts transcriptional patterns and reconstructs known regulatory subnetworks. Finally, we present Ara-BOX-cis (araboxcis.org), a Web site that provides interactive visualizations of the G-box regulatory network, a useful resource for generating predictions for gene regulatory relations. PMID:28864470
Defining Transcriptional Regulatory Mechanisms for Primary let-7 miRNAs
Gaeta, Xavier; Le, Luat; Lin, Ying; Xie, Yuan; Lowry, William E.
2017-01-01
The let-7 family of miRNAs have been shown to control developmental timing in organisms from C. elegans to humans; their function in several essential cell processes throughout development is also well conserved. Numerous studies have defined several steps of post-transcriptional regulation of let-7 production; from pri-miRNA through pre-miRNA, to the mature miRNA that targets endogenous mRNAs for degradation or translational inhibition. Less-well defined are modes of transcriptional regulation of the pri-miRNAs for let-7. let-7 pri-miRNAs are expressed in polycistronic fashion, in long transcripts newly annotated based on chromatin-associated RNA-sequencing. Upon differentiation, we found that some let-7 pri-miRNAs are regulated at the transcriptional level, while others appear to be constitutively transcribed. Using the Epigenetic Roadmap database, we further annotated regulatory elements of each polycistron identified putative promoters and enhancers. Probing these regulatory elements for transcription factor binding sites identified factors that regulate transcription of let-7 in both promoter and enhancer regions, and identified novel regulatory mechanisms for this important class of miRNAs. PMID:28052101
Archaeal RNA polymerase and transcription regulation
Jun, Sung-Hoon; Reichlen, Matthew J.; Tajiri, Momoko; Murakami, Katsuhiko S.
2010-01-01
To elucidate the mechanism of transcription by cellular RNA polymerases (RNAPs), high resolution X-ray crystal structures together with structure-guided biochemical, biophysical and genetics studies are essential. The recently-solved X-ray crystal structures of archaeal RNA polymerase (RNAP) allow a structural comparison of the transcription machinery among all three domains of life. The archaea were once thought of closely related to bacteria, but they are now considered to be more closely related to the eukaryote at the molecular level than bacteria. According to these structures, the archaeal transcription apparatus, which includes RNAP and general transcription factors, is similar to the eukaryotic transcription machinery. Yet, the transcription regulators, activators and repressors, encoded by archaeal genomes are closely related to bacterial factors. Therefore, archaeal transcription appears to possess an intriguing hybrid of eukaryotic-type transcription apparatus and bacterial-like regulatory mechanisms. Elucidating the transcription mechanism in archaea, which possesses a combination of bacterial and eukaryotic transcription mechanisms that are commonly regarded as separate and mutually exclusive, can provide data that will bring basic transcription mechanisms across all three domains of life. PMID:21250781
Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.
2015-03-22
Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.
Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less
Henry, Kelli F; Kawashima, Tomokazu; Goldberg, Robert B
2015-06-01
Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globular-stage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. A homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.
An, Shi-Qi; Febrer, Melanie; McCarthy, Yvonne; Tang, Dong-Jie; Clissold, Leah; Kaithakottil, Gemy; Swarbreck, David; Tang, Ji-Liang; Rogers, Jane; Dow, J Maxwell; Ryan, Robert P
2013-01-01
The bacterium Xanthomonas campestris is an economically important pathogen of many crop species and a model for the study of bacterial phytopathogenesis. In X. campestris, a regulatory system mediated by the signal molecule DSF controls virulence to plants. The synthesis and recognition of the DSF signal depends upon different Rpf proteins. DSF signal generation requires RpfF whereas signal perception and transduction depends upon a system comprising the sensor RpfC and regulator RpfG. Here we have addressed the action and role of Rpf/DSF signalling in phytopathogenesis by high-resolution transcriptional analysis coupled to functional genomics. We detected transcripts for many genes that were unidentified by previous computational analysis of the genome sequence. Novel transcribed regions included intergenic transcripts predicted as coding or non-coding as well as those that were antisense to coding sequences. In total, mutation of rpfF, rpfG and rpfC led to alteration in transcript levels (more than fourfold) of approximately 480 genes. The regulatory influence of RpfF and RpfC demonstrated considerable overlap. Contrary to expectation, the regulatory influence of RpfC and RpfG had limited overlap, indicating complexities of the Rpf signalling system. Importantly, functional analysis revealed over 160 new virulence factors within the group of Rpf-regulated genes. PMID:23617851
A dual switch controls bacterial enhancer-dependent transcription
Wiesler, Simone C.; Burrows, Patricia C.; Buck, Martin
2012-01-01
Bacterial RNA polymerases (RNAPs) are targets for antibiotics. Myxopyronin binds to the RNAP switch regions to block structural rearrangements needed for formation of open promoter complexes. Bacterial RNAPs containing the major variant σ54 factor are activated by enhancer-binding proteins (bEBPs) and transcribe genes whose products are needed in pathogenicity and stress responses. We show that (i) enhancer-dependent RNAPs help Escherichia coli to survive in the presence of myxopyronin, (ii) enhancer-dependent RNAPs partially resist inhibition by myxopyronin and (iii) ATP hydrolysis catalysed by bEBPs is obligatory for functional interaction of the RNAP switch regions with the transcription start site. We demonstrate that enhancer-dependent promoters contain two barriers to full DNA opening, allowing tight regulation of transcription initiation. bEBPs engage in a dual switch to (i) allow propagation of nucleated DNA melting from an upstream DNA fork junction and (ii) complete the formation of the transcription bubble and downstream DNA fork junction at the RNA synthesis start site, resulting in switch region-dependent RNAP clamp closure and open promoter complex formation. PMID:22965125
Transcriptional Regulatory Network Analysis of MYB Transcription Factor Family Genes in Rice.
Smita, Shuchi; Katiyar, Amit; Chinnusamy, Viswanathan; Pandey, Dev M; Bansal, Kailash C
2015-01-01
MYB transcription factor (TF) is one of the largest TF families and regulates defense responses to various stresses, hormone signaling as well as many metabolic and developmental processes in plants. Understanding these regulatory hierarchies of gene expression networks in response to developmental and environmental cues is a major challenge due to the complex interactions between the genetic elements. Correlation analyses are useful to unravel co-regulated gene pairs governing biological process as well as identification of new candidate hub genes in response to these complex processes. High throughput expression profiling data are highly useful for construction of co-expression networks. In the present study, we utilized transcriptome data for comprehensive regulatory network studies of MYB TFs by "top-down" and "guide-gene" approaches. More than 50% of OsMYBs were strongly correlated under 50 experimental conditions with 51 hub genes via "top-down" approach. Further, clusters were identified using Markov Clustering (MCL). To maximize the clustering performance, parameter evaluation of the MCL inflation score (I) was performed in terms of enriched GO categories by measuring F-score. Comparison of co-expressed cluster and clads analyzed from phylogenetic analysis signifies their evolutionarily conserved co-regulatory role. We utilized compendium of known interaction and biological role with Gene Ontology enrichment analysis to hypothesize function of coexpressed OsMYBs. In the other part, the transcriptional regulatory network analysis by "guide-gene" approach revealed 40 putative targets of 26 OsMYB TF hubs with high correlation value utilizing 815 microarray data. The putative targets with MYB-binding cis-elements enrichment in their promoter region, functional co-occurrence as well as nuclear localization supports our finding. Specially, enrichment of MYB binding regions involved in drought-inducibility implying their regulatory role in drought response in rice
Hummel, Aaron W; Doyle, Erin L; Bogdanove, Adam J
2012-09-01
Xanthomonas transcription activator-like (TAL) effectors promote disease in plants by binding to and activating host susceptibility genes. Plants counter with TAL effector-activated executor resistance genes, which cause host cell death and block disease progression. We asked whether the functional specificity of an executor gene could be broadened by adding different TAL effector binding elements (EBEs) to it. We added six EBEs to the rice Xa27 gene, which confers resistance to strains of the bacterial blight pathogen Xanthomonas oryzae pv. oryzae (Xoo) that deliver the TAL effector AvrXa27. The EBEs correspond to three other effectors from Xoo strain PXO99(A) and three from strain BLS256 of the bacterial leaf streak pathogen Xanthomonas oryzae pv. oryzicola (Xoc). Stable integration into rice produced healthy lines exhibiting gene activation by each TAL effector, and resistance to PXO99(A) , a PXO99(A) derivative lacking AvrXa27, and BLS256, as well as two other Xoo and 10 Xoc strains virulent toward wildtype Xa27 plants. Transcripts initiated primarily at a common site. Sequences in the EBEs were found to occur nonrandomly in rice promoters, suggesting an overlap with endogenous regulatory sequences. Thus, executor gene specificity can be broadened by adding EBEs, but caution is warranted because of the possible coincident introduction of endogenous regulatory elements. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.
SeqTU: A web server for identification of bacterial transcription units
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Xin; Chou, Wen -Chi; Ma, Qin
A transcription unit (TU) consists of K ≥ 1 consecutive genes on the same strand of a bacterial genome that are transcribed into a single mRNA molecule under certain conditions. Their identification is an essential step in elucidation of transcriptional regulatory networks. We have recently developed a machine-learning method to accurately identify TUs from RNA-seq data, based on two features of the assembled RNA reads: the continuity and stability of RNA-seq coverage across a genomic region. While good performance was achieved by the method on Escherichia coli and Clostridium thermocellum, substantial work is needed to make the program generally applicablemore » to all bacteria, knowing that the program requires organism specific information. A web server, named SeqTU, was developed to automatically identify TUs with given RNA-seq data of any bacterium using a machine-learning approach. The server consists of a number of utility tools, in addition to TU identification, such as data preparation, data quality check and RNA-read mapping. SeqTU provides a user-friendly interface and automated prediction of TUs from given RNA-seq data. Furthermore, the predicted TUs are displayed intuitively using HTML format along with a graphic visualization of the prediction.« less
SeqTU: A web server for identification of bacterial transcription units
Chen, Xin; Chou, Wen -Chi; Ma, Qin; ...
2017-03-07
A transcription unit (TU) consists of K ≥ 1 consecutive genes on the same strand of a bacterial genome that are transcribed into a single mRNA molecule under certain conditions. Their identification is an essential step in elucidation of transcriptional regulatory networks. We have recently developed a machine-learning method to accurately identify TUs from RNA-seq data, based on two features of the assembled RNA reads: the continuity and stability of RNA-seq coverage across a genomic region. While good performance was achieved by the method on Escherichia coli and Clostridium thermocellum, substantial work is needed to make the program generally applicablemore » to all bacteria, knowing that the program requires organism specific information. A web server, named SeqTU, was developed to automatically identify TUs with given RNA-seq data of any bacterium using a machine-learning approach. The server consists of a number of utility tools, in addition to TU identification, such as data preparation, data quality check and RNA-read mapping. SeqTU provides a user-friendly interface and automated prediction of TUs from given RNA-seq data. Furthermore, the predicted TUs are displayed intuitively using HTML format along with a graphic visualization of the prediction.« less
Fang, Xin; Sastry, Anand; Mih, Nathan; Kim, Donghyuk; Tan, Justin; Lloyd, Colton J.; Gao, Ye; Yang, Laurence; Palsson, Bernhard O.
2017-01-01
Transcriptional regulatory networks (TRNs) have been studied intensely for >25 y. Yet, even for the Escherichia coli TRN—probably the best characterized TRN—several questions remain. Here, we address three questions: (i) How complete is our knowledge of the E. coli TRN; (ii) how well can we predict gene expression using this TRN; and (iii) how robust is our understanding of the TRN? First, we reconstructed a high-confidence TRN (hiTRN) consisting of 147 transcription factors (TFs) regulating 1,538 transcription units (TUs) encoding 1,764 genes. The 3,797 high-confidence regulatory interactions were collected from published, validated chromatin immunoprecipitation (ChIP) data and RegulonDB. For 21 different TF knockouts, up to 63% of the differentially expressed genes in the hiTRN were traced to the knocked-out TF through regulatory cascades. Second, we trained supervised machine learning algorithms to predict the expression of 1,364 TUs given TF activities using 441 samples. The algorithms accurately predicted condition-specific expression for 86% (1,174 of 1,364) of the TUs, while 193 TUs (14%) were predicted better than random TRNs. Third, we identified 10 regulatory modules whose definitions were robust against changes to the TRN or expression compendium. Using surrogate variable analysis, we also identified three unmodeled factors that systematically influenced gene expression. Our computational workflow comprehensively characterizes the predictive capabilities and systems-level functions of an organism’s TRN from disparate data types. PMID:28874552
Role of the σ 54 Activator Interacting Domain in Bacterial Transcription Initiation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Siegel, Alexander R.; Wemmer, David E.
Bacterial sigma factors are subunits of RNA polymerase that direct the holoenzyme to specific sets of promoters in the genome and are a central element of regulating transcription. Most polymerase holoenzymes open the promoter and initiate transcription rapidly after binding. However, polymerase containing the members of the σ 54 family must be acted on by a transcriptional activator before DNA opening and initiation occur. A key domain in these transcriptional activators forms a hexameric AAA + ATPase that acts through conformational changes brought on by ATP hydrolysis. Contacts between the transcriptional activator and σ 54 are primarily made through anmore » N-terminal σ 54 activator interacting domain (AID). To better understand this mechanism of bacterial transcription initiation, we characterized the σ 54 AID by NMR spectroscopy and other biophysical methods and show that it is an intrinsically disordered domain in σ 54 alone. In this paper, we identified a minimal construct of the Aquifex aeolicus σ 54 AID that consists of two predicted helices and retains native-like binding affinity for the transcriptional activator NtrC1. Using the NtrC1 ATPase domain, bound with the non-hydrolyzable ATP analog ADP-beryllium fluoride, we studied the NtrC1–σ 54 AID complex using NMR spectroscopy. We show that the σ 54 AID becomes structured after associating with the core loops of the transcriptional activators in their ATP state and that the primary site of the interaction is the first predicted helix. Finally, understanding this complex, formed as the first step toward initiation, will help unravel the mechanism of σ 54 bacterial transcription initiation.« less
Dynamics of Bacterial Gene Regulatory Networks.
Shis, David L; Bennett, Matthew R; Igoshin, Oleg A
2018-05-20
The ability of bacterial cells to adjust their gene expression program in response to environmental perturbation is often critical for their survival. Recent experimental advances allowing us to quantitatively record gene expression dynamics in single cells and in populations coupled with mathematical modeling enable mechanistic understanding on how these responses are shaped by the underlying regulatory networks. Here, we review how the combination of local and global factors affect dynamical responses of gene regulatory networks. Our goal is to discuss the general principles that allow extrapolation from a few model bacteria to less understood microbes. We emphasize that, in addition to well-studied effects of network architecture, network dynamics are shaped by global pleiotropic effects and cell physiology.
Bacterial Iron–Sulfur Regulatory Proteins As Biological Sensor-Switches
Crack, Jason C.; Green, Jeffrey; Hutchings, Matthew I.; Thomson, Andrew J.
2012-01-01
Abstract Significance: In recent years, bacterial iron–sulfur cluster proteins that function as regulators of gene transcription have emerged as a major new group. In all cases, the cluster acts as a sensor of the environment and enables the organism to adapt to the prevailing conditions. This can range from mounting a response to oxidative or nitrosative stress to switching between anaerobic and aerobic respiratory pathways. The sensitivity of these ancient cofactors to small molecule reactive oxygen and nitrogen species, in particular, makes them ideally suited to function as sensors. Recent Advances: An important challenge is to obtain mechanistic and structural information about how these regulators function and, in particular, how the chemistry occurring at the cluster drives the subsequent regulatory response. For several regulators, including FNR, SoxR, NsrR, IscR, and Wbl proteins, major advances in understanding have been gained recently and these are reviewed here. Critical Issues: A common theme emerging from these studies is that the sensitivity and specificity of the cluster of each regulatory protein must be exquisitely controlled by the protein environment of the cluster. Future Directions: A major future challenge is to determine, for a range of regulators, the key factors for achieving control of sensitivity/specificity. Such information will lead, eventually, to a system understanding of stress response, which often involves more than one regulator. Antioxid. Redox Signal. 17, 1215–1231. PMID:22239203
Martínez-Núñez, Mario Alberto; Poot-Hernandez, Augusto Cesar; Rodríguez-Vázquez, Katya; Perez-Rueda, Ernesto
2013-01-01
In this work, the content of enzymes and DNA-binding transcription factors (TFs) in 794 non-redundant prokaryotic genomes was evaluated. The identification of enzymes was based on annotations deposited in the KEGG database as well as in databases of functional domains (COG and PFAM) and structural domains (Superfamily). For identifications of the TFs, hidden Markov profiles were constructed based on well-known transcriptional regulatory families. From these analyses, we obtained diverse and interesting results, such as the negative rate of incremental changes in the number of detected enzymes with respect to the genome size. On the contrary, for TFs the rate incremented as the complexity of genome increased. This inverse related performance shapes the diversity of metabolic and regulatory networks and impacts the availability of enzymes and TFs. Furthermore, the intersection of the derivatives between enzymes and TFs was identified at 9,659 genes, after this point, the regulatory complexity grows faster than metabolic complexity. In addition, TFs have a low number of duplications, in contrast to the apparent high number of duplications associated with enzymes. Despite the greater number of duplicated enzymes versus TFs, the increment by which duplicates appear is higher in TFs. A lower proportion of enzymes among archaeal genomes (22%) than in the bacterial ones (27%) was also found. This low proportion might be compensated by the interconnection between the metabolic pathways in Archaea. A similar proportion was also found for the archaeal TFs, for which the formation of regulatory complexes has been proposed. Finally, an enrichment of multifunctional enzymes in Bacteria, as a mechanism of ecological adaptation, was detected.
Martínez-Núñez, Mario Alberto; Poot-Hernandez, Augusto Cesar; Rodríguez-Vázquez, Katya; Perez-Rueda, Ernesto
2013-01-01
In this work, the content of enzymes and DNA-binding transcription factors (TFs) in 794 non-redundant prokaryotic genomes was evaluated. The identification of enzymes was based on annotations deposited in the KEGG database as well as in databases of functional domains (COG and PFAM) and structural domains (Superfamily). For identifications of the TFs, hidden Markov profiles were constructed based on well-known transcriptional regulatory families. From these analyses, we obtained diverse and interesting results, such as the negative rate of incremental changes in the number of detected enzymes with respect to the genome size. On the contrary, for TFs the rate incremented as the complexity of genome increased. This inverse related performance shapes the diversity of metabolic and regulatory networks and impacts the availability of enzymes and TFs. Furthermore, the intersection of the derivatives between enzymes and TFs was identified at 9,659 genes, after this point, the regulatory complexity grows faster than metabolic complexity. In addition, TFs have a low number of duplications, in contrast to the apparent high number of duplications associated with enzymes. Despite the greater number of duplicated enzymes versus TFs, the increment by which duplicates appear is higher in TFs. A lower proportion of enzymes among archaeal genomes (22%) than in the bacterial ones (27%) was also found. This low proportion might be compensated by the interconnection between the metabolic pathways in Archaea. A similar proportion was also found for the archaeal TFs, for which the formation of regulatory complexes has been proposed. Finally, an enrichment of multifunctional enzymes in Bacteria, as a mechanism of ecological adaptation, was detected. PMID:23922780
Effect of regulatory peptides on gene transcription.
Khavinson, V Kh; Shataeva, L K; Chernova, A A
2003-09-01
Experimental studies of geroprotective activity of synthetic oligopeptides and conformational analysis of the tetrapeptide Epithalon allowed us to hypothesize that regulatory oligopeptides directly initiate transcription of genes for vitally important proteins. Sequences of nucleotide pairs that can serve as binding sites for tetrapeptide Epithalon were identified in the promoter regions of retinal genes F379, telomerase, and RNA polymerase II.
Vermeirssen, Vanessa; De Clercq, Inge; Van Parys, Thomas; Van Breusegem, Frank; Van de Peer, Yves
2014-12-01
The abiotic stress response in plants is complex and tightly controlled by gene regulation. We present an abiotic stress gene regulatory network of 200,014 interactions for 11,938 target genes by integrating four complementary reverse-engineering solutions through average rank aggregation on an Arabidopsis thaliana microarray expression compendium. This ensemble performed the most robustly in benchmarking and greatly expands upon the availability of interactions currently reported. Besides recovering 1182 known regulatory interactions, cis-regulatory motifs and coherent functionalities of target genes corresponded with the predicted transcription factors. We provide a valuable resource of 572 abiotic stress modules of coregulated genes with functional and regulatory information, from which we deduced functional relationships for 1966 uncharacterized genes and many regulators. Using gain- and loss-of-function mutants of seven transcription factors grown under control and salt stress conditions, we experimentally validated 141 out of 271 predictions (52% precision) for 102 selected genes and mapped 148 additional transcription factor-gene regulatory interactions (49% recall). We identified an intricate core oxidative stress regulatory network where NAC13, NAC053, ERF6, WRKY6, and NAC032 transcription factors interconnect and function in detoxification. Our work shows that ensemble reverse-engineering can generate robust biological hypotheses of gene regulation in a multicellular eukaryote that can be tested by medium-throughput experimental validation. © 2014 American Society of Plant Biologists. All rights reserved.
A prior-based integrative framework for functional transcriptional regulatory network inference
Siahpirani, Alireza F.
2017-01-01
Abstract Transcriptional regulatory networks specify regulatory proteins controlling the context-specific expression levels of genes. Inference of genome-wide regulatory networks is central to understanding gene regulation, but remains an open challenge. Expression-based network inference is among the most popular methods to infer regulatory networks, however, networks inferred from such methods have low overlap with experimentally derived (e.g. ChIP-chip and transcription factor (TF) knockouts) networks. Currently we have a limited understanding of this discrepancy. To address this gap, we first develop a regulatory network inference algorithm, based on probabilistic graphical models, to integrate expression with auxiliary datasets supporting a regulatory edge. Second, we comprehensively analyze our and other state-of-the-art methods on different expression perturbation datasets. Networks inferred by integrating sequence-specific motifs with expression have substantially greater agreement with experimentally derived networks, while remaining more predictive of expression than motif-based networks. Our analysis suggests natural genetic variation as the most informative perturbation for network inference, and, identifies core TFs whose targets are predictable from expression. Multiple reasons make the identification of targets of other TFs difficult, including network architecture and insufficient variation of TF mRNA level. Finally, we demonstrate the utility of our inference algorithm to infer stress-specific regulatory networks and for regulator prioritization. PMID:27794550
Validating regulatory predictions from diverse bacteria with mutant fitness data
Sagawa, Shiori; Price, Morgan N.; Deutschbauer, Adam M.; ...
2017-05-24
Although transcriptional regulation is fundamental to understanding bacterial physiology, the targets of most bacterial transcription factors are not known. Comparative genomics has been used to identify likely targets of some of these transcription factors, but these predictions typically lack experimental support. Here, we used mutant fitness data, which measures the importance of each gene for a bacterium's growth across many conditions, to test regulatory predictions from RegPrecise, a curated collection of comparative genomics predictions. Because characterized transcription factors often have correlated fitness with one of their targets (either positively or negatively), correlated fitness patterns provide support for the comparative genomicsmore » predictions. At a false discovery rate of 3%, we identified significant cofitness for at least one target of 158 TFs in 107 ortholog groups and from 24 bacteria. Thus, high-throughput genetics can be used to identify a high-confidence subset of the sequence-based regulatory predictions.« less
Validating regulatory predictions from diverse bacteria with mutant fitness data
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sagawa, Shiori; Price, Morgan N.; Deutschbauer, Adam M.
Although transcriptional regulation is fundamental to understanding bacterial physiology, the targets of most bacterial transcription factors are not known. Comparative genomics has been used to identify likely targets of some of these transcription factors, but these predictions typically lack experimental support. Here, we used mutant fitness data, which measures the importance of each gene for a bacterium's growth across many conditions, to test regulatory predictions from RegPrecise, a curated collection of comparative genomics predictions. Because characterized transcription factors often have correlated fitness with one of their targets (either positively or negatively), correlated fitness patterns provide support for the comparative genomicsmore » predictions. At a false discovery rate of 3%, we identified significant cofitness for at least one target of 158 TFs in 107 ortholog groups and from 24 bacteria. Thus, high-throughput genetics can be used to identify a high-confidence subset of the sequence-based regulatory predictions.« less
The use of in vitro transcription to probe regulatory functions of viral protein domains.
Loewenstein, Paul M; Song, Chao-Zhong; Green, Maurice
2007-01-01
Adenoviruses (Ads), like other DNA tumor viruses, have evolved specific regulatory genes that facilitate virus replication by controlling the transcription of other viral genes as well as that of key cellular genes. In this regard, the E1A transcription unit contains multiple protein domains that can transcriptionally activate or repress cellular genes involved in the regulation of cell proliferation and cell differentiation. Studies using in vitro transcription have provided a basis for a molecular understanding of the interaction of viral regulatory proteins with the transcriptional machinery of the cell and continue to inform our understanding of transcription regulation. This chapter provides examples of the use of in vitro transcription to analyze transcriptional activation and transcriptional repression by purified, recombinant Ad E1A protein domains and single amino acid substitution mutants as well as the use of protein-affinity chromatography to identify host cell transcription factors involved in viral transcriptional regulation. A detailed description is provided of the methodology to prepare nuclear transcription extract, to prepare biologically active protein domains, to prepare affinity depleted transcription extracts, and to analyze transcription by primer extension and by run-off assay using naked DNA templates.
Identification of transcription regulatory relationships in rheumatoid arthritis and osteoarthritis.
Li, Guofeng; Han, Ning; Li, Zengchun; Lu, Qingyou
2013-05-01
Rheumatoid arthritis (RA) is recognized as the most crippling or disabling type of arthritis, and osteoarthritis (OA) is the most common form of arthritis. These diseases severely reduce the quality of life, and cause high socioeconomic burdens. However, the molecular mechanisms of RA and OA development remain elusive despite intensive research efforts. In this study, we aimed to identify the potential transcription regulatory relationships between transcription factors (TFs) and differentially co-expressed genes (DCGs) in RA and OA, respectively. We downloaded the gene expression profiles of RA and OA from the Gene Expression Omnibus and analyzed the gene expression using computational methods. We identified a set of 4,076 DCGs in pairwise comparisons between RA and OA patients, RA and normal donors (NDs), or OA and ND. After regulatory network construction and regulatory impact factor analysis, we found that EGR1, NFE2L1, and NFYA were crucial TFs in the regulatory network of RA and NFYA, CBFB, CREB1, YY1 and PATZ1 were crucial TFs in the regulatory network of OA. These TFs could regulate the DCGs expression to involve RA and OA by promoting or inhibiting their expression. Altogether, our work may extend our understanding of disease mechanisms and may lead to an improved diagnosis. However, further experiments are still needed to confirm these observations.
Evolution of UCP1 Transcriptional Regulatory Elements Across the Mammalian Phylogeny
Gaudry, Michael J.; Campbell, Kevin L.
2017-01-01
Uncoupling protein 1 (UCP1) permits non-shivering thermogenesis (NST) when highly expressed in brown adipose tissue (BAT) mitochondria. Exclusive to placental mammals, BAT has commonly been regarded to be advantageous for thermoregulation in hibernators, small-bodied species, and the neonates of larger species. While numerous regulatory control motifs associated with UCP1 transcription have been proposed for murid rodents, it remains unclear whether these are conserved across the eutherian mammal phylogeny and hence essential for UCP1 expression. To address this shortcoming, we conducted a broad comparative survey of putative UCP1 transcriptional regulatory elements in 139 mammals (135 eutherians). We find no evidence for presence of a UCP1 enhancer in monotremes and marsupials, supporting the hypothesis that this control region evolved in a stem eutherian ancestor. We additionally reveal that several putative promoter elements (e.g., CRE-4, CCAAT) identified in murid rodents are not conserved among BAT-expressing eutherians, and together with the putative regulatory region (PRR) and CpG island do not appear to be crucial for UCP1 expression. The specificity and importance of the upTRE, dnTRE, URE1, CRE-2, RARE-2, NBRE, BRE-1, and BRE-2 enhancer elements first described from rats and mice are moreover uncertain as these motifs differ substantially—but generally remain highly conserved—in other BAT-expressing eutherians. Other UCP1 enhancer motifs (CRE-3, PPRE, and RARE-3) as well as the TATA box are also highly conserved in nearly all eutherian lineages with an intact UCP1. While these transcriptional regulatory motifs are generally also maintained in species where this gene is pseudogenized, the loss or degeneration of key basal promoter (e.g., TATA box) and enhancer elements in other UCP1-lacking lineages make it unlikely that the enhancer region is pleiotropic (i.e., co-regulates additional genes). Importantly, differential losses of (or mutations within
Ares, Miguel A; Fernández-Vázquez, José L; Pacheco, Sabino; Martínez-Santos, Verónica I; Jarillo-Quijada, Ma Dolores; Torres, Javier; Alcántar-Curiel, María D; González-Y-Merchand, Jorge A; De la Cruz, Miguel A
2017-01-01
Klebsiella pneumoniae is a common opportunistic pathogen causing nosocomial infections. One of the main virulence determinants of K. pneumoniae is the type 3 pilus (T3P). T3P helps the bacterial interaction to both abiotic and biotic surfaces and it is crucial for the biofilm formation. T3P is genetically organized in three transcriptional units: the mrkABCDF polycistronic operon, the mrkHI bicistronic operon and the mrkJ gene. MrkH is a regulatory protein encoded in the mrkHI operon, which positively regulates the mrkA pilin gene and its own expression. In contrast, the H-NS nucleoid protein represses the transcriptional expression of T3P. Here we reported that MrkH and H-NS positively and negatively regulate mrkJ expression, respectively, by binding to the promoter of mrkJ. MrkH protein recognized a sequence located at position -63.5 relative to the transcriptional start site of mrkJ gene. Interestingly, our results show that, in addition to its known function as classic transcriptional activator, MrkH also positively controls the expression of mrk genes by acting as an anti-repressor of H-NS; moreover, our results support the notion that high levels of MrkH repress T3P expression. Our data provide new insights about the complex regulatory role of the MrkH protein on the transcriptional control of T3P in K. pneumoniae.
Ares, Miguel A.; Fernández-Vázquez, José L.; Pacheco, Sabino; Martínez-Santos, Verónica I.; Jarillo-Quijada, Ma. Dolores; Torres, Javier; Alcántar-Curiel, María D.; González-y-Merchand, Jorge A.; De la Cruz, Miguel A.
2017-01-01
Klebsiella pneumoniae is a common opportunistic pathogen causing nosocomial infections. One of the main virulence determinants of K. pneumoniae is the type 3 pilus (T3P). T3P helps the bacterial interaction to both abiotic and biotic surfaces and it is crucial for the biofilm formation. T3P is genetically organized in three transcriptional units: the mrkABCDF polycistronic operon, the mrkHI bicistronic operon and the mrkJ gene. MrkH is a regulatory protein encoded in the mrkHI operon, which positively regulates the mrkA pilin gene and its own expression. In contrast, the H-NS nucleoid protein represses the transcriptional expression of T3P. Here we reported that MrkH and H-NS positively and negatively regulate mrkJ expression, respectively, by binding to the promoter of mrkJ. MrkH protein recognized a sequence located at position -63.5 relative to the transcriptional start site of mrkJ gene. Interestingly, our results show that, in addition to its known function as classic transcriptional activator, MrkH also positively controls the expression of mrk genes by acting as an anti-repressor of H-NS; moreover, our results support the notion that high levels of MrkH repress T3P expression. Our data provide new insights about the complex regulatory role of the MrkH protein on the transcriptional control of T3P in K. pneumoniae. PMID:28278272
Bacterial community transcription patterns during a marine phytoplankton bloom.
Rinta-Kanto, Johanna M; Sun, Shulei; Sharma, Shalabh; Kiene, Ronald P; Moran, Mary Ann
2012-01-01
Bacterioplankton consume a large proportion of photosynthetically fixed carbon in the ocean and control its biogeochemical fate. We used an experimental metatranscriptomics approach to compare bacterial activities that route energy and nutrients during a phytoplankton bloom compared with non-bloom conditions. mRNAs were sequenced from duplicate bloom and control microcosms 1 day after a phytoplankton biomass peak, and transcript copies per litre of seawater were calculated using an internal mRNA standard. Transcriptome analysis revealed a potential novel mechanism for enhanced efficiency during carbon-limited growth, mediated through membrane-bound pyrophosphatases [V-type H(+)-translocating; hppA]; bloom bacterioplankton participated less in this metabolic energy scavenging than non-bloom bacterioplankton, with possible implications for differences in growth yields on organic substrates. Bloom bacterioplankton transcribed more copies of genes predicted to increase cell surface adhesiveness, mediated by changes in bacterial signalling molecules related to biofilm formation and motility; these may be important in microbial aggregate formation. Bloom bacterioplankton also transcribed more copies of genes for organic acid utilization, suggesting an increased importance of this compound class in the bioreactive organic matter released during phytoplankton blooms. Transcription patterns were surprisingly faithful within a taxon regardless of treatment, suggesting that phylogeny broadly predicts the ecological roles of bacterial groups across 'boom' and 'bust' environmental backgrounds. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.
Cagliero, Cedric; Zhou, Yan Ning; Jin, Ding Jun
2014-01-01
In a fast-growing Escherichia coli cell, most RNA polymerase (RNAP) is allocated to rRNA synthesis forming transcription foci at clusters of rrn operons or bacterial nucleolus, and each of the several nascent nucleoids contains multiple pairs of replication forks. The composition of transcription foci has not been determined. In addition, how the transcription machinery is three-dimensionally organized to promote cell growth in concord with replication machinery in the nucleoid remains essentially unknown. Here, we determine the spatial and functional landscapes of transcription and replication machineries in fast-growing E. coli cells using super-resolution-structured illumination microscopy. Co-images of RNAP and DNA reveal spatial compartmentation and duplication of the transcription foci at the surface of the bacterial chromosome, encompassing multiple nascent nucleoids. Transcription foci cluster with NusA and NusB, which are the rrn anti-termination system and are associated with nascent rRNAs. However, transcription foci tend to separate from SeqA and SSB foci, which track DNA replication forks and/or the replisomes, demonstrating that transcription machinery and replisome are mostly located in different chromosomal territories to maintain harmony between the two major cellular functions in fast-growing cells. Our study suggests that bacterial chromosomes are spatially and functionally organized, analogous to eukaryotes. PMID:25416798
RegPrecise 3.0--a resource for genome-scale exploration of transcriptional regulation in bacteria.
Novichkov, Pavel S; Kazakov, Alexey E; Ravcheev, Dmitry A; Leyn, Semen A; Kovaleva, Galina Y; Sutormin, Roman A; Kazanov, Marat D; Riehl, William; Arkin, Adam P; Dubchak, Inna; Rodionov, Dmitry A
2013-11-01
Genome-scale prediction of gene regulation and reconstruction of transcriptional regulatory networks in prokaryotes is one of the critical tasks of modern genomics. Bacteria from different taxonomic groups, whose lifestyles and natural environments are substantially different, possess highly diverged transcriptional regulatory networks. The comparative genomics approaches are useful for in silico reconstruction of bacterial regulons and networks operated by both transcription factors (TFs) and RNA regulatory elements (riboswitches). RegPrecise (http://regprecise.lbl.gov) is a web resource for collection, visualization and analysis of transcriptional regulons reconstructed by comparative genomics. We significantly expanded a reference collection of manually curated regulons we introduced earlier. RegPrecise 3.0 provides access to inferred regulatory interactions organized by phylogenetic, structural and functional properties. Taxonomy-specific collections include 781 TF regulogs inferred in more than 160 genomes representing 14 taxonomic groups of Bacteria. TF-specific collections include regulogs for a selected subset of 40 TFs reconstructed across more than 30 taxonomic lineages. Novel collections of regulons operated by RNA regulatory elements (riboswitches) include near 400 regulogs inferred in 24 bacterial lineages. RegPrecise 3.0 provides four classifications of the reference regulons implemented as controlled vocabularies: 55 TF protein families; 43 RNA motif families; ~150 biological processes or metabolic pathways; and ~200 effectors or environmental signals. Genome-wide visualization of regulatory networks and metabolic pathways covered by the reference regulons are available for all studied genomes. A separate section of RegPrecise 3.0 contains draft regulatory networks in 640 genomes obtained by an conservative propagation of the reference regulons to closely related genomes. RegPrecise 3.0 gives access to the transcriptional regulons reconstructed in
Song, Zhenhua; Zhang, Chi; He, Lingxiao; Sui, Yanfang; Lin, Xiafei; Pan, Jingjing
2018-06-12
Osteoarthritis (OA) is the most common form of joint disease. The development of inflammation have been considered to play a key role during the progression of OA. Regulatory pathways are known to play crucial roles in many pathogenic processes. Thus, deciphering these risk regulatory pathways is critical for elucidating the mechanisms underlying OA. We constructed an OA-specific regulatory network by integrating comprehensive curated transcription and post-transcriptional resource involving transcription factor (TF) and microRNA (miRNA). To deepen our understanding of underlying molecular mechanisms of OA, we developed an integrated systems approach to identify OA-specific risk regulatory pathways. In this study, we identified 89 significantly differentially expressed genes between normal and inflamed areas of OA patients. We found the OA-specific regulatory network was a standard scale-free network with small-world properties. It significant enriched many immune response-related functions including leukocyte differentiation, myeloid differentiation and T cell activation. Finally, 141 risk regulatory pathways were identified based on OA-specific regulatory network, which contains some known regulator of OA. The risk regulatory pathways may provide clues for the etiology of OA and be a potential resource for the discovery of novel OA-associated disease genes. Copyright © 2018 Elsevier Inc. All rights reserved.
Vermeirssen, Vanessa; De Clercq, Inge; Van Parys, Thomas; Van Breusegem, Frank; Van de Peer, Yves
2014-01-01
The abiotic stress response in plants is complex and tightly controlled by gene regulation. We present an abiotic stress gene regulatory network of 200,014 interactions for 11,938 target genes by integrating four complementary reverse-engineering solutions through average rank aggregation on an Arabidopsis thaliana microarray expression compendium. This ensemble performed the most robustly in benchmarking and greatly expands upon the availability of interactions currently reported. Besides recovering 1182 known regulatory interactions, cis-regulatory motifs and coherent functionalities of target genes corresponded with the predicted transcription factors. We provide a valuable resource of 572 abiotic stress modules of coregulated genes with functional and regulatory information, from which we deduced functional relationships for 1966 uncharacterized genes and many regulators. Using gain- and loss-of-function mutants of seven transcription factors grown under control and salt stress conditions, we experimentally validated 141 out of 271 predictions (52% precision) for 102 selected genes and mapped 148 additional transcription factor-gene regulatory interactions (49% recall). We identified an intricate core oxidative stress regulatory network where NAC13, NAC053, ERF6, WRKY6, and NAC032 transcription factors interconnect and function in detoxification. Our work shows that ensemble reverse-engineering can generate robust biological hypotheses of gene regulation in a multicellular eukaryote that can be tested by medium-throughput experimental validation. PMID:25549671
A transcription factor collective defines the HSN serotonergic neuron regulatory landscape.
Lloret-Fernández, Carla; Maicas, Miren; Mora-Martínez, Carlos; Artacho, Alejandro; Jimeno-Martín, Ángela; Chirivella, Laura; Weinberg, Peter; Flames, Nuria
2018-03-22
Cell differentiation is controlled by individual transcription factors (TFs) that together activate a selection of enhancers in specific cell types. How these combinations of TFs identify and activate their target sequences remains poorly understood. Here, we identify the cis -regulatory transcriptional code that controls the differentiation of serotonergic HSN neurons in Caenorhabditis elegans . Activation of the HSN transcriptome is directly orchestrated by a collective of six TFs. Binding site clusters for this TF collective form a regulatory signature that is sufficient for de novo identification of HSN neuron functional enhancers. Among C. elegans neurons, the HSN transcriptome most closely resembles that of mouse serotonergic neurons. Mouse orthologs of the HSN TF collective also regulate serotonergic differentiation and can functionally substitute for their worm counterparts which suggests deep homology. Our results identify rules governing the regulatory landscape of a critically important neuronal type in two species separated by over 700 million years. © 2018, Lloret-Fernández et al.
A transcription factor collective defines the HSN serotonergic neuron regulatory landscape
Artacho, Alejandro; Jimeno-Martín, Ángela; Chirivella, Laura; Weinberg, Peter
2018-01-01
Cell differentiation is controlled by individual transcription factors (TFs) that together activate a selection of enhancers in specific cell types. How these combinations of TFs identify and activate their target sequences remains poorly understood. Here, we identify the cis-regulatory transcriptional code that controls the differentiation of serotonergic HSN neurons in Caenorhabditis elegans. Activation of the HSN transcriptome is directly orchestrated by a collective of six TFs. Binding site clusters for this TF collective form a regulatory signature that is sufficient for de novo identification of HSN neuron functional enhancers. Among C. elegans neurons, the HSN transcriptome most closely resembles that of mouse serotonergic neurons. Mouse orthologs of the HSN TF collective also regulate serotonergic differentiation and can functionally substitute for their worm counterparts which suggests deep homology. Our results identify rules governing the regulatory landscape of a critically important neuronal type in two species separated by over 700 million years. PMID:29553368
Tsou, Ann-Ping; Sun, Yi-Ming; Liu, Chia-Lin; Huang, Hsien-Da; Horng, Jorng-Tzong; Tsai, Meng-Feng; Liu, Baw-Juine
2006-07-01
Identification of transcriptional regulatory sites plays an important role in the investigation of gene regulation. For this propose, we designed and implemented a data warehouse to integrate multiple heterogeneous biological data sources with data types such as text-file, XML, image, MySQL database model, and Oracle database model. The utility of the biological data warehouse in predicting transcriptional regulatory sites of coregulated genes was explored using a synexpression group derived from a microarray study. Both of the binding sites of known transcription factors and predicted over-represented (OR) oligonucleotides were demonstrated for the gene group. The potential biological roles of both known nucleotides and one OR nucleotide were demonstrated using bioassays. Therefore, the results from the wet-lab experiments reinforce the power and utility of the data warehouse as an approach to the genome-wide search for important transcription regulatory elements that are the key to many complex biological systems.
Bacterial Adaptation to Antibiotics through Regulatory RNAs.
Felden, Brice; Cattoir, Vincent
2018-05-01
The extensive use of antibiotics has resulted in a situation where multidrug-resistant pathogens have become a severe menace to human health worldwide. A deeper understanding of the principles used by pathogens to adapt to, respond to, and resist antibiotics would pave the road to the discovery of drugs with novel mechanisms. For bacteria, antibiotics represent clinically relevant stresses that induce protective responses. The recent implication of regulatory RNAs (small RNAs [sRNAs]) in antibiotic response and resistance in several bacterial pathogens suggests that they should be considered innovative drug targets. This minireview discusses sRNA-mediated mechanisms exploited by bacterial pathogens to fight against antibiotics. A critical discussion of the newest findings in the field is provided, with emphasis on the implication of sRNAs in major mechanisms leading to antibiotic resistance, including drug uptake, active drug efflux, drug target modifications, biofilms, cell walls, and lipopolysaccharide (LPS) biosynthesis. Of interest is the lack of knowledge about sRNAs implicated in Gram-positive compared to Gram-negative bacterial resistance. Copyright © 2018 American Society for Microbiology.
Lakshmanan, Meiyappan; Mohanty, Bijayalaxmi; Lim, Sun-Hyung; Ha, Sun-Hwa; Lee, Dong-Yup
2014-01-01
The ability of rice to germinate under anoxia by extending the coleoptile is a highly unusual characteristic and a key feature underpinning the ability of rice seeds to establish in such a stressful environment. The process has been a focal point for research for many years. However, the molecular mechanisms underlying the anoxic growth of the coleoptile still remain largely unknown. To unravel the key regulatory mechanisms of rice germination under anoxic stress, we combined in silico modelling with gene expression data analysis. Our initial modelling analysis via random flux sampling revealed numerous changes in rice primary metabolism in the absence of oxygen. In particular, several reactions associated with sucrose metabolism and fermentation showed a significant increase in flux levels, whereas reaction fluxes across oxidative phosphorylation, the tricarboxylic acid cycle and the pentose phosphate pathway were down-regulated. The subsequent comparative analysis of the differences in calculated fluxes with previously published gene expression data under air and anoxia identified at least 37 reactions from rice central metabolism that are transcriptionally regulated. Additionally, cis-regulatory content analyses of these transcriptionally controlled enzymes indicate a regulatory role for transcription factors such as MYB, bZIP, ERF and ZnF in transcriptional control of genes that are up-regulated during rice germination and coleoptile elongation under anoxia. PMID:24894389
DNA residence time is a regulatory factor of transcription repression
Clauß, Karen; Popp, Achim P.; Schulze, Lena; Hettich, Johannes; Reisser, Matthias; Escoter Torres, Laura; Uhlenhaut, N. Henriette
2017-01-01
Abstract Transcription comprises a highly regulated sequence of intrinsically stochastic processes, resulting in bursts of transcription intermitted by quiescence. In transcription activation or repression, a transcription factor binds dynamically to DNA, with a residence time unique to each factor. Whether the DNA residence time is important in the transcription process is unclear. Here, we designed a series of transcription repressors differing in their DNA residence time by utilizing the modular DNA binding domain of transcription activator-like effectors (TALEs) and varying the number of nucleotide-recognizing repeat domains. We characterized the DNA residence times of our repressors in living cells using single molecule tracking. The residence times depended non-linearly on the number of repeat domains and differed by more than a factor of six. The factors provoked a residence time-dependent decrease in transcript level of the glucocorticoid receptor-activated gene SGK1. Down regulation of transcription was due to a lower burst frequency in the presence of long binding repressors and is in accordance with a model of competitive inhibition of endogenous activator binding. Our single molecule experiments reveal transcription factor DNA residence time as a regulatory factor controlling transcription repression and establish TALE-DNA binding domains as tools for the temporal dissection of transcription regulation. PMID:28977492
A primer on thermodynamic-based models for deciphering transcriptional regulatory logic.
Dresch, Jacqueline M; Richards, Megan; Ay, Ahmet
2013-09-01
A rigorous analysis of transcriptional regulation at the DNA level is crucial to the understanding of many biological systems. Mathematical modeling has offered researchers a new approach to understanding this central process. In particular, thermodynamic-based modeling represents the most biophysically informed approach aimed at connecting DNA level regulatory sequences to the expression of specific genes. The goal of this review is to give biologists a thorough description of the steps involved in building, analyzing, and implementing a thermodynamic-based model of transcriptional regulation. The data requirements for this modeling approach are described, the derivation for a specific regulatory region is shown, and the challenges and future directions for the quantitative modeling of gene regulation are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.
Regulatory coding of lymphoid lineage choice by hematopoietic transcription factors
NASA Technical Reports Server (NTRS)
Warren, Luigi A.; Rothenberg, Ellen V.
2003-01-01
During lymphopoiesis, precursor cells negotiate a complex regulatory space, defined by the levels of several competing and cross-regulating transcription factors, before arriving at stable states of commitment to the B-, T- and NK-specific developmental programs. Recent perturbation experiments provide evidence that this space has three major axes, corresponding to the PU.1 versus GATA-1 balance, the intensity of Notch signaling through the CSL pathway, and the ratio of E-box transcription factors to their Id protein antagonists.
Povinelli, C M
1992-01-01
In order to detect sequence-based information predictive for the location of eukaryotic transcriptional regulatory domains, the frequencies and distributions of the 36 possible purine/pyrimidine reverse complement hexamer pairs was determined for test sets of real and random sequences. The distribution of one of the hexamer pairs (RRYYRR/YYRRYY, referred to as M1) was further examined in a larger set of sequences (> 32 genes, 230 kb). Predominant clusters of M1 and the locations of eukaryotic transcriptional regulatory domains were found to be associated and non-randomly distributed along the DNA consistent with a periodicity of approximately 1.2 kb. In the context of higher ordered chromatin this would align promoters, enhancers and the predominant clusters of M1 longitudinally along one face of a 30 nm fiber. Using only information about the distribution of the M1 motif, 50-70% of a sequence could be eliminated as being unlikely to contain transcriptional regulatory domains with an 87% recovery of the regulatory domains present.
Yokoyama, Katsushi; Ishijima, Sanae A; Clowney, Lester; Koike, Hideaki; Aramaki, Hironori; Tanaka, Chikako; Makino, Kozo; Suzuki, Masashi
2006-01-01
Feast/famine regulatory proteins comprise a diverse family of transcription factors, which have been referred to in various individual identifications, including Escherichia coli leucine-responsive regulatory protein and asparagine synthase C gene product. A full length feast/famine regulatory protein consists of the N-terminal DNA-binding domain and the C-domain, which is involved in dimerization and further assembly, thereby producing, for example, a disc or a chromatin-like cylinder. Various ligands of the size of amino acids bind at the interface between feast/famine regulatory protein dimers, thereby altering their assembly forms. Also, the combination of feast/famine regulatory protein subunits forming the same assembly is altered. In this way, a small number of feast/famine regulatory proteins are able to regulate a large number of genes in response to various environmental changes. Because feast/famine regulatory proteins are shared by archaea and eubacteria, the genome-wide regulation by feast/famine regulatory proteins is traceable back to their common ancestor, being the prototype of highly differentiated transcription regulatory mechanisms found in organisms nowadays.
A meiotic gene regulatory cascade driven by alternative fates for newly synthesized transcripts
Cremona, Nicole; Potter, Kristine; Wise, Jo Ann
2011-01-01
To determine the relative importance of transcriptional regulation versus RNA processing and turnover during the transition from proliferation to meiotic differentiation in the fission yeast Schizosaccharomyces pombe, we analyzed temporal profiles and effects of RNA surveillance factor mutants on expression of 32 meiotic genes. A comparison of nascent transcription with steady-state RNA accumulation reveals that the vast majority of these genes show a lag between maximal RNA synthesis and peak RNA accumulation. During meiosis, total RNA levels parallel 3′ processing, which occurs in multiple, temporally distinct waves that peak from 3 to 6 h after meiotic induction. Most early genes and one middle gene, mei4, share a regulatory mechanism in which a specialized RNA surveillance factor targets newly synthesized transcripts for destruction. Mei4p, a member of the forkhead transcription factor family, in turn regulates a host of downstream genes. Remarkably, a spike in transcription is observed for less than one-third of the genes surveyed, and even these show evidence of RNA-level regulation. In aggregate, our findings lead us to propose that a regulatory cascade driven by changes in processing and stability of newly synthesized transcripts operates alongside the well-known transcriptional cascade as fission yeast cells enter meiosis. PMID:21148298
2013-01-01
Background Interspecific hybridization creates individuals harboring diverged genomes. The interaction of these genomes can generate successful evolutionary novelty or disadvantageous genomic conflict. Annual sunflowers Helianthus annuus and H. petiolaris have a rich history of hybridization in natural populations. Although first-generation hybrids generally have low fertility, hybrid swarms that include later generation and fully fertile backcross plants have been identified, as well as at least three independently-originated stable hybrid taxa. We examine patterns of transcript accumulation in the earliest stages of hybridization of these species via analyses of transcriptome sequences from laboratory-derived F1 offspring of an inbred H. annuus cultivar and a wild H. petiolaris accession. Results While nearly 14% of the reference transcriptome showed significant accumulation differences between parental accessions, total F1 transcript levels showed little evidence of dominance, as midparent transcript levels were highly predictive of transcript accumulation in F1 plants. Allelic bias in F1 transcript accumulation was detected in 20% of transcripts containing sufficient polymorphism to distinguish parental alleles; however the magnitude of these biases were generally smaller than differences among parental accessions. Conclusions While analyses of allelic bias suggest that cis regulatory differences between H. annuus and H. petiolaris are common, their effect on transcript levels may be more subtle than trans-acting regulatory differences. Overall, these analyses found little evidence of regulatory incompatibility or dominance interactions between parental genomes within F1 hybrid individuals, although it is unclear whether this is a legacy or an enabler of introgression between species. PMID:23701699
Overview Article: Identifying transcriptional cis-regulatory modules in animal genomes
Suryamohan, Kushal; Halfon, Marc S.
2014-01-01
Gene expression is regulated through the activity of transcription factors and chromatin modifying proteins acting on specific DNA sequences, referred to as cis-regulatory elements. These include promoters, located at the transcription initiation sites of genes, and a variety of distal cis-regulatory modules (CRMs), the most common of which are transcriptional enhancers. Because regulated gene expression is fundamental to cell differentiation and acquisition of new cell fates, identifying, characterizing, and understanding the mechanisms of action of CRMs is critical for understanding development. CRM discovery has historically been challenging, as CRMs can be located far from the genes they regulate, have few readily-identifiable sequence characteristics, and for many years were not amenable to high-throughput discovery methods. However, the recent availability of complete genome sequences and the development of next-generation sequencing methods has led to an explosion of both computational and empirical methods for CRM discovery in model and non-model organisms alike. Experimentally, CRMs can be identified through chromatin immunoprecipitation directed against transcription factors or histone post-translational modifications, identification of nucleosome-depleted “open” chromatin regions, or sequencing-based high-throughput functional screening. Computational methods include comparative genomics, clustering of known or predicted transcription factor binding sites, and supervised machine-learning approaches trained on known CRMs. All of these methods have proven effective for CRM discovery, but each has its own considerations and limitations, and each is subject to a greater or lesser number of false-positive identifications. Experimental confirmation of predictions is essential, although shortcomings in current methods suggest that additional means of validation need to be developed. PMID:25704908
Dufour, Yann S.; Donohue, Timothy J.
2015-01-01
Transcriptional regulation plays a significant role in the biological response of bacteria to changing environmental conditions. Therefore, mapping transcriptional regulatory networks is an important step not only in understanding how bacteria sense and interpret their environment but also to identify the functions involved in biological responses to specific conditions. Recent experimental and computational developments have facilitated the characterization of regulatory networks on a genome-wide scale in model organisms. In addition, the multiplication of complete genome sequences has encouraged comparative analyses to detect conserved regulatory elements and infer regulatory networks in other less well-studied organisms. However, transcription regulation appears to evolve rapidly, thus, creating challenges for the transfer of knowledge to nonmodel organisms. Nevertheless, the mechanisms and constraints driving the evolution of regulatory networks have been the subjects of numerous analyses, and several models have been proposed. Overall, the contributions of mutations, recombination, and horizontal gene transfer are complex. Finally, the rapid evolution of regulatory networks plays a significant role in the remarkable capacity of bacteria to adapt to new or changing environments. Conversely, the characteristics of environmental niches determine the selective pressures and can shape the structure of regulatory network accordingly. PMID:23046950
CisMapper: predicting regulatory interactions from transcription factor ChIP-seq data
O'Connor, Timothy; Bodén, Mikael
2017-01-01
Abstract Identifying the genomic regions and regulatory factors that control the transcription of genes is an important, unsolved problem. The current method of choice predicts transcription factor (TF) binding sites using chromatin immunoprecipitation followed by sequencing (ChIP-seq), and then links the binding sites to putative target genes solely on the basis of the genomic distance between them. Evidence from chromatin conformation capture experiments shows that this approach is inadequate due to long-distance regulation via chromatin looping. We present CisMapper, which predicts the regulatory targets of a TF using the correlation between a histone mark at the TF's bound sites and the expression of each gene across a panel of tissues. Using both chromatin conformation capture and differential expression data, we show that CisMapper is more accurate at predicting the target genes of a TF than the distance-based approaches currently used, and is particularly advantageous for predicting the long-range regulatory interactions typical of tissue-specific gene expression. CisMapper also predicts which TF binding sites regulate a given gene more accurately than using genomic distance. Unlike distance-based methods, CisMapper can predict which transcription start site of a gene is regulated by a particular binding site of the TF. PMID:28204599
2014-01-01
Epithelial-to-mesenchymal transition (EMT) and its reverse process, mesenchymal-to-epithelial transition (MET), play important roles in embryogenesis, stem cell biology, and cancer progression. EMT can be regulated by many signaling pathways and regulatory transcriptional networks. Furthermore, post-transcriptional regulatory networks regulate EMT; these networks include the long non-coding RNA (lncRNA) and microRNA (miRNA) families. Specifically, the miR-200 family, miR-101, miR-506, and several lncRNAs have been found to regulate EMT. Recent studies have illustrated that several lncRNAs are overexpressed in various cancers and that they can promote tumor metastasis by inducing EMT. MiRNA controls EMT by regulating EMT transcription factors or other EMT regulators, suggesting that lncRNAs and miRNA are novel therapeutic targets for the treatment of cancer. Further efforts have shown that non-coding-mediated EMT regulation is closely associated with epigenetic regulation through promoter methylation (e.g., miR-200 or miR-506) and protein regulation (e.g., SET8 via miR-502). The formation of gene fusions has also been found to promote EMT in prostate cancer. In this review, we discuss the post-transcriptional regulatory network that is involved in EMT and MET and how targeting EMT and MET may provide effective therapeutics for human disease. PMID:24598126
Vivek-Ananth, R P; Samal, Areejit
2016-09-01
A major goal of systems biology is to build predictive computational models of cellular metabolism. Availability of complete genome sequences and wealth of legacy biochemical information has led to the reconstruction of genome-scale metabolic networks in the last 15 years for several organisms across the three domains of life. Due to paucity of information on kinetic parameters associated with metabolic reactions, the constraint-based modelling approach, flux balance analysis (FBA), has proved to be a vital alternative to investigate the capabilities of reconstructed metabolic networks. In parallel, advent of high-throughput technologies has led to the generation of massive amounts of omics data on transcriptional regulation comprising mRNA transcript levels and genome-wide binding profile of transcriptional regulators. A frontier area in metabolic systems biology has been the development of methods to integrate the available transcriptional regulatory information into constraint-based models of reconstructed metabolic networks in order to increase the predictive capabilities of computational models and understand the regulation of cellular metabolism. Here, we review the existing methods to integrate transcriptional regulatory information into constraint-based models of metabolic networks. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Ai, Trinh Ngoc; Naing, Aung Htay; Arun, Muthukrishnan; Lim, Sun-Hyung; Kim, Chang Kil
2016-11-01
The effects of three different sucrose concentrations on plant growth and anthocyanin accumulation were examined in non-transgenic (NT) and transgenic (T 2 ) specimens of the Petunia hybrida cultivar 'Mirage rose' that carried the anthocyanin regulatory transcription factors B-Peru+mPAP1 or RsMYB1. Anthocyanin accumulation was not observed in NT plants in any treatments, whereas a range of anthocyanin accumulation was observed in transgenic plants. The anthocyanin content detected in transgenic plants expressing the anthocyanin regulatory transcription factors (B-Peru+mPAP1 or RsMYB1) was higher than that in NT plants. In addition, increasing sucrose concentration strongly enhanced anthocyanin content as shown by quantitative real-time polymerase chain reaction (qRT-PCR) analysis, wherein increased concentrations of sucrose enhanced transcript levels of the transcription factors that are responsible for the induction of biosynthetic genes involved in anthocyanin synthesis; this pattern was not observed in NT plants. In addition, sucrose affected plant growth, although the effects were different between NT and transgenic plants. Taken together, the application of sucrose could enhance anthocyanin production in vegetative tissue of transgenic Petunia carrying anthocyanin regulatory transcription factors, and this study provides insights about interactive effects of sucrose and transcription factors in anthocyanin biosynthesis in the transgenic plant. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
On the contributions of topological features to transcriptional regulatory network robustness
2012-01-01
Background Because biological networks exhibit a high-degree of robustness, a systemic understanding of their architecture and function requires an appraisal of the network design principles that confer robustness. In this project, we conduct a computational study of the contribution of three degree-based topological properties (transcription factor-target ratio, degree distribution, cross-talk suppression) and their combinations on the robustness of transcriptional regulatory networks. We seek to quantify the relative degree of robustness conferred by each property (and combination) and also to determine the extent to which these properties alone can explain the robustness observed in transcriptional networks. Results To study individual properties and their combinations, we generated synthetic, random networks that retained one or more of the three properties with values derived from either the yeast or E. coli gene regulatory networks. Robustness of these networks were estimated through simulation. Our results indicate that the combination of the three properties we considered explains the majority of the structural robustness observed in the real transcriptional networks. Surprisingly, scale-free degree distribution is, overall, a minor contributor to robustness. Instead, most robustness is gained through topological features that limit the complexity of the overall network and increase the transcription factor subnetwork sparsity. Conclusions Our work demonstrates that (i) different types of robustness are implemented by different topological aspects of the network and (ii) size and sparsity of the transcription factor subnetwork play an important role for robustness induction. Our results are conserved across yeast and E Coli, which suggests that the design principles examined are present within an array of living systems. PMID:23194062
Kuang, Jian-Fei; Chen, Jian-Ye; Liu, Xun-Cheng; Han, Yan-Chao; Xiao, Yun-Yi; Shan, Wei; Tang, Yang; Wu, Ke-Qiang; He, Jun-Xian; Lu, Wang-Jin
2017-04-01
Fruit ripening is a complex, genetically programmed process involving the action of critical transcription factors (TFs). Despite the established significance of dehydration-responsive element binding (DREB) TFs in plant abiotic stress responses, the involvement of DREBs in fruit ripening is yet to be determined. Here, we identified four genes encoding ripening-regulated DREB TFs in banana (Musa acuminata), MaDREB1, MaDREB2, MaDREB3, and MaDREB4, and demonstrated that they play regulatory roles in fruit ripening. We showed that MaDREB1-MaDREB4 are nucleus-localized, induced by ethylene and encompass transcriptional activation activities. We performed a genome-wide chromatin immunoprecipitation and high-throughput sequencing (ChIP-Seq) experiment for MaDREB2 and identified 697 genomic regions as potential targets of MaDREB2. MaDREB2 binds to hundreds of loci with diverse functions and its binding sites are distributed in the promoter regions proximal to the transcriptional start site (TSS). Most of the MaDREB2-binding targets contain the conserved (A/G)CC(G/C)AC motif and MaDREB2 appears to directly regulate the expression of a number of genes involved in fruit ripening. In combination with transcriptome profiling (RNA sequencing) data, our results indicate that MaDREB2 may serve as both transcriptional activator and repressor during banana fruit ripening. In conclusion, our study suggests a hierarchical regulatory model of fruit ripening in banana and that the MaDREB TFs may act as transcriptional regulators in the regulatory network. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
Montgomery, J; Pollard, V; Deikman, J; Fischer, R L
1993-01-01
The tomato fruit consists of a thick, fleshy pericarp composed predominantly of highly vacuolated parenchymatous cells, which surrounds the seeds. During ripening, the activation of gene expression results in dramatic biochemical and physiological changes in the pericarp. The polygalacturonase (PG) gene, unlike many fruit ripening-induced genes, is not activated by the increase in ethylene hormone concentration associated with the onset of ripening. To investigate ethylene concentration-independent gene transcription in ripe tomato fruit, we analyzed the expression of chimeric PG promoter-beta-glucuronidase (GUS) reporter gene fusions in transgenic tomato plants. We determined that a 1.4-kb PG promoter directs ripening-regulated transcription in outer pericarp but not in inner pericarp cells, with a sharp boundary of PG promoter activity located midway through the pericarp. Promoter deletion analysis indicated that a minimum of three promoter regions influence the spatial regulation of PG transcription. A positive regulatory region from -231 to -134 promotes gene transcription in the outer pericarp of ripe fruit. A second positive regulatory region from -806 to -443 extends gene activity to the inner pericarp. However, a negative regulatory region from -1411 to -1150 inhibits gene transcription in the inner pericarp. DNase I footprint analysis showed that nuclear proteins in unripe and ripe fruit interact with DNA sequences within each of these three regulatory regions. Thus, temporal and spatial control of PG transcription is mediated by the interaction of negative and positive regulatory promoter elements, resulting in gene activity in the outer pericarp but not the inner pericarp of ripe tomato fruit. The expression pattern of PG suggests that, although they are morphologically similar, there is a fundamental difference between the parenchymatous cells within the inner and outer pericarp. PMID:8400876
Shailes, Hannah; Eleftherohorinou, Hariklia; Hoggart, Clive J; Cebey-Lopez, Miriam; Carter, Michael J; Janes, Victoria A; Gormley, Stuart; Shimizu, Chisato; Tremoulet, Adriana H; Barendregt, Anouk M; Salas, Antonio; Kanegaye, John; Pollard, Andrew J; Faust, Saul N; Patel, Sanjay; Kuijpers, Taco; Martinon-Torres, Federico; Burns, Jane C; Coin, Lachlan JM; Levin, Michael
2018-01-01
Importance As clinical features do not reliably distinguish bacterial from viral infection, many children worldwide receive unnecessary antibiotic treatment whilst bacterial infection is missed in others. Objective To identify a blood RNA expression signature that distinguishes bacterial from viral infection in febrile children. Design Febrile children presenting to participating hospitals in UK, Spain, Netherlands and USA between 2009-2013 were prospectively recruited, comprising a discovery group and validation group. Each group was classified after microbiological investigation into definite bacterial, definite viral infection or indeterminate infection. RNA expression signatures distinguishing definite bacterial from viral infection were identified in the discovery group and diagnostic performance assessed in the validation group. Additional validation was undertaken in separate studies of children with meningococcal disease (n=24) inflammatory diseases (n=48), and on published gene expression datasets. Exposures A 2-transcript RNA expression signature distinguishing bacterial infection from viral infection was evaluated against clinical and microbiological diagnosis. Main Outcomes Definite Bacterial and viral infection was confirmed by culture or molecular detection of the pathogens. Performance of the RNA signature was evaluated in the definite bacterial and viral group, and the indeterminate group. Results The discovery cohort of 240 children (median age 19 months, 62% males) included 52 with definite bacterial infection of whom 36 (69%) required intensive care; and 92 with definite viral infection of whom 32 (35%) required intensive care. 96 children had indeterminate infection. Bioinformatic analysis of RNA expression data identified a 38-transcript signature distinguishing bacterial from viral infection. A smaller (2-transcript) signature (FAM89A and IFI44L) was identified by removing highly correlated transcripts. When this 2-transcript signature was
Marbach, Daniel; Roy, Sushmita; Ay, Ferhat; Meyer, Patrick E.; Candeias, Rogerio; Kahveci, Tamer; Bristow, Christopher A.; Kellis, Manolis
2012-01-01
Gaining insights on gene regulation from large-scale functional data sets is a grand challenge in systems biology. In this article, we develop and apply methods for transcriptional regulatory network inference from diverse functional genomics data sets and demonstrate their value for gene function and gene expression prediction. We formulate the network inference problem in a machine-learning framework and use both supervised and unsupervised methods to predict regulatory edges by integrating transcription factor (TF) binding, evolutionarily conserved sequence motifs, gene expression, and chromatin modification data sets as input features. Applying these methods to Drosophila melanogaster, we predict ∼300,000 regulatory edges in a network of ∼600 TFs and 12,000 target genes. We validate our predictions using known regulatory interactions, gene functional annotations, tissue-specific expression, protein–protein interactions, and three-dimensional maps of chromosome conformation. We use the inferred network to identify putative functions for hundreds of previously uncharacterized genes, including many in nervous system development, which are independently confirmed based on their tissue-specific expression patterns. Last, we use the regulatory network to predict target gene expression levels as a function of TF expression, and find significantly higher predictive power for integrative networks than for motif or ChIP-based networks. Our work reveals the complementarity between physical evidence of regulatory interactions (TF binding, motif conservation) and functional evidence (coordinated expression or chromatin patterns) and demonstrates the power of data integration for network inference and studies of gene regulation at the systems level. PMID:22456606
Zheng, Meiying; Cooper, David R.; Grossoehme, Nickolas E.; Yu, Minmin; Hung, Li-Wei; Cieslik, Marcin; Derewenda, Urszula; Lesley, Scott A.; Wilson, Ian A.; Giedroc, David P.; Derewenda, Zygmunt S.
2009-01-01
The GntR superfamily of dimeric transcription factors, with more than 6200 members encoded in bacterial genomes, are characterized by N-terminal winged-helix DNA-binding domains and diverse C-terminal regulatory domains which provide a basis for the classification of the constituent families. The largest of these families, FadR, contains nearly 3000 proteins with all-α-helical regulatory domains classified into two related Pfam families: FadR_C and FCD. Only two crystal structures of FadR-family members, those of Escherichia coli FadR protein and LldR from Corynebacterium glutamicum, have been described to date in the literature. Here, the crystal structure of TM0439, a GntR regulator with an FCD domain found in the Thermotoga maritima genome, is described. The FCD domain is similar to that of the LldR regulator and contains a buried metal-binding site. Using atomic absorption spectroscopy and Trp fluorescence, it is shown that the recombinant protein contains bound Ni2+ ions but that it is able to bind Zn2+ with K d < 70 nM. It is concluded that Zn2+ is the likely physiological metal and that it may perform either structural or regulatory roles or both. Finally, the TM0439 structure is compared with two other FadR-family structures recently deposited by structural genomics consortia. The results call for a revision in the classification of the FadR family of transcription factors. PMID:19307717
2013-01-01
Background The regenerative response of Schwann cells after peripheral nerve injury is a critical process directly related to the pathophysiology of a number of neurodegenerative diseases. This SC injury response is dependent on an intricate gene regulatory program coordinated by a number of transcription factors and microRNAs, but the interactions among them remain largely unknown. Uncovering the transcriptional and post-transcriptional regulatory networks governing the Schwann cell injury response is a key step towards a better understanding of Schwann cell biology and may help develop novel therapies for related diseases. Performing such comprehensive network analysis requires systematic bioinformatics methods to integrate multiple genomic datasets. Results In this study we present a computational pipeline to infer transcription factor and microRNA regulatory networks. Our approach combined mRNA and microRNA expression profiling data, ChIP-Seq data of transcription factors, and computational transcription factor and microRNA target prediction. Using mRNA and microRNA expression data collected in a Schwann cell injury model, we constructed a regulatory network and studied regulatory pathways involved in Schwann cell response to injury. Furthermore, we analyzed network motifs and obtained insights on cooperative regulation of transcription factors and microRNAs in Schwann cell injury recovery. Conclusions This work demonstrates a systematic method for gene regulatory network inference that may be used to gain new information on gene regulation by transcription factors and microRNAs. PMID:23387820
Unraveling transcriptional control and cis-regulatory codes using the software suite GeneACT
Cheung, Tom Hiu; Kwan, Yin Lam; Hamady, Micah; Liu, Xuedong
2006-01-01
Deciphering gene regulatory networks requires the systematic identification of functional cis-acting regulatory elements. We present a suite of web-based bioinformatics tools, called GeneACT , that can rapidly detect evolutionarily conserved transcription factor binding sites or microRNA target sites that are either unique or over-represented in differentially expressed genes from DNA microarray data. GeneACT provides graphic visualization and extraction of common regulatory sequence elements in the promoters and 3'-untranslated regions that are conserved across multiple mammalian species. PMID:17064417
Liu, Wen; Yan, Yu; Zeng, Hongqiu; Li, Xiaolin; Wei, Yunxie; Liu, Guoyin; He, Chaozu; Shi, Haitao
2018-05-19
Cassava is a major food crop in tropical areas, but its productivity and quality are seriously limited by cassava bacterial blight. So far, the key factors regulating cassava immune response remain elusive. In this study, we identified three cassava Whirly genes (MeWHYs) in cassava variety of South China 124 (SC124), and explored the possible roles and utilization of MeWHYs in cassava disease resistance. Gene expression analysis revealed that the transcripts of three MeWHYs were commonly regulated by the highly conserved N-terminal epitope of f lagellin (flg22) and Xanthomonas axonopodis pv. manihotis Hainan (Xam HN) treatments. Overexpression of MeWHYs improved plant disease resistance against X. axonopodis pv. manihotis, while MeWHYs-silenced cassava plants by virus-induced gene silencing exhibited decreased disease resistance. Notably, MeWRKY75 physically interacted with three MeWHYs in yeast and in planta, and served as a transcriptional activator of MeWHY3. Moreover, the physical interaction between MeWHYs and MeWRKY75 promoted the transcriptional activities of each other. Consistently, MeWRKY75 also positively regulated disease resistance against cassava bacterial blight. Taken together, our observations suggested that MeWRKY75 and MeWHYs confer improved disease resistance against cassava bacterial blight through forming an interacting complex of MeWRKY75-MeWHY1/2/3 and transcriptional module of MeWRKY75-MeWHY3. This study facilitates our understanding of the positive effect of the MeWRKY75-MeWHY3 transcriptional module in plant disease resistance.
Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi
2018-05-17
Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.
Oncogenes Activate an Autonomous Transcriptional Regulatory Circuit That Drives Glioblastoma.
Singh, Dinesh K; Kollipara, Rahul K; Vemireddy, Vamsidara; Yang, Xiao-Li; Sun, Yuxiao; Regmi, Nanda; Klingler, Stefan; Hatanpaa, Kimmo J; Raisanen, Jack; Cho, Steve K; Sirasanagandla, Shyam; Nannepaga, Suraj; Piccirillo, Sara; Mashimo, Tomoyuki; Wang, Shan; Humphries, Caroline G; Mickey, Bruce; Maher, Elizabeth A; Zheng, Hongwu; Kim, Ryung S; Kittler, Ralf; Bachoo, Robert M
2017-01-24
Efforts to identify and target glioblastoma (GBM) drivers have primarily focused on receptor tyrosine kinases (RTKs). Clinical benefits, however, have been elusive. Here, we identify an SRY-related box 2 (SOX2) transcriptional regulatory network that is independent of upstream RTKs and capable of driving glioma-initiating cells. We identified oligodendrocyte lineage transcription factor 2 (OLIG2) and zinc-finger E-box binding homeobox 1 (ZEB1), which are frequently co-expressed irrespective of driver mutations, as potential SOX2 targets. In murine glioma models, we show that different combinations of tumor suppressor and oncogene mutations can activate Sox2, Olig2, and Zeb1 expression. We demonstrate that ectopic co-expression of the three transcription factors can transform tumor-suppressor-deficient astrocytes into glioma-initiating cells in the absence of an upstream RTK oncogene. Finally, we demonstrate that the transcriptional inhibitor mithramycin downregulates SOX2 and its target genes, resulting in markedly reduced proliferation of GBM cells in vivo. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Laurette, Patrick; Strub, Thomas; Koludrovic, Dana; Keime, Céline; Le Gras, Stéphanie; Seberg, Hannah; Van Otterloo, Eric; Imrichova, Hana; Siddaway, Robert; Aerts, Stein; Cornell, Robert A; Mengus, Gabrielle; Davidson, Irwin
2015-03-24
Microphthalmia-associated transcription factor (MITF) is the master regulator of the melanocyte lineage. To understand how MITF regulates transcription, we used tandem affinity purification and mass spectrometry to define a comprehensive MITF interactome identifying novel cofactors involved in transcription, DNA replication and repair, and chromatin organisation. We show that MITF interacts with a PBAF chromatin remodelling complex comprising BRG1 and CHD7. BRG1 is essential for melanoma cell proliferation in vitro and for normal melanocyte development in vivo. MITF and SOX10 actively recruit BRG1 to a set of MITF-associated regulatory elements (MAREs) at active enhancers. Combinations of MITF, SOX10, TFAP2A, and YY1 bind between two BRG1-occupied nucleosomes thus defining both a signature of transcription factors essential for the melanocyte lineage and a specific chromatin organisation of the regulatory elements they occupy. BRG1 also regulates the dynamics of MITF genomic occupancy. MITF-BRG1 interplay thus plays an essential role in transcription regulation in melanoma.
2011-01-01
Background Gene regulatory networks play essential roles in living organisms to control growth, keep internal metabolism running and respond to external environmental changes. Understanding the connections and the activity levels of regulators is important for the research of gene regulatory networks. While relevance score based algorithms that reconstruct gene regulatory networks from transcriptome data can infer genome-wide gene regulatory networks, they are unfortunately prone to false positive results. Transcription factor activities (TFAs) quantitatively reflect the ability of the transcription factor to regulate target genes. However, classic relevance score based gene regulatory network reconstruction algorithms use models do not include the TFA layer, thus missing a key regulatory element. Results This work integrates TFA prediction algorithms with relevance score based network reconstruction algorithms to reconstruct gene regulatory networks with improved accuracy over classic relevance score based algorithms. This method is called Gene expression and Transcription factor activity based Relevance Network (GTRNetwork). Different combinations of TFA prediction algorithms and relevance score functions have been applied to find the most efficient combination. When the integrated GTRNetwork method was applied to E. coli data, the reconstructed genome-wide gene regulatory network predicted 381 new regulatory links. This reconstructed gene regulatory network including the predicted new regulatory links show promising biological significances. Many of the new links are verified by known TF binding site information, and many other links can be verified from the literature and databases such as EcoCyc. The reconstructed gene regulatory network is applied to a recent transcriptome analysis of E. coli during isobutanol stress. In addition to the 16 significantly changed TFAs detected in the original paper, another 7 significantly changed TFAs have been detected by
RNA-FISH to Study Regulatory RNA at the Site of Transcription.
Soler, Marta; Boque-Sastre, Raquel; Guil, Sonia
2017-01-01
The increasing role of all types of regulatory RNAs in the orchestration of cellular programs has enhanced the development of a variety of techniques that allow its precise detection, quantification, and functional scrutiny. Recent advances in imaging and fluoresecent in situ hybridization (FISH) methods have enabled the utilization of user-friendly protocols that provide highly sensitive and accurate detection of ribonucleic acid molecules at both the single cell and subcellular levels. We herein describe the approach originally developed by Stellaris ® , in which the target RNA molecule is fluoresecently labeled with multiple tiled complementary probes each carrying a fluorophore, thus improving sensitivity and reducing the chance of false positives. We have applied this method to the detection of nascent RNAs that partake of special regulatory structures called R loops. Their growing role in active gene expression regulation (Aguilera and Garcia-Muse, Mol Cell 46:115-124, 2012; Ginno et al., Mol Cell 45:814-825, 2012; Sun et al., Science 340:619-621, 2013; Bhatia et al., Nature 511:362-365, 2014) imposes the use of a combination of in vivo and in vitro techniques for the detailed analysis of the transcripts involved. Therefore, their study is a good example to illustrate how RNA FISH, combined with transcriptional arrest and/or cell synchronization, permits localization and temporal characterization of potentially regulatory RNA sequences.
Fanconi Anemia Core Complex Gene Promoters Harbor Conserved Transcription Regulatory Elements
Meier, Daniel; Schindler, Detlev
2011-01-01
The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5′ region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3′ regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters. PMID:21826217
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.
Meier, Daniel; Schindler, Detlev
2011-01-01
The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
Identification of transcript regulatory patterns in cell differentiation.
Gusnanto, Arief; Gosling, John Paul; Pope, Christopher
2017-10-15
Studying transcript regulatory patterns in cell differentiation is critical in understanding its complex nature of the formation and function of different cell types. This is done usually by measuring gene expression at different stages of the cell differentiation. However, if the gene expression data available are only from the mature cells, we have some challenges in identifying transcript regulatory patterns that govern the cell differentiation. We propose to exploit the information of the lineage of cell differentiation in terms of correlation structure between cell types. We assume that two different cell types that are close in the lineage will exhibit many common genes that are co-expressed relative to those that are far in the lineage. Current analysis methods tend to ignore this correlation by testing for differential expression assuming some sort of independence between cell types. We employ a Bayesian approach to estimate the posterior distribution of the mean of expression in each cell type, by taking into account the cell formation path in the lineage. This enables us to infer genes that are specific in each cell type, indicating the genes are involved in directing the cell differentiation to that particular cell type. We illustrate the method using gene expression data from a study of haematopoiesis. R codes to perform the analysis are available in http://www1.maths.leeds.ac.uk/∼arief/R/CellDiff/. a.gusnanto@leeds.ac.uk. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Sensing new chemicals with bacterial transcription factors.
Libis, Vincent; Delépine, Baudoin; Faulon, Jean-Loup
2016-10-01
Bacteria rely on allosteric transcription factors (aTFs) to sense a wide range of chemicals. The variety of effectors has contributed in making aTFs the most used input system in synthetic biological circuits. Considering their enabling role in biotechnology, an important question concerns the size of the chemical space that can potentially be detected by these biosensors. From digging into the ever changing repertoire of natural regulatory circuits, to advances in aTF engineering, we review here different strategies that are pushing the boundaries of this chemical space. We also review natural and synthetic cases of indirect sensing, where aTFs work in combination with metabolism to enable detection of new molecules. Copyright © 2016 Elsevier Ltd. All rights reserved.
2011-01-01
Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG) that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses. PMID:21349196
Transcriptional and posttranscriptional regulation of cyanobacterial photosynthesis.
Wilde, Annegret; Hihara, Yukako
2016-03-01
Cyanobacteria are well established model organisms for the study of oxygenic photosynthesis, nitrogen metabolism, toxin biosynthesis, and salt acclimation. However, in comparison to other model bacteria little is known about regulatory networks, which allow cyanobacteria to acclimate to changing environmental conditions. The current work has begun to illuminate how transcription factors modulate expression of different photosynthetic regulons. During the past few years, the research on other regulatory principles like RNA-based regulation showed the importance of non-protein regulators for bacterial lifestyle. Investigations on modulation of photosynthetic components should elucidate the contributions of all factors within the context of a larger regulatory network. Here, we focus on regulation of photosynthetic processes including transcriptional and posttranscriptional mechanisms, citing examples from a limited number of cyanobacterial species. Though, the general idea holds true for most species, important differences exist between various organisms, illustrating diversity of acclimation strategies in the very heterogeneous cyanobacterial clade. This article is part of a Special Issue entitled Organization and dynamics of bioenergetic systems in bacteria, edited by Prof Conrad Mullineaux. Copyright © 2015 Elsevier B.V. All rights reserved.
2014-01-01
Background Uncovering the complex transcriptional regulatory networks (TRNs) that underlie plant and animal development remains a challenge. However, a vast amount of data from public microarray experiments is available, which can be subject to inference algorithms in order to recover reliable TRN architectures. Results In this study we present a simple bioinformatics methodology that uses public, carefully curated microarray data and the mutual information algorithm ARACNe in order to obtain a database of transcriptional interactions. We used data from Arabidopsis thaliana root samples to show that the transcriptional regulatory networks derived from this database successfully recover previously identified root transcriptional modules and to propose new transcription factors for the SHORT ROOT/SCARECROW and PLETHORA pathways. We further show that these networks are a powerful tool to integrate and analyze high-throughput expression data, as exemplified by our analysis of a SHORT ROOT induction time-course microarray dataset, and are a reliable source for the prediction of novel root gene functions. In particular, we used our database to predict novel genes involved in root secondary cell-wall synthesis and identified the MADS-box TF XAL1/AGL12 as an unexpected participant in this process. Conclusions This study demonstrates that network inference using carefully curated microarray data yields reliable TRN architectures. In contrast to previous efforts to obtain root TRNs, that have focused on particular functional modules or tissues, our root transcriptional interactions provide an overview of the transcriptional pathways present in Arabidopsis thaliana roots and will likely yield a plethora of novel hypotheses to be tested experimentally. PMID:24739361
DOE Office of Scientific and Technical Information (OSTI.GOV)
Acquaah-Mensah, George K.; Taylor, Ronald C.
Microarray data have been a valuable resource for identifying transcriptional regulatory relationships among genes. As an example, brain region-specific transcriptional regulatory events have the potential of providing etiological insights into Alzheimer Disease (AD). However, there is often a paucity of suitable brain-region specific expression data obtained via microarrays or other high throughput means. The Allen Brain Atlas in situ hybridization (ISH) data sets (Jones et al., 2009) represent a potentially valuable alternative source of high-throughput brain region-specific gene expression data for such purposes. In this study, Allen BrainAtlasmouse ISH data in the hippocampal fields were extracted, focusing on 508 genesmore » relevant to neurodegeneration. Transcriptional regulatory networkswere learned using three high-performing network inference algorithms. Only 17% of regulatory edges from a network reverse-engineered based on brain region-specific ISH data were also found in a network constructed upon gene expression correlations inmousewhole brain microarrays, thus showing the specificity of gene expression within brain sub-regions. Furthermore, the ISH data-based networks were used to identify instructive transcriptional regulatory relationships. Ncor2, Sp3 and Usf2 form a unique three-party regulatory motif, potentially affecting memory formation pathways. Nfe2l1, Egr1 and Usf2 emerge among regulators of genes involved in AD (e.g. Dhcr24, Aplp2, Tia1, Pdrx1, Vdac1, andSyn2). Further, Nfe2l1, Egr1 and Usf2 are sensitive to dietary factors and could be among links between dietary influences and genes in the AD etiology. Thus, this approach of harnessing brain region-specific ISH data represents a rare opportunity for gleaning unique etiological insights for diseases such as AD.« less
Mandin, Pierre; Chareyre, Sylvia; Barras, Frédéric
2016-09-20
Fe-S clusters are cofactors conserved through all domains of life. Once assembled by dedicated ISC and/or SUF scaffolds, Fe-S clusters are conveyed to their apo-targets via A-type carrier proteins (ATCs). Escherichia coli possesses four such ATCs. ErpA is the only ATC essential under aerobiosis. Recent studies reported a possible regulation of the erpA mRNA by the small RNA (sRNA) RyhB, which controls the expression of many genes under iron starvation. Surprisingly, erpA has not been identified in recent transcriptomic analysis of the iron starvation response, thus bringing into question the actual physiological significance of the putative regulation of erpA by RyhB. Using an sRNA library, we show that among 26 sRNAs, only RyhB represses the expression of an erpA-lacZ translational fusion. We further demonstrate that this repression occurs during iron starvation. Using mutational analysis, we show that RyhB base pairs to the erpA mRNA, inducing its disappearance. In addition, IscR, the master regulator of Fe-S homeostasis, represses expression of erpA at the transcriptional level when iron is abundant, but depleting iron from the medium alleviates this repression. The conjunction of transcriptional derepression by IscR and posttranscriptional repression by RyhB under Fe-limiting conditions is best described as an incoherent regulatory circuit. This double regulation allows full expression of erpA at iron concentrations for which Fe-S biogenesis switches from the ISC to the SUF system. We further provide evidence that this regulatory circuit coordinates ATC usage to iron availability. Regulatory small RNAs (sRNAs) have emerged as major actors in the control of gene expression in the last few decades. Relatively little is known about how these regulators interact with classical transcription factors to coordinate genetic responses. We show here how an sRNA, RyhB, and a transcription factor, IscR, regulate expression of an essential gene, erpA, in the bacterium E
Extensive cross-regulation of post-transcriptional regulatory networks in Drosophila
Stoiber, Marcus H.; Olson, Sara; May, Gemma E.; ...
2015-08-20
In eukaryotic cells, RNAs exist as ribonucleoprotein particles (RNPs). Despite the importance of these complexes in many biological processes, including splicing, polyadenylation, stability, transportation, localization, and translation, their compositions are largely unknown. We affinity-purified 20 distinct RNA-binding proteins (RBPs) from cultured Drosophila melanogaster cells under native conditions and identified both the RNA and protein compositions of these RNP complexes. We identified “high occupancy target” (HOT) RNAs that interact with the majority of the RBPs we surveyed. HOT RNAs encode components of the nonsense-mediated decay and splicing machinery, as well as RNA-binding and translation initiation proteins. The RNP complexes contain proteinsmore » and mRNAs involved in RNA binding and post-transcriptional regulation. Genes with the capacity to produce hundreds of mRNA isoforms, ultracomplex genes, interact extensively with heterogeneous nuclear ribonuclear proteins (hnRNPs). Our data are consistent with a model in which subsets of RNPs include mRNA and protein products from the same gene, indicating the widespread existence of auto-regulatory RNPs. Lastly, from the simultaneous acquisition and integrative analysis of protein and RNA constituents of RNPs, we identify extensive cross-regulatory and hierarchical interactions in post-transcriptional control.« less
Extensive cross-regulation of post-transcriptional regulatory networks in Drosophila
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stoiber, Marcus H.; Olson, Sara; May, Gemma E.
In eukaryotic cells, RNAs exist as ribonucleoprotein particles (RNPs). Despite the importance of these complexes in many biological processes, including splicing, polyadenylation, stability, transportation, localization, and translation, their compositions are largely unknown. We affinity-purified 20 distinct RNA-binding proteins (RBPs) from cultured Drosophila melanogaster cells under native conditions and identified both the RNA and protein compositions of these RNP complexes. We identified “high occupancy target” (HOT) RNAs that interact with the majority of the RBPs we surveyed. HOT RNAs encode components of the nonsense-mediated decay and splicing machinery, as well as RNA-binding and translation initiation proteins. The RNP complexes contain proteinsmore » and mRNAs involved in RNA binding and post-transcriptional regulation. Genes with the capacity to produce hundreds of mRNA isoforms, ultracomplex genes, interact extensively with heterogeneous nuclear ribonuclear proteins (hnRNPs). Our data are consistent with a model in which subsets of RNPs include mRNA and protein products from the same gene, indicating the widespread existence of auto-regulatory RNPs. Lastly, from the simultaneous acquisition and integrative analysis of protein and RNA constituents of RNPs, we identify extensive cross-regulatory and hierarchical interactions in post-transcriptional control.« less
Chow, Chi-Nga; Zheng, Han-Qin; Wu, Nai-Yun; Chien, Chia-Hung; Huang, Hsien-Da; Lee, Tzong-Yi; Chiang-Hsieh, Yi-Fan; Hou, Ping-Fu; Yang, Tien-Yi; Chang, Wen-Chi
2016-01-04
Transcription factors (TFs) are sequence-specific DNA-binding proteins acting as critical regulators of gene expression. The Plant Promoter Analysis Navigator (PlantPAN; http://PlantPAN2.itps.ncku.edu.tw) provides an informative resource for detecting transcription factor binding sites (TFBSs), corresponding TFs, and other important regulatory elements (CpG islands and tandem repeats) in a promoter or a set of plant promoters. Additionally, TFBSs, CpG islands, and tandem repeats in the conserve regions between similar gene promoters are also identified. The current PlantPAN release (version 2.0) contains 16 960 TFs and 1143 TF binding site matrices among 76 plant species. In addition to updating of the annotation information, adding experimentally verified TF matrices, and making improvements in the visualization of transcriptional regulatory networks, several new features and functions are incorporated. These features include: (i) comprehensive curation of TF information (response conditions, target genes, and sequence logos of binding motifs, etc.), (ii) co-expression profiles of TFs and their target genes under various conditions, (iii) protein-protein interactions among TFs and their co-factors, (iv) TF-target networks, and (v) downstream promoter elements. Furthermore, a dynamic transcriptional regulatory network under various conditions is provided in PlantPAN 2.0. The PlantPAN 2.0 is a systematic platform for plant promoter analysis and reconstructing transcriptional regulatory networks. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Global analysis of bacterial transcription factors to predict cellular target processes.
Doerks, Tobias; Andrade, Miguel A; Lathe, Warren; von Mering, Christian; Bork, Peer
2004-03-01
Whole-genome sequences are now available for >100 bacterial species, giving unprecedented power to comparative genomics approaches. We have applied genome-context methods to predict target processes that are regulated by transcription factors (TFs). Of 128 orthologous groups of proteins annotated as TFs, to date, 36 are functionally uncharacterized; in our analysis we predict a probable cellular target process or biochemical pathway for half of these functionally uncharacterized TFs.
Analysis of a Plant Transcriptional Regulatory Network Using Transient Expression Systems.
Díaz-Triviño, Sara; Long, Yuchen; Scheres, Ben; Blilou, Ikram
2017-01-01
In plant biology, transient expression systems have become valuable approaches used routinely to rapidly study protein expression, subcellular localization, protein-protein interactions, and transcriptional activity prior to in vivo studies. When studying transcriptional regulation, luciferase reporter assays offer a sensitive readout for assaying promoter behavior in response to different regulators or environmental contexts and to confirm and assess the functional relevance of predicted binding sites in target promoters. This chapter aims to provide detailed methods for using luciferase reporter system as a rapid, efficient, and versatile assay to analyze transcriptional regulation of target genes by transcriptional regulators. We describe a series of optimized transient expression systems consisting of Arabidopsis thaliana protoplasts, infiltrated Nicotiana benthamiana leaves, and human HeLa cells to study the transcriptional regulations of two well-characterized transcriptional regulators SCARECROW (SCR) and SHORT-ROOT (SHR) on one of their targets, CYCLIN D6 (CYCD6).Here, we illustrate similarities and differences in outcomes when using different systems. The plant-based systems revealed that the SCR-SHR complex enhances CYCD6 transcription, while analysis in HeLa cells showed that the complex is not sufficient to strongly induce CYCD6 transcription, suggesting that additional, plant-specific regulators are required for full activation. These results highlight the importance of the system and suggest that including heterologous systems, such as HeLa cells, can provide a more comprehensive analysis of a complex gene regulatory network.
Sasse, Sarah K; Gerber, Anthony N
2015-01-01
Nuclear receptors (NRs) are widely targeted to treat a range of human diseases. Feed-forward loops are an ancient mechanism through which single cell organisms organize transcriptional programming and modulate gene expression dynamics, but they have not been systematically studied as a regulatory paradigm for NR-mediated transcriptional responses. Here, we provide an overview of the basic properties of feed-forward loops as predicted by mathematical models and validated experimentally in single cell organisms. We review existing evidence implicating feed-forward loops as important in controlling clinically relevant transcriptional responses to estrogens, progestins, and glucocorticoids, among other NR ligands. We propose that feed-forward transcriptional circuits are a major mechanism through which NRs integrate signals, exert temporal control over gene regulation, and compartmentalize client transcriptomes into discrete subunits. Implications for the design and function of novel selective NR ligands are discussed. Copyright © 2014 Elsevier Inc. All rights reserved.
Exploring the bZIP transcription factor regulatory network in Neurospora crassa
Tian, Chaoguang; Li, Jingyi; Glass, N. Louise
2011-01-01
Transcription factors (TFs) are key nodes of regulatory networks in eukaryotic organisms, including filamentous fungi such as Neurospora crassa. The 178 predicted DNA-binding TFs in N. crassa are distributed primarily among six gene families, which represent an ancient expansion in filamentous ascomycete genomes; 98 TF genes show detectable expression levels during vegetative growth of N. crassa, including 35 that show a significant difference in expression level between hyphae at the periphery versus hyphae in the interior of a colony. Regulatory networks within a species genome include paralogous TFs and their respective target genes (TF regulon). To investigate TF network evolution in N. crassa, we focused on the basic leucine zipper (bZIP) TF family, which contains nine members. We performed baseline transcriptional profiling during vegetative growth of the wild-type and seven isogenic, viable bZIP deletion mutants. We further characterized the regulatory network of one member of the bZIP family, NCU03905. NCU03905 encodes an Ap1-like protein (NcAp-1), which is involved in resistance to multiple stress responses, including oxidative and heavy metal stress. Relocalization of NcAp-1 from the cytoplasm to the nucleus was associated with exposure to stress. A comparison of the NcAp-1 regulon with Ap1-like regulons in Saccharomyces cerevisiae, Schizosaccharomyces pombe, Candida albicans and Aspergillus fumigatus showed both conservation and divergence. These data indicate how N. crassa responds to stress and provide information on pathway evolution. PMID:21081763
Exploring the bZIP transcription factor regulatory network in Neurospora crassa.
Tian, Chaoguang; Li, Jingyi; Glass, N Louise
2011-03-01
Transcription factors (TFs) are key nodes of regulatory networks in eukaryotic organisms, including filamentous fungi such as Neurospora crassa. The 178 predicted DNA-binding TFs in N. crassa are distributed primarily among six gene families, which represent an ancient expansion in filamentous ascomycete genomes; 98 TF genes show detectable expression levels during vegetative growth of N. crassa, including 35 that show a significant difference in expression level between hyphae at the periphery versus hyphae in the interior of a colony. Regulatory networks within a species genome include paralogous TFs and their respective target genes (TF regulon). To investigate TF network evolution in N. crassa, we focused on the basic leucine zipper (bZIP) TF family, which contains nine members. We performed baseline transcriptional profiling during vegetative growth of the wild-type and seven isogenic, viable bZIP deletion mutants. We further characterized the regulatory network of one member of the bZIP family, NCU03905. NCU03905 encodes an Ap1-like protein (NcAp-1), which is involved in resistance to multiple stress responses, including oxidative and heavy metal stress. Relocalization of NcAp-1 from the cytoplasm to the nucleus was associated with exposure to stress. A comparison of the NcAp-1 regulon with Ap1-like regulons in Saccharomyces cerevisiae, Schizosaccharomyces pombe, Candida albicans and Aspergillus fumigatus showed both conservation and divergence. These data indicate how N. crassa responds to stress and provide information on pathway evolution.
Top-level dynamics and the regulated gene response of feed-forward loop transcriptional motifs.
Mayo, Michael; Abdelzaher, Ahmed; Perkins, Edward J; Ghosh, Preetam
2014-09-01
Feed-forward loops are hierarchical three-node transcriptional subnetworks, wherein a top-level protein regulates the activity of a target gene via two paths: a direct-regulatory path, and an indirect route, whereby the top-level proteins act implicitly through an intermediate transcription factor. Using a transcriptional network of the model bacterium Escherichia coli, we confirmed that nearly all types of feed-forward loop were significantly overrepresented in the bacterial network. We then used mathematical modeling to study their dynamics by manipulating the rise times of the top-level protein concentration, termed the induction time, through alteration of the protein destruction rates. Rise times of the regulated proteins exhibited two qualitatively different regimes, depending on whether top-level inductions were "fast" or "slow." In the fast regime, rise times were nearly independent of rapid top-level inductions, indicative of biological robustness, and occurred when RNA production rate-limits the protein yield. Alternatively, the protein rise times were dependent upon slower top-level inductions, greater than approximately one bacterial cell cycle. An equation is given for this crossover, which depends upon three parameters of the direct-regulatory path: transcriptional cooperation at the DNA-binding site, a protein-DNA dissociation constant, and the relative magnitude of the top-level protien concentration.
Visootsat, Akasit; Payungporn, Sunchai; T-Thienprasert, Nattanan P
2015-12-01
Hepatitis B virus (HBV) infection is a primary cause of hepatocellular carcinoma and liver cirrhosis worldwide. To develop novel antiviral drugs, a better understanding of HBV gene expression regulation is vital. One important aspect is to understand how HBV hijacks the cellular machinery to export unspliced RNA from the nucleus. The HBV post-transcriptional regulatory element (HBV PRE) has been proposed to be the HBV RNA nuclear export element. However, the function remains controversial, and the core element is unclear. This study, therefore, aimed to identify functional regulatory elements within the HBV PRE and investigate their functions. Using bioinformatics programs based on sequence conservation and conserved RNA secondary structures, three regulatory elements were predicted, namely PRE 1151-1410, PRE 1520-1620 and PRE 1650-1684. PRE 1151-1410 significantly increased intronless and unspliced luciferase activity in both HepG2 and COS-7 cells. Likewise, PRE 1151-1410 significantly elevated intronless and unspliced HBV surface transcripts in liver cancer cells. Moreover, motif analysis predicted that PRE 1151-1410 contains several regulatory motifs. This study reported the roles of PRE 1151-1410 in intronless transcript nuclear export and the splicing mechanism. Additionally, these results provide knowledge in the field of HBV RNA regulation. Moreover, PRE 1151-1410 may be used to enhance the expression of other mRNAs in intronless reporter plasmids.
Dias, Sheila; D'Amico, Angela; Cretney, Erika; Liao, Yang; Tellier, Julie; Bruggeman, Christine; Almeida, Francisca F; Leahy, Jamie; Belz, Gabrielle T; Smyth, Gordon K; Shi, Wei; Nutt, Stephen L
2017-01-17
FoxP3-expressing regulatory T (Treg) cells are essential for maintaining immune homeostasis. Activated Treg cells undergo further differentiation into an effector state that highly expresses genes critical for Treg cell function, although how this process is coordinated on a transcriptional level is poorly understood. Here, we demonstrate that mice lacking the transcription factor Myb in Treg cells succumbed to a multi-organ inflammatory disease. Myb was specifically expressed in, and required for the differentiation of, thymus-derived effector Treg cells. The combination of transcriptome and genomic footprint analyses revealed that Myb directly regulated a large proportion of the gene expression specific to effector Treg cells, identifying Myb as a critical component of the gene regulatory network controlling effector Treg cell differentiation and function. Copyright © 2017 Elsevier Inc. All rights reserved.
Scofield, Simon; Murison, Alexander; Jones, Angharad; Fozard, John; Aida, Mitsuhiro; Band, Leah R; Bennett, Malcolm; Murray, James A H
2018-04-30
The Arabidopsis homeodomain transcription factor SHOOT MERISTEMLESS (STM) is crucial for shoot apical meristem (SAM) function, yet the components and structure of the STM gene regulatory network (GRN) are largely unknown. Here, we show that transcriptional regulators are overrepresented among STM-regulated genes and, using these as GRN components in Bayesian network analysis, we infer STM GRN associations and reveal regulatory relationships between STM and factors involved in multiple aspects of SAM function. These include hormone regulation, TCP-mediated control of cell differentiation, AIL/PLT-mediated regulation of pluripotency and phyllotaxis, and specification of meristem-organ boundary zones via CUC1. We demonstrate a direct positive transcriptional feedback loop between STM and CUC1, despite their distinct expression patterns in the meristem and organ boundary, respectively. Our further finding that STM activates expression of the CUC1-targeting microRNA miR164c combined with mathematical modelling provides a potential solution for this apparent contradiction, demonstrating that these proposed regulatory interactions coupled with STM mobility could be sufficient to provide a mechanism for CUC1 localisation at the meristem-organ boundary. Our findings highlight the central role for the STM GRN in coordinating SAM functions. © 2018. Published by The Company of Biologists Ltd.
Transcription termination factor Rho and microbial phenotypic heterogeneity.
Bidnenko, Elena; Bidnenko, Vladimir
2018-06-01
Populations of genetically identical microorganisms exhibit high degree of cell-to-cell phenotypic diversity even when grown in uniform environmental conditions. Heterogeneity is a genetically determined trait, which ensures bacterial adaptation and survival in the ever changing environmental conditions. Fluctuations in gene expression (noise) at the level of transcription initiation largely contribute to cell-to-cell variability within population. Not surprisingly, the analyses of the mechanisms driving phenotypic heterogeneity are mainly focused on the activity of promoters and transcriptional factors. Less attention is currently given to a role of intrinsic and factor-dependent transcription terminators. Here, we discuss recent advances in understanding the regulatory role of the multi-functional transcription termination factor Rho, the major inhibitor of pervasive transcription in bacteria and the emerging global regulator of gene expression. We propose that termination activity of Rho might be among the mechanisms by which cells manage the intensity of transcriptional noise, thus affecting population heterogeneity.
Identification of germline transcriptional regulatory elements in Aedes aegypti.
Akbari, Omar S; Papathanos, Philippos A; Sandler, Jeremy E; Kennedy, Katie; Hay, Bruce A
2014-02-04
The mosquito Aedes aegypti is the principal vector for the yellow fever and dengue viruses, and is also responsible for recent outbreaks of the alphavirus chikungunya. Vector control strategies utilizing engineered gene drive systems are being developed as a means of replacing wild, pathogen transmitting mosquitoes with individuals refractory to disease transmission, or bringing about population suppression. Several of these systems, including Medea, UD(MEL), and site-specific nucleases, which can be used to drive genes into populations or bring about population suppression, utilize transcriptional regulatory elements that drive germline-specific expression. Here we report the identification of multiple regulatory elements able to drive gene expression specifically in the female germline, or in the male and female germline, in the mosquito Aedes aegypti. These elements can also be used as tools with which to probe the roles of specific genes in germline function and in the early embryo, through overexpression or RNA interference.
Identification of germline transcriptional regulatory elements in Aedes aegypti
NASA Astrophysics Data System (ADS)
Akbari, Omar S.; Papathanos, Philippos A.; Sandler, Jeremy E.; Kennedy, Katie; Hay, Bruce A.
2014-02-01
The mosquito Aedes aegypti is the principal vector for the yellow fever and dengue viruses, and is also responsible for recent outbreaks of the alphavirus chikungunya. Vector control strategies utilizing engineered gene drive systems are being developed as a means of replacing wild, pathogen transmitting mosquitoes with individuals refractory to disease transmission, or bringing about population suppression. Several of these systems, including Medea, UDMEL, and site-specific nucleases, which can be used to drive genes into populations or bring about population suppression, utilize transcriptional regulatory elements that drive germline-specific expression. Here we report the identification of multiple regulatory elements able to drive gene expression specifically in the female germline, or in the male and female germline, in the mosquito Aedes aegypti. These elements can also be used as tools with which to probe the roles of specific genes in germline function and in the early embryo, through overexpression or RNA interference.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Keating, David H.; Zhang, Yaoping; Ong, Irene M.
2014-08-13
Efficient microbial conversion of lignocellulosic hydrolysates to biofuels is a key barrier to the economically viable deployment of lignocellulosic biofuels. A chief contributor to this barrier is the impact on microbial processes and energy metabolism of lignocellulose-derived inhibitors, including phenolic carboxylates, phenolic amides (for ammonia-pretreated biomass), phenolic aldehydes, and furfurals. To understand the bacterial pathways induced by inhibitors present in ammonia-pretreated biomass hydrolysates, which are less well studied than acid-pretreated biomass hydrolysates, we developed and exploited synthetic mimics of ammonia-pretreated corn stover hydrolysate (ACSH). To determine regulatory responses to the inhibitors normally present in ACSH, we measured transcript and proteinmore » levels in an Escherichia coli ethanologen using RNA-seq and quantitative proteomics during fermentation to ethanol of synthetic hydrolysates containing or lacking the inhibitors. Our study identified four major regulators mediating these responses, the MarA/SoxS/Rob network, AaeR, FrmR, and YqhC. Induction of these regulons was correlated with a reduced rate of ethanol production, buildup of pyruvate, depletion of ATP and NAD(P)H, and an inhibition of xylose conversion. The aromatic aldehyde inhibitor 5-hydroxymethylfurfural appeared to be reduced to its alcohol form by the ethanologen during fermentation, whereas phenolic acid and amide inhibitors were not metabolized. Together, our findings establish that the major regulatory responses to lignocellulose-derived inhibitors are mediated by transcriptional rather than translational regulators, suggest that energy consumed for inhibitor efflux and detoxification may limit biofuel production, and identify a network of regulators for future synthetic biology efforts.« less
A new regulatory mechanism for bacterial lipoic acid synthesis
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-01
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID
A new regulatory mechanism for bacterial lipoic acid synthesis.
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-22
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015
The terminal differentiation of B lymphocytes into antibody-secreting plasma cells upon antigen stimulation is a crucial step in the humoral immune response. The mutually-repressive interactions among three key regulatory transcription factors underlying B to plasma cell differe...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zheng, Meiying; Cooper, David R.; Grossoehme, Nickolas E.
2009-04-01
Here, the crystal structure of TM0439, a GntR regulator with an FCD domain found in the Thermotoga maritima genome, is described. The GntR superfamily of dimeric transcription factors, with more than 6200 members encoded in bacterial genomes, are characterized by N-terminal winged-helix DNA-binding domains and diverse C-terminal regulatory domains which provide a basis for the classification of the constituent families. The largest of these families, FadR, contains nearly 3000 proteins with all-α-helical regulatory domains classified into two related Pfam families: FadR-C and FCD. Only two crystal structures of FadR-family members, those of Escherichia coli FadR protein and LldR from Corynebacteriummore » glutamicum, have been described to date in the literature. Here, the crystal structure of TM0439, a GntR regulator with an FCD domain found in the Thermotoga maritima genome, is described. The FCD domain is similar to that of the LldR regulator and contains a buried metal-binding site. Using atomic absorption spectroscopy and Trp fluorescence, it is shown that the recombinant protein contains bound Ni{sup 2+} ions but that it is able to bind Zn{sup 2+} with K{sub d} < 70 nM. It is concluded that Zn{sup 2+} is the likely physiological metal and that it may perform either structural or regulatory roles or both. Finally, the TM0439 structure is compared with two other FadR-family structures recently deposited by structural genomics consortia. The results call for a revision in the classification of the FadR family of transcription factors.« less
Redundancy of primary RNA-binding functions of the bacterial transcription terminator Rho
Shashni, Rajesh; Qayyum, M. Zuhaib; Vishalini, V.; Dey, Debashish; Sen, Ranjan
2014-01-01
The bacterial transcription terminator, Rho, terminates transcription at half of the operons. According to the classical model derived from in vitro assays on a few terminators, Rho is recruited to the transcription elongation complex (EC) by recognizing specific sites (rut) on the nascent RNA. Here, we explored the mode of in vivo recruitment process of Rho. We show that sequence specific recognition of the rut site, in majority of the Rho-dependent terminators, can be compromised to a great extent without seriously affecting the genome-wide termination function as well as the viability of Escherichia coli. These terminators function optimally only through a NusG-assisted recruitment and activation of Rho. Our data also indicate that at these terminators, Rho-EC-bound NusG interaction facilitates the isomerization of Rho into a translocase-competent form by stabilizing the interactions of mRNA with the secondary RNA binding site, thereby overcoming the defects of the primary RNA binding functions. PMID:25081210
VirF-Independent Regulation of Shigella virB Transcription is Mediated by the Small RNA RyhB
Broach, William H.; Egan, Nicholas; Wing, Helen J.; Payne, Shelley M.; Murphy, Erin R.
2012-01-01
Infection of the human host by Shigella species requires the coordinated production of specific Shigella virulence factors, a process mediated largely by the VirF/VirB regulatory cascade. VirF promotes the transcription of virB, a gene encoding the transcriptional activator of several virulence-associated genes. This study reveals that transcription of virB is also regulated by the small RNA RyhB, and importantly, that this regulation is not achieved indirectly via modulation of VirF activity. These data are the first to demonstrate that the regulation of virB transcription can be uncoupled from the master regulator VirF. It is also established that efficient RyhB-dependent regulation of transcription is facilitated by specific nucleic acid sequences within virB. This study not only reveals RyhB-dependent regulation of virB transcription as a novel point of control in the central regulatory circuit modulating Shigella virulence, but also highlights the versatility of RyhB in controlling bacterial gene expression. PMID:22701677
Bai, Fang; Ho Lim, Chae; Jia, Jingyue; Santostefano, Katherine; Simmons, Chelsey; Kasahara, Hideko; Wu, Weihui; Terada, Naohiro; Jin, Shouguang
2015-10-09
Forced expression of defined transcriptional factors has been well documented as an effective method for cellular reprogramming or directed differentiation. However, transgene expression is not amenable for therapeutic application due to potential insertional mutagenesis. Here, we have developed a bacterial type III secretion system (T3SS)-based protein delivery tool and shown its application in directing pluripotent stem cell differentiation by a controlled delivery of transcription factors relevant to early heart development. By fusing to an N-terminal secretion sequence for T3SS-dependent injection, three transcriptional factors, namely Gata4, Mef2c, and Tbx5 (abbreviated as GMT), were translocated into murine embryonic stem cells (ESCs), where the proteins are effectively targeted to the nucleus with an average intracellular half-life of 5.5 hours. Exogenous GMT protein injection activated the cardiac program, and multiple rounds of GMT protein delivery significantly improved the efficiency of ESC differentiation into cardiomyocytes. Combination of T3SS-mediated GMT delivery and Activin A treatment showed an additive effect, resulting in on average 60% of the ESCs differentiated into cardiomyocytes. ESC derived cardiomyocytes displayed spontaneous rhythmic contractile movement as well as normal hormonal responses. This work serves as a foundation for the bacterial delivery of multiple transcription factors to direct cell fate without jeopardizing genomic integrity.
Bai, Fang; Ho Lim, Chae; Jia, Jingyue; Santostefano, Katherine; Simmons, Chelsey; Kasahara, Hideko; Wu, Weihui; Terada, Naohiro; Jin, Shouguang
2015-01-01
Forced expression of defined transcriptional factors has been well documented as an effective method for cellular reprogramming or directed differentiation. However, transgene expression is not amenable for therapeutic application due to potential insertional mutagenesis. Here, we have developed a bacterial type III secretion system (T3SS)-based protein delivery tool and shown its application in directing pluripotent stem cell differentiation by a controlled delivery of transcription factors relevant to early heart development. By fusing to an N-terminal secretion sequence for T3SS-dependent injection, three transcriptional factors, namely Gata4, Mef2c, and Tbx5 (abbreviated as GMT), were translocated into murine embryonic stem cells (ESCs), where the proteins are effectively targeted to the nucleus with an average intracellular half-life of 5.5 hours. Exogenous GMT protein injection activated the cardiac program, and multiple rounds of GMT protein delivery significantly improved the efficiency of ESC differentiation into cardiomyocytes. Combination of T3SS-mediated GMT delivery and Activin A treatment showed an additive effect, resulting in on average 60% of the ESCs differentiated into cardiomyocytes. ESC derived cardiomyocytes displayed spontaneous rhythmic contractile movement as well as normal hormonal responses. This work serves as a foundation for the bacterial delivery of multiple transcription factors to direct cell fate without jeopardizing genomic integrity. PMID:26449528
Antisense Transcription Is Pervasive but Rarely Conserved in Enteric Bacteria
Raghavan, Rahul; Sloan, Daniel B.; Ochman, Howard
2012-01-01
ABSTRACT Noncoding RNAs, including antisense RNAs (asRNAs) that originate from the complementary strand of protein-coding genes, are involved in the regulation of gene expression in all domains of life. Recent application of deep-sequencing technologies has revealed that the transcription of asRNAs occurs genome-wide in bacteria. Although the role of the vast majority of asRNAs remains unknown, it is often assumed that their presence implies important regulatory functions, similar to those of other noncoding RNAs. Alternatively, many antisense transcripts may be produced by chance transcription events from promoter-like sequences that result from the degenerate nature of bacterial transcription factor binding sites. To investigate the biological relevance of antisense transcripts, we compared genome-wide patterns of asRNA expression in closely related enteric bacteria, Escherichia coli and Salmonella enterica serovar Typhimurium, by performing strand-specific transcriptome sequencing. Although antisense transcripts are abundant in both species, less than 3% of asRNAs are expressed at high levels in both species, and only about 14% appear to be conserved among species. And unlike the promoters of protein-coding genes, asRNA promoters show no evidence of sequence conservation between, or even within, species. Our findings suggest that many or even most bacterial asRNAs are nonadaptive by-products of the cell’s transcription machinery. PMID:22872780
Barzantny, Helena; Schröder, Jasmin; Strotmeier, Jasmin; Fredrich, Eugenie; Brune, Iris; Tauch, Andreas
2012-06-15
Lipophilic corynebacteria are involved in the generation of volatile odorous products in the process of human body odor formation by degrading skin lipids and specific odor precursors. Therefore, these bacteria represent appropriate model systems for the cosmetic industry to examine axillary malodor formation on the molecular level. To understand the transcriptional control of metabolic pathways involved in this process, the transcriptional regulatory network of the lipophilic axilla isolate Corynebacterium jeikeium K411 was reconstructed from the complete genome sequence. This bioinformatic approach detected a gene-regulatory repertoire of 83 candidate proteins, including 56 DNA-binding transcriptional regulators, nine two-component systems, nine sigma factors, and nine regulators with diverse physiological functions. Furthermore, a cross-genome comparison among selected corynebacterial species of the taxonomic cluster 3 revealed a common gene-regulatory repertoire of 44 transcriptional regulators, including the MarR-like regulator Jk0257, which is exclusively encoded in the genomes of this taxonomical subline. The current network reconstruction comprises 48 transcriptional regulators and 674 gene-regulatory interactions that were assigned to five interconnected functional modules. Most genes involved in lipid degradation are under the combined control of the global cAMP-sensing transcriptional regulator GlxR and the LuxR-family regulator RamA, probably reflecting the essential role of lipid degradation in C. jeikeium. This study provides the first genome-scale in silico analysis of the transcriptional regulation of metabolism in a lipophilic bacterium involved in the formation of human body odor. Copyright © 2012 Elsevier B.V. All rights reserved.
Evolution of DNA-Binding Sites of a Floral Master Regulatory Transcription Factor
Muiño, Jose M.; de Bruijn, Suzanne; Pajoro, Alice; Geuten, Koen; Vingron, Martin; Angenent, Gerco C.; Kaufmann, Kerstin
2016-01-01
Flower development is controlled by the action of key regulatory transcription factors of the MADS-domain family. The function of these factors appears to be highly conserved among species based on mutant phenotypes. However, the conservation of their downstream processes is much less well understood, mostly because the evolutionary turnover and variation of their DNA-binding sites (BSs) among plant species have not yet been experimentally determined. Here, we performed comparative ChIP (chromatin immunoprecipitation)-seq experiments of the MADS-domain transcription factor SEPALLATA3 (SEP3) in two closely related Arabidopsis species: Arabidopsis thaliana and A. lyrata which have very similar floral organ morphology. We found that BS conservation is associated with DNA sequence conservation, the presence of the CArG-box BS motif and on the relative position of the BS to its potential target gene. Differences in genome size and structure can explain that SEP3 BSs in A. lyrata can be located more distantly to their potential target genes than their counterparts in A. thaliana. In A. lyrata, we identified transposition as a mechanism to generate novel SEP3 binding locations in the genome. Comparative gene expression analysis shows that the loss/gain of BSs is associated with a change in gene expression. In summary, this study investigates the evolutionary dynamics of DNA BSs of a floral key-regulatory transcription factor and explores factors affecting this phenomenon. PMID:26429922
Wright, David P; Ulijasz, Andrew T
2014-01-01
Bacterial eukaryotic-like serine threonine kinases (eSTKs) and serine threonine phosphatases (eSTPs) have emerged as important signaling elements that are indispensable for pathogenesis. Differing considerably from their histidine kinase counterparts, few eSTK genes are encoded within the average bacterial genome, and their targets are pleiotropic in nature instead of exclusive. The growing list of important eSTK/P substrates includes proteins involved in translation, cell division, peptidoglycan synthesis, antibiotic tolerance, resistance to innate immunity and control of virulence factors. Recently it has come to light that eSTK/Ps also directly modulate transcriptional machinery in many microbial pathogens. This novel form of regulation is now emerging as an additional means by which bacteria can alter their transcriptomes in response to host-specific environmental stimuli. Here we focus on the ability of eSTKs and eSTPs in Gram-positive bacterial pathogens to directly modulate transcription, the known mechanistic outcomes of these modifications, and their roles as an added layer of complexity in controlling targeted RNA synthesis to enhance virulence potential. PMID:25603430
Moskvin, Oleg V; Bolotin, Dmitry; Wang, Andrew; Ivanov, Pavel S; Gomelsky, Mark
2011-02-01
We present Rhodobase, a web-based meta-analytical tool for analysis of transcriptional regulation in a model anoxygenic photosynthetic bacterium, Rhodobacter sphaeroides. The gene association meta-analysis is based on the pooled data from 100 of R. sphaeroides whole-genome DNA microarrays. Gene-centric regulatory networks were visualized using the StarNet approach (Jupiter, D.C., VanBuren, V., 2008. A visual data mining tool that facilitates reconstruction of transcription regulatory networks. PLoS ONE 3, e1717) with several modifications. We developed a means to identify and visualize operons and superoperons. We designed a framework for the cross-genome search for transcription factor binding sites that takes into account high GC-content and oligonucleotide usage profile characteristic of the R. sphaeroides genome. To facilitate reconstruction of directional relationships between co-regulated genes, we screened upstream sequences (-400 to +20bp from start codons) of all genes for putative binding sites of bacterial transcription factors using a self-optimizing search method developed here. To test performance of the meta-analysis tools and transcription factor site predictions, we reconstructed selected nodes of the R. sphaeroides transcription factor-centric regulatory matrix. The test revealed regulatory relationships that correlate well with the experimentally derived data. The database of transcriptional profile correlations, the network visualization engine and the optimized search engine for transcription factor binding sites analysis are available at http://rhodobase.org. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Rogers, Julia M; Bulyk, Martha L
2018-04-25
Sequence-specific transcription factors (TFs) bind short DNA sequences in the genome to regulate the expression of target genes. In the last decade, numerous technical advances have enabled the determination of the DNA-binding specificities of many of these factors. Large-scale screens of many TFs enabled the creation of databases of TF DNA-binding specificities, typically represented as position weight matrices (PWMs). Although great progress has been made in determining and predicting binding specificities systematically, there are still many surprises to be found when studying a particular TF's interactions with DNA in detail. Paralogous TFs' binding specificities can differ in subtle ways, in a manner that is not immediately apparent from looking at their PWMs. These differences affect gene regulatory outputs and enable TFs to rewire transcriptional networks over evolutionary time. This review discusses recent observations made in the study of TF-DNA interactions that highlight the importance of continued in-depth analysis of TF-DNA interactions and their inherent complexity. This article is categorized under: Biological Mechanisms > Regulatory Biology. © 2018 Wiley Periodicals, Inc.
Fan, Yanhua; Liu, Xi; Keyhani, Nemat O.; Tang, Guirong; Pei, Yan; Zhang, Wenwen; Tong, Sheng
2017-01-01
The regulatory network and biological functions of the fungal secondary metabolite oosporein have remained obscure. Beauveria bassiana has evolved the ability to parasitize insects and outcompete microbial challengers for assimilation of host nutrients. A novel zinc finger transcription factor, BbSmr1 (B. bassiana secondary metabolite regulator 1), was identified in a screen for oosporein overproduction. Deletion of Bbsmr1 resulted in up-regulation of the oosporein biosynthetic gene cluster (OpS genes) and constitutive oosporein production. Oosporein production was abolished in double mutants of Bbsmr1 and a second transcription factor, OpS3, within the oosporein gene cluster (ΔBbsmr1ΔOpS3), indicating that BbSmr1 acts as a negative regulator of OpS3 expression. Real-time quantitative PCR and a GFP promoter fusion construct of OpS1, the oosporein polyketide synthase, indicated that OpS1 is expressed mainly in insect cadavers at 24–48 h after death. Bacterial colony analysis in B. bassiana-infected insect hosts revealed increasing counts until host death, with a dramatic decrease (∼90%) after death that correlated with oosporein production. In vitro studies verified the inhibitory activity of oosporein against bacteria derived from insect cadavers. These results suggest that oosporein acts as an antimicrobial compound to limit microbial competition on B. bassiana-killed hosts, allowing the fungus to maximally use host nutrients to grow and sporulate on infected cadavers. PMID:28193896
Fan, Yanhua; Liu, Xi; Keyhani, Nemat O; Tang, Guirong; Pei, Yan; Zhang, Wenwen; Tong, Sheng
2017-02-28
The regulatory network and biological functions of the fungal secondary metabolite oosporein have remained obscure. Beauveria bassiana has evolved the ability to parasitize insects and outcompete microbial challengers for assimilation of host nutrients. A novel zinc finger transcription factor, BbSmr1 ( B. bassiana secondary metabolite regulator 1), was identified in a screen for oosporein overproduction. Deletion of Bbsmr1 resulted in up-regulation of the oosporein biosynthetic gene cluster ( OpS genes) and constitutive oosporein production. Oosporein production was abolished in double mutants of Bbsmr1 and a second transcription factor, OpS3 , within the oosporein gene cluster ( ΔBbsmr1ΔOpS3 ), indicating that BbSmr1 acts as a negative regulator of OpS3 expression. Real-time quantitative PCR and a GFP promoter fusion construct of OpS1 , the oosporein polyketide synthase, indicated that OpS1 is expressed mainly in insect cadavers at 24-48 h after death. Bacterial colony analysis in B. bassiana -infected insect hosts revealed increasing counts until host death, with a dramatic decrease (∼90%) after death that correlated with oosporein production. In vitro studies verified the inhibitory activity of oosporein against bacteria derived from insect cadavers. These results suggest that oosporein acts as an antimicrobial compound to limit microbial competition on B. bassiana -killed hosts, allowing the fungus to maximally use host nutrients to grow and sporulate on infected cadavers.
Global Analysis of Photosynthesis Transcriptional Regulatory Networks
Imam, Saheed; Noguera, Daniel R.; Donohue, Timothy J.
2014-01-01
Photosynthesis is a crucial biological process that depends on the interplay of many components. This work analyzed the gene targets for 4 transcription factors: FnrL, PrrA, CrpK and MppG (RSP_2888), which are known or predicted to control photosynthesis in Rhodobacter sphaeroides. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) identified 52 operons under direct control of FnrL, illustrating its regulatory role in photosynthesis, iron homeostasis, nitrogen metabolism and regulation of sRNA synthesis. Using global gene expression analysis combined with ChIP-seq, we mapped the regulons of PrrA, CrpK and MppG. PrrA regulates ∼34 operons encoding mainly photosynthesis and electron transport functions, while CrpK, a previously uncharacterized Crp-family protein, regulates genes involved in photosynthesis and maintenance of iron homeostasis. Furthermore, CrpK and FnrL share similar DNA binding determinants, possibly explaining our observation of the ability of CrpK to partially compensate for the growth defects of a ΔFnrL mutant. We show that the Rrf2 family protein, MppG, plays an important role in photopigment biosynthesis, as part of an incoherent feed-forward loop with PrrA. Our results reveal a previously unrealized, high degree of combinatorial regulation of photosynthetic genes and significant cross-talk between their transcriptional regulators, while illustrating previously unidentified links between photosynthesis and the maintenance of iron homeostasis. PMID:25503406
Global analysis of photosynthesis transcriptional regulatory networks.
Imam, Saheed; Noguera, Daniel R; Donohue, Timothy J
2014-12-01
Photosynthesis is a crucial biological process that depends on the interplay of many components. This work analyzed the gene targets for 4 transcription factors: FnrL, PrrA, CrpK and MppG (RSP_2888), which are known or predicted to control photosynthesis in Rhodobacter sphaeroides. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) identified 52 operons under direct control of FnrL, illustrating its regulatory role in photosynthesis, iron homeostasis, nitrogen metabolism and regulation of sRNA synthesis. Using global gene expression analysis combined with ChIP-seq, we mapped the regulons of PrrA, CrpK and MppG. PrrA regulates ∼34 operons encoding mainly photosynthesis and electron transport functions, while CrpK, a previously uncharacterized Crp-family protein, regulates genes involved in photosynthesis and maintenance of iron homeostasis. Furthermore, CrpK and FnrL share similar DNA binding determinants, possibly explaining our observation of the ability of CrpK to partially compensate for the growth defects of a ΔFnrL mutant. We show that the Rrf2 family protein, MppG, plays an important role in photopigment biosynthesis, as part of an incoherent feed-forward loop with PrrA. Our results reveal a previously unrealized, high degree of combinatorial regulation of photosynthetic genes and significant cross-talk between their transcriptional regulators, while illustrating previously unidentified links between photosynthesis and the maintenance of iron homeostasis.
Motohashi, Hozumi; O'Connor, Tania; Katsuoka, Fumiki; Engel, James Douglas; Yamamoto, Masayuki
2002-07-10
Recent progress in the analysis of transcriptional regulation has revealed the presence of an exquisite functional network comprising the Maf and Cap 'n' collar (CNC) families of regulatory proteins, many of which have been isolated. Among Maf factors, large Maf proteins are important in the regulation of embryonic development and cell differentiation, whereas small Maf proteins serve as obligatory heterodimeric partner molecules for members of the CNC family. Both Maf homodimers and CNC-small Maf heterodimers bind to the Maf recognition element (MARE). Since the MARE contains a consensus TRE sequence recognized by AP-1, Jun and Fos family members may act to compete or interfere with the function of CNC-small Maf heterodimers. Overall then, the quantitative balance of transcription factors interacting with the MARE determines its transcriptional activity. Many putative MARE-dependent target genes such as those induced by antioxidants and oxidative stress are under concerted regulation by the CNC family member Nrf2, as clearly proven by mouse germline mutagenesis. Since these genes represent a vital aspect of the cellular defense mechanism against oxidative stress, Nrf2-null mutant mice are highly sensitive to xenobiotic and oxidative insults. Deciphering the molecular basis of the regulatory network composed of Maf and CNC families of transcription factors will undoubtedly lead to a new paradigm for the cooperative function of transcription factors.
Berger, Michael; Farcas, Anca; Geertz, Marcel; Zhelyazkova, Petya; Brix, Klaudia; Travers, Andrew; Muskhelishvili, Georgi
2010-01-01
The histone-like protein HU is a highly abundant DNA architectural protein that is involved in compacting the DNA of the bacterial nucleoid and in regulating the main DNA transactions, including gene transcription. However, the coordination of the genomic structure and function by HU is poorly understood. Here, we address this question by comparing transcript patterns and spatial distributions of RNA polymerase in Escherichia coli wild-type and hupA/B mutant cells. We demonstrate that, in mutant cells, upregulated genes are preferentially clustered in a large chromosomal domain comprising the ribosomal RNA operons organized on both sides of OriC. Furthermore, we show that, in parallel to this transcription asymmetry, mutant cells are also impaired in forming the transcription foci—spatially confined aggregations of RNA polymerase molecules transcribing strong ribosomal RNA operons. Our data thus implicate HU in coordinating the global genomic structure and function by regulating the spatial distribution of RNA polymerase in the nucleoid. PMID:20010798
Liu, Junbo; Ma, Jun
2013-01-01
Anterior-posterior (AP) patterning in the Drosophila embryo is dependent on the Bicoid (Bcd) morphogen gradient. However, most target genes of Bcd also require additional inputs to establish their expression domains, reflective of the operation of a cross-regulatory network and contributions of other maternal signals. This is in contrast to hunchback (hb), which has an anterior expression domain driven by an enhancer that appears to respond primarily to the Bcd input. To gain a better understanding of the regulatory logic of the AP patterning network, we perform quantitative studies that specifically investigate the dynamics of hb transcription during development. We show that Bcd-dependent hb transcription, monitored by the intron-containing nascent transcripts near the P2 promoter, is turned off quickly–on the order of a few minutes–upon entering the interphase of nuclear cycle 14A. This shutdown contrasts with earlier cycles during which active hb transcription can persist until the moment when the nucleus enters mitosis. The shutdown takes place at a time when the nuclear Bcd gradient profile in the embryo remains largely intact, suggesting that this is a process likely subject to control of a currently unknown regulatory mechanism. We suggest that this dynamic feature offers a window of opportunity for hb to faithfully interpret, and directly benefit from, Bcd gradient properties, including its scaling properties, to help craft a robust AP patterning outcome. PMID:23646132
Cheatle Jarvela, Alys M.; Brubaker, Lisa; Vedenko, Anastasia; Gupta, Anisha; Armitage, Bruce A.; Bulyk, Martha L.; Hinman, Veronica F.
2014-01-01
Gene regulatory networks (GRNs) describe the progression of transcriptional states that take a single-celled zygote to a multicellular organism. It is well documented that GRNs can evolve extensively through mutations to cis-regulatory modules (CRMs). Transcription factor proteins that bind these CRMs may also evolve to produce novelty. Coding changes are considered to be rarer, however, because transcription factors are multifunctional and hence are more constrained to evolve in ways that will not produce widespread detrimental effects. Recent technological advances have unearthed a surprising variation in DNA-binding abilities, such that individual transcription factors may recognize both a preferred primary motif and an additional secondary motif. This provides a source of modularity in function. Here, we demonstrate that orthologous transcription factors can also evolve a changed preference for a secondary binding motif, thereby offering an unexplored mechanism for GRN evolution. Using protein-binding microarray, surface plasmon resonance, and in vivo reporter assays, we demonstrate an important difference in DNA-binding preference between Tbrain protein orthologs in two species of echinoderms, the sea star, Patiria miniata, and the sea urchin, Strongylocentrotus purpuratus. Although both orthologs recognize the same primary motif, only the sea star Tbr also has a secondary binding motif. Our in vivo assays demonstrate that this difference may allow for greater evolutionary change in timing of regulatory control. This uncovers a layer of transcription factor binding divergence that could exist for many pairs of orthologs. We hypothesize that this divergence provides modularity that allows orthologous transcription factors to evolve novel roles in GRNs through modification of binding to secondary sites. PMID:25016582
The terminal differentiation of B cells in lymphoid organs into antibody-secreting plasma cells upon antigen stimulation is a crucial step in the humoral immune response. The architecture of the B-cell transcriptional regulatory network consists of coupled mutually-repressive fee...
Redundancy of primary RNA-binding functions of the bacterial transcription terminator Rho.
Shashni, Rajesh; Qayyum, M Zuhaib; Vishalini, V; Dey, Debashish; Sen, Ranjan
2014-09-01
The bacterial transcription terminator, Rho, terminates transcription at half of the operons. According to the classical model derived from in vitro assays on a few terminators, Rho is recruited to the transcription elongation complex (EC) by recognizing specific sites (rut) on the nascent RNA. Here, we explored the mode of in vivo recruitment process of Rho. We show that sequence specific recognition of the rut site, in majority of the Rho-dependent terminators, can be compromised to a great extent without seriously affecting the genome-wide termination function as well as the viability of Escherichia coli. These terminators function optimally only through a NusG-assisted recruitment and activation of Rho. Our data also indicate that at these terminators, Rho-EC-bound NusG interaction facilitates the isomerization of Rho into a translocase-competent form by stabilizing the interactions of mRNA with the secondary RNA binding site, thereby overcoming the defects of the primary RNA binding functions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Conservation of Transcription Start Sites within Genes across a Bacterial Genus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shao, Wenjun; Price, Morgan N.; Deutschbauer, Adam M.
Transcription start sites (TSSs) lying inside annotated genes, on the same or opposite strand, have been observed in diverse bacteria, but the function of these unexpected transcripts is unclear. Here, we use the metal-reducing bacterium Shewanella oneidensis MR-1 and its relatives to study the evolutionary conservation of unexpected TSSs. Using high-resolution tiling microarrays and 5'-end RNA sequencing, we identified 2,531 TSSs in S. oneidensis MR-1, of which 18% were located inside coding sequences (CDSs). Comparative transcriptome analysis with seven additional Shewanella species revealed that the majority (76%) of the TSSs within the upstream regions of annotated genes (gTSSs) were conserved.more » Thirty percent of the TSSs that were inside genes and on the sense strand (iTSSs) were also conserved. Sequence analysis around these iTSSs showed conserved promoter motifs, suggesting that many iTSS are under purifying selection. Furthermore, conserved iTSSs are enriched for regulatory motifs, suggesting that they are regulated, and they tend to eliminate polar effects, which confirms that they are functional. In contrast, the transcription of antisense TSSs located inside CDSs (aTSSs) was significantly less likely to be conserved (22%). However, aTSSs whose transcription was conserved often have conserved promoter motifs and drive the expression of nearby genes. Overall, our findings demonstrate that some internal TSSs are conserved and drive protein expression despite their unusual locations, but the majority are not conserved and may reflect noisy initiation of transcription rather than a biological function.« less
Gubelmann, Carine; Schwalie, Petra C; Raghav, Sunil K; Röder, Eva; Delessa, Tenagne; Kiehlmann, Elke; Waszak, Sebastian M; Corsinotti, Andrea; Udin, Gilles; Holcombe, Wiebke; Rudofsky, Gottfried; Trono, Didier; Wolfrum, Christian; Deplancke, Bart
2014-01-01
Adipose tissue is a key determinant of whole body metabolism and energy homeostasis. Unraveling the regulatory mechanisms underlying adipogenesis is therefore highly relevant from a biomedical perspective. Our current understanding of fat cell differentiation is centered on the transcriptional cascades driven by the C/EBP protein family and the master regulator PPARγ. To elucidate further components of the adipogenic gene regulatory network, we performed a large-scale transcription factor (TF) screen overexpressing 734 TFs in mouse pre-adipocytes and probed their effect on differentiation. We identified 22 novel pro-adipogenic TFs and characterized the top ranking TF, ZEB1, as being essential for adipogenesis both in vitro and in vivo. Moreover, its expression levels correlate with fat cell differentiation potential in humans. Genomic profiling further revealed that this TF directly targets and controls the expression of most early and late adipogenic regulators, identifying ZEB1 as a central transcriptional component of fat cell differentiation. DOI: http://dx.doi.org/10.7554/eLife.03346.001 PMID:25163748
De la Cruz, Miguel A; Ares, Miguel A; von Bargen, Kristine; Panunzi, Leonardo G; Martínez-Cruz, Jessica; Valdez-Salazar, Hilda A; Jiménez-Galicia, César; Torres, Javier
2017-01-01
Helicobacter pylori is a Gram-negative bacterium that colonizes the human gastric mucosa and causes peptic ulcers and gastric carcinoma. H. pylori strain 26695 has a small genome (1.67 Mb), which codes for few known transcriptional regulators that control bacterial metabolism and virulence. We analyzed by qRT-PCR the expression of 16 transcriptional regulators in H. pylori 26695, including the three sigma factors under different environmental conditions. When bacteria were exposed to acidic pH, urea, nickel, or iron, the sigma factors were differentially expressed with a particularly strong induction of fliA . The regulatory genes hrcA, hup , and crdR were highly induced in the presence of urea, nickel, and iron. In terms of biofilm formation fliA, flgR, hp1021, fur, nikR , and crdR were induced in sessile bacteria. Transcriptional expression levels of rpoD, flgR, hspR, hp1043 , and cheY were increased in contact with AGS epithelial cells. Kanamycin, chloramphenicol, and tetracycline increased or decreased expression of regulatory genes, showing that these antibiotics affect the transcription of H. pylori . Our data indicate that environmental cues which may be present in the human stomach modulate H. pylori transcription.
Uncovering MicroRNA and Transcription Factor Mediated Regulatory Networks in Glioblastoma
Sun, Jingchun; Gong, Xue; Purow, Benjamin; Zhao, Zhongming
2012-01-01
Glioblastoma multiforme (GBM) is the most common and lethal brain tumor in humans. Recent studies revealed that patterns of microRNA (miRNA) expression in GBM tissue samples are different from those in normal brain tissues, suggesting that a number of miRNAs play critical roles in the pathogenesis of GBM. However, little is yet known about which miRNAs play central roles in the pathology of GBM and their regulatory mechanisms of action. To address this issue, in this study, we systematically explored the main regulation format (feed-forward loops, FFLs) consisting of miRNAs, transcription factors (TFs) and their impacting GBM-related genes, and developed a computational approach to construct a miRNA-TF regulatory network. First, we compiled GBM-related miRNAs, GBM-related genes, and known human TFs. We then identified 1,128 3-node FFLs and 805 4-node FFLs with statistical significance. By merging these FFLs together, we constructed a comprehensive GBM-specific miRNA-TF mediated regulatory network. Then, from the network, we extracted a composite GBM-specific regulatory network. To illustrate the GBM-specific regulatory network is promising for identification of critical miRNA components, we specifically examined a Notch signaling pathway subnetwork. Our follow up topological and functional analyses of the subnetwork revealed that six miRNAs (miR-124, miR-137, miR-219-5p, miR-34a, miR-9, and miR-92b) might play important roles in GBM, including some results that are supported by previous studies. In this study, we have developed a computational framework to construct a miRNA-TF regulatory network and generated the first miRNA-TF regulatory network for GBM, providing a valuable resource for further understanding the complex regulatory mechanisms in GBM. The observation of critical miRNAs in the Notch signaling pathway, with partial verification from previous studies, demonstrates that our network-based approach is promising for the identification of new and important
Wang, Yongli; Wang, Hui; Ma, Yujie; Du, Haiping; Yang, Qing; Yu, Deyue
2015-01-01
Plant responses to major environmental stressors, such as insect feeding, not only occur via the functions of defense genes but also involve a series of regulatory factors. Our previous transcriptome studies proposed that, in addition to two defense-related genes, GmVSPβ and GmN:IFR, a high proportion of transcription factors (TFs) participate in the incompatible soybean-common cutworm interaction networks. However, the regulatory mechanisms and effects of these TFs on those induced defense-related genes remain unknown. In the present work, we isolated and identified 12 genes encoding MYB, WRKY, NAC, bZIP, and DREB TFs from a common cutworm-induced cDNA library of a resistant soybean line. Sequence analysis of the promoters of three co-expressed genes, including GmVSPα, GmVSPβ, and GmN:IFR, revealed the enrichment of various TF-binding sites for defense and stress responses. To further identify the regulatory nodes composed of these TFs and defense gene promoters, we performed extensive transient co-transactivation assays to directly test the transcriptional activity of the 12 TFs binding at different levels to the three co-expressed gene promoters. The results showed that all 12 TFs were able to transactivate the GmVSPβ and GmN:IFR promoters. GmbZIP110 and GmMYB75 functioned as distinct regulators of GmVSPα/β and GmN:IFR expression, respectively, while GmWRKY39 acted as a common central regulator of GmVSPα/β and GmN:IFR expression. These corresponding TFs play crucial roles in coordinated plant defense regulation, which provides valuable information for understanding the molecular mechanisms involved in insect-induced transcriptional regulation in soybean. More importantly, the identified TFs and suitable promoters can be used to engineer insect-resistant plants in molecular breeding studies. PMID:26579162
Short-lived non-coding transcripts (SLiTs): Clues to regulatory long non-coding RNA.
Tani, Hidenori
2017-03-22
Whole transcriptome analyses have revealed a large number of novel long non-coding RNAs (lncRNAs). Although the importance of lncRNAs has been documented in previous reports, the biological and physiological functions of lncRNAs remain largely unknown. The role of lncRNAs seems an elusive problem. Here, I propose a clue to the identification of regulatory lncRNAs. The key point is RNA half-life. RNAs with a long half-life (t 1/2 > 4 h) contain a significant proportion of ncRNAs, as well as mRNAs involved in housekeeping functions, whereas RNAs with a short half-life (t 1/2 < 4 h) include known regulatory ncRNAs and regulatory mRNAs. This novel class of ncRNAs with a short half-life can be categorized as Short-Lived non-coding Transcripts (SLiTs). I consider that SLiTs are likely to be rich in functionally uncharacterized regulatory RNAs. This review describes recent progress in research into SLiTs.
2004-11-01
contributes to the pathogenicity of B. mallei in vivo. Burkholderia mallei , the etiologic agent of glanders , is a Many gram-negative bacteria possess...A Transcriptional Regulatory System that Contributes to the Virulence of Burkholderia mallei and Burkholderia pseudomallei. Submission Information... Burkholderia mallei Ricky L. Ulrich,’* David DeShazer,1 Harry B. lines,2 and Jeffrey A. Jeddelohi* Bacteriology Division’ and ToxinoloSy/Aerobiology
Unraveling the Tangled Skein: The Evolution of Transcriptional Regulatory Networks in Development.
Rebeiz, Mark; Patel, Nipam H; Hinman, Veronica F
2015-01-01
The molecular and genetic basis for the evolution of anatomical diversity is a major question that has inspired evolutionary and developmental biologists for decades. Because morphology takes form during development, a true comprehension of how anatomical structures evolve requires an understanding of the evolutionary events that alter developmental genetic programs. Vast gene regulatory networks (GRNs) that connect transcription factors to their target regulatory sequences control gene expression in time and space and therefore determine the tissue-specific genetic programs that shape morphological structures. In recent years, many new examples have greatly advanced our understanding of the genetic alterations that modify GRNs to generate newly evolved morphologies. Here, we review several aspects of GRN evolution, including their deep preservation, their mechanisms of alteration, and how they originate to generate novel developmental programs.
Comparative genomics of transcriptional regulation of methionine metabolism in proteobacteria
Leyn, Semen A.; Suvorova, Inna A.; Kholina, Tatiana D.; ...
2014-11-20
Methionine metabolism and uptake genes in Proteobacteria are controlled by a variety of RNA and DNA regulatory systems. We have applied comparative genomics to reconstruct regulons for three known transcription factors, MetJ, MetR, and SahR, and three known riboswitch motifs, SAH, SAM-SAH, and SAM_alpha, in ~200 genomes from 22 taxonomic groups of Proteobacteria. We also identified two novel regulons: a SahR-like transcription factor SamR controlling various methionine biosynthesis genes in the Xanthomonadales group, and a potential RNA regulatory element with terminator-antiterminator mechanism controlling the metX or metZ genes in beta-proteobacteria. For each analyzed regulator we identified the core, taxon-specific andmore » genome-specific regulon members. By analyzing the distribution of these regulators in bacterial genomes and by comparing their regulon contents we elucidated possible evolutionary scenarios for the regulation of the methionine metabolism genes in Proteobacteria.« less
Integrated Approach to Reconstruction of Microbial Regulatory Networks
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rodionov, Dmitry A; Novichkov, Pavel S
2013-11-04
This project had the goal(s) of development of integrated bioinformatics platform for genome-scale inference and visualization of transcriptional regulatory networks (TRNs) in bacterial genomes. The work was done in Sanford-Burnham Medical Research Institute (SBMRI, P.I. D.A. Rodionov) and Lawrence Berkeley National Laboratory (LBNL, co-P.I. P.S. Novichkov). The developed computational resources include: (1) RegPredict web-platform for TRN inference and regulon reconstruction in microbial genomes, and (2) RegPrecise database for collection, visualization and comparative analysis of transcriptional regulons reconstructed by comparative genomics. These analytical resources were selected as key components in the DOE Systems Biology KnowledgeBase (SBKB). The high-quality data accumulated inmore » RegPrecise will provide essential datasets of reference regulons in diverse microbes to enable automatic reconstruction of draft TRNs in newly sequenced genomes. We outline our progress toward the three aims of this grant proposal, which were: Develop integrated platform for genome-scale regulon reconstruction; Infer regulatory annotations in several groups of bacteria and building of reference collections of microbial regulons; and Develop KnowledgeBase on microbial transcriptional regulation.« less
Bourqui, Romain; Benchimol, William; Gaspin, Christine; Sirand-Pugnet, Pascal; Uricaru, Raluca; Dutour, Isabelle
2015-01-01
The revolution in high-throughput sequencing technologies has enabled the acquisition of gigabytes of RNA sequences in many different conditions and has highlighted an unexpected number of small RNAs (sRNAs) in bacteria. Ongoing exploitation of these data enables numerous applications for investigating bacterial transacting sRNA-mediated regulation networks. Focusing on sRNAs that regulate mRNA translation in trans, recent works have noted several sRNA-based regulatory pathways that are essential for key cellular processes. Although the number of known bacterial sRNAs is increasing, the experimental validation of their interactions with mRNA targets remains challenging and involves expensive and time-consuming experimental strategies. Hence, bioinformatics is crucial for selecting and prioritizing candidates before designing any experimental work. However, current software for target prediction produces a prohibitive number of candidates because of the lack of biological knowledge regarding the rules governing sRNA–mRNA interactions. Therefore, there is a real need to develop new approaches to help biologists focus on the most promising predicted sRNA–mRNA interactions. In this perspective, this review aims at presenting the advantages of mixing bioinformatics and visualization approaches for analyzing predicted sRNA-mediated regulatory bacterial networks. PMID:25477348
Thébault, Patricia; Bourqui, Romain; Benchimol, William; Gaspin, Christine; Sirand-Pugnet, Pascal; Uricaru, Raluca; Dutour, Isabelle
2015-09-01
The revolution in high-throughput sequencing technologies has enabled the acquisition of gigabytes of RNA sequences in many different conditions and has highlighted an unexpected number of small RNAs (sRNAs) in bacteria. Ongoing exploitation of these data enables numerous applications for investigating bacterial transacting sRNA-mediated regulation networks. Focusing on sRNAs that regulate mRNA translation in trans, recent works have noted several sRNA-based regulatory pathways that are essential for key cellular processes. Although the number of known bacterial sRNAs is increasing, the experimental validation of their interactions with mRNA targets remains challenging and involves expensive and time-consuming experimental strategies. Hence, bioinformatics is crucial for selecting and prioritizing candidates before designing any experimental work. However, current software for target prediction produces a prohibitive number of candidates because of the lack of biological knowledge regarding the rules governing sRNA-mRNA interactions. Therefore, there is a real need to develop new approaches to help biologists focus on the most promising predicted sRNA-mRNA interactions. In this perspective, this review aims at presenting the advantages of mixing bioinformatics and visualization approaches for analyzing predicted sRNA-mediated regulatory bacterial networks. © The Author 2014. Published by Oxford University Press.
Regulation of host-pathogen interactions via the post-transcriptional Csr/Rsm system.
Kusmierek, Maria; Dersch, Petra
2018-02-01
A successful colonization of specific hosts requires a rapid and efficient adaptation of the virulence-relevant gene expression program by bacterial pathogens. An important element in this endeavor is the Csr/Rsm system. This multi-component, post-transcriptional control system forms a central hub within complex regulatory networks and coordinately adjusts virulence properties with metabolic and physiological attributes of the pathogen. A key function is elicited by the RNA-binding protein CsrA/RsmA. CsrA/RsmA interacts with numerous target mRNAs, many of which encode crucial virulence factors, and alters their translation, stability or elongation of transcription. Recent studies highlighted that important colonization factors, toxins, and bacterial secretion systems are under CsrA/RsmA control. CsrA/RsmA deficiency impairs host colonization and attenuates virulence, making this post-transcriptional regulator a suitable drug target. The CsrA/RsmA protein can be inactivated through sequestration by non-coding RNAs, or via binding to specific highly abundant mRNAs and interacting proteins. The wide range of interaction partners and RNA targets, as well as the overarching, interlinked genetic control circuits illustrate the complexity of this regulatory system in the different pathogens. Future work addressing spatio-temporal changes of Csr/Rsm-mediated control during the course of an infection will help us to understand how bacteria reprogram their expression profile to cope with continuous changes experienced in colonized niches. Copyright © 2017 Elsevier Ltd. All rights reserved.
Chao, Yu; Chen, Yutong; Cao, Yaqian; Chen, Huamin; Wang, Jichun; Bi, Yong-Mei; Tian, Fang; Yang, Fenghuan; Rothstein, Steven J; Zhou, Xueping; He, Chenyang
2018-03-15
Limiting nitrogen (N) supply contributes to improved resistance to bacterial blight (BB) caused by Xanthomonas oryzae pv. oryzae (Xoo) in susceptible rice (Oryza sativa). To understand the regulatory roles of microRNAs in this phenomenon, sixty-three differentially-expressed overlapping miRNAs in response to Xoo infection and N-limitation stress in rice were identified through deep RNA-sequence and stem loop qRT-PCR. Among these, miR169o was further assessed as a typical overlapping miRNA through the overexpression of the miR169o primary gene. Osa-miR169o-OX plants were taller, and had more biomass accumulation with significantly increased nitrate and total amino acid contents in roots than wild type (WT). Transcript level assays showed that under different N supply conditions miR169o opposite regulated NRT2 which is reduced under normal N supply condition but remarkably induced under N limiting stress. On the other hand, osa-miR169o-OX plants also displayed increased disease lesion lengths and reduced transcriptional levels of defense gene (PR1b, PR10a, PR10b and PAL) compared with WT after inoculation with Xoo. In addition, miR169o impeded Xoo-mediated NRT transcription. Therefore, the overlapping miR169o contributes to increase N use efficiency and negatively regulates the resistance to bacterial blight in rice. Consistently, transient expression of NF-YAs in rice protoplast promoted the transcripts of PR genes and NRT2 genes, while reduced the transcripts of NRT1 genes. Our results provide novel and additional insights into the coordinated regulatory mechanisms of crosstalk between Xoo infection and N-deficiency responses in rice.
Method to determine transcriptional regulation pathways in organisms
Gardner, Timothy S.; Collins, James J.; Hayete, Boris; Faith, Jeremiah
2012-11-06
The invention relates to computer-implemented methods and systems for identifying regulatory relationships between expressed regulating polypeptides and targets of the regulatory activities of such regulating polypeptides. More specifically, the invention provides a new method for identifying regulatory dependencies between biochemical species in a cell. In particular embodiments, provided are computer-implemented methods for identifying a regulatory interaction between a transcription factor and a gene target of the transcription factor, or between a transcription factor and a set of gene targets of the transcription factor. Further provided are genome-scale methods for predicting regulatory interactions between a set of transcription factors and a corresponding set of transcriptional target substrates thereof.
Naryshkin, Nikolai; Druzhinin, Sergei; Revyakin, Andrei; Kim, Younggyu; Mekler, Vladimir; Ebright, Richard H.
2009-01-01
Static site-specific protein-DNA photocrosslinking permits identification of protein-DNA interactions within multiprotein-DNA complexes. Kinetic site-specific protein-DNA photocrosslinking--involving rapid-quench-flow mixing and pulsed-laser irradiation--permits elucidation of pathways and kinetics of formation of protein-DNA interactions within multiprotein-DNA complexes. We present detailed protocols for application of static and kinetic site-specific protein-DNA photocrosslinking to bacterial transcription initiation complexes. PMID:19378179
Wei, Yunxie; Chang, Yanli; Zeng, Hongqiu; Liu, Guoyin; He, Chaozu; Shi, Haitao
2018-01-01
With 1 AP2 domain and 1 B3 domain, 7 MeRAVs in apetala2/ethylene response factor (AP2/ERF) gene family have been identified in cassava. However, the in vivo roles of these remain unknown. Gene expression assays showed that the transcripts of MeRAVs were commonly regulated after Xanthomonas axonopodis pv manihotis (Xam) and MeRAVs were specifically located in plant cell nuclei. Through virus-induced gene silencing (VIGS) in cassava, we found that MeRAV1 and MeRAV2 are essential for plant disease resistance against cassava bacterial blight, as shown by the bacterial propagation of Xam in plant leaves. Through VIGS in cassava leaves and overexpression in cassava leave protoplasts, we found that MeRAV1 and MeRAV2 positively regulated melatonin biosynthesis genes and the endogenous melatonin level. Further investigation showed that MeRAV1 and MeRAV2 are direct transcriptional activators of 3 melatonin biosynthesis genes in cassava, as evidenced by chromatin immunoprecipitation-PCR in cassava leaf protoplasts and electrophoretic mobility shift assay. Moreover, cassava melatonin biosynthesis genes also positively regulated plant disease resistance. Taken together, this study identified MeRAV1 and MeRAV2 as common and upstream transcription factors of melatonin synthesis genes in cassava and revealed a model of MeRAV1 and MeRAV2-melatonin biosynthesis genes-melatonin level in plant disease resistance against cassava bacterial blight. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Deciphering the transcriptional cis-regulatory code.
Yáñez-Cuna, J Omar; Kvon, Evgeny Z; Stark, Alexander
2013-01-01
Information about developmental gene expression resides in defined regulatory elements, called enhancers, in the non-coding part of the genome. Although cells reliably utilize enhancers to orchestrate gene expression, a cis-regulatory code that would allow their interpretation has remained one of the greatest challenges of modern biology. In this review, we summarize studies from the past three decades that describe progress towards revealing the properties of enhancers and discuss how recent approaches are providing unprecedented insights into regulatory elements in animal genomes. Over the next years, we believe that the functional characterization of regulatory sequences in entire genomes, combined with recent computational methods, will provide a comprehensive view of genomic regulatory elements and their building blocks and will enable researchers to begin to understand the sequence basis of the cis-regulatory code. Copyright © 2012 Elsevier Ltd. All rights reserved.
Antisense transcription is pervasive but rarely conserved in enteric bacteria.
Raghavan, Rahul; Sloan, Daniel B; Ochman, Howard
2012-01-01
Noncoding RNAs, including antisense RNAs (asRNAs) that originate from the complementary strand of protein-coding genes, are involved in the regulation of gene expression in all domains of life. Recent application of deep-sequencing technologies has revealed that the transcription of asRNAs occurs genome-wide in bacteria. Although the role of the vast majority of asRNAs remains unknown, it is often assumed that their presence implies important regulatory functions, similar to those of other noncoding RNAs. Alternatively, many antisense transcripts may be produced by chance transcription events from promoter-like sequences that result from the degenerate nature of bacterial transcription factor binding sites. To investigate the biological relevance of antisense transcripts, we compared genome-wide patterns of asRNA expression in closely related enteric bacteria, Escherichia coli and Salmonella enterica serovar Typhimurium, by performing strand-specific transcriptome sequencing. Although antisense transcripts are abundant in both species, less than 3% of asRNAs are expressed at high levels in both species, and only about 14% appear to be conserved among species. And unlike the promoters of protein-coding genes, asRNA promoters show no evidence of sequence conservation between, or even within, species. Our findings suggest that many or even most bacterial asRNAs are nonadaptive by-products of the cell's transcription machinery. IMPORTANCE Application of high-throughput methods has revealed the expression throughout bacterial genomes of transcripts encoded on the strand complementary to protein-coding genes. Because transcription is costly, it is usually assumed that these transcripts, termed antisense RNAs (asRNAs), serve some function; however, the role of most asRNAs is unclear, raising questions about their relevance in cellular processes. Because natural selection conserves functional elements, comparisons between related species provide a method for assessing
Imbert, J; Zafarullah, M; Culotta, V C; Gedamu, L; Hamer, D
1989-01-01
Metallothionein (MT) gene promoters in higher eucaryotes contain multiple metal regulatory elements (MREs) that are responsible for the metal induction of MT gene transcription. We identified and purified to near homogeneity a 74-kilodalton mouse nuclear protein that specifically binds to certain MRE sequences. This protein, MBF-I, was purified employing as an affinity reagent a trout MRE that is shown to be functional in mouse cells but which lacks the G+C-rich and SP1-like sequences found in many mammalian MT gene promoters. Using point-mutated MREs, we showed that there is a strong correlation between DNA binding in vitro and MT gene regulation in vivo, suggesting a direct role of MBF-I in MT gene transcription. We also showed that MBF-I can induce MT gene transcription in vitro in a mouse extract and that this stimulation requires zinc. Images PMID:2586522
Qian, Jiang; Esumi, Noriko; Chen, Yangjian; Wang, Qingliang; Chowers, Itay; Zack, Donald J.
2005-01-01
Identification of tissue-specific gene regulatory networks can yield insights into the molecular basis of a tissue's development, function and pathology. Here, we present a computational approach designed to identify potential regulatory target genes of photoreceptor cell-specific transcription factors (TFs). The approach is based on the hypothesis that genes related to the retina in terms of expression, disease and/or function are more likely to be the targets of retina-specific TFs than other genes. A list of genes that are preferentially expressed in retina was obtained by integrating expressed sequence tag, SAGE and microarray datasets. The regulatory targets of retina-specific TFs are enriched in this set of retina-related genes. A Bayesian approach was employed to integrate information about binding site location relative to a gene's transcription start site. Our method was applied to three retina-specific TFs, CRX, NRL and NR2E3, and a number of potential targets were predicted. To experimentally assess the validity of the bioinformatic predictions, mobility shift, transient transfection and chromatin immunoprecipitation assays were performed with five predicted CRX targets, and the results were suggestive of CRX regulation in 5/5, 3/5 and 4/5 cases, respectively. Together, these experiments strongly suggest that RP1, GUCY2D, ABCA4 are novel targets of CRX. PMID:15967807
Zhai, Zhengyuan; An, Haoran; Wang, Guohong; Luo, Yunbo; Hao, Yanling
2015-01-01
Lactobacillus delbrueckii subsp. bulgaricus develops acid tolerance response when subjected to acid stress conditions, such as the induction of enzymes associated with carbohydrate metabolism. In this study, pyk gene encoding pyruvate kinase was over-expressed in heterologous host Lactococcus lactis NZ9000, and SDS-PAGE analysis revealed the successful expression of this gene in NZ9000. The survival rate of Pyk-overproducing strain was 45-fold higher than the control under acid stress condition (pH 4.0). In order to determine the transcription factor (TF) which regulates the expression of pyk by bacterial one-hybrid, we constructed a TF library including 65 TFs of L. bulgaricus. Western blotting indicated that TFs in this library could be successfully expressed in host strains. Subsequently, the promoter of pfk-pyk operon in L. bulgaricus was identified by 5′-RACE PCR. The bait plasmid pH3U3-p01 carrying the deletion fragment of pfk-pyk promoter captured catabolite control protein A (CcpA) which could regulate the expression of pyk by binding to a putative catabolite-responsive element (5′-TGTAAGCCCTAACA-3′) upstream the -35 region. Real-time qPCR analysis revealed the transcription of pyk was positively regulated by CcpA. This is the first report about identifying the TF of pyk in L. bulgaricus, which will provide new insight into the regulatory network. PMID:26581248
Wang, Yejun; MacKenzie, Keith D; White, Aaron P
2015-05-07
As sequencing costs are being lowered continuously, RNA-seq has gradually been adopted as the first choice for comparative transcriptome studies with bacteria. Unlike microarrays, RNA-seq can directly detect cDNA derived from mRNA transcripts at a single nucleotide resolution. Not only does this allow researchers to determine the absolute expression level of genes, but it also conveys information about transcript structure. Few automatic software tools have yet been established to investigate large-scale RNA-seq data for bacterial transcript structure analysis. In this study, 54 directional RNA-seq libraries from Salmonella serovar Typhimurium (S. Typhimurium) 14028s were examined for potential relationships between read mapping patterns and transcript structure. We developed an empirical method, combined with statistical tests, to automatically detect key transcript features, including transcriptional start sites (TSSs), transcriptional termination sites (TTSs) and operon organization. Using our method, we obtained 2,764 TSSs and 1,467 TTSs for 1331 and 844 different genes, respectively. Identification of TSSs facilitated further discrimination of 215 putative sigma 38 regulons and 863 potential sigma 70 regulons. Combining the TSSs and TTSs with intergenic distance and co-expression information, we comprehensively annotated the operon organization in S. Typhimurium 14028s. Our results show that directional RNA-seq can be used to detect transcriptional borders at an acceptable resolution of ±10-20 nucleotides. Technical limitations of the RNA-seq procedure may prevent single nucleotide resolution. The automatic transcript border detection methods, statistical models and operon organization pipeline that we have described could be widely applied to RNA-seq studies in other bacteria. Furthermore, the TSSs, TTSs, operons, promoters and unstranslated regions that we have defined for S. Typhimurium 14028s may constitute valuable resources that can be used for
Direct modulation of T-box riboswitch-controlled transcription by protein synthesis inhibitors
Stamatopoulou, Vassiliki; Apostolidi, Maria; Li, Shuang; Lamprinou, Katerina; Papakyriakou, Athanasios
2017-01-01
Abstract Recently, it was discovered that exposure to mainstream antibiotics activate numerous bacterial riboregulators that control antibiotic resistance genes including metabolite-binding riboswitches and other transcription attenuators. However, the effects of commonly used antibiotics, many of which exhibit RNA-binding properties, on the widespread T-box riboswitches, remain unknown. In Staphylococcus aureus, a species-specific glyS T-box controls the supply of glycine for both ribosomal translation and cell wall synthesis, making it a promising target for next-generation antimicrobials. Here, we report that specific protein synthesis inhibitors could either significantly increase T-box-mediated transcription antitermination, while other compounds could suppress it, both in vitro and in vivo. In-line probing of the full-length T-box combined with molecular modelling and docking analyses suggest that the antibiotics that promote transcription antitermination stabilize the T-box:tRNA complex through binding specific positions on stem I and the Staphylococcal-specific stem Sa. By contrast, the antibiotics that attenuate T-box transcription bind to other positions on stem I and do not interact with stem Sa. Taken together, our results reveal that the transcription of essential genes controlled by T-box riboswitches can be directly modulated by commonly used protein synthesis inhibitors. These findings accentuate the regulatory complexities of bacterial response to antimicrobials that involve multiple riboregulators. PMID:28973457
Martinez, Carlos A.; Barr, Kenneth; Kim, Ah-Ram; Reinitz, John
2013-01-01
Synthetic biology offers novel opportunities for elucidating transcriptional regulatory mechanisms and enhancer logic. Complex cis-regulatory sequences—like the ones driving expression of the Drosophila even-skipped gene—have proven difficult to design from existing knowledge, presumably due to the large number of protein-protein interactions needed to drive the correct expression patterns of genes in multicellular organisms. This work discusses two novel computational methods for the custom design of enhancers that employ a sophisticated, empirically validated transcriptional model, optimization algorithms, and synthetic biology. These synthetic elements have both utilitarian and academic value, including improving existing regulatory models as well as evolutionary questions. The first method involves the use of simulated annealing to explore the sequence space for synthetic enhancers whose expression output fit a given search criterion. The second method uses a novel optimization algorithm to find functionally accessible pathways between two enhancer sequences. These paths describe a set of mutations wherein the predicted expression pattern does not significantly vary at any point along the path. Both methods rely on a predictive mathematical framework that maps the enhancer sequence space to functional output. PMID:23732772
Crawford, Matthew A.; Tapscott, Timothy; Fitzsimmons, Liam F.; Liu, Lin; Reyes, Aníbal M.; Libby, Stephen J.; Trujillo, Madia; Fang, Ferric C.; Radi, Rafael
2016-01-01
ABSTRACT The four-cysteine zinc finger motif of the bacterial RNA polymerase regulator DksA is essential for protein structure, canonical control of the stringent response to nutritional limitation, and thiol-based sensing of oxidative and nitrosative stress. This interdependent relationship has limited our understanding of DksA-mediated functions in bacterial pathogenesis. Here, we have addressed this challenge by complementing ΔdksA Salmonella with Pseudomonas aeruginosa dksA paralogues that encode proteins differing in cysteine and zinc content. We find that four-cysteine, zinc-bound (C4) and two-cysteine, zinc-free (C2) DksA proteins are able to mediate appropriate stringent control in Salmonella and that thiol-based sensing of reactive species is conserved among C2 and C4 orthologues. However, variations in cysteine and zinc content determine the threshold at which individual DksA proteins sense and respond to reactive species. In particular, zinc acts as an antioxidant, dampening cysteine reactivity and raising the threshold of posttranslational thiol modification with reactive species. Consequently, C2 DksA triggers transcriptional responses in Salmonella at levels of oxidative or nitrosative stress normally tolerated by Salmonella expressing C4 orthologues. Inappropriate transcriptional regulation by C2 DksA increases the susceptibility of Salmonella to the antimicrobial effects of hydrogen peroxide and nitric oxide, and attenuates virulence in macrophages and mice. Our findings suggest that the redox-active sensory function of DksA proteins is finely tuned to optimize bacterial fitness according to the levels of oxidative and nitrosative stress encountered by bacterial species in their natural and host environments. PMID:27094335
Read, Timothy; Richmond, Phillip A; Dowell, Robin D
2016-01-01
Most genetic variants associated with disease occur within regulatory regions of the genome, underscoring the importance of defining the mechanisms underlying differences in regulation of gene expression between individuals. We discovered a pair of co-regulated, divergently oriented transcripts, AQY2 and ncFRE6, that are expressed in one strain of Saccharomyces cerevisiae, ∑1278b, but not in another, S288c. By combining classical genetics techniques with high-throughput sequencing, we identified a trans-acting single nucleotide polymorphism within the transcription factor RIM101 that causes the background-dependent expression of both transcripts. Subsequent RNA-seq experiments revealed that RIM101 regulates many more targets in S288c than in ∑1278b and that deletion of RIM101 in both backgrounds abrogates the majority of differential expression between the strains. Strikingly, only three transcripts undergo a significant change in expression after swapping RIM101 alleles between backgrounds, implying that the differences in the RIM101 allele lead to a remarkably focused transcriptional response. However, hundreds of RIM101-dependent targets undergo a subtle but consistent shift in expression in the S288c RIM101-swapped strain, but not its ∑1278b counterpart. We conclude that ∑1278b may harbor a variant(s) that buffers against widespread transcriptional dysregulation upon introduction of a non-native RIM101 allele, emphasizing the importance of accounting for genetic background when assessing the impact of a regulatory variant.
Benner, Christopher; Hutt, Kasey R.; Stunnenberg, Rieka; Garcia-Bassets, Ivan
2013-01-01
Genome-wide maps of DNase I hypersensitive sites (DHSs) reveal that most human promoters contain perpetually active cis-regulatory elements between −150 bp and +50 bp (−150/+50 bp) relative to the transcription start site (TSS). Transcription factors (TFs) recruit cofactors (chromatin remodelers, histone/protein-modifying enzymes, and scaffold proteins) to these elements in order to organize the local chromatin structure and coordinate the balance of post-translational modifications nearby, contributing to the overall regulation of transcription. However, the rules of TF-mediated cofactor recruitment to the −150/+50 bp promoter regions remain poorly understood. Here, we provide evidence for a general model in which a series of cis-regulatory elements (here termed ‘cardinal’ motifs) prefer acting individually, rather than in fixed combinations, within the −150/+50 bp regions to recruit TFs that dictate cofactor signatures distinctive of specific promoter subsets. Subsequently, human promoters can be subclassified based on the presence of cardinal elements and their associated cofactor signatures. In this study, furthermore, we have focused on promoters containing the nuclear respiratory factor 1 (NRF1) motif as the cardinal cis-regulatory element and have identified the pervasive association of NRF1 with the cofactor lysine-specific demethylase 1 (LSD1/KDM1A). This signature might be distinctive of promoters regulating nuclear-encoded mitochondrial and other particular genes in at least some cells. Together, we propose that decoding a signature-based, expanded model of control at proximal promoter regions should lead to a better understanding of coordinated regulation of gene transcription. PMID:24244184
Shelburne, Samuel A; Sumby, Paul; Sitkiewicz, Izabela; Granville, Chanel; DeLeo, Frank R; Musser, James M
2005-11-01
The molecular genetic mechanisms used by bacteria to persist in humans are poorly understood. Group A Streptococcus (GAS) causes the majority of bacterial pharyngitis cases in humans and is prone to persistently inhabit the upper respiratory tract. To gain information about how GAS survives in and infects the oropharynx, we analyzed the transcriptome of a serotype M1 strain grown in saliva. The dynamic pattern of changes in transcripts of genes [spy0874/0875, herein named sptR and sptS (sptR/S), for saliva persistence] encoding a two-component gene regulatory system of unknown function suggested that SptR/S contributed to persistence of GAS in saliva. Consistent with this idea, an isogenic nonpolar mutant strain (DeltasptR) was dramatically less able to survive in saliva compared with the parental strain. Iterative expression microarray analysis of bacteria grown in saliva revealed that transcripts of several known and putative GAS virulence factor genes were decreased significantly in the DeltasptR mutant strain. Compared with the parental strain, the isogenic mutant strain also had altered transcripts of multiple genes encoding proteins involved in complex carbohydrate acquisition and utilization pathways. Western immunoblot analysis and real-time PCR analysis of GAS in throat swabs taken from humans with pharyngitis confirmed the findings. We conclude that SptR/S optimizes persistence of GAS in human saliva, apparently by strategically influencing metabolic pathways and virulence factor production. The discovery of a genetic program that significantly increased persistence of a major human pathogen in saliva enhances understanding of how bacteria survive in the host and suggests new therapeutic strategies.
Jorjani, Hadi; Zavolan, Mihaela
2014-04-01
Accurate identification of transcription start sites (TSSs) is an essential step in the analysis of transcription regulatory networks. In higher eukaryotes, the capped analysis of gene expression technology enabled comprehensive annotation of TSSs in genomes such as those of mice and humans. In bacteria, an equivalent approach, termed differential RNA sequencing (dRNA-seq), has recently been proposed, but the application of this approach to a large number of genomes is hindered by the paucity of computational analysis methods. With few exceptions, when the method has been used, annotation of TSSs has been largely done manually. In this work, we present a computational method called 'TSSer' that enables the automatic inference of TSSs from dRNA-seq data. The method rests on a probabilistic framework for identifying both genomic positions that are preferentially enriched in the dRNA-seq data as well as preferentially captured relative to neighboring genomic regions. Evaluating our approach for TSS calling on several publicly available datasets, we find that TSSer achieves high consistency with the curated lists of annotated TSSs, but identifies many additional TSSs. Therefore, TSSer can accelerate genome-wide identification of TSSs in bacterial genomes and can aid in further characterization of bacterial transcription regulatory networks. TSSer is freely available under GPL license at http://www.clipz.unibas.ch/TSSer/index.php
Kinchington, P R; Vergnes, J P; Defechereux, P; Piette, J; Turse, S E
1994-01-01
Four of the 68 varicella-zoster virus (VZV) unique open reading frames (ORFs), i.e., ORFs 4, 61, 62, and 63, encode proteins that influence viral transcription and are considered to be positional homologs of herpes simplex virus type 1 (HSV-1) immediate-early (IE) proteins. In order to identify the elements that regulate transcription of VZV ORFs 4 and 63, the encoded mRNAs were mapped in detail. For ORF 4, a major 1.8-kb and a minor 3.0-kb polyadenylated [poly(A)+] RNA were identified, whereas ORF 63-specific probes recognized 1.3- and 1.9-kb poly(A)+ RNAs. Probes specific for sequences adjacent to the ORFs and mapping of the RNA 3' ends indicated that the ORF 4 RNAs were 3' coterminal, whereas the RNAs for ORF 63 represented two different termination sites. S1 nuclease mapping and primer extension analyses indicated a single transcription initiation site for ORF 4 at 38 bp upstream of the ORF start codon. For ORF 63, multiple transcriptional start sites at 87 to 95, 151 to 153, and (tentatively) 238 to 243 bp upstream of the ORF start codon were identified. TATA box motifs at good positional locations were found upstream of all mapped transcription initiation sites. However, no sequences resembling the TAATGARAT motif, which confers IE regulation upon HSV-1 IE genes, were found. The finding of the absence of this motif was supported through analyses of the regulatory sequences of ORFs 4 and 63 in transient transfection assays alongside those of ORFs 61 and 62. Sequences representing the promoters for ORFs 4, 61, and 63 were all stimulated by VZV infection but failed to be stimulated by coexpression with the HSV-1 transactivator Vmw65. In contrast, the promoter for ORF 62, which contains TAATGARAT motifs, was activated by VZV infection and coexpression with Vmw65. These results extend the transcriptional knowledge for VZV and suggest that ORFs 4 and 63 contain regulatory signals different from those of the ORF 62 and HSV-1 IE genes. Images PMID:8189496
Distinct tissue-specific transcriptional regulation revealed by gene regulatory networks in maize.
Huang, Ji; Zheng, Juefei; Yuan, Hui; McGinnis, Karen
2018-06-07
Transcription factors (TFs) are proteins that can bind to DNA sequences and regulate gene expression. Many TFs are master regulators in cells that contribute to tissue-specific and cell-type-specific gene expression patterns in eukaryotes. Maize has been a model organism for over one hundred years, but little is known about its tissue-specific gene regulation through TFs. In this study, we used a network approach to elucidate gene regulatory networks (GRNs) in four tissues (leaf, root, SAM and seed) in maize. We utilized GENIE3, a machine-learning algorithm combined with large quantity of RNA-Seq expression data to construct four tissue-specific GRNs. Unlike some other techniques, this approach is not limited by high-quality Position Weighed Matrix (PWM), and can therefore predict GRNs for over 2000 TFs in maize. Although many TFs were expressed across multiple tissues, a multi-tiered analysis predicted tissue-specific regulatory functions for many transcription factors. Some well-studied TFs emerged within the four tissue-specific GRNs, and the GRN predictions matched expectations based upon published results for many of these examples. Our GRNs were also validated by ChIP-Seq datasets (KN1, FEA4 and O2). Key TFs were identified for each tissue and matched expectations for key regulators in each tissue, including GO enrichment and identity with known regulatory factors for that tissue. We also found functional modules in each network by clustering analysis with the MCL algorithm. By combining publicly available genome-wide expression data and network analysis, we can uncover GRNs at tissue-level resolution in maize. Since ChIP-Seq and PWMs are still limited in several model organisms, our study provides a uniform platform that can be adapted to any species with genome-wide expression data to construct GRNs. We also present a publicly available database, maize tissue-specific GRN (mGRN, https://www.bio.fsu.edu/mcginnislab/mgrn/ ), for easy querying. All source code
Bacterial Adaptation of Respiration from Oxic to Microoxic and Anoxic Conditions: Redox Control
Bueno, Emilio; Mesa, Socorro; Bedmar, Eulogio J.; Richardson, David J.
2012-01-01
Abstract Under a shortage of oxygen, bacterial growth can be faced mainly by two ATP-generating mechanisms: (i) by synthesis of specific high-affinity terminal oxidases that allow bacteria to use traces of oxygen or (ii) by utilizing other substrates as final electron acceptors such as nitrate, which can be reduced to dinitrogen gas through denitrification or to ammonium. This bacterial respiratory shift from oxic to microoxic and anoxic conditions requires a regulatory strategy which ensures that cells can sense and respond to changes in oxygen tension and to the availability of other electron acceptors. Bacteria can sense oxygen by direct interaction of this molecule with a membrane protein receptor (e.g., FixL) or by interaction with a cytoplasmic transcriptional factor (e.g., Fnr). A third type of oxygen perception is based on sensing changes in redox state of molecules within the cell. Redox-responsive regulatory systems (e.g., ArcBA, RegBA/PrrBA, RoxSR, RegSR, ActSR, ResDE, and Rex) integrate the response to multiple signals (e.g., ubiquinone, menaquinone, redox active cysteine, electron transport to terminal oxidases, and NAD/NADH) and activate or repress target genes to coordinate the adaptation of bacterial respiration from oxic to anoxic conditions. Here, we provide a compilation of the current knowledge about proteins and regulatory networks involved in the redox control of the respiratory adaptation of different bacterial species to microxic and anoxic environments. Antioxid. Redox Signal. 16, 819–852. PMID:22098259
Schnapp, A; Pfleiderer, C; Rosenbauer, H; Grummt, I
1990-09-01
Control of mouse ribosomal RNA synthesis in response to extracellular signals is mediated by TIF-IA, a regulatory factor whose amount or activity correlates with cell proliferation. Factor TIF-IA interacts with RNA polymerase I (pol I), thus converting it into a transcriptionally active holoenzyme, which is able to initiate specifically at the rDNA promoter in the presence of the other auxiliary transcription initiation factors, designated TIF-IB, TIF-IC and UBF. With regard to several criteria, the growth-dependent factor TIF-IA behaves like a bacterial sigma factor: (i) it associates physically with pol I, (ii) it is required for initiation of transcription, (iii) it is present in limiting amounts and (iv) under certain salt conditions, it is chromatographically separable from the polymerase. In addition, evidence is presented that dephosphorylation of pol I abolishes in vitro transcription initiation from the ribosomal gene promoter without significantly affecting the polymerizing activity of the enzyme at nonspecific templates. The involvement of both a regulatory factor and post-translational modification of the transcribing enzyme provides an efficient and versatile mechanism of rDNA transcription regulation which enables the cell to adapt ribosome synthesis rapidly to a variety of extracellular signals.
Gu, Jinghua; Xuan, Jianhua; Riggins, Rebecca B; Chen, Li; Wang, Yue; Clarke, Robert
2012-08-01
Identification of transcriptional regulatory networks (TRNs) is of significant importance in computational biology for cancer research, providing a critical building block to unravel disease pathways. However, existing methods for TRN identification suffer from the inclusion of excessive 'noise' in microarray data and false-positives in binding data, especially when applied to human tumor-derived cell line studies. More robust methods that can counteract the imperfection of data sources are therefore needed for reliable identification of TRNs in this context. In this article, we propose to establish a link between the quality of one target gene to represent its regulator and the uncertainty of its expression to represent other target genes. Specifically, an outlier sum statistic was used to measure the aggregated evidence for regulation events between target genes and their corresponding transcription factors. A Gibbs sampling method was then developed to estimate the marginal distribution of the outlier sum statistic, hence, to uncover underlying regulatory relationships. To evaluate the effectiveness of our proposed method, we compared its performance with that of an existing sampling-based method using both simulation data and yeast cell cycle data. The experimental results show that our method consistently outperforms the competing method in different settings of signal-to-noise ratio and network topology, indicating its robustness for biological applications. Finally, we applied our method to breast cancer cell line data and demonstrated its ability to extract biologically meaningful regulatory modules related to estrogen signaling and action in breast cancer. The Gibbs sampler MATLAB package is freely available at http://www.cbil.ece.vt.edu/software.htm. xuan@vt.edu Supplementary data are available at Bioinformatics online.
Wong, S W; Schaffer, P A
1991-05-01
Like other DNA-containing viruses, the three origins of herpes simplex virus type 1 (HSV-1) DNA replication are flanked by sequences containing transcriptional regulatory elements. In a transient plasmid replication assay, deletion of sequences comprising the transcriptional regulatory elements of ICP4 and ICP22/47, which flank oriS, resulted in a greater than 80-fold decrease in origin function compared with a plasmid, pOS-822, which retains these sequences. In an effort to identify specific cis-acting elements responsible for this effect, we conducted systematic deletion analysis of the flanking region with plasmid pOS-822 and tested the resulting mutant plasmids for origin function. Stimulation by cis-acting elements was shown to be both distance and orientation dependent, as changes in either parameter resulted in a decrease in oriS function. Additional evidence for the stimulatory effect of flanking sequences on origin function was demonstrated by replacement of these sequences with the cytomegalovirus immediate-early promoter, resulting in nearly wild-type levels of oriS function. In competition experiments, cotransfection of cells with the test plasmid, pOS-822, and increasing molar concentrations of a competitor plasmid which contained the ICP4 and ICP22/47 transcriptional regulatory regions but lacked core origin sequences resulted in a significant reduction in the replication efficiency of pOS-822, demonstrating that factors which bind specifically to the oriS-flanking sequences are likely involved as auxiliary proteins in oriS function. Together, these studies demonstrate that trans-acting factors and the sites to which they bind play a critical role in the efficiency of HSV-1 DNA replication from oriS in transient-replication assays.
Direct modulation of T-box riboswitch-controlled transcription by protein synthesis inhibitors.
Stamatopoulou, Vassiliki; Apostolidi, Maria; Li, Shuang; Lamprinou, Katerina; Papakyriakou, Athanasios; Zhang, Jinwei; Stathopoulos, Constantinos
2017-09-29
Recently, it was discovered that exposure to mainstream antibiotics activate numerous bacterial riboregulators that control antibiotic resistance genes including metabolite-binding riboswitches and other transcription attenuators. However, the effects of commonly used antibiotics, many of which exhibit RNA-binding properties, on the widespread T-box riboswitches, remain unknown. In Staphylococcus aureus, a species-specific glyS T-box controls the supply of glycine for both ribosomal translation and cell wall synthesis, making it a promising target for next-generation antimicrobials. Here, we report that specific protein synthesis inhibitors could either significantly increase T-box-mediated transcription antitermination, while other compounds could suppress it, both in vitro and in vivo. In-line probing of the full-length T-box combined with molecular modelling and docking analyses suggest that the antibiotics that promote transcription antitermination stabilize the T-box:tRNA complex through binding specific positions on stem I and the Staphylococcal-specific stem Sa. By contrast, the antibiotics that attenuate T-box transcription bind to other positions on stem I and do not interact with stem Sa. Taken together, our results reveal that the transcription of essential genes controlled by T-box riboswitches can be directly modulated by commonly used protein synthesis inhibitors. These findings accentuate the regulatory complexities of bacterial response to antimicrobials that involve multiple riboregulators. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Wiegand, Sandra; Dietrich, Sascha; Hertel, Robert; Bongaerts, Johannes; Evers, Stefan; Volland, Sonja; Daniel, Rolf; Liesegang, Heiko
2013-10-01
The production of enzymes by an industrial strain requires a complex adaption of the bacterial metabolism to the conditions within the fermenter. Regulatory events within the process result in a dynamic change of the transcriptional activity of the genome. This complex network of genes is orchestrated by proteins as well as regulatory RNA elements. Here we present an RNA-Seq based study considering selected phases of an industry-oriented fermentation of Bacillus licheniformis. A detailed analysis of 20 strand-specific RNA-Seq datasets revealed a multitude of transcriptionally active genomic regions. 3314 RNA features encoded by such active loci have been identified and sorted into ten functional classes. The identified sequences include the expected RNA features like housekeeping sRNAs, metabolic riboswitches and RNA switches well known from studies on Bacillus subtilis as well as a multitude of completely new candidates for regulatory RNAs. An unexpectedly high number of 855 RNA features are encoded antisense to annotated protein and RNA genes, in addition to 461 independently transcribed small RNAs. These antisense transcripts contain molecules with a remarkable size range variation from 38 to 6348 base pairs in length. The genome of the type strain B. licheniformis DSM13 was completely reannotated using data obtained from RNA-Seq analyses and from public databases. The hereby generated data-sets represent a solid amount of knowledge on the dynamic transcriptional activities during the investigated fermentation stages. The identified regulatory elements enable research on the understanding and the optimization of crucial metabolic activities during a productive fermentation of Bacillus licheniformis strains.
Vastano, Valeria; Perrone, Filomena; Marasco, Rosangela; Sacco, Margherita; Muscariello, Lidia
2016-04-01
Exopolysaccharides (EPS) from lactic acid bacteria contribute to specific rheology and texture of fermented milk products and find applications also in non-dairy foods and in therapeutics. Recently, four clusters of genes (cps) associated with surface polysaccharide production have been identified in Lactobacillus plantarum WCFS1, a probiotic and food-associated lactobacillus. These clusters are involved in cell surface architecture and probably in release and/or exposure of immunomodulating bacterial molecules. Here we show a transcriptional analysis of these clusters. Indeed, RT-PCR experiments revealed that the cps loci are organized in five operons. Moreover, by reverse transcription-qPCR analysis performed on L. plantarum WCFS1 (wild type) and WCFS1-2 (ΔccpA), we demonstrated that expression of three cps clusters is under the control of the global regulator CcpA. These results, together with the identification of putative CcpA target sequences (catabolite responsive element CRE) in the regulatory region of four out of five transcriptional units, strongly suggest for the first time a role of the master regulator CcpA in EPS gene transcription among lactobacilli.
2012-01-01
Background The potential contribution of upstream sequence variation to the unique features of orthologous genes is just beginning to be unraveled. A core subset of stress-associated bZIP transcription factors from rice (Oryza sativa) formed ten clusters of orthologous groups (COG) with genes from the monocot sorghum (Sorghum bicolor) and dicot Arabidopsis (Arabidopsis thaliana). The total cis-regulatory information content of each stress-associated COG was examined by phylogenetic footprinting to reveal ortholog-specific, lineage-specific and species-specific conservation patterns. Results The most apparent pattern observed was the occurrence of spatially conserved ‘core modules’ among the COGs but not among paralogs. These core modules are comprised of various combinations of two to four putative transcription factor binding site (TFBS) classes associated with either developmental or stress-related functions. Outside the core modules are specific stress (ABA, oxidative, abiotic, biotic) or organ-associated signals, which may be functioning as ‘regulatory fine-tuners’ and further define lineage-specific and species-specific cis-regulatory signatures. Orthologous monocot and dicot promoters have distinct TFBS classes involved in disease and oxidative-regulated expression, while the orthologous rice and sorghum promoters have distinct combinations of root-specific signals, a pattern that is not particularly conserved in Arabidopsis. Conclusions Patterns of cis-regulatory conservation imply that each ortholog has distinct signatures, further suggesting that they are potentially unique in a regulatory context despite the presumed conservation of broad biological function during speciation. Based on the observed patterns of conservation, we postulate that core modules are likely primary determinants of basal developmental programming, which may be integrated with and further elaborated by additional intrinsic or extrinsic signals in conjunction with lineage
A transcription activator-like effector induction system mediated by proteolysis
Copeland, Matthew F.; Politz, Mark C.; Johnson, Charles B.; Markley, Andrew L.; Pfleger, Brian F.
2016-01-01
Simple and predictable trans-acting regulatory tools are needed in the fields of synthetic biology and metabolic engineering to build complex genetic circuits and optimize the levels of native and heterologous gene products. Transcription activator-like effectors (TALEs) are bacterial virulence factors that have recently gained traction in biotechnology applications due to their customizable DNA binding specificity. In this work we expand the versatility of these transcription factors to create an inducible TALE system by inserting tobacco-etch virus (TEV) protease recognition sites into the TALE backbone. The resulting engineered TALEs maintain transcriptional repression of their target genes in Escherichia coli, but are degraded following the induction of the TEV protease, thereby promoting expression of the previously repressed target gene of interest. This TALE-TEV technology enables both repression and induction of plasmid or chromosomal target genes in a manner analogous to traditional repressor proteins but with the added flexibility of being operator agnostic. PMID:26854666
Elucidating the role of transcription in shaping the 3D structure of the bacterial genome
NASA Astrophysics Data System (ADS)
Brandao, Hugo B.; Wang, Xindan; Rudner, David Z.; Mirny, Leonid
Active transcription has been linked to several genome conformation changes in bacteria, including the recruitment of chromosomal DNA to the cell membrane and formation of nucleoid clusters. Using genomic and imaging data as input into mathematical models and polymer simulations, we sought to explore the extent to which bacterial 3D genome structure could be explained by 1D transcription tracks. Using B. subtilis as a model organism, we investigated via polymer simulations the role of loop extrusion and DNA super-coiling on the formation of interaction domains and other fine-scale features that are visible in chromosome conformation capture (Hi-C) data. We then explored the role of the condensin structural maintenance of chromosome complex on the alignment of chromosomal arms. A parameter-free transcription traffic model demonstrated that mean chromosomal arm alignment can be quantitatively explained, and the effects on arm alignment in genomically rearranged strains of B. subtilis were accurately predicted. H.B. acknowledges support from the Natural Sciences and Engineering Research Council of Canada for a PGS-D fellowship.
Bisognin, Andrea; Sales, Gabriele; Coppe, Alessandro; Bortoluzzi, Stefania; Romualdi, Chiara
2012-01-01
MAGIA2 (http://gencomp.bio.unipd.it/magia2) is an update, extension and evolution of the MAGIA web tool. It is dedicated to the integrated analysis of in silico target prediction, microRNA (miRNA) and gene expression data for the reconstruction of post-transcriptional regulatory networks. miRNAs are fundamental post-transcriptional regulators of several key biological and pathological processes. As miRNAs act prevalently through target degradation, their expression profiles are expected to be inversely correlated to those of the target genes. Low specificity of target prediction algorithms makes integration approaches an interesting solution for target prediction refinement. MAGIA2 performs this integrative approach supporting different association measures, multiple organisms and almost all target predictions algorithms. Nevertheless, miRNAs activity should be viewed as part of a more complex scenario where regulatory elements and their interactors generate a highly connected network and where gene expression profiles are the result of different levels of regulation. The updated MAGIA2 tries to dissect this complexity by reconstructing mixed regulatory circuits involving either miRNA or transcription factor (TF) as regulators. Two types of circuits are identified: (i) a TF that regulates both a miRNA and its target and (ii) a miRNA that regulates both a TF and its target. PMID:22618880
Transcriptional regulation of metabolism in disease: From transcription factors to epigenetics
2018-01-01
Every cell in an individual has largely the same genomic sequence and yet cells in different tissues can present widely different phenotypes. This variation arises because each cell expresses a specific subset of genomic instructions. Control over which instructions, or genes, are expressed is largely controlled by transcriptional regulatory pathways. Each cell must assimilate a huge amount of environmental input, and thus it is of no surprise that transcription is regulated by many intertwining mechanisms. This large regulatory landscape means there are ample possibilities for problems to arise, which in a medical context means the development of disease states. Metabolism within the cell, and more broadly, affects and is affected by transcriptional regulation. Metabolism can therefore contribute to improper transcriptional programming, or pathogenic metabolism can be the result of transcriptional dysregulation. Here, we discuss the established and emerging mechanisms for controling transcription and how they affect metabolism in the context of pathogenesis. Cis- and trans-regulatory elements, microRNA and epigenetic mechanisms such as DNA and histone methylation, all have input into what genes are transcribed. Each has also been implicated in diseases such as metabolic syndrome, various forms of diabetes, and cancer. In this review, we discuss the current understanding of these areas and highlight some natural models that may inspire future therapeutics. PMID:29922517
Gu, Jinghua; Xuan, Jianhua; Riggins, Rebecca B.; Chen, Li; Wang, Yue; Clarke, Robert
2012-01-01
Motivation: Identification of transcriptional regulatory networks (TRNs) is of significant importance in computational biology for cancer research, providing a critical building block to unravel disease pathways. However, existing methods for TRN identification suffer from the inclusion of excessive ‘noise’ in microarray data and false-positives in binding data, especially when applied to human tumor-derived cell line studies. More robust methods that can counteract the imperfection of data sources are therefore needed for reliable identification of TRNs in this context. Results: In this article, we propose to establish a link between the quality of one target gene to represent its regulator and the uncertainty of its expression to represent other target genes. Specifically, an outlier sum statistic was used to measure the aggregated evidence for regulation events between target genes and their corresponding transcription factors. A Gibbs sampling method was then developed to estimate the marginal distribution of the outlier sum statistic, hence, to uncover underlying regulatory relationships. To evaluate the effectiveness of our proposed method, we compared its performance with that of an existing sampling-based method using both simulation data and yeast cell cycle data. The experimental results show that our method consistently outperforms the competing method in different settings of signal-to-noise ratio and network topology, indicating its robustness for biological applications. Finally, we applied our method to breast cancer cell line data and demonstrated its ability to extract biologically meaningful regulatory modules related to estrogen signaling and action in breast cancer. Availability and implementation: The Gibbs sampler MATLAB package is freely available at http://www.cbil.ece.vt.edu/software.htm. Contact: xuan@vt.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:22595208
Gonçalves, Joana P; Aires, Ricardo S; Francisco, Alexandre P; Madeira, Sara C
2012-01-01
Explaining regulatory mechanisms is crucial to understand complex cellular responses leading to system perturbations. Some strategies reverse engineer regulatory interactions from experimental data, while others identify functional regulatory units (modules) under the assumption that biological systems yield a modular organization. Most modular studies focus on network structure and static properties, ignoring that gene regulation is largely driven by stimulus-response behavior. Expression time series are key to gain insight into dynamics, but have been insufficiently explored by current methods, which often (1) apply generic algorithms unsuited for expression analysis over time, due to inability to maintain the chronology of events or incorporate time dependency; (2) ignore local patterns, abundant in most interesting cases of transcriptional activity; (3) neglect physical binding or lack automatic association of regulators, focusing mainly on expression patterns; or (4) limit the discovery to a predefined number of modules. We propose Regulatory Snapshots, an integrative mining approach to identify regulatory modules over time by combining transcriptional control with response, while overcoming the above challenges. Temporal biclustering is first used to reveal transcriptional modules composed of genes showing coherent expression profiles over time. Personalized ranking is then applied to prioritize prominent regulators targeting the modules at each time point using a network of documented regulatory associations and the expression data. Custom graphics are finally depicted to expose the regulatory activity in a module at consecutive time points (snapshots). Regulatory Snapshots successfully unraveled modules underlying yeast response to heat shock and human epithelial-to-mesenchymal transition, based on regulations documented in the YEASTRACT and JASPAR databases, respectively, and available expression data. Regulatory players involved in functionally enriched
Gonçalves, Joana P.; Aires, Ricardo S.; Francisco, Alexandre P.; Madeira, Sara C.
2012-01-01
Explaining regulatory mechanisms is crucial to understand complex cellular responses leading to system perturbations. Some strategies reverse engineer regulatory interactions from experimental data, while others identify functional regulatory units (modules) under the assumption that biological systems yield a modular organization. Most modular studies focus on network structure and static properties, ignoring that gene regulation is largely driven by stimulus-response behavior. Expression time series are key to gain insight into dynamics, but have been insufficiently explored by current methods, which often (1) apply generic algorithms unsuited for expression analysis over time, due to inability to maintain the chronology of events or incorporate time dependency; (2) ignore local patterns, abundant in most interesting cases of transcriptional activity; (3) neglect physical binding or lack automatic association of regulators, focusing mainly on expression patterns; or (4) limit the discovery to a predefined number of modules. We propose Regulatory Snapshots, an integrative mining approach to identify regulatory modules over time by combining transcriptional control with response, while overcoming the above challenges. Temporal biclustering is first used to reveal transcriptional modules composed of genes showing coherent expression profiles over time. Personalized ranking is then applied to prioritize prominent regulators targeting the modules at each time point using a network of documented regulatory associations and the expression data. Custom graphics are finally depicted to expose the regulatory activity in a module at consecutive time points (snapshots). Regulatory Snapshots successfully unraveled modules underlying yeast response to heat shock and human epithelial-to-mesenchymal transition, based on regulations documented in the YEASTRACT and JASPAR databases, respectively, and available expression data. Regulatory players involved in functionally enriched
Yao, Yongpeng; Li, Shanshan; Cao, Jiaqian; Liu, Weiwei; Fan, Keqiang; Xiang, Wensheng; Yang, Keqian; Kong, Deming; Wang, Weishan
2018-05-08
Here, we demonstrate an easy-to-implement and general biosensing strategy by coupling the small-molecule recognition of the bacterial allosteric transcription factor (aTF) with isothermal strand displacement amplification (SDA) in vitro. Based on this strategy, we developed two biosensors for the detection of an antiseptic, p-hydroxybenzoic acid, and a disease marker, uric acid, using bacterial aTF HosA and HucR, respectively, highlighting the great potential of this strategy for the development of small-molecule biosensors.
Dubois, Laurence; Bataillé, Laetitia; Painset, Anaïs; Le Gras, Stéphanie; Jost, Bernard; Crozatier, Michèle; Vincent, Alain
2015-01-01
Collier, the single Drosophila COE (Collier/EBF/Olf-1) transcription factor, is required in several developmental processes, including head patterning and specification of muscle and neuron identity during embryogenesis. To identify direct Collier (Col) targets in different cell types, we used ChIP-seq to map Col binding sites throughout the genome, at mid-embryogenesis. In vivo Col binding peaks were associated to 415 potential direct target genes. Gene Ontology analysis revealed a strong enrichment in proteins with DNA binding and/or transcription-regulatory properties. Characterization of a selection of candidates, using transgenic CRM-reporter assays, identified direct Col targets in dorso-lateral somatic muscles and specific neuron types in the central nervous system. These data brought new evidence that Col direct control of the expression of the transcription regulators apterous and eyes-absent (eya) is critical to specifying neuronal identities. They also showed that cross-regulation between col and eya in muscle progenitor cells is required for specification of muscle identity, revealing a new parallel between the myogenic regulatory networks operating in Drosophila and vertebrates. Col regulation of eya, both in specific muscle and neuronal lineages, may illustrate one mechanism behind the evolutionary diversification of Col biological roles. PMID:26204530
Suciu, Maria C.; Telenius, Jelena
2017-01-01
In the era of genome-wide association studies (GWAS) and personalized medicine, predicting the impact of single nucleotide polymorphisms (SNPs) in regulatory elements is an important goal. Current approaches to determine the potential of regulatory SNPs depend on inadequate knowledge of cell-specific DNA binding motifs. Here, we present Sasquatch, a new computational approach that uses DNase footprint data to estimate and visualize the effects of noncoding variants on transcription factor binding. Sasquatch performs a comprehensive k-mer-based analysis of DNase footprints to determine any k-mer's potential for protein binding in a specific cell type and how this may be changed by sequence variants. Therefore, Sasquatch uses an unbiased approach, independent of known transcription factor binding sites and motifs. Sasquatch only requires a single DNase-seq data set per cell type, from any genotype, and produces consistent predictions from data generated by different experimental procedures and at different sequence depths. Here we demonstrate the effectiveness of Sasquatch using previously validated functional SNPs and benchmark its performance against existing approaches. Sasquatch is available as a versatile webtool incorporating publicly available data, including the human ENCODE collection. Thus, Sasquatch provides a powerful tool and repository for prioritizing likely regulatory SNPs in the noncoding genome. PMID:28904015
Gundogdu, Ozan; da Silva, Daiani T; Mohammad, Banaz; Elmi, Abdi; Mills, Dominic C; Wren, Brendan W; Dorrell, Nick
2015-01-01
The ability of the human intestinal pathogen Campylobacter jejuni to respond to oxidative stress is central to bacterial survival both in vivo during infection and in the environment. Re-annotation of the C. jejuni NCTC11168 genome revealed the presence of two MarR-type transcriptional regulators Cj1546 and Cj1556, originally annotated as hypothetical proteins, which we have designated RrpA and RrpB (regulator of response to peroxide) respectively. Previously we demonstrated a role for RrpB in both oxidative and aerobic (O2) stress and that RrpB was a DNA binding protein with auto-regulatory activity, typical of MarR-type transcriptional regulators. In this study, we show that RrpA is also a DNA binding protein and that a rrpA mutant in strain 11168H exhibits increased sensitivity to hydrogen peroxide oxidative stress. Mutation of either rrpA or rrpB reduces catalase (KatA) expression. However, a rrpAB double mutant exhibits higher levels of resistance to hydrogen peroxide oxidative stress, with levels of KatA expression similar to the wild-type strain. Mutation of either rrpA or rrpB also results in a reduction in the level of katA expression, but this reduction was not observed in the rrpAB double mutant. Neither the rrpA nor rrpB mutant exhibits any significant difference in sensitivity to either cumene hydroperoxide or menadione oxidative stresses, but both mutants exhibit a reduced ability to survive aerobic (O2) stress, enhanced biofilm formation and reduced virulence in the Galleria mellonella infection model. The rrpAB double mutant exhibits wild-type levels of biofilm formation and wild-type levels of virulence in the G mellonella infection model. Together these data indicate a role for both RrpA and RrpB in the C. jejuni peroxide oxidative and aerobic (O2) stress responses, enhancing bacterial survival in vivo and in the environment.
A transcription activator-like effector (TALE) induction system mediated by proteolysis.
Copeland, Matthew F; Politz, Mark C; Johnson, Charles B; Markley, Andrew L; Pfleger, Brian F
2016-04-01
Simple and predictable trans-acting regulatory tools are needed in the fields of synthetic biology and metabolic engineering to build complex genetic circuits and optimize the levels of native and heterologous gene products. Transcription activator-like effectors (TALEs) are bacterial virulence factors that have recently gained traction in biotechnology applications owing to their customizable DNA-binding specificity. In this work we expanded the versatility of these transcription factors to create an inducible TALE system by inserting tobacco-etch virus (TEV) protease recognition sites into the TALE backbone. The resulting engineered TALEs maintain transcriptional repression of their target genes in Escherichia coli, but are degraded after induction of the TEV protease, thereby promoting expression of the previously repressed target gene of interest. This TALE-TEV technology enables both repression and induction of plasmid or chromosomal target genes in a manner analogous to traditional repressor proteins but with the added flexibility of being operator-agnostic.
Abdulrehman, Dário; Monteiro, Pedro Tiago; Teixeira, Miguel Cacho; Mira, Nuno Pereira; Lourenço, Artur Bastos; dos Santos, Sandra Costa; Cabrito, Tânia Rodrigues; Francisco, Alexandre Paulo; Madeira, Sara Cordeiro; Aires, Ricardo Santos; Oliveira, Arlindo Limede; Sá-Correia, Isabel; Freitas, Ana Teresa
2011-01-01
The YEAst Search for Transcriptional Regulators And Consensus Tracking (YEASTRACT) information system (http://www.yeastract.com) was developed to support the analysis of transcription regulatory associations in Saccharomyces cerevisiae. Last updated in June 2010, this database contains over 48 200 regulatory associations between transcription factors (TFs) and target genes, including 298 specific DNA-binding sites for 110 characterized TFs. All regulatory associations stored in the database were revisited and detailed information on the experimental evidences that sustain those associations was added and classified as direct or indirect evidences. The inclusion of this new data, gathered in response to the requests of YEASTRACT users, allows the user to restrict its queries to subsets of the data based on the existence or not of experimental evidences for the direct action of the TFs in the promoter region of their target genes. Another new feature of this release is the availability of all data through a machine readable web-service interface. Users are no longer restricted to the set of available queries made available through the existing web interface, and can use the web service interface to query, retrieve and exploit the YEASTRACT data using their own implementation of additional functionalities. The YEASTRACT information system is further complemented with several computational tools that facilitate the use of the curated data when answering a number of important biological questions. Since its first release in 2006, YEASTRACT has been extensively used by hundreds of researchers from all over the world. We expect that by making the new data and services available, the system will continue to be instrumental for yeast biologists and systems biology researchers. PMID:20972212
Aziz, Ramy K.; Kansal, Rita; Aronow, Bruce J.; Taylor, William L.; Rowe, Sarah L.; Kubal, Michael; Chhatwal, Gursharan S.; Walker, Mark J.; Kotb, Malak
2010-01-01
The onset of infection and the switch from primary to secondary niches are dramatic environmental changes that not only alter bacterial transcriptional programs, but also perturb their sociomicrobiology, often driving minor subpopulations with mutant phenotypes to prevail in specific niches. Having previously reported that M1T1 Streptococcus pyogenes become hypervirulent in mice due to selection of mutants in the covRS regulatory genes, we set out to dissect the impact of these mutations in vitro and in vivo from the impact of other adaptive events. Using a murine subcutaneous chamber model to sample the bacteria prior to selection or expansion of mutants, we compared gene expression dynamics of wild type (WT) and previously isolated animal-passaged (AP) covS mutant bacteria both in vitro and in vivo, and we found extensive transcriptional alterations of pathoadaptive and metabolic gene sets associated with invasion, immune evasion, tissue-dissemination, and metabolic reprogramming. In contrast to the virulence-associated differences between WT and AP bacteria, Phenotype Microarray analysis showed minor in vitro phenotypic differences between the two isogenic variants. Additionally, our results reflect that WT bacteria's rapid host-adaptive transcriptional reprogramming was not sufficient for their survival, and they were outnumbered by hypervirulent covS mutants with SpeB−/Sdahigh phenotype, which survived up to 14 days in mice chambers. Our findings demonstrate the engagement of unique regulatory modules in niche adaptation, implicate a critical role for bacterial genetic heterogeneity that surpasses transcriptional in vivo adaptation, and portray the dynamics underlying the selection of hypervirulent covS mutants over their parental WT cells. PMID:20418946
Bacterial RNA Biology on a Genome Scale.
Hör, Jens; Gorski, Stanislaw A; Vogel, Jörg
2018-06-07
Bacteria are an exceedingly diverse group of organisms whose molecular exploration is experiencing a renaissance. While the classical view of bacterial gene expression was relatively simple, the emerging view is more complex, encompassing extensive post-transcriptional control involving riboswitches, RNA thermometers, and regulatory small RNAs (sRNAs) associated with the RNA-binding proteins CsrA, Hfq, and ProQ, as well as CRISPR/Cas systems that are programmed by RNAs. Moreover, increasing interest in members of the human microbiota and environmental microbial communities has highlighted the importance of understudied bacterial species with largely unknown transcriptome structures and RNA-based control mechanisms. Collectively, this creates a need for global RNA biology approaches that can rapidly and comprehensively analyze the RNA composition of a bacterium of interest. We review such approaches with a focus on RNA-seq as a versatile tool to investigate the different layers of gene expression in which RNA is made, processed, regulated, modified, translated, and turned over. Copyright © 2017 Elsevier Inc. All rights reserved.
Brown, Tanya; Bourne, David; Rodriguez-Lanetty, Mauricio
2013-01-01
The impact of disease outbreaks on coral physiology represents an increasing concern for the fitness and resilience of reef ecosystems. Predicting the tolerance of corals to disease relies on an understanding of the coral immune response to pathogenic interactions. This study explored the transcriptional response of two putative immune genes (c3 and c-type lectin) and one stress response gene (hsp70) in the reef building coral, Acropora millepora challenged for 48 hours with bacterial strains, Vibrio coralliilyticus and Alteromonas sp. at concentrations of 106 cells ml-1. Coral fragments challenged with V. coralliilyticus appeared healthy while fragments challenged with Alteromonas sp. showed signs of tissue lesions after 48 hr. Coral-associated bacterial community profiles assessed using denaturing gradient gel electrophoresis changed after challenge by both bacterial strains with the Alteromonas sp. treatment demonstrating the greatest community shift. Transcriptional profiles of c3 and hsp70 increased at 24 hours and correlated with disease signs in the Alteromonas sp. treatment. The expression of hsp70 also showed a significant increase in V. coralliilyticus inoculated corals at 24 h suggesting that even in the absence of disease signs, the microbial inoculum activated a stress response in the coral. C-type lectin did not show a response to any of the bacterial treatments. Increase in gene expression of c3 and hsp70 in corals showing signs of disease indicates their potential involvement in immune and stress response to microbial challenges. PMID:23861754
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rodionov, Dmitry A.; Dubchak, Inna L.; Arkin, Adam P.
2005-09-01
Bacterial response to nitric oxide (NO) is of major importance since NO is an obligatory intermediate of the nitrogen cycle. Transcriptional regulation of the dissimilatory nitric oxides metabolism in bacteria is diverse and involves FNR-like transcription factors HcpR, DNR and NnrR, two-component systems NarXL and NarQP, NO-responsive activator NorR, and nitrite sensitive repressor NsrR. Using comparative genomics approaches we predict DNA-binding signals for these transcriptional factors and describe corresponding regulons in available bacterial genomes. Within the FNR family of regulators, we observed a correlation of two specificity-determining amino acids and contacting bases in corresponding DNA signal. Highly conserved regulon HcpRmore » for the hybrid cluster protein and some other redox enzymes is present in diverse anaerobic bacteria including Clostridia, Thermotogales and delta-proteobacteria. NnrR and DNR control denitrification in alpha- and beta-proteobacteria, respectively. Sigma-54-dependent NorR regulon found in some gamma- and beta-proteobacteria contains various enzymes involved in the NO detoxification. Repressor NsrR, which was previously known to control only nitrite reductase operon in Nitrosomonas spp., appears to be the master regulator of the nitric oxides metabolism not only in most gamma- and beta-proteobacteria (including well-studied species like Escherichia coli), but also in Gram-positive Bacillus and Streptomyces species. Positional analysis and comparison of regulatory regions of NO detoxification genes allows us to propose the candidate NsrR-binding signal. The most conserved member of the predicted NsrR regulon is the NO-detoxifying flavohemoglobin Hmp. In enterobacteria, the regulon includes also two nitrite-responsive loci, nipAB (hcp-hcr) and nipC(dnrN), thus confirming the identity of the effector, i.e., nitrite. The proposed NsrR regulons in Neisseria and some other species are extended to include denitrification genes. As
Jin, Erqing; Wong, Lynn; Jiao, Yun; Engel, Jake; Holdridge, Benjamin; Xu, Peng
2017-12-01
Engineering cell factories for producing biofuels and pharmaceuticals has spurred great interests to develop rapid and efficient synthetic biology tools customized for modular pathway engineering. Along the way, combinatorial gene expression control through modification of regulatory element offered tremendous opportunity for fine-tuning gene expression and generating digital-like genetic circuits. In this report, we present an efficient evolutionary approach to build a range of regulatory control elements. The reported method allows for rapid construction of promoter, 5'UTR, terminator and trans -activating RNA libraries. Synthetic overlapping oligos with high portion of degenerate nucleotides flanking the regulatory element could be efficiently assembled to a vector expressing fluorescence reporter. This approach combines high mutation rate of the synthetic DNA with the high assembly efficiency of Gibson Mix. Our constructed library demonstrates broad range of transcriptional or translational gene expression dynamics. Specifically, both the promoter library and 5'UTR library exhibits gene expression dynamics spanning across three order of magnitude. The terminator library and trans -activating RNA library displays relatively narrowed gene expression pattern. The reported study provides a versatile toolbox for rapidly constructing a large family of prokaryotic regulatory elements. These libraries also facilitate the implementation of combinatorial pathway engineering principles and the engineering of more efficient microbial cell factory for various biomanufacturing applications.
PlantTFDB 4.0: toward a central hub for transcription factors and regulatory interactions in plants.
Jin, Jinpu; Tian, Feng; Yang, De-Chang; Meng, Yu-Qi; Kong, Lei; Luo, Jingchu; Gao, Ge
2017-01-04
With the goal of providing a comprehensive, high-quality resource for both plant transcription factors (TFs) and their regulatory interactions with target genes, we upgraded plant TF database PlantTFDB to version 4.0 (http://planttfdb.cbi.pku.edu.cn/). In the new version, we identified 320 370 TFs from 165 species, presenting a more comprehensive genomic TF repertoires of green plants. Besides updating the pre-existing abundant functional and evolutionary annotation for identified TFs, we generated three new types of annotation which provide more directly clues to investigate functional mechanisms underlying: (i) a set of high-quality, non-redundant TF binding motifs derived from experiments; (ii) multiple types of regulatory elements identified from high-throughput sequencing data; (iii) regulatory interactions curated from literature and inferred by combining TF binding motifs and regulatory elements. In addition, we upgraded previous TF prediction server, and set up four novel tools for regulation prediction and functional enrichment analyses. Finally, we set up a novel companion portal PlantRegMap (http://plantregmap.cbi.pku.edu.cn) for users to access the regulation resource and analysis tools conveniently. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Schwessinger, Ron; Suciu, Maria C; McGowan, Simon J; Telenius, Jelena; Taylor, Stephen; Higgs, Doug R; Hughes, Jim R
2017-10-01
In the era of genome-wide association studies (GWAS) and personalized medicine, predicting the impact of single nucleotide polymorphisms (SNPs) in regulatory elements is an important goal. Current approaches to determine the potential of regulatory SNPs depend on inadequate knowledge of cell-specific DNA binding motifs. Here, we present Sasquatch, a new computational approach that uses DNase footprint data to estimate and visualize the effects of noncoding variants on transcription factor binding. Sasquatch performs a comprehensive k -mer-based analysis of DNase footprints to determine any k -mer's potential for protein binding in a specific cell type and how this may be changed by sequence variants. Therefore, Sasquatch uses an unbiased approach, independent of known transcription factor binding sites and motifs. Sasquatch only requires a single DNase-seq data set per cell type, from any genotype, and produces consistent predictions from data generated by different experimental procedures and at different sequence depths. Here we demonstrate the effectiveness of Sasquatch using previously validated functional SNPs and benchmark its performance against existing approaches. Sasquatch is available as a versatile webtool incorporating publicly available data, including the human ENCODE collection. Thus, Sasquatch provides a powerful tool and repository for prioritizing likely regulatory SNPs in the noncoding genome. © 2017 Schwessinger et al.; Published by Cold Spring Harbor Laboratory Press.
Schuster, Christoph; Gaillochet, Christophe; Medzihradszky, Anna; Busch, Wolfgang; Daum, Gabor; Krebs, Melanie; Kehle, Andreas; Lohmann, Jan U
2014-02-24
Plants continuously maintain pluripotent stem cells embedded in specialized tissues called meristems, which drive long-term growth and organogenesis. Stem cell fate in the shoot apical meristem (SAM) is controlled by the homeodomain transcription factor WUSCHEL (WUS) expressed in the niche adjacent to the stem cells. Here, we demonstrate that the bHLH transcription factor HECATE1 (HEC1) is a target of WUS and that it contributes to SAM function by promoting stem cell proliferation, while antagonizing niche cell activity. HEC1 represses the stem cell regulators WUS and CLAVATA3 (CLV3) and, like WUS, controls genes with functions in metabolism and hormone signaling. Among the targets shared by HEC1 and WUS are phytohormone response regulators, which we show to act as mobile signals in a universal feedback system. Thus, our work sheds light on the mechanisms guiding meristem function and suggests that the underlying regulatory system is far more complex than previously anticipated. Copyright © 2014 Elsevier Inc. All rights reserved.
The Yersinia pestis gcvB gene encodes two small regulatory RNA molecules
McArthur, Sarah D; Pulvermacher, Sarah C; Stauffer, George V
2006-01-01
Background In recent years it has become clear that small non-coding RNAs function as regulatory elements in bacterial virulence and bacterial stress responses. We tested for the presence of the small non-coding GcvB RNAs in Y. pestis as possible regulators of gene expression in this organism. Results In this study, we report that the Yersinia pestis KIM6 gcvB gene encodes two small RNAs. Transcription of gcvB is activated by the GcvA protein and repressed by the GcvR protein. The gcvB-encoded RNAs are required for repression of the Y. pestis dppA gene, encoding the periplasmic-binding protein component of the dipeptide transport system, showing that the GcvB RNAs have regulatory activity. A deletion of the gcvB gene from the Y. pestis KIM6 chromosome results in a decrease in the generation time of the organism as well as a change in colony morphology. Conclusion The results of this study indicate that the Y. pestis gcvB gene encodes two small non-coding regulatory RNAs that repress dppA expression. A gcvB deletion is pleiotropic, suggesting that the sRNAs are likely involved in controlling genes in addition to dppA. PMID:16768793
Conservation of lipid metabolic gene transcriptional regulatory networks in fish and mammals.
Carmona-Antoñanzas, Greta; Tocher, Douglas R; Martinez-Rubio, Laura; Leaver, Michael J
2014-01-15
Lipid content and composition in aquafeeds have changed rapidly as a result of the recent drive to replace ecologically limited marine ingredients, fishmeal and fish oil (FO). Terrestrial plant products are the most economic and sustainable alternative; however, plant meals and oils are devoid of physiologically important cholesterol and long-chain polyunsaturated fatty acids (LC-PUFA), eicosapentaenoic (EPA), docosahexaenoic (DHA) and arachidonic (ARA) acids. Although replacement of dietary FO with vegetable oil (VO) has little effect on growth in Atlantic salmon (Salmo salar), several studies have shown major effects on the activity and expression of genes involved in lipid homeostasis. In vertebrates, sterols and LC-PUFA play crucial roles in lipid metabolism by direct interaction with lipid-sensing transcription factors (TFs) and consequent regulation of target genes. The primary aim of the present study was to elucidate the role of key TFs in the transcriptional regulation of lipid metabolism in fish by transfection and overexpression of TFs. The results show that the expression of genes of LC-PUFA biosynthesis (elovl and fads2) and cholesterol metabolism (abca1) are regulated by Lxr and Srebp TFs in salmon, indicating highly conserved regulatory mechanism across vertebrates. In addition, srebp1 and srebp2 mRNA respond to replacement of dietary FO with VO. Thus, Atlantic salmon adjust lipid metabolism in response to dietary lipid composition through the transcriptional regulation of gene expression. It may be possible to further increase efficient and effective use of sustainable alternatives to marine products in aquaculture by considering these important molecular interactions when formulating diets. © 2013.
Engineering an allosteric transcription factor to respond to new ligands.
Taylor, Noah D; Garruss, Alexander S; Moretti, Rocco; Chan, Sum; Arbing, Mark A; Cascio, Duilio; Rogers, Jameson K; Isaacs, Farren J; Kosuri, Sriram; Baker, David; Fields, Stanley; Church, George M; Raman, Srivatsan
2016-02-01
Genetic regulatory proteins inducible by small molecules are useful synthetic biology tools as sensors and switches. Bacterial allosteric transcription factors (aTFs) are a major class of regulatory proteins, but few aTFs have been redesigned to respond to new effectors beyond natural aTF-inducer pairs. Altering inducer specificity in these proteins is difficult because substitutions that affect inducer binding may also disrupt allostery. We engineered an aTF, the Escherichia coli lac repressor, LacI, to respond to one of four new inducer molecules: fucose, gentiobiose, lactitol and sucralose. Using computational protein design, single-residue saturation mutagenesis or random mutagenesis, along with multiplex assembly, we identified new variants comparable in specificity and induction to wild-type LacI with its inducer, isopropyl β-D-1-thiogalactopyranoside (IPTG). The ability to create designer aTFs will enable applications including dynamic control of cell metabolism, cell biology and synthetic gene circuits.
Cerveau, Nicolas; Gilbert, Clément; Liu, Chao; Garrett, Roger A; Grève, Pierre; Bouchon, Didier; Cordaux, Richard
2015-06-10
Transposable elements (TEs) are DNA pieces that are present in almost all the living world at variable genomic density. Due to their mobility and density, TEs are involved in a large array of genomic modifications. In eukaryotes, TE expression has been studied in detail in several species. In prokaryotes, studies of IS expression are generally linked to particular copies that induce a modification of neighboring gene expression. Here we investigated global patterns of IS transcription in the Alphaproteobacterial endosymbiont Wolbachia wVulC, using both RT-PCR and bioinformatic analyses. We detected several transcriptional promoters in all IS groups. Nevertheless, only one of the potentially functional IS groups possesses a promoter located upstream of the transposase gene, that could lead up to the production of a functional protein. We found that the majority of IS groups are expressed whatever their functional status. RT-PCR analyses indicate that the transcription of two IS groups lacking internal promoters upstream of the transposase start codon may be driven by the genomic environment. We confirmed this observation with the transcription analysis of individual copies of one IS group. These results suggest that the genomic environment is important for IS expression and it could explain, at least partly, copy number variability of the various IS groups present in the wVulC genome and, more generally, in bacterial genomes. Copyright © 2015 Elsevier B.V. All rights reserved.
Africa, Lia A. A.; Murphy, Erin R.; Egan, Nicholas R.; Wigley, Amanda F.; Wing, Helen J.
2011-01-01
Actin-based motility is central to the pathogenicity of the intracellular bacterial pathogen Shigella. Two Shigella outer membrane proteins, IcsA and IcsP, are required for efficient actin-based motility in the host cell cytoplasm, and the genes encoding both proteins are carried on the large virulence plasmid. IcsA triggers actin polymerization on the surface of the bacterium, leading to the formation of an actin tail that allows both intra- and intercellular spread. IcsP, an outer membrane protease, modulates the amount and distribution of the IcsA protein on the bacterial surface through proteolytic cleavage of IcsA. Transcription of icsP is increased in the presence of VirB, a DNA-binding protein that positively regulates many genes carried on the large virulence plasmid. In Shigella dysenteriae, the small regulatory RNA RyhB, which is a member of the iron-responsive Fur regulon, suppresses several virulence-associated phenotypes by downregulating levels of virB in response to iron limitation. Here we show that the Fur/RyhB regulatory pathway downregulates IcsP levels in response to low iron concentrations in Shigella flexneri and that this occurs at the level of transcription through the RyhB-dependent regulation of VirB. These observations demonstrate that in Shigella species the Fur/RyhB regulatory pathway provides a mechanism to finely tune the expression of icsP in response to the low concentrations of free iron predicted to be encountered within colonic epithelial cells. PMID:21859852
Erbel-Sieler, Claudia; Dudley, Carol; Zhou, Yudong; Wu, Xinle; Estill, Sandi Jo; Han, Tina; Diaz-Arrastia, Ramon; Brunskill, Eric W; Potter, S Steven; McKnight, Steven L
2004-09-14
Laboratory mice bearing inactivating mutations in the genes encoding the NPAS1 and NPAS3 transcription factors have been shown to exhibit a spectrum of behavioral and neurochemical abnormalities. Behavioral abnormalities included diminished startle response, as measured by prepulse inhibition, and impaired social recognition. NPAS1/NPAS3-deficient mice also exhibited stereotypic darting behavior at weaning and increased locomotor activity. Immunohistochemical staining assays showed that the NPAS1 and NPAS3 proteins are expressed in inhibitory interneurons and that the viability and anatomical distribution of these neurons are unaffected by the absence of either transcription factor. Adult brain tissues from NPAS3- and NPAS1/NPAS3-deficient mice exhibited a distinct reduction in reelin, a large, secreted protein whose expression has been reported to be attenuated in the postmortem brain tissue of patients with schizophrenia. These observations raise the possibility that a regulatory program controlled in inhibitory interneurons by the NPAS1 and NPAS3 transcription factors may be either substantively or tangentially relevant to psychosis.
Erbel-Sieler, Claudia; Dudley, Carol; Zhou, Yudong; Wu, Xinle; Estill, Sandi Jo; Han, Tina; Diaz-Arrastia, Ramon; Brunskill, Eric W.; Potter, S. Steven; McKnight, Steven L.
2004-01-01
Laboratory mice bearing inactivating mutations in the genes encoding the NPAS1 and NPAS3 transcription factors have been shown to exhibit a spectrum of behavioral and neurochemical abnormalities. Behavioral abnormalities included diminished startle response, as measured by prepulse inhibition, and impaired social recognition. NPAS1/NPAS3-deficient mice also exhibited stereotypic darting behavior at weaning and increased locomotor activity. Immunohistochemical staining assays showed that the NPAS1 and NPAS3 proteins are expressed in inhibitory interneurons and that the viability and anatomical distribution of these neurons are unaffected by the absence of either transcription factor. Adult brain tissues from NPAS3- and NPAS1/NPAS3-deficient mice exhibited a distinct reduction in reelin, a large, secreted protein whose expression has been reported to be attenuated in the postmortem brain tissue of patients with schizophrenia. These observations raise the possibility that a regulatory program controlled in inhibitory interneurons by the NPAS1 and NPAS3 transcription factors may be either substantively or tangentially relevant to psychosis. PMID:15347806
Riboregulation of bacterial and archaeal transposition.
Ellis, Michael J; Haniford, David B
2016-05-01
The coexistence of transposons with their hosts depends largely on transposition levels being tightly regulated to limit the mutagenic burden associated with frequent transposition. For 'DNA-based' (class II) bacterial transposons there is growing evidence that regulation through small noncoding RNAs and/or the RNA-binding protein Hfq are prominent mechanisms of defense against transposition. Recent transcriptomics analyses have identified many new cases of antisense RNAs (asRNA) that potentially could regulate the expression of transposon-encoded genes giving the impression that asRNA regulation of DNA-based transposons is much more frequent than previously thought. Hfq is a highly conserved bacterial protein that plays a central role in posttranscriptional gene regulation and stress response pathways in many bacteria. Three different mechanisms for Hfq-directed control of bacterial transposons have been identified to date highlighting the versatility of this protein as a regulator of bacterial transposons. There is also evidence emerging that some DNA-based transposons encode RNAs that could regulate expression of host genes. In the case of IS200, which appears to have lost its ability to transpose, contributing a regulatory RNA to its host could account for the persistence of this mobile element in a wide range of bacterial species. It remains to be seen how prevalent these transposon-encoded RNA regulators are, but given the relatively large amount of intragenic transcription in bacterial genomes, it would not be surprising if new examples are forthcoming. WIREs RNA 2016, 7:382-398. doi: 10.1002/wrna.1341 For further resources related to this article, please visit the WIREs website. © 2016 Wiley Periodicals, Inc.
Zhou, Ke-Ren; Liu, Shun; Sun, Wen-Ju; Zheng, Ling-Ling; Zhou, Hui; Yang, Jian-Hua; Qu, Liang-Hu
2017-01-04
The abnormal transcriptional regulation of non-coding RNAs (ncRNAs) and protein-coding genes (PCGs) is contributed to various biological processes and linked with human diseases, but the underlying mechanisms remain elusive. In this study, we developed ChIPBase v2.0 (http://rna.sysu.edu.cn/chipbase/) to explore the transcriptional regulatory networks of ncRNAs and PCGs. ChIPBase v2.0 has been expanded with ∼10 200 curated ChIP-seq datasets, which represent about 20 times expansion when comparing to the previous released version. We identified thousands of binding motif matrices and their binding sites from ChIP-seq data of DNA-binding proteins and predicted millions of transcriptional regulatory relationships between transcription factors (TFs) and genes. We constructed 'Regulator' module to predict hundreds of TFs and histone modifications that were involved in or affected transcription of ncRNAs and PCGs. Moreover, we built a web-based tool, Co-Expression, to explore the co-expression patterns between DNA-binding proteins and various types of genes by integrating the gene expression profiles of ∼10 000 tumor samples and ∼9100 normal tissues and cell lines. ChIPBase also provides a ChIP-Function tool and a genome browser to predict functions of diverse genes and visualize various ChIP-seq data. This study will greatly expand our understanding of the transcriptional regulations of ncRNAs and PCGs. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Turatsinze, Jean-Valery; Thomas-Chollier, Morgane; Defrance, Matthieu; van Helden, Jacques
2008-01-01
This protocol shows how to detect putative cis-regulatory elements and regions enriched in such elements with the regulatory sequence analysis tools (RSAT) web server (http://rsat.ulb.ac.be/rsat/). The approach applies to known transcription factors, whose binding specificity is represented by position-specific scoring matrices, using the program matrix-scan. The detection of individual binding sites is known to return many false predictions. However, results can be strongly improved by estimating P value, and by searching for combinations of sites (homotypic and heterotypic models). We illustrate the detection of sites and enriched regions with a study case, the upstream sequence of the Drosophila melanogaster gene even-skipped. This protocol is also tested on random control sequences to evaluate the reliability of the predictions. Each task requires a few minutes of computation time on the server. The complete protocol can be executed in about one hour.
Washington, Tracy A; Smith, Janet L; Grossman, Alan D
2017-10-01
DnaA is the widely conserved bacterial AAA+ ATPase that functions as both the replication initiator and a transcription factor. In many organisms, DnaA controls expression of its own gene and likely several others during growth and in response to replication stress. To evaluate the effects of DnaA on gene expression, separate from its role in replication initiation, we analyzed changes in mRNA levels in Bacillus subtilis cells with and without dnaA, using engineered strains in which dnaA is not essential. We found that dnaA was required for many of the changes in gene expression in response to replication stress. We also found that dnaA indirectly affected expression of several regulons during growth, including those controlled by the transcription factors Spo0A, AbrB, PhoP, SinR, RemA, Rok and YvrH. These effects were largely mediated by the effects of DnaA on expression of sda. DnaA activates transcription of sda, and Sda inhibits histidine protein kinases required for activation of the transcription factor Spo0A. We also found that loss of dnaA caused a decrease in the development of genetic competence. Together, our results indicate that DnaA plays an important role in modulating cell physiology, separate from its role in replication initiation. © 2017 John Wiley & Sons Ltd.
Network perturbation by recurrent regulatory variants in cancer
Cho, Ara; Lee, Insuk; Choi, Jung Kyoon
2017-01-01
Cancer driving genes have been identified as recurrently affected by variants that alter protein-coding sequences. However, a majority of cancer variants arise in noncoding regions, and some of them are thought to play a critical role through transcriptional perturbation. Here we identified putative transcriptional driver genes based on combinatorial variant recurrence in cis-regulatory regions. The identified genes showed high connectivity in the cancer type-specific transcription regulatory network, with high outdegree and many downstream genes, highlighting their causative role during tumorigenesis. In the protein interactome, the identified transcriptional drivers were not as highly connected as coding driver genes but appeared to form a network module centered on the coding drivers. The coding and regulatory variants associated via these interactions between the coding and transcriptional drivers showed exclusive and complementary occurrence patterns across tumor samples. Transcriptional cancer drivers may act through an extensive perturbation of the regulatory network and by altering protein network modules through interactions with coding driver genes. PMID:28333928
Hahn, Steven; Young, Elton T.
2011-01-01
Here we review recent advances in understanding the regulation of mRNA synthesis in Saccharomyces cerevisiae. Many fundamental gene regulatory mechanisms have been conserved in all eukaryotes, and budding yeast has been at the forefront in the discovery and dissection of these conserved mechanisms. Topics covered include upstream activation sequence and promoter structure, transcription factor classification, and examples of regulated transcription factor activity. We also examine advances in understanding the RNA polymerase II transcription machinery, conserved coactivator complexes, transcription activation domains, and the cooperation of these factors in gene regulatory mechanisms. PMID:22084422
Hala, D
2017-03-21
The interconnected topology of transcriptional regulatory networks (TRNs) readily lends to mathematical (or in silico) representation and analysis as a stoichiometric matrix. Such a matrix can be 'solved' using the mathematical method of extreme pathway (ExPa) analysis, which identifies uniquely activated genes subject to transcription factor (TF) availability. In this manuscript, in silico multi-tissue TRN models of brain, liver and gonad were used to study reproductive endocrine developmental programming in zebrafish (Danio rerio) from 0.25h post fertilization (hpf; zygote) to 90 days post fertilization (dpf; adult life stage). First, properties of TRN models were studied by sequentially activating all genes in multi-tissue models. This analysis showed the brain to exhibit lowest proportion of co-regulated genes (19%) relative to liver (23%) and gonad (32%). This was surprising given that the brain comprised 75% and 25% more TFs than liver and gonad respectively. Such 'hierarchy' of co-regulatory capability (brain
Changes in rhizosphere bacterial gene expression following glyphosate treatment.
Newman, Molli M; Lorenz, Nicola; Hoilett, Nigel; Lee, Nathan R; Dick, Richard P; Liles, Mark R; Ramsier, Cliff; Kloepper, Joseph W
2016-05-15
In commercial agriculture, populations and interactions of rhizosphere microflora are potentially affected by the use of specific agrichemicals, possibly by affecting gene expression in these organisms. To investigate this, we examined changes in bacterial gene expression within the rhizosphere of glyphosate-tolerant corn (Zea mays) and soybean (Glycine max) in response to long-term glyphosate (PowerMAX™, Monsanto Company, MO, USA) treatment. A long-term glyphosate application study was carried out using rhizoboxes under greenhouse conditions with soil previously having no history of glyphosate exposure. Rhizosphere soil was collected from the rhizoboxes after four growing periods. Soil microbial community composition was analyzed using microbial phospholipid fatty acid (PLFA) analysis. Total RNA was extracted from rhizosphere soil, and samples were analyzed using RNA-Seq analysis. A total of 20-28 million bacterial sequences were obtained for each sample. Transcript abundance was compared between control and glyphosate-treated samples using edgeR. Overall rhizosphere bacterial metatranscriptomes were dominated by transcripts related to RNA and carbohydrate metabolism. We identified 67 differentially expressed bacterial transcripts from the rhizosphere. Transcripts downregulated following glyphosate treatment involved carbohydrate and amino acid metabolism, and upregulated transcripts involved protein metabolism and respiration. Additionally, bacterial transcripts involving nutrients, including iron, nitrogen, phosphorus, and potassium, were also affected by long-term glyphosate application. Overall, most bacterial and all fungal PLFA biomarkers decreased after glyphosate treatment compared to the control. These results demonstrate that long-term glyphosate use can affect rhizosphere bacterial activities and potentially shift bacterial community composition favoring more glyphosate-tolerant bacteria. Copyright © 2016 The Authors. Published by Elsevier B.V. All
Biophysics and bioinformatics of transcription regulation in bacteria and bacteriophages
NASA Astrophysics Data System (ADS)
Djordjevic, Marko
2005-11-01
Due to rapid accumulation of biological data, bioinformatics has become a very important branch of biological research. In this thesis, we develop novel bioinformatic approaches and aid design of biological experiments by using ideas and methods from statistical physics. Identification of transcription factor binding sites within the regulatory segments of genomic DNA is an important step towards understanding of the regulatory circuits that control expression of genes. We propose a novel, biophysics based algorithm, for the supervised detection of transcription factor (TF) binding sites. The method classifies potential binding sites by explicitly estimating the sequence-specific binding energy and the chemical potential of a given TF. In contrast with the widely used information theory based weight matrix method, our approach correctly incorporates saturation in the transcription factor/DNA binding probability. This results in a significant reduction in the number of expected false positives, and in the explicit appearance---and determination---of a binding threshold. The new method was used to identify likely genomic binding sites for the Escherichia coli TFs, and to examine the relationship between TF binding specificity and degree of pleiotropy (number of regulatory targets). We next address how parameters of protein-DNA interactions can be obtained from data on protein binding to random oligos under controlled conditions (SELEX experiment data). We show that 'robust' generation of an appropriate data set is achieved by a suitable modification of the standard SELEX procedure, and propose a novel bioinformatic algorithm for analysis of such data. Finally, we use quantitative data analysis, bioinformatic methods and kinetic modeling to analyze gene expression strategies of bacterial viruses. We study bacteriophage Xp10 that infects rice pathogen Xanthomonas oryzae. Xp10 is an unusual bacteriophage, which has morphology and genome organization that most closely
Mars, Ruben A T; Nicolas, Pierre; Denham, Emma L; van Dijl, Jan Maarten
2016-12-01
Bacteria can employ widely diverse RNA molecules to regulate their gene expression. Such molecules include trans-acting small regulatory RNAs, antisense RNAs, and a variety of transcriptional attenuation mechanisms in the 5' untranslated region. Thus far, most regulatory RNA research has focused on Gram-negative bacteria, such as Escherichia coli and Salmonella. Hence, there is uncertainty about whether the resulting insights can be extrapolated directly to other bacteria, such as the Gram-positive soil bacterium Bacillus subtilis. A recent study identified 1,583 putative regulatory RNAs in B. subtilis, whose expression was assessed across 104 conditions. Here, we review the current understanding of RNA-based regulation in B. subtilis, and we categorize the newly identified putative regulatory RNAs on the basis of their conservation in other bacilli and the stability of their predicted secondary structures. Our present evaluation of the publicly available data indicates that RNA-mediated gene regulation in B. subtilis mostly involves elements at the 5' ends of mRNA molecules. These can include 5' secondary structure elements and metabolite-, tRNA-, or protein-binding sites. Importantly, sense-independent segments are identified as the most conserved and structured potential regulatory RNAs in B. subtilis. Altogether, the present survey provides many leads for the identification of new regulatory RNA functions in B. subtilis. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Mars, Ruben A. T.; Nicolas, Pierre; Denham, Emma L.
2016-01-01
SUMMARY Bacteria can employ widely diverse RNA molecules to regulate their gene expression. Such molecules include trans-acting small regulatory RNAs, antisense RNAs, and a variety of transcriptional attenuation mechanisms in the 5′ untranslated region. Thus far, most regulatory RNA research has focused on Gram-negative bacteria, such as Escherichia coli and Salmonella. Hence, there is uncertainty about whether the resulting insights can be extrapolated directly to other bacteria, such as the Gram-positive soil bacterium Bacillus subtilis. A recent study identified 1,583 putative regulatory RNAs in B. subtilis, whose expression was assessed across 104 conditions. Here, we review the current understanding of RNA-based regulation in B. subtilis, and we categorize the newly identified putative regulatory RNAs on the basis of their conservation in other bacilli and the stability of their predicted secondary structures. Our present evaluation of the publicly available data indicates that RNA-mediated gene regulation in B. subtilis mostly involves elements at the 5′ ends of mRNA molecules. These can include 5′ secondary structure elements and metabolite-, tRNA-, or protein-binding sites. Importantly, sense-independent segments are identified as the most conserved and structured potential regulatory RNAs in B. subtilis. Altogether, the present survey provides many leads for the identification of new regulatory RNA functions in B. subtilis. PMID:27784798
Effects of Four Different Regulatory Mechanisms on the Dynamics of Gene Regulatory Cascades
NASA Astrophysics Data System (ADS)
Hansen, Sabine; Krishna, Sandeep; Semsey, Szabolcs; Lo Svenningsen, Sine
2015-07-01
Gene regulatory cascades (GRCs) are common motifs in cellular molecular networks. A given logical function in these cascades, such as the repression of the activity of a transcription factor, can be implemented by a number of different regulatory mechanisms. The potential consequences for the dynamic performance of the GRC of choosing one mechanism over another have not been analysed systematically. Here, we report the construction of a synthetic GRC in Escherichia coli, which allows us for the first time to directly compare and contrast the dynamics of four different regulatory mechanisms, affecting the transcription, translation, stability, or activity of a transcriptional repressor. We developed a biologically motivated mathematical model which is sufficient to reproduce the response dynamics determined by experimental measurements. Using the model, we explored the potential response dynamics that the constructed GRC can perform. We conclude that dynamic differences between regulatory mechanisms at an individual step in a GRC are often concealed in the overall performance of the GRC, and suggest that the presence of a given regulatory mechanism in a certain network environment does not necessarily mean that it represents a single optimal evolutionary solution.
The Regulatory Small RNA MarS Supports Virulence of Streptococcus pyogenes.
Pappesch, Roberto; Warnke, Philipp; Mikkat, Stefan; Normann, Jana; Wisniewska-Kucper, Aleksandra; Huschka, Franziska; Wittmann, Maja; Khani, Afsaneh; Schwengers, Oliver; Oehmcke-Hecht, Sonja; Hain, Torsten; Kreikemeyer, Bernd; Patenge, Nadja
2017-09-25
Small regulatory RNAs (sRNAs) play a role in the control of bacterial virulence gene expression. In this study, we investigated an sRNA that was identified in Streptococcus pyogenes (group A Streptococcus, GAS) but is conserved throughout various streptococci. In a deletion strain, expression of mga, the gene encoding the multiple virulence gene regulator, was reduced. Accordingly, transcript and proteome analyses revealed decreased expression of several Mga-activated genes. Therefore, and because the sRNA was shown to interact with the 5' UTR of the mga transcript in a gel-shift assay, we designated it MarS for m ga-activating regulatory sRNA. Down-regulation of important virulence factors, including the antiphagocytic M-protein, led to increased susceptibility of the deletion strain to phagocytosis and reduced adherence to human keratinocytes. In a mouse infection model, the marS deletion mutant showed reduced dissemination to the liver, kidney, and spleen. Additionally, deletion of marS led to increased tolerance towards oxidative stress. Our in vitro and in vivo results indicate a modulating effect of MarS on virulence gene expression and on the pathogenic potential of GAS.
Evolutionary rewiring of bacterial regulatory networks
Taylor, Tiffany B.; Mulley, Geraldine; McGuffin, Liam J.; Johnson, Louise J.; Brockhurst, Michael A.; Arseneault, Tanya; Silby, Mark W.; Jackson, Robert W.
2015-01-01
Bacteria have evolved complex regulatory networks that enable integration of multiple intracellular and extracellular signals to coordinate responses to environmental changes. However, our knowledge of how regulatory systems function and evolve is still relatively limited. There is often extensive homology between components of different networks, due to past cycles of gene duplication, divergence, and horizontal gene transfer, raising the possibility of cross-talk or redundancy. Consequently, evolutionary resilience is built into gene networks - homology between regulators can potentially allow rapid rescue of lost regulatory function across distant regions of the genome. In our recent study [Taylor, et al. Science (2015), 347(6225)] we find that mutations that facilitate cross-talk between pathways can contribute to gene network evolution, but that such mutations come with severe pleiotropic costs. Arising from this work are a number of questions surrounding how this phenomenon occurs. PMID:28357301
Lombardot, Thierry; Bauer, Margarete; Teeling, Hanno; Amann, Rudolf; Glöckner, Frank Oliver
2005-01-01
Rhodopirellula baltica (strain SH 1T) is a free-living marine representative of the phylogenetically independent and environmentally relevant phylum Planctomycetes. Little is known about the regulatory strategies of free-living bacteria with large (7.15 Mb) genomes. Therefore, a consistent, quantitative and qualitative description was produced by comparing R. baltica's transcriptional regulator pool with that of 123 publicly available bacterial genomes. The overall results are congruous with earlier observations that in Bacteria, the proportion of genes encoding transcriptional regulators generally increases with genome size. However, R. baltica distinctly stands out from this trend with only 2.4% (174) of all genes predicted to encode transcriptional regulators. The qualitative investigation of R. baltica's transcriptional regulators revealed a clear shift towards high numbers of two-component systems (66) as well as high numbers of sigma factors (49), with more than 76% (37) belonging to the extra-cytoplasmic function subfamily of sigma-70. Only one predicted sigma factor showed a relatively close phylogenetic relationship to that of another bacterium, the sigma factor SigZ of Bacillus subtilis. In summary, analysis of the R. baltica genome revealed disparate regulatory mechanisms and a clear bias towards direct environmental sensing. This strategy might provide a selective advantage for organisms living in habitats with frequently changing environmental conditions.
RNA search engines empower the bacterial intranet.
Dendooven, Tom; Luisi, Ben F
2017-08-15
RNA acts not only as an information bearer in the biogenesis of proteins from genes, but also as a regulator that participates in the control of gene expression. In bacteria, small RNA molecules (sRNAs) play controlling roles in numerous processes and help to orchestrate complex regulatory networks. Such processes include cell growth and development, response to stress and metabolic change, transcription termination, cell-to-cell communication, and the launching of programmes for host invasion. All these processes require recognition of target messenger RNAs by the sRNAs. This review summarizes recent results that have provided insights into how bacterial sRNAs are recruited into effector ribonucleoprotein complexes that can seek out and act upon target transcripts. The results hint at how sRNAs and their protein partners act as pattern-matching search engines that efficaciously regulate gene expression, by performing with specificity and speed while avoiding off-target effects. The requirements for efficient searches of RNA patterns appear to be common to all domains of life. © 2017 The Author(s).
RNA search engines empower the bacterial intranet
Dendooven, Tom
2017-01-01
RNA acts not only as an information bearer in the biogenesis of proteins from genes, but also as a regulator that participates in the control of gene expression. In bacteria, small RNA molecules (sRNAs) play controlling roles in numerous processes and help to orchestrate complex regulatory networks. Such processes include cell growth and development, response to stress and metabolic change, transcription termination, cell-to-cell communication, and the launching of programmes for host invasion. All these processes require recognition of target messenger RNAs by the sRNAs. This review summarizes recent results that have provided insights into how bacterial sRNAs are recruited into effector ribonucleoprotein complexes that can seek out and act upon target transcripts. The results hint at how sRNAs and their protein partners act as pattern-matching search engines that efficaciously regulate gene expression, by performing with specificity and speed while avoiding off-target effects. The requirements for efficient searches of RNA patterns appear to be common to all domains of life. PMID:28710287
Kelwick, Richard; Webb, Alexander J; MacDonald, James T; Freemont, Paul S
2016-11-01
Cell-free transcription-translation systems were originally applied towards in vitro protein production. More recently, synthetic biology is enabling these systems to be used within a systematic design context for prototyping DNA regulatory elements, genetic logic circuits and biosynthetic pathways. The Gram-positive soil bacterium, Bacillus subtilis, is an established model organism of industrial importance. To this end, we developed several B. subtilis-based cell-free systems. Our improved B. subtilis WB800N-based system was capable of producing 0.8µM GFP, which gave a ~72x fold-improvement when compared with a B. subtilis 168 cell-free system. Our improved system was applied towards the prototyping of a B. subtilis promoter library in which we engineered several promoters, derived from the wild-type P grac (σA) promoter, that display a range of comparable in vitro and in vivo transcriptional activities. Additionally, we demonstrate the cell-free characterisation of an inducible expression system, and the activity of a model enzyme - renilla luciferase. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Engineering an allosteric transcription factor to respond to new ligands
DOE Office of Scientific and Technical Information (OSTI.GOV)
Taylor, Noah D.; Garruss, Alexander S.; Moretti, Rocco
Genetic regulatory proteins inducible by small molecules are useful synthetic biology tools as sensors and switches. Bacterial allosteric transcription factors (aTFs) are a major class of regulatory proteins, but few aTFs have been redesigned to respond to new effectors beyond natural aTF-inducer pairs. Altering inducer specificity in these proteins is difficult because substitutions that affect inducer binding may also disrupt allostery. In this paper, we engineered an aTF, the Escherichia coli lac repressor, LacI, to respond to one of four new inducer molecules: fucose, gentiobiose, lactitol and sucralose. Using computational protein design, single-residue saturation mutagenesis or random mutagenesis, along withmore » multiplex assembly, we identified new variants comparable in specificity and induction to wild-type LacI with its inducer, isopropyl β-D-1-thiogalactopyranoside (IPTG). Finally, the ability to create designer aTFs will enable applications including dynamic control of cell metabolism, cell biology and synthetic gene circuits.« less
Engineering an allosteric transcription factor to respond to new ligands
Taylor, Noah D; Garruss, Alexander S; Moretti, Rocco; Chan, Sum; Arbing, Mark A; Cascio, Duilio; Rogers, Jameson K; Isaacs, Farren J; Kosuri, Sriram; Baker, David; Fields, Stanley; Church, George M; Raman, Srivatsan
2016-01-01
Genetic regulatory proteins inducible by small molecules are useful synthetic biology tools as sensors and switches. Bacterial allosteric transcription factors (aTFs) are a major class of regulatory proteins, but few aTFs have been redesigned to respond to new effectors beyond natural aTF-inducer pairs. Altering inducer specificity in these proteins is difficult because substitutions that affect inducer binding may also disrupt allostery. We engineered an aTF, the Escherichia coli lac repressor, LacI, to respond to one of four new inducer molecules: fucose, gentiobiose, lactitol or sucralose. Using computational protein design, single-residue saturation mutagenesis or random mutagenesis, along with multiplex assembly, we identified new variants comparable in specificity and induction to wild-type LacI with its inducer, isopropyl β-D-1-thiogalactopyranoside (IPTG). The ability to create designer aTFs will enable applications including dynamic control of cell metabolism, cell biology and synthetic gene circuits. PMID:26689263
Engineering an allosteric transcription factor to respond to new ligands
Taylor, Noah D.; Garruss, Alexander S.; Moretti, Rocco; ...
2015-12-21
Genetic regulatory proteins inducible by small molecules are useful synthetic biology tools as sensors and switches. Bacterial allosteric transcription factors (aTFs) are a major class of regulatory proteins, but few aTFs have been redesigned to respond to new effectors beyond natural aTF-inducer pairs. Altering inducer specificity in these proteins is difficult because substitutions that affect inducer binding may also disrupt allostery. In this paper, we engineered an aTF, the Escherichia coli lac repressor, LacI, to respond to one of four new inducer molecules: fucose, gentiobiose, lactitol and sucralose. Using computational protein design, single-residue saturation mutagenesis or random mutagenesis, along withmore » multiplex assembly, we identified new variants comparable in specificity and induction to wild-type LacI with its inducer, isopropyl β-D-1-thiogalactopyranoside (IPTG). Finally, the ability to create designer aTFs will enable applications including dynamic control of cell metabolism, cell biology and synthetic gene circuits.« less
Das, G; Henning, D; Wright, D; Reddy, R
1988-01-01
Whereas the genes coding for trimethyl guanosine-capped snRNAs are transcribed by RNA polymerase II, the U6 RNA genes are transcribed by RNA polymerase III. In this study, we have analyzed the cis-regulatory elements involved in the transcription of a mouse U6 snRNA gene in vitro and in frog oocytes. Transcriptional analysis of mutant U6 gene constructs showed that, unlike most known cases of polymerase III transcription, intragenic sequences except the initiation nucleotide are dispensable for efficient and accurate transcription of U6 gene in vitro. Transcription of 5' deletion mutants in vitro and in frog oocytes showed that the upstream region, within 79 bp from the initiation nucleotide, contains elements necessary for U6 gene transcription. Transcription studies were carried out in frog oocytes with U6 genes containing 5' distal sequence; these studies revealed that the distal element acts as an orientation-dependent enhancer when present upstream to the gene, while it is orientation-independent but distance-dependent enhancer when placed down-stream to the U6 gene. Analysis of 3' deletion mutants showed that the transcription termination of U6 RNA is dependent on a T cluster present on the 3' end of the gene, thus providing further support to other lines of evidence that U6 genes are transcribed by RNA polymerase III. These observations suggest the involvement of a composite of components of RNA polymerase II and III transcription machineries in the transcription of U6 genes by RNA polymerase III. Images PMID:3366121
Cross-regulatory circuit between AHR and microbiota.
Ji, Jian; Qu, Hao
2018-01-29
The gut microbes have a close symbiotic relationship with their host. Interactions between host and the microbiota affect the nutritional, immunological, and physiological status of the host. The aryl hydrocarbon receptor (AHR) is a ligand activated transcription factor that mediates the toxicity of xenobiotics. Recently, the relationship between the gut microbiota and AHR has attracted the attention of many researchers. The AHR influences the intestinal microbiota population and mediates host-microbe homeostasis. Interestingly, the gut microbiota also produces ligands of AHR from bacterial metabolism and thereby activates the AHR signaling pathway. This review presents current knowledge of the cross-regulatory circuit between the AHR and intestinal microbiota. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Kamke, Janine; Soni, Priya; Li, Yang; Ganesh, Siva; Kelly, William J; Leahy, Sinead C; Shi, Weibing; Froula, Jeff; Rubin, Edward M; Attwood, Graeme T
2017-08-08
Ruminants are important contributors to global methane emissions via microbial fermentation in their reticulo-rumens. This study is part of a larger program, characterising the rumen microbiomes of sheep which vary naturally in methane yield (g CH 4 /kg DM/day) and aims to define differences in microbial communities, and in gene and transcript abundances that can explain the animal methane phenotype. Rumen microbiome metagenomic and metatranscriptomic data were analysed by Gene Set Enrichment, sparse partial least squares regression and the Wilcoxon Rank Sum test to estimate correlations between specific KEGG bacterial pathways/genes and high methane yield in sheep. KEGG genes enriched in high methane yield sheep were reassembled from raw reads and existing contigs and analysed by MEGAN to predict their phylogenetic origin. Protein coding sequences from Succinivibrio dextrinosolvens strains were analysed using Effective DB to predict bacterial type III secreted proteins. The effect of S. dextrinosolvens strain H5 growth on methane formation by rumen methanogens was explored using co-cultures. Detailed analysis of the rumen microbiomes of high methane yield sheep shows that gene and transcript abundances of bacterial type III secretion system genes are positively correlated with methane yield in sheep. Most of the bacterial type III secretion system genes could not be assigned to a particular bacterial group, but several genes were affiliated with the genus Succinivibrio, and searches of bacterial genome sequences found that strains of S. dextrinosolvens were part of a small group of rumen bacteria that encode this type of secretion system. In co-culture experiments, S. dextrinosolvens strain H5 showed a growth-enhancing effect on a methanogen belonging to the order Methanomassiliicoccales, and inhibition of a representative of the Methanobrevibacter gottschalkii clade. This is the first report of bacterial type III secretion system genes being associated with high
Reilman, Ewoud; Mars, Ruben A. T.; van Dijl, Jan Maarten; Denham, Emma L.
2014-01-01
Expression of particular drug transporters in response to antibiotic pressure is a critical element in the development of bacterial multidrug resistance, and represents a serious concern for human health. To obtain a better understanding of underlying regulatory mechanisms, we have dissected the transcriptional activation of the ATP-binding cassette (ABC) transporter BmrC/BmrD of the Gram-positive model bacterium Bacillus subtilis. By using promoter-GFP fusions and live cell array technology, we demonstrate a temporally controlled transcriptional activation of the bmrCD genes in response to antibiotics that target protein synthesis. Intriguingly, bmrCD expression only occurs during the late-exponential and stationary growth stages, irrespective of the timing of the antibiotic challenge. We show that this is due to tight transcriptional control by the transition state regulator AbrB. Moreover, our results show that the bmrCD genes are co-transcribed with bmrB (yheJ), a small open reading frame immediately upstream of bmrC that harbors three alternative stem-loop structures. These stem-loops are apparently crucial for antibiotic-induced bmrCD transcription. Importantly, the antibiotic-induced bmrCD expression requires translation of bmrB, which implies that BmrB serves as a regulatory leader peptide. Altogether, we demonstrate for the first time that a ribosome-mediated transcriptional attenuation mechanism can control the expression of a multidrug ABC transporter. PMID:25217586
Saban, Ricardo; Simpson, Cindy; Vadigepalli, Rajanikanth; Memet, Sylvie; Dozmorov, Igor; Saban, Marcia R
2007-01-01
Background Tachykinins (TK), such as substance P, and their neurokinin receptors which are ubiquitously expressed in the human urinary tract, represent an endogenous system regulating bladder inflammatory, immune responses, and visceral hypersensitivity. Increasing evidence correlates alterations in the TK system with urinary tract diseases such as neurogenic bladders, outflow obstruction, idiopathic detrusor instability, and interstitial cystitis. However, despite promising effects in animal models, there seems to be no published clinical study showing that NK-receptor antagonists are an effective treatment of pain in general or urinary tract disorders, such as detrusor overactivity. In order to search for therapeutic targets that could block the tachykinin system, we set forth to determine the regulatory network downstream of NK1 receptor activation. First, NK1R-dependent transcripts were determined and used to query known databases for their respective transcription regulatory elements (TREs). Methods An expression analysis was performed using urinary bladders isolated from sensitized wild type (WT) and NK1R-/- mice that were stimulated with saline, LPS, or antigen to provoke inflammation. Based on cDNA array results, NK1R-dependent genes were selected. PAINT software was used to query TRANSFAC database and to retrieve upstream TREs that were confirmed by electrophoretic mobility shift assays. Results The regulatory network of TREs driving NK1R-dependent genes presented cRel in a central position driving 22% of all genes, followed by AP-1, NF-kappaB, v-Myb, CRE-BP1/c-Jun, USF, Pax-6, Efr-1, Egr-3, and AREB6. A comparison between NK1R-dependent and NK1R-independent genes revealed Nkx-2.5 as a unique discriminator. In the presence of NK1R, Nkx2-5 _01 was significantly correlated with 36 transcripts which included several candidates for mediating bladder development (FGF) and inflammation (PAR-3, IL-1R, IL-6, α-NGF, TSP2). In the absence of NK1R, the matrix Nkx2
Janky, Rekin's; van Helden, Jacques
2008-01-23
The detection of conserved motifs in promoters of orthologous genes (phylogenetic footprints) has become a common strategy to predict cis-acting regulatory elements. Several software tools are routinely used to raise hypotheses about regulation. However, these tools are generally used as black boxes, with default parameters. A systematic evaluation of optimal parameters for a footprint discovery strategy can bring a sizeable improvement to the predictions. We evaluate the performances of a footprint discovery approach based on the detection of over-represented spaced motifs. This method is particularly suitable for (but not restricted to) Bacteria, since such motifs are typically bound by factors containing a Helix-Turn-Helix domain. We evaluated footprint discovery in 368 Escherichia coli K12 genes with annotated sites, under 40 different combinations of parameters (taxonomical level, background model, organism-specific filtering, operon inference). Motifs are assessed both at the levels of correctness and significance. We further report a detailed analysis of 181 bacterial orthologs of the LexA repressor. Distinct motifs are detected at various taxonomical levels, including the 7 previously characterized taxon-specific motifs. In addition, we highlight a significantly stronger conservation of half-motifs in Actinobacteria, relative to Firmicutes, suggesting an intermediate state in specificity switching between the two Gram-positive phyla, and thereby revealing the on-going evolution of LexA auto-regulation. The footprint discovery method proposed here shows excellent results with E. coli and can readily be extended to predict cis-acting regulatory signals and propose testable hypotheses in bacterial genomes for which nothing is known about regulation.
Themes and Variations: Regulation of RpoN-Dependent Flagellar Genes across Diverse Bacterial Species
Tsang, Jennifer; Hoover, Timothy R.
2014-01-01
Flagellar biogenesis in bacteria is a complex process in which the transcription of dozens of structural and regulatory genes is coordinated with the assembly of the flagellum. Although the overall process of flagellar biogenesis is conserved among bacteria, the mechanisms used to regulate flagellar gene expression vary greatly among different bacterial species. Many bacteria use the alternative sigma factor σ 54 (also known as RpoN) to transcribe specific sets of flagellar genes. These bacteria include members of the Epsilonproteobacteria (e.g., Helicobacter pylori and Campylobacter jejuni), Gammaproteobacteria (e.g., Vibrio and Pseudomonas species), and Alphaproteobacteria (e.g., Caulobacter crescentus). This review characterizes the flagellar transcriptional hierarchies in these bacteria and examines what is known about how flagellar gene regulation is linked with other processes including growth phase, quorum sensing, and host colonization. PMID:24672734
Automatic reconstruction of a bacterial regulatory network using Natural Language Processing
Rodríguez-Penagos, Carlos; Salgado, Heladia; Martínez-Flores, Irma; Collado-Vides, Julio
2007-01-01
Background Manual curation of biological databases, an expensive and labor-intensive process, is essential for high quality integrated data. In this paper we report the implementation of a state-of-the-art Natural Language Processing system that creates computer-readable networks of regulatory interactions directly from different collections of abstracts and full-text papers. Our major aim is to understand how automatic annotation using Text-Mining techniques can complement manual curation of biological databases. We implemented a rule-based system to generate networks from different sets of documents dealing with regulation in Escherichia coli K-12. Results Performance evaluation is based on the most comprehensive transcriptional regulation database for any organism, the manually-curated RegulonDB, 45% of which we were able to recreate automatically. From our automated analysis we were also able to find some new interactions from papers not already curated, or that were missed in the manual filtering and review of the literature. We also put forward a novel Regulatory Interaction Markup Language better suited than SBML for simultaneously representing data of interest for biologists and text miners. Conclusion Manual curation of the output of automatic processing of text is a good way to complement a more detailed review of the literature, either for validating the results of what has been already annotated, or for discovering facts and information that might have been overlooked at the triage or curation stages. PMID:17683642
Chen, Liming; Bao, Yifan; Piekos, Stephanie C; Zhu, Kexin; Zhang, Lirong; Zhong, Xiao-Bo
2018-07-01
Cytochrome P450 (P450) enzymes are responsible for metabolizing drugs. Expression of P450s can directly affect drug metabolism, resulting in various outcomes in therapeutic efficacy and adverse effects. Several nuclear receptors are transcription factors that can regulate expression of P450s at both basal and drug-induced levels. Some long noncoding RNAs (lncRNAs) near a transcription factor are found to participate in the regulatory functions of the transcription factors. The aim of this study is to determine whether there is a transcriptional regulatory network containing nuclear receptors and lncRNAs controlling both basal and drug-induced expression of P450s in HepaRG cells. Small interfering RNAs or small hairpin RNAs were applied to knock down four nuclear receptors [hepatocyte nuclear factor 1 α (HNF1 α ), hepatocyte nuclear factor 4 α (HNF4 α ), pregnane X receptor (PXR), and constitutive androstane receptor (CAR)] as well as two lncRNAs [HNF1 α antisense RNA 1 (HNF1 α -AS1) and HNF4 α antisense RNA 1 (HNF4 α -AS1)] in HepaRG cells with or without treatment of phenobarbital or rifampicin. Expression of eight P450 enzymes was examined in both basal and drug-induced levels. CAR and PXR mainly regulated expression of specific P450s. HNF1 α and HNF4 α affected expression of a wide range of P450s as well as other transcription factors. HNF1 α and HNF4 α controlled the expression of their neighborhood lncRNAs, HNF1 α -AS1 and HNF4 α -AS1, respectively. HNF1 α -AS1 and HNF4 α -AS1 was also involved in the regulation of P450s and transcription factors in diverse manners. Altogether, our study concludes that a transcription regulatory network containing the nuclear receptors and lncRNAs controls both basal and drug-induced expression of P450s in HepaRG cells. Copyright © 2018 by The American Society for Pharmacology and Experimental Therapeutics.
MicroRNA and Transcription Factor: Key Players in Plant Regulatory Network
Samad, Abdul F. A.; Sajad, Muhammad; Nazaruddin, Nazaruddin; Fauzi, Izzat A.; Murad, Abdul M. A.; Zainal, Zamri; Ismail, Ismanizan
2017-01-01
Recent achievements in plant microRNA (miRNA), a large class of small and non-coding RNAs, are very exciting. A wide array of techniques involving forward genetic, molecular cloning, bioinformatic analysis, and the latest technology, deep sequencing have greatly advanced miRNA discovery. A tiny miRNA sequence has the ability to target single/multiple mRNA targets. Most of the miRNA targets are transcription factors (TFs) which have paramount importance in regulating the plant growth and development. Various families of TFs, which have regulated a range of regulatory networks, may assist plants to grow under normal and stress environmental conditions. This present review focuses on the regulatory relationships between miRNAs and different families of TFs like; NF-Y, MYB, AP2, TCP, WRKY, NAC, GRF, and SPL. For instance NF-Y play important role during drought tolerance and flower development, MYB are involved in signal transduction and biosynthesis of secondary metabolites, AP2 regulate the floral development and nodule formation, TCP direct leaf development and growth hormones signaling. WRKY have known roles in multiple stress tolerances, NAC regulate lateral root formation, GRF are involved in root growth, flower, and seed development, and SPL regulate plant transition from juvenile to adult. We also studied the relation between miRNAs and TFs by consolidating the research findings from different plant species which will help plant scientists in understanding the mechanism of action and interaction between these regulators in the plant growth and development under normal and stress environmental conditions. PMID:28446918
MicroRNA and Transcription Factor: Key Players in Plant Regulatory Network.
Samad, Abdul F A; Sajad, Muhammad; Nazaruddin, Nazaruddin; Fauzi, Izzat A; Murad, Abdul M A; Zainal, Zamri; Ismail, Ismanizan
2017-01-01
Recent achievements in plant microRNA (miRNA), a large class of small and non-coding RNAs, are very exciting. A wide array of techniques involving forward genetic, molecular cloning, bioinformatic analysis, and the latest technology, deep sequencing have greatly advanced miRNA discovery. A tiny miRNA sequence has the ability to target single/multiple mRNA targets. Most of the miRNA targets are transcription factors (TFs) which have paramount importance in regulating the plant growth and development. Various families of TFs, which have regulated a range of regulatory networks, may assist plants to grow under normal and stress environmental conditions. This present review focuses on the regulatory relationships between miRNAs and different families of TFs like; NF-Y, MYB, AP2, TCP, WRKY, NAC, GRF, and SPL. For instance NF-Y play important role during drought tolerance and flower development, MYB are involved in signal transduction and biosynthesis of secondary metabolites, AP2 regulate the floral development and nodule formation, TCP direct leaf development and growth hormones signaling. WRKY have known roles in multiple stress tolerances, NAC regulate lateral root formation, GRF are involved in root growth, flower, and seed development, and SPL regulate plant transition from juvenile to adult. We also studied the relation between miRNAs and TFs by consolidating the research findings from different plant species which will help plant scientists in understanding the mechanism of action and interaction between these regulators in the plant growth and development under normal and stress environmental conditions.
Clare, Alison J.; Wicky, Hollie E.; Empson, Ruth M.; Hughes, Stephanie M.
2017-01-01
Forebrain embryonic zinc finger (Fezf2) encodes a transcription factor essential for the specification of layer 5 projection neurons (PNs) in the developing cerebral cortex. As with many developmental transcription factors, Fezf2 continues to be expressed into adulthood, suggesting it remains crucial to the maintenance of neuronal phenotypes. Despite the continued expression, a function has yet to be explored for Fezf2 in the PNs of the developed cortex. Here, we investigated the role of Fezf2 in mature neurons, using lentiviral-mediated delivery of a shRNA to conditionally knockdown the expression of Fezf2 in the mouse primary motor cortex (M1). RNA-sequencing analysis of Fezf2-reduced M1 revealed significant changes to the transcriptome, identifying a regulatory role for Fezf2 in the mature M1. Kyoto Encyclopedia Genes and Genomes (KEGG) pathway analyses of Fezf2-regulated genes indicated a role in neuronal signaling and plasticity, with significant enrichment of neuroactive ligand-receptor interaction, cell adhesion molecules and calcium signaling pathways. Gene Ontology analysis supported a functional role for Fezf2-regulated genes in neuronal transmission and additionally indicated an importance in the regulation of behavior. Using the mammalian phenotype ontology database, we identified a significant overrepresentation of Fezf2-regulated genes associated with specific behavior phenotypes, including associative learning, social interaction, locomotor activation and hyperactivity. These roles were distinct from that of Fezf2-regulated genes identified in development, indicating a dynamic transition in Fezf2 function. Together our findings demonstrate a regulatory role for Fezf2 in the mature brain, with Fezf2-regulated genes having functional roles in sustaining normal neuronal and behavioral phenotypes. These results support the hypothesis that developmental transcription factors are important for maintaining neuron transcriptomes and that disruption of their
Yang, Ji; Hocking, Dianna M.; Cheng, Catherine; Dogovski, Con; Perugini, Matthew A.; Holien, Jessica K.; Parker, Michael W.; Hartland, Elizabeth L.; Tauschek, Marija; Robins-Browne, Roy M.
2013-01-01
The misuse of antibiotics during past decades has led to pervasive antibiotic resistance in bacteria. Hence, there is an urgent need for the development of new and alternative approaches to combat bacterial infections. In most bacterial pathogens the expression of virulence is tightly regulated at the transcriptional level. Therefore, targeting pathogens with drugs that interfere with virulence gene expression offers an effective alternative to conventional antimicrobial chemotherapy. Many Gram-negative intestinal pathogens produce AraC-like proteins that control the expression of genes required for infection. In this study we investigated the prototypical AraC-like virulence regulator, RegA, from the mouse attaching and effacing pathogen, Citrobacter rodentium, as a potential drug target. By screening a small molecule chemical library and chemical optimization, we identified two compounds that specifically inhibited the ability of RegA to activate its target promoters and thus reduced expression of a number of proteins required for virulence. Biophysical, biochemical, genetic, and computational analyses indicated that the more potent of these two compounds, which we named regacin, disrupts the DNA binding capacity of RegA by interacting with amino acid residues within a conserved region of the DNA binding domain. Oral administration of regacin to mice, commencing 15 min before or 12 h after oral inoculation with C. rodentium, caused highly significant attenuation of intestinal colonization by the mouse pathogen comparable to that of an isogenic regA-deletion mutant. These findings demonstrate that chemical inhibition of the DNA binding domains of transcriptional regulators is a viable strategy for the development of antimicrobial agents that target bacterial pathogens. PMID:24019519
Varala, Kranthi; Marshall-Colón, Amy; Cirrone, Jacopo; Brooks, Matthew D; Pasquino, Angelo V; Léran, Sophie; Mittal, Shipra; Rock, Tara M; Edwards, Molly B; Kim, Grace J; Ruffel, Sandrine; McCombie, W Richard; Shasha, Dennis; Coruzzi, Gloria M
2018-06-19
This study exploits time, the relatively unexplored fourth dimension of gene regulatory networks (GRNs), to learn the temporal transcriptional logic underlying dynamic nitrogen (N) signaling in plants. Our "just-in-time" analysis of time-series transcriptome data uncovered a temporal cascade of cis elements underlying dynamic N signaling. To infer transcription factor (TF)-target edges in a GRN, we applied a time-based machine learning method to 2,174 dynamic N-responsive genes. We experimentally determined a network precision cutoff, using TF-regulated genome-wide targets of three TF hubs (CRF4, SNZ, and CDF1), used to "prune" the network to 155 TFs and 608 targets. This network precision was reconfirmed using genome-wide TF-target regulation data for four additional TFs (TGA1, HHO5/6, and PHL1) not used in network pruning. These higher-confidence edges in the GRN were further filtered by independent TF-target binding data, used to calculate a TF "N-specificity" index. This refined GRN identifies the temporal relationship of known/validated regulators of N signaling (NLP7/8, TGA1/4, NAC4, HRS1, and LBD37/38/39) and 146 additional regulators. Six TFs-CRF4, SNZ, CDF1, HHO5/6, and PHL1-validated herein regulate a significant number of genes in the dynamic N response, targeting 54% of N-uptake/assimilation pathway genes. Phenotypically, inducible overexpression of CRF4 in planta regulates genes resulting in altered biomass, root development, and 15 NO 3 - uptake, specifically under low-N conditions. This dynamic N-signaling GRN now provides the temporal "transcriptional logic" for 155 candidate TFs to improve nitrogen use efficiency with potential agricultural applications. Broadly, these time-based approaches can uncover the temporal transcriptional logic for any biological response system in biology, agriculture, or medicine. Copyright © 2018 the Author(s). Published by PNAS.
Kim, S; Ip, H S; Lu, M M; Clendenin, C; Parmacek, M S
1997-01-01
The SM22alpha promoter has been used as a model system to define the molecular mechanisms that regulate smooth muscle cell (SMC) specific gene expression during mammalian development. The SM22alpha gene is expressed exclusively in vascular and visceral SMCs during postnatal development and is transiently expressed in the heart and somites during embryogenesis. Analysis of the SM22alpha promoter in transgenic mice revealed that 280 bp of 5' flanking sequence is sufficient to restrict expression of the lacZ reporter gene to arterial SMCs and the myotomal component of the somites. DNase I footprint and electrophoretic mobility shift analyses revealed that the SM22alpha promoter contains six nuclear protein binding sites (designated smooth muscle elements [SMEs] -1 to -6, respectively), two of which bind serum response factor (SRF) (SME-1 and SME-4). Mutational analyses demonstrated that a two-nucleotide substitution that selectively eliminates SRF binding to SME-4 decreases SM22alpha promoter activity in arterial SMCs by approximately 90%. Moreover, mutations that abolish binding of SRF to SME-1 and SME-4 or mutations that eliminate each SME-3 binding activity totally abolished SM22alpha promoter activity in the arterial SMCs and somites of transgenic mice. Finally, we have shown that a multimerized copy of SME-4 (bp -190 to -110) when linked to the minimal SM22alpha promoter (bp -90 to +41) is necessary and sufficient to direct high-level transcription in an SMC lineage-restricted fashion. Taken together, these data demonstrate that distinct transcriptional regulatory programs control SM22alpha gene expression in arterial versus visceral SMCs. Moreover, these data are consistent with a model in which combinatorial interactions between SRF and other transcription factors that bind to SME-4 (and that bind directly to SRF) activate transcription of the SM22alpha gene in arterial SMCs. PMID:9121477
Code of Federal Regulations, 2013 CFR
2013-04-01
... 18 Conservation of Power and Water Resources 1 2013-04-01 2013-04-01 false Transcripts. 1b.12 Section 1b.12 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.12 Transcripts. Transcripts, if any, of...
Code of Federal Regulations, 2014 CFR
2014-04-01
... 18 Conservation of Power and Water Resources 1 2014-04-01 2014-04-01 false Transcripts. 1b.12 Section 1b.12 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.12 Transcripts. Transcripts, if any, of...
Code of Federal Regulations, 2010 CFR
2010-04-01
... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Transcripts. 1b.12 Section 1b.12 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.12 Transcripts. Transcripts, if any, of...
Code of Federal Regulations, 2012 CFR
2012-04-01
... 18 Conservation of Power and Water Resources 1 2012-04-01 2012-04-01 false Transcripts. 1b.12 Section 1b.12 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.12 Transcripts. Transcripts, if any, of...
USDA-ARS?s Scientific Manuscript database
Transcription factors (TFs) are proteins that regulate the expression of target genes by binding to specific elements in their regulatory regions. Transcriptional regulators (TRs) also regulate the expression of target genes; however, they operate indirectly via interaction with the basal transcript...
Jothi, Raja; Balaji, S; Wuster, Arthur; Grochow, Joshua A; Gsponer, Jörg; Przytycka, Teresa M; Aravind, L; Babu, M Madan
2009-01-01
Although several studies have provided important insights into the general principles of biological networks, the link between network organization and the genome-scale dynamics of the underlying entities (genes, mRNAs, and proteins) and its role in systems behavior remain unclear. Here we show that transcription factor (TF) dynamics and regulatory network organization are tightly linked. By classifying TFs in the yeast regulatory network into three hierarchical layers (top, core, and bottom) and integrating diverse genome-scale datasets, we find that the TFs have static and dynamic properties that are similar within a layer and different across layers. At the protein level, the top-layer TFs are relatively abundant, long-lived, and noisy compared with the core- and bottom-layer TFs. Although variability in expression of top-layer TFs might confer a selective advantage, as this permits at least some members in a clonal cell population to initiate a response to changing conditions, tight regulation of the core- and bottom-layer TFs may minimize noise propagation and ensure fidelity in regulation. We propose that the interplay between network organization and TF dynamics could permit differential utilization of the same underlying network by distinct members of a clonal cell population.
Zhang, Yao; Lu, Yu-Xuan; Liu, Jian; Yang, Cui; Feng, Qi-Li; Xu, Wei-Hua
2013-01-01
Insect fat body is the organ for intermediary metabolism, comparable to vertebrate liver and adipose tissue. Larval fat body is disintegrated to individual fat body cells and then adult fat body is remodeled at the pupal stage. However, little is known about the dissociation mechanism. We find that the moth Helicoverpa armigera cathepsin L (Har-CL) is expressed heavily in the fat body and is released from fat body cells into the extracellular matrix. The inhibitor and RNAi experiments demonstrate that Har-CL functions in the fat body dissociation in H. armigera. Further, a nuclear protein is identified to be transcription factor Har-Relish, which was found in insect immune response and specifically binds to the promoter of Har-CL gene to regulate its activity. Har-Relish also responds to the steroid hormone ecdysone. Thus, the dissociation of the larval fat body is involved in the hormone (ecdysone)-transcription factor (Relish)-target gene (cathepsin L) regulatory pathway. PMID:23459255
Ishihama, Akira; Kori, Ayako; Koshio, Etsuko; Yamada, Kayoko; Maeda, Hiroto; Shimada, Tomohiro; Makinoshima, Hideki; Iwata, Akira; Fujita, Nobuyuki
2014-08-01
The expression pattern of the Escherichia coli genome is controlled in part by regulating the utilization of a limited number of RNA polymerases among a total of its approximately 4,600 genes. The distribution pattern of RNA polymerase changes from modulation of two types of protein-protein interactions: the interaction of core RNA polymerase with seven species of the sigma subunit for differential promoter recognition and the interaction of RNA polymerase holoenzyme with about 300 different species of transcription factors (TFs) with regulatory functions. We have been involved in the systematic search for the target promoters recognized by each sigma factor and each TF using the newly developed Genomic SELEX system. In parallel, we developed the promoter-specific (PS)-TF screening system for identification of the whole set of TFs involved in regulation of each promoter. Understanding the regulation of genome transcription also requires knowing the intracellular concentrations of the sigma subunits and TFs under various growth conditions. This report describes the intracellular levels of 65 species of TF with known function in E. coli K-12 W3110 at various phases of cell growth and at various temperatures. The list of intracellular concentrations of the sigma factors and TFs provides a community resource for understanding the transcription regulation of E. coli under various stressful conditions in nature. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Burr, Risa; Stewart, Emerson V; Espenshade, Peter J
2017-03-31
The Mga2 and Sre1 transcription factors regulate oxygen-responsive lipid homeostasis in the fission yeast Schizosaccharomyces pombe in a manner analogous to the mammalian sterol regulatory element-binding protein (SREBP)-1 and SREBP-2 transcription factors. Mga2 and SREBP-1 regulate triacylglycerol and glycerophospholipid synthesis, whereas Sre1 and SREBP-2 regulate sterol synthesis. In mammals, a shared activation mechanism allows for coordinate regulation of SREBP-1 and SREBP-2. In contrast, distinct pathways activate fission yeast Mga2 and Sre1. Therefore, it is unclear whether and how these two related pathways are coordinated to maintain lipid balance in fission yeast. Previously, we showed that Sre1 cleavage is defective in the absence of mga2 Here, we report that this defect is due to deficient unsaturated fatty acid synthesis, resulting in aberrant membrane transport. This defect is recapitulated by treatment with the fatty acid synthase inhibitor cerulenin and is rescued by addition of exogenous unsaturated fatty acids. Furthermore, sterol synthesis inhibition blocks Mga2 pathway activation. Together, these data demonstrate that Sre1 and Mga2 are each regulated by the lipid product of the other transcription factor pathway, providing a source of coordination for these two branches of lipid synthesis. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Peng, Chuangang; Yang, Qi; Wei, Bo; Liu, Yong; Li, Yuxiang; Gu, Dawei; Yin, Guochao; Wang, Bo; Xu, Dehui; Zhang, Xuebing; Kong, Daliang
2017-07-01
The aim was to research the molecular changes of bone cells induced by excessive dose of vitamin A, and analyze molecular mechanism underlying spontaneous fracture. The gene expression profile of GSE29859, including 4 cortical bone marrow samples with excessive doses of Vitamin A and 4 control cortical bone marrow samples, was obtained from the Gene Expression Omnibus (GEO) database. Differentially expressed genes (DGEs) between cortical bone marrow samples and control samples were screened out and pathway enrichment analysis was undertaken. Based on the MSigDB database, the potential regulatory transcription factors (TFs) were identified. A total of 373 DEGs including 342 up- and 31 down-regulated genes were identified. These DEGs were significantly enriched in pathways of protein processing in endoplasmic reticulum, ubiquitin mediated proteolysis and glycerophospholipid metabolism. Finally, the most significant regulatory TFs were obtained, including E2F Transcription Factor 1 (E2F1), GA Binding Protein Transcription Factor (GABP), Nuclear Factor, Erythroid 2-Like 2 (NRF2) and ELK1, Member of ETS Oncogene Family (ELK1). Key TFs including E2F1, GABP, NRF2 and ELK1 and their targets genes such as Ube2d3, Uba1, Phb2 and Tomm22 may play potential key roles in spontaneous fracture induced by hypervitaminosis A. The pathways of protein processing in endoplasmic reticulum, ubiquitin mediated proteolysis and glycerophospholipid metabolism may be key mechanisms involved in spontaneous fracture induced by hypervitaminosis A. Our findings will provide new insights for the target selection in clinical application to prevent spontaneous fracture induced by hypervitaminosis A. Copyright © 2017 Elsevier Ltd. All rights reserved.
Transcriptional Response of Nitrifying Communities to Wetting of Dry Soil
Firestone, Mary K.
2013-01-01
The first rainfall following a severe dry period provides an abrupt water potential change that is both an acute physiological stress and a defined stimulus for the reawakening of soil microbial communities. We followed the responses of indigenous communities of ammonia-oxidizing bacteria, ammonia-oxidizing archaea, and nitrite-oxidizing bacteria to the addition of water to laboratory incubations of soils taken from two California annual grasslands following a typically dry Mediterranean summer. By quantifying transcripts for a subunit of bacterial and archaeal ammonia monooxygenases (amoA) and a bacterial nitrite oxidoreductase (nxrA) in soil from 15 min to 72 h after water addition, we identified transcriptional response patterns for each of these three groups of nitrifiers. An increase in quantity of bacterial amoA transcripts was detectable within 1 h of wet-up and continued until the size of the ammonium pool began to decrease, reflecting a possible role of transcription in upregulation of nitrification after drought-induced stasis. In one soil, the pulse of amoA transcription lasted for less than 24 h, demonstrating the transience of transcriptional pools and the tight coupling of transcription to the local soil environment. Analysis of 16S rRNA using a high-density microarray suggested that nitrite-oxidizing Nitrobacter spp. respond in tandem with ammonia-oxidizing bacteria while nitrite-oxidizing Nitrospina spp. and Nitrospira bacteria may not. Archaeal ammonia oxidizers may respond slightly later than bacterial ammonia oxidizers but may maintain elevated transcription longer. Despite months of desiccation-induced inactivation, we found rapid transcriptional response by all three groups of soil nitrifiers. PMID:23524666
Investigating the transcriptional control of cardiovascular development
Kathiriya, Irfan S.; Nora, Elphege P.; Bruneau, Benoit G.
2015-01-01
Transcriptional regulation of thousands of genes instructs complex morphogenetic and molecular events for heart development. Cardiac transcription factors (TFs) choreograph gene expression at each stage of differentiation by interacting with co-factors, including chromatin-modifying enzymes, and by binding to a constellation of regulatory DNA elements. Here, we present salient examples relevant to cardiovascular development and heart disease and review techniques that can sharpen our understanding of cardiovascular biology. We discuss the interplay between cardiac TFs, cis-regulatory elements and chromatin as dynamic regulatory networks, to orchestrate sequential deployment of the cardiac gene expression program. PMID:25677518
Alzan, Heba F; Knowles, Donald P; Suarez, Carlos E
2016-11-01
Apicomplexa tick-borne hemoparasites, including Babesia bovis, Babesia microti, and Theileria equi are responsible for bovine and human babesiosis and equine theileriosis, respectively. These parasites of vast medical, epidemiological, and economic impact have complex life cycles in their vertebrate and tick hosts. Large gaps in knowledge concerning the mechanisms used by these parasites for gene regulation remain. Regulatory genes coding for DNA binding proteins such as members of the Api-AP2, HMG, and Myb families are known to play crucial roles as transcription factors. Although the repertoire of Api-AP2 has been defined and a HMG gene was previously identified in the B. bovis genome, these regulatory genes have not been described in detail in B. microti and T. equi. In this study, comparative bioinformatics was used to: (i) identify and map genes encoding for these transcription factors among three parasites' genomes; (ii) identify a previously unreported HMG gene in B. microti; (iii) define a repertoire of eight conserved Myb genes; and (iv) identify AP2 correlates among B. bovis and the better-studied Plasmodium parasites. Searching the available transcriptome of B. bovis defined patterns of transcription of these three gene families in B. bovis erythrocyte stage parasites. Sequence comparisons show conservation of functional domains and general architecture in the AP2, Myb, and HMG proteins, which may be significant for the regulation of common critical parasite life cycle transitions in B. bovis, B. microti, and T. equi. A detailed understanding of the role of gene families encoding DNA binding proteins will provide new tools for unraveling regulatory mechanisms involved in B. bovis, B. microti, and T. equi life cycles and environmental adaptive responses and potentially contributes to the development of novel convergent strategies for improved control of babesiosis and equine piroplasmosis.
Integrated Module and Gene-Specific Regulatory Inference Implicates Upstream Signaling Networks
Roy, Sushmita; Lagree, Stephen; Hou, Zhonggang; Thomson, James A.; Stewart, Ron; Gasch, Audrey P.
2013-01-01
Regulatory networks that control gene expression are important in diverse biological contexts including stress response and development. Each gene's regulatory program is determined by module-level regulation (e.g. co-regulation via the same signaling system), as well as gene-specific determinants that can fine-tune expression. We present a novel approach, Modular regulatory network learning with per gene information (MERLIN), that infers regulatory programs for individual genes while probabilistically constraining these programs to reveal module-level organization of regulatory networks. Using edge-, regulator- and module-based comparisons of simulated networks of known ground truth, we find MERLIN reconstructs regulatory programs of individual genes as well or better than existing approaches of network reconstruction, while additionally identifying modular organization of the regulatory networks. We use MERLIN to dissect global transcriptional behavior in two biological contexts: yeast stress response and human embryonic stem cell differentiation. Regulatory modules inferred by MERLIN capture co-regulatory relationships between signaling proteins and downstream transcription factors thereby revealing the upstream signaling systems controlling transcriptional responses. The inferred networks are enriched for regulators with genetic or physical interactions, supporting the inference, and identify modules of functionally related genes bound by the same transcriptional regulators. Our method combines the strengths of per-gene and per-module methods to reveal new insights into transcriptional regulation in stress and development. PMID:24146602
Salehipour, Pouya; Nematzadeh, Mahsa; Mobasheri, Maryam Beigom; Afsharpad, Mandana; Mansouri, Kamran; Modarressi, Mohammad Hossein
2017-09-01
Testis specific gene antigen 10 (TSGA10) is a cancer testis antigen involved in the process of spermatogenesis. TSGA10 could also play an important role in the inhibition of angiogenesis by preventing nuclear localization of HIF-1α. Although it has been shown that TSGA10 messenger RNA (mRNA) is mainly expressed in testis and some tumors, the transcription pattern and regulatory mechanisms of this gene remain largely unknown. Here, we report that human TSGA10 comprises at least 22 exons and generates four different transcript variants. It was identified that using two distinct promoters and splicing of exons 4 and 7 produced these transcript variants, which have the same coding sequence, but the sequence of 5'untanslated region (5'UTR) is different between them. This is significant because conserved regulatory RNA elements like upstream open reading frame (uORF) and putative internal ribosome entry site (IRES) were found in this region which have different combinations in each transcript variant and it may influence translational efficiency of them in normal or unusual environmental conditions like hypoxia. To indicate the transcription pattern of TSGA10 in breast cancer, expression of identified transcript variants was analyzed in 62 breast cancer samples. We found that TSGA10 tends to express variants with shorter 5'UTR and fewer uORF elements in breast cancer tissues. Our study demonstrates for the first time the expression of different TSGA10 transcript variants in testis and breast cancer tissues and provides a first clue to a role of TSGA10 5'UTR in regulation of translation in unusual environmental conditions like hypoxia. Copyright © 2017. Published by Elsevier B.V.
Suetomi, Yuta; Matsuda, Fuko; Uenoyama, Yoshihisa; Maeda, Kei-ichiro; Tsukamura, Hiroko; Ohkura, Satoshi
2013-10-01
Neurokinin B (NKB), encoded by TAC3, is thought to be an important accelerator of pulsatile gonadotropin-releasing hormone release. This study aimed to clarify the transcriptional regulatory mechanism of goat TAC3. First, we determined the full-length mRNA sequence of goat TAC3 from the hypothalamus to be 820 b, including a 381 b coding region, with the putative transcription start site located 143-b upstream of the start codon. The deduced amino acid sequence of NKB, which is produced from preproNKB, was completely conserved among goat, cattle, and human. Next, we cloned 5'-upstream region of goat TAC3 up to 3400 b from the translation initiation site, and this region was highly homologous with cattle TAC3 (89%). We used this goat TAC3 5'-upstream region to perform luciferase assays. We created a luciferase reporter vector containing DNA constructs from -2706, -1837, -834, -335, or -197 to +166 bp (the putative transcription start site was designated as +1) of goat TAC3 and these were transiently transfected into mouse hypothalamus-derived N7 cells and human neuroblastoma-derived SK-N-AS cells. The luciferase activity gradually increased with the deletion of the 5'-upstream region, suggesting that the transcriptional suppressive region is located between -2706 and -336 bp and that the core promoter exists downstream of -197 bp. Estradiol treatment did not lead to significant suppression of luciferase activity of any constructs, suggesting the existence of other factor(s) that regulate goat TAC3 transcription.
Sheehy, Samuel; Annabi, Borhane
2017-01-01
Signal-transducing functions driven by the cytoplasmic domain of membrane type-1 matrix metalloproteinase (MT1-MMP) are believed to regulate many inflammation-associated cancer cell functions including migration, proliferation, and survival. Aside from upregulation of the inflammation biomarker cyclooxygenase-2 (COX-2) expression, MT1-MMP's role in relaying intracellular signals triggered by extracellular pro-inflammatory cues remains poorly understood. Here, we triggered inflammation in HT1080 fibrosarcoma cells with phorbol-12-myristate-13-acetate (PMA), an inducer of COX-2 and of MT1-MMP. To assess the global transcriptional regulatory role that MT1-MMP may exert on inflammation biomarkers, we combined gene array screens with a transient MT1-MMP gene silencing strategy. Expression of MT1-MMP was found to exert both stimulatory and repressive transcriptional control of several inflammasome-related biomarkers such as interleukin (IL)-1B, IL-6, IL-12A, and IL-33, as well as of transcription factors such as EGR1, ELK1, and ETS1/2 in PMA-treated cells. Among the signal-transducing pathways explored, the silencing of MT1-MMP prevented PMA from phosphorylating extracellular signal-regulated kinase, inhibitor of κB, and p105 nuclear factor κB (NF-κB) intermediates. We also found a signaling axis linking MT1-MMP to MMP-9 transcriptional regulation. Altogether, our data indicate a significant involvement of MT1-MMP in the transcriptional regulation of inflammatory biomarkers consolidating its contribution to signal transduction functions in addition to its classical hydrolytic activity.
Reilman, Ewoud; Mars, Ruben A T; van Dijl, Jan Maarten; Denham, Emma L
2014-10-01
Expression of particular drug transporters in response to antibiotic pressure is a critical element in the development of bacterial multidrug resistance, and represents a serious concern for human health. To obtain a better understanding of underlying regulatory mechanisms, we have dissected the transcriptional activation of the ATP-binding cassette (ABC) transporter BmrC/BmrD of the Gram-positive model bacterium Bacillus subtilis. By using promoter-GFP fusions and live cell array technology, we demonstrate a temporally controlled transcriptional activation of the bmrCD genes in response to antibiotics that target protein synthesis. Intriguingly, bmrCD expression only occurs during the late-exponential and stationary growth stages, irrespective of the timing of the antibiotic challenge. We show that this is due to tight transcriptional control by the transition state regulator AbrB. Moreover, our results show that the bmrCD genes are co-transcribed with bmrB (yheJ), a small open reading frame immediately upstream of bmrC that harbors three alternative stem-loop structures. These stem-loops are apparently crucial for antibiotic-induced bmrCD transcription. Importantly, the antibiotic-induced bmrCD expression requires translation of bmrB, which implies that BmrB serves as a regulatory leader peptide. Altogether, we demonstrate for the first time that a ribosome-mediated transcriptional attenuation mechanism can control the expression of a multidrug ABC transporter. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Prevalence of transcription promoters within archaeal operons and coding sequences
Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S
2009-01-01
Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of ∼64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein–DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3′ ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes—events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements. PMID:19536208
Prevalence of transcription promoters within archaeal operons and coding sequences.
Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S
2009-01-01
Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.
Yeh, Hsiang-Yuan; Cheng, Shih-Wu; Lin, Yu-Chun; Yeh, Cheng-Yu; Lin, Shih-Fang; Soo, Von-Wun
2009-12-21
Prostate cancer is a world wide leading cancer and it is characterized by its aggressive metastasis. According to the clinical heterogeneity, prostate cancer displays different stages and grades related to the aggressive metastasis disease. Although numerous studies used microarray analysis and traditional clustering method to identify the individual genes during the disease processes, the important gene regulations remain unclear. We present a computational method for inferring genetic regulatory networks from micorarray data automatically with transcription factor analysis and conditional independence testing to explore the potential significant gene regulatory networks that are correlated with cancer, tumor grade and stage in the prostate cancer. To deal with missing values in microarray data, we used a K-nearest-neighbors (KNN) algorithm to determine the precise expression values. We applied web services technology to wrap the bioinformatics toolkits and databases to automatically extract the promoter regions of DNA sequences and predicted the transcription factors that regulate the gene expressions. We adopt the microarray datasets consists of 62 primary tumors, 41 normal prostate tissues from Stanford Microarray Database (SMD) as a target dataset to evaluate our method. The predicted results showed that the possible biomarker genes related to cancer and denoted the androgen functions and processes may be in the development of the prostate cancer and promote the cell death in cell cycle. Our predicted results showed that sub-networks of genes SREBF1, STAT6 and PBX1 are strongly related to a high extent while ETS transcription factors ELK1, JUN and EGR2 are related to a low extent. Gene SLC22A3 may explain clinically the differentiation associated with the high grade cancer compared with low grade cancer. Enhancer of Zeste Homolg 2 (EZH2) regulated by RUNX1 and STAT3 is correlated to the pathological stage. We provide a computational framework to reconstruct
2009-01-01
Background Prostate cancer is a world wide leading cancer and it is characterized by its aggressive metastasis. According to the clinical heterogeneity, prostate cancer displays different stages and grades related to the aggressive metastasis disease. Although numerous studies used microarray analysis and traditional clustering method to identify the individual genes during the disease processes, the important gene regulations remain unclear. We present a computational method for inferring genetic regulatory networks from micorarray data automatically with transcription factor analysis and conditional independence testing to explore the potential significant gene regulatory networks that are correlated with cancer, tumor grade and stage in the prostate cancer. Results To deal with missing values in microarray data, we used a K-nearest-neighbors (KNN) algorithm to determine the precise expression values. We applied web services technology to wrap the bioinformatics toolkits and databases to automatically extract the promoter regions of DNA sequences and predicted the transcription factors that regulate the gene expressions. We adopt the microarray datasets consists of 62 primary tumors, 41 normal prostate tissues from Stanford Microarray Database (SMD) as a target dataset to evaluate our method. The predicted results showed that the possible biomarker genes related to cancer and denoted the androgen functions and processes may be in the development of the prostate cancer and promote the cell death in cell cycle. Our predicted results showed that sub-networks of genes SREBF1, STAT6 and PBX1 are strongly related to a high extent while ETS transcription factors ELK1, JUN and EGR2 are related to a low extent. Gene SLC22A3 may explain clinically the differentiation associated with the high grade cancer compared with low grade cancer. Enhancer of Zeste Homolg 2 (EZH2) regulated by RUNX1 and STAT3 is correlated to the pathological stage. Conclusions We provide a
Genome engineering and gene expression control for bacterial strain development.
Song, Chan Woo; Lee, Joungmin; Lee, Sang Yup
2015-01-01
In recent years, a number of techniques and tools have been developed for genome engineering and gene expression control to achieve desired phenotypes of various bacteria. Here we review and discuss the recent advances in bacterial genome manipulation and gene expression control techniques, and their actual uses with accompanying examples. Genome engineering has been commonly performed based on homologous recombination. During such genome manipulation, the counterselection systems employing SacB or nucleases have mainly been used for the efficient selection of desired engineered strains. The recombineering technology enables simple and more rapid manipulation of the bacterial genome. The group II intron-mediated genome engineering technology is another option for some bacteria that are difficult to be engineered by homologous recombination. Due to the increasing demands on high-throughput screening of bacterial strains having the desired phenotypes, several multiplex genome engineering techniques have recently been developed and validated in some bacteria. Another approach to achieve desired bacterial phenotypes is the repression of target gene expression without the modification of genome sequences. This can be performed by expressing antisense RNA, small regulatory RNA, or CRISPR RNA to repress target gene expression at the transcriptional or translational level. All of these techniques allow efficient and rapid development and screening of bacterial strains having desired phenotypes, and more advanced techniques are expected to be seen. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bone sialoprotein and its transcriptional regulatory mechanism.
Ogata, Y
2008-04-01
Bone sialoprotein is a mineralized tissue-specific noncollagenous protein that is glycosylated, phosphorylated and sulfated. The temporo-spatial deposition of bone sialoprotein into the extracellular matrix of bone, and the ability of bone sialoprotein to nucleate hydroxyapatite crystal formation, indicates a potential role for bone sialoprotein in the initial mineralization of bone, dentin and cementum. Bone sialoprotein is also expressed in breast, lung, thyroid and prostate cancers. We used osteoblast-like cells (rat osteosarcoma cell lines ROS17/2.8 and UMR106, rat stromal bone marrow RBMC-D8 cells and human osteosarcoma Saos2 cells), and breast and prostate cancer cells to investigate the transcriptional regulation of bone sialoprotein. To determine the molecular basis of the transcriptional regulation of the bone sialoprotein gene, we conducted northern hybridization, transient transfection analyses with chimeric constructs of the bone sialoprotein gene promoter linked to a luciferase reporter gene and gel mobility shift assays. Bone sialoprotein transcription is regulated by hormones, growth factors and cytokines through tyrosine kinase, mitogen-activated protein kinase and cAMP-dependent pathways. Microcalcifications are often associated with human mammary lesions, particularly with breast carcinomas. Expression of bone sialoprotein by cancer cells could play a major role in the mineral deposition and in preferred bone homing of breast cancer cells. Bone sialoprotein protects cells from complement-mediated cellular lysis, activates matrix metalloproteinase 2 and has an angiogenic capacity. Therefore, regulation of the bone sialoprotein gene is potentially important in the differentiation of osteoblasts, bone matrix mineralization and tumor metastasis. This review highlights the function and transcriptional regulation of bone sialoprotein.
Gans, Jonathan; Osborne, Jonathan; Cheng, Juliet; Djapgne, Louise; Oglesby-Sherrouse, Amanda G
2018-01-01
Bacterial small RNA molecules (sRNAs) are increasingly recognized as central regulators of bacterial stress responses and pathogenesis. In many cases, RNA-binding proteins are critical for the stability and function of sRNAs. Previous studies have adopted strategies to genetically tag an sRNA of interest, allowing isolation of RNA-protein complexes from cells. Here we present a sequence-specific affinity purification protocol that requires no prior genetic manipulation of bacterial cells, allowing isolation of RNA-binding proteins bound to native RNA molecules.
Straub, Cécile; Castellote, Jessie; Onesime, Djamila; Bonnarme, Pascal; Irlinger, Françoise
2013-01-01
The cheese microbiota contributes to a large extent to the development of the typical color, flavor, and texture of the final product. Its composition is not well defined in most cases and varies from one cheese to another. The aim of the present study was to establish procedures for gene transcript quantification in cheeses by reverse transcription-quantitative PCR. Total RNA was extracted from five smear-ripened cheeses purchased on the retail market, using a method that does not involve prior separation of microbial cells. 16S rRNA and malate:quinone oxidoreductase gene transcripts of Corynebacterium casei, Brevibacterium aurantiacum, and Arthrobacter arilaitensis and 26S rRNA and beta tubulin gene transcripts of Geotrichum candidum and Debaryomyces hansenii could be detected and quantified in most of the samples. Three types of normalization were applied: against total RNA, against the amount of cheese, and against a reference gene. For the first two types of normalization, differences of reverse transcription efficiencies from one sample to another were taken into account by analysis of exogenous control mRNA. No good correlation was found between the abundances of target mRNA or rRNA transcripts and the viable cell concentration of the corresponding species. However, in most cases, no mRNA transcripts were detected for species that did not belong to the dominant species. The applications of gene expression measurement in cheeses containing an undefined microbiota, as well as issues concerning the strategy of normalization and the assessment of amplification specificity, are discussed. PMID:23124230
diCenzo, George C; Wellappili, Deelaka; Golding, G Brian; Finan, Turlough M
2018-05-04
Integration of newly acquired genes into existing regulatory networks is necessary for successful horizontal gene transfer (HGT). Ten percent of bacterial species contain at least two DNA replicons over 300 kilobases in size, with the secondary replicons derived predominately through HGT. The Sinorhizobium meliloti genome is split between a 3.7 Mb chromosome, a 1.7 Mb chromid consisting largely of genes acquired through ancient HGT, and a 1.4 Mb megaplasmid consisting primarily of recently acquired genes. Here, RNA-sequencing is used to examine the transcriptional consequences of massive, synthetic genome reduction produced through the removal of the megaplasmid and/or the chromid. Removal of the pSymA megaplasmid influenced the transcription of only six genes. In contrast, removal of the chromid influenced expression of ∼8% of chromosomal genes and ∼4% of megaplasmid genes. This was mediated in part by the loss of the ETR DNA region whose presence on pSymB is due to a translocation from the chromosome. No obvious functional bias among the up-regulated genes was detected, although genes with putative homologs on the chromid were enriched. Down-regulated genes were enriched in motility and sensory transduction pathways. Four transcripts were examined further, and in each case the transcriptional change could be traced to loss of specific pSymB regions. In particularly, a chromosomal transporter was induced due to deletion of bdhA likely mediated through 3-hydroxybutyrate accumulation. These data provide new insights into the evolution of the multipartite bacterial genome, and more generally into the integration of horizontally acquired genes into the transcriptome. Copyright © 2018 diCenzo, et al.
R-loops in bacterial transcription: their causes and consequences.
Gowrishankar, J; Leela, J Krishna; Anupama, K
2013-01-01
Nascent untranslated transcripts in bacteria are prone to generating RNA-DNA hybrids (R-loops); Rho-dependent transcription termination acts to reduce their prevalence. Here we discuss the mechanisms of R-loop formation and growth inhibition in bacteria.
José-Edwards, Diana S; Kerner, Pierre; Kugler, Jamie E; Deng, Wei; Jiang, Di; Di Gregorio, Anna
2011-07-01
The notochord is the distinctive characteristic of chordates; however, the knowledge of the complement of transcription factors governing the development of this structure is still incomplete. Here we present the expression patterns of seven transcription factor genes detected in the notochord of the ascidian Ciona intestinalis at various stages of embryonic development. Four of these transcription factors, Fos-a, NFAT5, AFF and Klf15, have not been directly associated with the notochord in previous studies, while the others, including Spalt-like-a, Lmx-like, and STAT5/6-b, display evolutionarily conserved expression in this structure as well as in other domains. We examined the hierarchical relationships between these genes and the transcription factor Brachyury, which is necessary for notochord development in all chordates. We found that Ciona Brachyury regulates the expression of most, although not all, of these genes. These results shed light on the genetic regulatory program underlying notochord formation in Ciona and possibly other chordates. Copyright © 2011 Wiley-Liss, Inc.
José-Edwards, Diana S.; Kerner, Pierre; Kugler, Jamie E.; Deng, Wei; Jiang, Di; Di Gregorio, Anna
2013-01-01
The notochord is the distinctive characteristic of chordates; however, the knowledge of the complement of transcription factors governing the development of this structure is still incomplete. Here we present the expression patterns of seven transcription factor genes detected in the notochord of the ascidian Ciona intestinalis at various stages of embryonic development. Four of these transcription factors, Fos-a, NFAT5, AFF and Klf15, have not been directly associated with the notochord in previous studies, while the others, including Spalt-like-a, Lmx-like and STAT5/6-b, display evolutionarily conserved expression in this structure as well as in other domains. We examined the hierarchical relationships between these genes and the transcription factor Brachyury, which is necessary for notochord development in all chordates. We found that Ciona Brachyury regulates the expression of most, although not all, of these genes. These results shed light on the genetic regulatory program underlying notochord formation in Ciona and possibly other chordates. PMID:21594950
Chiang-Ni, Chuan; Tsou, Chih-Cheng; Lin, Yee-Shin; Chuang, Woei-Jer; Lin, Ming-T; Liu, Ching-Chuan; Wu, Jiunn-Jong
2008-12-31
CovR/S is an important two component regulatory system, which regulates about 15% of the gene expression in Streptococcus pyogenes. The covR/S locus was identified as an operon generating an RNA transcript around 2.5-kb in size. In this study, we found the covR/S operon produced three RNA transcripts (around 2.5-, 1.0-, and 0.8-kb in size). Using RNA transcriptional terminator sequence prediction and transcriptional terminator analysis, we identified two atypical rho-independent terminator sequences downstream of the covR gene and showed these terminator sequences terminate RNA transcription efficiently. These results indicate that covR/S operon generates covR/S transcript and monocistronic covR transcripts.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Banerjee, Poulabi; Bahlo, Melanie; Schwartz, Jody R.
2002-01-01
Genome wide disease association analysis using SNPs is being explored as a method for dissecting complex genetic traits and a vast number of SNPs have been generated for this purpose. As there are cost and throughput limitations of genotyping large numbers of SNPs and statistical issues regarding the large number of dependent tests on the same data set, to make association analysis practical it has been proposed that SNPs should be prioritized based on likely functional importance. The most easily identifiable functional SNPs are coding SNPs (cSNPs) and accordingly cSNPs have been screened in a number of studies. SNPs inmore » gene regulatory sequences embedded in noncoding DNA are another class of SNPs suggested for prioritization due to their predicted quantitative impact on gene expression. The main challenge in evaluating these SNPs, in contrast to cSNPs is a lack of robust algorithms and databases for recognizing regulatory sequences in noncoding DNA. Approaches that have been previously used to delineate noncoding sequences with gene regulatory activity include cross-species sequence comparisons and the search for sequences recognized by transcription factors. We combined these two methods to sift through mouse human genomic sequences to identify putative gene regulatory elements and subsequently localized SNPs within these sequences in a 1 Megabase (Mb) region of human chromosome 5q31, orthologous to mouse chromosome 11 containing the Interleukin cluster.« less
Evolutionary divergence of vertebrate Hoxb2 expression patterns and transcriptional regulatory loci.
Scemama, Jean-Luc; Hunter, Michael; McCallum, Jeff; Prince, Victoria; Stellwag, Edmund
2002-10-15
Hox gene expression is regulated by a complex array of cis-acting elements that control spatial and temporal gene expression in developing embryos. Here, we report the isolation of the striped bass Hoxb2a gene, comparison of its expression to the orthologous gene from zebrafish, and comparative genomic analysis of the upstream regulatory region to that of other vertebrates. Comparison of the Hoxb2a gene expression patterns from striped bass to zebrafish revealed similar expression patterns within rhombomeres 3, 4, and 5 of the hindbrain but a notable absence of expression in neural crest tissues of striped bass while neural crest expression is observed in zebrafish and common to other vertebrates. Comparative genomic analysis of the striped bass Hoxb2a-b3a intergenic region to those from zebrafish, pufferfish, human, and mouse demonstrated the presence of common Meis, Hox/Pbx, Krox-20, and Box 1 elements, which are necessary for rhombomere 3, 4, and 5 expression. Despite their common occurrence, the location and orientation of these transcription elements differed among the five species analyzed, such that Krox-20 and Box 1 elements are located 3' to the Meis, Hox/Pbx elements in striped bass, pufferfish, and human while they are located 5' of this r4 enhancer in zebrafish and mouse. Our results suggest that the plasticity exhibited in the organization of key regulatory elements responsible for rhombomere-specific Hoxb2a expression may reflect the effects of stabilizing selection in the evolution cis-acting elements. Copyright 2002 Wiley-Liss, Inc.
Hu, Guangan; Chen, Jianzhu
2014-01-01
Memory CD8+ T cell development is defined by the expression of a specific set of memory signature genes (MSGs). Despite recent progress, many components of the transcriptional control of memory CD8+ T cell development are still unknown. To identify transcription factors (TFs) and their interactions in memory CD8+ T cell development, we construct a genome-wide regulatory network and apply it to identify key TFs that regulate MSGs. Most of the known TFs in memory CD8+ T cell development are rediscovered and about a dozen new TFs are also identified. Sox4, Bhlhe40, Bach2 and Runx2 are experimentally verified and Bach2 is further shown to promote both development and recall proliferation of memory CD8+ T cells through Prdm1 and Id3. Gene perturbation study identifies the mode of interactions among the TFs with Sox4 as a hub. The identified TFs and insights into their interactions should facilitate further dissection of molecular mechanisms underlying memory CD8+ T cell development. PMID:24335726
An integrated approach to reconstructing genome-scale transcriptional regulatory networks
Imam, Saheed; Noguera, Daniel R.; Donohue, Timothy J.; ...
2015-02-27
Transcriptional regulatory networks (TRNs) program cells to dynamically alter their gene expression in response to changing internal or environmental conditions. In this study, we develop a novel workflow for generating large-scale TRN models that integrates comparative genomics data, global gene expression analyses, and intrinsic properties of transcription factors (TFs). An assessment of this workflow using benchmark datasets for the well-studied γ-proteobacterium Escherichia coli showed that it outperforms expression-based inference approaches, having a significantly larger area under the precision-recall curve. Further analysis indicated that this integrated workflow captures different aspects of the E. coli TRN than expression-based approaches, potentially making themmore » highly complementary. We leveraged this new workflow and observations to build a large-scale TRN model for the α-Proteobacterium Rhodobacter sphaeroides that comprises 120 gene clusters, 1211 genes (including 93 TFs), 1858 predicted protein-DNA interactions and 76 DNA binding motifs. We found that ~67% of the predicted gene clusters in this TRN are enriched for functions ranging from photosynthesis or central carbon metabolism to environmental stress responses. We also found that members of many of the predicted gene clusters were consistent with prior knowledge in R. sphaeroides and/or other bacteria. Experimental validation of predictions from this R. sphaeroides TRN model showed that high precision and recall was also obtained for TFs involved in photosynthesis (PpsR), carbon metabolism (RSP_0489) and iron homeostasis (RSP_3341). In addition, this integrative approach enabled generation of TRNs with increased information content relative to R. sphaeroides TRN models built via other approaches. We also show how this approach can be used to simultaneously produce TRN models for each related organism used in the comparative genomics analysis. Our results highlight the advantages of
Rincon, Melvin Y; Sarcar, Shilpita; Danso-Abeam, Dina; Keyaerts, Marleen; Matrai, Janka; Samara-Kuko, Ermira; Acosta-Sanchez, Abel; Athanasopoulos, Takis; Dickson, George; Lahoutte, Tony; De Bleser, Pieter; VandenDriessche, Thierry; Chuah, Marinee K
2015-01-01
Gene therapy is a promising emerging therapeutic modality for the treatment of cardiovascular diseases and hereditary diseases that afflict the heart. Hence, there is a need to develop robust cardiac-specific expression modules that allow for stable expression of the gene of interest in cardiomyocytes. We therefore explored a new approach based on a genome-wide bioinformatics strategy that revealed novel cardiac-specific cis-acting regulatory modules (CS-CRMs). These transcriptional modules contained evolutionary-conserved clusters of putative transcription factor binding sites that correspond to a "molecular signature" associated with robust gene expression in the heart. We then validated these CS-CRMs in vivo using an adeno-associated viral vector serotype 9 that drives a reporter gene from a quintessential cardiac-specific α-myosin heavy chain promoter. Most de novo designed CS-CRMs resulted in a >10-fold increase in cardiac gene expression. The most robust CRMs enhanced cardiac-specific transcription 70- to 100-fold. Expression was sustained and restricted to cardiomyocytes. We then combined the most potent CS-CRM4 with a synthetic heart and muscle-specific promoter (SPc5-12) and obtained a significant 20-fold increase in cardiac gene expression compared to the cytomegalovirus promoter. This study underscores the potential of rational vector design to improve the robustness of cardiac gene therapy.
The Role of Multiple Transcription Factors In Archaeal Gene Expression
DOE Office of Scientific and Technical Information (OSTI.GOV)
Charles J. Daniels
2008-09-23
Since the inception of this research program, the project has focused on two central questions: What is the relationship between the 'eukaryal-like' transcription machinery of archaeal cells and its counterparts in eukaryal cells? And, how does the archaeal cell control gene expression using its mosaic of eukaryal core transcription machinery and its bacterial-like transcription regulatory proteins? During the grant period we have addressed these questions using a variety of in vivo approaches and have sought to specifically define the roles of the multiple TATA binding protein (TBP) and TFIIB-like (TFB) proteins in controlling gene expression in Haloferax volcanii. H. volcaniimore » was initially chosen as a model for the Archaea based on the availability of suitable genetic tools; however, later studies showed that all haloarchaea possessed multiple tbp and tfb genes, which led to the proposal that multiple TBP and TFB proteins may function in a manner similar to alternative sigma factors in bacterial cells. In vivo transcription and promoter analysis established a clear relationship between the promoter requirements of haloarchaeal genes and those of the eukaryal RNA polymerase II promoter. Studies on heat shock gene promoters, and the demonstration that specific tfb genes were induced by heat shock, provided the first indication that TFB proteins may direct expression of specific gene families. The construction of strains lacking tbp or tfb genes, coupled with the finding that many of these genes are differentially expressed under varying growth conditions, provided further support for this model. Genetic tools were also developed that led to the construction of insertion and deletion mutants, and a novel gene expression scheme was designed that allowed the controlled expression of these genes in vivo. More recent studies have used a whole genome array to examine the expression of these genes and we have established a linkage between the expression of
Evolutionary patterns of Escherichia coli small RNAs and their regulatory interactions.
Peer, Asaf; Margalit, Hanah
2014-07-01
Most bacterial small RNAs (sRNAs) are post-transcriptional regulators of gene expression, exerting their regulatory function by base-pairing with their target mRNAs. While it has become evident that sRNAs play central regulatory roles in the cell, little is known about their evolution and the evolution of their regulatory interactions. Here we used the prokaryotic phylogenetic tree to reconstruct the evolutionary history of Escherichia coli sRNAs and their binding sites on target mRNAs. We discovered that sRNAs currently present in E. coli mainly accumulated inside the Enterobacteriales order, succeeding the appearance of other types of noncoding RNAs and concurrently with the evolution of a variant of the Hfq protein exhibiting a longer C-terminal region. Our analysis of the evolutionary ages of sRNA-mRNA interactions revealed that while all sRNAs were evolutionarily older than most of their known binding sites on mRNA targets, for quite a few sRNAs there was at least one binding site that coappeared with or preceded them. It is conceivable that the establishment of these first interactions forced selective pressure on the sRNAs, after which additional targets were acquired by fitting a binding site to the active region of the sRNA. This conjecture is supported by the appearance of many binding sites on target mRNAs only after the sRNA gain, despite the prior presence of the target gene in ancestral genomes. Our results suggest a selective mechanism that maintained the sRNAs across the phylogenetic tree, and shed light on the evolution of E. coli post-transcriptional regulatory network. © 2014 Peer and Margalit; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Regulatory states in the developmental control of gene expression.
Peter, Isabelle S
2017-09-01
A growing body of evidence shows that gene expression in multicellular organisms is controlled by the combinatorial function of multiple transcription factors. This indicates that not the individual transcription factors or signaling molecules, but the combination of expressed regulatory molecules, the regulatory state, should be viewed as the functional unit in gene regulation. Here, I discuss the concept of the regulatory state and its proposed role in the genome-wide control of gene expression. Recent analyses of regulatory gene expression in sea urchin embryos have been instrumental for solving the genomic control of cell fate specification in this system. Some of the approaches that were used to determine the expression of regulatory states during sea urchin embryogenesis are reviewed. Significant developmental changes in regulatory state expression leading to the distinct specification of cell fates are regulated by gene regulatory network circuits. How these regulatory state transitions are encoded in the genome is illuminated using the sea urchin endoderm-mesoderms cell fate decision circuit as an example. These observations highlight the importance of considering developmental gene regulation, and the function of individual transcription factors, in the context of regulatory states. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Miklík, Dalibor; Šenigl, Filip; Hejnar, Jiří
2018-01-01
Individual groups of retroviruses and retroviral vectors differ in their integration site preference and interaction with the host genome. Hence, immediately after infection genome-wide distribution of integrated proviruses is non-random. During long-term in vitro or persistent in vivo infection, the genomic position and chromatin environment of the provirus affects its transcriptional activity. Thus, a selection of long-term stably expressed proviruses and elimination of proviruses, which have been gradually silenced by epigenetic mechanisms, helps in the identification of genomic compartments permissive for proviral transcription. We compare here the extent and time course of provirus silencing in single cell clones of the K562 human myeloid lymphoblastoma cell line that have been infected with retroviral reporter vectors derived from avian sarcoma/leukosis virus (ASLV), human immunodeficiency virus type 1 (HIV) and murine leukaemia virus (MLV). While MLV proviruses remain transcriptionally active, ASLV proviruses are prone to rapid silencing. The HIV provirus displays gradual silencing only after an extended time period in culture. The analysis of integration sites of long-term stably expressed proviruses shows a strong bias for some genomic features—especially integration close to the transcription start sites of active transcription units. Furthermore, complex analysis of histone modifications enriched at the site of integration points to the accumulation of proviruses of all three groups in gene regulatory segments, particularly close to the enhancer loci. We conclude that the proximity to active regulatory chromatin segments correlates with stable provirus expression in various retroviral species. PMID:29517993
Prithika, Udayakumar; Vikneswari, Ramaraj; Balamurugan, Krishnaswamy
2017-04-01
One of the key issues pertaining to the control of memory is to respond to a consistently changing environment or microbial niche present in it. Human cyclic AMP response element binding protein (CREB) transcription factor which plays a crucial role in memory has a homolog in C. elegans, crh-1. crh-1 appears to influence memory processes to certain extent by habituation of the host to a particular environment. The discrimination between the pathogen and a non-pathogen is essential for C. elegans in a microbial niche which determines its survival. Training the nematodes in the presence of a virulent pathogen (S. aureus) and an opportunistic pathogen (P. mirabilis) separately exhibits a different behavioural paradigm. This appears to be dependent on the CREB transcription factor. Here we show that C. elegans homolog crh-1 helps in memory response for a short term against the interacting pathogens. Following conditioning of the nematodes to S. aureus and P. mirabilis, the wild type nematodes exhibited a positive response towards the respective pathogens which diminished slowly after 2h. By contrast, the crh-1 deficient nematodes had a defective memory post conditioning. The molecular data reinforces the importance of crh-1 gene in retaining the memory of nematode. Our results also suggest that involvement of neurotransmitters play a crucial role in modulating the memory of the nematode with the assistance of CREB. Therefore, we elucidate that CREB is responsible for the short term memory response in C. elegans against bacterial pathogens. Copyright © 2016 Elsevier GmbH. All rights reserved.
Regulation of RB Transcription In Vivo by RB Family Members▿ ‡
Burkhart, Deborah L.; Ngai, Lynn K.; Roake, Caitlin M.; Viatour, Patrick; Thangavel, Chellappagounder; Ho, Victoria M.; Knudsen, Erik S.; Sage, Julien
2010-01-01
In cancer cells, the retinoblastoma tumor suppressor RB is directly inactivated by mutation in the RB gene or functionally inhibited by abnormal activation of cyclin-dependent kinase activity. While variations in RB levels may also provide an important means of controlling RB function in both normal and cancer cells, little is known about the mechanisms regulating RB transcription. Here we show that members of the RB and E2F families bind directly to the RB promoter. To investigate how the RB/E2F pathway may regulate Rb transcription, we generated reporter mice carrying an eGFP transgene inserted into a bacterial artificial chromosome containing most of the Rb gene. Expression of eGFP largely parallels that of Rb in transgenic embryos and adult mice. Using these reporter mice and mutant alleles for Rb, p107, and p130, we found that RB family members modulate Rb transcription in specific cell populations in vivo and in culture. Interestingly, while Rb is a target of the RB/E2F pathway in mouse and human cells, Rb expression does not strictly correlate with the cell cycle status of these cells. These experiments identify novel regulatory feedback mechanisms within the RB pathway in mammalian cells. PMID:20100864
Selection Shapes Transcriptional Logic and Regulatory Specialization in Genetic Networks
Fogelmark, Karl; Peterson, Carsten; Troein, Carl
2016-01-01
Background Living organisms need to regulate their gene expression in response to environmental signals and internal cues. This is a computational task where genes act as logic gates that connect to form transcriptional networks, which are shaped at all scales by evolution. Large-scale mutations such as gene duplications and deletions add and remove network components, whereas smaller mutations alter the connections between them. Selection determines what mutations are accepted, but its importance for shaping the resulting networks has been debated. Methodology To investigate the effects of selection in the shaping of transcriptional networks, we derive transcriptional logic from a combinatorially powerful yet tractable model of the binding between DNA and transcription factors. By evolving the resulting networks based on their ability to function as either a simple decision system or a circadian clock, we obtain information on the regulation and logic rules encoded in functional transcriptional networks. Comparisons are made between networks evolved for different functions, as well as with structurally equivalent but non-functional (neutrally evolved) networks, and predictions are validated against the transcriptional network of E. coli. Principal Findings We find that the logic rules governing gene expression depend on the function performed by the network. Unlike the decision systems, the circadian clocks show strong cooperative binding and negative regulation, which achieves tight temporal control of gene expression. Furthermore, we find that transcription factors act preferentially as either activators or repressors, both when binding multiple sites for a single target gene and globally in the transcriptional networks. This separation into positive and negative regulators requires gene duplications, which highlights the interplay between mutation and selection in shaping the transcriptional networks. PMID:26927540
Selection Shapes Transcriptional Logic and Regulatory Specialization in Genetic Networks.
Fogelmark, Karl; Peterson, Carsten; Troein, Carl
2016-01-01
Living organisms need to regulate their gene expression in response to environmental signals and internal cues. This is a computational task where genes act as logic gates that connect to form transcriptional networks, which are shaped at all scales by evolution. Large-scale mutations such as gene duplications and deletions add and remove network components, whereas smaller mutations alter the connections between them. Selection determines what mutations are accepted, but its importance for shaping the resulting networks has been debated. To investigate the effects of selection in the shaping of transcriptional networks, we derive transcriptional logic from a combinatorially powerful yet tractable model of the binding between DNA and transcription factors. By evolving the resulting networks based on their ability to function as either a simple decision system or a circadian clock, we obtain information on the regulation and logic rules encoded in functional transcriptional networks. Comparisons are made between networks evolved for different functions, as well as with structurally equivalent but non-functional (neutrally evolved) networks, and predictions are validated against the transcriptional network of E. coli. We find that the logic rules governing gene expression depend on the function performed by the network. Unlike the decision systems, the circadian clocks show strong cooperative binding and negative regulation, which achieves tight temporal control of gene expression. Furthermore, we find that transcription factors act preferentially as either activators or repressors, both when binding multiple sites for a single target gene and globally in the transcriptional networks. This separation into positive and negative regulators requires gene duplications, which highlights the interplay between mutation and selection in shaping the transcriptional networks.
Genomic dissection of conserved transcriptional regulation in intestinal epithelial cells
Camp, J. Gray; Weiser, Matthew; Cocchiaro, Jordan L.; Kingsley, David M.; Furey, Terrence S.; Sheikh, Shehzad Z.; Rawls, John F.
2017-01-01
The intestinal epithelium serves critical physiologic functions that are shared among all vertebrates. However, it is unknown how the transcriptional regulatory mechanisms underlying these functions have changed over the course of vertebrate evolution. We generated genome-wide mRNA and accessible chromatin data from adult intestinal epithelial cells (IECs) in zebrafish, stickleback, mouse, and human species to determine if conserved IEC functions are achieved through common transcriptional regulation. We found evidence for substantial common regulation and conservation of gene expression regionally along the length of the intestine from fish to mammals and identified a core set of genes comprising a vertebrate IEC signature. We also identified transcriptional start sites and other putative regulatory regions that are differentially accessible in IECs in all 4 species. Although these sites rarely showed sequence conservation from fish to mammals, surprisingly, they drove highly conserved IEC expression in a zebrafish reporter assay. Common putative transcription factor binding sites (TFBS) found at these sites in multiple species indicate that sequence conservation alone is insufficient to identify much of the functionally conserved IEC regulatory information. Among the rare, highly sequence-conserved, IEC-specific regulatory regions, we discovered an ancient enhancer upstream from her6/HES1 that is active in a distinct population of Notch-positive cells in the intestinal epithelium. Together, these results show how combining accessible chromatin and mRNA datasets with TFBS prediction and in vivo reporter assays can reveal tissue-specific regulatory information conserved across 420 million years of vertebrate evolution. We define an IEC transcriptional regulatory network that is shared between fish and mammals and establish an experimental platform for studying how evolutionarily distilled regulatory information commonly controls IEC development and physiology. PMID
Thermodynamics-based models of transcriptional regulation with gene sequence.
Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing
2015-12-01
Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.
Vischi Winck, Flavia; Arvidsson, Samuel; Riaño-Pachón, Diego Mauricio; Hempel, Sabrina; Koseska, Aneta; Nikoloski, Zoran; Urbina Gomez, David Alejandro; Rupprecht, Jens; Mueller-Roeber, Bernd
2013-01-01
The unicellular green alga Chlamydomonas reinhardtii is a long-established model organism for studies on photosynthesis and carbon metabolism-related physiology. Under conditions of air-level carbon dioxide concentration [CO2], a carbon concentrating mechanism (CCM) is induced to facilitate cellular carbon uptake. CCM increases the availability of carbon dioxide at the site of cellular carbon fixation. To improve our understanding of the transcriptional control of the CCM, we employed FAIRE-seq (formaldehyde-assisted Isolation of Regulatory Elements, followed by deep sequencing) to determine nucleosome-depleted chromatin regions of algal cells subjected to carbon deprivation. Our FAIRE data recapitulated the positions of known regulatory elements in the promoter of the periplasmic carbonic anhydrase (Cah1) gene, which is upregulated during CCM induction, and revealed new candidate regulatory elements at a genome-wide scale. In addition, time series expression patterns of 130 transcription factor (TF) and transcription regulator (TR) genes were obtained for cells cultured under photoautotrophic condition and subjected to a shift from high to low [CO2]. Groups of co-expressed genes were identified and a putative directed gene-regulatory network underlying the CCM was reconstructed from the gene expression data using the recently developed IOTA (inner composition alignment) method. Among the candidate regulatory genes, two members of the MYB-related TF family, Lcr1 (Low-CO 2 response regulator 1) and Lcr2 (Low-CO 2 response regulator 2), may play an important role in down-regulating the expression of a particular set of TF and TR genes in response to low [CO2]. The results obtained provide new insights into the transcriptional control of the CCM and revealed more than 60 new candidate regulatory genes. Deep sequencing of nucleosome-depleted genomic regions indicated the presence of new, previously unknown regulatory elements in the C. reinhardtii genome. Our work can
Ghosh, Gairika; Reddy, Jayavardhana; Sambhare, Susmit; Sen, Ranjan
2018-01-01
Rho is a hexameric molecular motor that functions as a conserved transcription terminator in the majority of bacterial species and is a potential drug target. Psu is a bacteriophage P4 capsid protein that inhibits Escherichia coli Rho by obstructing its ATPase and translocase activities. In this study, we explored the anti-Rho activity of Psu for Rho proteins from different pathogens. Sequence alignment and homology modeling of Rho proteins from pathogenic bacteria revealed the conserved nature of the Psu-interacting regions in all these proteins. We chose Rho proteins from various pathogens, including Mycobacterium smegmatis , Mycobacterium bovis , Mycobacterium tuberculosis , Xanthomonas campestris , Xanthomonas oryzae , Corynebacterium glutamicum , Vibrio cholerae , Salmonella enterica , and Pseudomonas syringae The purified recombinant Rho proteins of these organisms showed variable rates of ATP hydrolysis on poly(rC) as the substrate and were capable of releasing RNA from the E. coli transcription elongation complexes. Psu was capable of inhibiting these two functions of all these Rho proteins. In vivo pulldown assays revealed direct binding of Psu with many of these Rho proteins. In vivo expression of psu induced killing of M. smegmatis , M. bovis , X. campestris , and E. coli expressing S. enterica Rho indicating Psu-induced inhibition of Rho proteins of these strains under physiological conditions. We propose that the "universal" inhibitory function of the Psu protein against the Rho proteins from both Gram-negative and Gram-positive bacteria could be useful for designing peptides with antimicrobial functions and that these peptides could contribute to synergistic antibiotic treatment of the pathogens by compromising the Rho functions. IMPORTANCE Bacteriophage-derived protein factors modulating different bacterial processes could be converted into unique antimicrobial agents. Bacteriophage P4 capsid protein Psu is an inhibitor of the E. coli transcription
2011-01-01
Background Transcription factors (TFs) play a central role in regulating gene expression by interacting with cis-regulatory DNA elements associated with their target genes. Recent surveys have examined the DNA binding specificities of most Saccharomyces cerevisiae TFs, but a comprehensive evaluation of their data has been lacking. Results We analyzed in vitro and in vivo TF-DNA binding data reported in previous large-scale studies to generate a comprehensive, curated resource of DNA binding specificity data for all characterized S. cerevisiae TFs. Our collection comprises DNA binding site motifs and comprehensive in vitro DNA binding specificity data for all possible 8-bp sequences. Investigation of the DNA binding specificities within the basic leucine zipper (bZIP) and VHT1 regulator (VHR) TF families revealed unexpected plasticity in TF-DNA recognition: intriguingly, the VHR TFs, newly characterized by protein binding microarrays in this study, recognize bZIP-like DNA motifs, while the bZIP TF Hac1 recognizes a motif highly similar to the canonical E-box motif of basic helix-loop-helix (bHLH) TFs. We identified several TFs with distinct primary and secondary motifs, which might be associated with different regulatory functions. Finally, integrated analysis of in vivo TF binding data with protein binding microarray data lends further support for indirect DNA binding in vivo by sequence-specific TFs. Conclusions The comprehensive data in this curated collection allow for more accurate analyses of regulatory TF-DNA interactions, in-depth structural studies of TF-DNA specificity determinants, and future experimental investigations of the TFs' predicted target genes and regulatory roles. PMID:22189060
Pervasive transcription: detecting functional RNAs in bacteria.
Lybecker, Meghan; Bilusic, Ivana; Raghavan, Rahul
2014-01-01
Pervasive, or genome-wide, transcription has been reported in all domains of life. In bacteria, most pervasive transcription occurs antisense to protein-coding transcripts, although recently a new class of pervasive RNAs was identified that originates from within annotated genes. Initially considered to be non-functional transcriptional noise, pervasive transcription is increasingly being recognized as important in regulating gene expression. The function of pervasive transcription is an extensively debated question in the field of transcriptomics and regulatory RNA biology. Here, we highlight the most recent contributions addressing the purpose of pervasive transcription in bacteria and discuss their implications.
Transcriptional master regulator analysis in breast cancer genetic networks.
Tovar, Hugo; García-Herrera, Rodrigo; Espinal-Enríquez, Jesús; Hernández-Lemus, Enrique
2015-12-01
Gene regulatory networks account for the delicate mechanisms that control gene expression. Under certain circumstances, gene regulatory programs may give rise to amplification cascades. Such transcriptional cascades are events in which activation of key-responsive transcription factors called master regulators trigger a series of gene expression events. The action of transcriptional master regulators is then important for the establishment of certain programs like cell development and differentiation. However, such cascades have also been related with the onset and maintenance of cancer phenotypes. Here we present a systematic implementation of a series of algorithms aimed at the inference of a gene regulatory network and analysis of transcriptional master regulators in the context of primary breast cancer cells. Such studies were performed in a highly curated database of 880 microarray gene expression experiments on biopsy-captured tissue corresponding to primary breast cancer and healthy controls. Biological function and biochemical pathway enrichment analyses were also performed to study the role that the processes controlled - at the transcriptional level - by such master regulators may have in relation to primary breast cancer. We found that transcription factors such as AGTR2, ZNF132, TFDP3 and others are master regulators in this gene regulatory network. Sets of genes controlled by these regulators are involved in processes that are well-known hallmarks of cancer. This kind of analyses may help to understand the most upstream events in the development of phenotypes, in particular, those regarding cancer biology. Copyright © 2015 Elsevier Ltd. All rights reserved.
Topology and Control of the Cell-Cycle-Regulated Transcriptional Circuitry
Haase, Steven B.; Wittenberg, Curt
2014-01-01
Nearly 20% of the budding yeast genome is transcribed periodically during the cell division cycle. The precise temporal execution of this large transcriptional program is controlled by a large interacting network of transcriptional regulators, kinases, and ubiquitin ligases. Historically, this network has been viewed as a collection of four coregulated gene clusters that are associated with each phase of the cell cycle. Although the broad outlines of these gene clusters were described nearly 20 years ago, new technologies have enabled major advances in our understanding of the genes comprising those clusters, their regulation, and the complex regulatory interplay between clusters. More recently, advances are being made in understanding the roles of chromatin in the control of the transcriptional program. We are also beginning to discover important regulatory interactions between the cell-cycle transcriptional program and other cell-cycle regulatory mechanisms such as checkpoints and metabolic networks. Here we review recent advances and contemporary models of the transcriptional network and consider these models in the context of eukaryotic cell-cycle controls. PMID:24395825
Sequence-based model of gap gene regulatory network.
Kozlov, Konstantin; Gursky, Vitaly; Kulakovskiy, Ivan; Samsonova, Maria
2014-01-01
The detailed analysis of transcriptional regulation is crucially important for understanding biological processes. The gap gene network in Drosophila attracts large interest among researches studying mechanisms of transcriptional regulation. It implements the most upstream regulatory layer of the segmentation gene network. The knowledge of molecular mechanisms involved in gap gene regulation is far less complete than that of genetics of the system. Mathematical modeling goes beyond insights gained by genetics and molecular approaches. It allows us to reconstruct wild-type gene expression patterns in silico, infer underlying regulatory mechanism and prove its sufficiency. We developed a new model that provides a dynamical description of gap gene regulatory systems, using detailed DNA-based information, as well as spatial transcription factor concentration data at varying time points. We showed that this model correctly reproduces gap gene expression patterns in wild type embryos and is able to predict gap expression patterns in Kr mutants and four reporter constructs. We used four-fold cross validation test and fitting to random dataset to validate the model and proof its sufficiency in data description. The identifiability analysis showed that most model parameters are well identifiable. We reconstructed the gap gene network topology and studied the impact of individual transcription factor binding sites on the model output. We measured this impact by calculating the site regulatory weight as a normalized difference between the residual sum of squares error for the set of all annotated sites and for the set with the site of interest excluded. The reconstructed topology of the gap gene network is in agreement with previous modeling results and data from literature. We showed that 1) the regulatory weights of transcription factor binding sites show very weak correlation with their PWM score; 2) sites with low regulatory weight are important for the model output; 3
Protein-protein interactions in the regulation of WRKY transcription factors.
Chi, Yingjun; Yang, Yan; Zhou, Yuan; Zhou, Jie; Fan, Baofang; Yu, Jing-Quan; Chen, Zhixiang
2013-03-01
It has been almost 20 years since the first report of a WRKY transcription factor, SPF1, from sweet potato. Great progress has been made since then in establishing the diverse biological roles of WRKY transcription factors in plant growth, development, and responses to biotic and abiotic stress. Despite the functional diversity, almost all analyzed WRKY proteins recognize the TTGACC/T W-box sequences and, therefore, mechanisms other than mere recognition of the core W-box promoter elements are necessary to achieve the regulatory specificity of WRKY transcription factors. Research over the past several years has revealed that WRKY transcription factors physically interact with a wide range of proteins with roles in signaling, transcription, and chromatin remodeling. Studies of WRKY-interacting proteins have provided important insights into the regulation and mode of action of members of the important family of transcription factors. It has also emerged that the slightly varied WRKY domains and other protein motifs conserved within each of the seven WRKY subfamilies participate in protein-protein interactions and mediate complex functional interactions between WRKY proteins and between WRKY and other regulatory proteins in the modulation of important biological processes. In this review, we summarize studies of protein-protein interactions for WRKY transcription factors and discuss how the interacting partners contribute, at different levels, to the establishment of the complex regulatory and functional network of WRKY transcription factors.
Chauss, Daniel; Basu, Subhasree; Rajakaruna, Suren; Ma, Zhiwei; Gau, Victoria; Anastas, Sara; Brennan, Lisa A.; Hejtmancik, J. Fielding; Menko, A. Sue; Kantorow, Marc
2014-01-01
The mature eye lens contains a surface layer of epithelial cells called the lens epithelium that requires a functional mitochondrial population to maintain the homeostasis and transparency of the entire lens. The lens epithelium overlies a core of terminally differentiated fiber cells that must degrade their mitochondria to achieve lens transparency. These distinct mitochondrial populations make the lens a useful model system to identify those genes that regulate the balance between mitochondrial homeostasis and elimination. Here we used an RNA sequencing and bioinformatics approach to identify the transcript levels of all genes expressed by distinct regions of the lens epithelium and maturing fiber cells of the embryonic Gallus gallus (chicken) lens. Our analysis detected more than 15,000 unique transcripts expressed by the embryonic chicken lens. Of these, more than 3000 transcripts exhibited significant differences in expression between lens epithelial cells and fiber cells. Multiple transcripts coding for separate mitochondrial homeostatic and degradation mechanisms were identified to exhibit preferred patterns of expression in lens epithelial cells that require mitochondria relative to lens fiber cells that require mitochondrial elimination. These included differences in the expression levels of metabolic (DUT, PDK1, SNPH), autophagy (ATG3, ATG4B, BECN1, FYCO1, WIPI1), and mitophagy (BNIP3L/NIX, BNIP3, PARK2, p62/SQSTM1) transcripts between lens epithelial cells and lens fiber cells. These data provide a comprehensive window into all genes transcribed by the lens and those mitochondrial regulatory and degradation pathways that function to maintain mitochondrial populations in the lens epithelium and to eliminate mitochondria in maturing lens fiber cells. PMID:24928582
Alkallas, Rached; Fish, Lisa; Goodarzi, Hani; Najafabadi, Hamed S
2017-10-13
The abundance of mRNA is mainly determined by the rates of RNA transcription and decay. Here, we present a method for unbiased estimation of differential mRNA decay rate from RNA-sequencing data by modeling the kinetics of mRNA metabolism. We show that in all primary human tissues tested, and particularly in the central nervous system, many pathways are regulated at the mRNA stability level. We present a parsimonious regulatory model consisting of two RNA-binding proteins and four microRNAs that modulate the mRNA stability landscape of the brain, which suggests a new link between RBFOX proteins and Alzheimer's disease. We show that downregulation of RBFOX1 leads to destabilization of mRNAs encoding for synaptic transmission proteins, which may contribute to the loss of synaptic function in Alzheimer's disease. RBFOX1 downregulation is more likely to occur in older and female individuals, consistent with the association of Alzheimer's disease with age and gender."mRNA abundance is determined by the rates of transcription and decay. Here, the authors propose a method for estimating the rate of differential mRNA decay from RNA-seq data and model mRNA stability in the brain, suggesting a link between mRNA stability and Alzheimer's disease."
Integrative FourD omics approach profiles the target network of the carbon storage regulatory system
Sowa, Steven W.; Gelderman, Grant; Leistra, Abigail N.; Buvanendiran, Aishwarya; Lipp, Sarah; Pitaktong, Areen; Vakulskas, Christopher A.; Romeo, Tony; Baldea, Michael
2017-01-01
Abstract Multi-target regulators represent a largely untapped area for metabolic engineering and anti-bacterial development. These regulators are complex to characterize because they often act at multiple levels, affecting proteins, transcripts and metabolites. Therefore, single omics experiments cannot profile their underlying targets and mechanisms. In this work, we used an Integrative FourD omics approach (INFO) that consists of collecting and analyzing systems data throughout multiple time points, using multiple genetic backgrounds, and multiple omics approaches (transcriptomics, proteomics and high throughput sequencing crosslinking immunoprecipitation) to evaluate simultaneous changes in gene expression after imposing an environmental stress that accentuates the regulatory features of a network. Using this approach, we profiled the targets and potential regulatory mechanisms of a global regulatory system, the well-studied carbon storage regulatory (Csr) system of Escherichia coli, which is widespread among bacteria. Using 126 sets of proteomics and transcriptomics data, we identified 136 potential direct CsrA targets, including 50 novel ones, categorized their behaviors into distinct regulatory patterns, and performed in vivo fluorescence-based follow up experiments. The results of this work validate 17 novel mRNAs as authentic direct CsrA targets and demonstrate a generalizable strategy to integrate multiple lines of omics data to identify a core pool of regulator targets. PMID:28126921
Niu, Jun; Wang, Jia; Hu, Huiwen; Chen, Yinlei; An, Jiyong; Cai, Jian; Sun, Runze; Sheng, Zhongting; Liu, Xieping; Lin, Shanzhi
2016-01-01
MicroRNAs (miRNAs) are small, non-coding RNAs that play important roles in post-transcriptional regulation of their target genes, yet the transcriptional regulation of plant miRNAs by promoter is poorly understood. Here, we firstly clone pri-miR475b cDNA and its native promoter from P. suaveolens, and characterize Psu-MIR475b as class-II gene transcribed by RNA polymerase II. By 5′ deletion analysis of Psu-miR475b promoter in a series of promoter-GUS chimeric vectors, we functionally identify three positive regulatory regions and multiple cis-acting elements responsible for Psu-miR475b promoter activity in response to freezing stress and exogenous hormone treatment. Moreover, the Psu-miR475b promoter activity displays a tissue-specific manner, negatively regulated by freezing stress and positively by MeJA, SA or GA treatment. Importantly, we comparatively analyze the time-course transcriptional profiles of Psu-miR475b and its targets in Psu-miR475b over-expression transgenic plants controlled by Psu-miR475b-specific promoter or CaMV 35S constitutive promoter, and explore the regulatory mechanism of Psu-miR475b promoter controlling transcriptional expressions of Psu-MIR475b and its targets in response to freezing stress and exogenous hormone treatment. Our results reveal that Psu-miR475b promoter-mediated transcriptions of Psu-MIR475b and its targets in response to freezing stress may be involved in a cross-talk between freezing response and stress signaling process. PMID:26853706
Twu, Yuh-Ching; Teh, Hung-Sia
2014-03-01
The zinc finger transcription factor ThPOK plays a crucial role in CD4 T-cell development and CD4/CD8 lineage decision. In ThPOK-deficient mice, developing T cells expressing MHC class II-restricted T-cell receptors are redirected into the CD8 T-cell lineage. In this study, we investigated whether the ThPOK transgene affected the development and function of two additional types of T cells, namely self-specific CD8 T cells and CD4(+) FoxP3(+) T regulatory cells. Self-specific CD8 T cells are characterized by high expression of CD44, CD122, Ly6C, 1B11 and proliferation in response to either IL-2 or IL-15. The ThPOK transgene converted these self-specific CD8 T cells into CD4 T cells. The converted CD4(+) T cells are no longer self-reactive, lose the characteristics of self-specific CD8 T cells, acquire the properties of conventional CD4 T cells and survive poorly in peripheral lymphoid organs. By contrast, the ThPOK transgene promoted the development of CD4(+) FoxP3(+) regulatory T cells resulting in an increased recovery of CD4(+) FoxP3(+) regulatory T cells that expressed higher transforming growth factor-β-dependent suppressor activity. These studies indicate that the ThPOK transcription factor differentially affects the development and function of self-specific CD8 T cells and CD4(+) FoxP3(+) regulatory T cells. © 2013 John Wiley & Sons Ltd.
Morin, Manon; Ropers, Delphine; Letisse, Fabien; Laguerre, Sandrine; Portais, Jean-Charles; Cocaign-Bousquet, Muriel; Enjalbert, Brice
2016-05-01
Metabolic control in Escherichia coli is a complex process involving multilevel regulatory systems but the involvement of post-transcriptional regulation is uncertain. The post-transcriptional factor CsrA is stated as being the only regulator essential for the use of glycolytic substrates. A dozen enzymes in the central carbon metabolism (CCM) have been reported as potentially controlled by CsrA, but its impact on the CCM functioning has not been demonstrated. Here, a multiscale analysis was performed in a wild-type strain and its isogenic mutant attenuated for CsrA (including growth parameters, gene expression levels, metabolite pools, abundance of enzymes and fluxes). Data integration and regulation analysis showed a coordinated control of the expression of glycolytic enzymes. This also revealed the imbalance of metabolite pools in the csrA mutant upper glycolysis, before the phosphofructokinase PfkA step. This imbalance is associated with a glucose-phosphate stress. Restoring PfkA activity in the csrA mutant strain suppressed this stress and increased the mutant growth rate on glucose. Thus, the carbon storage regulator system is essential for the effective functioning of the upper glycolysis mainly through its control of PfkA. This work demonstrates the pivotal role of post-transcriptional regulation to shape the carbon metabolism. © 2016 John Wiley & Sons Ltd.
Lamacchia, Marina; Dyrka, Witold; Breton, Annick; Saupe, Sven J.; Paoletti, Mathieu
2016-01-01
Recognition and response to non self is essential to development and survival of all organisms. It can occur between individuals of the same species or between different organisms. Fungi are established models for conspecific non self recognition in the form of vegetative incompatibility (VI), a genetically controlled process initiating a programmed cell death (PCD) leading to the rejection of a fusion cell between genetically different isolates of the same species. In Podospora anserina VI is controlled by members of the hnwd gene family encoding for proteins analogous to NOD Like Receptors (NLR) immune receptors in eukaryotes. It was hypothesized that the hnwd controlled VI reaction was derived from the fungal innate immune response. Here we analyze the P. anserina transcriptional responses to two bacterial species, Serratia fonticola to which P. anserina survives and S. marcescens to which P. anserina succumbs, and compare these to the transcriptional response induced under VI conditions. Transcriptional responses to both bacteria largely overlap, however the number of genes regulated and magnitude of regulation is more important when P. anserina survives. Transcriptional responses to bacteria also overlap with the VI reaction for both up or down regulated gene sets. Genes up regulated tend to be clustered in the genome, and display limited phylogenetic distribution. In all three responses we observed genes related to autophagy to be up-regulated. Autophagy contributes to the fungal survival in all three conditions. Genes encoding for secondary metabolites and histidine kinase signaling are also up regulated in all three conditions. Transcriptional responses also display differences. Genes involved in response to oxidative stress, or encoding small secreted proteins are essentially expressed in response to bacteria, while genes encoding NLR proteins are expressed during VI. Most functions encoded in response to bacteria favor survival of the fungus while most
footprintDB: a database of transcription factors with annotated cis elements and binding interfaces.
Sebastian, Alvaro; Contreras-Moreira, Bruno
2014-01-15
Traditional and high-throughput techniques for determining transcription factor (TF) binding specificities are generating large volumes of data of uneven quality, which are scattered across individual databases. FootprintDB integrates some of the most comprehensive freely available libraries of curated DNA binding sites and systematically annotates the binding interfaces of the corresponding TFs. The first release contains 2422 unique TF sequences, 10 112 DNA binding sites and 3662 DNA motifs. A survey of the included data sources, organisms and TF families was performed together with proprietary database TRANSFAC, finding that footprintDB has a similar coverage of multicellular organisms, while also containing bacterial regulatory data. A search engine has been designed that drives the prediction of DNA motifs for input TFs, or conversely of TF sequences that might recognize input regulatory sequences, by comparison with database entries. Such predictions can also be extended to a single proteome chosen by the user, and results are ranked in terms of interface similarity. Benchmark experiments with bacterial, plant and human data were performed to measure the predictive power of footprintDB searches, which were able to correctly recover 10, 55 and 90% of the tested sequences, respectively. Correctly predicted TFs had a higher interface similarity than the average, confirming its diagnostic value. Web site implemented in PHP,Perl, MySQL and Apache. Freely available from http://floresta.eead.csic.es/footprintdb.
Diehl, Adam G
2018-01-01
Abstract The mouse is widely used as system to study human genetic mechanisms. However, extensive rewiring of transcriptional regulatory networks often confounds translation of findings between human and mouse. Site-specific gain and loss of individual transcription factor binding sites (TFBS) has caused functional divergence of orthologous regulatory loci, and so we must look beyond this positional conservation to understand common themes of regulatory control. Fortunately, transcription factor co-binding patterns shared across species often perform conserved regulatory functions. These can be compared to ‘regulatory sentences’ that retain the same meanings regardless of sequence and species context. By analyzing TFBS co-occupancy patterns observed in four human and mouse cell types, we learned a regulatory grammar: the rules by which TFBS are combined into meaningful regulatory sentences. Different parts of this grammar associate with specific sets of functional annotations regardless of sequence conservation and predict functional signatures more accurately than positional conservation. We further show that both species-specific and conserved portions of this grammar are involved in gene expression divergence and human disease risk. These findings expand our understanding of transcriptional regulatory mechanisms, suggesting that phenotypic divergence and disease risk are driven by a complex interplay between deeply conserved and species-specific transcriptional regulatory pathways. PMID:29361190
Regulatory principles governing Salmonella and Yersinia virulence
Erhardt, Marc; Dersch, Petra
2015-01-01
Enteric pathogens such as Salmonella and Yersinia evolved numerous strategies to survive and proliferate in different environmental reservoirs and mammalian hosts. Deciphering common and pathogen-specific principles for how these bacteria adjust and coordinate spatiotemporal expression of virulence determinants, stress adaptation, and metabolic functions is fundamental to understand microbial pathogenesis. In order to manage sudden environmental changes, attacks by the host immune systems and microbial competition, the pathogens employ a plethora of transcriptional and post-transcriptional control elements, including transcription factors, sensory and regulatory RNAs, RNAses, and proteases, to fine-tune and control complex gene regulatory networks. Many of the contributing global regulators and the molecular mechanisms of regulation are frequently conserved between Yersinia and Salmonella. However, the interplay, arrangement, and composition of the control elements vary between these closely related enteric pathogens, which generate phenotypic differences leading to distinct pathogenic properties. In this overview we present common and different regulatory networks used by Salmonella and Yersinia to coordinate the expression of crucial motility, cell adhesion and invasion determinants, immune defense strategies, and metabolic adaptation processes. We highlight evolutionary changes of the gene regulatory circuits that result in different properties of the regulatory elements and how this influences the overall outcome of the infection process. PMID:26441883
Changing Faces of Transcriptional Regulation Reflected by Zic3
Winata, Cecilia Lanny; Kondrychyn, Igor; Deddens, J.C.; Korzh, Vladimir
2015-01-01
The advent of genomics in the study of developmental mechanisms has brought a trove of information on gene datasets and regulation during development, where the Zic family of zinc-finger proteins plays an important role. Genomic analysis of the modes of action of Zic3 in pluripotent cells demonstrated its requirement for maintenance of stem cells pluripotency upon binding to the proximal regulatory regions (promoters) of genes associated with cell pluripotency (Nanog, Sox2, Oct4, etc.) as well as cell cycle, proliferation, oncogenesis and early embryogenesis. In contrast, during gastrulation and neurulation Zic3 acts by binding the distal regulatory regions (enhancers, etc) associated with control of gene transcription in the Nodal and Wnt signaling pathways, including genes that act to break body symmetry. This illustrates a general role of Zic3 as a transcriptional regulator that acts not only alone, but in many instances in conjunction with other transcription factors. The latter is done by binding to adjacent sites in the context of multi-transcription factor complexes associated with regulatory elements. PMID:26085810
Sun, Eric I; Leyn, Semen A; Kazanov, Marat D; Saier, Milton H; Novichkov, Pavel S; Rodionov, Dmitry A
2013-09-02
In silico comparative genomics approaches have been efficiently used for functional prediction and reconstruction of metabolic and regulatory networks. Riboswitches are metabolite-sensing structures often found in bacterial mRNA leaders controlling gene expression on transcriptional or translational levels.An increasing number of riboswitches and other cis-regulatory RNAs have been recently classified into numerous RNA families in the Rfam database. High conservation of these RNA motifs provides a unique advantage for their genomic identification and comparative analysis. A comparative genomics approach implemented in the RegPredict tool was used for reconstruction and functional annotation of regulons controlled by RNAs from 43 Rfam families in diverse taxonomic groups of Bacteria. The inferred regulons include ~5200 cis-regulatory RNAs and more than 12000 target genes in 255 microbial genomes. All predicted RNA-regulated genes were classified into specific and overall functional categories. Analysis of taxonomic distribution of these categories allowed us to establish major functional preferences for each analyzed cis-regulatory RNA motif family. Overall, most RNA motif regulons showed predictable functional content in accordance with their experimentally established effector ligands. Our results suggest that some RNA motifs (including thiamin pyrophosphate and cobalamin riboswitches that control the cofactor metabolism) are widespread and likely originated from the last common ancestor of all bacteria. However, many more analyzed RNA motifs are restricted to a narrow taxonomic group of bacteria and likely represent more recent evolutionary innovations. The reconstructed regulatory networks for major known RNA motifs substantially expand the existing knowledge of transcriptional regulation in bacteria. The inferred regulons can be used for genetic experiments, functional annotations of genes, metabolic reconstruction and evolutionary analysis. The obtained genome
Emerging principles of regulatory evolution.
Prud'homme, Benjamin; Gompel, Nicolas; Carroll, Sean B
2007-05-15
Understanding the genetic and molecular mechanisms governing the evolution of morphology is a major challenge in biology. Because most animals share a conserved repertoire of body-building and -patterning genes, morphological diversity appears to evolve primarily through changes in the deployment of these genes during development. The complex expression patterns of developmentally regulated genes are typically controlled by numerous independent cis-regulatory elements (CREs). It has been proposed that morphological evolution relies predominantly on changes in the architecture of gene regulatory networks and in particular on functional changes within CREs. Here, we discuss recent experimental studies that support this hypothesis and reveal some unanticipated features of how regulatory evolution occurs. From this growing body of evidence, we identify three key operating principles underlying regulatory evolution, that is, how regulatory evolution: (i) uses available genetic components in the form of preexisting and active transcription factors and CREs to generate novelty; (ii) minimizes the penalty to overall fitness by introducing discrete changes in gene expression; and (iii) allows interactions to arise among any transcription factor and downstream CRE. These principles endow regulatory evolution with a vast creative potential that accounts for both relatively modest morphological differences among closely related species and more profound anatomical divergences among groups at higher taxonomical levels.
GlpR is a direct transcriptional repressor of fructose metabolic genes in Haloferax volcanii.
Martin, Jonathan H; Rawls, Katie Sherwood; Chan, Jou Chin; Hwang, Sungmin; Martinez-Pastor, Mar; McMillan, Lana J; Prunetti, Laurence; Schmid, Amy K; Maupin-Furlow, Julie A
2018-06-18
DeoR-type helix-turn-helix (HTH) domain proteins are transcriptional regulators of sugar and nucleoside metabolism in diverse bacteria and occur in select archaea. In the model archaeon Haloferax volcanii , previous work implicated GlpR, a DeoR-type transcriptional regulator, in transcriptional repression of glpR and the gene encoding the fructose-specific phosphofructokinase ( pfkB ) during growth on glycerol. However, the global regulon governed by GlpR remained unclear. Here we compared transcriptomes of wild type and Δ glpR mutant strains grown on glycerol and glucose to detect significant transcript level differences for nearly 50 new genes regulated by GlpR. By coupling computational prediction of GlpR binding sequences with in vivo and in vitro DNA binding experiments, we determined that GlpR directly controls genes encoding enzymes in fructose degradation, including fructose bisphosphate aldolase, a central control point in glycolysis. GlpR also directly controls other transcription factors. In contrast, other metabolic pathways appear to be under indirect influence of GlpR. In vitro experiments demonstrated that GlpR purifies as a tetramer that binds the effector molecule fructose-1-phosphate (F1P). These results suggest that Hfx. volcanii GlpR functions as a direct negative regulator of fructose degradation during growth on carbon sources other than fructose, such as glucose and glycerol, and that GlpR bears striking functional similarity to bacterial DeoR-type regulators. IMPORTANCE Many archaea are extremophiles, able to thrive in habitats of extreme salinity, pH and temperature. These biological properties are ideal for applications in biotechnology. However, limited knowledge of archaeal metabolism is a bottleneck that prevents broad use of archaea as microbial factories for industrial products. Here we characterize how sugar uptake and use is regulated in a species that lives in high salinity. We demonstrate that a key sugar regulatory protein in
Biswas, Ambarish; Brown, Chris M
2014-06-08
Gene expression in vertebrate cells may be controlled post-transcriptionally through regulatory elements in mRNAs. These are usually located in the untranslated regions (UTRs) of mRNA sequences, particularly the 3'UTRs. Scan for Motifs (SFM) simplifies the process of identifying a wide range of regulatory elements on alignments of vertebrate 3'UTRs. SFM includes identification of both RNA Binding Protein (RBP) sites and targets of miRNAs. In addition to searching pre-computed alignments, the tool provides users the flexibility to search their own sequences or alignments. The regulatory elements may be filtered by expected value cutoffs and are cross-referenced back to their respective sources and literature. The output is an interactive graphical representation, highlighting potential regulatory elements and overlaps between them. The output also provides simple statistics and links to related resources for complementary analyses. The overall process is intuitive and fast. As SFM is a free web-application, the user does not need to install any software or databases. Visualisation of the binding sites of different classes of effectors that bind to 3'UTRs will facilitate the study of regulatory elements in 3' UTRs.
Liang, Kaiwei; Woodfin, Ashley R; Slaughter, Brian D; Unruh, Jay R; Box, Andrew C; Rickels, Ryan A; Gao, Xin; Haug, Jeffrey S; Jaspersen, Sue L; Shilatifard, Ali
2015-11-05
Although it is established that some general transcription factors are inactivated at mitosis, many details of mitotic transcription inhibition (MTI) and its underlying mechanisms are largely unknown. We have identified mitotic transcriptional activation (MTA) as a key regulatory step to control transcription in mitosis for genes with transcriptionally engaged RNA polymerase II (Pol II) to activate and transcribe until the end of the gene to clear Pol II from mitotic chromatin, followed by global impairment of transcription reinitiation through MTI. Global nascent RNA sequencing and RNA fluorescence in situ hybridization demonstrate the existence of transcriptionally engaged Pol II in early mitosis. Both genetic and chemical inhibition of P-TEFb in mitosis lead to delays in the progression of cell division. Together, our study reveals a mechanism for MTA and MTI whereby transcriptionally engaged Pol II can progress into productive elongation and finish transcription to allow proper cellular division. Copyright © 2015 Elsevier Inc. All rights reserved.
Cross-regulatory protein-protein interactions between Hox and Pax transcription factors.
Plaza, Serge; Prince, Frederic; Adachi, Yoshitsugu; Punzo, Claudio; Cribbs, David L; Gehring, Walter J
2008-09-09
Homeotic Hox selector genes encode highly conserved transcriptional regulators involved in the differentiation of multicellular organisms. Ectopic expression of the Antennapedia (ANTP) homeodomain protein in Drosophila imaginal discs induces distinct phenotypes, including an antenna-to-leg transformation and eye reduction. We have proposed that the eye loss phenotype is a consequence of a negative posttranslational control mechanism because of direct protein-protein interactions between ANTP and Eyeless (EY). In the present work, we analyzed the effect of various ANTP homeodomain mutations for their interaction with EY and for head development. Contrasting with the eye loss phenotype, we provide evidence that the antenna-to-leg transformation involves ANTP DNA-binding activity. In a complementary genetic screen performed in yeast, we isolated mutations located in the N terminus of the ANTP homeodomain that inhibit direct interactions with EY without abolishing DNA binding in vitro and in vivo. In a bimolecular fluorescence complementation assay, we detected the ANTP-EY interaction in vivo, these interactions occurring through the paired domain and/or the homeodomain of EY. These results demonstrate that the homeodomain supports multiple molecular regulatory functions in addition to protein-DNA and protein-RNA interactions; it is also involved in protein-protein interactions.
Cross-regulatory protein–protein interactions between Hox and Pax transcription factors
Plaza, Serge; Prince, Frederic; Adachi, Yoshitsugu; Punzo, Claudio; Cribbs, David L.; Gehring, Walter J.
2008-01-01
Homeotic Hox selector genes encode highly conserved transcriptional regulators involved in the differentiation of multicellular organisms. Ectopic expression of the Antennapedia (ANTP) homeodomain protein in Drosophila imaginal discs induces distinct phenotypes, including an antenna-to-leg transformation and eye reduction. We have proposed that the eye loss phenotype is a consequence of a negative posttranslational control mechanism because of direct protein–protein interactions between ANTP and Eyeless (EY). In the present work, we analyzed the effect of various ANTP homeodomain mutations for their interaction with EY and for head development. Contrasting with the eye loss phenotype, we provide evidence that the antenna-to-leg transformation involves ANTP DNA-binding activity. In a complementary genetic screen performed in yeast, we isolated mutations located in the N terminus of the ANTP homeodomain that inhibit direct interactions with EY without abolishing DNA binding in vitro and in vivo. In a bimolecular fluorescence complementation assay, we detected the ANTP–EY interaction in vivo, these interactions occurring through the paired domain and/or the homeodomain of EY. These results demonstrate that the homeodomain supports multiple molecular regulatory functions in addition to protein–DNA and protein–RNA interactions; it is also involved in protein–protein interactions. PMID:18755899
Transitions in a genetic transcriptional regulatory system under Lévy motion
Zheng, Yayun; Serdukova, Larissa; Duan, Jinqiao; Kurths, Jürgen
2016-01-01
Based on a stochastic differential equation model for a single genetic regulatory system, we examine the dynamical effects of noisy fluctuations, arising in the synthesis reaction, on the evolution of the transcription factor activator in terms of its concentration. The fluctuations are modeled by Brownian motion and α-stable Lévy motion. Two deterministic quantities, the mean first exit time (MFET) and the first escape probability (FEP), are used to analyse the transitions from the low to high concentration states. A shorter MFET or higher FEP in the low concentration region facilitates such a transition. We have observed that higher noise intensities and larger jumps of the Lévy motion shortens the MFET and thus benefits transitions. The Lévy motion activates a transition from the low concentration region to the non-adjacent high concentration region, while Brownian motion can not induce this phenomenon. There are optimal proportions of Gaussian and non-Gaussian noises, which maximise the quantities MFET and FEP for each concentration, when the total sum of noise intensities are kept constant. Because a weaker stability indicates a higher transition probability, a new geometric concept is introduced to quantify the basin stability of the low concentration region, characterised by the escaping behaviour. PMID:27411445
Pandey, Sheo Shankar; Patnana, Pradeep Kumar; Lomada, Santosh Kumar; Tomar, Archana; Chatterjee, Subhadeep
2016-01-01
Abilities of bacterial pathogens to adapt to the iron limitation present in hosts is critical to their virulence. Bacterial pathogens have evolved diverse strategies to coordinately regulate iron metabolism and virulence associated functions to maintain iron homeostasis in response to changing iron availability in the environment. In many bacteria the ferric uptake regulator (Fur) functions as transcription factor that utilize ferrous form of iron as cofactor to regulate transcription of iron metabolism and many cellular functions. However, mechanisms of fine-tuning and coordinated regulation of virulence associated function beyond iron and Fur-Fe2+ remain undefined. In this study, we show that a novel transcriptional regulator XibR (named X anthomonas iron binding regulator) of the NtrC family, is required for fine-tuning and co-coordinately regulating the expression of several iron regulated genes and virulence associated functions in phytopathogen Xanthomonas campestris pv. campestris (Xcc). Genome wide expression analysis of iron-starvation stimulon and XibR regulon, GUS assays, genetic and functional studies of xibR mutant revealed that XibR positively regulates functions involved in iron storage and uptake, chemotaxis, motility and negatively regulates siderophore production, in response to iron. Furthermore, chromatin immunoprecipitation followed by quantitative real-time PCR indicated that iron promoted binding of the XibR to the upstream regulatory sequence of operon’s involved in chemotaxis and motility. Circular dichroism spectroscopy showed that purified XibR bound ferric form of iron. Electrophoretic mobility shift assay revealed that iron positively affected the binding of XibR to the upstream regulatory sequences of the target virulence genes, an effect that was reversed by ferric iron chelator deferoxamine. Taken together, these data revealed that how XibR coordinately regulates virulence associated and iron metabolism functions in Xanthomonads in
Li, S; Zhang, P; Zhang, M; Fu, C; Yu, L
2013-01-01
Although the regulation of taxol biosynthesis at the transcriptional level remains unclear, 10-deacetylbaccatin III-10 β-O-acetyl transferase (DBAT) is a critical enzyme in the biosynthesis of taxol. The 1740 bp fragment 5'-flanking sequence of the dbat gene was cloned from Taxus chinensis cells. Important regulatory elements needed for activity of the dbat promoter were located by deletion analyses in T. chinensis cells. A novel WRKY transcription factor, TcWRKY1, was isolated with the yeast one-hybrid system from a T. chinensis cell cDNA library using the important regulatory elements as bait. The gene expression of TcWRKY1 in T. chinensis suspension cells was specifically induced by methyl jasmonate (MeJA). Biochemical analysis indicated that TcWRKY1 protein specifically interacts with the two W-box (TGAC) cis-elements among the important regulatory elements. Overexpression of TcWRKY1 enhanced dbat expression in T. chinensis suspension cells, and RNA interference (RNAi) reduced the level of transcripts of dbat. These results suggest that TcWRKY1 participates in regulation of taxol biosynthesis in T. chinensis cells, and that dbat is a target gene of this transcription factor. This research also provides a potential candidate gene for engineering increased taxol accumulation in Taxus cell cultures. © 2012 German Botanical Society and The Royal Botanical Society of the Netherlands.
Widespread promoter-mediated coordination of transcription and mRNA degradation
2012-01-01
Background Previous work showed that mRNA degradation is coordinated with transcription in yeast, and in several genes the control of mRNA degradation was linked to promoter elements through two different mechanisms. Here we show at the genomic scale that the coordination of transcription and mRNA degradation is promoter-dependent in yeast and is also observed in humans. Results We first demonstrate that swapping upstream cis-regulatory sequences between two yeast species affects both transcription and mRNA degradation and suggest that while some cis-regulatory elements control either transcription or degradation, multiple other elements enhance both processes. Second, we show that adjacent yeast genes that share a promoter (through divergent orientation) have increased similarity in their patterns of mRNA degradation, providing independent evidence for the promoter-mediated coupling of transcription to mRNA degradation. Finally, analysis of the differences in mRNA degradation rates between mammalian cell types or mammalian species suggests a similar coordination between transcription and mRNA degradation in humans. Conclusions Our results extend previous studies and suggest a pervasive promoter-mediated coordination between transcription and mRNA degradation in yeast. The diverse genes and regulatory elements associated with this coordination suggest that it is generated by a global mechanism of gene regulation and modulated by gene-specific mechanisms. The observation of a similar coupling in mammals raises the possibility that coupling of transcription and mRNA degradation may reflect an evolutionarily conserved phenomenon in gene regulation. PMID:23237624
Rydenfelt, Mattias; Cox, Robert Sidney; Garcia, Hernan; Phillips, Rob
2014-01-01
Transcription factors (TFs) with regulatory action at multiple promoter targets is the rule rather than the exception, with examples ranging from the cAMP receptor protein (CRP) in E. coli that regulates hundreds of different genes simultaneously to situations involving multiple copies of the same gene, such as plasmids, retrotransposons, or highly replicated viral DNA. When the number of TFs heavily exceeds the number of binding sites, TF binding to each promoter can be regarded as independent. However, when the number of TF molecules is comparable to the number of binding sites, TF titration will result in correlation (“promoter entanglement”) between transcription of different genes. We develop a statistical mechanical model which takes the TF titration effect into account and use it to predict both the level of gene expression for a general set of promoters and the resulting correlation in transcription rates of different genes. Our results show that the TF titration effect could be important for understanding gene expression in many regulatory settings. PMID:24580252
NASA Astrophysics Data System (ADS)
Yount, Boyd; Roberts, Rhonda S.; Lindesmith, Lisa; Baric, Ralph S.
2006-08-01
Live virus vaccines provide significant protection against many detrimental human and animal diseases, but reversion to virulence by mutation and recombination has reduced appeal. Using severe acute respiratory syndrome coronavirus as a model, we engineered a different transcription regulatory circuit and isolated recombinant viruses. The transcription network allowed for efficient expression of the viral transcripts and proteins, and the recombinant viruses replicated to WT levels. Recombinant genomes were then constructed that contained mixtures of the WT and mutant regulatory circuits, reflecting recombinant viruses that might occur in nature. Although viable viruses could readily be isolated from WT and recombinant genomes containing homogeneous transcription circuits, chimeras that contained mixed regulatory networks were invariantly lethal, because viable chimeric viruses were not isolated. Mechanistically, mixed regulatory circuits promoted inefficient subgenomic transcription from inappropriate start sites, resulting in truncated ORFs and effectively minimize viral structural protein expression. Engineering regulatory transcription circuits of intercommunicating alleles successfully introduces genetic traps into a viral genome that are lethal in RNA recombinant progeny viruses. regulation | systems biology | vaccine design
Gudapaty, Seshagirirao; Suzuki, Kazushi; Wang, Xin; Babitzke, Paul; Romeo, Tony
2001-01-01
The global regulator CsrA (carbon storage regulator) of Escherichia coli is a small RNA binding protein that represses various metabolic pathways and processes that are induced in the stationary phase of growth, while it activates certain exponential phase functions. Both repression and activation by CsrA involve posttranscriptional mechanisms, in which CsrA binding to mRNA leads to decreased or increased transcript stability, respectively. CsrA also binds to a small untranslated RNA, CsrB, forming a ribonucleoprotein complex, which antagonizes CsrA activity. We have further examined the regulatory interactions of CsrA and CsrB RNA. The 5′ end of the CsrB transcript was mapped, and a csrB::cam null mutant was constructed. CsrA protein and CsrB RNA levels were estimated throughout the growth curves of wild-type and isogenic csrA, csrB, rpoS, or csrA rpoS mutant strains. CsrA levels exhibited modest or negligible effects of these mutations. The intracellular concentration of CsrA exceeded the total CsrA-binding capacity of intracellular CsrB RNA. In contrast, CsrB levels were drastically decreased (∼10-fold) in the csrA mutants. CsrB transcript stability was unaffected by csrA. The expression of a csrB-lacZ transcriptional fusion containing the region from −242 to +4 bp of the csrB gene was decreased ∼20-fold by a csrA::kanR mutation in vivo but was unaffected by CsrA protein in vitro. These results reveal a significant, though most likely indirect, role for CsrA in regulating csrB transcription. Furthermore, our findings suggest that CsrA mediates an intriguing form of autoregulation, whereby its activity, but not its levels, is modulated through effects on an RNA antagonist, CsrB. PMID:11567002
Loots, Gabriela G
2008-01-01
Despite remarkable recent advances in genomics that have enabled us to identify most of the genes in the human genome, comparable efforts to define transcriptional cis-regulatory elements that control gene expression are lagging behind. The difficulty of this task stems from two equally important problems: our knowledge of how regulatory elements are encoded in genomes remains elementary, and there is a vast genomic search space for regulatory elements, since most of mammalian genomes are noncoding. Comparative genomic approaches are having a remarkable impact on the study of transcriptional regulation in eukaryotes and currently represent the most efficient and reliable methods of predicting noncoding sequences likely to control the patterns of gene expression. By subjecting eukaryotic genomic sequences to computational comparisons and subsequent experimentation, we are inching our way toward a more comprehensive catalog of common regulatory motifs that lie behind fundamental biological processes. We are still far from comprehending how the transcriptional regulatory code is encrypted in the human genome and providing an initial global view of regulatory gene networks, but collectively, the continued development of comparative and experimental approaches will rapidly expand our knowledge of the transcriptional regulome.
Multiple transcription factor codes activate epidermal wound–response genes in Drosophila
Pearson, Joseph C.; Juarez, Michelle T.; Kim, Myungjin; Drivenes, Øyvind; McGinnis, William
2009-01-01
Wounds in Drosophila and mouse embryos induce similar genetic pathways to repair epidermal barriers. However, the transcription factors that transduce wound signals to repair epidermal barriers are largely unknown. We characterize the transcriptional regulatory enhancers of 4 genes—Ddc, ple, msn, and kkv—that are rapidly activated in epidermal cells surrounding wounds in late Drosophila embryos and early larvae. These epidermal wound enhancers all contain evolutionarily conserved sequences matching binding sites for JUN/FOS and GRH transcription factors, but vary widely in trans- and cis-requirements for these inputs and their binding sites. We propose that the combination of GRH and FOS is part of an ancient wound–response pathway still used in vertebrates and invertebrates, but that other mechanisms have evolved that result in similar transcriptional output. A common, but largely untested assumption of bioinformatic analyses of gene regulatory networks is that transcription units activated in the same spatial and temporal patterns will require the same cis-regulatory codes. Our results indicate that this is an overly simplistic view. PMID:19168633
2013-01-01
Background As one of the most dominant bacterial groups on Earth, cyanobacteria play a pivotal role in the global carbon cycling and the Earth atmosphere composition. Understanding their molecular responses to environmental perturbations has important scientific and environmental values. Since important biological processes or networks are often evolutionarily conserved, the cross-species transcriptional network analysis offers a useful strategy to decipher conserved and species-specific transcriptional mechanisms that cells utilize to deal with various biotic and abiotic disturbances, and it will eventually lead to a better understanding of associated adaptation and regulatory networks. Results In this study, the Weighted Gene Co-expression Network Analysis (WGCNA) approach was used to establish transcriptional networks for four important cyanobacteria species under metal stress, including iron depletion and high copper conditions. Cross-species network comparison led to discovery of several core response modules and genes possibly essential to metal stress, as well as species-specific hub genes for metal stresses in different cyanobacteria species, shedding light on survival strategies of cyanobacteria responding to different environmental perturbations. Conclusions The WGCNA analysis demonstrated that the application of cross-species transcriptional network analysis will lead to novel insights to molecular response to environmental changes which will otherwise not be achieved by analyzing data from a single species. PMID:23421563
Opal, Steven M; Ellis, James L; Suri, Vipin; Freudenberg, Johannes M; Vlasuk, George P; Li, Yong; Chahin, Abdullah B; Palardy, John E; Parejo, Nicholas; Yamamoto, Michelle; Chahin, Abdulrahman; Kessimian, Noubar
2016-04-01
The sirtuin family consists of seven NAD+-dependent enzymes affecting a broad array of regulatory protein networks by primarily catalyzing the deacetylation of key lysine residues in regulatory proteins. The enzymatic activity of SIRT1 can be enhanced by small molecule activators known as SIRT1 activator compounds (STACs). We tested the therapeutic potential of the STAC SRT3025 in two preclinical models of severe infection, the murine cecal ligation and puncture (CLP) model to induce peritonitis and intratracheal installation of Streptococcus pneumoniae to induce severe bacterial pneumonia. SRT3025 provided significant survival benefits over vehicle control in both the peritonitis and pneumococcal pneumonia models when administered with appropriate antimicrobial agents. The survival benefit of SRT3025 in the CLP model was absent in SIRT1 knockout showing the SIRT1 dependency of SRT3025's effects. SRT3025 administration promoted bacterial clearance and significantly reduced inflammatory cytokines from the lungs of animals challenged with S. pneumoniae. SRT3025 treatment was also accompanied by striking changes in the transcription profiles in multiple inflammatory and metabolic pathways in liver, spleen, small bowel, and lung tissue. Remarkably, these organ-specific changes in the transcriptome analyses were similar following CLP or pneumococcal challenge despite different sets of pathogens at disparate sites of infection. Pharmacologic activation of SIRT1 modulates the innate host response and could represent a novel treatment strategy for severe infection.
Cheng, Hongtao; Liu, Hongbo; Deng, Yong; Xiao, Jinghua; Li, Xianghua; Wang, Shiping
2015-01-01
Blast caused by fungal Magnaporthe oryzae is a devastating disease of rice (Oryza sativa) worldwide, and this fungus also infects barley (Hordeum vulgare). At least 11 rice WRKY transcription factors have been reported to regulate rice response to M. oryzae either positively or negatively. However, the relationships of these WRKYs in the rice defense signaling pathway against M. oryzae are unknown. Previous studies have revealed that rice WRKY13 (as a transcriptional repressor) and WRKY45-2 enhance resistance to M. oryzae. Here, we show that rice WRKY42, functioning as a transcriptional repressor, suppresses resistance to M. oryzae. WRKY42-RNA interference (RNAi) and WRKY42-overexpressing (oe) plants showed increased resistance and susceptibility to M. oryzae, accompanied by increased or reduced jasmonic acid (JA) content, respectively, compared with wild-type plants. JA pretreatment enhanced the resistance of WRKY42-oe plants to M. oryzae. WRKY13 directly suppressed WRKY42. WRKY45-2, functioning as a transcriptional activator, directly activated WRKY13. In addition, WRKY13 directly suppressed WRKY45-2 by feedback regulation. The WRKY13-RNAi WRKY45-2-oe and WRKY13-oe WRKY42-oe double transgenic lines showed increased susceptibility to M. oryzae compared with WRKY45-2-oe and WRKY13-oe plants, respectively. These results suggest that the three WRKYs form a sequential transcriptional regulatory cascade. WRKY42 may negatively regulate rice response to M. oryzae by suppressing JA signaling-related genes, and WRKY45-2 transcriptionally activates WRKY13, whose encoding protein in turn transcriptionally suppresses WRKY42 to regulate rice resistance to M. oryzae. PMID:25624395
Li, Xiaolin; Fan, Shuhong; Hu, Wei; Liu, Guoyin; Wei, Yunxie; He, Chaozu; Shi, Haitao
2017-01-01
Basic domain-leucine zipper (bZIP) transcription factor, one type of conserved gene family, plays an important role in plant development and stress responses. Although 77 MebZIPs have been genome-wide identified in cassava, their in vivo roles remain unknown. In this study, we analyzed the expression pattern and the function of two MebZIPs ( MebZIP3 and MebZIP5 ) in response to pathogen infection. Gene expression analysis indicated that MebZIP3 and MebZIP5 were commonly regulated by flg22, Xanthomonas axonopodis pv. manihotis ( Xam ), salicylic acid (SA), and hydrogen peroxide (H 2 O 2 ). Subcellular localization analysis showed that MebZIP3 and MebZIP5 are specifically located in cell nucleus. Through overexpression in tobacco, we found that MebZIP3 and MebZIP5 conferred improved disease resistance against cassava bacterial blight, with more callose depositions. On the contrary, MebZIP3- and MebZIP5 -silenced plants by virus-induced gene silencing (VIGS) showed disease sensitive phenotype, lower transcript levels of defense-related genes and less callose depositions. Taken together, this study highlights the positive role of MebZIP3 and MebZIP5 in disease resistance against cassava bacterial blight for further utilization in genetic improvement of cassava disease resistance.
Suzuki, Harukazu; Forrest, Alistair R R; van Nimwegen, Erik; Daub, Carsten O; Balwierz, Piotr J; Irvine, Katharine M; Lassmann, Timo; Ravasi, Timothy; Hasegawa, Yuki; de Hoon, Michiel J L; Katayama, Shintaro; Schroder, Kate; Carninci, Piero; Tomaru, Yasuhiro; Kanamori-Katayama, Mutsumi; Kubosaki, Atsutaka; Akalin, Altuna; Ando, Yoshinari; Arner, Erik; Asada, Maki; Asahara, Hiroshi; Bailey, Timothy; Bajic, Vladimir B; Bauer, Denis; Beckhouse, Anthony G; Bertin, Nicolas; Björkegren, Johan; Brombacher, Frank; Bulger, Erika; Chalk, Alistair M; Chiba, Joe; Cloonan, Nicole; Dawe, Adam; Dostie, Josee; Engström, Pär G; Essack, Magbubah; Faulkner, Geoffrey J; Fink, J Lynn; Fredman, David; Fujimori, Ko; Furuno, Masaaki; Gojobori, Takashi; Gough, Julian; Grimmond, Sean M; Gustafsson, Mika; Hashimoto, Megumi; Hashimoto, Takehiro; Hatakeyama, Mariko; Heinzel, Susanne; Hide, Winston; Hofmann, Oliver; Hörnquist, Michael; Huminiecki, Lukasz; Ikeo, Kazuho; Imamoto, Naoko; Inoue, Satoshi; Inoue, Yusuke; Ishihara, Ryoko; Iwayanagi, Takao; Jacobsen, Anders; Kaur, Mandeep; Kawaji, Hideya; Kerr, Markus C; Kimura, Ryuichiro; Kimura, Syuhei; Kimura, Yasumasa; Kitano, Hiroaki; Koga, Hisashi; Kojima, Toshio; Kondo, Shinji; Konno, Takeshi; Krogh, Anders; Kruger, Adele; Kumar, Ajit; Lenhard, Boris; Lennartsson, Andreas; Lindow, Morten; Lizio, Marina; Macpherson, Cameron; Maeda, Norihiro; Maher, Christopher A; Maqungo, Monique; Mar, Jessica; Matigian, Nicholas A; Matsuda, Hideo; Mattick, John S; Meier, Stuart; Miyamoto, Sei; Miyamoto-Sato, Etsuko; Nakabayashi, Kazuhiko; Nakachi, Yutaka; Nakano, Mika; Nygaard, Sanne; Okayama, Toshitsugu; Okazaki, Yasushi; Okuda-Yabukami, Haruka; Orlando, Valerio; Otomo, Jun; Pachkov, Mikhail; Petrovsky, Nikolai; Plessy, Charles; Quackenbush, John; Radovanovic, Aleksandar; Rehli, Michael; Saito, Rintaro; Sandelin, Albin; Schmeier, Sebastian; Schönbach, Christian; Schwartz, Ariel S; Semple, Colin A; Sera, Miho; Severin, Jessica; Shirahige, Katsuhiko; Simons, Cas; St Laurent, George; Suzuki, Masanori; Suzuki, Takahiro; Sweet, Matthew J; Taft, Ryan J; Takeda, Shizu; Takenaka, Yoichi; Tan, Kai; Taylor, Martin S; Teasdale, Rohan D; Tegnér, Jesper; Teichmann, Sarah; Valen, Eivind; Wahlestedt, Claes; Waki, Kazunori; Waterhouse, Andrew; Wells, Christine A; Winther, Ole; Wu, Linda; Yamaguchi, Kazumi; Yanagawa, Hiroshi; Yasuda, Jun; Zavolan, Mihaela; Hume, David A; Arakawa, Takahiro; Fukuda, Shiro; Imamura, Kengo; Kai, Chikatoshi; Kaiho, Ai; Kawashima, Tsugumi; Kawazu, Chika; Kitazume, Yayoi; Kojima, Miki; Miura, Hisashi; Murakami, Kayoko; Murata, Mitsuyoshi; Ninomiya, Noriko; Nishiyori, Hiromi; Noma, Shohei; Ogawa, Chihiro; Sano, Takuma; Simon, Christophe; Tagami, Michihira; Takahashi, Yukari; Kawai, Jun; Hayashizaki, Yoshihide
2009-05-01
Using deep sequencing (deepCAGE), the FANTOM4 study measured the genome-wide dynamics of transcription-start-site usage in the human monocytic cell line THP-1 throughout a time course of growth arrest and differentiation. Modeling the expression dynamics in terms of predicted cis-regulatory sites, we identified the key transcription regulators, their time-dependent activities and target genes. Systematic siRNA knockdown of 52 transcription factors confirmed the roles of individual factors in the regulatory network. Our results indicate that cellular states are constrained by complex networks involving both positive and negative regulatory interactions among substantial numbers of transcription factors and that no single transcription factor is both necessary and sufficient to drive the differentiation process.
ReNE: A Cytoscape Plugin for Regulatory Network Enhancement
Politano, Gianfranco; Benso, Alfredo; Savino, Alessandro; Di Carlo, Stefano
2014-01-01
One of the biggest challenges in the study of biological regulatory mechanisms is the integration, americanmodeling, and analysis of the complex interactions which take place in biological networks. Despite post transcriptional regulatory elements (i.e., miRNAs) are widely investigated in current research, their usage and visualization in biological networks is very limited. Regulatory networks are commonly limited to gene entities. To integrate networks with post transcriptional regulatory data, researchers are therefore forced to manually resort to specific third party databases. In this context, we introduce ReNE, a Cytoscape 3.x plugin designed to automatically enrich a standard gene-based regulatory network with more detailed transcriptional, post transcriptional, and translational data, resulting in an enhanced network that more precisely models the actual biological regulatory mechanisms. ReNE can automatically import a network layout from the Reactome or KEGG repositories, or work with custom pathways described using a standard OWL/XML data format that the Cytoscape import procedure accepts. Moreover, ReNE allows researchers to merge multiple pathways coming from different sources. The merged network structure is normalized to guarantee a consistent and uniform description of the network nodes and edges and to enrich all integrated data with additional annotations retrieved from genome-wide databases like NCBI, thus producing a pathway fully manageable through the Cytoscape environment. The normalized network is then analyzed to include missing transcription factors, miRNAs, and proteins. The resulting enhanced network is still a fully functional Cytoscape network where each regulatory element (transcription factor, miRNA, gene, protein) and regulatory mechanism (up-regulation/down-regulation) is clearly visually identifiable, thus enabling a better visual understanding of its role and the effect in the network behavior. The enhanced network produced by Re
CoSMoS Unravels Mysteries of Transcription Initiation
Gourse, Richard L.; Landick, Robert
2013-01-01
Using a fluorescence method called colocalization single-molecule spectroscopy (CoSMoS), Friedman and Gelles dissect the kinetics of transcription initiation at a bacterial promoter. Ultimately, CoSMoS could greatly aid the study of the effects of DNA sequence and transcription factors on both prokaryotic and eukaryotic promoters. PMID:22341438
Marui, N; Offermann, M K; Swerlick, R; Kunsch, C; Rosen, C A; Ahmad, M; Alexander, R W; Medford, R M
1993-01-01
Oxidative stress and expression of the vascular cell adhesion molecule-1 (VCAM-1) on vascular endothelial cells are early features in the pathogenesis of atherosclerosis and other inflammatory diseases. Regulation of VCAM-1 gene expression may be coupled to oxidative stress through specific reduction-oxidation (redox) sensitive transcriptional or posttranscriptional regulatory factors. In cultured human umbilical vein endothelial (HUVE) cells, the cytokine interleukin 1 beta (IL-1 beta) activated VCAM-1 gene expression through a mechanism that was repressed approximately 90% by the antioxidants pyrrolidine dithiocarbamate (PDTC) and N-acetylcysteine (NAC). Furthermore, PDTC selectively inhibited the induction of VCAM-1, but not intercellular adhesion molecule-1 (ICAM-1), mRNA and protein accumulation by the cytokine tumor necrosis factor-alpha (TNF alpha) as well as the noncytokines bacterial endotoxin lipopolysaccharide (LPS) and double-stranded RNA, poly(I:C) (PIC). PDTC also markedly attenuated TNF alpha induction of VCAM-1-mediated cellular adhesion. In a distinct pattern, PDTC partially inhibited E-selectin gene expression in response to TNF alpha but not to LPS, IL-1 beta, or PIC. TNF alpha and LPS-mediated transcriptional activation of the human VCAM-1 promoter through NF-kappa B-like DNA enhancer elements and associated NF-kappa B-like DNA binding proteins was inhibited by PDTC. These studies suggest a molecular linkage between an antioxidant sensitive transcriptional regulatory mechanism and VCAM-1 gene expression that expands on the notion of oxidative stress as an important regulatory signal in the pathogenesis of atherosclerosis. Images PMID:7691889
Navarro, S; Cossalter, G; Chiavaroli, C; Kanda, A; Fleury, S; Lazzari, A; Cazareth, J; Sparwasser, T; Dombrowicz, D; Glaichenhaus, N; Julia, V
2011-01-01
The prevalence of asthma has steadily increased during the last decade, probably as the result of changes in the environment, including reduced microbial exposure during infancy. Accordingly, experimental studies have shown that deliberate infections with live pathogens prevent the development of allergic airway diseases in mice. Bacterial extracts are currently used in children suffering from repeated upper respiratory tract infections. In the present study, we have investigated whether bacterial extracts, commercially available as Broncho-Vaxom (BV), could prevent allergic airway disease in mice. Oral treatment with BV suppressed airway inflammation through interleukin-10 (IL-10)-dependent and MyD88 (myeloid differentiation primary response gene (88))-dependent mechanisms and induced the conversion of FoxP3 (forkhead box P3)(-) T cells into FoxP3(+) regulatory T cells. Furthermore, CD4(+) T cells purified from the trachea of BV-treated mice conferred protection against airway inflammation when adoptively transferred into sensitized mice. Therefore, treatment with BV could possibly be a safe and efficient strategy to prevent the development of allergic diseases in children.
NASA Astrophysics Data System (ADS)
Ye, Weiming; Li, Pengfei; Huang, Xuhui; Xia, Qinzhi; Mi, Yuanyuan; Chen, Runsheng; Hu, Gang
2010-10-01
Exploring the principle and relationship of gene transcriptional regulations (TR) has been becoming a generally researched issue. So far, two major mathematical methods, ordinary differential equation (ODE) method and Boolean map (BM) method have been widely used for these purposes. It is commonly believed that simplified BMs are reasonable approximations of more realistic ODEs, and both methods may reveal qualitatively the same essential features though the dynamical details of both systems may show some differences. In this Letter we exhaustively enumerated all the 3-gene networks and many autonomous randomly constructed TR networks with more genes by using both the ODE and BM methods. In comparison we found that both methods provide practically identical results in most of cases of steady solutions. However, to our great surprise, most of network structures showing periodic cycles with the BM method possess only stationary states in ODE descriptions. These observations strongly suggest that many periodic oscillations and other complicated oscillatory states revealed by the BM rule may be related to the computational errors of variable and time discretizations and rarely have correspondence in realistic biology transcriptional regulatory circuits.
In Silico Detection of Sequence Variations Modifying Transcriptional Regulation
Andersen, Malin C; Engström, Pär G; Lithwick, Stuart; Arenillas, David; Eriksson, Per; Lenhard, Boris; Wasserman, Wyeth W; Odeberg, Jacob
2008-01-01
Identification of functional genetic variation associated with increased susceptibility to complex diseases can elucidate genes and underlying biochemical mechanisms linked to disease onset and progression. For genes linked to genetic diseases, most identified causal mutations alter an encoded protein sequence. Technological advances for measuring RNA abundance suggest that a significant number of undiscovered causal mutations may alter the regulation of gene transcription. However, it remains a challenge to separate causal genetic variations from linked neutral variations. Here we present an in silico driven approach to identify possible genetic variation in regulatory sequences. The approach combines phylogenetic footprinting and transcription factor binding site prediction to identify variation in candidate cis-regulatory elements. The bioinformatics approach has been tested on a set of SNPs that are reported to have a regulatory function, as well as background SNPs. In the absence of additional information about an analyzed gene, the poor specificity of binding site prediction is prohibitive to its application. However, when additional data is available that can give guidance on which transcription factor is involved in the regulation of the gene, the in silico binding site prediction improves the selection of candidate regulatory polymorphisms for further analyses. The bioinformatics software generated for the analysis has been implemented as a Web-based application system entitled RAVEN (regulatory analysis of variation in enhancers). The RAVEN system is available at http://www.cisreg.ca for all researchers interested in the detection and characterization of regulatory sequence variation. PMID:18208319
On the Concept of Cis-regulatory Information: From Sequence Motifs to Logic Functions
NASA Astrophysics Data System (ADS)
Tarpine, Ryan; Istrail, Sorin
The regulatory genome is about the “system level organization of the core genomic regulatory apparatus, and how this is the locus of causality underlying the twin phenomena of animal development and animal evolution” (E.H. Davidson. The Regulatory Genome: Gene Regulatory Networks in Development and Evolution, Academic Press, 2006). Information processing in the regulatory genome is done through regulatory states, defined as sets of transcription factors (sequence-specific DNA binding proteins which determine gene expression) that are expressed and active at the same time. The core information processing machinery consists of modular DNA sequence elements, called cis-modules, that interact with transcription factors. The cis-modules “read” the information contained in the regulatory state of the cell through transcription factor binding, “process” it, and directly or indirectly communicate with the basal transcription apparatus to determine gene expression. This endowment of each gene with the information-receiving capacity through their cis-regulatory modules is essential for the response to every possible regulatory state to which it might be exposed during all phases of the life cycle and in all cell types. We present here a set of challenges addressed by our CYRENE research project aimed at studying the cis-regulatory code of the regulatory genome. The CYRENE Project is devoted to (1) the construction of a database, the cis-Lexicon, containing comprehensive information across species about experimentally validated cis-regulatory modules; and (2) the software development of a next-generation genome browser, the cis-Browser, specialized for the regulatory genome. The presentation is anchored on three main computational challenges: the Gene Naming Problem, the Consensus Sequence Bottleneck Problem, and the Logic Function Inference Problem.
Landscape of post-transcriptional gene regulation during hepatitis C virus infection
Schwerk, Johannes; Jarret, Abigail P.; Joslyn, Rochelle C.; Savan, Ram
2015-01-01
Post-transcriptional regulation of gene expression plays a pivotal role in various gene regulatory networks including, but not limited to metabolism, embryogenesis and immune responses. Different mechanisms of post-transcriptional regulation, which can act individually, synergistically, or even in an antagonistic manner have been described. Hepatitis C virus (HCV) is notorious for subverting host immune responses and indeed exploits several components of the host’s post-transcriptional regulatory machinery for its own benefit. At the same time, HCV replication is post-transcriptionally targeted by host cell components to blunt viral propagation. This review discusses the interplay of post-transcriptional mechanisms that affect host immune responses in the setting of HCV infection and highlights the sophisticated mechanisms both host and virus have evolved in the race for superiority. PMID:25890065
Sowa, Steven W; Gelderman, Grant; Leistra, Abigail N; Buvanendiran, Aishwarya; Lipp, Sarah; Pitaktong, Areen; Vakulskas, Christopher A; Romeo, Tony; Baldea, Michael; Contreras, Lydia M
2017-02-28
Multi-target regulators represent a largely untapped area for metabolic engineering and anti-bacterial development. These regulators are complex to characterize because they often act at multiple levels, affecting proteins, transcripts and metabolites. Therefore, single omics experiments cannot profile their underlying targets and mechanisms. In this work, we used an Integrative FourD omics approach (INFO) that consists of collecting and analyzing systems data throughout multiple time points, using multiple genetic backgrounds, and multiple omics approaches (transcriptomics, proteomics and high throughput sequencing crosslinking immunoprecipitation) to evaluate simultaneous changes in gene expression after imposing an environmental stress that accentuates the regulatory features of a network. Using this approach, we profiled the targets and potential regulatory mechanisms of a global regulatory system, the well-studied carbon storage regulatory (Csr) system of Escherichia coli, which is widespread among bacteria. Using 126 sets of proteomics and transcriptomics data, we identified 136 potential direct CsrA targets, including 50 novel ones, categorized their behaviors into distinct regulatory patterns, and performed in vivo fluorescence-based follow up experiments. The results of this work validate 17 novel mRNAs as authentic direct CsrA targets and demonstrate a generalizable strategy to integrate multiple lines of omics data to identify a core pool of regulator targets. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Duchi, Diego; Gryte, Kristofer; Robb, Nicole C; Morichaud, Zakia; Sheppard, Carol; Wigneshweraraj, Sivaramesh
2018-01-01
Abstract Transcription initiation is a major step in gene regulation for all organisms. In bacteria, the promoter DNA is first recognized by RNA polymerase (RNAP) to yield an initial closed complex. This complex subsequently undergoes conformational changes resulting in DNA strand separation to form a transcription bubble and an RNAP-promoter open complex; however, the series and sequence of conformational changes, and the factors that influence them are unclear. To address the conformational landscape and transitions in transcription initiation, we applied single-molecule Förster resonance energy transfer (smFRET) on immobilized Escherichia coli transcription open complexes. Our results revealed the existence of two stable states within RNAP–DNA complexes in which the promoter DNA appears to adopt closed and partially open conformations, and we observed large-scale transitions in which the transcription bubble fluctuated between open and closed states; these transitions, which occur roughly on the 0.1 s timescale, are distinct from the millisecond-timescale dynamics previously observed within diffusing open complexes. Mutational studies indicated that the σ70 region 3.2 of the RNAP significantly affected the bubble dynamics. Our results have implications for many steps of transcription initiation, and support a bend-load-open model for the sequence of transitions leading to bubble opening during open complex formation. PMID:29177430
Small regulatory RNA-induced growth rate heterogeneity of Bacillus subtilis.
Mars, Ruben A T; Nicolas, Pierre; Ciccolini, Mariano; Reilman, Ewoud; Reder, Alexander; Schaffer, Marc; Mäder, Ulrike; Völker, Uwe; van Dijl, Jan Maarten; Denham, Emma L
2015-03-01
Isogenic bacterial populations can consist of cells displaying heterogeneous physiological traits. Small regulatory RNAs (sRNAs) could affect this heterogeneity since they act by fine-tuning mRNA or protein levels to coordinate the appropriate cellular behavior. Here we show that the sRNA RnaC/S1022 from the Gram-positive bacterium Bacillus subtilis can suppress exponential growth by modulation of the transcriptional regulator AbrB. Specifically, the post-transcriptional abrB-RnaC/S1022 interaction allows B. subtilis to increase the cell-to-cell variation in AbrB protein levels, despite strong negative autoregulation of the abrB promoter. This behavior is consistent with existing mathematical models of sRNA action, thus suggesting that induction of protein expression noise could be a new general aspect of sRNA regulation. Importantly, we show that the sRNA-induced diversity in AbrB levels generates heterogeneity in growth rates during the exponential growth phase. Based on these findings, we hypothesize that the resulting subpopulations of fast- and slow-growing B. subtilis cells reflect a bet-hedging strategy for enhanced survival of unfavorable conditions.
NASA Astrophysics Data System (ADS)
Kang, Yan-Mei; Chen, Xi; Lin, Xu-Dong; Tan, Ning
The mean first passage time (MFPT) in a phenomenological gene transcriptional regulatory model with non-Gaussian noise is analytically investigated based on the singular perturbation technique. The effect of the non-Gaussian noise on the phenomenon of stochastic resonance (SR) is then disclosed based on a new combination of adiabatic elimination and linear response approximation. Compared with the results in the Gaussian noise case, it is found that bounded non-Gaussian noise inhibits the transition between different concentrations of protein, while heavy-tailed non-Gaussian noise accelerates the transition. It is also found that the optimal noise intensity for SR in the heavy-tailed noise case is smaller, while the optimal noise intensity in the bounded noise case is larger. These observations can be explained by the heavy-tailed noise easing random transitions.
N-3 polyunsaturated fatty acid regulation of hepatic gene transcription
Jump, Donald B.
2009-01-01
Purpose of review The liver plays a central role in whole body lipid metabolism and adapts rapidly to changes in dietary fat composition. This adaption involves changes in the expression of genes involved in glycolysis, de-novo lipogenesis, fatty acid elongation, desaturation and oxidation. This review brings together metabolic and molecular studies that help explain n-3 (omega-3) polyunsaturated fatty acid regulation of hepatic gene transcription. Recent findings Dietary n-3 polyunsaturated fatty acid regulates hepatic gene expression by targeting three major transcriptional regulatory networks: peroxisome proliferator-activated receptor α, sterol regulatory element binding protein-1 and the carbohydrate regulatory element binding protein/Max-like factor X heterodimer. 22 : 6,n-3, the most prominent n-3 polyunsaturated fatty acid in tissues, is a weak activator of peroxisome proliferator-activated receptor α. Hepatic metabolism of 22 : 6,n-3, however, generates 20 : 5,n-3, a strong peroxisome proliferator-activated receptor α activator. In contrast to peroxisome proliferator-activated receptor α, 22 : 6,n-3 is the most potent fatty acid regulator of hepatic sterol regulatory element binding protein-1. 22 : 6,n-3 suppresses sterol regulatory element binding protein-1 gene expression while enhancing degradation of nuclear sterol regulatory element binding protein-1 through 26S proteasome and Erk1/2-dependent mechanisms. Both n-3 and n-6 polyunsaturated fatty acid suppress carbohydrate regulatory element binding protein and Max-like factor X nuclear abundance and interfere with glucose-regulated hepatic metabolism. Summary These studies have revealed unique mechanisms by which specific polyunsaturated fatty acids control peroxisome proliferator activated receptor α, sterol regulatory element binding protein-1 and carbohydrate regulatory element binding protein/Max-like factor X function. As such, specific metabolic and signal transduction pathways contribute
A Genetic Selection For Neurospora crassa Mutants Altered in Their Light Regulation of Transcription
Navarro-Sampedro, Laura; Yanofsky, Charles; Corrochano, Luis M.
2008-01-01
Transcription of the Neurospora crassa gene con-10 is induced during conidiation and following exposure of vegetative mycelia to light, but light activation is transient due to photoadaptation. We describe mutational analyses of photoadaptation using a N. crassa strain bearing a translational fusion of con-10, including its regulatory region, to a selectable bacterial gene conferring hygromycin resistance (hph). Growth of this strain was sensitive to hygromycin, upon continuous culture in the light. Five mutants were isolated that were resistant to hygromycin when cultured under constant light. Three mutant strains displayed elevated, sustained accumulation of con-10∷hph mRNA during continued light exposure, suggesting that they bear mutations that reduce or eliminate the presumed light-dependent repression mechanism that blocks con-10 transcription upon prolonged illumination. These mutations altered photoadaptation for only a specific group of genes (con-10 and con-6), suggesting that regulation of photoadaptation is relatively gene specific. The mutations increased light-dependent mRNA accumulation for genes al-1, al-2, and al-3, each required for carotenoid biosynthesis, resulting in a threefold increase in carotenoid accumulation following continuous light exposure. Identification of the altered gene or genes in these mutants may reveal novel proteins that participate in light regulation of gene transcription in fungi. PMID:18202366
An internal regulatory element controls troponin I gene expression
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yutzey, K.E.; Kline, R.L.; Konieczmy, S.F.
1989-04-01
During skeletal myogenesis, approximately 20 contractile proteins and related gene products temporally accumulate as the cells fuse to form multinucleated muscle fibers. In most instances, the contractile protein genes are regulated transcriptionally, which suggests that a common molecular mechanism may coordinate the expression of this diverse and evolutionarily unrelated gene set. Recent studies have examined the muscle-specific cis-acting elements associated with numerous contractile protein genes. All of the identified regulatory elements are positioned in the 5'-flanking regions, usually within 1,500 base pairs of the transcription start site. Surprisingly, a DNA consensus sequence that is common to each contractile protein genemore » has not been identified. In contrast to the results of these earlier studies, the authors have found that the 5'-flanking region of the quail troponin I (TnI) gene is not sufficient to permit the normal myofiber transcriptional activation of the gene. Instead, the TnI gene utilizes a unique internal regulatory element that is responsible for the correct myofiber-specific expression pattern associated with the TnI gene. This is the first example in which a contractile protein gene has been shown to rely primarily on an internal regulatory element to elicit transcriptional activation during myogenesis. The diversity of regulatory elements associated with the contractile protein genes suggests that the temporal expression of the genes may involve individual cis-trans regulatory components specific for each gene.« less
An internal regulatory element controls troponin I gene expression.
Yutzey, K E; Kline, R L; Konieczny, S F
1989-01-01
During skeletal myogenesis, approximately 20 contractile proteins and related gene products temporally accumulate as the cells fuse to form multinucleated muscle fibers. In most instances, the contractile protein genes are regulated transcriptionally, which suggests that a common molecular mechanism may coordinate the expression of this diverse and evolutionarily unrelated gene set. Recent studies have examined the muscle-specific cis-acting elements associated with numerous contractile protein genes. All of the identified regulatory elements are positioned in the 5'-flanking regions, usually within 1,500 base pairs of the transcription start site. Surprisingly, a DNA consensus sequence that is common to each contractile protein gene has not been identified. In contrast to the results of these earlier studies, we have found that the 5'-flanking region of the quail troponin I (TnI) gene is not sufficient to permit the normal myofiber transcriptional activation of the gene. Instead, the TnI gene utilizes a unique internal regulatory element that is responsible for the correct myofiber-specific expression pattern associated with the TnI gene. This is the first example in which a contractile protein gene has been shown to rely primarily on an internal regulatory element to elicit transcriptional activation during myogenesis. The diversity of regulatory elements associated with the contractile protein genes suggests that the temporal expression of the genes may involve individual cis-trans regulatory components specific for each gene. Images PMID:2725509
Genome-scale cold stress response regulatory networks in ten Arabidopsis thaliana ecotypes
2013-01-01
Background Low temperature leads to major crop losses every year. Although several studies have been conducted focusing on diversity of cold tolerance level in multiple phenotypically divergent Arabidopsis thaliana (A. thaliana) ecotypes, genome-scale molecular understanding is still lacking. Results In this study, we report genome-scale transcript response diversity of 10 A. thaliana ecotypes originating from different geographical locations to non-freezing cold stress (10°C). To analyze the transcriptional response diversity, we initially compared transcriptome changes in all 10 ecotypes using Arabidopsis NimbleGen ATH6 microarrays. In total 6061 transcripts were significantly cold regulated (p < 0.01) in 10 ecotypes, including 498 transcription factors and 315 transposable elements. The majority of the transcripts (75%) showed ecotype specific expression pattern. By using sequence data available from Arabidopsis thaliana 1001 genome project, we further investigated sequence polymorphisms in the core cold stress regulon genes. Significant numbers of non-synonymous amino acid changes were observed in the coding region of the CBF regulon genes. Considering the limited knowledge about regulatory interactions between transcription factors and their target genes in the model plant A. thaliana, we have adopted a powerful systems genetics approach- Network Component Analysis (NCA) to construct an in-silico transcriptional regulatory network model during response to cold stress. The resulting regulatory network contained 1,275 nodes and 7,720 connections, with 178 transcription factors and 1,331 target genes. Conclusions A. thaliana ecotypes exhibit considerable variation in transcriptome level responses to non-freezing cold stress treatment. Ecotype specific transcripts and related gene ontology (GO) categories were identified to delineate natural variation of cold stress regulated differential gene expression in the model plant A. thaliana. The predicted
Mechanisms and Evolution of Control Logic in Prokaryotic Transcriptional Regulation
van Hijum, Sacha A. F. T.; Medema, Marnix H.; Kuipers, Oscar P.
2009-01-01
Summary: A major part of organismal complexity and versatility of prokaryotes resides in their ability to fine-tune gene expression to adequately respond to internal and external stimuli. Evolution has been very innovative in creating intricate mechanisms by which different regulatory signals operate and interact at promoters to drive gene expression. The regulation of target gene expression by transcription factors (TFs) is governed by control logic brought about by the interaction of regulators with TF binding sites (TFBSs) in cis-regulatory regions. A factor that in large part determines the strength of the response of a target to a given TF is motif stringency, the extent to which the TFBS fits the optimal TFBS sequence for a given TF. Advances in high-throughput technologies and computational genomics allow reconstruction of transcriptional regulatory networks in silico. To optimize the prediction of transcriptional regulatory networks, i.e., to separate direct regulation from indirect regulation, a thorough understanding of the control logic underlying the regulation of gene expression is required. This review summarizes the state of the art of the elements that determine the functionality of TFBSs by focusing on the molecular biological mechanisms and evolutionary origins of cis-regulatory regions. PMID:19721087
LacI Transcriptional Regulatory Networks in Clostridium thermocellum DSM1313
Wilson, Charlotte M.; Klingeman, Dawn M.; Schlachter, Caleb; ...
2016-12-21
Organisms regulate gene expression in response to the environment to coordinate metabolic reactions.Clostridium thermocellumexpresses enzymes for both lignocellulose solubilization and its fermentation to produce ethanol. In one LacI regulator termed GlyR3 inC. thermocellumATCC 27405 we identified a repressor of neighboring genes with repression relieved by laminaribiose (a β-1,3 disaccharide). To better understand the threeC. thermocellumLacI regulons, deletion mutants were constructed using the genetically tractable DSM1313 strain. DSM1313lacIgenes Clo1313_2023, Clo1313_0089, and Clo1313_0396 encode homologs of GlyR1, GlyR2, and GlyR3 from strain ATCC 27405, respectively. Furthermore, growth on cellobiose or pretreated switchgrass was unaffected by any of the gene deletions under controlled-pHmore » fermentations. Global gene expression patterns from time course analyses identified glycoside hydrolase genes encoding hemicellulases, including cellulosomal enzymes, that were highly upregulated (5- to 100-fold) in the absence of each LacI regulator, suggesting that these were repressed under wild-type conditions and that relatively few genes were controlled by each regulator under the conditions tested. Clo1313_2022, encoding lichenase enzyme LicB, was derepressed in a ΔglyR1strain. Higher expression of Clo1313_1398, which encodes the Man5A mannanase, was observed in a ΔglyR2strain, and α-mannobiose was identified as a probable inducer for GlyR2-regulated genes. For the ΔglyR3strain, upregulation of the two genes adjacent toglyR3in thecelC-glyR3-licAoperon was consistent with earlier studies. Electrophoretic mobility shift assays have confirmed LacI transcription factor binding to specific regions of gene promoters. IMPORTANCEUnderstandingC. thermocellumgene regulation is of importance for improved fundamental knowledge of this industrially relevant bacterium. Most LacI transcription factors regulate local genomic regions; however, a small number of those
Mouse regulatory DNA landscapes reveal global principles of cis-regulatory evolution.
Vierstra, Jeff; Rynes, Eric; Sandstrom, Richard; Zhang, Miaohua; Canfield, Theresa; Hansen, R Scott; Stehling-Sun, Sandra; Sabo, Peter J; Byron, Rachel; Humbert, Richard; Thurman, Robert E; Johnson, Audra K; Vong, Shinny; Lee, Kristen; Bates, Daniel; Neri, Fidencio; Diegel, Morgan; Giste, Erika; Haugen, Eric; Dunn, Douglas; Wilken, Matthew S; Josefowicz, Steven; Samstein, Robert; Chang, Kai-Hsin; Eichler, Evan E; De Bruijn, Marella; Reh, Thomas A; Skoultchi, Arthur; Rudensky, Alexander; Orkin, Stuart H; Papayannopoulou, Thalia; Treuting, Piper M; Selleri, Licia; Kaul, Rajinder; Groudine, Mark; Bender, M A; Stamatoyannopoulos, John A
2014-11-21
To study the evolutionary dynamics of regulatory DNA, we mapped >1.3 million deoxyribonuclease I-hypersensitive sites (DHSs) in 45 mouse cell and tissue types, and systematically compared these with human DHS maps from orthologous compartments. We found that the mouse and human genomes have undergone extensive cis-regulatory rewiring that combines branch-specific evolutionary innovation and loss with widespread repurposing of conserved DHSs to alternative cell fates, and that this process is mediated by turnover of transcription factor (TF) recognition elements. Despite pervasive evolutionary remodeling of the location and content of individual cis-regulatory regions, within orthologous mouse and human cell types the global fraction of regulatory DNA bases encoding recognition sites for each TF has been strictly conserved. Our findings provide new insights into the evolutionary forces shaping mammalian regulatory DNA landscapes. Copyright © 2014, American Association for the Advancement of Science.
USDA-ARS?s Scientific Manuscript database
Transcription activator-like (TAL) effectors found in Xanthomonas spp. promote bacterial growth and plant susceptibility by binding specific DNA sequences or, effector-binding elements (EBEs), and inducing host gene expression. In this study, we have found substantially different transcriptional pro...
Santiago, Teresa C; Mamoun, Choukri Ben
2003-10-03
In Saccharomyces cerevisiae, genes encoding phospholipid-synthesizing enzymes are regulated by inositol and choline (IC). The current model suggests that when these precursors become limiting, the transcriptional complex Ino2p-Ino4p activates the expression of these genes, whereas repression requires Opi1p and occurs when IC are available. In this study, microarray-based expression analysis was performed to assess the global transcriptional response to IC in a wild-type strain and in the opi1delta, ino2delta, and ino4delta null mutant strains. Fifty genes were either activated or repressed by IC in the wild-type strain, including three already known IC-repressed genes. We demonstrated that the IC response was not limited to genes involved in membrane biogenesis, but encompassed various metabolic pathways such as biotin synthesis, one-carbon compound metabolism, nitrogen-containing compound transport and degradation, cell wall organization and biogenesis, and acetyl-CoA metabolism. The expression of a large number of IC-regulated genes did not change in the opi1delta, ino2delta, and ino4delta strains, thus implicating new regulatory elements in the IC response. Our studies revealed that Opi1p, Ino2p, and Ino4p have dual regulatory activities, acting in both positive and negative transcriptional regulation of a large number of genes, most of which are not regulated by IC and only a subset of which is involved in membrane biogenesis. These data provide the first global response profile of yeast to IC and reveal novel regulatory mechanisms by these precursors.
Seo, Sang Woo; Kim, Donghyuk; Szubin, Richard; Palsson, Bernhard O
2015-08-25
Three transcription factors (TFs), OxyR, SoxR, and SoxS, play a critical role in transcriptional regulation of the defense system for oxidative stress in bacteria. However, their full genome-wide regulatory potential is unknown. Here, we perform a genome-scale reconstruction of the OxyR, SoxR, and SoxS regulons in Escherichia coli K-12 MG1655. Integrative data analysis reveals that a total of 68 genes in 51 transcription units (TUs) belong to these regulons. Among them, 48 genes showed more than 2-fold changes in expression level under single-TF-knockout conditions. This reconstruction expands the genome-wide roles of these factors to include direct activation of genes related to amino acid biosynthesis (methionine and aromatic amino acids), cell wall synthesis (lipid A biosynthesis and peptidoglycan growth), and divalent metal ion transport (Mn(2+), Zn(2+), and Mg(2+)). Investigating the co-regulation of these genes with other stress-response TFs reveals that they are independently regulated by stress-specific TFs. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Mikhailov, Alexander T; Torrado, Mario
2018-05-12
There is growing evidence that putative gene regulatory networks including cardio-enriched transcription factors, such as PITX2, TBX5, ZFHX3, and SHOX2, and their effector/target genes along with downstream non-coding RNAs can play a potentially important role in the process of adaptive and maladaptive atrial rhythm remodeling. In turn, expression of atrial fibrillation-associated transcription factors is under the control of upstream regulatory non-coding RNAs. This review broadly explores gene regulatory mechanisms associated with susceptibility to atrial fibrillation-with key examples from both animal models and patients-within the context of both cardiac transcription factors and non-coding RNAs. These two systems appear to have multiple levels of cross-regulation and act coordinately to achieve effective control of atrial rhythm effector gene expression. Perturbations of a dynamic expression balance between transcription factors and corresponding non-coding RNAs can provoke the development or promote the progression of atrial fibrillation. We also outline deficiencies in current models and discuss ongoing studies to clarify remaining mechanistic questions. An understanding of the function of transcription factors and non-coding RNAs in gene regulatory networks associated with atrial fibrillation risk will enable the development of innovative therapeutic strategies.
Jungreuthmayer, Christian; Ruckerbauer, David E.; Gerstl, Matthias P.; Hanscho, Michael; Zanghellini, Jürgen
2015-01-01
Despite the significant progress made in recent years, the computation of the complete set of elementary flux modes of large or even genome-scale metabolic networks is still impossible. We introduce a novel approach to speed up the calculation of elementary flux modes by including transcriptional regulatory information into the analysis of metabolic networks. Taking into account gene regulation dramatically reduces the solution space and allows the presented algorithm to constantly eliminate biologically infeasible modes at an early stage of the computation procedure. Thereby, computational costs, such as runtime, memory usage, and disk space, are extremely reduced. Moreover, we show that the application of transcriptional rules identifies non-trivial system-wide effects on metabolism. Using the presented algorithm pushes the size of metabolic networks that can be studied by elementary flux modes to new and much higher limits without the loss of predictive quality. This makes unbiased, system-wide predictions in large scale metabolic networks possible without resorting to any optimization principle. PMID:26091045
Bacterial Degradation of Benzoate
Valderrama, J. Andrés; Durante-Rodríguez, Gonzalo; Blázquez, Blas; García, José Luis; Carmona, Manuel; Díaz, Eduardo
2012-01-01
We have studied for the first time the transcriptional regulatory circuit that controls the expression of the box genes encoding the aerobic hybrid pathway used to assimilate benzoate via coenzyme A (CoA) derivatives in bacteria. The promoters responsible for the expression of the box cluster in the β-proteobacterium Azoarcus sp., their cognate transcriptional repressor, the BoxR protein, and the inducer molecule (benzoyl-CoA) have been characterized. The BoxR protein shows a significant sequence identity to the BzdR transcriptional repressor that controls the bzd genes involved in the anaerobic degradation of benzoate. Because the boxR gene is present in all box clusters so far identified in bacteria, the BoxR/benzoyl-CoA regulatory system appears to be a widespread strategy to control this aerobic hybrid pathway. Interestingly, the paralogous BoxR and BzdR regulators act synergistically to control the expression of the box and bzd genes. This cross-regulation between anaerobic and aerobic pathways for the catabolism of aromatic compounds has never been shown before, and it may reflect a biological strategy to increase the cell fitness in organisms that survive in environments subject to changing oxygen concentrations. PMID:22303008
CoSMoS unravels mysteries of transcription initiation.
Gourse, Richard L; Landick, Robert
2012-02-17
Using a fluorescence method called colocalization single-molecule spectroscopy (CoSMoS), Friedman and Gelles dissect the kinetics of transcription initiation at a bacterial promoter. Ultimately, CoSMoS could greatly aid the study of the effects of DNA sequence and transcription factors on both prokaryotic and eukaryotic promoters. Copyright © 2012 Elsevier Inc. All rights reserved.
Doidy, Joan; Li, Ying; Neymotin, Benjamin; Edwards, Molly B; Varala, Kranthi; Gresham, David; Coruzzi, Gloria M
2016-02-03
Dynamic transcriptional regulation is critical for an organism's response to environmental signals and yet remains elusive to capture. Such transcriptional regulation is mediated by master transcription factors (TF) that control large gene regulatory networks. Recently, we described a dynamic mode of TF regulation named "hit-and-run". This model proposes that master TF can interact transiently with a set of targets, but the transcription of these transient targets continues after the TF dissociation from the target promoter. However, experimental evidence validating active transcription of the transient TF-targets is still lacking. Here, we show that active transcription continues after transient TF-target interactions by tracking de novo synthesis of RNAs made in response to TF nuclear import. To do this, we introduced an affinity-labeled 4-thiouracil (4tU) nucleobase to specifically isolate newly synthesized transcripts following conditional TF nuclear import. Thus, we extended the TARGET system (Transient Assay Reporting Genome-wide Effects of Transcription factors) to include 4tU-labeling and named this new technology TARGET-tU. Our proof-of-principle example is the master TF Basic Leucine Zipper 1 (bZIP1), a central integrator of metabolic signaling in plants. Using TARGET-tU, we captured newly synthesized mRNAs made in response to bZIP1 nuclear import at a time when bZIP1 is no longer detectably bound to its target. Thus, the analysis of de novo transcripomics demonstrates that bZIP1 may act as a catalyst TF to initiate a transcriptional complex ("hit"), after which active transcription by RNA polymerase continues without the TF being bound to the gene promoter ("run"). Our findings provide experimental proof for active transcription of transient TF-targets supporting a "hit-and-run" mode of action. This dynamic regulatory model allows a master TF to catalytically propagate rapid and broad transcriptional responses to changes in environment. Thus, the
Bacterial and cellular RNAs at work during Listeria infection.
Sesto, Nina; Koutero, Mikael; Cossart, Pascale
2014-01-01
Listeria monocytogenes is an intracellular pathogen that can enter and invade host cells. In the course of its infection, RNA-mediated regulatory mechanisms provide a fast and versatile response for both the bacterium and the host. They regulate a variety of processes, such as environment sensing and virulence in pathogenic bacteria, as well as development, cellular differentiation, metabolism and immune responses in eukaryotic cells. The aim of this article is to summarize first the RNA-mediated regulatory mechanisms that play a role in the Listeria lifestyle and in its virulence, and then the host miRNA responses to Listeria infection. Finally, we discuss the potential cross-talk between bacterial RNAs and host RNA regulatory mechanisms as new mechanisms of bacterial virulence.
Suzuki, Toru; Muto, Shinsuke; Miyamoto, Saku; Aizawa, Kenichi; Horikoshi, Masami; Nagai, Ryozo
2003-08-01
Transcription involves molecular interactions between general and regulatory transcription factors with further regulation by protein-protein interactions (e.g. transcriptional cofactors). Here we describe functional interaction between DNA-binding transcription factor and histone chaperone. Affinity purification of factors interacting with the DNA-binding domain of the transcription factor Sp1 showed Sp1 to interact with the histone chaperone TAF-I, both alpha and beta isoforms. This interaction was specific as Sp1 did not interact with another histone chaperone CIA nor did other tested DNA-binding regulatory factors (MyoD, NFkappaB, p53) interact with TAF-I. Interaction of Sp1 and TAF-I occurs both in vitro and in vivo. Interaction with TAF-I results in inhibition of DNA-binding, and also likely as a result of such, inhibition of promoter activation by Sp1. Collectively, we describe interaction between DNA-binding transcription factor and histone chaperone which results in negative regulation of the former. This novel regulatory interaction advances our understanding of the mechanisms of eukaryotic transcription through DNA-binding regulatory transcription factors by protein-protein interactions, and also shows the DNA-binding domain to mediate important regulatory interactions.
Buss, Claudia; Opitz, Bastian; Hocke, Andreas C; Lippmann, Juliane; van Laak, Vincent; Hippenstiel, Stefan; Krüll, Matthias; Suttorp, Norbert; Eitel, Julia
2010-03-15
Chlamydophila pneumoniae infection of the vascular wall as well as activation of the transcription factor IFN regulatory factor (IRF)3 have been linked to development of chronic vascular lesions and atherosclerosis. The innate immune system detects invading pathogens by use of pattern recognition receptors, some of which are able to stimulate IRF3/7 activation and subsequent type I IFN production (e. g., IFN-beta). In this study, we show that infection of human endothelial cells with C. pneumoniae-induced production of IFN-beta, a cytokine that so far has been mainly associated with antiviral immunity. Moreover, C. pneumoniae infection led to IRF3 and IRF7 nuclear translocation in HUVECs and RNA interference experiments showed that IRF3 and IRF7 as well as the mitochondrial antiviral signaling (MAVS) were essential for IFN-beta induction. Finally, C. pneumoniae replication was enhanced in endothelial cells in which IRF3, IRF7, or MAVS expression was inhibited by small interfering RNA and attenuated by IFN-beta treatment. In conclusion, C. pneumoniae infection of endothelial cells activates an MAVS-, IRF3-, and IRF7-dependent signaling, which controls bacterial growth and might modulate development of vascular lesions.
A transcriptional blueprint for a spiral-cleaving embryo.
Chou, Hsien-Chao; Pruitt, Margaret M; Bastin, Benjamin R; Schneider, Stephan Q
2016-08-05
The spiral cleavage mode of early development is utilized in over one-third of all animal phyla and generates embryonic cells of different size, position, and fate through a conserved set of stereotypic and invariant asymmetric cell divisions. Despite the widespread use of spiral cleavage, regulatory and molecular features for any spiral-cleaving embryo are largely uncharted. To address this gap we use RNA-sequencing on the spiralian model Platynereis dumerilii to capture and quantify the first complete genome-wide transcriptional landscape of early spiral cleavage. RNA-sequencing datasets from seven stages in early Platynereis development, from the zygote to the protrochophore, are described here including the de novo assembly and annotation of ~17,200 Platynereis genes. Depth and quality of the RNA-sequencing datasets allow the identification of the temporal onset and level of transcription for each annotated gene, even if the expression is restricted to a single cell. Over 4000 transcripts are maternally contributed and cleared by the end of the early spiral cleavage phase. Small early waves of zygotic expression are followed by major waves of thousands of genes, demarcating the maternal to zygotic transition shortly after the completion of spiral cleavages in this annelid species. Our comprehensive stage-specific transcriptional analysis of early embryonic stages in Platynereis elucidates the regulatory genome during early spiral embryogenesis and defines the maternal to zygotic transition in Platynereis embryos. This transcriptome assembly provides the first systems-level view of the transcriptional and regulatory landscape for a spiral-cleaving embryo.
Lynch, Lydia; Michelet, Xavier; Zhang, Sai; Brennan, Patrick J; Moseman, Ashley; Lester, Chantel; Besra, Gurdyal; Vomhof-Dekrey, Emilie E; Tighe, Mike; Koay, Hui-Fern; Godfrey, Dale I; Leadbetter, Elizabeth A; Sant'Angelo, Derek B; von Andrian, Ulrich; Brenner, Michael B
2015-01-01
Invariant natural killer T cells (iNKT cells) are lipid-sensing innate T cells that are restricted by the antigen-presenting molecule CD1d and express the transcription factor PLZF. iNKT cells accumulate in adipose tissue, where they are anti-inflammatory, but the factors that contribute to their anti-inflammatory nature, as well as their targets in adipose tissue, are unknown. Here we found that iNKT cells in adipose tissue had a unique transcriptional program and produced interleukin 2 (IL-2) and IL-10. Unlike other iNKT cells, they lacked PLZF but expressed the transcription factor E4BP4, which controlled their IL-10 production. The adipose iNKT cells were a tissue-resident population that induced an anti-inflammatory phenotype in macrophages and, through the production of IL-2, controlled the number, proliferation and suppressor function of regulatory T cells (Treg cells) in adipose tissue. Thus, iNKT cells in adipose tissue are unique regulators of immunological homeostasis in this tissue.
Dynamic integration of splicing within gene regulatory pathways
Braunschweig, Ulrich; Gueroussov, Serge; Plocik, Alex; Graveley, Brenton R.; Blencowe, Benjamin J.
2013-01-01
Precursor mRNA splicing is one of the most highly regulated processes in metazoan species. In addition to generating vast repertoires of RNAs and proteins, splicing has a profound impact on other gene regulatory layers, including mRNA transcription, turnover, transport and translation. Conversely, factors regulating chromatin and transcription complexes impact the splicing process. This extensive cross-talk between gene regulatory layers takes advantage of dynamic spatial, physical and temporal organizational properties of the cell nucleus, and further emphasizes the importance of developing a multidimensional understanding of splicing control. PMID:23498935
The pine Pschi4 promoter directs wound-induced transcription
Haiguo Wu; Charles H. Michler; Liborio LaRussa; John M. Davis
1999-01-01
Mechanical wounding stimulates the accumulation of Pschi4 transcripts (encoding a putative extracellular chitinase) in pine trees. To gain insight into the transcriptional regulatory region(s) in this gymnosperm defense gene, the 5'-flanking region of Pschi4 was fused to the uidA reporter gene encoding -...
Transcriptional regulation of mammalian selenoprotein expression
Stoytcheva, Zoia R.; Berry, Marla J.
2009-01-01
Background Selenoproteins contain the twenty-first amino acid, selenocysteine, and are involved in cellular defenses against oxidative damage, important metabolic and developmental pathways, and responses to environmental challenges. Elucidating the mechanisms regulating selenoprotein expression at the transcriptional level is key to understanding how these mechanisms are called into play to respond to the changing environment. Methods This review summarizes published studies on transcriptional regulation of selenoprotein genes, focused primarily on genes whose encoded protein functions are at least partially understood. This is followed by in silico analysis of predicted regulatory elements in selenoprotein genes, including those in the aforementioned category as well as the genes whose functions are not known. Results Our findings reveal regulatory pathways common to many selenoprotein genes, including several involved in stress-responses. In addition, tissue-specific regulatory factors are implicated in regulating many selenoprotein genes. Conclusions These studies provide new insights into how selenoprotein genes respond to environmental and other challenges, and the roles these proteins play in allowing cells to adapt to these changes. General Significance Elucidating the regulatory mechanisms affecting selenoprotein expression is essential for understanding their roles in human diseases, and for developing diagnostic and potential therapeutic approaches to address dysregulation of members of this gene family. PMID:19465084
Dissecting the protein architecture of DNA-binding transcription factors in bacteria and archaea.
Rivera-Gómez, Nancy; Martínez-Núñez, Mario Alberto; Pastor, Nina; Rodriguez-Vazquez, Katya; Perez-Rueda, Ernesto
2017-08-01
Gene regulation at the transcriptional level is a central process in all organisms where DNA-binding transcription factors play a fundamental role. This class of proteins binds specifically at DNA sequences, activating or repressing gene expression as a function of the cell's metabolic status, operator context and ligand-binding status, among other factors, through the DNA-binding domain (DBD). In addition, TFs may contain partner domains (PaDos), which are involved in ligand binding and protein-protein interactions. In this work, we systematically evaluated the distribution, abundance and domain organization of DNA-binding TFs in 799 non-redundant bacterial and archaeal genomes. We found that the distributions of the DBDs and their corresponding PaDos correlated with the size of the genome. We also identified specific combinations between the DBDs and their corresponding PaDos. Within each class of DBDs there are differences in the actual angle formed at the dimerization interface, responding to the presence/absence of ligands and/or crystallization conditions, setting the orientation of the resulting helices and wings facing the DNA. Our results highlight the importance of PaDos as central elements that enhance the diversity of regulatory functions in all bacterial and archaeal organisms, and our results also demonstrate the role of PaDos in sensing diverse signal compounds. The highly specific interactions between DBDs and PaDos observed in this work, together with our structural analysis highlighting the difficulty in predicting both inter-domain geometry and quaternary structure, suggest that these systems appeared once and evolved with diverse duplication events in all the analysed organisms.
Garcia de Lomana, Adrian Lopez; Schäuble, Sascha; Valenzuela, Jacob; ...
2015-12-02
Algae accumulate lipids to endure different kinds of environmental stresses including macronutrient starvation. Although this response has been extensively studied, an in depth understanding of the transcriptional regulatory network (TRN) that controls the transition into lipid accumulation remains elusive. In this study, we used a systems biology approach to elucidate the transcriptional program that coordinates the nitrogen starvation-induced metabolic readjustments that drive lipid accumulation in Chlamydomonas reinhardtii. We demonstrate that nitrogen starvation triggered differential regulation of 2147 transcripts, which were co-regulated in 215 distinct modules and temporally ordered as 31 transcriptional waves. An early-stage response was triggered within 12 minmore » that initiated growth arrest through activation of key signaling pathways, while simultaneously preparing the intracellular environment for later stages by modulating transport processes and ubiquitin-mediated protein degradation. Subsequently, central metabolism and carbon fixation were remodeled to trigger the accumulation of triacylglycerols. Further analysis revealed that these waves of genome-wide transcriptional events were coordinated by a regulatory program orchestrated by at least 17 transcriptional regulators, many of which had not been previously implicated in this process. We demonstrate that the TRN coordinates transcriptional downregulation of 57 metabolic enzymes across a period of nearly 4 h to drive an increase in lipid content per unit biomass. Notably, this TRN appears to also drive lipid accumulation during sulfur starvation, while phosphorus starvation induces a different regulatory program. The TRN model described here is available as a community-wide web-resource at http://networks.systemsbiology.net/chlamy-portal. In conclusion, in this work, we have uncovered a comprehensive mechanistic model of the TRN controlling the transition from N starvation to lipid
DOE Office of Scientific and Technical Information (OSTI.GOV)
Garcia de Lomana, Adrian Lopez; Schäuble, Sascha; Valenzuela, Jacob
Algae accumulate lipids to endure different kinds of environmental stresses including macronutrient starvation. Although this response has been extensively studied, an in depth understanding of the transcriptional regulatory network (TRN) that controls the transition into lipid accumulation remains elusive. In this study, we used a systems biology approach to elucidate the transcriptional program that coordinates the nitrogen starvation-induced metabolic readjustments that drive lipid accumulation in Chlamydomonas reinhardtii. We demonstrate that nitrogen starvation triggered differential regulation of 2147 transcripts, which were co-regulated in 215 distinct modules and temporally ordered as 31 transcriptional waves. An early-stage response was triggered within 12 minmore » that initiated growth arrest through activation of key signaling pathways, while simultaneously preparing the intracellular environment for later stages by modulating transport processes and ubiquitin-mediated protein degradation. Subsequently, central metabolism and carbon fixation were remodeled to trigger the accumulation of triacylglycerols. Further analysis revealed that these waves of genome-wide transcriptional events were coordinated by a regulatory program orchestrated by at least 17 transcriptional regulators, many of which had not been previously implicated in this process. We demonstrate that the TRN coordinates transcriptional downregulation of 57 metabolic enzymes across a period of nearly 4 h to drive an increase in lipid content per unit biomass. Notably, this TRN appears to also drive lipid accumulation during sulfur starvation, while phosphorus starvation induces a different regulatory program. The TRN model described here is available as a community-wide web-resource at http://networks.systemsbiology.net/chlamy-portal. In conclusion, in this work, we have uncovered a comprehensive mechanistic model of the TRN controlling the transition from N starvation to lipid
The Transcription Terminator Rho: A First Bacterial Prion.
Pallarès, Irantzu; Ventura, Salvador
2017-06-01
Traditionally associated with neurodegenerative diseases, prions are increasingly recognized for their potential to confer beneficial traits on eukaryotic organisms. The discovery of the first bacterial prion suggests that the sustained mechanism of prion assembly is an ancient molecular tool aimed at providing fast and persistent adaptation to changing environments. Copyright © 2017 Elsevier Ltd. All rights reserved.
De novo design of a synthetic riboswitch that regulates transcription termination
Wachsmuth, Manja; Findeiß, Sven; Weissheimer, Nadine; Stadler, Peter F.; Mörl, Mario
2013-01-01
Riboswitches are regulatory RNA elements typically located in the 5′-untranslated region of certain mRNAs and control gene expression at the level of transcription or translation. These elements consist of a sensor and an adjacent actuator domain. The sensor usually is an aptamer that specifically interacts with a ligand. The actuator contains an intrinsic terminator or a ribosomal binding site for transcriptional or translational regulation, respectively. Ligand binding leads to structural rearrangements of the riboswitch and to presentation or masking of these regulatory elements. Based on this modular organization, riboswitches are an ideal target for constructing synthetic regulatory systems for gene expression. Although riboswitches for translational control have been designed successfully, attempts to construct synthetic elements regulating transcription have failed so far. Here, we present an in silico pipeline for the rational design of synthetic riboswitches that regulate gene expression at the transcriptional level. Using the well-characterized theophylline aptamer as sensor, we designed the actuator part as RNA sequences that can fold into functional intrinsic terminator structures. In the biochemical characterization, several of the designed constructs show ligand-dependent control of gene expression in Escherichia coli, demonstrating that it is possible to engineer riboswitches not only for translational but also for transcriptional regulation. PMID:23275562
Godahewa, G I; Perera, N C N; Lee, Sukkyoung; Kim, Myoung-Jin; Lee, Jehee
2017-09-05
Cathepsin Z (CTSZ) is lysosomal cysteine protease of the papain superfamily. It participates in the host immune defense via phagocytosis, signal transduction, cell-cell communication, proliferation, and migration of immune cells such as monocytes, macrophages, and dendritic cells. Hence, CTSZ is also acknowledged as an acute-phase protein in host immunity. In this study, we sought to identify the CTSZ homolog from disk abalone (AbCTSZ) and characterize it at the molecular, genomic, and transcriptional levels. AbCTSZ encodes a protein with 318 amino acids and a molecular mass of 36kDa. The structure of AbCTSZ reveals amino acid sequences that are characteristic of the signal sequence, pro-peptide, peptidase-C1 papain family cysteine protease domain, mini-loop, HIP motif, N-linked glycosylation sites, active sites, and conserved Cys residues. A pairwise comparison revealed that AbCTSZ shared the highest amino acid homology with its molluscan counterpart from Crassostrea gigas. A multiple alignment analysis revealed the conservation of functionally crucial elements of AbCTSZ, and a phylogenetic study further confirmed a proximal evolutionary relationship with its invertebrate counterparts. Further, an analysis of AbCTSZ genomic structure revealed seven exons separated by six introns, which differs from that of its vertebrate counterparts. Quantitative real time PCR (qPCR) detected the transcripts of AbCTSZ in early developmental stages and in eight different tissues. Higher levels of AbCTSZ transcripts were found in trochophore, gill, and hemocytes, highlighting its importance in the early development and immunity of disk abalone. In addition, we found that viable bacteria (Vibrio parahaemolyticus and Listeria monocytogenes) and bacterial lipopolysaccharides significantly modulated AbCTSZ transcription. Collectively, these lines of evidences suggest that AbCTSZ plays an indispensable role in the innate immunity of disk abalone. Copyright © 2017. Published by Elsevier
Mela, Francesca; Fritsche, Kathrin; de Boer, Wietse; van Veen, Johannes A; de Graaff, Leo H; van den Berg, Marlies; Leveau, Johan H J
2011-01-01
Interactions between bacteria and fungi cover a wide range of incentives, mechanisms and outcomes. The genus Collimonas consists of soil bacteria that are known for their antifungal activity and ability to grow at the expense of living fungi. In non-contact confrontation assays with the fungus Aspergillus niger, Collimonas fungivorans showed accumulation of biomass concomitant with inhibition of hyphal spread. Through microarray analysis of bacterial and fungal mRNA from the confrontation arena, we gained new insights into the mechanisms underlying the fungistatic effect and mycophagous phenotype of collimonads. Collimonas responded to the fungus by activating genes for the utilization of fungal-derived compounds and for production of a putative antifungal compound. In A. niger, differentially expressed genes included those involved in lipid and cell wall metabolism and cell defense, which correlated well with the hyphal deformations that were observed microscopically. Transcriptional profiles revealed distress in both partners: downregulation of ribosomal proteins and upregulation of mobile genetic elements in the bacteria and expression of endoplasmic reticulum stress and conidia-related genes in the fungus. Both partners experienced nitrogen shortage in each other's presence. Overall, our results indicate that the Collimonas/Aspergillus interaction is a complex interplay between trophism, antibiosis and competition for nutrients. PMID:21614084
2013-01-01
Precise regulation of DNA replication is necessary to ensure the inheritance of genetic features by daughter cells after each cell division. Therefore, determining how the regulatory processes operate to control DNA replication is crucial to our understanding and application to biotechnological processes. Contrary to early concepts of DNA replication, it appears that this process is operated by large, stationary nucleoprotein complexes, called replication factories, rather than by single enzymes trafficking along template molecules. Recent discoveries indicated that in bacterial cells two processes, central carbon metabolism (CCM) and transcription, significantly and specifically influence the control of DNA replication of various replicons. The impact of these discoveries on our understanding of the regulation of DNA synthesis is discussed in this review. It appears that CCM may influence DNA replication by either action of specific metabolites or moonlighting activities of some enzymes involved in this metabolic pathway. The role of transcription in the control of DNA replication may arise from either topological changes in nucleic acids which accompany RNA synthesis or direct interactions between replication and transcription machineries. Due to intriguing similarities between some prokaryotic and eukaryotic regulatory systems, possible implications of studies on regulation of microbial DNA replication on understanding such a process occurring in human cells are discussed. PMID:23714207
Nikel, Pablo I; Romero-Campero, Francisco J; Zeidman, Joshua A; Goñi-Moreno, Ángel; de Lorenzo, Víctor
2015-03-31
The growth of the soil bacterium Pseudomonas putida KT2440 on glycerol as the sole carbon source is characterized by a prolonged lag phase, not observed with other carbon substrates. We examined the bacterial growth in glycerol cultures while monitoring the metabolic activity of individual cells. Fluorescence microscopy and flow cytometry, as well as the analysis of the temporal start of growth in single-cell cultures, revealed that adoption of a glycerol-metabolizing regime was not the result of a gradual change in the whole population but rather reflected a time-dependent bimodal switch between metabolically inactive (i.e., nongrowing) and fully active (i.e., growing) bacteria. A transcriptional Φ(glpD-gfp) fusion (a proxy of the glycerol-3-phosphate [G3P] dehydrogenase activity) linked the macroscopic phenotype to the expression of the glp genes. Either deleting glpR (encoding the G3P-responsive transcriptional repressor that controls the expression of the glpFKRD gene cluster) or altering G3P formation (by overexpressing glpK, encoding glycerol kinase) abolished the bimodal glpD expression. These manipulations eliminated the stochastic growth start by shortening the otherwise long lag phase. Provision of glpR in trans restored the phenotypes lost in the ΔglpR mutant. The prolonged nongrowth regime of P. putida on glycerol could thus be traced to the regulatory device controlling the transcription of the glp genes. Since the physiological agonist of GlpR is G3P, the arrangement of metabolic and regulatory components at this checkpoint merges a positive feedback loop with a nonlinear transcriptional response, a layout fostering the observed time-dependent shift between two alternative physiological states. Phenotypic variation is a widespread attribute of prokaryotes that leads, inter alia, to the emergence of persistent bacteria, i.e., live but nongrowing members within a genetically clonal population. Persistence allows a fraction of cells to avoid the
Munding, Elizabeth M.; Igel, A. Haller; Shiue, Lily; Dorighi, Kristel M.; Treviño, Lisa R.; Ares, Manuel
2010-01-01
Splicing regulatory networks are essential components of eukaryotic gene expression programs, yet little is known about how they are integrated with transcriptional regulatory networks into coherent gene expression programs. Here we define the MER1 splicing regulatory network and examine its role in the gene expression program during meiosis in budding yeast. Mer1p splicing factor promotes splicing of just four pre-mRNAs. All four Mer1p-responsive genes also require Nam8p for splicing activation by Mer1p; however, other genes require Nam8p but not Mer1p, exposing an overlapping meiotic splicing network controlled by Nam8p. MER1 mRNA and three of the four Mer1p substrate pre-mRNAs are induced by the transcriptional regulator Ume6p. This unusual arrangement delays expression of Mer1p-responsive genes relative to other genes under Ume6p control. Products of Mer1p-responsive genes are required for initiating and completing recombination and for activation of Ndt80p, the activator of the transcriptional network required for subsequent steps in the program. Thus, the MER1 splicing regulatory network mediates the dependent relationship between the UME6 and NDT80 transcriptional regulatory networks in the meiotic gene expression program. This study reveals how splicing regulatory networks can be interlaced with transcriptional regulatory networks in eukaryotic gene expression programs. PMID:21123654
Cis-regulatory landscapes of four cell types of the retina
Hartl, Dominik; Jüttner, Josephine
2017-01-01
Abstract The retina is composed of ∼50 cell-types with specific functions for the process of vision. Identification of the cis-regulatory elements active in retinal cell-types is key to elucidate the networks controlling this diversity. Here, we combined transcriptome and epigenome profiling to map the regulatory landscape of four cell-types isolated from mouse retinas including rod and cone photoreceptors as well as rare inter-neuron populations such as horizontal and starburst amacrine cells. Integration of this information reveals sequence determinants and candidate transcription factors for controlling cellular specialization. Additionally, we refined parallel reporter assays to enable studying the transcriptional activity of large collection of sequences in individual cell-types isolated from a tissue. We provide proof of concept for this approach and its scalability by characterizing the transcriptional capacity of several hundred putative regulatory sequences within individual retinal cell-types. This generates a catalogue of cis-regulatory regions active in retinal cell types and we further demonstrate their utility as potential resource for cellular tagging and manipulation. PMID:29059322
Seok, Junhee; Kaushal, Amit; Davis, Ronald W; Xiao, Wenzhong
2010-01-18
The large amount of high-throughput genomic data has facilitated the discovery of the regulatory relationships between transcription factors and their target genes. While early methods for discovery of transcriptional regulation relationships from microarray data often focused on the high-throughput experimental data alone, more recent approaches have explored the integration of external knowledge bases of gene interactions. In this work, we develop an algorithm that provides improved performance in the prediction of transcriptional regulatory relationships by supplementing the analysis of microarray data with a new method of integrating information from an existing knowledge base. Using a well-known dataset of yeast microarrays and the Yeast Proteome Database, a comprehensive collection of known information of yeast genes, we show that knowledge-based predictions demonstrate better sensitivity and specificity in inferring new transcriptional interactions than predictions from microarray data alone. We also show that comprehensive, direct and high-quality knowledge bases provide better prediction performance. Comparison of our results with ChIP-chip data and growth fitness data suggests that our predicted genome-wide regulatory pairs in yeast are reasonable candidates for follow-up biological verification. High quality, comprehensive, and direct knowledge bases, when combined with appropriate bioinformatic algorithms, can significantly improve the discovery of gene regulatory relationships from high throughput gene expression data.
A system-level model for the microbial regulatory genome.
Brooks, Aaron N; Reiss, David J; Allard, Antoine; Wu, Wei-Ju; Salvanha, Diego M; Plaisier, Christopher L; Chandrasekaran, Sriram; Pan, Min; Kaur, Amardeep; Baliga, Nitin S
2014-07-15
Microbes can tailor transcriptional responses to diverse environmental challenges despite having streamlined genomes and a limited number of regulators. Here, we present data-driven models that capture the dynamic interplay of the environment and genome-encoded regulatory programs of two types of prokaryotes: Escherichia coli (a bacterium) and Halobacterium salinarum (an archaeon). The models reveal how the genome-wide distributions of cis-acting gene regulatory elements and the conditional influences of transcription factors at each of those elements encode programs for eliciting a wide array of environment-specific responses. We demonstrate how these programs partition transcriptional regulation of genes within regulons and operons to re-organize gene-gene functional associations in each environment. The models capture fitness-relevant co-regulation by different transcriptional control mechanisms acting across the entire genome, to define a generalized, system-level organizing principle for prokaryotic gene regulatory networks that goes well beyond existing paradigms of gene regulation. An online resource (http://egrin2.systemsbiology.net) has been developed to facilitate multiscale exploration of conditional gene regulation in the two prokaryotes. © 2014 The Authors. Published under the terms of the CC BY 4.0 license.
2013-01-01
Background Cytokine-activated transcription factors from the STAT (Signal Transducers and Activators of Transcription) family control common and context-specific genetic programs. It is not clear to what extent cell-specific features determine the binding capacity of seven STAT members and to what degree they share genetic targets. Molecular insight into the biology of STATs was gained from a meta-analysis of 29 available ChIP-seq data sets covering genome-wide occupancy of STATs 1, 3, 4, 5A, 5B and 6 in several cell types. Results We determined that the genomic binding capacity of STATs is primarily defined by the cell type and to a lesser extent by individual family members. For example, the overlap of shared binding sites between STATs 3 and 5 in T cells is greater than that between STAT5 in T cells and non-T cells. Even for the top 1,000 highly enriched STAT binding sites, ~15% of STAT5 binding sites in mouse female liver are shared by other STATs in different cell types while in T cells ~90% of STAT5 binding sites are co-occupied by STAT3, STAT4 and STAT6. In addition, we identified 116 cis-regulatory modules (CRM), which are recognized by all STAT members across cell types defining a common JAK-STAT signature. Lastly, in liver STAT5 binding significantly coincides with binding of the cell-specific transcription factors HNF4A, FOXA1 and FOXA2 and is associated with cell-type specific gene transcription. Conclusions Our results suggest that genomic binding of STATs is primarily determined by the cell type and further specificity is achieved in part by juxtaposed binding of cell-specific transcription factors. PMID:23324445
Gyenis, Ákos; Umlauf, David; Újfaludi, Zsuzsanna; Boros, Imre; Ye, Tao; Tora, Làszlò
2014-01-01
Faithful transcription of DNA is constantly threatened by different endogenous and environmental genotoxic effects. Transcription coupled repair (TCR) has been described to stop transcription and quickly remove DNA lesions from the transcribed strand of active genes, permitting rapid resumption of blocked transcription. This repair mechanism has been well characterized in the past using individual target genes. Moreover, numerous efforts investigated the fate of blocked RNA polymerase II (Pol II) during DNA repair mechanisms and suggested that stopped Pol II complexes can either backtrack, be removed and degraded or bypass the lesions to allow TCR. We investigated the effect of a non-lethal dose of UVB on global DNA-bound Pol II distribution in human cells. We found that the used UVB dose did not induce Pol II degradation however surprisingly at about 93% of the promoters of all expressed genes Pol II occupancy was seriously reduced 2–4 hours following UVB irradiation. The presence of Pol II at these cleared promoters was restored 5–6 hours after irradiation, indicating that the negative regulation is very dynamic. We also identified a small set of genes (including several p53 regulated genes), where the UVB-induced Pol II clearing did not operate. Interestingly, at promoters, where Pol II promoter clearance occurs, TFIIH, but not TBP, follows the behavior of Pol II, suggesting that at these genes upon UVB treatment TFIIH is sequestered for DNA repair by the TCR machinery. In agreement, in cells where the TCR factor, the Cockayne Syndrome B protein, was depleted UVB did not induce Pol II and TFIIH clearance at promoters. Thus, our study reveals a UVB induced negative regulatory mechanism that targets Pol II transcription initiation on the large majority of transcribed gene promoters, and a small subset of genes, where Pol II escapes this negative regulation. PMID:25058334
Architecture of the human regulatory network derived from ENCODE data.
Gerstein, Mark B; Kundaje, Anshul; Hariharan, Manoj; Landt, Stephen G; Yan, Koon-Kiu; Cheng, Chao; Mu, Xinmeng Jasmine; Khurana, Ekta; Rozowsky, Joel; Alexander, Roger; Min, Renqiang; Alves, Pedro; Abyzov, Alexej; Addleman, Nick; Bhardwaj, Nitin; Boyle, Alan P; Cayting, Philip; Charos, Alexandra; Chen, David Z; Cheng, Yong; Clarke, Declan; Eastman, Catharine; Euskirchen, Ghia; Frietze, Seth; Fu, Yao; Gertz, Jason; Grubert, Fabian; Harmanci, Arif; Jain, Preti; Kasowski, Maya; Lacroute, Phil; Leng, Jing Jane; Lian, Jin; Monahan, Hannah; O'Geen, Henriette; Ouyang, Zhengqing; Partridge, E Christopher; Patacsil, Dorrelyn; Pauli, Florencia; Raha, Debasish; Ramirez, Lucia; Reddy, Timothy E; Reed, Brian; Shi, Minyi; Slifer, Teri; Wang, Jing; Wu, Linfeng; Yang, Xinqiong; Yip, Kevin Y; Zilberman-Schapira, Gili; Batzoglou, Serafim; Sidow, Arend; Farnham, Peggy J; Myers, Richard M; Weissman, Sherman M; Snyder, Michael
2012-09-06
Transcription factors bind in a combinatorial fashion to specify the on-and-off states of genes; the ensemble of these binding events forms a regulatory network, constituting the wiring diagram for a cell. To examine the principles of the human transcriptional regulatory network, we determined the genomic binding information of 119 transcription-related factors in over 450 distinct experiments. We found the combinatorial, co-association of transcription factors to be highly context specific: distinct combinations of factors bind at specific genomic locations. In particular, there are significant differences in the binding proximal and distal to genes. We organized all the transcription factor binding into a hierarchy and integrated it with other genomic information (for example, microRNA regulation), forming a dense meta-network. Factors at different levels have different properties; for instance, top-level transcription factors more strongly influence expression and middle-level ones co-regulate targets to mitigate information-flow bottlenecks. Moreover, these co-regulations give rise to many enriched network motifs (for example, noise-buffering feed-forward loops). Finally, more connected network components are under stronger selection and exhibit a greater degree of allele-specific activity (that is, differential binding to the two parental alleles). The regulatory information obtained in this study will be crucial for interpreting personal genome sequences and understanding basic principles of human biology and disease.
Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V
2017-02-07
Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.
Taghavi, Safiyh; Wu, Xiao; Ouyang, Liming; ...
2015-01-21
Growth in sucrose medium was previously found to trigger the expression of functions involved in the plant associated life style of the endophytic bacterium Enterobacter sp. 638. Therefore, comparative transcriptome analysis between cultures grown in sucrose or lactate medium was used to gain insights in the expression levels of bacterial functions involved in the endophytic life style of strain 638. Growth on sucrose as a carbon source resulted in major changes in cell physiology, including a shift from a planktonic life style to the formation of bacterial aggregates. This shift was accompanied by a decrease in transcription of genes involvedmore » in motility (e.g. flagella biosynthesis) and an increase in the transcription of genes involved in colonization, adhesion and biofilm formation. The transcription levels of functions previously suggested as being involved in endophytic behavior and functions responsible for plant growth promoting properties, including the synthesis of indole-acetic acid, acetoin and 2,3-butanediol, also increased significantly for cultures grown in sucrose medium. Interestingly, despite an abundance of essential nutrients transcription levels of functions related to uptake and processing of nitrogen and iron became increased for cultures grown on sucrose as sole carbon source. Transcriptome data were also used to analyze putative regulatory relationships. In addition to the small RNA csrABCD regulon, which seems to play a role in the physiological adaptation and possibly the shift between free-living and plant-associated endophytic life style of Enterobacter sp. 638, our results also pointed to the involvement of rcsAB in controlling responses by Enterobacter sp. 638 to a plant-associated life style. Lastly, targeted mutagenesis was used to confirm this role and showed that compared to wild-type Enterobacter sp. 638 a ΔrcsB mutant was affected in its plant growth promoting ability.« less
Taghavi, Safiyh; Wu, Xiao; Ouyang, Liming; Stadler, Andrea; McCorkle, Sean; Zhu, Wei; Maslov, Sergei; van der Lelie, Daniel
2015-01-01
Growth in sucrose medium was previously found to trigger the expression of functions involved in the plant associated life style of the endophytic bacterium Enterobacter sp. 638. Therefore, comparative transcriptome analysis between cultures grown in sucrose or lactate medium was used to gain insights in the expression levels of bacterial functions involved in the endophytic life style of strain 638. Growth on sucrose as a carbon source resulted in major changes in cell physiology, including a shift from a planktonic life style to the formation of bacterial aggregates. This shift was accompanied by a decrease in transcription of genes involved in motility (e.g. flagella biosynthesis) and an increase in the transcription of genes involved in colonization, adhesion and biofilm formation. The transcription levels of functions previously suggested as being involved in endophytic behavior and functions responsible for plant growth promoting properties, including the synthesis of indole-acetic acid, acetoin and 2,3-butanediol, also increased significantly for cultures grown in sucrose medium. Interestingly, despite an abundance of essential nutrients transcription levels of functions related to uptake and processing of nitrogen and iron became increased for cultures grown on sucrose as sole carbon source. Transcriptome data were also used to analyze putative regulatory relationships. In addition to the small RNA csrABCD regulon, which seems to play a role in the physiological adaptation and possibly the shift between free-living and plant-associated endophytic life style of Enterobacter sp. 638, our results also pointed to the involvement of rcsAB in controlling responses by Enterobacter sp. 638 to a plant-associated life style. Targeted mutagenesis was used to confirm this role and showed that compared to wild-type Enterobacter sp. 638 a ΔrcsB mutant was affected in its plant growth promoting ability. PMID:25607953
Taghavi, Safiyh; Wu, Xiao; Ouyang, Liming; Zhang, Yian Biao; Stadler, Andrea; McCorkle, Sean; Zhu, Wei; Maslov, Sergei; van der Lelie, Daniel
2015-01-01
Growth in sucrose medium was previously found to trigger the expression of functions involved in the plant associated life style of the endophytic bacterium Enterobacter sp. 638. Therefore, comparative transcriptome analysis between cultures grown in sucrose or lactate medium was used to gain insights in the expression levels of bacterial functions involved in the endophytic life style of strain 638. Growth on sucrose as a carbon source resulted in major changes in cell physiology, including a shift from a planktonic life style to the formation of bacterial aggregates. This shift was accompanied by a decrease in transcription of genes involved in motility (e.g., flagella biosynthesis) and an increase in the transcription of genes involved in colonization, adhesion and biofilm formation. The transcription levels of functions previously suggested as being involved in endophytic behavior and functions responsible for plant growth promoting properties, including the synthesis of indole-acetic acid, acetoin and 2,3-butanediol, also increased significantly for cultures grown in sucrose medium. Interestingly, despite an abundance of essential nutrients transcription levels of functions related to uptake and processing of nitrogen and iron became increased for cultures grown on sucrose as sole carbon source. Transcriptome data were also used to analyze putative regulatory relationships. In addition to the small RNA csrABCD regulon, which seems to play a role in the physiological adaptation and possibly the shift between free-living and plant-associated endophytic life style of Enterobacter sp. 638, our results also pointed to the involvement of rcsAB in controlling responses by Enterobacter sp. 638 to a plant-associated life style. Targeted mutagenesis was used to confirm this role and showed that compared to wild-type Enterobacter sp. 638 a ΔrcsB mutant was affected in its plant growth promoting ability.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Taghavi, Safiyh; Wu, Xiao; Ouyang, Liming
Growth in sucrose medium was previously found to trigger the expression of functions involved in the plant associated life style of the endophytic bacterium Enterobacter sp. 638. Therefore, comparative transcriptome analysis between cultures grown in sucrose or lactate medium was used to gain insights in the expression levels of bacterial functions involved in the endophytic life style of strain 638. Growth on sucrose as a carbon source resulted in major changes in cell physiology, including a shift from a planktonic life style to the formation of bacterial aggregates. This shift was accompanied by a decrease in transcription of genes involvedmore » in motility (e.g. flagella biosynthesis) and an increase in the transcription of genes involved in colonization, adhesion and biofilm formation. The transcription levels of functions previously suggested as being involved in endophytic behavior and functions responsible for plant growth promoting properties, including the synthesis of indole-acetic acid, acetoin and 2,3-butanediol, also increased significantly for cultures grown in sucrose medium. Interestingly, despite an abundance of essential nutrients transcription levels of functions related to uptake and processing of nitrogen and iron became increased for cultures grown on sucrose as sole carbon source. Transcriptome data were also used to analyze putative regulatory relationships. In addition to the small RNA csrABCD regulon, which seems to play a role in the physiological adaptation and possibly the shift between free-living and plant-associated endophytic life style of Enterobacter sp. 638, our results also pointed to the involvement of rcsAB in controlling responses by Enterobacter sp. 638 to a plant-associated life style. Lastly, targeted mutagenesis was used to confirm this role and showed that compared to wild-type Enterobacter sp. 638 a ΔrcsB mutant was affected in its plant growth promoting ability.« less
Dynamics and function of distal regulatory elements during neurogenesis and neuroplasticity
Thakurela, Sudhir; Sahu, Sanjeeb Kumar; Garding, Angela; Tiwari, Vijay K.
2015-01-01
Gene regulation in mammals involves a complex interplay between promoters and distal regulatory elements that function in concert to drive precise spatiotemporal gene expression programs. However, the dynamics of the distal gene regulatory landscape and its function in the transcriptional reprogramming that underlies neurogenesis and neuronal activity remain largely unknown. Here, we performed a combinatorial analysis of genome-wide data sets for chromatin accessibility (FAIRE-seq) and the enhancer mark H3K27ac, revealing the highly dynamic nature of distal gene regulation during neurogenesis, which gets progressively restricted to distinct genomic regions as neurons acquire a post-mitotic, terminally differentiated state. We further find that the distal accessible and active regions serve as target sites for distinct transcription factors that function in a stage-specific manner to contribute to the transcriptional program underlying neuronal commitment and maturation. Mature neurons respond to a sustained activity of NMDA receptors by epigenetic reprogramming at a large number of distal regulatory regions as well as dramatic reorganization of super-enhancers. Such massive remodeling of the distal regulatory landscape in turn results in a transcriptome that confers a transient loss of neuronal identity and gain of cellular plasticity. Furthermore, NMDA receptor activity also induces many novel prosurvival genes that function in neuroprotective pathways. Taken together, these findings reveal the dynamics of the distal regulatory landscape during neurogenesis and uncover novel regulatory elements that function in concert with epigenetic mechanisms and transcription factors to generate the transcriptome underlying neuronal development and activity. PMID:26170447
Artiles, Karen; Anastasia, Stephanie; McCusker, Derek; Kellogg, Douglas R.
2009-01-01
The key molecular event that marks entry into the cell cycle is transcription of G1 cyclins, which bind and activate cyclin-dependent kinases. In yeast cells, initiation of G1 cyclin transcription is linked to achievement of a critical cell size, which contributes to cell-size homeostasis. The critical cell size is modulated by nutrients, such that cells growing in poor nutrients are smaller than cells growing in rich nutrients. Nutrient modulation of cell size does not work through known critical regulators of G1 cyclin transcription and is therefore thought to work through a distinct pathway. Here, we report that Rts1, a highly conserved regulatory subunit of protein phosphatase 2A (PP2A), is required for normal control of G1 cyclin transcription. Loss of Rts1 caused delayed initiation of bud growth and delayed and reduced accumulation of G1 cyclins. Expression of the G1 cyclin CLN2 from an inducible promoter rescued the delayed bud growth in rts1Δ cells, indicating that Rts1 acts at the level of transcription. Moreover, loss of Rts1 caused altered regulation of Swi6, a key component of the SBF transcription factor that controls G1 cyclin transcription. Epistasis analysis revealed that Rts1 does not work solely through several known critical upstream regulators of G1 cyclin transcription. Cells lacking Rts1 failed to undergo nutrient modulation of cell size. Together, these observations demonstrate that Rts1 is a key player in pathways that link nutrient availability, cell size, and G1 cyclin transcription. Since Rts1 is highly conserved, it may function in similar pathways in vertebrates. PMID:19911052
Recurrent rewiring and emergence of RNA regulatory networks.
Wilinski, Daniel; Buter, Natascha; Klocko, Andrew D; Lapointe, Christopher P; Selker, Eric U; Gasch, Audrey P; Wickens, Marvin
2017-04-04
Alterations in regulatory networks contribute to evolutionary change. Transcriptional networks are reconfigured by changes in the binding specificity of transcription factors and their cognate sites. The evolution of RNA-protein regulatory networks is far less understood. The PUF (Pumilio and FBF) family of RNA regulatory proteins controls the translation, stability, and movements of hundreds of mRNAs in a single species. We probe the evolution of PUF-RNA networks by direct identification of the mRNAs bound to PUF proteins in budding and filamentous fungi and by computational analyses of orthologous RNAs from 62 fungal species. Our findings reveal that PUF proteins gain and lose mRNAs with related and emergent biological functions during evolution. We demonstrate at least two independent rewiring events for PUF3 orthologs, independent but convergent evolution of PUF4/5 binding specificity and the rewiring of the PUF4/5 regulons in different fungal lineages. These findings demonstrate plasticity in RNA regulatory networks and suggest ways in which their rewiring occurs.
Extending the dynamic range of transcription factor action by translational regulation
NASA Astrophysics Data System (ADS)
Sokolowski, Thomas R.; Walczak, Aleksandra M.; Bialek, William; Tkačik, Gašper
2016-02-01
A crucial step in the regulation of gene expression is binding of transcription factor (TF) proteins to regulatory sites along the DNA. But transcription factors act at nanomolar concentrations, and noise due to random arrival of these molecules at their binding sites can severely limit the precision of regulation. Recent work on the optimization of information flow through regulatory networks indicates that the lower end of the dynamic range of concentrations is simply inaccessible, overwhelmed by the impact of this noise. Motivated by the behavior of homeodomain proteins, such as the maternal morphogen Bicoid in the fruit fly embryo, we suggest a scheme in which transcription factors also act as indirect translational regulators, binding to the mRNA of other regulatory proteins. Intuitively, each mRNA molecule acts as an independent sensor of the input concentration, and averaging over these multiple sensors reduces the noise. We analyze information flow through this scheme and identify conditions under which it outperforms direct transcriptional regulation. Our results suggest that the dual role of homeodomain proteins is not just a historical accident, but a solution to a crucial physics problem in the regulation of gene expression.
Transcriptional Mechanisms Underlying Hemoglobin Synthesis
Katsumura, Koichi R.; DeVilbiss, Andrew W.; Pope, Nathaniel J.; Johnson, Kirby D.; Bresnick, Emery H.
2013-01-01
The physiological switch in expression of the embryonic, fetal, and adult β-like globin genes has garnered enormous attention from investigators interested in transcriptional mechanisms and the molecular basis of hemoglobinopathies. These efforts have led to the discovery of cell type-specific transcription factors, unprecedented mechanisms of transcriptional coregulator function, genome biology principles, unique contributions of nuclear organization to transcription and cell function, and promising therapeutic targets. Given the vast literature accrued on this topic, this article will focus on the master regulator of erythroid cell development and function GATA-1, its associated proteins, and its frontline role in controlling hemoglobin synthesis. GATA-1 is a crucial regulator of genes encoding hemoglobin subunits and heme biosynthetic enzymes. GATA-1-dependent mechanisms constitute an essential regulatory core that nucleates additional mechanisms to achieve the physiological control of hemoglobin synthesis. PMID:23838521
Giresi, Paul G.; Kim, Jonghwan; McDaniell, Ryan M.; Iyer, Vishwanath R.; Lieb, Jason D.
2007-01-01
DNA segments that actively regulate transcription in vivo are typically characterized by eviction of nucleosomes from chromatin and are experimentally identified by their hypersensitivity to nucleases. Here we demonstrate a simple procedure for the isolation of nucleosome-depleted DNA from human chromatin, termed FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements). To perform FAIRE, chromatin is crosslinked with formaldehyde in vivo, sheared by sonication, and phenol-chloroform extracted. The DNA recovered in the aqueous phase is fluorescently labeled and hybridized to a DNA microarray. FAIRE performed in human cells strongly enriches DNA coincident with the location of DNaseI hypersensitive sites, transcriptional start sites, and active promoters. Evidence for cell-type–specific patterns of FAIRE enrichment is also presented. FAIRE has utility as a positive selection for genomic regions associated with regulatory activity, including regions traditionally detected by nuclease hypersensitivity assays. PMID:17179217
Tran, Chi Nhan; Giangrossi, Mara; Prosseda, Gianni; Brandi, Anna; Di Martino, Maria Letizia; Colonna, Bianca; Falconi, Maurizio
2011-10-01
The icsA gene of Shigella encodes a structural protein involved in colonization of the intestinal mucosa by bacteria. This gene is expressed upon invasion of the host and is controlled by a complex regulatory circuit involving the nucleoid protein H-NS, the AraC-like transcriptional activator VirF, and a 450 nt antisense RNA (RnaG) acting as transcriptional attenuator. We investigated on the interplay of these factors at the molecular level. DNase I footprints reveal that both H-NS and VirF bind to a region including the icsA and RnaG promoters. H-NS is shown to repress icsA transcription at 30°C but not at 37°C, suggesting a significant involvement of this protein in the temperature-regulated expression of icsA. We also demonstrate that VirF directly stimulates icsA transcription and is able to alleviate H-NS repression in vitro. According to these results, icsA expression is derepressed in hns- background and overexpressed when VirF is provided in trans. Moreover, we find that RnaG-mediated transcription attenuation depends on 80 nt at its 5'-end, a stretch carrying the antisense region. Bases engaged in the initial contact leading to sense-antisense pairing have been identified using synthetic RNA and DNA oligonucleotides designed to rebuild and mutagenize the two stem-loop motifs of the antisense region.
Reverse Engineering of Genome-wide Gene Regulatory Networks from Gene Expression Data
Liu, Zhi-Ping
2015-01-01
Transcriptional regulation plays vital roles in many fundamental biological processes. Reverse engineering of genome-wide regulatory networks from high-throughput transcriptomic data provides a promising way to characterize the global scenario of regulatory relationships between regulators and their targets. In this review, we summarize and categorize the main frameworks and methods currently available for inferring transcriptional regulatory networks from microarray gene expression profiling data. We overview each of strategies and introduce representative methods respectively. Their assumptions, advantages, shortcomings, and possible improvements and extensions are also clarified and commented. PMID:25937810
Sibling rivalry: related bacterial small RNAs and their redundant and non-redundant roles
Caswell, Clayton C.; Oglesby-Sherrouse, Amanda G.; Murphy, Erin R.
2014-01-01
Small RNA molecules (sRNAs) are now recognized as key regulators controlling bacterial gene expression, as sRNAs provide a quick and efficient means of positively or negatively altering the expression of specific genes. To date, numerous sRNAs have been identified and characterized in a myriad of bacterial species, but more recently, a theme in bacterial sRNAs has emerged: the presence of more than one highly related sRNAs produced by a given bacterium, here termed sibling sRNAs. Sibling sRNAs are those that are highly similar at the nucleotide level, and while it might be expected that sibling sRNAs exert identical regulatory functions on the expression of target genes based on their high degree of relatedness, emerging evidence is demonstrating that this is not always the case. Indeed, there are several examples of bacterial sibling sRNAs with non-redundant regulatory functions, but there are also instances of apparent regulatory redundancy between sibling sRNAs. This review provides a comprehensive overview of the current knowledge of bacterial sibling sRNAs, and also discusses important questions about the significance and evolutionary implications of this emerging class of regulators. PMID:25389522
Sibling rivalry: related bacterial small RNAs and their redundant and non-redundant roles.
Caswell, Clayton C; Oglesby-Sherrouse, Amanda G; Murphy, Erin R
2014-01-01
Small RNA molecules (sRNAs) are now recognized as key regulators controlling bacterial gene expression, as sRNAs provide a quick and efficient means of positively or negatively altering the expression of specific genes. To date, numerous sRNAs have been identified and characterized in a myriad of bacterial species, but more recently, a theme in bacterial sRNAs has emerged: the presence of more than one highly related sRNAs produced by a given bacterium, here termed sibling sRNAs. Sibling sRNAs are those that are highly similar at the nucleotide level, and while it might be expected that sibling sRNAs exert identical regulatory functions on the expression of target genes based on their high degree of relatedness, emerging evidence is demonstrating that this is not always the case. Indeed, there are several examples of bacterial sibling sRNAs with non-redundant regulatory functions, but there are also instances of apparent regulatory redundancy between sibling sRNAs. This review provides a comprehensive overview of the current knowledge of bacterial sibling sRNAs, and also discusses important questions about the significance and evolutionary implications of this emerging class of regulators.
Identification of regulatory network hubs that control lipid metabolism in Chlamydomonas reinhardtii
Gargouri, Mahmoud; Park, Jeong -Jin; Holguin, F. Omar; ...
2015-05-28
Microalgae-based biofuels are promising sources of alternative energy, but improvements throughout the production process are required to establish them as economically feasible. One of the most influential improvements would be a significant increase in lipid yields, which could be achieved by altering the regulation of lipid biosynthesis and accumulation. Chlamydomonas reinhardtii accumulates oil (triacylglycerols, TAG) in response to nitrogen (N) deprivation. Although a few important regulatory genes have been identified that are involved in controlling this process, a global understanding of the larger regulatory network has not been developed. In order to uncover this network in this species, a combinedmore » omics (transcriptomic, proteomic and metabolomic) analysis was applied to cells grown in a time course experiment after a shift from N-replete to N-depleted conditions. Changes in transcript and protein levels of 414 predicted transcription factors (TFs) and transcriptional regulators (TRs) were monitored relative to other genes. The TF and TR genes were thus classified by two separate measures: up-regulated versus down-regulated and early response versus late response relative to two phases of polar lipid synthesis (before and after TAG biosynthesis initiation). Lipidomic and primary metabolite profiling generated compound accumulation levels that were integrated with the transcript dataset and TF profiling to produce a transcriptional regulatory network. In conclusion, evaluation of this proposed regulatory network led to the identification of several regulatory hubs that control many aspects of cellular metabolism, from N assimilation and metabolism, to central metabolism, photosynthesis and lipid metabolism.« less
Pervasive Targeting of Nascent Transcripts by Hfq.
Kambara, Tracy K; Ramsey, Kathryn M; Dove, Simon L
2018-05-01
Hfq is an RNA chaperone and an important post-transcriptional regulator in bacteria. Using chromatin immunoprecipitation coupled with high-throughput DNA sequencing (ChIP-seq), we show that Hfq associates with hundreds of different regions of the Pseudomonas aeruginosa chromosome. These associations are abolished when transcription is inhibited, indicating that they reflect Hfq binding to transcripts during their synthesis. Analogous ChIP-seq analyses with the post-transcriptional regulator Crc reveal that it associates with many of the same nascent transcripts as Hfq, an activity we show is Hfq dependent. Our findings indicate that Hfq binds many transcripts co-transcriptionally in P. aeruginosa, often in concert with Crc, and uncover direct regulatory targets of these proteins. They also highlight a general approach for studying the interactions of RNA-binding proteins with nascent transcripts in bacteria. The binding of post-transcriptional regulators to nascent mRNAs may represent a prevalent means of controlling translation in bacteria where transcription and translation are coupled. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Technical Advance: Transcription factor, promoter, and enhancer utilization in human myeloid cells.
Joshi, Anagha; Pooley, Christopher; Freeman, Tom C; Lennartsson, Andreas; Babina, Magda; Schmidl, Christian; Geijtenbeek, Teunis; Michoel, Tom; Severin, Jessica; Itoh, Masayoshi; Lassmann, Timo; Kawaji, Hideya; Hayashizaki, Yoshihide; Carninci, Piero; Forrest, Alistair R R; Rehli, Michael; Hume, David A
2015-05-01
The generation of myeloid cells from their progenitors is regulated at the level of transcription by combinatorial control of key transcription factors influencing cell-fate choice. To unravel the global dynamics of this process at the transcript level, we generated transcription profiles for 91 human cell types of myeloid origin by use of CAGE profiling. The CAGE sequencing of these samples has allowed us to investigate diverse aspects of transcription control during myelopoiesis, such as identification of novel transcription factors, miRNAs, and noncoding RNAs specific to the myeloid lineage. We further reconstructed a transcription regulatory network by clustering coexpressed transcripts and associating them with enriched cis-regulatory motifs. With the use of the bidirectional expression as a proxy for enhancers, we predicted over 2000 novel enhancers, including an enhancer 38 kb downstream of IRF8 and an intronic enhancer in the KIT gene locus. Finally, we highlighted relevance of these data to dissect transcription dynamics during progressive maturation of granulocyte precursors. A multifaceted analysis of the myeloid transcriptome is made available (www.myeloidome.roslin.ed.ac.uk). This high-quality dataset provides a powerful resource to study transcriptional regulation during myelopoiesis and to infer the likely functions of unannotated genes in human innate immunity. © The Author(s).
Cis-regulatory Elements and Human Evolution
Siepel, Adam
2014-01-01
Modification of gene regulation has long been considered an important force in human evolution, particularly through changes to cis-regulatory elements (CREs) that function in transcriptional regulation. For decades, however, the study of cis-regulatory evolution was severely limited by the available data. New data sets describing the locations of CREs and genetic variation within and between species have now made it possible to study CRE evolution much more directly on a genome-wide scale. Here, we review recent research on the evolution of CREs in humans based on large-scale genomic data sets. We consider inferences based on primate divergence, human polymorphism, and combinations of divergence and polymorphism. We then consider “new frontiers” in this field stemming from recent research on transcriptional regulation. PMID:25218861
In silico modeling of epigenetic-induced changes in photoreceptor cis-regulatory elements.
Hossain, Reafa A; Dunham, Nicholas R; Enke, Raymond A; Berndsen, Christopher E
2018-01-01
DNA methylation is a well-characterized epigenetic repressor of mRNA transcription in many plant and vertebrate systems. However, the mechanism of this repression is not fully understood. The process of transcription is controlled by proteins that regulate recruitment and activity of RNA polymerase by binding to specific cis-regulatory sequences. Cone-rod homeobox (CRX) is a well-characterized mammalian transcription factor that controls photoreceptor cell-specific gene expression. Although much is known about the functions and DNA binding specificity of CRX, little is known about how DNA methylation modulates CRX binding affinity to genomic cis-regulatory elements. We used bisulfite pyrosequencing of human ocular tissues to measure DNA methylation levels of the regulatory regions of RHO , PDE6B, PAX6 , and LINE1 retrotransposon repeats. To describe the molecular mechanism of repression, we used molecular modeling to illustrate the effect of DNA methylation on human RHO regulatory sequences. In this study, we demonstrate an inverse correlation between DNA methylation in regulatory regions adjacent to the human RHO and PDE6B genes and their subsequent transcription in human ocular tissues. Docking of CRX to the DNA models shows that CRX interacts with the grooves of these sequences, suggesting changes in groove structure could regulate binding. Molecular dynamics simulations of the RHO promoter and enhancer regions show changes in the flexibility and groove width upon epigenetic modification. Models also demonstrate changes in the local dynamics of CRX binding sites within RHO regulatory sequences which may account for the repression of CRX-dependent transcription. Collectively, these data demonstrate epigenetic regulation of CRX binding sites in human retinal tissue and provide insight into the mechanism of this mode of epigenetic regulation to be tested in future experiments.
van der Meulen, Sjoerd B; de Jong, Anne; Kok, Jan
2016-01-01
RNA sequencing has revolutionized genome-wide transcriptome analyses, and the identification of non-coding regulatory RNAs in bacteria has thus increased concurrently. Here we reveal the transcriptome map of the lactic acid bacterial paradigm Lactococcus lactis MG1363 by employing differential RNA sequencing (dRNA-seq) and a combination of manual and automated transcriptome mining. This resulted in a high-resolution genome annotation of L. lactis and the identification of 60 cis-encoded antisense RNAs (asRNAs), 186 trans-encoded putative regulatory RNAs (sRNAs) and 134 novel small ORFs. Based on the putative targets of asRNAs, a novel classification is proposed. Several transcription factor DNA binding motifs were identified in the promoter sequences of (a)sRNAs, providing insight in the interplay between lactococcal regulatory RNAs and transcription factors. The presence and lengths of 14 putative sRNAs were experimentally confirmed by differential Northern hybridization, including the abundant RNA 6S that is differentially expressed depending on the available carbon source. For another sRNA, LLMGnc_147, functional analysis revealed that it is involved in carbon uptake and metabolism. L. lactis contains 13% leaderless mRNAs (lmRNAs) that, from an analysis of overrepresentation in GO classes, seem predominantly involved in nucleotide metabolism and DNA/RNA binding. Moreover, an A-rich sequence motif immediately following the start codon was uncovered, which could provide novel insight in the translation of lmRNAs. Altogether, this first experimental genome-wide assessment of the transcriptome landscape of L. lactis and subsequent sRNA studies provide an extensive basis for the investigation of regulatory RNAs in L. lactis and related lactococcal species.
EsrE-A yigP Locus-Encoded Transcript-Is a 3′ UTR sRNA Involved in the Respiratory Chain of E. coli
Xia, Hui; Yang, Xichen; Tang, Qiongwei; Ye, Jiang; Wu, Haizhen; Zhang, Huizhan
2017-01-01
The yigP locus is widely conserved among γ-proteobacteria. Mutation of the yigP locus impacts aerobic growth of Gram-negative bacteria. However, the underlying mechanism of how the yigP locus influences aerobic growth remains largely unknown. Here, we demonstrated that the yigP locus in Escherichia coli encodes two transcripts; the mRNA of ubiquinone biosynthesis protein, UbiJ, and the 3′ untranslated region small regulatory RNA (sRNA), EsrE. EsrE is an independent transcript that is transcribed using an internal promoter of the yigP locus. Surprisingly, we found that both the EsrE sRNA and UbiJ protein were required for Q8 biosynthesis, and were sufficient to rescue the growth defect ascribed to deletion of the yigP locus. Moreover, our data showed that EsrE targeted multiple mRNAs involved in several cellular processes including murein biosynthesis and the tricarboxylic acid cycle. Among these targets, sdhD mRNA that encodes one subunit of succinate dehydrogenase (SDH), was significantly activated. Our findings provided an insight into the important function of EsrE in bacterial adaptation to various environments, as well as coordinating different aspects of bacterial physiology. PMID:28900423
2010-01-01
Background The large amount of high-throughput genomic data has facilitated the discovery of the regulatory relationships between transcription factors and their target genes. While early methods for discovery of transcriptional regulation relationships from microarray data often focused on the high-throughput experimental data alone, more recent approaches have explored the integration of external knowledge bases of gene interactions. Results In this work, we develop an algorithm that provides improved performance in the prediction of transcriptional regulatory relationships by supplementing the analysis of microarray data with a new method of integrating information from an existing knowledge base. Using a well-known dataset of yeast microarrays and the Yeast Proteome Database, a comprehensive collection of known information of yeast genes, we show that knowledge-based predictions demonstrate better sensitivity and specificity in inferring new transcriptional interactions than predictions from microarray data alone. We also show that comprehensive, direct and high-quality knowledge bases provide better prediction performance. Comparison of our results with ChIP-chip data and growth fitness data suggests that our predicted genome-wide regulatory pairs in yeast are reasonable candidates for follow-up biological verification. Conclusion High quality, comprehensive, and direct knowledge bases, when combined with appropriate bioinformatic algorithms, can significantly improve the discovery of gene regulatory relationships from high throughput gene expression data. PMID:20122245
Enhancing gene regulatory network inference through data integration with markov random fields
Banf, Michael; Rhee, Seung Y.
2017-02-01
Here, a gene regulatory network links transcription factors to their target genes and represents a map of transcriptional regulation. Much progress has been made in deciphering gene regulatory networks computationally. However, gene regulatory network inference for most eukaryotic organisms remain challenging. To improve the accuracy of gene regulatory network inference and facilitate candidate selection for experimentation, we developed an algorithm called GRACE (Gene Regulatory network inference ACcuracy Enhancement). GRACE exploits biological a priori and heterogeneous data integration to generate high- confidence network predictions for eukaryotic organisms using Markov Random Fields in a semi-supervised fashion. GRACE uses a novel optimization schememore » to integrate regulatory evidence and biological relevance. It is particularly suited for model learning with sparse regulatory gold standard data. We show GRACE’s potential to produce high confidence regulatory networks compared to state of the art approaches using Drosophila melanogaster and Arabidopsis thaliana data. In an A. thaliana developmental gene regulatory network, GRACE recovers cell cycle related regulatory mechanisms and further hypothesizes several novel regulatory links, including a putative control mechanism of vascular structure formation due to modifications in cell proliferation.« less
Enhancing gene regulatory network inference through data integration with markov random fields
DOE Office of Scientific and Technical Information (OSTI.GOV)
Banf, Michael; Rhee, Seung Y.
Here, a gene regulatory network links transcription factors to their target genes and represents a map of transcriptional regulation. Much progress has been made in deciphering gene regulatory networks computationally. However, gene regulatory network inference for most eukaryotic organisms remain challenging. To improve the accuracy of gene regulatory network inference and facilitate candidate selection for experimentation, we developed an algorithm called GRACE (Gene Regulatory network inference ACcuracy Enhancement). GRACE exploits biological a priori and heterogeneous data integration to generate high- confidence network predictions for eukaryotic organisms using Markov Random Fields in a semi-supervised fashion. GRACE uses a novel optimization schememore » to integrate regulatory evidence and biological relevance. It is particularly suited for model learning with sparse regulatory gold standard data. We show GRACE’s potential to produce high confidence regulatory networks compared to state of the art approaches using Drosophila melanogaster and Arabidopsis thaliana data. In an A. thaliana developmental gene regulatory network, GRACE recovers cell cycle related regulatory mechanisms and further hypothesizes several novel regulatory links, including a putative control mechanism of vascular structure formation due to modifications in cell proliferation.« less
Wren, Jonathan D; Conway, Tyrrell
2006-01-01
The goals of this study were to gain a better quantitative understanding of the dynamic range of transcriptional and translational response observed in biological systems and to examine the reporting of regulatory events for trends and biases. A straightforward pattern-matching routine extracted 3,408 independent observations regarding transcriptional fold-changes and 1,125 regarding translational fold-changes from over 15 million MEDLINE abstracts. Approximately 95% of reported changes were > or =2-fold. Further, the historical trend of reporting individual fold-changes is declining in favor of high-throughput methods for transcription but not translation. Where it was possible to compare the average fold-changes in transcription and translation for the same gene/product (203 examples), approximately 53% were a < or =2-fold difference, suggesting a loose tendency for the two to be coupled in magnitude. We found also that approximately three-fourths of reported regulatory events have been at the transcriptional level. The frequency distribution appears to be normally distributed and peaks near 2-fold, suggesting that nature selects for a low-energy solution to regulatory responses. Because high-throughput technologies ordinarily sacrifice measurement quality for quantity, this also suggests that many regulatory events may not be reliably detectable by such technologies. Text mining of regulatory events and responses provides additional information incorporable into microarray analysis, such as prior fold-change observations and flagging genes that are regulated post-transcription. All extracted regulation and response patterns can be downloaded at the following website: www.ou.edu/microarray/ oumcf/Meta_analysis.xls.
Cis-regulatory landscapes of four cell types of the retina.
Hartl, Dominik; Krebs, Arnaud R; Jüttner, Josephine; Roska, Botond; Schübeler, Dirk
2017-11-16
The retina is composed of ∼50 cell-types with specific functions for the process of vision. Identification of the cis-regulatory elements active in retinal cell-types is key to elucidate the networks controlling this diversity. Here, we combined transcriptome and epigenome profiling to map the regulatory landscape of four cell-types isolated from mouse retinas including rod and cone photoreceptors as well as rare inter-neuron populations such as horizontal and starburst amacrine cells. Integration of this information reveals sequence determinants and candidate transcription factors for controlling cellular specialization. Additionally, we refined parallel reporter assays to enable studying the transcriptional activity of large collection of sequences in individual cell-types isolated from a tissue. We provide proof of concept for this approach and its scalability by characterizing the transcriptional capacity of several hundred putative regulatory sequences within individual retinal cell-types. This generates a catalogue of cis-regulatory regions active in retinal cell types and we further demonstrate their utility as potential resource for cellular tagging and manipulation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
A transcriptional dynamic network during Arabidopsis thaliana pollen development.
Wang, Jigang; Qiu, Xiaojie; Li, Yuhua; Deng, Youping; Shi, Tieliu
2011-01-01
To understand transcriptional regulatory networks (TRNs), especially the coordinated dynamic regulation between transcription factors (TFs) and their corresponding target genes during development, computational approaches would represent significant advances in the genome-wide expression analysis. The major challenges for the experiments include monitoring the time-specific TFs' activities and identifying the dynamic regulatory relationships between TFs and their target genes, both of which are currently not yet available at the large scale. However, various methods have been proposed to computationally estimate those activities and regulations. During the past decade, significant progresses have been made towards understanding pollen development at each development stage under the molecular level, yet the regulatory mechanisms that control the dynamic pollen development processes remain largely unknown. Here, we adopt Networks Component Analysis (NCA) to identify TF activities over time course, and infer their regulatory relationships based on the coexpression of TFs and their target genes during pollen development. We carried out meta-analysis by integrating several sets of gene expression data related to Arabidopsis thaliana pollen development (stages range from UNM, BCP, TCP, HP to 0.5 hr pollen tube and 4 hr pollen tube). We constructed a regulatory network, including 19 TFs, 101 target genes and 319 regulatory interactions. The computationally estimated TF activities were well correlated to their coordinated genes' expressions during the development process. We clustered the expression of their target genes in the context of regulatory influences, and inferred new regulatory relationships between those TFs and their target genes, such as transcription factor WRKY34, which was identified that specifically expressed in pollen, and regulated several new target genes. Our finding facilitates the interpretation of the expression patterns with more biological
Simon, Jeremy M.; Giresi, Paul G.; Davis, Ian J.; Lieb, Jason D.
2013-01-01
Eviction or destabilization of nucleosomes from chromatin is a hallmark of functional regulatory elements of the eukaryotic genome. Historically identified by nuclease hypersensitivity, these regulatory elements are typically bound by transcription factors or other regulatory proteins. FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements) is an alternative approach to identify these genomic regions and has proven successful in a multitude of eukaryotic cell and tissue types. Cells or dissociated tissues are crosslinked briefly with formaldehyde, lysed, and sonicated. Sheared chromatin is subjected to phenol-chloroform extraction and the isolated DNA, typically encompassing 1–3% of the human genome, is purified. We provide guidelines for quantitative analysis by PCR, microarrays, or next-generation sequencing. Regulatory elements enriched by FAIRE display high concordance with those identified by nuclease hypersensitivity or ChIP, and the entire procedure can be completed in three days. FAIRE exhibits low technical variability, which allows its use in large-scale studies of chromatin from normal or diseased tissues. PMID:22262007
Circuitry Linking the Catabolite Repression and Csr Global Regulatory Systems of Escherichia coli.
Pannuri, Archana; Vakulskas, Christopher A; Zere, Tesfalem; McGibbon, Louise C; Edwards, Adrianne N; Georgellis, Dimitris; Babitzke, Paul; Romeo, Tony
2016-11-01
Cyclic AMP (cAMP) and the cAMP receptor protein (cAMP-CRP) and CsrA are the principal regulators of the catabolite repression and carbon storage global regulatory systems, respectively. cAMP-CRP controls the transcription of genes for carbohydrate metabolism and other processes in response to carbon nutritional status, while CsrA binds to diverse mRNAs and regulates translation, RNA stability, and/or transcription elongation. CsrA also binds to the regulatory small RNAs (sRNAs) CsrB and CsrC, which antagonize its activity. The BarA-UvrY two-component signal transduction system (TCS) directly activates csrB and csrC (csrB/C) transcription, while CsrA does so indirectly. We show that cAMP-CRP inhibits csrB/C transcription without negatively regulating phosphorylated UvrY (P-UvrY) or CsrA levels. A crp deletion caused an elevation in CsrB/C levels in the stationary phase of growth and increased the expression of csrB-lacZ and csrC-lacZ transcriptional fusions, although modest stimulation of CsrB/C turnover by the crp deletion partially masked the former effects. DNase I footprinting and other studies demonstrated that cAMP-CRP bound specifically to three sites located upstream from the csrC promoter, two of which overlapped the P-UvrY binding site. These two proteins competed for binding at the overlapping sites. In vitro transcription-translation experiments confirmed direct repression of csrC-lacZ expression by cAMP-CRP. In contrast, cAMP-CRP effects on csrB transcription may be mediated indirectly, as it bound nonspecifically to csrB DNA. In the reciprocal direction, CsrA bound to crp mRNA with high affinity and specificity and yet exhibited only modest, conditional effects on expression. Our findings are incorporated into an emerging model for the response of Csr circuitry to carbon nutritional status. Csr (Rsm) noncoding small RNAs (sRNAs) CsrB and CsrC of Escherichia coli use molecular mimicry to sequester the RNA binding protein CsrA (RsmA) away from lower
Circuitry Linking the Catabolite Repression and Csr Global Regulatory Systems of Escherichia coli
Pannuri, Archana; Vakulskas, Christopher A.; Zere, Tesfalem; McGibbon, Louise C.; Edwards, Adrianne N.; Georgellis, Dimitris; Babitzke, Paul
2016-01-01
ABSTRACT Cyclic AMP (cAMP) and the cAMP receptor protein (cAMP-CRP) and CsrA are the principal regulators of the catabolite repression and carbon storage global regulatory systems, respectively. cAMP-CRP controls the transcription of genes for carbohydrate metabolism and other processes in response to carbon nutritional status, while CsrA binds to diverse mRNAs and regulates translation, RNA stability, and/or transcription elongation. CsrA also binds to the regulatory small RNAs (sRNAs) CsrB and CsrC, which antagonize its activity. The BarA-UvrY two-component signal transduction system (TCS) directly activates csrB and csrC (csrB/C) transcription, while CsrA does so indirectly. We show that cAMP-CRP inhibits csrB/C transcription without negatively regulating phosphorylated UvrY (P-UvrY) or CsrA levels. A crp deletion caused an elevation in CsrB/C levels in the stationary phase of growth and increased the expression of csrB-lacZ and csrC-lacZ transcriptional fusions, although modest stimulation of CsrB/C turnover by the crp deletion partially masked the former effects. DNase I footprinting and other studies demonstrated that cAMP-CRP bound specifically to three sites located upstream from the csrC promoter, two of which overlapped the P-UvrY binding site. These two proteins competed for binding at the overlapping sites. In vitro transcription-translation experiments confirmed direct repression of csrC-lacZ expression by cAMP-CRP. In contrast, cAMP-CRP effects on csrB transcription may be mediated indirectly, as it bound nonspecifically to csrB DNA. In the reciprocal direction, CsrA bound to crp mRNA with high affinity and specificity and yet exhibited only modest, conditional effects on expression. Our findings are incorporated into an emerging model for the response of Csr circuitry to carbon nutritional status. IMPORTANCE Csr (Rsm) noncoding small RNAs (sRNAs) CsrB and CsrC of Escherichia coli use molecular mimicry to sequester the RNA binding protein CsrA (Rsm
CoryneRegNet 4.0 – A reference database for corynebacterial gene regulatory networks
Baumbach, Jan
2007-01-01
Background Detailed information on DNA-binding transcription factors (the key players in the regulation of gene expression) and on transcriptional regulatory interactions of microorganisms deduced from literature-derived knowledge, computer predictions and global DNA microarray hybridization experiments, has opened the way for the genome-wide analysis of transcriptional regulatory networks. The large-scale reconstruction of these networks allows the in silico analysis of cell behavior in response to changing environmental conditions. We previously published CoryneRegNet, an ontology-based data warehouse of corynebacterial transcription factors and regulatory networks. Initially, it was designed to provide methods for the analysis and visualization of the gene regulatory network of Corynebacterium glutamicum. Results Now we introduce CoryneRegNet release 4.0, which integrates data on the gene regulatory networks of 4 corynebacteria, 2 mycobacteria and the model organism Escherichia coli K12. As the previous versions, CoryneRegNet provides a web-based user interface to access the database content, to allow various queries, and to support the reconstruction, analysis and visualization of regulatory networks at different hierarchical levels. In this article, we present the further improved database content of CoryneRegNet along with novel analysis features. The network visualization feature GraphVis now allows the inter-species comparisons of reconstructed gene regulatory networks and the projection of gene expression levels onto that networks. Therefore, we added stimulon data directly into the database, but also provide Web Service access to the DNA microarray analysis platform EMMA. Additionally, CoryneRegNet now provides a SOAP based Web Service server, which can easily be consumed by other bioinformatics software systems. Stimulons (imported from the database, or uploaded by the user) can be analyzed in the context of known transcriptional regulatory networks to
Zhang, Monica; Song, Lingyun; Lee, Bum-Kyu; Iyer, Vishwanath R.; Furey, Terrence S.; Crawford, Gregory E.; Yan, Hai; He, Yiping
2014-01-01
Despite an emerging understanding of the genetic alterations giving rise to various tumors, the mechanisms whereby most oncogenes are overexpressed remain unclear. Here we have utilized an integrated approach of genomewide regulatory element mapping via DNase-seq followed by conventional reporter assays and transcription factor binding site discovery to characterize the transcriptional regulation of the medulloblastoma oncogene Orthodenticle Homeobox 2 (OTX2). Through these studies we have revealed that OTX2 is differentially regulated in medulloblastoma at the level of chromatin accessibility, which is in part mediated by DNA methylation. In cell lines exhibiting chromatin accessibility of OTX2 regulatory regions, we found that autoregulation maintains OTX2 expression. Comparison of medulloblastoma regulatory elements with those of the developing brain reveals that these tumors engage a developmental regulatory program to drive OTX2 transcription. Finally, we have identified a transcriptional regulatory element mediating retinoid-induced OTX2 repression in these tumors. This work characterizes for the first time the mechanisms of OTX2 overexpression in medulloblastoma. Furthermore, this study establishes proof of principle for applying ENCODE datasets towards the characterization of upstream trans-acting factors mediating expression of individual genes. PMID:25198066
Green, Maurice; Thorburn, Andrew; Kern, Robert; Loewenstein, Paul M
2007-01-01
Microinjection of mammalian cells provides a powerful method for analyzing in vivo functions of viral genes and viral gene products. By microinjection, a controlled amount (ranging from several to many thousands of copies) of a viral or cellular gene, a protein product of a gene, a polypeptide fragment encoding a specific protein domain, or an RNA molecule can be delivered into a target cell and the functional consequences analyzed. Microinjection can be used to deliver antibody targeted to a specific protein domain in order to analyze the requirement of the protein for specific cell functions such as cell cycle progression, transcription of specific genes, or intracellular transport. This chapter describes examples of the successful use of microinjection to probe adenovirus E1A regulatory mechanisms. Detailed methods are provided for manual and semiautomatic microinjection of mammalian cells as well as bioassay protocols for microinjected cells including immunofluorescence, colorimetic, in situ hybridization, and autoradiography.
Bilsland, Alan E.; Stevenson, Katrina; Liu, Yu; Hoare, Stacey; Cairney, Claire J.; Roffey, Jon; Keith, W. Nicol
2014-01-01
Cancer cells depend on transcription of telomerase reverse transcriptase (TERT). Many transcription factors affect TERT, though regulation occurs in context of a broader network. Network effects on telomerase regulation have not been investigated, though deeper understanding of TERT transcription requires a systems view. However, control over individual interactions in complex networks is not easily achievable. Mathematical modelling provides an attractive approach for analysis of complex systems and some models may prove useful in systems pharmacology approaches to drug discovery. In this report, we used transfection screening to test interactions among 14 TERT regulatory transcription factors and their respective promoters in ovarian cancer cells. The results were used to generate a network model of TERT transcription and to implement a dynamic Boolean model whose steady states were analysed. Modelled effects of signal transduction inhibitors successfully predicted TERT repression by Src-family inhibitor SU6656 and lack of repression by ERK inhibitor FR180204, results confirmed by RT-QPCR analysis of endogenous TERT expression in treated cells. Modelled effects of GSK3 inhibitor 6-bromoindirubin-3′-oxime (BIO) predicted unstable TERT repression dependent on noise and expression of JUN, corresponding with observations from a previous study. MYC expression is critical in TERT activation in the model, consistent with its well known function in endogenous TERT regulation. Loss of MYC caused complete TERT suppression in our model, substantially rescued only by co-suppression of AR. Interestingly expression was easily rescued under modelled Ets-factor gain of function, as occurs in TERT promoter mutation. RNAi targeting AR, JUN, MXD1, SP3, or TP53, showed that AR suppression does rescue endogenous TERT expression following MYC knockdown in these cells and SP3 or TP53 siRNA also cause partial recovery. The model therefore successfully predicted several aspects of TERT
Kuuluvainen, Emilia; Hakala, Heini; Havula, Essi; Sahal Estimé, Michelle; Rämet, Mika; Hietakangas, Ville; Mäkelä, Tomi P
2014-06-06
The Cdk8 (cyclin-dependent kinase 8) module of Mediator integrates regulatory cues from transcription factors to RNA polymerase II. It consists of four subunits where Med12 and Med13 link Cdk8 and cyclin C (CycC) to core Mediator. Here we have investigated the contributions of the Cdk8 module subunits to transcriptional regulation using RNA interference in Drosophila cells. Genome-wide expression profiling demonstrated separation of Cdk8-CycC and Med12-Med13 profiles. However, transcriptional regulation by Cdk8-CycC was dependent on Med12-Med13. This observation also revealed that Cdk8-CycC and Med12-Med13 often have opposite transcriptional effects. Interestingly, Med12 and Med13 profiles overlapped significantly with that of the GATA factor Serpent. Accordingly, mutational analyses indicated that GATA sites are required for Med12-Med13 regulation of Serpent-dependent genes. Med12 and Med13 were also found to be required for Serpent-activated innate immunity genes in defense to bacterial infection. The results reveal a novel role for the Cdk8 module in Serpent-dependent transcription and innate immunity. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Integrative Genomic Analyses Yields Cell Cycle Regulatory Programs with Prognostic Value
Cheng, Chao; Lou, Shaoke; Andrews, Erik H.; Ung, Matthew H.; Varn, Frederick S.
2016-01-01
Liposarcoma is the second most common form of sarcoma, which has been categorized into four molecular subtypes, which are associated with differential prognosis of patients. However, the transcriptional regulatory programs associated with distinct histological and molecular subtypes of liposarcoma have not been investigated. This study uses integrative analyses to systematically define the transcriptional regulatory programs associated with liposarcoma. Likewise, computational methods are used to identify regulatory programs associated with different liposarcoma subtypes as well as programs that are predictive of prognosis. Further analysis of curated gene sets was used to identify prognostic gene signatures. The integration of data from a variety sources including gene expression profiles, transcription factor (TF) binding data from ChIP-seq experiments, curated gene sets, and clinical information of patients indicated discrete regulatory programs (e.g., controlled by E2F1 and E2F4) with significantly different regulatory activity in one or multiple subtypes of liposarcoma with respect to normal adipose tissue. These programs were also shown to be prognostic, wherein liposarcoma patients with higher E2F4 or E2F1 activity associated with unfavorable prognosis. A total of 259 gene sets were significantly associated with patient survival in liposarcoma, among which >50% are involved in cell cycle and proliferation. PMID:26856934
Modeling the integration of bacterial rRNA fragments into the human cancer genome.
Sieber, Karsten B; Gajer, Pawel; Dunning Hotopp, Julie C
2016-03-21
Cancer is a disease driven by the accumulation of genomic alterations, including the integration of exogenous DNA into the human somatic genome. We previously identified in silico evidence of DNA fragments from a Pseudomonas-like bacteria integrating into the 5'-UTR of four proto-oncogenes in stomach cancer sequencing data. The functional and biological consequences of these bacterial DNA integrations remain unknown. Modeling of these integrations suggests that the previously identified sequences cover most of the sequence flanking the junction between the bacterial and human DNA. Further examination of these reads reveals that these integrations are rich in guanine nucleotides and the integrated bacterial DNA may have complex transcript secondary structures. The models presented here lay the foundation for future experiments to test if bacterial DNA integrations alter the transcription of the human genes.
A novel statistical approach for identification of the master regulator transcription factor.
Sikdar, Sinjini; Datta, Susmita
2017-02-02
Transcription factors are known to play key roles in carcinogenesis and therefore, are gaining popularity as potential therapeutic targets in drug development. A 'master regulator' transcription factor often appears to control most of the regulatory activities of the other transcription factors and the associated genes. This 'master regulator' transcription factor is at the top of the hierarchy of the transcriptomic regulation. Therefore, it is important to identify and target the master regulator transcription factor for proper understanding of the associated disease process and identifying the best therapeutic option. We present a novel two-step computational approach for identification of master regulator transcription factor in a genome. At the first step of our method we test whether there exists any master regulator transcription factor in the system. We evaluate the concordance of two ranked lists of transcription factors using a statistical measure. In case the concordance measure is statistically significant, we conclude that there is a master regulator. At the second step, our method identifies the master regulator transcription factor, if there exists one. In the simulation scenario, our method performs reasonably well in validating the existence of a master regulator when the number of subjects in each treatment group is reasonably large. In application to two real datasets, our method ensures the existence of master regulators and identifies biologically meaningful master regulators. An R code for implementing our method in a sample test data can be found in http://www.somnathdatta.org/software . We have developed a screening method of identifying the 'master regulator' transcription factor just using only the gene expression data. Understanding the regulatory structure and finding the master regulator help narrowing the search space for identifying biomarkers for complex diseases such as cancer. In addition to identifying the master regulator our
Ibraheem, Omodele; Botha, Christiaan E J; Bradley, Graeme
2010-12-01
The regulation of gene expression involves a multifarious regulatory system. Each gene contains a unique combination of cis-acting regulatory sequence elements in the 5' regulatory region that determines its temporal and spatial expression. Cis-acting regulatory elements are essential transcriptional gene regulatory units; they control many biological processes and stress responses. Thus a full understanding of the transcriptional gene regulation system will depend on successful functional analyses of cis-acting elements. Cis-acting regulatory elements present within the 5' regulatory region of the sucrose transporter gene families in rice (Oryza sativa Japonica cultivar-group) and Arabidopsis thaliana, were identified using a bioinformatics approach. The possible cis-acting regulatory elements were predicted by scanning 1.5kbp of 5' regulatory regions of the sucrose transporter genes translational start sites, using Plant CARE, PLACE and Genomatix Matinspector professional databases. Several cis-acting regulatory elements that are associated with plant development, plant hormonal regulation and stress response were identified, and were present in varying frequencies within the 1.5kbp of 5' regulatory region, among which are; A-box, RY, CAT, Pyrimidine-box, Sucrose-box, ABRE, ARF, ERE, GARE, Me-JA, ARE, DRE, GA-motif, GATA, GT-1, MYC, MYB, W-box, and I-box. This result reveals the probable cis-acting regulatory elements that possibly are involved in the expression and regulation of sucrose transporter gene families in rice and Arabidopsis thaliana during cellular development or environmental stress conditions. Copyright © 2010 Elsevier Ltd. All rights reserved.
Lachance, Denis; Giguère, Isabelle; Séguin, Armand
2014-01-01
This research aimed to investigate the role of diverse transcription factors (TFs) and to delineate gene regulatory networks directly in conifers at a relatively high-throughput level. The approach integrated sequence analyses, transcript profiling, and development of a conifer-specific activation assay. Transcript accumulation profiles of 102 TFs and potential target genes were clustered to identify groups of coordinately expressed genes. Several different patterns of transcript accumulation were observed by profiling in nine different organs and tissues: 27 genes were preferential to secondary xylem both in stems and roots, and other genes were preferential to phelloderm and periderm or were more ubiquitous. A robust system has been established as a screening approach to define which TFs have the ability to regulate a given promoter in planta. Trans-activation or repression effects were observed in 30% of TF–candidate gene promoter combinations. As a proof of concept, phylogenetic analysis and expression and trans-activation data were used to demonstrate that two spruce NAC-domain proteins most likely play key roles in secondary vascular growth as observed in other plant species. This study tested many TFs from diverse families in a conifer tree species, which broadens the knowledge of promoter–TF interactions in wood development and enables comparisons of gene regulatory networks found in angiosperms and gymnosperms. PMID:24713992
A transcription factor hierarchy defines an environmental stress response network.
Song, Liang; Huang, Shao-Shan Carol; Wise, Aaron; Castanon, Rosa; Nery, Joseph R; Chen, Huaming; Watanabe, Marina; Thomas, Jerushah; Bar-Joseph, Ziv; Ecker, Joseph R
2016-11-04
Environmental stresses are universally encountered by microbes, plants, and animals. Yet systematic studies of stress-responsive transcription factor (TF) networks in multicellular organisms have been limited. The phytohormone abscisic acid (ABA) influences the expression of thousands of genes, allowing us to characterize complex stress-responsive regulatory networks. Using chromatin immunoprecipitation sequencing, we identified genome-wide targets of 21 ABA-related TFs to construct a comprehensive regulatory network in Arabidopsis thaliana Determinants of dynamic TF binding and a hierarchy among TFs were defined, illuminating the relationship between differential gene expression patterns and ABA pathway feedback regulation. By extrapolating regulatory characteristics of observed canonical ABA pathway components, we identified a new family of transcriptional regulators modulating ABA and salt responsiveness and demonstrated their utility to modulate plant resilience to osmotic stress. Copyright © 2016, American Association for the Advancement of Science.
Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe
2015-05-30
Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.
Fungal Innate Immunity Induced by Bacterial Microbe-Associated Molecular Patterns (MAMPs)
Ipcho, Simon; Sundelin, Thomas; Erbs, Gitte; Kistler, H. Corby; Newman, Mari-Anne; Olsson, Stefan
2016-01-01
Plants and animals detect bacterial presence through Microbe-Associated Molecular Patterns (MAMPs) which induce an innate immune response. The field of fungal–bacterial interaction at the molecular level is still in its infancy and little is known about MAMPs and their detection by fungi. Exposing Fusarium graminearum to bacterial MAMPs led to increased fungal membrane hyperpolarization, a putative defense response, and a range of transcriptional responses. The fungus reacted with a different transcript profile to each of the three tested MAMPs, although a core set of genes related to energy generation, transport, amino acid production, secondary metabolism, and especially iron uptake were detected for all three. Half of the genes related to iron uptake were predicted MirA type transporters that potentially take up bacterial siderophores. These quick responses can be viewed as a preparation for further interactions with beneficial or pathogenic bacteria, and constitute a fungal innate immune response with similarities to those of plants and animals. PMID:27172188
A New Algorithm for Identifying Cis-Regulatory Modules Based on Hidden Markov Model
2017-01-01
The discovery of cis-regulatory modules (CRMs) is the key to understanding mechanisms of transcription regulation. Since CRMs have specific regulatory structures that are the basis for the regulation of gene expression, how to model the regulatory structure of CRMs has a considerable impact on the performance of CRM identification. The paper proposes a CRM discovery algorithm called ComSPS. ComSPS builds a regulatory structure model of CRMs based on HMM by exploring the rules of CRM transcriptional grammar that governs the internal motif site arrangement of CRMs. We test ComSPS on three benchmark datasets and compare it with five existing methods. Experimental results show that ComSPS performs better than them. PMID:28497059
Devaney, Joseph M; Tosi, Laura L; Fritz, David T; Gordish-Dressman, Heather A; Jiang, Shan; Orkunoglu-Suer, Funda E; Gordon, Andrew H; Harmon, Brennan T; Thompson, Paul D; Clarkson, Priscilla M; Angelopoulos, Theodore J; Gordon, Paul M; Moyna, Niall M; Pescatello, Linda S; Visich, Paul S; Zoeller, Robert F; Brandoli, Cinzia; Hoffman, Eric P; Rogers, Melissa B
2009-08-15
A classic morphogen, bone morphogenetic protein 2 (BMP2) regulates the differentiation of pluripotent mesenchymal cells. High BMP2 levels promote osteogenesis or chondrogenesis and low levels promote adipogenesis. BMP2 inhibits myogenesis. Thus, BMP2 synthesis is tightly controlled. Several hundred nucleotides within the 3' untranslated regions of BMP2 genes are conserved from mammals to fishes indicating that the region is under stringent selective pressure. Our analyses indicate that this region controls BMP2 synthesis by post-transcriptional mechanisms. A common A to C single nucleotide polymorphism (SNP) in the BMP2 gene (rs15705, +A1123C) disrupts a putative post-transcriptional regulatory motif within the human ultra-conserved sequence. In vitro studies indicate that RNAs bearing the A or C alleles have different protein binding characteristics in extracts from mesenchymal cells. Reporter genes with the C allele of the ultra-conserved sequence were differentially expressed in mesenchymal cells. Finally, we analyzed MRI data from the upper arm of 517 healthy individuals aged 18-41 years. Individuals with the C/C genotype were associated with lower baseline subcutaneous fat volumes (P = 0.0030) and an increased gain in skeletal muscle volume (P = 0.0060) following resistance training in a cohort of young males. The rs15705 SNP explained 2-4% of inter-individual variability in the measured parameters. The rs15705 variant is one of the first genetic markers that may be exploited to facilitate early diagnosis, treatment, and/or prevention of diseases associated with poor fitness. Furthermore, understanding the mechanisms by which regulatory polymorphisms influence BMP2 synthesis will reveal novel pharmaceutical targets for these disabling conditions. (c) 2009 Wiley-Liss, Inc.
Devaney, Joseph M.; Tosi, Laura L.; Fritz, David T.; Gordish-Dressman, Heather A.; Jiang, Shan; Orkunoglu-Suer, Funda E.; Gordon, Andrew H.; Harmon, Brennan T.; Thompson, Paul D.; Clarkson, Priscilla M.; Angelopoulos, Theodore J.; Gordon, Paul M.; Moyna, Niall M.; Pescatello, Linda S.; Visich, Paul S.; Zoeller, Robert F.; Brandoli, Cinzia; Hoffman, Eric P.; Rogers, Melissa B.
2014-01-01
A classic morphogen, bone morphogenetic protein 2 (BMP2) regulates the differentiation of pluripotent mesenchymal cells. High BMP2 levels promote osteogenesis or chondrogenesis and low levels promote adipogenesis. BMP2 inhibits myogenesis. Thus, BMP2 synthesis is tightly controlled. Several hundred nucleotides within the 3′ untranslated regions of BMP2 genes are conserved from mammals to fishes indicating that the region is under stringent selective pressure. Our analyses indicate that this region controls BMP2 synthesis by post-transcriptional mechanisms. A common A to C single nucleotide polymorphism (SNP) in the BMP2 gene (rs15705, +A1123C) disrupts a putative post-transcriptional regulatory motif within the human ultra-conserved sequence. In vitro studies indicate that RNAs bearing the A or C alleles have different protein binding characteristics in extracts from mesenchymal cells. Reporter genes with the C allele of the ultra-conserved sequence were differentially expressed in mesenchymal cells. Finally, we analyzed MRI data from the upper arm of 517 healthy individuals aged 18–41 years. Individuals with the C/C genotype were associated with lower baseline subcutaneous fat volumes (P = 0.0030) and an increased gain in skeletal muscle volume (P = 0.0060) following resistance training in a cohort of young males. The rs15705 SNP explained 2–4% of inter-individual variability in the measured parameters. The rs15705 variant is one of the first genetic markers that maybe exploited to facilitate early diagnosis, treatment, and/or prevention of diseases associated with poor fitness. Furthermore, understanding the mechanisms by which regulatory polymorphisms influence BMP2 synthesis will reveal novel pharmaceutical targets for these disabling conditions. PMID:19492344
Balazadeh, Salma; Siddiqui, Hamad; Allu, Annapurna D; Matallana-Ramirez, Lilian P; Caldana, Camila; Mehrnia, Mohammad; Zanor, Maria-Inés; Köhler, Barbara; Mueller-Roeber, Bernd
2010-04-01
The onset and progression of senescence are under genetic and environmental control. The Arabidopsis thaliana NAC transcription factor ANAC092 (also called AtNAC2 and ORE1) has recently been shown to control age-dependent senescence, but its mode of action has not been analysed yet. To explore the regulatory network administered by ANAC092 we performed microarray-based expression profiling using estradiol-inducible ANAC092 overexpression lines. Approximately 46% of the 170 genes up-regulated upon ANAC092 induction are known senescence-associated genes, suggesting that the NAC factor exerts its role in senescence through a regulatory network that includes many of the genes previously reported to be senescence regulated. We selected 39 candidate genes and confirmed their time-dependent response to enhanced ANAC092 expression by quantitative RT-PCR. We also found that the majority of them (24 genes) are up-regulated by salt stress, a major promoter of plant senescence, in a manner similar to that of ANAC092, which itself is salt responsive. Furthermore, 24 genes like ANAC092 turned out to be stage-dependently expressed during seed growth with low expression at early and elevated expression at late stages of seed development. Disruption of ANAC092 increased the rate of seed germination under saline conditions, whereas the opposite occurred in respective overexpression plants. We also detected a delay of salinity-induced chlorophyll loss in detached anac092-1 mutant leaves. Promoter-reporter (GUS) studies revealed transcriptional control of ANAC092 expression during leaf and flower ageing and in response to salt stress. We conclude that ANAC092 exerts its functions during senescence and seed germination through partly overlapping target gene sets.
van Verk, Marcel C; Pappaioannou, Dimitri; Neeleman, Lyda; Bol, John F; Linthorst, Huub J M
2008-04-01
PR-1a is a salicylic acid-inducible defense gene of tobacco (Nicotiana tabacum). One-hybrid screens identified a novel tobacco WRKY transcription factor (NtWRKY12) with specific binding sites in the PR-1a promoter at positions -564 (box WK(1)) and -859 (box WK(2)). NtWRKY12 belongs to the class of transcription factors in which the WRKY sequence is followed by a GKK rather than a GQK sequence. The binding sequence of NtWRKY12 (WK box TTTTCCAC) deviated significantly from the consensus sequence (W box TTGAC[C/T]) shown to be recognized by WRKY factors with the GQK sequence. Mutation of the GKK sequence in NtWRKY12 into GQK or GEK abolished binding to the WK box. The WK(1) box is in close proximity to binding sites in the PR-1a promoter for transcription factors TGA1a (as-1 box) and Myb1 (MBSII box). Expression studies with PR-1a promoterbeta-glucuronidase (GUS) genes in stably and transiently transformed tobacco indicated that NtWRKY12 and TGA1a act synergistically in PR-1a expression induced by salicylic acid and bacterial elicitors. Cotransfection of Arabidopsis thaliana protoplasts with 35SNtWRKY12 and PR-1aGUS promoter fusions showed that overexpression of NtWRKY12 resulted in a strong increase in GUS expression, which required functional WK boxes in the PR-1a promoter.
Searching for statistically significant regulatory modules.
Bailey, Timothy L; Noble, William Stafford
2003-10-01
The regulatory machinery controlling gene expression is complex, frequently requiring multiple, simultaneous DNA-protein interactions. The rate at which a gene is transcribed may depend upon the presence or absence of a collection of transcription factors bound to the DNA near the gene. Locating transcription factor binding sites in genomic DNA is difficult because the individual sites are small and tend to occur frequently by chance. True binding sites may be identified by their tendency to occur in clusters, sometimes known as regulatory modules. We describe an algorithm for detecting occurrences of regulatory modules in genomic DNA. The algorithm, called mcast, takes as input a DNA database and a collection of binding site motifs that are known to operate in concert. mcast uses a motif-based hidden Markov model with several novel features. The model incorporates motif-specific p-values, thereby allowing scores from motifs of different widths and specificities to be compared directly. The p-value scoring also allows mcast to only accept motif occurrences with significance below a user-specified threshold, while still assigning better scores to motif occurrences with lower p-values. mcast can search long DNA sequences, modeling length distributions between motifs within a regulatory module, but ignoring length distributions between modules. The algorithm produces a list of predicted regulatory modules, ranked by E-value. We validate the algorithm using simulated data as well as real data sets from fruitfly and human. http://meme.sdsc.edu/MCAST/paper
The Regulation of Transcription in Memory Consolidation
Alberini, Cristina M.; Kandel, Eric R.
2015-01-01
De novo transcription of DNA is a fundamental requirement for the formation of long-term memory. It is required during both consolidation and reconsolidation, the posttraining and postreactivation phases that change the state of the memory from a fragile into a stable and long-lasting form. Transcription generates both mRNAs that are translated into proteins, which are necessary for the growth of new synaptic connections, as well as noncoding RNA transcripts that have regulatory or effector roles in gene expression. The result is a cascade of events that ultimately leads to structural changes in the neurons that mediate long-term memory storage. The de novo transcription, critical for synaptic plasticity and memory formation, is orchestrated by chromatin and epigenetic modifications. The complexity of transcription regulation, its temporal progression, and the effectors produced all contribute to the flexibility and persistence of long-term memory formation. In this article, we provide an overview of the mechanisms contributing to this transcriptional regulation underlying long-term memory formation. PMID:25475090
Ashworth, Justin; Plaisier, Christopher L.; Lo, Fang Yin; Reiss, David J.; Baliga, Nitin S.
2014-01-01
Widespread microbial genome sequencing presents an opportunity to understand the gene regulatory networks of non-model organisms. This requires knowledge of the binding sites for transcription factors whose DNA-binding properties are unknown or difficult to infer. We adapted a protein structure-based method to predict the specificities and putative regulons of homologous transcription factors across diverse species. As a proof-of-concept we predicted the specificities and transcriptional target genes of divergent archaeal feast/famine regulatory proteins, several of which are encoded in the genome of Halobacterium salinarum. This was validated by comparison to experimentally determined specificities for transcription factors in distantly related extremophiles, chromatin immunoprecipitation experiments, and cis-regulatory sequence conservation across eighteen related species of halobacteria. Through this analysis we were able to infer that Halobacterium salinarum employs a divergent local trans-regulatory strategy to regulate genes (carA and carB) involved in arginine and pyrimidine metabolism, whereas Escherichia coli employs an operon. The prediction of gene regulatory binding sites using structure-based methods is useful for the inference of gene regulatory relationships in new species that are otherwise difficult to infer. PMID:25255272
Ashworth, Justin; Plaisier, Christopher L; Lo, Fang Yin; Reiss, David J; Baliga, Nitin S
2014-01-01
Widespread microbial genome sequencing presents an opportunity to understand the gene regulatory networks of non-model organisms. This requires knowledge of the binding sites for transcription factors whose DNA-binding properties are unknown or difficult to infer. We adapted a protein structure-based method to predict the specificities and putative regulons of homologous transcription factors across diverse species. As a proof-of-concept we predicted the specificities and transcriptional target genes of divergent archaeal feast/famine regulatory proteins, several of which are encoded in the genome of Halobacterium salinarum. This was validated by comparison to experimentally determined specificities for transcription factors in distantly related extremophiles, chromatin immunoprecipitation experiments, and cis-regulatory sequence conservation across eighteen related species of halobacteria. Through this analysis we were able to infer that Halobacterium salinarum employs a divergent local trans-regulatory strategy to regulate genes (carA and carB) involved in arginine and pyrimidine metabolism, whereas Escherichia coli employs an operon. The prediction of gene regulatory binding sites using structure-based methods is useful for the inference of gene regulatory relationships in new species that are otherwise difficult to infer.
Schäper, Simon; Steinchen, Wieland; Krol, Elizaveta; Altegoer, Florian; Skotnicka, Dorota; Bange, Gert; Becker, Anke
2017-01-01
Cyclic dimeric GMP (c-di-GMP) has emerged as a key regulatory player in the transition between planktonic and sedentary biofilm-associated bacterial lifestyles. It controls a multitude of processes including production of extracellular polysaccharides (EPSs). The PilZ domain, consisting of an N-terminal “RxxxR” motif and a β-barrel domain, represents a prototype c-di-GMP receptor. We identified a class of c-di-GMP–responsive proteins, represented by the AraC-like transcription factor CuxR in plant symbiotic α-proteobacteria. In Sinorhizobium meliloti, CuxR stimulates transcription of an EPS biosynthesis gene cluster at elevated c-di-GMP levels. CuxR consists of a Cupin domain, a helical hairpin, and bipartite helix-turn-helix motif. Although unrelated in sequence, the mode of c-di-GMP binding to CuxR is highly reminiscent to that of PilZ domains. c-di-GMP interacts with a conserved N-terminal RxxxR motif and the Cupin domain, thereby promoting CuxR dimerization and DNA binding. We unravel structure and mechanism of a previously unrecognized c-di-GMP–responsive transcription factor and provide insights into the molecular evolution of c-di-GMP binding to proteins. PMID:28559336
Elucidation of Small RNAs that Activate Transcription in Bacteria
2012-03-01
bacterial sRNAs that activate transcription of a target gene in E. coli to varying degrees. Mutation of the strongest activator modified its...identified RNA- based transcriptional activators in yeast (Buskirk et al., 2003) although the underlying mechanism was not elucidated. We show that the...previous yeast two-hybrid (Buskirk et al., 2003) and three-hybrid studies (Bernstein et al., 2002). Colonies were observed from co-transformations of pBT
A Hox regulatory network establishes motor neuron pool identity and target-muscle connectivity.
Dasen, Jeremy S; Tice, Bonnie C; Brenner-Morton, Susan; Jessell, Thomas M
2005-11-04
Spinal motor neurons acquire specialized "pool" identities that determine their ability to form selective connections with target muscles in the limb, but the molecular basis of this striking example of neuronal specificity has remained unclear. We show here that a Hox transcriptional regulatory network specifies motor neuron pool identity and connectivity. Two interdependent sets of Hox regulatory interactions operate within motor neurons, one assigning rostrocaudal motor pool position and a second directing motor pool diversity at a single segmental level. This Hox regulatory network directs the downstream transcriptional identity of motor neuron pools and defines the pattern of target-muscle connectivity.
Genome-wide dynamics of a bacterial response to antibiotics that target the cell envelope
2011-01-01
Background A decline in the discovery of new antibacterial drugs, coupled with a persistent rise in the occurrence of drug-resistant bacteria, has highlighted antibiotics as a diminishing resource. The future development of new drugs with novel antibacterial activities requires a detailed understanding of adaptive responses to existing compounds. This study uses Streptomyces coelicolor A3(2) as a model system to determine the genome-wide transcriptional response following exposure to three antibiotics (vancomycin, moenomycin A and bacitracin) that target distinct stages of cell wall biosynthesis. Results A generalised response to all three antibiotics was identified which involves activation of transcription of the cell envelope stress sigma factor σE, together with elements of the stringent response, and of the heat, osmotic and oxidative stress regulons. Attenuation of this system by deletion of genes encoding the osmotic stress sigma factor σB or the ppGpp synthetase RelA reduced resistance to both vancomycin and bacitracin. Many antibiotic-specific transcriptional changes were identified, representing cellular processes potentially important for tolerance to each antibiotic. Sensitivity studies using mutants constructed on the basis of the transcriptome profiling confirmed a role for several such genes in antibiotic resistance, validating the usefulness of the approach. Conclusions Antibiotic inhibition of bacterial cell wall biosynthesis induces both common and compound-specific transcriptional responses. Both can be exploited to increase antibiotic susceptibility. Regulatory networks known to govern responses to environmental and nutritional stresses are also at the core of the common antibiotic response, and likely help cells survive until any specific resistance mechanisms are fully functional. PMID:21569315
DNA context represents transcription regulation of the gene in mouse embryonic stem cells
NASA Astrophysics Data System (ADS)
Ha, Misook; Hong, Soondo
2016-04-01
Understanding gene regulatory information in DNA remains a significant challenge in biomedical research. This study presents a computational approach to infer gene regulatory programs from primary DNA sequences. Using DNA around transcription start sites as attributes, our model predicts gene regulation in the gene. We find that H3K27ac around TSS is an informative descriptor of the transcription program in mouse embryonic stem cells. We build a computational model inferring the cell-type-specific H3K27ac signatures in the DNA around TSS. A comparison of embryonic stem cell and liver cell-specific H3K27ac signatures in DNA shows that the H3K27ac signatures in DNA around TSS efficiently distinguish the cell-type specific H3K27ac peaks and the gene regulation. The arrangement of the H3K27ac signatures inferred from the DNA represents the transcription regulation of the gene in mESC. We show that the DNA around transcription start sites is associated with the gene regulatory program by specific interaction with H3K27ac.
DNA context represents transcription regulation of the gene in mouse embryonic stem cells.
Ha, Misook; Hong, Soondo
2016-04-14
Understanding gene regulatory information in DNA remains a significant challenge in biomedical research. This study presents a computational approach to infer gene regulatory programs from primary DNA sequences. Using DNA around transcription start sites as attributes, our model predicts gene regulation in the gene. We find that H3K27ac around TSS is an informative descriptor of the transcription program in mouse embryonic stem cells. We build a computational model inferring the cell-type-specific H3K27ac signatures in the DNA around TSS. A comparison of embryonic stem cell and liver cell-specific H3K27ac signatures in DNA shows that the H3K27ac signatures in DNA around TSS efficiently distinguish the cell-type specific H3K27ac peaks and the gene regulation. The arrangement of the H3K27ac signatures inferred from the DNA represents the transcription regulation of the gene in mESC. We show that the DNA around transcription start sites is associated with the gene regulatory program by specific interaction with H3K27ac.
Yamasaki, Yuji; Gao, Feng; Jordan, Mark C; Ayele, Belay T
2017-09-16
Maturation forms one of the critical seed developmental phases and it is characterized mainly by programmed cell death, dormancy and desiccation, however, the transcriptional programs and regulatory networks underlying acquisition of dormancy and deposition of storage reserves during the maturation phase of seed development are poorly understood in wheat. The present study performed comparative spatiotemporal transcriptomic analysis of seed maturation in two wheat genotypes with contrasting seed weight/size and dormancy phenotype. The embryo and endosperm tissues of maturing seeds appeared to exhibit genotype-specific temporal shifts in gene expression profile that might contribute to the seed phenotypic variations. Functional annotations of gene clusters suggest that the two tissues exhibit distinct but genotypically overlapping molecular functions. Motif enrichment predicts genotypically distinct abscisic acid (ABA) and gibberellin (GA) regulated transcriptional networks contribute to the contrasting seed weight/size and dormancy phenotypes between the two genotypes. While other ABA responsive element (ABRE) motifs are enriched in both genotypes, the prevalence of G-box-like motif specifically in tissues of the dormant genotype suggests distinct ABA mediated transcriptional mechanisms control the establishment of dormancy during seed maturation. In agreement with this, the bZIP transcription factors that co-express with ABRE enriched embryonic genes differ with genotype. The enrichment of SITEIIATCYTC motif specifically in embryo clusters of maturing seeds irrespective of genotype predicts a tissue specific role for the respective TCP transcription factors with no or minimal contribution to the variations in seed dormancy. The results of this study advance our understanding of the seed maturation associated molecular mechanisms underlying variation in dormancy and weight/size in wheat seeds, which is a critical step towards the designing of molecular strategies
Transcriptional Regulation of Pattern-Triggered Immunity in Plants.
Li, Bo; Meng, Xiangzong; Shan, Libo; He, Ping
2016-05-11
Perception of microbe-associated molecular patterns (MAMPs) by cell-surface-resident pattern recognition receptors (PRRs) induces rapid, robust, and selective transcriptional reprogramming, which is central for launching effective pattern-triggered immunity (PTI) in plants. Signal relay from PRR complexes to the nuclear transcriptional machinery via intracellular kinase cascades rapidly activates primary immune response genes. The coordinated action of gene-specific transcription factors and the general transcriptional machinery contribute to the selectivity of immune gene activation. In addition, PRR complexes and signaling components are often transcriptionally upregulated upon MAMP perception to ensure the robustness and sustainability of PTI outputs. In this review, we discuss recent advances in deciphering the signaling pathways and regulatory mechanisms that coordinately lead to timely and accurate MAMP-induced gene expression in plants. Copyright © 2016 Elsevier Inc. All rights reserved.
Wilczynski, Bartek; Furlong, Eileen E M
2010-04-15
Development is regulated by dynamic patterns of gene expression, which are orchestrated through the action of complex gene regulatory networks (GRNs). Substantial progress has been made in modeling transcriptional regulation in recent years, including qualitative "coarse-grain" models operating at the gene level to very "fine-grain" quantitative models operating at the biophysical "transcription factor-DNA level". Recent advances in genome-wide studies have revealed an enormous increase in the size and complexity or GRNs. Even relatively simple developmental processes can involve hundreds of regulatory molecules, with extensive interconnectivity and cooperative regulation. This leads to an explosion in the number of regulatory functions, effectively impeding Boolean-based qualitative modeling approaches. At the same time, the lack of information on the biophysical properties for the majority of transcription factors within a global network restricts quantitative approaches. In this review, we explore the current challenges in moving from modeling medium scale well-characterized networks to more poorly characterized global networks. We suggest to integrate coarse- and find-grain approaches to model gene regulatory networks in cis. We focus on two very well-studied examples from Drosophila, which likely represent typical developmental regulatory modules across metazoans. Copyright (c) 2009 Elsevier Inc. All rights reserved.
Evolutionary Analysis of DELLA-Associated Transcriptional Networks.
Briones-Moreno, Asier; Hernández-García, Jorge; Vargas-Chávez, Carlos; Romero-Campero, Francisco J; Romero, José M; Valverde, Federico; Blázquez, Miguel A
2017-01-01
DELLA proteins are transcriptional regulators present in all land plants which have been shown to modulate the activity of over 100 transcription factors in Arabidopsis, involved in multiple physiological and developmental processes. It has been proposed that DELLAs transduce environmental information to pre-wired transcriptional circuits because their stability is regulated by gibberellins (GAs), whose homeostasis largely depends on environmental signals. The ability of GAs to promote DELLA degradation coincides with the origin of vascular plants, but the presence of DELLAs in other land plants poses at least two questions: what regulatory properties have DELLAs provided to the behavior of transcriptional networks in land plants, and how has the recruitment of DELLAs by GA signaling affected this regulation. To address these issues, we have constructed gene co-expression networks of four different organisms within the green lineage with different properties regarding DELLAs: Arabidopsis thaliana and Solanum lycopersicum (both with GA-regulated DELLA proteins), Physcomitrella patens (with GA-independent DELLA proteins) and Chlamydomonas reinhardtii (a green alga without DELLA), and we have examined the relative evolution of the subnetworks containing the potential DELLA-dependent transcriptomes. Network analysis indicates a relative increase in parameters associated with the degree of interconnectivity in the DELLA-associated subnetworks of land plants, with a stronger effect in species with GA-regulated DELLA proteins. These results suggest that DELLAs may have played a role in the coordination of multiple transcriptional programs along evolution, and the function of DELLAs as regulatory 'hubs' became further consolidated after their recruitment by GA signaling in higher plants.
Kumar, Meera Ajeet; Christensen, Kendra; Woods, Benjamin; Dettlaff, Ashley; Perley, Danielle; Scheidegger, Adam; Balakrishnan, Lata; Milavetz, Barry
2017-01-01
The location of nucleosomes in SV40 virions and minichromosomes isolated during infection were determined by next generation sequencing (NGS). The patterns of reads within the regulatory region of chromatin from wild-type virions indicated that micrococcal nuclease-resistant nucleosomes were specifically positioned at nt 5223 and nt 363, while in minichromosomes isolated 48 h post-infection we observed nuclease-resistant nucleosomes at nt 5119 and nt 212. The nucleosomes at nt 5223 and nt 363 in virion chromatin would be expected to repress early and late transcription, respectively. In virions from the mutant cs1085, which does not repress early transcription, we found that these two nucleosomes were significantly reduced compared to wild-type virions confirming a repressive role for them. In chromatin from cells infected for only 30 min with wild-type virus, we observed a significant reduction in the nucleosomes at nt 5223 and nt 363 indicating that the potential repression by these nucleosomes appeared to be relieved very early in infection. PMID:28126638
Structural Basis of Mitochondrial Transcription Initiation.
Hillen, Hauke S; Morozov, Yaroslav I; Sarfallah, Azadeh; Temiakov, Dmitry; Cramer, Patrick
2017-11-16
Transcription in human mitochondria is driven by a single-subunit, factor-dependent RNA polymerase (mtRNAP). Despite its critical role in both expression and replication of the mitochondrial genome, transcription initiation by mtRNAP remains poorly understood. Here, we report crystal structures of human mitochondrial transcription initiation complexes assembled on both light and heavy strand promoters. The structures reveal how transcription factors TFAM and TFB2M assist mtRNAP to achieve promoter-dependent initiation. TFAM tethers the N-terminal region of mtRNAP to recruit the polymerase to the promoter whereas TFB2M induces structural changes in mtRNAP to enable promoter opening and trapping of the DNA non-template strand. Structural comparisons demonstrate that the initiation mechanism in mitochondria is distinct from that in the well-studied nuclear, bacterial, or bacteriophage transcription systems but that similarities are found on the topological and conceptual level. These results provide a framework for studying the regulation of gene expression and DNA replication in mitochondria. Copyright © 2017 Elsevier Inc. All rights reserved.
Transcription regulation by the Mediator complex.
Soutourina, Julie
2018-04-01
Alterations in the regulation of gene expression are frequently associated with developmental diseases or cancer. Transcription activation is a key phenomenon in the regulation of gene expression. In all eukaryotes, mediator of RNA polymerase II transcription (Mediator), a large complex with modular organization, is generally required for transcription by RNA polymerase II, and it regulates various steps of this process. The main function of Mediator is to transduce signals from the transcription activators bound to enhancer regions to the transcription machinery, which is assembled at promoters as the preinitiation complex (PIC) to control transcription initiation. Recent functional studies of Mediator with the use of structural biology approaches and functional genomics have revealed new insights into Mediator activity and its regulation during transcription initiation, including how Mediator is recruited to transcription regulatory regions and how it interacts and cooperates with PIC components to assist in PIC assembly. Novel roles of Mediator in the control of gene expression have also been revealed by showing its connection to the nuclear pore and linking Mediator to the regulation of gene positioning in the nuclear space. Clear links between Mediator subunits and disease have also encouraged studies to explore targeting of this complex as a potential therapeutic approach in cancer and fungal infections.
Wang, Guohua; Wang, Fang; Huang, Qian; Li, Yu; Liu, Yunlong; Wang, Yadong
2015-01-01
Transcription factors are proteins that bind to DNA sequences to regulate gene transcription. The transcription factor binding sites are short DNA sequences (5-20 bp long) specifically bound by one or more transcription factors. The identification of transcription factor binding sites and prediction of their function continue to be challenging problems in computational biology. In this study, by integrating the DNase I hypersensitive sites with known position weight matrices in the TRANSFAC database, the transcription factor binding sites in gene regulatory region are identified. Based on the global gene expression patterns in cervical cancer HeLaS3 cell and HelaS3-ifnα4h cell (interferon treatment on HeLaS3 cell for 4 hours), we present a model-based computational approach to predict a set of transcription factors that potentially cause such differential gene expression. Significantly, 6 out 10 predicted functional factors, including IRF, IRF-2, IRF-9, IRF-1 and IRF-3, ICSBP, belong to interferon regulatory factor family and upregulate the gene expression levels responding to the interferon treatment. Another factor, ISGF-3, is also a transcriptional activator induced by interferon alpha. Using the different transcription factor binding sites selected criteria, the prediction result of our model is consistent. Our model demonstrated the potential to computationally identify the functional transcription factors in gene regulation.
Acevedo-Luna, Natalia; Mariño-Ramírez, Leonardo; Halbert, Armand; Hansen, Ulla; Landsman, David; Spouge, John L
2016-11-21
Transcription factors (TFs) form complexes that bind regulatory modules (RMs) within DNA, to control specific sets of genes. Some transcription factor binding sites (TFBSs) near the transcription start site (TSS) display tight positional preferences relative to the TSS. Furthermore, near the TSS, RMs can co-localize TFBSs with each other and the TSS. The proportion of TFBS positional preferences due to TFBS co-localization within RMs is unknown, however. ChIP experiments confirm co-localization of some TFBSs genome-wide, including near the TSS, but they typically examine only a few TFs at a time, using non-physiological conditions that can vary from lab to lab. In contrast, sequence analysis can examine many TFs uniformly and methodically, broadly surveying the co-localization of TFBSs with tight positional preferences relative to the TSS. Our statistics found 43 significant sets of human motifs in the JASPAR TF Database with positional preferences relative to the TSS, with 38 preferences tight (±5 bp). Each set of motifs corresponded to a gene group of 135 to 3304 genes, with 42/43 (98%) gene groups independently validated by DAVID, a gene ontology database, with FDR < 0.05. Motifs corresponding to two TFBSs in a RM should co-occur more than by chance alone, enriching the intersection of the gene groups corresponding to the two TFs. Thus, a gene-group intersection systematically enriched beyond chance alone provides evidence that the two TFs participate in an RM. Of the 903 = 43*42/2 intersections of the 43 significant gene groups, we found 768/903 (85%) pairs of gene groups with significantly enriched intersections, with 564/768 (73%) intersections independently validated by DAVID with FDR < 0.05. A user-friendly web site at http://go.usa.gov/3kjsH permits biologists to explore the interaction network of our TFBSs to identify candidate subunit RMs. Gene duplication and convergent evolution within a genome provide obvious biological mechanisms for
Tammimies, Kristiina; Bieder, Andrea; Lauter, Gilbert; Sugiaman-Trapman, Debora; Torchet, Rachel; Hokkanen, Marie-Estelle; Burghoorn, Jan; Castrén, Eero; Kere, Juha; Tapia-Páez, Isabel; Swoboda, Peter
2016-01-01
DYX1C1, DCDC2, and KIAA0319 are three of the most replicated dyslexia candidate genes (DCGs). Recently, these DCGs were implicated in functions at the cilium. Here, we investigate the regulation of these DCGs by Regulatory Factor X transcription factors (RFX TFs), a gene family known for transcriptionally regulating ciliary genes. We identify conserved X-box motifs in the promoter regions of DYX1C1, DCDC2, and KIAA0319 and demonstrate their functionality, as well as the ability to recruit RFX TFs using reporter gene and electrophoretic mobility shift assays. Furthermore, we uncover a complex regulation pattern between RFX1, RFX2, and RFX3 and their significant effect on modifying the endogenous expression of DYX1C1 and DCDC2 in a human retinal pigmented epithelial cell line immortalized with hTERT (hTERT-RPE1). In addition, induction of ciliogenesis increases the expression of RFX TFs and DCGs. At the protein level, we show that endogenous DYX1C1 localizes to the base of the cilium, whereas DCDC2 localizes along the entire axoneme of the cilium, thereby validating earlier localization studies using overexpression models. Our results corroborate the emerging role of DCGs in ciliary function and characterize functional noncoding elements, X-box promoter motifs, in DCG promoter regions, which thus can be targeted for mutation screening in dyslexia and ciliopathies associated with these genes.—Tammimies, K., Bieder, A., Lauter, G., Sugiaman-Trapman, D., Torchet, R., Hokkanen, M.-E., Burghoorn, J., Castrén, E., Kere, J., Tapia-Páez, I., Swoboda, P. Ciliary dyslexia candidate genes DYX1C1 and DCDC2 are regulated by Regulatory Factor (RF) X transcription factors through X-box promoter motifs. PMID:27451412
Tammimies, Kristiina; Bieder, Andrea; Lauter, Gilbert; Sugiaman-Trapman, Debora; Torchet, Rachel; Hokkanen, Marie-Estelle; Burghoorn, Jan; Castrén, Eero; Kere, Juha; Tapia-Páez, Isabel; Swoboda, Peter
2016-10-01
DYX1C1, DCDC2, and KIAA0319 are three of the most replicated dyslexia candidate genes (DCGs). Recently, these DCGs were implicated in functions at the cilium. Here, we investigate the regulation of these DCGs by Regulatory Factor X transcription factors (RFX TFs), a gene family known for transcriptionally regulating ciliary genes. We identify conserved X-box motifs in the promoter regions of DYX1C1, DCDC2, and KIAA0319 and demonstrate their functionality, as well as the ability to recruit RFX TFs using reporter gene and electrophoretic mobility shift assays. Furthermore, we uncover a complex regulation pattern between RFX1, RFX2, and RFX3 and their significant effect on modifying the endogenous expression of DYX1C1 and DCDC2 in a human retinal pigmented epithelial cell line immortalized with hTERT (hTERT-RPE1). In addition, induction of ciliogenesis increases the expression of RFX TFs and DCGs. At the protein level, we show that endogenous DYX1C1 localizes to the base of the cilium, whereas DCDC2 localizes along the entire axoneme of the cilium, thereby validating earlier localization studies using overexpression models. Our results corroborate the emerging role of DCGs in ciliary function and characterize functional noncoding elements, X-box promoter motifs, in DCG promoter regions, which thus can be targeted for mutation screening in dyslexia and ciliopathies associated with these genes.-Tammimies, K., Bieder, A., Lauter, G., Sugiaman-Trapman, D., Torchet, R., Hokkanen, M.-E., Burghoorn, J., Castrén, E., Kere, J., Tapia-Páez, I., Swoboda, P. Ciliary dyslexia candidate genes DYX1C1 and DCDC2 are regulated by Regulatory Factor (RF) X transcription factors through X-box promoter motifs. © The Author(s).
Transcriptional response of Musca domestica larvae to bacterial infection.
Tang, Ting; Li, Xiang; Yang, Xue; Yu, Xue; Wang, Jianhui; Liu, Fengsong; Huang, Dawei
2014-01-01
The house fly Musca domestica, a cosmopolitan dipteran insect, is a significant vector for human and animal bacterial pathogens, but little is known about its immune response to these pathogens. To address this issue, we inoculated the larvae with a mixture of Escherichia coli and Staphylococcus aureus and profiled the transcriptome 6, 24, and 48 h thereafter. Many genes known to controlling innate immunity in insects were induced following infection, including genes encoding pattern recognition proteins (PGRPs), various components of the Toll and IMD signaling pathways and of the proPO-activating and redox systems, and multiple antimicrobial peptides. Interestingly, we also uncovered a large set of novel immune response genes including two broad-spectrum antimicrobial peptides (muscin and domesticin), which might have evolved to adapt to house-fly's unique ecological environments. Finally, genes mediating oxidative phosphorylation were repressed at 48 h post-infection, suggesting disruption of energy homeostasis and mitochondrial function at the late stages of infection. Collectively, our data reveal dynamic changes in gene expression following bacterial infection in the house fly, paving the way for future in-depth analysis of M. domestica's immune system.
A model for genesis of transcription systems.
Burton, Zachary F; Opron, Kristopher; Wei, Guowei; Geiger, James H
2016-01-01
Repeating sequences generated from RNA gene fusions/ligations dominate ancient life, indicating central importance of building structural complexity in evolving biological systems. A simple and coherent story of life on earth is told from tracking repeating motifs that generate α/β proteins, 2-double-Ψ-β-barrel (DPBB) type RNA polymerases (RNAPs), general transcription factors (GTFs), and promoters. A general rule that emerges is that biological complexity that arises through generation of repeats is often bounded by solubility and closure (i.e., to form a pseudo-dimer or a barrel). Because the first DNA genomes were replicated by DNA template-dependent RNA synthesis followed by RNA template-dependent DNA synthesis via reverse transcriptase, the first DNA replication origins were initially 2-DPBB type RNAP promoters. A simplifying model for evolution of promoters/replication origins via repetition of core promoter elements is proposed. The model can explain why Pribnow boxes in bacterial transcription (i.e., (-12)TATAATG(-6)) so closely resemble TATA boxes (i.e., (-31)TATAAAAG(-24)) in archaeal/eukaryotic transcription. The evolution of anchor DNA sequences in bacterial (i.e., (-35)TTGACA(-30)) and archaeal (BRE(up); BRE for TFB recognition element) promoters is potentially explained. The evolution of BRE(down) elements of archaeal promoters is potentially explained.
CRP-cAMP mediates silencing of Salmonella virulence at the post-transcriptional level
El Mouali, Youssef; Gaviria-Cantin, Tania; Gibert, Marta; Westermann, Alexander J.; Vogel, Jörg
2018-01-01
Invasion of epithelial cells by Salmonella enterica requires expression of genes located in the pathogenicity island I (SPI-1). The expression of SPI-1 genes is very tightly regulated and activated only under specific conditions. Most studies have focused on the regulatory pathways that induce SPI-1 expression. Here, we describe a new regulatory circuit involving CRP-cAMP, a widely established metabolic regulator, in silencing of SPI-1 genes under non-permissive conditions. In CRP-cAMP-deficient strains we detected a strong upregulation of SPI-1 genes in the mid-logarithmic growth phase. Genetic analyses revealed that CRP-cAMP modulates the level of HilD, the master regulator of Salmonella invasion. This regulation occurs at the post-transcriptional level and requires the presence of a newly identified regulatory motif within the hilD 3’UTR. We further demonstrate that in Salmonella the Hfq-dependent sRNA Spot 42 is under the transcriptional repression of CRP-cAMP and, when this transcriptional repression is relieved, Spot 42 exerts a positive effect on hilD expression. In vivo and in vitro assays indicate that Spot 42 targets, through its unstructured region III, the 3’UTR of the hilD transcript. Together, our results highlight the biological relevance of the hilD 3’UTR as a hub for post-transcriptional control of Salmonella invasion gene expression. PMID:29879120
Hamed, Mohamed; Spaniol, Christian; Nazarieh, Maryam; Helms, Volkhard
2015-07-01
TFmiR is a freely available web server for deep and integrative analysis of combinatorial regulatory interactions between transcription factors, microRNAs and target genes that are involved in disease pathogenesis. Since the inner workings of cells rely on the correct functioning of an enormously complex system of activating and repressing interactions that can be perturbed in many ways, TFmiR helps to better elucidate cellular mechanisms at the molecular level from a network perspective. The provided topological and functional analyses promote TFmiR as a reliable systems biology tool for researchers across the life science communities. TFmiR web server is accessible through the following URL: http://service.bioinformatik.uni-saarland.de/tfmir. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Hongqiang; Chen, Hao; Bao, Lei
2005-01-01
Genetic loci that regulate inherited traits are routinely identified using quantitative trait locus (QTL) mapping methods. However, the genotype-phenotype associations do not provide information on the gene expression program through which the genetic loci regulate the traits. Transcription modules are 'selfconsistent regulatory units' and are closely related to the modular components of gene regulatory network [Ihmels, J., Friedlander, G., Bergmann, S., Sarig, O., Ziv, Y. and Barkai, N. (2002) Revealing modular organization in the yeast transcriptional network. Nat. Genet., 31, 370-377; Segal, E., Shapira, M., Regev, A., Pe'er, D., Botstein, D., Koller, D. and Friedman, N. (2003) Module networks: identifyingmore » regulatory modules and their condition-specific regulators from gene expression data. Nat. Genet., 34, 166-176]. We used genome-wide genotype and gene expression data of a genetic reference population that consists of mice of 32 recombinant inbred strains to identify the transcription modules and the genetic loci regulating them. Twenty-nine transcription modules defined by genetic variations were identified. Statistically significant associations between the transcription modules and 18 classical physiological and behavioral traits were found. Genome-wide interval mapping showed that major QTLs regulating the transcription modules are often co-localized with the QTLs regulating the associated classical traits. The association and the possible co-regulation of the classical trait and transcription module indicate that the transcription module may be involved in the gene pathways connecting the QTL and the classical trait. Our results show that a transcription module may associate with multiple seemingly unrelated classical traits and a classical trait may associate with different modules. Literature mining results provided strong independent evidences for the relations among genes of the transcription modules, genes in the regions of the QTLs
Liebers, Monique; Grübler, Björn; Chevalier, Fabien; Lerbs-Mache, Silva; Merendino, Livia; Blanvillain, Robert; Pfannschmidt, Thomas
2017-01-01
Plastids display a high morphological and functional diversity. Starting from an undifferentiated small proplastid, these plant cell organelles can develop into four major forms: etioplasts in the dark, chloroplasts in green tissues, chromoplasts in colored flowers and fruits and amyloplasts in roots. The various forms are interconvertible into each other depending on tissue context and respective environmental condition. Research of the last two decades uncovered that each plastid type contains its own specific proteome that can be highly different from that of the other types. Composition of these proteomes largely defines the enzymatic functionality of the respective plastid. The vast majority of plastid proteins is encoded in the nucleus and must be imported from the cytosol. However, a subset of proteins of the photosynthetic and gene expression machineries are encoded on the plastid genome and are transcribed by a complex transcriptional apparatus consisting of phage-type nuclear-encoded RNA polymerases and a bacterial-type plastid-encoded RNA polymerase. Both types recognize specific sets of promoters and transcribe partly over-lapping as well as specific sets of genes. Here we summarize the current knowledge about the sequential activity of these plastid RNA polymerases and their relative activities in different types of plastids. Based on published plastid gene expression profiles we hypothesize that each conversion from one plastid type into another is either accompanied or even preceded by significant changes in plastid transcription suggesting that these changes represent important determinants of plastid morphology and protein composition and, hence, the plastid type.
Liebers, Monique; Grübler, Björn; Chevalier, Fabien; Lerbs-Mache, Silva; Merendino, Livia; Blanvillain, Robert; Pfannschmidt, Thomas
2017-01-01
Plastids display a high morphological and functional diversity. Starting from an undifferentiated small proplastid, these plant cell organelles can develop into four major forms: etioplasts in the dark, chloroplasts in green tissues, chromoplasts in colored flowers and fruits and amyloplasts in roots. The various forms are interconvertible into each other depending on tissue context and respective environmental condition. Research of the last two decades uncovered that each plastid type contains its own specific proteome that can be highly different from that of the other types. Composition of these proteomes largely defines the enzymatic functionality of the respective plastid. The vast majority of plastid proteins is encoded in the nucleus and must be imported from the cytosol. However, a subset of proteins of the photosynthetic and gene expression machineries are encoded on the plastid genome and are transcribed by a complex transcriptional apparatus consisting of phage-type nuclear-encoded RNA polymerases and a bacterial-type plastid-encoded RNA polymerase. Both types recognize specific sets of promoters and transcribe partly over-lapping as well as specific sets of genes. Here we summarize the current knowledge about the sequential activity of these plastid RNA polymerases and their relative activities in different types of plastids. Based on published plastid gene expression profiles we hypothesize that each conversion from one plastid type into another is either accompanied or even preceded by significant changes in plastid transcription suggesting that these changes represent important determinants of plastid morphology and protein composition and, hence, the plastid type. PMID:28154576
Diverse patterns of genomic targeting by transcriptional regulators in Drosophila melanogaster.
Slattery, Matthew; Ma, Lijia; Spokony, Rebecca F; Arthur, Robert K; Kheradpour, Pouya; Kundaje, Anshul; Nègre, Nicolas; Crofts, Alex; Ptashkin, Ryan; Zieba, Jennifer; Ostapenko, Alexander; Suchy, Sarah; Victorsen, Alec; Jameel, Nader; Grundstad, A Jason; Gao, Wenxuan; Moran, Jennifer R; Rehm, E Jay; Grossman, Robert L; Kellis, Manolis; White, Kevin P
2014-07-01
Annotation of regulatory elements and identification of the transcription-related factors (TRFs) targeting these elements are key steps in understanding how cells interpret their genetic blueprint and their environment during development, and how that process goes awry in the case of disease. One goal of the modENCODE (model organism ENCyclopedia of DNA Elements) Project is to survey a diverse sampling of TRFs, both DNA-binding and non-DNA-binding factors, to provide a framework for the subsequent study of the mechanisms by which transcriptional regulators target the genome. Here we provide an updated map of the Drosophila melanogaster regulatory genome based on the location of 84 TRFs at various stages of development. This regulatory map reveals a variety of genomic targeting patterns, including factors with strong preferences toward proximal promoter binding, factors that target intergenic and intronic DNA, and factors with distinct chromatin state preferences. The data also highlight the stringency of the Polycomb regulatory network, and show association of the Trithorax-like (Trl) protein with hotspots of DNA binding throughout development. Furthermore, the data identify more than 5800 instances in which TRFs target DNA regions with demonstrated enhancer activity. Regions of high TRF co-occupancy are more likely to be associated with open enhancers used across cell types, while lower TRF occupancy regions are associated with complex enhancers that are also regulated at the epigenetic level. Together these data serve as a resource for the research community in the continued effort to dissect transcriptional regulatory mechanisms directing Drosophila development. © 2014 Slattery et al.; Published by Cold Spring Harbor Laboratory Press.
SPARTA: Simple Program for Automated reference-based bacterial RNA-seq Transcriptome Analysis.
Johnson, Benjamin K; Scholz, Matthew B; Teal, Tracy K; Abramovitch, Robert B
2016-02-04
Many tools exist in the analysis of bacterial RNA sequencing (RNA-seq) transcriptional profiling experiments to identify differentially expressed genes between experimental conditions. Generally, the workflow includes quality control of reads, mapping to a reference, counting transcript abundance, and statistical tests for differentially expressed genes. In spite of the numerous tools developed for each component of an RNA-seq analysis workflow, easy-to-use bacterially oriented workflow applications to combine multiple tools and automate the process are lacking. With many tools to choose from for each step, the task of identifying a specific tool, adapting the input/output options to the specific use-case, and integrating the tools into a coherent analysis pipeline is not a trivial endeavor, particularly for microbiologists with limited bioinformatics experience. To make bacterial RNA-seq data analysis more accessible, we developed a Simple Program for Automated reference-based bacterial RNA-seq Transcriptome Analysis (SPARTA). SPARTA is a reference-based bacterial RNA-seq analysis workflow application for single-end Illumina reads. SPARTA is turnkey software that simplifies the process of analyzing RNA-seq data sets, making bacterial RNA-seq analysis a routine process that can be undertaken on a personal computer or in the classroom. The easy-to-install, complete workflow processes whole transcriptome shotgun sequencing data files by trimming reads and removing adapters, mapping reads to a reference, counting gene features, calculating differential gene expression, and, importantly, checking for potential batch effects within the data set. SPARTA outputs quality analysis reports, gene feature counts and differential gene expression tables and scatterplots. SPARTA provides an easy-to-use bacterial RNA-seq transcriptional profiling workflow to identify differentially expressed genes between experimental conditions. This software will enable microbiologists with
Kumar, Sunil; Ambrosini, Giovanna; Bucher, Philipp
2017-01-04
SNP2TFBS is a computational resource intended to support researchers investigating the molecular mechanisms underlying regulatory variation in the human genome. The database essentially consists of a collection of text files providing specific annotations for human single nucleotide polymorphisms (SNPs), namely whether they are predicted to abolish, create or change the affinity of one or several transcription factor (TF) binding sites. A SNP's effect on TF binding is estimated based on a position weight matrix (PWM) model for the binding specificity of the corresponding factor. These data files are regenerated at regular intervals by an automatic procedure that takes as input a reference genome, a comprehensive SNP catalogue and a collection of PWMs. SNP2TFBS is also accessible over a web interface, enabling users to view the information provided for an individual SNP, to extract SNPs based on various search criteria, to annotate uploaded sets of SNPs or to display statistics about the frequencies of binding sites affected by selected SNPs. Homepage: http://ccg.vital-it.ch/snp2tfbs/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Hammarén, Milka Marjut; Luukinen, Bruno Vincent; Pesu, Marko; Rämet, Mika; Parikka, Mataleena
2014-01-01
Tuberculosis is still a major health problem worldwide. Currently it is not known what kind of immune responses lead to successful control and clearance of Mycobacterium tuberculosis. This gap in knowledge is reflected by the inability to develop sufficient diagnostic and therapeutic tools to fight tuberculosis. We have used the Mycobacterium marinum infection model in the adult zebrafish and taken advantage of heterogeneity of zebrafish population to dissect the characteristics of adaptive immune responses, some of which are associated with well-controlled latency or bacterial clearance while others with progressive infection. Differences in T cell responses between subpopulations were measured at the transcriptional level. It was discovered that a high total T cell level was usually associated with lower bacterial loads alongside with a T helper 2 (Th2)-type gene expression signature. At late time points, spontaneous reactivation with apparent symptoms was characterized by a low Th2/Th1 marker ratio and a substantial induction of foxp3 reflecting the level of regulatory T cells. Characteristic gata3/tbx21 has potential as a biomarker for the status of mycobacterial disease. PMID:24968056
CRX ChIP-seq reveals the cis-regulatory architecture of mouse photoreceptors
Corbo, Joseph C.; Lawrence, Karen A.; Karlstetter, Marcus; Myers, Connie A.; Abdelaziz, Musa; Dirkes, William; Weigelt, Karin; Seifert, Martin; Benes, Vladimir; Fritsche, Lars G.; Weber, Bernhard H.F.; Langmann, Thomas
2010-01-01
Approximately 98% of mammalian DNA is noncoding, yet we understand relatively little about the function of this enigmatic portion of the genome. The cis-regulatory elements that control gene expression reside in noncoding regions and can be identified by mapping the binding sites of tissue-specific transcription factors. Cone-rod homeobox (CRX) is a key transcription factor in photoreceptor differentiation and survival, but its in vivo targets are largely unknown. Here, we used chromatin immunoprecipitation with massively parallel sequencing (ChIP-seq) on CRX to identify thousands of cis-regulatory regions around photoreceptor genes in adult mouse retina. CRX directly regulates downstream photoreceptor transcription factors and their target genes via a network of spatially distributed regulatory elements around each locus. CRX-bound regions act in a synergistic fashion to activate transcription and contain multiple CRX binding sites which interact in a spacing- and orientation-dependent manner to fine-tune transcript levels. CRX ChIP-seq was also performed on Nrl−/− retinas, which represent an enriched source of cone photoreceptors. Comparison with the wild-type ChIP-seq data set identified numerous rod- and cone-specific CRX-bound regions as well as many shared elements. Thus, CRX combinatorially orchestrates the transcriptional networks of both rods and cones by coordinating the expression of photoreceptor genes including most retinal disease genes. In addition, this study pinpoints thousands of noncoding regions of relevance to both Mendelian and complex retinal disease. PMID:20693478
Transcriptional organization of the DNA region controlling expression of the K99 gene cluster.
Roosendaal, B; Damoiseaux, J; Jordi, W; de Graaf, F K
1989-01-01
The transcriptional organization of the K99 gene cluster was investigated in two ways. First, the DNA region, containing the transcriptional signals was analyzed using a transcription vector system with Escherichia coli galactokinase (GalK) as assayable marker and second, an in vitro transcription system was employed. A detailed analysis of the transcription signals revealed that a strong promoter PA and a moderate promoter PB are located upstream of fanA and fanB, respectively. No promoter activity was detected in the intercistronic region between fanB and fanC. Factor-dependent terminators of transcription were detected and are probably located in the intercistronic region between fanA and fanB (T1), and between fanB and fanC (T2). A third terminator (T3) was observed between fanC and fanD and has an efficiency of 90%. Analysis of the regulatory region in an in vitro transcription system confirmed the location of the respective transcription signals. A model for the transcriptional organization of the K99 cluster is presented. Indications were obtained that the trans-acting regulatory polypeptides FanA and FanB both function as anti-terminators. A model for the regulation of expression of the K99 gene cluster is postulated.
Ning, Xi; Sun, Yao; Wang, Changchun; Zhang, Weilin; Sun, Meihao; Hu, Haitao; Liu, Jianzhong; Yang, Ling
2018-01-01
Glutaredoxins (GRXs) belong to the antioxidants involved in the cellular stress responses. In spite of the identification 48 GRX genes in rice genomes, the biological functions of most of them remain unknown. Especially, the biological roles of members of GRX family in disease resistance are still lacking. Our proteomic analysis found that OsGRX20 increased by 2.7-fold after infection by bacterial blight. In this study, we isolated and characterized the full-length nucleotide sequences of the rice OsGRX20 gene, which encodes a GRX family protein with CPFC active site of CPYC-type class. OsGRX20 protein was localized in nucleus and cytosol, and its transcripts were expressed predominantly in leaves. Several stress- and hormone-related motifs putatively acting as regulatory elements were found in the OsGRX20 promoter. Real-time quantitative PCR analysis indicated that OsGRX20 was expressed at a significantly higher level in leaves of a resistant or tolerant rice genotype, Yongjing 50A, than in a sensitive genotype, Xiushui 11, exposed to bacterial blight, methyl viologen, heat, and cold. Its expression could be induced by salt, PEG-6000, 2,4-D, salicylic acid, jasmonic acid, and abscisic acid treatments in Yongjing 50A. Overexpression of OsGRX20 in rice Xiushui 11 significantly enhanced its resistance to bacterial blight attack, and tolerance to methyl viologen and salt stresses. In contrast, interference of OsGRX20 in Yongjing 50A led to increased susceptibility to bacterial blight, methyl viologen and salt stresses. OsGRX20 restrained accumulation of superoxide radicals in aerial tissue during methyl viologen treatment. Consistently, alterations in OsGRX20 expression affect the ascorbate/dehydroascorbate ratio and the abundance of transcripts encoding four reactive oxygen species scavenging enzymes after methyl viologen-induced stress. Our results demonstrate that OsGRX20 functioned as a positive regulator in rice tolerance to multiple stresses, which may be of
Reid, S D; Green, N M; Buss, J K; Lei, B; Musser, J M
2001-06-19
Species of pathogenic microbes are composed of an array of evolutionarily distinct chromosomal genotypes characterized by diversity in gene content and sequence (allelic variation). The occurrence of substantial genetic diversity has hindered progress in developing a comprehensive understanding of the molecular basis of virulence and new therapeutics such as vaccines. To provide new information that bears on these issues, 11 genes encoding extracellular proteins in the human bacterial pathogen group A Streptococcus identified by analysis of four genomes were studied. Eight of the 11 genes encode proteins with a LPXTG(L) motif that covalently links Gram-positive virulence factors to the bacterial cell surface. Sequence analysis of the 11 genes in 37 geographically and phylogenetically diverse group A Streptococcus strains cultured from patients with different infection types found that recent horizontal gene transfer has contributed substantially to chromosomal diversity. Regions of the inferred proteins likely to interact with the host were identified by molecular population genetic analysis, and Western immunoblot analysis with sera from infected patients confirmed that they were antigenic. Real-time reverse transcriptase-PCR (TaqMan) assays found that transcription of six of the 11 genes was substantially up-regulated in the stationary phase. In addition, transcription of many genes was influenced by the covR and mga trans-acting gene regulatory loci. Multilocus investigation of putative virulence genes by the integrated approach described herein provides an important strategy to aid microbial pathogenesis research and rapidly identify new targets for therapeutics research.
Feld, Louise; Hjelmsø, Mathis Hjort; Nielsen, Morten Schostag; Jacobsen, Anne Dorthe; Rønn, Regin; Ekelund, Flemming; Krogh, Paul Henning; Strobel, Bjarne Westergaard; Jacobsen, Carsten Suhr
2015-01-01
Background and Methods Assessing the effects of pesticide hazards on microbiological processes in the soil is currently based on analyses that provide limited insight into the ongoing processes. This study proposes a more comprehensive approach. The side effects of pesticides may appear as changes in the expression of specific microbial genes or as changes in diversity. To assess the impact of pesticides on gene expression, we focused on the amoA gene, which is involved in ammonia oxidation. We prepared soil microcosms and exposed them to dazomet, mancozeb or no pesticide. We hypothesized that the amount of amoA transcript decreases upon pesticide application, and to test this hypothesis, we used reverse-transcription qPCR. We also hypothesized that bacterial diversity is affected by pesticides. This hypothesis was investigated via 454 sequencing and diversity analysis of the 16S ribosomal RNA and RNA genes, representing the active and total soil bacterial communities, respectively. Results and Conclusion Treatment with dazomet reduced both the bacterial and archaeal amoA transcript numbers by more than two log units and produced long-term effects for more than 28 days. Mancozeb also inhibited the numbers of amoA transcripts, but only transiently. The bacterial and archaeal amoA transcripts were both sensitive bioindicators of pesticide side effects. Additionally, the numbers of bacterial amoA transcripts correlated with nitrate production in N-amended microcosms. Dazomet reduced the total bacterial numbers by one log unit, but the population size was restored after twelve days. The diversity of the active soil bacteria also seemed to be re-established after twelve days. However, the total bacterial diversity as reflected in the 16S ribosomal RNA gene sequences was largely dominated by Firmicutes and Proteobacteria at day twelve, likely reflecting a halt in the growth of early opportunists and the re-establishment of a more diverse population. We observed no
Land use type significantly affects microbial gene transcription in soil.
Nacke, Heiko; Fischer, Christiane; Thürmer, Andrea; Meinicke, Peter; Daniel, Rolf
2014-05-01
Soil microorganisms play an essential role in sustaining biogeochemical processes and cycling of nutrients across different land use types. To gain insights into microbial gene transcription in forest and grassland soil, we isolated mRNA from 32 sampling sites. After sequencing of generated complementary DNA (cDNA), a total of 5,824,229 sequences could be further analyzed. We were able to assign nonribosomal cDNA sequences to all three domains of life. A dominance of bacterial sequences, which were affiliated to 25 different phyla, was found. Bacterial groups capable of aromatic compound degradation such as Phenylobacterium and Burkholderia were detected in significantly higher relative abundance in forest soil than in grassland soil. Accordingly, KEGG pathway categories related to degradation of aromatic ring-containing molecules (e.g., benzoate degradation) were identified in high abundance within forest soil-derived metatranscriptomic datasets. The impact of land use type forest on community composition and activity is evidently to a high degree caused by the presence of wood breakdown products. Correspondingly, bacterial groups known to be involved in lignin degradation and containing ligninolytic genes such as Burkholderia, Bradyrhizobium, and Azospirillum exhibited increased transcriptional activity in forest soil. Higher solar radiation in grassland presumably induced increased transcription of photosynthesis-related genes within this land use type. This is in accordance with high abundance of photosynthetic organisms and plant-infecting viruses in grassland.
Transcriptional regulation of hepatic lipogenesis.
Wang, Yuhui; Viscarra, Jose; Kim, Sun-Joong; Sul, Hei Sook
2015-11-01
Fatty acid and fat synthesis in the liver is a highly regulated metabolic pathway that is important for very low-density lipoprotein (VLDL) production and thus energy distribution to other tissues. Having common features at their promoter regions, lipogenic genes are coordinately regulated at the transcriptional level. Transcription factors, such as upstream stimulatory factors (USFs), sterol regulatory element-binding protein 1C (SREBP1C), liver X receptors (LXRs) and carbohydrate-responsive element-binding protein (ChREBP) have crucial roles in this process. Recently, insights have been gained into the signalling pathways that regulate these transcription factors. After feeding, high blood glucose and insulin levels activate lipogenic genes through several pathways, including the DNA-dependent protein kinase (DNA-PK), atypical protein kinase C (aPKC) and AKT-mTOR pathways. These pathways control the post-translational modifications of transcription factors and co-regulators, such as phosphorylation, acetylation or ubiquitylation, that affect their function, stability and/or localization. Dysregulation of lipogenesis can contribute to hepatosteatosis, which is associated with obesity and insulin resistance.
Reconstructing directed gene regulatory network by only gene expression data.
Zhang, Lu; Feng, Xi Kang; Ng, Yen Kaow; Li, Shuai Cheng
2016-08-18
Accurately identifying gene regulatory network is an important task in understanding in vivo biological activities. The inference of such networks is often accomplished through the use of gene expression data. Many methods have been developed to evaluate gene expression dependencies between transcription factor and its target genes, and some methods also eliminate transitive interactions. The regulatory (or edge) direction is undetermined if the target gene is also a transcription factor. Some methods predict the regulatory directions in the gene regulatory networks by locating the eQTL single nucleotide polymorphism, or by observing the gene expression changes when knocking out/down the candidate transcript factors; regrettably, these additional data are usually unavailable, especially for the samples deriving from human tissues. In this study, we propose the Context Based Dependency Network (CBDN), a method that is able to infer gene regulatory networks with the regulatory directions from gene expression data only. To determine the regulatory direction, CBDN computes the influence of source to target by evaluating the magnitude changes of expression dependencies between the target gene and the others with conditioning on the source gene. CBDN extends the data processing inequality by involving the dependency direction to distinguish between direct and transitive relationship between genes. We also define two types of important regulators which can influence a majority of the genes in the network directly or indirectly. CBDN can detect both of these two types of important regulators by averaging the influence functions of candidate regulator to the other genes. In our experiments with simulated and real data, even with the regulatory direction taken into account, CBDN outperforms the state-of-the-art approaches for inferring gene regulatory network. CBDN identifies the important regulators in the predicted network: 1. TYROBP influences a batch of genes that are
Noda, Masafumi; Miyauchi, Rumi; Danshiitsoodol, Narandalai; Matoba, Yasuyuki; Kumagai, Takanori; Sugiyama, Masanori
2018-04-01
We have previously shown that the lactic acid bacterium Lactobacillus brevis 174A, isolated from Citrus iyo fruit, produces a bacteriocin designated brevicin 174A, which is comprised of two antibacterial polypeptides (designated brevicins 174A-β and 174A-γ). We have also found a gene cluster, composed of eight open reading frames (ORFs), that contains genes for the biosynthesis of brevicin 174A, self-resistance to its own bacteriocin, and two transcriptional regulatory proteins. Some lactic acid bacterial strains have a system to start the production of bacteriocin at an adequate stage of growth. Generally, the system consists of a membrane-bound histidine protein kinase (HPK) that senses a specific environmental stimulus and a corresponding response regulator (RR) that mediates the cellular response. We have previously shown that although the HPK- and RR-encoding genes are not found on the brevicin 174A biosynthetic gene cluster in the 174A strain, two putative regulatory genes, designated breD and breG , are in the gene cluster. In the present study, we demonstrate that the expression of brevicin 174A production and self-resistance is positively controlled by two transcriptional regulatory proteins, designated BreD and BreG. BreD is expressed together with BreE as the self-resistance determinant of L. brevis 174A. DNase I footprinting analysis and a promoter assay demonstrated that BreD binds to the breED promoter as a positive autoregulator. The present study also demonstrates that BreG, carrying a transmembrane domain, binds to the common promoter of breB and breC , encoding brevicins 174A-β and 174A-γ, respectively, for positive regulation. IMPORTANCE The problem of the appearance of bacteria that are resistant to practical antibiotics and the increasing demand for safe foods have increased interest in replacing conventional antibiotics with bacteriocin produced by the lactic acid bacteria. This antibacterial substance can inhibit the growth of pathogenic
Lo Scrudato, Mirella; Blokesch, Melanie
2013-01-01
The human pathogen Vibrio cholerae is an aquatic bacterium associated with zooplankton and their chitinous exoskeletons. On chitinous surfaces, V. cholerae initiates a developmental programme, known as natural competence, to mediate transformation, which is a mode of horizontal gene transfer. Competence facilitates the uptake of free DNA and recombination into the bacterial genome. Recent studies have indicated that chitin surfaces are required, but not sufficient to induce competence. Two additional regulatory pathways, i.e. catabolite repression and quorum sensing (QS), are components of the regulatory network that controls natural competence in V. cholerae. In this study, we investigated the link between chitin induction and QS. We show that the major regulators of these two pathways, TfoX and HapR, are both involved in the activation of a gene encoding a transcriptional regulator of the LuxR-type family, which we named QS and TfoX-dependent regulator (QstR). We demonstrate that HapR binds the promoter of qstR in a site-specific manner, indicating a role for HapR as an activator of qstR. In addition, epistasis experiments indicate that QstR compensates for the absence of HapR. We also provide evidence that QstR is required for the proper expression of a small but essential subset of competence genes and propose a new regulatory model in which QstR links chitin-induced TfoX activity with QS. PMID:23382174
A gene regulatory network armature for T-lymphocyte specification
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fung, Elizabeth-sharon
Choice of a T-lymphoid fate by hematopoietic progenitor cells depends on sustained Notch-Delta signaling combined with tightly-regulated activities of multiple transcription factors. To dissect the regulatory network connections that mediate this process, we have used high-resolution analysis of regulatory gene expression trajectories from the beginning to the end of specification; tests of the short-term Notchdependence of these gene expression changes; and perturbation analyses of the effects of overexpression of two essential transcription factors, namely PU.l and GATA-3. Quantitative expression measurements of >50 transcription factor and marker genes have been used to derive the principal components of regulatory change through whichmore » T-cell precursors progress from primitive multipotency to T-lineage commitment. Distinct parts of the path reveal separate contributions of Notch signaling, GATA-3 activity, and downregulation of PU.l. Using BioTapestry, the results have been assembled into a draft gene regulatory network for the specification of T-cell precursors and the choice of T as opposed to myeloid dendritic or mast-cell fates. This network also accommodates effects of E proteins and mutual repression circuits of Gfil against Egr-2 and of TCF-l against PU.l as proposed elsewhere, but requires additional functions that remain unidentified. Distinctive features of this network structure include the intense dose-dependence of GATA-3 effects; the gene-specific modulation of PU.l activity based on Notch activity; the lack of direct opposition between PU.l and GATA-3; and the need for a distinct, late-acting repressive function or functions to extinguish stem and progenitor-derived regulatory gene expression.« less
Monteiro, Pedro Tiago; Pais, Pedro; Costa, Catarina; Manna, Sauvagya; Sá-Correia, Isabel; Teixeira, Miguel Cacho
2017-01-04
We present the PATHOgenic YEAst Search for Transcriptional Regulators And Consensus Tracking (PathoYeastract - http://pathoyeastract.org) database, a tool for the analysis and prediction of transcription regulatory associations at the gene and genomic levels in the pathogenic yeasts Candida albicans and C. glabrata Upon data retrieval from hundreds of publications, followed by curation, the database currently includes 28 000 unique documented regulatory associations between transcription factors (TF) and target genes and 107 DNA binding sites, considering 134 TFs in both species. Following the structure used for the YEASTRACT database, PathoYeastract makes available bioinformatics tools that enable the user to exploit the existing information to predict the TFs involved in the regulation of a gene or genome-wide transcriptional response, while ranking those TFs in order of their relative importance. Each search can be filtered based on the selection of specific environmental conditions, experimental evidence or positive/negative regulatory effect. Promoter analysis tools and interactive visualization tools for the representation of TF regulatory networks are also provided. The PathoYeastract database further provides simple tools for the prediction of gene and genomic regulation based on orthologous regulatory associations described for other yeast species, a comparative genomics setup for the study of cross-species evolution of regulatory networks. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
10 CFR 2.327 - Official recording; transcript.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 10 Energy 1 2014-01-01 2014-01-01 false Official recording; transcript. 2.327 Section 2.327 Energy NUCLEAR REGULATORY COMMISSION AGENCY RULES OF PRACTICE AND PROCEDURE Rules of General Applicability... Procedures, Presiding Officer Powers, and General Hearing Management for NRC Adjudicatory Hearings § 2.327...
10 CFR 2.327 - Official recording; transcript.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 10 Energy 1 2010-01-01 2010-01-01 false Official recording; transcript. 2.327 Section 2.327 Energy NUCLEAR REGULATORY COMMISSION RULES OF PRACTICE FOR DOMESTIC LICENSING PROCEEDINGS AND ISSUANCE OF ORDERS..., Selection of Specific Hearing Procedures, Presiding Officer Powers, and General Hearing Management for NRC...
A novel E2 box-GATA element modulates Cdc6 transcription during human cells polyploidization
Vilaboa, Nuria; Bermejo, Rodrigo; Martinez, Pilar; Bornstein, Rafael; Calés, Carmela
2004-01-01
Cdc6 is a key regulator of the strict alternation of S and M phases during the mitotic cell cycle. In mammalian and plant cells that physiologically become polyploid, cdc6 is transcriptionally and post-translationally regulated. We have recently reported that Cdc6 levels are maintained in megakaryoblastic HEL cells, but severely downregulated by ectopic expression of transcriptional repressor Drosophila melanogaster escargot. Here, we show that cdc6 promoter activity is upregulated during megakaryocytic differentiation of HEL endoreplicating cells, and that Escargot interferes with such activation. Transactivation experiments showed that a 1.7 kb region located at 2800 upstream cdc6 transcription initiation site behaved as a potent enhancer in endoreplicating cells only. This activity was mainly dependent on a novel cis-regulatory element composed by an E2 box overlapping a GATA motif. Ectopic Escargot could bind this regulatory element in vitro and endogenous GATA-1 and E2A formed specific complexes in megakaryoblastic cells as well as in primary megakaryocytes. Chromatin Immunoprecipitation analysis revealed that both transcription factors were occupying the E2 box/GATA site in vivo. Altogether, these data suggest that cdc6 expression could be actively maintained during megakaryocytic differentiation through transcriptional mechanisms involving specific cis- and trans-regulatory elements. PMID:15590906
The physical size of transcription factors is key to transcriptional regulation in chromatin domains
NASA Astrophysics Data System (ADS)
Maeshima, Kazuhiro; Kaizu, Kazunari; Tamura, Sachiko; Nozaki, Tadasu; Kokubo, Tetsuro; Takahashi, Koichi
2015-02-01
Genetic information, which is stored in the long strand of genomic DNA as chromatin, must be scanned and read out by various transcription factors. First, gene-specific transcription factors, which are relatively small (˜50 kDa), scan the genome and bind regulatory elements. Such factors then recruit general transcription factors, Mediators, RNA polymerases, nucleosome remodellers, and histone modifiers, most of which are large protein complexes of 1-3 MDa in size. Here, we propose a new model for the functional significance of the size of transcription factors (or complexes) for gene regulation of chromatin domains. Recent findings suggest that chromatin consists of irregularly folded nucleosome fibres (10 nm fibres) and forms numerous condensed domains (e.g., topologically associating domains). Although the flexibility and dynamics of chromatin allow repositioning of genes within the condensed domains, the size exclusion effect of the domain may limit accessibility of DNA sequences by transcription factors. We used Monte Carlo computer simulations to determine the physical size limit of transcription factors that can enter condensed chromatin domains. Small gene-specific transcription factors can penetrate into the chromatin domains and search their target sequences, whereas large transcription complexes cannot enter the domain. Due to this property, once a large complex binds its target site via gene-specific factors it can act as a ‘buoy’ to keep the target region on the surface of the condensed domain and maintain transcriptional competency. This size-dependent specialization of target-scanning and surface-tethering functions could provide novel insight into the mechanisms of various DNA transactions, such as DNA replication and repair/recombination.
Zang, Hongyan; Li, Ning; Pan, Yuling; Hao, Jingguang
2017-03-01
Breast cancer is a common malignancy among women with a rising incidence. Our intention was to detect transcription factors (TFs) for deeper understanding of the underlying mechanisms of breast cancer. Integrated analysis of gene expression datasets of breast cancer was performed. Then, functional annotation of differentially expressed genes (DEGs) was conducted, including Gene Ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment. Furthermore, TFs were identified and a global transcriptional regulatory network was constructed. Seven publically available GEO datasets were obtained, and a set of 1196 DEGs were identified (460 up-regulated and 736 down-regulated). Functional annotation results showed that cell cycle was the most significantly enriched pathway, which was consistent with the fact that cell cycle is closely related to various tumors. Fifty-three differentially expressed TFs were identified, and the regulatory networks consisted of 817 TF-target interactions between 46 TFs and 602 DEGs in the context of breast cancer. Top 10 TFs covering the most downstream DEGs were SOX10, NFATC2, ZNF354C, ARID3A, BRCA1, FOXO3, GATA3, ZEB1, HOXA5 and EGR1. The transcriptional regulatory networks could enable a better understanding of regulatory mechanisms of breast cancer pathology and provide an opportunity for the development of potential therapy.
Bacterial interactions in dental biofilm development.
Hojo, K; Nagaoka, S; Ohshima, T; Maeda, N
2009-11-01
Recent analyses with ribosomal RNA-based technologies have revealed the diversity of bacterial populations within dental biofilms, and have highlighted their important contributions to oral health and disease. Dental biofilms are exceedingly complex and multispecies ecosystems, where oral bacteria interact cooperatively or competitively with other members. Bacterial interactions that influence dental biofilm communities include various different mechanisms. During the early stage of biofilm formation, it is known that planktonic bacterial cells directly attach to surfaces of the oral cavity or indirectly bind to other bacterial cells that have already colonized. Adherence through co-aggregation may be critical for the temporary retention of bacteria on dental surfaces, and may facilitate eventual bacterial colonization. It is likely that metabolic communication, genetic exchange, production of inhibitory factors (e.g., bacteriocins, hydrogen peroxide, etc.), and quorum-sensing are pivotal regulatory factors that determine the bacterial composition and/or metabolism. Since each bacterium can easily access a neighboring bacterial cell and its metabolites, genetic exchanges and metabolic communication may occur frequently in dental biofilms. Quorum-sensing is defined as gene regulation in response to cell density, which influences various functions, e.g., virulence and bacteriocin production. In this review, we discuss these important interactions among oral bacteria within the dental biofilm communities.
Purification and characterization of human mitochondrial transcription factor 1.
Fisher, R P; Clayton, D A
1988-01-01
We purified to near homogeneity a transcription factor from human KB cell mitochondria. This factor, designated mitochondrial transcription factor 1 (mtTF1), is required for the in vitro recognition of both major promoters of human mitochondrial DNA by the homologous mitochondrial RNA polymerase. Furthermore, it has been shown to bind upstream regulatory elements of the two major promoters. After separation from RNA polymerase by phosphocellulose chromatography, mtTF1 was chromatographed on a MonoQ anion-exchange fast-performance liquid chromatography column. Analysis of mtTF1-containing fractions by sodium dodecyl sulfate-polyacrylamide gel electrophoresis revealed a single major polypeptide with an Mr of approximately 25,000. Centrifugation in analytical glycerol gradients indicated a sedimentation coefficient of approximately 2.5 S, consistent with a monomeric 25-kilodalton protein. Finally, when the 25-kilodalton polypeptide was excised from a stained sodium dodecyl sulfate-polyacrylamide gel and allowed to renature, it regained DNA-binding and transcriptional stimulatory activities at both promoters. Although mtTF1 is the only mitochondrial DNA-binding transcription factor to be purified and characterized, its properties, such as a high affinity for random DNA and a weak specificity for one of its target sequences, may typify this class of regulatory proteins. Images PMID:3211148
Vazquez-Anderson, Jorge; Contreras, Lydia M
2013-01-01
RNAs have many important functional properties, including that they are independently controllable and highly tunable. As a result of these advantageous properties, their use in a myriad of sophisticated devices has been widely explored. Yet, the exploitation of RNAs for synthetic applications is highly dependent on the ability to characterize the many new molecules that continue to be discovered by large-scale sequencing and high-throughput screening techniques. In this review, we present an exhaustive survey of the most recent synthetic bacterial riboswitches and small RNAs while emphasizing their virtues in gene expression management. We also explore the use of these RNA components as building blocks in the RNA synthetic biology toolbox and discuss examples of synthetic RNA components used to rewire bacterial regulatory circuitry. We anticipate that this field will expand its catalog of smart devices by mimicking and manipulating natural RNA mechanisms and functions. PMID:24356572
Regulatory networks between neurotrophins and miRNAs in brain diseases and cancers
Shi, Jian
2015-01-01
Neurotrophins are involved in many physiological and pathological processes in the nervous system. They regulate and modify signal transduction, transcription and translation in neurons. It is recently demonstrated that the neurotrophin expression is regulated by microRNAs (miRNAs), changing our views on neurotrophins and miRNAs. Generally, miRNAs regulate neurotrophins and their receptors in at least two ways: (1) miRNAs bind directly to the 3′ untranslated region (UTR) of isoform-specific mRNAs and post-transcriptionally regulate their expression; (2) miRNAs bind to the 3′ UTR of the regulatory factors of neurotrophins and regulate their expression. On the other hand, neurotrophins can regulate miRNAs. The results of BNDF research show that neurotrophins regulate miRNAs in at least three ways: (1) ERK stimulation enhances the activation of TRBP (HIV-1 TAR RNA-binding protein) and Dicer, leading to the upregulation of miRNA biogenesis; (2) ERK-dependent upregulation of Lin28a (RNA-binding proteins) blocks select miRNA biogenesis; (3) transcriptional regulation of miRNA expression through activation of transcription factors, including CREB and NF-κB. These regulatory processes integrate positive and negative regulatory loops in neurotrophin and miRNA signaling pathways, and also expand the function of neurotrophins and miRNAs. In this review, we summarize the current knowledge of the regulatory networks between neurotrophins and miRNAs in brain diseases and cancers, for which novel cutting edge therapeutic, delivery and diagnostic approaches are emerging. PMID:25544363
Löffler, Michael; Simen, Joana Danica; Müller, Jan; Jäger, Günter; Laghrami, Salaheddine; Schäferhoff, Karin; Freund, Andreas; Takors, Ralf
2017-09-20
Transcriptional control under nitrogen and carbon-limitation conditions have been well analyzed for Escherichia coli. However, the transcriptional dynamics that underlie the shift in regulatory programs from nitrogen to carbon limitation is not well studied. In the present study, cells were cultivated at steady state under nitrogen (ammonia)-limited conditions then shifted to carbon (glucose) limitation to monitor changes in transcriptional dynamics. Nitrogen limitation was found to be dominated by sigma 54 (RpoN) and sigma 38 (RpoS), whereas the "housekeeping" sigma factor 70 (RpoD) and sigma 38 regulate cellular status under glucose limitation. During the transition, nitrogen-mediated control was rapidly redeemed and mRNAs that encode active uptake systems, such as ptsG and manXYZ, were quickly amplified. Next, genes encoding facilitators such as lamB were overexpressed, followed by high affinity uptake systems such as mglABC and non-specific porins such as ompF. These regulatory programs are complex and require well-equilibrated and superior control. At the metabolome level, 2-oxoglutarate is the likely component that links carbon- and nitrogen-mediated regulation by interacting with major regulatory elements. In the case of dual glucose and ammonia limitation, sigma 24 (RpoE) appears to play a key role in orchestrating these complex regulatory networks. Copyright © 2017 Elsevier B.V. All rights reserved.
Nascent-Seq reveals novel features of mouse circadian transcriptional regulation
Menet, Jerome S; Rodriguez, Joseph; Abruzzi, Katharine C; Rosbash, Michael
2012-01-01
A substantial fraction of the metazoan transcriptome undergoes circadian oscillations in many cells and tissues. Based on the transcription feedback loops important for circadian timekeeping, it is commonly assumed that this mRNA cycling reflects widespread transcriptional regulation. To address this issue, we directly measured the circadian dynamics of mouse liver transcription using Nascent-Seq (genome-wide sequencing of nascent RNA). Although many genes are rhythmically transcribed, many rhythmic mRNAs manifest poor transcriptional rhythms, indicating a prominent contribution of post-transcriptional regulation to circadian mRNA expression. This analysis of rhythmic transcription also showed that the rhythmic DNA binding profile of the transcription factors CLOCK and BMAL1 does not determine the transcriptional phase of most target genes. This likely reflects gene-specific collaborations of CLK:BMAL1 with other transcription factors. These insights from Nascent-Seq indicate that it should have broad applicability to many other gene expression regulatory issues. DOI: http://dx.doi.org/10.7554/eLife.00011.001 PMID:23150795
Gene Regulation, Two Component Regulatory Systems, and Adaptive Responses in Treponema Denticola.
Marconi, Richard T
2017-10-13
The oral microbiome consists of a remarkably diverse group of 500-700 bacterial species. The microbial etiology of periodontal disease is similarly complex. Of the ~400 bacterial species identified in subgingival plaque, at least 50 belong to the genus Treponema. As periodontal disease develops and progresses, T. denticola transitions from a low to high abundance species in the subgingival crevice. Changes in the overall composition of the bacterial population trigger significant changes in the local physical, immunological and physiochemical conditions. For T. denticola to thrive in periodontal pockets, it must be nimble and adapt to rapidly changing environmental conditions. The purpose of this chapter is to review the current understanding of the molecular basis of these essential adaptive responses, with a focus on the role of two component regulatory systems with global regulatory potential.
Post-transcriptional Mechanisms Contribute Little to Phenotypic Variation in Snake Venoms.
Rokyta, Darin R; Margres, Mark J; Calvin, Kate
2015-09-09
Protein expression is a major link in the genotype-phenotype relationship, and processes affecting protein abundances, such as rates of transcription and translation, could contribute to phenotypic evolution if they generate heritable variation. Recent work has suggested that mRNA abundances do not accurately predict final protein abundances, which would imply that post-transcriptional regulatory processes contribute significantly to phenotypes. Post-transcriptional processes also appear to buffer changes in transcriptional patterns as species diverge, suggesting that the transcriptional changes have little or no effect on the phenotypes undergoing study. We tested for concordance between mRNA and protein expression levels in snake venoms by means of mRNA-seq and quantitative mass spectrometry for 11 snakes representing 10 species, six genera, and three families. In contrast to most previous work, we found high correlations between venom gland transcriptomes and venom proteomes for 10 of our 11 comparisons. We tested for protein-level buffering of transcriptional changes during species divergence by comparing the difference between transcript abundance and protein abundance for three pairs of species and one intraspecific pair. We found no evidence for buffering during divergence of our three species pairs but did find evidence for protein-level buffering for our single intraspecific comparison, suggesting that buffering, if present, was a transient phenomenon in venom divergence. Our results demonstrated that post-transcriptional mechanisms did not contribute significantly to phenotypic evolution in venoms and suggest a more prominent and direct role for cis-regulatory evolution in phenotypic variation, particularly for snake venoms. Copyright © 2015 Rokyta et al.
Fakhry, Carl Tony; Kulkarni, Prajna; Chen, Ping; Kulkarni, Rahul; Zarringhalam, Kourosh
2017-08-22
Small RNAs (sRNAs) constitute an important class of post-transcriptional regulators that control critical cellular processes in bacteria. Recent research using high-throughput transcriptomic approaches has led to a dramatic increase in the discovery of bacterial sRNAs. However, it is generally believed that the currently identified sRNAs constitute a limited subset of the bacterial sRNA repertoire. In several cases, sRNAs belonging to a specific class are already known and the challenge is to identify additional sRNAs belonging to the same class. In such cases, machine-learning approaches can be used to predict novel sRNAs in a given class. In this work, we develop novel bioinformatics approaches that integrate sequence and structure-based features to train machine-learning models for the discovery of bacterial sRNAs. We show that features derived from recurrent structural motifs in the ensemble of low energy secondary structures can distinguish the RNA classes with high accuracy. We apply this approach to predict new members in two broad classes of bacterial small RNAs: 1) sRNAs that bind to the RNA-binding protein RsmA/CsrA in diverse bacterial species and 2) sRNAs regulated by the master regulator of virulence, ToxT, in Vibrio cholerae. The involvement of sRNAs in bacterial adaptation to changing environments is an increasingly recurring theme in current research in microbiology. It is likely that future research, combining experimental and computational approaches, will discover many more examples of sRNAs as components of critical regulatory pathways in bacteria. We have developed a novel approach for prediction of small RNA regulators in important bacterial pathways. This approach can be applied to specific classes of sRNAs for which several members have been identified and the challenge is to identify additional sRNAs.
Enhancer scanning to locate regulatory regions in genomic loci
Buckley, Melissa; Gjyshi, Anxhela; Mendoza-Fandiño, Gustavo; Baskin, Rebekah; Carvalho, Renato S.; Carvalho, Marcelo A.; Woods, Nicholas T.; Monteiro, Alvaro N.A.
2016-01-01
The present protocol provides a rapid, streamlined and scalable strategy to systematically scan genomic regions for the presence of transcriptional regulatory regions active in a specific cell type. It creates genomic tiles spanning a region of interest that are subsequently cloned by recombination into a luciferase reporter vector containing the Simian Virus 40 promoter. Tiling clones are transfected into specific cell types to test for the presence of transcriptional regulatory regions. The protocol includes testing of different SNP (single nucleotide polymorphism) alleles to determine their effect on regulatory activity. This procedure provides a systematic framework to identify candidate functional SNPs within a locus during functional analysis of genome-wide association studies. This protocol adapts and combines previous well-established molecular biology methods to provide a streamlined strategy, based on automated primer design and recombinational cloning to rapidly go from a genomic locus to a set of candidate functional SNPs in eight weeks. PMID:26658467
Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E
1998-06-01
Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.
Disentangling the many layers of eukaryotic transcriptional regulation.
Lelli, Katherine M; Slattery, Matthew; Mann, Richard S
2012-01-01
Regulation of gene expression in eukaryotes is an extremely complex process. In this review, we break down several critical steps, emphasizing new data and techniques that have expanded current gene regulatory models. We begin at the level of DNA sequence where cis-regulatory modules (CRMs) provide important regulatory information in the form of transcription factor (TF) binding sites. In this respect, CRMs function as instructional platforms for the assembly of gene regulatory complexes. We discuss multiple mechanisms controlling complex assembly, including cooperative DNA binding, combinatorial codes, and CRM architecture. The second section of this review places CRM assembly in the context of nucleosomes and condensed chromatin. We discuss how DNA accessibility and histone modifications contribute to TF function. Lastly, new advances in chromosomal mapping techniques have provided increased understanding of intra- and interchromosomal interactions. We discuss how these topological maps influence gene regulatory models.
Nicolas, Pierre; Repoila, Francis; Bardowski, Jacek; Aymerich, Stéphane
2017-01-01
In eukaryotes, RNA species originating from pervasive transcription are regulators of various cellular processes, from the expression of individual genes to the control of cellular development and oncogenesis. In prokaryotes, the function of pervasive transcription and its output on cell physiology is still unknown. Most bacteria possess termination factor Rho, which represses pervasive, mostly antisense, transcription. Here, we investigate the biological significance of Rho-controlled transcription in the Gram-positive model bacterium Bacillus subtilis. Rho inactivation strongly affected gene expression in B. subtilis, as assessed by transcriptome and proteome analysis of a rho–null mutant during exponential growth in rich medium. Subsequent physiological analyses demonstrated that a considerable part of Rho-controlled transcription is connected to balanced regulation of three mutually exclusive differentiation programs: cell motility, biofilm formation, and sporulation. In the absence of Rho, several up-regulated sense and antisense transcripts affect key structural and regulatory elements of these differentiation programs, thereby suppressing motility and biofilm formation and stimulating sporulation. We dissected how Rho is involved in the activity of the cell fate decision-making network, centered on the master regulator Spo0A. We also revealed a novel regulatory mechanism of Spo0A activation through Rho-dependent intragenic transcription termination of the protein kinase kinB gene. Altogether, our findings indicate that distinct Rho-controlled transcripts are functional and constitute a previously unknown built-in module for the control of cell differentiation in B. subtilis. In a broader context, our results highlight the recruitment of the termination factor Rho, for which the conserved biological role is probably to repress pervasive transcription, in highly integrated, bacterium-specific, regulatory networks. PMID:28723971
Brucella BioR regulator defines a complex regulatory mechanism for bacterial biotin metabolism.
Feng, Youjun; Xu, Jie; Zhang, Huimin; Chen, Zeliang; Srinivas, Swaminath
2013-08-01
The enzyme cofactor biotin (vitamin H or B7) is an energetically expensive molecule whose de novo biosynthesis requires 20 ATP equivalents. It seems quite likely that diverse mechanisms have evolved to tightly regulate its biosynthesis. Unlike the model regulator BirA, a bifunctional biotin protein ligase with the capability of repressing the biotin biosynthetic pathway, BioR has been recently reported by us as an alternative machinery and a new type of GntR family transcriptional factor that can repress the expression of the bioBFDAZ operon in the plant pathogen Agrobacterium tumefaciens. However, quite unusually, a closely related human pathogen, Brucella melitensis, has four putative BioR-binding sites (both bioR and bioY possess one site in the promoter region, whereas the bioBFDAZ [bio] operon contains two tandem BioR boxes). This raised the question of whether BioR mediates the complex regulatory network of biotin metabolism. Here, we report that this is the case. The B. melitensis BioR ortholog was overexpressed and purified to homogeneity, and its solution structure was found to be dimeric. Functional complementation in a bioR isogenic mutant of A. tumefaciens elucidated that Brucella BioR is a functional repressor. Electrophoretic mobility shift assays demonstrated that the four predicted BioR sites of Brucella plus the BioR site of A. tumefaciens can all interact with the Brucella BioR protein. In a reporter strain that we developed on the basis of a double mutant of A. tumefaciens (the ΔbioR ΔbioBFDA mutant), the β-galactosidase (β-Gal) activity of three plasmid-borne transcriptional fusions (bioBbme-lacZ, bioYbme-lacZ, and bioRbme-lacZ) was dramatically decreased upon overexpression of Brucella bioR. Real-time quantitative PCR analyses showed that the expression of bioBFDA and bioY is significantly elevated upon removal of bioR from B. melitensis. Together, we conclude that Brucella BioR is not only a negative autoregulator but also a repressor of
Brucella BioR Regulator Defines a Complex Regulatory Mechanism for Bacterial Biotin Metabolism
Xu, Jie; Zhang, Huimin; Srinivas, Swaminath
2013-01-01
The enzyme cofactor biotin (vitamin H or B7) is an energetically expensive molecule whose de novo biosynthesis requires 20 ATP equivalents. It seems quite likely that diverse mechanisms have evolved to tightly regulate its biosynthesis. Unlike the model regulator BirA, a bifunctional biotin protein ligase with the capability of repressing the biotin biosynthetic pathway, BioR has been recently reported by us as an alternative machinery and a new type of GntR family transcriptional factor that can repress the expression of the bioBFDAZ operon in the plant pathogen Agrobacterium tumefaciens. However, quite unusually, a closely related human pathogen, Brucella melitensis, has four putative BioR-binding sites (both bioR and bioY possess one site in the promoter region, whereas the bioBFDAZ [bio] operon contains two tandem BioR boxes). This raised the question of whether BioR mediates the complex regulatory network of biotin metabolism. Here, we report that this is the case. The B. melitensis BioR ortholog was overexpressed and purified to homogeneity, and its solution structure was found to be dimeric. Functional complementation in a bioR isogenic mutant of A. tumefaciens elucidated that Brucella BioR is a functional repressor. Electrophoretic mobility shift assays demonstrated that the four predicted BioR sites of Brucella plus the BioR site of A. tumefaciens can all interact with the Brucella BioR protein. In a reporter strain that we developed on the basis of a double mutant of A. tumefaciens (the ΔbioR ΔbioBFDA mutant), the β-galactosidase (β-Gal) activity of three plasmid-borne transcriptional fusions (bioBbme-lacZ, bioYbme-lacZ, and bioRbme-lacZ) was dramatically decreased upon overexpression of Brucella bioR. Real-time quantitative PCR analyses showed that the expression of bioBFDA and bioY is significantly elevated upon removal of bioR from B. melitensis. Together, we conclude that Brucella BioR is not only a negative autoregulator but also a repressor of
Transcription through enhancers suppresses their activity in Drosophila
2013-01-01
Background Enhancer elements determine the level of target gene transcription in a tissue-specific manner, providing for individual patterns of gene expression in different cells. Knowledge of the mechanisms controlling enhancer action is crucial for understanding global regulation of transcription. In particular, enhancers are often localized within transcribed regions of the genome. A number of experiments suggest that transcription can have both positive and negative effects on regulatory elements. In this study, we performed direct tests for the effect of transcription on enhancer activity. Results Using a transgenic reporter system, we investigated the relationship between the presence of pass-through transcription and the activity of Drosophila enhancers controlling the expression of the white and yellow genes. The results show that transcription from different promoters affects the activity of enhancers, counteracting their ability to activate the target genes. As expected, the presence of a transcriptional terminator between the inhibiting promoter and the affected enhancer strongly reduces the suppression. Moreover, transcription leads to dislodging of the Zeste protein that is responsible for the enhancer-dependent regulation of the white gene, suggesting a 'transcription interference’ mechanism for this regulation. Conclusions Our findings suggest a role for pass-through transcription in negative regulation of enhancer activity. PMID:24279291
Lim, Chun Shen; Brown, Chris M
2016-09-01
Many viruses contain RNA elements that modulate splicing and/or promote nuclear export of their RNAs. The RNAs of the major human pathogen, hepatitis B virus (HBV) contain a large (~600 bases) composite cis-acting 'post-transcriptional regulatory element' (PRE). This element promotes expression from these naturally intronless transcripts. Indeed, the related woodchuck hepadnavirus PRE (WPRE) is used to enhance expression in gene therapy and other expression vectors. These PRE are likely to act through a combination of mechanisms, including promotion of RNA nuclear export. Functional components of both the HBV PRE and WPRE are 2 conserved RNA cis-acting stem-loop (SL) structures, SLα and SLβ. They are within the coding regions of polymerase (P) gene, and both P and X genes, respectively. Based on previous studies using mutagenesis and/or nuclear magnetic resonance (NMR), here we propose 2 covariance models for SLα and SLβ. The model for the 30-nucleotide SLα contains a G-bulge and a CNGG(U) apical loop of which the first and the fourth loop residues form a CG pair and the fifth loop residue is bulged out, as observed in the NMR structure. The model for the 23-nucleotide SLβ contains a 7-base-pair stem and a 9-nucleotide loop. Comparison of the models with other RNA structural elements, as well as similarity searches of human transcriptome and viral genomes demonstrate that SLα and SLβ are specific to HBV transcripts. However, they are well conserved among the hepadnaviruses of non-human primates, the woodchuck and ground squirrel.
Lim, Chun Shen; Brown, Chris M.
2016-01-01
ABSTRACT Many viruses contain RNA elements that modulate splicing and/or promote nuclear export of their RNAs. The RNAs of the major human pathogen, hepatitis B virus (HBV) contain a large (~600 bases) composite cis-acting 'post-transcriptional regulatory element' (PRE). This element promotes expression from these naturally intronless transcripts. Indeed, the related woodchuck hepadnavirus PRE (WPRE) is used to enhance expression in gene therapy and other expression vectors. These PRE are likely to act through a combination of mechanisms, including promotion of RNA nuclear export. Functional components of both the HBV PRE and WPRE are 2 conserved RNA cis-acting stem-loop (SL) structures, SLα and SLβ. They are within the coding regions of polymerase (P) gene, and both P and X genes, respectively. Based on previous studies using mutagenesis and/or nuclear magnetic resonance (NMR), here we propose 2 covariance models for SLα and SLβ. The model for the 30-nucleotide SLα contains a G-bulge and a CNGG(U) apical loop of which the first and the fourth loop residues form a CG pair and the fifth loop residue is bulged out, as observed in the NMR structure. The model for the 23-nucleotide SLβ contains a 7-base-pair stem and a 9-nucleotide loop. Comparison of the models with other RNA structural elements, as well as similarity searches of human transcriptome and viral genomes demonstrate that SLα and SLβ are specific to HBV transcripts. However, they are well conserved among the hepadnaviruses of non-human primates, the woodchuck and ground squirrel. PMID:27031749
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shrestha, Manisha; Xiao, Yi; Robinson, Howard
Pseudomonas aeruginosa employs a type three secretion system to facilitate infections in mammalian hosts. The operons encoding genes of structural components of the secretion machinery and associated virulence factors are all under the control of the AraC-type transcriptional activator protein, ExsA. ExsA belongs to a unique subfamily of AraC-proteins that is regulated through protein-protein contacts rather than small molecule ligands. Prior to infection, ExsA is inhibited through a direct interaction with the anti-activator ExsD. To activate ExsA upon host cell contact this interaction is disrupted by the anti-antiactivator protein ExsC. Here we report the crystal structure of the regulatory domainmore » of ExsA, which is known to mediate ExsA dimerization as well as ExsD binding. The crystal structure suggests two models for the ExsA dimer. Both models confirmed the previously shown involvement of helix α-3 in ExsA dimerization but one also suggest a role for helix α-2. These structural data are supported by the observation that a mutation in α-2 greatly diminished the ability of ExsA to activate transcription in vitro. Lastly, additional in vitro transcription studies revealed that a conserved pocket, used by AraC and the related ToxT protein for the binding of small molecule regulators, although present in ExsA is not involved in binding of ExsD.« less
Shrestha, Manisha; Xiao, Yi; Robinson, Howard; ...
2015-08-28
Pseudomonas aeruginosa employs a type three secretion system to facilitate infections in mammalian hosts. The operons encoding genes of structural components of the secretion machinery and associated virulence factors are all under the control of the AraC-type transcriptional activator protein, ExsA. ExsA belongs to a unique subfamily of AraC-proteins that is regulated through protein-protein contacts rather than small molecule ligands. Prior to infection, ExsA is inhibited through a direct interaction with the anti-activator ExsD. To activate ExsA upon host cell contact this interaction is disrupted by the anti-antiactivator protein ExsC. Here we report the crystal structure of the regulatory domainmore » of ExsA, which is known to mediate ExsA dimerization as well as ExsD binding. The crystal structure suggests two models for the ExsA dimer. Both models confirmed the previously shown involvement of helix α-3 in ExsA dimerization but one also suggest a role for helix α-2. These structural data are supported by the observation that a mutation in α-2 greatly diminished the ability of ExsA to activate transcription in vitro. Lastly, additional in vitro transcription studies revealed that a conserved pocket, used by AraC and the related ToxT protein for the binding of small molecule regulators, although present in ExsA is not involved in binding of ExsD.« less
Plass, Mireya; Rasmussen, Simon H; Krogh, Anders
2017-04-01
Post-transcriptional regulation is regarded as one of the major processes involved in the regulation of gene expression. It is mainly performed by RNA binding proteins and microRNAs, which target RNAs and typically affect their stability. Recent efforts from the scientific community have aimed at understanding post-transcriptional regulation at a global scale by using high-throughput sequencing techniques such as cross-linking and immunoprecipitation (CLIP), which facilitates identification of binding sites of these regulatory factors. However, the diversity in the experimental procedures and bioinformatics analyses has hindered the integration of multiple datasets and thus limited the development of an integrated view of post-transcriptional regulation. In this work, we have performed a comprehensive analysis of 107 CLIP datasets from 49 different RBPs in HEK293 cells to shed light on the complex interactions that govern post-transcriptional regulation. By developing a more stringent CLIP analysis pipeline we have discovered the existence of conserved regulatory AU-rich regions in the 3'UTRs where miRNAs and RBPs that regulate several processes such as polyadenylation or mRNA stability bind. Analogous to promoters, many factors have binding sites overlapping or in close proximity in these hotspots and hence the regulation of the mRNA may depend on their relative concentrations. This hypothesis is supported by RBP knockdown experiments that alter the relative concentration of RBPs in the cell. Upon AGO2 knockdown (KD), transcripts containing "free" target sites show increased expression levels compared to those containing target sites in hotspots, which suggests that target sites within hotspots are less available for miRNAs to bind. Interestingly, these hotspots appear enriched in genes with regulatory functions such as DNA binding and RNA binding. Taken together, our results suggest that hotspots are functional regulatory elements that define an extra layer of